#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
NOC2L	26155	broad.mit.edu	37	1	892634	892634	+	Missense_Mutation	SNP	A	A	G			TCGA-61-2111-01	TCGA-61-2111-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2111-01	TCGA-61-2111-11	g.chr1:892634A>G	ENST00000327044.6	-	3	248	c.199T>C	c.(199-201)Tct>Cct	p.S67P	NOC2L_ENST00000487214.1_5'UTR	NM_015658.3	NP_056473	Q9Y3T9	NOC2L_HUMAN	nucleolar complex associated 2 homolog (S. cerevisiae)	67					apoptotic process (GO:0006915)|cellular response to UV (GO:0034644)|chromatin assembly (GO:0031497)|negative regulation of B cell apoptotic process (GO:0002903)|negative regulation of histone acetylation (GO:0035067)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nucleolus to nucleoplasm transport (GO:0032066)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|nucleosome binding (GO:0031491)|poly(A) RNA binding (GO:0044822)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)	p.S67P(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|ovary(2)|skin(2)|urinary_tract(1)	16	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00459)|Epithelial(90;1.86e-38)|OV - Ovarian serous cystadenocarcinoma(86;6.08e-23)|Colorectal(212;0.000161)|COAD - Colon adenocarcinoma(227;0.000194)|BRCA - Breast invasive adenocarcinoma(365;0.000475)|Kidney(185;0.00231)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0344)|Lung(427;0.2)		TTGTGCTCAGAGGCACGGCCT	0.592																																																1	Substitution - Missense(1)	ovary(1)	1											52.0	55.0	54.0					1																	892634		2203	4300	6503	882497	SO:0001583	missense	26155			AL050019	CCDS3.1	1p36.33	2014-06-12			ENSG00000188976	ENSG00000188976			24517	protein-coding gene	gene with protein product	"""novel INHAT repressor"", ""protein phosphatase 1, regulatory subunit 12"""	610770					Standard	NM_015658		Approved	DKFZP564C186, NET7, NET15, NIR, PPP1R112	uc001abz.4	Q9Y3T9	OTTHUMG00000040720	ENST00000327044.6:c.199T>C	1.37:g.892634A>G	ENSP00000317992:p.Ser67Pro		882497	Q5SVA3|Q9BTN6	Missense_Mutation	SNP	ENST00000327044.6	37	CCDS3.1	SNP	11	Broad	.	.	.	.	.	.	.	.	.	.	A	13.65	2.301951	0.40694	.	.	ENSG00000188976	ENST00000327044	T	0.50813	0.73	4.87	4.87	0.63330	.	0.063914	0.64402	D	0.000004	T	0.68430	0.3000	M	0.82056	2.57	0.54753	D	0.999987	D;D	0.89917	1.0;1.0	D;D	0.71184	0.972;0.972	T	0.72808	-0.4181	10	0.56958	D	0.05	-11.926	13.6307	0.62193	1.0:0.0:0.0:0.0	.	67;67	B3KNC3;Q9Y3T9	.;NOC2L_HUMAN	P	67	ENSP00000317992:S67P	ENSP00000317992:S67P	S	-	1	0	NOC2L	882497	0.994000	0.37717	0.909000	0.35828	0.493000	0.33554	3.238000	0.51352	1.827000	0.53221	0.456000	0.33151	TCT		0.592	NOC2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097869.1	NM_015658		Missense_Mutation
NUDC	10726	broad.mit.edu	37	1	27268302	27268302	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2111-01	TCGA-61-2111-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2111-01	TCGA-61-2111-11	g.chr1:27268302G>A	ENST00000321265.5	+	4	545	c.422G>A	c.(421-423)gGg>gAg	p.G141E		NM_006600.3	NP_006591.1	Q9Y266	NUDC_HUMAN	nudC nuclear distribution protein	141					cell proliferation (GO:0008283)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|multicellular organismal development (GO:0007275)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|nucleoplasm (GO:0005654)		p.G141E(1)		cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|ovary(1)	8				UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;6.1e-51)|OV - Ovarian serous cystadenocarcinoma(117;2.87e-29)|Colorectal(126;5.74e-09)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000281)|STAD - Stomach adenocarcinoma(196;0.000604)|KIRC - Kidney renal clear cell carcinoma(1967;0.000739)|READ - Rectum adenocarcinoma(331;0.0421)		GACTCCCCAGGGAAGCAGGTG	0.542																																																1	Substitution - Missense(1)	ovary(1)	1											58.0	52.0	54.0					1																	27268302		2203	4300	6503	27140889	SO:0001583	missense	10726				CCDS292.1	1p35-p34	2013-08-06	2013-08-06		ENSG00000090273	ENSG00000090273			8045	protein-coding gene	gene with protein product		610325	"""nuclear distribution gene C homolog (A. nidulans)"", ""nuclear distribution C homolog (A. nidulans)"""				Standard	NM_006600		Approved	NudC	uc001bng.2	Q9Y266	OTTHUMG00000004226	ENST00000321265.5:c.422G>A	1.37:g.27268302G>A	ENSP00000319664:p.Gly141Glu		27140889	Q5QP31|Q5QP35|Q9H0N2|Q9Y2B6	Missense_Mutation	SNP	ENST00000321265.5	37	CCDS292.1	SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	G	4.646	0.120125	0.08881	.	.	ENSG00000090273	ENST00000435827;ENST00000321265;ENST00000452707	T	0.81247	-1.47	4.37	1.14	0.20703	.	0.424311	0.28031	N	0.016880	T	0.52533	0.1740	N	0.12182	0.205	0.33974	D	0.647201	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.48703	-0.9012	10	0.02654	T	1	0.0016	3.0249	0.06087	0.0988:0.3281:0.4049:0.1682	.	92;141	Q9H2R7;Q9Y266	.;NUDC_HUMAN	E	145;141;92	ENSP00000319664:G141E	ENSP00000319664:G141E	G	+	2	0	NUDC	27140889	0.952000	0.32445	0.998000	0.56505	0.972000	0.66771	-0.017000	0.12590	0.571000	0.29365	0.655000	0.94253	GGG		0.542	NUDC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012172.2			Missense_Mutation
COL16A1	1307	broad.mit.edu	37	1	32157226	32157226	+	Silent	SNP	G	G	T			TCGA-61-2111-01	TCGA-61-2111-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2111-01	TCGA-61-2111-11	g.chr1:32157226G>T	ENST00000373672.3	-	18	1791	c.1275C>A	c.(1273-1275)atC>atA	p.I425I	COL16A1_ENST00000373668.3_Silent_p.I425I|COL16A1_ENST00000271069.6_Silent_p.I425I	NM_001856.3	NP_001847.3	Q07092	COGA1_HUMAN	collagen, type XVI, alpha 1	425	Triple-helical region 9 (COL9) with 3 imperfections.				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|female pregnancy (GO:0007565)|integrin-mediated signaling pathway (GO:0007229)	collagen type XVI trimer (GO:0005597)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	integrin binding (GO:0005178)	p.I425I(1)		breast(4)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(15)|ovary(8)|prostate(4)	48		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0423)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.059)		CAATGACACAGATCTCTCCTG	0.627																																					Colon(143;498 1786 21362 25193 36625)											1	Substitution - coding silent(1)	ovary(1)	1											143.0	154.0	151.0					1																	32157226		1967	4142	6109	31929813	SO:0001819	synonymous_variant	1307			M92642	CCDS41297.1	1p35-p34	2013-01-16			ENSG00000084636	ENSG00000084636		"""Collagens"""	2193	protein-coding gene	gene with protein product		120326				1631157	Standard	NM_001856		Approved		uc001btk.1	Q07092	OTTHUMG00000003883	ENST00000373672.3:c.1275C>A	1.37:g.32157226G>T			31929813	Q16593|Q59F89|Q71RG9	Silent	SNP	ENST00000373672.3	37	CCDS41297.1	SNP	33	Broad																																																																																				0.627	COL16A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011057.2	NM_001856		Silent
ST3GAL3	6487	broad.mit.edu	37	1	44395826	44395826	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2111-01	TCGA-61-2111-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2111-01	TCGA-61-2111-11	g.chr1:44395826G>A	ENST00000361392.4	+	12	1238	c.1061G>A	c.(1060-1062)cGa>cAa	p.R354Q	ST3GAL3_ENST00000372374.2_Missense_Mutation_p.R323Q|ST3GAL3_ENST00000531816.1_Missense_Mutation_p.E93K|ST3GAL3_ENST00000361746.4_Missense_Mutation_p.R423Q|ST3GAL3_ENST00000361812.4_Silent_p.A155A|ST3GAL3_ENST00000531993.1_Missense_Mutation_p.R240Q|ST3GAL3_ENST00000528371.1_Missense_Mutation_p.E178K|ST3GAL3_ENST00000533933.1_Missense_Mutation_p.R256Q|ST3GAL3_ENST00000372372.2_Missense_Mutation_p.R392Q|ST3GAL3_ENST00000372366.1_3'UTR|ST3GAL3_ENST00000372375.2_Missense_Mutation_p.R408Q|ST3GAL3_ENST00000332628.6_Missense_Mutation_p.R323Q|ST3GAL3_ENST00000262915.3_Missense_Mutation_p.R423Q|ST3GAL3_ENST00000372365.1_3'UTR|ST3GAL3_ENST00000372362.2_Silent_p.A140A|ST3GAL3_ENST00000335430.6_3'UTR|ST3GAL3_ENST00000351035.3_Missense_Mutation_p.R392Q|ST3GAL3_ENST00000545417.1_Silent_p.A155A|ST3GAL3_ENST00000361400.4_Missense_Mutation_p.R338Q|ST3GAL3_ENST00000531451.1_Silent_p.A124A|ST3GAL3_ENST00000330208.2_Silent_p.A140A|ST3GAL3_ENST00000372367.1_Missense_Mutation_p.E193K|ST3GAL3_ENST00000347631.2_Missense_Mutation_p.R369Q|ST3GAL3_ENST00000372369.1_Missense_Mutation_p.R324Q|ST3GAL3_ENST00000372368.2_Missense_Mutation_p.R408Q|ST3GAL3_ENST00000372377.4_3'UTR|ST3GAL3_ENST00000353126.3_Missense_Mutation_p.R256Q	NM_001270459.1|NM_006279.3|NM_174964.2	NP_001257388.1|NP_006270.1|NP_777624.1	Q11203	SIAT6_HUMAN	ST3 beta-galactoside alpha-2,3-sialyltransferase 3	354					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|sialylation (GO:0097503)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	beta-galactoside (CMP) alpha-2,3-sialyltransferase activity (GO:0003836)|N-acetyllactosaminide alpha-2,3-sialyltransferase activity (GO:0008118)	p.R423Q(1)		central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(3)|ovary(3)|skin(1)	19	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0518)				AATATCCAGCGAGAGAAAGAG	0.547																																																1	Substitution - Missense(1)	ovary(1)	1											200.0	184.0	190.0					1																	44395826		2203	4300	6503	44168413	SO:0001583	missense	6487			L23768	CCDS492.1, CCDS493.1, CCDS494.1, CCDS495.1, CCDS496.1, CCDS497.1, CCDS498.1, CCDS499.1, CCDS500.1, CCDS53310.1, CCDS57988.1, CCDS57989.1, CCDS57990.1, CCDS57991.1, CCDS57992.1, CCDS57993.1, CCDS57994.1	1p34.1	2014-01-31	2005-02-07	2005-02-07	ENSG00000126091	ENSG00000126091	2.4.99.6	"""Sialyltransferases"""	10866	protein-coding gene	gene with protein product	"""ST3Gal III"""	606494	"""sialyltransferase 6 (N-acetyllacosaminide alpha 2,3-sialyltransferase)"", ""mental retardation, non-syndromic, autosomal recessive, 12"""	SIAT6, MRT12		8333853, 21907012	Standard	NM_174963		Approved		uc001cjz.4	Q11203	OTTHUMG00000007561	ENST00000361392.4:c.1061G>A	1.37:g.44395826G>A	ENSP00000355341:p.Arg354Gln		44168413	A9Z1W2|D3DPX8|Q5T4W9|Q5T4X0|Q5T4X7|Q5T4X8|Q5T4X9|Q5T4Y0|Q5T4Y2|Q5T4Y3|Q5T4Y4|Q86UR6|Q86UR7|Q86UR8|Q86UR9|Q86US0|Q86US1|Q86US2|Q8IX41|Q8IX42|Q8IX43|Q8IX44|Q8IX45|Q8IX46|Q8IX47|Q8IX48|Q8IX49|Q8IX50|Q8IX51|Q8IX52|Q8IX53|Q8IX54|Q8IX55|Q8IX56|Q8IX57|Q8IX58	Missense_Mutation	SNP	ENST00000361392.4	37	CCDS492.1	SNP	37	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.42|16.42	3.118971|3.118971	0.56505|0.56505	.|.	.|.	ENSG00000126091|ENSG00000126091	ENST00000372367;ENST00000528371;ENST00000531816|ENST00000361392;ENST00000361400;ENST00000262915;ENST00000372375;ENST00000351035;ENST00000372374;ENST00000353126;ENST00000347631;ENST00000372369;ENST00000361746;ENST00000372368;ENST00000372372;ENST00000531993;ENST00000533933;ENST00000332628	T;T;T|T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.77620|0.60171	-0.16;0.43;-1.11|1.61;1.61;1.61;1.61;1.61;1.61;1.51;1.61;1.61;1.61;1.61;1.61;0.21;1.51;1.61	4.5|4.5	4.5|4.5	0.54988|0.54988	.|.	.|0.243620	.|0.33591	.|N	.|0.004758	T|T	0.61800|0.61800	0.2376|0.2376	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	B;B;B|D;D;P;P;D;P;P;D;P;D;P;D	0.22604|0.69078	0.021;0.021;0.072|0.995;0.997;0.792;0.792;0.99;0.876;0.873;0.995;0.939;0.985;0.873;0.996	B;B;B|P;P;B;B;P;B;P;P;P;P;P;P	0.16722|0.56563	0.011;0.011;0.016|0.7;0.612;0.063;0.063;0.533;0.091;0.473;0.612;0.556;0.663;0.556;0.801	T|T	0.57242|0.57242	-0.7845|-0.7845	8|9	0.51188|0.27082	T|T	0.08|0.32	.|.	10.1612|10.1612	0.42853|0.42853	0.0939:0.0:0.9061:0.0|0.0939:0.0:0.9061:0.0	.|.	93;178;193|369;324;209;240;323;256;392;338;408;354;423;369	Q11203-22;Q11203-17;Q11203-24|Q11203-2;Q11203-5;Q11203-21;Q11203-16;Q11203-7;Q11203-8;Q11203-19;Q11203-15;Q11203-13;Q11203;Q11203-4;Q5T4W8	.;.;.|.;.;.;.;.;.;.;.;.;SIAT6_HUMAN;.;.	K|Q	193;178;93|354;338;423;408;392;323;256;369;324;423;408;392;240;256;323	ENSP00000361442:E193K;ENSP00000434876:E178K;ENSP00000434378:E93K|ENSP00000355341:R354Q;ENSP00000354748:R338Q;ENSP00000262915:R423Q;ENSP00000361450:R408Q;ENSP00000316999:R392Q;ENSP00000361449:R323Q;ENSP00000330463:R256Q;ENSP00000317192:R369Q;ENSP00000361444:R324Q;ENSP00000354657:R423Q;ENSP00000361443:R408Q;ENSP00000361447:R392Q;ENSP00000432682:R240Q;ENSP00000432965:R256Q;ENSP00000329755:R323Q	ENSP00000361442:E193K|ENSP00000262915:R423Q	E|R	+|+	1|2	0|0	ST3GAL3|ST3GAL3	44168413|44168413	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	3.274000|3.274000	0.51631|0.51631	2.507000|2.507000	0.84556|0.84556	0.591000|0.591000	0.81541|0.81541	GAG|CGA		0.547	ST3GAL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019964.1	NM_174963		Missense_Mutation
CDC7	8317	broad.mit.edu	37	1	91973480	91973480	+	Missense_Mutation	SNP	A	A	G			TCGA-61-2111-01	TCGA-61-2111-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2111-01	TCGA-61-2111-11	g.chr1:91973480A>G	ENST00000428239.1	+	3	444	c.185A>G	c.(184-186)gAc>gGc	p.D62G	CDC7_ENST00000234626.6_Missense_Mutation_p.D62G|CDC7_ENST00000430031.2_Intron|CDC7_ENST00000497611.1_3'UTR	NM_001134420.1	NP_001127892.1	O00311	CDC7_HUMAN	cell division cycle 7	62	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell cycle phase transition (GO:0044770)|cell division (GO:0051301)|DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|positive regulation of cell proliferation (GO:0008284)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.D62G(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|stomach(2)	23		all_lung(203;0.0165)|Lung NSC(277;0.0562)		all cancers(265;0.00108)|Epithelial(280;0.0184)|KIRC - Kidney renal clear cell carcinoma(1967;0.124)		AAGATTGAGGACAAAATTGGA	0.299																																																1	Substitution - Missense(1)	ovary(1)	1											102.0	115.0	111.0					1																	91973480		2203	4290	6493	91746068	SO:0001583	missense	8317			AF015592	CCDS734.1	1p22	2013-01-17	2013-01-17	2003-07-23	ENSG00000097046	ENSG00000097046			1745	protein-coding gene	gene with protein product		603311	"""CDC7 (cell division cycle 7, S. cerevisiae, homolog)-like 1"", ""CDC7 cell division cycle 7 (S. cerevisiae)"", ""cell division cycle 7 (S. cerevisiae)"", ""cell division cycle 7 homolog (S. cerevisiae)"""	CDC7L1		9405610, 9250678	Standard	NM_003503		Approved	Hsk1, huCdc7, HsCdc7	uc001dof.3	O00311	OTTHUMG00000047810	ENST00000428239.1:c.185A>G	1.37:g.91973480A>G	ENSP00000393139:p.Asp62Gly		91746068	D3DT31|O00558|Q5T5U5	Missense_Mutation	SNP	ENST00000428239.1	37	CCDS734.1	SNP	10	Broad	.	.	.	.	.	.	.	.	.	.	A	9.124	1.009814	0.19277	.	.	ENSG00000097046	ENST00000234626;ENST00000428239;ENST00000426137	T;T;T	0.06294	3.32;3.32;3.32	5.87	4.75	0.60458	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.179295	0.64402	N	0.000013	T	0.02342	0.0072	L	0.41415	1.275	0.48975	D	0.999736	B	0.12630	0.006	B	0.19148	0.024	T	0.33007	-0.9885	10	0.42905	T	0.14	-15.3449	8.1727	0.31264	0.7885:0.0:0.2115:0.0	.	62	O00311	CDC7_HUMAN	G	62	ENSP00000234626:D62G;ENSP00000393139:D62G;ENSP00000398077:D62G	ENSP00000234626:D62G	D	+	2	0	CDC7	91746068	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.127000	0.57944	1.165000	0.42670	0.533000	0.62120	GAC		0.299	CDC7-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027928.1	NM_003503		Missense_Mutation
ARHGAP21	57584	broad.mit.edu	37	10	24909163	24909163	+	Missense_Mutation	SNP	C	C	G			TCGA-61-2111-01	TCGA-61-2111-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2111-01	TCGA-61-2111-11	g.chr10:24909163C>G	ENST00000396432.2	-	9	2147	c.1661G>C	c.(1660-1662)cGa>cCa	p.R554P	ARHGAP21_ENST00000320481.6_Missense_Mutation_p.R341P	NM_020824.3	NP_065875.3	Q5T5U3	RHG21_HUMAN	Rho GTPase activating protein 21	553					establishment of Golgi localization (GO:0051683)|Golgi organization (GO:0007030)|maintenance of Golgi location (GO:0051684)|organelle transport along microtubule (GO:0072384)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)	p.R553P(1)		NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(17)|lung(21)|ovary(7)|pancreas(1)|prostate(5)|skin(2)|stomach(2)|urinary_tract(1)	78						ATTGGAACCTCGAAAAGATTT	0.403																																																1	Substitution - Missense(1)	ovary(1)	10											78.0	80.0	79.0					10																	24909163		2203	4300	6503	24949169	SO:0001583	missense	57584			AF480466	CCDS7144.2	10p12.31	2013-01-10			ENSG00000107863	ENSG00000107863		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	23725	protein-coding gene	gene with protein product		609870				12056806	Standard	NM_020824		Approved	KIAA1424, ARHGAP10	uc001isb.2	Q5T5U3	OTTHUMG00000017825	ENST00000396432.2:c.1661G>C	10.37:g.24909163C>G	ENSP00000379709:p.Arg554Pro		24949169	Q0VF98|Q7Z3P7|Q8N3A2|Q8NI19|Q8TBV5|Q9P2C3	Missense_Mutation	SNP	ENST00000396432.2	37	CCDS7144.2	SNP	31	Broad	.	.	.	.	.	.	.	.	.	.	C	17.32	3.359370	0.61403	.	.	ENSG00000107863	ENST00000396432;ENST00000447364;ENST00000320481;ENST00000376410;ENST00000446003;ENST00000445703	T;T;T;T	0.55234	2.5;2.6;0.53;0.55	5.5	4.55	0.56014	.	0.139058	0.47852	D	0.000212	T	0.69214	0.3086	M	0.68317	2.08	0.41373	D	0.987507	D;D	0.89917	1.0;0.999	D;D	0.77557	0.99;0.916	T	0.72043	-0.4409	10	0.54805	T	0.06	.	13.644	0.62270	0.0:0.9211:0.0:0.0789	.	544;553	F8W9U9;Q5T5U3	.;RHG21_HUMAN	P	554;543;341;544;554;389	ENSP00000379709:R554P;ENSP00000365604:R341P;ENSP00000365592:R544P;ENSP00000405018:R554P	ENSP00000365604:R341P	R	-	2	0	ARHGAP21	24949169	1.000000	0.71417	0.932000	0.37286	0.950000	0.60333	4.127000	0.57944	1.355000	0.45865	-0.355000	0.07637	CGA		0.403	ARHGAP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047229.4	NM_020824		Missense_Mutation
DNMBP	23268	broad.mit.edu	37	10	101659761	101659761	+	Missense_Mutation	SNP	G	G	T			TCGA-61-2111-01	TCGA-61-2111-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2111-01	TCGA-61-2111-11	g.chr10:101659761G>T	ENST00000324109.4	-	7	2708	c.2617C>A	c.(2617-2619)Cat>Aat	p.H873N	DNMBP_ENST00000342239.3_Missense_Mutation_p.H873N|DNMBP_ENST00000540316.1_5'Flank|DNMBP_ENST00000543621.1_Missense_Mutation_p.H119N	NM_015221.2	NP_056036.1	Q6XZF7	DNMBP_HUMAN	dynamin binding protein	873	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				intracellular signal transduction (GO:0035556)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|synapse (GO:0045202)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.H873N(1)		central_nervous_system(1)|cervix(4)|endometrium(9)|large_intestine(14)|lung(19)|ovary(5)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	61		Colorectal(252;0.234)		Epithelial(162;2.94e-10)|all cancers(201;3.15e-08)		GCCTCATCATGATTCTGGCAG	0.438																																																1	Substitution - Missense(1)	ovary(1)	10											177.0	157.0	164.0					10																	101659761		2203	4300	6503	101649751	SO:0001583	missense	23268			AL833283	CCDS7485.1	10q24.31	2012-07-24			ENSG00000107554	ENSG00000107554		"""Rho guanine nucleotide exchange factors"""	30373	protein-coding gene	gene with protein product	"""scaffold protein TUBA"""	611282				10231032, 14506234	Standard	NM_015221		Approved	KIAA1010, Tuba, ARHGEF36	uc001kqj.2	Q6XZF7	OTTHUMG00000018897	ENST00000324109.4:c.2617C>A	10.37:g.101659761G>T	ENSP00000315659:p.His873Asn		101649751	Q8IVY3|Q9Y2L3	Missense_Mutation	SNP	ENST00000324109.4	37	CCDS7485.1	SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	G	27.3	4.821271	0.90873	.	.	ENSG00000107554	ENST00000342239;ENST00000324109;ENST00000393570;ENST00000543621;ENST00000370423;ENST00000422692	T;T;T;T	0.46063	0.88;2.18;2.18;1.45	5.48	5.48	0.80851	Dbl homology (DH) domain (5);	0.000000	0.50627	D	0.000109	T	0.65852	0.2731	M	0.72353	2.195	0.80722	D	1	D;D;D	0.89917	0.999;1.0;0.999	D;D;D	0.87578	0.998;0.998;0.998	T	0.63655	-0.6588	10	0.44086	T	0.13	-23.0668	19.7014	0.96054	0.0:0.0:1.0:0.0	.	873;119;873	Q6XZF7;Q6XZF7-2;Q5SVK8	DNMBP_HUMAN;.;.	N	873;873;119;119;161;161	ENSP00000344914:H873N;ENSP00000315659:H873N;ENSP00000443657:H119N;ENSP00000409476:H161N	ENSP00000315659:H873N	H	-	1	0	DNMBP	101649751	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.727000	0.98787	2.733000	0.93635	0.561000	0.74099	CAT		0.438	DNMBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049832.2	NM_015221		Missense_Mutation
CFAP43	80217	broad.mit.edu	37	10	105920866	105920866	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2111-01	TCGA-61-2111-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2111-01	TCGA-61-2111-11	g.chr10:105920866C>T	ENST00000357060.3	-	27	3584	c.3469G>A	c.(3469-3471)Gaa>Aaa	p.E1157K	WDR96_ENST00000428666.1_Missense_Mutation_p.E1158K	NM_025145.5	NP_079421.5												p.E1157K(1)		NS(1)|breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(14)|lung(21)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						TGTTTTCTTTCTTCTTCAGTC	0.323																																																1	Substitution - Missense(1)	ovary(1)	10											108.0	99.0	103.0					10																	105920866		2203	4299	6502	105910856	SO:0001583	missense	80217																														ENST00000357060.3:c.3469G>A	10.37:g.105920866C>T	ENSP00000349568:p.Glu1157Lys		105910856		Missense_Mutation	SNP	ENST00000357060.3	37	CCDS31281.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	29.5	5.007324	0.93287	.	.	ENSG00000197748	ENST00000357060;ENST00000428666	T;T	0.19250	2.16;2.18	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	T	0.53802	0.1819	M	0.86028	2.79	0.58432	D	0.999995	D;D	0.89917	0.999;1.0	D;D	0.77557	0.972;0.99	T	0.58736	-0.7584	10	0.72032	D	0.01	.	19.4031	0.94639	0.0:1.0:0.0:0.0	.	1158;1157	G5E9L1;Q8NDM7	.;WDR96_HUMAN	K	1157;1158	ENSP00000349568:E1157K;ENSP00000400289:E1158K	ENSP00000349568:E1157K	E	-	1	0	WDR96	105910856	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	6.100000	0.71473	2.671000	0.90904	0.655000	0.94253	GAA		0.323	WDR96-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				Missense_Mutation
KIF18A	81930	broad.mit.edu	37	11	28045385	28045385	+	Missense_Mutation	SNP	G	G	C			TCGA-61-2111-01	TCGA-61-2111-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2111-01	TCGA-61-2111-11	g.chr11:28045385G>C	ENST00000263181.6	-	16	2807	c.2517C>G	c.(2515-2517)aaC>aaG	p.N839K		NM_031217.3	NP_112494.3	Q8NI77	KI18A_HUMAN	kinesin family member 18A	839					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic metaphase plate congression (GO:0007080)|protein transport (GO:0015031)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore microtubule (GO:0005828)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|ruffle (GO:0001726)	actin binding (GO:0003779)|ATP binding (GO:0005524)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|plus-end-directed microtubule motor activity (GO:0008574)|tubulin-dependent ATPase activity (GO:0070463)|ubiquitin binding (GO:0043130)	p.N839K(1)		breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(10)|ovary(3)|prostate(1)|skin(1)|urinary_tract(2)	36						TTAACGAACTGTTTGATGTAG	0.323																																																1	Substitution - Missense(1)	ovary(1)	11											100.0	92.0	95.0					11																	28045385		2201	4299	6500	28001961	SO:0001583	missense	81930			AL136819	CCDS7867.1	11p14.1	2014-06-12			ENSG00000121621	ENSG00000121621		"""Kinesins"""	29441	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 99"""	611271				11230166	Standard	NM_031217		Approved	DKFZP434G2226, PPP1R99	uc001msc.2	Q8NI77	OTTHUMG00000166195	ENST00000263181.6:c.2517C>G	11.37:g.28045385G>C	ENSP00000263181:p.Asn839Lys		28001961	Q4VPE3|Q86VS5|Q9H0F3	Missense_Mutation	SNP	ENST00000263181.6	37	CCDS7867.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	3.922	-0.017864	0.07681	.	.	ENSG00000121621	ENST00000263181	T	0.73575	-0.76	5.56	1.97	0.26223	.	0.659654	0.16138	N	0.227865	T	0.60996	0.2312	L	0.32530	0.975	0.09310	N	1	B	0.24186	0.099	B	0.25405	0.06	T	0.53899	-0.8373	10	0.54805	T	0.06	.	7.3032	0.26432	0.719:0.0:0.281:0.0	.	839	Q8NI77	KI18A_HUMAN	K	839	ENSP00000263181:N839K	ENSP00000263181:N839K	N	-	3	2	KIF18A	28001961	0.139000	0.22563	0.126000	0.21872	0.031000	0.12232	0.817000	0.27281	0.485000	0.27652	-0.302000	0.09304	AAC		0.323	KIF18A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388328.3	NM_031217		Missense_Mutation
TTC17	55761	broad.mit.edu	37	11	43429058	43429058	+	Missense_Mutation	SNP	G	G	C			TCGA-61-2111-01	TCGA-61-2111-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2111-01	TCGA-61-2111-11	g.chr11:43429058G>C	ENST00000039989.4	+	15	2009	c.1995G>C	c.(1993-1995)ttG>ttC	p.L665F	TTC17_ENST00000299240.6_Missense_Mutation_p.L665F|TTC17_ENST00000526774.1_3'UTR	NM_018259.5	NP_060729.2	Q96AE7	TTC17_HUMAN	tetratricopeptide repeat domain 17	665					actin filament polymerization (GO:0030041)|cilium organization (GO:0044782)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)		p.L665F(1)		breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(27)|ovary(5)|prostate(3)|skin(3)	53						CCAACCTTTTGATTCATTACG	0.423																																																1	Substitution - Missense(1)	ovary(1)	11											108.0	92.0	97.0					11																	43429058		2203	4300	6503	43385634	SO:0001583	missense	55761			AK001540	CCDS31466.1	11p11.2	2013-01-10			ENSG00000052841	ENSG00000052841		"""Tetratricopeptide (TTC) repeat domain containing"""	25596	protein-coding gene	gene with protein product						12477932	Standard	NM_018259		Approved	FLJ10890	uc001mxi.3	Q96AE7	OTTHUMG00000166398	ENST00000039989.4:c.1995G>C	11.37:g.43429058G>C	ENSP00000039989:p.Leu665Phe		43385634	G3XAB3|Q8NEC0	Missense_Mutation	SNP	ENST00000039989.4	37	CCDS31466.1	SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	G	18.29	3.590986	0.66219	.	.	ENSG00000052841	ENST00000299240;ENST00000039989	T;T	0.61274	0.12;0.12	5.63	4.69	0.59074	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	T	0.68348	0.2991	M	0.62209	1.925	0.50039	D	0.999843	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.999	T	0.68941	-0.5276	10	0.54805	T	0.06	-7.8068	5.6698	0.17715	0.1664:0.0:0.6775:0.1562	.	665;665;665	Q8NEC0;Q96AE7;G3XAB3	.;TTC17_HUMAN;.	F	665	ENSP00000299240:L665F;ENSP00000039989:L665F	ENSP00000039989:L665F	L	+	3	2	TTC17	43385634	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.211000	0.58507	1.296000	0.44742	0.591000	0.81541	TTG		0.423	TTC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389577.2	NM_018259		Missense_Mutation
SSSCA1	10534	broad.mit.edu	37	11	65337979	65337979	+	Missense_Mutation	SNP	C	C	A			TCGA-61-2111-01	TCGA-61-2111-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2111-01	TCGA-61-2111-11	g.chr11:65337979C>A	ENST00000309328.3	+	1	79	c.17C>A	c.(16-18)gCt>gAt	p.A6D	SSSCA1_ENST00000526877.1_Missense_Mutation_p.A6D|FAM89B_ENST00000449319.2_5'Flank|FAM89B_ENST00000530349.1_5'Flank|SSSCA1_ENST00000527920.1_5'UTR|SSSCA1-AS1_ENST00000567594.1_RNA|SSSCA1_ENST00000531405.1_5'UTR|FAM89B_ENST00000316409.2_5'Flank	NM_006396.1	NP_006387.1	O60232	SSA27_HUMAN	Sjogren syndrome/scleroderma autoantigen 1	6					mitotic nuclear division (GO:0007067)			p.A6D(1)		kidney(1)|lung(4)|ovary(1)|prostate(1)|skin(1)	8						CTGAACGGAGCTGGTGAGGAC	0.662																																																1	Substitution - Missense(1)	ovary(1)	11											58.0	59.0	59.0					11																	65337979		2201	4297	6498	65094555	SO:0001583	missense	10534			AB001740	CCDS8104.1	11q13.1	2007-10-04	2007-10-04			ENSG00000173465			11328	protein-coding gene	gene with protein product		606044	"""Sjogren's syndrome/scleroderma autoantigen 1"""			9486406	Standard	NM_006396		Approved	p27	uc001oek.3	O60232		ENST00000309328.3:c.17C>A	11.37:g.65337979C>A	ENSP00000312318:p.Ala6Asp		65094555		Missense_Mutation	SNP	ENST00000309328.3	37	CCDS8104.1	SNP	28	Broad	.	.	.	.	.	.	.	.	.	.	C	13.19	2.164173	0.38217	.	.	ENSG00000173465	ENST00000309328;ENST00000526877	T;T	0.51574	0.77;0.7	5.54	4.63	0.57726	.	0.135826	0.48767	D	0.000172	T	0.21718	0.0523	N	0.04880	-0.145	0.44570	D	0.997534	P	0.43094	0.799	B	0.36030	0.216	T	0.05338	-1.0891	10	0.15499	T	0.54	-1.5711	10.0133	0.41999	0.0:0.9074:0.0:0.0926	.	6	O60232	SSA27_HUMAN	D	6	ENSP00000312318:A6D;ENSP00000431666:A6D	ENSP00000312318:A6D	A	+	2	0	SSSCA1	65094555	0.449000	0.25689	0.838000	0.33150	0.071000	0.16799	2.184000	0.42575	1.337000	0.45525	0.561000	0.74099	GCT		0.662	SSSCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389511.1	NM_006396		Missense_Mutation
TRPC6	7225	broad.mit.edu	37	11	101374891	101374891	+	Missense_Mutation	SNP	G	G	T			TCGA-61-2111-01	TCGA-61-2111-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2111-01	TCGA-61-2111-11	g.chr11:101374891G>T	ENST00000344327.3	-	2	1233	c.809C>A	c.(808-810)tCc>tAc	p.S270Y	TRPC6_ENST00000360497.4_Missense_Mutation_p.S270Y|TRPC6_ENST00000532133.1_Missense_Mutation_p.S270Y|TRPC6_ENST00000348423.4_Missense_Mutation_p.S270Y|TRPC6_ENST00000526713.1_5'Flank	NM_004621.5	NP_004612.2	Q9Y210	TRPC6_HUMAN	transient receptor potential cation channel, subfamily C, member 6	270			S -> T (in FSGS2). {ECO:0000269|PubMed:15924139}.		aging (GO:0007568)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|ion transmembrane transport (GO:0034220)|platelet activation (GO:0030168)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ion transmembrane transporter activity (GO:0032414)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)	inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)	p.S270Y(1)		autonomic_ganglia(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(14)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	55		Acute lymphoblastic leukemia(157;0.000918)|all_hematologic(158;0.0162)		BRCA - Breast invasive adenocarcinoma(274;0.0442)		CCTAGATCTGGAGTGGCTAAA	0.468																																					Colon(166;1315 1927 11094 12848 34731)											1	Substitution - Missense(1)	ovary(1)	11											149.0	144.0	146.0					11																	101374891		2203	4299	6502	100880101	SO:0001583	missense	7225			AJ006276	CCDS8311.1	11q22.1	2014-02-04				ENSG00000137672		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12338	protein-coding gene	gene with protein product		603652	"""focal segmental glomerulosclerosis 2"""	FSGS2		9925922, 16382100, 15879175	Standard	NM_004621		Approved	TRP6	uc001pgk.4	Q9Y210		ENST00000344327.3:c.809C>A	11.37:g.101374891G>T	ENSP00000340913:p.Ser270Tyr		100880101	Q52M59|Q9HCW3|Q9NQA8|Q9NQA9	Missense_Mutation	SNP	ENST00000344327.3	37	CCDS8311.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	24.1	4.497523	0.85069	.	.	ENSG00000137672	ENST00000344327;ENST00000532133;ENST00000348423;ENST00000360497	D;D;D;D	0.87809	-2.3;-2.3;-2.3;-2.3	5.84	5.84	0.93424	Transient receptor potential II (1);	0.000000	0.85682	D	0.000000	D	0.95121	0.8419	M	0.89840	3.065	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.91635	0.999;0.999;0.999	D	0.95307	0.8408	10	0.87932	D	0	-6.1183	20.1438	0.98071	0.0:0.0:1.0:0.0	.	270;270;270	Q9Y210-3;Q9Y210-2;Q9Y210	.;.;TRPC6_HUMAN	Y	270	ENSP00000340913:S270Y;ENSP00000435574:S270Y;ENSP00000343672:S270Y;ENSP00000353687:S270Y	ENSP00000340913:S270Y	S	-	2	0	TRPC6	100880101	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.869000	0.99810	2.768000	0.95171	0.650000	0.86243	TCC		0.468	TRPC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394770.1	NM_004621		Missense_Mutation
USP2	9099	broad.mit.edu	37	11	119227995	119227995	+	Silent	SNP	G	G	A			TCGA-61-2111-01	TCGA-61-2111-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2111-01	TCGA-61-2111-11	g.chr11:119227995G>A	ENST00000260187.2	-	12	1926	c.1632C>T	c.(1630-1632)taC>taT	p.Y544Y	USP2_ENST00000525735.1_Silent_p.Y335Y|USP2_ENST00000455332.2_Silent_p.Y301Y	NM_004205.4	NP_004196.4	O75604	UBP2_HUMAN	ubiquitin specific peptidase 2	544	USP.				cell cycle (GO:0007049)|muscle organ development (GO:0007517)|negative regulation of skeletal muscle tissue development (GO:0048642)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of skeletal muscle tissue development (GO:0048643)|protein deubiquitination (GO:0016579)|protein stabilization (GO:0050821)|ubiquitin-dependent protein catabolic process (GO:0006511)	cell cortex (GO:0005938)|centrosome (GO:0005813)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	cyclin binding (GO:0030332)|cysteine-type endopeptidase activity (GO:0004197)|metal ion binding (GO:0046872)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)	p.Y544Y(1)		breast(2)|endometrium(2)|kidney(2)|large_intestine(5)|lung(5)|ovary(2)|prostate(3)|skin(2)|urinary_tract(1)	24		all_hematologic(192;4.65e-05)|Breast(348;0.0101)|all_neural(223;0.0218)|Medulloblastoma(222;0.0425)|Renal(330;0.157)		BRCA - Breast invasive adenocarcinoma(274;3.93e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.000513)|Colorectal(284;0.0116)|Lung(307;0.0853)|LUSC - Lung squamous cell carcinoma(976;0.0889)		TGGACACAGCGTACAGGTTGT	0.602																																																1	Substitution - coding silent(1)	ovary(1)	11											95.0	84.0	88.0					11																	119227995		2199	4295	6494	118733205	SO:0001819	synonymous_variant	9099			AF079564	CCDS8422.1, CCDS8423.1, CCDS58189.1	11q23.3	2008-02-05	2005-08-08			ENSG00000036672		"""Ubiquitin-specific peptidases"""	12618	protein-coding gene	gene with protein product		604725	"""ubiquitin specific protease 2"""			12838346	Standard	NM_004205		Approved	UBP41	uc001pwm.4	O75604		ENST00000260187.2:c.1632C>T	11.37:g.119227995G>A			118733205	B0YJB8|E9PPM2|Q8IUM2|Q8IW04|Q96MB9|Q9BQ21	Silent	SNP	ENST00000260187.2	37	CCDS8422.1	SNP	40	Broad																																																																																				0.602	USP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388361.2	NM_171997		Silent
ZBTB44	29068	broad.mit.edu	37	11	130130762	130130762	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2111-01	TCGA-61-2111-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2111-01	TCGA-61-2111-11	g.chr11:130130762G>A	ENST00000357899.4	-	2	1279	c.1007C>T	c.(1006-1008)tCt>tTt	p.S336F	ZBTB44_ENST00000397753.1_Missense_Mutation_p.S336F|ZBTB44_ENST00000530205.1_Missense_Mutation_p.S336F|ZBTB44_ENST00000525842.1_Missense_Mutation_p.S336F			Q8NCP5	ZBT44_HUMAN	zinc finger and BTB domain containing 44	336					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S336F(1)		autonomic_ganglia(1)|breast(1)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|prostate(2)	15	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0192)|Lung(977;0.235)		TATAGAGGAAGACTGTGGACT	0.423																																																1	Substitution - Missense(1)	ovary(1)	11											91.0	86.0	87.0					11																	130130762		1892	4109	6001	129635972	SO:0001583	missense	29068			AK024659	CCDS44776.1, CCDS73414.1, CCDS73415.1	11q24.3	2013-01-08	2006-09-19	2006-09-19		ENSG00000196323		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	25001	protein-coding gene	gene with protein product			"""BTB (POZ) domain containing 15"""	BTBD15		11042152	Standard	NM_014155		Approved	HSPC063, ZNF851	uc001qgb.4	Q8NCP5		ENST00000357899.4:c.1007C>T	11.37:g.130130762G>A	ENSP00000350574:p.Ser336Phe		129635972	Q6IPT8|Q86VJ7|Q86XX5	Missense_Mutation	SNP	ENST00000357899.4	37		SNP	33	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.94|18.94	3.730743|3.730743	0.69074|0.69074	.|.	.|.	ENSG00000196323|ENSG00000196323	ENST00000529982|ENST00000525842;ENST00000397753;ENST00000445008;ENST00000357899;ENST00000530205	.|T;T;T;T;T	.|0.14144	.|2.53;2.8;2.57;2.8;2.53	5.47|5.47	5.47|5.47	0.80525|0.80525	.|.	.|0.050705	.|0.85682	.|D	.|0.000000	T|T	0.27967|0.27967	0.0689|0.0689	L|L	0.27053|0.27053	0.805|0.805	0.80722|0.80722	D|D	1|1	.|D;D;D;P	.|0.69078	.|0.997;0.997;0.995;0.693	.|D;D;D;P	.|0.80764	.|0.994;0.994;0.979;0.46	T|T	0.02975|0.02975	-1.1087|-1.1087	5|10	.|0.72032	.|D	.|0.01	.|.	19.3282|19.3282	0.94273|0.94273	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|336;336;336;336	.|Q8NCP5-4;Q8NCP5-3;Q8NCP5;Q8NCP5-2	.|.;.;ZBT44_HUMAN;.	F|F	190|336	.|ENSP00000433457:S336F;ENSP00000380861:S336F;ENSP00000408079:S336F;ENSP00000350574:S336F;ENSP00000434177:S336F	.|ENSP00000350574:S336F	L|S	-|-	1|2	0|0	ZBTB44|ZBTB44	129635972|129635972	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	9.434000|9.434000	0.97515|0.97515	2.566000|2.566000	0.86566|0.86566	0.563000|0.563000	0.77884|0.77884	CTT|TCT		0.423	ZBTB44-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000386126.1	NM_014155		Missense_Mutation
PRMT8	56341	broad.mit.edu	37	12	3702270	3702270	+	Silent	SNP	C	C	T			TCGA-61-2111-01	TCGA-61-2111-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2111-01	TCGA-61-2111-11	g.chr12:3702270C>T	ENST00000382622.3	+	10	1497	c.1107C>T	c.(1105-1107)gaC>gaT	p.D369D	PRMT8_ENST00000452611.2_Silent_p.D360D|PRMT8_ENST00000261252.4_3'UTR	NM_019854.4	NP_062828.3	Q9NR22	ANM8_HUMAN	protein arginine methyltransferase 8	369	SAM-dependent MTase PRMT-type. {ECO:0000255|PROSITE-ProRule:PRU01015}.				histone arginine methylation (GO:0034969)|histone H4-R3 methylation (GO:0043985)|histone methylation (GO:0016571)|peptidyl-arginine methylation (GO:0018216)|peptidyl-arginine methylation, to asymmetrical-dimethyl arginine (GO:0019919)|regulation of protein binding (GO:0043393)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	histone methyltransferase activity (H4-R3 specific) (GO:0044020)|histone-arginine N-methyltransferase activity (GO:0008469)|identical protein binding (GO:0042802)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein-arginine omega-N asymmetric methyltransferase activity (GO:0035242)|protein-arginine omega-N monomethyltransferase activity (GO:0035241)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)	p.D369D(1)		breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(9)|lung(14)|ovary(3)|skin(5)|upper_aerodigestive_tract(1)	37			OV - Ovarian serous cystadenocarcinoma(31;0.0109)|COAD - Colon adenocarcinoma(12;0.0264)			TGCAGCGAGACCTCGATTTCA	0.537																																																1	Substitution - coding silent(1)	ovary(1)	12											95.0	78.0	84.0					12																	3702270		2203	4300	6503	3572531	SO:0001819	synonymous_variant	56341			AF263539	CCDS8521.2, CCDS58200.1	12p13.3	2006-03-03	2006-02-16	2006-02-16	ENSG00000111218	ENSG00000111218		"""Protein arginine methyltransferases"""	5188	protein-coding gene	gene with protein product		610086	"""HMT1 hnRNP methyltransferase-like 3 (S. cerevisiae)"", ""HMT1 hnRNP methyltransferase-like 4 (S. cerevisiae)"""	HRMT1L3, HRMT1L4		16051612	Standard	NM_019854		Approved		uc001qmf.4	Q9NR22	OTTHUMG00000128493	ENST00000382622.3:c.1107C>T	12.37:g.3702270C>T			3572531	B2RDP0|Q8TBJ8	Silent	SNP	ENST00000382622.3	37	CCDS8521.2	SNP	18	Broad																																																																																				0.537	PRMT8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250297.2	NM_019854		Silent
SLC39A5	283375	broad.mit.edu	37	12	56630437	56630437	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2111-01	TCGA-61-2111-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2111-01	TCGA-61-2111-11	g.chr12:56630437G>A	ENST00000266980.4	+	8	1407	c.1114G>A	c.(1114-1116)Ggc>Agc	p.G372S	ANKRD52_ENST00000548241.1_5'Flank|SLC39A5_ENST00000454355.2_Missense_Mutation_p.G372S	NM_001135195.1	NP_001128667.1	Q6ZMH5	S39A5_HUMAN	solute carrier family 39 (zinc transporter), member 5	372					cellular response to zinc ion starvation (GO:0034224)|G1 to G0 transition involved in cell differentiation (GO:0070315)|neural precursor cell proliferation (GO:0061351)|transmembrane transport (GO:0055085)|zinc ion transport (GO:0006829)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	metal ion transmembrane transporter activity (GO:0046873)	p.G371S(1)		NS(1)|cervix(6)|endometrium(1)|large_intestine(5)|lung(6)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						TGGGCACCAAGGCCACAGTCA	0.617																																																1	Substitution - Missense(1)	ovary(1)	12											103.0	93.0	96.0					12																	56630437		2203	4300	6503	54916704	SO:0001583	missense	283375				CCDS8912.2	12q13.3	2013-07-17	2013-07-17		ENSG00000139540	ENSG00000139540		"""Solute carriers"""	20502	protein-coding gene	gene with protein product		608730	"""solute carrier family 39 (metal ion transporter), member 5"""				Standard	NM_173596		Approved		uc010sqj.2	Q6ZMH5	OTTHUMG00000156962	ENST00000266980.4:c.1114G>A	12.37:g.56630437G>A	ENSP00000266980:p.Gly372Ser		54916704	B2R808|Q8N6Y3	Missense_Mutation	SNP	ENST00000266980.4	37	CCDS8912.2	SNP	35	Broad	.	.	.	.	.	.	.	.	.	.	G	16.72	3.202111	0.58234	.	.	ENSG00000139540	ENST00000454355;ENST00000266980	T;T	0.45668	0.89;0.89	4.96	3.14	0.36123	.	0.366378	0.23819	N	0.044242	T	0.32346	0.0826	L	0.50847	1.595	0.46260	D	0.998959	P	0.41475	0.751	B	0.40375	0.327	T	0.08576	-1.0715	10	0.09084	T	0.74	-11.5812	8.6729	0.34161	0.2483:0.0:0.7517:0.0	.	372	Q6ZMH5	S39A5_HUMAN	S	372	ENSP00000405360:G372S;ENSP00000266980:G372S	ENSP00000266980:G372S	G	+	1	0	SLC39A5	54916704	0.840000	0.29493	1.000000	0.80357	0.977000	0.68977	1.249000	0.32839	0.816000	0.34421	0.655000	0.94253	GGC		0.617	SLC39A5-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346834.1	NM_173596		Missense_Mutation
PIWIL1	9271	broad.mit.edu	37	12	130831585	130831585	+	Missense_Mutation	SNP	T	T	A			TCGA-61-2111-01	TCGA-61-2111-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2111-01	TCGA-61-2111-11	g.chr12:130831585T>A	ENST00000245255.3	+	6	903	c.631T>A	c.(631-633)Ttc>Atc	p.F211I		NM_001190971.1|NM_004764.4	NP_001177900.1|NP_004755.2	Q96J94	PIWL1_HUMAN	piwi-like RNA-mediated gene silencing 1	211					gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|regulation of translation (GO:0006417)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|mRNA cap binding complex (GO:0005845)|P granule (GO:0043186)|polysome (GO:0005844)	mRNA binding (GO:0003729)|piRNA binding (GO:0034584)|single-stranded RNA binding (GO:0003727)	p.F211I(1)		breast(6)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(26)|ovary(2)|prostate(4)|skin(3)|urinary_tract(1)	57	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;3.02e-06)|Epithelial(86;3.85e-05)|all cancers(50;4.65e-05)		TTGTTTGCAGTTCTATAATAT	0.328																																																1	Substitution - Missense(1)	ovary(1)	12											98.0	94.0	96.0					12																	130831585		2203	4300	6503	129397538	SO:0001583	missense	9271			AF104260	CCDS9268.1	12q24.33	2014-01-21	2013-02-15		ENSG00000125207	ENSG00000125207		"""Argonaute/PIWI family"""	9007	protein-coding gene	gene with protein product		605571	"""piwi (Drosophila)-like 1"", ""piwi-like 1 (Drosophila)"""			9851978, 12906857	Standard	NM_004764		Approved	PIWI, HIWI, CT80.1	uc001uik.3	Q96J94	OTTHUMG00000168382	ENST00000245255.3:c.631T>A	12.37:g.130831585T>A	ENSP00000245255:p.Phe211Ile		129397538	A4F266|O95404|Q8NA60|Q8TBY5|Q96JD5	Missense_Mutation	SNP	ENST00000245255.3	37	CCDS9268.1	SNP	60	Broad	.	.	.	.	.	.	.	.	.	.	T	17.91	3.505097	0.64410	.	.	ENSG00000125207	ENST00000245255;ENST00000540672	T;T	0.09445	2.98;2.98	5.53	5.53	0.82687	Argonaute/Dicer protein, PAZ (1);	0.045624	0.85682	D	0.000000	T	0.15132	0.0365	L	0.48362	1.52	0.58432	D	0.999992	P;P	0.47677	0.899;0.57	P;B	0.46110	0.504;0.219	T	0.01639	-1.1306	10	0.36615	T	0.2	-3.964	14.8477	0.70272	0.0:0.0:0.0:1.0	.	211;211	Q96J94;Q96J94-2	PIWL1_HUMAN;.	I	211;72	ENSP00000245255:F211I;ENSP00000441695:F72I	ENSP00000245255:F211I	F	+	1	0	PIWIL1	129397538	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	5.080000	0.64437	2.090000	0.63153	0.528000	0.53228	TTC		0.328	PIWIL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399510.1			Missense_Mutation
RBM25	58517	broad.mit.edu	37	14	73578334	73578334	+	Missense_Mutation	SNP	G	G	A	rs369541790		TCGA-61-2111-01	TCGA-61-2111-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2111-01	TCGA-61-2111-11	g.chr14:73578334G>A	ENST00000261973.7	+	16	2401	c.2116G>A	c.(2116-2118)Gta>Ata	p.V706I	RBM25_ENST00000527432.1_Missense_Mutation_p.V706I|RBM25_ENST00000532483.1_3'UTR	NM_021239.2	NP_067062.1	P49756	RBM25_HUMAN	RNA binding motif protein 25	706					mRNA processing (GO:0006397)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of apoptotic process (GO:0042981)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.V706I(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(6)|ovary(2)|pancreas(1)	31				BRCA - Breast invasive adenocarcinoma(234;0.00362)|OV - Ovarian serous cystadenocarcinoma(108;0.0688)		CAGTGATGACGTACCCCGAAA	0.393																																																1	Substitution - Missense(1)	ovary(1)	14						G	ILE/VAL	0,4406		0,0,2203	116.0	111.0	113.0		2116	5.9	1.0	14		113	1,8599	1.2+/-3.3	0,1,4299	no	missense	RBM25	NM_021239.2	29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	706/844	73578334	1,13005	2203	4300	6503	72648087	SO:0001583	missense	58517			BX647116	CCDS32113.1	14q24.3	2013-02-12	2004-04-23	2004-04-29	ENSG00000119707	ENSG00000119707		"""RNA binding motif (RRM) containing"""	23244	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 94"""	612427	"""RNA-binding region (RNP1, RRM) containing 7"""	RNPC7		9847074, 7596406	Standard	NM_021239		Approved	S164, fSAP94, NET52, Snu71	uc001xno.3	P49756	OTTHUMG00000167540	ENST00000261973.7:c.2116G>A	14.37:g.73578334G>A	ENSP00000261973:p.Val706Ile		72648087	A0PJL9|B2RNA8|B3KT03|Q2TA72|Q5XJ17|Q6P665|Q9H6A1|Q9UEQ5|Q9UIE9	Missense_Mutation	SNP	ENST00000261973.7	37	CCDS32113.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	G	15.06	2.722322	0.48728	0.0	1.16E-4	ENSG00000119707	ENST00000261973;ENST00000527432	T;T	0.11495	2.77;2.77	5.93	5.93	0.95920	.	0.234732	0.43260	D	0.000596	T	0.08980	0.0222	N	0.22421	0.69	0.80722	D	1	D	0.54601	0.967	B	0.43478	0.421	T	0.37220	-0.9715	10	0.17832	T	0.49	.	14.495	0.67680	0.0697:0.0:0.9303:0.0	.	706	P49756	RBM25_HUMAN	I	706	ENSP00000261973:V706I;ENSP00000431150:V706I	ENSP00000261973:V706I	V	+	1	0	RBM25	72648087	1.000000	0.71417	1.000000	0.80357	0.526000	0.34562	5.305000	0.65750	2.814000	0.96858	0.591000	0.81541	GTA		0.393	RBM25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394966.1	XM_027330		Missense_Mutation
OR4N4	283694	broad.mit.edu	37	15	22382523	22382523	+	Silent	SNP	G	G	C			TCGA-61-2111-01	TCGA-61-2111-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2111-01	TCGA-61-2111-11	g.chr15:22382523G>C	ENST00000328795.4	+	1	142	c.51G>C	c.(49-51)ctG>ctC	p.L17L	RP11-69H14.6_ENST00000558896.1_RNA	NM_001005241.2	NP_001005241.2	Q8N0Y3	OR4N4_HUMAN	olfactory receptor, family 4, subfamily N, member 4	17						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L17L(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(19)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	40		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)		TCCTTGGTCTGACTCAGTCTC	0.353																																																1	Substitution - coding silent(1)	ovary(1)	15											137.0	134.0	135.0					15																	22382523		2187	4260	6447	19883887	SO:0001819	synonymous_variant	283694			AI018459	CCDS32173.1	15q11.2	2012-08-09				ENSG00000183706		"""GPCR / Class A : Olfactory receptors"""	15375	protein-coding gene	gene with protein product							Standard	NM_001005241		Approved		uc010tzv.2	Q8N0Y3		ENST00000328795.4:c.51G>C	15.37:g.22382523G>C			19883887	Q6IEY3|Q6IF56	Silent	SNP	ENST00000328795.4	37	CCDS32173.1	SNP	45	Broad																																																																																				0.353	OR4N4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414922.1			Silent
MGA	23269	broad.mit.edu	37	15	42041563	42041563	+	Missense_Mutation	SNP	A	A	G			TCGA-61-2111-01	TCGA-61-2111-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2111-01	TCGA-61-2111-11	g.chr15:42041563A>G	ENST00000570161.1	+	16	5758	c.5758A>G	c.(5758-5760)Acc>Gcc	p.T1920A	MGA_ENST00000545763.1_Missense_Mutation_p.T1711A|MGA_ENST00000219905.7_Missense_Mutation_p.T1920A|MGA_ENST00000389936.4_Missense_Mutation_p.T1881A|MGA_ENST00000566586.1_Missense_Mutation_p.T1711A			O43451	MGA_HUMAN	MGA, MAX dimerization protein	0					carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)	p.T1969A(1)		NS(1)|breast(4)|central_nervous_system(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(33)|ovary(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	AGGCTCTGAAACCAAAATAAC	0.463																																																1	Substitution - Missense(1)	ovary(1)	15											60.0	55.0	57.0					15																	42041563		1874	4103	5977	39828855	SO:0001583	missense	23269			AB011090	CCDS55959.1, CCDS55960.1	15q15	2012-11-15	2012-11-15		ENSG00000174197	ENSG00000174197		"""MAX dimerization proteins"", ""T-boxes"""	14010	protein-coding gene	gene with protein product			"""MAX gene associated"""				Standard	NM_001080541		Approved	KIAA0518, MAD5, MXD5, FLJ12634	uc010ucy.2	Q8IWI9		ENST00000570161.1:c.5758A>G	15.37:g.42041563A>G	ENSP00000457035:p.Thr1920Ala		39828855	Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	ENST00000570161.1	37	CCDS55959.1	SNP	2	Broad	.	.	.	.	.	.	.	.	.	.	A	13.29	2.194424	0.38806	.	.	ENSG00000174197	ENST00000219905;ENST00000389936;ENST00000545763	T;T;T	0.24350	1.86;1.86;1.86	5.72	4.56	0.56223	.	0.385199	0.22241	N	0.062697	T	0.11153	0.0272	N	0.08118	0	0.19945	N	0.999945	B;B;B;B	0.34372	0.451;0.433;0.048;0.048	B;B;B;B	0.33454	0.079;0.164;0.05;0.05	T	0.09058	-1.0692	10	0.38643	T	0.18	.	4.625	0.12474	0.624:0.0:0.0946:0.2814	.	536;1711;1920;1881	B4DVS1;F5H7K2;E7ENI0;Q8IWI9	.;.;.;MGAP_HUMAN	A	1920;1881;1711	ENSP00000219905:T1920A;ENSP00000374586:T1881A;ENSP00000442467:T1711A	ENSP00000219905:T1920A	T	+	1	0	MGA	39828855	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.062000	0.41413	2.184000	0.69523	0.460000	0.39030	ACC		0.463	MGA-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000420229.1	NM_001164273.1		Missense_Mutation
SPTBN5	51332	broad.mit.edu	37	15	42168422	42168423	+	Missense_Mutation	DNP	CA	CA	TT			TCGA-61-2111-01	TCGA-61-2111-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2111-01	TCGA-61-2111-11	g.chr15:42168422_42168423CA>TT	ENST00000320955.6	-	21	4238_4239	c.4011_4012TG>AA	c.(4009-4014)gcTGcg>gcAAcg	p.A1338T		NM_016642.2	NP_057726.4	Q9NRC6	SPTN5_HUMAN	spectrin, beta, non-erythrocytic 5	1338					actin cytoskeleton organization (GO:0030036)|actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi organization (GO:0007030)|lysosomal transport (GO:0007041)|protein homooligomerization (GO:0051260)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|photoreceptor connecting cilium (GO:0032391)|photoreceptor disc membrane (GO:0097381)|spectrin (GO:0008091)	actin binding (GO:0003779)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|kinesin binding (GO:0019894)|myosin tail binding (GO:0032029)|protein self-association (GO:0043621)|spectrin binding (GO:0030507)	p.A1338T(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(6)|lung(18)|ovary(5)|prostate(8)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	62		all_cancers(109;1.84e-17)|all_epithelial(112;1.12e-15)|Lung NSC(122;7.6e-10)|all_lung(180;4.15e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		all cancers(2;4.33e-34)|Epithelial(2;1.72e-25)|OV - Ovarian serous cystadenocarcinoma(18;8.32e-20)|GBM - Glioblastoma multiforme(94;4.69e-07)|Colorectal(2;0.00104)|COAD - Colon adenocarcinoma(120;0.0405)|READ - Rectum adenocarcinoma(92;0.0908)		GGCTCATGCGCAGCCATCAGCC	0.624																																																1	Substitution - Missense(1)	ovary(1)	15																																								39955715	SO:0001583	missense	51332			AF233523	CCDS61599.1	15q21	2010-08-17			ENSG00000137877	ENSG00000137877			15680	protein-coding gene	gene with protein product	"""beta V spectrin"""	605916				10764729	Standard	NM_016642		Approved	HUSPECV, BSPECV, HUBSPECV	uc001zos.4	Q9NRC6		ENST00000320955.6:c.4011_4012delinsTT	15.37:g.42168422_42168423delinsTT	ENSP00000317790:p.Ala1338Thr		39955714		Missense_Mutation	DNP	ENST00000320955.6	37		DNP	25	Broad																																																																																				0.624	SPTBN5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000420237.1	NM_016642		Missense_Mutation
ZNF48	197407	broad.mit.edu	37	16	30409092	30409092	+	Missense_Mutation	SNP	C	C	A			TCGA-61-2111-01	TCGA-61-2111-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2111-01	TCGA-61-2111-11	g.chr16:30409092C>A	ENST00000320159.2	+	2	897	c.521C>A	c.(520-522)gCc>gAc	p.A174D	SEPT1_ENST00000570039.1_5'Flank	NM_001214906.1|NM_001214907.1|NM_001214909.1|NM_152652.2	NP_001201835.1|NP_001201836.1|NP_001201838.1|NP_689865.2	Q96MX3	ZNF48_HUMAN	zinc finger protein 48	174					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.A174D(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(11)|ovary(2)|pancreas(1)|skin(1)	21						CGGCCACCAGCCCAGGGTCCC	0.607																																																1	Substitution - Missense(1)	ovary(1)	16											35.0	43.0	40.0					16																	30409092		2197	4300	6497	30316593	SO:0001583	missense	197407			M88358, AK056313	CCDS10679.1, CCDS73868.1	16p11.2	2013-01-08			ENSG00000180035	ENSG00000180035		"""Zinc fingers, C2H2-type"""	13114	protein-coding gene	gene with protein product			"""zinc finger protein 553"""	ZNF553		1505991	Standard	NM_152652		Approved	DKFZp762K013, FLJ31751, MGC43952	uc021tgi.1	Q96MX3	OTTHUMG00000048195	ENST00000320159.2:c.521C>A	16.37:g.30409092C>A	ENSP00000324056:p.Ala174Asp		30316593	Q15920|Q4G0R3|Q69YP3|Q96IL9	Missense_Mutation	SNP	ENST00000320159.2	37	CCDS10679.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	17.28	3.349651	0.61183	.	.	ENSG00000180035	ENST00000495929;ENST00000320159	T	0.07908	3.15	5.11	4.15	0.48705	.	0.000000	0.39834	N	0.001257	T	0.19604	0.0471	L	0.42686	1.345	0.35103	D	0.765436	D	0.67145	0.996	D	0.69479	0.964	T	0.15435	-1.0437	10	0.72032	D	0.01	0.0093	12.6797	0.56914	0.1661:0.8339:0.0:0.0	.	174	Q96MX3	ZNF48_HUMAN	D	299;174	ENSP00000324056:A174D	ENSP00000324056:A174D	A	+	2	0	ZNF48	30316593	.	.	0.993000	0.49108	0.994000	0.84299	.	.	1.343000	0.45638	0.563000	0.77884	GCC		0.607	ZNF48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255549.2	NM_152652		Missense_Mutation
TP53	7157	broad.mit.edu	37	17	7577551	7577551	+	Missense_Mutation	SNP	C	C	A	rs397516437		TCGA-61-2111-01	TCGA-61-2111-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2111-01	TCGA-61-2111-11	g.chr17:7577551C>A	ENST00000269305.4	-	7	919	c.730G>T	c.(730-732)Ggc>Tgc	p.G244C	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.G244C|TP53_ENST00000445888.2_Missense_Mutation_p.G244C|TP53_ENST00000420246.2_Missense_Mutation_p.G244C|TP53_ENST00000413465.2_Missense_Mutation_p.G244C|TP53_ENST00000359597.4_Missense_Mutation_p.G244C	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	244	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		G -> A (in sporadic cancers; somatic mutation).|G -> C (in sporadic cancers; somatic mutation).|G -> D (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs28934572).|G -> E (in a sporadic cancer; somatic mutation).|G -> R (in sporadic cancers; somatic mutation).|G -> S (in sporadic cancers; somatic mutation).|G -> V (in LFS; germline mutation and in sporadic cancers; somatic mutation).|MG -> IC (in a sporadic cancer; somatic mutation).|MG -> IS (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.G244C(45)|p.G244S(38)|p.0?(8)|p.G244R(6)|p.?(5)|p.G244fs*3(4)|p.G151C(4)|p.G244fs*4(3)|p.M243_G244>IC(1)|p.G244fs*19(1)|p.G244fs*17(1)|p.M243fs*18(1)|p.S241_G245delSCMGG(1)|p.C242fs*98(1)|p.C242_M246>L(1)|p.G244del(1)|p.G151S(1)|p.G151fs*4(1)|p.C238_M246delCNSSCMGGM(1)|p.G151R(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TTCATGCCGCCCATGCAGGAA	0.582		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	125	Substitution - Missense(95)|Deletion - Frameshift(8)|Whole gene deletion(8)|Unknown(5)|Insertion - Frameshift(4)|Deletion - In frame(3)|Complex - deletion inframe(1)|Complex - compound substitution(1)	lung(23)|upper_aerodigestive_tract(11)|large_intestine(10)|liver(10)|stomach(9)|endometrium(8)|oesophagus(8)|kidney(7)|breast(7)|biliary_tract(6)|urinary_tract(5)|haematopoietic_and_lymphoid_tissue(4)|ovary(4)|bone(4)|central_nervous_system(3)|skin(2)|adrenal_gland(1)|soft_tissue(1)|pancreas(1)|prostate(1)	17											147.0	111.0	123.0					17																	7577551		2203	4300	6503	7518276	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.730G>T	17.37:g.7577551C>A	ENSP00000269305:p.Gly244Cys		7518276	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	C	25.1	4.604756	0.87157	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99901	-7.65;-7.65;-7.65;-7.65;-7.65;-7.65;-7.65;-7.65	4.62	4.62	0.57501	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99894	0.9949	M	0.90759	3.145	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0	D	0.96044	0.9026	10	0.87932	D	0	-29.0146	15.3618	0.74483	0.0:1.0:0.0:0.0	.	244;244;151;244;244;244	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	C	244;244;244;244;244;244;233;151;112;151	ENSP00000410739:G244C;ENSP00000352610:G244C;ENSP00000269305:G244C;ENSP00000398846:G244C;ENSP00000391127:G244C;ENSP00000391478:G244C;ENSP00000425104:G112C;ENSP00000423862:G151C	ENSP00000269305:G244C	G	-	1	0	TP53	7518276	1.000000	0.71417	0.998000	0.56505	0.983000	0.72400	7.609000	0.82925	2.564000	0.86499	0.462000	0.41574	GGC		0.582	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Missense_Mutation
STAT5B	6777	broad.mit.edu	37	17	40359726	40359726	+	Missense_Mutation	SNP	G	G	C	rs150697956	byFrequency	TCGA-61-2111-01	TCGA-61-2111-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2111-01	TCGA-61-2111-11	g.chr17:40359726G>C	ENST00000293328.3	-	16	2095	c.1927C>G	c.(1927-1929)Ctg>Gtg	p.L643V		NM_012448.3	NP_036580.2	P51692	STA5B_HUMAN	signal transducer and activator of transcription 5B	643	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				2-oxoglutarate metabolic process (GO:0006103)|acute-phase response (GO:0006953)|allantoin metabolic process (GO:0000255)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hormone stimulus (GO:0032870)|citrate metabolic process (GO:0006101)|creatine metabolic process (GO:0006600)|creatinine metabolic process (GO:0046449)|development of secondary female sexual characteristics (GO:0046543)|development of secondary male sexual characteristics (GO:0046544)|fatty acid metabolic process (GO:0006631)|female pregnancy (GO:0007565)|isoleucine metabolic process (GO:0006549)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lactation (GO:0007595)|lipid storage (GO:0019915)|liver development (GO:0001889)|luteinization (GO:0001553)|natural killer cell differentiation (GO:0001779)|negative regulation of apoptotic process (GO:0043066)|negative regulation of erythrocyte differentiation (GO:0045647)|oxaloacetate metabolic process (GO:0006107)|Peyer's patch development (GO:0048541)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of cellular component movement (GO:0051272)|positive regulation of gamma-delta T cell differentiation (GO:0045588)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|positive regulation of natural killer cell proliferation (GO:0032819)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|progesterone metabolic process (GO:0042448)|prolactin signaling pathway (GO:0038161)|regulation of cell adhesion (GO:0030155)|regulation of epithelial cell differentiation (GO:0030856)|regulation of multicellular organism growth (GO:0040014)|regulation of steroid metabolic process (GO:0019218)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to interleukin-15 (GO:0070672)|response to interleukin-2 (GO:0070669)|response to interleukin-4 (GO:0070670)|response to lipopolysaccharide (GO:0032496)|succinate metabolic process (GO:0006105)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|taurine metabolic process (GO:0019530)|transcription from RNA polymerase II promoter (GO:0006366)|valine metabolic process (GO:0006573)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|glucocorticoid receptor binding (GO:0035259)|protein dimerization activity (GO:0046983)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)	p.L643V(1)		breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(5)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		all_cancers(22;4.15e-07)|all_epithelial(22;2.83e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.135)	Dasatinib(DB01254)	AAAGGCATCAGATTCCAAAAC	0.388																																																1	Substitution - Missense(1)	ovary(1)	17											97.0	96.0	96.0					17																	40359726		2203	4300	6503	37613252	SO:0001583	missense	6777			BC065227	CCDS11423.1	17q11.2	2014-09-17			ENSG00000173757	ENSG00000173757		"""SH2 domain containing"""	11367	protein-coding gene	gene with protein product		604260				8631883	Standard	NM_012448		Approved		uc002hzh.3	P51692	OTTHUMG00000150724	ENST00000293328.3:c.1927C>G	17.37:g.40359726G>C	ENSP00000293328:p.Leu643Val		37613252	Q8WWS8	Missense_Mutation	SNP	ENST00000293328.3	37	CCDS11423.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	33	5.215254	0.95104	.	.	ENSG00000173757	ENST00000293328	D	0.96011	-3.88	5.33	5.33	0.75918	SH2 motif (4);	0.135575	0.52532	D	0.000078	D	0.96266	0.8782	L	0.38175	1.15	0.80722	D	1	D	0.76494	0.999	D	0.91635	0.999	D	0.95003	0.8145	10	0.30854	T	0.27	-8.9333	19.2079	0.93742	0.0:0.0:1.0:0.0	.	643	P51692	STA5B_HUMAN	V	643	ENSP00000293328:L643V	ENSP00000293328:L643V	L	-	1	2	STAT5B	37613252	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.828000	0.86729	2.768000	0.95171	0.655000	0.94253	CTG		0.388	STAT5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319797.1	NM_012448		Missense_Mutation
ATP8B1	5205	broad.mit.edu	37	18	55355593	55355593	+	Missense_Mutation	SNP	G	G	A	rs121909104		TCGA-61-2111-01	TCGA-61-2111-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2111-01	TCGA-61-2111-11	g.chr18:55355593G>A	ENST00000283684.4	-	12	1366	c.1367C>T	c.(1366-1368)aCg>aTg	p.T456M	RP11-35G9.5_ENST00000588925.1_RNA|ATP8B1_ENST00000536015.1_Missense_Mutation_p.T456M|RP11-35G9.3_ENST00000599199.1_RNA			O43520	AT8B1_HUMAN	ATPase, aminophospholipid transporter, class I, type 8B, member 1	456			T -> M (in PFIC1). {ECO:0000269|PubMed:15239083}.		bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|drug transmembrane transport (GO:0006855)|inner ear receptor cell development (GO:0060119)|ion transmembrane transport (GO:0034220)|negative regulation of transcription, DNA-templated (GO:0045892)|phospholipid translocation (GO:0045332)|regulation of microvillus assembly (GO:0032534)|sensory perception of sound (GO:0007605)|transmembrane transport (GO:0055085)|vestibulocochlear nerve formation (GO:0021650)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)	ATP binding (GO:0005524)|cardiolipin binding (GO:1901612)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.T456M(1)		breast(6)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(19)|ovary(3)|prostate(1)	53		Colorectal(73;0.229)				GAGTGTCCCCGTCTTATCAGA	0.453																																																1	Substitution - Missense(1)	ovary(1)	18	GRCh37	CM043817	ATP8B1	M	rs121909104						245.0	216.0	226.0					18																	55355593		2203	4300	6503	53506591	SO:0001583	missense	5205			AF038007	CCDS11965.1	18q21	2010-04-28	2010-04-28		ENSG00000081923	ENSG00000081923		"""ATPases / P-type"""	3706	protein-coding gene	gene with protein product		602397	"""ATPase, Class I, type 8B, member 1"", ""ATPase, class I, type 8B, member 1"""	FIC1, BRIC, PFIC1		9500542, 7655458	Standard	NM_005603		Approved	ATPIC, PFIC	uc002lgw.3	O43520	OTTHUMG00000132739	ENST00000283684.4:c.1367C>T	18.37:g.55355593G>A	ENSP00000283684:p.Thr456Met		53506591	Q9BTP8	Missense_Mutation	SNP	ENST00000283684.4	37	CCDS11965.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	G	27.1	4.801038	0.90538	.	.	ENSG00000081923	ENST00000283684;ENST00000536015	T;T	0.72615	-0.67;-0.67	5.92	5.92	0.95590	HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.000000	0.85682	D	0.000000	D	0.90926	0.7148	H	0.97962	4.115	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.93524	0.6864	10	0.87932	D	0	.	19.9157	0.97061	0.0:0.0:1.0:0.0	.	456	O43520	AT8B1_HUMAN	M	456	ENSP00000283684:T456M;ENSP00000445359:T456M	ENSP00000283684:T456M	T	-	2	0	ATP8B1	53506591	1.000000	0.71417	0.959000	0.39883	0.863000	0.49368	9.869000	0.99810	2.809000	0.96659	0.655000	0.94253	ACG		0.453	ATP8B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256097.1	NM_005603		Missense_Mutation
LONP1	9361	broad.mit.edu	37	19	5700873	5700873	+	Missense_Mutation	SNP	A	A	T			TCGA-61-2111-01	TCGA-61-2111-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2111-01	TCGA-61-2111-11	g.chr19:5700873A>T	ENST00000360614.3	-	9	1590	c.1433T>A	c.(1432-1434)cTg>cAg	p.L478Q	LONP1_ENST00000540670.2_Missense_Mutation_p.L282Q|LONP1_ENST00000585374.1_Missense_Mutation_p.L364Q|LONP1_ENST00000590729.1_Missense_Mutation_p.L348Q|LONP1_ENST00000593119.1_Missense_Mutation_p.L414Q	NM_004793.2	NP_004784.2			lon peptidase 1, mitochondrial											breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						CGCCAGGTCCAGGTTCTCGTT	0.602																																																0			19											221.0	150.0	174.0					19																	5700873		2203	4300	6503	5651873	SO:0001583	missense	9361			U02389	CCDS12148.1, CCDS62507.1, CCDS62508.1	19p13.2	2014-01-28	2006-10-20	2006-10-20	ENSG00000196365	ENSG00000196365		"""ATPases / AAA-type"", ""Serine peptidases / Serine peptidases"""	9479	protein-coding gene	gene with protein product		605490	"""protease, serine, 15"""	PRSS15		8248235, 8119403	Standard	NM_004793		Approved	LonHS, hLON, PIM1	uc002mcx.4	P36776		ENST00000360614.3:c.1433T>A	19.37:g.5700873A>T	ENSP00000353826:p.Leu478Gln		5651873		Missense_Mutation	SNP	ENST00000360614.3	37	CCDS12148.1	SNP	7	Broad	.	.	.	.	.	.	.	.	.	.	A	18.42	3.619416	0.66787	.	.	ENSG00000196365	ENST00000360614;ENST00000358403;ENST00000540670	T;T	0.27104	1.69;1.69	4.57	4.57	0.56435	.	0.081158	0.49916	D	0.000132	T	0.54679	0.1873	M	0.89658	3.05	0.58432	D	0.999994	D;D;D	0.76494	0.988;0.999;0.988	P;D;P	0.65684	0.903;0.937;0.903	T	0.64618	-0.6365	10	0.87932	D	0	-23.3241	11.9092	0.52729	1.0:0.0:0.0:0.0	.	478;414;478	E5KMH8;Q8N8K8;P36776	.;.;LONM_HUMAN	Q	478;442;282	ENSP00000353826:L478Q;ENSP00000441523:L282Q	ENSP00000351177:L442Q	L	-	2	0	LONP1	5651873	1.000000	0.71417	0.999000	0.59377	0.481000	0.33189	8.946000	0.92992	1.700000	0.51204	0.459000	0.35465	CTG		0.602	LONP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451662.1	NM_004793		Missense_Mutation
PIK3R2	5296	broad.mit.edu	37	19	18276981	18276981	+	Missense_Mutation	SNP	G	G	A	rs200508580		TCGA-61-2111-01	TCGA-61-2111-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2111-01	TCGA-61-2111-11	g.chr19:18276981G>A	ENST00000593731.1	+	12	1988	c.1428G>A	c.(1426-1428)atG>atA	p.M476I	PIK3R2_ENST00000222254.8_Missense_Mutation_p.M476I			O00459	P85B_HUMAN	phosphoinositide-3-kinase, regulatory subunit 2 (beta)	476					blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)	cytosol (GO:0005829)|phosphatidylinositol 3-kinase complex (GO:0005942)	phosphatidylinositol 3-kinase regulator activity (GO:0035014)|receptor tyrosine kinase binding (GO:0030971)	p.M476I(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(3)|pancreas(1)|stomach(1)	24					Isoprenaline(DB01064)	AGCTGCAGATGAAGCGTACTG	0.547																																																1	Substitution - Missense(1)	ovary(1)	19											81.0	84.0	83.0					19																	18276981		2203	4300	6503	18137981	SO:0001583	missense	5296				CCDS12371.1	19p13.11	2013-03-28	2008-02-04		ENSG00000105647	ENSG00000105647		"""SH2 domain containing"""	8980	protein-coding gene	gene with protein product		603157				1314371	Standard	NM_005027		Approved	P85B, p85	uc002nia.2	O00459	OTTHUMG00000183383	ENST00000593731.1:c.1428G>A	19.37:g.18276981G>A	ENSP00000471914:p.Met476Ile		18137981	Q5EAT5|Q9UPH9	Missense_Mutation	SNP	ENST00000593731.1	37	CCDS12371.1	SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	G	14.17	2.455585	0.43634	.	.	ENSG00000105647	ENST00000222254	T	0.48201	0.82	4.37	4.37	0.52481	.	0.118360	0.85682	D	0.000000	T	0.44117	0.1278	L	0.56340	1.77	0.58432	D	0.999998	P	0.38677	0.642	B	0.34779	0.189	T	0.52518	-0.8565	10	0.54805	T	0.06	-58.3163	16.3579	0.83243	0.0:0.0:1.0:0.0	.	476	O00459	P85B_HUMAN	I	476	ENSP00000222254:M476I	ENSP00000222254:M476I	M	+	3	0	PIK3R2	18137981	1.000000	0.71417	1.000000	0.80357	0.617000	0.37484	7.500000	0.81588	2.378000	0.81104	0.561000	0.74099	ATG		0.547	PIK3R2-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	nonsense_mediated_decay	protein_coding	OTTHUMT00000466386.2	NM_005027		Missense_Mutation
IL4I1	259307	broad.mit.edu	37	19	50399262	50399262	+	Missense_Mutation	SNP	G	G	C			TCGA-61-2111-01	TCGA-61-2111-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2111-01	TCGA-61-2111-11	g.chr19:50399262G>C	ENST00000391826.2	-	3	204	c.62C>G	c.(61-63)tCc>tGc	p.S21C	IL4I1_ENST00000595948.1_Missense_Mutation_p.S43C|IL4I1_ENST00000341114.3_Missense_Mutation_p.S43C	NM_152899.1	NP_690863.1	Q96RQ9	OXLA_HUMAN	interleukin 4 induced 1	21						extracellular region (GO:0005576)|lysosome (GO:0005764)	L-amino-acid oxidase activity (GO:0001716)	p.S43C(1)		endometrium(3)|large_intestine(3)|lung(6)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	16		all_lung(116;1.47e-05)|all_neural(266;0.0459)|Ovarian(192;0.0481)		GBM - Glioblastoma multiforme(134;0.00245)|OV - Ovarian serous cystadenocarcinoma(262;0.0169)	Flavin adenine dinucleotide(DB03147)	CCAGTCCTGGGAGGCCACCAG	0.632																																																1	Substitution - Missense(1)	ovary(1)	19											66.0	56.0	59.0					19																	50399262		2203	4300	6503	55091074	SO:0001583	missense	259307			AF293462	CCDS12786.1, CCDS12787.1	19q13.3-q13.4	2014-06-26				ENSG00000104951			19094	protein-coding gene	gene with protein product		609742				12031486	Standard	NM_152899		Approved	FIG1	uc002pqt.1	Q96RQ9		ENST00000391826.2:c.62C>G	19.37:g.50399262G>C	ENSP00000375702:p.Ser21Cys		55091074	Q1WMJ3|Q4GZN1|Q4GZN2|Q6P2Q3|Q8TEM5|Q96RQ8	Missense_Mutation	SNP	ENST00000391826.2	37	CCDS12787.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	12.71	2.018456	0.35606	.	.	ENSG00000104951	ENST00000341114;ENST00000391826	T;T	0.33654	1.4;1.41	5.07	4.03	0.46877	.	0.629307	0.17010	N	0.190562	T	0.50973	0.1647	M	0.62723	1.935	0.09310	N	1	D;D;D	0.71674	0.998;0.997;0.997	P;P;P	0.61874	0.895;0.788;0.788	T	0.36504	-0.9745	10	0.66056	D	0.02	-25.6001	9.8353	0.40966	0.0987:0.0:0.9013:0.0	.	43;43;21	Q96RQ9-2;Q1WMJ3;Q96RQ9	.;.;OXLA_HUMAN	C	43;21	ENSP00000342557:S43C;ENSP00000375702:S21C	ENSP00000342557:S43C	S	-	2	0	IL4I1	55091074	0.376000	0.25098	0.710000	0.30468	0.043000	0.13939	3.176000	0.50863	2.381000	0.81170	0.542000	0.68232	TCC		0.632	IL4I1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466413.1			Missense_Mutation
PPP2R1A	5518	broad.mit.edu	37	19	52715982	52715982	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2111-01	TCGA-61-2111-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2111-01	TCGA-61-2111-11	g.chr19:52715982C>T	ENST00000322088.6	+	5	605	c.547C>T	c.(547-549)Cgg>Tgg	p.R183W	PPP2R1A_ENST00000444322.2_Missense_Mutation_p.R128W|PPP2R1A_ENST00000462990.1_Missense_Mutation_p.R4W	NM_014225.5	NP_055040.2	P30153	2AAA_HUMAN	protein phosphatase 2, regulatory subunit A, alpha	183	PP2A subunit B binding.|Polyoma small and medium T antigens Binding.|SV40 small T antigen binding.				apoptotic process (GO:0006915)|ceramide metabolic process (GO:0006672)|chromosome segregation (GO:0007059)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|inactivation of MAPK activity (GO:0000188)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope reassembly (GO:0007084)|mRNA metabolic process (GO:0016071)|negative regulation of cell growth (GO:0030308)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine dephosphorylation (GO:0070262)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|protein complex assembly (GO:0006461)|protein dephosphorylation (GO:0006470)|regulation of cell adhesion (GO:0030155)|regulation of cell differentiation (GO:0045595)|regulation of DNA replication (GO:0006275)|regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|response to organic substance (GO:0010033)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|second-messenger-mediated signaling (GO:0019932)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)	antigen binding (GO:0003823)|protein heterodimerization activity (GO:0046982)|protein phosphatase type 2A regulator activity (GO:0008601)|protein serine/threonine phosphatase activity (GO:0004722)	p.R183W(22)|p.R183G(2)		NS(1)|breast(4)|cervix(2)|endometrium(62)|kidney(1)|large_intestine(7)|lung(21)|ovary(32)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	135				GBM - Glioblastoma multiforme(134;0.00456)|OV - Ovarian serous cystadenocarcinoma(262;0.015)		CATGGTGCGGCGGGCCGCAGC	0.617			Mis		clear cell ovarian carcinoma																																		Dom?	yes		19	19q13.41	5518	"""protein phosphatase 2, regulatory subunit A, alpha"""		E	24	Substitution - Missense(24)	ovary(16)|endometrium(4)|large_intestine(3)|pancreas(1)	19											69.0	57.0	61.0					19																	52715982		2203	4300	6503	57407794	SO:0001583	missense	5518				CCDS12849.1	19q13	2010-06-18	2010-04-14		ENSG00000105568	ENSG00000105568	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9302	protein-coding gene	gene with protein product	"""protein phosphatase 2A, regulatory subunit A, alpha isoform"", ""protein phosphatase 2, 65kDa regulatory subunit A"""	605983	"""protein phosphatase 2 (formerly 2A), regulatory subunit A (PR 65), alpha isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit A, alpha isoform"""				Standard	NR_033500		Approved	PR65A, PP2A-Aalpha	uc002pyp.3	P30153	OTTHUMG00000137367	ENST00000322088.6:c.547C>T	19.37:g.52715982C>T	ENSP00000324804:p.Arg183Trp		57407794	Q13773|Q6ICQ3|Q96DH3	Missense_Mutation	SNP	ENST00000322088.6	37	CCDS12849.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	23.0	4.360081	0.82353	.	.	ENSG00000105568	ENST00000423369;ENST00000391791;ENST00000322088;ENST00000444322	T;T	0.06528	3.29;3.29	4.5	4.5	0.54988	Armadillo-like helical (1);Armadillo-type fold (1);	0.114427	0.37136	N	0.002231	T	0.34193	0.0889	H	0.96333	3.805	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.997;0.997	T	0.40459	-0.9562	10	0.87932	D	0	-15.4468	10.2034	0.43099	0.1981:0.8019:0.0:0.0	.	128;183;183	F5H3X9;A8K7B7;P30153	.;.;2AAA_HUMAN	W	173;103;183;128	ENSP00000324804:R183W;ENSP00000415067:R128W	ENSP00000324804:R183W	R	+	1	2	PPP2R1A	57407794	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	4.933000	0.63484	2.503000	0.84419	0.655000	0.94253	CGG		0.617	PPP2R1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000267967.2	NM_014225		Missense_Mutation
YIPF4	84272	broad.mit.edu	37	2	32517297	32517297	+	Silent	SNP	T	T	C			TCGA-61-2111-01	TCGA-61-2111-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2111-01	TCGA-61-2111-11	g.chr2:32517297T>C	ENST00000238831.4	+	3	531	c.285T>C	c.(283-285)gtT>gtC	p.V95V		NM_032312.3	NP_115688.1	Q9BSR8	YIPF4_HUMAN	Yip1 domain family, member 4	95						endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)				kidney(2)|lung(3)|prostate(3)|skin(1)	9	Acute lymphoblastic leukemia(172;0.155)					TCCGATGTGTTTTGATGCCAA	0.343																																																0			2											116.0	112.0	113.0					2																	32517297		2203	4300	6503	32370801	SO:0001819	synonymous_variant	84272			AK098486	CCDS1781.1	2p22.3	2008-02-05			ENSG00000119820	ENSG00000119820		"""Yip1 domain family"""	28145	protein-coding gene	gene with protein product						12477932	Standard	NM_032312		Approved	MGC11061, FinGER4	uc002rok.3	Q9BSR8	OTTHUMG00000128452	ENST00000238831.4:c.285T>C	2.37:g.32517297T>C			32370801		Silent	SNP	ENST00000238831.4	37	CCDS1781.1	SNP	64	Broad																																																																																				0.343	YIPF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250250.3	NM_032312		Silent
SNRNP200	23020	broad.mit.edu	37	2	96949058	96949058	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2111-01	TCGA-61-2111-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2111-01	TCGA-61-2111-11	g.chr2:96949058G>A	ENST00000323853.5	-	34	4873	c.4796C>T	c.(4795-4797)cCg>cTg	p.P1599L	SNRNP200_ENST00000349783.5_Intron	NM_014014.4	NP_054733.2	O75643	U520_HUMAN	small nuclear ribonucleoprotein 200kDa (U5)	1599	Helicase C-terminal 2. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)|cis assembly of pre-catalytic spliceosome (GO:0000354)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U5 snRNP (GO:0005682)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|ATP-dependent RNA helicase activity (GO:0004004)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(18)|lung(37)|ovary(7)|prostate(4)|skin(5)|stomach(1)|urinary_tract(1)	90						CTCCAGGTACGGAATCAGATC	0.572																																																0			2											102.0	80.0	87.0					2																	96949058		2203	4300	6503	96312785	SO:0001583	missense	23020			AL831994	CCDS2020.1	2q11.2	2013-05-13	2008-10-29	2008-10-29	ENSG00000144028	ENSG00000144028			30859	protein-coding gene	gene with protein product	"""U5 snRNP specific protein, 200 KD"""	601664	"""activating signal cointegrator 1 complex subunit 3-like 1"", ""retinitis pigmentosa 33 (autosomal dominant)"""	ASCC3L1, RP33		9872452, 8670905, 9774689, 9539711, 16612614, 19878916	Standard	NM_014014		Approved	U5-200KD, HELIC2, KIAA0788, BRR2	uc002svu.3	O75643	OTTHUMG00000130455	ENST00000323853.5:c.4796C>T	2.37:g.96949058G>A	ENSP00000317123:p.Pro1599Leu		96312785	O94884|Q6NZY0|Q6PX59|Q8NBE6|Q96IF2|Q9H7S0	Missense_Mutation	SNP	ENST00000323853.5	37	CCDS2020.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	14.30	2.493767	0.44352	.	.	ENSG00000144028	ENST00000323853;ENST00000536601;ENST00000543553	D	0.90197	-2.63	4.6	2.75	0.32379	Helicase, C-terminal (1);	0.058300	0.64402	D	0.000002	D	0.88629	0.6488	M	0.81942	2.565	0.80722	D	1	D;B	0.54601	0.967;0.015	B;B	0.38683	0.279;0.006	D	0.87518	0.2444	10	0.87932	D	0	-19.4683	10.5401	0.45029	0.0:0.1448:0.7049:0.1503	.	1350;1599	A4FU77;O75643	.;U520_HUMAN	L	1599;58;182	ENSP00000317123:P1599L	ENSP00000317123:P1599L	P	-	2	0	SNRNP200	96312785	1.000000	0.71417	0.593000	0.28771	0.158000	0.22134	9.138000	0.94501	0.647000	0.30713	-0.188000	0.12872	CCG		0.572	SNRNP200-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252846.2	NM_014014		Missense_Mutation
IL18R1	8809	broad.mit.edu	37	2	103013236	103013236	+	Missense_Mutation	SNP	C	C	G			TCGA-61-2111-01	TCGA-61-2111-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2111-01	TCGA-61-2111-11	g.chr2:103013236C>G	ENST00000409599.1	+	12	1872	c.1516C>G	c.(1516-1518)Ctt>Gtt	p.L506V	IL18R1_ENST00000233957.1_Missense_Mutation_p.L506V			Q13478	IL18R_HUMAN	interleukin 18 receptor 1	506	TIR. {ECO:0000255|PROSITE- ProRule:PRU00204}.				immune response (GO:0006955)|natural killer cell activation (GO:0030101)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|signal transduction (GO:0007165)|T-helper 1 cell differentiation (GO:0045063)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-1 receptor activity (GO:0004908)|interleukin-18 receptor activity (GO:0042008)|receptor activity (GO:0004872)	p.L506V(1)		breast(1)|endometrium(3)|large_intestine(11)|lung(12)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34						CGATAAATCTCTTTCTTATAA	0.403																																																1	Substitution - Missense(1)	ovary(1)	2											77.0	84.0	82.0					2																	103013236		2203	4300	6503	102379668	SO:0001583	missense	8809			U43672	CCDS2060.1	2q12	2013-01-29			ENSG00000115604	ENSG00000115604		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5988	protein-coding gene	gene with protein product		604494				8626725, 10191101	Standard	NM_003855		Approved	IL1RRP, IL-1Rrp, CD218a	uc010fiy.3	Q13478	OTTHUMG00000130780	ENST00000409599.1:c.1516C>G	2.37:g.103013236C>G	ENSP00000387211:p.Leu506Val		102379668	B2R9Y5|Q52LC9	Missense_Mutation	SNP	ENST00000409599.1	37	CCDS2060.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	6.329	0.428715	0.11987	.	.	ENSG00000115604	ENST00000410040;ENST00000409599;ENST00000233957	T;T;T	0.07327	3.2;3.2;3.2	5.13	4.24	0.50183	Toll/interleukin-1 receptor homology (TIR) domain (4);	0.334410	0.25912	N	0.027493	T	0.06462	0.0166	N	0.11341	0.13	0.80722	D	1	P;P	0.40970	0.734;0.734	P;P	0.46796	0.527;0.527	T	0.50939	-0.8768	10	0.15066	T	0.55	.	10.3415	0.43882	0.0:0.7893:0.1368:0.0739	.	505;506	B7ZKV7;Q13478	.;IL18R_HUMAN	V	506	ENSP00000386663:L506V;ENSP00000387211:L506V;ENSP00000233957:L506V	ENSP00000233957:L506V	L	+	1	0	IL18R1	102379668	0.997000	0.39634	0.046000	0.18839	0.043000	0.13939	2.787000	0.47798	1.271000	0.44313	0.563000	0.77884	CTT		0.403	IL18R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253294.2	NM_003855		Missense_Mutation
GRB14	2888	broad.mit.edu	37	2	165349666	165349666	+	Silent	SNP	G	G	A			TCGA-61-2111-01	TCGA-61-2111-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2111-01	TCGA-61-2111-11	g.chr2:165349666G>A	ENST00000263915.3	-	14	2041	c.1503C>T	c.(1501-1503)caC>caT	p.H501H	GRB14_ENST00000543549.1_Silent_p.H414H|GRB14_ENST00000497306.1_5'UTR	NM_004490.2	NP_004481.2	Q14449	GRB14_HUMAN	growth factor receptor-bound protein 14	501	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				blood coagulation (GO:0007596)|leukocyte migration (GO:0050900)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)	p.H501H(1)		breast(3)|endometrium(2)|large_intestine(6)|lung(10)|ovary(7)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	32						CATCCAGTGTGTGGAACATTT	0.373																																																1	Substitution - coding silent(1)	ovary(1)	2											99.0	114.0	109.0					2																	165349666		2203	4300	6503	165057912	SO:0001819	synonymous_variant	2888				CCDS2222.1	2q22-q24	2013-02-14			ENSG00000115290	ENSG00000115290		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	4565	protein-coding gene	gene with protein product		601524				8812444	Standard	XM_005246477		Approved		uc002ucl.3	Q14449	OTTHUMG00000132135	ENST00000263915.3:c.1503C>T	2.37:g.165349666G>A			165057912	B7Z7F9|Q7Z6I1	Silent	SNP	ENST00000263915.3	37	CCDS2222.1	SNP	48	Broad																																																																																				0.373	GRB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255180.2			Silent
CCDC141	285025	broad.mit.edu	37	2	179702417	179702417	+	Silent	SNP	G	G	A	rs373773937		TCGA-61-2111-01	TCGA-61-2111-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2111-01	TCGA-61-2111-11	g.chr2:179702417G>A	ENST00000420890.2	-	23	3646	c.3529C>T	c.(3529-3531)Cta>Tta	p.L1177L	CCDC141_ENST00000295723.5_Silent_p.L602L|CCDC141_ENST00000480419.1_5'UTR	NM_173648.3	NP_775919.3	Q6ZP82	CC141_HUMAN	coiled-coil domain containing 141	1177								p.L602L(1)		NS(2)|breast(1)|endometrium(5)|kidney(1)|large_intestine(17)|lung(37)|ovary(8)|pancreas(2)|skin(4)|upper_aerodigestive_tract(1)	78			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.0531)|all cancers(119;0.147)			TCTTGTGGTAGTCGCTCTTCC	0.493																																																1	Substitution - coding silent(1)	ovary(1)	2											89.0	89.0	89.0					2																	179702417		2203	4300	6503	179410662	SO:0001819	synonymous_variant	285025			AK096821		2q31.2	2013-01-14			ENSG00000163492	ENSG00000163492		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	26821	protein-coding gene	gene with protein product	"""coiled-coil protein associated with myosin II and DISC1"""					20956536	Standard	NM_173648		Approved	FLJ39502, CAMDI	uc002une.2	Q6ZP82	OTTHUMG00000132578	ENST00000420890.2:c.3529C>T	2.37:g.179702417G>A			179410662	H7C0P1|J3KNW6|Q8N8H3	Silent	SNP	ENST00000420890.2	37		SNP	36	Broad																																																																																				0.493	CCDC141-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_173648		Silent
LANCL1	10314	broad.mit.edu	37	2	211299245	211299245	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2111-01	TCGA-61-2111-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2111-01	TCGA-61-2111-11	g.chr2:211299245G>A	ENST00000443314.1	-	9	1508	c.1166C>T	c.(1165-1167)cCc>cTc	p.P389L	LANCL1_ENST00000450366.2_Missense_Mutation_p.P389L|LANCL1_ENST00000431941.2_Missense_Mutation_p.P389L|AC007970.1_ENST00000433296.1_RNA|LANCL1_ENST00000441020.3_Missense_Mutation_p.P389L|AC007970.1_ENST00000420418.1_RNA|LANCL1_ENST00000233714.4_Missense_Mutation_p.P389L			O43813	LANC1_HUMAN	LanC lantibiotic synthetase component C-like 1 (bacterial)	389					G-protein coupled receptor signaling pathway (GO:0007186)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|G-protein coupled receptor activity (GO:0004930)|glutathione binding (GO:0043295)|low-density lipoprotein particle receptor binding (GO:0050750)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			breast(1)|large_intestine(5)|liver(1)|lung(4)|prostate(1)	12				Epithelial(149;0.00562)|Lung(261;0.0468)|LUSC - Lung squamous cell carcinoma(261;0.0495)|all cancers(144;0.0569)		GGCTTTTGTGGGGACTAGCAG	0.433																																																0			2											108.0	109.0	109.0					2																	211299245		2203	4300	6503	211007490	SO:0001583	missense	10314			Y11395	CCDS2392.1	2q33-q35	2008-05-23	2001-12-04		ENSG00000115365	ENSG00000115365			6508	protein-coding gene	gene with protein product		604155	"""LanC (bacterial lantibiotic synthetase component C)-like 1"""	GPR69A		9512664	Standard	NM_001136574		Approved	p40	uc010zjh.2	O43813	OTTHUMG00000132991	ENST00000443314.1:c.1166C>T	2.37:g.211299245G>A	ENSP00000388713:p.Pro389Leu		211007490		Missense_Mutation	SNP	ENST00000443314.1	37	CCDS2392.1	SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	G	35	5.575010	0.96553	.	.	ENSG00000115365	ENST00000443314;ENST00000441020;ENST00000450366;ENST00000233714;ENST00000431941	T;T;T;T;T	0.53423	0.62;0.62;0.62;0.62;0.62	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.78710	0.4326	M	0.93328	3.405	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.83184	-0.0087	10	0.72032	D	0.01	.	20.2191	0.98319	0.0:0.0:1.0:0.0	.	389	O43813	LANC1_HUMAN	L	389	ENSP00000388713:P389L;ENSP00000393323:P389L;ENSP00000393597:P389L;ENSP00000233714:P389L;ENSP00000397646:P389L	ENSP00000233714:P389L	P	-	2	0	LANCL1	211007490	1.000000	0.71417	0.989000	0.46669	0.988000	0.76386	9.437000	0.97535	2.780000	0.95670	0.655000	0.94253	CCC		0.433	LANCL1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336817.1	NM_006055		Missense_Mutation
OR6B3	150681	broad.mit.edu	37	2	240985328	240985328	+	Silent	SNP	G	G	T			TCGA-61-2111-01	TCGA-61-2111-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2111-01	TCGA-61-2111-11	g.chr2:240985328G>T	ENST00000319423.4	-	1	161	c.162C>A	c.(160-162)tcC>tcA	p.S54S	PRR21_ENST00000408934.1_5'Flank	NM_173351.1	NP_775486.1	Q8NGW1	OR6B3_HUMAN	olfactory receptor, family 6, subfamily B, member 3	54						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(10)|lung(4)|ovary(2)|prostate(1)	18		all_epithelial(40;1.64e-11)|Breast(86;0.000327)|Renal(207;0.00571)|Ovarian(221;0.104)|all_hematologic(139;0.182)|all_lung(227;0.229)|Melanoma(123;0.238)		Epithelial(121;1.05e-29)|all cancers(36;3.52e-28)|OV - Ovarian serous cystadenocarcinoma(60;4.63e-14)|Kidney(56;2.99e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.56e-05)|Lung(119;0.00344)|LUSC - Lung squamous cell carcinoma(224;0.0148)|Colorectal(34;0.019)|COAD - Colon adenocarcinoma(134;0.141)		GCCTGTGGAGGGAGGTGCTGC	0.567																																																0			2											69.0	79.0	75.0					2																	240985328		2035	4187	6222	240634001	SO:0001819	synonymous_variant	150681				CCDS42837.1	2q37.3	2013-09-23	2002-11-13	2002-11-15	ENSG00000178586	ENSG00000178586		"""GPCR / Class A : Olfactory receptors"""	15042	protein-coding gene	gene with protein product			"""olfactory receptor, family 6, subfamily B, member 3 pseudogene"""	OR6B3P			Standard	NM_173351		Approved	OR6B3Q	uc010zoe.2	Q8NGW1	OTTHUMG00000152399	ENST00000319423.4:c.162C>A	2.37:g.240985328G>T			240634001	Q6IFH3	Silent	SNP	ENST00000319423.4	37	CCDS42837.1	SNP	43	Broad																																																																																				0.567	OR6B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326078.1			Silent
ANO7	50636	broad.mit.edu	37	2	242149886	242149886	+	Missense_Mutation	SNP	T	T	G			TCGA-61-2111-01	TCGA-61-2111-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2111-01	TCGA-61-2111-11	g.chr2:242149886T>G	ENST00000274979.8	+	15	1727	c.1624T>G	c.(1624-1626)Tct>Gct	p.S542A	ANO7_ENST00000402430.3_Missense_Mutation_p.S541A	NM_001001891.3	NP_001001891.2	Q6IWH7	ANO7_HUMAN	anoctamin 7	542					calcium activated galactosylceramide scrambling (GO:0061591)|calcium activated phosphatidylcholine scrambling (GO:0061590)|calcium activated phosphatidylserine scrambling (GO:0061589)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)|phospholipid scramblase activity (GO:0017128)			NS(1)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(14)|pancreas(2)|prostate(1)|skin(3)|urinary_tract(2)	32						CCGTTAGGCCTCTCGCATCGC	0.642																																																0			2											95.0	81.0	86.0					2																	242149886		2203	4300	6503	241798559	SO:0001583	missense	50636			AY617079	CCDS33423.1, CCDS46563.1	2q37.3	2014-04-09	2008-08-28	2008-08-28	ENSG00000146205	ENSG00000146205		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	31677	protein-coding gene	gene with protein product		605096	"""transmembrane protein 16G"""	PCANAP5, TMEM16G		14981236, 15375614, 24692353	Standard	NM_001001891		Approved	NGEP, PCANAP5L, IPCA-5	uc002wax.2	Q6IWH7	OTTHUMG00000151702	ENST00000274979.8:c.1624T>G	2.37:g.242149886T>G	ENSP00000274979:p.Ser542Ala		241798559	Q6IWH6	Missense_Mutation	SNP	ENST00000274979.8	37	CCDS33423.1	SNP	54	Broad	.	.	.	.	.	.	.	.	.	.	T	10.70	1.424286	0.25639	.	.	ENSG00000146205	ENST00000274979;ENST00000402430	T;T	0.63096	-0.02;-0.02	3.49	-6.98	0.01611	.	0.960325	0.08533	N	0.931797	T	0.44767	0.1309	L	0.45352	1.415	0.09310	N	1	B	0.14012	0.009	B	0.20384	0.029	T	0.44772	-0.9306	10	0.08381	T	0.77	.	10.0462	0.42188	0.0:0.0892:0.6283:0.2825	.	542	Q6IWH7	ANO7_HUMAN	A	542;541	ENSP00000274979:S542A;ENSP00000385418:S541A	ENSP00000274979:S542A	S	+	1	0	ANO7	241798559	0.000000	0.05858	0.000000	0.03702	0.087000	0.18053	-0.123000	0.10611	-0.968000	0.03578	0.260000	0.18958	TCT		0.642	ANO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323509.1	NM_001001891		Missense_Mutation
VSTM2L	128434	broad.mit.edu	37	20	36572444	36572444	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2111-01	TCGA-61-2111-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2111-01	TCGA-61-2111-11	g.chr20:36572444C>T	ENST00000373461.4	+	4	651	c.404C>T	c.(403-405)aCg>aTg	p.T135M	VSTM2L_ENST00000373458.3_Missense_Mutation_p.T118M|VSTM2L_ENST00000373459.4_Silent_p.H61H	NM_080607.2	NP_542174.1	Q96N03	VTM2L_HUMAN	V-set and transmembrane domain containing 2 like	135	Ig-like.							p.T135M(1)		central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(4)|ovary(1)|skin(1)	8		Myeloproliferative disorder(115;0.00878)				GTGAAGCCCACGGACGAAGGC	0.647																																																1	Substitution - Missense(1)	ovary(1)	20											57.0	38.0	45.0					20																	36572444		2203	4300	6503	36005858	SO:0001583	missense	128434			AL109964	CCDS13299.1	20q11.23	2013-01-11	2007-08-10	2007-08-10	ENSG00000132821	ENSG00000132821		"""Immunoglobulin superfamily / V-set domain containing"""	16096	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 102"""	C20orf102			Standard	NM_080607		Approved	dJ1118M15.2	uc002xhk.4	Q96N03	OTTHUMG00000032430	ENST00000373461.4:c.404C>T	20.37:g.36572444C>T	ENSP00000362560:p.Thr135Met		36005858	E1P5V7|Q5JWZ4|Q5JWZ5|Q8ND45|Q9BR37	Missense_Mutation	SNP	ENST00000373461.4	37	CCDS13299.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	21.0	4.083577	0.76642	.	.	ENSG00000132821	ENST00000373458;ENST00000373461;ENST00000448944	T;T;T	0.28255	1.62;1.62;1.62	5.44	5.44	0.79542	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.111045	0.64402	D	0.000006	T	0.41650	0.1168	L	0.50333	1.59	0.37039	D	0.897056	D	0.67145	0.996	P	0.53722	0.733	T	0.46062	-0.9218	10	0.54805	T	0.06	-26.7824	14.745	0.69483	0.1449:0.8551:0.0:0.0	.	135	Q96N03	VTM2L_HUMAN	M	118;135;118	ENSP00000362557:T118M;ENSP00000362560:T135M;ENSP00000406537:T118M	ENSP00000362557:T118M	T	+	2	0	VSTM2L	36005858	0.995000	0.38212	1.000000	0.80357	0.984000	0.73092	3.052000	0.49893	2.550000	0.86006	0.462000	0.41574	ACG		0.647	VSTM2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079133.1			Missense_Mutation
KRTAP13-1	140258	broad.mit.edu	37	21	31768590	31768590	+	Missense_Mutation	SNP	G	G	T			TCGA-61-2111-01	TCGA-61-2111-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2111-01	TCGA-61-2111-11	g.chr21:31768590G>T	ENST00000355459.2	+	1	199	c.186G>T	c.(184-186)gaG>gaT	p.E62D		NM_181599.2	NP_853630.2	Q8IUC0	KR131_HUMAN	keratin associated protein 13-1	62	5 X 10 AA approximate repeats.					intermediate filament (GO:0005882)		p.E62D(1)		endometrium(1)|kidney(2)|large_intestine(3)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						CCTGCTGGGAGCCCACCAGCT	0.612																																																1	Substitution - Missense(1)	ovary(1)	21											58.0	59.0	59.0					21																	31768590		2203	4300	6503	30690461	SO:0001583	missense	140258			AJ457066	CCDS13590.2	21q22.11	2013-06-20			ENSG00000198390	ENSG00000198390		"""Keratin associated proteins"""	18924	protein-coding gene	gene with protein product		608718				12359730	Standard	NM_181599		Approved	KAP13.1	uc002yoa.3	Q8IUC0	OTTHUMG00000057800	ENST00000355459.2:c.186G>T	21.37:g.31768590G>T	ENSP00000347635:p.Glu62Asp		30690461	Q14D20|Q3LI79	Missense_Mutation	SNP	ENST00000355459.2	37	CCDS13590.2	SNP	34	Broad	.	.	.	.	.	.	.	.	.	.	G	14.12	2.442049	0.43326	.	.	ENSG00000198390	ENST00000355459	T	0.08458	3.09	4.51	0.72	0.18214	.	0.341119	0.20447	N	0.092171	T	0.11495	0.0280	M	0.83953	2.67	0.09310	N	1	B	0.22746	0.074	B	0.24701	0.055	T	0.20940	-1.0260	10	0.56958	D	0.05	.	4.3628	0.11210	0.3621:0.1599:0.478:0.0	.	62	Q8IUC0	KR131_HUMAN	D	62	ENSP00000347635:E62D	ENSP00000347635:E62D	E	+	3	2	KRTAP13-1	30690461	0.000000	0.05858	0.108000	0.21378	0.236000	0.25371	-0.813000	0.04491	0.119000	0.18210	0.557000	0.71058	GAG		0.612	KRTAP13-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128252.3			Missense_Mutation
MN1	4330	broad.mit.edu	37	22	28194044	28194044	+	Missense_Mutation	SNP	T	T	C			TCGA-61-2111-01	TCGA-61-2111-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2111-01	TCGA-61-2111-11	g.chr22:28194044T>C	ENST00000302326.4	-	1	3442	c.2488A>G	c.(2488-2490)Acc>Gcc	p.T830A		NM_002430.2	NP_002421.3	Q10571	MN1_HUMAN	meningioma (disrupted in balanced translocation) 1	830					intramembranous ossification (GO:0001957)			p.T830A(1)		NS(1)|breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(6)|lung(15)|ovary(3)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	45						TGGCAAGCGGTGGAGAGCGCA	0.612			T	ETV6	"""AML, meningioma"""																																		Dom	yes		22	22q13	4330	meningioma (disrupted in balanced translocation) 1		"""L, O"""	1	Substitution - Missense(1)	ovary(1)	22											57.0	66.0	63.0					22																	28194044		1961	4136	6097	26524044	SO:0001583	missense	4330			X82209	CCDS42998.1	22q12.1	2010-09-29			ENSG00000169184	ENSG00000169184			7180	protein-coding gene	gene with protein product	"""probable tumor suppressor protein MN1"""	156100	"""meningioma chromosome region"""	MGCR		7731706, 12569362	Standard	NM_002430		Approved	MGCR1-PEN, MGCR1	uc003adj.3	Q10571	OTTHUMG00000150975	ENST00000302326.4:c.2488A>G	22.37:g.28194044T>C	ENSP00000304956:p.Thr830Ala		26524044	A9Z1V9	Missense_Mutation	SNP	ENST00000302326.4	37	CCDS42998.1	SNP	59	Broad	.	.	.	.	.	.	.	.	.	.	T	18.73	3.686612	0.68157	.	.	ENSG00000169184	ENST00000302326	T	0.58506	0.33	3.74	3.74	0.42951	.	0.000000	0.85682	D	0.000000	T	0.62429	0.2427	L	0.29908	0.895	0.46149	D	0.998897	D	0.67145	0.996	D	0.77557	0.99	T	0.63207	-0.6689	10	0.48119	T	0.1	-12.4296	11.4387	0.50083	0.0:0.0:0.0:1.0	.	830	Q10571	MN1_HUMAN	A	830	ENSP00000304956:T830A	ENSP00000304956:T830A	T	-	1	0	MN1	26524044	1.000000	0.71417	0.995000	0.50966	0.997000	0.91878	5.064000	0.64338	1.567000	0.49668	0.379000	0.24179	ACC		0.612	MN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320737.1	NM_002430		Missense_Mutation
MYH9	4627	broad.mit.edu	37	22	36696211	36696211	+	Nonsense_Mutation	SNP	G	G	A			TCGA-61-2111-01	TCGA-61-2111-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2111-01	TCGA-61-2111-11	g.chr22:36696211G>A	ENST00000216181.5	-	23	3168	c.2938C>T	c.(2938-2940)Cag>Tag	p.Q980*		NM_002473.4	NP_002464.1	P35579	MYH9_HUMAN	myosin, heavy chain 9, non-muscle	980					actin cytoskeleton reorganization (GO:0031532)|actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|angiogenesis (GO:0001525)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood vessel endothelial cell migration (GO:0043534)|cytokinesis (GO:0000910)|establishment of meiotic spindle localization (GO:0051295)|establishment of T cell polarity (GO:0001768)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|meiotic spindle organization (GO:0000212)|membrane protein ectodomain proteolysis (GO:0006509)|monocyte differentiation (GO:0030224)|myoblast fusion (GO:0007520)|platelet aggregation (GO:0070527)|platelet formation (GO:0030220)|protein transport (GO:0015031)|regulation of cell shape (GO:0008360)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|uropod organization (GO:0032796)	actin cytoskeleton (GO:0015629)|actomyosin (GO:0042641)|actomyosin contractile ring (GO:0005826)|cell leading edge (GO:0031252)|cell-cell adherens junction (GO:0005913)|cleavage furrow (GO:0032154)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle (GO:0001726)|spindle (GO:0005819)|stress fiber (GO:0001725)|uropod (GO:0001931)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)|protein anchor (GO:0043495)|protein homodimerization activity (GO:0042803)	p.Q980*(1)		NS(1)|breast(8)|central_nervous_system(3)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(16)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(3)	86						AGGATGATCTGCTCCTCCTCC	0.647			T	ALK	ALCL		"""Deafness, autosomal dominant 17, Epstein syndrome, Fechtner syndrome, May-Hegglin anomaly, Sebastian syndrome"""		Hereditary Macrothrombocytopenia, MYH9-associated																														Dom	yes		22	22q13.1	4627	"""myosin, heavy polypeptide 9, non-muscle"""	yes	L	1	Substitution - Nonsense(1)	ovary(1)	22											97.0	85.0	89.0					22																	36696211		2203	4300	6503	35026157	SO:0001587	stop_gained	4627	Familial Cancer Database	MYHIIA syndrome, incl. Fechtner Syndrome, FTNS, and May-Hegglin Anomaly, MHA		CCDS13927.1	22q13.1	2014-09-17	2006-09-29		ENSG00000100345	ENSG00000100345		"""Myosins / Myosin superfamily : Class II"""	7579	protein-coding gene	gene with protein product	"""nonmuscle myosin heavy chain II-A"""	160775	"""myosin, heavy polypeptide 9, non-muscle"""	DFNA17		1860190, 11023810	Standard	NM_002473		Approved	NMMHCA, NMHC-II-A, MHA, FTNS, EPSTS	uc003apg.3	P35579	OTTHUMG00000030429	ENST00000216181.5:c.2938C>T	22.37:g.36696211G>A	ENSP00000216181:p.Gln980*		35026157	A8K6E4|O60805|Q60FE2|Q86T83	Nonsense_Mutation	SNP	ENST00000216181.5	37	CCDS13927.1	SNP	46	Broad	.	.	.	.	.	.	.	.	.	.	G	43	9.972419	0.99308	.	.	ENSG00000100345	ENST00000216181	.	.	.	5.63	4.59	0.56863	.	0.211098	0.37715	N	0.001964	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	10.9924	0.47557	0.0:0.2511:0.6243:0.1246	.	.	.	.	X	980	.	ENSP00000216181:Q980X	Q	-	1	0	MYH9	35026157	0.831000	0.29352	1.000000	0.80357	0.955000	0.61496	1.315000	0.33608	1.326000	0.45319	0.655000	0.94253	CAG		0.647	MYH9-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000259110.3	NM_002473		Nonsense_Mutation
MSANTD1	345222	broad.mit.edu	37	4	3255148	3255148	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2111-01	TCGA-61-2111-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2111-01	TCGA-61-2111-11	g.chr4:3255148G>A	ENST00000438480.2	+	2	2282	c.535G>A	c.(535-537)Gaa>Aaa	p.E179K	MSANTD1_ENST00000507492.1_Missense_Mutation_p.E166K|MSANTD1_ENST00000510580.1_Missense_Mutation_p.E179K	NM_001042690.1	NP_001036155.1	Q6ZTZ1	MSD1_HUMAN	Myb/SANT-like DNA-binding domain containing 1	179										endometrium(1)|lung(2)	3						GTGCTCCTACGAAGGCCGCTT	0.627																																																0			4											137.0	127.0	130.0					4																	3255148		2203	4300	6503	3224946	SO:0001583	missense	345222				CCDS47003.1	4p16.2	2012-03-02	2012-03-02	2012-03-02	ENSG00000188981	ENSG00000188981			33741	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 44"""	C4orf44			Standard	NM_001042690		Approved	LOC345222	uc003ggs.3	Q6ZTZ1	OTTHUMG00000159977	ENST00000438480.2:c.535G>A	4.37:g.3255148G>A	ENSP00000411584:p.Glu179Lys		3224946	C9J6V0	Missense_Mutation	SNP	ENST00000438480.2	37	CCDS47003.1	SNP	37	Broad	.	.	.	.	.	.	.	.	.	.	G	30	5.055505	0.93793	.	.	ENSG00000188981	ENST00000507492;ENST00000438480;ENST00000510580	.	.	.	5.31	5.31	0.75309	.	0.136685	0.47455	D	0.000233	T	0.76557	0.4004	L	0.57536	1.79	0.58432	D	0.99999	D;D	0.89917	1.0;1.0	D;D	0.73708	0.981;0.981	T	0.77534	-0.2552	9	0.56958	D	0.05	.	18.0228	0.89260	0.0:0.0:1.0:0.0	.	179;179	D6RD98;Q6ZTZ1	.;CD044_HUMAN	K	166;179;179	.	ENSP00000411584:E179K	E	+	1	0	C4orf44	3224946	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	7.039000	0.76544	2.501000	0.84356	0.558000	0.71614	GAA		0.627	MSANTD1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370924.1	NM_001012982		Missense_Mutation
PPP2R2C	5522	broad.mit.edu	37	4	6374266	6374266	+	Silent	SNP	G	G	T			TCGA-61-2111-01	TCGA-61-2111-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2111-01	TCGA-61-2111-11	g.chr4:6374266G>T	ENST00000382599.4	-	5	825	c.609C>A	c.(607-609)atC>atA	p.I203I	PPP2R2C_ENST00000314348.8_5'UTR|PPP2R2C_ENST00000335585.5_Silent_p.I203I|PPP2R2C_ENST00000507294.1_Silent_p.I196I|PPP2R2C_ENST00000506140.1_Silent_p.I196I|PPP2R2C_ENST00000515571.1_Silent_p.I186I			Q9Y2T4	2ABG_HUMAN	protein phosphatase 2, regulatory subunit B, gamma	203					regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)	p.I203I(1)		central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	28						TCCTGTCGGTGATGGCCAGGT	0.577																																																1	Substitution - coding silent(1)	ovary(1)	4											157.0	125.0	136.0					4																	6374266		2203	4300	6503	6425167	SO:0001819	synonymous_variant	5522			AF086924	CCDS3388.1, CCDS56304.1, CCDS56305.1, CCDS3387.1	4p16.1	2013-01-10	2010-04-14		ENSG00000074211	ENSG00000074211	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""WD repeat domain containing"""	9306	protein-coding gene	gene with protein product	"""PP2A subunit B isoform gamma"""	605997	"""protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), gamma isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B, gamma isoform"""			10574460, 10945473	Standard	NM_020416		Approved	PR52, IMYPNO, MGC33570, PR55G	uc003gja.3	Q9Y2T4	OTTHUMG00000090445	ENST00000382599.4:c.609C>A	4.37:g.6374266G>T			6425167	A8MSY7|B7Z3Y1|Q7Z4V7|Q8NEC4|Q9H3G7	Silent	SNP	ENST00000382599.4	37		SNP	45	Broad																																																																																				0.577	PPP2R2C-001	NOVEL	overlapping_uORF|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000206889.2	NM_181876		Silent
DNAH5	1767	broad.mit.edu	37	5	13770873	13770873	+	Missense_Mutation	SNP	C	C	T	rs573476401	byFrequency	TCGA-61-2111-01	TCGA-61-2111-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2111-01	TCGA-61-2111-11	g.chr5:13770873C>T	ENST00000265104.4	-	56	9694	c.9590G>A	c.(9589-9591)cGg>cAg	p.R3197Q	DNAH5_ENST00000504001.3_5'UTR	NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	3197	Stalk. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.R3197Q(2)		NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					GGCCAGGGTCCGCACCTCCAC	0.458									Kartagener syndrome				T|||	2	0.000399361	0.0	0.0	5008	,	,		19892	0.0		0.0	False		,,,				2504	0.002															2	Substitution - Missense(2)	ovary(2)	5											84.0	78.0	80.0					5																	13770873		2203	4300	6503	13823873	SO:0001583	missense	1767	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.9590G>A	5.37:g.13770873C>T	ENSP00000265104:p.Arg3197Gln		13823873	Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	ENST00000265104.4	37	CCDS3882.1	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	T	8.380	0.837376	0.16891	.	.	ENSG00000039139	ENST00000265104	T	0.21543	2.0	5.81	3.43	0.39272	.	0.292466	0.38605	N	0.001629	T	0.04588	0.0125	N	0.00277	-1.72	0.21579	N	0.999637	B	0.02656	0.0	B	0.01281	0.0	T	0.40683	-0.9550	10	0.12430	T	0.62	.	9.7652	0.40557	0.0:0.1948:0.0:0.8052	.	3197	Q8TE73	DYH5_HUMAN	Q	3197	ENSP00000265104:R3197Q	ENSP00000265104:R3197Q	R	-	2	0	DNAH5	13823873	1.000000	0.71417	0.996000	0.52242	0.720000	0.41350	1.834000	0.39171	0.131000	0.18576	-0.254000	0.11334	CGG		0.458	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369		Missense_Mutation
GIN1	54826	broad.mit.edu	37	5	102423841	102423841	+	Missense_Mutation	SNP	C	C	G			TCGA-61-2111-01	TCGA-61-2111-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2111-01	TCGA-61-2111-11	g.chr5:102423841C>G	ENST00000399004.2	-	8	1424	c.1330G>C	c.(1330-1332)Gat>Cat	p.D444H	GIN1_ENST00000508629.1_3'UTR	NM_017676.2	NP_060146.2	Q9NXP7	GIN1_HUMAN	gypsy retrotransposon integrase 1	444					DNA integration (GO:0015074)		nucleic acid binding (GO:0003676)	p.D444H(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		all_cancers(142;3.23e-07)|all_epithelial(76;3.64e-10)|Prostate(80;0.00914)|Ovarian(225;0.0139)|Lung NSC(167;0.0212)|Colorectal(57;0.0249)|all_lung(232;0.0283)		Epithelial(69;3.57e-14)|COAD - Colon adenocarcinoma(37;0.00794)		TAGTCATGATCTGCCACTACT	0.303																																																1	Substitution - Missense(1)	ovary(1)	5											95.0	85.0	88.0					5																	102423841		1853	4101	5954	102451740	SO:0001583	missense	54826			BC015325	CCDS43349.1	5q21.1	2008-02-11	2007-06-13	2007-06-13		ENSG00000145723			25959	protein-coding gene	gene with protein product	"""gypsy integrase 1"", ""Ty3/Gypsy integrase 1"""		"""zinc finger, H2C2 domain containing"""	ZH2C2		11470852	Standard	NM_017676		Approved	FLJ20125, GIN-1, TGIN1	uc003koa.1	Q9NXP7		ENST00000399004.2:c.1330G>C	5.37:g.102423841C>G	ENSP00000381970:p.Asp444His		102451740	B2RXF7|B4DIV4|Q6AI03|Q96BR2	Missense_Mutation	SNP	ENST00000399004.2	37	CCDS43349.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	18.23	3.579117	0.65878	.	.	ENSG00000145723	ENST00000399004	T	0.31247	1.5	5.65	5.65	0.86999	.	14.748200	0.00166	N	0.000001	T	0.54029	0.1833	L	0.29908	0.895	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.30327	-0.9982	10	0.87932	D	0	-25.7779	18.2582	0.90025	0.0:1.0:0.0:0.0	.	444	Q9NXP7	GIN1_HUMAN	H	444	ENSP00000381970:D444H	ENSP00000381970:D444H	D	-	1	0	GIN1	102451740	1.000000	0.71417	1.000000	0.80357	0.481000	0.33189	4.681000	0.61663	2.817000	0.96982	0.563000	0.77884	GAT		0.303	GIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370478.3	NM_017676		Missense_Mutation
SLC23A1	9963	broad.mit.edu	37	5	138718925	138718925	+	Missense_Mutation	SNP	G	G	C			TCGA-61-2111-01	TCGA-61-2111-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2111-01	TCGA-61-2111-11	g.chr5:138718925G>C	ENST00000348729.3	-	1	64	c.18C>G	c.(16-18)gaC>gaG	p.D6E	SLC23A1_ENST00000353963.3_Missense_Mutation_p.D6E|SLC23A1_ENST00000503919.1_5'UTR	NM_005847.4	NP_005838	Q9UHI7	S23A1_HUMAN	solute carrier family 23 (ascorbic acid transporter), member 1	6					brain development (GO:0007420)|dehydroascorbic acid transport (GO:0070837)|L-ascorbic acid metabolic process (GO:0019852)|L-ascorbic acid transport (GO:0015882)|lung development (GO:0030324)|nucleobase transport (GO:0015851)|nucleobase-containing compound metabolic process (GO:0006139)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transepithelial L-ascorbic acid transport (GO:0070904)|vitamin metabolic process (GO:0006766)|vitamin transmembrane transport (GO:0035461)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|brush border (GO:0005903)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular organelle (GO:0043229)|membrane (GO:0016020)|plasma membrane (GO:0005886)	dehydroascorbic acid transporter activity (GO:0033300)|L-ascorbate:sodium symporter activity (GO:0008520)|L-ascorbic acid transporter activity (GO:0015229)|nucleobase transmembrane transporter activity (GO:0015205)|sodium ion transmembrane transporter activity (GO:0015081)|sodium-dependent L-ascorbate transmembrane transporter activity (GO:0070890)	p.D6E(1)		biliary_tract(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(5)|liver(2)|lung(5)|ovary(1)	19			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)		Vitamin C(DB00126)	GGCCCTCGAGGTCCTCCTGGG	0.652																																																1	Substitution - Missense(1)	ovary(1)	5											26.0	25.0	25.0					5																	138718925		2203	4299	6502	138746824	SO:0001583	missense	9963			AF058317	CCDS4212.1, CCDS4213.1	5q31.2	2013-07-18	2013-07-18	2003-03-21	ENSG00000170482	ENSG00000170482		"""Solute carriers"""	10974	protein-coding gene	gene with protein product		603790	"""solute carrier family 23 (nucleobase transporters), member 2"""	SLC23A2		9804989, 10331392	Standard	NM_005847		Approved	YSPL3, SVCT1	uc003leg.3	Q9UHI7	OTTHUMG00000129228	ENST00000348729.3:c.18C>G	5.37:g.138718925G>C	ENSP00000302701:p.Asp6Glu		138746824	O95191|Q8WWB6|Q9UGH4|Q9UI39	Missense_Mutation	SNP	ENST00000348729.3	37	CCDS4212.1	SNP	44	Broad	.	.	.	.	.	.	.	.	.	.	G	8.530	0.870859	0.17322	.	.	ENSG00000170482	ENST00000353963;ENST00000348729;ENST00000339881;ENST00000453898;ENST00000508270	T;T	0.17054	2.3;2.3	5.03	3.23	0.37069	.	1.175590	0.06086	N	0.662746	T	0.10380	0.0254	N	0.08118	0	0.35197	D	0.773902	B;B	0.06786	0.0;0.001	B;B	0.12156	0.001;0.007	T	0.15694	-1.0428	10	0.87932	D	0	-8.5093	6.1182	0.20137	0.0949:0.0:0.7197:0.1853	.	6;6	Q9UHI7;Q9UHI7-2	S23A1_HUMAN;.	E	6;6;6;6;80	ENSP00000302851:D6E;ENSP00000302701:D6E	ENSP00000343584:D6E	D	-	3	2	SLC23A1	138746824	0.040000	0.19996	0.681000	0.30009	0.075000	0.17131	-0.042000	0.12063	0.688000	0.31529	0.462000	0.41574	GAC		0.652	SLC23A1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000374185.1	NM_152685		Missense_Mutation
PCDHB3	56132	broad.mit.edu	37	5	140481609	140481609	+	Missense_Mutation	SNP	T	T	C			TCGA-61-2111-01	TCGA-61-2111-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2111-01	TCGA-61-2111-11	g.chr5:140481609T>C	ENST00000231130.2	+	1	1376	c.1376T>C	c.(1375-1377)tTc>tCc	p.F459S	AC005754.7_ENST00000607216.1_RNA	NM_018937.2	NP_061760.1	Q9Y5E6	PCDB3_HUMAN	protocadherin beta 3	459	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.F459S(1)		NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	72			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TACACCCTGTTCGTCCGCGAG	0.602																																																1	Substitution - Missense(1)	ovary(1)	5											89.0	86.0	87.0					5																	140481609		2203	4296	6499	140461793	SO:0001583	missense	56132			AF152496	CCDS4245.1	5q31	2010-01-26			ENSG00000113205	ENSG00000113205		"""Cadherins / Protocadherins : Clustered"""	8688	other	protocadherin		606329				10380929	Standard	NM_018937		Approved	PCDH-BETA3	uc003lio.3	Q9Y5E6	OTTHUMG00000129622	ENST00000231130.2:c.1376T>C	5.37:g.140481609T>C	ENSP00000231130:p.Phe459Ser		140461793	B2R8P2	Missense_Mutation	SNP	ENST00000231130.2	37	CCDS4245.1	SNP	62	Broad	.	.	.	.	.	.	.	.	.	.	T	11.49	1.654639	0.29425	.	.	ENSG00000113205	ENST00000231130	T	0.03358	3.96	4.26	-8.52	0.00920	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.01387	0.0045	N	0.04655	-0.195	0.09310	N	1	B	0.18013	0.025	B	0.18263	0.021	T	0.48163	-0.9059	9	0.59425	D	0.04	.	1.1444	0.01772	0.1609:0.2982:0.2515:0.2894	.	459	Q9Y5E6	PCDB3_HUMAN	S	459	ENSP00000231130:F459S	ENSP00000231130:F459S	F	+	2	0	PCDHB3	140461793	0.000000	0.05858	0.000000	0.03702	0.947000	0.59692	-1.065000	0.03458	-1.758000	0.01315	0.460000	0.39030	TTC		0.602	PCDHB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251817.2	NM_018937		Missense_Mutation
FCHSD1	89848	broad.mit.edu	37	5	141021095	141021095	+	Silent	SNP	C	C	T	rs530774288		TCGA-61-2111-01	TCGA-61-2111-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2111-01	TCGA-61-2111-11	g.chr5:141021095C>T	ENST00000435817.2	-	20	2093	c.2043G>A	c.(2041-2043)ccG>ccA	p.P681P	FCHSD1_ENST00000522783.1_3'UTR|FCHSD1_ENST00000523856.1_5'UTR|FCHSD1_ENST00000522126.1_3'UTR	NM_033449.2	NP_258260.1	Q86WN1	FCSD1_HUMAN	FCH and double SH3 domains 1	681	Pro-rich.		P -> L (in dbSNP:rs32957).					p.P681P(1)	FCHSD1/BRAF(2)	central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(8)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	24			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGCCAGGATCCGGGGCTTTAG	0.577																																																1	Substitution - coding silent(1)	ovary(1)	5											34.0	42.0	39.0					5																	141021095		1958	4141	6099	141001279	SO:0001819	synonymous_variant	89848			AK027281	CCDS47295.1	5q31.3	2008-02-05			ENSG00000197948	ENSG00000197948			25463	protein-coding gene	gene with protein product						11214971, 15067381	Standard	NM_033449		Approved	FLJ00007	uc003llk.3	Q86WN1	OTTHUMG00000163762	ENST00000435817.2:c.2043G>A	5.37:g.141021095C>T			141001279	Q6UX75|Q86Y77|Q9NXX8	Silent	SNP	ENST00000435817.2	37	CCDS47295.1	SNP	23	Broad																																																																																				0.577	FCHSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375282.2	NM_033449		Silent
RANBP6	26953	broad.mit.edu	37	9	6013873	6013873	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2111-01	TCGA-61-2111-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2111-01	TCGA-61-2111-11	g.chr9:6013873C>T	ENST00000259569.5	-	1	1745	c.1735G>A	c.(1735-1737)Gaa>Aaa	p.E579K	RANBP6_ENST00000485372.1_5'UTR	NM_001243202.1|NM_001243203.1|NM_012416.3	NP_001230131.1|NP_001230132.1|NP_036548.1	O60518	RNBP6_HUMAN	RAN binding protein 6	579					protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.E579K(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(5)|large_intestine(8)|lung(9)|ovary(7)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	51		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00522)|Lung(218;0.101)		ATAAATTTTTCCTTCCCAACA	0.393																																																1	Substitution - Missense(1)	ovary(1)	9											159.0	152.0	154.0					9																	6013873		2203	4300	6503	6003873	SO:0001583	missense	26953			AF039023	CCDS6467.1	9p24.1	2008-03-26			ENSG00000137040	ENSG00000137040			9851	protein-coding gene	gene with protein product							Standard	NM_001243202		Approved		uc003zjr.3	O60518	OTTHUMG00000019512	ENST00000259569.5:c.1735G>A	9.37:g.6013873C>T	ENSP00000259569:p.Glu579Lys		6003873	Q5T7X4|Q7Z3V2|Q96E78	Missense_Mutation	SNP	ENST00000259569.5	37	CCDS6467.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	15.84	2.951946	0.53293	.	.	ENSG00000137040	ENST00000259569	T	0.68765	-0.35	3.76	2.86	0.33363	Armadillo-type fold (1);	0.000000	0.85682	U	0.000000	T	0.79470	0.4451	M	0.85859	2.78	0.80722	D	1	D;D	0.71674	0.998;0.987	D;P	0.64506	0.926;0.78	T	0.80808	-0.1217	10	0.62326	D	0.03	-11.9682	9.4465	0.38701	0.0:0.8934:0.0:0.1066	.	167;579	B4DTX6;O60518	.;RNBP6_HUMAN	K	579	ENSP00000259569:E579K	ENSP00000259569:E579K	E	-	1	0	RANBP6	6003873	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.662000	0.61525	1.162000	0.42619	0.650000	0.86243	GAA		0.393	RANBP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051650.1	NM_012416		Missense_Mutation
FIGF	2277	broad.mit.edu	37	X	15376214	15376214	+	Missense_Mutation	SNP	G	G	A	rs201472376		TCGA-61-2111-01	TCGA-61-2111-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2111-01	TCGA-61-2111-11	g.chrX:15376214G>A	ENST00000297904.3	-	3	832	c.403C>T	c.(403-405)Cct>Tct	p.P135S		NM_004469.4	NP_004460.1	O43915	VEGFD_HUMAN	c-fos induced growth factor (vascular endothelial growth factor D)	135					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|induction of positive chemotaxis (GO:0050930)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive chemotaxis (GO:0050918)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of mast cell chemotaxis (GO:0060754)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|platelet alpha granule lumen (GO:0031093)	chemoattractant activity (GO:0042056)|platelet-derived growth factor receptor binding (GO:0005161)|vascular endothelial growth factor receptor binding (GO:0005172)	p.P135S(1)|p.P135T(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(1)	17	Hepatocellular(33;0.183)					TTCACACAAGGGGGCTTGAAG	0.488																																																2	Substitution - Missense(2)	ovary(1)|lung(1)	X											263.0	212.0	230.0					X																	15376214		2203	4300	6503	15286135	SO:0001583	missense	2277			AJ000185	CCDS14166.1	Xp22.31	2008-02-05			ENSG00000165197	ENSG00000165197			3708	protein-coding gene	gene with protein product		300091		VEGFD		9479493	Standard	NM_004469		Approved	VEGF-D	uc004cwt.2	O43915	OTTHUMG00000021175	ENST00000297904.3:c.403C>T	X.37:g.15376214G>A	ENSP00000297904:p.Pro135Ser		15286135	B2R7Z3	Missense_Mutation	SNP	ENST00000297904.3	37	CCDS14166.1	SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	G	23.9	4.468360	0.84533	.	.	ENSG00000165197	ENST00000297904	.	.	.	5.11	5.11	0.69529	Platelet-derived growth factor, conserved site (1);Platelet-derived growth factor (PDGF) (3);	0.000000	0.85682	D	0.000000	T	0.62901	0.2466	N	0.21282	0.65	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.59129	-0.7512	9	0.21014	T	0.42	-34.6502	16.7771	0.85553	0.0:0.0:1.0:0.0	.	135	O43915	VEGFD_HUMAN	S	135	.	ENSP00000297904:P135S	P	-	1	0	FIGF	15286135	1.000000	0.71417	0.610000	0.28997	0.990000	0.78478	9.416000	0.97383	2.254000	0.74563	0.529000	0.55759	CCT		0.488	FIGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055859.1	NM_004469		Missense_Mutation
CNKSR2	22866	broad.mit.edu	37	X	21627436	21627436	+	Missense_Mutation	SNP	C	C	T	rs141899187		TCGA-61-2111-01	TCGA-61-2111-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2111-01	TCGA-61-2111-11	g.chrX:21627436C>T	ENST00000379510.3	+	20	2429	c.2393C>T	c.(2392-2394)gCg>gTg	p.A798V	CNKSR2_ENST00000279451.4_Missense_Mutation_p.A798V|CNKSR2_ENST00000425654.2_Missense_Mutation_p.A768V|CNKSR2_ENST00000543067.1_Missense_Mutation_p.A749V	NM_014927.3	NP_055742.2	Q8WXI2	CNKR2_HUMAN	connector enhancer of kinase suppressor of Ras 2	798					regulation of signal transduction (GO:0009966)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)				breast(3)|endometrium(8)|kidney(2)|large_intestine(15)|lung(28)|prostate(2)|upper_aerodigestive_tract(3)	61						TCTGACTCCGCGGCCATCTCC	0.562																																																0			X						C	VAL/ALA,VAL/ALA,VAL/ALA,VAL/ALA	0,3835		0,0,1632,571	67.0	64.0	65.0		2303,2393,2246,2393	2.8	0.0	X	dbSNP_134	65	1,6727		0,1,2427,1872	no	missense,missense,missense,missense	CNKSR2	NM_001168647.1,NM_001168648.1,NM_001168649.1,NM_014927.3	64,64,64,64	0,1,4059,2443	TT,TC,CC,C		0.0149,0.0,0.0095	possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging	768/1005,798/899,749/850,798/1035	21627436	1,10562	2203	4300	6503	21537357	SO:0001583	missense	22866			AB020709	CCDS14198.1, CCDS55387.1, CCDS55388.1, CCDS55389.1	Xp22.12	2013-01-10			ENSG00000149970	ENSG00000149970		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	19701	protein-coding gene	gene with protein product		300724					Standard	NM_014927		Approved	KIAA0902, CNK2, KSR2	uc004czx.2	Q8WXI2	OTTHUMG00000021233	ENST00000379510.3:c.2393C>T	X.37:g.21627436C>T	ENSP00000368824:p.Ala798Val		21537357	B4DGR4|B7ZLJ1|B9EG83|E7ESA4|O94976|Q5JPK4|Q5JPN0|Q8WXI1	Missense_Mutation	SNP	ENST00000379510.3	37	CCDS14198.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	5.635	0.301871	0.10678	0.0	1.49E-4	ENSG00000149970	ENST00000425654;ENST00000543067;ENST00000279451;ENST00000379510	T;T;T;T	0.18338	2.48;2.22;2.22;2.49	5.51	2.82	0.32997	.	0.209995	0.49305	N	0.000143	T	0.10895	0.0266	L	0.36672	1.1	0.09310	N	0.999999	B;B;B;B	0.34313	0.0;0.005;0.448;0.001	B;B;B;B	0.21917	0.001;0.001;0.037;0.001	T	0.18777	-1.0326	10	0.29301	T	0.29	-22.976	10.1189	0.42607	0.0:0.7777:0.0:0.2223	.	768;749;390;798	B7ZLJ1;B4DGR4;B3KPN2;Q8WXI2	.;.;.;CNKR2_HUMAN	V	768;749;798;798	ENSP00000397906:A768V;ENSP00000444633:A749V;ENSP00000279451:A798V;ENSP00000368824:A798V	ENSP00000279451:A798V	A	+	2	0	CNKSR2	21537357	0.000000	0.05858	0.004000	0.12327	0.400000	0.30750	0.420000	0.21263	0.162000	0.19483	0.513000	0.50165	GCG		0.562	CNKSR2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056019.1	NM_014927		Missense_Mutation
SLC25A14	9016	broad.mit.edu	37	X	129479159	129479159	+	Missense_Mutation	SNP	C	C	A			TCGA-61-2111-01	TCGA-61-2111-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2111-01	TCGA-61-2111-11	g.chrX:129479159C>A	ENST00000218197.5	+	2	306	c.79C>A	c.(79-81)Cag>Aag	p.Q27K	SLC25A14_ENST00000339231.3_Missense_Mutation_p.Q24K|SLC25A14_ENST00000545805.1_Missense_Mutation_p.Q27K|SLC25A14_ENST00000361980.5_Missense_Mutation_p.Q24K|SLC25A14_ENST00000467496.1_3'UTR|SLC25A14_ENST00000543953.1_5'UTR	NM_001282195.1|NM_001282196.1|NM_001282198.1	NP_001269124.1|NP_001269125.1|NP_001269127.1	O95258	UCP5_HUMAN	solute carrier family 25 (mitochondrial carrier, brain), member 14	27					aerobic respiration (GO:0009060)|mitochondrial transport (GO:0006839)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)		p.Q27K(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)	22						TTTTTAGCACCAGAAAAGTAC	0.373																																																1	Substitution - Missense(1)	ovary(1)	X											172.0	139.0	150.0					X																	129479159		2203	4300	6503	129306840	SO:0001583	missense	9016			AF078544	CCDS14623.1, CCDS14624.1, CCDS76020.1, CCDS76021.1	Xq24	2013-05-22			ENSG00000102078	ENSG00000102078		"""Solute carriers"""	10984	protein-coding gene	gene with protein product		300242				9852133	Standard	XM_005262485		Approved	BMCP1, UCP5	uc004evp.1	O95258	OTTHUMG00000022394	ENST00000218197.5:c.79C>A	X.37:g.129479159C>A	ENSP00000218197:p.Gln27Lys		129306840	D3DTG2|Q0VDH7|Q9HC60|Q9HC61	Missense_Mutation	SNP	ENST00000218197.5	37	CCDS14623.1	SNP	21	Broad	.	.	.	.	.	.	.	.	.	.	C	14.04	2.416242	0.42918	.	.	ENSG00000102078	ENST00000424447;ENST00000545805;ENST00000218197;ENST00000361980;ENST00000339231	T;T;T;T;T	0.80994	-1.1;-1.37;-1.35;-1.44;-1.26	4.79	4.79	0.61399	.	.	.	.	.	T	0.78039	0.4221	N	0.08118	0	0.80722	D	1	B;P;P	0.37398	0.114;0.593;0.458	B;P;P	0.57846	0.033;0.828;0.678	T	0.76052	-0.3100	9	0.25106	T	0.35	-6.5974	14.3284	0.66534	0.0:1.0:0.0:0.0	.	24;24;27	O95258-3;O95258-2;O95258	.;.;UCP5_HUMAN	K	27;27;27;24;24	ENSP00000402578:Q27K;ENSP00000444642:Q27K;ENSP00000218197:Q27K;ENSP00000354455:Q24K;ENSP00000342797:Q24K	ENSP00000218197:Q27K	Q	+	1	0	SLC25A14	129306840	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.133000	0.57983	2.348000	0.79779	0.594000	0.82650	CAG		0.373	SLC25A14-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058253.1	NM_022810, NM_003951		Missense_Mutation
FOXN4	121643	broad.mit.edu	37	12	109717631	109717639	+	In_Frame_Del	DEL	GGGTTAGGC	GGGTTAGGC	-	rs375715687		TCGA-61-2111-01	TCGA-61-2111-11							Unknown	Unknown	Unknown	Phase_I	Capture	---			Illumina GAIIx	TCGA-61-2111-01	TCGA-61-2111-11	g.chr12:109717631_109717639delGGGTTAGGC	ENST00000299162.5	-	10	1495_1503	c.1391_1399delGCCTAACCC	c.(1390-1401)ggcctaacccct>gct	p.464_467GLTP>A	FOXN4_ENST00000355216.1_In_Frame_Del_p.284_287GLTP>A	NM_213596.2	NP_998761.2	Q96NZ1	FOXN4_HUMAN	forkhead box N4	464					amacrine cell differentiation (GO:0035881)|atrioventricular canal development (GO:0036302)|heart looping (GO:0001947)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of heart contraction (GO:0008016)|regulation of transcription, DNA-templated (GO:0006355)|retina layer formation (GO:0010842)|transcription, DNA-templated (GO:0006351)|ventral spinal cord interneuron fate commitment (GO:0060579)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|enhancer sequence-specific DNA binding (GO:0001158)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G284_P287>A(1)		large_intestine(5)|lung(9)|ovary(2)	16						CCCGAGGCAGGGGTTAGGCCTGAGGCCCC	0.622																																																1	Complex - deletion inframe(1)	ovary(1)	12																																								108202022	SO:0001651	inframe_deletion	121643			AF425596	CCDS9126.2	12q24.12	2008-02-05			ENSG00000139445	ENSG00000139445		"""Forkhead boxes"""	21399	protein-coding gene	gene with protein product		609429					Standard	NM_213596		Approved		uc001toe.4	Q96NZ1	OTTHUMG00000152868	ENST00000299162.5:c.1391_1399delGCCTAACCC	12.37:g.109717631_109717639delGGGTTAGGC	ENSP00000299162:p.Gly464_Pro467delinsAla		108202014	Q6ZMR4|Q96NZ0	In_Frame_Del	DEL	ENST00000299162.5	37	CCDS9126.2	DEL	43	Broad																																																																																				0.622	FOXN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328306.1	XM_062735		In_Frame_Del
