#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
CAPZB	832	broad.mit.edu	37	1	19746216	19746216	+	Missense_Mutation	SNP	T	T	A			TCGA-61-2104-01	TCGA-61-2104-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2104-01	TCGA-61-2104-11	g.chr1:19746216T>A	ENST00000375142.1	-	2	78	c.32A>T	c.(31-33)gAc>gTc	p.D11V	CAPZB_ENST00000264203.3_Missense_Mutation_p.D37V|CAPZB_ENST00000375144.1_5'UTR|CAPZB_ENST00000401084.2_Missense_Mutation_p.D11V|CAPZB_ENST00000264202.6_Missense_Mutation_p.D11V|CAPZB_ENST00000482808.1_5'UTR|CAPZB_ENST00000433834.1_Missense_Mutation_p.D40V	NM_001206540.1	NP_001193469.1	P47756	CAPZB_HUMAN	capping protein (actin filament) muscle Z-line, beta	11					actin cytoskeleton organization (GO:0030036)|barbed-end actin filament capping (GO:0051016)|blood coagulation (GO:0007596)|cellular component movement (GO:0006928)|cytoskeleton organization (GO:0007010)|lamellipodium assembly (GO:0030032)|muscle fiber development (GO:0048747)|negative regulation of microtubule polymerization (GO:0031115)|neuron projection development (GO:0031175)|regulation of cell morphogenesis (GO:0022604)|regulation of protein kinase C signaling (GO:0090036)	acrosomal vesicle (GO:0001669)|actin cytoskeleton (GO:0015629)|cortical cytoskeleton (GO:0030863)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|F-actin capping protein complex (GO:0008290)|intercalated disc (GO:0014704)|lamellipodium (GO:0030027)|membrane (GO:0016020)|WASH complex (GO:0071203)|Z disc (GO:0030018)	actin binding (GO:0003779)	p.D11V(1)		endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)|urinary_tract(1)	7		Colorectal(325;3.93e-05)|Renal(390;0.000147)|all_lung(284;0.000169)|Lung NSC(340;0.000202)|Breast(348;0.000496)|Ovarian(437;0.00428)|Myeloproliferative disorder(586;0.0262)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Kidney(64;8.63e-06)|BRCA - Breast invasive adenocarcinoma(304;4.06e-05)|KIRC - Kidney renal clear cell carcinoma(64;0.000175)|GBM - Glioblastoma multiforme(114;0.000525)|STAD - Stomach adenocarcinoma(196;0.00779)|READ - Rectum adenocarcinoma(331;0.103)|Lung(427;0.173)		CCTCATTAGGTCCAAGGCACA	0.493																																																1	Substitution - Missense(1)	ovary(1)	1											63.0	65.0	64.0					1																	19746216		2068	4216	6284	19618803	SO:0001583	missense	832			U03271	CCDS41277.1, CCDS55579.1, CCDS72717.1, CCDS72718.1	1p36.1	2014-05-09			ENSG00000077549	ENSG00000077549			1491	protein-coding gene	gene with protein product		601572					Standard	NM_004930		Approved		uc021ohr.1	P47756	OTTHUMG00000002556	ENST00000375142.1:c.32A>T	1.37:g.19746216T>A	ENSP00000364284:p.Asp11Val		19618803	Q32Q68|Q5U0L4|Q8TB49|Q9NUC4	Missense_Mutation	SNP	ENST00000375142.1	37	CCDS55579.1	SNP	58	Broad	.	.	.	.	.	.	.	.	.	.	T	29.0	4.971716	0.92919	.	.	ENSG00000077549	ENST00000401084;ENST00000264203;ENST00000375142;ENST00000433834;ENST00000375145;ENST00000264202	.	.	.	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	D	0.86744	0.6006	H	0.95504	3.68	0.80722	D	1	P;D;P	0.69078	0.952;0.997;0.781	P;D;P	0.85130	0.904;0.997;0.815	D	0.90427	0.4421	9	0.87932	D	0	-5.1128	13.9266	0.63966	0.0:0.0:0.0:1.0	.	40;37;11	B1AK88;B1AK85;P47756-2	.;.;.	V	11;37;11;40;73;11	.	ENSP00000264202:D11V	D	-	2	0	CAPZB	19618803	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.255000	0.78338	2.168000	0.68352	0.533000	0.62120	GAC		0.493	CAPZB-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000007260.1			Missense_Mutation
NT5C1A	84618	broad.mit.edu	37	1	40126874	40126874	+	Silent	SNP	C	C	T			TCGA-61-2104-01	TCGA-61-2104-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2104-01	TCGA-61-2104-11	g.chr1:40126874C>T	ENST00000235628.1	-	5	617	c.618G>A	c.(616-618)ctG>ctA	p.L206L		NM_032526.1	NP_115915.1	Q9BXI3	5NT1A_HUMAN	5'-nucleotidase, cytosolic IA	206					adenosine metabolic process (GO:0046085)|dephosphorylation (GO:0016311)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleoside metabolic process (GO:0009116)|purine nucleobase metabolic process (GO:0006144)|purine nucleoside monophosphate catabolic process (GO:0009128)|purine nucleotide catabolic process (GO:0006195)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	5'-nucleotidase activity (GO:0008253)|magnesium ion binding (GO:0000287)|nucleotide binding (GO:0000166)	p.L206L(1)		breast(1)|large_intestine(3)|lung(7)|ovary(2)|prostate(2)	15	Lung NSC(20;3.81e-06)|Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;1.87e-18)|Epithelial(16;4.3e-17)|all cancers(16;8.48e-16)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			AGGCCACGCGCAGCTGACTCT	0.627																																																1	Substitution - coding silent(1)	ovary(1)	1											59.0	51.0	53.0					1																	40126874		2203	4300	6503	39899461	SO:0001819	synonymous_variant	84618			AF331801	CCDS440.1	1p34.3-p33	2008-07-18			ENSG00000116981	ENSG00000116981			17819	protein-coding gene	gene with protein product	"""cytosolic 5' nucleotidase, type 1A"", ""AMP-specific 5'-NT"", ""cytosolic 5'-nucleotidase IA"""	610525				11133996, 11690631	Standard	NM_032526		Approved	CN-I, CN-IA, CN1A, CN1, MGC119199, MGC119201	uc001cdq.1	Q9BXI3	OTTHUMG00000009244	ENST00000235628.1:c.618G>A	1.37:g.40126874C>T			39899461	Q3SYB9|Q5TG98|Q9BWT8	Silent	SNP	ENST00000235628.1	37	CCDS440.1	SNP	25	Broad																																																																																				0.627	NT5C1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025626.1	NM_032526		Silent
C1orf194	127003	broad.mit.edu	37	1	109650546	109650546	+	Silent	SNP	G	G	A			TCGA-61-2104-01	TCGA-61-2104-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2104-01	TCGA-61-2104-11	g.chr1:109650546G>A	ENST00000369948.3	-	2	270	c.195C>T	c.(193-195)ccC>ccT	p.P65P	C1orf194_ENST00000369949.4_Silent_p.P53P|C1orf194_ENST00000369945.3_Intron			Q5T5A4	CA194_HUMAN	chromosome 1 open reading frame 194	65								p.P53P(2)		large_intestine(2)|lung(2)|ovary(2)	6						TAGGTACCTCGGGATCAAAAT	0.488																																																2	Substitution - coding silent(2)	ovary(1)|lung(1)	1											87.0	83.0	84.0					1																	109650546		1568	3582	5150	109452069	SO:0001819	synonymous_variant	127003				CCDS41364.1	1p13.3	2011-03-31			ENSG00000179902	ENSG00000179902			32331	protein-coding gene	gene with protein product							Standard	NM_001122961		Approved		uc009wew.3	Q5T5A4	OTTHUMG00000011735	ENST00000369948.3:c.195C>T	1.37:g.109650546G>A			109452069	Q5T5A3	Silent	SNP	ENST00000369948.3	37		SNP	39	Broad																																																																																				0.488	C1orf194-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000032416.2	NM_001122961		Silent
SPAG17	200162	broad.mit.edu	37	1	118624223	118624223	+	Missense_Mutation	SNP	A	A	C			TCGA-61-2104-01	TCGA-61-2104-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2104-01	TCGA-61-2104-11	g.chr1:118624223A>C	ENST00000336338.5	-	14	1870	c.1805T>G	c.(1804-1806)tTt>tGt	p.F602C		NM_206996.2	NP_996879.1	Q6Q759	SPG17_HUMAN	sperm associated antigen 17	602						cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)|sperm flagellum (GO:0036126)		p.F602C(1)		NS(1)|biliary_tract(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(30)|liver(2)|lung(56)|ovary(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	123	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		CTCAAAAGTAAACACCTTGAA	0.438																																																1	Substitution - Missense(1)	ovary(1)	1											115.0	110.0	111.0					1																	118624223		2203	4300	6503	118425746	SO:0001583	missense	200162				CCDS899.1	1p12	2014-01-21			ENSG00000155761	ENSG00000155761			26620	protein-coding gene	gene with protein product							Standard	NM_206996		Approved	FLJ34497, PF6, RP4-776P7.2, CT143	uc001ehk.2	Q6Q759	OTTHUMG00000012198	ENST00000336338.5:c.1805T>G	1.37:g.118624223A>C	ENSP00000337804:p.Phe602Cys		118425746	Q8NAZ1|Q9NT21	Missense_Mutation	SNP	ENST00000336338.5	37	CCDS899.1	SNP	1	Broad	.	.	.	.	.	.	.	.	.	.	A	19.93	3.917655	0.73098	.	.	ENSG00000155761	ENST00000336338	T	0.25579	1.79	5.34	5.34	0.76211	.	0.199292	0.52532	D	0.000069	T	0.43545	0.1252	M	0.78916	2.43	0.35236	D	0.777349	D	0.89917	1.0	D	0.91635	0.999	T	0.53767	-0.8392	10	0.87932	D	0	.	14.1866	0.65609	1.0:0.0:0.0:0.0	.	602	Q6Q759	SPG17_HUMAN	C	602	ENSP00000337804:F602C	ENSP00000337804:F602C	F	-	2	0	SPAG17	118425746	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.930000	0.70104	2.160000	0.67779	0.482000	0.46254	TTT		0.438	SPAG17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033723.1	NM_206996		Missense_Mutation
ARHGEF11	9826	broad.mit.edu	37	1	156918111	156918111	+	Splice_Site	SNP	C	C	G			TCGA-61-2104-01	TCGA-61-2104-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2104-01	TCGA-61-2104-11	g.chr1:156918111C>G	ENST00000361409.2	-	22	2727	c.1985G>C	c.(1984-1986)aGg>aCg	p.R662T	ARHGEF11_ENST00000487682.1_5'Flank|ARHGEF11_ENST00000368194.3_Splice_Site_p.R702T|ARHGEF11_ENST00000315174.8_Splice_Site_p.R78T	NM_014784.3	NP_055599.1	O15085	ARHGB_HUMAN	Rho guanine nucleotide exchange factor (GEF) 11	662					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|cellular component movement (GO:0006928)|cytokinesis (GO:0000910)|establishment of cell polarity (GO:0030010)|G-protein coupled receptor signaling pathway (GO:0007186)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell growth (GO:0001558)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)|striated muscle contraction (GO:0006941)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|membrane (GO:0016020)	G-protein coupled receptor binding (GO:0001664)|GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.R702T(1)		NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(27)|ovary(4)|pancreas(2)|pleura(1)|prostate(4)|skin(7)|stomach(1)|urinary_tract(2)	81	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					CCCTGCCCACCTGGTGGAGAG	0.607																																																1	Substitution - Missense(1)	ovary(1)	1											90.0	79.0	83.0					1																	156918111		2203	4300	6503	155184735	SO:0001630	splice_region_variant	9826			AB002378	CCDS1162.1, CCDS1163.1	1q21	2011-11-16			ENSG00000132694	ENSG00000132694		"""Rho guanine nucleotide exchange factors"""	14580	protein-coding gene	gene with protein product		605708				10526156, 9205841	Standard	NM_014784		Approved	KIAA0380, GTRAP48, PDZ-RHOGEF	uc001fqn.3	O15085	OTTHUMG00000041292	ENST00000361409.2:c.1985+1G>C	1.37:g.156918111C>G			155184735	D3DVD0|Q5VY40|Q6PFW2	Missense_Mutation	SNP	ENST00000361409.2	37	CCDS1162.1	SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	C	26.5	4.742880	0.89573	.	.	ENSG00000132694	ENST00000368194;ENST00000361409;ENST00000315174	T;T;T	0.68903	-0.35;-0.36;-0.36	5.76	5.76	0.90799	.	0.000000	0.64402	D	0.000005	T	0.66247	0.2770	N	0.24115	0.695	0.58432	D	0.999999	D;D;P	0.76494	0.999;0.999;0.459	D;D;B	0.80764	0.98;0.994;0.19	T	0.63994	-0.6511	9	.	.	.	-24.1394	19.5514	0.95322	0.0:1.0:0.0:0.0	.	78;662;702	F8W8P9;O15085;O15085-2	.;ARHGB_HUMAN;.	T	702;662;78	ENSP00000357177:R702T;ENSP00000354644:R662T;ENSP00000313470:R78T	.	R	-	2	0	ARHGEF11	155184735	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	6.942000	0.75928	2.721000	0.93114	0.655000	0.94253	AGG		0.607	ARHGEF11-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000098931.1	NM_198236	Missense_Mutation	Missense_Mutation
POU2F1	5451	broad.mit.edu	37	1	167343397	167343397	+	Missense_Mutation	SNP	A	A	T			TCGA-61-2104-01	TCGA-61-2104-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2104-01	TCGA-61-2104-11	g.chr1:167343397A>T	ENST00000541643.3	+	7	548	c.386A>T	c.(385-387)cAg>cTg	p.Q129L	POU2F1_ENST00000367865.1_3'UTR|POU2F1_ENST00000367862.5_Missense_Mutation_p.Q141L|POU2F1_ENST00000420254.3_Missense_Mutation_p.Q129L|POU2F1_ENST00000367866.2_Missense_Mutation_p.Q152L|POU2F1_ENST00000452019.1_Missense_Mutation_p.Q129L|POU2F1_ENST00000429375.2_Intron			P14859	PO2F1_HUMAN	POU class 2 homeobox 1	129					gene expression (GO:0010467)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription from RNA polymerase III promoter (GO:0006383)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q129L(1)		breast(2)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(3)|liver(2)|lung(7)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	30						GCACAGGCACAGGCACAGCTG	0.572																																																1	Substitution - Missense(1)	ovary(1)	1											48.0	44.0	45.0					1																	167343397		2203	4300	6503	165610021	SO:0001583	missense	5451			BC001664	CCDS1259.1, CCDS1259.2, CCDS55655.1, CCDS55656.1	1q24.2	2011-06-20	2007-07-13		ENSG00000143190	ENSG00000143190		"""Homeoboxes / POU class"""	9212	protein-coding gene	gene with protein product		164175	"""POU domain class 2, transcription factor 1"""	OTF1		1887216	Standard	NM_002697		Approved	OCT1	uc001gee.3	P14859	OTTHUMG00000034436	ENST00000541643.3:c.386A>T	1.37:g.167343397A>T	ENSP00000441285:p.Gln129Leu		165610021	B1AL91|B1AL93|B4E029|J3KP77|Q5TBT7|Q6PK46|Q8NEU9|Q9BPV1	Missense_Mutation	SNP	ENST00000541643.3	37		SNP	7	Broad	.	.	.	.	.	.	.	.	.	.	A	0.477	-0.881851	0.02530	.	.	ENSG00000143190	ENST00000367866;ENST00000452019;ENST00000492850;ENST00000367865;ENST00000420254;ENST00000541643;ENST00000367862;ENST00000443275	T;T;T;T;T;T;T	0.78126	-1.15;-1.15;-1.15;-1.15;-1.15;-1.15;-1.15	4.42	3.28	0.37604	.	2.655720	0.00994	N	0.003577	T	0.65481	0.2695	N	0.19112	0.55	0.51233	D	0.999913	D;B;B;B	0.57899	0.981;0.0;0.0;0.0	D;B;B;B	0.67900	0.954;0.0;0.001;0.0	T	0.69807	-0.5045	10	0.09084	T	0.74	.	7.3857	0.26880	0.8066:0.0:0.0:0.1934	.	129;141;127;129	P14859-4;P14859-2;P14859-3;P14859	.;.;.;PO2F1_HUMAN	L	152;129;6;127;129;129;141;37	ENSP00000356840:Q152L;ENSP00000391523:Q129L;ENSP00000356839:Q127L;ENSP00000414660:Q129L;ENSP00000441285:Q129L;ENSP00000356836:Q141L;ENSP00000415993:Q37L	ENSP00000356836:Q141L	Q	+	2	0	POU2F1	165610021	1.000000	0.71417	0.994000	0.49952	0.467000	0.32768	4.446000	0.60014	0.996000	0.38943	-0.336000	0.08194	CAG		0.572	POU2F1-203	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_002697		Missense_Mutation
CAMSAP2	23271	broad.mit.edu	37	1	200819245	200819245	+	Silent	SNP	C	C	A	rs569271779		TCGA-61-2104-01	TCGA-61-2104-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2104-01	TCGA-61-2104-11	g.chr1:200819245C>A	ENST00000236925.4	+	12	3430	c.3381C>A	c.(3379-3381)tcC>tcA	p.S1127S	CAMSAP2_ENST00000358823.2_Silent_p.S1116S|CAMSAP2_ENST00000413307.2_Silent_p.S1100S			Q08AD1	CAMP2_HUMAN	calmodulin regulated spectrin-associated protein family, member 2	1127					microtubule cytoskeleton organization (GO:0000226)|regulation of organelle organization (GO:0033043)	cytoplasm (GO:0005737)|microtubule minus-end (GO:0036449)	microtubule minus-end binding (GO:0051011)	p.S1116S(1)									TTGAAGTTTCCCTCTCAGATT	0.408																																																1	Substitution - coding silent(1)	ovary(1)	1											115.0	126.0	122.0					1																	200819245		2203	4300	6503	199085868	SO:0001819	synonymous_variant	23271			AB029001	CCDS1404.1, CCDS72998.1, CCDS72999.1	1q32	2011-08-18	2011-08-18	2011-08-18	ENSG00000118200	ENSG00000118200			29188	protein-coding gene	gene with protein product		613775	"""calmodulin regulated spectrin-associated protein 1-like 1"""	CAMSAP1L1		15897902, 19508979	Standard	XM_005245040		Approved	KIAA1078	uc001gvk.3	Q08AD1	OTTHUMG00000035740	ENST00000236925.4:c.3381C>A	1.37:g.200819245C>A			199085868	B1APG6|Q08AD2|Q6PGN8|Q96FB3|Q9UG20|Q9UPS4	Silent	SNP	ENST00000236925.4	37		SNP	22	Broad																																																																																				0.408	CAMSAP2-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000086956.2	NM_203459		Silent
CRTAC1	55118	broad.mit.edu	37	10	99661322	99661322	+	Silent	SNP	C	C	T			TCGA-61-2104-01	TCGA-61-2104-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2104-01	TCGA-61-2104-11	g.chr10:99661322C>T	ENST00000370597.3	-	8	1426	c.1071G>A	c.(1069-1071)caG>caA	p.Q357Q	CRTAC1_ENST00000370591.2_Silent_p.Q357Q|CRTAC1_ENST00000298819.4_Silent_p.Q357Q	NM_018058.6	NP_060528.3	Q9NQ79	CRAC1_HUMAN	cartilage acidic protein 1	357						extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)	p.Q357Q(1)		autonomic_ganglia(1)|breast(1)|endometrium(6)|kidney(3)|large_intestine(7)|lung(6)|ovary(6)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	35		Colorectal(252;0.24)		Epithelial(162;2.18e-10)|all cancers(201;3.27e-09)		TCTCCAGCTCCTGGTCATTGT	0.582																																																1	Substitution - coding silent(1)	ovary(1)	10											153.0	126.0	135.0					10																	99661322		2203	4300	6503	99651312	SO:0001819	synonymous_variant	55118			AJ276171	CCDS31266.1, CCDS55723.1	10q22	2007-12-03			ENSG00000095713	ENSG00000095713			14882	protein-coding gene	gene with protein product		606276				11139377	Standard	NM_018058		Approved	FLJ10320, CEP-68, ASPIC1	uc001kou.2	Q9NQ79	OTTHUMG00000018871	ENST00000370597.3:c.1071G>A	10.37:g.99661322C>T			99651312	B1ALN4|Q5T4F8|Q8N4H6|Q8TE52|Q9NQ78|Q9NQ80|Q9NW46	Silent	SNP	ENST00000370597.3	37	CCDS31266.1	SNP	24	Broad																																																																																				0.582	CRTAC1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000049754.1	NM_018058		Silent
MCMBP	79892	broad.mit.edu	37	10	121612689	121612689	+	Missense_Mutation	SNP	G	G	C			TCGA-61-2104-01	TCGA-61-2104-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2104-01	TCGA-61-2104-11	g.chr10:121612689G>C	ENST00000360003.3	-	6	616	c.447C>G	c.(445-447)aaC>aaG	p.N149K	MCMBP_ENST00000369077.3_Missense_Mutation_p.N149K|MCMBP_ENST00000466047.1_Intron	NM_001256378.1|NM_001256379.1|NM_024834.3	NP_001243307.1|NP_001243308.1|NP_079110.1	Q9BTE3	MCMBP_HUMAN	minichromosome maintenance complex binding protein	149					DNA-dependent DNA replication (GO:0006261)|mitotic nuclear division (GO:0007067)|sister chromatid cohesion (GO:0007062)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)	p.N149K(1)		breast(1)|endometrium(3)|large_intestine(4)|lung(9)|ovary(2)|skin(2)	21						CTCGAGCTTGGTTTGCATTAA	0.368																																																1	Substitution - Missense(1)	ovary(1)	10											279.0	238.0	252.0					10																	121612689		2203	4300	6503	121602679	SO:0001583	missense	79892			BC007219	CCDS7617.1, CCDS58099.1	10q26.13	2013-10-11	2011-01-05	2011-01-05	ENSG00000197771	ENSG00000197771			25782	protein-coding gene	gene with protein product		610909	"""chromosome 10 open reading frame 119"""	C10orf119		17296731	Standard	NM_024834		Approved	FLJ13081, MCM-BP	uc001ler.3	Q9BTE3	OTTHUMG00000019159	ENST00000360003.3:c.447C>G	10.37:g.121612689G>C	ENSP00000353098:p.Asn149Lys		121602679	B3KSP7|Q6IA56|Q9BVT9|Q9H916	Missense_Mutation	SNP	ENST00000360003.3	37	CCDS7617.1	SNP	44	Broad	.	.	.	.	.	.	.	.	.	.	G	13.33	2.206163	0.39003	.	.	ENSG00000197771	ENST00000360003;ENST00000369077	.	.	.	6.17	5.1	0.69264	.	0.154070	0.56097	D	0.000024	T	0.52709	0.1751	L	0.34521	1.04	0.40921	D	0.984316	B	0.21821	0.061	B	0.22152	0.038	T	0.46638	-0.9177	9	0.32370	T	0.25	-8.147	16.4691	0.84095	0.0719:0.0:0.9281:0.0	.	149	Q9BTE3	MCMBP_HUMAN	K	149	.	ENSP00000353098:N149K	N	-	3	2	MCMBP	121602679	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.036000	0.41165	2.941000	0.99782	0.655000	0.94253	AAC		0.368	MCMBP-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000050684.1	NM_024834		Missense_Mutation
CHID1	66005	broad.mit.edu	37	11	900012	900012	+	Missense_Mutation	SNP	C	C	G			TCGA-61-2104-01	TCGA-61-2104-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2104-01	TCGA-61-2104-11	g.chr11:900012C>G	ENST00000449825.1	-	6	894	c.538G>C	c.(538-540)Gtg>Ctg	p.V180L	CHID1_ENST00000526714.1_5'UTR|CHID1_ENST00000436108.2_Missense_Mutation_p.V180L|CHID1_ENST00000323541.7_Missense_Mutation_p.V210L|CHID1_ENST00000323578.8_Missense_Mutation_p.V180L|CHID1_ENST00000429789.2_Missense_Mutation_p.V180L|CHID1_ENST00000454838.2_Missense_Mutation_p.V205L|CHID1_ENST00000528581.1_Missense_Mutation_p.V205L|CHID1_ENST00000336845.5_Missense_Mutation_p.V205L	NM_001142675.1	NP_001136147.1	Q9BWS9	CHID1_HUMAN	chitinase domain containing 1	180					carbohydrate metabolic process (GO:0005975)|chitin catabolic process (GO:0006032)|innate immune response (GO:0045087)|negative regulation of cytokine production involved in inflammatory response (GO:1900016)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	chitinase activity (GO:0004568)|oligosaccharide binding (GO:0070492)	p.V180L(1)		endometrium(4)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(1)	13		all_cancers(49;9.46e-06)|Breast(177;0.00257)|all_epithelial(84;0.0027)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;5.48e-25)|Epithelial(43;3.75e-24)|BRCA - Breast invasive adenocarcinoma(625;4.65e-05)|Lung(200;0.0624)|LUSC - Lung squamous cell carcinoma(625;0.0735)		ACCTTTGCCACCTGGACCACG	0.622																																					Pancreas(117;992 2327 5172 41921)											1	Substitution - Missense(1)	ovary(1)	11											186.0	140.0	156.0					11																	900012		2203	4299	6502	890012	SO:0001583	missense	66005			AK124697	CCDS7722.1, CCDS44510.1, CCDS44511.1	11p15.5	2005-10-27			ENSG00000177830	ENSG00000177830			28474	protein-coding gene	gene with protein product		615692					Standard	NM_023947		Approved	MGC3234, FLJ42707	uc001lsm.3	Q9BWS9	OTTHUMG00000133314	ENST00000449825.1:c.538G>C	11.37:g.900012C>G	ENSP00000391255:p.Val180Leu		890012	B3KWB0|Q8NBM9|Q96CZ3|Q96S93|Q96SK0|Q9BY52	Missense_Mutation	SNP	ENST00000449825.1	37	CCDS7722.1	SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	11.16	1.558363	0.27827	.	.	ENSG00000177830	ENST00000323541;ENST00000449825;ENST00000454838;ENST00000323578;ENST00000429789;ENST00000528581;ENST00000336845;ENST00000436108	T;T;T;T;T;T;T;T	0.25912	3.61;3.61;3.61;3.61;1.77;3.61;3.61;3.61	4.05	3.13	0.36017	Chitinase II (1);Glycoside hydrolase, family 18, catalytic domain (1);Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.415649	0.24251	N	0.040173	T	0.15176	0.0366	L	0.31926	0.97	0.42356	D	0.992396	B;B;B;B;B	0.18310	0.0;0.0;0.027;0.003;0.0	B;B;B;B;B	0.15484	0.007;0.007;0.013;0.002;0.004	T	0.06075	-1.0847	10	0.09084	T	0.74	-31.0651	7.7536	0.28911	0.0:0.8028:0.0:0.1972	.	241;210;180;205;180	B4DN31;B7Z705;Q9BWS9-3;Q9BWS9-2;Q9BWS9	.;.;.;.;CHID1_HUMAN	L	210;180;205;180;180;205;205;180	ENSP00000324821:V210L;ENSP00000391255:V180L;ENSP00000398722:V205L;ENSP00000325055:V180L;ENSP00000416034:V180L;ENSP00000435503:V205L;ENSP00000338838:V205L;ENSP00000388156:V180L	ENSP00000324821:V210L	V	-	1	0	CHID1	890012	0.076000	0.21285	0.997000	0.53966	0.586000	0.36452	0.394000	0.20834	1.077000	0.40990	-0.258000	0.10820	GTG		0.622	CHID1-203	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257112.1	NM_023947		Missense_Mutation
C11orf42	160298	broad.mit.edu	37	11	6232258	6232258	+	Missense_Mutation	SNP	G	G	A	rs369121502		TCGA-61-2104-01	TCGA-61-2104-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2104-01	TCGA-61-2104-11	g.chr11:6232258G>A	ENST00000316375.2	+	3	1038	c.988G>A	c.(988-990)Gac>Aac	p.D330N	FAM160A2_ENST00000529360.1_5'Flank	NM_173525.2	NP_775796.2	Q8N5U0	CK042_HUMAN	chromosome 11 open reading frame 42	330								p.D330N(1)		endometrium(3)|kidney(3)|large_intestine(1)|lung(4)|ovary(2)|skin(1)|soft_tissue(1)	15		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;1.95e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CTCAGAGTTCGACAGTGACGA	0.627																																																1	Substitution - Missense(1)	ovary(1)	11						G	ASN/ASP	0,4400		0,0,2200	27.0	32.0	30.0		988	4.8	1.0	11		30	1,8579		0,1,4289	no	missense	C11orf42	NM_173525.2	23	0,1,6489	AA,AG,GG		0.0117,0.0,0.0077	possibly-damaging	330/334	6232258	1,12979	2200	4290	6490	6188834	SO:0001583	missense	160298			BC031612	CCDS7759.1	11p15.4	2012-08-09			ENSG00000180878	ENSG00000180878			28541	protein-coding gene	gene with protein product						12477932	Standard	NM_173525		Approved	MGC34805	uc001mcj.3	Q8N5U0	OTTHUMG00000133377	ENST00000316375.2:c.988G>A	11.37:g.6232258G>A	ENSP00000321021:p.Asp330Asn		6188834		Missense_Mutation	SNP	ENST00000316375.2	37	CCDS7759.1	SNP	37	Broad	.	.	.	.	.	.	.	.	.	.	G	10.33	1.320417	0.23994	0.0	1.17E-4	ENSG00000180878	ENST00000316375	T	0.59224	0.28	4.84	4.84	0.62591	.	0.000000	0.56097	D	0.000034	T	0.62648	0.2445	N	0.24115	0.695	0.35367	D	0.78869	D	0.76494	0.999	D	0.77557	0.99	T	0.72737	-0.4203	10	0.87932	D	0	-11.9828	13.2978	0.60307	0.0:0.0:1.0:0.0	.	330	Q8N5U0	CK042_HUMAN	N	330	ENSP00000321021:D330N	ENSP00000321021:D330N	D	+	1	0	C11orf42	6188834	1.000000	0.71417	1.000000	0.80357	0.349000	0.29174	4.633000	0.61318	2.497000	0.84241	0.484000	0.47621	GAC		0.627	C11orf42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257227.2	NM_173525		Missense_Mutation
OR5D16	390144	broad.mit.edu	37	11	55606964	55606964	+	Missense_Mutation	SNP	A	A	T			TCGA-61-2104-01	TCGA-61-2104-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2104-01	TCGA-61-2104-11	g.chr11:55606964A>T	ENST00000378396.1	+	1	737	c.737A>T	c.(736-738)cAc>cTc	p.H246L		NM_001005496.1	NP_001005496.1	Q8NGK9	OR5DG_HUMAN	olfactory receptor, family 5, subfamily D, member 16	246						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.H246L(1)		cervix(1)|endometrium(2)|large_intestine(4)|lung(26)|ovary(5)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	44		all_epithelial(135;0.208)				TGTGCCTCCCACCTGACTGCC	0.502																																																1	Substitution - Missense(1)	ovary(1)	11											147.0	126.0	133.0					11																	55606964		2201	4296	6497	55363540	SO:0001583	missense	390144			AB065783	CCDS31512.1	11q11	2012-08-09			ENSG00000205029	ENSG00000205029		"""GPCR / Class A : Olfactory receptors"""	15283	protein-coding gene	gene with protein product							Standard	NM_001005496		Approved		uc010rio.2	Q8NGK9	OTTHUMG00000154233	ENST00000378396.1:c.737A>T	11.37:g.55606964A>T	ENSP00000367649:p.His246Leu		55363540	Q6IF65|Q96RB4	Missense_Mutation	SNP	ENST00000378396.1	37	CCDS31512.1	SNP	6	Broad	.	.	.	.	.	.	.	.	.	.	.	18.30	3.593940	0.66219	.	.	ENSG00000205029	ENST00000378396	T	0.00307	8.17	4.53	3.39	0.38822	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.01189	0.0039	H	0.99058	4.415	0.37887	D	0.930575	D	0.89917	1.0	D	0.91635	0.999	T	0.13629	-1.0502	9	0.87932	D	0	-14.7683	9.1647	0.37043	0.9107:0.0:0.0893:0.0	.	246	Q8NGK9	OR5DG_HUMAN	L	246	ENSP00000367649:H246L	ENSP00000367649:H246L	H	+	2	0	OR5D16	55363540	1.000000	0.71417	0.568000	0.28447	0.691000	0.40173	6.878000	0.75567	0.717000	0.32145	0.439000	0.28862	CAC		0.502	OR5D16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334506.1	NM_001005496		Missense_Mutation
OR5A1	219982	broad.mit.edu	37	11	59211280	59211280	+	Silent	SNP	G	G	A			TCGA-61-2104-01	TCGA-61-2104-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2104-01	TCGA-61-2104-11	g.chr11:59211280G>A	ENST00000302030.2	+	1	664	c.639G>A	c.(637-639)tcG>tcA	p.S213S		NM_001004728.1	NP_001004728.1	Q8NGJ0	OR5A1_HUMAN	olfactory receptor, family 5, subfamily A, member 1	213						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S213S(2)		central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(14)|ovary(2)|prostate(2)|skin(3)|stomach(1)	28						GAGGAACATCGTTCCTCCAAC	0.547																																																2	Substitution - coding silent(2)	ovary(1)|large_intestine(1)	11											224.0	209.0	214.0					11																	59211280		2201	4295	6496	58967856	SO:0001819	synonymous_variant	219982			AB065804	CCDS31561.1	11q12.1	2012-08-09			ENSG00000172320	ENSG00000172320		"""GPCR / Class A : Olfactory receptors"""	8319	protein-coding gene	gene with protein product				OR5A1P			Standard	NM_001004728		Approved	OST181	uc001nnx.1	Q8NGJ0	OTTHUMG00000167339	ENST00000302030.2:c.639G>A	11.37:g.59211280G>A			58967856	B9EH58|Q6IFF2|Q96RB1	Silent	SNP	ENST00000302030.2	37	CCDS31561.1	SNP	40	Broad																																																																																				0.547	OR5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394233.1	NM_001004728		Silent
VWCE	220001	broad.mit.edu	37	11	61036471	61036471	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2104-01	TCGA-61-2104-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2104-01	TCGA-61-2104-11	g.chr11:61036471C>T	ENST00000335613.5	-	15	2191	c.1805G>A	c.(1804-1806)tGc>tAc	p.C602Y	VWCE_ENST00000535710.1_Missense_Mutation_p.C67Y	NM_152718.2	NP_689931.2	Q96DN2	VWCE_HUMAN	von Willebrand factor C and EGF domains	602	VWFC 4. {ECO:0000255|PROSITE- ProRule:PRU00220}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)	p.C602Y(1)		biliary_tract(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(17)|ovary(3)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	37						TGTCCTCTTGCAGCTCACCGA	0.622																																																1	Substitution - Missense(1)	ovary(1)	11											86.0	67.0	74.0					11																	61036471		2203	4299	6502	60793047	SO:0001583	missense	220001			AK056571	CCDS8002.1	11q12.2	2006-08-04			ENSG00000167992	ENSG00000167992			26487	protein-coding gene	gene with protein product		611115				12869306	Standard	NM_152718		Approved	URG11, FLJ32009, VWC1	uc001nra.3	Q96DN2	OTTHUMG00000168208	ENST00000335613.5:c.1805G>A	11.37:g.61036471C>T	ENSP00000334186:p.Cys602Tyr		60793047	A5PKV0|Q7Z7L6|Q86WK8	Missense_Mutation	SNP	ENST00000335613.5	37	CCDS8002.1	SNP	25	Broad	.	.	.	.	.	.	.	.	.	.	C	19.27	3.795762	0.70452	.	.	ENSG00000167992	ENST00000335613;ENST00000535710	T;T	0.79033	-1.23;-1.23	5.09	5.09	0.68999	von Willebrand factor, type C (3);	0.000000	0.44688	D	0.000427	D	0.90435	0.7005	M	0.92412	3.305	0.41038	D	0.985201	D	0.76494	0.999	D	0.81914	0.995	D	0.92881	0.6323	10	0.87932	D	0	.	15.4305	0.75092	0.0:1.0:0.0:0.0	.	602	Q96DN2	VWCE_HUMAN	Y	602;67	ENSP00000334186:C602Y;ENSP00000442570:C67Y	ENSP00000334186:C602Y	C	-	2	0	VWCE	60793047	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	4.891000	0.63185	2.363000	0.80096	0.561000	0.74099	TGC		0.622	VWCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398811.1	NM_152718		Missense_Mutation
DYNC2H1	79659	broad.mit.edu	37	11	103339318	103339318	+	Splice_Site	SNP	T	T	A			TCGA-61-2104-01	TCGA-61-2104-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2104-01	TCGA-61-2104-11	g.chr11:103339318T>A	ENST00000375735.2	+	88	12794	c.12650T>A	c.(12649-12651)aTc>aAc	p.I4217N	DYNC2H1_ENST00000398093.3_Splice_Site_p.I4224N|DYNC2H1_ENST00000334267.7_Splice_Site_p.I830N	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	4217					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)	p.I1657N(1)|p.I830N(1)		NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		CCATGGCAGATCAGTGGCTTG	0.383																																																2	Substitution - Missense(2)	ovary(2)	11											114.0	106.0	109.0					11																	103339318		1898	4144	6042	102844528	SO:0001630	splice_region_variant	79659			AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.12649-1T>A	11.37:g.103339318T>A			102844528	O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Missense_Mutation	SNP	ENST00000375735.2	37	CCDS53701.1	SNP	50	Broad	.	.	.	.	.	.	.	.	.	.	T	17.61	3.432150	0.62844	.	.	ENSG00000187240	ENST00000375735;ENST00000334267;ENST00000398093;ENST00000540621;ENST00000533197	T;T;T;T	0.11495	2.77;2.77;2.77;2.77	5.69	5.69	0.88448	Dynein heavy chain (1);	0.268590	0.39083	N	0.001466	T	0.32496	0.0831	M	0.68593	2.085	0.80722	D	1	D;P;B	0.76494	0.999;0.6;0.391	D;P;P	0.81914	0.995;0.828;0.674	T	0.02603	-1.1135	10	0.87932	D	0	.	15.9546	0.79876	0.0:0.0:0.0:1.0	.	830;4217;4224	Q8NCM8-3;Q8NCM8;Q8NCM8-2	.;DYHC2_HUMAN;.	N	4217;830;4224;463;134	ENSP00000364887:I4217N;ENSP00000334021:I830N;ENSP00000381167:I4224N;ENSP00000436736:I134N	ENSP00000334021:I830N	I	+	2	0	DYNC2H1	102844528	1.000000	0.71417	0.998000	0.56505	0.392000	0.30506	7.189000	0.77747	2.173000	0.68751	0.454000	0.30748	ATC		0.383	DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387196.1	XM_370652	Missense_Mutation	Missense_Mutation
TAOK3	51347	broad.mit.edu	37	12	118636982	118636982	+	Missense_Mutation	SNP	G	G	T			TCGA-61-2104-01	TCGA-61-2104-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2104-01	TCGA-61-2104-11	g.chr12:118636982G>T	ENST00000392533.3	-	13	1558	c.1068C>A	c.(1066-1068)agC>agA	p.S356R	TAOK3_ENST00000419821.2_Missense_Mutation_p.S356R	NM_016281.3	NP_057365.3	Q9H2K8	TAOK3_HUMAN	TAO kinase 3	356	Ser-rich.			STGSQSSSVNSMQEVMDESSSEL -> TWNQPEQGNGQPGQ QPFHSKHVR (in Ref. 1; AAF14559). {ECO:0000305}.	cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|MAPK cascade (GO:0000165)|mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of JNK cascade (GO:0046329)|negative regulation of protein kinase activity (GO:0006469)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase inhibitor activity (GO:0004860)|protein serine/threonine kinase activity (GO:0004674)|transferase activity (GO:0016740)	p.S356R(1)		central_nervous_system(1)|lung(5)|skin(1)	7	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GGCTGCCTGTGCTCACGGACA	0.512																																																1	Substitution - Missense(1)	ovary(1)	12											213.0	141.0	166.0					12																	118636982		2203	4300	6503	117121365	SO:0001583	missense	51347			AF135158	CCDS9188.1	12q	2007-08-03				ENSG00000135090			18133	protein-coding gene	gene with protein product						10559204, 10924369	Standard	NM_016281		Approved	JIK, DPK, MAP3K18	uc001twy.4	Q9H2K8		ENST00000392533.3:c.1068C>A	12.37:g.118636982G>T	ENSP00000376317:p.Ser356Arg		117121365	Q658N1|Q8IUM4|Q9HC79|Q9NZM9|Q9UHG7	Missense_Mutation	SNP	ENST00000392533.3	37	CCDS9188.1	SNP	46	Broad	.	.	.	.	.	.	.	.	.	.	G	19.65	3.867169	0.72065	.	.	ENSG00000135090	ENST00000419821;ENST00000392533	T;T	0.74315	-0.83;-0.83	5.19	3.38	0.38709	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	D	0.82688	0.5091	M	0.70595	2.14	0.80722	D	1	D	0.89917	1.0	D	0.76071	0.987	T	0.82072	-0.0638	10	0.62326	D	0.03	.	9.1243	0.36805	0.2222:0.0:0.7778:0.0	.	356	Q9H2K8	TAOK3_HUMAN	R	356	ENSP00000416374:S356R;ENSP00000376317:S356R	ENSP00000376317:S356R	S	-	3	2	TAOK3	117121365	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.975000	0.56859	0.783000	0.33636	0.585000	0.79938	AGC		0.512	TAOK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401456.2	NM_016281		Missense_Mutation
MNAT1	4331	broad.mit.edu	37	14	61278795	61278795	+	Missense_Mutation	SNP	C	C	G			TCGA-61-2104-01	TCGA-61-2104-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2104-01	TCGA-61-2104-11	g.chr14:61278795C>G	ENST00000261245.4	+	5	612	c.511C>G	c.(511-513)Ctg>Gtg	p.L171V	MNAT1_ENST00000539616.2_Missense_Mutation_p.L171V	NM_002431.3	NP_002422.1	P51948	MAT1_HUMAN	MNAT CDK-activating kinase assembly factor 1	171					7-methylguanosine mRNA capping (GO:0006370)|adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|cell proliferation (GO:0008283)|DNA repair (GO:0006281)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|negative regulation of apoptotic process (GO:0043066)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|protein complex assembly (GO:0006461)|protein phosphorylation (GO:0006468)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to calcium ion (GO:0051592)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|ventricular system development (GO:0021591)|viral process (GO:0016032)	cytoplasm (GO:0005737)|holo TFIIH complex (GO:0005675)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein N-terminus binding (GO:0047485)|zinc ion binding (GO:0008270)	p.L171V(1)		NS(1)|large_intestine(1)|lung(5)|ovary(2)|upper_aerodigestive_tract(2)	11				OV - Ovarian serous cystadenocarcinoma(108;0.0174)		AGAAGAACAACTGCAGCAGAT	0.328								Direct reversal of damage;Direct reversal of damage;Nucleotide excision repair (NER)																																								1	Substitution - Missense(1)	ovary(1)	14											109.0	120.0	116.0					14																	61278795		2203	4300	6503	60348548	SO:0001583	missense	4331			X87843	CCDS9750.1, CCDS53899.1	14q23	2013-07-31	2013-07-31		ENSG00000020426	ENSG00000020426		"""RING-type (C3HC4) zinc fingers"", ""General transcription factor IIH complex subunits"""	7181	protein-coding gene	gene with protein product	"""CDK-activating kinase assembly factor"""	602659	"""menage a trois 1 (CAK assembly factor)"", ""menage a trois homolog 1, cyclin H assembly factor (Xenopus laevis)"""			9465303	Standard	NM_002431		Approved	MAT1, RNF66	uc001xfd.3	P51948	OTTHUMG00000152340	ENST00000261245.4:c.511C>G	14.37:g.61278795C>G	ENSP00000261245:p.Leu171Val		60348548	G3V1U8|Q15817|Q6ICQ7	Missense_Mutation	SNP	ENST00000261245.4	37	CCDS9750.1	SNP	20	Broad	.	.	.	.	.	.	.	.	.	.	C	9.559	1.117849	0.20877	.	.	ENSG00000020426	ENST00000261245;ENST00000539616;ENST00000554002;ENST00000557134	T;T;T	0.46063	0.94;0.95;0.88	5.62	2.77	0.32553	Cdk-activating kinase assembly factor MAT1, centre (1);	0.130203	0.52532	D	0.000067	T	0.26085	0.0636	L	0.34521	1.04	0.21984	N	0.99943	B;B	0.24317	0.082;0.101	B;B	0.22152	0.023;0.038	T	0.10706	-1.0618	10	0.31617	T	0.26	-27.2065	4.2948	0.10895	0.2831:0.5018:0.0:0.2151	.	171;171	G3V1U8;P51948	.;MAT1_HUMAN	V	171;171;66;31	ENSP00000261245:L171V;ENSP00000446437:L171V;ENSP00000451017:L31V	ENSP00000261245:L171V	L	+	1	2	MNAT1	60348548	0.041000	0.20044	0.839000	0.33178	0.972000	0.66771	0.135000	0.15952	0.833000	0.34828	0.650000	0.86243	CTG		0.328	MNAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276956.1	NM_002431		Missense_Mutation
C15orf41	84529	broad.mit.edu	37	15	36872070	36872070	+	Silent	SNP	G	G	C			TCGA-61-2104-01	TCGA-61-2104-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2104-01	TCGA-61-2104-11	g.chr15:36872070G>C	ENST00000566621.1	+	1	259	c.9G>C	c.(7-9)ctG>ctC	p.L3L	C15orf41_ENST00000437989.2_Silent_p.L3L|C15orf41_ENST00000569302.1_Silent_p.L3L	NM_001130010.1	NP_001123482.1	Q9Y2V0	CO041_HUMAN	chromosome 15 open reading frame 41	3								p.L3L(1)		kidney(1)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)	12		all_epithelial(112;3.06e-10)|Lung NSC(122;6.48e-08)|all_lung(180;8.31e-07)|Melanoma(134;0.222)		all cancers(64;1.76e-19)|GBM - Glioblastoma multiforme(113;5.03e-07)|BRCA - Breast invasive adenocarcinoma(123;0.11)		ACATGATACTGACCAAAGCTC	0.572																																																1	Substitution - coding silent(1)	ovary(1)	15											52.0	50.0	51.0					15																	36872070		1566	3579	5145	34659362	SO:0001819	synonymous_variant	84529			BC006254	CCDS45215.1, CCDS45216.1	15q14	2012-05-31			ENSG00000186073	ENSG00000186073			26929	protein-coding gene	gene with protein product		615626					Standard	XM_005254719		Approved	HH114, MGC11326, FLJ22851	uc001zje.4	Q9Y2V0	OTTHUMG00000172659	ENST00000566621.1:c.9G>C	15.37:g.36872070G>C			34659362	B2RD87	Silent	SNP	ENST00000566621.1	37	CCDS45215.1	SNP	45	Broad																																																																																				0.572	C15orf41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419741.1	NM_032499		Silent
EIF2AK4	440275	broad.mit.edu	37	15	40282563	40282563	+	Missense_Mutation	SNP	C	C	A			TCGA-61-2104-01	TCGA-61-2104-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2104-01	TCGA-61-2104-11	g.chr15:40282563C>A	ENST00000263791.5	+	16	2659	c.2616C>A	c.(2614-2616)gaC>gaA	p.D872E	EIF2AK4_ENST00000382727.2_Missense_Mutation_p.D844E	NM_001013703.2	NP_001013725.2	Q9P2K8	E2AK4_HUMAN	eukaryotic translation initiation factor 2 alpha kinase 4	872	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.		D -> V. {ECO:0000269|PubMed:17344846}.		cellular response to starvation (GO:0009267)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of translation (GO:0017148)|protein phosphorylation (GO:0006468)|regulation of translational initiation (GO:0006446)|regulation of translational initiation in response to stress (GO:0043558)	cytosolic ribosome (GO:0022626)	ATP binding (GO:0005524)|eukaryotic translation initiation factor 2alpha kinase activity (GO:0004694)|protein serine/threonine kinase activity (GO:0004674)	p.D872E(1)		NS(1)|breast(2)|endometrium(1)|kidney(3)|large_intestine(8)|lung(18)|ovary(1)|prostate(3)|skin(2)|stomach(1)	40		all_cancers(109;1.05e-19)|all_epithelial(112;4.38e-17)|Lung NSC(122;1.09e-12)|all_lung(180;3.56e-11)|Melanoma(134;0.0575)|Ovarian(310;0.0826)|Colorectal(260;0.119)		GBM - Glioblastoma multiforme(113;5.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0616)		TGGCGACAGACCATCTAGCCT	0.378																																																1	Substitution - Missense(1)	ovary(1)	15											210.0	196.0	201.0					15																	40282563		1856	4080	5936	38069855	SO:0001583	missense	440275			AB037759	CCDS42016.1	15q13.3	2008-08-18				ENSG00000128829			19687	protein-coding gene	gene with protein product		609280				10504407	Standard	XM_005254392		Approved	GCN2, KIAA1338	uc001zkm.1	Q9P2K8		ENST00000263791.5:c.2616C>A	15.37:g.40282563C>A	ENSP00000263791:p.Asp872Glu		38069855	C9JEC4|Q69YL7|Q6DC97|Q96GN6|Q9H5K1|Q9NSQ3|Q9NSZ5|Q9UJ56	Missense_Mutation	SNP	ENST00000263791.5	37	CCDS42016.1	SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	14.07	2.427064	0.43122	.	.	ENSG00000128829	ENST00000263791;ENST00000382727	T;T	0.64260	-0.09;-0.09	5.82	1.91	0.25777	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.46619	0.1402	N	0.16790	0.44	0.45676	D	0.998598	P	0.35192	0.489	B	0.41946	0.371	T	0.21895	-1.0232	10	0.32370	T	0.25	-22.0259	8.5461	0.33421	0.0:0.493:0.0:0.507	.	872	Q9P2K8	E2AK4_HUMAN	E	872;844	ENSP00000263791:D872E;ENSP00000372174:D844E	ENSP00000263791:D872E	D	+	3	2	EIF2AK4	38069855	0.998000	0.40836	0.999000	0.59377	0.978000	0.69477	0.453000	0.21811	0.116000	0.18110	-0.136000	0.14681	GAC		0.378	EIF2AK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418395.1			Missense_Mutation
TBC1D21	161514	broad.mit.edu	37	15	74180790	74180790	+	Missense_Mutation	SNP	A	A	T			TCGA-61-2104-01	TCGA-61-2104-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2104-01	TCGA-61-2104-11	g.chr15:74180790A>T	ENST00000300504.2	+	10	997	c.914A>T	c.(913-915)gAc>gTc	p.D305V	AC108137.1_ENST00000410132.1_RNA|TBC1D21_ENST00000535547.2_Missense_Mutation_p.D269V|TBC1D21_ENST00000562056.1_Missense_Mutation_p.D268V	NM_153356.1	NP_699187.1	Q8IYX1	TBC21_HUMAN	TBC1 domain family, member 21	305						acrosomal vesicle (GO:0001669)|extracellular vesicular exosome (GO:0070062)	Rab GTPase activator activity (GO:0005097)	p.D305V(1)		breast(1)|endometrium(2)|large_intestine(2)|lung(6)|ovary(3)|skin(1)|stomach(1)|urinary_tract(1)	17						AACCTCATCGACCTTGATGCT	0.572																																																1	Substitution - Missense(1)	ovary(1)	15											190.0	137.0	155.0					15																	74180790		2198	4297	6495	71967843	SO:0001583	missense	161514			BC033516	CCDS10252.1, CCDS66822.1	15q24	2013-07-09			ENSG00000167139	ENSG00000167139			28536	protein-coding gene	gene with protein product	"""male germ cell-specific expressed, containing a RabGAP domain"""					21128978	Standard	XR_243080		Approved	MGC34741, MgcRabGAP	uc002avz.3	Q8IYX1	OTTHUMG00000137594	ENST00000300504.2:c.914A>T	15.37:g.74180790A>T	ENSP00000300504:p.Asp305Val		71967843	B9A6M2	Missense_Mutation	SNP	ENST00000300504.2	37	CCDS10252.1	SNP	10	Broad	.	.	.	.	.	.	.	.	.	.	A	16.46	3.130800	0.56828	.	.	ENSG00000167139	ENST00000300504;ENST00000535547	T;T	0.21361	2.01;2.01	5.28	5.28	0.74379	Rab-GAP/TBC domain (1);	0.000000	0.64402	D	0.000010	T	0.32133	0.0819	L	0.27053	0.805	0.58432	D	0.999998	D;D	0.76494	0.999;0.999	D;D	0.83275	0.996;0.97	T	0.08249	-1.0731	10	0.66056	D	0.02	.	11.6155	0.51088	1.0:0.0:0.0:0.0	.	269;305	B9A6M2;Q8IYX1	.;TBC21_HUMAN	V	305;269	ENSP00000300504:D305V;ENSP00000439325:D269V	ENSP00000300504:D305V	D	+	2	0	TBC1D21	71967843	1.000000	0.71417	0.998000	0.56505	0.625000	0.37756	4.431000	0.59915	2.000000	0.58554	0.459000	0.35465	GAC		0.572	TBC1D21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268994.1	NM_153356		Missense_Mutation
SIN3A	25942	broad.mit.edu	37	15	75715060	75715060	+	Silent	SNP	C	C	G			TCGA-61-2104-01	TCGA-61-2104-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2104-01	TCGA-61-2104-11	g.chr15:75715060C>G	ENST00000394947.3	-	3	608	c.294G>C	c.(292-294)gtG>gtC	p.V98V	SIN3A_ENST00000360439.4_Silent_p.V98V|SIN3A_ENST00000394949.4_Silent_p.V98V|SIN3A_ENST00000567289.1_Silent_p.V98V	NM_001145358.1	NP_001138830.1			SIN3 transcription regulator family member A									p.V98V(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(15)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	63						GACTCTGGACCACCTGGCCTC	0.582																																																1	Substitution - coding silent(1)	ovary(1)	15											107.0	101.0	103.0					15																	75715060		2197	4294	6491	73502113	SO:0001819	synonymous_variant	25942			AK027559	CCDS10279.1	15q22.33	2013-08-21	2013-08-21		ENSG00000169375	ENSG00000169375			19353	protein-coding gene	gene with protein product		607776	"""SIN3 homolog A, transcription regulator (yeast)"", ""SIN3 transcription regulator homolog A (yeast)"""			10773092, 7601471	Standard	NM_001145357		Approved	KIAA0700, DKFZP434K2235	uc002bai.3	Q96ST3	OTTHUMG00000142834	ENST00000394947.3:c.294G>C	15.37:g.75715060C>G			73502113		Silent	SNP	ENST00000394947.3	37	CCDS10279.1	SNP	21	Broad																																																																																				0.582	SIN3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286469.1	NM_015477		Silent
IRF8	3394	broad.mit.edu	37	16	85936730	85936730	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2104-01	TCGA-61-2104-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2104-01	TCGA-61-2104-11	g.chr16:85936730C>T	ENST00000268638.5	+	2	531	c.109C>T	c.(109-111)Cgg>Tgg	p.R37W	IRF8_ENST00000563180.1_Missense_Mutation_p.R37W	NM_002163.2	NP_002154.1	Q02556	IRF8_HUMAN	interferon regulatory factor 8	37					cellular response to lipopolysaccharide (GO:0071222)|cytokine-mediated signaling pathway (GO:0019221)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|immune response (GO:0006955)|interferon-gamma-mediated signaling pathway (GO:0060333)|myeloid cell differentiation (GO:0030099)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|phagocytosis (GO:0006909)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|transcription from RNA polymerase II promoter (GO:0006366)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|nucleus (GO:0005634)	regulatory region DNA binding (GO:0000975)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)	p.R37W(1)		breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|large_intestine(2)|lung(8)|ovary(2)|prostate(1)|urinary_tract(1)	24		Prostate(104;0.0771)				GAGCATGTTCCGGATCCCTTG	0.522																																																1	Substitution - Missense(1)	ovary(1)	16											137.0	129.0	132.0					16																	85936730		2198	4300	6498	84494231	SO:0001583	missense	3394			M91196	CCDS10956.1	16q24.1	2014-09-17	2004-11-12	2004-11-12	ENSG00000140968	ENSG00000140968			5358	protein-coding gene	gene with protein product		601565	"""interferon consensus sequence binding protein 1"""	ICSBP1		1460054, 11997525	Standard	NM_002163		Approved	IRF-8, ICSBP	uc002fjh.3	Q02556	OTTHUMG00000137648	ENST00000268638.5:c.109C>T	16.37:g.85936730C>T	ENSP00000268638:p.Arg37Trp		84494231	A0AV82	Missense_Mutation	SNP	ENST00000268638.5	37	CCDS10956.1	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	C	26.7	4.763397	0.89932	.	.	ENSG00000140968	ENST00000268638	D	0.98120	-4.73	5.58	4.62	0.57501	Interferon regulatory factor, conserved site (1);Winged helix-turn-helix transcription repressor DNA-binding (1);Interferon regulatory factor DNA-binding domain (4);	0.000000	0.85682	D	0.000000	D	0.98969	0.9649	M	0.93062	3.375	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99482	1.0948	10	0.87932	D	0	-38.4199	15.5442	0.76081	0.1393:0.8607:0.0:0.0	.	37;37	B2R8V7;Q02556	.;IRF8_HUMAN	W	37	ENSP00000268638:R37W	ENSP00000268638:R37W	R	+	1	2	IRF8	84494231	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	2.085000	0.41634	1.339000	0.45563	0.555000	0.69702	CGG		0.522	IRF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269100.2	NM_002163		Missense_Mutation
ANKRD11	29123	broad.mit.edu	37	16	89350055	89350055	+	Silent	SNP	C	C	T			TCGA-61-2104-01	TCGA-61-2104-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2104-01	TCGA-61-2104-11	g.chr16:89350055C>T	ENST00000301030.4	-	9	3355	c.2895G>A	c.(2893-2895)agG>agA	p.R965R	ANKRD11_ENST00000378330.2_Silent_p.R965R	NM_001256183.1|NM_013275.5	NP_001243112.1|NP_037407.4	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11	965	Lys-rich.				bone development (GO:0060348)|face morphogenesis (GO:0060325)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|odontogenesis of dentin-containing tooth (GO:0042475)|skeletal system morphogenesis (GO:0048705)|tissue homeostasis (GO:0001894)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.R965R(1)		breast(4)|central_nervous_system(3)|endometrium(17)|kidney(2)|large_intestine(18)|lung(20)|ovary(6)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	83		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		CGGGCTTGGCCCTGCCGTCCC	0.647																																																1	Substitution - coding silent(1)	ovary(1)	16											83.0	88.0	86.0					16																	89350055		2198	4300	6498	87877556	SO:0001819	synonymous_variant	29123			AY373756	CCDS32513.1	16q24.3	2013-01-10				ENSG00000167522		"""Ankyrin repeat domain containing"""	21316	protein-coding gene	gene with protein product		611192				11483580	Standard	NM_001256182		Approved	LZ16, T13	uc002fnc.2	Q6UB99		ENST00000301030.4:c.2895G>A	16.37:g.89350055C>T			87877556	Q6NTG1|Q6QMF8	Silent	SNP	ENST00000301030.4	37	CCDS32513.1	SNP	22	Broad																																																																																				0.647	ANKRD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430462.3	NM_013275		Silent
ANKFY1	51479	broad.mit.edu	37	17	4113234	4113234	+	Missense_Mutation	SNP	T	T	A			TCGA-61-2104-01	TCGA-61-2104-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2104-01	TCGA-61-2104-11	g.chr17:4113234T>A	ENST00000341657.4	-	5	502	c.467A>T	c.(466-468)aAg>aTg	p.K156M	ANKFY1_ENST00000570535.1_Missense_Mutation_p.K198M|ANKFY1_ENST00000574367.1_Missense_Mutation_p.K156M|ANKFY1_ENST00000433651.1_Missense_Mutation_p.K156M	NM_016376.3	NP_057460.3	Q9P2R3	ANFY1_HUMAN	ankyrin repeat and FYVE domain containing 1	156					endosomal vesicle fusion (GO:0034058)|endosome localization (GO:0032439)|Golgi to lysosome transport (GO:0090160)|positive regulation of pinocytosis (GO:0048549)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|macropinosome (GO:0044354)|membrane (GO:0016020)	metal ion binding (GO:0046872)|phosphatidylinositol phosphate binding (GO:1901981)|Rab GTPase binding (GO:0017137)	p.K156M(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(11)|liver(1)|lung(5)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	32						CATAACACCCTTCTCACATCT	0.423																																																1	Substitution - Missense(1)	ovary(1)	17											99.0	94.0	96.0					17																	4113234		1932	4137	6069	4059983	SO:0001583	missense	51479			AB033081	CCDS42236.1, CCDS58502.1	17p13.3	2013-01-10			ENSG00000185722	ENSG00000185722		"""Zinc fingers, FYVE domain containing"", ""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	20763	protein-coding gene	gene with protein product		607927				10940552, 17273843	Standard	NM_016376		Approved	ANKHZN, KIAA1255, ZFYVE14, BTBD23	uc002fxn.3	Q9P2R3	OTTHUMG00000177727	ENST00000341657.4:c.467A>T	17.37:g.4113234T>A	ENSP00000343362:p.Lys156Met		4059983	A8KA65|Q5RKV4|Q9ULG5	Missense_Mutation	SNP	ENST00000341657.4	37		SNP	56	Broad	.	.	.	.	.	.	.	.	.	.	T	22.5	4.302005	0.81136	.	.	ENSG00000185722	ENST00000341657;ENST00000535427;ENST00000433651	T;T	0.69175	-0.38;-0.38	5.68	5.68	0.88126	BTB/POZ-like (1);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	T	0.78181	0.4243	L	0.56769	1.78	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;0.999;0.999;0.999	D;D;D;D;D	0.87578	0.998;0.983;0.971;0.951;0.951	T	0.75861	-0.3168	10	0.30854	T	0.27	-26.9417	15.1126	0.72372	0.0:0.0:0.0:1.0	.	97;156;156;156;198	F5H754;Q9P2R3-3;Q9P2R3;Q9P2R3-2;Q9P2R3-4	.;.;ANFY1_HUMAN;.;.	M	156;97;156	ENSP00000343362:K156M;ENSP00000416005:K156M	ENSP00000343362:K156M	K	-	2	0	ANKFY1	4059983	1.000000	0.71417	1.000000	0.80357	0.797000	0.45037	8.040000	0.89188	2.176000	0.68965	0.383000	0.25322	AAG		0.423	ANKFY1-008	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000438702.1	NM_016376		Missense_Mutation
TP53	7157	broad.mit.edu	37	17	7578443	7578443	+	Missense_Mutation	SNP	A	A	T			TCGA-61-2104-01	TCGA-61-2104-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2104-01	TCGA-61-2104-11	g.chr17:7578443A>T	ENST00000269305.4	-	5	676	c.487T>A	c.(487-489)Tac>Aac	p.Y163N	TP53_ENST00000413465.2_Missense_Mutation_p.Y163N|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.Y163N|TP53_ENST00000420246.2_Missense_Mutation_p.Y163N|TP53_ENST00000445888.2_Missense_Mutation_p.Y163N|TP53_ENST00000359597.4_Missense_Mutation_p.Y163N	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	163	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		Y -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:17224074}.|Y -> D (in sporadic cancers; somatic mutation).|Y -> F (in a sporadic cancer; somatic mutation).|Y -> H (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:17224074}.|Y -> N (in sporadic cancers; somatic mutation).|Y -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.Y163N(20)|p.Y163H(17)|p.0?(8)|p.Y163D(5)|p.I162_Y163>N(3)|p.Y163fs*7(2)|p.V157_C176del20(1)|p.Y163fs*1(1)|p.Y163_Q165delYKQ(1)|p.P151_V173del23(1)|p.S149fs*72(1)|p.I30_Y31>N(1)|p.I162_Y163delIY(1)|p.I69_Y70>N(1)|p.Y70N(1)|p.A161fs*7(1)|p.Y31N(1)|p.Y163fs*14(1)|p.A159_Q167delAMAIYKQSQ(1)|p.Y163fs*18(1)|p.Y70D(1)|p.Y31D(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GACTGCTTGTAGATGGCCATG	0.622		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	71	Substitution - Missense(46)|Whole gene deletion(8)|Deletion - Frameshift(6)|Deletion - In frame(5)|Complex - deletion inframe(5)|Insertion - Frameshift(1)	breast(14)|lung(12)|liver(8)|skin(6)|large_intestine(4)|haematopoietic_and_lymphoid_tissue(4)|oesophagus(4)|bone(4)|upper_aerodigestive_tract(3)|central_nervous_system(3)|ovary(3)|stomach(2)|adrenal_gland(1)|biliary_tract(1)|prostate(1)|pancreas(1)	17											53.0	54.0	53.0					17																	7578443		2203	4300	6503	7519168	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.487T>A	17.37:g.7578443A>T	ENSP00000269305:p.Tyr163Asn		7519168	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	15	Broad	.	.	.	.	.	.	.	.	.	.	A	15.86	2.958850	0.53400	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	D;D;D;D;D;D;D;D;D	0.99869	-7.33;-7.33;-7.33;-7.33;-7.33;-7.33;-7.33;-7.33;-7.33	5.59	4.52	0.55395	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.062225	0.64402	D	0.000003	D	0.99843	0.9928	M	0.89478	3.035	0.58432	D	0.999997	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	0.999;1.0;0.998;1.0;1.0;1.0;0.999	D	0.97202	0.9865	10	0.87932	D	0	-16.6607	9.9777	0.41795	0.9196:0.0:0.0804:0.0	.	124;163;163;70;163;163;163	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	N	163;163;163;163;163;163;152;70;31;70;31;163	ENSP00000410739:Y163N;ENSP00000352610:Y163N;ENSP00000269305:Y163N;ENSP00000398846:Y163N;ENSP00000391127:Y163N;ENSP00000391478:Y163N;ENSP00000425104:Y31N;ENSP00000423862:Y70N;ENSP00000424104:Y163N	ENSP00000269305:Y163N	Y	-	1	0	TP53	7519168	1.000000	0.71417	0.998000	0.56505	0.047000	0.14425	9.287000	0.95975	1.067000	0.40740	-0.256000	0.11100	TAC		0.622	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Missense_Mutation
GLP2R	9340	broad.mit.edu	37	17	9760756	9760756	+	Missense_Mutation	SNP	C	C	T	rs575133662		TCGA-61-2104-01	TCGA-61-2104-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2104-01	TCGA-61-2104-11	g.chr17:9760756C>T	ENST00000262441.5	+	6	1141	c.628C>T	c.(628-630)Cgc>Tgc	p.R210C	GLP2R_ENST00000574745.1_Missense_Mutation_p.R30C	NM_004246.1	NP_004237.1	O95838	GLP2R_HUMAN	glucagon-like peptide 2 receptor	210					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|positive regulation of cell proliferation (GO:0008284)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|glucagon receptor activity (GO:0004967)	p.R210C(2)		endometrium(4)|large_intestine(7)|lung(22)|ovary(2)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	44					Glucagon recombinant(DB00040)|Teduglutide(DB08900)	CCACTGCACGCGCAACTACAT	0.493													C|||	1	0.000199681	0.0	0.0014	5008	,	,		20519	0.0		0.0	False		,,,				2504	0.0															2	Substitution - Missense(2)	ovary(1)|endometrium(1)	17											186.0	154.0	165.0					17																	9760756		2203	4300	6503	9701481	SO:0001583	missense	9340			AF105367	CCDS11150.1	17p13.3	2012-08-10			ENSG00000065325	ENSG00000065325		"""GPCR / Class B : Glucagon receptors"""	4325	protein-coding gene	gene with protein product		603659				9990065	Standard	NM_004246		Approved		uc002gmd.1	O95838	OTTHUMG00000130269	ENST00000262441.5:c.628C>T	17.37:g.9760756C>T	ENSP00000262441:p.Arg210Cys		9701481	Q4VAT3	Missense_Mutation	SNP	ENST00000262441.5	37	CCDS11150.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	12.99	2.103897	0.37145	.	.	ENSG00000065325	ENST00000396206;ENST00000304773;ENST00000262441	T	0.37058	1.22	5.28	5.28	0.74379	GPCR, family 2-like (1);	0.000000	0.40469	N	0.001095	T	0.70675	0.3251	H	0.96889	3.9	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.78940	-0.2006	10	0.87932	D	0	.	11.2655	0.49108	0.283:0.717:0.0:0.0	.	210	O95838	GLP2R_HUMAN	C	210;185;210	ENSP00000262441:R210C	ENSP00000262441:R210C	R	+	1	0	GLP2R	9701481	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	4.895000	0.63214	2.756000	0.94617	0.655000	0.94253	CGC		0.493	GLP2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252601.4			Missense_Mutation
DNAH17	8632	broad.mit.edu	37	17	76511006	76511006	+	Missense_Mutation	SNP	C	C	A			TCGA-61-2104-01	TCGA-61-2104-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2104-01	TCGA-61-2104-11	g.chr17:76511006C>A	ENST00000585328.1	-	26	4078	c.3954G>T	c.(3952-3954)agG>agT	p.R1318S	DNAH17_ENST00000389840.5_Missense_Mutation_p.R1317S	NM_173628.3	NP_775899.3	Q9UFH2	DYH17_HUMAN	dynein, axonemal, heavy chain 17	1317	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.R1318S(1)		NS(2)|breast(7)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(8)|lung(37)|ovary(8)|prostate(7)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	116			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			TGTCCAAAGACCTCATGTCCT	0.502																																																1	Substitution - Missense(1)	ovary(1)	17											159.0	162.0	161.0					17																	76511006		2091	4222	6313	74022601	SO:0001583	missense	8632			AJ000522		17q25.3	2012-04-19	2006-09-04		ENSG00000187775	ENSG00000187775		"""Axonemal dyneins"""	2946	protein-coding gene	gene with protein product		610063	"""dynein, axonemal, heavy polypeptide 17"", ""dynein, axonemal, heavy chain like 1"", ""dynein, axonemal, heavy like 1"""	DNAHL1		9545504	Standard	NM_173628		Approved	DNEL2, FLJ40457	uc010dhp.2	Q9UFH2		ENST00000585328.1:c.3954G>T	17.37:g.76511006C>A	ENSP00000465516:p.Arg1318Ser		74022601	O00431|O15206|Q2M2Y1|Q6ZRQ2|Q8N7Q7	Missense_Mutation	SNP	ENST00000585328.1	37		SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	17.52	3.409512	0.62399	.	.	ENSG00000187775	ENST00000300671;ENST00000389840	T	0.61274	0.12	5.31	3.15	0.36227	.	.	.	.	.	T	0.73345	0.3575	M	0.91872	3.25	0.09310	N	1	.	.	.	.	.	.	T	0.64542	-0.6383	7	0.62326	D	0.03	.	8.2124	0.31492	0.0:0.727:0.1331:0.1399	.	.	.	.	S	1318;1317	ENSP00000374490:R1317S	ENSP00000300671:R1318S	R	-	3	2	DNAH17	74022601	0.000000	0.05858	1.000000	0.80357	0.983000	0.72400	-0.199000	0.09491	2.476000	0.83614	0.563000	0.77884	AGG		0.502	DNAH17-001	PUTATIVE	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000318962.2	NM_173628		Missense_Mutation
FHOD3	80206	broad.mit.edu	37	18	34298398	34298398	+	Missense_Mutation	SNP	C	C	G			TCGA-61-2104-01	TCGA-61-2104-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2104-01	TCGA-61-2104-11	g.chr18:34298398C>G	ENST00000359247.4	+	15	2561	c.2561C>G	c.(2560-2562)cCc>cGc	p.P854R	FHOD3_ENST00000257209.4_Missense_Mutation_p.P871R|FHOD3_ENST00000445677.1_Missense_Mutation_p.P833R|FHOD3_ENST00000591635.1_Intron|FHOD3_ENST00000592128.1_5'Flank|FHOD3_ENST00000590592.1_Missense_Mutation_p.P1046R	NM_001281739.1	NP_001268668.1	Q2V2M9	FHOD3_HUMAN	formin homology 2 domain containing 3	854	FH1.|Pro-rich.				actin filament network formation (GO:0051639)|cardiac myofibril assembly (GO:0055003)|negative regulation of actin filament polymerization (GO:0030837)|sarcomere organization (GO:0045214)	striated muscle thin filament (GO:0005865)		p.P871R(1)		NS(1)|breast(5)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|liver(2)|lung(29)|ovary(3)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)	90		all_epithelial(2;0.0181)|Colorectal(2;0.0195)				AGCATTCCTCCCCCTCCTGTC	0.647																																																1	Substitution - Missense(1)	ovary(1)	18											49.0	42.0	45.0					18																	34298398		2193	4284	6477	32552396	SO:0001583	missense	80206			AK091899	CCDS32816.1, CCDS62418.1, CCDS62419.1	18q12	2007-08-02				ENSG00000134775			26178	protein-coding gene	gene with protein product		609691				11214970	Standard	NM_025135		Approved	FHOS2, KIAA1695, FLJ22297, FLJ22717	uc021uiv.1	Q2V2M9		ENST00000359247.4:c.2561C>G	18.37:g.34298398C>G	ENSP00000352186:p.Pro854Arg		32552396	A8MQT4|E5F5Q0|Q642I2|Q6ZRQ7|Q86TF9|Q8N3A5|Q9C0G8|Q9H604|Q9H6G7	Missense_Mutation	SNP	ENST00000359247.4	37		SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	C	15.67	2.900773	0.52227	.	.	ENSG00000134775	ENST00000257209;ENST00000359247;ENST00000445677	T;T;T	0.53640	0.62;0.63;0.61	4.46	4.46	0.54185	Actin-binding FH2 (1);	0.128723	0.52532	D	0.000062	T	0.64735	0.2625	M	0.62723	1.935	0.80722	D	1	D;D;D	0.71674	0.998;0.997;0.998	D;D;D	0.69654	0.965;0.923;0.965	T	0.68161	-0.5482	10	0.56958	D	0.05	.	15.6858	0.77409	0.0:1.0:0.0:0.0	.	833;854;871	Q2V2M9-2;Q2V2M9;Q2V2M9-3	.;FHOD3_HUMAN;.	R	871;854;833	ENSP00000257209:P871R;ENSP00000352186:P854R;ENSP00000411430:P833R	ENSP00000257209:P871R	P	+	2	0	FHOD3	32552396	1.000000	0.71417	1.000000	0.80357	0.742000	0.42306	5.939000	0.70179	2.034000	0.60081	0.555000	0.69702	CCC		0.647	FHOD3-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460884.1	XM_371114		Missense_Mutation
FHOD3	80206	broad.mit.edu	37	18	34324133	34324133	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2104-01	TCGA-61-2104-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2104-01	TCGA-61-2104-11	g.chr18:34324133G>A	ENST00000359247.4	+	19	3442	c.3442G>A	c.(3442-3444)Ggg>Agg	p.G1148R	FHOD3_ENST00000257209.4_Missense_Mutation_p.G1165R|FHOD3_ENST00000445677.1_Missense_Mutation_p.G1127R|FHOD3_ENST00000591635.1_Missense_Mutation_p.G361R|FHOD3_ENST00000592128.1_Missense_Mutation_p.G144R|FHOD3_ENST00000590592.1_Missense_Mutation_p.G1340R	NM_001281739.1	NP_001268668.1	Q2V2M9	FHOD3_HUMAN	formin homology 2 domain containing 3	1148	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				actin filament network formation (GO:0051639)|cardiac myofibril assembly (GO:0055003)|negative regulation of actin filament polymerization (GO:0030837)|sarcomere organization (GO:0045214)	striated muscle thin filament (GO:0005865)		p.G1165R(1)		NS(1)|breast(5)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|liver(2)|lung(29)|ovary(3)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)	90		all_epithelial(2;0.0181)|Colorectal(2;0.0195)				CTCGGAGATCGGGGCCATCAC	0.557																																																1	Substitution - Missense(1)	ovary(1)	18											69.0	60.0	63.0					18																	34324133		2203	4300	6503	32578131	SO:0001583	missense	80206			AK091899	CCDS32816.1, CCDS62418.1, CCDS62419.1	18q12	2007-08-02				ENSG00000134775			26178	protein-coding gene	gene with protein product		609691				11214970	Standard	NM_025135		Approved	FHOS2, KIAA1695, FLJ22297, FLJ22717	uc021uiv.1	Q2V2M9		ENST00000359247.4:c.3442G>A	18.37:g.34324133G>A	ENSP00000352186:p.Gly1148Arg		32578131	A8MQT4|E5F5Q0|Q642I2|Q6ZRQ7|Q86TF9|Q8N3A5|Q9C0G8|Q9H604|Q9H6G7	Missense_Mutation	SNP	ENST00000359247.4	37		SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	23.8	4.453987	0.84209	.	.	ENSG00000134775	ENST00000257209;ENST00000359247;ENST00000445677	T;T;T	0.16743	2.32;2.32;2.32	5.29	4.39	0.52855	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.000000	0.85682	D	0.000000	T	0.45357	0.1338	M	0.85197	2.74	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;0.999	D;D;D;D	0.97110	0.989;1.0;1.0;0.985	T	0.49341	-0.8950	10	0.48119	T	0.1	.	13.7549	0.62930	0.0:0.0:0.8449:0.1551	.	369;1127;1148;1165	E7ETX5;Q2V2M9-2;Q2V2M9;Q2V2M9-3	.;.;FHOD3_HUMAN;.	R	1165;1148;1127	ENSP00000257209:G1165R;ENSP00000352186:G1148R;ENSP00000411430:G1127R	ENSP00000257209:G1165R	G	+	1	0	FHOD3	32578131	1.000000	0.71417	0.943000	0.38184	0.989000	0.77384	9.869000	0.99810	1.167000	0.42706	0.563000	0.77884	GGG		0.557	FHOD3-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460884.1	XM_371114		Missense_Mutation
C19orf47	126526	broad.mit.edu	37	19	40828170	40828170	+	Missense_Mutation	SNP	C	C	A			TCGA-61-2104-01	TCGA-61-2104-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2104-01	TCGA-61-2104-11	g.chr19:40828170C>A	ENST00000582783.1	-	9	900	c.888G>T	c.(886-888)aaG>aaT	p.K296N	C19orf47_ENST00000584868.1_5'UTR|C19orf47_ENST00000392035.2_Missense_Mutation_p.K229N	NM_001256440.1	NP_001243369.1	Q8N9M1	CS047_HUMAN	chromosome 19 open reading frame 47	296						nucleus (GO:0005634)		p.K229N(1)		endometrium(5)|kidney(2)|lung(7)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	20			Lung(22;0.000636)			GTCCTAGCTTCTTCAGGACCC	0.637																																																1	Substitution - Missense(1)	ovary(1)	19											40.0	42.0	41.0					19																	40828170		2203	4300	6503	45520010	SO:0001583	missense	126526			AL834131	CCDS58662.1	19q13.2	2012-07-20			ENSG00000160392	ENSG00000160392			26723	protein-coding gene	gene with protein product						12477932	Standard	NM_001256440		Approved	FLJ36888	uc002oni.5	Q8N9M1	OTTHUMG00000179028	ENST00000582783.1:c.888G>T	19.37:g.40828170C>A	ENSP00000463159:p.Lys296Asn		45520010	Q8IZ33|Q8N0V9	Missense_Mutation	SNP	ENST00000582783.1	37	CCDS58662.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	20.7	4.026087	0.75390	.	.	ENSG00000160392	ENST00000357884;ENST00000392035	.	.	.	5.57	4.54	0.55810	.	0.000000	0.85682	D	0.000000	T	0.77391	0.4123	M	0.74881	2.28	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.78607	-0.2138	9	0.49607	T	0.09	-11.5768	13.1376	0.59417	0.0:0.9216:0.0:0.0784	.	296	Q8N9M1	CS047_HUMAN	N	296;229	.	ENSP00000350556:K296N	K	-	3	2	C19orf47	45520010	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	3.271000	0.51608	1.351000	0.45789	0.561000	0.74099	AAG		0.637	C19orf47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444488.1	NM_178830		Missense_Mutation
SHANK1	50944	broad.mit.edu	37	19	51215261	51215261	+	Silent	SNP	C	C	A			TCGA-61-2104-01	TCGA-61-2104-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2104-01	TCGA-61-2104-11	g.chr19:51215261C>A	ENST00000293441.1	-	6	921	c.903G>T	c.(901-903)ctG>ctT	p.L301L	SHANK1_ENST00000359082.3_Silent_p.L301L|SHANK1_ENST00000391814.1_Silent_p.L301L	NM_016148.2	NP_057232.2	Q9Y566	SHAN1_HUMAN	SH3 and multiple ankyrin repeat domains 1	301					adult behavior (GO:0030534)|associative learning (GO:0008306)|cytoskeletal anchoring at plasma membrane (GO:0007016)|dendritic spine morphogenesis (GO:0060997)|determination of affect (GO:0050894)|habituation (GO:0046959)|long-term memory (GO:0007616)|negative regulation of actin filament bundle assembly (GO:0032232)|neuromuscular process controlling balance (GO:0050885)|olfactory behavior (GO:0042048)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|protein complex assembly (GO:0006461)|protein localization to synapse (GO:0035418)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|righting reflex (GO:0060013)|social behavior (GO:0035176)|synapse maturation (GO:0060074)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|excitatory synapse (GO:0060076)|intracellular (GO:0005622)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ankyrin repeat binding (GO:0071532)|GKAP/Homer scaffold activity (GO:0030160)|identical protein binding (GO:0042802)|ionotropic glutamate receptor binding (GO:0035255)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|scaffold protein binding (GO:0097110)|SH3 domain binding (GO:0017124)|somatostatin receptor binding (GO:0031877)	p.L301L(1)		breast(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(15)|liver(1)|lung(21)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	64		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00493)|GBM - Glioblastoma multiforme(134;0.0199)		CCCTGTTGAACAGGAGCAGCT	0.637																																																1	Substitution - coding silent(1)	ovary(1)	19											72.0	76.0	75.0					19																	51215261		2203	4300	6503	55907073	SO:0001819	synonymous_variant	50944			AF163302	CCDS12799.1	19q13.3	2013-01-10			ENSG00000161681	ENSG00000161681		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	15474	protein-coding gene	gene with protein product	"""somatostatin receptor-interacting protein"""	604999				10551867	Standard	NM_016148		Approved	SSTRIP, SPANK-1, synamon	uc002psx.1	Q9Y566	OTTHUMG00000137380	ENST00000293441.1:c.903G>T	19.37:g.51215261C>A			55907073	A8MXP5|B7WNY6|Q9NYW9	Silent	SNP	ENST00000293441.1	37	CCDS12799.1	SNP	17	Broad																																																																																				0.637	SHANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268071.1	NM_016148		Silent
DPP10	57628	broad.mit.edu	37	2	116510761	116510761	+	Missense_Mutation	SNP	T	T	A			TCGA-61-2104-01	TCGA-61-2104-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2104-01	TCGA-61-2104-11	g.chr2:116510761T>A	ENST00000410059.1	+	11	1442	c.962T>A	c.(961-963)aTc>aAc	p.I321N	DPP10_ENST00000393147.2_Missense_Mutation_p.I325N|DPP10_ENST00000409163.1_Missense_Mutation_p.I271N|DPP10_ENST00000310323.8_Missense_Mutation_p.I314N	NM_001178037.1|NM_020868.3	NP_001171508.1|NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl-peptidase 10 (non-functional)	321						integral component of membrane (GO:0016021)|membrane (GO:0016020)	serine-type peptidase activity (GO:0008236)	p.I314N(1)|p.I321N(1)		breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(24)|liver(2)|lung(48)|ovary(6)|prostate(1)|skin(5)|soft_tissue(1)	101						GAATACTATATCACTATGGTT	0.353																																																2	Substitution - Missense(2)	ovary(2)	2											87.0	78.0	81.0					2																	116510761		2203	4300	6503	116227231	SO:0001583	missense	57628			AY172661	CCDS33278.1, CCDS46400.1, CCDS54388.1, CCDS54389.1	2q14.1	2010-05-04	2010-05-04		ENSG00000175497	ENSG00000175497			20823	protein-coding gene	gene with protein product		608209	"""dipeptidylpeptidase 10"", ""dipeptidyl-peptidase 10"""			10819331, 12662155	Standard	NM_020868		Approved	DPRP3	uc002tle.3	Q8N608	OTTHUMG00000153294	ENST00000410059.1:c.962T>A	2.37:g.116510761T>A	ENSP00000386565:p.Ile321Asn		116227231	A8K1Q2|J3KPP2|J3KQ46|Q0GLB8|Q53QT3|Q53S86|Q53SL8|Q53SS4|Q6TTV4|Q86YR9|Q9P236	Missense_Mutation	SNP	ENST00000410059.1	37	CCDS46400.1	SNP	50	Broad	.	.	.	.	.	.	.	.	.	.	T	22.1	4.240416	0.79912	.	.	ENSG00000175497	ENST00000410059;ENST00000409163;ENST00000393147;ENST00000310323;ENST00000476155	T;T;T;T	0.40476	1.03;1.03;1.03;1.03	5.1	5.1	0.69264	Peptidase S9B, dipeptidylpeptidase IV N-terminal (1);	0.145403	0.49916	D	0.000124	T	0.70996	0.3288	M	0.91510	3.215	0.53005	D	0.999969	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.998;0.989;0.999;0.999	T	0.78638	-0.2126	10	0.87932	D	0	-13.7364	14.2231	0.65841	0.0:0.0:0.0:1.0	.	314;325;317;321	Q8N608-2;Q0GLB8;Q0GLB9;Q8N608	.;.;.;DPP10_HUMAN	N	321;271;325;314;271	ENSP00000386565:I321N;ENSP00000387038:I271N;ENSP00000376855:I325N;ENSP00000309066:I314N	ENSP00000309066:I314N	I	+	2	0	DPP10	116227231	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.504000	0.81646	2.149000	0.67028	0.528000	0.53228	ATC		0.353	DPP10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330580.4	NM_020868		Missense_Mutation
CASS4	57091	broad.mit.edu	37	20	55020984	55020984	+	Missense_Mutation	SNP	G	G	A	rs149841530	byFrequency	TCGA-61-2104-01	TCGA-61-2104-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2104-01	TCGA-61-2104-11	g.chr20:55020984G>A	ENST00000360314.3	+	4	713	c.488G>A	c.(487-489)cGg>cAg	p.R163Q	CASS4_ENST00000434344.1_Missense_Mutation_p.R163Q|CASS4_ENST00000371336.3_Missense_Mutation_p.R163Q	NM_001164116.1	NP_001157588.1	Q9NQ75	CASS4_HUMAN	Cas scaffolding protein family member 4	163					cell adhesion (GO:0007155)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|membrane (GO:0016020)	phosphorelay sensor kinase activity (GO:0000155)	p.R163Q(1)		breast(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(26)|ovary(4)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	54						AGACCTGTCCGGGCCTCACTG	0.567																																																1	Substitution - Missense(1)	ovary(1)	20											109.0	94.0	99.0					20																	55020984		2203	4300	6503	54454391	SO:0001583	missense	57091			AJ276678	CCDS33492.1, CCDS54475.1	20q13.31	2011-04-13	2008-04-14	2008-04-15	ENSG00000087589	ENSG00000087589		"""Cas scaffolding proteins"""	15878	protein-coding gene	gene with protein product	"""HEF-like protein"", ""HEF1-Efs-p130Cas-like"""		"""chromosome 20 open reading frame 32"""	C20orf32			Standard	NM_020356		Approved	HEFL, HEPL	uc002xxr.2	Q9NQ75	OTTHUMG00000032788	ENST00000360314.3:c.488G>A	20.37:g.55020984G>A	ENSP00000353462:p.Arg163Gln		54454391	E1P5Z8|Q5QPD6|Q96K09|Q9BYL5	Missense_Mutation	SNP	ENST00000360314.3	37	CCDS33492.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	13.42	2.231137	0.39399	.	.	ENSG00000087589	ENST00000360314;ENST00000371336;ENST00000434344	T;T;T	0.20881	2.48;2.48;2.04	5.43	-0.5	0.12012	.	1.740750	0.02647	N	0.105942	T	0.17577	0.0422	M	0.69823	2.125	0.09310	N	1	B;P;B;B	0.38455	0.074;0.632;0.196;0.41	B;B;B;B	0.25884	0.005;0.064;0.031;0.017	T	0.23013	-1.0200	10	0.20519	T	0.43	-2.549	2.6806	0.05093	0.2201:0.1235:0.5296:0.1268	.	109;163;163;163	B4DII4;Q9NQ75-3;Q9NQ75-2;Q9NQ75	.;.;.;CASS4_HUMAN	Q	163	ENSP00000353462:R163Q;ENSP00000360387:R163Q;ENSP00000410027:R163Q	ENSP00000353462:R163Q	R	+	2	0	CASS4	54454391	0.018000	0.18449	0.005000	0.12908	0.040000	0.13550	0.030000	0.13688	0.053000	0.16036	0.655000	0.94253	CGG		0.567	CASS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079789.2	NM_020356		Missense_Mutation
ADAMTS5	11096	broad.mit.edu	37	21	28305259	28305259	+	Silent	SNP	A	A	G			TCGA-61-2104-01	TCGA-61-2104-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2104-01	TCGA-61-2104-11	g.chr21:28305259A>G	ENST00000284987.5	-	5	1915	c.1794T>C	c.(1792-1794)gcT>gcC	p.A598A	AP001601.2_ENST00000426771.1_RNA	NM_007038.3	NP_008969.2	Q9UNA0	ATS5_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 5	598	TSP type-1 1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				defense response to bacterium (GO:0042742)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.A598A(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(34)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	72						TGTTTCTGGGAGCAGGGTTAT	0.577																																					Esophageal Squamous(53;683 1080 10100 14424 45938)											1	Substitution - coding silent(1)	ovary(1)	21											156.0	107.0	123.0					21																	28305259		2203	4300	6503	27227130	SO:0001819	synonymous_variant	11096			AF142099	CCDS13579.1	21q21.3	2008-07-31	2008-07-31		ENSG00000154736	ENSG00000154736		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	221	protein-coding gene	gene with protein product	"""aggrecanase-2"""	605007	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 5 (aggrecanase-2)"""			10438522	Standard	NM_007038		Approved	ADMP-2, ADAMTS11	uc002ymg.3	Q9UNA0	OTTHUMG00000078686	ENST00000284987.5:c.1794T>C	21.37:g.28305259A>G			27227130	Q52LV4|Q9UKP2	Silent	SNP	ENST00000284987.5	37	CCDS13579.1	SNP	11	Broad																																																																																				0.577	ADAMTS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171648.1			Silent
DSCAM	1826	broad.mit.edu	37	21	41684012	41684012	+	Silent	SNP	G	G	C			TCGA-61-2104-01	TCGA-61-2104-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2104-01	TCGA-61-2104-11	g.chr21:41684012G>C	ENST00000400454.1	-	9	2535	c.2058C>G	c.(2056-2058)gtC>gtG	p.V686V		NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule	686					cell adhesion (GO:0007155)|dendrite morphogenesis (GO:0048813)|dendrite self-avoidance (GO:0070593)|locomotory behavior (GO:0007626)|negative regulation of cell adhesion (GO:0007162)|nervous system development (GO:0007399)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)	axon (GO:0030424)|extracellular region (GO:0005576)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.V686V(1)		NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(22)|lung(47)|ovary(7)|pancreas(2)|prostate(3)|skin(14)|upper_aerodigestive_tract(6)|urinary_tract(4)	142		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				GCTCACCTCTGACAATCAACT	0.463																																					Melanoma(134;970 1778 1785 21664 32388)											1	Substitution - coding silent(1)	ovary(1)	21											104.0	100.0	102.0					21																	41684012		1975	4170	6145	40605882	SO:0001819	synonymous_variant	1826			AF023449	CCDS42929.1	21q22.2-q22.3	2013-02-11			ENSG00000171587	ENSG00000171587		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	3039	protein-coding gene	gene with protein product		602523				9426258	Standard	NM_001271534		Approved	CHD2-42, CHD2-52	uc002yyq.1	O60469	OTTHUMG00000086732	ENST00000400454.1:c.2058C>G	21.37:g.41684012G>C			40605882	O60468	Silent	SNP	ENST00000400454.1	37	CCDS42929.1	SNP	45	Broad																																																																																				0.463	DSCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195029.1	NM_001389		Silent
FBLN2	2199	broad.mit.edu	37	3	13661310	13661310	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2104-01	TCGA-61-2104-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2104-01	TCGA-61-2104-11	g.chr3:13661310G>A	ENST00000295760.7	+	8	2203	c.2134G>A	c.(2134-2136)Gcg>Acg	p.A712T	FBLN2_ENST00000404922.3_Missense_Mutation_p.A712T|FBLN2_ENST00000492059.1_Missense_Mutation_p.A712T|FBLN2_ENST00000535798.1_Missense_Mutation_p.A738T	NM_001998.2	NP_001989.2	P98095	FBLN2_HUMAN	fibulin 2	712	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.				extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)	p.A712T(1)|p.A131T(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(10)|ovary(3)|prostate(3)|urinary_tract(1)	24			UCEC - Uterine corpus endometrioid carcinoma (1;0.00416)			TGCCATCATGGCGGATGGCGT	0.597																																																2	Substitution - Missense(2)	ovary(2)	3											87.0	90.0	89.0					3																	13661310		2113	4218	6331	13636311	SO:0001583	missense	2199			X82494	CCDS46761.1, CCDS46762.1	3p25-p24	2010-06-15			ENSG00000163520	ENSG00000163520		"""Fibulins"""	3601	protein-coding gene	gene with protein product		135821				7806230	Standard	NM_001165035		Approved		uc011ava.2	P98095	OTTHUMG00000155437	ENST00000295760.7:c.2134G>A	3.37:g.13661310G>A	ENSP00000295760:p.Ala712Thr		13636311	B7Z9C5|Q8IUI0|Q8IUI1	Missense_Mutation	SNP	ENST00000295760.7	37	CCDS46762.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	10.90	1.480447	0.26598	.	.	ENSG00000163520	ENST00000535798;ENST00000404922;ENST00000295760;ENST00000492059	D;D;D;D	0.87334	-2.24;-2.24;-2.24;-2.24	5.28	5.28	0.74379	Epidermal growth factor-like (1);EGF-like region, conserved site (1);	0.130208	0.51477	D	0.000091	D	0.88089	0.6343	N	0.26092	0.79	0.38806	D	0.95531	P;D;D	0.89917	0.714;1.0;1.0	B;D;D	0.91635	0.289;0.999;0.999	D	0.85794	0.1369	10	0.20519	T	0.43	.	14.1859	0.65605	0.0:0.1498:0.8501:0.0	.	712;712;738	P98095;P98095-2;F5H1F3	FBLN2_HUMAN;.;.	T	738;712;712;712	ENSP00000445705:A738T;ENSP00000384169:A712T;ENSP00000295760:A712T;ENSP00000420042:A712T	ENSP00000295760:A712T	A	+	1	0	FBLN2	13636311	1.000000	0.71417	1.000000	0.80357	0.816000	0.46133	4.736000	0.62059	2.463000	0.83235	0.643000	0.83706	GCG		0.597	FBLN2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000340083.3	NM_001004019		Missense_Mutation
CSPG5	10675	broad.mit.edu	37	3	47618422	47618422	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2104-01	TCGA-61-2104-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2104-01	TCGA-61-2104-11	g.chr3:47618422C>T	ENST00000383738.2	-	2	3192	c.1094G>A	c.(1093-1095)cGg>cAg	p.R365Q	CSPG5_ENST00000456150.1_Missense_Mutation_p.R227Q|CSPG5_ENST00000465441.1_5'Flank|CSPG5_ENST00000264723.4_Missense_Mutation_p.R365Q	NM_001206943.1|NM_001206945.1	NP_001193872.1|NP_001193874.1	O95196	CSPG5_HUMAN	chondroitin sulfate proteoglycan 5 (neuroglycan C)	365					axon regeneration (GO:0031103)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|intracellular transport (GO:0046907)|nervous system development (GO:0007399)|regulation of growth (GO:0040008)|regulation of synaptic transmission (GO:0050804)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|Golgi lumen (GO:0005796)|Golgi-associated vesicle membrane (GO:0030660)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)	growth factor activity (GO:0008083)	p.R365Q(2)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)|pancreas(1)|prostate(2)	22				BRCA - Breast invasive adenocarcinoma(193;0.000266)|KIRC - Kidney renal clear cell carcinoma(197;0.00551)|Kidney(197;0.00621)		GCCGTTATGCCGCACAAAGCC	0.632																																																2	Substitution - Missense(2)	ovary(1)|prostate(1)	3											94.0	97.0	96.0					3																	47618422		2203	4299	6502	47593426	SO:0001583	missense	10675			AF059274	CCDS2757.1, CCDS56252.1, CCDS56253.1, CCDS74930.1	3p21.3	2008-07-18			ENSG00000114646	ENSG00000114646			2467	protein-coding gene	gene with protein product		606775				9950058	Standard	NM_006574		Approved	NGC	uc003crp.4	O95196	OTTHUMG00000133518	ENST00000383738.2:c.1094G>A	3.37:g.47618422C>T	ENSP00000373244:p.Arg365Gln		47593426	Q71M39|Q71M40	Missense_Mutation	SNP	ENST00000383738.2	37	CCDS56253.1	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	C	21.6	4.175636	0.78564	.	.	ENSG00000114646	ENST00000456150;ENST00000383738;ENST00000264723	T;T;T	0.25250	1.86;1.83;1.81	4.63	3.75	0.43078	.	0.137586	0.46442	D	0.000299	T	0.19127	0.0459	L	0.44542	1.39	0.09310	N	1	P;P	0.50066	0.931;0.822	B;B	0.35971	0.215;0.184	T	0.12502	-1.0545	10	0.56958	D	0.05	-10.6519	11.9076	0.52721	0.0:0.9132:0.0:0.0868	.	365;365	O95196;O95196-2	CSPG5_HUMAN;.	Q	227;365;365	ENSP00000392096:R227Q;ENSP00000373244:R365Q;ENSP00000264723:R365Q	ENSP00000264723:R365Q	R	-	2	0	CSPG5	47593426	0.023000	0.18921	0.469000	0.27204	0.985000	0.73830	1.332000	0.33805	1.145000	0.42336	0.655000	0.94253	CGG		0.632	CSPG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257489.1	NM_006574		Missense_Mutation
RAD54L2	23132	broad.mit.edu	37	3	51664783	51664783	+	Missense_Mutation	SNP	G	G	T			TCGA-61-2104-01	TCGA-61-2104-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2104-01	TCGA-61-2104-11	g.chr3:51664783G>T	ENST00000409535.2	+	6	786	c.661G>T	c.(661-663)Gtc>Ttc	p.V221F	RAD54L2_ENST00000296477.3_5'UTR	NM_015106.2	NP_055921.2	Q9Y4B4	ARIP4_HUMAN	RAD54-like 2 (S. cerevisiae)	221						nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|transcription cofactor activity (GO:0003712)	p.V221F(1)		NS(2)|breast(1)|cervix(2)|endometrium(4)|large_intestine(5)|liver(2)|lung(9)|ovary(4)|skin(2)	31				BRCA - Breast invasive adenocarcinoma(193;0.000102)|Kidney(197;0.000758)|KIRC - Kidney renal clear cell carcinoma(197;0.000896)		CAGTGAATCTGTCAGTGAAGA	0.488																																																1	Substitution - Missense(1)	ovary(1)	3											99.0	84.0	89.0					3																	51664783		2203	4300	6503	51639823	SO:0001583	missense	23132			AB018352	CCDS33765.2	3p21.2	2006-01-17			ENSG00000164080	ENSG00000164080			29123	protein-coding gene	gene with protein product						9872452	Standard	NM_015106		Approved	KIAA0809, SRISNF2L	uc011bdt.2	Q9Y4B4	OTTHUMG00000152936	ENST00000409535.2:c.661G>T	3.37:g.51664783G>T	ENSP00000386520:p.Val221Phe		51639823	Q8TB57|Q9BV54	Missense_Mutation	SNP	ENST00000409535.2	37	CCDS33765.2	SNP	48	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.86|17.86	3.492880|3.492880	0.64074|0.64074	.|.	.|.	ENSG00000164080|ENSG00000164080	ENST00000432863|ENST00000409535	.|T	.|0.22134	.|1.97	5.8|5.8	5.8|5.8	0.92144|0.92144	.|.	.|0.386948	.|0.26079	.|N	.|0.026469	T|T	0.12178|0.12178	0.0296|0.0296	N|N	0.08118|0.08118	0|0	0.80722|0.80722	D|D	1|1	.|B	.|0.27192	.|0.171	.|B	.|0.25405	.|0.06	T|T	0.09862|0.09862	-1.0655|-1.0655	5|10	.|0.56958	.|D	.|0.05	-17.6871|-17.6871	12.3782|12.3782	0.55291|0.55291	0.0762:0.0:0.9238:0.0|0.0762:0.0:0.9238:0.0	.|.	.|221	.|Q9Y4B4	.|ARIP4_HUMAN	F|F	49|221	.|ENSP00000386520:V221F	.|ENSP00000386520:V221F	C|V	+|+	2|1	0|0	RAD54L2|RAD54L2	51639823|51639823	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.957000|0.957000	0.61999|0.61999	4.453000|4.453000	0.60061|0.60061	2.744000|2.744000	0.94065|0.94065	0.655000|0.655000	0.94253|0.94253	TGT|GTC		0.488	RAD54L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328700.2	NM_015106		Missense_Mutation
ARL13B	200894	broad.mit.edu	37	3	93722507	93722507	+	Silent	SNP	C	C	T			TCGA-61-2104-01	TCGA-61-2104-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2104-01	TCGA-61-2104-11	g.chr3:93722507C>T	ENST00000394222.3	+	3	410	c.135C>T	c.(133-135)taC>taT	p.Y45Y	ARL13B_ENST00000535334.1_5'UTR|ARL13B_ENST00000539730.1_Intron|ARL13B_ENST00000471138.1_Silent_p.Y45Y|ARL13B_ENST00000486562.1_Intron|ARL13B_ENST00000303097.7_Intron	NM_001174150.1	NP_001167621.1	Q3SXY8	AR13B_HUMAN	ADP-ribosylation factor-like 13B	45					cilium assembly (GO:0042384)|dorsal/ventral pattern formation (GO:0009953)|formation of radial glial scaffolds (GO:0021943)|heart looping (GO:0001947)|interneuron migration from the subpallium to the cortex (GO:0021830)|left/right axis specification (GO:0070986)|neural tube patterning (GO:0021532)|nonmotile primary cilium assembly (GO:0035058)|small GTPase mediated signal transduction (GO:0007264)|smoothened signaling pathway (GO:0007224)	ciliary membrane (GO:0060170)|cilium (GO:0005929)|intracellular (GO:0005622)|primary cilium (GO:0072372)	GTP binding (GO:0005525)	p.Y45Y(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|urinary_tract(2)	10						TAACAGAATACCCTGAAGATG	0.308																																																1	Substitution - coding silent(1)	ovary(1)	3											68.0	70.0	69.0					3																	93722507		2203	4298	6501	95205197	SO:0001819	synonymous_variant	200894			AL713789	CCDS2924.1, CCDS2925.1, CCDS54615.1	3q11	2014-05-09	2005-11-18	2005-11-18	ENSG00000169379	ENSG00000169379		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	25419	protein-coding gene	gene with protein product		608922	"""ADP-ribosylation factor-like 2-like 1"""	ARL2L1		15314642, 18674751	Standard	NR_033427		Approved	DKFZp761H079, JBTS8	uc003drf.3	Q3SXY8	OTTHUMG00000159012	ENST00000394222.3:c.135C>T	3.37:g.93722507C>T			95205197	D3DN29|G3V1S8|Q504W8|Q8TCL5	Silent	SNP	ENST00000394222.3	37	CCDS2925.1	SNP	18	Broad																																																																																				0.308	ARL13B-005	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352904.1	NM_182896		Silent
MCF2L2	23101	broad.mit.edu	37	3	183017978	183017978	+	Silent	SNP	G	G	A			TCGA-61-2104-01	TCGA-61-2104-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2104-01	TCGA-61-2104-11	g.chr3:183017978G>A	ENST00000328913.3	-	11	1417	c.1120C>T	c.(1120-1122)Ctg>Ttg	p.L374L	MCF2L2_ENST00000473233.1_Silent_p.L374L|MCF2L2_ENST00000414362.2_Silent_p.L374L|MCF2L2_ENST00000447025.2_Silent_p.L374L	NM_015078.2	NP_055893	Q86YR7	MF2L2_HUMAN	MCF.2 cell line derived transforming sequence-like 2	374							Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.L374L(1)		breast(2)|endometrium(5)|kidney(4)|large_intestine(22)|lung(25)|ovary(3)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	72	all_cancers(143;1.26e-12)|Ovarian(172;0.0355)		all cancers(12;3.35e-44)|Epithelial(37;6.48e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;6.75e-21)			GCCTTTTCCAGGGGCTCCTGC	0.602																																																1	Substitution - coding silent(1)	ovary(1)	3											35.0	35.0	35.0					3																	183017978		2203	4300	6503	184500672	SO:0001819	synonymous_variant	23101			AB020668	CCDS3243.1	3q27	2012-07-24			ENSG00000053524	ENSG00000053524		"""Rho guanine nucleotide exchange factors"""	30319	protein-coding gene	gene with protein product							Standard	NM_015078		Approved	KIAA0861, ARHGEF22	uc003fli.1	Q86YR7	OTTHUMG00000158388	ENST00000328913.3:c.1120C>T	3.37:g.183017978G>A			184500672	O94942|Q6P2B8|Q6ZVJ5|Q8N318	Silent	SNP	ENST00000328913.3	37	CCDS3243.1	SNP	35	Broad																																																																																				0.602	MCF2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350868.1	NM_015078		Silent
EPHA5	2044	broad.mit.edu	37	4	66467704	66467704	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2104-01	TCGA-61-2104-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2104-01	TCGA-61-2104-11	g.chr4:66467704C>T	ENST00000273854.3	-	3	1165	c.565G>A	c.(565-567)Ggt>Agt	p.G189S	EPHA5_ENST00000511294.1_Missense_Mutation_p.G189S|EPHA5_ENST00000354839.4_Missense_Mutation_p.G189S|EPHA5_ENST00000432638.2_Missense_Mutation_p.G189S	NM_001281765.1|NM_004439.5	NP_001268694.1|NP_004430.4	P54756	EPHA5_HUMAN	EPH receptor A5	189	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.				axon guidance (GO:0007411)|cAMP-mediated signaling (GO:0019933)|ephrin receptor signaling pathway (GO:0048013)|hippocampus development (GO:0021766)|negative regulation of synapse assembly (GO:0051964)|neuron development (GO:0048666)|positive regulation of CREB transcription factor activity (GO:0032793)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of Rac GTPase activity (GO:0032314)	dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|GPI-linked ephrin receptor activity (GO:0005004)|transmembrane-ephrin receptor activity (GO:0005005)	p.G189S(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(25)|liver(1)|lung(76)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	142						ACACGGTCACCAAGATCAAGT	0.393										TSP Lung(17;0.13)																																						1	Substitution - Missense(1)	ovary(1)	4											107.0	100.0	103.0					4																	66467704		2203	4300	6503	66150299	SO:0001583	missense	2044			L36644	CCDS3513.1, CCDS3514.1, CCDS75131.1, CCDS75132.1, CCDS75133.1	4q13.1	2013-02-11	2004-10-28		ENSG00000145242	ENSG00000145242		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3389	protein-coding gene	gene with protein product		600004	"""EphA5"""			9267020, 7528718	Standard	NM_004439		Approved	Hek7, TYRO4, CEK7, EHK1	uc003hcy.3	P54756	OTTHUMG00000129273	ENST00000273854.3:c.565G>A	4.37:g.66467704C>T	ENSP00000273854:p.Gly189Ser		66150299	Q7Z3F2	Missense_Mutation	SNP	ENST00000273854.3	37	CCDS3513.1	SNP	21	Broad	.	.	.	.	.	.	.	.	.	.	C	21.4	4.141595	0.77775	.	.	ENSG00000145242	ENST00000273854;ENST00000432638;ENST00000354839;ENST00000511294	T;T;T;T	0.03607	3.87;3.87;3.87;3.87	5.83	5.83	0.93111	Ephrin receptor, ligand binding (2);Galactose-binding domain-like (1);	0.000000	0.64402	D	0.000006	T	0.21347	0.0514	M	0.77616	2.38	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.996;1.0;1.0	T	0.00035	-1.2260	10	0.66056	D	0.02	.	20.1208	0.97960	0.0:1.0:0.0:0.0	.	189;189;189;189	B7ZKW7;B7ZKJ3;P54756-2;P54756	.;.;.;EPHA5_HUMAN	S	189	ENSP00000273854:G189S;ENSP00000389208:G189S;ENSP00000346899:G189S;ENSP00000427638:G189S	ENSP00000273854:G189S	G	-	1	0	EPHA5	66150299	1.000000	0.71417	1.000000	0.80357	0.343000	0.28985	7.818000	0.86416	2.758000	0.94735	0.655000	0.94253	GGT		0.393	EPHA5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251388.2	NM_004439		Missense_Mutation
MUC7	4589	broad.mit.edu	37	4	71347351	71347351	+	Missense_Mutation	SNP	C	C	A			TCGA-61-2104-01	TCGA-61-2104-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2104-01	TCGA-61-2104-11	g.chr4:71347351C>A	ENST00000304887.5	+	3	1080	c.890C>A	c.(889-891)tCc>tAc	p.S297Y	MUC7_ENST00000413702.1_Missense_Mutation_p.S297Y|MUC7_ENST00000456088.1_Missense_Mutation_p.S297Y	NM_152291.2	NP_689504.2	Q8TAX7	MUC7_HUMAN	mucin 7, secreted	297	Thr-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)		p.S297Y(1)		central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(2)|lung(23)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	42			Lung(101;0.211)			CCACCGTCTTCCCCAGCTCCA	0.557																																																1	Substitution - Missense(1)	ovary(1)	4											388.0	358.0	368.0					4																	71347351		2203	4300	6503	71381940	SO:0001583	missense	4589			BC025688	CCDS3541.1	4q13.3	2008-02-05	2006-03-14		ENSG00000171195	ENSG00000171195		"""Mucins"""	7518	protein-coding gene	gene with protein product		158375	"""mucin 7, salivary"""			8838308	Standard	NM_152291		Approved	FLJ27047, MG2	uc003hfj.3	Q8TAX7	OTTHUMG00000129916	ENST00000304887.5:c.890C>A	4.37:g.71347351C>A	ENSP00000302021:p.Ser297Tyr		71381940	Q9UCD7|Q9UCD8	Missense_Mutation	SNP	ENST00000304887.5	37	CCDS3541.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	-	9.987	1.229715	0.22542	.	.	ENSG00000171195	ENST00000413702;ENST00000456088;ENST00000304887	T;T;T	0.52295	0.67;0.67;0.67	2.16	0.246	0.15516	.	.	.	.	.	T	0.26521	0.0648	N	0.24115	0.695	0.09310	N	1	P	0.37573	0.6	B	0.29716	0.106	T	0.08576	-1.0715	8	.	.	.	.	8.0687	0.30676	0.4279:0.5721:0.0:0.0	.	297	Q8TAX7	MUC7_HUMAN	Y	297	ENSP00000407422:S297Y;ENSP00000400585:S297Y;ENSP00000302021:S297Y	.	S	+	2	0	MUC7	71381940	0.002000	0.14202	0.000000	0.03702	0.000000	0.00434	1.545000	0.36169	0.010000	0.14839	-0.235000	0.12190	TCC		0.557	MUC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252168.2	NM_152291		Missense_Mutation
PCDHGA3	56112	broad.mit.edu	37	5	140725527	140725527	+	Missense_Mutation	SNP	G	G	T			TCGA-61-2104-01	TCGA-61-2104-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2104-01	TCGA-61-2104-11	g.chr5:140725527G>T	ENST00000253812.6	+	1	1927	c.1927G>T	c.(1927-1929)Gtg>Ttg	p.V643L	PCDHGA2_ENST00000394576.2_Intron|PCDHGA1_ENST00000517417.1_Intron	NM_018916.3|NM_032011.1	NP_061739.2|NP_114400.1	Q9Y5H0	PCDG3_HUMAN	protocadherin gamma subfamily A, 3	643	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCAGAGCCTCGTGGTGGCCGT	0.711																																																0			5											14.0	21.0	19.0					5																	140725527		2144	4266	6410	140705711	SO:0001583	missense	56112			AF152510	CCDS47290.1, CCDS75329.1	5q31	2010-01-26			ENSG00000254245	ENSG00000254245		"""Cadherins / Protocadherins : Clustered"""	8701	other	protocadherin		606290				10380929	Standard	NM_032011		Approved	PCDH-GAMMA-A3		Q9Y5H0	OTTHUMG00000163680	ENST00000253812.6:c.1927G>T	5.37:g.140725527G>T	ENSP00000253812:p.Val643Leu		140705711	Q9Y5D4	Missense_Mutation	SNP	ENST00000253812.6	37	CCDS47290.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	.	11.18	1.563451	0.27915	.	.	ENSG00000254245	ENST00000253812	T	0.52983	0.64	5.12	3.17	0.36434	Cadherin (4);Cadherin-like (1);	0.322330	0.16120	U	0.228692	T	0.34048	0.0884	N	0.20986	0.625	0.21719	N	0.999576	B;B	0.23058	0.079;0.048	B;B	0.31290	0.127;0.079	T	0.25012	-1.0144	10	0.30854	T	0.27	.	9.2785	0.37714	0.0764:0.2756:0.648:0.0	.	643;643	Q9Y5H0-2;Q9Y5H0	.;PCDG3_HUMAN	L	643	ENSP00000253812:V643L	ENSP00000253812:V643L	V	+	1	0	PCDHGA3	140705711	0.029000	0.19370	0.994000	0.49952	0.985000	0.73830	0.422000	0.21296	1.267000	0.44247	0.558000	0.71614	GTG		0.711	PCDHGA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377017.1	NM_018916		Missense_Mutation
SH3TC2	79628	broad.mit.edu	37	5	148408091	148408091	+	Missense_Mutation	SNP	C	C	T	rs549821020		TCGA-61-2104-01	TCGA-61-2104-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2104-01	TCGA-61-2104-11	g.chr5:148408091C>T	ENST00000515425.1	-	11	1305	c.1204G>A	c.(1204-1206)Gtc>Atc	p.V402I	SH3TC2_ENST00000538184.1_5'UTR|SH3TC2_ENST00000512049.1_Missense_Mutation_p.V395I|SH3TC2_ENST00000513340.1_5'UTR|SH3TC2_ENST00000394358.2_Missense_Mutation_p.V287I	NM_024577.3	NP_078853.2	Q8TF17	S3TC2_HUMAN	SH3 domain and tetratricopeptide repeats 2	402					cell death (GO:0008219)|peripheral nervous system myelin maintenance (GO:0032287)|regulation of ERBB signaling pathway (GO:1901184)|regulation of intracellular protein transport (GO:0033157)	cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)		p.V402I(1)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(12)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	39			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCAGGCCTGACCTCCTTGAAA	0.612																																																1	Substitution - Missense(1)	ovary(1)	5											31.0	33.0	32.0					5																	148408091		2203	4300	6503	148388284	SO:0001583	missense	79628			AK127248	CCDS4293.1	5q32	2014-09-17			ENSG00000169247	ENSG00000169247		"""Tetratricopeptide (TTC) repeat domain containing"""	29427	protein-coding gene	gene with protein product		608206				14574644	Standard	NM_024577		Approved	KIAA1985, CMT4C	uc003lpu.3	Q8TF17	OTTHUMG00000129930	ENST00000515425.1:c.1204G>A	5.37:g.148408091C>T	ENSP00000423660:p.Val402Ile		148388284	B3KWE5|Q14CC0|Q14CF5|Q9H8I5	Missense_Mutation	SNP	ENST00000515425.1	37	CCDS4293.1	SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	0.023	-1.404353	0.01165	.	.	ENSG00000169247	ENST00000515425;ENST00000512049;ENST00000394358	T;T;T	0.75050	-0.9;-0.9;-0.55	6.03	0.00184	0.14048	.	0.810100	0.11746	N	0.533516	T	0.46580	0.1400	N	0.03608	-0.345	0.09310	N	1	B;B;B;B	0.21520	0.057;0.0;0.0;0.0	B;B;B;B	0.16722	0.016;0.0;0.0;0.0	T	0.30736	-0.9968	10	0.33940	T	0.23	.	6.1497	0.20304	0.0:0.4126:0.129:0.4584	.	287;395;402;402	C9JLC3;Q14CC0;E9PDF1;Q8TF17	.;.;.;S3TC2_HUMAN	I	402;395;287	ENSP00000423660:V402I;ENSP00000421860:V395I;ENSP00000377886:V287I	ENSP00000377886:V287I	V	-	1	0	SH3TC2	148388284	0.007000	0.16637	0.062000	0.19696	0.008000	0.06430	0.087000	0.14958	-0.077000	0.12752	-0.176000	0.13171	GTC		0.612	SH3TC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252186.2	NM_024577		Missense_Mutation
DEFB112	245915	broad.mit.edu	37	6	50011475	50011475	+	Missense_Mutation	SNP	T	T	A			TCGA-61-2104-01	TCGA-61-2104-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2104-01	TCGA-61-2104-11	g.chr6:50011475T>A	ENST00000322246.4	-	2	154	c.155A>T	c.(154-156)aAg>aTg	p.K52M		NM_001037498.1	NP_001032587.1	Q30KQ8	DB112_HUMAN	defensin, beta 112	52					defense response to bacterium (GO:0042742)	extracellular region (GO:0005576)		p.K52M(1)		central_nervous_system(1)|large_intestine(3)|lung(12)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	19	Lung NSC(77;0.042)					TGTACATGACTTCCACCTACT	0.413																																																1	Substitution - Missense(1)	ovary(1)	6											178.0	142.0	154.0					6																	50011475		2203	4300	6503	50119434	SO:0001583	missense	245915			DQ012016	CCDS34476.1	6p12.3	2010-03-30			ENSG00000180872	ENSG00000180872		"""Defensins, beta"""	18093	protein-coding gene	gene with protein product						11854508, 16033865	Standard	NM_001037498		Approved	DEFB-12	uc011dws.2	Q30KQ8	OTTHUMG00000160215	ENST00000322246.4:c.155A>T	6.37:g.50011475T>A	ENSP00000319126:p.Lys52Met		50119434	Q8NET0	Missense_Mutation	SNP	ENST00000322246.4	37	CCDS34476.1	SNP	56	Broad	.	.	.	.	.	.	.	.	.	.	T	7.634	0.679541	0.14907	.	.	ENSG00000180872	ENST00000322246	T	0.21932	1.98	3.43	-2.2	0.06994	.	3.592490	0.00923	N	0.002613	T	0.02807	0.0084	N	0.08118	0	0.09310	N	1	P	0.39964	0.697	B	0.35353	0.201	T	0.13926	-1.0491	10	0.59425	D	0.04	.	2.3896	0.04375	0.363:0.22:0.0:0.417	.	52	Q30KQ8	DB112_HUMAN	M	52	ENSP00000319126:K52M	ENSP00000319126:K52M	K	-	2	0	DEFB112	50119434	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.163000	0.00576	-0.383000	0.07858	-0.461000	0.05368	AAG		0.413	DEFB112-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359672.1	NM_001037498		Missense_Mutation
MLIP	90523	broad.mit.edu	37	6	54095599	54095599	+	Missense_Mutation	SNP	C	C	G			TCGA-61-2104-01	TCGA-61-2104-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2104-01	TCGA-61-2104-11	g.chr6:54095599C>G	ENST00000274897.5	+	11	1314	c.1201C>G	c.(1201-1203)Cag>Gag	p.Q401E	MLIP_ENST00000358276.5_Intron|MLIP_ENST00000370877.2_Intron|MLIP_ENST00000370876.2_Intron|MLIP_ENST00000502396.1_Missense_Mutation_p.Q936E|MLIP_ENST00000509997.1_Intron	NM_138569.2	NP_612636.2	Q5VWP3	MLIP_HUMAN	muscular LMNA-interacting protein	401						nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|PML body (GO:0016605)		p.Q401E(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(16)|ovary(8)|skin(4)|stomach(1)|urinary_tract(1)	34						GCTGCATCCACAGACCCTCTC	0.512																																																1	Substitution - Missense(1)	ovary(1)	6											306.0	271.0	283.0					6																	54095599		2203	4300	6503	54203558	SO:0001583	missense	90523			AK055530	CCDS4954.1, CCDS64448.1, CCDS64449.1	6p12.2-p12.1	2011-04-29	2011-04-29	2011-04-29	ENSG00000146147	ENSG00000146147			21355	protein-coding gene	gene with protein product	"""muscle-enriched A-type lamin interacting protein"""	614106	"""chromosome 6 open reading frame 142"""	C6orf142		21498514	Standard	NM_138569		Approved	MGC18257	uc011dxa.2	Q5VWP3	OTTHUMG00000014891	ENST00000274897.5:c.1201C>G	6.37:g.54095599C>G	ENSP00000274897:p.Gln401Glu		54203558	B7Z2N0|D6RE05|Q96H08|Q96NF7	Missense_Mutation	SNP	ENST00000274897.5	37	CCDS4954.1	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	14.23	2.474018	0.43942	.	.	ENSG00000146147	ENST00000274897;ENST00000502396	T;T	0.24350	2.23;1.86	5.59	4.7	0.59300	.	0.166031	0.29692	N	0.011459	T	0.10294	0.0252	N	0.24115	0.695	0.80722	D	1	P;P	0.41393	0.748;0.518	B;B	0.40101	0.319;0.147	T	0.04053	-1.0981	10	0.87932	D	0	.	12.4069	0.55445	0.0:0.8311:0.1689:0.0	.	936;401	Q5VWP3-3;Q5VWP3	.;MLIP_HUMAN	E	401;936	ENSP00000274897:Q401E;ENSP00000426290:Q936E	ENSP00000274897:Q401E	Q	+	1	0	MLIP	54203558	0.996000	0.38824	0.998000	0.56505	0.994000	0.84299	3.081000	0.50120	1.314000	0.45095	0.650000	0.86243	CAG		0.512	MLIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040979.3	NM_138569		Missense_Mutation
DOPEY1	23033	broad.mit.edu	37	6	83877648	83877648	+	Missense_Mutation	SNP	T	T	G			TCGA-61-2104-01	TCGA-61-2104-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2104-01	TCGA-61-2104-11	g.chr6:83877648T>G	ENST00000349129.2	+	39	7420	c.7160T>G	c.(7159-7161)aTc>aGc	p.I2387S	DOPEY1_ENST00000237163.5_Missense_Mutation_p.I2291S|DOPEY1_ENST00000369739.3_Missense_Mutation_p.I2398S|PGM3_ENST00000513973.1_3'UTR|DOPEY1_ENST00000484282.1_3'UTR|PGM3_ENST00000512866.1_Intron	NM_015018.3	NP_055833.2	Q5JWR5	DOP1_HUMAN	dopey family member 1	2387					protein transport (GO:0015031)			p.I2387S(1)		breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(16)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	67		all_cancers(76;2.29e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.00203)		BRCA - Breast invasive adenocarcinoma(397;0.053)		CTGCTCACCATCTGCACCGTG	0.498																																																1	Substitution - Missense(1)	ovary(1)	6											58.0	52.0	54.0					6																	83877648		2203	4300	6503	83934367	SO:0001583	missense	23033			AK027030	CCDS4996.1, CCDS64467.1	6q15	2013-03-05	2006-02-02	2006-02-02	ENSG00000083097	ENSG00000083097			21194	protein-coding gene	gene with protein product			"""KIAA1117"""	KIAA1117		16301316, 16303751, 10931277	Standard	NM_015018		Approved	dJ202D23.2	uc011dyy.2	Q5JWR5	OTTHUMG00000016365	ENST00000349129.2:c.7160T>G	6.37:g.83877648T>G	ENSP00000195654:p.Ile2387Ser		83934367	Q86XV1|Q9H5J5|Q9NSL4|Q9UPN5|Q9Y414	Missense_Mutation	SNP	ENST00000349129.2	37	CCDS4996.1	SNP	50	Broad	.	.	.	.	.	.	.	.	.	.	T	7.550	0.662539	0.14645	.	.	ENSG00000083097	ENST00000349129;ENST00000237163;ENST00000369739	T;T	0.40756	1.02;1.85	5.76	2.09	0.27110	.	0.669254	0.15711	N	0.248414	T	0.08403	0.0209	N	0.14661	0.345	0.80722	D	1	B;B;B	0.24721	0.034;0.11;0.11	B;B;B	0.24974	0.057;0.042;0.057	T	0.19679	-1.0298	10	0.09084	T	0.74	.	8.5252	0.33300	0.0:0.2124:0.0:0.7876	.	2278;2378;2387	E1P545;B2RWN9;Q5JWR5	.;.;DOP1_HUMAN	S	2387;2291;2291	ENSP00000195654:I2387S;ENSP00000237163:I2291S	ENSP00000237163:I2291S	I	+	2	0	DOPEY1	83934367	0.987000	0.35691	0.008000	0.14137	0.255000	0.26057	4.019000	0.57181	0.129000	0.18514	-0.899000	0.02877	ATC		0.498	DOPEY1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043785.2	NM_015018		Missense_Mutation
AHR	196	broad.mit.edu	37	7	17379496	17379496	+	Missense_Mutation	SNP	C	C	G			TCGA-61-2104-01	TCGA-61-2104-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2104-01	TCGA-61-2104-11	g.chr7:17379496C>G	ENST00000242057.4	+	10	2690	c.2047C>G	c.(2047-2049)Caa>Gaa	p.Q683E		NM_001621.4	NP_001612.1	P35869	AHR_HUMAN	aryl hydrocarbon receptor	683					apoptotic process (GO:0006915)|blood vessel development (GO:0001568)|cell cycle (GO:0007049)|circadian regulation of gene expression (GO:0032922)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045899)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|regulation of B cell proliferation (GO:0030888)|regulation of gene expression (GO:0010468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to toxic substance (GO:0009636)|response to xenobiotic stimulus (GO:0009410)|transcription from RNA polymerase II promoter (GO:0006366)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosolic aryl hydrocarbon receptor complex (GO:0034752)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|enhancer binding (GO:0035326)|Hsp90 protein binding (GO:0051879)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.Q683E(1)		NS(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(11)|ovary(1)|pancreas(1)|urinary_tract(3)	33	Lung NSC(10;0.0392)|all_lung(11;0.0754)				Atorvastatin(DB01076)|Flutamide(DB00499)|Ginseng(DB01404)|Leflunomide(DB01097)|Mexiletine(DB00379)|Nimodipine(DB00393)	TGGGATCAGTCAAGAGTTCCC	0.373																																																1	Substitution - Missense(1)	ovary(1)	7											118.0	113.0	115.0					7																	17379496		2203	4300	6503	17346021	SO:0001583	missense	196			L19872	CCDS5366.1	7p15	2013-05-21			ENSG00000106546	ENSG00000106546		"""Basic helix-loop-helix proteins"""	348	protein-coding gene	gene with protein product		600253				8125016	Standard	NM_001621		Approved	bHLHe76	uc011jxz.1	P35869	OTTHUMG00000149967	ENST00000242057.4:c.2047C>G	7.37:g.17379496C>G	ENSP00000242057:p.Gln683Glu		17346021	A4D130|Q13728|Q13803|Q13804	Missense_Mutation	SNP	ENST00000242057.4	37	CCDS5366.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	C	0.545	-0.851951	0.02651	.	.	ENSG00000106546	ENST00000242057	T	0.46819	0.86	5.9	4.03	0.46877	.	0.644386	0.15487	N	0.259768	T	0.41166	0.1147	L	0.40543	1.245	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.19192	-1.0313	10	0.21014	T	0.42	.	17.3935	0.87439	0.0:0.6555:0.3445:0.0	.	683	P35869	AHR_HUMAN	E	683	ENSP00000242057:Q683E	ENSP00000242057:Q683E	Q	+	1	0	AHR	17346021	0.002000	0.14202	0.340000	0.25575	0.248000	0.25809	0.687000	0.25407	1.486000	0.48398	-0.172000	0.13284	CAA		0.373	AHR-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314620.2	NM_001621		Missense_Mutation
NPC1L1	29881	broad.mit.edu	37	7	44579789	44579789	+	Silent	SNP	A	A	G			TCGA-61-2104-01	TCGA-61-2104-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2104-01	TCGA-61-2104-11	g.chr7:44579789A>G	ENST00000289547.4	-	2	262	c.207T>C	c.(205-207)gaT>gaC	p.D69D	NPC1L1_ENST00000546276.1_Silent_p.D69D|NPC1L1_ENST00000423141.1_Silent_p.D69D|NPC1L1_ENST00000381160.3_Silent_p.D69D	NM_013389.2	NP_037521.2	Q9UHC9	NPCL1_HUMAN	NPC1-like 1	69					cholesterol biosynthetic process (GO:0006695)|cholesterol transport (GO:0030301)|intestinal cholesterol absorption (GO:0030299)|lipoprotein metabolic process (GO:0042157)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|sterol transport (GO:0015918)	brush border membrane (GO:0031526)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|hedgehog receptor activity (GO:0008158)|myosin V binding (GO:0031489)|Rab GTPase binding (GO:0017137)	p.D69D(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|large_intestine(7)|lung(27)|ovary(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	57					Ezetimibe(DB00973)	GGATCAGGTGATCACCTGTGA	0.582																																																1	Substitution - coding silent(1)	ovary(1)	7											62.0	63.0	62.0					7																	44579789		2203	4300	6503	44546314	SO:0001819	synonymous_variant	29881				CCDS5491.1, CCDS43575.1, CCDS75587.1	7p13	2012-11-15	2012-11-15		ENSG00000015520	ENSG00000015520			7898	protein-coding gene	gene with protein product		608010	"""NPC1 (Niemann-Pick disease, type C1, gene)-like 1"""			10783261	Standard	NM_013389		Approved		uc003tlb.3	Q9UHC9	OTTHUMG00000023691	ENST00000289547.4:c.207T>C	7.37:g.44579789A>G			44546314	A4D2J7|B7ZLE6|D3DVK9|Q17RV5|Q6R3Q4|Q9UHC8	Silent	SNP	ENST00000289547.4	37	CCDS5491.1	SNP	12	Broad																																																																																				0.582	NPC1L1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251256.1	NM_013389		Silent
MLXIPL	51085	broad.mit.edu	37	7	73010600	73010600	+	Silent	SNP	G	G	A	rs569809024		TCGA-61-2104-01	TCGA-61-2104-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2104-01	TCGA-61-2104-11	g.chr7:73010600G>A	ENST00000313375.3	-	13	1988	c.1941C>T	c.(1939-1941)acC>acT	p.T647T	MLXIPL_ENST00000434326.1_Silent_p.T553T|MLXIPL_ENST00000354613.1_Intron|MLXIPL_ENST00000414749.2_Intron|MLXIPL_ENST00000429400.2_Silent_p.T647T|MLXIPL_ENST00000395189.1_Silent_p.T554T	NM_032951.2|NM_032953.2	NP_116569.1|NP_116571.1	Q9NP71	MLXPL_HUMAN	MLX interacting protein-like	647					anatomical structure morphogenesis (GO:0009653)|energy reserve metabolic process (GO:0006112)|fatty acid homeostasis (GO:0055089)|glucose homeostasis (GO:0042593)|glucose mediated signaling pathway (GO:0010255)|intracellular signal transduction (GO:0035556)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of oxidative phosphorylation (GO:0090324)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular metabolic process (GO:0031325)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of glycolytic process (GO:0045821)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of energy homeostasis (GO:2000505)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|triglyceride homeostasis (GO:0070328)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	carbohydrate response element binding (GO:0035538)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.T647T(1)		cervix(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	13		Lung NSC(55;0.0659)|all_lung(88;0.152)				GCCGGTTCTCGGTCTCGGGGA	0.612													G|||	1	0.000199681	0.0	0.0	5008	,	,		15019	0.001		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	7											87.0	91.0	90.0					7																	73010600		2203	4300	6503	72648536	SO:0001819	synonymous_variant	51085			AK055029	CCDS5553.1, CCDS5554.1, CCDS47605.1, CCDS47606.1	7q11.23	2013-05-21	2005-10-31	2005-10-31	ENSG00000009950	ENSG00000009950			12744	protein-coding gene	gene with protein product	"""carbohydrate response element binding protein"""	605678	"""Williams Beuren syndrome chromosome region 14"""	WBSCR14		9860302	Standard	XM_005250399		Approved	WS-bHLH, MIO, CHREBP, MONDOB, bHLHd14	uc003tyn.1	Q9NP71	OTTHUMG00000129995	ENST00000313375.3:c.1941C>T	7.37:g.73010600G>A			72648536	C5HU02|C5HU03|C5HU04|Q96E48|Q9BY03|Q9BY04|Q9BY05|Q9BY06|Q9Y2P3	Silent	SNP	ENST00000313375.3	37	CCDS5553.1	SNP	39	Broad																																																																																				0.612	MLXIPL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252262.1	NM_032951		Silent
TRAPPC9	83696	broad.mit.edu	37	8	141034107	141034107	+	Missense_Mutation	SNP	G	G	C			TCGA-61-2104-01	TCGA-61-2104-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2104-01	TCGA-61-2104-11	g.chr8:141034107G>C	ENST00000438773.2	-	18	2759	c.2626C>G	c.(2626-2628)Ctc>Gtc	p.L876V	TRAPPC9_ENST00000389328.4_Missense_Mutation_p.L974V|TRAPPC9_ENST00000389327.3_Missense_Mutation_p.L867V	NM_001160372.1	NP_001153844.1	Q96Q05	TPPC9_HUMAN	trafficking protein particle complex 9	876					cell differentiation (GO:0030154)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)		p.L974V(1)		breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(16)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	47						CCCAGGGAGAGATTCCTGTAA	0.483																																																1	Substitution - Missense(1)	ovary(1)	8											89.0	90.0	90.0					8																	141034107		2203	4300	6503	141103289	SO:0001583	missense	83696			BC006206	CCDS34946.1, CCDS55278.1	8q24.3	2010-10-22			ENSG00000167632	ENSG00000167632		"""Trafficking protein particle complex"""	30832	protein-coding gene	gene with protein product	"""TRAPP 120 kDa subunit"", ""tularik gene 1"""	611966				11572484	Standard	NM_031466		Approved	IKBKBBP, NIBP, KIAA1882, T1, TRS120, MRT13	uc003yvh.2	Q96Q05	OTTHUMG00000164187	ENST00000438773.2:c.2626C>G	8.37:g.141034107G>C	ENSP00000405060:p.Leu876Val		141103289	Q4VTT3|Q658K7|Q6P149|Q6ZQT3|Q7L5C4|Q86Y21|Q96SL2|Q9BQA2	Missense_Mutation	SNP	ENST00000438773.2	37	CCDS55278.1	SNP	33	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.39|16.39	3.110614|3.110614	0.56398|0.56398	.|.	.|.	ENSG00000167632|ENSG00000167632	ENST00000389328;ENST00000389327;ENST00000438773|ENST00000520857	.|.	.|.	.|.	5.35|5.35	4.45|4.45	0.53987|0.53987	.|.	0.072523|.	0.53938|.	D|.	0.000045|.	T|T	0.45216|0.45216	0.1331|0.1331	L|L	0.34521|0.34521	1.04|1.04	0.38316|0.38316	D|D	0.943395|0.943395	P;P;P;P|.	0.52463|.	0.76;0.953;0.826;0.94|.	B;P;B;P|.	0.54759|.	0.357;0.76;0.39;0.465|.	T|T	0.43032|0.43032	-0.9416|-0.9416	9|5	0.18710|.	T|.	0.47|.	.|.	7.625|7.625	0.28208|0.28208	0.0828:0.0:0.7516:0.1655|0.0828:0.0:0.7516:0.1655	.|.	974;876;867;974|.	A6NIF0;Q96Q05;Q96Q05-3;Q96Q05-2|.	.;TPPC9_HUMAN;.;.|.	V|C	974;867;876|719	.|.	ENSP00000373978:L867V|.	L|S	-|-	1|2	0|0	TRAPPC9|TRAPPC9	141103289|141103289	1.000000|1.000000	0.71417|0.71417	0.499000|0.499000	0.27577|0.27577	0.960000|0.960000	0.62799|0.62799	2.867000|2.867000	0.48428|0.48428	1.207000|1.207000	0.43291|0.43291	0.467000|0.467000	0.42956|0.42956	CTC|TCT		0.483	TRAPPC9-002	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000377749.1	NM_031466		Missense_Mutation
SMU1	55234	broad.mit.edu	37	9	33060569	33060569	+	Nonsense_Mutation	SNP	G	G	T			TCGA-61-2104-01	TCGA-61-2104-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2104-01	TCGA-61-2104-11	g.chr9:33060569G>T	ENST00000397149.3	-	6	694	c.644C>A	c.(643-645)tCa>tAa	p.S215*	SMU1_ENST00000536631.1_Nonsense_Mutation_p.S54*	NM_018225.2	NP_060695.2	Q2TAY7	SMU1_HUMAN	smu-1 suppressor of mec-8 and unc-52 homolog (C. elegans)	215						cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.S215*(1)		endometrium(2)|lung(4)|ovary(2)|prostate(1)	9			LUSC - Lung squamous cell carcinoma(29;0.0227)	GBM - Glioblastoma multiforme(74;0.11)		CTCCACATGTGATTTCTGACC	0.368																																																1	Substitution - Nonsense(1)	ovary(1)	9											81.0	77.0	78.0					9																	33060569		2203	4300	6503	33050569	SO:0001587	stop_gained	55234			AK001667	CCDS6534.1	9p12	2013-01-10			ENSG00000122692	ENSG00000122692		"""WD repeat domain containing"""	18247	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 57"""					11438655, 11410362	Standard	NM_018225		Approved	SMU-1, FLJ10805, BWD, fSAP57	uc003zsf.1	Q2TAY7	OTTHUMG00000019757	ENST00000397149.3:c.644C>A	9.37:g.33060569G>T	ENSP00000380336:p.Ser215*		33050569	B4E3L0|Q9BU59|Q9HA96|Q9NVD1	Nonsense_Mutation	SNP	ENST00000397149.3	37	CCDS6534.1	SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	G	37	6.309265	0.97462	.	.	ENSG00000122692	ENST00000397149;ENST00000536631	.	.	.	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-16.5196	17.3142	0.87218	0.0:0.0:1.0:0.0	.	.	.	.	X	215;54	.	ENSP00000380336:S215X	S	-	2	0	SMU1	33050569	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.705000	0.98719	2.763000	0.94921	0.561000	0.74099	TCA		0.368	SMU1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052022.1	NM_018225		Nonsense_Mutation
C9orf43	257169	broad.mit.edu	37	9	116175803	116175803	+	Missense_Mutation	SNP	C	C	G			TCGA-61-2104-01	TCGA-61-2104-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2104-01	TCGA-61-2104-11	g.chr9:116175803C>G	ENST00000288462.4	+	2	476	c.30C>G	c.(28-30)gaC>gaG	p.D10E	C9orf43_ENST00000374165.1_Missense_Mutation_p.D10E|C9orf43_ENST00000490544.1_3'UTR|POLE3_ENST00000374171.4_5'Flank	NM_152786.1	NP_689999.1	Q8TAL5	CI043_HUMAN	chromosome 9 open reading frame 43	10								p.D10E(1)		breast(2)|large_intestine(6)|lung(2)|ovary(1)|pancreas(1)|prostate(3)	15						GCCAGTGGGACGAAACCACCT	0.532																																																1	Substitution - Missense(1)	ovary(1)	9											71.0	66.0	68.0					9																	116175803		2203	4300	6503	115215624	SO:0001583	missense	257169			BC026884	CCDS6796.1	9q33.1	2012-03-15			ENSG00000157653	ENSG00000157653			23570	protein-coding gene	gene with protein product						12477932	Standard	NM_152786		Approved	MGC17358	uc004bhp.3	Q8TAL5	OTTHUMG00000020526	ENST00000288462.4:c.30C>G	9.37:g.116175803C>G	ENSP00000288462:p.Asp10Glu		115215624		Missense_Mutation	SNP	ENST00000288462.4	37	CCDS6796.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	c	14.85	2.658321	0.47467	.	.	ENSG00000157653	ENST00000374165;ENST00000288462	T;T	0.64438	-0.1;-0.1	5.46	-4.62	0.03370	.	0.000000	0.45361	D	0.000375	T	0.64472	0.2601	L	0.32530	0.975	0.27738	N	0.944584	D	0.89917	1.0	D	0.91635	0.999	T	0.65569	-0.6136	10	0.72032	D	0.01	-21.3837	13.9756	0.64271	0.0:0.5933:0.0:0.4067	.	10	Q8TAL5	CI043_HUMAN	E	10	ENSP00000363280:D10E;ENSP00000288462:D10E	ENSP00000288462:D10E	D	+	3	2	C9orf43	115215624	0.450000	0.25697	0.972000	0.41901	0.201000	0.24016	-0.968000	0.03817	-0.692000	0.05128	-1.322000	0.01289	GAC		0.532	C9orf43-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053739.1	NM_152786		Missense_Mutation
NEB	4703	broad.mit.edu	37	2	152402513	152402514	+	Splice_Site	INS	-	-	T			TCGA-61-2104-01	TCGA-61-2104-11							Unknown	Unknown	Unknown	Phase_I	Capture	---			Illumina GAIIx	TCGA-61-2104-01	TCGA-61-2104-11	g.chr2:152402513_152402514insT	ENST00000172853.10	-	107	15511		c.e107-1		NEB_ENST00000603639.1_Splice_Site|NEB_ENST00000397345.3_Splice_Site|NEB_ENST00000409198.1_Splice_Site|NEB_ENST00000604864.1_Splice_Site|NEB_ENST00000427231.2_Splice_Site			P20929	NEBU_HUMAN	nebulin						muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)	p.?(1)		NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		GGTAATTAGACTTAAAAAAAAA	0.351																																																1	Unknown(1)	ovary(1)	2							,,	6,3514		1,4,1755					,,	6.1	1.0		dbSNP_130	62	88,7696		1,86,3805	no	splice-3,splice-3,splice-3	NEB	NM_004543.4,NM_001164508.1,NM_001164507.1	,,	2,90,5560	A1A1,A1R,RR		1.1305,0.1705,0.8316	,,	,,		94,11210				152110760	SO:0001630	splice_region_variant	4703			X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.15364-1->A	2.37:g.152402515_152402515dupT			152110759	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Splice_Site_Ins	INS	ENST00000172853.10	37		INS	20	Broad																																																																																				0.351	NEB-201	KNOWN	basic	protein_coding	protein_coding		NM_004543	Intron	Splice_Site_Ins
GIGYF2	26058	broad.mit.edu	37	2	233712227	233712229	+	In_Frame_Del	DEL	ACA	ACA	-	rs7563724|rs398061180|rs527464858|rs58340018|rs376678075|rs10555297	byFrequency	TCGA-61-2104-01	TCGA-61-2104-11							Unknown	Unknown	Unknown	Phase_I	Capture	---			Illumina GAIIx	TCGA-61-2104-01	TCGA-61-2104-11	g.chr2:233712227_233712229delACA	ENST00000409547.1	+	29	3941_3943	c.3630_3632delACA	c.(3628-3633)ccacag>ccg	p.Q1216del	GIGYF2_ENST00000373566.3_In_Frame_Del_p.Q1238del|GIGYF2_ENST00000409480.1_In_Frame_Del_p.Q1238del|GIGYF2_ENST00000409451.3_In_Frame_Del_p.Q1237del|GIGYF2_ENST00000409196.3_In_Frame_Del_p.Q1210del|GIGYF2_ENST00000373563.4_In_Frame_Del_p.Q1216del	NM_015575.3	NP_056390.2	Q6Y7W6	PERQ2_HUMAN	GRB10 interacting GYF protein 2	1216	Gln-rich.				adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|feeding behavior (GO:0007631)|homeostasis of number of cells within a tissue (GO:0048873)|insulin-like growth factor receptor signaling pathway (GO:0048009)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|musculoskeletal movement (GO:0050881)|negative regulation of translation (GO:0017148)|neuromuscular process controlling balance (GO:0050885)|post-embryonic development (GO:0009791)|spinal cord motor neuron differentiation (GO:0021522)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)	p.Q1216delQ(2)|p.Q1237delQ(1)		NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(17)|lung(11)|ovary(5)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	63		Breast(86;0.00279)|all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)		Epithelial(121;7.37e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000472)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(119;0.0118)|GBM - Glioblastoma multiforme(43;0.0145)		agcagctgccacagcagcagcag	0.547														2800	0.559105	0.6021	0.6138	5008	,	,		10978	0.6022		0.6302	False		,,,				2504	0.3446															3	Deletion - In frame(3)	breast(2)|ovary(1)	2																																								233420473	SO:0001651	inframe_deletion	26058			U80751	CCDS33401.1, CCDS46542.1, CCDS46543.1	2q37.1	2011-07-06	2008-02-11	2008-02-11	ENSG00000204120	ENSG00000204120		"""Trinucleotide (CAG) repeat containing"""	11960	protein-coding gene	gene with protein product	"""GYF domain containing 2"""	612003	"""PERQ amino acid rich, with GYF domain 2"", ""PERQ amino acid rich, with GYF domain 3"", ""trinucleotide repeat containing 15"", ""Parkinson disease (autosomal recessive, early onset) 11"""	PERQ2, PERQ3, TNRC15, PARK11		9225980, 9734811, 12771153, 18358451, 19279319	Standard	NM_015575		Approved	KIAA0642, GYF2	uc002vtk.4	Q6Y7W6	OTTHUMG00000153237	ENST00000409547.1:c.3630_3632delACA	2.37:g.233712227_233712229delACA	ENSP00000386537:p.Gln1216del		233420471	A6H8W4|B9EG55|E9PBB0|O75137|Q7Z2Z8|Q7Z3I2|Q96HU4|Q9NV82	In_Frame_Del	DEL	ENST00000409547.1	37	CCDS33401.1	DEL	6	Broad																																																																																				0.547	GIGYF2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000330316.2	NM_001103146		In_Frame_Del
SORBS2	8470	broad.mit.edu	37	4	186536310	186536310	+	Frame_Shift_Del	DEL	C	C	-			TCGA-61-2104-01	TCGA-61-2104-11							Unknown	Unknown	Unknown	Phase_I	Capture	---			Illumina GAIIx	TCGA-61-2104-01	TCGA-61-2104-11	g.chr4:186536310delC	ENST00000284776.7	-	16	3152	c.2643delG	c.(2641-2643)gagfs	p.E881fs	SORBS2_ENST00000437304.2_Frame_Shift_Del_p.E605fs|SORBS2_ENST00000448662.2_Frame_Shift_Del_p.E442fs|SORBS2_ENST00000431808.1_Frame_Shift_Del_p.E881fs|SORBS2_ENST00000498125.1_5'UTR|SORBS2_ENST00000319471.9_Frame_Shift_Del_p.E512fs|SORBS2_ENST00000393528.3_Frame_Shift_Del_p.E447fs|SORBS2_ENST00000418609.1_Frame_Shift_Del_p.E785fs|SORBS2_ENST00000355634.5_Frame_Shift_Del_p.E981fs|SORBS2_ENST00000449407.2_Frame_Shift_Del_p.E425fs	NM_021069.4	NP_066547.1	O94875	SRBS2_HUMAN	sorbin and SH3 domain containing 2	881	SH3 1. {ECO:0000255|PROSITE- ProRule:PRU00192}.				actin filament organization (GO:0007015)|cell adhesion (GO:0007155)|cell migration (GO:0016477)	actin cytoskeleton (GO:0015629)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	cytoskeletal adaptor activity (GO:0008093)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)	p.E881fs*37(1)		endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(9)|lung(21)|ovary(2)|prostate(2)|skin(4)|urinary_tract(1)	53		all_cancers(14;4.27e-52)|all_epithelial(14;6.58e-39)|all_lung(41;1.42e-13)|Lung NSC(41;3.73e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.00692)|Hepatocellular(41;0.00826)|Renal(120;0.00994)|Prostate(90;0.0101)|all_hematologic(60;0.0174)|all_neural(102;0.244)		OV - Ovarian serous cystadenocarcinoma(60;1.54e-09)|BRCA - Breast invasive adenocarcinoma(30;0.000232)|GBM - Glioblastoma multiforme(59;0.000385)|STAD - Stomach adenocarcinoma(60;0.00109)|LUSC - Lung squamous cell carcinoma(40;0.0205)		TAAATGACAACTCCCTGGAAG	0.423																																					Esophageal Squamous(153;41 2433 9491 36028)											1	Deletion - Frameshift(1)	ovary(1)	4											114.0	104.0	108.0					4																	186536310		2203	4300	6503	186773304	SO:0001589	frameshift_variant	8470				CCDS3845.1, CCDS43289.2, CCDS47173.1, CCDS47174.1, CCDS47175.1, CCDS47176.1, CCDS54825.1, CCDS59482.1	4q35.1	2008-02-05			ENSG00000154556	ENSG00000154556			24098	protein-coding gene	gene with protein product	"""Arg/Abl interacting protein"""					9211900, 9872452	Standard	NM_021069		Approved	ARGBP2, KIAA0777	uc003iym.3	O94875	OTTHUMG00000157215	ENST00000284776.7:c.2643delG	4.37:g.186536310delC	ENSP00000284776:p.Glu881fs		186773304	A6NEK9|B3KPQ7|B7Z1G5|B7Z3X6|C9JKV9|D3DP62|D3DP63|E9PAS5|E9PAW4|G3XAI0|H7BXR4|J3KNZ5|O60592|O60593|Q96EX0	Frame_Shift_Del	DEL	ENST00000284776.7	37	CCDS3845.1	DEL	20	Broad																																																																																				0.423	SORBS2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347944.3	NM_003603		Frame_Shift_Del
