#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
SLC9A1	6548	broad.mit.edu	37	1	27432547	27432547	+	Silent	SNP	C	C	T			TCGA-61-2110-01	TCGA-61-2110-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2110-01	TCGA-61-2110-11	g.chr1:27432547C>T	ENST00000263980.3	-	5	1889	c.1314G>A	c.(1312-1314)aaG>aaA	p.K438K	SLC9A1_ENST00000374086.3_Silent_p.K438K|SLC9A1_ENST00000545949.1_Silent_p.K99K	NM_003047.4	NP_003038.2	P19634	SL9A1_HUMAN	solute carrier family 9, subfamily A (NHE1, cation proton antiporter 1), member 1	438					carbohydrate metabolic process (GO:0005975)|cardiac muscle cell differentiation (GO:0055007)|cell growth (GO:0016049)|cellular response to acidic pH (GO:0071468)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|hydrogen ion transmembrane transport (GO:1902600)|ion transport (GO:0006811)|negative regulation of apoptotic process (GO:0043066)|neuron death (GO:0070997)|positive regulation of action potential (GO:0045760)|positive regulation of cell growth (GO:0030307)|positive regulation of mitochondrial membrane permeability (GO:0035794)|protein oligomerization (GO:0051259)|regulation of intracellular pH (GO:0051453)|regulation of pH (GO:0006885)|regulation of sensory perception of pain (GO:0051930)|regulation of the force of heart contraction (GO:0002026)|response to acidic pH (GO:0010447)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|sodium ion export (GO:0071436)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium-dependent protein binding (GO:0048306)|sodium:proton antiporter activity (GO:0015385)|solute:proton antiporter activity (GO:0015299)			central_nervous_system(1)|cervix(3)|endometrium(3)|kidney(2)|large_intestine(4)|liver(1)|lung(7)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	27				UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;2.19e-50)|OV - Ovarian serous cystadenocarcinoma(117;1.8e-29)|Colorectal(126;7.61e-09)|COAD - Colon adenocarcinoma(152;9.32e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000521)|KIRC - Kidney renal clear cell carcinoma(1967;0.00079)|STAD - Stomach adenocarcinoma(196;0.00125)|READ - Rectum adenocarcinoma(331;0.046)	Amiloride(DB00594)	CGATACGGAACTTGTTGATGA	0.617																																																0			1											71.0	68.0	69.0					1																	27432547		2203	4300	6503	27305134	SO:0001819	synonymous_variant	6548			M81768	CCDS295.1	1p36.1-p35	2014-06-13	2012-03-22		ENSG00000090020	ENSG00000090020		"""Solute carriers"""	11071	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 143"""	107310	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 1 (antiporter, Na+/H+, amiloride sensitive)"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 1"""	APNH, NHE1		8283968	Standard	NM_003047		Approved	PPP1R143	uc001bnm.4	P19634	OTTHUMG00000004271	ENST00000263980.3:c.1314G>A	1.37:g.27432547C>T			27305134	B1ALD6|D3DPL4|Q96EM2	Silent	SNP	ENST00000263980.3	37	CCDS295.1	SNP	20	Broad																																																																																				0.617	SLC9A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012336.2	NM_003047		Silent
FLG2	388698	broad.mit.edu	37	1	152324055	152324055	+	Silent	SNP	G	G	A	rs537172304		TCGA-61-2110-01	TCGA-61-2110-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2110-01	TCGA-61-2110-11	g.chr1:152324055G>A	ENST00000388718.5	-	3	6279	c.6207C>T	c.(6205-6207)caC>caT	p.H2069H	FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000445097.1_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	2069					establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.H2069H(1)		NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GAGTAGTTCCGTGTCTCTCAT	0.532													G|||	1	0.000199681	0.0	0.0014	5008	,	,		29224	0.0		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	1											547.0	482.0	504.0					1																	152324055		2203	4300	6503	150590679	SO:0001819	synonymous_variant	388698			AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.6207C>T	1.37:g.152324055G>A			150590679	Q9H4U1	Silent	SNP	ENST00000388718.5	37	CCDS30861.1	SNP	40	Broad																																																																																				0.532	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034018.5	NM_001014342		Silent
PAQR6	79957	broad.mit.edu	37	1	156214595	156214595	+	Silent	SNP	G	G	A	rs189957556	byFrequency	TCGA-61-2110-01	TCGA-61-2110-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2110-01	TCGA-61-2110-11	g.chr1:156214595G>A	ENST00000292291.5	-	7	875	c.717C>T	c.(715-717)tcC>tcT	p.S239S	PAQR6_ENST00000368270.1_Silent_p.S215S|PAQR6_ENST00000492619.1_5'UTR|PAQR6_ENST00000540423.1_Silent_p.S236S|PAQR6_ENST00000356983.2_Silent_p.S133S|PAQR6_ENST00000335852.1_Silent_p.S133S	NM_001272104.1|NM_001272105.1|NM_198406.2	NP_001259033.1|NP_001259034.1|NP_940798.1	Q6TCH4	PAQR6_HUMAN	progestin and adipoQ receptor family member VI	239						integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.S133S(1)		lung(4)|ovary(1)	5	Hepatocellular(266;0.158)					CAGGCAGGTGGGAGGCGAAGA	0.667																																					GBM(16;219 398 12385 32425 38531)											1	Substitution - coding silent(1)	ovary(1)	1											44.0	46.0	46.0					1																	156214595		2203	4300	6503	154481219	SO:0001819	synonymous_variant	79957			AF455045	CCDS1135.1, CCDS1136.1, CCDS60301.1, CCDS72945.1, CCDS72946.1	1q23	2008-02-05			ENSG00000160781	ENSG00000160781			30132	protein-coding gene	gene with protein product		614579				12477932	Standard	NM_024897		Approved	FLJ22672	uc010phh.2	Q6TCH4	OTTHUMG00000017490	ENST00000292291.5:c.717C>T	1.37:g.156214595G>A			154481219	B7Z9R9|D3DVB4|D3DVB6|Q5TCK9|Q6PDU0|Q7Z4Q7|Q7Z4Q9|Q8N121|Q8N3M2|Q9H621	Silent	SNP	ENST00000292291.5	37	CCDS1136.1	SNP	43	Broad																																																																																				0.667	PAQR6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046297.2	NM_024897		Silent
RCSD1	92241	broad.mit.edu	37	1	167666650	167666650	+	Missense_Mutation	SNP	G	G	T			TCGA-61-2110-01	TCGA-61-2110-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2110-01	TCGA-61-2110-11	g.chr1:167666650G>T	ENST00000367854.3	+	6	1120	c.789G>T	c.(787-789)aaG>aaT	p.K263N	RCSD1_ENST00000537350.1_Missense_Mutation_p.K233N	NM_052862.3	NP_443094.3	Q6JBY9	CPZIP_HUMAN	RCSD domain containing 1	263	RCSD.				cellular hyperosmotic response (GO:0071474)|skeletal muscle contraction (GO:0003009)	actin filament (GO:0005884)	actin filament binding (GO:0051015)	p.K263N(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(2)|ovary(2)|prostate(2)|skin(2)|urinary_tract(1)	24	all_hematologic(923;0.215)					ACGGTGAAAAGGCCAGGCGGA	0.627																																																1	Substitution - Missense(1)	ovary(1)	1											45.0	63.0	57.0					1																	167666650		2201	4299	6500	165933274	SO:0001583	missense	92241			BC072399	CCDS1263.1	1q24.2	2008-02-05			ENSG00000198771	ENSG00000198771			28310	protein-coding gene	gene with protein product		610579				12477932	Standard	NM_052862		Approved	MK2S4, MGC21854	uc001gem.3	Q6JBY9	OTTHUMG00000035318	ENST00000367854.3:c.789G>T	1.37:g.167666650G>T	ENSP00000356828:p.Lys263Asn		165933274	B1AK48|Q4G0E7|Q6IN93|Q8IZM2|Q96DX0|Q9NST4	Missense_Mutation	SNP	ENST00000367854.3	37	CCDS1263.1	SNP	35	Broad	.	.	.	.	.	.	.	.	.	.	G	10.02	1.236717	0.22711	.	.	ENSG00000198771	ENST00000367854;ENST00000537350	T;T	0.48201	0.83;0.82	4.68	2.54	0.30619	.	1.779960	0.02448	N	0.085260	T	0.15176	0.0366	L	0.32530	0.975	0.33704	D	0.614952	B;B	0.21071	0.026;0.051	B;B	0.20577	0.008;0.03	T	0.09684	-1.0663	9	0.20519	T	0.43	-3.1606	3.7108	0.08418	0.0967:0.116:0.5241:0.2632	.	233;263	B7ZKW8;Q6JBY9	.;CPZIP_HUMAN	N	263;233	ENSP00000356828:K263N;ENSP00000439409:K233N	ENSP00000356828:K263N	K	+	3	2	RCSD1	165933274	0.000000	0.05858	0.002000	0.10522	0.019000	0.09904	0.578000	0.23773	0.941000	0.37499	0.460000	0.39030	AAG		0.627	RCSD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000085451.1	NM_052862		Missense_Mutation
HMCN1	83872	broad.mit.edu	37	1	186084057	186084057	+	Nonsense_Mutation	SNP	C	C	T	rs150673369		TCGA-61-2110-01	TCGA-61-2110-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2110-01	TCGA-61-2110-11	g.chr1:186084057C>T	ENST00000271588.4	+	74	11612	c.11383C>T	c.(11383-11385)Cga>Tga	p.R3795*	HMCN1_ENST00000367492.2_Nonsense_Mutation_p.R3795*	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	3795	Ig-like C2-type 36.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)	p.R3795*(2)		NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						AGATCGCAGGCGAATAGATTT	0.423																																																2	Substitution - Nonsense(2)	ovary(1)|prostate(1)	1						C	stop/ARG	0,4406		0,0,2203	174.0	168.0	170.0		11383	0.4	0.9	1	dbSNP_134	170	1,8599	1.2+/-3.3	0,1,4299	no	stop-gained	HMCN1	NM_031935.2		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		3795/5636	186084057	1,13005	2203	4300	6503	184350680	SO:0001587	stop_gained	83872			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.11383C>T	1.37:g.186084057C>T	ENSP00000271588:p.Arg3795*		184350680	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Nonsense_Mutation	SNP	ENST00000271588.4	37	CCDS30956.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	53	21.554364	0.99941	0.0	1.16E-4	ENSG00000143341	ENST00000271588;ENST00000367492	.	.	.	5.03	0.405	0.16361	.	0.167438	0.52532	D	0.000078	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.11182	T	0.66	.	13.0711	0.59061	0.5598:0.4402:0.0:0.0	.	.	.	.	X	3795	.	ENSP00000271588:R3795X	R	+	1	2	HMCN1	184350680	0.999000	0.42202	0.947000	0.38551	0.974000	0.67602	0.735000	0.26115	0.176000	0.19873	0.563000	0.77884	CGA		0.423	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935		Nonsense_Mutation
JMJD4	65094	broad.mit.edu	37	1	227921325	227921325	+	Silent	SNP	C	C	G			TCGA-61-2110-01	TCGA-61-2110-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2110-01	TCGA-61-2110-11	g.chr1:227921325C>G	ENST00000366758.3	-	4	749	c.750G>C	c.(748-750)ggG>ggC	p.G250G	SNAP47_ENST00000315781.5_5'Flank|JMJD4_ENST00000485807.1_5'UTR|SNAP47_ENST00000366759.4_5'Flank|SNAP47_ENST00000480897.1_3'UTR|SNAP47_ENST00000366760.1_Intron|JMJD4_ENST00000438896.2_Silent_p.G250G	NM_023007.2	NP_075383.2	Q9H9V9	JMJD4_HUMAN	jumonji domain containing 4	250	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.							p.G250G(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)|skin(1)	9		Prostate(94;0.0885)				ACTTCTTCCTCCCACAGACAT	0.637																																																1	Substitution - coding silent(1)	ovary(1)	1											50.0	50.0	50.0					1																	227921325		2203	4300	6503	225987948	SO:0001819	synonymous_variant	65094			AK022579	CCDS1561.1, CCDS59203.1	1q42.13	2008-02-05			ENSG00000081692	ENSG00000081692			25724	protein-coding gene	gene with protein product						12477932	Standard	NM_023007		Approved	FLJ12517	uc001hrb.3	Q9H9V9	OTTHUMG00000037698	ENST00000366758.3:c.750G>C	1.37:g.227921325C>G			225987948	Q5TBZ1|Q5TBZ6|Q9H970	Silent	SNP	ENST00000366758.3	37	CCDS1561.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	.	9.816	1.184593	0.21870	.	.	ENSG00000081692	ENST00000438896	.	.	.	4.37	2.46	0.29980	.	0.000000	0.85682	D	0.000000	T	0.56426	0.1984	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.58601	-0.7608	6	0.87932	D	0	-43.3736	2.7566	0.05294	0.1916:0.5218:0.1851:0.1016	.	.	.	.	A	243	.	ENSP00000387830:G243A	G	-	2	0	JMJD4	225987948	0.988000	0.35896	1.000000	0.80357	0.958000	0.62258	0.099000	0.15210	1.165000	0.42670	0.563000	0.77884	GGA		0.637	JMJD4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000091970.1	NM_023007		Silent
OBSCN	84033	broad.mit.edu	37	1	228400296	228400296	+	Nonsense_Mutation	SNP	G	G	A			TCGA-61-2110-01	TCGA-61-2110-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2110-01	TCGA-61-2110-11	g.chr1:228400296G>A	ENST00000422127.1	+	2	856	c.812G>A	c.(811-813)tGg>tAg	p.W271*	OBSCN_ENST00000366709.4_5'UTR|C1orf145_ENST00000295012.5_Intron|OBSCN_ENST00000284548.11_Nonsense_Mutation_p.W271*|OBSCN_ENST00000570156.2_Nonsense_Mutation_p.W271*|OBSCN_ENST00000366707.4_5'UTR	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	271	Ig-like 3.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)	p.W271*(2)		NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				GAGACGGTGTGGAAGAAGGAC	0.667																																																2	Substitution - Nonsense(2)	ovary(2)	1											52.0	61.0	58.0					1																	228400296		2150	4233	6383	226466919	SO:0001587	stop_gained	84033			AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.812G>A	1.37:g.228400296G>A	ENSP00000409493:p.Trp271*		226466919	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Nonsense_Mutation	SNP	ENST00000422127.1	37	CCDS58065.1	SNP	47	Broad	.	.	.	.	.	.	.	.	.	.	g	38	7.031607	0.98013	.	.	ENSG00000154358	ENST00000284548;ENST00000422127	.	.	.	4.26	4.26	0.50523	.	0.182466	0.39210	N	0.001436	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.7031	0.85364	0.0:0.0:1.0:0.0	.	.	.	.	X	271	.	ENSP00000284548:W271X	W	+	2	0	OBSCN	226466919	1.000000	0.71417	0.997000	0.53966	0.995000	0.86356	9.570000	0.98174	1.925000	0.55765	0.556000	0.70494	TGG		0.667	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843		Nonsense_Mutation
PLD5	200150	broad.mit.edu	37	1	242383405	242383405	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2110-01	TCGA-61-2110-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2110-01	TCGA-61-2110-11	g.chr1:242383405G>A	ENST00000536534.2	-	5	861	c.620C>T	c.(619-621)aCg>aTg	p.T207M	PLD5_ENST00000442594.2_Missense_Mutation_p.T115M|PLD5_ENST00000427495.1_Missense_Mutation_p.T145M			Q8N7P1	PLD5_HUMAN	phospholipase D family, member 5	207						integral component of membrane (GO:0016021)	catalytic activity (GO:0003824)	p.T115M(3)|p.T207M(1)		breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(22)|ovary(6)|skin(3)|urinary_tract(1)	55	Melanoma(84;0.242)		OV - Ovarian serous cystadenocarcinoma(106;0.0329)			GTTCATGTACGTCACCTCGGC	0.557																																																4	Substitution - Missense(4)	lung(2)|ovary(1)|large_intestine(1)	1											131.0	118.0	123.0					1																	242383405		2203	4300	6503	240450028	SO:0001583	missense	200150			AK098092	CCDS1621.1, CCDS1621.2, CCDS55692.1	1q43	2008-02-05			ENSG00000180287	ENSG00000180287			26879	protein-coding gene	gene with protein product							Standard	NM_001195811		Approved	FLJ40773	uc001hzn.2	Q8N7P1	OTTHUMG00000039867	ENST00000536534.2:c.620C>T	1.37:g.242383405G>A	ENSP00000440896:p.Thr207Met		240450028	A1KXV0|B7Z324|Q494U9|Q8NB22	Missense_Mutation	SNP	ENST00000536534.2	37	CCDS1621.2	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	G	13.40	2.226328	0.39300	.	.	ENSG00000180287	ENST00000427495;ENST00000442594;ENST00000536534	T;T;T	0.13778	2.56;2.56;2.56	5.52	4.6	0.57074	.	0.238118	0.43747	D	0.000527	T	0.07548	0.0190	N	0.17474	0.49	0.33978	D	0.647606	B;B;B	0.33694	0.421;0.297;0.421	B;B;B	0.21360	0.034;0.015;0.023	T	0.14420	-1.0473	10	0.54805	T	0.06	-20.8238	10.7734	0.46336	0.0909:0.0:0.9091:0.0	.	115;207;145	Q8N7P1-2;Q8N7P1;Q8N7P1-4	.;PLD5_HUMAN;.	M	145;115;207	ENSP00000401285:T145M;ENSP00000414188:T115M;ENSP00000440896:T207M	ENSP00000401285:T145M	T	-	2	0	PLD5	240450028	0.983000	0.35010	0.999000	0.59377	0.995000	0.86356	1.828000	0.39111	2.591000	0.87537	0.655000	0.94253	ACG		0.557	PLD5-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397213.2	NM_152666		Missense_Mutation
KIAA1217	56243	broad.mit.edu	37	10	24762850	24762850	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2110-01	TCGA-61-2110-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2110-01	TCGA-61-2110-11	g.chr10:24762850G>A	ENST00000376454.3	+	6	1570	c.1540G>A	c.(1540-1542)Gag>Aag	p.E514K	KIAA1217_ENST00000396446.1_Missense_Mutation_p.E232K|KIAA1217_ENST00000430453.2_Missense_Mutation_p.E435K|KIAA1217_ENST00000376451.2_Missense_Mutation_p.E232K|KIAA1217_ENST00000376462.1_Missense_Mutation_p.E434K|KIAA1217_ENST00000307544.6_Missense_Mutation_p.E232K|KIAA1217_ENST00000376452.3_Missense_Mutation_p.E514K|KIAA1217_ENST00000458595.1_Missense_Mutation_p.E514K|KIAA1217_ENST00000396445.1_Missense_Mutation_p.E232K	NM_019590.3	NP_062536.2	Q5T5P2	SKT_HUMAN	KIAA1217	514					embryonic skeletal system development (GO:0048706)	cytoplasm (GO:0005737)		p.E514K(1)		breast(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(19)|lung(19)|ovary(5)|prostate(3)|skin(3)|urinary_tract(1)	70						CTTTAAAAAGGAGCCAGGCAC	0.562																																																1	Substitution - Missense(1)	ovary(1)	10											58.0	60.0	60.0					10																	24762850		2203	4300	6503	24802856	SO:0001583	missense	56243			BX640796	CCDS31165.1, CCDS41496.1, CCDS60501.1, CCDS60502.1, CCDS60504.1, CCDS60505.1	10p12.31	2009-09-16			ENSG00000120549	ENSG00000120549			25428	protein-coding gene	gene with protein product	"""sickle tail"""					10574462	Standard	XM_005252500		Approved	DKFZP761L0424, SKT	uc001iru.4	Q5T5P2	OTTHUMG00000017824	ENST00000376454.3:c.1540G>A	10.37:g.24762850G>A	ENSP00000365637:p.Glu514Lys		24802856	A5LHW9|A6NLF3|A6PVQ5|A6PVQ6|A6PVQ7|B9EGK4|Q4KMG4|Q5T5P3|Q5T7H3|Q6MZZ6|Q6ZUI4|Q8WV45|Q9NSR2|Q9ULK3	Missense_Mutation	SNP	ENST00000376454.3	37	CCDS31165.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	31	5.058435	0.93846	.	.	ENSG00000120549	ENST00000376462;ENST00000376456;ENST00000458595;ENST00000442879;ENST00000376454;ENST00000376452;ENST00000438429;ENST00000430453;ENST00000307544;ENST00000450158;ENST00000396445;ENST00000376451;ENST00000396446	T;T;T;T;T;T;T;T;T;T;T	0.50277	0.75;0.75;0.75;0.75;0.75;0.75;0.75;0.75;0.75;0.75;0.75	5.56	5.56	0.83823	.	0.142143	0.64402	D	0.000006	T	0.69223	0.3087	M	0.65498	2.005	0.80722	D	1	D;D;D;D;D;D;D;P	0.76494	0.971;0.968;0.971;0.981;0.99;0.971;0.999;0.868	P;P;P;P;P;P;D;B	0.83275	0.775;0.772;0.716;0.851;0.851;0.716;0.996;0.443	T	0.70633	-0.4818	10	0.66056	D	0.02	.	19.4959	0.95072	0.0:0.0:1.0:0.0	.	514;514;232;232;232;232;514;514	Q5T5P2-7;A6NLF3;Q5T5P2-4;Q5T5P2-8;Q5T5P2-3;Q5T5P2-6;Q5T5P2;Q5T5P2-2	.;.;.;.;.;.;SKT_HUMAN;.	K	434;514;514;232;514;514;364;435;232;232;232;232;232	ENSP00000365645:E434K;ENSP00000365639:E514K;ENSP00000392625:E514K;ENSP00000365637:E514K;ENSP00000365635:E514K;ENSP00000404798:E364K;ENSP00000389680:E435K;ENSP00000302343:E232K;ENSP00000379722:E232K;ENSP00000365634:E232K;ENSP00000379723:E232K	ENSP00000302343:E232K	E	+	1	0	KIAA1217	24802856	1.000000	0.71417	1.000000	0.80357	0.914000	0.54420	9.040000	0.93783	2.624000	0.88883	0.591000	0.81541	GAG		0.562	KIAA1217-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047223.2	NM_019590		Missense_Mutation
ARMC4	55130	broad.mit.edu	37	10	28233340	28233340	+	Silent	SNP	C	C	A			TCGA-61-2110-01	TCGA-61-2110-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2110-01	TCGA-61-2110-11	g.chr10:28233340C>A	ENST00000305242.5	-	12	1646	c.1554G>T	c.(1552-1554)ctG>ctT	p.L518L	ARMC4_ENST00000545014.1_Silent_p.L43L|ARMC4_ENST00000480504.1_5'Flank|ARMC4_ENST00000537576.1_Silent_p.L210L	NM_018076.2	NP_060546.2	Q5T2S8	ARMC4_HUMAN	armadillo repeat containing 4	518					cell projection organization (GO:0030030)|cilium movement (GO:0003341)|left/right axis specification (GO:0070986)|outer dynein arm assembly (GO:0036158)|ventricular system development (GO:0021591)	axoneme (GO:0005930)|ciliary base (GO:0097546)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)		p.L518L(1)		NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(17)|liver(1)|lung(17)|ovary(5)|prostate(3)|skin(8)|stomach(2)|urinary_tract(3)	75						TGATTTCCTTCAGTATTTTTA	0.348																																																1	Substitution - coding silent(1)	ovary(1)	10											66.0	68.0	67.0					10																	28233340		2203	4300	6503	28273346	SO:0001819	synonymous_variant	55130			AL136859	CCDS7157.1	10p12.1-p11.23	2014-02-03			ENSG00000169126	ENSG00000169126		"""Armadillo repeat containing"""	25583	protein-coding gene	gene with protein product		615408				11230166	Standard	XM_005252485		Approved	FLJ10817, FLJ10376, DKFZP434P1735, CILD23	uc001itz.3	Q5T2S8	OTTHUMG00000017867	ENST00000305242.5:c.1554G>T	10.37:g.28233340C>A			28273346	A8K906|B7Z7I1|Q9H0C0	Silent	SNP	ENST00000305242.5	37	CCDS7157.1	SNP	29	Broad																																																																																				0.348	ARMC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047339.1	NM_018076		Silent
COL17A1	1308	broad.mit.edu	37	10	105819892	105819892	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2110-01	TCGA-61-2110-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2110-01	TCGA-61-2110-11	g.chr10:105819892C>T	ENST00000353479.5	-	14	1416	c.1126G>A	c.(1126-1128)Gcc>Acc	p.A376T	COL17A1_ENST00000393211.3_Missense_Mutation_p.A376T|COL17A1_ENST00000369733.3_Missense_Mutation_p.A376T	NM_000494.3	NP_000485.3	Q9UMD9	COHA1_HUMAN	collagen, type XVII, alpha 1	376	Nonhelical region (NC16).				cell junction assembly (GO:0034329)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|hemidesmosome (GO:0030056)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)		p.A376T(1)		NS(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|liver(1)|lung(22)|ovary(5)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	62		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;2.5e-09)|all cancers(201;7.94e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		GCGATGCTGGCAGGGGAGGCT	0.517																																																1	Substitution - Missense(1)	ovary(1)	10											141.0	98.0	113.0					10																	105819892		2203	4300	6503	105809882	SO:0001583	missense	1308			M91669	CCDS7554.1	10q24.3	2013-01-16			ENSG00000065618	ENSG00000065618		"""Collagens"""	2194	protein-coding gene	gene with protein product		113811		BPAG2		7916703	Standard	NM_000494		Approved	BP180	uc001kxr.3	Q9UMD9	OTTHUMG00000018998	ENST00000353479.5:c.1126G>A	10.37:g.105819892C>T	ENSP00000340937:p.Ala376Thr		105809882	Q02802|Q5JV36|Q99018|Q9NQK9|Q9UC14	Missense_Mutation	SNP	ENST00000353479.5	37	CCDS7554.1	SNP	25	Broad	.	.	.	.	.	.	.	.	.	.	C	12.71	2.020543	0.35606	.	.	ENSG00000065618	ENST00000353479;ENST00000369733;ENST00000541872;ENST00000393211	D;D;T	0.91180	-2.8;-2.8;0.65	5.73	2.52	0.30459	.	0.302373	0.23569	N	0.046767	T	0.80297	0.4597	N	0.17872	0.535	0.20873	N	0.99984	B;B	0.12013	0.005;0.003	B;B	0.09377	0.004;0.004	T	0.66540	-0.5898	10	0.32370	T	0.25	-11.7962	6.8602	0.24062	0.0:0.5883:0.0:0.4117	.	376;376	Q9UMD9-2;Q9UMD9	.;COHA1_HUMAN	T	376;376;360;376	ENSP00000340937:A376T;ENSP00000358748:A376T;ENSP00000376905:A376T	ENSP00000340937:A376T	A	-	1	0	COL17A1	105809882	0.923000	0.31300	0.252000	0.24328	0.105000	0.19272	1.589000	0.36644	0.781000	0.33589	0.655000	0.94253	GCC		0.517	COL17A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050181.1	NM_130778, NM_000494		Missense_Mutation
DOCK1	1793	broad.mit.edu	37	10	129207368	129207369	+	Missense_Mutation	DNP	CT	CT	AG			TCGA-61-2110-01	TCGA-61-2110-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2110-01	TCGA-61-2110-11	g.chr10:129207368_129207369CT>AG	ENST00000280333.6	+	41	4236_4237	c.4127_4128CT>AG	c.(4126-4128)aCT>aAG	p.T1376K		NM_001380.3	NP_001371.1	Q14185	DOCK1_HUMAN	dedicator of cytokinesis 1	1376	DHR-2.				apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|hematopoietic progenitor cell differentiation (GO:0002244)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|phagocytosis, engulfment (GO:0006911)|positive regulation of GTPase activity (GO:0043547)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)	p.T1376K(1)		NS(2)|breast(1)|central_nervous_system(7)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(10)|lung(15)|ovary(4)|prostate(3)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	72		all_epithelial(44;2.3e-07)|all_lung(145;0.00466)|Lung NSC(174;0.00685)|Colorectal(57;0.0107)|Renal(717;0.0113)|Breast(234;0.0492)|all_neural(114;0.108)|all_hematologic(284;0.14)		BRCA - Breast invasive adenocarcinoma(275;0.0221)|Colorectal(40;0.115)		CGGCTCTTAACTCAGTTTCCAA	0.441																																																1	Substitution - Missense(1)	ovary(1)	10																																								129097359	SO:0001583	missense	1793			D50857	CCDS73222.1	10q26.13-q26.3	2009-10-28			ENSG00000150760	ENSG00000150760			2987	protein-coding gene	gene with protein product	"""DOwnstream of CrK"""	601403	"""dedicator of cyto-kinesis 1"""			8657152, 8661160	Standard	XM_006717681		Approved	DOCK180, ced5	uc001ljt.3	Q14185	OTTHUMG00000019249	Exception_encountered	10.37:g.129207368_129207369delinsAG	ENSP00000280333:p.Thr1376Lys		129097358	A9Z1Z5	Missense_Mutation	DNP	ENST00000280333.6	37		DNP	20	Broad																																																																																				0.441	DOCK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000050979.2	NM_001380		Missense_Mutation
CNTN5	53942	broad.mit.edu	37	11	100095518	100095518	+	Nonsense_Mutation	SNP	C	C	A			TCGA-61-2110-01	TCGA-61-2110-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2110-01	TCGA-61-2110-11	g.chr11:100095518C>A	ENST00000524871.1	+	16	2269	c.1979C>A	c.(1978-1980)tCa>tAa	p.S660*	CNTN5_ENST00000279463.3_Nonsense_Mutation_p.S660*|CNTN5_ENST00000527185.1_Nonsense_Mutation_p.S660*|CNTN5_ENST00000528682.1_Nonsense_Mutation_p.S660*|CNTN5_ENST00000418526.2_Nonsense_Mutation_p.S586*|CNTN5_ENST00000524560.1_Intron	NM_014361.3	NP_055176.1	O94779	CNTN5_HUMAN	contactin 5	660	Ig-like C2-type 6.				cell adhesion (GO:0007155)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(12)|lung(38)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	81		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)		GACAGTGTGTCAGATGAGGCA	0.428																																																0			11											137.0	134.0	135.0					11																	100095518		2010	4187	6197	99600728	SO:0001587	stop_gained	53942			AB013802	CCDS53696.1, CCDS53697.1, CCDS58168.1	11q22.1	2013-02-11			ENSG00000149972	ENSG00000149972		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2175	protein-coding gene	gene with protein product		607219					Standard	NM_014361		Approved	NB-2, hNB-2	uc021qpb.1	O94779	OTTHUMG00000167579	ENST00000524871.1:c.1979C>A	11.37:g.100095518C>A	ENSP00000435637:p.Ser660*		99600728	A1L4P0|B7ZM07|E9PKE8|O94780|Q49AF3	Nonsense_Mutation	SNP	ENST00000524871.1	37	CCDS53696.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	C	37	6.064741	0.97251	.	.	ENSG00000149972	ENST00000527185;ENST00000528682;ENST00000524871;ENST00000418526;ENST00000279463	.	.	.	5.61	5.61	0.85477	.	0.307853	0.36101	N	0.002797	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.6296	0.91355	0.0:1.0:0.0:0.0	.	.	.	.	X	660;660;660;586;660	.	ENSP00000279463:S660X	S	+	2	0	CNTN5	99600728	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.583000	0.53928	2.655000	0.90218	0.650000	0.86243	TCA		0.428	CNTN5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395148.2	NM_014361		Nonsense_Mutation
TBC1D4	9882	broad.mit.edu	37	13	75869049	75869049	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2110-01	TCGA-61-2110-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2110-01	TCGA-61-2110-11	g.chr13:75869049G>A	ENST00000377636.3	-	18	3603	c.3257C>T	c.(3256-3258)cCc>cTc	p.P1086L	TBC1D4_ENST00000478591.1_5'UTR|TBC1D4_ENST00000431480.2_Missense_Mutation_p.P1078L|TBC1D4_ENST00000377625.2_Missense_Mutation_p.P1023L|TBC1D4_ENST00000425511.1_Missense_Mutation_p.P250L	NM_014832.2	NP_055647.2	O60343	TBCD4_HUMAN	TBC1 domain family, member 4	1086	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.				cellular response to insulin stimulus (GO:0032869)|membrane organization (GO:0061024)|negative regulation of vesicle fusion (GO:0031339)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)	Rab GTPase activator activity (GO:0005097)	p.P1086L(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(12)|lung(18)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Prostate(6;0.014)|Breast(118;0.0982)		GBM - Glioblastoma multiforme(99;0.0116)		GAGGAACCAGGGGGCAGCATA	0.393																																																1	Substitution - Missense(1)	ovary(1)	13											75.0	74.0	75.0					13																	75869049		1924	4175	6099	74767050	SO:0001583	missense	9882			AB011175	CCDS41901.1, CCDS66563.1, CCDS66564.1	13q22.2	2013-07-09			ENSG00000136111	ENSG00000136111			19165	protein-coding gene	gene with protein product	"""Akt substrate of 160 kDa"""	612465				11829485, 11994271, 15304337	Standard	XM_005266603		Approved	KIAA0603, AS160, DKFZp779C0666	uc001vjl.1	O60343	OTTHUMG00000017088	ENST00000377636.3:c.3257C>T	13.37:g.75869049G>A	ENSP00000366863:p.Pro1086Leu		74767050	A7E2X8|B4DU25|B4E235|B6ETN8|B6ETN9|Q5W0B9|Q68D14	Missense_Mutation	SNP	ENST00000377636.3	37	CCDS41901.1	SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	G	29.8	5.035570	0.93630	.	.	ENSG00000136111	ENST00000377636;ENST00000431480;ENST00000377625;ENST00000425511	T;T;T;T	0.23147	1.92;1.92;1.92;1.92	5.55	4.71	0.59529	Rab-GAP/TBC domain (4);	0.000000	0.64402	D	0.000001	T	0.63295	0.2499	H	0.95224	3.64	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.995;0.999;0.998;1.0	T	0.75952	-0.3136	10	0.87932	D	0	-20.9614	14.5921	0.68373	0.0705:0.0:0.9295:0.0	.	250;1023;1078;1086	O60343-4;O60343-2;O60343-3;O60343	.;.;.;TBCD4_HUMAN	L	1086;1078;1023;250	ENSP00000366863:P1086L;ENSP00000395986:P1078L;ENSP00000366852:P1023L;ENSP00000390654:P250L	ENSP00000366852:P1023L	P	-	2	0	TBC1D4	74767050	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.338000	0.96553	1.340000	0.45581	0.563000	0.77884	CCC		0.393	TBC1D4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045283.1	NM_014832		Missense_Mutation
RASA3	22821	broad.mit.edu	37	13	114751254	114751254	+	Missense_Mutation	SNP	T	T	G			TCGA-61-2110-01	TCGA-61-2110-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2110-01	TCGA-61-2110-11	g.chr13:114751254T>G	ENST00000334062.7	-	23	2382	c.2261A>C	c.(2260-2262)aAa>aCa	p.K754T	RASA3_ENST00000389544.4_Missense_Mutation_p.K722T	NM_007368.2	NP_031394.2	Q14644	RASA3_HUMAN	RAS p21 protein activator 3	754					calcium ion transmembrane transport (GO:0070588)|intracellular signal transduction (GO:0035556)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	calcium-release channel activity (GO:0015278)|GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|Ras GTPase activator activity (GO:0005099)	p.K754T(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(20)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	47	Lung NSC(43;0.00814)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.016)|all_epithelial(44;0.00577)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.188)	BRCA - Breast invasive adenocarcinoma(86;0.128)			ATACACAGATTTGCTCCCACA	0.642																																																1	Substitution - Missense(1)	ovary(1)	13											78.0	72.0	74.0					13																	114751254		2203	4300	6503	113769356	SO:0001583	missense	22821				CCDS32016.1	13q34	2013-01-10			ENSG00000185989	ENSG00000185989		"""Pleckstrin homology (PH) domain containing"""	20331	protein-coding gene	gene with protein product		605182				7637787, 9382842	Standard	NM_007368		Approved	GAP1IP4BP, GAPIII	uc001vui.3	Q14644	OTTHUMG00000017399	ENST00000334062.7:c.2261A>C	13.37:g.114751254T>G	ENSP00000335029:p.Lys754Thr		113769356	A6NL15|F8W6X8|Q8IUY2	Missense_Mutation	SNP	ENST00000334062.7	37	CCDS32016.1	SNP	64	Broad	.	.	.	.	.	.	.	.	.	.	T	5.198	0.222060	0.09863	.	.	ENSG00000185989	ENST00000334062;ENST00000389544	D;D	0.86164	-1.97;-2.08	4.78	2.5	0.30297	.	0.097591	0.64402	D	0.000002	T	0.82185	0.4982	L	0.51422	1.61	0.80722	D	1	B	0.14438	0.01	B	0.31495	0.131	T	0.70174	-0.4944	9	.	.	.	.	6.9812	0.24704	0.0:0.1998:0.0:0.8002	.	754	Q14644	RASA3_HUMAN	T	754;722	ENSP00000335029:K754T;ENSP00000374195:K722T	.	K	-	2	0	RASA3	113769356	1.000000	0.71417	0.973000	0.42090	0.311000	0.27955	2.172000	0.42463	0.276000	0.22118	-0.415000	0.06103	AAA		0.642	RASA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045957.2	NM_007368		Missense_Mutation
TEP1	7011	broad.mit.edu	37	14	20864064	20864064	+	Silent	SNP	G	G	A	rs558347552		TCGA-61-2110-01	TCGA-61-2110-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2110-01	TCGA-61-2110-11	g.chr14:20864064G>A	ENST00000262715.5	-	11	1744	c.1704C>T	c.(1702-1704)aaC>aaT	p.N568N	TEP1_ENST00000556935.1_Silent_p.N460N	NM_007110.4	NP_009041.2	Q99973	TEP1_HUMAN	telomerase-associated protein 1	568	TROVE. {ECO:0000255|PROSITE- ProRule:PRU00343}.				RNA-dependent DNA replication (GO:0006278)|telomere maintenance via recombination (GO:0000722)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|ribonucleoprotein complex (GO:0030529)|telomerase holoenzyme complex (GO:0005697)	ATP binding (GO:0005524)|RNA binding (GO:0003723)	p.N568N(1)		NS(4)|breast(1)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(48)|ovary(7)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	96	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;7.42e-08)|all cancers(55;6.46e-07)	GBM - Glioblastoma multiforme(265;0.028)|READ - Rectum adenocarcinoma(17;0.233)		CATCATGGGCGTTAAGAAATC	0.507													G|||	1	0.000199681	0.0	0.0	5008	,	,		17664	0.0		0.0	False		,,,				2504	0.001															1	Substitution - coding silent(1)	ovary(1)	14											131.0	127.0	129.0					14																	20864064		2203	4300	6503	19933904	SO:0001819	synonymous_variant	7011				CCDS9548.1	14q11.2	2013-01-10			ENSG00000129566	ENSG00000129566		"""WD repeat domain containing"""	11726	protein-coding gene	gene with protein product	"""TROVE domain family, member 1"""	601686				9403057	Standard	NM_007110		Approved	TP1, TLP1, VAULT2, p240, TROVE1	uc001vxe.3	Q99973	OTTHUMG00000029515	ENST00000262715.5:c.1704C>T	14.37:g.20864064G>A			19933904	A0AUV9	Silent	SNP	ENST00000262715.5	37	CCDS9548.1	SNP	40	Broad																																																																																				0.507	TEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073563.2	NM_007110		Silent
KHNYN	23351	broad.mit.edu	37	14	24901081	24901081	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2110-01	TCGA-61-2110-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2110-01	TCGA-61-2110-11	g.chr14:24901081C>T	ENST00000251343.5	+	3	753	c.614C>T	c.(613-615)gCa>gTa	p.A205V	CBLN3_ENST00000555436.1_5'Flank|CBLN3_ENST00000267406.6_5'Flank|KHNYN_ENST00000556842.1_Missense_Mutation_p.A205V|KHNYN_ENST00000553935.1_Missense_Mutation_p.A205V|KHNYN_ENST00000554268.1_5'Flank			O15037	KHNYN_HUMAN	KH and NYN domain containing	205							RNA binding (GO:0003723)	p.A205V(1)		kidney(1)|large_intestine(3)|liver(1)|lung(12)|ovary(3)|pancreas(1)|prostate(3)	24						GGGCCAGGAGCACTGGCTTCT	0.647											OREG0022627	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	14											54.0	58.0	57.0					14																	24901081		2202	4298	6500	23970921	SO:0001583	missense	23351			AB002321	CCDS32058.1	14q11.2	2010-11-23	2009-10-14	2009-10-14	ENSG00000100441	ENSG00000100441			20166	protein-coding gene	gene with protein product			"""KIAA0323"""	KIAA0323		17114934	Standard	NM_015299		Approved		uc001wph.4	O15037		ENST00000251343.5:c.614C>T	14.37:g.24901081C>T	ENSP00000251343:p.Ala205Val	774	23970921	Q86TZ6|Q8IUQ2|Q96BA9	Missense_Mutation	SNP	ENST00000251343.5	37	CCDS32058.1	SNP	25	Broad	.	.	.	.	.	.	.	.	.	.	C	1.528	-0.545001	0.04024	.	.	ENSG00000100441	ENST00000251343;ENST00000556842;ENST00000553935	T;T;T	0.23950	1.88;1.88;1.88	3.79	0.638	0.17742	.	1.641560	0.03410	N	0.204708	T	0.15739	0.0379	N	0.19112	0.55	0.09310	N	0.999995	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.0	T	0.19778	-1.0295	10	0.31617	T	0.26	.	2.8157	0.05455	0.2209:0.5308:0.0:0.2483	.	246;205	D3DS77;O15037	.;KHNYN_HUMAN	V	205	ENSP00000251343:A205V;ENSP00000451106:A205V;ENSP00000450799:A205V	ENSP00000251343:A205V	A	+	2	0	KHNYN	23970921	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.249000	0.08842	0.393000	0.25203	0.563000	0.77884	GCA		0.647	KHNYN-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412928.1			Missense_Mutation
AGBL1	123624	broad.mit.edu	37	15	87217595	87217595	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2110-01	TCGA-61-2110-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2110-01	TCGA-61-2110-11	g.chr15:87217595G>A	ENST00000441037.2	+	22	3106	c.3011G>A	c.(3010-3012)aGc>aAc	p.S1004N	AGBL1_ENST00000389298.3_Missense_Mutation_p.S735N|AGBL1_ENST00000421325.2_Missense_Mutation_p.S1004N	NM_152336.2	NP_689549.2	Q96MI9	CBPC4_HUMAN	ATP/GTP binding protein-like 1	1004					C-terminal protein deglutamylation (GO:0035609)|protein side chain deglutamylation (GO:0035610)	cytoplasm (GO:0005737)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)	p.S1004N(1)		NS(3)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|liver(2)|lung(28)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	62						GCCAGCTGCAGCCATCAGCTC	0.562																																																1	Substitution - Missense(1)	ovary(1)	15											39.0	40.0	40.0					15																	87217595		2004	4173	6177	85018599	SO:0001583	missense	123624			AK056872	CCDS58398.1	15q25.3	2014-06-23			ENSG00000166748	ENSG00000166748			26504	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 4"""	615496				21074048, 24094747	Standard	NM_152336		Approved	FLJ32310, CCP4	uc002blz.1	Q96MI9	OTTHUMG00000149978	ENST00000441037.2:c.3011G>A	15.37:g.87217595G>A	ENSP00000413001:p.Ser1004Asn		85018599	A1A4X5|A6NJH6|C9JHL5	Missense_Mutation	SNP	ENST00000441037.2	37	CCDS58398.1	SNP	34	Broad	.	.	.	.	.	.	.	.	.	.	G	12.33	1.906469	0.33628	.	.	ENSG00000166748	ENST00000421325;ENST00000389298	T;T	0.10005	2.92;2.92	5.63	4.71	0.59529	.	.	.	.	.	T	0.07728	0.0194	N	0.19112	0.55	0.20764	N	0.999858	P	0.40970	0.734	B	0.37601	0.254	T	0.28038	-1.0056	9	0.27082	T	0.32	-4.6063	11.89	0.52624	0.0822:0.0:0.9178:0.0	.	1004	Q96MI9	CBPC4_HUMAN	N	1004;735	ENSP00000397173:S1004N;ENSP00000373949:S735N	ENSP00000373949:S735N	S	+	2	0	AGBL1	85018599	0.998000	0.40836	0.998000	0.56505	0.965000	0.64279	3.061000	0.49963	1.349000	0.45751	0.563000	0.77884	AGC		0.562	AGBL1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000314929.5	NM_152336		Missense_Mutation
ZNF785	146540	broad.mit.edu	37	16	30594011	30594011	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2110-01	TCGA-61-2110-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2110-01	TCGA-61-2110-11	g.chr16:30594011C>T	ENST00000395216.2	-	3	1247	c.1088G>A	c.(1087-1089)cGc>cAc	p.R363H	AC002310.7_ENST00000486926.1_RNA|AC002310.7_ENST00000492040.1_RNA|ZNF785_ENST00000470110.1_Missense_Mutation_p.R348H	NM_152458.6	NP_689671.2	A8K8V0	ZN785_HUMAN	zinc finger protein 785	363					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R363H(1)		endometrium(3)|lung(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	9						GCTGCAGGAGCGGTGGATCCA	0.667																																																1	Substitution - Missense(1)	ovary(1)	16											54.0	58.0	57.0					16																	30594011		2197	4300	6497	30501512	SO:0001583	missense	146540			BC040642	CCDS10685.1	16p11.2	2013-01-08			ENSG00000197162	ENSG00000197162		"""Zinc fingers, C2H2-type"", ""-"""	26496	protein-coding gene	gene with protein product						10493829	Standard	NM_152458		Approved	FLJ32130	uc002dyu.3	A8K8V0	OTTHUMG00000132398	ENST00000395216.2:c.1088G>A	16.37:g.30594011C>T	ENSP00000378642:p.Arg363His		30501512	O75701|Q8IW91|Q8WV14|Q96MN0	Missense_Mutation	SNP	ENST00000395216.2	37	CCDS10685.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	c	19.36	3.812938	0.70912	.	.	ENSG00000197162	ENST00000470110;ENST00000395222;ENST00000395216	T;T	0.05855	3.38;3.43	4.25	1.17	0.20885	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.05227	0.0139	L	0.36672	1.1	0.09310	N	1	B;B;B	0.22146	0.065;0.065;0.027	B;B;B	0.13407	0.002;0.004;0.009	T	0.38222	-0.9671	9	0.59425	D	0.04	.	4.2604	0.10739	0.0:0.5974:0.1903:0.2124	.	328;363;348	B4DQL1;A8K8V0;A8K8V0-2	.;ZN785_HUMAN;.	H	348;328;363	ENSP00000420340:R348H;ENSP00000378642:R363H	ENSP00000378642:R363H	R	-	2	0	ZNF785	30501512	0.001000	0.12720	0.001000	0.08648	0.512000	0.34134	0.134000	0.15932	0.108000	0.17862	-0.152000	0.13540	CGC		0.667	ZNF785-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255529.2	NM_152458		Missense_Mutation
MYBBP1A	10514	broad.mit.edu	37	17	4453489	4453489	+	Missense_Mutation	SNP	C	C	G			TCGA-61-2110-01	TCGA-61-2110-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2110-01	TCGA-61-2110-11	g.chr17:4453489C>G	ENST00000254718.4	-	9	1489	c.1183G>C	c.(1183-1185)Gtg>Ctg	p.V395L	MYBBP1A_ENST00000381556.2_Missense_Mutation_p.V395L			Q9BQG0	MBB1A_HUMAN	MYB binding protein (P160) 1a	395	Interaction with MYB. {ECO:0000250}.				cellular response to glucose starvation (GO:0042149)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleocytoplasmic transport (GO:0006913)|osteoblast differentiation (GO:0001649)|positive regulation of cell cycle arrest (GO:0071158)|regulation of transcription, DNA-templated (GO:0006355)|respiratory electron transport chain (GO:0022904)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|NLS-dependent protein nuclear import complex (GO:0042564)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA-directed DNA polymerase activity (GO:0003887)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding (GO:0043565)|transcription factor binding (GO:0008134)	p.V395L(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(7)|ovary(3)|prostate(2)|skin(2)|stomach(1)	24						AGGAACCGCACGACCCGCCAG	0.637																																																1	Substitution - Missense(1)	ovary(1)	17											82.0	88.0	86.0					17																	4453489		2203	4300	6503	4400238	SO:0001583	missense	10514			AF147709	CCDS11046.1, CCDS42238.1	17p13.3	2008-07-18			ENSG00000132382	ENSG00000132382			7546	protein-coding gene	gene with protein product	"""p53-activated protein-2"""	604885				10644447	Standard	NM_014520		Approved	P160, PAP2, FLJ37886	uc002fxz.4	Q9BQG0	OTTHUMG00000090747	ENST00000254718.4:c.1183G>C	17.37:g.4453489C>G	ENSP00000254718:p.Val395Leu		4400238	Q86VM3|Q9BW49|Q9P0V5|Q9UF99	Missense_Mutation	SNP	ENST00000254718.4	37	CCDS11046.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	6.988	0.552383	0.13374	.	.	ENSG00000132382	ENST00000381556;ENST00000254718;ENST00000426435	T;T	0.65916	-0.18;-0.18	5.06	0.312	0.15837	Armadillo-type fold (1);	0.436386	0.22721	N	0.056442	T	0.44286	0.1286	L	0.47716	1.5	0.20307	N	0.999917	B;B	0.29646	0.253;0.213	B;B	0.32393	0.145;0.089	T	0.30880	-0.9963	10	0.07175	T	0.84	-8.6027	4.4151	0.11452	0.0:0.5081:0.1618:0.3301	.	395;395	Q9BQG0;Q9BQG0-2	MBB1A_HUMAN;.	L	395	ENSP00000370968:V395L;ENSP00000254718:V395L	ENSP00000254718:V395L	V	-	1	0	MYBBP1A	4400238	0.725000	0.28048	0.008000	0.14137	0.674000	0.39518	1.637000	0.37155	-0.052000	0.13311	0.655000	0.94253	GTG		0.637	MYBBP1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000207488.2	NM_014520		Missense_Mutation
TP53	7157	broad.mit.edu	37	17	7578550	7578550	+	Missense_Mutation	SNP	G	G	T			TCGA-61-2110-01	TCGA-61-2110-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2110-01	TCGA-61-2110-11	g.chr17:7578550G>T	ENST00000269305.4	-	5	569	c.380C>A	c.(379-381)tCc>tAc	p.S127Y	TP53_ENST00000445888.2_Missense_Mutation_p.S127Y|TP53_ENST00000455263.2_Missense_Mutation_p.S127Y|TP53_ENST00000420246.2_Missense_Mutation_p.S127Y|TP53_ENST00000359597.4_Missense_Mutation_p.S127Y|TP53_ENST00000413465.2_Missense_Mutation_p.S127Y|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	127	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		S -> C (in a sporadic cancer; somatic mutation).|S -> F (in sporadic cancers; somatic mutation).|S -> P (in sporadic cancers; somatic mutation).|S -> T (in sporadic cancers; somatic mutation).|S -> Y (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.S127F(23)|p.0?(8)|p.S127Y(8)|p.S127C(7)|p.Y126_K132delYSPALNK(6)|p.A129fs*20(3)|p.Y126_N131delYSPALN(3)|p.S34C(2)|p.P128fs*42(2)|p.V73fs*9(1)|p.S127fs*36(1)|p.P128fs*18(1)|p.Y126fs*11(1)|p.S127_Q136del10(1)|p.P13fs*18(1)|p.?(1)|p.S34F(1)|p.A36fs*20(1)|p.S127fs*42(1)|p.Y126fs*18(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GAGGGCAGGGGAGTACTGTAG	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	73	Substitution - Missense(41)|Deletion - In frame(10)|Deletion - Frameshift(9)|Whole gene deletion(8)|Insertion - Frameshift(4)|Unknown(1)	lung(13)|ovary(8)|upper_aerodigestive_tract(7)|large_intestine(6)|central_nervous_system(6)|skin(5)|NS(4)|prostate(4)|bone(4)|urinary_tract(3)|breast(3)|stomach(2)|haematopoietic_and_lymphoid_tissue(2)|liver(2)|oesophagus(2)|biliary_tract(1)|pancreas(1)	17											44.0	44.0	44.0					17																	7578550		2203	4300	6503	7519275	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.380C>A	17.37:g.7578550G>T	ENSP00000269305:p.Ser127Tyr		7519275	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	22.3	4.276306	0.80580	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000514944;ENST00000508793;ENST00000503591	D;D;D;D;D;D;D;D;D	0.99940	-8.39;-8.39;-8.39;-8.39;-8.39;-8.39;-8.39;-8.39;-8.39	5.48	4.51	0.55191	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99933	0.9970	M	0.91038	3.17	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;0.995;1.0;1.0;1.0	D	0.95614	0.8675	10	0.87932	D	0	-30.2503	12.2742	0.54724	0.0828:0.0:0.9172:0.0	.	88;127;127;34;127;127;127	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	Y	127;127;127;127;127;127;116;34;34;127;127	ENSP00000410739:S127Y;ENSP00000352610:S127Y;ENSP00000269305:S127Y;ENSP00000398846:S127Y;ENSP00000391127:S127Y;ENSP00000391478:S127Y;ENSP00000423862:S34Y;ENSP00000424104:S127Y;ENSP00000426252:S127Y	ENSP00000269305:S127Y	S	-	2	0	TP53	7519275	1.000000	0.71417	0.890000	0.34922	0.931000	0.56810	9.763000	0.98947	1.448000	0.47680	0.655000	0.94253	TCC		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Missense_Mutation
C17orf104	284071	broad.mit.edu	37	17	42745400	42745400	+	Silent	SNP	T	T	C			TCGA-61-2110-01	TCGA-61-2110-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2110-01	TCGA-61-2110-11	g.chr17:42745400T>C	ENST00000409122.2	+	5	2263	c.2121T>C	c.(2119-2121)taT>taC	p.Y707Y	C17orf104_ENST00000409464.1_Silent_p.Y541Y|C17orf104_ENST00000359945.3_Silent_p.Y707Y	NM_001145080.2	NP_001138552.2	A2RUB1	CQ104_HUMAN	chromosome 17 open reading frame 104	707								p.Y707Y(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(7)|ovary(2)|pancreas(1)|skin(1)	24						TGGATTCCTATGACTTACTTT	0.373																																																1	Substitution - coding silent(1)	ovary(1)	17											83.0	72.0	75.0					17																	42745400		2203	4300	6503	40100926	SO:0001819	synonymous_variant	284071				CCDS45703.1, CCDS45703.2	17q21.31	2009-09-08			ENSG00000180336	ENSG00000180336			26670	protein-coding gene	gene with protein product							Standard	NM_001145080		Approved	FLJ35848	uc002iha.3	A2RUB1	OTTHUMG00000153039	ENST00000409122.2:c.2121T>C	17.37:g.42745400T>C			40100926	B4DXJ2|B5MD93|B9EGQ6|C4AM97|Q4G0Y1|Q8IVZ7|Q8NA45	Silent	SNP	ENST00000409122.2	37	CCDS45703.2	SNP	51	Broad																																																																																				0.373	C17orf104-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329171.2	NM_001145080		Silent
THOP1	7064	broad.mit.edu	37	19	2799759	2799759	+	Missense_Mutation	SNP	A	A	C			TCGA-61-2110-01	TCGA-61-2110-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2110-01	TCGA-61-2110-11	g.chr19:2799759A>C	ENST00000307741.6	+	5	762	c.559A>C	c.(559-561)Acc>Ccc	p.T187P	THOP1_ENST00000586677.1_Missense_Mutation_p.T66P	NM_003249.3	NP_003240.1	P52888	THOP1_HUMAN	thimet oligopeptidase 1	187					intracellular signal transduction (GO:0035556)|peptide metabolic process (GO:0006518)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|peptide binding (GO:0042277)			NS(1)|central_nervous_system(1)|endometrium(1)|lung(8)|ovary(2)|skin(1)	14				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CGAGGACACGACCTTCCTGCC	0.612																																																0			19											147.0	105.0	119.0					19																	2799759		2203	4300	6503	2750759	SO:0001583	missense	7064				CCDS12095.1	19p13.3	2008-02-05				ENSG00000172009	3.4.24.15		11793	protein-coding gene	gene with protein product		601117				9790774	Standard	NM_003249		Approved		uc002lwj.3	P52888		ENST00000307741.6:c.559A>C	19.37:g.2799759A>C	ENSP00000304467:p.Thr187Pro		2750759	B3KSE2|Q9UCB3	Missense_Mutation	SNP	ENST00000307741.6	37	CCDS12095.1	SNP	10	Broad	.	.	.	.	.	.	.	.	.	.	A	21.6	4.169986	0.78452	.	.	ENSG00000172009	ENST00000307741	T	0.08193	3.12	4.32	4.32	0.51571	Neurolysin/Thimet oligopeptidase, domain 2 (1);	0.108734	0.64402	D	0.000009	T	0.25754	0.0627	M	0.81802	2.56	0.80722	D	1	D;D	0.60160	0.985;0.987	P;P	0.60415	0.874;0.811	T	0.02581	-1.1138	10	0.66056	D	0.02	-57.7052	12.3274	0.55020	1.0:0.0:0.0:0.0	.	66;187	B4DU96;P52888	.;THOP1_HUMAN	P	187	ENSP00000304467:T187P	ENSP00000304467:T187P	T	+	1	0	THOP1	2750759	1.000000	0.71417	0.979000	0.43373	0.798000	0.45092	8.678000	0.91211	1.595000	0.50050	0.454000	0.30748	ACC		0.612	THOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451587.2			Missense_Mutation
MYT1L	23040	broad.mit.edu	37	2	1906916	1906916	+	Silent	SNP	A	A	G	rs527880727		TCGA-61-2110-01	TCGA-61-2110-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2110-01	TCGA-61-2110-11	g.chr2:1906916A>G	ENST00000399161.2	-	14	2715	c.1968T>C	c.(1966-1968)taT>taC	p.Y656Y	MYT1L_ENST00000428368.2_Silent_p.Y654Y	NM_015025.2	NP_055840.2	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	656					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.Y656Y(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(16)|lung(50)|ovary(5)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	97	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		CTCGCTTGCCATAAGTATGGT	0.483													A|||	1	0.000199681	0.0	0.0014	5008	,	,		17800	0.0		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	2											144.0	137.0	139.0					2																	1906916		1928	4128	6056	1885923	SO:0001819	synonymous_variant	23040			AF036943	CCDS46222.1	2p25.3	2013-01-10			ENSG00000186487	ENSG00000186487		"""Zinc fingers, C2HC-type containing"""	7623	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 1"""	613084				9373037	Standard	XM_006711862		Approved	KIAA1106, NZF1, ZC2HC4B	uc002qxd.3	Q9UL68	OTTHUMG00000151407	ENST00000399161.2:c.1968T>C	2.37:g.1906916A>G			1885923	A7E2C7|B2RP54|Q6IQ17|Q9UPP6	Silent	SNP	ENST00000399161.2	37		SNP	8	Broad																																																																																				0.483	MYT1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000322493.1	NM_015025		Silent
SOWAHC	65124	broad.mit.edu	37	2	110372940	110372940	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2110-01	TCGA-61-2110-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2110-01	TCGA-61-2110-11	g.chr2:110372940G>A	ENST00000356454.3	+	1	1030	c.874G>A	c.(874-876)Ggc>Agc	p.G292S	SEPT10_ENST00000545389.1_5'Flank|SEPT10_ENST00000334001.6_5'Flank|SEPT10_ENST00000356688.4_5'Flank|SEPT10_ENST00000415095.1_5'Flank|SEPT10_ENST00000437928.1_5'Flank|SEPT10_ENST00000397714.2_5'Flank|SEPT10_ENST00000397712.2_5'Flank	NM_023016.3	NP_075392.2	Q53LP3	SWAHC_HUMAN	sosondowah ankyrin repeat domain family member C	292								p.G292S(1)									CTGCGAGCCCGGCCTGCTGGT	0.657																																																1	Substitution - Missense(1)	ovary(1)	2											16.0	17.0	17.0					2																	110372940		2185	4266	6451	109730229	SO:0001583	missense	65124			AK023346	CCDS33270.1	2q13	2013-01-10	2012-01-12	2012-01-12	ENSG00000198142	ENSG00000198142		"""Ankyrin repeat domain containing"""	26149	protein-coding gene	gene with protein product			"""ankyrin repeat domain 57"""	C2orf26, ANKRD57		22234889	Standard	NM_023016		Approved	FLJ21870	uc002tfb.3	Q53LP3	OTTHUMG00000153219	ENST00000356454.3:c.874G>A	2.37:g.110372940G>A	ENSP00000365830:p.Gly292Ser		109730229	Q8NE15|Q9H6U1	Missense_Mutation	SNP	ENST00000356454.3	37	CCDS33270.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	3.883	-0.025499	0.07589	.	.	ENSG00000198142	ENST00000356454	T	0.69685	-0.42	4.22	1.43	0.22495	Ankyrin repeat-containing domain (3);	0.297063	0.30686	N	0.009088	T	0.46927	0.1418	N	0.25201	0.72	0.09310	N	1	B	0.22800	0.075	B	0.20767	0.031	T	0.27872	-1.0061	10	0.30078	T	0.28	-12.4066	8.5009	0.33156	0.3254:0.0:0.6746:0.0	.	292	Q53LP3	ANR57_HUMAN	S	292	ENSP00000365830:G292S	ENSP00000365830:G292S	G	+	1	0	ANKRD57	109730229	0.000000	0.05858	0.678000	0.29963	0.163000	0.22366	-0.012000	0.12699	0.172000	0.19760	-0.137000	0.14449	GGC		0.657	SOWAHC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330168.1	NM_023016		Missense_Mutation
TTN	7273	broad.mit.edu	37	2	179440618	179440618	+	Missense_Mutation	SNP	A	A	G			TCGA-61-2110-01	TCGA-61-2110-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2110-01	TCGA-61-2110-11	g.chr2:179440618A>G	ENST00000591111.1	-	276	65542	c.65318T>C	c.(65317-65319)gTc>gCc	p.V21773A	RP11-171I2.5_ENST00000604215.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000590807.1_RNA|RP11-171I2.2_ENST00000603521.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.V23414A|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.V20846A|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.V14349A|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.V14474A|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.V14541A|TTN-AS1_ENST00000591332.1_RNA			Q8WZ42	TITIN_HUMAN	titin	21773	Ig-like 114.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AATGGTCATGACAAATTTACC	0.448																																																0			2											122.0	132.0	129.0					2																	179440618		1966	4163	6129	179148864	SO:0001583	missense	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.65318T>C	2.37:g.179440618A>G	ENSP00000465570:p.Val21773Ala		179148864	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		SNP	10	Broad	.	.	.	.	.	.	.	.	.	.	A	10.14	1.269510	0.23221	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.41758	0.99;0.99;0.99;0.99	5.76	4.57	0.56435	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.38214	0.1032	L	0.50993	1.605	0.26546	N	0.973993	B;B;B;B	0.09022	0.002;0.002;0.002;0.001	B;B;B;B	0.14578	0.011;0.011;0.011;0.007	T	0.36016	-0.9765	9	0.87932	D	0	.	9.1834	0.37156	0.8584:0.0:0.1416:0.0	.	14349;14474;14541;21773	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	A	20846;14349;14541;14474;14347	ENSP00000343764:V20846A;ENSP00000434586:V14349A;ENSP00000340554:V14541A;ENSP00000352154:V14474A	ENSP00000340554:V14541A	V	-	2	0	TTN	179148864	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	4.336000	0.59304	0.977000	0.38444	0.533000	0.62120	GTC		0.448	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		Missense_Mutation
FAM124B	79843	broad.mit.edu	37	2	225266122	225266122	+	Nonsense_Mutation	SNP	G	G	A			TCGA-61-2110-01	TCGA-61-2110-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2110-01	TCGA-61-2110-11	g.chr2:225266122G>A	ENST00000409685.3	-	1	629	c.364C>T	c.(364-366)Cag>Tag	p.Q122*	FAM124B_ENST00000243806.2_Nonsense_Mutation_p.Q122*|FAM124B_ENST00000389874.3_Nonsense_Mutation_p.Q122*	NM_001122779.1	NP_001116251.1	Q9H5Z6	F124B_HUMAN	family with sequence similarity 124B	122								p.Q122*(1)		endometrium(2)|large_intestine(2)|lung(7)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	16		Renal(207;0.0112)|all_lung(227;0.0126)|Lung NSC(271;0.0161)|all_hematologic(139;0.138)		Epithelial(121;4.4e-10)|all cancers(144;2.02e-07)|Lung(261;0.00766)|LUSC - Lung squamous cell carcinoma(224;0.00825)		ATGGGCAGCTGACTGTCCAGG	0.562																																																1	Substitution - Nonsense(1)	ovary(1)	2											54.0	52.0	53.0					2																	225266122		2203	4300	6503	224974366	SO:0001587	stop_gained	79843			AK075126	CCDS2461.1, CCDS46527.1	2q36.2	2008-02-05			ENSG00000124019	ENSG00000124019			26224	protein-coding gene	gene with protein product						12477932	Standard	NM_001122779		Approved	FLJ22746	uc002vnx.3	Q9H5Z6	OTTHUMG00000133168	ENST00000409685.3:c.364C>T	2.37:g.225266122G>A	ENSP00000386895:p.Gln122*		224974366	A6NNC7|Q8NBZ4|Q8TAV7	Nonsense_Mutation	SNP	ENST00000409685.3	37	CCDS46527.1	SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	G	39	7.645591	0.98409	.	.	ENSG00000124019	ENST00000389874;ENST00000409685;ENST00000243806	.	.	.	5.79	4.9	0.64082	.	0.348682	0.34555	N	0.003861	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.36615	T	0.2	-14.2537	16.8416	0.85971	0.0:0.1286:0.8714:0.0	.	.	.	.	X	122	.	ENSP00000243806:Q122X	Q	-	1	0	FAM124B	224974366	1.000000	0.71417	0.923000	0.36655	0.971000	0.66376	4.565000	0.60836	1.426000	0.47256	0.655000	0.94253	CAG		0.562	FAM124B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330873.1	NM_024785		Nonsense_Mutation
PER2	8864	broad.mit.edu	37	2	239169529	239169529	+	Silent	SNP	A	A	C			TCGA-61-2110-01	TCGA-61-2110-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2110-01	TCGA-61-2110-11	g.chr2:239169529A>C	ENST00000254657.3	-	13	1761	c.1482T>G	c.(1480-1482)ctT>ctG	p.L494L	PER2_ENST00000254658.3_3'UTR	NM_022817.2	NP_073728.1	O15055	PER2_HUMAN	period circadian clock 2	494					circadian regulation of gene expression (GO:0032922)|circadian regulation of translation (GO:0097167)|circadian rhythm (GO:0007623)|fatty acid metabolic process (GO:0006631)|gluconeogenesis (GO:0006094)|glycogen biosynthetic process (GO:0005978)|histone H3 deacetylation (GO:0070932)|lactate biosynthetic process (GO:0019249)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of DNA-templated transcription, termination (GO:0060567)|negative regulation of fat cell proliferation (GO:0070345)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of cell cycle (GO:0051726)|regulation of circadian rhythm (GO:0042752)|regulation of glutamate uptake involved in transmission of nerve impulse (GO:0051946)|regulation of insulin secretion (GO:0050796)|regulation of neurogenesis (GO:0050767)|regulation of vasoconstriction (GO:0019229)|response to ischemia (GO:0002931)|transcription, DNA-templated (GO:0006351)|white fat cell differentiation (GO:0050872)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	pre-mRNA binding (GO:0036002)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding transcription factor activity (GO:0000989)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|ubiquitin binding (GO:0043130)			NS(1)|breast(5)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0423)|all_lung(227;0.114)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Lung NSC(271;0.223)|Hepatocellular(293;0.244)		Epithelial(121;6.84e-24)|OV - Ovarian serous cystadenocarcinoma(60;9.73e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;6.77e-05)|Lung(119;0.00941)|LUSC - Lung squamous cell carcinoma(224;0.0161)		TCTGGCTCATAAGGTGCTCGT	0.622																																																0			2											118.0	126.0	123.0					2																	239169529		2203	4300	6503	238834268	SO:0001819	synonymous_variant	8864			AB002345	CCDS2528.1	2q37.3	2012-12-13	2012-12-13		ENSG00000132326	ENSG00000132326			8846	protein-coding gene	gene with protein product		603426	"""period (Drosophila) homolog 2"", ""period homolog 2 (Drosophila)"""			9427249, 17218255	Standard	NM_022817		Approved	KIAA0347	uc002vyc.3	O15055	OTTHUMG00000152884	ENST00000254657.3:c.1482T>G	2.37:g.239169529A>C			238834268	A2I2P7|Q4ZG49|Q6DT41|Q9UQ45	Silent	SNP	ENST00000254657.3	37	CCDS2528.1	SNP	13	Broad																																																																																				0.622	PER2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257167.1	NM_022817		Silent
TLDC2	140711	broad.mit.edu	37	20	35507570	35507570	+	Silent	SNP	C	C	T			TCGA-61-2110-01	TCGA-61-2110-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2110-01	TCGA-61-2110-11	g.chr20:35507570C>T	ENST00000217320.3	+	3	360	c.316C>T	c.(316-318)Ctg>Ttg	p.L106L	TLDC2_ENST00000602922.1_Silent_p.L106L	NM_080628.1	NP_542195.1	A0PJX2	TLDC2_HUMAN	TBC/LysM-associated domain containing 2	106	TLD.							p.L106L(1)									GCCAGTGCTGCTGGTGCTCAG	0.687																																																1	Substitution - coding silent(1)	ovary(1)	20											38.0	34.0	35.0					20																	35507570		2203	4300	6503	34940984	SO:0001819	synonymous_variant	140711			AL079335	CCDS33465.1	20q11.23	2013-03-14	2013-03-14	2013-03-14	ENSG00000101342	ENSG00000101342			16112	protein-coding gene	gene with protein product	"""hypothetical protein LOC140711"", ""TLD domain containing 2"""		"""chromosome 20 open reading frame 118"""	C20orf118			Standard	NM_080628		Approved	dJ132F21.2	uc002xgg.1	A0PJX2	OTTHUMG00000032400	ENST00000217320.3:c.316C>T	20.37:g.35507570C>T			34940984	B3KVU8	Silent	SNP	ENST00000217320.3	37	CCDS33465.1	SNP	28	Broad																																																																																				0.687	TLDC2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079060.2	NM_080628		Silent
PREX1	57580	broad.mit.edu	37	20	47305234	47305234	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2110-01	TCGA-61-2110-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2110-01	TCGA-61-2110-11	g.chr20:47305234C>T	ENST00000371941.3	-	10	1317	c.1295G>A	c.(1294-1296)cGg>cAg	p.R432Q	PREX1_ENST00000396220.1_Missense_Mutation_p.R432Q	NM_020820.3	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1	432	DEP 1. {ECO:0000255|PROSITE- ProRule:PRU00066}.				actin filament polymerization (GO:0030041)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|neutrophil activation (GO:0042119)|neutrophil chemotaxis (GO:0030593)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of actin filament polymerization (GO:0030833)|regulation of dendrite development (GO:0050773)|superoxide metabolic process (GO:0006801)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.R432Q(1)		breast(3)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(27)|lung(53)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	110			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			CAGCTTTCTCCGGCGGTCCTT	0.562																																																1	Substitution - Missense(1)	ovary(1)	20											167.0	119.0	136.0					20																	47305234		2203	4300	6503	46738641	SO:0001583	missense	57580			AB037836	CCDS13410.1	20q13.13	2013-01-10	2008-09-15		ENSG00000124126	ENSG00000124126		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	32594	protein-coding gene	gene with protein product		606905				11955434, 15545267, 16301320	Standard	NM_020820		Approved	KIAA1415, P-REX1	uc002xtw.1	Q8TCU6	OTTHUMG00000032685	ENST00000371941.3:c.1295G>A	20.37:g.47305234C>T	ENSP00000361009:p.Arg432Gln		46738641	E1P5X9|Q5JS95|Q5JS96|Q69YL2|Q7Z2L9|Q9BQH0|Q9BX55|Q9H4Q6|Q9P2D2|Q9UGQ4	Missense_Mutation	SNP	ENST00000371941.3	37	CCDS13410.1	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	C	27.1	4.795891	0.90453	.	.	ENSG00000124126	ENST00000371941;ENST00000396220	T;T	0.28895	1.59;1.59	5.29	4.35	0.52113	DEP domain (3);Winged helix-turn-helix transcription repressor DNA-binding (1);	0.000000	0.56097	U	0.000034	T	0.45034	0.1322	M	0.75884	2.315	0.51767	D	0.999934	D	0.56287	0.975	P	0.50791	0.65	T	0.51934	-0.8642	10	0.72032	D	0.01	.	13.8488	0.63483	0.0:0.9265:0.0:0.0735	.	432	Q8TCU6	PREX1_HUMAN	Q	432	ENSP00000361009:R432Q;ENSP00000379522:R432Q	ENSP00000361009:R432Q	R	-	2	0	PREX1	46738641	0.965000	0.33210	0.619000	0.29118	0.996000	0.88848	3.822000	0.55708	1.229000	0.43630	0.563000	0.77884	CGG		0.562	PREX1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079623.1	NM_020820		Missense_Mutation
HIRA	7290	broad.mit.edu	37	22	19340961	19340961	+	Missense_Mutation	SNP	C	C	A			TCGA-61-2110-01	TCGA-61-2110-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2110-01	TCGA-61-2110-11	g.chr22:19340961C>A	ENST00000263208.5	-	23	3022	c.2766G>T	c.(2764-2766)caG>caT	p.Q922H	HIRA_ENST00000546308.1_3'UTR|HIRA_ENST00000340170.4_Missense_Mutation_p.Q715H|HIRA_ENST00000541063.1_Missense_Mutation_p.Q878H	NM_003325.3	NP_003316.3	P54198	HIRA_HUMAN	histone cell cycle regulator	922	Interaction with histone H4.				anatomical structure morphogenesis (GO:0009653)|chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|gastrulation (GO:0007369)|muscle cell differentiation (GO:0042692)|osteoblast differentiation (GO:0001649)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.Q922H(1)		autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(14)|ovary(2)|prostate(1)|skin(1)	37	Colorectal(54;0.0993)					CTGCTGCCACCTGGTTCTCTA	0.627																																																1	Substitution - Missense(1)	ovary(1)	22											79.0	55.0	63.0					22																	19340961		2203	4300	6503	17720961	SO:0001583	missense	7290			X75296	CCDS13759.1	22q11.2	2013-05-03	2013-05-03		ENSG00000100084	ENSG00000100084		"""WD repeat domain containing"""	4916	protein-coding gene	gene with protein product	"""DiGeorge critical region gene 1"""	600237	"""HIR (histone cell cycle regulation defective) homolog A (S. cerevisiae)"", ""HIR histone cell cycle regulation defective homolog A (S. cerevisiae)"""	TUPLE1		8111380, 7633437, 9731536	Standard	NM_003325		Approved	DGCR1, TUP1	uc002zpf.1	P54198	OTTHUMG00000150134	ENST00000263208.5:c.2766G>T	22.37:g.19340961C>A	ENSP00000263208:p.Gln922His		17720961	Q05BU9|Q8IXN2	Missense_Mutation	SNP	ENST00000263208.5	37	CCDS13759.1	SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	C	29.1	4.979490	0.92982	.	.	ENSG00000100084	ENST00000340170;ENST00000263208;ENST00000541063;ENST00000539600	T;T;T	0.74315	-0.65;-0.83;-0.68	5.11	5.11	0.69529	TUP1-like enhancer of split (1);	0.061444	0.64402	D	0.000002	D	0.87188	0.6115	M	0.81341	2.54	0.80722	D	1	D;D;D	0.76494	0.999;0.994;0.998	D;D;D	0.85130	0.997;0.991;0.996	D	0.88183	0.2872	10	0.62326	D	0.03	-16.163	18.7208	0.91692	0.0:1.0:0.0:0.0	.	878;715;922	F5H4M2;P54198-2;P54198	.;.;HIRA_HUMAN	H	715;922;878;431	ENSP00000345350:Q715H;ENSP00000263208:Q922H;ENSP00000446073:Q878H	ENSP00000263208:Q922H	Q	-	3	2	HIRA	17720961	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	5.390000	0.66261	2.659000	0.90383	0.563000	0.77884	CAG		0.627	HIRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316488.2	NM_003325		Missense_Mutation
TTLL12	23170	broad.mit.edu	37	22	43570517	43570517	+	Missense_Mutation	SNP	A	A	C			TCGA-61-2110-01	TCGA-61-2110-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2110-01	TCGA-61-2110-11	g.chr22:43570517A>C	ENST00000216129.6	-	7	1085	c.1022T>G	c.(1021-1023)tTc>tGc	p.F341C	TTLL12_ENST00000484118.1_5'UTR|TTLL12_ENST00000494035.1_5'Flank	NM_015140.3	NP_055955.1	Q14166	TTL12_HUMAN	tubulin tyrosine ligase-like family, member 12	341	TTL. {ECO:0000255|PROSITE- ProRule:PRU00568}.				cellular protein modification process (GO:0006464)			p.F341C(1)		central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(1)	13		Ovarian(80;0.221)|Glioma(61;0.222)				GTAGTCCTTGAAGTGTGAGAA	0.662																																																1	Substitution - Missense(1)	ovary(1)	22											96.0	96.0	96.0					22																	43570517		2203	4300	6503	41900461	SO:0001583	missense	23170			D63487	CCDS14047.1	22q13.31	2013-02-14	2006-02-02		ENSG00000100304	ENSG00000100304		"""Tubulin tyrosine ligase-like family"""	28974	protein-coding gene	gene with protein product						15890843	Standard	NM_015140		Approved	KIAA0153	uc003bdp.3	Q14166	OTTHUMG00000150682	ENST00000216129.6:c.1022T>G	22.37:g.43570517A>C	ENSP00000216129:p.Phe341Cys		41900461	Q20WK5|Q9UGU3	Missense_Mutation	SNP	ENST00000216129.6	37	CCDS14047.1	SNP	9	Broad	.	.	.	.	.	.	.	.	.	.	A	19.59	3.856753	0.71834	.	.	ENSG00000100304	ENST00000216129;ENST00000423379	T	0.08720	3.06	5.09	5.09	0.68999	.	0.169650	0.52532	D	0.000070	T	0.27866	0.0686	M	0.80332	2.49	0.58432	D	0.999992	D;D	0.67145	0.996;0.996	P;P	0.60886	0.88;0.88	T	0.04413	-1.0953	10	0.72032	D	0.01	-10.7894	14.8504	0.70292	1.0:0.0:0.0:0.0	.	341;341	B1AH89;Q14166	.;TTL12_HUMAN	C	341	ENSP00000216129:F341C	ENSP00000216129:F341C	F	-	2	0	TTLL12	41900461	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	6.140000	0.71738	1.904000	0.55121	0.533000	0.62120	TTC		0.662	TTLL12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319611.1	NM_015140		Missense_Mutation
SNRK	54861	broad.mit.edu	37	3	43389239	43389239	+	Silent	SNP	C	C	T	rs2036617	byFrequency	TCGA-61-2110-01	TCGA-61-2110-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2110-01	TCGA-61-2110-11	g.chr3:43389239C>T	ENST00000296088.7	+	7	1792	c.1488C>T	c.(1486-1488)gaC>gaT	p.D496D	SNRK_ENST00000437827.1_Silent_p.D290D|SNRK-AS1_ENST00000422681.1_RNA|SNRK_ENST00000429705.2_Silent_p.D496D|SNRK_ENST00000454177.1_Silent_p.D496D|RP11-188P20.3_ENST00000607513.1_RNA	NM_017719.4	NP_060189.3			SNF related kinase									p.D496D(1)		breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|liver(2)|lung(3)|ovary(5)|prostate(1)|skin(2)|stomach(1)	27				KIRC - Kidney renal clear cell carcinoma(284;0.0636)|Kidney(284;0.0792)		GGGAATCTGACGATGAGTTTG	0.507													T|||	130	0.0259585	0.0915	0.013	5008	,	,		20155	0.0		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	3						T	,	322,3734		22,278,1728	112.0	119.0	117.0		1488,1488	-3.3	0.2	3	dbSNP_94	117	8,8356		0,8,4174	no	coding-synonymous,coding-synonymous	SNRK	NM_001100594.1,NM_017719.4	,	22,286,5902	TT,TC,CC		0.0956,7.9389,2.657	,	496/766,496/766	43389239	330,12090	2028	4182	6210	43364243	SO:0001819	synonymous_variant	54861			D43636	CCDS43075.1	3p22.1	2005-08-09			ENSG00000163788	ENSG00000163788			30598	protein-coding gene	gene with protein product		612760				8654423, 7788527	Standard	NM_017719		Approved	FLJ20224, HSNFRK, KIAA0096	uc003cmt.4	Q9NRH2	OTTHUMG00000156491	ENST00000296088.7:c.1488C>T	3.37:g.43389239C>T			43364243		Silent	SNP	ENST00000296088.7	37	CCDS43075.1	SNP	19	Broad																																																																																				0.507	SNRK-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344325.1	NM_017719		Silent
MON1A	84315	broad.mit.edu	37	3	49949408	49949408	+	Missense_Mutation	SNP	C	C	T	rs370838633		TCGA-61-2110-01	TCGA-61-2110-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2110-01	TCGA-61-2110-11	g.chr3:49949408C>T	ENST00000417270.1	-	4	881	c.188G>A	c.(187-189)cGt>cAt	p.R63H	MON1A_ENST00000296473.3_Missense_Mutation_p.R152H|MON1A_ENST00000483022.1_5'UTR|CTD-2330K9.3_ENST00000419183.1_Intron|MON1A_ENST00000455683.2_Intron			Q86VX9	MON1A_HUMAN	MON1 secretory trafficking family member A	55								p.R55H(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(2)|prostate(1)	13				BRCA - Breast invasive adenocarcinoma(193;4.62e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00551)|Kidney(197;0.00621)		CTCGTAGGAACGGGCATGGAC	0.627																																																1	Substitution - Missense(1)	ovary(1)	3											48.0	49.0	49.0					3																	49949408		2203	4300	6503	49924412	SO:0001583	missense	84315			AK074404	CCDS2808.2, CCDS46830.1	3p21.31	2013-08-21	2013-08-21		ENSG00000164077	ENSG00000164077			28207	protein-coding gene	gene with protein product		611464	"""MON1 homolog A (yeast)"""			12477932	Standard	NM_032355		Approved	MGC13272, SAND1	uc003cxz.3	Q86VX9	OTTHUMG00000156737	ENST00000417270.1:c.188G>A	3.37:g.49949408C>T	ENSP00000399613:p.Arg63His		49924412	B2RDQ1|G5E9N1|Q8NAV7|Q9BRF3	Missense_Mutation	SNP	ENST00000417270.1	37		SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	13.91	2.378855	0.42207	.	.	ENSG00000164077	ENST00000296473;ENST00000417270	.	.	.	5.0	3.22	0.36961	.	0.300830	0.40144	N	0.001173	T	0.31979	0.0814	L	0.34521	1.04	0.30256	N	0.793598	B	0.13145	0.007	B	0.06405	0.002	T	0.21042	-1.0257	8	.	.	.	-0.9152	7.9292	0.29893	0.0:0.6847:0.0:0.3153	.	55	Q86VX9	MON1A_HUMAN	H	152;63	.	.	R	-	2	0	MON1A	49924412	0.997000	0.39634	1.000000	0.80357	0.989000	0.77384	1.343000	0.33930	0.524000	0.28502	-0.254000	0.11334	CGT		0.627	MON1A-005	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000345538.2	NM_032355		Missense_Mutation
SUCNR1	56670	broad.mit.edu	37	3	151599309	151599309	+	Missense_Mutation	SNP	A	A	T			TCGA-61-2110-01	TCGA-61-2110-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2110-01	TCGA-61-2110-11	g.chr3:151599309A>T	ENST00000362032.5	+	3	1083	c.978A>T	c.(976-978)gaA>gaT	p.E326D	RP11-454C18.2_ENST00000475855.1_RNA|RP11-454C18.2_ENST00000483843.2_RNA	NM_033050.4	NP_149039.2	Q9BXA5	SUCR1_HUMAN	succinate receptor 1	326						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.E326D(1)		endometrium(2)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	14			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0813)		Succinic acid(DB00139)	GGGCTCATGAACTCCTACTTT	0.403																																																1	Substitution - Missense(1)	ovary(1)	3											69.0	70.0	70.0					3																	151599309		2203	4300	6503	153081999	SO:0001583	missense	56670			AF348078	CCDS3162.1	3q25.1	2012-08-21	2004-07-08	2004-07-09	ENSG00000198829	ENSG00000198829		"""GPCR / Class A : Orphans"""	4542	protein-coding gene	gene with protein product		606381	"""G protein-coupled receptor 91"""	GPR91		11273702, 15141213, 17192395	Standard	NM_033050		Approved		uc003ezf.2	Q9BXA5	OTTHUMG00000159880	ENST00000362032.5:c.978A>T	3.37:g.151599309A>T	ENSP00000355156:p.Glu326Asp		153081999	A8K305|Q8TDQ8	Missense_Mutation	SNP	ENST00000362032.5	37	CCDS3162.1	SNP	2	Broad	.	.	.	.	.	.	.	.	.	.	A	7.852	0.724127	0.15439	.	.	ENSG00000198829	ENST00000362032	T	0.61040	0.14	4.41	0.47	0.16747	.	4.714200	0.01554	U	0.019799	T	0.34193	0.0889	N	0.08118	0	0.09310	N	1	B	0.19817	0.039	B	0.12156	0.007	T	0.16247	-1.0409	10	0.12430	T	0.62	.	4.9038	0.13788	0.7022:0.0:0.1611:0.1367	.	326	Q9BXA5	SUCR1_HUMAN	D	326	ENSP00000355156:E326D	ENSP00000355156:E326D	E	+	3	2	SUCNR1	153081999	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.369000	0.20416	0.002000	0.14630	-0.361000	0.07541	GAA		0.403	SUCNR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357897.2	NM_033050		Missense_Mutation
HSD17B11	51170	broad.mit.edu	37	4	88261739	88261739	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2110-01	TCGA-61-2110-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2110-01	TCGA-61-2110-11	g.chr4:88261739G>A	ENST00000358290.4	-	6	1030	c.715C>T	c.(715-717)Cct>Tct	p.P239S	RP11-529H2.2_ENST00000508163.1_RNA|HSD17B11_ENST00000507286.1_Missense_Mutation_p.P195S|HSD17B11_ENST00000507518.1_5'UTR	NM_016245.3	NP_057329.2	Q8NBQ5	DHB11_HUMAN	hydroxysteroid (17-beta) dehydrogenase 11	239					androgen catabolic process (GO:0006710)|steroid biosynthetic process (GO:0006694)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|lipid particle (GO:0005811)	estradiol 17-beta-dehydrogenase activity (GO:0004303)|steroid dehydrogenase activity (GO:0016229)	p.P239S(1)		cervix(1)|endometrium(4)|kidney(2)|lung(2)|ovary(2)	11		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.000339)		ACTTCCTCAGGTTCCAGAGTG	0.408																																																1	Substitution - Missense(1)	ovary(1)	4											88.0	90.0	89.0					4																	88261739		2203	4300	6503	88480763	SO:0001583	missense	51170			AF126780	CCDS3619.1	4q22.1	2011-09-20	2006-11-22	2006-11-22	ENSG00000198189	ENSG00000198189	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	22960	protein-coding gene	gene with protein product	"""retinal short-chain dehydrogenase/reductase 2"", ""short chain dehydrogenase/reductase family 16C, member 2"""	612831	"""dehydrogenase/reductase (SDR family) member 8"""	DHRS8		11165019, 12697717, 19027726	Standard	XM_006714232		Approved	RetSDR2, 17-BETA-HSD11, 17-BETA-HSDXI, PAN1B, SDR16C2	uc003hqp.2	Q8NBQ5	OTTHUMG00000130594	ENST00000358290.4:c.715C>T	4.37:g.88261739G>A	ENSP00000351035:p.Pro239Ser		88480763	Q96HF6|Q9UKU4	Missense_Mutation	SNP	ENST00000358290.4	37	CCDS3619.1	SNP	44	Broad	.	.	.	.	.	.	.	.	.	.	G	11.94	1.788461	0.31685	.	.	ENSG00000198189	ENST00000358290;ENST00000507286	D;T	0.92299	-3.01;0.26	5.64	5.64	0.86602	NAD(P)-binding domain (1);	0.157960	0.44097	D	0.000489	D	0.93543	0.7939	M	0.88570	2.965	0.47659	D	0.99948	P	0.37176	0.586	B	0.38194	0.267	D	0.93794	0.7095	10	0.54805	T	0.06	.	16.6324	0.85037	0.0:0.0:1.0:0.0	.	239	Q8NBQ5	DHB11_HUMAN	S	239;195	ENSP00000351035:P239S;ENSP00000423775:P195S	ENSP00000351035:P239S	P	-	1	0	HSD17B11	88480763	1.000000	0.71417	1.000000	0.80357	0.061000	0.15899	2.517000	0.45529	2.658000	0.90341	0.655000	0.94253	CCT		0.408	HSD17B11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253041.1	NM_016245		Missense_Mutation
EXOC3	11336	broad.mit.edu	37	5	454157	454157	+	Missense_Mutation	SNP	C	C	A			TCGA-61-2110-01	TCGA-61-2110-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2110-01	TCGA-61-2110-11	g.chr5:454157C>A	ENST00000512944.1	+	4	1226	c.1037C>A	c.(1036-1038)aCc>aAc	p.T346N	EXOC3_ENST00000315013.5_Missense_Mutation_p.T346N	NM_007277.4	NP_009208.2	O60645	EXOC3_HUMAN	exocyst complex component 3	357					cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|membrane organization (GO:0061024)|protein transport (GO:0015031)	exocyst (GO:0000145)|secretory granule membrane (GO:0030667)		p.T346N(1)		breast(2)|cervix(1)|endometrium(4)|large_intestine(1)|lung(13)|ovary(1)|urinary_tract(1)	23		Ovarian(839;0.0563)	Epithelial(17;0.000529)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|all cancers(22;0.00186)|Lung(60;0.0863)			GTCTTAAACACCTACACAAGG	0.572																																																1	Substitution - Missense(1)	ovary(1)	5											17.0	17.0	17.0					5																	454157		2014	4168	6182	507157	SO:0001583	missense	11336			BC034427	CCDS54830.1	5p15.33	2013-01-22	2005-11-01	2005-11-01	ENSG00000180104	ENSG00000180104			30378	protein-coding gene	gene with protein product		608186	"""SEC6-like 1 (S. cerevisiae)"""	SEC6L1		8619474	Standard	XM_005248238		Approved	Sec6p	uc003jba.3	O60645	OTTHUMG00000162205	ENST00000512944.1:c.1037C>A	5.37:g.454157C>A	ENSP00000425587:p.Thr346Asn		507157	Q6P2E8|Q8TEN6|Q8WUW0|Q96DI4	Missense_Mutation	SNP	ENST00000512944.1	37	CCDS54830.1	SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	16.41	3.114156	0.56398	.	.	ENSG00000180104	ENST00000512944;ENST00000315013;ENST00000340158	T;T	0.06608	3.28;3.28	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	T	0.26882	0.0658	M	0.77103	2.36	0.80722	D	1	D	0.71674	0.998	D	0.79108	0.992	T	0.00121	-1.2028	10	0.41790	T	0.15	-39.0971	17.553	0.87881	0.0:1.0:0.0:0.0	.	357	O60645	EXOC3_HUMAN	N	346;346;356	ENSP00000425587:T346N;ENSP00000323377:T346N	ENSP00000323377:T346N	T	+	2	0	EXOC3	507157	1.000000	0.71417	0.973000	0.42090	0.012000	0.07955	7.333000	0.79214	2.747000	0.94245	0.462000	0.41574	ACC		0.572	EXOC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367882.1	NM_007277		Missense_Mutation
C7	730	broad.mit.edu	37	5	40976882	40976882	+	Missense_Mutation	SNP	G	G	A	rs201976045		TCGA-61-2110-01	TCGA-61-2110-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2110-01	TCGA-61-2110-11	g.chr5:40976882G>A	ENST00000313164.9	+	16	2464	c.2105G>A	c.(2104-2106)tGt>tAt	p.C702Y	C7_ENST00000494960.1_3'UTR	NM_000587.2	NP_000578.2	P10643	CO7_HUMAN	complement component 7	702	Factor I module (FIM) 1.				cellular sodium ion homeostasis (GO:0006883)|complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)		p.C702Y(1)					Ovarian(839;0.0112)				GTGCCTAAATGTCAGCGCTGG	0.393																																																1	Substitution - Missense(1)	ovary(1)	5						G	TYR/CYS	0,3928		0,0,1964	85.0	88.0	87.0		2105	4.9	1.0	5		87	2,8300		0,2,4149	no	missense	C7	NM_000587.2	194	0,2,6113	AA,AG,GG		0.0241,0.0,0.0164	probably-damaging	702/844	40976882	2,12228	1964	4151	6115	41012639	SO:0001583	missense	730			J03507	CCDS47201.1	5p13.1	2014-09-17			ENSG00000112936	ENSG00000112936		"""Complement system"""	1346	protein-coding gene	gene with protein product		217070					Standard	NM_000587		Approved		uc003jmh.3	P10643	OTTHUMG00000150340	ENST00000313164.9:c.2105G>A	5.37:g.40976882G>A	ENSP00000322061:p.Cys702Tyr		41012639	Q6P3T5|Q92489	Missense_Mutation	SNP	ENST00000313164.9	37	CCDS47201.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	21.5	4.164934	0.78339	0.0	2.41E-4	ENSG00000112936	ENST00000313164	T	0.66995	-0.24	4.88	4.88	0.63580	Factor I / membrane attack complex (1);	0.000000	0.85682	D	0.000000	D	0.84356	0.5454	M	0.86953	2.85	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.87347	0.2335	10	0.87932	D	0	-18.1741	17.822	0.88653	0.0:0.0:1.0:0.0	.	702	P10643	CO7_HUMAN	Y	702	ENSP00000322061:C702Y	ENSP00000322061:C702Y	C	+	2	0	C7	41012639	1.000000	0.71417	0.996000	0.52242	0.925000	0.55904	4.659000	0.61504	2.531000	0.85337	0.591000	0.81541	TGT		0.393	C7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317680.1			Missense_Mutation
PCDHA4	56144	broad.mit.edu	37	5	140188264	140188264	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2110-01	TCGA-61-2110-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2110-01	TCGA-61-2110-11	g.chr5:140188264C>T	ENST00000530339.1	+	1	1492	c.1492C>T	c.(1492-1494)Cgg>Tgg	p.R498W	PCDHA4_ENST00000512229.2_Missense_Mutation_p.R498W|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA4_ENST00000356878.4_Missense_Mutation_p.R498W|PCDHA1_ENST00000394633.3_Intron|PCDHA3_ENST00000522353.2_Intron	NM_018907.2	NP_061730.1	Q9UN74	PCDA4_HUMAN	protocadherin alpha 4	498	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.R498W(1)		breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(6)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGTAGAGCGGCGGGTAGGGGA	0.662																																																1	Substitution - Missense(1)	ovary(1)	5											55.0	59.0	58.0					5																	140188264		2202	4300	6502	140168448	SO:0001583	missense	56144			AF152482	CCDS54916.1	5q31	2010-11-26				ENSG00000204967		"""Cadherins / Protocadherins : Clustered"""	8670	other	complex locus constituent	"""ortholog of mouse CNR1, KIAA0345-like 10"""	606310				10380929, 10662547	Standard	NM_018907		Approved	CNR1, CRNR1, PCDH-ALPHA4, CNRN1		Q9UN74		ENST00000530339.1:c.1492C>T	5.37:g.140188264C>T	ENSP00000435300:p.Arg498Trp		140168448	O75285|Q2M253	Missense_Mutation	SNP	ENST00000530339.1	37	CCDS54916.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	c	11.05	1.526057	0.27299	.	.	ENSG00000204967	ENST00000512229;ENST00000356878;ENST00000530339	T;T;T	0.52526	0.66;0.66;0.66	4.18	3.29	0.37713	Cadherin (4);Cadherin-like (1);	0.279853	0.19043	U	0.124233	T	0.35219	0.0924	L	0.39898	1.24	0.23243	N	0.998052	P;B;P	0.40250	0.709;0.282;0.639	B;B;B	0.37047	0.236;0.24;0.149	T	0.23013	-1.0200	10	0.62326	D	0.03	.	7.3112	0.26475	0.1683:0.7435:0.0:0.0882	.	498;498;498	Q9UN74-2;Q9UN74;D6RA20	.;PCDA4_HUMAN;.	W	498	ENSP00000423470:R498W;ENSP00000349344:R498W;ENSP00000435300:R498W	ENSP00000349344:R498W	R	+	1	2	PCDHA4	140168448	0.000000	0.05858	1.000000	0.80357	0.410000	0.31052	-0.461000	0.06712	0.871000	0.35750	0.580000	0.79431	CGG		0.662	PCDHA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372864.2	NM_018907		Missense_Mutation
GRM6	2916	broad.mit.edu	37	5	178413884	178413884	+	Silent	SNP	G	G	A	rs149519053		TCGA-61-2110-01	TCGA-61-2110-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2110-01	TCGA-61-2110-11	g.chr5:178413884G>A	ENST00000517717.1	-	8	1493	c.1455C>T	c.(1453-1455)ggC>ggT	p.G485G	RP11-281O15.4_ENST00000519491.1_RNA|GRM6_ENST00000231188.5_Silent_p.G485G			O15303	GRM6_HUMAN	glutamate receptor, metabotropic 6	485					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|detection of light stimulus involved in visual perception (GO:0050908)|detection of visible light (GO:0009584)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|locomotory behavior (GO:0007626)|positive regulation of calcium ion import (GO:0090280)|regulation of synaptic transmission, glutamatergic (GO:0051966)|retina development in camera-type eye (GO:0060041)|synaptic transmission (GO:0007268)	cell projection (GO:0042995)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|new growing cell tip (GO:0035841)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)|protein homodimerization activity (GO:0042803)	p.G485G(1)		NS(2)|breast(4)|endometrium(9)|large_intestine(12)|lung(21)|ovary(2)|pancreas(1)|prostate(3)|urinary_tract(1)	55	all_cancers(89;0.000828)|Renal(175;0.000159)|all_epithelial(37;0.000167)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	all_cancers(40;0.0156)|all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.245)		CCTGGTACCCGCCACTGCTGG	0.647													G|||	1	0.000199681	0.0008	0.0	5008	,	,		17044	0.0		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	5						G		0,4406		0,0,2203	68.0	56.0	60.0		1455	-2.6	1.0	5	dbSNP_134	60	2,8598	2.2+/-6.3	0,2,4298	yes	coding-synonymous	GRM6	NM_000843.3		0,2,6501	AA,AG,GG		0.0233,0.0,0.0154		485/878	178413884	2,13004	2203	4300	6503	178346490	SO:0001819	synonymous_variant	2916			U82083	CCDS4442.1	5q35	2014-01-28						"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4598	protein-coding gene	gene with protein product		604096				9215706	Standard	NM_000843		Approved	GPRC1F, mGlu6, MGLUR6, CSNB1B	uc003mjr.3	O15303	OTTHUMG00000130889	ENST00000517717.1:c.1455C>T	5.37:g.178413884G>A			178346490		Silent	SNP	ENST00000517717.1	37	CCDS4442.1	SNP	38	Broad																																																																																				0.647	GRM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253474.2			Silent
SLC44A4	80736	broad.mit.edu	37	6	31831460	31831460	+	Missense_Mutation	SNP	T	T	C			TCGA-61-2110-01	TCGA-61-2110-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2110-01	TCGA-61-2110-11	g.chr6:31831460T>C	ENST00000229729.6	-	21	2097	c.2077A>G	c.(2077-2079)Aag>Gag	p.K693E	SLC44A4_ENST00000375562.4_Missense_Mutation_p.K651E|SLC44A4_ENST00000544672.1_Missense_Mutation_p.K617E|NEU1_ENST00000375631.4_5'Flank	NM_025257.2	NP_079533.2	Q53GD3	CTL4_HUMAN	solute carrier family 44, member 4	693					acetylcholine biosynthetic process (GO:0008292)|acetylcholine secretion (GO:0061526)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|positive regulation of cell growth (GO:0030307)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.K693E(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|prostate(3)|skin(1)|urinary_tract(2)	35					Choline(DB00122)	CCCAGAATCTTTAGAAGGCTC	0.607																																																1	Substitution - Missense(1)	ovary(1)	6											60.0	58.0	58.0					6																	31831460		1511	2709	4220	31939439	SO:0001583	missense	80736			AF134726	CCDS4724.2, CCDS54989.1, CCDS54990.1	6p21.3	2014-02-17	2005-09-06	2005-09-06	ENSG00000204385	ENSG00000204385		"""Solute carriers"""	13941	protein-coding gene	gene with protein product		606107	"""chromosome 6 open reading frame 29"""	C6orf29		10677542, 15715662, 24379411	Standard	NM_025257		Approved	NG22, CTL4, FLJ14491, TPPT	uc010jti.3	Q53GD3	OTTHUMG00000031133	ENST00000229729.6:c.2077A>G	6.37:g.31831460T>C	ENSP00000229729:p.Lys693Glu		31939439	A2BED3|B0UXX8|B0UZY8|B4DU94|B4DWM2|E9PEK7|Q5JP84|Q5JQ93|Q658S8|Q6UX89|Q8TEW4|Q96C58|Q96K59|Q9Y332	Missense_Mutation	SNP	ENST00000229729.6	37	CCDS4724.2	SNP	64	Broad	.	.	.	.	.	.	.	.	.	.	T	15.39	2.818159	0.50633	.	.	ENSG00000204385	ENST00000229729;ENST00000375562;ENST00000544672	T;T;T	0.12039	3.08;2.72;2.9	5.43	1.42	0.22433	.	0.527191	0.20385	N	0.093375	T	0.05547	0.0146	M	0.66439	2.03	0.47737	D	0.999506	B	0.12630	0.006	B	0.22753	0.041	T	0.15867	-1.0422	10	0.18710	T	0.47	-3.9846	8.5479	0.33433	0.116:0.0:0.4667:0.4173	.	693	Q53GD3	CTL4_HUMAN	E	693;651;617	ENSP00000229729:K693E;ENSP00000364712:K651E;ENSP00000444109:K617E	ENSP00000229729:K693E	K	-	1	0	SLC44A4	31939439	0.990000	0.36364	0.978000	0.43139	0.893000	0.52053	1.359000	0.34113	0.137000	0.18759	0.533000	0.62120	AAG		0.607	SLC44A4-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076234.3			Missense_Mutation
UTRN	7402	broad.mit.edu	37	6	145157613	145157613	+	Missense_Mutation	SNP	T	T	C			TCGA-61-2110-01	TCGA-61-2110-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2110-01	TCGA-61-2110-11	g.chr6:145157613T>C	ENST00000367545.3	+	70	10001	c.10001T>C	c.(10000-10002)aTt>aCt	p.I3334T	UTRN_ENST00000367526.4_Missense_Mutation_p.I889T	NM_007124.2	NP_009055.2	P46939	UTRO_HUMAN	utrophin	3334					aging (GO:0007568)|muscle cell differentiation (GO:0042692)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|neuron projection morphogenesis (GO:0048812)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane (GO:0016020)|membrane raft (GO:0045121)|myofibril (GO:0030016)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|protein kinase binding (GO:0019901)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)	p.I3334T(1)		NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|cervix(2)|endometrium(21)|kidney(10)|large_intestine(29)|lung(56)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	148		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		AGGATGCAGATTTTAGAAGAT	0.512																																																1	Substitution - Missense(1)	ovary(1)	6											63.0	60.0	61.0					6																	145157613		2203	4300	6503	145199306	SO:0001583	missense	7402			AK023675	CCDS34547.1	6q24	2008-02-05	2006-12-13		ENSG00000152818	ENSG00000152818			12635	protein-coding gene	gene with protein product		128240	"""utrophin (homologous to dystrophin)"""	DMDL		1426262	Standard	NM_007124		Approved	DRP, DRP1	uc003qkt.3	P46939	OTTHUMG00000015746	ENST00000367545.3:c.10001T>C	6.37:g.145157613T>C	ENSP00000356515:p.Ile3334Thr		145199306	Q5SYY1|Q5SZ57|Q9UJ40	Missense_Mutation	SNP	ENST00000367545.3	37	CCDS34547.1	SNP	52	Broad	.	.	.	.	.	.	.	.	.	.	T	24.1	4.493688	0.84962	.	.	ENSG00000152818	ENST00000367545;ENST00000367526	T;T	0.64618	-0.11;3.29	5.91	5.91	0.95273	.	0.000000	0.53938	D	0.000043	T	0.69097	0.3073	M	0.82323	2.585	0.48901	D	0.999726	P	0.37997	0.614	P	0.48270	0.572	T	0.74115	-0.3769	10	0.66056	D	0.02	.	16.3436	0.83110	0.0:0.0:0.0:1.0	.	3334	P46939	UTRO_HUMAN	T	3334;889	ENSP00000356515:I3334T;ENSP00000356496:I889T	ENSP00000356496:I889T	I	+	2	0	UTRN	145199306	1.000000	0.71417	0.928000	0.36995	0.932000	0.56968	8.040000	0.89188	2.269000	0.75478	0.533000	0.62120	ATT		0.512	UTRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042551.1			Missense_Mutation
HECW1	23072	broad.mit.edu	37	7	43590137	43590137	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2110-01	TCGA-61-2110-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2110-01	TCGA-61-2110-11	g.chr7:43590137G>A	ENST00000395891.2	+	27	4947	c.4342G>A	c.(4342-4344)Gtg>Atg	p.V1448M	HECW1_ENST00000453890.1_Missense_Mutation_p.V1414M	NM_015052.3	NP_055867.3	Q76N89	HECW1_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1	1448	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.V1427M(1)		NS(2)|breast(10)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(57)|ovary(8)|pancreas(2)|prostate(2)|skin(6)|urinary_tract(3)	125						GAAGTGGCGGGTGGAGCGCGG	0.622																																																1	Substitution - Missense(1)	ovary(1)	7											65.0	74.0	71.0					7																	43590137		2182	4286	6468	43556662	SO:0001583	missense	23072			AB048365	CCDS5469.2, CCDS69286.1	7p13	2004-12-13			ENSG00000002746	ENSG00000002746			22195	protein-coding gene	gene with protein product		610384				12690205, 14684739	Standard	XM_005249665		Approved	KIAA0322, NEDL1	uc003tid.1	Q76N89	OTTHUMG00000128917	ENST00000395891.2:c.4342G>A	7.37:g.43590137G>A	ENSP00000379228:p.Val1448Met		43556662	A7E2X0|A8MYS3|B4DH42|O15036|Q9HCC7	Missense_Mutation	SNP	ENST00000395891.2	37	CCDS5469.2	SNP	44	Broad	.	.	.	.	.	.	.	.	.	.	G	33	5.223683	0.95139	.	.	ENSG00000002746	ENST00000395891;ENST00000453890;ENST00000265522	T;T	0.57907	0.37;0.37	5.62	5.62	0.85841	HECT (4);	0.000000	0.85682	D	0.000000	T	0.60090	0.2242	N	0.13235	0.315	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.979	T	0.66732	-0.5849	10	0.72032	D	0.01	.	19.6632	0.95882	0.0:0.0:1.0:0.0	.	1414;1448	B4DH42;Q76N89	.;HECW1_HUMAN	M	1448;1414;1448	ENSP00000379228:V1448M;ENSP00000407774:V1414M	ENSP00000265522:V1448M	V	+	1	0	HECW1	43556662	1.000000	0.71417	0.998000	0.56505	0.982000	0.71751	9.476000	0.97823	2.625000	0.88918	0.655000	0.94253	GTG		0.622	HECW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250893.2	NM_015052		Missense_Mutation
C7orf65	401335	broad.mit.edu	37	7	47694947	47694947	+	Splice_Site	SNP	G	G	C			TCGA-61-2110-01	TCGA-61-2110-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2110-01	TCGA-61-2110-11	g.chr7:47694947G>C	ENST00000408988.2	+	1	105		c.e1+1			NM_001123065.1	NP_001116537.1	Q6ZTY9	CG065_HUMAN	chromosome 7 open reading frame 65											endometrium(1)|lung(2)	3						GGAGGCAGCGgtcaggacagt	0.617																																																0			7											30.0	35.0	33.0					7																	47694947		1568	3582	5150	47661472	SO:0001630	splice_region_variant	401335				CCDS43580.1	7p12.3	2009-02-11			ENSG00000221845	ENSG00000221845			34432	protein-coding gene	gene with protein product							Standard	NM_001123065		Approved	FLJ44108	uc010kyp.1	Q6ZTY9	OTTHUMG00000155550	ENST00000408988.2:c.70+1G>C	7.37:g.47694947G>C			47661472	A4D2F8	Splice_Site_SNP	SNP	ENST00000408988.2	37	CCDS43580.1	SNP	44	Broad																																																																																				0.617	C7orf65-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340616.1	NM_001123065	Intron	Splice_Site_SNP
SLC20A2	6575	broad.mit.edu	37	8	42275437	42275437	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2110-01	TCGA-61-2110-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2110-01	TCGA-61-2110-11	g.chr8:42275437C>T	ENST00000342228.3	-	11	2212	c.1843G>A	c.(1843-1845)Gac>Aac	p.D615N	SLC20A2_ENST00000520179.1_Missense_Mutation_p.D615N|SLC20A2_ENST00000520262.1_Missense_Mutation_p.D615N	NM_006749.4	NP_006740.1	Q08357	S20A2_HUMAN	solute carrier family 20 (phosphate transporter), member 2	615					ion transport (GO:0006811)|phosphate ion transmembrane transport (GO:0035435)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	inorganic phosphate transmembrane transporter activity (GO:0005315)|receptor activity (GO:0004872)|sodium:phosphate symporter activity (GO:0005436)|virus receptor activity (GO:0001618)	p.D615N(1)		breast(1)|endometrium(6)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|stomach(1)	26	all_lung(13;8.33e-12)|Lung NSC(13;1.41e-10)|Ovarian(28;0.00579)|Prostate(17;0.0119)|Lung SC(25;0.211)	all_lung(54;0.00671)|Lung NSC(58;0.0184)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	BRCA - Breast invasive adenocarcinoma(8;5.73e-10)|OV - Ovarian serous cystadenocarcinoma(14;0.00419)|Lung(22;0.0302)|LUSC - Lung squamous cell carcinoma(45;0.0869)			AGGCGCCAGTCCACAGCCTTG	0.592																																																1	Substitution - Missense(1)	ovary(1)	8											68.0	65.0	66.0					8																	42275437		2203	4300	6503	42394594	SO:0001583	missense	6575				CCDS6132.1	8p11.21	2013-05-22			ENSG00000168575	ENSG00000168575		"""Solute carriers"""	10947	protein-coding gene	gene with protein product		158378		MLVAR, GLVR2		7745689, 16790504	Standard	NM_001257180		Approved	PiT-2, Glvr-2	uc010lxm.4	Q08357	OTTHUMG00000164169	ENST00000342228.3:c.1843G>A	8.37:g.42275437C>T	ENSP00000340465:p.Asp615Asn		42394594		Missense_Mutation	SNP	ENST00000342228.3	37	CCDS6132.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	36	5.954909	0.97139	.	.	ENSG00000168575	ENST00000342228;ENST00000520262;ENST00000520179	D;D;D	0.89196	-2.48;-2.48;-2.48	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	D	0.83271	0.5218	N	0.11789	0.175	0.80722	D	1	P	0.37370	0.592	P	0.46320	0.512	T	0.78468	-0.2192	10	0.02654	T	1	-50.1828	18.3732	0.90420	0.0:1.0:0.0:0.0	.	615	Q08357	S20A2_HUMAN	N	615	ENSP00000340465:D615N;ENSP00000429754:D615N;ENSP00000429712:D615N	ENSP00000340465:D615N	D	-	1	0	SLC20A2	42394594	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	7.818000	0.86416	2.941000	0.99782	0.655000	0.94253	GAC		0.592	SLC20A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377578.1			Missense_Mutation
OR1L4	254973	broad.mit.edu	37	9	125486515	125486515	+	Missense_Mutation	SNP	C	C	G			TCGA-61-2110-01	TCGA-61-2110-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2110-01	TCGA-61-2110-11	g.chr9:125486515C>G	ENST00000259466.1	+	1	247	c.247C>G	c.(247-249)Ctg>Gtg	p.L83V		NM_001005235.1	NP_001005235.1	Q8NGR5	OR1L4_HUMAN	olfactory receptor, family 1, subfamily L, member 4	83						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|large_intestine(3)|lung(13)|prostate(1)|skin(1)	20						GCCTAAGATGCTGGTGAATTT	0.443																																																0			9											120.0	117.0	118.0					9																	125486515		2203	4300	6503	124526336	SO:0001583	missense	254973				CCDS35129.1	9q33.2	2013-09-20			ENSG00000136939	ENSG00000136939		"""GPCR / Class A : Olfactory receptors"""	8216	protein-coding gene	gene with protein product				OR1L5			Standard	NM_001005235		Approved	OR9-E	uc004bmu.1	Q8NGR5	OTTHUMG00000020620	ENST00000259466.1:c.247C>G	9.37:g.125486515C>G	ENSP00000259466:p.Leu83Val		124526336	Q6IFN0|Q96R81	Missense_Mutation	SNP	ENST00000259466.1	37	CCDS35129.1	SNP	28	Broad	.	.	.	.	.	.	.	.	.	.	.	12.44	1.937192	0.34189	.	.	ENSG00000136939	ENST00000259466	T	0.00438	7.42	3.9	2.97	0.34412	GPCR, rhodopsin-like superfamily (1);	0.000000	0.40908	D	0.000995	T	0.01124	0.0037	M	0.88640	2.97	0.33523	D	0.592654	D	0.76494	0.999	D	0.77557	0.99	T	0.20739	-1.0266	10	0.87932	D	0	-11.1797	6.8757	0.24145	0.1735:0.7259:0.0:0.1005	.	83	Q8NGR5	OR1L4_HUMAN	V	83	ENSP00000259466:L83V	ENSP00000259466:L83V	L	+	1	2	OR1L4	124526336	0.326000	0.24669	0.992000	0.48379	0.678000	0.39670	0.014000	0.13333	2.019000	0.59389	0.298000	0.19748	CTG		0.443	OR1L4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053951.1			Missense_Mutation
SHROOM2	357	broad.mit.edu	37	X	9900829	9900829	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2110-01	TCGA-61-2110-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2110-01	TCGA-61-2110-11	g.chrX:9900829C>T	ENST00000380913.3	+	6	3596	c.3506C>T	c.(3505-3507)tCg>tTg	p.S1169L	SHROOM2_ENST00000418909.2_Missense_Mutation_p.S4L|SHROOM2_ENST00000493668.1_3'UTR	NM_001649.2	NP_001640.1	Q13796	SHRM2_HUMAN	shroom family member 2	1169					apical protein localization (GO:0045176)|brain development (GO:0007420)|camera-type eye development (GO:0043010)|camera-type eye morphogenesis (GO:0048593)|cell migration (GO:0016477)|cell-cell junction maintenance (GO:0045217)|cellular pigment accumulation (GO:0043482)|ear development (GO:0043583)|establishment of melanosome localization (GO:0032401)|eye pigment granule organization (GO:0008057)|lens morphogenesis in camera-type eye (GO:0002089)|melanosome organization (GO:0032438)|negative regulation of actin filament depolymerization (GO:0030835)|sodium ion transmembrane transport (GO:0035725)	apical plasma membrane (GO:0016324)|cell cortex (GO:0005938)|cell-cell adherens junction (GO:0005913)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|beta-catenin binding (GO:0008013)|ligand-gated sodium channel activity (GO:0015280)	p.S1169L(1)		breast(4)|central_nervous_system(2)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(13)|ovary(3)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)	57		Hepatocellular(5;0.000888)				ATGGAGACCTCGCGCTCCCCC	0.642																																																1	Substitution - Missense(1)	ovary(1)	X											43.0	41.0	42.0					X																	9900829		2203	4299	6502	9860829	SO:0001583	missense	357			X83543	CCDS14135.1	Xp22.3	2008-02-05	2006-07-20	2006-07-20	ENSG00000146950	ENSG00000146950			630	protein-coding gene	gene with protein product		300103	"""apical protein, Xenopus laevis-like"", ""apical protein-like (Xenopus laevis)"""	APXL		7795590, 16615870	Standard	NM_001649		Approved		uc004csu.1	Q13796	OTTHUMG00000021121	ENST00000380913.3:c.3506C>T	X.37:g.9900829C>T	ENSP00000370299:p.Ser1169Leu		9860829	B9EIQ7	Missense_Mutation	SNP	ENST00000380913.3	37	CCDS14135.1	SNP	31	Broad	.	.	.	.	.	.	.	.	.	.	C	16.93	3.258090	0.59321	.	.	ENSG00000146950	ENST00000380913;ENST00000418909;ENST00000452575;ENST00000540923	T;T;T	0.48201	2.34;1.42;0.82	4.66	4.66	0.58398	.	0.958291	0.08729	N	0.902332	T	0.64853	0.2636	L	0.52573	1.65	0.29890	N	0.82528	P;D	0.89917	0.875;1.0	B;D	0.63381	0.138;0.914	T	0.62129	-0.6919	10	0.72032	D	0.01	-15.2887	16.9974	0.86371	0.0:1.0:0.0:0.0	.	4;1169	Q68DU3;Q13796	.;SHRM2_HUMAN	L	1169;4;4;4	ENSP00000370299:S1169L;ENSP00000415229:S4L;ENSP00000406724:S4L	ENSP00000370299:S1169L	S	+	2	0	SHROOM2	9860829	0.997000	0.39634	0.904000	0.35570	0.481000	0.33189	3.043000	0.49823	1.931000	0.55961	0.523000	0.50628	TCG		0.642	SHROOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055721.1	NM_001649		Missense_Mutation
WWC3	55841	broad.mit.edu	37	X	10096631	10096631	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2110-01	TCGA-61-2110-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2110-01	TCGA-61-2110-11	g.chrX:10096631C>T	ENST00000380861.4	+	17	2706	c.2315C>T	c.(2314-2316)gCa>gTa	p.A772V	WWC3_ENST00000454666.1_Missense_Mutation_p.A772V	NM_015691.3	NP_056506.2	Q9ULE0	WWC3_HUMAN	WWC family member 3	772					negative regulation of hippo signaling (GO:0035331)|negative regulation of organ growth (GO:0046621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	cytosol (GO:0005829)	kinase binding (GO:0019900)|protein complex scaffold (GO:0032947)	p.A772V(1)		NS(1)|breast(3)|endometrium(10)|kidney(1)|large_intestine(11)|lung(17)|ovary(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	52						AGAACCACGGCACAGCTGCAG	0.677																																																1	Substitution - Missense(1)	ovary(1)	X											42.0	33.0	36.0					X																	10096631		2200	4298	6498	10056631	SO:0001583	missense	55841			AK091936	CCDS14136.1	Xp22.32	2008-02-05			ENSG00000047644	ENSG00000047644		"""WW, C2 and coiled-coil domain containing"""	29237	protein-coding gene	gene with protein product						10574462	Standard	NM_015691		Approved	KIAA1280, BM042	uc004csx.4	Q9ULE0	OTTHUMG00000021123	ENST00000380861.4:c.2315C>T	X.37:g.10096631C>T	ENSP00000370242:p.Ala772Val		10056631	A8KA96|Q659C1|Q9BTQ1	Missense_Mutation	SNP	ENST00000380861.4	37	CCDS14136.1	SNP	25	Broad	.	.	.	.	.	.	.	.	.	.	c	16.19	3.052230	0.55218	.	.	ENSG00000047644	ENST00000380861;ENST00000454666;ENST00000543412	T;T	0.05717	3.4;3.4	4.95	4.95	0.65309	.	0.234827	0.41294	D	0.000912	T	0.11537	0.0281	L	0.49126	1.545	0.48511	D	0.99966	P	0.43607	0.812	P	0.45474	0.482	T	0.08106	-1.0738	9	.	.	.	-15.0965	17.6585	0.88184	0.0:1.0:0.0:0.0	.	772	Q9ULE0	WWC3_HUMAN	V	772;772;267	ENSP00000370242:A772V;ENSP00000399584:A772V	.	A	+	2	0	WWC3	10056631	1.000000	0.71417	0.426000	0.26672	0.201000	0.24016	5.784000	0.68990	2.187000	0.69744	0.525000	0.51046	GCA		0.677	WWC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055725.1	NM_015691		Missense_Mutation
DMD	1756	broad.mit.edu	37	X	32382739	32382739	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2110-01	TCGA-61-2110-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2110-01	TCGA-61-2110-11	g.chrX:32382739G>A	ENST00000357033.4	-	36	5320	c.5114C>T	c.(5113-5115)tCa>tTa	p.S1705L	DMD_ENST00000378677.2_Missense_Mutation_p.S1701L	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	1705	Interaction with SYNM. {ECO:0000250}.				cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				CTTTTTCTCTGATTCATCCAA	0.363																																																0			X											252.0	212.0	226.0					X																	32382739		2202	4300	6502	32292660	SO:0001583	missense	1756			AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.5114C>T	X.37:g.32382739G>A	ENSP00000354923:p.Ser1705Leu		32292660	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	ENST00000357033.4	37	CCDS14233.1	SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	G	11.70	1.715390	0.30413	.	.	ENSG00000198947	ENST00000534884;ENST00000378682;ENST00000378684;ENST00000378677;ENST00000357033;ENST00000542849;ENST00000535280	T;T	0.50548	0.74;0.74	5.38	4.52	0.55395	.	0.243724	0.20469	N	0.091727	T	0.41328	0.1154	L	0.57536	1.79	0.80722	D	1	B;P;B;B;B	0.39624	0.206;0.681;0.245;0.245;0.245	B;B;B;B;B	0.36186	0.124;0.219;0.197;0.197;0.197	T	0.22068	-1.0227	10	0.11485	T	0.65	.	13.7632	0.62979	0.0765:0.0:0.9235:0.0	.	1697;1705;1701;364;361	P11532-4;P11532;E9PDN5;E7EQS7;E7EQS6	.;DMD_HUMAN;.;.;.	L	1697;364;361;1701;1705;1705;1582	ENSP00000367948:S1701L;ENSP00000354923:S1705L	ENSP00000354923:S1705L	S	-	2	0	DMD	32292660	1.000000	0.71417	0.997000	0.53966	0.863000	0.49368	5.742000	0.68646	1.158000	0.42547	-0.255000	0.11280	TCA		0.363	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	NM_004006		Missense_Mutation
FAM47A	158724	broad.mit.edu	37	X	34148259	34148259	+	Missense_Mutation	SNP	G	G	T			TCGA-61-2110-01	TCGA-61-2110-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2110-01	TCGA-61-2110-11	g.chrX:34148259G>T	ENST00000346193.3	-	1	2188	c.2137C>A	c.(2137-2139)Cct>Act	p.P713T		NM_203408.3	NP_981953.2	Q5JRC9	FA47A_HUMAN	family with sequence similarity 47, member A	713								p.P713T(1)		NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(5)|large_intestine(17)|lung(44)|ovary(5)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	97						TCAATCAAAGGTTCATCACTT	0.423																																																1	Substitution - Missense(1)	ovary(1)	X											106.0	102.0	104.0					X																	34148259		2202	4300	6502	34058180	SO:0001583	missense	158724			BC026171	CCDS43926.1	Xp21.1	2004-08-09			ENSG00000185448	ENSG00000185448			29962	protein-coding gene	gene with protein product	"""similar to hypothetical protein FLJ35782"""					12477932	Standard	NM_203408		Approved	MGC27003	uc004ddg.3	Q5JRC9	OTTHUMG00000021339	ENST00000346193.3:c.2137C>A	X.37:g.34148259G>T	ENSP00000345029:p.Pro713Thr		34058180	A8K8I9|Q8TAA0	Missense_Mutation	SNP	ENST00000346193.3	37	CCDS43926.1	SNP	44	Broad	.	.	.	.	.	.	.	.	.	.	G	15.58	2.876163	0.51801	.	.	ENSG00000185448	ENST00000346193	T	0.19105	2.17	1.17	0.18	0.15068	.	.	.	.	.	T	0.21103	0.0508	M	0.66439	2.03	0.23598	N	0.997326	B	0.20988	0.05	B	0.26310	0.068	T	0.34354	-0.9832	9	0.62326	D	0.03	.	4.0743	0.09897	0.0:0.0:0.5953:0.4047	.	713	Q5JRC9	FA47A_HUMAN	T	713	ENSP00000345029:P713T	ENSP00000345029:P713T	P	-	1	0	FAM47A	34058180	0.050000	0.20438	0.943000	0.38184	0.938000	0.57974	0.340000	0.19892	-0.002000	0.14469	0.544000	0.68410	CCT		0.423	FAM47A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056205.1	NM_203408		Missense_Mutation
AWAT1	158833	broad.mit.edu	37	X	69460020	69460020	+	Missense_Mutation	SNP	G	G	T			TCGA-61-2110-01	TCGA-61-2110-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2110-01	TCGA-61-2110-11	g.chrX:69460020G>T	ENST00000374521.3	+	7	908	c.867G>T	c.(865-867)aaG>aaT	p.K289N		NM_001013579.2	NP_001013597.1	Q58HT5	AWAT1_HUMAN	acyl-CoA wax alcohol acyltransferase 1	289					lipid metabolic process (GO:0006629)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	long-chain-alcohol O-fatty-acyltransferase activity (GO:0047196)	p.K369N(1)		breast(2)|central_nervous_system(1)|large_intestine(4)|lung(3)|ovary(4)|skin(1)	15						AAATTGAAAAGCCAAGCCAGG	0.502																																																1	Substitution - Missense(1)	ovary(1)	X											74.0	60.0	65.0					X																	69460020		2203	4300	6503	69376745	SO:0001583	missense	158833			BC039181	CCDS35321.1	Xq13.1	2010-01-25	2009-02-23	2009-02-23	ENSG00000204195	ENSG00000204195			23252	protein-coding gene	gene with protein product		300924	"""diacylglycerol O-acyltransferase 2-like 3"""	DGAT2L3		14970677, 15671038	Standard	NM_001013579		Approved		uc004dxy.3	Q58HT5	OTTHUMG00000021773	ENST00000374521.3:c.867G>T	X.37:g.69460020G>T	ENSP00000363645:p.Lys289Asn		69376745	Q5JT21|Q6IEE4	Missense_Mutation	SNP	ENST00000374521.3	37	CCDS35321.1	SNP	34	Broad	.	.	.	.	.	.	.	.	.	.	G	0.006	-2.043893	0.00398	.	.	ENSG00000204195	ENST00000374521	T	0.13778	2.56	5.39	-10.8	0.00216	.	0.796497	0.11912	N	0.517509	T	0.02083	0.0065	N	0.01505	-0.83	0.09310	N	0.999996	B	0.06786	0.001	B	0.12156	0.007	T	0.30297	-0.9983	10	0.02654	T	1	0.4212	1.5712	0.02616	0.1892:0.3039:0.2627:0.2442	.	289	Q58HT5	AWAT1_HUMAN	N	289	ENSP00000363645:K289N	ENSP00000363645:K289N	K	+	3	2	AWAT1	69376745	0.000000	0.05858	0.130000	0.21974	0.689000	0.40095	-5.995000	0.00086	-3.453000	0.00160	-1.293000	0.01348	AAG		0.502	AWAT1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057066.3	NM_001013579		Missense_Mutation
SASH3	54440	broad.mit.edu	37	X	128926972	128926972	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2110-01	TCGA-61-2110-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2110-01	TCGA-61-2110-11	g.chrX:128926972C>T	ENST00000356892.3	+	7	923	c.809C>T	c.(808-810)aCa>aTa	p.T270I	RP4-753P9.3_ENST00000432513.1_RNA	NM_018990.3	NP_061863.1	O75995	SASH3_HUMAN	SAM and SH3 domain containing 3	270	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.				homeostasis of number of cells within a tissue (GO:0048873)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043372)|positive regulation of immunoglobulin production (GO:0002639)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of organ growth (GO:0046622)|positive regulation of T cell cytokine production (GO:0002726)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of tumor necrosis factor production (GO:0032760)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.T270I(1)		breast(2)|endometrium(2)|large_intestine(1)|lung(3)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	12						CAGGAGCACACATCCACCCTC	0.567																																																1	Substitution - Missense(1)	ovary(1)	X											100.0	75.0	83.0					X																	128926972		2203	4300	6503	128754653	SO:0001583	missense	54440			BC051881	CCDS14614.1	Xq26	2013-01-10	2008-02-18	2008-02-18	ENSG00000122122	ENSG00000122122		"""SAM and SH3 domain containing"", ""Sterile alpha motif (SAM) domain containing"""	15975	protein-coding gene	gene with protein product		300441	"""chromosome X open reading frame 9"""	CXorf9		11470164	Standard	NM_018990		Approved	SLY, 753P9, SH3D6C, HACS2	uc004euu.3	O75995	OTTHUMG00000022372	ENST00000356892.3:c.809C>T	X.37:g.128926972C>T	ENSP00000349359:p.Thr270Ile		128754653	A6NCH1|A8K7K8|Q5JZ38	Missense_Mutation	SNP	ENST00000356892.3	37	CCDS14614.1	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	11.56	1.675204	0.29783	.	.	ENSG00000122122	ENST00000443760;ENST00000356892	D	0.85861	-2.04	5.66	4.78	0.61160	Src homology-3 domain (1);Sterile alpha motif domain (2);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 2 (1);	0.246302	0.48767	D	0.000169	T	0.72145	0.3424	N	0.16066	0.365	0.42178	D	0.991678	B;B	0.22983	0.078;0.003	B;B	0.24848	0.056;0.003	T	0.65438	-0.6168	10	0.30854	T	0.27	-23.3621	8.9436	0.35745	0.0:0.7731:0.1465:0.0804	.	288;270	B4DKQ0;O75995	.;SASH3_HUMAN	I	288;270	ENSP00000349359:T270I	ENSP00000349359:T270I	T	+	2	0	SASH3	128754653	0.576000	0.26700	0.879000	0.34478	0.703000	0.40648	1.033000	0.30191	1.121000	0.41925	0.529000	0.55759	ACA		0.567	SASH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058208.1	NM_018990		Missense_Mutation
ZNF185	7739	broad.mit.edu	37	X	152113972	152113972	+	Missense_Mutation	SNP	C	C	A			TCGA-61-2110-01	TCGA-61-2110-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2110-01	TCGA-61-2110-11	g.chrX:152113972C>A	ENST00000370268.4	+	16	1407	c.1370C>A	c.(1369-1371)tCt>tAt	p.S457Y	ZNF185_ENST00000449285.2_Missense_Mutation_p.S458Y|ZNF185_ENST00000454925.1_Missense_Mutation_p.S95Y|ZNF185_ENST00000318529.8_Missense_Mutation_p.S236Y|ZNF185_ENST00000539731.1_Missense_Mutation_p.S460Y|ZNF185_ENST00000370270.2_Missense_Mutation_p.S489Y|ZNF185_ENST00000535861.1_Missense_Mutation_p.S489Y|ZNF185_ENST00000324823.6_Missense_Mutation_p.S225Y|ZNF185_ENST00000318504.7_Missense_Mutation_p.S398Y			O15231	ZN185_HUMAN	zinc finger protein 185 (LIM domain)	457						actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)	p.S220Y(1)		NS(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|ovary(3)	12	Acute lymphoblastic leukemia(192;6.56e-05)					CCCAGCGGATCTGAGCAACTT	0.617																																																1	Substitution - Missense(1)	ovary(1)	X											29.0	33.0	32.0					X																	152113972		2057	4182	6239	151864628	SO:0001583	missense	7739			AK056517	CCDS48184.1, CCDS55528.1, CCDS55529.1, CCDS55530.1, CCDS55531.1, CCDS55532.1, CCDS69832.1	Xq28	2012-08-08			ENSG00000147394	ENSG00000147394		"""Zinc fingers, C2H2-type"""	12976	protein-coding gene	gene with protein product		300381				9268636	Standard	NM_001178106		Approved		uc011myg.2	O15231	OTTHUMG00000024187	ENST00000370268.4:c.1370C>A	X.37:g.152113972C>A	ENSP00000359291:p.Ser457Tyr		151864628	A4FTV3|A6NME5|B4DLE9|B7Z771|B8K2L9|B8K2M0|B8K2M1|B8K2M2|E9PFR6|F5GXF7|F5GZL4|F8W8V7|H0Y4M8|O00345|Q8N1R8|Q9NSD2	Missense_Mutation	SNP	ENST00000370268.4	37	CCDS48184.1	SNP	32	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	8.949|8.949	0.967738|0.967738	0.18659|0.18659	.|.	.|.	ENSG00000147394|ENSG00000147394	ENST00000454925|ENST00000535861;ENST00000539731;ENST00000449285;ENST00000318504;ENST00000535156;ENST00000324823;ENST00000433245;ENST00000370268;ENST00000318529;ENST00000370270;ENST00000436731	.|T;T;T;T;T	.|0.45276	.|0.91;0.91;0.9;0.9;0.9	2.54|2.54	0.633|0.633	0.17712|0.17712	.|.	.|0.527178	.|0.13972	.|U	.|0.350080	T|T	0.20659|0.20659	0.0497|0.0497	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	.|P;P;P;P;P;P;P;P;P	.|0.51791	.|0.736;0.478;0.521;0.948;0.948;0.907;0.868;0.948;0.478	.|B;B;B;B;B;B;B;B;B	.|0.43413	.|0.187;0.134;0.126;0.321;0.243;0.243;0.419;0.346;0.101	T|T	0.10776|0.10776	-1.0615|-1.0615	5|10	.|0.62326	.|D	.|0.03	.|.	3.7229|3.7229	0.08463|0.08463	0.0:0.5895:0.2501:0.1604|0.0:0.5895:0.2501:0.1604	.|.	.|458;398;428;460;489;457;95;236;220	.|O15231-3;B8K2L9;B8K2M0;F5GZL4;F5GXF7;O15231;Q8N1R8;F8W8V7;O15231-2	.|.;.;.;.;.;ZN185_HUMAN;.;.;.	M|Y	98|489;460;458;398;292;225;323;457;236;220;162	.|ENSP00000440847:S489Y;ENSP00000444367:S460Y;ENSP00000395228:S458Y;ENSP00000312782:S398Y;ENSP00000359291:S457Y	.|ENSP00000312782:S398Y	L|S	+|+	1|2	2|0	ZNF185|ZNF185	151864628|151864628	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.002000|0.002000	0.02628|0.02628	0.082000|0.082000	0.14847|0.14847	0.056000|0.056000	0.16144|0.16144	-0.530000|-0.530000	0.04314|0.04314	CTG|TCT		0.617	ZNF185-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000377480.1	NM_007150		Missense_Mutation
