#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
NADK	65220	broad.mit.edu	37	1	1686116	1686116	+	Missense_Mutation	SNP	C	C	T	rs139648414		TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr1:1686116C>T	ENST00000341426.5	-	8	931	c.710G>A	c.(709-711)cGg>cAg	p.R237Q	NADK_ENST00000341991.3_Missense_Mutation_p.R237Q|NADK_ENST00000342348.5_Missense_Mutation_p.R205Q|NADK_ENST00000344463.4_Missense_Mutation_p.R382Q|NADK_ENST00000492768.1_5'Flank|NADK_ENST00000378625.1_Missense_Mutation_p.R382Q	NM_023018.4	NP_075394.3	O95544	NADK_HUMAN	NAD kinase	237					ATP metabolic process (GO:0046034)|NAD metabolic process (GO:0019674)|NADP biosynthetic process (GO:0006741)|phosphorylation (GO:0016310)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)	p.R237Q(1)		NS(1)|autonomic_ganglia(1)|endometrium(4)|large_intestine(2)|lung(4)|ovary(1)|prostate(2)|stomach(1)|urinary_tract(1)	17	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;5.61e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;8.75e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.33e-23)|GBM - Glioblastoma multiforme(42;1.35e-07)|Colorectal(212;0.000203)|COAD - Colon adenocarcinoma(227;0.000225)|Kidney(185;0.00265)|STAD - Stomach adenocarcinoma(132;0.00655)|BRCA - Breast invasive adenocarcinoma(365;0.00855)|KIRC - Kidney renal clear cell carcinoma(229;0.0382)|Lung(427;0.207)		CAGCCGACTCCGGAGAACAAC	0.657													C|||	1	0.000199681	0.0	0.0014	5008	,	,		16397	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	1						C	GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG	4,4402	8.1+/-20.4	0,4,2199	98.0	96.0	97.0		710,1145,614,710	5.8	1.0	1	dbSNP_134	97	1,8599	1.2+/-3.3	0,1,4299	yes	missense,missense,missense,missense	NADK	NM_001198993.1,NM_001198994.1,NM_001198995.1,NM_023018.4	43,43,43,43	0,5,6498	TT,TC,CC		0.0116,0.0908,0.0384	probably-damaging,probably-damaging,probably-damaging,probably-damaging	237/447,382/592,205/415,237/447	1686116	5,13001	2203	4300	6503	1675976	SO:0001583	missense	65220			BC001709	CCDS30565.1, CCDS55561.1, CCDS55562.1	1p36.33	2013-04-29			ENSG00000008130	ENSG00000008130	2.7.1.23		29831	protein-coding gene	gene with protein product		611616				11594753	Standard	NM_023018		Approved	FLJ13052	uc001aie.3	O95544	OTTHUMG00000000942	ENST00000341426.5:c.710G>A	1.37:g.1686116C>T	ENSP00000341679:p.Arg237Gln		1675976	A6NNN3|A8K296|B7Z434|F5GXR5|Q5QPS4|Q9H2P2|Q9H931	Missense_Mutation	SNP	ENST00000341426.5	37	CCDS30565.1	SNP	23	Broad	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	37	5.993658	0.97184	9.08E-4	1.16E-4	ENSG00000008130	ENST00000341426;ENST00000341991;ENST00000378625;ENST00000344463;ENST00000342348;ENST00000400922	T;T;T;T;T;T	0.54071	0.59;0.59;0.59;0.59;0.59;0.59	5.84	5.84	0.93424	ATP-NAD kinase, PpnK-type, alpha/beta (1);ATP-NAD kinase, PpnK-type (1);	0.000000	0.85682	D	0.000000	T	0.81269	0.4787	H	0.95745	3.715	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.994;0.999;0.998;0.997	D	0.86241	0.1643	10	0.87932	D	0	-40.8561	16.847	0.85983	0.0:1.0:0.0:0.0	.	205;382;382;237	F5GXR5;Q9H2P2;Q5QPS4;O95544	.;.;.;NADK_HUMAN	Q	237;237;382;382;205;205	ENSP00000341679:R237Q;ENSP00000344340:R237Q;ENSP00000367890:R382Q;ENSP00000340925:R382Q;ENSP00000339727:R205Q;ENSP00000383713:R205Q	ENSP00000341679:R237Q	R	-	2	0	NADK	1675976	1.000000	0.71417	0.995000	0.50966	0.977000	0.68977	7.358000	0.79466	2.768000	0.95171	0.561000	0.74099	CGG		0.657	NADK-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000002769.1	NM_023018		Missense_Mutation
SLC45A1	50651	broad.mit.edu	37	1	8399602	8399602	+	Silent	SNP	C	C	T			TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr1:8399602C>T	ENST00000471889.1	+	8	2209	c.1824C>T	c.(1822-1824)ttC>ttT	p.F608F	SLC45A1_ENST00000289877.8_Silent_p.F608F|SLC45A1_ENST00000377479.2_Silent_p.F642F			Q9Y2W3	S45A1_HUMAN	solute carrier family 45, member 1	608					carbohydrate transport (GO:0008643)	integral component of membrane (GO:0016021)	symporter activity (GO:0015293)	p.F608F(1)		central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|liver(1)|lung(12)|ovary(2)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(2)	33	Ovarian(185;0.0661)|all_lung(157;0.127)	all_epithelial(116;1.22e-15)|all_lung(118;0.000147)|Lung NSC(185;0.000251)|Renal(390;0.000469)|Colorectal(325;0.00578)|Breast(348;0.00686)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.11)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;3.95e-66)|GBM - Glioblastoma multiforme(8;5.93e-33)|Colorectal(212;2.86e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|Kidney(185;5.33e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000513)|KIRC - Kidney renal clear cell carcinoma(229;0.000979)|STAD - Stomach adenocarcinoma(132;0.00199)|READ - Rectum adenocarcinoma(331;0.0649)		CCCTCTACTTCATCGCCTATC	0.612																																																1	Substitution - coding silent(1)	ovary(1)	1											150.0	131.0	137.0					1																	8399602		2203	4300	6503	8322189	SO:0001819	synonymous_variant	50651			AF118274	CCDS30577.1	1p36.23	2014-01-28	2005-10-04	2005-10-04	ENSG00000162426	ENSG00000162426		"""Solute carriers"""	17939	protein-coding gene	gene with protein product	"""H+/sugar symporter"""	605763	"""deleted in neuroblastoma 5"""	DNB5		10729226	Standard	XM_005263467		Approved		uc001apb.3	Q9Y2W3	OTTHUMG00000000503	ENST00000471889.1:c.1824C>T	1.37:g.8399602C>T			8322189	Q5VY46|Q5VY49	Silent	SNP	ENST00000471889.1	37	CCDS30577.1	SNP	29	Broad																																																																																				0.612	SLC45A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001245.5			Silent
RCC1	1104	broad.mit.edu	37	1	28863288	28863288	+	Missense_Mutation	SNP	T	T	G			TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr1:28863288T>G	ENST00000373833.6	+	12	1252	c.967T>G	c.(967-969)Tat>Gat	p.Y323D	RCC1_ENST00000373832.1_Missense_Mutation_p.Y323D|RCC1_ENST00000398958.2_Missense_Mutation_p.Y323D|RCC1_ENST00000373831.3_Missense_Mutation_p.Y354D			P18754	RCC1_HUMAN	regulator of chromosome condensation 1	323					chromosome segregation (GO:0007059)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|positive regulation of Ran GTPase activity (GO:0032853)|regulation of mitosis (GO:0007088)|spindle assembly (GO:0051225)|viral process (GO:0016032)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|nucleosomal DNA binding (GO:0031492)|Ran guanyl-nucleotide exchange factor activity (GO:0005087)	p.Y323D(1)		breast(1)|kidney(2)|large_intestine(6)|lung(4)|ovary(1)	14		Colorectal(325;3.46e-05)|Lung NSC(340;0.000318)|all_lung(284;0.000434)|Renal(390;0.00121)|Breast(348;0.00345)|all_neural(195;0.00989)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0261)|Medulloblastoma(700;0.123)		Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|STAD - Stomach adenocarcinoma(196;0.00299)|KIRC - Kidney renal clear cell carcinoma(1967;0.0101)|BRCA - Breast invasive adenocarcinoma(304;0.022)|READ - Rectum adenocarcinoma(331;0.0649)		CCGGGCTGAGTATGGGCGGCT	0.607																																																1	Substitution - Missense(1)	ovary(1)	1											95.0	96.0	96.0					1																	28863288		2203	4300	6503	28735875	SO:0001583	missense	1104			X12654	CCDS323.1, CCDS41295.1	1p35.3	2008-08-18	2005-05-09	2005-05-09	ENSG00000180198	ENSG00000180198			1913	protein-coding gene	gene with protein product		179710	"""chromosome condensation 1"""	CHC1		7851910	Standard	NM_001048199		Approved		uc001bqf.2	P18754	OTTHUMG00000003645	ENST00000373833.6:c.967T>G	1.37:g.28863288T>G	ENSP00000362939:p.Tyr323Asp		28735875	Q16269|Q6NT97	Missense_Mutation	SNP	ENST00000373833.6	37	CCDS323.1	SNP	57	Broad	.	.	.	.	.	.	.	.	.	.	T	20.4	3.977065	0.74360	.	.	ENSG00000180198	ENST00000398958;ENST00000373833;ENST00000373832;ENST00000373831;ENST00000411533	D;D;D;D;D	0.85411	-1.98;-1.98;-1.98;-1.98;-1.98	5.8	5.8	0.92144	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.000000	0.85682	D	0.000000	D	0.91310	0.7260	M	0.65677	2.01	0.80722	D	1	D;D;D	0.89917	0.99;1.0;1.0	P;D;D	0.97110	0.79;1.0;0.999	D	0.92053	0.5650	10	0.72032	D	0.01	-11.1551	14.9715	0.71238	0.0:0.0:0.0:1.0	.	354;340;323	P18754-2;E9PAT9;P18754	.;.;RCC1_HUMAN	D	323;323;323;354;340	ENSP00000381931:Y323D;ENSP00000362939:Y323D;ENSP00000362938:Y323D;ENSP00000362937:Y354D;ENSP00000413644:Y340D	ENSP00000362937:Y354D	Y	+	1	0	RCC1	28735875	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.005000	0.88553	2.212000	0.71576	0.533000	0.62120	TAT		0.607	RCC1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010323.3	NM_001269		Missense_Mutation
GADD45A	1647	broad.mit.edu	37	1	68152185	68152185	+	Missense_Mutation	SNP	A	A	G			TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr1:68152185A>G	ENST00000370986.4	+	3	733	c.299A>G	c.(298-300)gAg>gGg	p.E100G	GADD45A_ENST00000460575.1_3'UTR|GADD45A_ENST00000370985.3_Missense_Mutation_p.E66G	NM_001924.3	NP_001915.1	P24522	GA45A_HUMAN	growth arrest and DNA-damage-inducible, alpha	100					activation of MAPKKK activity (GO:0000185)|apoptotic process (GO:0006915)|cell cycle arrest (GO:0007050)|cellular response to ionizing radiation (GO:0071479)|cellular response to mechanical stimulus (GO:0071260)|centrosome cycle (GO:0007098)|DNA repair (GO:0006281)|negative regulation of protein kinase activity (GO:0006469)|positive regulation of apoptotic process (GO:0043065)|positive regulation of JNK cascade (GO:0046330)|positive regulation of p38MAPK cascade (GO:1900745)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|signal transduction in response to DNA damage (GO:0042770)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	core promoter binding (GO:0001047)	p.E100G(1)		lung(2)|ovary(2)	4						CGGCTGGCGGAGCTCCTGCTC	0.672																																																1	Substitution - Missense(1)	ovary(1)	1											28.0	33.0	31.0					1																	68152185		2202	4299	6501	67924773	SO:0001583	missense	1647			M60974	CCDS640.1, CCDS55605.1, CCDS72806.1	1p31.2	2010-08-27			ENSG00000116717	ENSG00000116717			4095	protein-coding gene	gene with protein product		126335		DDIT1		1990262, 8226988	Standard	NM_001924		Approved	GADD45	uc001ddz.2	P24522	OTTHUMG00000009374	ENST00000370986.4:c.299A>G	1.37:g.68152185A>G	ENSP00000360025:p.Glu100Gly		67924773	Q5TCA7|Q5TCA8	Missense_Mutation	SNP	ENST00000370986.4	37	CCDS640.1	SNP	11	Broad	.	.	.	.	.	.	.	.	.	.	A	19.61	3.859790	0.71834	.	.	ENSG00000116717	ENST00000370986;ENST00000370985	T;T	0.60299	0.2;0.2	5.49	5.49	0.81192	Ribosomal protein L7Ae/L30e/S12e/Gadd45 (1);	0.323640	0.36519	N	0.002559	T	0.65291	0.2677	M	0.85710	2.77	0.58432	D	0.999997	P;P	0.48589	0.896;0.912	P;P	0.52856	0.519;0.711	T	0.70854	-0.4759	10	0.49607	T	0.09	-5.4395	14.5618	0.68144	1.0:0.0:0.0:0.0	.	66;100	Q5TCA7;P24522	.;GA45A_HUMAN	G	100;66	ENSP00000360025:E100G;ENSP00000360024:E66G	ENSP00000360024:E66G	E	+	2	0	GADD45A	67924773	1.000000	0.71417	0.970000	0.41538	0.258000	0.26162	4.132000	0.57977	2.082000	0.62665	0.383000	0.25322	GAG		0.672	GADD45A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025988.2	NM_001924		Missense_Mutation
FMO5	2330	broad.mit.edu	37	1	146673058	146673058	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr1:146673058C>T	ENST00000254090.4	-	7	1247	c.859G>A	c.(859-861)Gat>Aat	p.D287N	RP11-337C18.8_ENST00000606757.1_RNA|FMO5_ENST00000369272.3_Intron|RP11-337C18.8_ENST00000607149.1_RNA|RP11-337C18.10_ENST00000606856.1_RNA|FMO5_ENST00000441068.2_Missense_Mutation_p.D287N	NM_001461.2	NP_001452.2	P49326	FMO5_HUMAN	flavin containing monooxygenase 5	287						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	flavin adenine dinucleotide binding (GO:0050660)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)	p.D287N(1)		breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(9)|ovary(3)|upper_aerodigestive_tract(1)	25	all_hematologic(923;0.0487)					GGCAGGTCATCATTTAAGGTT	0.423																																																1	Substitution - Missense(1)	ovary(1)	1											65.0	65.0	65.0					1																	146673058		2203	4300	6503	145139682	SO:0001583	missense	2330			Z47553	CCDS926.1, CCDS44209.1, CCDS44210.1	1q21.1	2011-08-04			ENSG00000131781	ENSG00000131781			3773	protein-coding gene	gene with protein product		603957				8786146, 9119381	Standard	NM_001461		Approved		uc001epi.2	P49326	OTTHUMG00000014607	ENST00000254090.4:c.859G>A	1.37:g.146673058C>T	ENSP00000254090:p.Asp287Asn		145139682	B2RBG1|C9JJD1|Q8IV22	Missense_Mutation	SNP	ENST00000254090.4	37	CCDS926.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	.	35	5.436758	0.96168	.	.	ENSG00000131781	ENST00000441068;ENST00000254090	T;T	0.63744	-0.06;-0.06	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.77987	0.4213	M	0.81942	2.565	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	T	0.76916	-0.2782	9	.	.	.	-17.6682	18.3732	0.90420	0.0:1.0:0.0:0.0	.	287;287	P49326;C9JJD1	FMO5_HUMAN;.	N	287	ENSP00000416011:D287N;ENSP00000254090:D287N	.	D	-	1	0	FMO5	145139682	1.000000	0.71417	1.000000	0.80357	0.890000	0.51754	7.782000	0.85680	2.941000	0.99782	0.655000	0.94253	GAT		0.423	FMO5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040373.2	NM_001461		Missense_Mutation
BNIPL	149428	broad.mit.edu	37	1	151011022	151011022	+	Missense_Mutation	SNP	C	C	A			TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr1:151011022C>A	ENST00000368931.3	+	3	336	c.180C>A	c.(178-180)gaC>gaA	p.D60E	BNIPL_ENST00000295294.7_5'UTR	NM_138278.3	NP_612122.2	Q7Z465	BNIPL_HUMAN	BCL2/adenovirus E1B 19kD interacting protein like	60					apoptotic process (GO:0006915)|negative regulation of cell proliferation (GO:0008285)|regulation of growth rate (GO:0040009)	cytosol (GO:0005829)|nucleus (GO:0005634)	identical protein binding (GO:0042802)			autonomic_ganglia(1)|endometrium(3)|large_intestine(1)|lung(4)|skin(1)	10	Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			ATCCTGAAGACCCTAAAGGAG	0.478																																																0			1											103.0	99.0	101.0					1																	151011022		1885	4126	6011	149277646	SO:0001583	missense	149428			AF193056	CCDS978.2, CCDS53362.1	1q21.2	2008-02-05			ENSG00000163141	ENSG00000163141			16976	protein-coding gene	gene with protein product		611275				12681488, 11741952	Standard	NM_138278		Approved	BNIPl-1, BNIPL-2, PP753	uc001ewl.2	Q7Z465	OTTHUMG00000035157	ENST00000368931.3:c.180C>A	1.37:g.151011022C>A	ENSP00000357927:p.Asp60Glu		149277646	Q6DK43|Q8TCY7|Q8WYG2	Missense_Mutation	SNP	ENST00000368931.3	37	CCDS978.2	SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	5.507	0.278455	0.10403	.	.	ENSG00000163141	ENST00000368931;ENST00000361277	T;T	0.34667	1.35;1.36	4.72	-2.26	0.06867	.	0.655695	0.16013	N	0.233675	T	0.04815	0.0130	L	0.29908	0.895	0.09310	N	0.999994	B	0.09022	0.002	B	0.04013	0.001	T	0.40720	-0.9548	10	0.02654	T	1	.	4.9981	0.14249	0.0:0.3984:0.2851:0.3166	.	60	Q7Z465	BNIPL_HUMAN	E	60	ENSP00000357927:D60E;ENSP00000355333:D60E	ENSP00000355333:D60E	D	+	3	2	BNIPL	149277646	0.000000	0.05858	0.000000	0.03702	0.174000	0.22865	-0.848000	0.04326	-0.692000	0.05128	-0.467000	0.05162	GAC		0.478	BNIPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085092.1	NM_138279		Missense_Mutation
FLG	2312	broad.mit.edu	37	1	152285796	152285796	+	Silent	SNP	T	T	G			TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr1:152285796T>G	ENST00000368799.1	-	3	1601	c.1566A>C	c.(1564-1566)tcA>tcC	p.S522S	FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	522	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.S522S(1)		autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTCCTCTGCTTGACCCCGGGT	0.592									Ichthyosis																																							1	Substitution - coding silent(1)	ovary(1)	1											360.0	359.0	359.0					1																	152285796		2203	4300	6503	150552420	SO:0001819	synonymous_variant	2312	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.1566A>C	1.37:g.152285796T>G			150552420	Q01720|Q5T583|Q9UC71	Silent	SNP	ENST00000368799.1	37	CCDS30860.1	SNP	63	Broad																																																																																				0.592	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016		Silent
BCAN	63827	broad.mit.edu	37	1	156628876	156628876	+	Missense_Mutation	SNP	C	C	A			TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr1:156628876C>A	ENST00000329117.5	+	14	3022	c.2686C>A	c.(2686-2688)Cgc>Agc	p.R896S	RP11-284F21.7_ENST00000448869.1_RNA	NM_021948.4	NP_068767.3	Q96GW7	PGCB_HUMAN	brevican	896					carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|hippocampus development (GO:0021766)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|hyaluronic acid binding (GO:0005540)	p.R896S(1)		cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	55	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					GCTACTGGGACGCTGGAAGGC	0.647																																																1	Substitution - Missense(1)	ovary(1)	1											49.0	45.0	46.0					1																	156628876		2201	4299	6500	154895500	SO:0001583	missense	63827			BC027971	CCDS1149.1, CCDS1150.1	1q31	2013-05-07			ENSG00000132692	ENSG00000132692		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	23059	protein-coding gene	gene with protein product	"""chondroitin sulfate proteoglycan 7"", ""brevican proteoglycan"""	600347				11054543, 11873941	Standard	NM_021948		Approved	BEHAB, MGC13038, CSPG7	uc001fpp.3	Q96GW7	OTTHUMG00000033322	ENST00000329117.5:c.2686C>A	1.37:g.156628876C>A	ENSP00000331210:p.Arg896Ser		154895500	D3DVC2|Q5SZ10|Q5T3I5|Q8TBB9|Q9HBK1|Q9HBK4	Missense_Mutation	SNP	ENST00000329117.5	37	CCDS1149.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	12.13	1.844742	0.32606	.	.	ENSG00000132692	ENST00000329117	T	0.14893	2.47	3.99	1.1	0.20463	.	1.682990	0.03551	N	0.225408	T	0.03136	0.0092	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.39623	-0.9605	10	0.66056	D	0.02	0.0638	3.2638	0.06858	0.2072:0.5734:0.0:0.2194	.	896	Q96GW7	PGCB_HUMAN	S	896	ENSP00000331210:R896S	ENSP00000331210:R896S	R	+	1	0	BCAN	154895500	0.000000	0.05858	0.002000	0.10522	0.738000	0.42128	0.312000	0.19397	0.267000	0.21916	0.491000	0.48974	CGC		0.647	BCAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081844.2	NM_021948		Missense_Mutation
CDH23	64072	broad.mit.edu	37	10	73464679	73464679	+	Silent	SNP	C	C	T	rs183220886	byFrequency	TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr10:73464679C>T	ENST00000224721.6	+	24	2765	c.2760C>T	c.(2758-2760)atC>atT	p.I920I	CDH23_ENST00000299366.7_Silent_p.I960I	NM_022124.5	NP_071407.4	Q9H251	CAD23_HUMAN	cadherin-related 23	915	Cadherin 9. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium ion transport (GO:0006816)|calcium-dependent cell-cell adhesion (GO:0016339)|cytosolic calcium ion homeostasis (GO:0051480)|equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)	calcium ion binding (GO:0005509)	p.I920I(1)		NS(1)|breast(2)|central_nervous_system(6)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(27)|lung(49)|ovary(3)|pancreas(1)|prostate(7)|stomach(7)|upper_aerodigestive_tract(3)	133						TGGTGGCCATCGACCTCGATG	0.647													C|||	7	0.00139776	0.0053	0.0	5008	,	,		18693	0.0		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	10						C	,,	7,4239		0,7,2116	52.0	57.0	55.0		2745,2745,2745	-0.3	1.0	10		55	0,8460		0,0,4230	no	coding-synonymous,coding-synonymous,coding-synonymous	CDH23	NM_001171930.1,NM_001171931.1,NM_022124.5	,,	0,7,6346	TT,TC,CC		0.0,0.1649,0.0551	,,	915/1382,915/1062,915/3355	73464679	7,12699	2123	4230	6353	73134685	SO:0001819	synonymous_variant	64072			AY010111	CCDS53540.1, CCDS73146.1	10q22.1	2014-08-08	2010-01-25		ENSG00000107736	ENSG00000107736		"""Cadherins / Cadherin-related"""	13733	protein-coding gene	gene with protein product	"""cadherin-related family member 23"""	605516	"""cadherin related 23"", ""cadherin-like 23"""	DFNB12, USH1D		11090341	Standard	NM_022124		Approved	CDHR23	uc001jrx.4	Q9H251	OTTHUMG00000019347	ENST00000224721.6:c.2760C>T	10.37:g.73464679C>T			73134685	C4IXS9|F6U049|Q5QGS1|Q5QGS2|Q5QGS5|Q5QGS6|Q5XKN2|Q6UWW1|Q96JL3|Q9H4K9	Silent	SNP	ENST00000224721.6	37		SNP	31	Broad																																																																																				0.647	CDH23-001	PUTATIVE	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051227.4	NM_052836		Silent
SPOCK2	9806	broad.mit.edu	37	10	73826811	73826811	+	Silent	SNP	G	G	A			TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr10:73826811G>A	ENST00000373109.2	-	8	1221	c.777C>T	c.(775-777)acC>acT	p.T259T	SPOCK2_ENST00000460053.1_5'UTR|SPOCK2_ENST00000536168.1_Silent_p.T259T|SPOCK2_ENST00000317376.4_Silent_p.T259T	NM_001244950.1	NP_001231879.1	Q92563	TICN2_HUMAN	sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 2	259					extracellular matrix organization (GO:0030198)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|positive regulation of cell-substrate adhesion (GO:0010811)|regulation of cell differentiation (GO:0045595)|signal transduction (GO:0007165)|synapse assembly (GO:0007416)	proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix binding (GO:0050840)|glycosaminoglycan binding (GO:0005539)	p.T259T(1)		endometrium(2)|large_intestine(2)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	9						GGTCAGCACTGGTGTCCAGCT	0.577																																																1	Substitution - coding silent(1)	ovary(1)	10											100.0	86.0	91.0					10																	73826811		2203	4300	6503	73496817	SO:0001819	synonymous_variant	9806			AJ001453	CCDS7313.1, CCDS44431.1	10q22.1	2013-09-19			ENSG00000107742	ENSG00000107742			13564	protein-coding gene	gene with protein product		607988				10386950	Standard	NM_014767		Approved	KIAA0275, testican-2	uc001jso.2	Q92563	OTTHUMG00000018430	ENST00000373109.2:c.777C>T	10.37:g.73826811G>A			73496817	C9J767|Q6UW87	Silent	SNP	ENST00000373109.2	37	CCDS7313.1	SNP	47	Broad																																																																																				0.577	SPOCK2-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048560.2			Silent
LGI1	9211	broad.mit.edu	37	10	95552607	95552607	+	Missense_Mutation	SNP	C	C	G			TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr10:95552607C>G	ENST00000371418.4	+	6	871	c.611C>G	c.(610-612)cCa>cGa	p.P204R	LGI1_ENST00000542308.1_Missense_Mutation_p.P156R|LGI1_ENST00000371413.3_Missense_Mutation_p.P204R	NM_005097.2	NP_005088.1	O95970	LGI1_HUMAN	leucine-rich, glioma inactivated 1	204	LRRCT.				axon guidance (GO:0007411)|cell proliferation (GO:0008283)|nervous system development (GO:0007399)|neuron projection development (GO:0031175)|positive regulation of cell growth (GO:0030307)|positive regulation of synaptic transmission (GO:0050806)|protein homooligomerization (GO:0051260)	cell junction (GO:0030054)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|synapse (GO:0045202)	receptor binding (GO:0005102)	p.P204R(1)		central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(18)|ovary(2)|skin(1)	29		Colorectal(252;0.124)				GAAGGCCCCCCAGAATACAAG	0.403																																																1	Substitution - Missense(1)	ovary(1)	10	GRCh37	CD020573	LGI1	D							130.0	133.0	132.0					10																	95552607		2203	4300	6503	95542597	SO:0001583	missense	9211			AF055636	CCDS7431.1	10q24	2008-08-01	2002-06-05		ENSG00000108231	ENSG00000108231			6572	protein-coding gene	gene with protein product		604619	"""epilepsy, partial"""	EPT		9879993, 11978770, 15079011	Standard	NM_005097		Approved	IB1099, ETL1, EPITEMPIN	uc001kjc.4	O95970	OTTHUMG00000018777	ENST00000371418.4:c.611C>G	10.37:g.95552607C>G	ENSP00000360472:p.Pro204Arg		95542597	A8K0Z1|B4E1S0|Q5W001|Q5W002|Q8NI23|Q96LF5	Missense_Mutation	SNP	ENST00000371418.4	37	CCDS7431.1	SNP	21	Broad	.	.	.	.	.	.	.	.	.	.	C	19.72	3.880439	0.72294	.	.	ENSG00000108231	ENST00000542308;ENST00000371418;ENST00000371413	D;D;D	0.90133	-2.62;-2.62;-2.62	5.19	4.28	0.50868	Cysteine-rich flanking region, C-terminal (1);	0.162750	0.56097	D	0.000033	D	0.89339	0.6687	L	0.49126	1.545	0.51233	D	0.999918	D;P;B	0.55172	0.97;0.567;0.225	P;B;B	0.49708	0.62;0.43;0.052	D	0.86586	0.1857	10	0.10636	T	0.68	-3.8792	15.3326	0.74226	0.1405:0.8595:0.0:0.0	.	156;204;204	O95970-3;O95970-2;O95970	.;.;LGI1_HUMAN	R	156;204;204	ENSP00000440763:P156R;ENSP00000360472:P204R;ENSP00000360467:P204R	ENSP00000360467:P204R	P	+	2	0	LGI1	95542597	1.000000	0.71417	0.970000	0.41538	0.991000	0.79684	5.818000	0.69236	1.398000	0.46701	0.650000	0.86243	CCA		0.403	LGI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049445.1	NM_005097		Missense_Mutation
SBF2	81846	broad.mit.edu	37	11	9878254	9878254	+	Missense_Mutation	SNP	T	T	A			TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr11:9878254T>A	ENST00000256190.8	-	19	2251	c.2114A>T	c.(2113-2115)gAt>gTt	p.D705V	RP11-1H15.2_ENST00000533659.1_RNA	NM_030962.3	NP_112224.1	Q86WG5	MTMRD_HUMAN	SET binding factor 2	705					cell death (GO:0008219)|myelination (GO:0042552)|positive regulation of Rab GTPase activity (GO:0032851)|protein tetramerization (GO:0051262)	membrane (GO:0016020)|vacuolar membrane (GO:0005774)	phosphatase activity (GO:0016791)|phosphatase regulator activity (GO:0019208)|phosphatidylinositol binding (GO:0035091)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.D705V(1)		breast(4)|endometrium(8)|kidney(2)|large_intestine(8)|lung(16)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	48				all cancers(16;2.88e-11)|Epithelial(150;3.61e-10)|BRCA - Breast invasive adenocarcinoma(625;0.00887)		ATAATGGTCATCAGGAAGCTT	0.393																																																1	Substitution - Missense(1)	ovary(1)	11											196.0	195.0	195.0					11																	9878254		2201	4294	6495	9834830	SO:0001583	missense	81846			AB051553	CCDS31427.1	11p15.3	2014-09-17	2004-11-12	2004-11-12	ENSG00000133812	ENSG00000133812		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"", ""DENN/MADD domain containing"", ""Pleckstrin homology (PH) domain containing"""	2135	protein-coding gene	gene with protein product	"""myotubularin related 13"""	607697	"""Charcot-Marie-Tooth neuropathy 4B2 (autosomal recessive, with myelin outfolding)"", ""DENN/MADD domain containing 7B"""	CMT4B2		10644431	Standard	NM_030962		Approved	KIAA1766, MTMR13, DENND7B	uc001mib.2	Q86WG5	OTTHUMG00000165890	ENST00000256190.8:c.2114A>T	11.37:g.9878254T>A	ENSP00000256190:p.Asp705Val		9834830	Q3MJF0|Q68DQ3|Q6P459|Q6PJD1|Q7Z325|Q7Z621|Q86VE2|Q96FE2|Q9C097	Missense_Mutation	SNP	ENST00000256190.8	37	CCDS31427.1	SNP	50	Broad	.	.	.	.	.	.	.	.	.	.	t	6.067	0.380760	0.11466	.	.	ENSG00000133812	ENST00000256190	T	0.41758	0.99	5.59	4.39	0.52855	.	0.963293	0.08685	N	0.908873	T	0.19886	0.0478	N	0.02539	-0.55	0.43054	D	0.994667	B	0.02656	0.0	B	0.10450	0.005	T	0.12993	-1.0526	10	0.27785	T	0.31	.	8.4938	0.33117	0.1276:0.0:0.1323:0.7401	.	705	Q86WG5	MTMRD_HUMAN	V	705	ENSP00000256190:D705V	ENSP00000256190:D705V	D	-	2	0	SBF2	9834830	0.833000	0.29383	0.986000	0.45419	0.191000	0.23601	3.167000	0.50793	2.251000	0.74343	0.456000	0.33151	GAT		0.393	SBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386911.2	NM_030962		Missense_Mutation
NRXN2	9379	broad.mit.edu	37	11	64428376	64428376	+	Silent	SNP	C	C	T			TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr11:64428376C>T	ENST00000377551.1	-	9	2245	c.2034G>A	c.(2032-2034)ggG>ggA	p.G678G	NRXN2_ENST00000496291.1_5'UTR|NRXN2_ENST00000377559.3_Silent_p.G647G|AP001092.4_ENST00000433606.1_RNA|NRXN2_ENST00000409571.1_Silent_p.G671G|NRXN2_ENST00000265459.6_Silent_p.G678G			Q9P2S2	NRX2A_HUMAN	neurexin 2	678	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|gephyrin clustering (GO:0097116)|neuroligin clustering (GO:0097118)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	calcium channel regulator activity (GO:0005246)|cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)|neuroligin family protein binding (GO:0097109)	p.G678G(1)		breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(1)|lung(34)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(6)|urinary_tract(1)	71						CGCCCACAGCCCCCTGAGCCT	0.662																																																1	Substitution - coding silent(1)	ovary(1)	11											44.0	44.0	44.0					11																	64428376		2201	4297	6498	64184952	SO:0001819	synonymous_variant	9379				CCDS8077.1, CCDS31597.1, CCDS8078.1	11q13	2008-07-18			ENSG00000110076	ENSG00000110076			8009	protein-coding gene	gene with protein product	"""neurexin II"""	600566				1621094	Standard	NM_015080		Approved		uc021qkw.1	P58401	OTTHUMG00000045214	ENST00000377551.1:c.2034G>A	11.37:g.64428376C>T			64184952	A7E2C1|Q9Y2D6	Silent	SNP	ENST00000377551.1	37	CCDS8077.1	SNP	22	Broad																																																																																				0.662	NRXN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000104967.3	NM_015080		Silent
CPT1A	1374	broad.mit.edu	37	11	68552333	68552333	+	Silent	SNP	C	C	T			TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr11:68552333C>T	ENST00000265641.5	-	10	1267	c.1113G>A	c.(1111-1113)tcG>tcA	p.S371S	CPT1A_ENST00000540367.1_Silent_p.S371S|CPT1A_ENST00000539743.1_Silent_p.S371S|CPT1A_ENST00000376618.2_Silent_p.S371S	NM_001876.3	NP_001867.2	P50416	CPT1A_HUMAN	carnitine palmitoyltransferase 1A (liver)	371					carnitine metabolic process (GO:0009437)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|cellular response to fatty acid (GO:0071398)|eating behavior (GO:0042755)|epithelial cell differentiation (GO:0030855)|fatty acid beta-oxidation (GO:0006635)|glucose metabolic process (GO:0006006)|long-chain fatty acid metabolic process (GO:0001676)|positive regulation of fatty acid beta-oxidation (GO:0032000)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	integral component of mitochondrial outer membrane (GO:0031307)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	carnitine O-palmitoyltransferase activity (GO:0004095)	p.S371S(1)		NS(2)|breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|liver(1)|lung(17)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42	Esophageal squamous(3;3.28e-14)		LUAD - Lung adenocarcinoma(13;0.0676)|STAD - Stomach adenocarcinoma(18;0.142)		Glyburide(DB01016)|L-Carnitine(DB00583)|Perhexiline(DB01074)	GCTGAGGCTCCGAGGTATTGT	0.642																																																1	Substitution - coding silent(1)	ovary(1)	11											72.0	65.0	67.0					11																	68552333		2200	4294	6494	68308909	SO:0001819	synonymous_variant	1374			L39211	CCDS8185.1, CCDS31624.1	11q13.2	2007-07-26				ENSG00000110090	2.3.1.21		2328	protein-coding gene	gene with protein product		600528		CPT1		7892212, 9070950	Standard	NM_001876		Approved	CPT1-L, L-CPT1	uc001oog.4	P50416		ENST00000265641.5:c.1113G>A	11.37:g.68552333C>T			68308909	Q8TCU0|Q9BWK0	Silent	SNP	ENST00000265641.5	37	CCDS8185.1	SNP	23	Broad																																																																																				0.642	CPT1A-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397457.2	NM_001876		Silent
GRAMD1B	57476	broad.mit.edu	37	11	123474134	123474134	+	Splice_Site	SNP	C	C	T			TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr11:123474134C>T	ENST00000529750.1	+	8	949	c.622C>T	c.(622-624)Cct>Tct	p.P208S	GRAMD1B_ENST00000456860.2_Splice_Site_p.P215S|GRAMD1B_ENST00000322282.7_Splice_Site_p.P208S	NM_020716.1	NP_065767.1	Q3KR37	GRM1B_HUMAN	GRAM domain containing 1B	208						integral component of membrane (GO:0016021)|membrane (GO:0016020)		p.P208S(1)		NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(17)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	30		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.32e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0394)		TCCCCTGAAGCCTCTGTGTCC	0.592																																																1	Substitution - Missense(1)	ovary(1)	11											72.0	68.0	70.0					11																	123474134		1978	4160	6138	122979344	SO:0001630	splice_region_variant	57476			AB033027	CCDS53720.1, CCDS66253.1, CCDS66254.1	11q24.1	2005-11-02				ENSG00000023171			29214	protein-coding gene	gene with protein product						10574462	Standard	NM_001286564		Approved	KIAA1201	uc001pyx.2	Q3KR37		ENST00000529750.1:c.622-1C>T	11.37:g.123474134C>T			122979344	Q6UW85|Q9ULL9	Missense_Mutation	SNP	ENST00000529750.1	37	CCDS53720.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	18.31	3.596023	0.66332	.	.	ENSG00000023171	ENST00000539133;ENST00000456860;ENST00000322282;ENST00000529750;ENST00000529432;ENST00000534764	T;T;T;T;T	0.28454	1.97;2.0;2.0;2.01;1.61	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	T	0.39172	0.1068	L	0.59436	1.845	0.80722	D	1	B;B;B;B	0.33212	0.402;0.383;0.296;0.063	B;B;B;B	0.40134	0.171;0.32;0.027;0.074	T	0.12993	-1.0526	9	.	.	.	.	18.8313	0.92141	0.0:1.0:0.0:0.0	.	168;215;208;215	B7Z4N9;F5H572;Q3KR37;E7EPH8	.;.;GRM1B_HUMAN;.	S	215;215;208;208;168;204	ENSP00000402457:P215S;ENSP00000325628:P208S;ENSP00000436500:P208S;ENSP00000432987:P168S;ENSP00000434214:P204S	.	P	+	1	0	GRAMD1B	122979344	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	7.631000	0.83237	2.436000	0.82500	0.491000	0.48974	CCT		0.592	GRAMD1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000387404.2	XM_370660	Missense_Mutation	Missense_Mutation
R3HDM2	22864	broad.mit.edu	37	12	57648692	57648692	+	Missense_Mutation	SNP	A	A	C			TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr12:57648692A>C	ENST00000347140.3	-	24	3185	c.2795T>G	c.(2794-2796)aTt>aGt	p.I932S	R3HDM2_ENST00000402412.1_Missense_Mutation_p.I946S|R3HDM2_ENST00000413953.2_Intron|R3HDM2_ENST00000403821.2_Missense_Mutation_p.I966S|RP11-123K3.4_ENST00000548184.1_Intron|R3HDM2_ENST00000441731.2_Missense_Mutation_p.I627S|R3HDM2_ENST00000358907.2_Missense_Mutation_p.I932S			Q9Y2K5	R3HD2_HUMAN	R3H domain containing 2	932						nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.I593S(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(3)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	22						CACAGCCACAATGGTGTACAA	0.587																																																1	Substitution - Missense(1)	ovary(1)	12											69.0	62.0	65.0					12																	57648692		2203	4300	6503	55934959	SO:0001583	missense	22864			AB023219	CCDS8937.2	12q13.3	2012-11-19			ENSG00000179912	ENSG00000179912			29167	protein-coding gene	gene with protein product							Standard	NM_014925		Approved	KIAA1002	uc009zpm.1	Q9Y2K5	OTTHUMG00000171568	ENST00000347140.3:c.2795T>G	12.37:g.57648692A>C	ENSP00000317903:p.Ile932Ser		55934959	Q2M1T9|Q3ZCT5	Missense_Mutation	SNP	ENST00000347140.3	37	CCDS8937.2	SNP	4	Broad	.	.	.	.	.	.	.	.	.	.	A	25.9	4.685177	0.88639	.	.	ENSG00000179912	ENST00000393811;ENST00000347140;ENST00000402412;ENST00000358907;ENST00000441731;ENST00000429355;ENST00000403821	T;T;T;T;T;T;T	0.55052	0.54;1.54;1.55;1.54;0.57;1.15;1.55	5.32	5.32	0.75619	.	0.115504	0.56097	D	0.000022	T	0.48484	0.1502	L	0.38175	1.15	0.44531	D	0.997485	P;P;P;P	0.52061	0.596;0.596;0.856;0.95	B;B;B;P	0.45232	0.26;0.26;0.282;0.474	T	0.54536	-0.8279	10	0.87932	D	0	-13.0161	14.7093	0.69215	1.0:0.0:0.0:0.0	.	966;946;932;659	B5MCG9;B5MCU0;Q9Y2K5;E9PAL1	.;.;R3HD2_HUMAN;.	S	659;932;946;932;627;697;966	ENSP00000377400:I659S;ENSP00000317903:I932S;ENSP00000385839:I946S;ENSP00000351784:I932S;ENSP00000408536:I627S;ENSP00000394676:I697S;ENSP00000385169:I966S	ENSP00000317903:I932S	I	-	2	0	R3HDM2	55934959	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.618000	0.90932	2.371000	0.80710	0.533000	0.62120	ATT		0.587	R3HDM2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326570.2	NM_014925		Missense_Mutation
NT5DC3	51559	broad.mit.edu	37	12	104171699	104171699	+	Missense_Mutation	SNP	G	G	C			TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr12:104171699G>C	ENST00000392876.3	-	14	1595	c.1555C>G	c.(1555-1557)Cgg>Ggg	p.R519G		NM_001031701.2	NP_001026871.1	Q86UY8	NT5D3_HUMAN	5'-nucleotidase domain containing 3	519						cytosol (GO:0005829)|mitochondrion (GO:0005739)|receptor complex (GO:0043235)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)	p.R444G(1)		NS(1)|breast(1)|endometrium(1)|kidney(4)|large_intestine(3)|lung(15)|ovary(2)|skin(1)|stomach(2)	30						GGAGTCCTCCGGGGGTAGAAA	0.622																																																1	Substitution - Missense(1)	ovary(1)	12											64.0	67.0	66.0					12																	104171699		2203	4300	6503	102695829	SO:0001583	missense	51559			AB032786	CCDS41824.1	12q22-q23.1	2006-02-03			ENSG00000111696	ENSG00000111696			30826	protein-coding gene	gene with protein product		611076					Standard	NM_001031701		Approved	TU12B1-TY, FLJ11266	uc010swe.1	Q86UY8	OTTHUMG00000157017	ENST00000392876.3:c.1555C>G	12.37:g.104171699G>C	ENSP00000376615:p.Arg519Gly		102695829	Q9NUM7|Q9P2T2|Q9P2T3	Missense_Mutation	SNP	ENST00000392876.3	37	CCDS41824.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	23.9	4.466714	0.84425	.	.	ENSG00000111696	ENST00000392876	T	0.22743	1.94	5.8	-2.53	0.06326	HAD-like domain (1);	0.000000	0.85682	D	0.000000	T	0.46983	0.1421	M	0.86573	2.825	0.49582	D	0.999806	D	0.59357	0.985	P	0.62184	0.899	T	0.61456	-0.7059	10	0.72032	D	0.01	-24.1928	18.7136	0.91667	0.0:0.0:0.3514:0.6486	.	519	Q86UY8	NT5D3_HUMAN	G	519	ENSP00000376615:R519G	ENSP00000376615:R519G	R	-	1	2	NT5DC3	102695829	1.000000	0.71417	0.884000	0.34674	0.998000	0.95712	1.174000	0.31932	-0.719000	0.04942	0.655000	0.94253	CGG		0.622	NT5DC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347118.2	NM_016575		Missense_Mutation
RCBTB2	1102	broad.mit.edu	37	13	49077028	49077028	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr13:49077028G>A	ENST00000344532.3	-	11	1372	c.949C>T	c.(949-951)Cac>Tac	p.H317Y	RCBTB2_ENST00000544904.1_Missense_Mutation_p.S245L|RCBTB2_ENST00000544492.1_Missense_Mutation_p.H43Y|RCBTB2_ENST00000430805.2_Missense_Mutation_p.H322Y	NM_001268.2	NP_001259.1	O95199	RCBT2_HUMAN	regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 2	317					positive regulation of Ran GTPase activity (GO:0032853)	acrosomal vesicle (GO:0001669)	Ran guanyl-nucleotide exchange factor activity (GO:0005087)	p.H317Y(1)		breast(5)|endometrium(3)|kidney(2)|large_intestine(2)|lung(11)|ovary(2)|prostate(3)|skin(3)	31		all_cancers(8;4.86e-71)|all_epithelial(8;2.11e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;2.3e-10)|Lung NSC(96;1.07e-07)|Breast(56;1.53e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.00826)|Myeloproliferative disorder(33;0.0179)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(99;1.8e-09)|LUSC - Lung squamous cell carcinoma(3;0.116)		TGTGTGGAGTGACAGGCTGCA	0.572																																																1	Substitution - Missense(1)	ovary(1)	13											112.0	78.0	90.0					13																	49077028		2203	4300	6503	47975029	SO:0001583	missense	1102			AF060219	CCDS9411.1, CCDS73570.1, CCDS73571.1, CCDS73572.1	13q14.3	2013-01-08	2005-05-09	2005-05-09	ENSG00000136161	ENSG00000136161		"""BTB/POZ domain containing"""	1914	protein-coding gene	gene with protein product		603524	"""chromosome condensation 1-like"""	CHC1L		9806834	Standard	XM_005266242		Approved		uc001vch.3	O95199	OTTHUMG00000016902	ENST00000344532.3:c.949C>T	13.37:g.49077028G>A	ENSP00000345144:p.His317Tyr		47975029	B2RDW8	Missense_Mutation	SNP	ENST00000344532.3	37	CCDS9411.1	SNP	45	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	30|30	5.054358|5.054358	0.93793|0.93793	.|.	.|.	ENSG00000136161|ENSG00000136161	ENST00000344532;ENST00000452987;ENST00000430805;ENST00000544492|ENST00000544904	D;D;T|T	0.84730|0.50548	-1.89;-1.89;-1.33|0.74	5.73|5.73	5.73|5.73	0.89815|0.89815	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.56601|0.56601	0.1996|0.1996	M|M	0.79475|0.79475	2.455|2.455	0.40685|0.40685	D|D	0.982349|0.982349	D;D;D|B	0.89917|0.24963	1.0;0.977;0.967|0.115	D;P;P|B	0.91635|0.28139	0.999;0.893;0.838|0.086	T|T	0.58572|0.58572	-0.7613|-0.7613	10|9	0.62326|0.87932	D|D	0.03|0	.|.	20.2786|20.2786	0.98501|0.98501	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	43;322;317|245	B4E372;B4DWG0;O95199|B4DPP7	.;.;RCBT2_HUMAN|.	Y|L	317;322;322;43|245	ENSP00000345144:H317Y;ENSP00000389910:H322Y;ENSP00000443862:H43Y|ENSP00000443904:S245L	ENSP00000345144:H317Y|ENSP00000443904:S245L	H|S	-|-	1|2	0|0	RCBTB2|RCBTB2	47975029|47975029	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.929000|0.929000	0.56500|0.56500	9.420000|9.420000	0.97426|0.97426	2.868000|2.868000	0.98415|0.98415	0.557000|0.557000	0.71058|0.71058	CAC|TCA		0.572	RCBTB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044888.2	NM_001268		Missense_Mutation
FBXO34	55030	broad.mit.edu	37	14	55818057	55818057	+	Missense_Mutation	SNP	C	C	A			TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr14:55818057C>A	ENST00000313833.4	+	2	1194	c.949C>A	c.(949-951)Ctt>Att	p.L317I	FBXO34_ENST00000440021.1_Missense_Mutation_p.L317I	NM_017943.3	NP_060413.2	Q9NWN3	FBX34_HUMAN	F-box protein 34	317								p.L317I(1)		breast(2)|kidney(2)|large_intestine(4)|lung(5)|ovary(3)|pancreas(1)|skin(2)|stomach(3)	22						CAGAGTATTGCTTGCAAATAG	0.532																																																1	Substitution - Missense(1)	ovary(1)	14											116.0	113.0	114.0					14																	55818057		2203	4300	6503	54887810	SO:0001583	missense	55030			AK000732	CCDS32086.1	14q22.1	2004-08-24	2004-06-15			ENSG00000178974		"""F-boxes /  ""other"""""	20201	protein-coding gene	gene with protein product		609104	"""F-box only protein 34"""				Standard	NM_017943		Approved	FLJ20725, Fbx34	uc010aoo.3	Q9NWN3		ENST00000313833.4:c.949C>A	14.37:g.55818057C>A	ENSP00000313159:p.Leu317Ile		54887810	Q2VPB5|Q4VBP5|Q86TY4	Missense_Mutation	SNP	ENST00000313833.4	37	CCDS32086.1	SNP	28	Broad	.	.	.	.	.	.	.	.	.	.	C	13.22	2.172250	0.38315	.	.	ENSG00000178974	ENST00000313833;ENST00000440021	T;T	0.28069	1.63;1.63	5.48	5.48	0.80851	.	0.547984	0.15313	N	0.268956	T	0.54791	0.1880	M	0.69823	2.125	0.45852	D	0.998718	D	0.89917	1.0	D	0.74023	0.982	T	0.53107	-0.8485	10	0.87932	D	0	0.0555	13.7801	0.63077	0.0:0.9273:0.0:0.0727	.	317	Q9NWN3	FBX34_HUMAN	I	317	ENSP00000313159:L317I;ENSP00000394117:L317I	ENSP00000313159:L317I	L	+	1	0	FBXO34	54887810	1.000000	0.71417	0.983000	0.44433	0.019000	0.09904	3.640000	0.54350	2.861000	0.98227	0.650000	0.86243	CTT		0.532	FBXO34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411322.1			Missense_Mutation
SPTB	6710	broad.mit.edu	37	14	65263353	65263353	+	Missense_Mutation	SNP	C	C	A			TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr14:65263353C>A	ENST00000389721.5	-	10	1295	c.1263G>T	c.(1261-1263)gaG>gaT	p.E421D	SPTB_ENST00000556626.1_Missense_Mutation_p.E421D|SPTB_ENST00000542895.1_Missense_Mutation_p.E421D|SPTB_ENST00000389720.3_Missense_Mutation_p.E421D|SPTB_ENST00000389722.3_Missense_Mutation_p.E421D	NM_000347.5	NP_000338.3	P11277	SPTB1_HUMAN	spectrin, beta, erythrocytic	421					actin filament capping (GO:0051693)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)	actin cytoskeleton (GO:0015629)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ankyrin binding (GO:0030506)|structural constituent of cytoskeleton (GO:0005200)			breast(5)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(36)|ovary(8)|pancreas(1)|prostate(4)|skin(10)|urinary_tract(3)	106		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)		GGGCCAGTTGCTCTAGCTTCT	0.587																																																0			14											66.0	67.0	67.0					14																	65263353		2203	4300	6503	64333106	SO:0001583	missense	6710				CCDS32099.1, CCDS32100.1	14q24.1-q24.2	2013-01-10	2008-07-29			ENSG00000070182		"""Pleckstrin homology (PH) domain containing"""	11274	protein-coding gene	gene with protein product	"""spherocytosis, clinical type I"""	182870				2209094	Standard	NM_001024858		Approved		uc001xhr.3	P11277		ENST00000389721.5:c.1263G>T	14.37:g.65263353C>A	ENSP00000374371:p.Glu421Asp		64333106	Q15510|Q15519	Missense_Mutation	SNP	ENST00000389721.5	37	CCDS32100.1	SNP	28	Broad	.	.	.	.	.	.	.	.	.	.	C	21.6	4.176416	0.78564	.	.	ENSG00000070182	ENST00000389723;ENST00000389722;ENST00000556626;ENST00000389721;ENST00000542895;ENST00000389720	T;T;T;T;T	0.73789	-0.71;-0.71;-0.78;-0.78;-0.66	5.81	4.0	0.46444	.	0.000000	0.85682	D	0.000000	T	0.75324	0.3834	M	0.69248	2.105	0.53688	D	0.999974	P;D	0.54964	0.553;0.969	B;P	0.48770	0.32;0.589	T	0.75918	-0.3148	10	0.72032	D	0.01	.	9.2057	0.37287	0.0:0.7751:0.0:0.2249	.	421;425	P11277;Q59FP5	SPTB1_HUMAN;.	D	425;421;421;421;421;421	ENSP00000374372:E421D;ENSP00000451752:E421D;ENSP00000374371:E421D;ENSP00000443882:E421D;ENSP00000374370:E421D	ENSP00000374370:E421D	E	-	3	2	SPTB	64333106	0.831000	0.29352	1.000000	0.80357	0.992000	0.81027	0.038000	0.13862	0.810000	0.34279	0.655000	0.94253	GAG		0.587	SPTB-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000414080.1			Missense_Mutation
YLPM1	56252	broad.mit.edu	37	14	75265812	75265812	+	Missense_Mutation	SNP	A	A	T			TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr14:75265812A>T	ENST00000325680.7	+	5	3936	c.3812A>T	c.(3811-3813)gAc>gTc	p.D1271V	YLPM1_ENST00000238571.3_Missense_Mutation_p.D1076V|YLPM1_ENST00000552421.1_Intron	NM_019589.2	NP_062535.2	P49750	YLPM1_HUMAN	YLP motif containing 1	1076					regulation of telomere maintenance (GO:0032204)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			breast(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(12)|lung(24)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	62			KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00162)		TGGGAGAGAGACCAGGATATG	0.478																																																0			14											121.0	118.0	119.0					14																	75265812		1980	4159	6139	74335565	SO:0001583	missense	56252			AK090435	CCDS45135.1	14q24.3	2014-06-13	2004-07-15	2004-07-15	ENSG00000119596	ENSG00000119596			17798	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 169"""		"""chromosome 14 open reading frame 170"""	C14orf170		7596406	Standard	NM_019589		Approved	ZAP, PPP1R169	uc001xqj.4	P49750	OTTHUMG00000172503	ENST00000325680.7:c.3812A>T	14.37:g.75265812A>T	ENSP00000324463:p.Asp1271Val		74335565	P49752|Q96I64|Q9P1V7	Missense_Mutation	SNP	ENST00000325680.7	37	CCDS45135.1	SNP	10	Broad	.	.	.	.	.	.	.	.	.	.	A	15.05	2.718097	0.48622	.	.	ENSG00000119596	ENST00000325680;ENST00000238571;ENST00000423680	.	.	.	5.78	5.78	0.91487	.	0.284658	0.30791	N	0.008871	T	0.67297	0.2878	L	0.52573	1.65	0.53005	D	0.999964	D	0.61697	0.99	P	0.59487	0.858	T	0.69351	-0.5168	9	0.59425	D	0.04	-11.9107	14.0676	0.64839	1.0:0.0:0.0:0.0	.	1271	P49750-4	.	V	1271;1076;984	.	ENSP00000238571:D1076V	D	+	2	0	YLPM1	74335565	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	3.390000	0.52523	2.210000	0.71456	0.368000	0.22195	GAC		0.478	YLPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404451.1	NM_019589		Missense_Mutation
RCOR1	23186	broad.mit.edu	37	14	103167617	103167617	+	Missense_Mutation	SNP	G	G	C			TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr14:103167617G>C	ENST00000570597.1	+	4	439	c.439G>C	c.(439-441)Gat>Cat	p.D147H	RCOR1_ENST00000262241.6_Missense_Mutation_p.D150H			Q9UKL0	RCOR1_HUMAN	REST corepressor 1	147	ELM2. {ECO:0000255|PROSITE- ProRule:PRU00512}.|Interaction with HDAC1.				blood coagulation (GO:0007596)|histone H4 deacetylation (GO:0070933)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|transcription regulatory region DNA binding (GO:0044212)	p.D147H(1)		NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	12						TTTTTCAGTGGATGAATACAT	0.368																																																1	Substitution - Missense(1)	ovary(1)	14											153.0	142.0	145.0					14																	103167617		2203	4300	6503	102237370	SO:0001583	missense	23186			AF155595	CCDS9974.1, CCDS9974.2	14q32.33	2004-04-16	2004-04-16	2004-04-16		ENSG00000089902			17441	protein-coding gene	gene with protein product		607675	"""REST corepressor"""	RCOR		10449787	Standard	NM_015156		Approved	COREST, KIAA0071	uc001ymb.4	Q9UKL0		ENST00000570597.1:c.439G>C	14.37:g.103167617G>C	ENSP00000459789:p.Asp147His		102237370	Q15044|Q6P2I9|Q86VG5	Missense_Mutation	SNP	ENST00000570597.1	37		SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	27.3	4.816638	0.90790	.	.	ENSG00000089902	ENST00000262241	.	.	.	5.39	5.39	0.77823	ELM2 domain (2);	0.000000	0.85682	D	0.000000	D	0.84460	0.5477	M	0.85462	2.755	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.86783	0.1980	9	0.87932	D	0	-27.2662	19.1463	0.93471	0.0:0.0:1.0:0.0	.	147	Q9UKL0	RCOR1_HUMAN	H	147	.	ENSP00000262241:D147H	D	+	1	0	RCOR1	102237370	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	9.835000	0.99442	2.527000	0.85204	0.655000	0.94253	GAT		0.368	RCOR1-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_015156		Missense_Mutation
MYZAP	100820829	broad.mit.edu	37	15	57925928	57925928	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr15:57925928C>T	ENST00000267853.5	+	8	1016	c.922C>T	c.(922-924)Cgc>Tgc	p.R308C	GCOM1_ENST00000380569.2_Missense_Mutation_p.R308C|GCOM1_ENST00000380568.3_Missense_Mutation_p.R308C|MYZAP_ENST00000380565.4_Missense_Mutation_p.R308C|GCOM1_ENST00000574161.1_Missense_Mutation_p.R308C|POLR2M_ENST00000380563.2_5'UTR|GCOM1_ENST00000396180.1_Missense_Mutation_p.R277C|GCOM1_ENST00000587652.1_Missense_Mutation_p.R308C|GCOM1_ENST00000380561.2_Missense_Mutation_p.R277C|GCOM1_ENST00000380560.2_Missense_Mutation_p.R239C|GCOM1_ENST00000572390.1_Missense_Mutation_p.R308C			P0CAP1	MYZAP_HUMAN	myocardial zonula adherens protein	308					intracellular signal transduction (GO:0035556)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|I band (GO:0031674)											GCTGATTGAGCGCATGGAAAA	0.507																																																0			15											118.0	108.0	112.0					15																	57925928		2192	4292	6484	55713220	SO:0001583	missense	145781			FJ970029		15q21.3	2012-10-05			ENSG00000263155	ENSG00000263155			43444	protein-coding gene	gene with protein product	"""myocardium-enriched zonula adherens protein"""	614071				20093627, 21992629, 22160502	Standard	NM_001018100		Approved	MYOZAP, Gup, Gup1, GCOM1		P0CAP1	OTTHUMG00000132453	ENST00000267853.5:c.922C>T	15.37:g.57925928C>T	ENSP00000267853:p.Arg308Cys		55713220	D2E9U7|Q6EER8|Q6EES2|Q6EEV3|Q6EF00|Q6EF01|Q6EF02|Q6EF46|Q6EFN8|Q6EM48|Q6K046|Q6K050|Q6K051|Q6ZQZ3|Q8NC58|Q8NCF3|Q96DI5|Q96JB7|Q96NF5	Missense_Mutation	SNP	ENST00000267853.5	37	CCDS10162.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	16.06	3.014588	0.54468	.	.	ENSG00000137878	ENST00000380569;ENST00000380561;ENST00000396180;ENST00000380560;ENST00000267853;ENST00000380565;ENST00000380568;ENST00000461709	T;T;T;T;T;T;T;T	0.33865	1.39;1.39;1.39;1.39;1.39;1.39;1.39;1.39	5.68	2.81	0.32909	.	0.213542	0.49916	N	0.000137	T	0.47358	0.1441	L	0.47716	1.5	0.80722	D	1	D;D;D;B	0.76494	0.999;0.999;0.999;0.043	D;P;D;B	0.65443	0.935;0.886;0.935;0.009	T	0.32587	-0.9901	10	0.52906	T	0.07	-0.8683	10.1113	0.42563	0.0:0.7798:0.0:0.2202	.	308;308;308;308	P0CAP1-2;P0CAP1-11;P0CAP1-4;P0CAP1	.;.;.;GCOM1_HUMAN	C	308;277;277;239;308;308;308;23	ENSP00000369943:R308C;ENSP00000369935:R277C;ENSP00000379483:R277C;ENSP00000369933:R239C;ENSP00000267853:R308C;ENSP00000369939:R308C;ENSP00000369942:R308C;ENSP00000431396:R23C	ENSP00000267853:R308C	R	+	1	0	GCOM1	55713220	1.000000	0.71417	1.000000	0.80357	0.902000	0.53008	2.713000	0.47194	0.354000	0.24105	-0.217000	0.12591	CGC		0.507	MYZAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255716.2	NM_001018100		Missense_Mutation
ISLR2	57611	broad.mit.edu	37	15	74426774	74426774	+	Missense_Mutation	SNP	C	C	G			TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr15:74426774C>G	ENST00000361742.3	+	4	2448	c.1679C>G	c.(1678-1680)cCg>cGg	p.P560R	ISLR2_ENST00000445793.1_Missense_Mutation_p.P560R|ISLR2_ENST00000561975.1_Intron|ISLR2_ENST00000565159.1_Missense_Mutation_p.P560R|ISLR2_ENST00000435464.1_Missense_Mutation_p.P560R|ISLR2_ENST00000453268.2_Missense_Mutation_p.P560R|ISLR2_ENST00000565540.1_Missense_Mutation_p.P560R|ISLR2_ENST00000419208.1_Missense_Mutation_p.P560R	NM_001130136.1|NM_020851.2	NP_001123608.1|NP_065902.1	Q6UXK2	ISLR2_HUMAN	immunoglobulin superfamily containing leucine-rich repeat 2	560					positive regulation of axon extension (GO:0045773)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.P560R(1)		breast(3)|endometrium(6)|large_intestine(7)|lung(17)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	36						GGCCTGCGGCCGGGTACCAAC	0.657																																																1	Substitution - Missense(1)	ovary(1)	15											11.0	14.0	13.0					15																	74426774		2137	4203	6340	72213827	SO:0001583	missense	57611				CCDS10259.1	15q24.1	2013-01-11			ENSG00000167178	ENSG00000167178		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	29286	protein-coding gene	gene with protein product		614179				10819331, 12975309	Standard	NM_001130136		Approved	KIAA1465	uc010bjf.3	Q6UXK2	OTTHUMG00000137624	ENST00000361742.3:c.1679C>G	15.37:g.74426774C>G	ENSP00000355402:p.Pro560Arg		72213827	A8K352|Q9P263	Missense_Mutation	SNP	ENST00000361742.3	37	CCDS10259.1	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	C	19.01	3.744448	0.69418	.	.	ENSG00000167178	ENST00000445793;ENST00000361742;ENST00000435464;ENST00000453268;ENST00000419208	T;T;T;T;T	0.09723	2.95;2.95;2.95;2.95;2.95	4.73	4.73	0.59995	.	0.000000	0.85682	D	0.000000	T	0.23094	0.0558	L	0.29908	0.895	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.02491	-1.1151	10	0.87932	D	0	.	16.4299	0.83839	0.0:1.0:0.0:0.0	.	560	Q6UXK2	ISLR2_HUMAN	R	560	ENSP00000403244:P560R;ENSP00000355402:P560R;ENSP00000411443:P560R;ENSP00000411834:P560R;ENSP00000408872:P560R	ENSP00000355402:P560R	P	+	2	0	ISLR2	72213827	1.000000	0.71417	0.921000	0.36526	0.754000	0.42855	7.262000	0.78410	2.166000	0.68216	0.313000	0.20887	CCG		0.657	ISLR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269046.1	NM_020851		Missense_Mutation
SYNM	23336	broad.mit.edu	37	15	99672085	99672085	+	Missense_Mutation	SNP	G	G	T			TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr15:99672085G>T	ENST00000336292.6	+	5	3637	c.3517G>T	c.(3517-3519)Gtc>Ttc	p.V1173F	RP11-6O2.4_ENST00000566974.1_RNA|SYNM_ENST00000560674.1_Intron|SYNM_ENST00000328642.7_Intron|SYNM_ENST00000561323.1_3'UTR	NM_145728.2	NP_663780.2	O15061	SYNEM_HUMAN	synemin, intermediate filament protein	1174	Interaction with TLN1 and VCL.|Tail.				intermediate filament cytoskeleton organization (GO:0045104)	adherens junction (GO:0005912)|costamere (GO:0043034)|intermediate filament (GO:0005882)|membrane (GO:0016020)|neurofilament cytoskeleton (GO:0060053)	intermediate filament binding (GO:0019215)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(8)|lung(6)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	29						TGTGAGGCATGTCACGCTGGG	0.627																																					Pancreas(125;1071 1762 21750 40003 40381)											0			15											30.0	33.0	32.0					15																	99672085		2053	4207	6260	97489608	SO:0001583	missense	23336			AK026420	CCDS73786.1, CCDS73787.1	15q26.3	2014-09-17	2008-09-19	2008-09-19	ENSG00000182253	ENSG00000182253		"""A-kinase anchor proteins"", ""Intermediate filaments type IV"""	24466	protein-coding gene	gene with protein product	"""synemin alpha"", ""synemin beta"""	606087	"""desmuslin"""	DMN		11737198, 11454237	Standard	NM_145728		Approved	KIAA0353, SYN	uc002bup.3	O15061		ENST00000336292.6:c.3517G>T	15.37:g.99672085G>T	ENSP00000336775:p.Val1173Phe		97489608	A7E2Y2|Q2TBJ4|Q5NJJ9|Q8TE61|Q8TE62	Missense_Mutation	SNP	ENST00000336292.6	37		SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	4.412	0.076152	0.08485	.	.	ENSG00000182253	ENST00000336292	T	0.80304	-1.36	5.02	-10.0	0.00425	.	.	.	.	.	T	0.47116	0.1428	.	.	.	0.09310	N	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.37572	-0.9700	8	0.02654	T	1	.	2.5087	0.04652	0.1825:0.2549:0.3924:0.1702	.	1174	O15061	SYNEM_HUMAN	F	1173	ENSP00000336775:V1173F	ENSP00000336775:V1173F	V	+	1	0	SYNM	97489608	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-0.439000	0.06897	-3.899000	0.00093	-0.499000	0.04595	GTC		0.627	SYNM-202	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_145728		Missense_Mutation
IFT140	9742	broad.mit.edu	37	16	1634421	1634421	+	Splice_Site	SNP	A	A	C			TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr16:1634421A>C	ENST00000426508.2	-	11	1519	c.1156T>G	c.(1156-1158)Tgg>Ggg	p.W386G	LA16c-395F10.2_ENST00000563162.1_RNA|IFT140_ENST00000439987.2_5'UTR	NM_014714.3	NP_055529.2	Q96RY7	IF140_HUMAN	intraflagellar transport 140	386					cilium assembly (GO:0042384)|intraciliary retrograde transport (GO:0035721)|protein localization to cilium (GO:0061512)|regulation of cilium assembly (GO:1902017)|renal system development (GO:0072001)|retina development in camera-type eye (GO:0060041)|skeletal system morphogenesis (GO:0048705)	axoneme (GO:0005930)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|intraciliary transport particle A (GO:0030991)|photoreceptor connecting cilium (GO:0032391)		p.W386G(1)		breast(1)|central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(12)|lung(10)|ovary(5)|pancreas(1)|prostate(4)|skin(4)|stomach(2)|urinary_tract(1)	53		Hepatocellular(780;0.219)				CTGGAACCCCACTTCATTTCC	0.537																																																1	Substitution - Missense(1)	ovary(1)	16											29.0	24.0	26.0					16																	1634421		2199	4300	6499	1574422	SO:0001630	splice_region_variant	9742			AB011162	CCDS10439.1	16p13.3	2014-07-03	2014-07-03	2005-11-02	ENSG00000187535	ENSG00000187535		"""Intraflagellar transport homologs"", ""WD repeat domain containing"""	29077	protein-coding gene	gene with protein product		614620	"""WD and tetratricopeptide repeats 2"", ""intraflagellar transport 140 homolog (Chlamydomonas)"""	WDTC2		9628581	Standard	NM_014714		Approved	gs114, KIAA0590	uc002cmb.3	Q96RY7	OTTHUMG00000128585	ENST00000426508.2:c.1156-1T>G	16.37:g.1634421A>C			1574422	A2A2A8|D3DU75|O60332|Q9UG52	Missense_Mutation	SNP	ENST00000426508.2	37	CCDS10439.1	SNP	6	Broad	.	.	.	.	.	.	.	.	.	.	A	15.43	2.831428	0.50845	.	.	ENSG00000187535	ENST00000397417;ENST00000426508;ENST00000439987	T	0.73152	-0.72	5.81	5.81	0.92471	WD40/YVTN repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.85177	0.5637	M	0.83953	2.67	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.87386	0.2360	10	0.87932	D	0	.	15.3442	0.74320	1.0:0.0:0.0:0.0	.	386;111	Q96RY7;B4DR58	IF140_HUMAN;.	G	386	ENSP00000406012:W386G	ENSP00000380562:W386G	W	-	1	0	IFT140	1574422	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	8.903000	0.92573	2.219000	0.72066	0.533000	0.62120	TGG		0.537	IFT140-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250438.2	NM_014714	Missense_Mutation	Missense_Mutation
ANKS4B	257629	broad.mit.edu	37	16	21261783	21261783	+	Missense_Mutation	SNP	C	C	G			TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr16:21261783C>G	ENST00000311620.5	+	2	969	c.896C>G	c.(895-897)cCc>cGc	p.P299R		NM_145865.2	NP_665872.2	Q8N8V4	ANS4B_HUMAN	ankyrin repeat and sterile alpha motif domain containing 4B	299					response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum membrane (GO:0005789)|plasma membrane (GO:0005886)		p.P299R(1)		NS(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|lung(11)|ovary(2)	20				GBM - Glioblastoma multiforme(48;0.0565)		TTTAAACTGCCCAGTGAATTG	0.463																																																1	Substitution - Missense(1)	ovary(1)	16											99.0	104.0	103.0					16																	21261783		2001	4186	6187	21169284	SO:0001583	missense	257629			AK096138	CCDS42130.1	16p12.2	2013-01-10				ENSG00000175311		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	26795	protein-coding gene	gene with protein product		609901					Standard	NM_145865		Approved	FLJ38819, HARP	uc010bwp.1	Q8N8V4		ENST00000311620.5:c.896C>G	16.37:g.21261783C>G	ENSP00000308772:p.Pro299Arg		21169284		Missense_Mutation	SNP	ENST00000311620.5	37	CCDS42130.1	SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	C	1.618	-0.522336	0.04141	.	.	ENSG00000175311	ENST00000311620	T	0.39592	1.07	5.98	2.55	0.30701	.	0.987982	0.08288	N	0.968878	T	0.28433	0.0703	L	0.31065	0.9	0.09310	N	1	B	0.10296	0.003	B	0.06405	0.002	T	0.25984	-1.0116	10	0.11485	T	0.65	-0.0416	8.1867	0.31343	0.1208:0.6898:0.1174:0.0721	.	299	Q8N8V4	ANS4B_HUMAN	R	299	ENSP00000308772:P299R	ENSP00000308772:P299R	P	+	2	0	ANKS4B	21169284	0.008000	0.16893	0.789000	0.31954	0.501000	0.33797	1.987000	0.40687	0.865000	0.35603	0.585000	0.79938	CCC		0.463	ANKS4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436535.1	NM_145865		Missense_Mutation
HS3ST4	9951	broad.mit.edu	37	16	25704390	25704390	+	Missense_Mutation	SNP	C	C	G			TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr16:25704390C>G	ENST00000331351.5	+	1	1044	c.652C>G	c.(652-654)Cgc>Ggc	p.R218G		NM_006040.2	NP_006031.2	Q9Y661	HS3S4_HUMAN	heparan sulfate (glucosamine) 3-O-sulfotransferase 4	218					heparan sulfate proteoglycan metabolic process (GO:0030201)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity (GO:0008467)			breast(2)|endometrium(3)|large_intestine(1)|lung(9)	15				GBM - Glioblastoma multiforme(48;0.0988)		GGAGGCGATCCGCGTGCACCC	0.662																																																0			16											18.0	22.0	21.0					16																	25704390		1984	4146	6130	25611891	SO:0001583	missense	9951			AF105378	CCDS53995.1	16p11.2	2008-03-12			ENSG00000182601	ENSG00000182601	2.8.2.23	"""Sulfotransferases, membrane-bound"""	5200	protein-coding gene	gene with protein product		604059				9988767	Standard	NM_006040		Approved	3OST4	uc002dof.3	Q9Y661	OTTHUMG00000059978	ENST00000331351.5:c.652C>G	16.37:g.25704390C>G	ENSP00000330606:p.Arg218Gly		25611891	Q5QI42|Q8NDC2	Missense_Mutation	SNP	ENST00000331351.5	37	CCDS53995.1	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	.	16.42	3.119288	0.56505	.	.	ENSG00000182601	ENST00000331351	D	0.82081	-1.57	4.29	4.29	0.51040	Sulfotransferase domain (1);	0.154950	0.42053	D	0.000771	D	0.90273	0.6958	M	0.75777	2.31	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.90978	0.4825	10	0.51188	T	0.08	.	15.7052	0.77573	0.0:1.0:0.0:0.0	.	218	Q9Y661	HS3S4_HUMAN	G	218	ENSP00000330606:R218G	ENSP00000330606:R218G	R	+	1	0	HS3ST4	25611891	1.000000	0.71417	0.980000	0.43619	0.810000	0.45777	1.128000	0.31369	1.916000	0.55485	0.563000	0.77884	CGC		0.662	HS3ST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133286.2	NM_006040		Missense_Mutation
TP53	7157	broad.mit.edu	37	17	7577141	7577141	+	Missense_Mutation	SNP	C	C	A	rs193920774		TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr17:7577141C>A	ENST00000269305.4	-	8	986	c.797G>T	c.(796-798)gGa>gTa	p.G266V	TP53_ENST00000445888.2_Missense_Mutation_p.G266V|TP53_ENST00000420246.2_Missense_Mutation_p.G266V|TP53_ENST00000359597.4_Missense_Mutation_p.G266V|TP53_ENST00000455263.2_Missense_Mutation_p.G266V|TP53_ENST00000413465.2_Intron|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	266	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		G -> A (in sporadic cancers; somatic mutation).|G -> E (in sporadic cancers; somatic mutation).|G -> R (in sporadic cancers; somatic mutation).|G -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.G266E(50)|p.G266V(42)|p.0?(8)|p.?(3)|p.G266fs*79(3)|p.G262_F270delGNLLGRNSF(2)|p.G266A(2)|p.G266_E271delGRNSFE(2)|p.G262_S269delGNLLGRNS(2)|p.G266fs*4(1)|p.G266T(1)|p.L265_K305del41(1)|p.E258fs*71(1)|p.L265_R267delLGR(1)|p.G266_N268delGRN(1)|p.G262fs*2(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCTGTTCCGTCCCAGTAGATT	0.517		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	121	Substitution - Missense(95)|Deletion - In frame(9)|Whole gene deletion(8)|Deletion - Frameshift(6)|Unknown(3)	lung(23)|oesophagus(10)|haematopoietic_and_lymphoid_tissue(10)|large_intestine(9)|breast(9)|upper_aerodigestive_tract(8)|ovary(8)|urinary_tract(7)|pancreas(6)|skin(5)|central_nervous_system(4)|stomach(4)|bone(4)|liver(4)|endometrium(3)|vulva(1)|kidney(1)|thyroid(1)|cervix(1)|eye(1)|genital_tract(1)|biliary_tract(1)	17											50.0	44.0	46.0					17																	7577141		2203	4300	6503	7517866	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.797G>T	17.37:g.7577141C>A	ENSP00000269305:p.Gly266Val		7517866	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	23.2	4.388215	0.82902	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99900	-7.62;-7.62;-7.62;-7.62;-7.62;-7.62	5.13	5.13	0.70059	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99906	0.9955	M	0.92367	3.3	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;1.0;0.999;0.999	D	0.96190	0.9137	10	0.87932	D	0	-13.0798	16.1198	0.81342	0.0:1.0:0.0:0.0	.	266;266;266;266	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	V	266;266;266;266;266;255;134	ENSP00000352610:G266V;ENSP00000269305:G266V;ENSP00000398846:G266V;ENSP00000391127:G266V;ENSP00000391478:G266V;ENSP00000425104:G134V	ENSP00000269305:G266V	G	-	2	0	TP53	7517866	1.000000	0.71417	0.996000	0.52242	0.744000	0.42396	7.587000	0.82613	2.667000	0.90743	0.462000	0.41574	GGA		0.517	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Missense_Mutation
RAI1	10743	broad.mit.edu	37	17	17700514	17700514	+	Missense_Mutation	SNP	C	C	G			TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr17:17700514C>G	ENST00000353383.1	+	3	4721	c.4252C>G	c.(4252-4254)Ctg>Gtg	p.L1418V	RAI1_ENST00000261641.6_Missense_Mutation_p.L1418V	NM_030665.3	NP_109590.3	Q7Z5J4	RAI1_HUMAN	retinoic acid induced 1	1418					circadian regulation of gene expression (GO:0032922)|negative regulation of multicellular organism growth (GO:0040015)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	enhancer binding (GO:0035326)|zinc ion binding (GO:0008270)	p.L1418V(1)		breast(1)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(14)|ovary(1)|prostate(1)|skin(5)|urinary_tract(7)	48				READ - Rectum adenocarcinoma(1115;0.0276)		CAGTAAGAAACTGTCTTCTAC	0.547																																																1	Substitution - Missense(1)	ovary(1)	17											79.0	79.0	79.0					17																	17700514		2203	4300	6503	17641239	SO:0001583	missense	10743			AJ230819	CCDS11188.1	17p11.2	2011-02-08			ENSG00000108557	ENSG00000108557			9834	protein-coding gene	gene with protein product		607642	"""Smith-Magenis syndrome chromosome region"""	SMCR		10036180	Standard	NM_030665		Approved	DKFZP434A139, SMS, KIAA1820, MGC12824	uc002grm.3	Q7Z5J4	OTTHUMG00000059314	ENST00000353383.1:c.4252C>G	17.37:g.17700514C>G	ENSP00000323074:p.Leu1418Val		17641239	Q8N3B4|Q8ND08|Q8WU64|Q96JK5|Q9H1C1|Q9H1C2|Q9UF69	Missense_Mutation	SNP	ENST00000353383.1	37	CCDS11188.1	SNP	20	Broad	.	.	.	.	.	.	.	.	.	.	C	13.69	2.312191	0.40895	.	.	ENSG00000108557	ENST00000353383;ENST00000395776;ENST00000261641	T;T	0.68025	-0.3;0.31	5.22	3.22	0.36961	.	0.125588	0.34314	N	0.004070	T	0.67050	0.2852	L	0.27053	0.805	0.29507	N	0.854476	D	0.76494	0.999	D	0.76071	0.987	T	0.61088	-0.7133	10	0.32370	T	0.25	.	8.6744	0.34170	0.0:0.7623:0.0:0.2377	.	1418	Q7Z5J4	RAI1_HUMAN	V	1418	ENSP00000323074:L1418V;ENSP00000261641:L1418V	ENSP00000261641:L1418V	L	+	1	2	RAI1	17641239	0.995000	0.38212	0.997000	0.53966	0.955000	0.61496	0.416000	0.21198	0.586000	0.29626	0.561000	0.74099	CTG		0.547	RAI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131775.1	NM_030665		Missense_Mutation
VTN	7448	broad.mit.edu	37	17	26695999	26695999	+	Silent	SNP	G	G	C			TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr17:26695999G>C	ENST00000226218.4	-	5	1338	c.720C>G	c.(718-720)ccC>ccG	p.P240P	VTN_ENST00000536498.1_5'UTR|CTB-96E2.2_ENST00000555059.2_5'Flank|VTN_ENST00000438614.1_5'Flank|SARM1_ENST00000379061.4_Intron|SARM1_ENST00000457710.3_5'Flank|CTB-96E2.3_ENST00000591482.1_RNA|TMEM199_ENST00000509083.1_Intron	NM_000638.3	NP_000629.3	P04004	VTNC_HUMAN	vitronectin	240					cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|immune response (GO:0006955)|innate immune response (GO:0045087)|negative regulation of blood coagulation (GO:0030195)|negative regulation of endopeptidase activity (GO:0010951)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein binding (GO:0032092)|positive regulation of receptor-mediated endocytosis (GO:0048260)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|positive regulation of wound healing (GO:0090303)|regulation of complement activation (GO:0030449)|smooth muscle cell-matrix adhesion (GO:0061302)	alphav-beta3 integrin-vitronectin complex (GO:0071062)|blood microparticle (GO:0072562)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix binding (GO:0050840)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)	p.P240P(1)		kidney(2)|large_intestine(7)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	13	all_lung(13;0.000533)|Lung NSC(42;0.00171)			UCEC - Uterine corpus endometrioid carcinoma (53;0.153)	Abciximab(DB00054)	AGATATTTCGGGGGTAATCAG	0.592																																																1	Substitution - coding silent(1)	ovary(1)	17											96.0	98.0	98.0					17																	26695999		2203	4300	6503	23720126	SO:0001819	synonymous_variant	7448			BC005046	CCDS11229.1	17q11.2	2014-08-08	2006-02-10		ENSG00000109072	ENSG00000109072		"""Endogenous ligands"""	12724	protein-coding gene	gene with protein product	"""serum spreading factor"", ""somatomedin B"", ""complement S-protein"""	193190	"""vitronectin (serum spreading factor, somatomedin B, complement S-protein)"""			2447940	Standard	NM_000638		Approved	VN	uc002hbc.3	P04004	OTTHUMG00000132500	ENST00000226218.4:c.720C>G	17.37:g.26695999G>C			23720126	B2R7G0|P01141|Q9BSH7	Silent	SNP	ENST00000226218.4	37	CCDS11229.1	SNP	43	Broad																																																																																				0.592	VTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255680.2	NM_000638		Silent
IKZF3	22806	broad.mit.edu	37	17	37922082	37922082	+	Silent	SNP	A	A	G			TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr17:37922082A>G	ENST00000346872.3	-	8	1552	c.1491T>C	c.(1489-1491)tcT>tcC	p.S497S	IKZF3_ENST00000377944.3_Silent_p.S354S|IKZF3_ENST00000467757.1_Silent_p.S441S|IKZF3_ENST00000346243.3_Silent_p.S419S|IKZF3_ENST00000351680.3_Silent_p.S458S|IKZF3_ENST00000583368.1_Silent_p.S250S|IKZF3_ENST00000350532.3_Silent_p.S458S|IKZF3_ENST00000439167.2_Silent_p.S424S|IKZF3_ENST00000377958.2_Silent_p.S410S|IKZF3_ENST00000535189.1_Silent_p.S463S|IKZF3_ENST00000439016.2_Silent_p.S402S|RP11-94L15.2_ENST00000488188.2_lincRNA|IKZF3_ENST00000377952.2_Silent_p.S276S|IKZF3_ENST00000394189.2_Silent_p.S315S|IKZF3_ENST00000377945.3_Silent_p.S363S	NM_012481.4	NP_036613.2	Q9UKT9	IKZF3_HUMAN	IKAROS family zinc finger 3 (Aiolos)	497					B cell activation (GO:0042113)|mesoderm development (GO:0007498)|regulation of apoptotic process (GO:0042981)|regulation of B cell differentiation (GO:0045577)|regulation of B cell proliferation (GO:0030888)|regulation of lymphocyte differentiation (GO:0045619)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S497S(1)		NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(6)|large_intestine(4)|liver(1)|lung(13)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	42	Breast(7;4.5e-103)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)			TGGCTATGTGAGACGAGAACT	0.478																																																1	Substitution - coding silent(1)	ovary(1)	17											120.0	112.0	115.0					17																	37922082		2203	4300	6503	35175608	SO:0001819	synonymous_variant	22806			AF129512	CCDS11346.1, CCDS11347.1, CCDS11348.1, CCDS11349.1, CCDS11350.1, CCDS11351.1, CCDS58539.1, CCDS58540.1, CCDS58541.1, CCDS58542.1, CCDS58543.1, CCDS58544.1, CCDS58545.1, CCDS74055.1	17q11.2	2013-01-08	2006-08-25	2006-08-25	ENSG00000161405	ENSG00000161405		"""Zinc fingers, C2H2-type"", ""IKAROS zinc fingers"""	13178	protein-coding gene	gene with protein product		606221	"""zinc finger protein, subfamily 1A, 3 (Aiolos)"""	ZNFN1A3		9155026, 10552935	Standard	NM_012481		Approved	Aiolos	uc002hsu.4	Q9UKT9	OTTHUMG00000133250	ENST00000346872.3:c.1491T>C	17.37:g.37922082A>G			35175608	B4DVV5|Q69BL6|Q69BL7|Q69BL8|Q69BL9|Q69BM0|Q69BM1|Q69BM2|Q69BM3|Q69BM5|Q8N574|Q8WWQ9|Q8WWR0|Q8WWR1|Q8WWR2|Q8WWR3	Silent	SNP	ENST00000346872.3	37	CCDS11346.1	SNP	11	Broad	.	.	.	.	.	.	.	.	.	.	A	8.242	0.806955	0.16467	.	.	ENSG00000161405	ENST00000439167;ENST00000439016	.	.	.	5.5	1.91	0.25777	.	.	.	.	.	T	0.41719	0.1171	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.24476	-1.0159	4	.	.	.	-11.4948	0.4301	0.00469	0.2916:0.2338:0.1383:0.3363	.	.	.	.	P	412;451	.	.	L	-	2	0	IKZF3	35175608	0.030000	0.19436	0.985000	0.45067	0.997000	0.91878	-0.525000	0.06214	0.034000	0.15491	0.482000	0.46254	CTC		0.478	IKZF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257004.2	NM_012481		Silent
STAT5A	6776	broad.mit.edu	37	17	40459648	40459648	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr17:40459648G>A	ENST00000345506.4	+	16	2455	c.1813G>A	c.(1813-1815)Gac>Aac	p.D605N	STAT5A_ENST00000590949.1_Missense_Mutation_p.D605N|STAT5A_ENST00000587646.1_Missense_Mutation_p.D93N|STAT5A_ENST00000452307.2_Missense_Mutation_p.D602N|STAT5A_ENST00000588868.1_Missense_Mutation_p.D574N|STAT5A_ENST00000546010.2_Missense_Mutation_p.D575N	NM_003152.3	NP_003143.2	P42229	STA5A_HUMAN	signal transducer and activator of transcription 5A	605	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				2-oxoglutarate metabolic process (GO:0006103)|allantoin metabolic process (GO:0000255)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|citrate metabolic process (GO:0006101)|creatine metabolic process (GO:0006600)|creatinine metabolic process (GO:0046449)|development of secondary female sexual characteristics (GO:0046543)|development of secondary male sexual characteristics (GO:0046544)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|fatty acid metabolic process (GO:0006631)|female pregnancy (GO:0007565)|isoleucine metabolic process (GO:0006549)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lactation (GO:0007595)|lipid storage (GO:0019915)|luteinization (GO:0001553)|mammary gland epithelium development (GO:0061180)|natural killer cell differentiation (GO:0001779)|negative regulation of erythrocyte differentiation (GO:0045647)|negative regulation of mast cell apoptotic process (GO:0033026)|oxaloacetate metabolic process (GO:0006107)|peptidyl-tyrosine phosphorylation (GO:0018108)|Peyer's patch development (GO:0048541)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of gamma-delta T cell differentiation (GO:0045588)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of mast cell differentiation (GO:0060376)|positive regulation of mast cell proliferation (GO:0070668)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prolactin signaling pathway (GO:0038161)|prostate gland epithelium morphogenesis (GO:0060740)|regulation of cell adhesion (GO:0030155)|regulation of epithelial cell differentiation (GO:0030856)|regulation of multicellular organism growth (GO:0040014)|regulation of steroid metabolic process (GO:0019218)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|succinate metabolic process (GO:0006105)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|taurine metabolic process (GO:0019530)|transcription, DNA-templated (GO:0006351)|valine metabolic process (GO:0006573)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	calcium ion binding (GO:0005509)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			central_nervous_system(1)|kidney(2)|large_intestine(1)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	14		all_cancers(22;1.56e-06)|all_epithelial(22;3.17e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.128)		ACAGGCCCACGACCTGCTCAT	0.577																																																0			17											75.0	67.0	70.0					17																	40459648		2203	4300	6503	37713174	SO:0001583	missense	6776			U43185	CCDS11424.1, CCDS74066.1, CCDS74067.1	17q11.2	2013-02-14			ENSG00000126561	ENSG00000126561		"""SH2 domain containing"""	11366	protein-coding gene	gene with protein product		601511		STAT5		7719937, 8631883	Standard	NM_003152		Approved	MGF	uc002hzj.2	P42229	OTTHUMG00000150725	ENST00000345506.4:c.1813G>A	17.37:g.40459648G>A	ENSP00000341208:p.Asp605Asn		37713174	Q1KLZ6	Missense_Mutation	SNP	ENST00000345506.4	37	CCDS11424.1	SNP	37	Broad	.	.	.	.	.	.	.	.	.	.	G	21.1	4.095496	0.76870	.	.	ENSG00000126561	ENST00000345506;ENST00000546010;ENST00000540577;ENST00000452307	T;T;D	0.96365	0.89;0.89;-3.99	4.94	4.94	0.65067	SH2 motif (4);	0.104859	0.64402	D	0.000005	D	0.95762	0.8621	L	0.59436	1.845	0.80722	D	1	P;B;B;B;B	0.38195	0.622;0.358;0.168;0.059;0.021	B;B;B;B;B	0.41946	0.371;0.178;0.118;0.075;0.017	D	0.96242	0.9176	10	0.66056	D	0.02	-47.7145	18.5174	0.90939	0.0:0.0:1.0:0.0	.	605;602;575;576;605	A8K6I5;Q8WWS9;Q1KLZ6;Q59GY7;P42229	.;.;.;.;STA5A_HUMAN	N	605;575;576;602	ENSP00000341208:D605N;ENSP00000443107:D575N;ENSP00000400320:D602N	ENSP00000341208:D605N	D	+	1	0	STAT5A	37713174	1.000000	0.71417	0.984000	0.44739	0.845000	0.48019	7.681000	0.84073	2.456000	0.83038	0.491000	0.48974	GAC		0.577	STAT5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319804.1	NM_003152		Missense_Mutation
ITGB4	3691	broad.mit.edu	37	17	73723818	73723818	+	Silent	SNP	T	T	C			TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr17:73723818T>C	ENST00000200181.3	+	5	538	c.351T>C	c.(349-351)caT>caC	p.H117H	ITGB4_ENST00000579662.1_Silent_p.H117H|ITGB4_ENST00000450894.3_Silent_p.H117H|ITGB4_ENST00000339591.3_Silent_p.H117H|ITGB4_ENST00000584558.1_3'UTR|ITGB4_ENST00000449880.2_Silent_p.H117H	NM_000213.3	NP_000204.3	P16144	ITB4_HUMAN	integrin, beta 4	117					amelogenesis (GO:0097186)|autophagy (GO:0006914)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell motility (GO:0048870)|cell-matrix adhesion (GO:0007160)|digestive tract development (GO:0048565)|extracellular matrix organization (GO:0030198)|filopodium assembly (GO:0046847)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|mesodermal cell differentiation (GO:0048333)|nail development (GO:0035878)|renal system development (GO:0072001)|response to wounding (GO:0009611)|skin development (GO:0043588)	basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|hemidesmosome (GO:0030056)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor binding (GO:0001664)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|liver(1)|lung(25)|skin(1)|urinary_tract(1)	43	all_cancers(13;1.5e-07)		all cancers(21;8.32e-07)|Epithelial(20;1.92e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|Lung(188;0.132)|LUSC - Lung squamous cell carcinoma(166;0.154)			AGGAGCGGCATTTTGAGCTGG	0.612																																																0			17											54.0	49.0	51.0					17																	73723818		2203	4300	6503	71235413	SO:0001819	synonymous_variant	3691				CCDS11727.1, CCDS32736.1, CCDS58599.1	17q25.1	2013-09-19			ENSG00000132470	ENSG00000132470		"""CD molecules"", ""Integrins"", ""Fibronectin type III domain containing"""	6158	protein-coding gene	gene with protein product		147557				2070796	Standard	XM_005257309		Approved	CD104	uc002jpg.3	P16144	OTTHUMG00000179814	ENST00000200181.3:c.351T>C	17.37:g.73723818T>C			71235413	A0AVL6|O14690|O14691|O15339|O15340|O15341|Q0VF97|Q9UIQ4	Silent	SNP	ENST00000200181.3	37	CCDS11727.1	SNP	52	Broad																																																																																				0.612	ITGB4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000448334.1			Silent
QRICH2	84074	broad.mit.edu	37	17	74289761	74289762	+	Missense_Mutation	DNP	GG	GG	AA			TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr17:74289761_74289762GG>AA	ENST00000262765.5	-	4	727_728	c.548_549CC>TT	c.(547-549)aCC>aTT	p.T183I		NM_032134.1	NP_115510.1	Q9H0J4	QRIC2_HUMAN	glutamine rich 2	183								p.T183I(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(17)|ovary(4)|pancreas(2)|prostate(3)|skin(2)|stomach(4)	62						GTTGTGTCGAGGTAAGCTTCTC	0.54																																																1	Substitution - Missense(1)	ovary(1)	17																																								71801357	SO:0001583	missense	84074			AK058102	CCDS32741.1	17q25.1	2009-03-19			ENSG00000129646	ENSG00000129646			25326	protein-coding gene	gene with protein product							Standard	NM_032134		Approved	DKFZP434P0316	uc002jrd.1	Q9H0J4	OTTHUMG00000167578	ENST00000262765.5:c.548_549delinsAA	17.37:g.74289761_74289762delinsAA	ENSP00000262765:p.Thr183Ile		71801356	A2RRE1|Q96LM3	Missense_Mutation	DNP	ENST00000262765.5	37	CCDS32741.1	DNP	35	Broad																																																																																				0.540	QRICH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395140.1	NM_032134		Missense_Mutation
SPHK1	8877	broad.mit.edu	37	17	74382981	74382981	+	Missense_Mutation	SNP	A	A	G			TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr17:74382981A>G	ENST00000545180.1	+	8	1278	c.469A>G	c.(469-471)Acg>Gcg	p.T157A	SPHK1_ENST00000590959.1_Missense_Mutation_p.T171A|SPHK1_ENST00000592299.1_Missense_Mutation_p.T157A|SPHK1_ENST00000323374.4_Missense_Mutation_p.T243A|SPHK1_ENST00000392496.3_Missense_Mutation_p.T157A			Q9NYA1	SPHK1_HUMAN	sphingosine kinase 1	157	DAGKc. {ECO:0000255|PROSITE- ProRule:PRU00783}.				'de novo' posttranslational protein folding (GO:0051084)|blood vessel development (GO:0001568)|brain development (GO:0007420)|calcium-mediated signaling (GO:0019722)|cellular protein metabolic process (GO:0044267)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to starvation (GO:0009267)|cyclooxygenase pathway (GO:0019371)|female pregnancy (GO:0007565)|inflammatory response (GO:0006954)|intracellular signal transduction (GO:0035556)|lipid phosphorylation (GO:0046834)|negative regulation of apoptotic process (GO:0043066)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of neuron projection development (GO:0010976)|positive regulation of neurotransmitter secretion (GO:0001956)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of smooth muscle contraction (GO:0045987)|protein folding (GO:0006457)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of interleukin-1 beta production (GO:0032651)|regulation of tumor necrosis factor-mediated signaling pathway (GO:0010803)|response to amine (GO:0014075)|response to ATP (GO:0033198)|response to interleukin-1 (GO:0070555)|response to magnesium ion (GO:0032026)|response to progesterone (GO:0032570)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingoid catabolic process (GO:0046521)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingosine metabolic process (GO:0006670)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|D-erythro-sphingosine kinase activity (GO:0017050)|diacylglycerol kinase activity (GO:0004143)|DNA binding (GO:0003677)|magnesium ion binding (GO:0000287)|NAD+ kinase activity (GO:0003951)|protein phosphatase 2A binding (GO:0051721)|sphinganine kinase activity (GO:0008481)	p.T243A(1)		cervix(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)	11					Fingolimod(DB08868)	GTCTCTGCACACGGCTTCGGG	0.592																																					GBM(90;966 1307 27369 33775 44498)											1	Substitution - Missense(1)	ovary(1)	17											72.0	70.0	71.0					17																	74382981		2203	4300	6503	71894576	SO:0001583	missense	8877			BC030553	CCDS11744.1, CCDS45785.1, CCDS59297.1	17q25.2	2004-02-18				ENSG00000176170			11240	protein-coding gene	gene with protein product		603730				9726979	Standard	NM_182965		Approved	SPHK	uc002jrj.2	Q9NYA1		ENST00000545180.1:c.469A>G	17.37:g.74382981A>G	ENSP00000440970:p.Thr157Ala		71894576	Q8N632|Q96GK1|Q9HD92|Q9NY70|Q9NYL3	Missense_Mutation	SNP	ENST00000545180.1	37	CCDS45785.1	SNP	6	Broad	.	.	.	.	.	.	.	.	.	.	A	10.89	1.479250	0.26511	.	.	ENSG00000176170	ENST00000545180;ENST00000323374;ENST00000392496;ENST00000543830	T;T;T	0.13901	2.55;2.55;2.55	5.11	4.04	0.47022	Diacylglycerol kinase, catalytic domain (1);	0.420625	0.28192	N	0.016251	T	0.16257	0.0391	M	0.69823	2.125	0.37622	D	0.921345	B;B;B	0.17268	0.003;0.004;0.021	B;B;B	0.17722	0.019;0.013;0.019	T	0.05869	-1.0859	10	0.23302	T	0.38	-16.2735	10.5191	0.44907	0.9236:0.0:0.0764:0.0	.	243;171;157	Q9NYA1-2;Q96GK1;Q9NYA1	.;.;SPHK1_HUMAN	A	157;243;157;156	ENSP00000440970:T157A;ENSP00000313681:T243A;ENSP00000376285:T157A	ENSP00000313681:T243A	T	+	1	0	SPHK1	71894576	0.018000	0.18449	0.175000	0.22980	0.451000	0.32288	2.140000	0.42159	0.794000	0.33899	0.460000	0.39030	ACG		0.592	SPHK1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450113.1	NM_182965, NM_021972		Missense_Mutation
AFG3L2	10939	broad.mit.edu	37	18	12329615	12329615	+	Silent	SNP	C	C	T			TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr18:12329615C>T	ENST00000269143.3	-	17	2574	c.2343G>A	c.(2341-2343)aaG>aaA	p.K781K	TUBB6_ENST00000590967.1_Intron|TUBB6_ENST00000591909.1_3'UTR	NM_006796.2	NP_006787.2	Q9Y4W6	AFG32_HUMAN	AFG3-like AAA ATPase 2	781					axonogenesis (GO:0007409)|cell death (GO:0008219)|cristae formation (GO:0042407)|mitochondrial fusion (GO:0008053)|mitochondrial protein processing (GO:0034982)|muscle fiber development (GO:0048747)|myelination (GO:0042552)|nerve development (GO:0021675)|neuromuscular junction development (GO:0007528)|regulation of multicellular organism growth (GO:0040014)|righting reflex (GO:0060013)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metalloendopeptidase activity (GO:0004222)|unfolded protein binding (GO:0051082)|zinc ion binding (GO:0008270)			NS(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(12)|prostate(3)|skin(1)|stomach(3)|urinary_tract(1)	27					Adenosine triphosphate(DB00171)	TTTCCCGCTCCTTGTTCCAGT	0.527																																																0			18											92.0	99.0	97.0					18																	12329615		2203	4300	6503	12319615	SO:0001819	synonymous_variant	10939			Y18314	CCDS11859.1	18p11.21	2014-09-17	2013-10-17		ENSG00000141385	ENSG00000141385		"""ATPases / AAA-type"""	315	protein-coding gene	gene with protein product		604581	"""AFG3 (ATPase family gene 3, yeast)-like 2"", ""spinocerebellar ataxia 28"", ""AFG3 ATPase family gene 3-like 2 (yeast)"", ""AFG3 ATPase family gene 3-like 2 (S. cerevisiae)"", ""AFG3 ATPase family member 3-like 2 (S. cerevisiae)"""	SCA28		10395799, 18769991	Standard	NM_006796		Approved	SPAX5	uc002kqz.2	Q9Y4W6	OTTHUMG00000131695	ENST00000269143.3:c.2343G>A	18.37:g.12329615C>T			12319615	Q6P1L0	Silent	SNP	ENST00000269143.3	37	CCDS11859.1	SNP	24	Broad																																																																																				0.527	AFG3L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254603.2	NM_006796		Silent
MYO5B	4645	broad.mit.edu	37	18	47421484	47421484	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr18:47421484C>T	ENST00000285039.7	-	22	3171	c.2872G>A	c.(2872-2874)Gag>Aag	p.E958K	MYO5B_ENST00000324581.6_Missense_Mutation_p.E99K	NM_001080467.2	NP_001073936.1	Q9ULV0	MYO5B_HUMAN	myosin VB	958					endosome localization (GO:0032439)|metabolic process (GO:0008152)|protein transport (GO:0015031)|transmembrane transport (GO:0055085)|vesicle-mediated transport (GO:0016192)|water transport (GO:0006833)	apical cortex (GO:0045179)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|protein complex (GO:0043234)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|Rab GTPase binding (GO:0017137)			NS(1)|breast(6)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(4)	87				READ - Rectum adenocarcinoma(32;0.103)		CGCTCTACCTCCATGGTGTAT	0.547																																																0			18											75.0	73.0	74.0					18																	47421484		2006	4184	6190	45675482	SO:0001583	missense	4645			AB032945	CCDS42436.1	18q	2011-09-27			ENSG00000167306	ENSG00000167306		"""Myosins / Myosin superfamily : Class V"""	7603	protein-coding gene	gene with protein product		606540				8884266, 17462998	Standard	NM_001080467		Approved	KIAA1119	uc002leb.2	Q9ULV0		ENST00000285039.7:c.2872G>A	18.37:g.47421484C>T	ENSP00000285039:p.Glu958Lys		45675482	B0I1R3|Q0P656|Q9H6Y6	Missense_Mutation	SNP	ENST00000285039.7	37	CCDS42436.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	18.49	3.634715	0.67130	.	.	ENSG00000167306	ENST00000285039;ENST00000324581	T;T	0.28069	1.63;1.63	5.68	4.8	0.61643	.	0.058960	0.64402	D	0.000003	T	0.52041	0.1710	M	0.61703	1.905	0.80722	D	1	B;D	0.76494	0.449;0.999	B;D	0.79784	0.445;0.993	T	0.48547	-0.9026	10	0.30854	T	0.27	.	16.2739	0.82634	0.0:0.867:0.133:0.0	.	958;99	Q9ULV0;Q9H6Y6	MYO5B_HUMAN;.	K	958;99	ENSP00000285039:E958K;ENSP00000315531:E99K	ENSP00000285039:E958K	E	-	1	0	MYO5B	45675482	0.998000	0.40836	0.997000	0.53966	0.345000	0.29048	4.037000	0.57311	1.378000	0.46305	0.491000	0.48974	GAG		0.547	MYO5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448515.2			Missense_Mutation
SERPINB3	6317	broad.mit.edu	37	18	61326648	61326648	+	Silent	SNP	C	C	T			TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr18:61326648C>T	ENST00000283752.5	-	4	479	c.336G>A	c.(334-336)acG>acA	p.T112T	SERPINB11_ENST00000489748.1_RNA|SERPINB3_ENST00000332821.8_Silent_p.T112T	NM_006919.2	NP_008850.1	P29508	SPB3_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 3	112					negative regulation of catalytic activity (GO:0043086)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of peptidase activity (GO:0010466)|negative regulation of proteolysis (GO:0045861)|regulation of proteolysis (GO:0030162)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)|virus receptor activity (GO:0001618)	p.T112T(2)		breast(2)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(14)|ovary(1)|skin(5)|upper_aerodigestive_tract(2)	36						AAAATAGATACGTTTTTTCTC	0.413																																																2	Substitution - coding silent(2)	ovary(1)|endometrium(1)	18											167.0	157.0	160.0					18																	61326648		2203	4300	6503	59477628	SO:0001819	synonymous_variant	6317			U19568	CCDS11987.1	18q21.3	2014-02-18	2005-08-18		ENSG00000057149	ENSG00000057149		"""Serine (or cysteine) peptidase inhibitors"""	10569	protein-coding gene	gene with protein product		600517	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 3"""	SCC, SCCA1		7724531, 24172014	Standard	NM_006919		Approved	T4-A, HsT1196	uc002lji.3	P29508	OTTHUMG00000060403	ENST00000283752.5:c.336G>A	18.37:g.61326648C>T			59477628	A6NDM2|B2RBT5|B3W5Y6|Q53H28|Q53YB5|Q86VF3|Q86W04|Q8IWL4|Q8IXI3|Q96J21|Q9BYF8	Silent	SNP	ENST00000283752.5	37	CCDS11987.1	SNP	19	Broad																																																																																				0.413	SERPINB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133791.1	NM_006919		Silent
KCNN1	3780	broad.mit.edu	37	19	18092529	18092529	+	Silent	SNP	G	G	T			TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr19:18092529G>T	ENST00000222249.9	+	5	829	c.510G>T	c.(508-510)gtG>gtT	p.V170V		NM_002248.3	NP_002239.2	Q92952	KCNN1_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 1	170					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)	p.V187V(1)		endometrium(1)|kidney(1)|lung(5)|urinary_tract(1)	8					Miconazole(DB01110)|Procaine(DB00721)	TGTTCATGGTGGACAACGGGG	0.682																																																1	Substitution - coding silent(1)	ovary(1)	19											25.0	25.0	25.0					19																	18092529		2130	4230	6360	17953529	SO:0001819	synonymous_variant	3780			U69883	CCDS67611.1	19p13.1	2012-07-05				ENSG00000105642		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6290	protein-coding gene	gene with protein product		602982				8781233, 10516439, 16382103	Standard	NM_002248		Approved	KCa2.1, hSK1	uc002nht.3	Q92952		ENST00000222249.9:c.510G>T	19.37:g.18092529G>T			17953529	Q5KR10|Q6DJU4	Silent	SNP	ENST00000222249.9	37		SNP	47	Broad																																																																																				0.682	KCNN1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000471896.2	NM_002248		Silent
GSK3A	2931	broad.mit.edu	37	19	42734952	42734952	+	Silent	SNP	G	G	A	rs370274345		TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr19:42734952G>A	ENST00000222330.3	-	11	1573	c.1446C>T	c.(1444-1446)tcC>tcT	p.S482S	GSK3A_ENST00000398249.4_Silent_p.S400S	NM_019884.2	NP_063937.2	P49840	GSK3A_HUMAN	glycogen synthase kinase 3 alpha	482					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cardiac left ventricle morphogenesis (GO:0003214)|cell migration (GO:0016477)|cellular protein metabolic process (GO:0044267)|cellular response to insulin stimulus (GO:0032869)|cellular response to interleukin-3 (GO:0036016)|cellular response to lithium ion (GO:0071285)|cellular response to organic cyclic compound (GO:0071407)|endoplasmic reticulum unfolded protein response (GO:0030968)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glycogen metabolic process (GO:0005977)|hypermethylation of CpG island (GO:0044027)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell growth involved in cardiac muscle cell development (GO:0061052)|negative regulation of glucose import (GO:0046325)|negative regulation of glycogen (starch) synthase activity (GO:2000466)|negative regulation of glycogen biosynthetic process (GO:0045719)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of TOR signaling (GO:0032007)|negative regulation of transferase activity (GO:0051348)|negative regulation of type B pancreatic cell development (GO:2000077)|negative regulation of UDP-glucose catabolic process (GO:0010905)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of adrenergic receptor signaling pathway (GO:0071879)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of glycogen (starch) synthase activity (GO:2000467)|positive regulation of heart contraction (GO:0045823)|positive regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901030)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein phosphorylation (GO:0006468)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of systemic arterial blood pressure (GO:0003073)|Wnt signaling pathway (GO:0016055)	beta-catenin destruction complex (GO:0030877)|cytosol (GO:0005829)	ATP binding (GO:0005524)|protein kinase A catalytic subunit binding (GO:0034236)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)	p.S482S(1)		endometrium(3)|large_intestine(3)|lung(6)|ovary(3)|prostate(2)|skin(1)|urinary_tract(1)	19		Prostate(69;0.00682)				GCCCTCAGGAGGAGTTAGTGA	0.627																																																1	Substitution - coding silent(1)	ovary(1)	19						G		1,4387		0,1,2193	73.0	59.0	64.0		1446	-3.3	1.0	19		64	0,8570		0,0,4285	no	coding-synonymous	GSK3A	NM_019884.2		0,1,6478	AA,AG,GG		0.0,0.0228,0.0077		482/484	42734952	1,12957	2194	4285	6479	47426792	SO:0001819	synonymous_variant	2931				CCDS12599.1	19q13	2008-02-15			ENSG00000105723	ENSG00000105723			4616	protein-coding gene	gene with protein product		606784				9809441	Standard	NM_019884		Approved		uc002otb.1	P49840	OTTHUMG00000150722	ENST00000222330.3:c.1446C>T	19.37:g.42734952G>A			47426792	O14959	Silent	SNP	ENST00000222330.3	37	CCDS12599.1	SNP	35	Broad																																																																																				0.627	GSK3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319782.1			Silent
CEACAM1	634	broad.mit.edu	37	19	43026338	43026338	+	Silent	SNP	G	G	A			TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr19:43026338G>A	ENST00000161559.6	-	3	575	c.441C>T	c.(439-441)ccC>ccT	p.P147P	LIPE-AS1_ENST00000457234.2_RNA|LIPE-AS1_ENST00000594688.1_RNA|CEACAM1_ENST00000403444.3_Silent_p.P147P|CEACAM1_ENST00000358394.3_Silent_p.P147P|LIPE-AS1_ENST00000594624.2_RNA|CEACAM1_ENST00000308072.4_Silent_p.P107P|CEACAM1_ENST00000599389.1_Silent_p.P147P|CEACAM1_ENST00000351134.3_Intron|CEACAM1_ENST00000352591.5_Silent_p.P147P|CEACAM1_ENST00000403461.1_Silent_p.P147P	NM_001712.4	NP_001703.2	P13688	CEAM1_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein)	147	Ig-like C2-type 1.				angiogenesis (GO:0001525)|cell migration (GO:0016477)|homophilic cell adhesion (GO:0007156)|integrin-mediated signaling pathway (GO:0007229)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(1)	17		Prostate(69;0.00682)		GBM - Glioblastoma multiforme(486;0.00148)	Arcitumomab(DB00113)	TGGAGATGGAGGGCTTGGGCA	0.483																																																0			19											136.0	130.0	132.0					19																	43026338		2203	4300	6503	47718178	SO:0001819	synonymous_variant	634			M72238	CCDS12609.1, CCDS46089.1, CCDS54272.1, CCDS54273.1, CCDS54274.1	19q13.2	2014-05-16			ENSG00000079385	ENSG00000079385		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1814	protein-coding gene	gene with protein product		109770		BGP		2457922, 2025273	Standard	NM_001712		Approved	BGP1, CD66a	uc002otv.3	P13688	OTTHUMG00000151078	ENST00000161559.6:c.441C>T	19.37:g.43026338G>A			47718178	A6NE38|A8MY49|O60430|Q069I7|Q13854|Q13857|Q13858|Q13859|Q13860|Q15600|Q15601|Q16170|Q5UB49|Q7KYP5|Q96CA7|Q9UQV9	Silent	SNP	ENST00000161559.6	37	CCDS12609.1	SNP	35	Broad																																																																																				0.483	CEACAM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000321190.2	NM_001712		Silent
PSG11	5680	broad.mit.edu	37	19	43523159	43523159	+	Missense_Mutation	SNP	G	G	C			TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr19:43523159G>C	ENST00000401740.1	-	3	575	c.472C>G	c.(472-474)Ccc>Gcc	p.P158A	PSG11_ENST00000306322.7_Missense_Mutation_p.P36A|PSG11_ENST00000595312.1_5'UTR|PSG11_ENST00000320078.7_Missense_Mutation_p.P158A|PSG11_ENST00000403486.1_Missense_Mutation_p.P36A			Q00887	PSG9_HUMAN	pregnancy specific beta-1-glycoprotein 11	158	Ig-like C2-type 1.				female pregnancy (GO:0007565)	extracellular region (GO:0005576)		p.P158A(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(15)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	26		Prostate(69;0.00682)				GCCTCCCTGGGGTTTAAGTTG	0.527																																																1	Substitution - Missense(1)	ovary(1)	19											190.0	195.0	193.0					19																	43523159		2199	4297	6496	48214999	SO:0001583	missense	5680			U25988	CCDS12614.2, CCDS12615.2	19q13.2	2013-01-29			ENSG00000243130	ENSG00000243130		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9516	protein-coding gene	gene with protein product	"""pregnancy specific beta-1-glycoprotein 13"""	176401		PSG13, PSG14		7794280	Standard	NM_001113410		Approved	MGC22484	uc002ovm.1	Q9UQ72	OTTHUMG00000151546	ENST00000401740.1:c.472C>G	19.37:g.43523159G>C	ENSP00000384995:p.Pro158Ala		48214999	B2R869|Q15227|Q15236|Q15237|Q8WW78|Q9UQ73	Missense_Mutation	SNP	ENST00000401740.1	37	CCDS12614.2	SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	g	10.75	1.439046	0.25900	.	.	ENSG00000243130	ENST00000320078;ENST00000403486;ENST00000306322;ENST00000401740	T;T;T;T	0.12672	2.66;2.66;2.66;2.66	1.13	-0.571	0.11749	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.23054	0.0557	L	0.45698	1.435	0.09310	N	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.14200	-1.0481	9	0.46703	T	0.11	.	4.3746	0.11263	0.0:0.432:0.568:0.0	.	36;158	Q9UQ72-2;Q9UQ72	.;PSG11_HUMAN	A	158;36;36;158	ENSP00000319140:P158A;ENSP00000385427:P36A;ENSP00000304913:P36A;ENSP00000384995:P158A	ENSP00000304913:P36A	P	-	1	0	PSG11	48214999	0.000000	0.05858	0.040000	0.18447	0.111000	0.19643	0.127000	0.15790	0.567000	0.29293	0.184000	0.17185	CCC		0.527	PSG11-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323079.1	NM_002785		Missense_Mutation
CBLC	23624	broad.mit.edu	37	19	45284251	45284252	+	Missense_Mutation	DNP	TG	TG	GA			TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr19:45284251_45284252TG>GA	ENST00000270279.3	+	2	506_507	c.443_444TG>GA	c.(442-444)aTG>aGA	p.M148R	CBLC_ENST00000341505.4_Missense_Mutation_p.M148R	NM_012116.3	NP_036248.3	Q9ULV8	CBLC_HUMAN	Cbl proto-oncogene C, E3 ubiquitin protein ligase	148	Cbl-PTB. {ECO:0000255|PROSITE- ProRule:PRU00839}.|EF-hand-like.				cell surface receptor signaling pathway (GO:0007166)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)|negative regulation of MAP kinase activity (GO:0043407)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|epidermal growth factor receptor binding (GO:0005154)|ligase activity (GO:0016874)|phosphotyrosine binding (GO:0001784)|SH3 domain binding (GO:0017124)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.M148R(1)		breast(1)|kidney(1)|lung(6)|ovary(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	17	Lung NSC(12;0.00136)|all_lung(12;0.00371)	Ovarian(192;0.231)				TGTGGACACATGTACCAGCTCA	0.634			M		AML																																		Rec	yes		19	19q13.2	23624	Cas-Br-M (murine) ecotropic retroviral transforming sequence c		L	1	Substitution - Missense(1)	ovary(1)	19																																								49976092	SO:0001583	missense	23624			AB028645	CCDS12643.1, CCDS46109.1	19q13.2	2013-07-09	2013-07-09		ENSG00000142273	ENSG00000142273		"""RING-type (C3HC4) zinc fingers"""	15961	protein-coding gene	gene with protein product		608453	"""Cas-Br-M (murine) ectropic retroviral transforming sequence c"", ""Cas-Br-M (murine) ecotropic retroviral transforming sequence c"""			10362357, 10571044	Standard	NM_012116		Approved	CBL-3, CBL-SL, RNF57	uc002ozs.3	Q9ULV8	OTTHUMG00000150715	Exception_encountered	19.37:g.45284251_45284252delinsGA	ENSP00000270279:p.Met148Arg		49976091	Q8N1E5|Q9Y5Z2|Q9Y5Z3	Missense_Mutation	DNP	ENST00000270279.3	37	CCDS12643.1	DNP	51	Broad																																																																																				0.634	CBLC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319732.2	NM_012116		Missense_Mutation
SLC27A5	10998	broad.mit.edu	37	19	59009969	59009969	+	Silent	SNP	C	C	A			TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr19:59009969C>A	ENST00000263093.2	-	10	2095	c.1986G>T	c.(1984-1986)ctG>ctT	p.L662L	SLC27A5_ENST00000599700.1_5'UTR|SLC27A5_ENST00000601355.1_Silent_p.L578L|SLC27A5_ENST00000594786.1_Silent_p.L67L	NM_012254.2	NP_036386.1	Q9Y2P5	S27A5_HUMAN	solute carrier family 27 (fatty acid transporter), member 5	662					bile acid and bile salt transport (GO:0015721)|bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|ketone body biosynthetic process (GO:0046951)|plasma membrane long-chain fatty acid transport (GO:0015911)|small molecule metabolic process (GO:0044281)|triglyceride mobilization (GO:0006642)|very long-chain fatty acid metabolic process (GO:0000038)	basal plasma membrane (GO:0009925)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|protein complex (GO:0043234)	ATP binding (GO:0005524)|cholate-CoA ligase activity (GO:0047747)|fatty acid transporter activity (GO:0015245)|very long-chain fatty acid-CoA ligase activity (GO:0031957)	p.L662L(1)		central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	19		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0168)|Lung(386;0.181)		CCAGTACAAACAGAGGGTCAA	0.597																																																1	Substitution - coding silent(1)	ovary(1)	19											157.0	131.0	140.0					19																	59009969		2203	4300	6503	63701781	SO:0001819	synonymous_variant	10998			AF064255	CCDS12983.1	19q13.43	2013-07-15			ENSG00000083807	ENSG00000083807		"""Acyl-CoA synthetase family"", ""Solute carriers"""	10999	protein-coding gene	gene with protein product	"""fatty-acid-Coenzyme A ligase, very long-chain 3"""	603314				10479480, 10749848	Standard	NM_012254		Approved	FATP5, VLACSR, VLCS-H2, VLCSH2, FACVL3, FLJ22987, ACSVL6, ACSB	uc002qtc.2	Q9Y2P5	OTTHUMG00000183543	ENST00000263093.2:c.1986G>T	19.37:g.59009969C>A			63701781	B3KVP6|B4DPQ1	Silent	SNP	ENST00000263093.2	37	CCDS12983.1	SNP	17	Broad																																																																																				0.597	SLC27A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467060.1	NM_012254		Silent
TMEM131	23505	broad.mit.edu	37	2	98409324	98409324	+	Missense_Mutation	SNP	A	A	C			TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr2:98409324A>C	ENST00000186436.5	-	31	3897	c.3669T>G	c.(3667-3669)agT>agG	p.S1223R		NM_015348.1	NP_056163.1	Q92545	TM131_HUMAN	transmembrane protein 131	1223						integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(4)|prostate(1)|skin(1)|stomach(1)	57						TATTGCTGTGACTGCTGTGTG	0.542																																																0			2											116.0	102.0	106.0					2																	98409324		2166	4283	6449	97775756	SO:0001583	missense	23505			AK025852	CCDS46368.1	2q11.2	2006-04-12			ENSG00000075568	ENSG00000075568			30366	protein-coding gene	gene with protein product		615659				9039502, 10996388	Standard	NM_015348		Approved	CC28, YR-23, RW1, KIAA0257, PRO1048	uc002syh.4	Q92545	OTTHUMG00000153061	ENST00000186436.5:c.3669T>G	2.37:g.98409324A>C	ENSP00000186436:p.Ser1223Arg		97775756		Missense_Mutation	SNP	ENST00000186436.5	37	CCDS46368.1	SNP	10	Broad	.	.	.	.	.	.	.	.	.	.	A	13.50	2.255770	0.39896	.	.	ENSG00000075568	ENST00000186436;ENST00000409721	T	0.31510	1.49	4.65	-2.37	0.06643	.	0.570578	0.20382	N	0.093435	T	0.14442	0.0349	N	0.22421	0.69	0.80722	D	1	B	0.29909	0.261	B	0.26416	0.069	T	0.15521	-1.0434	10	0.16420	T	0.52	-1.4888	8.3469	0.32279	0.7075:0.1239:0.1686:0.0	.	1223	Q92545	TM131_HUMAN	R	1223;140	ENSP00000186436:S1223R	ENSP00000186436:S1223R	S	-	3	2	TMEM131	97775756	0.596000	0.26866	0.733000	0.30861	0.995000	0.86356	-0.204000	0.09425	-0.422000	0.07405	0.533000	0.62120	AGT		0.542	TMEM131-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329285.2	XM_371542		Missense_Mutation
MYO3B	140469	broad.mit.edu	37	2	171260805	171260805	+	Missense_Mutation	SNP	G	G	C			TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr2:171260805G>C	ENST00000408978.4	+	20	2469	c.2326G>C	c.(2326-2328)Gac>Cac	p.D776H	MYO3B_ENST00000409044.3_Missense_Mutation_p.D776H|MYO3B_ENST00000334231.6_Missense_Mutation_p.D785H|MYO3B_ENST00000602629.1_3'UTR	NM_138995.4	NP_620482.3	Q8WXR4	MYO3B_HUMAN	myosin IIIB	776	Myosin motor.				peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|stereocilium bundle tip (GO:0032426)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|protein serine/threonine kinase activity (GO:0004674)	p.D776H(1)		breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(25)|ovary(6)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	59						GGAATATGAGGACAACCGCCC	0.512																																																1	Substitution - Missense(1)	ovary(1)	2											143.0	135.0	138.0					2																	171260805		1919	4132	6051	170969051	SO:0001583	missense	140469				CCDS42773.1, CCDS46446.1	2q31.1-q31.2	2011-09-27			ENSG00000071909	ENSG00000071909		"""Myosins / Myosin superfamily : Class III"""	15576	protein-coding gene	gene with protein product		610040					Standard	NM_001083615		Approved		uc002ufy.3	Q8WXR4	OTTHUMG00000154002	ENST00000408978.4:c.2326G>C	2.37:g.171260805G>C	ENSP00000386213:p.Asp776His		170969051	B8ZZR2|Q53QE1|Q53T08|Q8IX64|Q8IX65|Q8IX66|Q8IX67|Q8IX68|Q96N94	Missense_Mutation	SNP	ENST00000408978.4	37	CCDS42773.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	21.7	4.186051	0.78789	.	.	ENSG00000071909	ENST00000409044;ENST00000408978;ENST00000317915;ENST00000484338;ENST00000334231	T;T;T;T	0.78246	-1.16;-1.16;-1.16;-1.16	5.47	5.47	0.80525	Myosin head, motor domain (3);	0.088391	0.85682	D	0.000000	D	0.92909	0.7744	H	0.97491	4.015	0.58432	D	0.999998	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.997;0.999	D	0.94918	0.8071	10	0.87932	D	0	.	19.686	0.95979	0.0:0.0:1.0:0.0	.	776;776;776	Q8WXR4-5;Q8WXR4-4;Q8WXR4	.;.;MYO3B_HUMAN	H	776;776;775;785;785	ENSP00000386497:D776H;ENSP00000386213:D776H;ENSP00000446237:D785H;ENSP00000335100:D785H	ENSP00000314213:D775H	D	+	1	0	MYO3B	170969051	1.000000	0.71417	1.000000	0.80357	0.894000	0.52154	7.871000	0.87180	2.728000	0.93425	0.655000	0.94253	GAC		0.512	MYO3B-004	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333410.1			Missense_Mutation
PDXK	8566	broad.mit.edu	37	21	45175862	45175862	+	Missense_Mutation	SNP	C	C	G			TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr21:45175862C>G	ENST00000291565.4	+	11	1040	c.857C>G	c.(856-858)cCc>cGc	p.P286R	PDXK_ENST00000467908.1_Missense_Mutation_p.P246R|PDXK_ENST00000468090.1_Missense_Mutation_p.P258R	NM_003681.4	NP_003672.1	O00764	PDXK_HUMAN	pyridoxal (pyridoxine, vitamin B6) kinase	286					cell proliferation (GO:0008283)|pyridoxal 5'-phosphate salvage (GO:0009443)|pyridoxal phosphate biosynthetic process (GO:0042823)|small molecule metabolic process (GO:0044281)|vitamin B6 metabolic process (GO:0042816)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|lithium ion binding (GO:0031403)|magnesium ion binding (GO:0000287)|potassium ion binding (GO:0030955)|protein homodimerization activity (GO:0042803)|pyridoxal kinase activity (GO:0008478)|pyridoxal phosphate binding (GO:0030170)|sodium ion binding (GO:0031402)|zinc ion binding (GO:0008270)	p.P286R(2)		endometrium(1)|lung(2)|ovary(1)|urinary_tract(1)	5				Colorectal(79;0.109)|READ - Rectum adenocarcinoma(84;0.161)|STAD - Stomach adenocarcinoma(101;0.18)	Pyridoxal(DB00147)|Pyridoxine(DB00165)	AGGCCCAGCCCCATGCAGCTG	0.682																																																2	Substitution - Missense(2)	ovary(2)	21											33.0	33.0	33.0					21																	45175862		2200	4299	6499	44000290	SO:0001583	missense	8566			U89606	CCDS13699.1	21q22.3	2007-05-10			ENSG00000160209	ENSG00000160209	2.7.1.35		8819	protein-coding gene	gene with protein product		179020	"""chromosome 21 open reading frame 97"", ""chromosome 21 open reading frame 124"""	C21orf97, C21orf124		9099727	Standard	NM_003681		Approved	PNK, PKH, FLJ21324, PRED79, FLJ31940, MGC15873	uc002zdm.4	O00764	OTTHUMG00000086870	ENST00000291565.4:c.857C>G	21.37:g.45175862C>G	ENSP00000291565:p.Pro286Arg		44000290	Q7Z2Y0|Q9BS02	Missense_Mutation	SNP	ENST00000291565.4	37	CCDS13699.1	SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	C	10.56	1.384223	0.25031	.	.	ENSG00000160209	ENST00000468090;ENST00000291565;ENST00000467908	.	.	.	4.6	4.6	0.57074	.	0.177641	0.49916	D	0.000121	T	0.64864	0.2637	L	0.61387	1.9	0.38094	D	0.93705	P;P	0.44877	0.845;0.807	P;B	0.54401	0.751;0.34	T	0.64198	-0.6464	9	0.21540	T	0.41	-22.9631	12.2191	0.54423	0.1705:0.8295:0.0:0.0	.	258;286	O00764-2;O00764	.;PDXK_HUMAN	R	258;286;246	.	ENSP00000291565:P286R	P	+	2	0	PDXK	44000290	0.419000	0.25449	0.891000	0.34965	0.153000	0.21895	3.309000	0.51903	2.112000	0.64535	0.585000	0.79938	CCC		0.682	PDXK-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195636.1	NM_003681		Missense_Mutation
MCM3AP	8888	broad.mit.edu	37	21	47676785	47676785	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr21:47676785C>T	ENST00000397708.1	-	18	4104	c.3850G>A	c.(3850-3852)Gag>Aag	p.E1284K	MCM3AP_ENST00000467026.1_5'UTR|MCM3AP_ENST00000291688.1_Missense_Mutation_p.E1284K|AP001469.9_ENST00000430259.1_RNA|MCM3AP-AS1_ENST00000590829.1_RNA			O60318	GANP_HUMAN	minichromosome maintenance complex component 3 associated protein	1284					DNA replication (GO:0006260)|immune system process (GO:0002376)|mRNA transport (GO:0051028)|protein import into nucleus (GO:0006606)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transferase activity, transferring acyl groups (GO:0016746)	p.E1284K(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(10)|kidney(5)|large_intestine(17)|lung(24)|ovary(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	72	Breast(49;0.112)					ATGGGGCACTCTGCGCTGGGC	0.667																																																1	Substitution - Missense(1)	ovary(1)	21											15.0	19.0	17.0					21																	47676785		2199	4295	6494	46501213	SO:0001583	missense	8888			AB005543	CCDS13734.1	21q22.3	2012-12-19	2007-04-04		ENSG00000160294	ENSG00000160294			6946	protein-coding gene	gene with protein product	"""germinal-centre associated nuclear protein"""	603294	"""minichromosome maintenance deficient (S. cerevisiae) 3-associated protein"", ""MCM3 minichromosome maintenance deficient 3 (S. cerevisiae) associated protein"""			9712829, 16914116, 21195085	Standard	XM_005261205		Approved	Map80, KIAA0572, GANP, SAC3	uc002zir.1	O60318	OTTHUMG00000090630	ENST00000397708.1:c.3850G>A	21.37:g.47676785C>T	ENSP00000380820:p.Glu1284Lys		46501213	C9JL56|Q2M3C1|Q6PJP6|Q9BSY5|Q9UMT4	Missense_Mutation	SNP	ENST00000397708.1	37	CCDS13734.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	18.83	3.706695	0.68615	.	.	ENSG00000160294	ENST00000397708;ENST00000291688	T;T	0.03772	3.81;3.81	5.59	4.69	0.59074	.	0.152400	0.56097	D	0.000025	T	0.05502	0.0145	L	0.29908	0.895	0.41592	D	0.988802	P	0.42456	0.78	B	0.38106	0.265	T	0.38993	-0.9635	10	0.56958	D	0.05	-25.131	16.3994	0.83633	0.0:0.8682:0.1318:0.0	.	1284	O60318	MCM3A_HUMAN	K	1284	ENSP00000380820:E1284K;ENSP00000291688:E1284K	ENSP00000291688:E1284K	E	-	1	0	MCM3AP	46501213	1.000000	0.71417	0.997000	0.53966	0.498000	0.33706	5.315000	0.65810	1.333000	0.45449	0.655000	0.94253	GAG		0.667	MCM3AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207254.1	NM_003906		Missense_Mutation
CCT8L2	150160	broad.mit.edu	37	22	17072656	17072656	+	Missense_Mutation	SNP	G	G	C			TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr22:17072656G>C	ENST00000359963.3	-	1	1044	c.785C>G	c.(784-786)tCt>tGt	p.S262C		NM_014406.4	NP_055221.1	Q96SF2	TCPQM_HUMAN	chaperonin containing TCP1, subunit 8 (theta)-like 2	262					anion transport (GO:0006820)|cellular protein metabolic process (GO:0044267)|potassium ion transmembrane transport (GO:0071805)|transport (GO:0006810)	cytoplasm (GO:0005737)	anion channel activity (GO:0005253)|ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)	p.S262C(1)		breast(3)|endometrium(7)|kidney(1)|large_intestine(8)|liver(2)|lung(37)|ovary(3)|prostate(3)|skin(2)|stomach(1)	67	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.0157)|Lung NSC(13;0.147)|all_lung(157;0.175)				AGCAGGACTAGAAAGACGGGC	0.507																																																1	Substitution - Missense(1)	ovary(1)	22											109.0	103.0	105.0					22																	17072656		2203	4300	6503	15452656	SO:0001583	missense	150160			AP003553	CCDS13738.1	22q11.1	2011-09-01			ENSG00000198445	ENSG00000198445			15553	protein-coding gene	gene with protein product							Standard	NM_014406		Approved	CESK1	uc002zlp.1	Q96SF2	OTTHUMG00000141302	ENST00000359963.3:c.785C>G	22.37:g.17072656G>C	ENSP00000353048:p.Ser262Cys		15452656	A4QPH3|Q9UJS3	Missense_Mutation	SNP	ENST00000359963.3	37	CCDS13738.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	g	12.01	1.809843	0.31961	.	.	ENSG00000198445	ENST00000359963	T	0.78246	-1.16	1.98	0.869	0.19096	.	0.641922	0.11995	U	0.509439	T	0.80768	0.4686	L	0.51422	1.61	0.09310	N	1	D	0.67145	0.996	D	0.64506	0.926	T	0.67476	-0.5661	10	0.72032	D	0.01	-7.7464	6.2969	0.21091	0.0:0.3156:0.6844:0.0	.	262	Q96SF2	TCPQM_HUMAN	C	262	ENSP00000353048:S262C	ENSP00000353048:S262C	S	-	2	0	CCT8L2	15452656	0.001000	0.12720	0.003000	0.11579	0.052000	0.14988	0.214000	0.17541	0.163000	0.19507	0.379000	0.24179	TCT		0.507	CCT8L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280580.1			Missense_Mutation
ZNF280B	140883	broad.mit.edu	37	22	22842614	22842614	+	Silent	SNP	C	C	T	rs544119930		TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr22:22842614C>T	ENST00000406426.1	-	4	1852	c.1110G>A	c.(1108-1110)gaG>gaA	p.E370E	ZNF280B_ENST00000360412.2_Silent_p.E370E			Q86YH2	Z280B_HUMAN	zinc finger protein 280B	370					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E370E(1)		autonomic_ganglia(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(9)|ovary(2)	22	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.74e-30)|Acute lymphoblastic leukemia(6;7.75e-22)		READ - Rectum adenocarcinoma(21;0.145)		CAGTAGAGGGCTCCTGGGCAG	0.502													C|||	1	0.000199681	0.0	0.0	5008	,	,		16783	0.0		0.0	False		,,,				2504	0.001															1	Substitution - coding silent(1)	ovary(1)	22											121.0	113.0	116.0					22																	22842614		2203	4300	6503	21172614	SO:0001819	synonymous_variant	140883			AK097608	CCDS13799.1	22q11.2	2007-09-20	2007-09-20	2007-09-20	ENSG00000198477	ENSG00000275004			23022	protein-coding gene	gene with protein product			"""zinc finger protein 279"", ""suppressor of hairy wing homolog 2 (Drosophila)"""	ZNF279, SUHW2		9074928	Standard	NM_080764		Approved	5'OY11.1, ZNF632	uc002zwc.1	Q86YH2	OTTHUMG00000151066	ENST00000406426.1:c.1110G>A	22.37:g.22842614C>T			21172614		Silent	SNP	ENST00000406426.1	37	CCDS13799.1	SNP	28	Broad																																																																																				0.502	ZNF280B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321170.2	NM_080764		Silent
RASL10A	10633	broad.mit.edu	37	22	29707931	29707931	+	IGR	SNP	C	C	G			TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr22:29707931C>G	ENST00000216101.6	-	0	1490				GAS2L1_ENST00000407647.2_Missense_Mutation_p.P497R|RASL10A_ENST00000608559.1_5'Flank|GAS2L1_ENST00000407854.1_Missense_Mutation_p.P497R|GAS2L1_ENST00000403764.1_Missense_Mutation_p.P497R|GAS2L1_ENST00000406549.3_Intron|GAS2L1_ENST00000471961.1_Missense_Mutation_p.P497R|GAS2L1_ENST00000341313.6_3'UTR|GAS2L1_ENST00000360113.2_3'UTR	NM_006477.4	NP_006468.1	Q92737	RSLAA_HUMAN	RAS-like, family 10, member A						small GTPase mediated signal transduction (GO:0007264)	nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.T496T(1)		NS(1)	1						AGTTGGGCACCACACCGGCCA	0.711																																																1	Substitution - coding silent(1)	ovary(1)	22											17.0	23.0	21.0					22																	29707931		2067	4184	6251	28037931	SO:0001628	intergenic_variant	10634			Y07847	CCDS13854.1	22q12.2	2014-05-09			ENSG00000100276	ENSG00000100276			16954	protein-coding gene	gene with protein product		602220				8975699, 15731001	Standard	NM_006477		Approved	RRP22	uc031rxl.1	Q92737	OTTHUMG00000151106		22.37:g.29707931C>G			28037931	Q49AU5|Q6PI03	Missense_Mutation	SNP	ENST00000216101.6	37	CCDS13854.1	SNP	21	Broad	.	.	.	.	.	.	.	.	.	.	C	5.862	0.343241	0.11069	.	.	ENSG00000185340	ENST00000407647;ENST00000403764;ENST00000471961;ENST00000407854	T;T;T;T	0.51325	0.71;0.71;0.71;0.71	3.3	2.24	0.28232	.	.	.	.	.	T	0.27169	0.0666	N	0.08118	0	0.09310	N	0.999999	B	0.06786	0.001	B	0.06405	0.002	T	0.20806	-1.0264	9	0.52906	T	0.07	-4.3659	9.1906	0.37197	0.2182:0.7818:0.0:0.0	.	497	E7EQM6	.	R	497	ENSP00000385554:P497R;ENSP00000385358:P497R;ENSP00000450152:P497R;ENSP00000385023:P497R	ENSP00000385358:P497R	P	+	2	0	GAS2L1	28037931	0.013000	0.17824	0.166000	0.22797	0.960000	0.62799	-0.120000	0.10660	0.698000	0.31739	0.491000	0.48974	CCA		0.711	RASL10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321342.1			Missense_Mutation
NR1D2	9975	broad.mit.edu	37	3	24018833	24018833	+	Missense_Mutation	SNP	C	C	A			TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr3:24018833C>A	ENST00000312521.4	+	8	1982	c.1663C>A	c.(1663-1665)Ctt>Att	p.L555I	NR1D2_ENST00000492552.1_3'UTR	NM_001145425.1|NM_005126.4	NP_001138897.1|NP_005117	Q14995	NR1D2_HUMAN	nuclear receptor subfamily 1, group D, member 2	555	Interaction with ZNHIT1.|Ligand-binding.				gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|lipid homeostasis (GO:0055088)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of circadian rhythm (GO:0042752)|regulation of energy homeostasis (GO:2000505)|regulation of inflammatory response (GO:0050727)|regulation of lipid metabolic process (GO:0019216)|regulation of skeletal muscle cell differentiation (GO:2001014)|regulation of transcription, DNA-templated (GO:0006355)|rhythmic process (GO:0048511)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)	p.L555I(1)		NS(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(4)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	22						TACAAAACTGCTTCTAAAGTT	0.398																																																1	Substitution - Missense(1)	ovary(1)	3											76.0	81.0	80.0					3																	24018833		2203	4300	6503	23993837	SO:0001583	missense	9975			BC045613	CCDS33718.1	3p24.1	2013-01-16			ENSG00000174738	ENSG00000174738		"""Nuclear hormone receptors"""	7963	protein-coding gene	gene with protein product		602304				7997240, 10198169	Standard	NM_005126		Approved	BD73, RVR, EAR-1r, HZF2, Hs.37288	uc003ccs.2	Q14995	OTTHUMG00000155659	ENST00000312521.4:c.1663C>A	3.37:g.24018833C>A	ENSP00000310006:p.Leu555Ile		23993837	B2R8Q3|O00402|Q86XD4	Missense_Mutation	SNP	ENST00000312521.4	37	CCDS33718.1	SNP	28	Broad	.	.	.	.	.	.	.	.	.	.	C	22.5	4.293623	0.80914	.	.	ENSG00000174738	ENST00000312521;ENST00000396676	D	0.97731	-4.51	5.92	5.92	0.95590	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.057930	0.64402	D	0.000001	D	0.98541	0.9513	M	0.78344	2.41	0.80722	D	1	D	0.56521	0.976	D	0.64506	0.926	D	0.97919	1.0313	10	0.30854	T	0.27	.	20.3605	0.98856	0.0:1.0:0.0:0.0	.	555	Q14995	NR1D2_HUMAN	I	555	ENSP00000310006:L555I	ENSP00000310006:L555I	L	+	1	0	NR1D2	23993837	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.792000	0.85828	2.817000	0.96982	0.558000	0.71614	CTT		0.398	NR1D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341017.3			Missense_Mutation
MAGI1	9223	broad.mit.edu	37	3	65342471	65342471	+	Missense_Mutation	SNP	T	T	A			TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr3:65342471T>A	ENST00000402939.2	-	23	3970	c.3971A>T	c.(3970-3972)gAg>gTg	p.E1324V	RP11-88H12.2_ENST00000602316.1_RNA|MAGI1_ENST00000330909.8_3'UTR	NM_001033057.1	NP_001028229.1	Q96QZ7	MAGI1_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 1	1353					cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|neuron death (GO:0070997)|protein complex assembly (GO:0006461)	cell junction (GO:0030054)|cell projection (GO:0042995)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	alpha-actinin binding (GO:0051393)|ATP binding (GO:0005524)|protein C-terminus binding (GO:0008022)	p.E1324V(1)		breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|liver(1)|lung(21)|pancreas(1)|skin(5)	51		Lung NSC(201;0.0016)		BRCA - Breast invasive adenocarcinoma(55;0.00138)|KIRC - Kidney renal clear cell carcinoma(15;0.0988)|Kidney(15;0.133)		CCTCCGCTTCTCTGGGGACCG	0.721																																																1	Substitution - Missense(1)	ovary(1)	3											38.0	41.0	40.0					3																	65342471		2203	4300	6503	65317511	SO:0001583	missense	9223			AB010894	CCDS33780.1, CCDS33781.1, CCDS2904.1	3p14.1	2009-10-06	2005-05-10	2005-05-10	ENSG00000151276	ENSG00000151276			946	protein-coding gene	gene with protein product		602625	"""BAI1-associated protein 1"""	BAIAP1		9647739, 9225980	Standard	XM_005265563		Approved	BAP1, MAGI-1, TNRC19, AIP3, WWP3	uc003dmn.3	Q96QZ7	OTTHUMG00000157554	ENST00000402939.2:c.3971A>T	3.37:g.65342471T>A	ENSP00000385450:p.Glu1324Val		65317511	A8K188|O00309|O43863|O75085|Q96QZ8|Q96QZ9	Missense_Mutation	SNP	ENST00000402939.2	37	CCDS33780.1	SNP	54	Broad	.	.	.	.	.	.	.	.	.	.	T	11.44	1.639271	0.29157	.	.	ENSG00000151276	ENST00000402939	T	0.15372	2.43	5.31	5.31	0.75309	.	0.340277	0.30060	N	0.010510	T	0.14570	0.0352	L	0.32530	0.975	0.80722	D	1	P	0.41848	0.763	B	0.37144	0.242	T	0.03139	-1.1068	10	0.40728	T	0.16	-12.421	15.2578	0.73599	0.0:0.0:0.0:1.0	.	1324	Q96QZ7-2	.	V	1324	ENSP00000385450:E1324V	ENSP00000385450:E1324V	E	-	2	0	MAGI1	65317511	1.000000	0.71417	0.990000	0.47175	0.150000	0.21749	5.063000	0.64332	2.006000	0.58801	0.533000	0.62120	GAG		0.721	MAGI1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000349126.1	NM_004742		Missense_Mutation
MYH15	22989	broad.mit.edu	37	3	108117551	108117551	+	Missense_Mutation	SNP	C	C	T	rs537723723		TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr3:108117551C>T	ENST00000273353.3	-	36	5182	c.5126G>A	c.(5125-5127)cGt>cAt	p.R1709H		NM_014981.1	NP_055796.1	Q9Y2K3	MYH15_HUMAN	myosin, heavy chain 15	1709						cytoplasm (GO:0005737)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(1)|breast(3)|central_nervous_system(2)|cervix(4)|endometrium(10)|kidney(4)|large_intestine(14)|lung(47)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	105						CCTGCGGCCACGCTCTGTCTG	0.527																																																0			3											187.0	190.0	189.0					3																	108117551		1972	4159	6131	109600241	SO:0001583	missense	22989			AB023217	CCDS43127.1	3q13	2011-09-27	2006-09-29		ENSG00000144821	ENSG00000144821		"""Myosins / Myosin superfamily : Class II"""	31073	protein-coding gene	gene with protein product		609929	"""myosin, heavy polypeptide 15"""			15014174, 15042088	Standard	NM_014981		Approved	KIAA1000	uc003dxa.1	Q9Y2K3	OTTHUMG00000159226	ENST00000273353.3:c.5126G>A	3.37:g.108117551C>T	ENSP00000273353:p.Arg1709His		109600241		Missense_Mutation	SNP	ENST00000273353.3	37	CCDS43127.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	14.76	2.631755	0.46944	.	.	ENSG00000144821	ENST00000273353	D	0.84873	-1.91	5.15	0.99	0.19807	Myosin tail (1);	.	.	.	.	D	0.87581	0.6213	M	0.88979	2.995	0.09310	N	1	B	0.33103	0.397	B	0.42282	0.382	T	0.80598	-0.1311	9	0.87932	D	0	.	4.5594	0.12152	0.1512:0.5771:0.0:0.2717	.	1709	Q9Y2K3	MYH15_HUMAN	H	1709	ENSP00000273353:R1709H	ENSP00000273353:R1709H	R	-	2	0	MYH15	109600241	0.000000	0.05858	0.000000	0.03702	0.061000	0.15899	1.138000	0.31491	-0.123000	0.11745	-0.150000	0.13652	CGT		0.527	MYH15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353935.1	XM_036988		Missense_Mutation
ALDH1L1	10840	broad.mit.edu	37	3	125843212	125843212	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr3:125843212C>T	ENST00000393434.2	-	16	2232	c.1883G>A	c.(1882-1884)gGa>gAa	p.G628E	ALDH1L1_ENST00000472186.1_Missense_Mutation_p.G628E|ALDH1L1_ENST00000273450.3_Missense_Mutation_p.G638E|ALDH1L1_ENST00000393431.2_3'UTR|ALDH1L1_ENST00000452905.2_Missense_Mutation_p.G527E	NM_012190.3	NP_036322.2	O75891	AL1L1_HUMAN	aldehyde dehydrogenase 1 family, member L1	628	Aldehyde dehydrogenase.				10-formyltetrahydrofolate catabolic process (GO:0009258)|biosynthetic process (GO:0009058)|one-carbon metabolic process (GO:0006730)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	catalytic activity (GO:0003824)|formyltetrahydrofolate dehydrogenase activity (GO:0016155)|hydroxymethyl-, formyl- and related transferase activity (GO:0016742)|methyltransferase activity (GO:0008168)|oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor (GO:0016620)	p.G628E(1)		NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|kidney(5)|large_intestine(10)|lung(22)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	52				GBM - Glioblastoma multiforme(114;0.0462)	Tetrahydrofolic acid(DB00116)	CTTACCAGATCCTGGGAGGAC	0.592																																																1	Substitution - Missense(1)	ovary(1)	3											129.0	128.0	128.0					3																	125843212		2203	4300	6503	127325902	SO:0001583	missense	10840			AF052732	CCDS3034.1, CCDS58850.1, CCDS58851.1	3q21.2	2010-07-19		2005-01-27	ENSG00000144908	ENSG00000144908	1.5.1.6	"""Aldehyde dehydrogenases"""	3978	protein-coding gene	gene with protein product	"""cytosolic 10-formyltetrahydrofolate dehydrogenase"""	600249	"""formyltetrahydrofolate dehydrogenase"""	FTHFD			Standard	NM_012190		Approved	10-fTHF	uc031sbp.1	O75891	OTTHUMG00000125551	ENST00000393434.2:c.1883G>A	3.37:g.125843212C>T	ENSP00000377083:p.Gly628Glu		127325902	B4DG36|E9PBX3|Q68CS1	Missense_Mutation	SNP	ENST00000393434.2	37	CCDS3034.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	14.39	2.520620	0.44866	.	.	ENSG00000144908	ENST00000273450;ENST00000472186;ENST00000452905;ENST00000393434	D;D;D;D	0.83163	-1.69;-1.69;-1.69;-1.69	4.41	3.53	0.40419	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, N-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.000000	0.85682	D	0.000000	D	0.92619	0.7655	H	0.95079	3.62	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.80764	0.994;0.989	D	0.93028	0.6446	10	0.87932	D	0	.	10.1237	0.42637	0.0:0.9004:0.0:0.0996	.	527;628	E9PBX3;O75891	.;AL1L1_HUMAN	E	638;628;527;628	ENSP00000273450:G638E;ENSP00000420293:G628E;ENSP00000395881:G527E;ENSP00000377083:G628E	ENSP00000273450:G638E	G	-	2	0	ALDH1L1	127325902	1.000000	0.71417	0.978000	0.43139	0.023000	0.10783	7.074000	0.76791	1.081000	0.41110	-0.236000	0.12185	GGA		0.592	ALDH1L1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354391.1	NM_012190		Missense_Mutation
PLCH1	23007	broad.mit.edu	37	3	155200160	155200160	+	Missense_Mutation	SNP	A	A	G			TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr3:155200160A>G	ENST00000340059.7	-	23	3678	c.3679T>C	c.(3679-3681)Tgt>Cgt	p.C1227R	PLCH1_ENST00000494598.1_Intron|PLCH1_ENST00000460012.1_Missense_Mutation_p.C1189R|PLCH1_ENST00000414191.1_Missense_Mutation_p.C1189R|PLCH1_ENST00000447496.2_3'UTR|PLCH1_ENST00000334686.6_Missense_Mutation_p.C1189R	NM_001130960.1	NP_001124432.1	Q4KWH8	PLCH1_HUMAN	phospholipase C, eta 1	1227					inositol phosphate metabolic process (GO:0043647)|lipid catabolic process (GO:0016042)|phosphatidylinositol-mediated signaling (GO:0048015)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase C activity (GO:0050429)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)			NS(3)|breast(3)|endometrium(9)|kidney(4)|large_intestine(20)|lung(45)|ovary(2)|prostate(5)|skin(8)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	107			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			GGCAAGGGACAATGGCCTGAC	0.483																																																0			3											71.0	68.0	69.0					3																	155200160		2203	4300	6503	156682854	SO:0001583	missense	23007			AB028992	CCDS33881.1, CCDS46939.1, CCDS46940.1	3q25	2013-01-10	2006-03-16	2006-03-16	ENSG00000114805	ENSG00000114805	3.1.4.11	"""EF-hand domain containing"""	29185	protein-coding gene	gene with protein product		612835	"""phospholipase C-like 3"""	PLCL3		15702972	Standard	NM_014996		Approved	KIAA1069, MGC117152, DKFZp434C1372, PLCeta1	uc021xge.1	Q4KWH8	OTTHUMG00000158477	ENST00000340059.7:c.3679T>C	3.37:g.155200160A>G	ENSP00000345988:p.Cys1227Arg		156682854	Q29RV9|Q4KWH9|Q68CN0|Q86XK4|Q9H9U2|Q9UPT3	Missense_Mutation	SNP	ENST00000340059.7	37	CCDS46939.1	SNP	5	Broad	.	.	.	.	.	.	.	.	.	.	A	10.41	1.342360	0.24339	.	.	ENSG00000114805	ENST00000460012;ENST00000340059;ENST00000334686;ENST00000414191	T;T;T;T	0.36157	1.27;1.27;1.27;1.27	4.91	-4.61	0.03380	.	2.691000	0.00817	N	0.001554	T	0.17280	0.0415	N	0.08118	0	0.09310	N	1	B;B	0.16802	0.019;0.0	B;B	0.23018	0.043;0.0	T	0.11817	-1.0572	10	0.54805	T	0.06	.	0.9489	0.01372	0.2434:0.3293:0.2152:0.2121	.	1189;1227	Q4KWH8-2;Q4KWH8	.;PLCH1_HUMAN	R	1189;1227;1189;1189	ENSP00000417502:C1189R;ENSP00000345988:C1227R;ENSP00000335469:C1189R;ENSP00000412977:C1189R	ENSP00000335469:C1189R	C	-	1	0	PLCH1	156682854	0.000000	0.05858	0.000000	0.03702	0.118000	0.20060	0.037000	0.13840	-0.977000	0.03537	0.377000	0.23210	TGT		0.483	PLCH1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000351125.1	NM_014996		Missense_Mutation
SLITRK3	22865	broad.mit.edu	37	3	164905717	164905717	+	Nonsense_Mutation	SNP	C	C	A			TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr3:164905717C>A	ENST00000475390.1	-	2	3345	c.2902G>T	c.(2902-2904)Gaa>Taa	p.E968*	SLITRK3_ENST00000241274.3_Nonsense_Mutation_p.E968*			O94933	SLIK3_HUMAN	SLIT and NTRK-like family, member 3	968					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)		p.E968*(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(66)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(5)	119						TCCAGGACTTCGAGGTAATCC	0.388										HNSCC(40;0.11)																																						1	Substitution - Nonsense(1)	ovary(1)	3											135.0	134.0	134.0					3																	164905717		2203	4300	6503	166388411	SO:0001587	stop_gained	22865			AB020655	CCDS3197.1	3q26.1	2004-07-28			ENSG00000121871	ENSG00000121871			23501	protein-coding gene	gene with protein product		609679				10048485, 14557068	Standard	NM_014926		Approved	KIAA0848	uc003fek.3	O94933	OTTHUMG00000158072	ENST00000475390.1:c.2902G>T	3.37:g.164905717C>A	ENSP00000420091:p.Glu968*		166388411	Q1RMY6	Nonsense_Mutation	SNP	ENST00000475390.1	37	CCDS3197.1	SNP	31	Broad	.	.	.	.	.	.	.	.	.	.	C	43	10.499899	0.99416	.	.	ENSG00000121871	ENST00000475390;ENST00000241274	.	.	.	5.97	5.97	0.96955	.	0.000000	0.35708	N	0.003029	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-13.5308	20.4388	0.99107	0.0:1.0:0.0:0.0	.	.	.	.	X	968	.	ENSP00000241274:E968X	E	-	1	0	SLITRK3	166388411	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.455000	0.80726	2.836000	0.97738	0.655000	0.94253	GAA		0.388	SLITRK3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350126.1	NM_014926		Nonsense_Mutation
ETV5	2119	broad.mit.edu	37	3	185823281	185823281	+	Silent	SNP	T	T	A			TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr3:185823281T>A	ENST00000306376.5	-	4	384	c.138A>T	c.(136-138)ctA>ctT	p.L46L	DGKG_ENST00000447054.1_5'Flank|ETV5_ENST00000434744.1_Silent_p.L46L|ETV5_ENST00000537818.1_Silent_p.L88L	NM_004454.2	NP_004445.1	P41161	ETV5_HUMAN	ets variant 5	46					cell differentiation (GO:0030154)|cellular response to oxidative stress (GO:0034599)|locomotory behavior (GO:0007626)|male germ-line stem cell asymmetric division (GO:0048133)|neuromuscular synaptic transmission (GO:0007274)|positive regulation of glial cell proliferation (GO:0060252)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of branching involved in mammary gland duct morphogenesis (GO:0060762)|regulation of synapse organization (GO:0050807)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.L46L(1)		breast(2)|cervix(1)|large_intestine(7)|lung(9)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	28	all_cancers(143;4.06e-12)|Ovarian(172;0.0386)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.62e-24)			GATCCTGAAATAGCTCTGAAA	0.403			T	"""TMPRSS2, SCL45A3"""	Prostate																																		Dom	yes		3	3q28	2119	ets variant gene 5		E	1	Substitution - coding silent(1)	ovary(1)	3											77.0	82.0	80.0					3																	185823281		2203	4300	6503	187305975	SO:0001819	synonymous_variant	2119			BC007333	CCDS33906.1	3q28	2008-09-12	2008-09-12		ENSG00000244405	ENSG00000244405			3494	protein-coding gene	gene with protein product	"""ets-related molecule"""	601600	"""ets variant gene 5 (ets-related molecule)"""			8152800	Standard	NM_004454		Approved	ERM	uc003fpz.3	P41161	OTTHUMG00000156639	ENST00000306376.5:c.138A>T	3.37:g.185823281T>A			187305975	A6NH46|B7Z7D7|Q6IBN5	Silent	SNP	ENST00000306376.5	37	CCDS33906.1	SNP	49	Broad																																																																																				0.403	ETV5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344947.1	NM_004454		Silent
BOD1L1	259282	broad.mit.edu	37	4	13604894	13604894	+	Missense_Mutation	SNP	T	T	A			TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr4:13604894T>A	ENST00000040738.5	-	10	3765	c.3630A>T	c.(3628-3630)caA>caT	p.Q1210H		NM_148894.2	NP_683692.2	Q8NFC6	BD1L1_HUMAN	biorientation of chromosomes in cell division 1-like 1	1210						nucleus (GO:0005634)	DNA binding (GO:0003677)	p.Q1210H(1)									ACACAGCACTTTGTATATGCA	0.408																																																1	Substitution - Missense(1)	ovary(1)	4											168.0	175.0	173.0					4																	13604894		2203	4300	6503	13213992	SO:0001583	missense	259282			AF528529	CCDS3411.2	4p16.1	2012-04-10	2012-04-10	2012-04-10	ENSG00000038219	ENSG00000038219			31792	protein-coding gene	gene with protein product			"""family with sequence similarity 44, member A"", ""biorientation of chromosomes in cell division 1-like"""	FAM44A, BOD1L			Standard	XM_005248150		Approved	FLJ33215, KIAA1327	uc003gmz.1	Q8NFC6	OTTHUMG00000090659	ENST00000040738.5:c.3630A>T	4.37:g.13604894T>A	ENSP00000040738:p.Gln1210His		13213992	Q6P0M8|Q96AL1|Q9H6G0|Q9NTD6|Q9P2L9	Missense_Mutation	SNP	ENST00000040738.5	37	CCDS3411.2	SNP	64	Broad	.	.	.	.	.	.	.	.	.	.	T	9.325	1.059012	0.19987	.	.	ENSG00000038219	ENST00000040738	T	0.08458	3.09	5.02	-0.201	0.13212	.	0.313134	0.23391	N	0.048681	T	0.07413	0.0187	N	0.24115	0.695	0.09310	N	1	P	0.44578	0.838	P	0.47206	0.541	T	0.23691	-1.0181	10	0.54805	T	0.06	-0.8788	8.3417	0.32247	0.0:0.3078:0.0:0.6922	.	1210	Q8NFC6	BOD1L_HUMAN	H	1210	ENSP00000040738:Q1210H	ENSP00000040738:Q1210H	Q	-	3	2	BOD1L	13213992	0.131000	0.22433	0.001000	0.08648	0.172000	0.22775	0.481000	0.22260	-0.150000	0.11195	-0.274000	0.10170	CAA		0.408	BOD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207321.1	NM_148894		Missense_Mutation
CD38	952	broad.mit.edu	37	4	15835888	15835888	+	Missense_Mutation	SNP	A	A	T			TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr4:15835888A>T	ENST00000226279.3	+	4	685	c.548A>T	c.(547-549)aAc>aTc	p.N183I		NM_001775.2	NP_001766.2	P28907	CD38_HUMAN	CD38 molecule	183					apoptotic signaling pathway (GO:0097190)|B cell receptor signaling pathway (GO:0050853)|female pregnancy (GO:0007565)|long term synaptic depression (GO:0060292)|negative regulation of apoptotic process (GO:0043066)|negative regulation of bone resorption (GO:0045779)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cell growth (GO:0030307)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of insulin secretion (GO:0032024)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vasoconstriction (GO:0045907)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to hydroperoxide (GO:0033194)|response to hypoxia (GO:0001666)|response to interleukin-1 (GO:0070555)|response to progesterone (GO:0032570)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	NAD(P)+ nucleosidase activity (GO:0050135)|NAD+ nucleosidase activity (GO:0003953)|phosphorus-oxygen lyase activity (GO:0016849)|transferase activity (GO:0016740)	p.N183I(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(2)|prostate(1)|stomach(1)	14						TGCAGCAACAACCCTGTTTCA	0.383																																																1	Substitution - Missense(1)	ovary(1)	4											95.0	93.0	94.0					4																	15835888		2203	4300	6503	15444986	SO:0001583	missense	952			D84276	CCDS3417.1	4p15.32	2010-05-04	2006-03-28		ENSG00000004468	ENSG00000004468	3.2.2.5	"""CD molecules"""	1667	protein-coding gene	gene with protein product	"""ADP-ribosyl cyclase 1"", ""NAD(+) nucleosidase"""	107270	"""CD38 antigen (p45)"""			9074508, 2319135	Standard	NM_001775		Approved		uc003gol.1	P28907	OTTHUMG00000048206	ENST00000226279.3:c.548A>T	4.37:g.15835888A>T	ENSP00000226279:p.Asn183Ile		15444986	O00121|O00122|Q96HY4	Missense_Mutation	SNP	ENST00000226279.3	37	CCDS3417.1	SNP	2	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	15.01|15.01	2.707749|2.707749	0.48412|0.48412	.|.	.|.	ENSG00000004468|ENSG00000004468	ENST00000226279;ENST00000510674|ENST00000540195	T;T|.	0.18016|.	2.24;2.24|.	5.4|5.4	1.48|1.48	0.22813|0.22813	.|.	0.500775|.	0.24405|.	N|.	0.038804|.	T|T	0.56352|0.56352	0.1979|0.1979	M|M	0.84585|0.84585	2.705|2.705	0.09310|0.09310	N|N	0.999999|0.999999	D|.	0.89917|.	1.0|.	D|.	0.87578|.	0.998|.	T|T	0.49606|0.49606	-0.8922|-0.8922	10|6	0.87932|0.44086	D|T	0|0.13	-27.6845|-27.6845	5.3435|5.3435	0.15996|0.15996	0.5555:0.3538:0.0907:0.0|0.5555:0.3538:0.0907:0.0	.|.	183|.	P28907|.	CD38_HUMAN|.	I|S	183;71|138	ENSP00000226279:N183I;ENSP00000423047:N71I|.	ENSP00000226279:N183I|ENSP00000442176:T138S	N|T	+|+	2|1	0|0	CD38|CD38	15444986|15444986	0.003000|0.003000	0.15002|0.15002	0.001000|0.001000	0.08648|0.08648	0.002000|0.002000	0.02628|0.02628	0.343000|0.343000	0.19944|0.19944	0.386000|0.386000	0.24997|0.24997	0.528000|0.528000	0.53228|0.53228	AAC|ACC		0.383	CD38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250322.2	NM_001775		Missense_Mutation
BMP3	651	broad.mit.edu	37	4	81967139	81967139	+	Silent	SNP	C	C	T			TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr4:81967139C>T	ENST00000282701.2	+	2	884	c.564C>T	c.(562-564)gcC>gcT	p.A188A		NM_001201.2	NP_001192.2	P12645	BMP3_HUMAN	bone morphogenetic protein 3	188					cartilage development (GO:0051216)|cell differentiation (GO:0030154)|cell-cell signaling (GO:0007267)|growth (GO:0040007)|ossification (GO:0001503)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal system development (GO:0001501)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	BMP receptor binding (GO:0070700)|receptor binding (GO:0005102)	p.A188A(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(8)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(1)	29						TGGATATGGCCAAATCTCATC	0.408																																																1	Substitution - coding silent(1)	ovary(1)	4											147.0	152.0	151.0					4																	81967139		2203	4300	6503	82186163	SO:0001819	synonymous_variant	651			M22491	CCDS3588.1	4q21	2013-02-06	2008-05-22		ENSG00000152785	ENSG00000152785		"""Bone morphogenetic proteins"""	1070	protein-coding gene	gene with protein product	"""osteogenin"""	112263	"""bone morphogenetic protein 3 (osteogenic)"""				Standard	NM_001201		Approved		uc003hmg.4	P12645	OTTHUMG00000130292	ENST00000282701.2:c.564C>T	4.37:g.81967139C>T			82186163	Q4VAS5	Silent	SNP	ENST00000282701.2	37	CCDS3588.1	SNP	21	Broad																																																																																				0.408	BMP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252634.1			Silent
LARP7	51574	broad.mit.edu	37	4	113568614	113568614	+	Missense_Mutation	SNP	T	T	A			TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr4:113568614T>A	ENST00000344442.5	+	7	1184	c.906T>A	c.(904-906)gaT>gaA	p.D302E	MIR302A_ENST00000385192.1_RNA|LARP7_ENST00000509061.1_Missense_Mutation_p.D309E|MIR302B_ENST00000505215.1_RNA|MIR302B_ENST00000510655.1_RNA|MIR302B_ENST00000362188.1_RNA|MIR302D_ENST00000362275.1_RNA|MIR302B_ENST00000509938.1_RNA|LARP7_ENST00000324052.6_Missense_Mutation_p.D302E|MIR302C_ENST00000362232.1_RNA|MIR367_ENST00000362299.1_RNA	NM_016648.3	NP_057732.2	Q4G0J3	LARP7_HUMAN	La ribonucleoprotein domain family, member 7	302	Lys-rich.				RNA processing (GO:0006396)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.D302E(1)		endometrium(2)|large_intestine(2)|lung(8)|ovary(4)|skin(1)	17		Ovarian(17;0.0443)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000603)		GCTCTGAAGATGCAGAATCCC	0.398																																																1	Substitution - Missense(1)	ovary(1)	4											93.0	94.0	94.0					4																	113568614		1857	4098	5955	113788063	SO:0001583	missense	51574			AF068284	CCDS3701.2, CCDS58924.1	4q25	2013-02-12			ENSG00000174720	ENSG00000174720		"""La ribonucleoprotein domain containing"", ""RNA binding motif (RRM) containing"""	24912	protein-coding gene	gene with protein product	"""P-TEFb-interaction protein for 7SK stability"""	612026				18191186, 18249148, 18281698, 22865833, 22488152	Standard	NM_016648		Approved	HDCMA18P, PIP7S, DKFZP564K112	uc003ibb.4	Q4G0J3	OTTHUMG00000132909	ENST00000344442.5:c.906T>A	4.37:g.113568614T>A	ENSP00000344950:p.Asp302Glu		113788063	B2ZHN6|Q3B7A9|Q9P1S7|Q9Y3Z8	Missense_Mutation	SNP	ENST00000344442.5	37	CCDS3701.2	SNP	51	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	21.4|21.4	4.141367|4.141367	0.77775|0.77775	.|.	.|.	ENSG00000174720|ENSG00000174720	ENST00000344442;ENST00000509061;ENST00000324052|ENST00000511529	T;T;T|.	0.50001|.	0.76;0.76;0.76|.	5.86|5.86	-5.85|-5.85	0.02311|0.02311	.|.	0.313726|.	0.37053|.	N|.	0.002272|.	T|T	0.29783|0.29783	0.0744|0.0744	L|L	0.42245|0.42245	1.32|1.32	0.09310|0.09310	N|N	0.999996|0.999996	B|.	0.06786|.	0.001|.	B|.	0.06405|.	0.002|.	T|T	0.34104|0.34104	-0.9842|-0.9842	10|5	0.21540|.	T|.	0.41|.	-20.3271|-20.3271	3.8707|3.8707	0.09035|0.09035	0.1027:0.3678:0.1061:0.4234|0.1027:0.3678:0.1061:0.4234	.|.	302|.	Q4G0J3|.	LARP7_HUMAN|.	E|K	302;309;302|83	ENSP00000344950:D302E;ENSP00000422626:D309E;ENSP00000314311:D302E|.	ENSP00000314311:D302E|.	D|M	+|+	3|2	2|0	LARP7|LARP7	113788063|113788063	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.861000|0.861000	0.49209|0.49209	-2.110000|-2.110000	0.01334|0.01334	-1.086000|-1.086000	0.03084|0.03084	0.460000|0.460000	0.39030|0.39030	GAT|ATG		0.398	LARP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256417.2	NM_016648		Missense_Mutation
ANK2	287	broad.mit.edu	37	4	114161671	114161671	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr4:114161671C>T	ENST00000357077.4	+	8	777	c.724C>T	c.(724-726)Cat>Tat	p.H242Y	ANK2_ENST00000394537.3_Missense_Mutation_p.H242Y|ANK2_ENST00000506722.1_Missense_Mutation_p.H221Y|ANK2_ENST00000264366.6_Missense_Mutation_p.H242Y	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	242					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.H242Y(1)		NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		CATAGCTGCACATTACGGAAA	0.423																																																1	Substitution - Missense(1)	ovary(1)	4											156.0	147.0	150.0					4																	114161671		2203	4300	6503	114381120	SO:0001583	missense	287			M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.724C>T	4.37:g.114161671C>T	ENSP00000349588:p.His242Tyr		114381120	Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	ENST00000357077.4	37	CCDS3702.1	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	31	5.082935	0.94050	.	.	ENSG00000145362	ENST00000503271;ENST00000503423;ENST00000506722;ENST00000504454;ENST00000394537;ENST00000357077;ENST00000264366;ENST00000343056	T;T;T;T;T;T;T	0.63913	-0.07;0.11;0.11;0.11;0.11;0.11;0.11	5.5	5.5	0.81552	Ankyrin repeat-containing domain (3);	0.000000	0.52532	D	0.000065	T	0.57695	0.2071	N	0.01209	-0.955	0.80722	D	1	D;D;D;D;P	0.89917	0.999;1.0;1.0;0.999;0.956	D;D;D;D;D	0.91635	0.999;0.999;0.999;0.998;0.974	T	0.75889	-0.3158	10	0.72032	D	0.01	.	19.3647	0.94458	0.0:1.0:0.0:0.0	.	242;242;242;221;221	Q01484;Q01484-2;Q01484-4;Q01484-5;F8WEF9	ANK2_HUMAN;.;.;.;.	Y	221;221;221;257;242;242;242;221	ENSP00000423799:H221Y;ENSP00000421011:H221Y;ENSP00000421067:H221Y;ENSP00000424722:H257Y;ENSP00000378044:H242Y;ENSP00000349588:H242Y;ENSP00000264366:H242Y	ENSP00000264366:H242Y	H	+	1	0	ANK2	114381120	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	7.776000	0.85560	2.740000	0.93945	0.650000	0.86243	CAT		0.423	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	NM_001148		Missense_Mutation
ANK2	287	broad.mit.edu	37	4	114195729	114195729	+	Missense_Mutation	SNP	T	T	G			TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr4:114195729T>G	ENST00000357077.4	+	15	1660	c.1607T>G	c.(1606-1608)aTc>aGc	p.I536S	ANK2_ENST00000394537.3_Missense_Mutation_p.I536S|ANK2_ENST00000506722.1_Missense_Mutation_p.I515S|ANK2_ENST00000264366.6_Missense_Mutation_p.I536S	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	536					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.I536S(1)		NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		CCACTGCACATCTCTGCCCGG	0.527																																																1	Substitution - Missense(1)	ovary(1)	4											102.0	98.0	99.0					4																	114195729		2203	4300	6503	114415178	SO:0001583	missense	287			M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.1607T>G	4.37:g.114195729T>G	ENSP00000349588:p.Ile536Ser		114415178	Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	ENST00000357077.4	37	CCDS3702.1	SNP	50	Broad	.	.	.	.	.	.	.	.	.	.	T	26.9	4.778083	0.90195	.	.	ENSG00000145362	ENST00000503271;ENST00000503423;ENST00000506722;ENST00000504454;ENST00000394537;ENST00000357077;ENST00000264366;ENST00000343056	T;T;T;T;T;T;T	0.67523	-0.27;-0.11;-0.27;-0.11;-0.27;-0.27;-0.27	5.62	5.62	0.85841	Ankyrin repeat-containing domain (3);	0.000000	0.51477	D	0.000087	T	0.74275	0.3695	L	0.35487	1.065	0.80722	D	1	D;P;D;D;D	0.89917	1.0;0.811;0.999;0.992;0.998	D;P;D;P;D	0.87578	0.998;0.712;0.981;0.858;0.997	T	0.75769	-0.3201	10	0.51188	T	0.08	.	15.8229	0.78673	0.0:0.0:0.0:1.0	.	536;536;536;515;515	Q01484;Q01484-2;Q01484-4;Q01484-5;F8WEF9	ANK2_HUMAN;.;.;.;.	S	515;515;515;551;536;536;536;515	ENSP00000423799:I515S;ENSP00000421011:I515S;ENSP00000421067:I515S;ENSP00000424722:I551S;ENSP00000378044:I536S;ENSP00000349588:I536S;ENSP00000264366:I536S	ENSP00000264366:I536S	I	+	2	0	ANK2	114415178	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.981000	0.88123	2.126000	0.65437	0.528000	0.53228	ATC		0.527	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	NM_001148		Missense_Mutation
TLL1	7092	broad.mit.edu	37	4	166924625	166924625	+	Missense_Mutation	SNP	G	G	T			TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr4:166924625G>T	ENST00000061240.2	+	6	1362	c.715G>T	c.(715-717)Gtt>Ttt	p.V239F	TLL1_ENST00000513213.1_Missense_Mutation_p.V239F|TLL1_ENST00000507499.1_Missense_Mutation_p.V239F	NM_012464.4	NP_036596.3	O43897	TLL1_HUMAN	tolloid-like 1	239	Metalloprotease. {ECO:0000250}.				cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.V239F(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(21)|lung(26)|ovary(2)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	77	all_hematologic(180;0.221)	Melanoma(52;0.0315)|Prostate(90;0.0405)		GBM - Glioblastoma multiforme(119;0.103)		TGGGATTGTTGTTCATGAATT	0.433																																																1	Substitution - Missense(1)	ovary(1)	4											176.0	160.0	165.0					4																	166924625		2203	4300	6503	167144075	SO:0001583	missense	7092			AF282732	CCDS3811.1, CCDS56342.1	4q32-q33	2008-07-29			ENSG00000038295	ENSG00000038295			11843	protein-coding gene	gene with protein product		606742				10516436	Standard	NM_012464		Approved		uc003irh.2	O43897	OTTHUMG00000161112	ENST00000061240.2:c.715G>T	4.37:g.166924625G>T	ENSP00000061240:p.Val239Phe		167144075	B2RMU2|Q96AN3|Q9NQS4	Missense_Mutation	SNP	ENST00000061240.2	37	CCDS3811.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	20.3	3.962809	0.74016	.	.	ENSG00000038295	ENST00000061240;ENST00000507499;ENST00000513213	T;T;T	0.65916	-0.18;-0.18;-0.18	5.35	5.35	0.76521	Peptidase, metallopeptidase (1);Peptidase M12A, astacin (2);Metallopeptidase, catalytic domain (1);	0.000000	0.64402	U	0.000001	D	0.85894	0.5803	H	0.96996	3.92	0.80722	D	1	D;D	0.71674	0.998;0.984	D;P	0.64042	0.921;0.746	D	0.90431	0.4424	10	0.72032	D	0.01	.	19.4213	0.94723	0.0:0.0:1.0:0.0	.	239;239	E9PD25;O43897	.;TLL1_HUMAN	F	239	ENSP00000061240:V239F;ENSP00000426082:V239F;ENSP00000422937:V239F	ENSP00000061240:V239F	V	+	1	0	TLL1	167144075	1.000000	0.71417	1.000000	0.80357	0.045000	0.14185	9.813000	0.99286	2.653000	0.90120	0.557000	0.71058	GTT		0.433	TLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363821.1			Missense_Mutation
ARHGEF28	64283	broad.mit.edu	37	5	73187940	73187940	+	Missense_Mutation	SNP	A	A	G			TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr5:73187940A>G	ENST00000426542.2	+	26	3471	c.3451A>G	c.(3451-3453)Aga>Gga	p.R1151G	ARHGEF28_ENST00000545377.1_Missense_Mutation_p.R1151G|ARHGEF28_ENST00000296799.4_Missense_Mutation_p.R838G|ARHGEF28_ENST00000287898.5_Missense_Mutation_p.R1151G|ARHGEF28_ENST00000513042.2_Missense_Mutation_p.R1151G|ARHGEF28_ENST00000296794.6_Missense_Mutation_p.R1151G|ARHGEF28_ENST00000512883.1_Missense_Mutation_p.R115G|ARHGEF28_ENST00000437974.1_Missense_Mutation_p.R1151G			Q8N1W1	ARG28_HUMAN	Rho guanine nucleotide exchange factor (GEF) 28	1151	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				central nervous system neuron axonogenesis (GO:0021955)|intracellular signal transduction (GO:0035556)|neurofilament cytoskeleton organization (GO:0060052)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|RNA binding (GO:0003723)										TAATGAGGAGAGAGGAATGTT	0.418																																																0			5											98.0	91.0	93.0					5																	73187940		1951	4138	6089	73223696	SO:0001583	missense	64283				CCDS47231.1, CCDS47231.2, CCDS54870.1, CCDS58957.1	5q13.2	2012-08-08			ENSG00000214944	ENSG00000214944			30322	protein-coding gene	gene with protein product		612790				9199174, 11058585	Standard	NM_001177693		Approved	RGNEF, p190RhoGEF, RIP2	uc010izf.3	Q8N1W1	OTTHUMG00000162454	ENST00000426542.2:c.3451A>G	5.37:g.73187940A>G	ENSP00000412175:p.Arg1151Gly		73223696	B2RXG7|B4E3K4|B5MDA3|B7ZW32|E9PC75|Q8NCM7|Q96E37|Q9H6L3|Q9H6W0	Missense_Mutation	SNP	ENST00000426542.2	37	CCDS54870.1	SNP	11	Broad	.	.	.	.	.	.	.	.	.	.	A	19.53	3.845601	0.71603	.	.	ENSG00000214944	ENST00000296794;ENST00000545377;ENST00000513042;ENST00000287898;ENST00000437974;ENST00000426542;ENST00000296799;ENST00000512883	T;T;T;T;T;T;T;T	0.64085	-0.08;-0.08;-0.08;-0.08;-0.08;-0.08;-0.08;-0.08	5.75	1.7	0.24286	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.000000	0.32533	U	0.005980	T	0.78136	0.4236	M	0.80422	2.495	0.45930	D	0.998763	D;D;D;D;D	0.89917	1.0;0.999;0.999;1.0;0.999	D;D;D;D;D	0.91635	0.993;0.968;0.96;0.999;0.982	T	0.80804	-0.1219	10	0.87932	D	0	.	13.7691	0.63012	0.4813:0.5187:0.0:0.0	.	838;1151;1151;115;1151	B5MDA3;Q8N1W1;E9PC75;D6RGZ3;Q8N1W1-4	.;RGNEF_HUMAN;.;.;.	G	1151;1151;1151;1151;1151;1151;838;115	ENSP00000296794:R1151G;ENSP00000441913:R1151G;ENSP00000441436:R1151G;ENSP00000287898:R1151G;ENSP00000411459:R1151G;ENSP00000412175:R1151G;ENSP00000296799:R838G;ENSP00000421081:R115G	ENSP00000287898:R1151G	R	+	1	2	RP11-428C6.1	73223696	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.927000	0.40094	0.409000	0.25649	0.533000	0.62120	AGA		0.418	ARHGEF28-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000368975.1			Missense_Mutation
ZNF608	57507	broad.mit.edu	37	5	123984816	123984816	+	Missense_Mutation	SNP	A	A	T			TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr5:123984816A>T	ENST00000306315.5	-	4	1696	c.1261T>A	c.(1261-1263)Tca>Aca	p.S421T	ZNF608_ENST00000504926.1_5'UTR	NM_020747.2	NP_065798.2	Q9ULD9	ZN608_HUMAN	zinc finger protein 608	421							metal ion binding (GO:0046872)			breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(12)|ovary(3)|skin(6)|urinary_tract(1)	46		all_cancers(142;0.186)|Prostate(80;0.081)	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.00126)|Epithelial(69;0.00238)|all cancers(49;0.00783)		CTTGTCGGTGACTCACAAAAC	0.537																																																0			5											21.0	22.0	22.0					5																	123984816		2196	4276	6472	124012715	SO:0001583	missense	57507			AB033107	CCDS34219.1	5q23.2	2008-05-02			ENSG00000168916	ENSG00000168916		"""Zinc fingers, C2H2-type"""	29238	protein-coding gene	gene with protein product						10574462, 10508479	Standard	NM_020747		Approved	KIAA1281, DKFZp434M098, NY-REN-36	uc003ktq.1	Q9ULD9	OTTHUMG00000162999	ENST00000306315.5:c.1261T>A	5.37:g.123984816A>T	ENSP00000307746:p.Ser421Thr		124012715	A7E2W9|Q3SYM6|Q68D12|Q8IY05|Q9Y5A1	Missense_Mutation	SNP	ENST00000306315.5	37	CCDS34219.1	SNP	10	Broad	.	.	.	.	.	.	.	.	.	.	A	26.2	4.715422	0.89112	.	.	ENSG00000168916	ENST00000306315;ENST00000509799;ENST00000513986	T	0.68331	-0.32	5.4	5.4	0.78164	.	0.000000	0.64402	D	0.000001	T	0.81842	0.4908	M	0.76838	2.35	0.54753	D	0.999989	D	0.67145	0.996	D	0.77557	0.99	D	0.84563	0.0651	10	0.87932	D	0	-9.9229	15.4434	0.75208	1.0:0.0:0.0:0.0	.	421	Q9ULD9	ZN608_HUMAN	T	421	ENSP00000307746:S421T	ENSP00000307746:S421T	S	-	1	0	ZNF608	124012715	1.000000	0.71417	1.000000	0.80357	0.912000	0.54170	9.319000	0.96338	2.053000	0.61076	0.445000	0.29226	TCA		0.537	ZNF608-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371300.1	XM_114432		Missense_Mutation
FSTL4	23105	broad.mit.edu	37	5	132736454	132736454	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr5:132736454G>A	ENST00000265342.7	-	4	634	c.385C>T	c.(385-387)Cac>Tac	p.H129Y		NM_015082.1	NP_055897.1	Q6MZW2	FSTL4_HUMAN	follistatin-like 4	129	Kazal-like. {ECO:0000255|PROSITE- ProRule:PRU00798}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(8)|skin(2)|upper_aerodigestive_tract(1)	23		all_cancers(142;0.244)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TCCTTGCTGTGGATGACGGTG	0.527																																																0			5											51.0	45.0	47.0					5																	132736454		2203	4300	6503	132764353	SO:0001583	missense	23105			AB028984	CCDS34238.1	5q31.1	2013-01-29			ENSG00000053108	ENSG00000053108		"""EF-hand domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	21389	protein-coding gene	gene with protein product						10470851, 15527507	Standard	NM_015082		Approved	KIAA1061	uc003kyn.1	Q6MZW2	OTTHUMG00000162729	ENST00000265342.7:c.385C>T	5.37:g.132736454G>A	ENSP00000265342:p.His129Tyr		132764353	Q8TBU0|Q9UPU1	Missense_Mutation	SNP	ENST00000265342.7	37	CCDS34238.1	SNP	47	Broad	.	.	.	.	.	.	.	.	.	.	G	19.91	3.914476	0.72983	.	.	ENSG00000053108	ENST00000265342;ENST00000510685	T;T	0.03889	3.77;3.77	5.71	5.71	0.89125	Proteinase inhibitor I1, Kazal (1);Protease inhibitor, Kazal-type (1);	0.277014	0.40818	N	0.001013	T	0.15392	0.0371	L	0.47190	1.495	0.80722	D	1	D	0.55385	0.971	P	0.60068	0.868	T	0.00044	-1.2221	10	0.59425	D	0.04	-17.1423	18.8554	0.92249	0.0:0.0:1.0:0.0	.	129	Q6MZW2	FSTL4_HUMAN	Y	129;131	ENSP00000265342:H129Y;ENSP00000427662:H131Y	ENSP00000265342:H129Y	H	-	1	0	FSTL4	132764353	1.000000	0.71417	0.864000	0.33941	0.367000	0.29736	7.442000	0.80503	2.718000	0.92993	0.655000	0.94253	CAC		0.527	FSTL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370212.1	XM_048786		Missense_Mutation
CATSPER3	347732	broad.mit.edu	37	5	134305677	134305677	+	Missense_Mutation	SNP	C	C	G			TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr5:134305677C>G	ENST00000282611.6	+	2	233	c.147C>G	c.(145-147)agC>agG	p.S49R	CATSPER3_ENST00000511235.1_3'UTR	NM_178019.2	NP_821138.1	Q86XQ3	CTSR3_HUMAN	cation channel, sperm associated 3	49					calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sodium ion transport (GO:0006814)|sperm capacitation (GO:0048240)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)	acrosomal vesicle (GO:0001669)|CatSper complex (GO:0036128)|endoplasmic reticulum (GO:0005783)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|voltage-gated calcium channel activity (GO:0005245)	p.S49R(1)		NS(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|stomach(1)|urinary_tract(1)	18			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			TCATAATGAGCCGTTTCTTTA	0.403																																																1	Substitution - Missense(1)	ovary(1)	5											218.0	197.0	204.0					5																	134305677		2203	4300	6503	134333576	SO:0001583	missense	347732			AF432876	CCDS4181.1	5q31.2	2011-07-05			ENSG00000152705	ENSG00000152705		"""Voltage-gated ion channels / Cation channels, sperm associated"""	20819	protein-coding gene	gene with protein product		609120				12646162, 12932298, 17227845, 16382101	Standard	NM_178019		Approved	CACRC	uc003lag.3	Q86XQ3	OTTHUMG00000129137	ENST00000282611.6:c.147C>G	5.37:g.134305677C>G	ENSP00000282611:p.Ser49Arg		134333576	Q86XS6	Missense_Mutation	SNP	ENST00000282611.6	37	CCDS4181.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	12.61	1.988304	0.35036	.	.	ENSG00000152705	ENST00000282611	D	0.97575	-4.44	5.42	-0.314	0.12750	.	0.092879	0.47852	D	0.000209	D	0.95357	0.8493	L	0.32530	0.975	0.09310	N	1	D	0.58268	0.982	P	0.55824	0.785	D	0.90922	0.4784	10	0.62326	D	0.03	-12.5051	9.9716	0.41757	0.0:0.5209:0.0:0.4791	.	49	Q86XQ3	CTSR3_HUMAN	R	49	ENSP00000282611:S49R	ENSP00000282611:S49R	S	+	3	2	CATSPER3	134333576	0.004000	0.15560	0.005000	0.12908	0.009000	0.06853	0.152000	0.16302	-0.186000	0.10533	-0.484000	0.04775	AGC		0.403	CATSPER3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251191.2	NM_178019		Missense_Mutation
PURA	5813	broad.mit.edu	37	5	139494241	139494241	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr5:139494241C>T	ENST00000331327.3	+	1	534	c.475C>T	c.(475-477)Ctc>Ttc	p.L159F		NM_005859.4	NP_005850.1	Q00577	PURA_HUMAN	purine-rich element binding protein A	159					DNA replication initiation (GO:0006270)|DNA unwinding involved in DNA replication (GO:0006268)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|DNA replication factor A complex (GO:0005662)|neuronal cell body (GO:0043025)|nuclear chromosome, telomeric region (GO:0000784)|nucleus (GO:0005634)	double-stranded telomeric DNA binding (GO:0003691)|poly(A) RNA binding (GO:0044822)|purine-rich negative regulatory element binding (GO:0032422)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|single-stranded DNA binding (GO:0003697)|transcription factor binding (GO:0008134)|translation repressor activity, nucleic acid binding (GO:0000900)	p.L159F(1)		central_nervous_system(1)|lung(2)|ovary(1)|prostate(1)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTACATGGATCTCAAGGAGAA	0.706																																																1	Substitution - Missense(1)	ovary(1)	5											16.0	20.0	19.0					5																	139494241		2200	4294	6494	139474425	SO:0001583	missense	5813			BC036087	CCDS4220.1	5q31	2008-02-05			ENSG00000185129	ENSG00000185129			9701	protein-coding gene	gene with protein product		600473				1448097	Standard	NM_005859		Approved	PURALPHA, PUR1, PUR-ALPHA	uc003lfa.3	Q00577	OTTHUMG00000129242	ENST00000331327.3:c.475C>T	5.37:g.139494241C>T	ENSP00000332706:p.Leu159Phe		139474425		Missense_Mutation	SNP	ENST00000331327.3	37	CCDS4220.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	34	5.411996	0.96072	.	.	ENSG00000185129	ENST00000331327	T	0.52526	0.66	4.91	4.91	0.64330	.	0.000000	0.64402	D	0.000002	T	0.71358	0.3330	M	0.81112	2.525	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.76002	-0.3118	10	0.87932	D	0	-8.1389	17.9042	0.88913	0.0:1.0:0.0:0.0	.	159	Q00577	PURA_HUMAN	F	159	ENSP00000332706:L159F	ENSP00000332706:L159F	L	+	1	0	PURA	139474425	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.867000	0.69597	2.564000	0.86499	0.655000	0.94253	CTC		0.706	PURA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251341.3	NM_005859		Missense_Mutation
PCDHA10	56139	broad.mit.edu	37	5	140236983	140236983	+	Missense_Mutation	SNP	C	C	G			TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr5:140236983C>G	ENST00000307360.5	+	1	1350	c.1350C>G	c.(1348-1350)aaC>aaG	p.N450K	PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA10_ENST00000506939.2_Missense_Mutation_p.N450K|PCDHA4_ENST00000512229.2_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA1_ENST00000504120.2_Intron	NM_018901.2	NP_061724.1	Q9Y5I2	PCDAA_HUMAN	protocadherin alpha 10	450	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.N450K(2)|p.N450N(2)		NS(1)|breast(11)|cervix(1)|endometrium(11)|kidney(5)|large_intestine(13)|liver(2)|lung(20)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)	79			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGAACGACAACGCGCCTGCGT	0.682																																																4	Substitution - Missense(2)|Substitution - coding silent(2)	ovary(2)|endometrium(2)	5											102.0	95.0	97.0					5																	140236983		2196	4276	6472	140217167	SO:0001583	missense	56139			AF152475	CCDS34255.1, CCDS54921.1, CCDS75325.1	5q31	2010-11-26			ENSG00000250120	ENSG00000250120		"""Cadherins / Protocadherins : Clustered"""	8664	other	complex locus constituent	"""KIAA0345-like 4"", ""ortholog to mouse CNR8"""	606316		CNRS8		10380929	Standard	NM_018901		Approved	CNR8, CRNR8, CNRN8, PCDH-ALPHA10		Q9Y5I2	OTTHUMG00000163372	ENST00000307360.5:c.1350C>G	5.37:g.140236983C>G	ENSP00000304234:p.Asn450Lys		140217167	A1L493|O75280|Q9NRU2	Missense_Mutation	SNP	ENST00000307360.5	37	CCDS54921.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	11.01	1.513737	0.27123	.	.	ENSG00000250120	ENST00000506939;ENST00000307360	T;T	0.65364	-0.15;-0.15	3.96	-1.07	0.09968	Cadherin (4);Cadherin conserved site (1);Cadherin-like (1);	.	.	.	.	D	0.87313	0.6146	H	0.99887	4.895	0.26118	N	0.980594	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.91635	0.999;0.944;0.995	T	0.76345	-0.2993	9	0.87932	D	0	.	9.8304	0.40939	0.0:0.4053:0.0:0.5947	.	450;450;450	Q9Y5I2-3;Q9Y5I2;Q9Y5I2-2	.;PCDAA_HUMAN;.	K	450	ENSP00000421030:N450K;ENSP00000304234:N450K	ENSP00000304234:N450K	N	+	3	2	PCDHA10	140217167	0.000000	0.05858	0.996000	0.52242	0.189000	0.23516	-0.682000	0.05185	-0.125000	0.11703	-0.265000	0.10407	AAC		0.682	PCDHA10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372895.2	NM_018901		Missense_Mutation
CAMK2A	815	broad.mit.edu	37	5	149629831	149629831	+	Silent	SNP	G	G	A	rs570919176		TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr5:149629831G>A	ENST00000348628.6	-	11	1523	c.858C>T	c.(856-858)acC>acT	p.T286T	CAMK2A_ENST00000398376.3_Silent_p.T286T	NM_015981.3|NM_171825.2	NP_057065.2|NP_741960.1	Q9UQM7	KCC2A_HUMAN	calcium/calmodulin-dependent protein kinase II alpha	286					calcium ion transport (GO:0006816)|cytokine-mediated signaling pathway (GO:0019221)|G1/S transition of mitotic cell cycle (GO:0000082)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of neurotransmitter secretion (GO:0046928)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|kinase activity (GO:0016301)|protein homodimerization activity (GO:0042803)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(6)|skin(1)|stomach(1)	15		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GGCAGTCCACGGTCTCCTGTC	0.607													G|||	1	0.000199681	0.0008	0.0	5008	,	,		20342	0.0		0.0	False		,,,				2504	0.0															0			5											99.0	97.0	98.0					5																	149629831		2123	4257	6380	149610024	SO:0001819	synonymous_variant	815			AB023185	CCDS43386.1, CCDS43387.1	5q32	2013-09-20	2008-10-30		ENSG00000070808	ENSG00000070808	2.7.11.17		1460	protein-coding gene	gene with protein product	"""CaM-kinase II alpha chain"", ""calcium/calmodulin-dependent protein kinase II alpha-B subunit"", ""CaM kinase II alpha subunit"", ""CaMK-II alpha subunit"", ""calcium/calmodulin-dependent protein kinase type II alpha chain"""	114078	"""calcium/calmodulin-dependent protein kinase (CaM kinase) II alpha"""	CAMKA		10231032, 3475713	Standard	NM_015981		Approved	KIAA0968, CaMKIINalpha	uc003lrt.2	Q9UQM7	OTTHUMG00000134281	ENST00000348628.6:c.858C>T	5.37:g.149629831G>A			149610024	Q9UL21|Q9Y2H4|Q9Y352	Silent	SNP	ENST00000348628.6	37	CCDS43386.1	SNP	39	Broad																																																																																				0.607	CAMK2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258869.2	NM_015981		Silent
GABBR1	2550	broad.mit.edu	37	6	29589553	29589553	+	Silent	SNP	A	A	G			TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr6:29589553A>G	ENST00000377034.4	-	10	1442	c.1107T>C	c.(1105-1107)acT>acC	p.T369T	GABBR1_ENST00000377012.4_Silent_p.T252T|GABBR1_ENST00000376977.3_Silent_p.T369T|GABBR1_ENST00000355973.3_Silent_p.T252T|GABBR1_ENST00000377016.4_Silent_p.T307T	NM_001470.2	NP_001461.1	Q9UBS5	GABR1_HUMAN	gamma-aminobutyric acid (GABA) B receptor, 1	369					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|gamma-aminobutyric acid signaling pathway (GO:0007214)|negative regulation of adenylate cyclase activity (GO:0007194)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|G-protein coupled receptor heterodimeric complex (GO:0038039)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	G-protein coupled GABA receptor activity (GO:0004965)	p.T369T(1)		endometrium(3)|kidney(1)|large_intestine(13)|liver(1)|lung(16)|ovary(5)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47					Baclofen(DB00181)|Progabide(DB00837)|Vigabatrin(DB01080)	TCCGGGCTTCAGTCTCATAGA	0.547																																																1	Substitution - coding silent(1)	ovary(1)	6											62.0	66.0	65.0					6																	29589553		2203	4300	6503	29697532	SO:0001819	synonymous_variant	2550			Y11044	CCDS4663.1, CCDS4664.1, CCDS4665.1	6p21.3	2012-08-29			ENSG00000204681	ENSG00000204681		"""GABA receptors"", ""GPCR / Class C : GABA(B) receptors"""	4070	protein-coding gene	gene with protein product	"""GABA-B receptor"""	603540				9753614, 9798068	Standard	NM_001470		Approved	hGB1a, GPRC3A	uc003nmt.4	Q9UBS5	OTTHUMG00000031095	ENST00000377034.4:c.1107T>C	6.37:g.29589553A>G			29697532	B0UXY7|O95375|O95468|O95975|O96022|Q5STL4|Q5SUJ8|Q5SUL3|Q71SG6|Q86W60|Q9UQQ0	Silent	SNP	ENST00000377034.4	37	CCDS4663.1	SNP	7	Broad																																																																																				0.547	GABBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076141.3			Silent
NOTCH4	4855	broad.mit.edu	37	6	32189051	32189051	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr6:32189051C>T	ENST00000375023.3	-	4	641	c.503G>A	c.(502-504)gGa>gAa	p.G168E		NM_004557.3	NP_004548.3	Q99466	NOTC4_HUMAN	notch 4	168	EGF-like 4. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell differentiation (GO:0030154)|cell fate determination (GO:0001709)|embryo development (GO:0009790)|endothelial cell morphogenesis (GO:0001886)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|mammary gland development (GO:0030879)|morphogenesis of a branching structure (GO:0001763)|negative regulation of cell differentiation (GO:0045596)|negative regulation of endothelial cell differentiation (GO:0045602)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|patterning of blood vessels (GO:0001569)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(47)|ovary(5)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(1)	100						ACACACCCCTCCATTAACACA	0.572																																																0			6											74.0	68.0	70.0					6																	32189051		1510	2709	4219	32297029	SO:0001583	missense	4855				CCDS34420.1	6p21.3	2013-01-10	2010-06-24		ENSG00000204301	ENSG00000204301		"""Ankyrin repeat domain containing"""	7884	protein-coding gene	gene with protein product		164951	"""Notch (Drosophila) homolog 4"", ""Notch homolog 4 (Drosophila)"""	INT3		7835890	Standard	NM_004557		Approved		uc003obb.3	Q99466	OTTHUMG00000031044	ENST00000375023.3:c.503G>A	6.37:g.32189051C>T	ENSP00000364163:p.Gly168Glu		32297029	B0V183|B0V1X5|O00306|Q5SSY7|Q99458|Q99940|Q9H3S8|Q9UII9|Q9UIJ0	Missense_Mutation	SNP	ENST00000375023.3	37	CCDS34420.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	16.47	3.133038	0.56828	.	.	ENSG00000204301	ENST00000375023	D	0.93366	-3.21	4.44	4.44	0.53790	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.178649	0.26915	N	0.021842	D	0.93255	0.7851	M	0.66939	2.045	0.80722	D	1	D;P	0.62365	0.991;0.948	P;B	0.53518	0.728;0.133	D	0.93382	0.6744	10	0.54805	T	0.06	.	14.5934	0.68386	0.0:1.0:0.0:0.0	.	168;168	Q6P3V5;Q99466	.;NOTC4_HUMAN	E	168	ENSP00000364163:G168E	ENSP00000364163:G168E	G	-	2	0	NOTCH4	32297029	1.000000	0.71417	0.947000	0.38551	0.146000	0.21551	5.791000	0.69045	2.299000	0.77371	0.561000	0.74099	GGA		0.572	NOTCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076045.2			Missense_Mutation
AARS2	57505	broad.mit.edu	37	6	44271068	44271068	+	Silent	SNP	G	G	A			TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr6:44271068G>A	ENST00000244571.4	-	15	2102	c.2100C>T	c.(2098-2100)ccC>ccT	p.P700P	TMEM151B_ENST00000438774.2_Intron|RP11-444E17.6_ENST00000505802.1_Intron|AARS2_ENST00000491573.1_5'Flank	NM_020745.3	NP_065796			alanyl-tRNA synthetase 2, mitochondrial									p.P700P(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(3)|skin(2)|stomach(1)	34	Hepatocellular(11;0.00908)|all_lung(25;0.0101)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			TGAGCGCCAGGGGCACCTCCT	0.647																																																1	Substitution - coding silent(1)	ovary(1)	6											45.0	43.0	44.0					6																	44271068		2203	4300	6503	44379046	SO:0001819	synonymous_variant	57505			AB033096	CCDS34464.1	6p21.1	2012-10-26	2012-10-26	2007-02-23	ENSG00000124608	ENSG00000124608	6.1.1.7	"""Aminoacyl tRNA synthetases / Class II"""	21022	protein-coding gene	gene with protein product	"""alanine tRNA ligase 2, mitochondrial"""	612035	"""alanyl-tRNA synthetase like"", ""alanyl-tRNA synthetase 2, mitochondrial (putative)"""	AARSL		15779907, 21549344	Standard	NM_020745		Approved	KIAA1270, bA444E17.1	uc010jza.1	Q5JTZ9	OTTHUMG00000014766	ENST00000244571.4:c.2100C>T	6.37:g.44271068G>A			44379046		Silent	SNP	ENST00000244571.4	37	CCDS34464.1	SNP	43	Broad																																																																																				0.647	AARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040741.2	NM_020745		Silent
ROS1	6098	broad.mit.edu	37	6	117674279	117674279	+	Missense_Mutation	SNP	T	T	C			TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr6:117674279T>C	ENST00000368508.3	-	26	4393	c.4195A>G	c.(4195-4197)Atc>Gtc	p.I1399V	GOPC_ENST00000467125.1_Intron|ROS1_ENST00000368507.3_Missense_Mutation_p.I1393V	NM_002944.2	NP_002935.2	P08922	ROS1_HUMAN	ROS proto-oncogene 1 , receptor tyrosine kinase	1399					cell differentiation (GO:0030154)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|columnar/cuboidal epithelial cell development (GO:0002066)|negative regulation of gene expression (GO:0010629)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of phosphate transport (GO:0010966)|regulation of TOR signaling (GO:0032006)|spermatogenesis (GO:0007283)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.I1399V(1)	TPM3_ENST00000368530/ROS1(4)|LRIG3/ROS1(2)|CD74_ENST00000009530/ROS1(32)|SLC34A2/ROS1(14)|EZR/ROS1(4)|GOPC/ROS1(14)|SDC4/ROS1(7)	NS(2)|breast(7)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(28)|lung(56)|ovary(8)|prostate(5)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	162		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		TTTGCTGTGATGATCCAGTAT	0.388			T	"""GOPC, SDC4, SLC34A2, EZR, LRIG3"""	"""glioblastoma, NSCLC"""																																		Dom	yes		6	6q22	6098	v-ros UR2 sarcoma virus oncogene homolog 1 (avian)		"""O, E"""	1	Substitution - Missense(1)	ovary(1)	6											183.0	161.0	169.0					6																	117674279		2203	4300	6503	117780972	SO:0001583	missense	6098			M13599	CCDS5116.1	6q21-q22	2014-06-26	2014-06-26		ENSG00000047936	ENSG00000047936		"""Fibronectin type III domain containing"""	10261	protein-coding gene	gene with protein product		165020	"""v-ros avian UR2 sarcoma virus oncogene homolog 1"", ""v-ros UR2 sarcoma virus oncogene homolog 1 (avian)"", ""c-ros oncogene 1 , receptor tyrosine kinase"""			1611909	Standard	NM_002944		Approved	MCF3, ROS, c-ros-1	uc003pxp.1	P08922	OTTHUMG00000016188	ENST00000368508.3:c.4195A>G	6.37:g.117674279T>C	ENSP00000357494:p.Ile1399Val		117780972	Q15368|Q5TDB5	Missense_Mutation	SNP	ENST00000368508.3	37	CCDS5116.1	SNP	51	Broad	.	.	.	.	.	.	.	.	.	.	T	1.298	-0.605703	0.03717	.	.	ENSG00000047936	ENST00000368508;ENST00000368507	D;D	0.90900	-2.75;-2.75	5.37	-0.676	0.11361	.	0.954411	0.08713	N	0.904729	T	0.50820	0.1638	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.52525	-0.8564	10	0.05436	T	0.98	.	3.4152	0.07373	0.4188:0.2347:0.0:0.3465	.	1399	P08922	ROS1_HUMAN	V	1399;1393	ENSP00000357494:I1399V;ENSP00000357493:I1393V	ENSP00000357493:I1393V	I	-	1	0	ROS1	117780972	0.000000	0.05858	0.003000	0.11579	0.768000	0.43524	-0.654000	0.05354	-0.085000	0.12573	0.455000	0.32223	ATC		0.388	ROS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043464.1			Missense_Mutation
AKAP7	9465	broad.mit.edu	37	6	131490397	131490397	+	Silent	SNP	A	A	T	rs113026534		TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr6:131490397A>T	ENST00000431975.2	+	5	671	c.573A>T	c.(571-573)tcA>tcT	p.S191S	AKAP7_ENST00000366358.2_Intron|AKAP7_ENST00000541650.1_Silent_p.S190S|AKAP7_ENST00000368123.4_Silent_p.S169S	NM_016377.3	NP_057461.2	Q9P0M2	AKA7G_HUMAN	A kinase (PRKA) anchor protein 7	191						cytosol (GO:0005829)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|nucleotide binding (GO:0000166)|protein kinase A binding (GO:0051018)	p.S169S(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)|stomach(1)	13	Breast(56;0.152)			GBM - Glioblastoma multiforme(226;0.0184)|OV - Ovarian serous cystadenocarcinoma(155;0.0345)		ATGTAAACTCACTTTTGGAGA	0.378																																																1	Substitution - coding silent(1)	ovary(1)	6											140.0	142.0	141.0					6																	131490397		2203	4300	6503	131532090	SO:0001819	synonymous_variant	9465			AF047715	CCDS5142.1, CCDS5143.1, CCDS5144.1, CCDS5142.2	6q23.2	2012-10-24			ENSG00000118507	ENSG00000118507		"""A-kinase anchor proteins"""	377	protein-coding gene	gene with protein product		604693				9545239	Standard	NM_016377		Approved	AKAP18, AKAP15	uc003qck.4	O43687	OTTHUMG00000015563	ENST00000431975.2:c.573A>T	6.37:g.131490397A>T			131532090	B4DUC3|Q9HCZ8	Silent	SNP	ENST00000431975.2	37	CCDS5142.2	SNP	6	Broad																																																																																				0.378	AKAP7-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042209.2	NM_004842		Silent
SHPRH	257218	broad.mit.edu	37	6	146256292	146256292	+	Missense_Mutation	SNP	A	A	C			TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr6:146256292A>C	ENST00000367505.2	-	13	3005	c.2741T>G	c.(2740-2742)aTa>aGa	p.I914R	SHPRH_ENST00000438092.2_Missense_Mutation_p.I914R|SHPRH_ENST00000367503.3_Missense_Mutation_p.I914R|SHPRH_ENST00000275233.7_Missense_Mutation_p.I914R			Q149N8	SHPRH_HUMAN	SNF2 histone linker PHD RING helicase, E3 ubiquitin protein ligase	914					DNA repair (GO:0006281)|nucleosome assembly (GO:0006334)|protein polyubiquitination (GO:0000209)	nucleosome (GO:0000786)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.I914R(1)		breast(2)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(15)|lung(33)|ovary(3)|pancreas(2)|prostate(7)|skin(1)|urinary_tract(1)	79		Ovarian(120;0.0365)		OV - Ovarian serous cystadenocarcinoma(155;1.47e-07)|GBM - Glioblastoma multiforme(68;0.0124)		TTGTGGTGGTATTTGGATCTG	0.383																																																1	Substitution - Missense(1)	ovary(1)	6											62.0	58.0	59.0					6																	146256292		1850	4098	5948	146297985	SO:0001583	missense	257218			AB095943	CCDS43513.1, CCDS47496.1, CCDS43513.2	6q24.2	2012-02-23	2012-02-23		ENSG00000146414	ENSG00000146414		"""RING-type (C3HC4) zinc fingers"""	19336	protein-coding gene	gene with protein product		608048	"""SNF2 histone linker PHD RING helicase"""			12837266	Standard	NM_001042683		Approved	FLJ90837, KIAA2023, bA545I5.2	uc003qlf.3	Q149N8	OTTHUMG00000015750	ENST00000367505.2:c.2741T>G	6.37:g.146256292A>C	ENSP00000356475:p.Ile914Arg		146297985	Q149N9|Q5VV79|Q68DS5|Q7Z5J5|Q8IVE8|Q8IWQ9|Q8N1S8|Q8NBR7	Missense_Mutation	SNP	ENST00000367505.2	37	CCDS43513.2	SNP	16	Broad	.	.	.	.	.	.	.	.	.	.	A	23.8	4.464375	0.84425	.	.	ENSG00000146414	ENST00000367505;ENST00000367503;ENST00000438092;ENST00000275233	T;T;T;T	0.76709	-1.04;-1.04;-1.04;-1.04	5.73	5.73	0.89815	SNF2-related (1);	0.000000	0.85682	D	0.000000	D	0.88351	0.6413	M	0.88704	2.975	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.992;0.999;0.999	D	0.90725	0.4638	10	0.87932	D	0	-25.6066	16.0173	0.80450	1.0:0.0:0.0:0.0	.	803;914;914	Q149N8-2;Q149N8;Q149N8-4	.;SHPRH_HUMAN;.	R	914	ENSP00000356475:I914R;ENSP00000356473:I914R;ENSP00000412797:I914R;ENSP00000275233:I914R	ENSP00000275233:I914R	I	-	2	0	SHPRH	146297985	1.000000	0.71417	0.998000	0.56505	0.920000	0.55202	9.339000	0.96797	2.181000	0.69327	0.533000	0.62120	ATA		0.383	SHPRH-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000042571.2	NM_173082		Missense_Mutation
SYNE1	23345	broad.mit.edu	37	6	152522993	152522993	+	Missense_Mutation	SNP	T	T	C			TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr6:152522993T>C	ENST00000367255.5	-	127	23712	c.23111A>G	c.(23110-23112)cAt>cGt	p.H7704R	SYNE1_ENST00000341594.5_Missense_Mutation_p.H7316R|SYNE1_ENST00000448038.1_Missense_Mutation_p.H7633R|SYNE1_ENST00000356820.4_Missense_Mutation_p.H2228R|SYNE1_ENST00000265368.4_Missense_Mutation_p.H7704R|SYNE1_ENST00000423061.1_Missense_Mutation_p.H7633R	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	7704					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		GAGCTCTTCATGGTGATCCGG	0.458										HNSCC(10;0.0054)																																						0			6											116.0	121.0	119.0					6																	152522993		2203	4300	6503	152564686	SO:0001583	missense	23345			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.23111A>G	6.37:g.152522993T>C	ENSP00000356224:p.His7704Arg		152564686	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	37	CCDS5236.2	SNP	51	Broad	.	.	.	.	.	.	.	.	.	.	T	20.3	3.959147	0.74016	.	.	ENSG00000131018	ENST00000367255;ENST00000367257;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000356820;ENST00000367251	T;T;T;T;T;T;T;T	0.33865	1.39;1.39;1.39;1.39;1.39;1.39;1.39;1.39	6.08	6.08	0.98989	.	0.091701	0.47852	D	0.000215	T	0.53965	0.1829	M	0.85197	2.74	0.58432	D	0.999992	D;D;D;D	0.69078	0.992;0.992;0.997;0.996	P;P;P;P	0.62298	0.796;0.796;0.9;0.796	T	0.57751	-0.7757	10	0.40728	T	0.16	.	16.6512	0.85203	0.0:0.0:0.0:1.0	.	7704;7704;7633;7633	Q8NF91;E7EQI5;Q8NF91-4;E9PEL9	SYNE1_HUMAN;.;.;.	R	7704;350;7633;7704;7633;7316;2228;626	ENSP00000356224:H7704R;ENSP00000356226:H350R;ENSP00000396024:H7633R;ENSP00000265368:H7704R;ENSP00000390975:H7633R;ENSP00000341887:H7316R;ENSP00000349276:H2228R;ENSP00000356220:H626R	ENSP00000265368:H7704R	H	-	2	0	SYNE1	152564686	1.000000	0.71417	0.903000	0.35520	0.337000	0.28794	8.040000	0.89188	2.333000	0.79357	0.482000	0.46254	CAT		0.458	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961		Missense_Mutation
SP4	6671	broad.mit.edu	37	7	21521627	21521627	+	Nonsense_Mutation	SNP	C	C	T			TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr7:21521627C>T	ENST00000222584.3	+	5	2211	c.1993C>T	c.(1993-1995)Cga>Tga	p.R665*		NM_003112.3	NP_003103.2	Q02446	SP4_HUMAN	Sp4 transcription factor	665					regulation of heart contraction (GO:0008016)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)	p.R665*(2)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(11)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	35						ATCTCATTTACGAGCACATCT	0.398																																																2	Substitution - Nonsense(2)	ovary(1)|large_intestine(1)	7											150.0	145.0	147.0					7																	21521627		2203	4300	6503	21488152	SO:0001587	stop_gained	6671				CCDS5373.1	7p15	2013-01-08			ENSG00000105866	ENSG00000105866		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	11209	protein-coding gene	gene with protein product		600540				1454515	Standard	XM_005249828		Approved	SPR-1, HF1B, MGC130008, MGC130009	uc003sva.3	Q02446	OTTHUMG00000094801	ENST00000222584.3:c.1993C>T	7.37:g.21521627C>T	ENSP00000222584:p.Arg665*		21488152	O60402|Q32M52	Nonsense_Mutation	SNP	ENST00000222584.3	37	CCDS5373.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	41	9.151051	0.99082	.	.	ENSG00000105866	ENST00000222584	.	.	.	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	20.1935	0.98237	0.0:1.0:0.0:0.0	.	.	.	.	X	665	.	ENSP00000222584:R665X	R	+	1	2	SP4	21488152	0.997000	0.39634	0.994000	0.49952	0.980000	0.70556	1.498000	0.35660	2.779000	0.95612	0.591000	0.81541	CGA		0.398	SP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211617.2	NM_003112		Nonsense_Mutation
HOXA1	3198	broad.mit.edu	37	7	27135280	27135280	+	Silent	SNP	C	C	A			TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr7:27135280C>A	ENST00000343060.4	-	1	313	c.252G>T	c.(250-252)ggG>ggT	p.G84G	HOTAIRM1_ENST00000425358.2_RNA|HOTAIRM1_ENST00000429611.3_RNA|HOTAIRM1_ENST00000434063.3_RNA|HOXA1_ENST00000355633.5_Silent_p.G84G|HOTAIRM1_ENST00000495032.1_RNA	NM_005522.4	NP_005513	P49639	HXA1_HUMAN	homeobox A1	84					abducens nerve formation (GO:0021599)|anatomical structure morphogenesis (GO:0009653)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|artery morphogenesis (GO:0048844)|central nervous system neuron differentiation (GO:0021953)|cochlea development (GO:0090102)|cochlea morphogenesis (GO:0090103)|cognition (GO:0050890)|embryonic neurocranium morphogenesis (GO:0048702)|facial nerve structural organization (GO:0021612)|facial nucleus development (GO:0021754)|inner ear development (GO:0048839)|motor neuron axon guidance (GO:0008045)|multicellular organismal development (GO:0007275)|neuromuscular process (GO:0050905)|optokinetic behavior (GO:0007634)|outer ear morphogenesis (GO:0042473)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of behavior (GO:0050795)|rhombomere 3 development (GO:0021569)|rhombomere 4 development (GO:0021570)|rhombomere 5 development (GO:0021571)|semicircular canal formation (GO:0060876)|sensory perception of sound (GO:0007605)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.G84G(1)		endometrium(2)|kidney(2)|large_intestine(4)|liver(1)|lung(14)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						CCCCCAGGTTCCCGGAAGTCT	0.612											OREG0003750	type=REGULATORY REGION|Gene=BC031342|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																																				1	Substitution - coding silent(1)	ovary(1)	7											55.0	57.0	57.0					7																	27135280		2203	4300	6503	27101805	SO:0001819	synonymous_variant	3198				CCDS5401.1, CCDS5402.2	7p15.2	2011-06-20	2005-12-22		ENSG00000105991	ENSG00000105991		"""Homeoboxes / ANTP class : HOXL subclass"""	5099	protein-coding gene	gene with protein product		142955	"""homeo box A1"""	HOX1F, HOX1		1973146	Standard	NM_153620		Approved		uc003sye.3	P49639	OTTHUMG00000023207	ENST00000343060.4:c.252G>T	7.37:g.27135280C>A		792	27101805	A4D184|B2R8U7|O43363	Silent	SNP	ENST00000343060.4	37	CCDS5401.1	SNP	30	Broad																																																																																				0.612	HOXA1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000358454.1			Silent
HECW1	23072	broad.mit.edu	37	7	43581522	43581522	+	Silent	SNP	G	G	A	rs532223116		TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr7:43581522G>A	ENST00000395891.2	+	26	4778	c.4173G>A	c.(4171-4173)ttG>ttA	p.L1391L	HECW1_ENST00000453890.1_Silent_p.L1357L	NM_015052.3	NP_055867.3	Q76N89	HECW1_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1	1391	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.L1370L(1)		NS(2)|breast(10)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(57)|ovary(8)|pancreas(2)|prostate(2)|skin(6)|urinary_tract(3)	125						ACCAGAGTTTGCAGTGGATGA	0.433																																																1	Substitution - coding silent(1)	ovary(1)	7											172.0	156.0	161.0					7																	43581522		1887	4137	6024	43548047	SO:0001819	synonymous_variant	23072			AB048365	CCDS5469.2, CCDS69286.1	7p13	2004-12-13			ENSG00000002746	ENSG00000002746			22195	protein-coding gene	gene with protein product		610384				12690205, 14684739	Standard	XM_005249665		Approved	KIAA0322, NEDL1	uc003tid.1	Q76N89	OTTHUMG00000128917	ENST00000395891.2:c.4173G>A	7.37:g.43581522G>A			43548047	A7E2X0|A8MYS3|B4DH42|O15036|Q9HCC7	Silent	SNP	ENST00000395891.2	37	CCDS5469.2	SNP	46	Broad	.	.	.	.	.	.	.	.	.	.	G	9.113	1.007096	0.19199	.	.	ENSG00000002746	ENST00000429529	.	.	.	5.95	5.06	0.68205	.	.	.	.	.	T	0.59810	0.2221	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.58487	-0.7628	4	.	.	.	.	8.8232	0.35039	0.2255:0.0:0.7745:0.0	.	.	.	.	Y	115	.	.	C	+	2	0	HECW1	43548047	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	0.765000	0.26546	1.491000	0.48482	0.563000	0.77884	TGC		0.433	HECW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250893.2	NM_015052		Silent
EPHB4	2050	broad.mit.edu	37	7	100421431	100421431	+	Silent	SNP	G	G	T	rs373788065		TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr7:100421431G>T	ENST00000358173.3	-	3	714	c.246C>A	c.(244-246)ggC>ggA	p.G82G	EPHB4_ENST00000477446.1_5'UTR|RN7SL750P_ENST00000582814.1_RNA|EPHB4_ENST00000360620.3_Silent_p.G82G	NM_004444.4	NP_004435.3	P54760	EPHB4_HUMAN	EPH receptor B4	82	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|ephrin receptor signaling pathway (GO:0048013)|heart morphogenesis (GO:0003007)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.G82G(1)		breast(1)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(7)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(3)	47	Lung NSC(181;0.041)|all_lung(186;0.0581)					CGTGGACGGCGCCCCGCCGTG	0.667																																					GBM(200;2113 3072 25865 52728)											1	Substitution - coding silent(1)	ovary(1)	7											45.0	41.0	43.0					7																	100421431		2202	4299	6501	100259367	SO:0001819	synonymous_variant	2050			AY056047	CCDS5706.1	7q22	2013-02-11	2004-10-28		ENSG00000196411	ENSG00000196411		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3395	protein-coding gene	gene with protein product		600011	"""EphB4"""	HTK		8188704	Standard	NM_004444		Approved	Tyro11	uc003uwn.1	P54760	OTTHUMG00000157040	ENST00000358173.3:c.246C>A	7.37:g.100421431G>T			100259367	B5A970|B5A971|B5A972|Q7Z635|Q9BTA5|Q9BXP0	Silent	SNP	ENST00000358173.3	37	CCDS5706.1	SNP	38	Broad																																																																																				0.667	EPHB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347222.1	NM_004444		Silent
CADPS2	93664	broad.mit.edu	37	7	122056211	122056211	+	Missense_Mutation	SNP	C	C	A			TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr7:122056211C>A	ENST00000449022.2	-	18	2503	c.2484G>T	c.(2482-2484)atG>atT	p.M828I	CADPS2_ENST00000412584.2_Missense_Mutation_p.M825I|CADPS2_ENST00000334010.7_Missense_Mutation_p.M829I|RP5-1101C3.1_ENST00000593910.1_RNA|RP5-1101C3.1_ENST00000591140.1_RNA|CADPS2_ENST00000313070.7_Missense_Mutation_p.M825I	NM_017954.10	NP_060424.9	Q86UW7	CAPS2_HUMAN	Ca++-dependent secretion activator 2	828	Interaction with DRD2.				cellular response to starvation (GO:0009267)|positive regulation of exocytosis (GO:0045921)|protein transport (GO:0015031)|synaptic vesicle priming (GO:0016082)	cell junction (GO:0030054)|cytoplasmic membrane-bounded vesicle (GO:0016023)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)	p.M828I(1)		breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(26)|ovary(2)	43						ATGCCTGGTTCATGGTCTCTA	0.373																																																1	Substitution - Missense(1)	ovary(1)	7											60.0	56.0	57.0					7																	122056211		1828	4081	5909	121843447	SO:0001583	missense	93664				CCDS47691.1, CCDS55158.1	7q31.32	2013-01-10	2008-08-28		ENSG00000081803	ENSG00000081803		"""Pleckstrin homology (PH) domain containing"""	16018	protein-coding gene	gene with protein product		609978	"""Ca++-dependent activator protein for secretion 2"""				Standard	NM_017954		Approved		uc010lkq.3	Q86UW7	OTTHUMG00000157093	ENST00000449022.2:c.2484G>T	7.37:g.122056211C>A	ENSP00000398481:p.Met828Ile		121843447	A4D0X3|B7ZM56|Q658Q2|Q7Z5T7|Q8IZW9|Q8N7M4|Q9H6P4|Q9HCI1|Q9NWK8	Missense_Mutation	SNP	ENST00000449022.2	37	CCDS55158.1	SNP	29	Broad	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	13.31|13.31|13.31	2.198893|2.198893|2.198893	0.38806|0.38806|0.38806	.|.|.	.|.|.	ENSG00000081803|ENSG00000081803|ENSG00000081803	ENST00000397721|ENST00000360097;ENST00000313070;ENST00000334010;ENST00000420900;ENST00000545465;ENST00000412584;ENST00000449022|ENST00000462699	.|T;T;T;T|.	.|0.41065|.	.|1.01;1.03;1.01;1.03|.	5.71|5.71|5.71	5.71|5.71|5.71	0.89125|0.89125|0.89125	.|Calcium-dependent secretion activator (1);|.	.|0.150412|.	.|0.64402|.	.|D|.	.|0.000010|.	.|T|.	.|0.68778|.	.|0.3038|.	L|L|L	0.43152|0.43152|0.43152	1.355|1.355|1.355	0.53005|0.53005|0.53005	D|D|D	0.999965|0.999965|0.999965	.|B;B;B;B|.	.|0.19331|.	.|0.035;0.007;0.004;0.003|.	.|B;B;B;B|.	.|0.20955|.	.|0.032;0.002;0.006;0.004|.	.|T|.	.|0.63247|.	.|-0.6680|.	.|10|.	.|0.36615|.	.|T|.	.|0.2|.	-23.1568|-23.1568|-23.1568	19.8426|19.8426|19.8426	0.96695|0.96695|0.96695	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.|.	.|835;825;828;825|.	.|B7ZM57;Q86UW7-2;Q86UW7;Q86UW7-3|.	.|.;.;CAPS2_HUMAN;.|.	X|I|L	474|1;825;829;836;792;825;828|22	.|ENSP00000325581:M825I;ENSP00000333940:M829I;ENSP00000400401:M825I;ENSP00000398481:M828I|.	.|ENSP00000325581:M825I|.	E|M|X	-|-|-	1|3|2	0|0|2	CADPS2|CADPS2|CADPS2	121843447|121843447|121843447	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.974000|0.974000|0.974000	0.67602|0.67602|0.67602	3.524000|3.524000|3.524000	0.53495|0.53495|0.53495	2.686000|2.686000|2.686000	0.91538|0.91538|0.91538	0.585000|0.585000|0.585000	0.79938|0.79938|0.79938	GAA|ATG|TGA		0.373	CADPS2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347414.2	NM_017954		Missense_Mutation
SPAM1	6677	broad.mit.edu	37	7	123594492	123594492	+	Missense_Mutation	SNP	A	A	G			TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr7:123594492A>G	ENST00000439500.1	+	4	1481	c.868A>G	c.(868-870)Aaa>Gaa	p.K290E	SPAM1_ENST00000402183.2_Missense_Mutation_p.K290E|SPAM1_ENST00000223028.7_Missense_Mutation_p.K290E|SPAM1_ENST00000340011.5_Missense_Mutation_p.K290E|SPAM1_ENST00000460182.1_Missense_Mutation_p.K290E	NM_001174045.1|NM_001174046.1	NP_001167516.1|NP_001167517.1	P38567	HYALP_HUMAN	sperm adhesion molecule 1 (PH-20 hyaluronidase, zona pellucida binding)	290					binding of sperm to zona pellucida (GO:0007339)|carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)	hyalurononglucosaminidase activity (GO:0004415)	p.K290E(1)		breast(1)|cervix(1)|endometrium(3)|kidney(5)|large_intestine(5)|lung(23)|ovary(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						CAGAGTTTCCAAAATACCTGA	0.413																																																1	Substitution - Missense(1)	ovary(1)	7											68.0	64.0	65.0					7																	123594492		2203	4299	6502	123381728	SO:0001583	missense	6677			L13781	CCDS5790.1, CCDS5791.1	7q31	2008-05-02			ENSG00000106304	ENSG00000106304			11217	protein-coding gene	gene with protein product		600930				8282124, 8575780	Standard	NM_153189		Approved	HYAL5, PH-20, SPAG15	uc003vle.3	P38567	OTTHUMG00000157284	ENST00000439500.1:c.868A>G	7.37:g.123594492A>G	ENSP00000402123:p.Lys290Glu		123381728	Q8TC30	Missense_Mutation	SNP	ENST00000439500.1	37	CCDS5791.1	SNP	5	Broad	.	.	.	.	.	.	.	.	.	.	A	13.03	2.116352	0.37339	.	.	ENSG00000106304	ENST00000402183;ENST00000460182;ENST00000340011;ENST00000439500;ENST00000223028	T;T;T;T;T	0.23754	1.89;1.89;1.89;1.89;1.89	6.17	-10.1	0.00402	Aldolase-type TIM barrel (1);Glycoside hydrolase, superfamily (1);	0.936106	0.09242	N	0.829133	T	0.15305	0.0369	L	0.55213	1.73	0.09310	N	1	B;B	0.21225	0.053;0.053	B;B	0.22152	0.038;0.038	T	0.20974	-1.0259	9	.	.	.	-2.534	3.3236	0.07059	0.2376:0.3911:0.2432:0.1281	.	290;290	Q8TC30;P38567	.;HYALP_HUMAN	E	290	ENSP00000386028:K290E;ENSP00000417934:K290E;ENSP00000345849:K290E;ENSP00000402123:K290E;ENSP00000223028:K290E	.	K	+	1	0	SPAM1	123381728	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.458000	0.06737	-1.413000	0.02027	-0.313000	0.08912	AAA		0.413	SPAM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000348309.1			Missense_Mutation
DOCK5	80005	broad.mit.edu	37	8	25101189	25101189	+	Splice_Site	SNP	G	G	A			TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr8:25101189G>A	ENST00000276440.7	+	2	87		c.e2-1		DOCK5_ENST00000410074.1_Splice_Site|DOCK5_ENST00000481100.1_Splice_Site	NM_024940.6	NP_079216.4	Q9H7D0	DOCK5_HUMAN	dedicator of cytokinesis 5						positive regulation of GTPase activity (GO:0043547)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(9)|large_intestine(13)|lung(20)|ovary(3)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	72		all_cancers(63;0.0361)|Ovarian(32;0.000711)|all_epithelial(46;0.0153)|Hepatocellular(4;0.115)|Prostate(55;0.13)|Breast(100;0.143)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0267)|Epithelial(17;1.07e-11)|Colorectal(74;0.0276)|COAD - Colon adenocarcinoma(73;0.0828)		CTCATTTCCAGCGATCTATAA	0.488																																					Pancreas(145;34 1887 3271 10937 30165)											0			8											112.0	91.0	98.0					8																	25101189		2203	4300	6503	25157106	SO:0001630	splice_region_variant	80005				CCDS6047.1	8p21.2	2009-04-17			ENSG00000147459	ENSG00000147459			23476	protein-coding gene	gene with protein product						12432077	Standard	NM_024940		Approved	FLJ21034	uc003xeg.3	Q9H7D0	OTTHUMG00000131991	ENST00000276440.7:c.44-1G>A	8.37:g.25101189G>A			25157106	B2RNY0|Q5XKD5|Q6AI11|Q6PJS6|Q6ZTS6	Splice_Site_SNP	SNP	ENST00000276440.7	37	CCDS6047.1	SNP	34	Broad	.	.	.	.	.	.	.	.	.	.	G	24.8	4.574800	0.86542	.	.	ENSG00000147459	ENST00000410074;ENST00000481100;ENST00000276440	.	.	.	6.16	6.16	0.99307	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.7766	0.88510	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	DOCK5	25157106	1.000000	0.71417	0.986000	0.45419	0.959000	0.62525	6.561000	0.73955	2.937000	0.99478	0.650000	0.86243	.		0.488	DOCK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254955.2	NM_024940	Intron	Splice_Site_SNP
TG	7038	broad.mit.edu	37	8	133935586	133935586	+	Missense_Mutation	SNP	T	T	C			TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr8:133935586T>C	ENST00000220616.4	+	22	4572	c.4532T>C	c.(4531-4533)gTc>gCc	p.V1511A	TG_ENST00000377869.1_Intron|TG_ENST00000542445.1_5'UTR	NM_003235.4	NP_003226.4	P01266	THYG_HUMAN	thyroglobulin	1511	Thyroglobulin type-1 11. {ECO:0000255|PROSITE-ProRule:PRU00500}.				hormone biosynthetic process (GO:0042446)|iodide transport (GO:0015705)|regulation of myelination (GO:0031641)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)|extracellular space (GO:0005615)		p.V1511A(1)		NS(1)|breast(11)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(34)|liver(2)|lung(59)|ovary(9)|pancreas(2)|prostate(6)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(8)	168	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		GTTCTAGGTGTCACTGACTGT	0.542																																																1	Substitution - Missense(1)	ovary(1)	8											78.0	73.0	75.0					8																	133935586		2203	4300	6503	134004768	SO:0001583	missense	7038			AU141420	CCDS34944.1	8q24	2012-10-02			ENSG00000042832	ENSG00000042832			11764	protein-coding gene	gene with protein product		188450					Standard	NM_003235		Approved	TGN, AITD3	uc003ytw.3	P01266	OTTHUMG00000164649	ENST00000220616.4:c.4532T>C	8.37:g.133935586T>C	ENSP00000220616:p.Val1511Ala		134004768	O15274|O43899|Q15593|Q15948|Q9NYR1|Q9NYR2|Q9UMZ0|Q9UNY3	Missense_Mutation	SNP	ENST00000220616.4	37	CCDS34944.1	SNP	58	Broad	.	.	.	.	.	.	.	.	.	.	T	17.74	3.464755	0.63513	.	.	ENSG00000042832	ENST00000543313;ENST00000220616	T	0.65178	-0.14	4.63	3.46	0.39613	Thyroglobulin type-1 (2);	0.683649	0.13302	N	0.398151	T	0.68705	0.3030	M	0.74881	2.28	0.80722	D	1	D	0.60575	0.988	P	0.52343	0.696	T	0.67225	-0.5724	10	0.87932	D	0	.	6.8684	0.24106	0.0:0.1087:0.0:0.8913	.	1511	P01266	THYG_HUMAN	A	317;1511	ENSP00000220616:V1511A	ENSP00000220616:V1511A	V	+	2	0	TG	134004768	1.000000	0.71417	0.991000	0.47740	0.838000	0.47535	3.010000	0.49559	0.636000	0.30508	0.454000	0.30748	GTC		0.542	TG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379606.1	NM_003235		Missense_Mutation
PTAR1	375743	broad.mit.edu	37	9	72333391	72333391	+	Missense_Mutation	SNP	G	G	C	rs376519073		TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr9:72333391G>C	ENST00000340434.4	-	8	1079	c.1076C>G	c.(1075-1077)aCg>aGg	p.T359R	PTAR1_ENST00000377200.5_Missense_Mutation_p.T307R	NM_001099666.1	NP_001093136.1	Q7Z6K3	PTAR1_HUMAN	protein prenyltransferase alpha subunit repeat containing 1	359					protein prenylation (GO:0018342)		protein prenyltransferase activity (GO:0008318)	p.T359R(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)	5						TGGAACTGGCGTCCGCTTCAG	0.527																																																1	Substitution - Missense(1)	ovary(1)	9											115.0	115.0	115.0					9																	72333391		1948	4153	6101	71523211	SO:0001583	missense	375743			BC053622	CCDS47978.1	9q21.13	2008-10-01			ENSG00000188647	ENSG00000188647		"""Prenyltransferase alpha subunit repeat containing"""	30449	protein-coding gene	gene with protein product						12477932	Standard	NM_001099666		Approved		uc004ahj.4	Q7Z6K3	OTTHUMG00000019982	ENST00000340434.4:c.1076C>G	9.37:g.72333391G>C	ENSP00000344299:p.Thr359Arg		71523211	Q5T7V5|Q5T7V6	Missense_Mutation	SNP	ENST00000340434.4	37	CCDS47978.1	SNP	40	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.42|18.42	3.621133|3.621133	0.66787|0.66787	.|.	.|.	ENSG00000188647|ENSG00000188647	ENST00000415701|ENST00000377200;ENST00000340434	.|T;T	.|0.41065	.|1.01;1.01	6.02|6.02	6.02|6.02	0.97574|0.97574	.|.	.|0.240692	.|0.44285	.|D	.|0.000463	T|T	0.39009|0.39009	0.1062|0.1062	L|L	0.27053|0.27053	0.805|0.805	0.80722|0.80722	D|D	1|1	.|D	.|0.56746	.|0.977	.|P	.|0.46585	.|0.521	T|T	0.03728|0.03728	-1.1009|-1.1009	5|10	.|0.20046	.|T	.|0.44	.|.	20.5407|20.5407	0.99260|0.99260	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|359	.|Q7Z6K3	.|PTAR1_HUMAN	E|R	124|307;359	.|ENSP00000366405:T307R;ENSP00000344299:T359R	.|ENSP00000344299:T359R	D|T	-|-	3|2	2|0	PTAR1|PTAR1	71523211|71523211	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.927000|0.927000	0.56198|0.56198	5.504000|5.504000	0.66968|0.66968	2.865000|2.865000	0.98341|0.98341	0.655000|0.655000	0.94253|0.94253	GAC|ACG		0.527	PTAR1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052582.4	NM_001099666		Missense_Mutation
OR13F1	138805	broad.mit.edu	37	9	107267333	107267333	+	Missense_Mutation	SNP	G	G	A	rs372415307		TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr9:107267333G>A	ENST00000334726.2	+	1	879	c.790G>A	c.(790-792)Gct>Act	p.A264T		NM_001004485.1	NP_001004485.1	Q8NGS4	O13F1_HUMAN	olfactory receptor, family 13, subfamily F, member 1	264						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A264T(1)		endometrium(3)|large_intestine(6)|lung(17)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	31						GAAGCCCTCCGCTGTAGATTC	0.473																																																1	Substitution - Missense(1)	ovary(1)	9						A	THR/ALA	1,4405	826.1+/-416.6	0,1,2202	94.0	91.0	92.0		790	-1.6	0.0	9		92	0,8600		0,0,4300	no	missense	OR13F1	NM_001004485.1	58	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	264/320	107267333	1,13005	2203	4300	6503	106307154	SO:0001583	missense	138805				CCDS35087.1	9q31.1	2013-09-24			ENSG00000186881	ENSG00000186881		"""GPCR / Class A : Olfactory receptors"""	14723	protein-coding gene	gene with protein product							Standard	NM_001004485		Approved		uc011lvm.2	Q8NGS4	OTTHUMG00000020404	ENST00000334726.2:c.790G>A	9.37:g.107267333G>A	ENSP00000334452:p.Ala264Thr		106307154	Q6IF50	Missense_Mutation	SNP	ENST00000334726.2	37	CCDS35087.1	SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	A	5.435	0.265378	0.10294	2.27E-4	0.0	ENSG00000186881	ENST00000334726	T	0.00099	8.73	4.29	-1.58	0.08479	GPCR, rhodopsin-like superfamily (1);	0.584933	0.15308	N	0.269257	T	0.00073	0.0002	N	0.20685	0.6	0.09310	N	1	B	0.10296	0.003	B	0.15484	0.013	T	0.28650	-1.0037	10	0.66056	D	0.02	.	5.0094	0.14304	0.1827:0.0:0.3754:0.4418	.	264	Q8NGS4	O13F1_HUMAN	T	264	ENSP00000334452:A264T	ENSP00000334452:A264T	A	+	1	0	OR13F1	106307154	0.000000	0.05858	0.010000	0.14722	0.048000	0.14542	-0.342000	0.07801	-0.573000	0.05998	-1.632000	0.00781	GCT		0.473	OR13F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053475.1			Missense_Mutation
COL27A1	85301	broad.mit.edu	37	9	116973264	116973264	+	Silent	SNP	C	C	T			TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr9:116973264C>T	ENST00000356083.3	+	12	2716	c.2325C>T	c.(2323-2325)ggC>ggT	p.G775G	MIR455_ENST00000384993.1_RNA	NM_032888.2	NP_116277.2	Q8IZC6	CORA1_HUMAN	collagen, type XXVII, alpha 1	775	Collagen-like 3.|Pro-rich.|Triple-helical region.				extracellular matrix organization (GO:0030198)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|fibrillar collagen trimer (GO:0005583)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)	p.G775G(1)		central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(17)|lung(30)|ovary(4)|prostate(6)|skin(3)|soft_tissue(1)|stomach(1)|urinary_tract(3)	80						CCCTGCAGGGCCTGCCTGGCG	0.632																																																1	Substitution - coding silent(1)	ovary(1)	9											96.0	84.0	88.0					9																	116973264		2203	4300	6503	116013085	SO:0001819	synonymous_variant	85301			AB058773	CCDS6802.1	9q33.1	2013-01-16			ENSG00000196739	ENSG00000196739		"""Collagens"""	22986	protein-coding gene	gene with protein product		608461				12766169	Standard	NM_032888		Approved	KIAA1870, MGC11337, FLJ11895	uc011lxl.2	Q8IZC6	OTTHUMG00000020537	ENST00000356083.3:c.2325C>T	9.37:g.116973264C>T			116013085	Q66K43|Q96JF7	Silent	SNP	ENST00000356083.3	37	CCDS6802.1	SNP	26	Broad																																																																																				0.632	COL27A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053763.1	NM_032888		Silent
DEC1	50514	broad.mit.edu	37	9	118163578	118163578	+	Missense_Mutation	SNP	C	C	A	rs369269380		TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr9:118163578C>A	ENST00000374016.1	+	7	713	c.194C>A	c.(193-195)gCa>gAa	p.A65E		NM_017418.2	NP_059114.1	Q9P2X7	DEC1_HUMAN	deleted in esophageal cancer 1	65					negative regulation of cell proliferation (GO:0008285)			p.A65E(1)		kidney(1)|large_intestine(1)|ovary(1)	3						CCCAAGGCTGCAGAGGGAATT	0.423																																																1	Substitution - Missense(1)	ovary(1)	9						C	GLU/ALA	0,4406		0,0,2203	114.0	111.0	112.0		194	-1.0	0.0	9		112	1,8599	1.2+/-3.3	0,1,4299	no	missense	DEC1	NM_017418.2	107	0,1,6502	AA,AC,CC		0.0116,0.0,0.0077	benign	65/71	118163578	1,13005	2203	4300	6503	117203399	SO:0001583	missense	50514			AB022761	CCDS6812.1	9q32	2008-02-05			ENSG00000173077	ENSG00000173077			23658	protein-coding gene	gene with protein product		604767				8603412, 10612805	Standard	NM_017418		Approved	CTS9	uc004bjk.1	Q9P2X7	OTTHUMG00000020549	ENST00000374016.1:c.194C>A	9.37:g.118163578C>A	ENSP00000363128:p.Ala65Glu		117203399		Missense_Mutation	SNP	ENST00000374016.1	37	CCDS6812.1	SNP	25	Broad	.	.	.	.	.	.	.	.	.	.	C	10.87	1.473439	0.26423	0.0	1.16E-4	ENSG00000173077	ENST00000374016	T	0.57752	0.38	3.97	-0.984	0.10259	.	.	.	.	.	T	0.38665	0.1049	.	.	.	0.09310	N	1	B	0.28713	0.22	B	0.31686	0.134	T	0.38735	-0.9647	8	0.87932	D	0	.	4.5237	0.11971	0.5808:0.2752:0.0:0.144	.	65	Q9P2X7	DEC1_HUMAN	E	65	ENSP00000363128:A65E	ENSP00000363128:A65E	A	+	2	0	DEC1	117203399	0.000000	0.05858	0.000000	0.03702	0.025000	0.11179	-0.410000	0.07151	-0.177000	0.10690	0.655000	0.94253	GCA		0.423	DEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053791.1	NM_017418		Missense_Mutation
OR1L8	138881	broad.mit.edu	37	9	125330329	125330329	+	Missense_Mutation	SNP	A	A	G	rs562905023		TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr9:125330329A>G	ENST00000304865.2	-	1	509	c.428T>C	c.(427-429)gTc>gCc	p.V143A		NM_001004454.1	NP_001004454.1	Q8NGR8	OR1L8_HUMAN	olfactory receptor, family 1, subfamily L, member 8	143						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V143A(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20						CACCAGCAGGACACAGTGGTG	0.542													A|||	1	0.000199681	0.0	0.0014	5008	,	,		21750	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	9											117.0	86.0	97.0					9																	125330329		2203	4300	6503	124370150	SO:0001583	missense	138881				CCDS35124.1	9q33.2	2013-09-20			ENSG00000171496	ENSG00000171496		"""GPCR / Class A : Olfactory receptors"""	15110	protein-coding gene	gene with protein product							Standard	NM_001004454		Approved		uc004bmp.1	Q8NGR8	OTTHUMG00000020609	ENST00000304865.2:c.428T>C	9.37:g.125330329A>G	ENSP00000306607:p.Val143Ala		124370150	A3KFM3|B9EIR6|Q6IF15|Q96R79	Missense_Mutation	SNP	ENST00000304865.2	37	CCDS35124.1	SNP	10	Broad	.	.	.	.	.	.	.	.	.	.	A	4.293	0.053631	0.08291	.	.	ENSG00000171496	ENST00000304865	T	0.02067	4.47	4.49	0.461	0.16689	GPCR, rhodopsin-like superfamily (1);	0.599763	0.13503	N	0.383083	T	0.01661	0.0053	L	0.27053	0.805	0.09310	N	1	B	0.13145	0.007	B	0.21151	0.033	T	0.49041	-0.8980	10	0.07482	T	0.82	-14.1981	8.1852	0.31335	0.7267:0.0:0.2733:0.0	.	143	Q8NGR8	OR1L8_HUMAN	A	143	ENSP00000306607:V143A	ENSP00000306607:V143A	V	-	2	0	OR1L8	124370150	0.000000	0.05858	0.005000	0.12908	0.594000	0.36715	-0.528000	0.06193	0.004000	0.14682	0.369000	0.22263	GTC		0.542	OR1L8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053939.1			Missense_Mutation
ZNF79	7633	broad.mit.edu	37	9	130207146	130207146	+	Silent	SNP	C	C	T	rs577713787		TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr9:130207146C>T	ENST00000342483.5	+	5	1573	c.1167C>T	c.(1165-1167)taC>taT	p.Y389Y	RPL12_ENST00000497322.1_5'Flank|ZNF79_ENST00000543471.1_Silent_p.Y365Y	NM_007135.2	NP_009066.2	Q15937	ZNF79_HUMAN	zinc finger protein 79	389					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Y389Y(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(1)|lung(13)|ovary(2)|prostate(1)|stomach(2)	28						AGAAACCCTACAAGTGCAGCG	0.532													C|||	1	0.000199681	0.0008	0.0	5008	,	,		20010	0.0		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	9											73.0	70.0	71.0					9																	130207146		2203	4300	6503	129246967	SO:0001819	synonymous_variant	7633			X65232	CCDS6871.1, CCDS69664.1, CCDS75904.1	9q34	2013-01-08	2006-05-12		ENSG00000196152	ENSG00000196152		"""Zinc fingers, C2H2-type"""	13153	protein-coding gene	gene with protein product		194552	"""zinc finger protein 79 (pT7)"""			8478004	Standard	NM_007135		Approved	pT7	uc004bqw.4	Q15937	OTTHUMG00000020703	ENST00000342483.5:c.1167C>T	9.37:g.130207146C>T			129246967	Q5VVW1|Q96NV1	Silent	SNP	ENST00000342483.5	37	CCDS6871.1	SNP	17	Broad																																																																																				0.532	ZNF79-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054188.1	NM_007135		Silent
C9orf78	51759	broad.mit.edu	37	9	132597484	132597484	+	Missense_Mutation	SNP	T	T	G			TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr9:132597484T>G	ENST00000372447.3	-	1	70	c.17A>C	c.(16-18)aAg>aCg	p.K6T	USP20_ENST00000358355.1_5'Flank|USP20_ENST00000315480.4_5'Flank|USP20_ENST00000372429.3_5'Flank|C9orf78_ENST00000461762.1_5'Flank	NM_016520.2	NP_057604.1	Q9NZ63	CI078_HUMAN	chromosome 9 open reading frame 78	6						cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.K6T(1)		kidney(2)|lung(7)|ovary(1)|prostate(1)|stomach(2)	13		Ovarian(14;0.00556)				ACGGAAAATCTTCCGGACGAC	0.677																																																1	Substitution - Missense(1)	ovary(1)	9											44.0	47.0	46.0					9																	132597484		2203	4300	6503	131637305	SO:0001583	missense	51759			BC017570	CCDS6931.1	9q34.2	2012-03-16			ENSG00000136819	ENSG00000136819			24932	protein-coding gene	gene with protein product	"""Hepatocellular carcinoma-associated antigen 59"""					11042152, 12097419	Standard	NM_016520		Approved	HSPC220, HCA59	uc004byp.3	Q9NZ63	OTTHUMG00000020796	ENST00000372447.3:c.17A>C	9.37:g.132597484T>G	ENSP00000361524:p.Lys6Thr		131637305	B3KPX8|Q8WVU6|Q9NT39	Missense_Mutation	SNP	ENST00000372447.3	37	CCDS6931.1	SNP	56	Broad	.	.	.	.	.	.	.	.	.	.	T	13.48	2.251175	0.39797	.	.	ENSG00000136819	ENST00000372447	T	0.56275	0.47	4.83	4.83	0.62350	.	0.089786	0.85682	D	0.000000	T	0.53465	0.1798	M	0.79926	2.475	0.80722	D	1	B	0.21688	0.059	B	0.25884	0.064	T	0.58983	-0.7539	10	0.72032	D	0.01	.	7.5577	0.27833	0.0:0.0986:0.0:0.9014	.	6	Q9NZ63	CI078_HUMAN	T	6	ENSP00000361524:K6T	ENSP00000361524:K6T	K	-	2	0	C9orf78	131637305	0.739000	0.28196	1.000000	0.80357	0.198000	0.23893	1.685000	0.37659	1.920000	0.55613	0.472000	0.43445	AAG		0.677	C9orf78-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054625.1	NM_016520		Missense_Mutation
CAMSAP1	157922	broad.mit.edu	37	9	138714002	138714002	+	Missense_Mutation	SNP	G	G	C			TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr9:138714002G>C	ENST00000389532.4	-	11	2569	c.2505C>G	c.(2503-2505)agC>agG	p.S835R	CAMSAP1_ENST00000483991.1_5'UTR|CAMSAP1_ENST00000409386.3_Missense_Mutation_p.S846R|CAMSAP1_ENST00000312405.6_Missense_Mutation_p.S557R	NM_015447.3	NP_056262.3	Q5T5Y3	CAMP1_HUMAN	calmodulin regulated spectrin-associated protein 1	835					cytoskeleton organization (GO:0007010)|neuron projection development (GO:0031175)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)|microtubule (GO:0005874)	calmodulin binding (GO:0005516)|microtubule binding (GO:0008017)|spectrin binding (GO:0030507)	p.S835R(1)		breast(3)|central_nervous_system(2)|endometrium(6)|kidney(4)|large_intestine(11)|lung(16)|ovary(3)|pancreas(1)|skin(1)	47				OV - Ovarian serous cystadenocarcinoma(145;1.4e-06)|Epithelial(140;1.11e-05)		TCTGGGAGCTGCTGGTGCTGG	0.607																																																1	Substitution - Missense(1)	ovary(1)	9											38.0	38.0	38.0					9																	138714002		2203	4300	6503	137853823	SO:0001583	missense	157922			AJ519841	CCDS35176.2	9q34.3	2008-02-05			ENSG00000130559	ENSG00000130559			19946	protein-coding gene	gene with protein product		613774				12477932	Standard	NM_015447		Approved	FLJ31228, DKFZp434F195	uc004cgr.4	Q5T5Y3	OTTHUMG00000020918	ENST00000389532.4:c.2505C>G	9.37:g.138714002G>C	ENSP00000374183:p.Ser835Arg		137853823	A1L4L2|B2REB2|B2REB3|Q70W33|Q8NCY0|Q96E80|Q96FM3|Q9UFJ5	Missense_Mutation	SNP	ENST00000389532.4	37	CCDS35176.2	SNP	46	Broad	.	.	.	.	.	.	.	.	.	.	G	22.6	4.307857	0.81247	.	.	ENSG00000130559	ENST00000389532;ENST00000312405;ENST00000409386	T;T;T	0.70869	-0.52;-0.52;-0.52	5.01	4.1	0.47936	.	0.125215	0.64402	D	0.000001	T	0.75895	0.3912	M	0.83012	2.62	0.49582	D	0.999806	D;B	0.67145	0.996;0.415	P;B	0.50754	0.649;0.267	T	0.79369	-0.1832	10	0.87932	D	0	-3.5019	8.07	0.30682	0.1866:0.0:0.8134:0.0	.	835;846	Q5T5Y3;Q5T5Y3-3	CAMP1_HUMAN;.	R	835;557;846	ENSP00000374183:S835R;ENSP00000312463:S557R;ENSP00000386420:S846R	ENSP00000312463:S557R	S	-	3	2	CAMSAP1	137853823	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	4.410000	0.59774	2.497000	0.84241	0.655000	0.94253	AGC		0.607	CAMSAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055024.2	XM_351857		Missense_Mutation
NOTCH1	4851	broad.mit.edu	37	9	139391081	139391081	+	Missense_Mutation	SNP	G	G	T			TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr9:139391081G>T	ENST00000277541.6	-	34	7185	c.7110C>A	c.(7108-7110)agC>agA	p.S2370R		NM_017617.3	NP_060087.3	P46531	NOTC1_HUMAN	notch 1	2370					anagen (GO:0042640)|aortic valve morphogenesis (GO:0003180)|apoptotic process involved in embryonic digit morphogenesis (GO:1902263)|arterial endothelial cell differentiation (GO:0060842)|atrioventricular node development (GO:0003162)|atrioventricular valve morphogenesis (GO:0003181)|auditory receptor cell fate commitment (GO:0009912)|axonogenesis (GO:0007409)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac atrium morphogenesis (GO:0003209)|cardiac chamber formation (GO:0003207)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac left ventricle morphogenesis (GO:0003214)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac right atrium morphogenesis (GO:0003213)|cardiac right ventricle formation (GO:0003219)|cardiac septum morphogenesis (GO:0060411)|cardiac vascular smooth muscle cell development (GO:0060948)|cardiac ventricle morphogenesis (GO:0003208)|cell fate specification (GO:0001708)|cell migration involved in endocardial cushion formation (GO:0003273)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|cilium morphogenesis (GO:0060271)|collecting duct development (GO:0072044)|compartment pattern specification (GO:0007386)|coronary artery morphogenesis (GO:0060982)|coronary vein morphogenesis (GO:0003169)|determination of left/right symmetry (GO:0007368)|distal tubule development (GO:0072017)|embryonic hindlimb morphogenesis (GO:0035116)|endocardial cell differentiation (GO:0060956)|endocardial cushion morphogenesis (GO:0003203)|endocardium development (GO:0003157)|endocardium morphogenesis (GO:0003160)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|forebrain development (GO:0030900)|foregut morphogenesis (GO:0007440)|gene expression (GO:0010467)|glial cell differentiation (GO:0010001)|glomerular mesangial cell development (GO:0072144)|growth involved in heart morphogenesis (GO:0003241)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart looping (GO:0001947)|heart trabecula morphogenesis (GO:0061384)|humoral immune response (GO:0006959)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|keratinocyte differentiation (GO:0030216)|left/right axis specification (GO:0070986)|liver development (GO:0001889)|lung development (GO:0030324)|mesenchymal cell development (GO:0014031)|mitral valve formation (GO:0003192)|negative regulation of anoikis (GO:2000811)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of endothelial cell chemotaxis (GO:2001027)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of neurogenesis (GO:0050768)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of pro-B cell differentiation (GO:2000974)|negative regulation of stem cell differentiation (GO:2000737)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|Notch signaling pathway involved in regulation of secondary heart field cardioblast proliferation (GO:0003270)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland epithelium morphogenesis (GO:0060740)|pulmonary valve morphogenesis (GO:0003184)|regulation of epithelial cell proliferation involved in prostate gland development (GO:0060768)|regulation of extracellular matrix assembly (GO:1901201)|regulation of somitogenesis (GO:0014807)|regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003256)|regulation of transcription, DNA-templated (GO:0006355)|response to muramyl dipeptide (GO:0032495)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell division (GO:0048103)|sprouting angiogenesis (GO:0002040)|transcription initiation from RNA polymerase II promoter (GO:0006367)|tube formation (GO:0035148)|vasculogenesis involved in coronary vascular morphogenesis (GO:0060979)|venous endothelial cell differentiation (GO:0060843)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|MAML1-RBP-Jkappa- ICN1 complex (GO:0002193)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|receptor activity (GO:0004872)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(16)|central_nervous_system(17)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1183)|kidney(4)|large_intestine(1)|lung(57)|oesophagus(2)|ovary(3)|pancreas(1)|prostate(3)|skin(21)|upper_aerodigestive_tract(39)|urinary_tract(3)	1359	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		CCAGCCGGGTGCTGGGCAGGC	0.642			"""T, Mis, O"""	TRB@	T-ALL					HNSCC(8;0.001)																													Dom	yes		9	9q34.3	4851	"""Notch homolog 1, translocation-associated (Drosophila) (TAN1)"""		L	0			9											51.0	58.0	56.0					9																	139391081		2035	4181	6216	138510902	SO:0001583	missense	4851			AF308602	CCDS43905.1	9q34.3	2013-01-10	2010-06-24		ENSG00000148400	ENSG00000148400		"""Ankyrin repeat domain containing"""	7881	protein-coding gene	gene with protein product		190198	"""Notch (Drosophila) homolog 1 (translocation-associated)"", ""Notch homolog 1, translocation-associated (Drosophila)"""	TAN1		1831692	Standard	NM_017617		Approved		uc004chz.3	P46531	OTTHUMG00000020935	ENST00000277541.6:c.7110C>A	9.37:g.139391081G>T	ENSP00000277541:p.Ser2370Arg		138510902	Q59ED8|Q5SXM3	Missense_Mutation	SNP	ENST00000277541.6	37	CCDS43905.1	SNP	46	Broad	.	.	.	.	.	.	.	.	.	.	G	12.84	2.058174	0.36277	.	.	ENSG00000148400	ENST00000277541	D	0.81499	-1.5	5.31	3.45	0.39498	.	0.436901	0.26210	N	0.025683	T	0.61476	0.2350	N	0.14661	0.345	0.36779	D	0.884211	P	0.36354	0.549	B	0.32533	0.147	T	0.63726	-0.6572	10	0.21014	T	0.42	.	10.6649	0.45723	0.1561:0.0:0.8439:0.0	.	2370	P46531	NOTC1_HUMAN	R	2370	ENSP00000277541:S2370R	ENSP00000277541:S2370R	S	-	3	2	NOTCH1	138510902	1.000000	0.71417	0.032000	0.17829	0.867000	0.49689	4.677000	0.61634	1.379000	0.46325	0.563000	0.77884	AGC		0.642	NOTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055087.1	NM_017617		Missense_Mutation
DPP7	29952	broad.mit.edu	37	9	140007856	140007856	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chr9:140007856G>A	ENST00000371579.2	-	5	582	c.578C>T	c.(577-579)gCa>gTa	p.A193V		NM_013379.2	NP_037511.2	Q9UHL4	DPP2_HUMAN	dipeptidyl-peptidase 7	193						cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	dipeptidyl-peptidase activity (GO:0008239)|serine-type peptidase activity (GO:0008236)	p.A193V(1)		endometrium(2)|large_intestine(2)|lung(1)|ovary(1)|skin(1)	7	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0878)	OV - Ovarian serous cystadenocarcinoma(145;4.25e-05)|Epithelial(140;0.000633)		GCCGAGGCCTGCCACAGCTAG	0.662																																																1	Substitution - Missense(1)	ovary(1)	9											31.0	37.0	35.0					9																	140007856		2203	4299	6502	139127677	SO:0001583	missense	29952			AF154502	CCDS7030.1	9q34.3	2008-02-05	2006-01-12		ENSG00000176978	ENSG00000176978			14892	protein-coding gene	gene with protein product		610537	"""dipeptidylpeptidase 7"""			10477574, 11139392	Standard	XM_005266075		Approved	DPPII	uc004clh.3	Q9UHL4	OTTHUMG00000020977	ENST00000371579.2:c.578C>T	9.37:g.140007856G>A	ENSP00000360635:p.Ala193Val		139127677	A8K7U7|Q5VSF1|Q969X4	Missense_Mutation	SNP	ENST00000371579.2	37	CCDS7030.1	SNP	46	Broad	.	.	.	.	.	.	.	.	.	.	G	17.85	3.489774	0.64074	.	.	ENSG00000176978	ENST00000371579	D	0.92699	-3.09	5.11	4.15	0.48705	.	0.000000	0.85682	D	0.000000	D	0.87974	0.6313	L	0.58302	1.8	0.39897	D	0.973847	B	0.33494	0.414	B	0.30029	0.11	D	0.85230	0.1032	10	0.17832	T	0.49	-15.1611	12.1076	0.53821	0.0:0.1735:0.8265:0.0	.	193	Q9UHL4	DPP2_HUMAN	V	193	ENSP00000360635:A193V	ENSP00000360635:A193V	A	-	2	0	DPP7	139127677	1.000000	0.71417	0.898000	0.35279	0.028000	0.11728	4.441000	0.59981	2.399000	0.81585	0.561000	0.74099	GCA		0.662	DPP7-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055279.1	NM_013379		Missense_Mutation
FAM47A	158724	broad.mit.edu	37	X	34149721	34149721	+	Silent	SNP	C	C	T			TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-2113-01	TCGA-61-2113-11	g.chrX:34149721C>T	ENST00000346193.3	-	1	726	c.675G>A	c.(673-675)ccG>ccA	p.P225P		NM_203408.3	NP_981953.2	Q5JRC9	FA47A_HUMAN	family with sequence similarity 47, member A	225	Pro-rich.							p.P225P(2)		NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(5)|large_intestine(17)|lung(44)|ovary(5)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	97						CAGGAGGCTCCGGGCGGAGAC	0.657																																																2	Substitution - coding silent(2)	ovary(1)|lung(1)	X																																								34059642	SO:0001819	synonymous_variant	158724			BC026171	CCDS43926.1	Xp21.1	2004-08-09			ENSG00000185448	ENSG00000185448			29962	protein-coding gene	gene with protein product	"""similar to hypothetical protein FLJ35782"""					12477932	Standard	NM_203408		Approved	MGC27003	uc004ddg.3	Q5JRC9	OTTHUMG00000021339	ENST00000346193.3:c.675G>A	X.37:g.34149721C>T			34059642	A8K8I9|Q8TAA0	Silent	SNP	ENST00000346193.3	37	CCDS43926.1	SNP	23	Broad																																																																																				0.657	FAM47A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056205.1	NM_203408		Silent
B3GNT7	93010	broad.mit.edu	37	2	232263379	232263380	+	In_Frame_Ins	INS	-	-	GCG			TCGA-61-2113-01	TCGA-61-2113-11							Unknown	Unknown	Unknown	Phase_I	Capture	---			Illumina GAIIx	TCGA-61-2113-01	TCGA-61-2113-11	g.chr2:232263379_232263380insGCG	ENST00000287590.5	+	2	1210_1211	c.949_950insGCG	c.(949-951)tgc>tGCGgc	p.317_318insG		NM_145236.2	NP_660279.1	Q8NFL0	B3GN7_HUMAN	UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 7	317					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	galactosyltransferase activity (GO:0008378)	p.C317_D318insG(1)		endometrium(2)|kidney(1)|large_intestine(7)|lung(4)|ovary(1)|prostate(1)|skin(1)	17		Renal(207;0.025)|all_hematologic(139;0.094)|Acute lymphoblastic leukemia(138;0.164)|Medulloblastoma(418;0.232)		Epithelial(121;3.22e-11)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.0139)		GCACCATGCCTGCGACACCCTG	0.683																																																1	Insertion - In frame(1)	ovary(1)	2																																								231971624	SO:0001652	inframe_insertion	93010			AK000770	CCDS46540.1	2q36.1	2013-02-21			ENSG00000156966	ENSG00000156966		"""Beta 3-glycosyltransferases"""	18811	protein-coding gene	gene with protein product		615313				12061784	Standard	NM_145236		Approved	beta3GnT7	uc002vrs.3	Q8NFL0	OTTHUMG00000153880	ENST00000287590.5:c.950_952dupGCG	2.37:g.232263380_232263382dupGCG	ENSP00000287590:p.Cys317_Asp318insGly		231971623	B3KWY4|B7WNP0	In_Frame_Ins	INS	ENST00000287590.5	37	CCDS46540.1	INS	55	Broad																																																																																				0.683	B3GNT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332827.1	NM_145236		In_Frame_Ins
