#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
HECTD3	79654	broad.mit.edu	37	1	45475345	45475345	+	Missense_Mutation	SNP	T	T	C			TCGA-61-2101-01	TCGA-61-2101-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2101-01	TCGA-61-2101-11	g.chr1:45475345T>C	ENST00000372172.4	-	5	841	c.770A>G	c.(769-771)aAc>aGc	p.N257S	UROD_ENST00000246337.4_5'Flank|HECTD3_ENST00000372168.3_5'Flank	NM_024602.5	NP_078878.3	Q5T447	HECD3_HUMAN	HECT domain containing E3 ubiquitin protein ligase 3	257	DOC. {ECO:0000255|PROSITE- ProRule:PRU00614}.				proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.N257S(1)		breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(11)|prostate(1)|stomach(1)	28	Acute lymphoblastic leukemia(166;0.155)					GCAGGACACGTTGAACTCCTC	0.582																																																1	Substitution - Missense(1)	ovary(1)	1											60.0	59.0	59.0					1																	45475345		2119	4213	6332	45247932	SO:0001583	missense	79654			BC019105	CCDS41318.1	1p34.1	2012-02-23	2012-02-23		ENSG00000126107	ENSG00000126107			26117	protein-coding gene	gene with protein product			"""HECT domain containing 3"""			12477932	Standard	NM_024602		Approved	FLJ21156	uc009vxk.3	Q5T447	OTTHUMG00000008587	ENST00000372172.4:c.770A>G	1.37:g.45475345T>C	ENSP00000361245:p.Asn257Ser		45247932	B3KPV7|B3KRH4|Q5T448|Q9H783	Missense_Mutation	SNP	ENST00000372172.4	37	CCDS41318.1	SNP	60	Broad	.	.	.	.	.	.	.	.	.	.	T	10.78	1.446328	0.25987	.	.	ENSG00000126107	ENST00000372172	T	0.71103	-0.54	4.9	4.9	0.64082	Anaphase-promoting complex, subunit 10/DOC domain (2);Galactose-binding domain-like (1);	1.365760	0.04597	N	0.397844	T	0.54127	0.1839	N	0.04636	-0.2	0.80722	D	1	B	0.06786	0.001	B	0.06405	0.002	T	0.02339	-1.1174	10	0.18276	T	0.48	.	14.8076	0.69968	0.0:0.0:0.0:1.0	.	257	Q5T447	HECD3_HUMAN	S	257	ENSP00000361245:N257S	ENSP00000361245:N257S	N	-	2	0	HECTD3	45247932	1.000000	0.71417	1.000000	0.80357	0.854000	0.48673	2.799000	0.47892	1.965000	0.57142	0.460000	0.39030	AAC		0.582	HECTD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023734.1	NM_024602		Missense_Mutation
MAGI3	260425	broad.mit.edu	37	1	114214377	114214377	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2101-01	TCGA-61-2101-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2101-01	TCGA-61-2101-11	g.chr1:114214377G>A	ENST00000307546.9	+	17	2912	c.2837G>A	c.(2836-2838)gGa>gAa	p.G946E	MAGI3_ENST00000369611.4_Missense_Mutation_p.G946E|MAGI3_ENST00000369615.1_Missense_Mutation_p.G946E|MAGI3_ENST00000369617.4_Missense_Mutation_p.G971E	NM_001142782.1	NP_001136254.1	Q5TCQ9	MAGI3_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 3	971	Interaction with LPAR2 and GRIN2B.|PDZ 5. {ECO:0000255|PROSITE- ProRule:PRU00143}.				apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|nucleotide phosphorylation (GO:0046939)|positive regulation of JUN kinase activity (GO:0043507)|viral process (GO:0016032)	membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	ATP binding (GO:0005524)|guanylate kinase activity (GO:0004385)	p.G946E(1)		NS(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(9)|ovary(3)|prostate(7)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	41	Lung SC(450;0.184)	all_cancers(81;2.34e-09)|all_epithelial(167;7.41e-09)|all_lung(203;7.13e-06)|Lung NSC(69;1.2e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CCACCATCAGGAACAAACTCA	0.488																																																1	Substitution - Missense(1)	ovary(1)	1											79.0	85.0	83.0					1																	114214377		2203	4300	6503	114015900	SO:0001583	missense	260425			AF213259	CCDS860.1, CCDS44196.1	1p12-p11.2	2008-02-05			ENSG00000081026	ENSG00000081026			29647	protein-coding gene	gene with protein product		615943				10997877, 10748157	Standard	NM_152900		Approved	MAGI-3	uc001edk.3	Q5TCQ9	OTTHUMG00000011737	ENST00000307546.9:c.2837G>A	1.37:g.114214377G>A	ENSP00000304604:p.Gly946Glu		114015900	Q5TCQ8|Q5TCR0|Q9H2V6|Q9H5Y8|Q9HBC4|Q9HCD8	Missense_Mutation	SNP	ENST00000307546.9	37	CCDS44196.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	23.0	4.366598	0.82463	.	.	ENSG00000081026	ENST00000369617;ENST00000307546;ENST00000369615;ENST00000369611	T;T;T;T	0.15603	2.6;2.41;2.6;2.6	5.27	5.27	0.74061	.	0.054708	0.64402	D	0.000001	T	0.31888	0.0811	M	0.63843	1.955	0.80722	D	1	D;D;D	0.89917	1.0;0.998;0.998	D;D;D	0.87578	0.998;0.975;0.989	T	0.01476	-1.1345	10	0.37606	T	0.19	-11.8804	18.8828	0.92364	0.0:0.0:1.0:0.0	.	946;946;971	Q5TCQ9-4;Q5TCQ9-3;Q5TCQ9-2	.;.;.	E	971;946;946;946	ENSP00000358630:G971E;ENSP00000304604:G946E;ENSP00000358628:G946E;ENSP00000358624:G946E	ENSP00000304604:G946E	G	+	2	0	MAGI3	114015900	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.452000	0.97615	2.444000	0.82710	0.563000	0.77884	GGA		0.488	MAGI3-004	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000032429.1	NM_152900		Missense_Mutation
KPRP	448834	broad.mit.edu	37	1	152732622	152732622	+	Silent	SNP	C	C	T			TCGA-61-2101-01	TCGA-61-2101-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2101-01	TCGA-61-2101-11	g.chr1:152732622C>T	ENST00000606109.1	+	1	586	c.558C>T	c.(556-558)ggC>ggT	p.G186G	KPRP_ENST00000368773.1_Silent_p.G186G			Q5T749	KPRP_HUMAN	keratinocyte proline-rich protein	186	Gln-rich.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)		p.G186G(1)		NS(1)|breast(1)|endometrium(9)|kidney(1)|large_intestine(10)|lung(21)|ovary(6)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			AGTATCAAGGCTCCTATAGCA	0.562																																																1	Substitution - coding silent(1)	ovary(1)	1											140.0	138.0	139.0					1																	152732622		2203	4300	6503	150999246	SO:0001819	synonymous_variant	448834			AY960854	CCDS30862.1	1q21.3	2008-02-05	2007-02-02	2006-12-07	ENSG00000203786	ENSG00000203786			31823	protein-coding gene	gene with protein product		613260	"""chromosome 1 open reading frame 45"""	C1orf45		16297201	Standard	NM_001025231		Approved		uc001fal.1	Q5T749	OTTHUMG00000012402	ENST00000606109.1:c.558C>T	1.37:g.152732622C>T			150999246		Silent	SNP	ENST00000606109.1	37	CCDS30862.1	SNP	28	Broad																																																																																				0.562	KPRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034522.2	NM_001025231		Silent
DHX9	1660	broad.mit.edu	37	1	182812436	182812436	+	Missense_Mutation	SNP	T	T	G			TCGA-61-2101-01	TCGA-61-2101-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2101-01	TCGA-61-2101-11	g.chr1:182812436T>G	ENST00000367549.3	+	3	229	c.119T>G	c.(118-120)gTg>gGg	p.V40G		NM_001357.4	NP_001348.2	Q08211	DHX9_HUMAN	DEAH (Asp-Glu-Ala-His) box helicase 9	40	DRBM 1. {ECO:0000255|PROSITE- ProRule:PRU00266}.|Interaction with CREBBP.				ATP catabolic process (GO:0006200)|cellular response to heat (GO:0034605)|circadian rhythm (GO:0007623)|CRD-mediated mRNA stabilization (GO:0070934)|DNA duplex unwinding (GO:0032508)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|positive regulation of type I interferon production (GO:0032481)|RNA splicing (GO:0008380)	centrosome (GO:0005813)|CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent RNA helicase activity (GO:0004004)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)|RNA polymerase II transcription factor binding (GO:0001085)	p.V40G(8)		NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(10)|kidney(3)|large_intestine(7)|liver(1)|lung(19)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	49						AAGGTTCAGGTGGAAGGTTAT	0.333																																					Colon(69;210 1162 3697 13559 39565)											8	Substitution - Missense(8)	lung(5)|endometrium(1)|kidney(1)|central_nervous_system(1)	1											54.0	51.0	52.0					1																	182812436		1803	4059	5862	181079059	SO:0001583	missense	1660			L13848	CCDS41444.1	1q25	2013-05-13	2013-05-13	2003-06-20	ENSG00000135829	ENSG00000135829		"""DEAH-boxes"""	2750	protein-coding gene	gene with protein product	"""NDH II"", ""RNA helicase A"""	603115	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 9 (RNA helicase A, nuclear DNA helicase II; leukophysin)"", ""DEAH (Asp-Glu-Ala-His) box polypeptide 9"""	LKP, DDX9		8344961, 9111062	Standard	NM_001357		Approved	RHA	uc001gpr.3	Q08211	OTTHUMG00000035337	ENST00000367549.3:c.119T>G	1.37:g.182812436T>G	ENSP00000356520:p.Val40Gly		181079059	B2RNV4|Q05CI5|Q12803|Q32Q22|Q5VY62|Q6PD69|Q99556	Missense_Mutation	SNP	ENST00000367549.3	37	CCDS41444.1	SNP	59	Broad	.	.	.	.	.	.	.	.	.	.	T	22.5	4.303744	0.81136	.	.	ENSG00000135829	ENST00000399175;ENST00000367549	D	0.81996	-1.56	5.63	5.63	0.86233	Double-stranded RNA-binding (3);Double-stranded RNA-binding-like (1);	0.000000	0.85682	D	0.000000	D	0.93255	0.7851	M	0.94142	3.5	0.80722	D	1	D	0.67145	0.996	D	0.70716	0.97	D	0.94934	0.8085	10	0.87932	D	0	.	15.1117	0.72362	0.0:0.0:0.0:1.0	.	40	Q08211	DHX9_HUMAN	G	40	ENSP00000356520:V40G	ENSP00000356520:V40G	V	+	2	0	DHX9	181079059	1.000000	0.71417	1.000000	0.80357	0.913000	0.54294	7.285000	0.78660	2.263000	0.75096	0.533000	0.62120	GTG		0.333	DHX9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085522.2	NM_030588		Missense_Mutation
OR2L13	284521	broad.mit.edu	37	1	248263372	248263372	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2101-01	TCGA-61-2101-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2101-01	TCGA-61-2101-11	g.chr1:248263372G>A	ENST00000358120.2	+	2	840	c.695G>A	c.(694-696)gGg>gAg	p.G232E	OR2L13_ENST00000366478.2_Missense_Mutation_p.G232E			Q8N349	OR2LD_HUMAN	olfactory receptor, family 2, subfamily L, member 13	232						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.G232E(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(12)|lung(32)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	59	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0132)			TCAAAGGAGGGGAGAAAAAAG	0.438																																																1	Substitution - Missense(1)	ovary(1)	1											137.0	132.0	133.0					1																	248263372		2203	4300	6503	246329995	SO:0001583	missense	284521			BC028158	CCDS1637.1	1q44	2012-08-09			ENSG00000196071	ENSG00000196071		"""GPCR / Class A : Olfactory receptors"""	19578	protein-coding gene	gene with protein product				OR2L14			Standard	NM_175911		Approved		uc001ids.3	Q8N349	OTTHUMG00000040446	ENST00000358120.2:c.695G>A	1.37:g.248263372G>A	ENSP00000350836:p.Gly232Glu		246329995	Q5VUR5	Missense_Mutation	SNP	ENST00000358120.2	37	CCDS1637.1	SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	G	9.872	1.199328	0.22121	.	.	ENSG00000196071	ENST00000366478;ENST00000358120	T;T	0.00287	8.29;8.29	3.95	3.03	0.35002	GPCR, rhodopsin-like superfamily (1);	0.000000	0.45867	D	0.000322	T	0.00724	0.0024	M	0.92412	3.305	0.09310	N	1	D	0.76494	0.999	D	0.69307	0.963	T	0.26710	-1.0095	10	0.72032	D	0.01	.	8.0575	0.30614	0.204:0.0:0.796:0.0	.	232	Q8N349	OR2LD_HUMAN	E	232	ENSP00000355434:G232E;ENSP00000350836:G232E	ENSP00000350836:G232E	G	+	2	0	OR2L13	246329995	0.409000	0.25368	0.008000	0.14137	0.004000	0.04260	3.171000	0.50824	0.836000	0.34901	0.455000	0.32223	GGG		0.438	OR2L13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097342.1	NM_175911		Missense_Mutation
NPY4R	5540	broad.mit.edu	37	10	47087274	47087274	+	Nonsense_Mutation	SNP	G	G	A			TCGA-61-2101-01	TCGA-61-2101-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2101-01	TCGA-61-2101-11	g.chr10:47087274G>A	ENST00000395716.1	+	2	576	c.491G>A	c.(490-492)tGg>tAg	p.W164*	NPY4R_ENST00000374312.1_Nonsense_Mutation_p.W164*			P50391	NPY4R_HUMAN	neuropeptide Y receptor Y4	164					blood circulation (GO:0008015)|digestion (GO:0007586)|feeding behavior (GO:0007631)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|pancreatic polypeptide receptor activity (GO:0001602)|peptide binding (GO:0042277)|peptide YY receptor activity (GO:0001601)	p.W164*(1)									GTGCTCATCTGGGTCATTGCC	0.582																																																1	Substitution - Nonsense(1)	ovary(1)	10											229.0	182.0	198.0					10																	47087274		2203	4300	6503	46507280	SO:0001587	stop_gained	5540				CCDS73100.1	10q11.2	2013-03-26	2013-03-26	2013-03-26	ENSG00000204174	ENSG00000204174		"""GPCR / Class A : Neuropeptide receptors : Y"""	9329	protein-coding gene	gene with protein product		601790	"""pancreatic polypeptide receptor 1"""	PPYR1		9417917	Standard	NM_005972		Approved	Y4, PP1	uc001jee.3	P50391	OTTHUMG00000018108	ENST00000395716.1:c.491G>A	10.37:g.47087274G>A	ENSP00000379066:p.Trp164*		46507280	Q13456|Q5ISU3|Q5T2X9|Q6FH06	Nonsense_Mutation	SNP	ENST00000395716.1	37	CCDS31193.1	SNP	47	Broad	.	.	.	.	.	.	.	.	.	.	G	36	5.714602	0.96830	.	.	ENSG00000204174	ENST00000374312;ENST00000395716	.	.	.	4.93	4.93	0.64822	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.0236	0.80522	0.0:0.0:1.0:0.0	.	.	.	.	X	164	.	ENSP00000363431:W164X	W	+	2	0	PPYR1	46507280	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	9.445000	0.97587	2.464000	0.83262	0.609000	0.83330	TGG		0.582	NPY4R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047837.1			Nonsense_Mutation
CCDC186	55088	broad.mit.edu	37	10	115917409	115917409	+	Silent	SNP	C	C	T			TCGA-61-2101-01	TCGA-61-2101-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2101-01	TCGA-61-2101-11	g.chr10:115917409C>T	ENST00000369287.3	-	3	929	c.663G>A	c.(661-663)gaG>gaA	p.E221E		NM_018017.2	NP_060487.2	Q7Z3E2	CC186_HUMAN		221								p.E221E(1)		NS(1)|autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(9)|ovary(2)	24		Colorectal(252;0.172)|Breast(234;0.188)		Epithelial(162;0.0161)|all cancers(201;0.0397)		CTACGAAGAGCTCCTGATGCT	0.279																																																1	Substitution - coding silent(1)	ovary(1)	10											79.0	79.0	79.0					10																	115917409		2202	4298	6500	115907399	SO:0001819	synonymous_variant	55088																														ENST00000369287.3:c.663G>A	10.37:g.115917409C>T			115907399	Q2M2V6|Q3ZB81|Q6NS91|Q7RTP1|Q8N117|Q8N3G3|Q8N6C2|Q9NWA3	Silent	SNP	ENST00000369287.3	37	CCDS7587.1	SNP	28	Broad																																																																																				0.279	C10orf118-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050455.1			Silent
OR52E4	390081	broad.mit.edu	37	11	5906140	5906140	+	Silent	SNP	T	T	C			TCGA-61-2101-01	TCGA-61-2101-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2101-01	TCGA-61-2101-11	g.chr11:5906140T>C	ENST00000316987.2	+	1	640	c.618T>C	c.(616-618)tcT>tcC	p.S206S		NM_001005165.1	NP_001005165.1	Q8NGH9	O52E4_HUMAN	olfactory receptor, family 52, subfamily E, member 4	206						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S206S(1)		autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(7)|liver(2)|lung(13)|ovary(2)|prostate(1)|skin(2)	30		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;1.24e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TGGTGATTTCTTATATTATTG	0.448																																																1	Substitution - coding silent(1)	ovary(1)	11											287.0	249.0	262.0					11																	5906140		2201	4296	6497	5862716	SO:0001819	synonymous_variant	390081			AB065817	CCDS31401.1	11p15.4	2012-08-09			ENSG00000180974	ENSG00000180974		"""GPCR / Class A : Olfactory receptors"""	15213	protein-coding gene	gene with protein product							Standard	NM_001005165		Approved		uc010qzs.2	Q8NGH9	OTTHUMG00000168804	ENST00000316987.2:c.618T>C	11.37:g.5906140T>C			5862716	Q6IFG0	Silent	SNP	ENST00000316987.2	37	CCDS31401.1	SNP	56	Broad																																																																																				0.448	OR52E4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401146.1	NM_001005165		Silent
NEU3	10825	broad.mit.edu	37	11	74705648	74705648	+	Silent	SNP	C	C	T			TCGA-61-2101-01	TCGA-61-2101-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2101-01	TCGA-61-2101-11	g.chr11:74705648C>T	ENST00000544263.1	+	3	260	c.90C>T	c.(88-90)ctC>ctT	p.L30L	NEU3_ENST00000529024.1_Intron|NEU3_ENST00000532963.1_Intron|NEU3_ENST00000531619.1_Silent_p.L63L|NEU3_ENST00000534628.1_Silent_p.L63L|NEU3_ENST00000545272.1_Intron|NEU3_ENST00000531509.1_Silent_p.L63L|NEU3_ENST00000294064.4_Silent_p.L63L			Q9UQ49	NEUR3_HUMAN	sialidase 3 (membrane sialidase)	30					carbohydrate metabolic process (GO:0005975)|ganglioside catabolic process (GO:0006689)|glycosphingolipid metabolic process (GO:0006687)|oligosaccharide catabolic process (GO:0009313)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	alpha-sialidase activity (GO:0016997)|exo-alpha-(2->3)-sialidase activity (GO:0052794)|exo-alpha-(2->6)-sialidase activity (GO:0052795)|exo-alpha-(2->8)-sialidase activity (GO:0052796)|exo-alpha-sialidase activity (GO:0004308)	p.L63L(1)		kidney(2)|large_intestine(1)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)	11						CAGCCCTGCTCTACATACCCC	0.562																																																1	Substitution - coding silent(1)	ovary(1)	11											128.0	133.0	131.0					11																	74705648		2037	4182	6219	74383296	SO:0001819	synonymous_variant	10825			AB008185	CCDS44682.1	11q13.5	2008-02-05				ENSG00000162139			7760	protein-coding gene	gene with protein product		604617				10405317	Standard	NM_006656		Approved		uc001ovw.3	Q9UQ49		ENST00000544263.1:c.90C>T	11.37:g.74705648C>T			74383296	A8K327|Q9NQE1	Silent	SNP	ENST00000544263.1	37		SNP	32	Broad																																																																																				0.562	NEU3-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_006656		Silent
AEBP2	121536	broad.mit.edu	37	12	19593257	19593257	+	Silent	SNP	G	G	A			TCGA-61-2101-01	TCGA-61-2101-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2101-01	TCGA-61-2101-11	g.chr12:19593257G>A	ENST00000398864.3	+	1	650	c.624G>A	c.(622-624)gaG>gaA	p.E208E	AEBP2_ENST00000266508.9_Silent_p.E208E|AEBP2_ENST00000360995.4_5'Flank|AEBP2_ENST00000541908.1_Intron	NM_001114176.1	NP_001107648.1	Q6ZN18	AEBP2_HUMAN	AE binding protein 2	208	Ser-rich.				chromatin modification (GO:0016568)	ESC/E(Z) complex (GO:0035098)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|transcription corepressor activity (GO:0003714)	p.E208E(1)		ovary(1)	1	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.00804)|Esophageal squamous(101;0.143)					GCAGCTTGGAGATGTCGTCGG	0.682																																																1	Substitution - coding silent(1)	ovary(1)	12											25.0	30.0	28.0					12																	19593257		1620	3676	5296	19484524	SO:0001819	synonymous_variant	121536				CCDS44841.1, CCDS44842.1, CCDS58215.1	12p12.3	2012-10-02			ENSG00000139154	ENSG00000139154			24051	protein-coding gene	gene with protein product						10329662	Standard	NM_153207		Approved	MGC17922	uc001ref.2	Q6ZN18	OTTHUMG00000168906	ENST00000398864.3:c.624G>A	12.37:g.19593257G>A			19484524	Q59FS5|Q6ZN62|Q96BG3	Silent	SNP	ENST00000398864.3	37	CCDS44841.1	SNP	33	Broad																																																																																				0.682	AEBP2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000401575.1	NM_153207		Silent
Unknown	0	broad.mit.edu	37	13	0	0	+	IGR	SNP	G	G	A			TCGA-61-2101-01	TCGA-61-2101-11							Unknown	Invalid:failed_liftOver	Unknown	x	x	---			x	TCGA-61-2101-01	TCGA-61-2101-11	g.chr13:0G>A								None (None upstream) : None (None downstream)																							NNNNNNNNNN	0.0																																																0			13																																								113599140	SO:0001628	intergenic_variant	348013																															13.37:g.0G>A			113599140		Missense_Mutation	SNP		37		SNP	43	Broad																																																																																			0	0.000									Missense_Mutation
AHNAK2	113146	broad.mit.edu	37	14	105412849	105412849	+	Missense_Mutation	SNP	A	A	C			TCGA-61-2101-01	TCGA-61-2101-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2101-01	TCGA-61-2101-11	g.chr14:105412849A>C	ENST00000333244.5	-	7	9058	c.8939T>G	c.(8938-8940)aTg>aGg	p.M2980R	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	2980						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)		p.M2980R(1)		cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GAACTTGGGCATTTTGAACTT	0.602																																																1	Substitution - Missense(1)	ovary(1)	14											260.0	273.0	269.0					14																	105412849		1978	4132	6110	104483894	SO:0001583	missense	113146			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.8939T>G	14.37:g.105412849A>C	ENSP00000353114:p.Met2980Arg		104483894	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	CCDS45177.1	SNP	8	Broad	.	.	.	.	.	.	.	.	.	.	a	12.56	1.975013	0.34848	.	.	ENSG00000185567	ENST00000333244	T	0.01397	4.94	4.35	4.35	0.52113	.	.	.	.	.	T	0.09113	0.0225	M	0.92833	3.35	0.26311	N	0.977827	D	0.67145	0.996	D	0.65010	0.931	T	0.19451	-1.0305	9	0.22109	T	0.4	.	10.1848	0.42991	0.8513:0.0:0.0:0.1487	.	2980	Q8IVF2	AHNK2_HUMAN	R	2980	ENSP00000353114:M2980R	ENSP00000353114:M2980R	M	-	2	0	AHNAK2	104483894	0.898000	0.30612	0.933000	0.37362	0.915000	0.54546	1.932000	0.40143	1.624000	0.50355	0.397000	0.26171	ATG		0.602	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420		Missense_Mutation
VPS18	57617	broad.mit.edu	37	15	41191655	41191655	+	Silent	SNP	C	C	T			TCGA-61-2101-01	TCGA-61-2101-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2101-01	TCGA-61-2101-11	g.chr15:41191655C>T	ENST00000220509.5	+	4	978	c.639C>T	c.(637-639)ggC>ggT	p.G213G	VPS18_ENST00000558474.1_Intron	NM_020857.2	NP_065908.1	Q9P253	VPS18_HUMAN	vacuolar protein sorting 18 homolog (S. cerevisiae)	213					endosome organization (GO:0007032)|intracellular protein transport (GO:0006886)|lysosome organization (GO:0007040)|vesicle-mediated transport (GO:0016192)|viral entry into host cell (GO:0046718)	actin filament (GO:0005884)|early endosome (GO:0005769)|HOPS complex (GO:0030897)|lysosomal membrane (GO:0005765)	metal ion binding (GO:0046872)	p.G213G(1)		autonomic_ganglia(1)|endometrium(5)|kidney(4)|large_intestine(4)|lung(6)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	28		all_cancers(109;1.35e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;9.68e-11)|all_lung(180;2.25e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;1.07e-05)|COAD - Colon adenocarcinoma(120;0.15)|BRCA - Breast invasive adenocarcinoma(123;0.164)		CCGAGCGGGGCCCTGATGGGC	0.617																																																1	Substitution - coding silent(1)	ovary(1)	15											59.0	63.0	62.0					15																	41191655		2203	4300	6503	38978947	SO:0001819	synonymous_variant	57617			AF308802	CCDS10069.1	15q14-q15	2006-12-19	2006-12-19		ENSG00000104142	ENSG00000104142			15972	protein-coding gene	gene with protein product		608551	"""vacuolar protein sorting protein 18"""			11250079, 16203730	Standard	NM_020857		Approved	KIAA1475, PEP3	uc001zne.3	Q9P253	OTTHUMG00000130135	ENST00000220509.5:c.639C>T	15.37:g.41191655C>T			38978947	Q8TCG0|Q96DI3|Q9H268	Silent	SNP	ENST00000220509.5	37	CCDS10069.1	SNP	26	Broad																																																																																				0.617	VPS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252443.2			Silent
ARNT2	9915	broad.mit.edu	37	15	80800500	80800500	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2101-01	TCGA-61-2101-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2101-01	TCGA-61-2101-11	g.chr15:80800500G>A	ENST00000303329.4	+	6	791	c.626G>A	c.(625-627)cGg>cAg	p.R209Q	ARNT2_ENST00000533983.1_Missense_Mutation_p.R198Q|ARNT2_ENST00000527771.1_Missense_Mutation_p.R198Q	NM_014862.3	NP_055677.3	Q9HBZ2	ARNT2_HUMAN	aryl-hydrocarbon receptor nuclear translocator 2	209	PAS 1. {ECO:0000255|PROSITE- ProRule:PRU00140}.				central nervous system development (GO:0007417)|in utero embryonic development (GO:0001701)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|response to estradiol (GO:0032355)|response to hypoxia (GO:0001666)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	aryl hydrocarbon receptor binding (GO:0017162)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)	p.R209Q(1)		NS(1)|central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(16)|ovary(1)|pancreas(2)|prostate(2)|skin(1)	35			BRCA - Breast invasive adenocarcinoma(143;0.134)			CTCTTAGGCCGGATCTTGGAC	0.552																																																1	Substitution - Missense(1)	ovary(1)	15											101.0	80.0	87.0					15																	80800500		2203	4300	6503	78587555	SO:0001583	missense	9915			AB002305	CCDS32307.1	15q25.1	2013-05-21			ENSG00000172379	ENSG00000172379		"""Basic helix-loop-helix proteins"""	16876	protein-coding gene	gene with protein product		606036				11247670	Standard	NM_014862		Approved	KIAA0307, bHLHe1	uc002bfr.3	Q9HBZ2	OTTHUMG00000165478	ENST00000303329.4:c.626G>A	15.37:g.80800500G>A	ENSP00000307479:p.Arg209Gln		78587555	B4DIS7|O15024|Q8IYC2	Missense_Mutation	SNP	ENST00000303329.4	37	CCDS32307.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	29.2	4.982234	0.93044	.	.	ENSG00000172379	ENST00000360062;ENST00000303329;ENST00000540859	T	0.06371	3.31	4.02	4.02	0.46733	PAS (1);PAS fold (1);	0.610700	0.17006	N	0.190705	T	0.25531	0.0621	M	0.73962	2.25	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.02933	-1.1092	10	0.87932	D	0	.	15.903	0.79397	0.0:0.0:1.0:0.0	.	209	Q9HBZ2	ARNT2_HUMAN	Q	198;209;209	ENSP00000307479:R209Q	ENSP00000307479:R209Q	R	+	2	0	ARNT2	78587555	1.000000	0.71417	1.000000	0.80357	0.868000	0.49771	8.475000	0.90417	2.053000	0.61076	0.289000	0.19496	CGG		0.552	ARNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384389.2			Missense_Mutation
ZC3H7A	29066	broad.mit.edu	37	16	11857502	11857502	+	Missense_Mutation	SNP	T	T	C			TCGA-61-2101-01	TCGA-61-2101-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2101-01	TCGA-61-2101-11	g.chr16:11857502T>C	ENST00000396516.2	-	15	2031	c.1834A>G	c.(1834-1836)Att>Gtt	p.I612V	ZC3H7A_ENST00000355758.4_Missense_Mutation_p.I612V			Q8IWR0	Z3H7A_HUMAN	zinc finger CCCH-type containing 7A	612						nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.I612V(1)		breast(2)|endometrium(3)|kidney(5)|large_intestine(2)|liver(1)|lung(3)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(2)	25						TCTCGCAAAATGTGGACAAGG	0.299																																																1	Substitution - Missense(1)	ovary(1)	16											109.0	99.0	102.0					16																	11857502		2197	4300	6497	11765003	SO:0001583	missense	29066			AF161540	CCDS10550.1	16p13-p12	2013-01-11	2005-06-02	2005-06-08	ENSG00000122299	ENSG00000122299		"""Zinc fingers, CCCH-type domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	30959	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 7"", ""zinc finger CCCH-type containing 7"""	ZC3HDC7, ZC3H7		11042152	Standard	NM_014153		Approved	HSPC055, FLJ20318	uc002dbl.3	Q8IWR0	OTTHUMG00000129825	ENST00000396516.2:c.1834A>G	16.37:g.11857502T>C	ENSP00000379773:p.Ile612Val		11765003	D3DUG5|Q9NPE9	Missense_Mutation	SNP	ENST00000396516.2	37	CCDS10550.1	SNP	51	Broad	.	.	.	.	.	.	.	.	.	.	T	12.03	1.816935	0.32145	.	.	ENSG00000122299	ENST00000355758;ENST00000396516	T;T	0.10099	2.91;2.91	5.33	5.33	0.75918	.	0.096556	0.64402	D	0.000001	T	0.11793	0.0287	L	0.41573	1.285	0.80722	D	1	P;P	0.40302	0.712;0.589	B;B	0.40375	0.327;0.175	T	0.13656	-1.0501	10	0.27082	T	0.32	.	14.7766	0.69736	0.0:0.0:0.0:1.0	.	333;612	Q9NXC8;Q8IWR0	.;Z3H7A_HUMAN	V	612	ENSP00000347999:I612V;ENSP00000379773:I612V	ENSP00000347999:I612V	I	-	1	0	ZC3H7A	11765003	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.000000	0.63940	2.137000	0.66172	0.533000	0.62120	ATT		0.299	ZC3H7A-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437066.1	NM_014153		Missense_Mutation
FBXL19	54620	broad.mit.edu	37	16	30958164	30958164	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2101-01	TCGA-61-2101-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2101-01	TCGA-61-2101-11	g.chr16:30958164G>A	ENST00000380310.2	+	10	1959	c.1801G>A	c.(1801-1803)Gcc>Acc	p.A601T	ORAI3_ENST00000566237.1_5'Flank|ORAI3_ENST00000318663.4_5'Flank|FBXL19_ENST00000562319.1_Missense_Mutation_p.A581T|FBXL19_ENST00000565690.1_Missense_Mutation_p.A465T|ORAI3_ENST00000562699.1_5'Flank|FBXL19_ENST00000471231.2_Missense_Mutation_p.A289T|AC135048.13_ENST00000566056.1_RNA|FBXL19_ENST00000338343.4_Missense_Mutation_p.A581T	NM_001099784.2	NP_001093254.2	Q6PCT2	FXL19_HUMAN	F-box and leucine-rich repeat protein 19	601					proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)	SCF ubiquitin ligase complex (GO:0019005)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.A431T(1)		breast(2)|endometrium(3)|lung(5)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	16						CCAGCTGAGCGCCCTGGACCT	0.682																																																1	Substitution - Missense(1)	ovary(1)	16											21.0	26.0	24.0					16																	30958164		2146	4246	6392	30865665	SO:0001583	missense	54620			AK127701	CCDS45465.1, CCDS73873.1	16p11.2	2014-02-20			ENSG00000099364	ENSG00000099364		"""F-boxes / Leucine-rich repeats"""	25300	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1C"""	609085					Standard	NM_001099784		Approved	DKFZp434K0410, Fbl19, JHDM1C, CXXC11	uc002eab.2	Q6PCT2	OTTHUMG00000132403	ENST00000380310.2:c.1801G>A	16.37:g.30958164G>A	ENSP00000369666:p.Ala601Thr		30865665	A8MT10|Q8N789|Q9NT14	Missense_Mutation	SNP	ENST00000380310.2	37	CCDS45465.1	SNP	38	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.34|14.34	2.506851|2.506851	0.44558|0.44558	.|.	.|.	ENSG00000099364|ENSG00000099364	ENST00000338343;ENST00000380310|ENST00000427128	T;T|.	0.29142|.	1.58;1.58|.	4.91|4.91	4.91|4.91	0.64330|0.64330	.|.	0.298226|.	0.29152|.	N|.	0.012994|.	T|T	0.18045|0.18045	0.0433|0.0433	N|N	0.05230|0.05230	-0.09|-0.09	0.27620|0.27620	N|N	0.948392|0.948392	P;B|.	0.48407|.	0.91;0.128|.	B;B|.	0.42653|.	0.394;0.005|.	T|T	0.12630|0.12630	-1.0540|-1.0540	10|5	0.25751|.	T|.	0.34|.	-10.4509|-10.4509	7.1438|7.1438	0.25570|0.25570	0.092:0.1753:0.7326:0.0|0.092:0.1753:0.7326:0.0	.|.	601;558|.	Q6PCT2;Q6PCT2-2|.	FXL19_HUMAN;.|.	T|H	581;601|492	ENSP00000339712:A581T;ENSP00000369666:A601T|.	ENSP00000339712:A581T|.	A|R	+|+	1|2	0|0	FBXL19|FBXL19	30865665|30865665	1.000000|1.000000	0.71417|0.71417	0.979000|0.979000	0.43373|0.43373	0.970000|0.970000	0.65996|0.65996	3.384000|3.384000	0.52478|0.52478	2.275000|2.275000	0.75901|0.75901	0.561000|0.561000	0.74099|0.74099	GCC|CGC		0.682	FBXL19-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_019085		Missense_Mutation
FAM83G	644815	broad.mit.edu	37	17	18874744	18874744	+	Silent	SNP	C	C	T	rs201696809		TCGA-61-2101-01	TCGA-61-2101-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2101-01	TCGA-61-2101-11	g.chr17:18874744C>T	ENST00000388995.6	-	6	2623	c.2400G>A	c.(2398-2400)acG>acA	p.T800T	SLC5A10_ENST00000395645.3_Intron|SLC5A10_ENST00000395642.1_Intron|SLC5A10_ENST00000395643.2_Intron|SLC5A10_ENST00000317977.6_Intron|SLC5A10_ENST00000395647.2_Intron|FAM83G_ENST00000345041.4_Silent_p.T800T|SLC5A10_ENST00000417251.2_Intron|FAM83G_ENST00000585154.2_Silent_p.T800T			A6ND36	FA83G_HUMAN	family with sequence similarity 83, member G	800					BMP signaling pathway (GO:0030509)	cytosol (GO:0005829)|nucleus (GO:0005634)		p.T800T(1)		central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(7)|ovary(2)|prostate(3)|stomach(1)	22						GGCTACCGCCCGTCCTGGCCT	0.632																																																1	Substitution - coding silent(1)	ovary(1)	17											58.0	71.0	67.0					17																	18874744		2106	4191	6297	18815469	SO:0001819	synonymous_variant	644815			AK123558	CCDS42276.1	17p11.2	2014-05-01	2006-03-22		ENSG00000188522	ENSG00000188522			32554	protein-coding gene	gene with protein product	"""protein associated with SMAD1"""	615886				24554596	Standard	NM_001039999		Approved	FLJ41564, PAWS1	uc002guw.3	A6ND36	OTTHUMG00000059411	ENST00000388995.6:c.2400G>A	17.37:g.18874744C>T			18815469	Q3KQZ4|Q6ZW60	Silent	SNP	ENST00000388995.6	37	CCDS42276.1	SNP	23	Broad																																																																																				0.632	FAM83G-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253108.4			Silent
UNC45B	146862	broad.mit.edu	37	17	33475450	33475450	+	Splice_Site	SNP	G	G	A			TCGA-61-2101-01	TCGA-61-2101-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2101-01	TCGA-61-2101-11	g.chr17:33475450G>A	ENST00000268876.5	+	2	265	c.168G>A	c.(166-168)acG>acA	p.T56T	UNC45B_ENST00000591048.1_Splice_Site_p.T56T|UNC45B_ENST00000433649.1_Splice_Site_p.T56T|UNC45B_ENST00000394570.2_Splice_Site_p.T56T|UNC45B_ENST00000378449.1_Splice_Site_p.T56T	NM_173167.2	NP_775259.1	Q8IWX7	UN45B_HUMAN	unc-45 homolog B (C. elegans)	56					cell differentiation (GO:0030154)|chaperone-mediated protein folding (GO:0061077)|muscle organ development (GO:0007517)	cytoplasm (GO:0005737)|cytosol (GO:0005829)		p.T56T(1)		breast(1)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(10)|lung(24)|ovary(3)|prostate(2)|skin(1)|stomach(1)|urinary_tract(3)	59		Ovarian(249;0.17)				GCCTGAAAACGGTCTGGGGCA	0.627																																																1	Substitution - coding silent(1)	ovary(1)	17											36.0	36.0	36.0					17																	33475450		2203	4300	6503	30499563	SO:0001630	splice_region_variant	146862			AW755253	CCDS11292.1, CCDS45648.1	17q12	2008-02-05	2005-11-17	2005-11-17	ENSG00000141161	ENSG00000141161			14304	protein-coding gene	gene with protein product		611220	"""cardiomyopathy associated 4"""	CMYA4		12356907	Standard	NM_001267052		Approved	UNC45	uc002hja.3	Q8IWX7	OTTHUMG00000132931	ENST00000268876.5:c.168+1G>A	17.37:g.33475450G>A			30499563	Q495Q8|Q495Q9	Silent	SNP	ENST00000268876.5	37	CCDS11292.1	SNP	39	Broad																																																																																				0.627	UNC45B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256458.2	NM_173167	Silent	Silent
DDX5	1655	broad.mit.edu	37	17	62499129	62499129	+	Missense_Mutation	SNP	T	T	C			TCGA-61-2101-01	TCGA-61-2101-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2101-01	TCGA-61-2101-11	g.chr17:62499129T>C	ENST00000225792.5	-	8	1299	c.898A>G	c.(898-900)Ata>Gta	p.I300V	DDX5_ENST00000580026.1_5'Flank|DDX5_ENST00000578804.1_Missense_Mutation_p.I300V|DDX5_ENST00000450599.2_Missense_Mutation_p.I221V|MIR3064_ENST00000581130.1_RNA|MIR5047_ENST00000579212.1_RNA	NM_004396.3	NP_004387.1	P17844	DDX5_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 5	300	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				cell growth (GO:0016049)|circadian rhythm (GO:0007623)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of osteoblast differentiation (GO:0045667)|regulation of skeletal muscle cell differentiation (GO:2001014)|regulation of viral genome replication (GO:0045069)|transcription, DNA-templated (GO:0006351)	catalytic step 2 spliceosome (GO:0071013)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|pre-mRNA binding (GO:0036002)|RNA helicase activity (GO:0003724)|transcription coactivator activity (GO:0003713)	p.I300V(1)		breast(3)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)	19	Breast(5;2.15e-14)		BRCA - Breast invasive adenocarcinoma(8;8.6e-12)			CCAATGTTTATATGAATATAG	0.378			T	ETV4	prostate																																NSCLC(22;406 813 4871 19580 40307)		Dom	yes		17	17q21	1655	DEAD (Asp-Glu-Ala-Asp) box polypeptide 5		E	1	Substitution - Missense(1)	ovary(1)	17											137.0	133.0	134.0					17																	62499129		2203	4300	6503	59929591	SO:0001583	missense	1655			AF015812	CCDS11659.1	17q21	2012-07-27	2012-02-23		ENSG00000108654	ENSG00000108654		"""DEAD-boxes"""	2746	protein-coding gene	gene with protein product		180630	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 5 (RNA helicase, 68kD)"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 5"""	HLR1, G17P1		22156369, 18698352	Standard	NM_004396		Approved	p68	uc002jek.2	P17844	OTTHUMG00000178936	ENST00000225792.5:c.898A>G	17.37:g.62499129T>C	ENSP00000225792:p.Ile300Val		59929591	B4DLW8|B5BU21|D3DU32|E7ETL9|O75681|Q53Y61	Missense_Mutation	SNP	ENST00000225792.5	37	CCDS11659.1	SNP	49	Broad	.	.	.	.	.	.	.	.	.	.	T	14.45	2.539444	0.45176	.	.	ENSG00000108654	ENST00000540698;ENST00000450599;ENST00000225792	.	.	.	5.91	5.91	0.95273	DEAD-like helicase (2);	0.000000	0.85682	D	0.000000	T	0.42108	0.1188	N	0.11870	0.19	0.80722	D	1	B;B;B;B	0.21309	0.007;0.054;0.026;0.026	B;B;B;B	0.24701	0.021;0.055;0.04;0.04	T	0.29274	-1.0017	9	0.22706	T	0.39	-13.5598	16.3483	0.83171	0.0:0.0:0.0:1.0	.	221;300;289;300	B4DLW8;B5BUE6;B4DN41;P17844	.;.;.;DDX5_HUMAN	V	300;230;289	.	ENSP00000225792:I289V	I	-	1	0	DDX5	59929591	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.505000	0.81655	2.254000	0.74563	0.533000	0.62120	ATA		0.378	DDX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444030.1	NM_004396		Missense_Mutation
DSG3	1830	broad.mit.edu	37	18	29055915	29055915	+	Missense_Mutation	SNP	T	T	G			TCGA-61-2101-01	TCGA-61-2101-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2101-01	TCGA-61-2101-11	g.chr18:29055915T>G	ENST00000257189.4	+	16	2775	c.2692T>G	c.(2692-2694)Tgc>Ggc	p.C898G		NM_001944.2	NP_001935.2	P32926	DSG3_HUMAN	desmoglein 3	898					apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|homophilic cell adhesion (GO:0007156)	cell junction (GO:0030054)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.C898G(1)		breast(1)|central_nervous_system(2)|cervix(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(28)|ovary(4)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)	62			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			ATTTGTTAAGTGCCAGACTTT	0.507																																																1	Substitution - Missense(1)	ovary(1)	18											126.0	123.0	124.0					18																	29055915		2203	4300	6503	27309913	SO:0001583	missense	1830			M76482	CCDS11898.1	18q12.1	2010-06-24	2010-06-24		ENSG00000134757	ENSG00000134757		"""Cadherins / Major cadherins"""	3050	protein-coding gene	gene with protein product	"""pemphigus vulgaris antigen"""	169615	"""desmoglein 3 (pemphigus vulgaris antigen)"""			1601426	Standard	NM_001944		Approved	CDHF6	uc002kws.3	P32926	OTTHUMG00000131985	ENST00000257189.4:c.2692T>G	18.37:g.29055915T>G	ENSP00000257189:p.Cys898Gly		27309913	A8K2V2	Missense_Mutation	SNP	ENST00000257189.4	37	CCDS11898.1	SNP	59	Broad	.	.	.	.	.	.	.	.	.	.	T	8.902	0.956529	0.18507	.	.	ENSG00000134757	ENST00000257189	T	0.58797	0.31	5.54	-1.39	0.08997	.	0.623245	0.15000	N	0.286190	T	0.24470	0.0593	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.12319	-1.0552	10	0.22706	T	0.39	.	3.3926	0.07294	0.1089:0.1035:0.3909:0.3967	.	898	P32926	DSG3_HUMAN	G	898	ENSP00000257189:C898G	ENSP00000257189:C898G	C	+	1	0	DSG3	27309913	0.000000	0.05858	0.007000	0.13788	0.210000	0.24377	-1.971000	0.01503	-0.122000	0.11766	0.533000	0.62120	TGC		0.507	DSG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254949.1	NM_001944		Missense_Mutation
TPM4	7171	broad.mit.edu	37	19	16178452	16178452	+	Silent	SNP	G	G	A			TCGA-61-2101-01	TCGA-61-2101-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2101-01	TCGA-61-2101-11	g.chr19:16178452G>A	ENST00000344824.6	+	1	136	c.18G>A	c.(16-18)aaG>aaA	p.K6K	CTD-2231E14.4_ENST00000585520.1_lincRNA|TPM4_ENST00000538887.1_Silent_p.K6K	NM_001145160.1	NP_001138632.1	P67936	TPM4_HUMAN	tropomyosin 4	0					cellular component movement (GO:0006928)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|osteoblast differentiation (GO:0001649)	cortical cytoskeleton (GO:0030863)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|focal adhesion (GO:0005925)|membrane (GO:0016020)|muscle thin filament tropomyosin (GO:0005862)|podosome (GO:0002102)|stress fiber (GO:0001725)	calcium ion binding (GO:0005509)|structural constituent of muscle (GO:0008307)	p.K6K(1)	TPM4/ALK(12)	breast(1)|large_intestine(3)	4						CCATCAAGAAGAAAATGCAGA	0.647			T	ALK	ALCL																																		Dom	yes		19	19p13.1	7171	tropomyosin 4		L	1	Substitution - coding silent(1)	ovary(1)	19											109.0	102.0	104.0					19																	16178452		1568	3582	5150	16039452	SO:0001819	synonymous_variant	7171				CCDS12338.1, CCDS46007.1	19p13.1	2013-03-11			ENSG00000167460	ENSG00000167460		"""Tropomyosins"""	12013	protein-coding gene	gene with protein product		600317				8641132	Standard	NM_003290		Approved		uc002ndi.2	P67936	OTTHUMG00000182134	ENST00000344824.6:c.18G>A	19.37:g.16178452G>A			16039452	P07226|Q15659|Q5U0D9|Q9BU85|Q9H8Q3|Q9UCS1|Q9UCS2|Q9UCS3|Q9UCS4	Silent	SNP	ENST00000344824.6	37	CCDS46007.1	SNP	33	Broad																																																																																				0.647	TPM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459672.2	NM_003290		Silent
CCDC85A	114800	broad.mit.edu	37	2	56599594	56599594	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2101-01	TCGA-61-2101-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2101-01	TCGA-61-2101-11	g.chr2:56599594G>A	ENST00000407595.2	+	4	1935	c.1433G>A	c.(1432-1434)cGa>cAa	p.R478Q	RP11-482H16.1_ENST00000607540.1_RNA	NM_001080433.1	NP_001073902.1	Q96PX6	CC85A_HUMAN	coiled-coil domain containing 85A	478								p.R478Q(1)		breast(6)|cervix(2)|endometrium(5)|kidney(1)|lung(18)|ovary(2)|pancreas(1)|prostate(3)	38			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			GGAATAGGACGATGCCTGCCT	0.522																																																1	Substitution - Missense(1)	ovary(1)	2											40.0	44.0	43.0					2																	56599594		2000	4168	6168	56453098	SO:0001583	missense	114800			AB067499	CCDS46290.1	2p16.1	2006-03-29			ENSG00000055813	ENSG00000055813			29400	protein-coding gene	gene with protein product						11572484	Standard	NM_001080433		Approved	KIAA1912	uc002rzn.3	Q96PX6	OTTHUMG00000152033	ENST00000407595.2:c.1433G>A	2.37:g.56599594G>A	ENSP00000384040:p.Arg478Gln		56453098		Missense_Mutation	SNP	ENST00000407595.2	37	CCDS46290.1	SNP	37	Broad	.	.	.	.	.	.	.	.	.	.	G	15.04	2.715901	0.48622	.	.	ENSG00000055813	ENST00000407595;ENST00000407862	.	.	.	5.84	4.96	0.65561	.	0.146062	0.29389	N	0.012291	T	0.23054	0.0557	N	0.08118	0	0.27568	N	0.94996	B	0.21147	0.052	B	0.10450	0.005	T	0.12344	-1.0551	9	0.36615	T	0.2	-42.6934	10.8874	0.46974	0.0863:0.0:0.9137:0.0	.	478	Q96PX6	CC85A_HUMAN	Q	478;67	.	ENSP00000384040:R478Q	R	+	2	0	CCDC85A	56453098	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.489000	0.60309	1.482000	0.48325	0.591000	0.81541	CGA		0.522	CCDC85A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324993.1			Missense_Mutation
TET3	200424	broad.mit.edu	37	2	74329292	74329292	+	Missense_Mutation	SNP	C	C	T	rs568566594		TCGA-61-2101-01	TCGA-61-2101-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2101-01	TCGA-61-2101-11	g.chr2:74329292C>T	ENST00000409262.3	+	9	4972	c.4972C>T	c.(4972-4974)Cgc>Tgc	p.R1658C		NM_144993.1	NP_659430.1	O43151	TET3_HUMAN	tet methylcytosine dioxygenase 3	1658					DNA demethylation (GO:0080111)|DNA demethylation of male pronucleus (GO:0044727)|histone H3-K4 trimethylation (GO:0080182)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methylcytosine dioxygenase activity (GO:0070579)	p.R819C(1)		NS(1)|breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						CCCCTACAGCCGCTGGATCTA	0.672													C|||	1	0.000199681	0.0	0.0	5008	,	,		13033	0.0		0.0	False		,,,				2504	0.001															1	Substitution - Missense(1)	ovary(1)	2											5.0	6.0	6.0					2																	74329292		2011	4098	6109	74182800	SO:0001583	missense	200424				CCDS46339.1, CCDS46339.2	2p13.1	2011-09-30	2011-09-30		ENSG00000187605	ENSG00000187605			28313	protein-coding gene	gene with protein product		613555	"""tet oncogene family member 3"""			9455477	Standard	XM_005264187		Approved	MGC22014, hCG_40738	uc031roi.1	O43151	OTTHUMG00000152823	ENST00000409262.3:c.4972C>T	2.37:g.74329292C>T	ENSP00000386869:p.Arg1658Cys		74182800	A6NEI3|Q86Z24|Q8TBM9	Missense_Mutation	SNP	ENST00000409262.3	37	CCDS46339.1	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	C	17.96	3.515031	0.64634	.	.	ENSG00000187605	ENST00000409262;ENST00000233310	T	0.15834	2.39	5.33	4.46	0.54185	.	0.242131	0.42294	N	0.000736	T	0.21590	0.0520	M	0.69823	2.125	0.80722	D	1	B	0.22541	0.071	B	0.12156	0.007	T	0.03493	-1.1031	10	0.62326	D	0.03	.	12.7885	0.57520	0.0:0.9205:0.0:0.0795	.	1658	O43151	TET3_HUMAN	C	1658;1542	ENSP00000386869:R1658C	ENSP00000233310:R1542C	R	+	1	0	TET3	74182800	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.534000	0.60622	1.489000	0.48450	0.655000	0.94253	CGC		0.672	TET3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328141.4			Missense_Mutation
AMER3	205147	broad.mit.edu	37	2	131522197	131522197	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2101-01	TCGA-61-2101-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2101-01	TCGA-61-2101-11	g.chr2:131522197C>T	ENST00000423981.1	+	2	2662	c.2552C>T	c.(2551-2553)gCc>gTc	p.A851V	AMER3_ENST00000321420.4_Missense_Mutation_p.A851V	NM_001105193.1|NM_001105194.1|NM_001105195.1|NM_152698.2	NP_001098663.1|NP_001098664.1|NP_001098665.1|NP_689911.2	Q8N944	AMER3_HUMAN	APC membrane recruitment protein 3	851					Wnt signaling pathway (GO:0016055)	plasma membrane (GO:0005886)	lipid binding (GO:0008289)	p.A851V(1)									GAAGTGGGGGCCTCTGGGCCA	0.627																																																1	Substitution - Missense(1)	skin(1)	2											8.0	9.0	9.0					2																	131522197		1741	3744	5485	131238667	SO:0001583	missense	205147			AK095696	CCDS2164.1	2q21.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000178171	ENSG00000178171		"""-"""	26771	protein-coding gene	gene with protein product			"""family with sequence similarity 123C"""	FAM123C		20843316	Standard	NM_001105195		Approved	FLJ38377	uc002trw.2	Q8N944	OTTHUMG00000131637	ENST00000423981.1:c.2552C>T	2.37:g.131522197C>T	ENSP00000392700:p.Ala851Val		131238667	B7ZLH6	Missense_Mutation	SNP	ENST00000423981.1	37	CCDS2164.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	12.39	1.925096	0.34002	.	.	ENSG00000178171	ENST00000321420;ENST00000423981	T;T	0.51817	0.69;0.69	4.34	1.24	0.21308	.	1.583790	0.04559	U	0.391336	T	0.35189	0.0923	L	0.29908	0.895	0.09310	N	1	B	0.25312	0.123	B	0.21360	0.034	T	0.30238	-0.9985	10	0.66056	D	0.02	.	4.143	0.10203	0.0:0.558:0.1907:0.2512	.	851	Q8N944	F123C_HUMAN	V	851	ENSP00000314914:A851V;ENSP00000392700:A851V	ENSP00000314914:A851V	A	+	2	0	FAM123C	131238667	0.001000	0.12720	0.000000	0.03702	0.062000	0.15995	0.390000	0.20768	0.094000	0.17404	0.561000	0.74099	GCC		0.627	AMER3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254531.3	NM_152698		Missense_Mutation
DGKD	8527	broad.mit.edu	37	2	234367037	234367037	+	Silent	SNP	C	C	T			TCGA-61-2101-01	TCGA-61-2101-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2101-01	TCGA-61-2101-11	g.chr2:234367037C>T	ENST00000264057.2	+	22	2700	c.2688C>T	c.(2686-2688)atC>atT	p.I896I	DGKD_ENST00000409813.3_Silent_p.I852I	NM_152879.2	NP_690618.2	Q16760	DGKD_HUMAN	diacylglycerol kinase, delta 130kDa	896					blood coagulation (GO:0007596)|cell growth (GO:0016049)|diacylglycerol metabolic process (GO:0046339)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|multicellular organismal development (GO:0007275)|platelet activation (GO:0030168)|protein homooligomerization (GO:0051260)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein transport (GO:0015031)|response to organic substance (GO:0010033)|second-messenger-mediated signaling (GO:0019932)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol binding (GO:0019992)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.I896I(1)		central_nervous_system(2)|endometrium(4)|kidney(1)|large_intestine(13)|lung(15)|ovary(1)|pancreas(1)|skin(1)	38		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0538)		Epithelial(121;1.31e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000416)|Lung(119;0.00285)|LUSC - Lung squamous cell carcinoma(224;0.00655)	Phosphatidylserine(DB00144)	ATCATCGGATCGCCCAGGTAG	0.612																																																1	Substitution - coding silent(1)	endometrium(1)	2											92.0	71.0	78.0					2																	234367037		2203	4300	6503	234031776	SO:0001819	synonymous_variant	8527			D63479	CCDS2504.1, CCDS46546.1	2q37	2013-01-10	2002-08-29		ENSG00000077044	ENSG00000077044		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	2851	protein-coding gene	gene with protein product	"""diglyceride kinase"""	601826	"""diacylglycerol kinase, delta (130kD)"""			8626538, 12810723	Standard	NM_003648		Approved	KIAA0145, DGKdelta	uc002vui.1	Q16760	OTTHUMG00000133290	ENST00000264057.2:c.2688C>T	2.37:g.234367037C>T			234031776	Q14158|Q6PK55|Q8NG53	Silent	SNP	ENST00000264057.2	37	CCDS2504.1	SNP	31	Broad																																																																																				0.612	DGKD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257072.2	NM_003648		Silent
ZNF831	128611	broad.mit.edu	37	20	57782030	57782030	+	Nonsense_Mutation	SNP	C	C	T			TCGA-61-2101-01	TCGA-61-2101-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2101-01	TCGA-61-2101-11	g.chr20:57782030C>T	ENST00000371030.2	+	3	3946	c.3946C>T	c.(3946-3948)Cga>Tga	p.R1316*		NM_178457.1	NP_848552.1	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	1316							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)	p.R1316*(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(71)|ovary(2)|pancreas(1)|prostate(4)|skin(16)|upper_aerodigestive_tract(2)|urinary_tract(3)	125	all_lung(29;0.0085)					AACCTGGGTGCGAAGAAGAAG	0.532																																																1	Substitution - Nonsense(1)	ovary(1)	20											78.0	84.0	82.0					20																	57782030		1937	4137	6074	57215425	SO:0001587	stop_gained	128611			AL121919	CCDS42894.1	20q13.32	2008-10-20	2008-03-25	2008-03-25	ENSG00000124203	ENSG00000124203			16167	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 174"""	C20orf174			Standard	NM_178457		Approved	dJ492J12.1	uc002yan.3	Q5JPB2	OTTHUMG00000032864	ENST00000371030.2:c.3946C>T	20.37:g.57782030C>T	ENSP00000360069:p.Arg1316*		57215425	Q5TDR4|Q8TCP0	Nonsense_Mutation	SNP	ENST00000371030.2	37	CCDS42894.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	41	8.812320	0.98962	.	.	ENSG00000124203	ENST00000371030	.	.	.	5.44	4.49	0.54785	.	1.434950	0.04290	N	0.345272	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07030	T	0.85	-1.112	11.6326	0.51185	0.1777:0.8223:0.0:0.0	.	.	.	.	X	1316	.	ENSP00000360069:R1316X	R	+	1	2	ZNF831	57215425	0.021000	0.18746	0.014000	0.15608	0.011000	0.07611	1.946000	0.40283	1.267000	0.44247	0.655000	0.94253	CGA		0.532	ZNF831-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000079916.2	NM_178457		Nonsense_Mutation
KBTBD8	84541	broad.mit.edu	37	3	67054290	67054290	+	Missense_Mutation	SNP	A	A	G			TCGA-61-2101-01	TCGA-61-2101-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2101-01	TCGA-61-2101-11	g.chr3:67054290A>G	ENST00000417314.2	+	3	948	c.899A>G	c.(898-900)aAg>aGg	p.K300R	KBTBD8_ENST00000295568.4_Missense_Mutation_p.K274R|KBTBD8_ENST00000460576.1_Intron			Q8NFY9	KBTB8_HUMAN	kelch repeat and BTB (POZ) domain containing 8	300						cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)		p.K274R(1)		breast(1)|endometrium(1)|kidney(4)|large_intestine(7)|lung(4)|ovary(2)|prostate(1)	20		Lung NSC(201;0.0765)		BRCA - Breast invasive adenocarcinoma(55;6.02e-06)|KIRC - Kidney renal clear cell carcinoma(39;0.105)|Kidney(39;0.125)		CACTCAGGAAAGAAGCAAACA	0.433																																																1	Substitution - Missense(1)	ovary(1)	3											123.0	119.0	121.0					3																	67054290		2203	4300	6503	67136980	SO:0001583	missense	84541			AF385438	CCDS2906.1, CCDS2906.2	3p14	2013-01-08			ENSG00000163376	ENSG00000163376		"""BTB/POZ domain containing"""	30691	protein-coding gene	gene with protein product	"""T-cell activation kelch repeat protein"""					11347906	Standard	NM_032505		Approved	TA-KRP, KIAA1842	uc003dmy.3	Q8NFY9	OTTHUMG00000158779	ENST00000417314.2:c.899A>G	3.37:g.67054290A>G	ENSP00000401878:p.Lys300Arg		67136980	B4DTW6|Q96JI5	Missense_Mutation	SNP	ENST00000417314.2	37	CCDS2906.2	SNP	3	Broad	.	.	.	.	.	.	.	.	.	.	A	14.79	2.640515	0.47153	.	.	ENSG00000163376	ENST00000295568;ENST00000417314	T;T	0.66280	-0.2;-0.2	4.58	4.58	0.56647	Kelch-type beta propeller (1);	0.000000	0.85682	U	0.000000	T	0.39306	0.1073	N	0.08118	0	0.49213	D	0.999764	B	0.27351	0.176	B	0.19666	0.026	T	0.28235	-1.0050	9	.	.	.	.	14.2294	0.65882	1.0:0.0:0.0:0.0	.	300	Q8NFY9	KBTB8_HUMAN	R	274;300	ENSP00000295568:K274R;ENSP00000401878:K300R	.	K	+	2	0	KBTBD8	67136980	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.481000	0.81124	1.807000	0.52817	0.455000	0.32223	AAG		0.433	KBTBD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352189.1	NM_032505		Missense_Mutation
TNPO1	3842	broad.mit.edu	37	5	72168473	72168473	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2101-01	TCGA-61-2101-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2101-01	TCGA-61-2101-11	g.chr5:72168473G>A	ENST00000337273.5	+	7	1030	c.604G>A	c.(604-606)Gct>Act	p.A202T	TNPO1_ENST00000506351.2_Missense_Mutation_p.A194T|TNPO1_ENST00000447967.2_Silent_p.T113T|TNPO1_ENST00000523768.1_Missense_Mutation_p.A152T|TNPO1_ENST00000454282.1_Missense_Mutation_p.A152T	NM_002270.3	NP_002261.3	Q92973	TNPO1_HUMAN	transportin 1	202					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|protein import into nucleus, translocation (GO:0000060)|RNA metabolic process (GO:0016070)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	nuclear localization sequence binding (GO:0008139)|poly(A) RNA binding (GO:0044822)	p.A194T(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(10)|lung(6)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	36		Lung NSC(167;0.0053)|Ovarian(174;0.0175)		OV - Ovarian serous cystadenocarcinoma(47;6.14e-54)		TAGGTCTCACGCTGTTGCATG	0.328																																																1	Substitution - Missense(1)	ovary(1)	5											146.0	128.0	134.0					5																	72168473		2203	4300	6503	72204229	SO:0001583	missense	3842			U70322	CCDS4016.1, CCDS43329.1	5q13.1	2009-01-12	2004-01-29	2004-01-30	ENSG00000083312	ENSG00000083312		"""Importins"""	6401	protein-coding gene	gene with protein product	"""importin 2"""	602901	"""karyopherin (importin) beta 2"""	KPNB2		8808633, 9144189	Standard	NM_153188		Approved	MIP, TRN, IPO2, MIP1	uc003kci.4	Q92973	OTTHUMG00000100967	ENST00000337273.5:c.604G>A	5.37:g.72168473G>A	ENSP00000336712:p.Ala202Thr		72204229	B4DVC6|Q92957|Q92975	Missense_Mutation	SNP	ENST00000337273.5	37	CCDS43329.1	SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	G	35	5.454894	0.96223	.	.	ENSG00000083312	ENST00000337273;ENST00000454282;ENST00000523768;ENST00000506351	T;T;T;T	0.73789	-0.78;-0.78;-0.78;-0.78	5.25	5.25	0.73442	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.89594	0.6760	M	0.93062	3.375	0.80722	D	1	D;D	0.76494	0.999;0.989	D;P	0.70716	0.97;0.614	D	0.91839	0.5482	10	0.87932	D	0	-14.3056	19.1933	0.93675	0.0:0.0:1.0:0.0	.	152;202	Q92973-3;Q92973	.;TNPO1_HUMAN	T	202;152;152;194	ENSP00000336712:A202T;ENSP00000398524:A152T;ENSP00000428899:A152T;ENSP00000425118:A194T	ENSP00000336712:A202T	A	+	1	0	TNPO1	72204229	1.000000	0.71417	0.977000	0.42913	0.969000	0.65631	9.444000	0.97578	2.626000	0.88956	0.591000	0.81541	GCT		0.328	TNPO1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000218577.3	NM_002270		Missense_Mutation
ETF1	2107	broad.mit.edu	37	5	137854397	137854397	+	Silent	SNP	G	G	T			TCGA-61-2101-01	TCGA-61-2101-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2101-01	TCGA-61-2101-11	g.chr5:137854397G>T	ENST00000360541.5	-	3	467	c.246C>A	c.(244-246)ctC>ctA	p.L82L	ETF1_ENST00000503014.1_Silent_p.L68L|ETF1_ENST00000499810.2_Silent_p.L49L|ETF1_ENST00000514005.1_5'UTR	NM_004730.3	NP_004721.1	P62495	ERF1_HUMAN	eukaryotic translation termination factor 1	82					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|protein methylation (GO:0006479)|regulation of translational termination (GO:0006449)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational termination (GO:0006415)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	poly(A) RNA binding (GO:0044822)|ribosome binding (GO:0043022)|RNA binding (GO:0003723)|translation release factor activity (GO:0003747)|translation release factor activity, codon specific (GO:0016149)|translation termination factor activity (GO:0008079)	p.L82L(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|prostate(1)|urinary_tract(1)	18			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			TATAAAGTTTGAGTCTTTGTT	0.388																																																1	Substitution - coding silent(1)	ovary(1)	5											173.0	173.0	173.0					5																	137854397		2203	4300	6503	137882296	SO:0001819	synonymous_variant	2107			AF095901	CCDS4207.1, CCDS75313.1, CCDS75314.1	5q31.2	2008-02-05			ENSG00000120705	ENSG00000120705			3477	protein-coding gene	gene with protein product	"""sup45 (yeast omnipotent suppressor 45) homolog-like 1"", ""polypeptide chain release factor 1"""	600285		SUP45L1, ERF1, ERF		1546371, 7990965	Standard	NM_004730		Approved	eRF1, TB3-1, RF1	uc003ldc.5	P62495	OTTHUMG00000129199	ENST00000360541.5:c.246C>A	5.37:g.137854397G>T			137882296	B2R6B4|D3DQC1|P46055|Q5M7Z7|Q96CG1	Silent	SNP	ENST00000360541.5	37	CCDS4207.1	SNP	45	Broad																																																																																				0.388	ETF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251276.2	NM_004730		Silent
PCDHB16	57717	broad.mit.edu	37	5	140564006	140564006	+	Silent	SNP	G	G	A			TCGA-61-2101-01	TCGA-61-2101-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2101-01	TCGA-61-2101-11	g.chr5:140564006G>A	ENST00000361016.2	+	1	3027	c.1872G>A	c.(1870-1872)gtG>gtA	p.V624V		NM_020957.1	NP_066008.1	Q9NRJ7	PCDBG_HUMAN	protocadherin beta 16	624	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.V624V(1)		breast(1)|endometrium(10)|kidney(3)|large_intestine(14)|lung(29)|ovary(5)|pancreas(2)|prostate(3)|skin(1)|urinary_tract(1)	69			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ATGGCGAGGTGCGCACCGCCA	0.701																																																1	Substitution - coding silent(1)	ovary(1)	5											21.0	22.0	22.0					5																	140564006		2035	3990	6025	140544190	SO:0001819	synonymous_variant	57717			AF217757	CCDS4251.1	5q31	2014-04-11			ENSG00000196963			"""Cadherins / Protocadherins : Clustered"""	14546	other	protocadherin	"""cadherin ME1"", ""protocadherin-3x"", ""PCDHbeta 16"""	606345				11230163, 11322959	Standard	NM_020957		Approved	PCDHB8a, PCDH3X, KIAA1621, PCDH-BETA16, ME1	uc003liv.3	Q9NRJ7	OTTHUMG00000188325	ENST00000361016.2:c.1872G>A	5.37:g.140564006G>A			140544190	B3KPK5|Q8IYD5|Q96SE9|Q9HCF1	Silent	SNP	ENST00000361016.2	37	CCDS4251.1	SNP	46	Broad																																																																																				0.701	PCDHB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251800.1	NM_020957		Silent
KCTD16	57528	broad.mit.edu	37	5	143853578	143853578	+	Silent	SNP	G	G	A			TCGA-61-2101-01	TCGA-61-2101-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2101-01	TCGA-61-2101-11	g.chr5:143853578G>A	ENST00000507359.3	+	3	2279	c.1188G>A	c.(1186-1188)gaG>gaA	p.E396E	KCTD16_ENST00000512467.1_Silent_p.E396E	NM_020768.3	NP_065819.1	Q68DU8	KCD16_HUMAN	potassium channel tetramerization domain containing 16	396					protein homooligomerization (GO:0051260)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|receptor complex (GO:0043235)		p.E396E(1)		large_intestine(5)|lung(9)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	21		all_hematologic(541;0.118)	KIRC - Kidney renal clear cell carcinoma(527;0.00111)|Kidney(363;0.00176)			AGGAGCTGGAGAAATGTATCC	0.408																																																1	Substitution - coding silent(1)	ovary(1)	5											60.0	71.0	67.0					5																	143853578		2200	4300	6500	143833771	SO:0001819	synonymous_variant	57528			AB037738	CCDS34260.1	5q32	2013-06-20	2013-06-20		ENSG00000183775	ENSG00000183775			29244	protein-coding gene	gene with protein product		613423	"""potassium channel tetramerisation domain containing 16"""			10718198	Standard	NM_020768		Approved	KIAA1317	uc003lnm.1	Q68DU8	OTTHUMG00000163172	ENST00000507359.3:c.1188G>A	5.37:g.143853578G>A			143833771	Q9P2M9	Silent	SNP	ENST00000507359.3	37	CCDS34260.1	SNP	33	Broad																																																																																				0.408	KCTD16-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371898.3	XM_098368		Silent
ABCC10	89845	broad.mit.edu	37	6	43415478	43415478	+	Silent	SNP	G	G	A	rs201628117	byFrequency	TCGA-61-2101-01	TCGA-61-2101-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2101-01	TCGA-61-2101-11	g.chr6:43415478G>A	ENST00000372530.4	+	18	3977	c.3762G>A	c.(3760-3762)gcG>gcA	p.A1254A	ABCC10_ENST00000244533.3_Silent_p.A1226A	NM_001198934.1	NP_001185863.1	Q5T3U5	MRP7_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 10	1254	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)	p.A1226A(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(8)|lung(21)|ovary(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	56	all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0152)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)		Cyclosporine(DB00091)|Cytarabine(DB00987)|Daunorubicin(DB00694)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Estradiol(DB00783)|Etoposide(DB00773)|Gemcitabine(DB00441)|Methotrexate(DB00563)|Paclitaxel(DB01229)|Sildenafil(DB00203)|Tenofovir(DB00300)|Verapamil(DB00661)|Vincristine(DB00541)	TGGTGTTGGCGTACCGGCCAG	0.657													G|||	2	0.000399361	0.0	0.0029	5008	,	,		17578	0.0		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	6											143.0	149.0	147.0					6																	43415478		2203	4300	6503	43523456	SO:0001819	synonymous_variant	89845			U66684	CCDS4896.1, CCDS56430.1	6p12.3	2012-03-14			ENSG00000124574	ENSG00000124574		"""ATP binding cassette transporters / subfamily C"""	52	protein-coding gene	gene with protein product		612509				8894702	Standard	NM_033450		Approved	EST182763, MRP7, SIMRP7	uc003ouy.1	Q5T3U5	OTTHUMG00000014733	ENST00000372530.4:c.3762G>A	6.37:g.43415478G>A			43523456	Q8NHX7|Q9H7N2|Q9NXY3|Q9UF48	Silent	SNP	ENST00000372530.4	37	CCDS56430.1	SNP	40	Broad																																																																																				0.657	ABCC10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040603.2	NM_033450		Silent
TBX18	9096	broad.mit.edu	37	6	85472351	85472351	+	Silent	SNP	C	C	T			TCGA-61-2101-01	TCGA-61-2101-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2101-01	TCGA-61-2101-11	g.chr6:85472351C>T	ENST00000369663.5	-	2	745	c.408G>A	c.(406-408)ccG>ccA	p.P136P	TBX18_ENST00000606521.1_5'UTR|TBX18_ENST00000606784.1_5'UTR	NM_001080508.1	NP_001073977.1	O95935	TBX18_HUMAN	T-box 18	136					anterior/posterior axis specification (GO:0009948)|cochlea morphogenesis (GO:0090103)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of canonical Wnt signaling pathway involved in neural plate anterior/posterior pattern formation (GO:0060829)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of mesenchymal cell proliferation involved in ureter development (GO:2000729)|sensory perception of sound (GO:0007605)|sinoatrial node development (GO:0003163)|smooth muscle cell differentiation (GO:0051145)|somitogenesis (GO:0001756)|ureter development (GO:0072189)	nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)	p.P136P(1)		NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(9)|liver(1)|lung(31)|ovary(2)|pancreas(3)|prostate(6)|skin(3)	61		all_cancers(76;0.000283)|Acute lymphoblastic leukemia(125;3.66e-08)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0858)		BRCA - Breast invasive adenocarcinoma(108;0.0267)		GCGGGGCCTGCGGCGAGGGCA	0.687																																																1	Substitution - coding silent(1)	ovary(1)	6											36.0	43.0	41.0					6																	85472351		2201	4294	6495	85529070	SO:0001819	synonymous_variant	9096			AJ010278	CCDS34495.1	6q14.1-q15	2012-12-19			ENSG00000112837	ENSG00000112837		"""T-boxes"""	11595	protein-coding gene	gene with protein product		604613				9888994, 16688725, 23242162	Standard	NM_001080508		Approved		uc003pkl.2	O95935	OTTHUMG00000015129	ENST00000369663.5:c.408G>A	6.37:g.85472351C>T			85529070	A2RU13|Q7Z6U4|Q9UJI6	Silent	SNP	ENST00000369663.5	37	CCDS34495.1	SNP	27	Broad																																																																																				0.687	TBX18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041378.2	NM_001080508		Silent
ANKRD6	22881	broad.mit.edu	37	6	90323541	90323541	+	Missense_Mutation	SNP	C	C	T	rs369598670		TCGA-61-2101-01	TCGA-61-2101-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2101-01	TCGA-61-2101-11	g.chr6:90323541C>T	ENST00000522441.1	+	7	1188	c.547C>T	c.(547-549)Cgc>Tgc	p.R183C	ANKRD6_ENST00000485637.1_Missense_Mutation_p.R183C|ANKRD6_ENST00000447838.2_Missense_Mutation_p.R183C|ANKRD6_ENST00000339746.4_Missense_Mutation_p.R183C|ANKRD6_ENST00000520793.1_Missense_Mutation_p.R150C|ANKRD6_ENST00000369408.5_Missense_Mutation_p.R183C	NM_001242811.1	NP_001229740.1	Q9Y2G4	ANKR6_HUMAN	ankyrin repeat domain 6	183					negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of JNK cascade (GO:0046330)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.R183C(1)		NS(1)|endometrium(3)|large_intestine(7)|lung(3)|ovary(3)|pancreas(1)|prostate(1)|stomach(2)	21		all_cancers(76;1.22e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.49e-10)|all_hematologic(105;7.79e-07)|all_epithelial(107;1.83e-05)|Lung NSC(302;0.239)		BRCA - Breast invasive adenocarcinoma(108;0.0209)		CGTTGCTGCGCGCTATAATCA	0.443																																																1	Substitution - Missense(1)	ovary(1)	6						C	CYS/ARG,CYS/ARG,CYS/ARG,CYS/ARG,CYS/ARG	2,3982		0,2,1990	115.0	112.0	113.0		547,547,547,448,547	4.7	1.0	6		113	0,8342		0,0,4171	no	missense,missense,missense,missense,missense	ANKRD6	NM_001242809.1,NM_001242811.1,NM_001242813.1,NM_001242814.1,NM_014942.4	180,180,180,180,180	0,2,6161	TT,TC,CC		0.0,0.0502,0.0162	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	183/728,183/728,183/693,150/664,183/723	90323541	2,12324	1992	4171	6163	90380262	SO:0001583	missense	22881			AB023174	CCDS47460.1, CCDS56441.1, CCDS56442.1, CCDS56443.1	6q14.2-q16.1	2013-03-20			ENSG00000135299	ENSG00000135299		"""Ankyrin repeat domain containing"""	17280	protein-coding gene	gene with protein product		610583					Standard	NM_001242809		Approved	KIAA0957	uc003pni.4	Q9Y2G4	OTTHUMG00000015202	ENST00000522441.1:c.547C>T	6.37:g.90323541C>T	ENSP00000430985:p.Arg183Cys		90380262	B3KUC3|Q5JUJ4|Q5JUJ5|Q8IUQ8|Q9NU24|Q9UFQ9	Missense_Mutation	SNP	ENST00000522441.1	37	CCDS56441.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	26.8	4.768098	0.90020	5.02E-4	0.0	ENSG00000135299	ENST00000369408;ENST00000339746;ENST00000447838;ENST00000522441;ENST00000485637;ENST00000520793	T;T;T;T;T;T	0.66460	-0.21;-0.21;-0.21;-0.21;-0.21;-0.2	4.66	4.66	0.58398	Ankyrin repeat-containing domain (4);	0.000000	0.56097	D	0.000028	T	0.76364	0.3977	M	0.62723	1.935	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.997;1.0;0.999;1.0	T	0.76615	-0.2894	10	0.51188	T	0.08	-17.7733	18.1135	0.89543	0.0:1.0:0.0:0.0	.	150;183;183;183	B3KUC3;Q9Y2G4;Q9Y2G4-1;C9JJE8	.;ANKR6_HUMAN;.;.	C	183;183;183;183;183;150	ENSP00000358416:R183C;ENSP00000345767:R183C;ENSP00000396771:R183C;ENSP00000430985:R183C;ENSP00000430954:R183C;ENSP00000429782:R150C	ENSP00000345767:R183C	R	+	1	0	ANKRD6	90380262	1.000000	0.71417	0.991000	0.47740	0.999000	0.98932	7.036000	0.76524	2.577000	0.86979	0.655000	0.94253	CGC		0.443	ANKRD6-006	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000376594.1			Missense_Mutation
ETV1	2115	broad.mit.edu	37	7	13971229	13971229	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2101-01	TCGA-61-2101-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2101-01	TCGA-61-2101-11	g.chr7:13971229G>A	ENST00000430479.1	-	9	1367	c.700C>T	c.(700-702)Cca>Tca	p.P234S	ETV1_ENST00000403527.1_Missense_Mutation_p.P194S|ETV1_ENST00000405192.2_Missense_Mutation_p.P234S|ETV1_ENST00000343495.5_Missense_Mutation_p.P216S|ETV1_ENST00000405358.4_Missense_Mutation_p.P248S|ETV1_ENST00000399357.3_Missense_Mutation_p.P131S|ETV1_ENST00000242066.5_Missense_Mutation_p.P216S|ETV1_ENST00000420159.2_Missense_Mutation_p.P176S|ETV1_ENST00000403685.1_Missense_Mutation_p.P216S|ETV1_ENST00000476720.2_5'UTR|ETV1_ENST00000405218.2_Missense_Mutation_p.P234S	NM_004956.4	NP_004947.2	P50549	ETV1_HUMAN	ets variant 1	234					axon guidance (GO:0007411)|cell differentiation (GO:0030154)|mechanosensory behavior (GO:0007638)|muscle organ development (GO:0007517)|peripheral nervous system neuron development (GO:0048935)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P234S(1)	TMPRSS2/ETV1(34)|ACSL3_ENST00000357430/ETV1(2)|EWSR1/ETV1(7)|KLK2/ETV1(3)|SLC45A3/ETV1(3)|HNRNPA2B1/ETV1(8)	breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(9)|lung(15)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	31						TCATACACTGGGTCGTGGTAC	0.527			T	"""EWSR1, TMPRSS2, SLC45A3, C15orf21, HNRNPA2B1. ACSL3"""	"""Ewing sarcoma, prostate"""																																		Dom	yes		7	7p22	2115	ets variant gene 1		"""M, E"""	1	Substitution - Missense(1)	ovary(1)	7											129.0	126.0	127.0					7																	13971229		2011	4174	6185	13937754	SO:0001583	missense	2115				CCDS55083.1, CCDS55084.1, CCDS55085.1, CCDS55086.1, CCDS55087.1, CCDS55088.1	7p22	2008-09-12	2008-09-12		ENSG00000006468	ENSG00000006468			3490	protein-coding gene	gene with protein product		600541	"""ets variant gene 1"""			1340465	Standard	NM_004956		Approved	ER81	uc003ssw.4	P50549	OTTHUMG00000152403	ENST00000430479.1:c.700C>T	7.37:g.13971229G>A	ENSP00000405327:p.Pro234Ser		13937754	A4D118|B2R768|B7Z2I4|B7Z618|B7Z9P2|C9JT37|E9PHB1|F5GXR2|O75849|Q4KMQ6|Q59GA7|Q6AI30|Q9UQ71|Q9Y636	Missense_Mutation	SNP	ENST00000430479.1	37	CCDS55088.1	SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	G	34	5.390474	0.95988	.	.	ENSG00000006468	ENST00000430479;ENST00000242066;ENST00000343495;ENST00000420159;ENST00000399357;ENST00000405192;ENST00000405358;ENST00000403527;ENST00000405218;ENST00000403685;ENST00000438956;ENST00000443608	T;T;T;T;T;T;T;T;T;T;T;T	0.27256	1.68;1.68;1.68;1.68;1.68;1.68;1.68;1.68;1.68;1.68;1.68;1.68	6.13	6.13	0.99165	PEA3-type ETS-domain transcription factor, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.53110	0.1776	M	0.67700	2.07	0.80722	D	1	D;P;D;D;D;D;P;P	0.76494	0.989;0.92;0.998;0.998;0.999;0.999;0.948;0.935	D;P;D;D;D;D;P;P	0.91635	0.927;0.73;0.966;0.994;0.999;0.996;0.625;0.824	T	0.37314	-0.9711	10	0.46703	T	0.11	.	20.8401	0.99726	0.0:0.0:1.0:0.0	.	245;216;248;176;131;194;176;234	Q59GA7;P50549-2;B5MCT2;F5GXR2;B7Z9P2;E9PHB1;B7Z618;P50549	.;.;.;.;.;.;.;ETV1_HUMAN	S	234;216;216;176;131;234;248;194;234;216;176;131	ENSP00000405327:P234S;ENSP00000242066:P216S;ENSP00000340853:P216S;ENSP00000411626:P176S;ENSP00000382293:P131S;ENSP00000385381:P234S;ENSP00000384085:P248S;ENSP00000384138:P194S;ENSP00000385551:P234S;ENSP00000385686:P216S;ENSP00000393078:P176S;ENSP00000394710:P131S	ENSP00000242066:P216S	P	-	1	0	ETV1	13937754	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.225000	0.95219	2.932000	0.99384	0.644000	0.83932	CCA		0.527	ETV1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326111.1	NM_004956		Missense_Mutation
DGKB	1607	broad.mit.edu	37	7	14647099	14647099	+	Missense_Mutation	SNP	G	G	C			TCGA-61-2101-01	TCGA-61-2101-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2101-01	TCGA-61-2101-11	g.chr7:14647099G>C	ENST00000403951.2	-	17	1815	c.1396C>G	c.(1396-1398)Cgt>Ggt	p.R466G	DGKB_ENST00000406247.3_Missense_Mutation_p.R466G|DGKB_ENST00000258767.5_Missense_Mutation_p.R466G|DGKB_ENST00000444700.2_Missense_Mutation_p.R447G|DGKB_ENST00000403963.1_5'UTR|DGKB_ENST00000399322.3_Missense_Mutation_p.R466G|DGKB_ENST00000407950.1_Missense_Mutation_p.R458G|DGKB_ENST00000402815.1_Missense_Mutation_p.R465G			Q9Y6T7	DGKB_HUMAN	diacylglycerol kinase, beta 90kDa	466	DAGKc. {ECO:0000255|PROSITE- ProRule:PRU00783}.				blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)	p.R466G(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|liver(1)|lung(34)|ovary(4)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	72						TAAACCTGACGAGGATTTAAT	0.279																																																1	Substitution - Missense(1)	ovary(1)	7											51.0	48.0	49.0					7																	14647099		1786	4052	5838	14613624	SO:0001583	missense	1607			AB018261	CCDS47547.1, CCDS47548.1	7p21.2	2013-01-10	2002-08-29		ENSG00000136267	ENSG00000136267	2.7.1.107	"""EF-hand domain containing"""	2850	protein-coding gene	gene with protein product		604070	"""diacylglycerol kinase, beta (90kD)"""	DAGK2		7689223	Standard	NM_004080		Approved	KIAA0718, DGK, DGK-BETA	uc003ssz.3	Q9Y6T7	OTTHUMG00000152477	ENST00000403951.2:c.1396C>G	7.37:g.14647099G>C	ENSP00000385780:p.Arg466Gly		14613624	A4D116|A4D117|A8MXU2|O75241|Q2M377|Q75MF9|Q75MU7|Q86UI5|Q86UM9|Q9UQ29	Missense_Mutation	SNP	ENST00000403951.2	37	CCDS47547.1	SNP	37	Broad	.	.	.	.	.	.	.	.	.	.	G	19.38	3.816416	0.70912	.	.	ENSG00000136267	ENST00000403951;ENST00000399322;ENST00000258767;ENST00000402815;ENST00000407950;ENST00000444700;ENST00000406247	T;T;T;T;T;T;T	0.42131	0.98;0.98;0.98;0.98;0.98;0.98;0.98	5.6	5.6	0.85130	Diacylglycerol kinase, catalytic domain (3);	0.000000	0.85682	D	0.000000	T	0.64571	0.2610	M	0.76002	2.32	0.54753	D	0.999981	D;D;D;D	0.89917	0.99;0.998;0.998;1.0	D;D;D;D	0.91635	0.96;0.988;0.995;0.999	T	0.65647	-0.6117	10	0.59425	D	0.04	.	14.772	0.69688	0.0:0.0:0.8556:0.1444	.	465;447;466;466	B7ZL83;C9JTC0;Q9Y6T7-2;Q9Y6T7	.;.;.;DGKB_HUMAN	G	466;466;466;465;458;447;466	ENSP00000385780:R466G;ENSP00000382260:R466G;ENSP00000258767:R466G;ENSP00000384909:R465G;ENSP00000385031:R458G;ENSP00000388451:R447G;ENSP00000386066:R466G	ENSP00000258767:R466G	R	-	1	0	DGKB	14613624	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.070000	0.57548	2.786000	0.95864	0.561000	0.74099	CGT		0.279	DGKB-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000326356.2	NM_004080		Missense_Mutation
CRCP	27297	broad.mit.edu	37	7	65579900	65579900	+	5'UTR	SNP	G	G	A			TCGA-61-2101-01	TCGA-61-2101-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2101-01	TCGA-61-2101-11	g.chr7:65579900G>A	ENST00000395326.3	+	0	309				CRCP_ENST00000431089.2_Splice_Site_p.V29M|CRCP_ENST00000398684.2_5'UTR|AC068533.7_ENST00000450043.1_Intron|CRCP_ENST00000338592.5_5'UTR	NM_014478.4	NP_055293.1	O75575	RPC9_HUMAN	CGRP receptor component						defense response to virus (GO:0051607)|innate immune response (GO:0045087)|neuropeptide signaling pathway (GO:0007218)|transcription from RNA polymerase III promoter (GO:0006383)	acrosomal vesicle (GO:0001669)|DNA polymerase III complex (GO:0009360)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcitonin gene-related polypeptide receptor activity (GO:0001635)|DNA-directed RNA polymerase activity (GO:0003899)|nucleotide binding (GO:0000166)	p.?(1)		cervix(1)|kidney(1)|lung(4)	6						CAGCTGTGAAGTGTGAGGTTC	0.667																																																1	Unknown(1)	ovary(1)	7											107.0	101.0	103.0					7																	65579900		2203	4300	6503	65217335	SO:0001623	5_prime_UTR_variant	27297			AF073792	CCDS5532.1, CCDS47599.1, CCDS47600.1, CCDS55116.1	7q11.1	2009-01-14			ENSG00000241258	ENSG00000241258			17888	protein-coding gene	gene with protein product	"""calcitonin gene-related peptide-receptor component protein"""	606121				8622957, 10067875, 12482973	Standard	NM_014478		Approved	CGRP-RCP, RCP, RCP9	uc011kdw.2	O75575	OTTHUMG00000129519	ENST00000395326.3:c.-50G>A	7.37:g.65579900G>A			65217335	A8MUZ4|A8MW23|B2R4H4|B4E198|Q3KRA3|Q5HYF1|Q8IXL4	Missense_Mutation	SNP	ENST00000395326.3	37	CCDS5532.1	SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	G	15.21	2.764723	0.49574	.	.	ENSG00000241258	ENST00000431089	.	.	.	2.71	1.8	0.24995	.	.	.	.	.	T	0.48150	0.1484	.	.	.	0.19775	N	0.999952	D	0.54397	0.966	P	0.58331	0.837	T	0.25502	-1.0130	7	0.42905	T	0.14	.	4.8971	0.13755	0.1818:0.0:0.8182:0.0	.	29	B4E198	.	M	29	.	ENSP00000388653:V29M	V	+	1	0	CRCP	65217335	0.000000	0.05858	0.000000	0.03702	0.020000	0.10135	-0.050000	0.11904	0.668000	0.31126	0.298000	0.19748	GTG		0.667	CRCP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251697.2	NM_014478		Missense_Mutation
BAZ1B	9031	broad.mit.edu	37	7	72884711	72884711	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2101-01	TCGA-61-2101-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2101-01	TCGA-61-2101-11	g.chr7:72884711C>T	ENST00000339594.4	-	8	3034	c.2696G>A	c.(2695-2697)cGc>cAc	p.R899H	BAZ1B_ENST00000404251.1_Missense_Mutation_p.R899H	NM_032408.3	NP_115784.1	Q9UIG0	BAZ1B_HUMAN	bromodomain adjacent to zinc finger domain, 1B	899					cellular response to DNA damage stimulus (GO:0006974)|chromatin assembly or disassembly (GO:0006333)|chromatin-mediated maintenance of transcription (GO:0048096)|double-strand break repair (GO:0006302)|heart morphogenesis (GO:0003007)|histone phosphorylation (GO:0016572)|peptidyl-tyrosine phosphorylation (GO:0018108)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed chromosome (GO:0000793)|nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|histone kinase activity (GO:0035173)|lysine-acetylated histone binding (GO:0070577)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)|vitamin D receptor activator activity (GO:0071884)|zinc ion binding (GO:0008270)	p.R899H(1)		NS(1)|breast(5)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(12)|lung(20)|ovary(5)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	61		Lung NSC(55;0.0659)|all_lung(88;0.152)				AGGAGTCCTGCGCATGACTAG	0.418																																					Esophageal Squamous(112;1167 1561 21085 43672 48228)											1	Substitution - Missense(1)	ovary(1)	7											187.0	159.0	169.0					7																	72884711		2203	4300	6503	72522647	SO:0001583	missense	9031			AF084479	CCDS5549.1	7q11.23	2013-01-28			ENSG00000009954	ENSG00000009954		"""Zinc fingers, PHD-type"""	961	protein-coding gene	gene with protein product	"""Williams-Beuren syndrome chromosome region 9"", ""Williams-Beuren syndrome chromosome region 10"", ""transcription factor WSTF"""	605681		WBSCR9, WBSCR10		9858827, 9828126	Standard	NM_032408		Approved	WSTF	uc003tyc.3	Q9UIG0	OTTHUMG00000023847	ENST00000339594.4:c.2696G>A	7.37:g.72884711C>T	ENSP00000342434:p.Arg899His		72522647	B9EGK3|D3DXE9|O95039|O95247|O95277|Q6P1K4|Q86UJ6	Missense_Mutation	SNP	ENST00000339594.4	37	CCDS5549.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	31	5.075833	0.94000	.	.	ENSG00000009954	ENST00000339594;ENST00000404251	T;T	0.64438	-0.1;-0.1	5.18	5.18	0.71444	.	0.000000	0.85682	D	0.000000	T	0.75686	0.3883	L	0.56769	1.78	0.58432	D	0.999998	D	0.89917	1.0	D	0.80764	0.994	T	0.73017	-0.4115	10	0.32370	T	0.25	-15.9366	17.6718	0.88220	0.0:1.0:0.0:0.0	.	899	Q9UIG0	BAZ1B_HUMAN	H	899	ENSP00000342434:R899H;ENSP00000385442:R899H	ENSP00000342434:R899H	R	-	2	0	BAZ1B	72522647	1.000000	0.71417	0.969000	0.41365	0.927000	0.56198	7.376000	0.79658	2.440000	0.82611	0.557000	0.71058	CGC		0.418	BAZ1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252123.4	NM_032408		Missense_Mutation
PRKDC	5591	broad.mit.edu	37	8	48734191	48734191	+	Missense_Mutation	SNP	T	T	C			TCGA-61-2101-01	TCGA-61-2101-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2101-01	TCGA-61-2101-11	g.chr8:48734191T>C	ENST00000314191.2	-	66	9138	c.9082A>G	c.(9082-9084)Aaa>Gaa	p.K3028E	PRKDC_ENST00000338368.3_Missense_Mutation_p.K3028E|PRKDC_ENST00000523565.1_5'UTR	NM_006904.6	NP_008835.5	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic polypeptide	3029	FAT. {ECO:0000255|PROSITE- ProRule:PRU00534}.|KIP-binding.				B cell lineage commitment (GO:0002326)|brain development (GO:0007420)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|ectopic germ cell programmed cell death (GO:0035234)|heart development (GO:0007507)|immunoglobulin V(D)J recombination (GO:0033152)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of protein phosphorylation (GO:0001933)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|pro-B cell differentiation (GO:0002328)|protein destabilization (GO:0031648)|regulation of circadian rhythm (GO:0042752)|response to gamma radiation (GO:0010332)|rhythmic process (GO:0048511)|signal transduction involved in mitotic G1 DNA damage checkpoint (GO:0072431)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell receptor V(D)J recombination (GO:0033153)|telomere maintenance (GO:0000723)	cytosol (GO:0005829)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription factor binding (GO:0008134)	p.K3029E(1)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(9)|cervix(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(30)|lung(56)|ovary(6)|pancreas(1)|prostate(8)|skin(7)	147		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)			Caffeine(DB00201)	CTCCAGATTTTATTTAGGTCT	0.343								Non-homologous end-joining																													Esophageal Squamous(79;1091 1253 12329 31680 40677)											1	Substitution - Missense(1)	ovary(1)	8											39.0	37.0	38.0					8																	48734191		1799	4068	5867	48896744	SO:0001583	missense	5591				CCDS75734.1, CCDS75735.1	8q11	2014-09-17				ENSG00000253729	2.7.11.1		9413	protein-coding gene	gene with protein product		600899		HYRC, HYRC1		7638222	Standard	NM_001081640		Approved	DNPK1, p350, DNAPK, XRCC7, DNA-PKcs	uc003xqi.3	P78527		ENST00000314191.2:c.9082A>G	8.37:g.48734191T>C	ENSP00000313420:p.Lys3028Glu		48896744	P78528|Q13327|Q13337|Q14175|Q59H99|Q7Z611|Q96SE6|Q9UME3	Missense_Mutation	SNP	ENST00000314191.2	37		SNP	61	Broad	.	.	.	.	.	.	.	.	.	.	T	18.76	3.692923	0.68271	.	.	ENSG00000253729	ENST00000314191;ENST00000338368	T;T	0.70282	-0.47;-0.47	5.4	5.4	0.78164	PIK-related kinase (1);PIK-related kinase, FAT (1);	0.118539	0.56097	D	0.000031	D	0.82287	0.5004	M	0.76328	2.33	0.41915	D	0.990481	D;D	0.59767	0.975;0.986	P;D	0.63283	0.875;0.913	D	0.84210	0.0455	10	0.54805	T	0.06	.	15.7083	0.77602	0.0:0.0:0.0:1.0	.	3028;3029	E7EUY0;P78527	.;PRKDC_HUMAN	E	3028	ENSP00000313420:K3028E;ENSP00000345182:K3028E	ENSP00000313420:K3028E	K	-	1	0	PRKDC	48896744	1.000000	0.71417	0.861000	0.33841	0.425000	0.31504	5.886000	0.69743	2.167000	0.68274	0.528000	0.53228	AAA		0.343	PRKDC-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001081640		Missense_Mutation
TRPA1	8989	broad.mit.edu	37	8	72971638	72971638	+	Missense_Mutation	SNP	T	T	G			TCGA-61-2101-01	TCGA-61-2101-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2101-01	TCGA-61-2101-11	g.chr8:72971638T>G	ENST00000262209.4	-	8	1187	c.980A>C	c.(979-981)tAt>tCt	p.Y327S		NM_007332.2	NP_015628.2	O75762	TRPA1_HUMAN	transient receptor potential cation channel, subfamily A, member 1	327					calcium ion transmembrane transport (GO:0070588)|detection of chemical stimulus involved in sensory perception of pain (GO:0050968)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|response to cold (GO:0009409)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to pain (GO:0048265)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|stereocilium bundle (GO:0032421)	calcium channel activity (GO:0005262)|channel activity (GO:0015267)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(26)|lung(44)|ovary(4)|prostate(6)|stomach(1)	98			Epithelial(68;0.223)		Menthol(DB00825)	TGAAATTAAATAGTCTGCTAG	0.219																																																0			8											19.0	22.0	21.0					8																	72971638		2159	4203	6362	73134192	SO:0001583	missense	8989			Y10601	CCDS34908.1	8q13	2013-01-10	2003-11-20	2003-11-20	ENSG00000104321	ENSG00000104321		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	497	protein-coding gene	gene with protein product		604775	"""ankyrin-like with transmembrane domains 1"""	ANKTM1		16382100	Standard	NM_007332		Approved		uc003xza.3	O75762	OTTHUMG00000164516	ENST00000262209.4:c.980A>C	8.37:g.72971638T>G	ENSP00000262209:p.Tyr327Ser		73134192	A6NIN6	Missense_Mutation	SNP	ENST00000262209.4	37	CCDS34908.1	SNP	49	Broad	.	.	.	.	.	.	.	.	.	.	T	17.06	3.292995	0.60086	.	.	ENSG00000104321	ENST00000523582;ENST00000262209	T;T	0.65732	-0.17;-0.17	5.02	5.02	0.67125	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	T	0.63534	0.2519	M	0.66939	2.045	0.80722	D	1	P	0.38300	0.626	B	0.39152	0.292	T	0.69135	-0.5225	10	0.62326	D	0.03	-20.9085	15.4506	0.75271	0.0:0.0:0.0:1.0	.	327	O75762	TRPA1_HUMAN	S	179;327	ENSP00000428151:Y179S;ENSP00000262209:Y327S	ENSP00000262209:Y327S	Y	-	2	0	TRPA1	73134192	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.006000	0.63978	2.182000	0.69389	0.533000	0.62120	TAT		0.219	TRPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379079.2	NM_007332		Missense_Mutation
KIAA1161	57462	broad.mit.edu	37	9	34371740	34371740	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2101-01	TCGA-61-2101-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2101-01	TCGA-61-2101-11	g.chr9:34371740C>T	ENST00000297625.7	-	2	1325	c.1100G>A	c.(1099-1101)cGc>cAc	p.R367H		NM_020702.3	NP_065753.2	Q6NSJ0	K1161_HUMAN	KIAA1161	401					carbohydrate metabolic process (GO:0005975)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of protein kinase B signaling (GO:0051897)|skeletal muscle fiber development (GO:0048741)	integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)	p.R367H(1)		breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(5)|ovary(1)	12			LUSC - Lung squamous cell carcinoma(29;0.0107)	GBM - Glioblastoma multiforme(74;0.126)		CTCGCCGAAGCGCGACGAGTT	0.672																																																1	Substitution - Missense(1)	ovary(1)	9											31.0	33.0	33.0					9																	34371740		2047	4163	6210	34361740	SO:0001583	missense	57462			AB032987		9p11.2	2009-11-06			ENSG00000164976	ENSG00000164976			19918	protein-coding gene	gene with protein product						10574461	Standard	XM_006716808		Approved	NET37	uc003zue.4	Q6NSJ0	OTTHUMG00000019816	ENST00000297625.7:c.1100G>A	9.37:g.34371740C>T	ENSP00000297625:p.Arg367His		34361740	Q5T587|Q5T588|Q9ULQ9	Missense_Mutation	SNP	ENST00000297625.7	37		SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	9.739	1.164384	0.21538	.	.	ENSG00000164976	ENST00000297625	T	0.42131	0.98	5.36	2.5	0.30297	Glycoside hydrolase, superfamily (1);	0.323527	0.34628	N	0.003804	T	0.12135	0.0295	N	0.03608	-0.345	0.21527	N	0.99966	P	0.38827	0.649	B	0.32022	0.139	T	0.06232	-1.0838	10	0.15499	T	0.54	-5.342	1.2192	0.01921	0.1829:0.4123:0.2155:0.1893	.	401	Q6NSJ0	K1161_HUMAN	H	367	ENSP00000297625:R367H	ENSP00000297625:R367H	R	-	2	0	KIAA1161	34361740	0.997000	0.39634	0.577000	0.28562	0.354000	0.29330	2.604000	0.46274	0.617000	0.30160	-0.372000	0.07161	CGC		0.672	KIAA1161-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000052158.1	XM_351807		Missense_Mutation
TP53	7157	broad.mit.edu	37	17	7579423	7579432	+	Frame_Shift_Del	DEL	GGCTGGTGCA	GGCTGGTGCA	-	rs587782148		TCGA-61-2101-01	TCGA-61-2101-11							Unknown	Unknown	Unknown	Phase_I	Capture	---			Illumina GAIIx	TCGA-61-2101-01	TCGA-61-2101-11	g.chr17:7579423_7579432delGGCTGGTGCA	ENST00000269305.4	-	4	444_453	c.255_264delTGCACCAGCC	c.(253-264)cctgcaccagccfs	p.PAPA85fs	TP53_ENST00000413465.2_Frame_Shift_Del_p.PAPA85fs|TP53_ENST00000455263.2_Frame_Shift_Del_p.PAPA85fs|TP53_ENST00000359597.4_Frame_Shift_Del_p.PAPA85fs|TP53_ENST00000420246.2_Frame_Shift_Del_p.PAPA85fs|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Frame_Shift_Del_p.PAPA85fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	85	Interaction with WWOX.		P -> L (in sporadic cancers; somatic mutation).|P -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.A88fs*32(3)|p.A76_S90del15(3)|p.P87Q(3)|p.G59fs*23(3)|p.S90fs*33(3)|p.A88fs*35(2)|p.A86fs*64(1)|p.P85fs*59(1)|p.P85fs*58(1)|p.A86V(1)|p.A88fs*52(1)|p.V73fs*9(1)|p.D48fs*55(1)|p.A79_A88del10(1)|p.S33fs*23(1)|p.P87P(1)|p.A86fs*59(1)|p.A86fs*34(1)|p.P87fs*54(1)|p.A86fs*33(1)|p.A86fs*32(1)|p.P13fs*18(1)|p.P89fs*60(1)|p.A83fs*35(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCCAGGAGGGGGCTGGTGCAGGGGCCGCCG	0.619		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	43	Deletion - Frameshift(24)|Whole gene deletion(8)|Deletion - In frame(4)|Substitution - Missense(4)|Insertion - Frameshift(2)|Substitution - coding silent(1)	upper_aerodigestive_tract(9)|haematopoietic_and_lymphoid_tissue(5)|lung(4)|ovary(4)|prostate(4)|bone(4)|central_nervous_system(3)|urinary_tract(3)|breast(3)|large_intestine(1)|stomach(1)|soft_tissue(1)|endometrium(1)	17																																								7520157	SO:0001589	frameshift_variant	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.255_264delTGCACCAGCC	17.37:g.7579423_7579432delGGCTGGTGCA	ENSP00000269305:p.Pro85fs		7520148	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	ENST00000269305.4	37	CCDS11118.1	DEL	43	Broad																																																																																				0.619	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Frame_Shift_Del
