#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	SNP	G	G	A			TCGA-04-1648-01A-01W-0639-09	TCGA-04-1648-11A-01W-0639-09	G	G					Unknown	Invalid:failed_liftOver	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cde94745-b8b6-474d-a28d-7f5548bd9f13	cc11f6ea-0d2f-476b-be91-c42f228d764a	g.chrUnknown:0G>A								None (None upstream) : None (None downstream)																								0.0																																																0			MT																																								9277	SO:0001628	intergenic_variant	4514																															Unknown.37:g.0G>A			9277		Missense_Mutation	SNP	superfamily_CytC_oxdse_III,HMMPfam_COX3	p.A24T		37	c.70		MT																																																																																			-	superfamily_CytC_oxdse_III,HMMPfam_COX3	0	0					MT-CO3			G			9277	+1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000362079	ensembl	human	known	54_36p	missense	SNP	NULL	A
SMG6	23293	genome.wustl.edu	37	17	2203659	2203659	+	Missense_Mutation	SNP	G	G	T	rs138301573		TCGA-04-1648-01A-01W-0639-09	TCGA-04-1648-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cde94745-b8b6-474d-a28d-7f5548bd9f13	cc11f6ea-0d2f-476b-be91-c42f228d764a	g.chr17:2203659G>T	ENST00000263073.6	-	2	438	c.388C>A	c.(388-390)Cgt>Agt	p.R130S	SMG6_ENST00000544865.1_Missense_Mutation_p.R99S	NM_017575.4	NP_060045.4	Q86US8	EST1A_HUMAN	SMG6 nonsense mediated mRNA decay factor	130	Interaction with telomeric DNA.				gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of dephosphorylation (GO:0035303)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|telomere maintenance (GO:0000723)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleus (GO:0005634)|telomerase holoenzyme complex (GO:0005697)	endoribonuclease activity (GO:0004521)|metal ion binding (GO:0046872)|telomeric DNA binding (GO:0042162)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(7)|lung(10)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45						TTTAGACTACGATCCTCTTGT	0.458																																					Melanoma(59;28 1088 11621 25887 46638 50814)											0			17											141.0	152.0	149.0					17																	2203659		2203	4300	6503	2150409	SO:0001583	missense	23293			AB018275	CCDS11016.1, CCDS58498.1	17p13.3	2013-07-02	2013-07-02	2006-02-16	ENSG00000070366	ENSG00000070366			17809	protein-coding gene	gene with protein product	"""EST1 telomerase component homolog A (S. cerevisiae)"""	610963	"""chromosome 17 open reading frame 31"", ""smg-6 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	C17orf31		12676087, 12699629	Standard	NM_017575		Approved	KIAA0732, SMG-6, EST1A	uc002fub.1	Q86US8	OTTHUMG00000177578	ENST00000263073.6:c.388C>A	17.37:g.2203659G>T	ENSP00000263073:p.Arg130Ser		2150409	B7Z874|O94837|Q86VH6|Q9UF60	Missense_Mutation	SNP	HMMPfam_EST1,superfamily_PIN domain-like,HMMSmart_SM00670	p.R130S	ENST00000263073.6	37	c.388	CCDS11016.1	17	.	.	.	.	.	.	.	.	.	.	G	10.47	1.360325	0.24598	.	.	ENSG00000070366	ENST00000263073;ENST00000544865	T;T	0.07444	3.19;3.2	5.6	3.53	0.40419	.	0.545245	0.17711	N	0.164594	T	0.04907	0.0132	L	0.27053	0.805	0.25725	N	0.985338	B	0.28350	0.208	B	0.26517	0.07	T	0.42050	-0.9474	10	0.08381	T	0.77	-0.5847	6.5183	0.22260	0.1011:0.0:0.5898:0.3091	.	130	Q86US8	EST1A_HUMAN	S	130;99	ENSP00000263073:R130S;ENSP00000443920:R99S	ENSP00000263073:R130S	R	-	1	0	SMG6	2150409	0.005000	0.15991	0.998000	0.56505	0.981000	0.71138	1.055000	0.30467	0.651000	0.30788	0.655000	0.94253	CGT	-	NULL		0.458	SMG6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMG6	protein_coding	OTTHUMT00000437826.3	G			2150409	-1	no_errors	NM_017575	genbank	human	validated	54_36p	missense	SNP	0.883	T
MTCL1	23255	genome.wustl.edu	37	18	8793102	8793102	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1648-01A-01W-0639-09	TCGA-04-1648-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cde94745-b8b6-474d-a28d-7f5548bd9f13	cc11f6ea-0d2f-476b-be91-c42f228d764a	g.chr18:8793102C>A	ENST00000359865.3	+	8	2136	c.1994C>A	c.(1993-1995)aCa>aAa	p.T665K	SOGA2_ENST00000518815.1_Intron|SOGA2_ENST00000517570.1_Intron|SOGA2_ENST00000306285.7_5'UTR|SOGA2_ENST00000400050.3_Intron|SOGA2_ENST00000306329.11_Intron	NM_015210.3	NP_056025.2																					GAGACATTTACAAACAAGATC	0.488																																																0			18											87.0	96.0	93.0					18																	8793102		2203	4300	6503	8783102	SO:0001583	missense	23255																														ENST00000359865.3:c.1994C>A	18.37:g.8793102C>A	ENSP00000352927:p.Thr665Lys		8783102		Missense_Mutation	SNP	NULL	p.T665K	ENST00000359865.3	37	c.1994	CCDS11841.1	18	.	.	.	.	.	.	.	.	.	.	C	12.88	2.069549	0.36470	.	.	ENSG00000168502	ENST00000306329;ENST00000359865	T	0.40225	1.04	5.52	3.52	0.40303	.	0.822627	0.10514	N	0.665737	T	0.20455	0.0492	N	0.04508	-0.205	0.80722	D	1	B	0.12013	0.005	B	0.12837	0.008	T	0.04537	-1.0944	10	0.07030	T	0.85	.	12.2188	0.54423	0.1277:0.8022:0.0:0.07	.	665	Q9Y4B5-3	.	K	686;665	ENSP00000352927:T665K	ENSP00000305027:T686K	T	+	2	0	CCDC165	8783102	1.000000	0.71417	0.647000	0.29507	0.996000	0.88848	2.631000	0.46502	1.324000	0.45282	0.561000	0.74099	ACA	-	NULL		0.488	SOGA2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KIAA0802	protein_coding	OTTHUMT00000254476.1	C			8783102	+1	no_errors	NM_015210	genbank	human	predicted	54_36p	missense	SNP	0.972	A
PRAMEF10	343071	genome.wustl.edu	37	1	12954898	12954898	+	Missense_Mutation	SNP	T	T	C			TCGA-04-1648-01A-01W-0639-09	TCGA-04-1648-11A-01W-0639-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cde94745-b8b6-474d-a28d-7f5548bd9f13	cc11f6ea-0d2f-476b-be91-c42f228d764a	g.chr1:12954898T>C	ENST00000235347.4	-	3	464	c.385A>G	c.(385-387)Atg>Gtg	p.M129V		NM_001039361.3	NP_001034450.2	O60809	PRA10_HUMAN	PRAME family member 10	129					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					NS(2)|breast(1)|large_intestine(2)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	12	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		CTCTTACTCATGGCCTCTGGG	0.527																																																0			1											50.0	53.0	52.0					1																	12954898		1897	3829	5726	12877485	SO:0001583	missense	343071			AL049682	CCDS41255.1	1p36.21	2013-01-17			ENSG00000187545	ENSG00000187545		"""-"""	27997	protein-coding gene	gene with protein product							Standard	NM_001039361		Approved		uc001auo.3	O60809	OTTHUMG00000001981	ENST00000235347.4:c.385A>G	1.37:g.12954898T>C	ENSP00000235347:p.Met129Val		12877485	Q2M1V2	Missense_Mutation	SNP	superfamily_SSF52047	p.M129V	ENST00000235347.4	37	c.385	CCDS41255.1	1	.	.	.	.	.	.	.	.	.	.	.	1.885	-0.457016	0.04540	.	.	ENSG00000187545	ENST00000235347	T	0.16196	2.36	1.37	-1.54	0.08584	.	1.612070	0.04072	N	0.308230	T	0.15046	0.0363	L	0.39085	1.19	0.09310	N	1	B	0.31274	0.317	B	0.36567	0.228	T	0.30534	-0.9975	10	0.33141	T	0.24	.	4.7691	0.13146	0.0:0.6229:0.0:0.3771	.	129	O60809	PRA10_HUMAN	V	129	ENSP00000235347:M129V	ENSP00000235347:M129V	M	-	1	0	PRAMEF10	12877485	0.000000	0.05858	0.000000	0.03702	0.064000	0.16182	0.010000	0.13242	-0.413000	0.07507	0.163000	0.16589	ATG	-	superfamily_SSF52047		0.527	PRAMEF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRAMEF10	protein_coding	OTTHUMT00000005512.2	T	XM_496342		12877485	-1	no_errors	NM_001039361	genbank	human	validated	54_36p	missense	SNP	0.001	C
Unknown	0	genome.wustl.edu	37	13	19412701	19412701	+	IGR	SNP	C	C	T			TCGA-04-1648-01A-01W-0639-09	TCGA-04-1648-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cde94745-b8b6-474d-a28d-7f5548bd9f13	cc11f6ea-0d2f-476b-be91-c42f228d764a	g.chr13:19412701C>T								LINC00418 (118832 upstream) : RP11-38M15.11 (21265 downstream)																							GCTTTGAGATCATTAAGCTCT	0.338																																																0			13																																								18310701	SO:0001628	intergenic_variant	284232																															13.37:g.19412701C>T			18310701		RNA	SNP	-	NULL		37	NULL		13																																																																																			-	-	0	0.338					LOC284232			C			18310701	-1	pseudogene	XR_037095	genbank	human	model	54_36p	rna	SNP	0.960	T
DEK	7913	genome.wustl.edu	37	6	18264202	18264202	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1648-01A-01W-0639-09	TCGA-04-1648-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cde94745-b8b6-474d-a28d-7f5548bd9f13	cc11f6ea-0d2f-476b-be91-c42f228d764a	g.chr6:18264202G>C	ENST00000397239.3	-	2	464	c.17C>G	c.(16-18)cCt>cGt	p.P6R	DEK_ENST00000244776.7_Missense_Mutation_p.P6R	NM_003472.3	NP_003463.1	P35659	DEK_HUMAN	DEK proto-oncogene	6					chromatin modification (GO:0016568)|regulation of double-strand break repair (GO:2000779)|regulation of double-strand break repair via nonhomologous end joining (GO:2001032)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)|viral genome replication (GO:0019079)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|prostate(1)|upper_aerodigestive_tract(1)	7	Ovarian(93;0.00769)|Breast(50;0.0495)	all_hematologic(90;0.053)	OV - Ovarian serous cystadenocarcinoma(7;0.00291)|all cancers(50;0.031)|Epithelial(50;0.0332)			CTCCGCAGCAGGGGCCGAGGC	0.672			T	NUP214	AML																																		Dom	yes		6	6p23	7913	DEK oncogene (DNA binding)		L	0			6																																								18372181	SO:0001583	missense	7913			X64229	CCDS34344.1, CCDS47382.1	6p23	2014-06-25	2014-06-25		ENSG00000124795	ENSG00000124795			2768	protein-coding gene	gene with protein product		125264	"""DEK oncogene (DNA binding)"", ""DEK oncogene"""			1549122	Standard	NM_003472		Approved	D6S231E	uc003ncr.1	P35659	OTTHUMG00000014319	ENST00000397239.3:c.17C>G	6.37:g.18264202G>C	ENSP00000380414:p.Pro6Arg		18372181	B2R6K6|B4DN37|Q5TGV4|Q5TGV5	Missense_Mutation	SNP	HMMPfam_SAP,HMMSmart_SM00513,superfamily_DEK C-terminal domain,HMMPfam_DEK_C	p.P6R	ENST00000397239.3	37	c.17	CCDS34344.1	6	.	.	.	.	.	.	.	.	.	.	G	15.39	2.818537	0.50633	.	.	ENSG00000124795	ENST00000397239;ENST00000244776;ENST00000515742	T;T;T	0.67865	0.8;-0.29;0.73	4.52	3.63	0.41609	.	0.602255	0.13847	N	0.358585	T	0.33440	0.0863	N	0.22421	0.69	0.09310	N	1	B;B	0.15141	0.012;0.012	B;B	0.15870	0.014;0.014	T	0.38436	-0.9661	10	0.72032	D	0.01	-14.2768	10.7672	0.46301	0.0:0.0:0.8093:0.1907	.	6;6	B4DN37;P35659	.;DEK_HUMAN	R	6;6;11	ENSP00000380414:P6R;ENSP00000244776:P6R;ENSP00000423553:P11R	ENSP00000244776:P6R	P	-	2	0	DEK	18372181	0.996000	0.38824	0.029000	0.17559	0.598000	0.36846	4.326000	0.59241	0.837000	0.34925	0.491000	0.48974	CCT	-	NULL		0.672	DEK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DEK	protein_coding	OTTHUMT00000039962.4	G			18372181	-1	no_errors	NM_003472	genbank	human	reviewed	54_36p	missense	SNP	0.001	C
IFNW1	3467	genome.wustl.edu	37	9	21141414	21141414	+	Nonsense_Mutation	SNP	A	A	T			TCGA-04-1648-01A-01W-0639-09	TCGA-04-1648-11A-01W-0639-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cde94745-b8b6-474d-a28d-7f5548bd9f13	cc11f6ea-0d2f-476b-be91-c42f228d764a	g.chr9:21141414A>T	ENST00000380229.2	-	1	730	c.156T>A	c.(154-156)tgT>tgA	p.C52*		NM_002177.1	NP_002168.1	P05000	IFNW1_HUMAN	interferon, omega 1	52					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|cell cycle arrest (GO:0007050)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|natural killer cell activation involved in immune response (GO:0002323)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|regulation of MHC class I biosynthetic process (GO:0045343)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|T cell activation involved in immune response (GO:0002286)	extracellular space (GO:0005615)	cytokine activity (GO:0005125)|cytokine receptor binding (GO:0005126)|type I interferon receptor binding (GO:0005132)			endometrium(1)|kidney(1)|lung(2)|ovary(1)	5				GBM - Glioblastoma multiforme(5;2.35e-185)|Lung(24;2.24e-22)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)		TGTCCTTGAGACACAAGAAAG	0.522																																																0			9											123.0	125.0	124.0					9																	21141414		2203	4300	6503	21131414	SO:0001587	stop_gained	3467				CCDS6496.1	9p22	2010-12-10			ENSG00000177047	ENSG00000177047		"""Interferons"""	5448	protein-coding gene	gene with protein product	"""IFN-omega 1, interferon omega-1"""	147553				1385305	Standard	NM_002177		Approved		uc003zol.1	P05000	OTTHUMG00000019656	ENST00000380229.2:c.156T>A	9.37:g.21141414A>T	ENSP00000369578:p.Cys52*		21131414	Q13168|Q5U802|Q5VWD0|Q7M4P5	Nonsense_Mutation	SNP	HMMPfam_Interferon,superfamily_4_helix_cytokine,HMMSmart_IFabd,PatternScan_INTERFERON_A_B_D	p.C52*	ENST00000380229.2	37	c.156	CCDS6496.1	9	.	.	.	.	.	.	.	.	.	.	-	38	7.283771	0.98186	.	.	ENSG00000177047	ENST00000380229	.	.	.	4.54	-0.905	0.10527	.	0.121078	0.56097	D	0.000037	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.1667	0.37056	0.494:0.0:0.506:0.0	.	.	.	.	X	52	.	ENSP00000369578:C52X	C	-	3	2	IFNW1	21131414	0.000000	0.05858	0.039000	0.18376	0.266000	0.26442	-1.019000	0.03622	-0.335000	0.08451	0.383000	0.25322	TGT	-	HMMPfam_Interferon,superfamily_4_helix_cytokine		0.522	IFNW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFNW1	protein_coding	OTTHUMT00000051885.1	A	NM_002177		21131414	-1	no_errors	NM_002177	genbank	human	provisional	54_36p	nonsense	SNP	0.011	T
IGSF6	10261	genome.wustl.edu	37	16	21658719	21658719	+	Silent	SNP	G	G	A			TCGA-04-1648-01A-01W-0639-09	TCGA-04-1648-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cde94745-b8b6-474d-a28d-7f5548bd9f13	cc11f6ea-0d2f-476b-be91-c42f228d764a	g.chr16:21658719G>A	ENST00000268389.4	-	2	223	c.162C>T	c.(160-162)tcC>tcT	p.S54S	METTL9_ENST00000396014.4_Intron|METTL9_ENST00000358154.3_Intron	NM_005849.3	NP_005840.2	O95976	IGSF6_HUMAN	immunoglobulin superfamily, member 6	54	Ig-like C2-type.				cell surface receptor signaling pathway (GO:0007166)|immune response (GO:0006955)	integral component of plasma membrane (GO:0005887)	transmembrane signaling receptor activity (GO:0004888)			endometrium(1)|large_intestine(1)|lung(4)|urinary_tract(1)	7				GBM - Glioblastoma multiforme(48;0.066)		ATCCGGTTGCGGAGAAGGTAC	0.562																																																0			16											128.0	98.0	108.0					16																	21658719		2199	4300	6499	21566220	SO:0001819	synonymous_variant	10261			AJ223183	CCDS10599.1	16p12.2	2013-01-11			ENSG00000140749	ENSG00000140749		"""Immunoglobulin superfamily / V-set domain containing"""	5953	protein-coding gene	gene with protein product		606222				9809579	Standard	NM_005849		Approved	DORA	uc002djg.2	O95976	OTTHUMG00000090709	ENST00000268389.4:c.162C>T	16.37:g.21658719G>A			21566220	Q8WWD8	Silent	SNP	HMMPfam_V-set,superfamily_SSF48726,HMMSmart_IG	p.S54	ENST00000268389.4	37	c.162	CCDS10599.1	16																																																																																			-	HMMPfam_V-set,superfamily_SSF48726,HMMSmart_IG		0.562	IGSF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGSF6	protein_coding	OTTHUMT00000207400.1	G			21566220	-1	no_errors	NM_005849	genbank	human	validated	54_36p	silent	SNP	0.159	A
AHDC1	27245	genome.wustl.edu	37	1	27875240	27875240	+	Silent	SNP	A	A	G			TCGA-04-1648-01A-01W-0639-09	TCGA-04-1648-11A-01W-0639-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cde94745-b8b6-474d-a28d-7f5548bd9f13	cc11f6ea-0d2f-476b-be91-c42f228d764a	g.chr1:27875240A>G	ENST00000247087.5	-	5	3983	c.3387T>C	c.(3385-3387)aaT>aaC	p.N1129N	AHDC1_ENST00000374011.2_Silent_p.N1129N			Q5TGY3	AHDC1_HUMAN	AT hook, DNA binding motif, containing 1	1129							DNA binding (GO:0003677)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(8)|lung(20)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	42		all_lung(284;1.06e-05)|Lung NSC(340;1.86e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0434)|OV - Ovarian serous cystadenocarcinoma(117;8.48e-25)|Colorectal(126;9.17e-09)|COAD - Colon adenocarcinoma(152;1.84e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00192)|BRCA - Breast invasive adenocarcinoma(304;0.00259)|STAD - Stomach adenocarcinoma(196;0.00311)|READ - Rectum adenocarcinoma(331;0.0291)		CAAAACTGGGATTGTAGAGCT	0.592																																																0			1											77.0	77.0	77.0					1																	27875240		2203	4299	6502	27747827	SO:0001819	synonymous_variant	27245			AK125431	CCDS30652.1	1p36.13	2008-02-05			ENSG00000126705	ENSG00000126705			25230	protein-coding gene	gene with protein product		615790				8619474, 9110174	Standard	XM_005245848		Approved	DJ159A19.3, RP1-159A19.1	uc009vsy.3	Q5TGY3	OTTHUMG00000003398	ENST00000247087.5:c.3387T>C	1.37:g.27875240A>G			27747827	Q5TGY4|Q6PJK1|Q6ZUQ6|Q99769|Q9NUF5	Silent	SNP	HMMSmart_AT_hook,HMMPfam_AT_hook	p.N1129	ENST00000247087.5	37	c.3387	CCDS30652.1	1																																																																																			-	NULL		0.592	AHDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AHDC1	protein_coding	OTTHUMT00000009523.3	A			27747827	-1	no_errors	NM_001029882	genbank	human	validated	54_36p	silent	SNP	1.000	G
NOL4	8715	genome.wustl.edu	37	18	31803028	31803028	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1648-01A-01W-0639-09	TCGA-04-1648-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cde94745-b8b6-474d-a28d-7f5548bd9f13	cc11f6ea-0d2f-476b-be91-c42f228d764a	g.chr18:31803028G>T	ENST00000261592.5	-	1	487	c.190C>A	c.(190-192)Ctg>Atg	p.L64M	NOL4_ENST00000590846.1_5'Flank|NOL4_ENST00000589544.1_Missense_Mutation_p.L64M|NOL4_ENST00000535475.1_5'Flank|NOL4_ENST00000538587.1_5'Flank|NOL4_ENST00000269185.4_De_novo_Start_InFrame|RP11-379L18.1_ENST00000587528.1_RNA	NM_001198546.1|NM_003787.4	NP_001185475.1|NP_003778.2	O94818	NOL4_HUMAN	nucleolar protein 4	64						nucleolus (GO:0005730)	RNA binding (GO:0003723)			NS(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(7)|lung(20)|ovary(4)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	51						GGCTGGCCCAGCTGGAAGCCC	0.577																																																0			18											48.0	52.0	51.0					18																	31803028		1964	4160	6124	30057026	SO:0001583	missense	8715			AB017800	CCDS11907.2, CCDS56058.1, CCDS56059.1, CCDS59308.1	18q12	2010-05-04			ENSG00000101746	ENSG00000101746			7870	protein-coding gene	gene with protein product	"""cancer/testis antigen 125"""	603577				9813152	Standard	NM_003787		Approved	NOLP, HRIHFB2255, CT125	uc010dmi.3	O94818	OTTHUMG00000132291	ENST00000261592.5:c.190C>A	18.37:g.31803028G>T	ENSP00000261592:p.Leu64Met		30057026	B4DSQ0|B7Z3Z7|F5H1E3|Q6IBS2|Q9BWF1	Missense_Mutation	SNP	NULL	p.L64M	ENST00000261592.5	37	c.190	CCDS11907.2	18	.	.	.	.	.	.	.	.	.	.	G	12.37	1.919106	0.33908	.	.	ENSG00000101746	ENST00000261592	D	0.84146	-1.81	5.72	5.72	0.89469	.	.	.	.	.	T	0.80778	0.4688	L	0.42245	1.32	0.80722	D	1	B;P	0.35656	0.226;0.514	B;B	0.37989	0.262;0.262	T	0.79888	-0.1613	9	0.48119	T	0.1	-5.0983	10.8545	0.46792	0.086:0.0:0.914:0.0	.	64;64	O94818;O94818-2	NOL4_HUMAN;.	M	64	ENSP00000261592:L64M	ENSP00000261592:L64M	L	-	1	2	NOL4	30057026	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.227000	0.65305	2.701000	0.92244	0.561000	0.74099	CTG	-	NULL		0.577	NOL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOL4	protein_coding	OTTHUMT00000255386.1	G	NM_003787		30057026	-1	no_errors	NM_003787	genbank	human	validated	54_36p	missense	SNP	1.000	T
MAGEB3	4114	genome.wustl.edu	37	X	30254353	30254353	+	Silent	SNP	G	G	T			TCGA-04-1648-01A-01W-0639-09	TCGA-04-1648-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cde94745-b8b6-474d-a28d-7f5548bd9f13	cc11f6ea-0d2f-476b-be91-c42f228d764a	g.chrX:30254353G>T	ENST00000361644.2	+	5	1049	c.312G>T	c.(310-312)gtG>gtT	p.V104V		NM_002365.4	NP_002356.2	O15480	MAGB3_HUMAN	melanoma antigen family B, 3	104										NS(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(12)|prostate(2)|skin(2)	25						CCTCCACTGTGCAGTCTCGCA	0.413																																																0			X											50.0	43.0	46.0					X																	30254353		2202	4300	6502	30164274	SO:0001819	synonymous_variant	4114			AK057441	CCDS14220.1	Xp21.3	2009-03-17			ENSG00000198798	ENSG00000198798			6810	protein-coding gene	gene with protein product	"""cancer/testis antigen family 3, member 5"""	300152				9441743	Standard	NM_002365		Approved	CT3.5	uc004dca.2	O15480	OTTHUMG00000021320	ENST00000361644.2:c.312G>T	X.37:g.30254353G>T			30164274	A0AVE4|B3KQ52|O75861	Silent	SNP	HMMPfam_MAGE	p.V104	ENST00000361644.2	37	c.312	CCDS14220.1	X																																																																																			-	NULL		0.413	MAGEB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEB3	protein_coding	OTTHUMT00000056158.2	G	NM_002365		30164274	+1	no_errors	NM_002365	genbank	human	reviewed	54_36p	silent	SNP	0.000	T
MAGEB1	4112	genome.wustl.edu	37	X	30269047	30269047	+	Missense_Mutation	SNP	T	T	A			TCGA-04-1648-01A-01W-0639-09	TCGA-04-1648-11A-01W-0639-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cde94745-b8b6-474d-a28d-7f5548bd9f13	cc11f6ea-0d2f-476b-be91-c42f228d764a	g.chrX:30269047T>A	ENST00000378981.3	+	4	758	c.437T>A	c.(436-438)tTc>tAc	p.F146Y	MAGEB1_ENST00000397548.2_Missense_Mutation_p.F146Y|MAGEB1_ENST00000397550.1_Missense_Mutation_p.F146Y	NM_002363.4	NP_002354.2	P43366	MAGB1_HUMAN	melanoma antigen family B, 1	146	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									NS(2)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(8)|lung(12)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	32						AAGGATCACTTCACTGAGATC	0.468																																																0			X											64.0	49.0	54.0					X																	30269047		2202	4300	6502	30178968	SO:0001583	missense	4112				CCDS14222.1	Xp21.3	2009-03-17			ENSG00000214107	ENSG00000214107			6808	protein-coding gene	gene with protein product	"""DSS/AHC critical interval MAGE superfamily 10"", ""cancer/testis antigen family 3, member 1"""	300097				7761436, 9441743	Standard	NM_002363		Approved	MAGEL1, MAGE-Xp, DAM10, MGC9322, CT3.1	uc004dce.3	P43366	OTTHUMG00000021322	ENST00000378981.3:c.437T>A	X.37:g.30269047T>A	ENSP00000368264:p.Phe146Tyr		30178968	B2RC79|O00601|O75862|Q6FHJ0|Q96CW8	Missense_Mutation	SNP	HMMPfam_MAGE	p.F146Y	ENST00000378981.3	37	c.437	CCDS14222.1	X	.	.	.	.	.	.	.	.	.	.	T	16.46	3.130001	0.56721	.	.	ENSG00000214107	ENST00000378981;ENST00000397550;ENST00000397548	T;T;T	0.06528	3.29;3.29;3.29	3.98	3.98	0.46160	.	0.289920	0.34245	N	0.004131	T	0.17238	0.0414	M	0.67953	2.075	0.09310	N	1	D	0.63880	0.993	D	0.63381	0.914	T	0.02037	-1.1225	10	0.54805	T	0.06	.	8.3307	0.32184	0.0:0.0:0.0:1.0	.	146	P43366	MAGB1_HUMAN	Y	146	ENSP00000368264:F146Y;ENSP00000380683:F146Y;ENSP00000380681:F146Y	ENSP00000368264:F146Y	F	+	2	0	MAGEB1	30178968	0.011000	0.17503	0.133000	0.22050	0.009000	0.06853	0.615000	0.24329	1.784000	0.52394	0.481000	0.45027	TTC	-	HMMPfam_MAGE		0.468	MAGEB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEB1	protein_coding	OTTHUMT00000056160.1	T	NM_002363		30178968	+1	no_errors	NM_002363	genbank	human	reviewed	54_36p	missense	SNP	0.339	A
ARMC5	79798	genome.wustl.edu	37	16	31477442	31477442	+	Silent	SNP	T	T	C	rs116201073	byFrequency	TCGA-04-1648-01A-01W-0639-09	TCGA-04-1648-11A-01W-0639-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cde94745-b8b6-474d-a28d-7f5548bd9f13	cc11f6ea-0d2f-476b-be91-c42f228d764a	g.chr16:31477442T>C	ENST00000563544.1	+	7	2586	c.2040T>C	c.(2038-2040)ggT>ggC	p.G680G	ARMC5_ENST00000412665.2_Silent_p.G324G|ARMC5_ENST00000268314.4_Silent_p.G680G|ARMC5_ENST00000538189.1_Silent_p.G712G|ARMC5_ENST00000457010.2_3'UTR|ARMC5_ENST00000408912.3_Silent_p.G775G			Q96C12	ARMC5_HUMAN	armadillo repeat containing 5	680										central_nervous_system(1)|endometrium(4)|large_intestine(3)|liver(2)|lung(12)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	28						AGCAGGGTGGTCTCCGGCTCC	0.647													C|||	122	0.024361	0.0893	0.0058	5008	,	,		15259	0.0		0.0	False		,,,				2504	0.0															0			16						C	,	253,3943		8,237,1853	31.0	36.0	34.0		2040,	3.0	1.0	16	dbSNP_132	34	1,8425		0,1,4212	no	coding-synonymous,utr-3	ARMC5	NM_001105247.1,NM_024742.2	,	8,238,6065	CC,CT,TT		0.0119,6.0296,2.0124	,	680/936,	31477442	254,12368	2098	4213	6311	31384943	SO:0001819	synonymous_variant	79798			AY217348	CCDS42155.1, CCDS45472.1, CCDS73874.1	16p11	2013-02-14			ENSG00000140691	ENSG00000140691		"""Armadillo repeat containing"""	25781	protein-coding gene	gene with protein product		615549					Standard	NM_024742		Approved	FLJ13063	uc002ecc.3	Q96C12	OTTHUMG00000176618	ENST00000563544.1:c.2040T>C	16.37:g.31477442T>C			31384943	Q86WM9|Q9H7P8|Q9H925	Silent	SNP	HMMPfam_Arm,HMMSmart_SM00185,superfamily_ARM repeat	p.G680	ENST00000563544.1	37	c.2040	CCDS45472.1	16																																																																																			-	superfamily_ARM repeat		0.647	ARMC5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ARMC5	protein_coding	OTTHUMT00000432847.1	T	NM_024742		31384943	+1	no_errors	NM_001105247	genbank	human	validated	54_36p	silent	SNP	0.665	C
PANDAR	101154753	genome.wustl.edu	37	6	36642118	36642118	+	RNA	SNP	G	G	T			TCGA-04-1648-01A-01W-0639-09	TCGA-04-1648-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cde94745-b8b6-474d-a28d-7f5548bd9f13	cc11f6ea-0d2f-476b-be91-c42f228d764a	g.chr6:36642118G>T	ENST00000516055.1	+	0	107																											GCCAGCCAGCGAGATGATGCC	0.493																																																0			6																																								36750096			389386																															6.37:g.36642118G>T			36750096		RNA	SNP	-	NULL	ENST00000516055.1	37	NULL		6																																																																																			-	-		0.493	Y_RNA.734-201	NOVEL	basic	misc_RNA	LOC389386	misc_RNA		G			36750096	+1	pseudogene	XR_017251	genbank	human	model	54_36p	rna	SNP	1.000	T
PPP1R16B	26051	genome.wustl.edu	37	20	37501504	37501504	+	Intron	SNP	C	C	T	rs79649066	byFrequency	TCGA-04-1648-01A-01W-0639-09	TCGA-04-1648-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cde94745-b8b6-474d-a28d-7f5548bd9f13	cc11f6ea-0d2f-476b-be91-c42f228d764a	g.chr20:37501504C>T	ENST00000299824.1	+	3	439				PPP1R16B_ENST00000468265.1_Intron|PPP1R16B_ENST00000373331.2_Intron|RN7SL116P_ENST00000470786.2_RNA	NM_015568.2	NP_056383.1	Q96T49	PP16B_HUMAN	protein phosphatase 1, regulatory subunit 16B						regulation of filopodium assembly (GO:0051489)|signal transduction (GO:0007165)	nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein phosphatase binding (GO:0019903)			biliary_tract(1)|endometrium(4)|kidney(3)|large_intestine(10)|lung(23)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	49		Myeloproliferative disorder(115;0.00878)				ctgtagtgcgctatgctgatc	0.602													C|||	311	0.0621006	0.0045	0.1671	5008	,	,		19326	0.0546		0.0934	False		,,,				2504	0.0409															0			20																																								36934918	SO:0001627	intron_variant	0			AB020630	CCDS13309.1, CCDS54462.1	20q11.23	2013-01-10	2011-10-04		ENSG00000101445	ENSG00000101445		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	15850	protein-coding gene	gene with protein product	"""TGF-beta-inhibited membrane-associated protein"", ""ankyrin repeat domain protein 4"""	613275	"""protein phosphatase 1, regulatory (inhibitor) subunit 16B"""			10048485, 12055102	Standard	NM_001172735		Approved	KIAA0823, TIMAP, ANKRD4	uc002xje.3	Q96T49	OTTHUMG00000032465	ENST00000299824.1:c.251-16734C>T	20.37:g.37501504C>T			36934918	A2RRR6|E9PFS8|O94912|Q5W9G4|Q9NQG4	RNA	SNP	-	NULL	ENST00000299824.1	37	NULL	CCDS13309.1	20																																																																																			-	-		0.602	PPP1R16B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000222227	protein_coding	OTTHUMT00000079220.2	C	NM_015568		36934918	+1	no_errors	ENST00000410295	ensembl	human	novel	54_36p	rna	SNP	1.000	T
MKL1	57591	genome.wustl.edu	37	22	40825656	40825656	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1648-01A-01W-0639-09	TCGA-04-1648-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cde94745-b8b6-474d-a28d-7f5548bd9f13	cc11f6ea-0d2f-476b-be91-c42f228d764a	g.chr22:40825656C>A	ENST00000355630.3	-	7	845	c.255G>T	c.(253-255)gaG>gaT	p.E85D	MKL1_ENST00000396617.3_Missense_Mutation_p.E85D|MKL1_ENST00000402630.1_Missense_Mutation_p.E85D|MKL1_ENST00000407029.1_Missense_Mutation_p.E85D|MKL1_ENST00000402042.1_Missense_Mutation_p.E85D	NM_020831.3	NP_065882.1	Q969V6	MKL1_HUMAN	megakaryoblastic leukemia (translocation) 1	85	Mediates interaction with SCAI and ACTB. {ECO:0000250}.				negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription via serum response element binding (GO:0010735)|smooth muscle cell differentiation (GO:0051145)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	actin binding (GO:0003779)|actin monomer binding (GO:0003785)|leucine zipper domain binding (GO:0043522)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(13)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	30						GGATGTTCTTCTCCACCAGCT	0.577			T	RBM15	acute megakaryocytic leukemia																																		Dom	yes		22	22q13	57591	megakaryoblastic leukemia (translocation) 1		L	0			22											121.0	106.0	111.0					22																	40825656		2203	4300	6503	39155602	SO:0001583	missense	57591			AB037859	CCDS14003.1, CCDS74865.1, CCDS74866.1	22q13	2008-06-12			ENSG00000196588	ENSG00000196588			14334	protein-coding gene	gene with protein product	"""megakaryocytic acute leukemia"", ""myocardin-related transcription factor A"", ""basic, SAP and coiled-coil domain"""	606078				11431691, 12019265, 14970199	Standard	XM_005261692		Approved	KIAA1438, MAL, MRTF-A, BSAC	uc003ayw.1	Q969V6	OTTHUMG00000151146	ENST00000355630.3:c.255G>T	22.37:g.40825656C>A	ENSP00000347847:p.Glu85Asp		39155602	Q8TCL1|Q96SC5|Q96SC6|Q9P2B0	Missense_Mutation	SNP	HMMSmart_RPEL,superfamily_SSF68906,HMMPfam_SAP,HMMSmart_SAP	p.E85D	ENST00000355630.3	37	c.255	CCDS14003.1	22	.	.	.	.	.	.	.	.	.	.	C	22.0	4.226936	0.79576	.	.	ENSG00000196588	ENST00000355630;ENST00000396617;ENST00000402042;ENST00000407029;ENST00000402630	D;D;D;D;D	0.99842	-7.1;-7.1;-7.1;-7.1;-7.1	5.25	3.13	0.36017	.	0.232964	0.35466	N	0.003199	D	0.99619	0.9861	L	0.60455	1.87	0.40838	D	0.983642	D;D;D	0.71674	0.998;0.998;0.998	D;D;D	0.67103	0.949;0.924;0.924	D	0.98054	1.0389	10	0.66056	D	0.02	-32.0474	12.0892	0.53715	0.0:0.8581:0.0:0.1419	.	85;85;85	B0QY83;E7ER32;Q969V6	.;.;MKL1_HUMAN	D	85	ENSP00000347847:E85D;ENSP00000379861:E85D;ENSP00000385584:E85D;ENSP00000385835:E85D;ENSP00000385076:E85D	ENSP00000347847:E85D	E	-	3	2	MKL1	39155602	0.994000	0.37717	1.000000	0.80357	0.982000	0.71751	0.414000	0.21164	0.708000	0.31955	0.467000	0.42956	GAG	-	HMMSmart_RPEL		0.577	MKL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MKL1	protein_coding	OTTHUMT00000321522.1	C	NM_020831		39155602	-1	no_errors	NM_020831	genbank	human	validated	54_36p	missense	SNP	1.000	A
CNTN1	1272	genome.wustl.edu	37	12	41327522	41327522	+	Missense_Mutation	SNP	G	G	A	rs201607834		TCGA-04-1648-01A-01W-0639-09	TCGA-04-1648-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cde94745-b8b6-474d-a28d-7f5548bd9f13	cc11f6ea-0d2f-476b-be91-c42f228d764a	g.chr12:41327522G>A	ENST00000551295.2	+	9	944	c.827G>A	c.(826-828)cGg>cAg	p.R276Q	CNTN1_ENST00000547849.1_Missense_Mutation_p.R276Q|CNTN1_ENST00000547702.1_Missense_Mutation_p.R276Q|CNTN1_ENST00000347616.1_Missense_Mutation_p.R276Q|CNTN1_ENST00000348761.2_Missense_Mutation_p.R265Q|CNTN1_ENST00000360099.3_Missense_Mutation_p.R276Q	NM_001843.3	NP_001834.2	Q12860	CNTN1_HUMAN	contactin 1	276	Ig-like C2-type 3.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|Notch signaling pathway (GO:0007219)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transport (GO:0010765)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(21)|lung(49)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	90	all_cancers(12;2.07e-06)|all_epithelial(1;4.26e-06)|Breast(8;0.0716)	Lung NSC(34;0.0211)|all_lung(34;0.0294)				ATCCGATGGCGGAAGGTTCTA	0.378													G|||	1	0.000199681	0.0	0.0	5008	,	,		15939	0.0		0.001	False		,,,				2504	0.0															0			12											92.0	93.0	93.0					12																	41327522		2202	4299	6501	39613789	SO:0001583	missense	1272			Z21488	CCDS8737.1, CCDS8738.1, CCDS58225.1	12q11-q12	2014-01-30				ENSG00000018236		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"", ""Endogenous ligands"""	2171	protein-coding gene	gene with protein product	"""glycoprotein gP135"""	600016				7959734, 8586965	Standard	NM_001843		Approved	F3, GP135	uc031qgz.1	Q12860		ENST00000551295.2:c.827G>A	12.37:g.41327522G>A	ENSP00000447006:p.Arg276Gln		39613789	A8K0H9|A8K0Y3|Q12861|Q14030|Q7M4P0|Q8N466	Missense_Mutation	SNP	superfamily_Immunoglobulin,HMMSmart_SM00409,HMMSmart_SM00408,HMMPfam_ig,HMMPfam_V-set,PatternScan_N6_MTASE,HMMPfam_I-set,superfamily_Fibronectin type III,HMMSmart_SM00060,HMMPfam_fn3	p.R276Q	ENST00000551295.2	37	c.827	CCDS8737.1	12	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	20.9	4.064261	0.76187	.	.	ENSG00000018236	ENST00000547702;ENST00000551295;ENST00000547849;ENST00000347616;ENST00000360099;ENST00000348761	T;T;T;T;T;T	0.27402	1.67;1.67;1.67;1.67;1.67;1.67	5.27	5.27	0.74061	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.245550	0.39909	N	0.001224	T	0.42988	0.1227	L	0.46819	1.47	0.35450	D	0.795655	P;D;D	0.69078	0.949;0.996;0.997	B;P;P	0.58520	0.35;0.753;0.84	T	0.51795	-0.8660	10	0.51188	T	0.08	.	13.5716	0.61849	0.075:0.0:0.925:0.0	.	276;265;276	Q12860-3;Q12860-2;Q12860	.;.;CNTN1_HUMAN	Q	276;276;276;276;276;265	ENSP00000448004:R276Q;ENSP00000447006:R276Q;ENSP00000448653:R276Q;ENSP00000325660:R276Q;ENSP00000353213:R276Q;ENSP00000261160:R265Q	ENSP00000325660:R276Q	R	+	2	0	CNTN1	39613789	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.203000	0.51075	2.642000	0.89623	0.650000	0.86243	CGG	-	superfamily_Immunoglobulin,HMMPfam_I-set,HMMSmart_SM00409,HMMSmart_SM00408		0.378	CNTN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTN1	protein_coding	OTTHUMT00000403692.2	G	NM_001843		39613789	+1	no_errors	NM_001843	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
PWP2	5822	genome.wustl.edu	37	21	45547958	45547958	+	Silent	SNP	C	C	T			TCGA-04-1648-01A-01W-0639-09	TCGA-04-1648-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cde94745-b8b6-474d-a28d-7f5548bd9f13	cc11f6ea-0d2f-476b-be91-c42f228d764a	g.chr21:45547958C>T	ENST00000291576.7	+	18	2413	c.2286C>T	c.(2284-2286)gcC>gcT	p.A762A	PWP2_ENST00000494310.1_3'UTR	NM_005049.2	NP_005040.2	Q15269	PWP2_HUMAN	PWP2 periodic tryptophan protein homolog (yeast)	762					signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|signal transducer activity (GO:0004871)			cervix(1)|endometrium(6)|large_intestine(6)|lung(4)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(1)	21				STAD - Stomach adenocarcinoma(101;0.172)|Colorectal(79;0.2)		TCACCAGGGCCATCCTCATGG	0.687																																																0			21											30.0	28.0	28.0					21																	45547958		2202	4299	6501	44372386	SO:0001819	synonymous_variant	5822				CCDS33579.1	21q22.3	2013-01-10	2001-11-28	2006-11-24	ENSG00000241945	ENSG00000241945		"""WD repeat domain containing"""	9711	protein-coding gene	gene with protein product		601475	"""PWP2 (periodic tryptophan protein, yeast) homolog"""	PWP2H		8893822	Standard	NM_005049		Approved	EHOC-17, UTP1	uc002zeb.3	Q15269	OTTHUMG00000086893	ENST00000291576.7:c.2286C>T	21.37:g.45547958C>T			44372386	B2RAG8|Q96A77	Silent	SNP	superfamily_Peptidase_S9A_N,HMMSmart_WD40,superfamily_WD40_like,HMMPfam_WD40,PatternScan_WD_REPEATS_1,HMMPfam_PWP2	p.A762	ENST00000291576.7	37	c.2286	CCDS33579.1	21																																																																																			-	NULL		0.687	PWP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PWP2	protein_coding	OTTHUMT00000195736.3	C	NM_005049		44372386	+1	no_errors	NM_005049	genbank	human	validated	54_36p	silent	SNP	1.000	T
NGFR	4804	genome.wustl.edu	37	17	47590126	47590126	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1648-01A-01W-0639-09	TCGA-04-1648-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cde94745-b8b6-474d-a28d-7f5548bd9f13	cc11f6ea-0d2f-476b-be91-c42f228d764a	g.chr17:47590126G>C	ENST00000172229.3	+	6	1164	c.1039G>C	c.(1039-1041)Gtg>Ctg	p.V347L	RP5-1029K10.2_ENST00000514506.1_RNA|NGFR_ENST00000504201.1_Missense_Mutation_p.V253L	NM_002507.3	NP_002498.1	P08138	TNR16_HUMAN	nerve growth factor receptor	347	Death. {ECO:0000255|PROSITE- ProRule:PRU00064}.				apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|central nervous system development (GO:0007417)|circadian regulation of gene expression (GO:0032922)|detection of temperature stimulus (GO:0016048)|glucose homeostasis (GO:0042593)|hair follicle morphogenesis (GO:0031069)|intracellular protein transport (GO:0006886)|membrane protein intracellular domain proteolysis (GO:0031293)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell cycle (GO:0045786)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of hair follicle development (GO:0051799)|nerve development (GO:0021675)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of axonogenesis (GO:0050772)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of odontogenesis of dentin-containing tooth (GO:0042488)|regulation of axonogenesis (GO:0050770)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of glucose import in response to insulin stimulus (GO:2001273)	cell surface (GO:0009986)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|neuronal postsynaptic density (GO:0097481)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	death receptor activity (GO:0005035)|Rab GTPase binding (GO:0017137)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)|transmembrane signaling receptor activity (GO:0004888)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(7)|ovary(1)	17	all_cancers(4;1.45e-13)|Breast(4;6.34e-28)|all_epithelial(4;4.95e-17)					GCGGGAGGAGGTGGAGAAGCT	0.647																																																0			17											59.0	65.0	63.0					17																	47590126		2202	4296	6498	44945125	SO:0001583	missense	4804			M14764	CCDS11549.1	17q21-q22	2013-05-22	2010-04-28		ENSG00000064300	ENSG00000064300		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	7809	protein-coding gene	gene with protein product	"""low affinity nerve growth factor receptor"", ""TNFR superfamily, member 16"""	162010	"""nerve growth factor receptor (TNFR superfamily, member 16)"""			3022937, 3006050	Standard	NM_002507		Approved	TNFRSF16, CD271, p75NTR	uc002ioz.4	P08138	OTTHUMG00000161495	ENST00000172229.3:c.1039G>C	17.37:g.47590126G>C	ENSP00000172229:p.Val347Leu		44945125	B2R961|B4E096	Missense_Mutation	SNP	PatternScan_LIPASE_SER,superfamily_TNF receptor-like,HMMPfam_TNFR_c6,HMMSmart_SM00208,PatternScan_TNFR_NGFR_1,PatternScan_EGF_2,superfamily_DEATH domain,HMMSmart_SM00005,HMMPfam_Death	p.V347L	ENST00000172229.3	37	c.1039	CCDS11549.1	17	.	.	.	.	.	.	.	.	.	.	G	25.5	4.646832	0.87958	.	.	ENSG00000064300	ENST00000172229;ENST00000504201	D;D	0.81821	-1.54;-1.54	4.74	4.74	0.60224	Death (3);DEATH-like (2);	0.374675	0.25827	N	0.028058	D	0.85344	0.5675	M	0.76170	2.325	0.50171	D	0.999857	P	0.41784	0.762	P	0.50570	0.644	D	0.83912	0.0296	10	0.27785	T	0.31	-7.0489	16.4949	0.84237	0.0:0.0:1.0:0.0	.	347	P08138	TNR16_HUMAN	L	347;253	ENSP00000172229:V347L;ENSP00000421731:V253L	ENSP00000172229:V347L	V	+	1	0	NGFR	44945125	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	6.371000	0.73119	2.160000	0.67779	0.561000	0.74099	GTG	-	superfamily_DEATH domain,HMMSmart_SM00005,HMMPfam_Death		0.647	NGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NGFR	protein_coding	OTTHUMT00000365150.1	G			44945125	+1	no_errors	NM_002507	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
MCFD2	90411	genome.wustl.edu	37	2	47135071	47135071	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1648-01A-01W-0639-09	TCGA-04-1648-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cde94745-b8b6-474d-a28d-7f5548bd9f13	cc11f6ea-0d2f-476b-be91-c42f228d764a	g.chr2:47135071G>C	ENST00000409105.1	-	4	366	c.187C>G	c.(187-189)Cca>Gca	p.P63A	MCFD2_ENST00000409207.1_Missense_Mutation_p.P63A|AC016722.4_ENST00000429761.1_RNA|MCFD2_ENST00000409913.1_Missense_Mutation_p.P11A|MCFD2_ENST00000409218.1_Missense_Mutation_p.P63A|MCFD2_ENST00000493804.1_Intron|MCFD2_ENST00000409973.1_Missense_Mutation_p.P63A|MCFD2_ENST00000319466.4_Missense_Mutation_p.P63A|MCFD2_ENST00000409800.1_Missense_Mutation_p.P11A|MCFD2_ENST00000409147.1_Missense_Mutation_p.P11A|MCFD2_ENST00000444761.2_Missense_Mutation_p.P44A	NM_001171506.2	NP_001164977.1	Q8NI22	MCFD2_HUMAN	multiple coagulation factor deficiency 2	63					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)	calcium ion binding (GO:0005509)			central_nervous_system(1)|large_intestine(1)|lung(2)	4		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.0792)|LUSC - Lung squamous cell carcinoma(58;0.114)		Antihemophilic Factor(DB00025)	TCCGCCTCTGGTTTGTTGATG	0.423																																																0			2											130.0	119.0	123.0					2																	47135071		2203	4300	6503	46988575	SO:0001583	missense	90411			AF475284	CCDS33192.1, CCDS54354.1, CCDS54355.1	2p21	2014-09-17			ENSG00000180398	ENSG00000180398		"""EF-hand domain containing"""	18451	protein-coding gene	gene with protein product		607788				12717434, 2463956	Standard	NM_139279		Approved	F5F8D, LMAN1IP, SDNSF	uc021vha.1	Q8NI22	OTTHUMG00000153100	ENST00000409105.1:c.187C>G	2.37:g.47135071G>C	ENSP00000386651:p.Pro63Ala		46988575	A8K7W2|D6W5A9|E9PD95|Q53SS3|Q68D61|Q8N3M5	Missense_Mutation	SNP	superfamily_EF-hand,PatternScan_EF_HAND_1	p.P63A	ENST00000409105.1	37	c.187	CCDS33192.1	2	.	.	.	.	.	.	.	.	.	.	G	21.1	4.102256	0.76983	.	.	ENSG00000180398	ENST00000444761;ENST00000409105;ENST00000409913;ENST00000319466;ENST00000409800;ENST00000409207;ENST00000409973;ENST00000409147;ENST00000409218;ENST00000412438;ENST00000434262	D;D;D;D;D;D;D;D;D;D;D	0.90197	-1.83;-1.86;-1.98;-1.86;-1.98;-1.86;-1.86;-1.98;-1.86;-1.86;-2.63	5.45	4.51	0.55191	EF-hand-like domain (1);	0.102166	0.64402	D	0.000002	D	0.92328	0.7566	L	0.51422	1.61	0.58432	D	0.999996	B;D	0.58970	0.116;0.984	B;P	0.58721	0.126;0.844	D	0.91566	0.5268	10	0.44086	T	0.13	-7.2594	16.5588	0.84534	0.0:0.0:0.8611:0.1389	.	44;63	E9PD95;Q8NI22	.;MCFD2_HUMAN	A	44;63;11;63;11;63;63;11;63;63;30	ENSP00000394647:P44A;ENSP00000386651:P63A;ENSP00000386941:P11A;ENSP00000317271:P63A;ENSP00000387202:P11A;ENSP00000386386:P63A;ENSP00000386279:P63A;ENSP00000387082:P11A;ENSP00000386261:P63A;ENSP00000402717:P63A;ENSP00000387360:P30A	ENSP00000317271:P63A	P	-	1	0	MCFD2	46988575	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	6.000000	0.70678	2.835000	0.97688	0.650000	0.86243	CCA	-	superfamily_EF-hand		0.423	MCFD2-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	MCFD2	protein_coding	OTTHUMT00000329518.1	G	NM_139279		46988575	-1	no_errors	NM_139279	genbank	human	validated	54_36p	missense	SNP	1.000	C
OR4A5	81318	genome.wustl.edu	37	11	51411931	51411931	+	Silent	SNP	C	C	T	rs140587389	byFrequency	TCGA-04-1648-01A-01W-0639-09	TCGA-04-1648-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cde94745-b8b6-474d-a28d-7f5548bd9f13	cc11f6ea-0d2f-476b-be91-c42f228d764a	g.chr11:51411931C>T	ENST00000319760.6	-	1	517	c.465G>A	c.(463-465)gcG>gcA	p.A155A		NM_001005272.3	NP_001005272.3	Q8NH83	OR4A5_HUMAN	olfactory receptor, family 4, subfamily A, member 5	155						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A155A(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(28)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	49		all_lung(304;0.236)				CAATTTGAAACGCAGAATGTA	0.453													.|||	3	0.000599042	0.0008	0.0	5008	,	,		21566	0.002		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	NS(1)	11						C		3,4399		0,3,2198	86.0	78.0	81.0		465	0.9	0.0	11	dbSNP_134	81	1,8591		0,1,4295	no	coding-synonymous	OR4A5	NM_001005272.3		0,4,6493	TT,TC,CC		0.0116,0.0682,0.0308		155/316	51411931	4,12990	2201	4296	6497	51268507	SO:0001819	synonymous_variant	81318			AB065506	CCDS73289.1	11p11.12	2012-08-09			ENSG00000221840	ENSG00000221840		"""GPCR / Class A : Olfactory receptors"""	15162	protein-coding gene	gene with protein product							Standard	NM_001005272		Approved		uc001nhi.2	Q8NH83	OTTHUMG00000166764	ENST00000319760.6:c.465G>A	11.37:g.51411931C>T			51268507	Q6IF84	Silent	SNP	superfamily_Family A G protein-coupled receptor-like,PatternScan_LECTIN_LEGUME_ALPHA,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.A155	ENST00000319760.6	37	c.465	CCDS31497.1	11																																																																																			-	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1		0.453	OR4A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4A5	protein_coding	OTTHUMT00000391399.1	C	NM_001005272		51268507	-1	no_errors	NM_001005272	genbank	human	provisional	54_36p	silent	SNP	0.000	T
COPZ1	22818	genome.wustl.edu	37	12	54744303	54744303	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1648-01A-01W-0639-09	TCGA-04-1648-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cde94745-b8b6-474d-a28d-7f5548bd9f13	cc11f6ea-0d2f-476b-be91-c42f228d764a	g.chr12:54744303G>C	ENST00000262061.2	+	9	567	c.530G>C	c.(529-531)cGg>cCg	p.R177P	COPZ1_ENST00000455864.2_Missense_Mutation_p.R154P|COPZ1_ENST00000416254.2_Missense_Mutation_p.R126P|COPZ1_ENST00000552362.1_Missense_Mutation_p.R160P|COPZ1_ENST00000548753.1_Missense_Mutation_p.R89P|COPZ1_ENST00000552218.1_Missense_Mutation_p.R198P|COPZ1_ENST00000549043.1_Missense_Mutation_p.R185P|COPZ1_ENST00000548281.1_3'UTR|COPZ1_ENST00000551779.1_3'UTR|COPZ1_ENST00000549116.1_Missense_Mutation_p.R119P	NM_001271734.1|NM_001271736.1|NM_016057.1	NP_001258663.1|NP_001258665.1|NP_057141.1	P61923	COPZ1_HUMAN	coatomer protein complex, subunit zeta 1	177					COPI coating of Golgi vesicle (GO:0048205)|intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	COPI vesicle coat (GO:0030126)|cytosol (GO:0005829)				kidney(1)|lung(4)	5						TCACTCCTTCGGTGAAGACCT	0.478																																																0			12											238.0	200.0	213.0					12																	54744303		2203	4300	6503	53030570	SO:0001583	missense	22818			AF151878	CCDS8877.1, CCDS61137.1, CCDS61138.1, CCDS61139.1	12q13.2-q13.3	2008-02-05		2003-07-23					2243	protein-coding gene	gene with protein product		615472	"""coatomer protein complex, subunit zeta"""	COPZ			Standard	NM_001271734		Approved	CGI-120	uc009znm.2	P61923		ENST00000262061.2:c.530G>C	12.37:g.54744303G>C	ENSP00000262061:p.Arg177Pro		53030570	B4DDX8|B4DHZ0|F8VS17|F8VWL5|Q549N6|Q9Y3C3	Missense_Mutation	SNP	superfamily_SNARE-like,HMMPfam_Clat_adaptor_s,PatternScan_CLAT_ADAPTOR_S	p.R177P	ENST00000262061.2	37	c.530	CCDS8877.1	12	.	.	.	.	.	.	.	.	.	.	G	17.56	3.420177	0.62622	.	.	ENSG00000111481	ENST00000262061;ENST00000549043;ENST00000552218;ENST00000552362;ENST00000455864;ENST00000416254;ENST00000549116;ENST00000548753	.	.	.	4.64	3.74	0.42951	.	0.140928	0.48767	N	0.000164	T	0.49813	0.1579	L	0.29908	0.895	0.80722	D	1	P;P;D;P	0.58620	0.938;0.922;0.983;0.892	P;P;P;P	0.51193	0.578;0.662;0.627;0.578	T	0.55431	-0.8142	9	0.87932	D	0	-4.6896	12.7657	0.57391	0.0:0.1666:0.8334:0.0	.	154;185;126;177	B4DDX8;F8VWL5;B4DHZ0;P61923	.;.;.;COPZ1_HUMAN	P	177;185;198;160;154;126;119;89	.	ENSP00000262061:R177P	R	+	2	0	COPZ1	53030570	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	6.259000	0.72494	1.304000	0.44892	0.555000	0.69702	CGG	-	NULL		0.478	COPZ1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	COPZ1	protein_coding	OTTHUMT00000405753.1	G	NM_016057		53030570	+1	no_errors	NM_016057	genbank	human	provisional	54_36p	missense	SNP	1.000	C
PRR12	57479	genome.wustl.edu	37	19	50098268	50098268	+	Missense_Mutation	SNP	C	C	A	rs146291703	byFrequency	TCGA-04-1648-01A-01W-0639-09	TCGA-04-1648-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cde94745-b8b6-474d-a28d-7f5548bd9f13	cc11f6ea-0d2f-476b-be91-c42f228d764a	g.chr19:50098268C>A	ENST00000418929.2	+	4	688	c.676C>A	c.(676-678)Cct>Act	p.P226T		NM_020719.1	NP_065770.1	Q9ULL5	PRR12_HUMAN	proline rich 12	0	Pro-rich.						DNA binding (GO:0003677)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|pancreas(1)|prostate(2)	11		all_lung(116;2.45e-07)|Lung NSC(112;1.24e-06)|Ovarian(192;0.0728)|all_neural(266;0.0887)		OV - Ovarian serous cystadenocarcinoma(262;0.00319)|GBM - Glioblastoma multiforme(134;0.0132)		CCAGACCCCCCCTTACCGCCC	0.711													C|||	10	0.00199681	0.0008	0.0043	5008	,	,		8922	0.0		0.003	False		,,,				2504	0.0031															0			19						C	THR/PRO	8,3838		0,8,1915	8.0	9.0	9.0		676	3.6	1.0	19	dbSNP_134	9	90,8070		0,90,3990	no	missense	PRR12	NM_020719.1	38	0,98,5905	AA,AC,CC		1.1029,0.208,0.8163	possibly-damaging	226/2037	50098268	98,11908	1923	4080	6003	54790080	SO:0001583	missense	57479			AB033031	CCDS46143.1	19q13.33	2008-07-02	2006-02-06	2006-02-06		ENSG00000126464			29217	protein-coding gene	gene with protein product			"""KIAA1205"""	KIAA1205		10574462	Standard	NM_020719		Approved		uc002poo.4	Q9ULL5		ENST00000418929.2:c.676C>A	19.37:g.50098268C>A	ENSP00000394510:p.Pro226Thr		54790080	E9PB06|Q8N4J6	Missense_Mutation	SNP	NULL	p.P226T	ENST00000418929.2	37	c.676	CCDS46143.1	19	10	0.004578754578754579	3	0.006097560975609756	4	0.011049723756906077	0	0.0	3	0.00395778364116095	C	8.389	0.839314	0.16891	0.00208	0.011029	ENSG00000126464	ENST00000418929	.	.	.	3.63	3.63	0.41609	.	.	.	.	.	T	0.11922	0.0290	.	.	.	0.28117	N	0.930771	P	0.46784	0.884	P	0.44673	0.457	T	0.01791	-1.1273	7	0.02654	T	1	.	10.0609	0.42275	0.0:0.6521:0.3479:0.0	.	226	Q9ULL5-3	.	T	226	.	ENSP00000394510:P226T	P	+	1	0	PRR12	54790080	0.000000	0.05858	1.000000	0.80357	0.993000	0.82548	0.234000	0.17930	2.056000	0.61249	0.563000	0.77884	CCT	-	NULL		0.711	PRR12-001	NOVEL	basic|appris_principal|CCDS	protein_coding	PRR12	protein_coding	OTTHUMT00000465915.1	C	NM_020719		54790080	+1	no_errors	NM_020719	genbank	human	validated	54_36p	missense	SNP	0.810	A
VOPP1	81552	genome.wustl.edu	37	7	55560041	55560041	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1648-01A-01W-0639-09	TCGA-04-1648-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cde94745-b8b6-474d-a28d-7f5548bd9f13	cc11f6ea-0d2f-476b-be91-c42f228d764a	g.chr7:55560041G>A	ENST00000285279.5	-	4	462	c.262C>T	c.(262-264)Ccg>Tcg	p.P88S	VOPP1_ENST00000428648.1_Missense_Mutation_p.P21S|VOPP1_ENST00000433959.1_Missense_Mutation_p.P79S|VOPP1_ENST00000453256.1_Missense_Mutation_p.P21S|VOPP1_ENST00000545390.1_Missense_Mutation_p.P85S|VOPP1_ENST00000428097.1_Missense_Mutation_p.P21S|VOPP1_ENST00000471168.1_5'Flank|VOPP1_ENST00000418904.1_Missense_Mutation_p.P71S|VOPP1_ENST00000454227.1_Missense_Mutation_p.P25S|VOPP1_ENST00000427700.1_Missense_Mutation_p.P86S	NM_001284282.1|NM_030796.3	NP_001271211.1|NP_110423.3	Q96AW1	VOPP1_HUMAN	vesicular, overexpressed in cancer, prosurvival protein 1	88	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cytoplasmic vesicle membrane (GO:0030659)|endosome (GO:0005768)|integral component of organelle membrane (GO:0031301)	signal transducer activity (GO:0004871)			endometrium(1)|lung(4)	5						ATCAGCGGCGGGGGGTACATG	0.627																																																0			7											16.0	21.0	19.0					7																	55560041		1901	4090	5991	55527535	SO:0001583	missense	81552				CCDS47588.1, CCDS64654.1, CCDS64656.1	7p11.2	2010-06-22			ENSG00000154978	ENSG00000154978			34518	protein-coding gene	gene with protein product	"""Glioblastoma-amplified secreted protein"", ""EGFR-coamplified and overexpressed protein"""	611915				15735698	Standard	NM_030796		Approved	ECop, GASP, FLJ20532, DKFZp564K0822	uc003tqs.3	Q96AW1	OTTHUMG00000156124	ENST00000285279.5:c.262C>T	7.37:g.55560041G>A	ENSP00000285279:p.Pro88Ser		55527535	B0AZU1|B2RAT4|B3KS72|C9JWR3|Q6FIE3|Q8NBN8|Q96RE5|Q9H0W4	Missense_Mutation	SNP	NULL	p.P88S	ENST00000285279.5	37	c.262	CCDS47588.1	7	.	.	.	.	.	.	.	.	.	.	G	13.13	2.146231	0.37923	.	.	ENSG00000154978	ENST00000285279;ENST00000428648;ENST00000433959;ENST00000545390;ENST00000428097;ENST00000418904;ENST00000454227;ENST00000453256;ENST00000427700;ENST00000455023;ENST00000414113;ENST00000417399;ENST00000452832	.	.	.	4.46	4.46	0.54185	.	.	.	.	.	T	0.49898	0.1584	N	0.04508	-0.205	0.42605	D	0.993297	B;D;P;P	0.89917	0.394;1.0;0.537;0.537	B;D;B;B	0.87578	0.057;0.998;0.203;0.203	T	0.57225	-0.7848	8	0.32370	T	0.25	-5.3229	14.6278	0.68635	0.0:0.0:1.0:0.0	.	71;85;88;79	C9JWR3;B0AZU1;Q96AW1;B3KS72	.;.;VOPP1_HUMAN;.	S	88;21;79;85;21;71;25;21;86;21;21;21;21	.	ENSP00000285279:P88S	P	-	1	0	VOPP1	55527535	1.000000	0.71417	0.688000	0.30117	0.833000	0.47200	6.174000	0.71943	2.008000	0.58898	0.563000	0.77884	CCG	-	NULL		0.627	VOPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ECOP	protein_coding	OTTHUMT00000343074.1	G	NM_030796		55527535	-1	no_errors	NM_030796	genbank	human	validated	54_36p	missense	SNP	0.863	A
Unknown	0	genome.wustl.edu	37	7	55813114	55813114	+	IGR	SNP	G	G	A	rs563405159	byFrequency	TCGA-04-1648-01A-01W-0639-09	TCGA-04-1648-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cde94745-b8b6-474d-a28d-7f5548bd9f13	cc11f6ea-0d2f-476b-be91-c42f228d764a	g.chr7:55813114G>A								FKBP9L (56120 upstream) : RNU6-1126P (43946 downstream)																							GGCAGGAGCAGCTTTGGACTG	0.607													g|||	12	0.00239617	0.0	0.0043	5008	,	,		22178	0.0		0.0089	False		,,,				2504	0.0															0			7																																								55780608	SO:0001628	intergenic_variant	0																															7.37:g.55813114G>A			55780608		RNA	SNP	-	NULL		37	NULL		7																																																																																			-	-	0	0.607					LOC100128326			G			55780608	-1	pseudogene	XR_036976	genbank	human	model	54_36p	rna	SNP	0.008	A
SPTB	6710	genome.wustl.edu	37	14	65253544	65253544	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1648-01A-01W-0639-09	TCGA-04-1648-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cde94745-b8b6-474d-a28d-7f5548bd9f13	cc11f6ea-0d2f-476b-be91-c42f228d764a	g.chr14:65253544G>T	ENST00000389721.5	-	15	3171	c.3139C>A	c.(3139-3141)Cag>Aag	p.Q1047K	SPTB_ENST00000556626.1_Missense_Mutation_p.Q1047K|SPTB_ENST00000542895.1_Missense_Mutation_p.Q1047K|SPTB_ENST00000389720.3_Missense_Mutation_p.Q1047K|SPTB_ENST00000389722.3_Missense_Mutation_p.Q1047K	NM_000347.5	NP_000338.3	P11277	SPTB1_HUMAN	spectrin, beta, erythrocytic	1047					actin filament capping (GO:0051693)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)	actin cytoskeleton (GO:0015629)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ankyrin binding (GO:0030506)|structural constituent of cytoskeleton (GO:0005200)			breast(5)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(36)|ovary(8)|pancreas(1)|prostate(4)|skin(10)|urinary_tract(3)	106		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)		AGGGATTGCTGCAGGCCCTGC	0.612																																																0			14											54.0	59.0	57.0					14																	65253544		2203	4300	6503	64323297	SO:0001583	missense	6710				CCDS32099.1, CCDS32100.1	14q24.1-q24.2	2013-01-10	2008-07-29			ENSG00000070182		"""Pleckstrin homology (PH) domain containing"""	11274	protein-coding gene	gene with protein product	"""spherocytosis, clinical type I"""	182870				2209094	Standard	NM_001024858		Approved		uc001xhr.3	P11277		ENST00000389721.5:c.3139C>A	14.37:g.65253544G>T	ENSP00000374371:p.Gln1047Lys		64323297	Q15510|Q15519	Missense_Mutation	SNP	superfamily_Calponin-homology,HMMPfam_CH,PatternScan_ACTININ_1,HMMSmart_CH,PatternScan_ACTININ_2,superfamily_Spectrin,HMMPfam_Spectrin,HMMSmart_SPEC,superfamily_SSF50729,HMMPfam_PH,HMMSmart_PH	p.Q1047K	ENST00000389721.5	37	c.3139	CCDS32100.1	14	.	.	.	.	.	.	.	.	.	.	G	0.834	-0.744208	0.03065	.	.	ENSG00000070182	ENST00000389723;ENST00000389722;ENST00000556626;ENST00000389721;ENST00000542895;ENST00000389720	T;T;T;T;T	0.47177	0.85;0.85;0.85;0.85;0.85	4.89	3.99	0.46301	.	0.260691	0.37715	N	0.001978	T	0.22044	0.0531	N	0.05050	-0.12	0.35767	D	0.820586	B;B	0.02656	0.0;0.0	B;B	0.09377	0.004;0.002	T	0.22765	-1.0207	10	0.02654	T	1	.	11.7161	0.51655	0.0:0.0:0.6792:0.3208	.	1047;1051	P11277;Q59FP5	SPTB1_HUMAN;.	K	1051;1047;1047;1047;1047;1047	ENSP00000374372:Q1047K;ENSP00000451752:Q1047K;ENSP00000374371:Q1047K;ENSP00000443882:Q1047K;ENSP00000374370:Q1047K	ENSP00000374370:Q1047K	Q	-	1	0	SPTB	64323297	0.986000	0.35501	0.843000	0.33291	0.707000	0.40811	1.910000	0.39927	1.176000	0.42840	0.549000	0.68633	CAG	-	HMMPfam_Spectrin,superfamily_Spectrin,HMMSmart_SPEC		0.612	SPTB-004	KNOWN	basic|CCDS	protein_coding	SPTB	protein_coding	OTTHUMT00000414080.1	G			64323297	-1	no_errors	NM_001024858	genbank	human	validated	54_36p	missense	SNP	0.044	T
CABP4	57010	genome.wustl.edu	37	11	67225049	67225049	+	Missense_Mutation	SNP	G	G	C	rs146764702		TCGA-04-1648-01A-01W-0639-09	TCGA-04-1648-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cde94745-b8b6-474d-a28d-7f5548bd9f13	cc11f6ea-0d2f-476b-be91-c42f228d764a	g.chr11:67225049G>C	ENST00000325656.5	+	4	624	c.547G>C	c.(547-549)Ggc>Cgc	p.G183R	CABP4_ENST00000438189.2_Missense_Mutation_p.G78R|CTC-1337H24.1_ENST00000602912.1_lincRNA	NM_145200.3	NP_660201.1	P57796	CABP4_HUMAN	calcium binding protein 4	183	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				photoreceptor cell morphogenesis (GO:0008594)|phototransduction (GO:0007602)|retinal bipolar neuron differentiation (GO:0060040)|retinal cone cell development (GO:0046549)|signal transduction (GO:0007165)|visual perception (GO:0007601)	cytosol (GO:0005829)|extracellular region (GO:0005576)|synapse (GO:0045202)|terminal bouton (GO:0043195)	calcium ion binding (GO:0005509)			central_nervous_system(2)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)|skin(2)	11			BRCA - Breast invasive adenocarcinoma(15;8.18e-06)			TGCAGTGGGCGGCCGTGTGGA	0.622																																																0			11						G	ARG/GLY	5,4391		0,5,2193	54.0	47.0	49.0		547	4.6	1.0	11	dbSNP_134	49	2,8578		0,2,4288	no	missense	CABP4	NM_145200.3	125	0,7,6481	CC,CG,GG		0.0233,0.1137,0.0539	probably-damaging	183/276	67225049	7,12969	2198	4290	6488	66981625	SO:0001583	missense	57010			AC005849	CCDS8166.1, CCDS73333.1	11q13.2	2013-09-20			ENSG00000175544	ENSG00000175544		"""EF-hand domain containing"""	1386	protein-coding gene	gene with protein product		608965				10625670, 16960802	Standard	NM_145200		Approved	CSNB2B	uc001olo.3	P57796	OTTHUMG00000168033	ENST00000325656.5:c.547G>C	11.37:g.67225049G>C	ENSP00000324960:p.Gly183Arg		66981625	Q8N4Z2|Q8WWY5	Missense_Mutation	SNP	superfamily_EF-hand,HMMSmart_SM00054,HMMPfam_efhand,PatternScan_EF_HAND_1	p.G183R	ENST00000325656.5	37	c.547	CCDS8166.1	11	.	.	.	.	.	.	.	.	.	.	G	27.9	4.872550	0.91587	0.001137	2.33E-4	ENSG00000175544	ENST00000438189;ENST00000325656	T;T	0.55234	0.53;0.53	4.58	4.58	0.56647	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	T	0.80742	0.4681	H	0.95260	3.645	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.86875	0.2038	10	0.87932	D	0	-27.4611	16.6615	0.85242	0.0:0.0:1.0:0.0	.	183;78	P57796;P57796-2	CABP4_HUMAN;.	R	78;183	ENSP00000401555:G78R;ENSP00000324960:G183R	ENSP00000324960:G183R	G	+	1	0	CABP4	66981625	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	7.583000	0.82559	2.545000	0.85829	0.655000	0.94253	GGC	-	superfamily_EF-hand		0.622	CABP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CABP4	protein_coding	OTTHUMT00000397624.2	G			66981625	+1	no_errors	NM_145200	genbank	human	validated	54_36p	missense	SNP	0.996	C
SLC10A1	6554	genome.wustl.edu	37	14	70245181	70245181	+	Missense_Mutation	SNP	T	T	G	rs200093127		TCGA-04-1648-01A-01W-0639-09	TCGA-04-1648-11A-01W-0639-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cde94745-b8b6-474d-a28d-7f5548bd9f13	cc11f6ea-0d2f-476b-be91-c42f228d764a	g.chr14:70245181T>G	ENST00000216540.4	-	4	945	c.812A>C	c.(811-813)aAt>aCt	p.N271T		NM_003049.3	NP_003040.1	Q14973	NTCP_HUMAN	solute carrier family 10 (sodium/bile acid cotransporter), member 1	271					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	bile acid:sodium symporter activity (GO:0008508)			NS(1)|breast(1)|endometrium(1)|large_intestine(3)|lung(5)|ovary(2)|prostate(1)	14				all cancers(60;0.00228)|BRCA - Breast invasive adenocarcinoma(234;0.0137)|OV - Ovarian serous cystadenocarcinoma(108;0.0226)	Bumetanide(DB00887)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Ethinyl Estradiol(DB00977)|Indomethacin(DB00328)|Liothyronine(DB00279)|Liotrix(DB01583)|Pitavastatin(DB08860)|Probenecid(DB01032)|Progesterone(DB00396)|Testosterone(DB00624)|Ursodeoxycholic acid(DB01586)	AAAGGCCACATTGAGGATGGT	0.488																																																0			14											168.0	141.0	150.0					14																	70245181		2203	4300	6503	69314934	SO:0001583	missense	6554			L21893	CCDS9797.1	14q24.2	2013-07-18	2013-07-18		ENSG00000100652	ENSG00000100652		"""Solute carriers"""	10905	protein-coding gene	gene with protein product		182396				8132774	Standard	NM_003049		Approved	NTCP	uc001xlr.2	Q14973	OTTHUMG00000171236	ENST00000216540.4:c.812A>C	14.37:g.70245181T>G	ENSP00000216540:p.Asn271Thr		69314934	B9EGB6|Q2TU29	Missense_Mutation	SNP	HMMPfam_SBF	p.N271T	ENST00000216540.4	37	c.812	CCDS9797.1	14	.	.	.	.	.	.	.	.	.	.	T	11.87	1.767038	0.31320	.	.	ENSG00000100652	ENST00000216540	T	0.62788	-0.0	4.81	4.81	0.61882	.	0.106561	0.64402	D	0.000006	T	0.35422	0.0931	N	0.11427	0.14	0.33372	D	0.57365	B	0.28258	0.205	B	0.20955	0.032	T	0.44375	-0.9332	10	0.16420	T	0.52	-9.8173	7.1917	0.25828	0.0:0.0787:0.1482:0.773	.	271	Q14973	NTCP_HUMAN	T	271	ENSP00000216540:N271T	ENSP00000216540:N271T	N	-	2	0	SLC10A1	69314934	1.000000	0.71417	0.999000	0.59377	0.899000	0.52679	3.233000	0.51311	2.020000	0.59435	0.459000	0.35465	AAT	-	NULL		0.488	SLC10A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC10A1	protein_coding	OTTHUMT00000412464.1	T			69314934	-1	no_errors	NM_003049	genbank	human	validated	54_36p	missense	SNP	1.000	G
CABS1	85438	genome.wustl.edu	37	4	71200893	71200893	+	Missense_Mutation	SNP	A	A	G			TCGA-04-1648-01A-01W-0639-09	TCGA-04-1648-11A-01W-0639-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cde94745-b8b6-474d-a28d-7f5548bd9f13	cc11f6ea-0d2f-476b-be91-c42f228d764a	g.chr4:71200893A>G	ENST00000273936.5	+	1	211	c.137A>G	c.(136-138)gAc>gGc	p.D46G		NM_033122.3	NP_149113.3	Q96KC9	CABS1_HUMAN	calcium-binding protein, spermatid-specific 1	46					spermatogenesis (GO:0007283)	mitochondrial inner membrane (GO:0005743)|motile cilium (GO:0031514)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(4)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						TCAGAAGGAGACCACGTCACT	0.378																																																0			4											101.0	105.0	104.0					4																	71200893		2203	4299	6502	71235482	SO:0001583	missense	85438			AF380838	CCDS3539.1	4q13.3	2013-10-11	2011-01-25	2011-01-25	ENSG00000145309	ENSG00000145309			30710	protein-coding gene	gene with protein product	"""casein-like phosphoprotein"""		"""chromosome 4 open reading frame 35"""	C4orf35		19208547, 19271754	Standard	NM_033122		Approved	NYD-SP26, FLJ32897, CLPH	uc003hff.3	Q96KC9	OTTHUMG00000129405	ENST00000273936.5:c.137A>G	4.37:g.71200893A>G	ENSP00000273936:p.Asp46Gly		71235482	B2RCB5|Q86UE0|Q96M17	Missense_Mutation	SNP	NULL	p.D46G	ENST00000273936.5	37	c.137	CCDS3539.1	4	.	.	.	.	.	.	.	.	.	.	A	14.86	2.661143	0.47572	.	.	ENSG00000145309	ENST00000273936	T	0.39997	1.05	4.79	3.63	0.41609	.	0.000000	0.42053	D	0.000776	T	0.39036	0.1063	L	0.34521	1.04	0.32722	N	0.510189	D	0.55385	0.971	P	0.52793	0.709	T	0.51834	-0.8655	10	0.62326	D	0.03	-21.3713	6.561	0.22485	0.8951:0.0:0.1049:0.0	.	46	Q96KC9	CABS1_HUMAN	G	46	ENSP00000273936:D46G	ENSP00000273936:D46G	D	+	2	0	CABS1	71235482	1.000000	0.71417	0.999000	0.59377	0.426000	0.31534	2.373000	0.44266	2.142000	0.66516	0.528000	0.53228	GAC	-	NULL		0.378	CABS1-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	C4orf35	protein_coding	OTTHUMT00000251561.3	A	NM_033122		71235482	+1	no_errors	NM_033122	genbank	human	validated	54_36p	missense	SNP	0.994	G
MIR1324	100302212	genome.wustl.edu	37	3	75679944	75679944	+	RNA	SNP	C	C	T	rs7614638	byFrequency	TCGA-04-1648-01A-01W-0639-09	TCGA-04-1648-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cde94745-b8b6-474d-a28d-7f5548bd9f13	cc11f6ea-0d2f-476b-be91-c42f228d764a	g.chr3:75679944C>T	ENST00000408868.1	+	0	31					NR_031714.1				microRNA 1324																		CTGGTCCTGCCCTCACTGGGA	0.547																																																0			3											48.0	51.0	50.0					3																	75679944		1568	3576	5144	75762634			0					3	2011-09-12		2008-12-18	ENSG00000221795	ENSG00000221795		"""ncRNAs / Micro RNAs"""	35377	non-coding RNA	RNA, micro				MIRN1324			Standard	NR_031714		Approved	hsa-mir-1324	uc021xar.1				3.37:g.75679944C>T			75762634		RNA	SNP	-	NULL	ENST00000408868.1	37	NULL		3																																																																																			-	-		0.547	MIR1324-201	KNOWN	basic	miRNA	MIRN1324	miRNA		C	NR_031714		75762634	+1	no_errors	ENST00000408868	ensembl	human	known	54_36p	rna	SNP	0.159	T
GTF2A1	2957	genome.wustl.edu	37	14	81668965	81668965	+	Intron	SNP	G	G	T			TCGA-04-1648-01A-01W-0639-09	TCGA-04-1648-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cde94745-b8b6-474d-a28d-7f5548bd9f13	cc11f6ea-0d2f-476b-be91-c42f228d764a	g.chr14:81668965G>T	ENST00000553612.1	-	4	741				GTF2A1_ENST00000434192.2_Intron|SNORA79_ENST00000408376.1_RNA	NM_001278940.1|NM_015859.3	NP_001265869.1|NP_056943.1	P52655	TF2AA_HUMAN	general transcription factor IIA, 1, 19/37kDa						gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIIA complex (GO:0005672)	DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|TBP-class protein binding (GO:0017025)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)|upper_aerodigestive_tract(1)	12				BRCA - Breast invasive adenocarcinoma(234;0.0287)		tgcctgaagagtggtaaaccg	0.428																																																0			14																																								80738718	SO:0001627	intron_variant	0			X75383	CCDS9873.1, CCDS9874.1	14q31	2010-03-23	2002-08-29					"""General transcription factors"""	4646	protein-coding gene	gene with protein product		600520	"""glucose regulated protein, 58kD pseudogene"""			8224848	Standard	NM_015859		Approved	TFIIA	uc001xvf.2	P52655		ENST00000553612.1:c.338-963C>A	14.37:g.81668965G>T			80738718	Q3KNQ9	RNA	SNP	-	NULL	ENST00000553612.1	37	NULL	CCDS9873.1	14																																																																																			-	-		0.428	GTF2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000210351	protein_coding	OTTHUMT00000413309.1	G	NM_015859		80738718	+1	pseudogene	ENST00000387616	ensembl	human	novel	54_36p	rna	SNP	0.000	T
METTL25	84190	genome.wustl.edu	37	12	82872797	82872797	+	Silent	SNP	G	G	A			TCGA-04-1648-01A-01W-0639-09	TCGA-04-1648-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cde94745-b8b6-474d-a28d-7f5548bd9f13	cc11f6ea-0d2f-476b-be91-c42f228d764a	g.chr12:82872797G>A	ENST00000248306.3	+	12	1875	c.1806G>A	c.(1804-1806)caG>caA	p.Q602Q	RP11-263K4.5_ENST00000552532.1_lincRNA	NM_032230.2	NP_115606.2	Q8N6Q8	MET25_HUMAN	methyltransferase like 25	602							methyltransferase activity (GO:0008168)										TGAAGAAGCAGCAGTGATTTC	0.348																																																0			12											169.0	149.0	156.0					12																	82872797		2203	4300	6503	81396928	SO:0001819	synonymous_variant	84190			BC029120	CCDS9024.1	12q21.31	2012-08-13	2012-08-13	2012-08-13	ENSG00000127720	ENSG00000127720			26228	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 26"""	C12orf26			Standard	NM_032230		Approved	FLJ22789	uc001szq.3	Q8N6Q8	OTTHUMG00000170252	ENST00000248306.3:c.1806G>A	12.37:g.82872797G>A			81396928	Q9H5Y3	Silent	SNP	superfamily_S-adenosyl-L-methionine-dependent methyltransferases	p.Q602	ENST00000248306.3	37	c.1806	CCDS9024.1	12																																																																																			-	NULL		0.348	METTL25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C12orf26	protein_coding	OTTHUMT00000408192.1	G	NM_032230		81396928	+1	no_errors	NM_032230	genbank	human	predicted	54_36p	silent	SNP	0.985	A
ATP2C2	9914	genome.wustl.edu	37	16	84497251	84497251	+	Silent	SNP	C	C	T	rs375028020		TCGA-04-1648-01A-01W-0639-09	TCGA-04-1648-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cde94745-b8b6-474d-a28d-7f5548bd9f13	cc11f6ea-0d2f-476b-be91-c42f228d764a	g.chr16:84497251C>T	ENST00000262429.4	+	27	2843	c.2754C>T	c.(2752-2754)tcC>tcT	p.S918S	RP11-517C16.2_ENST00000565700.1_RNA|ATP2C2_ENST00000416219.2_Silent_p.S947S|ATP2C2_ENST00000420010.2_3'UTR	NM_014861.2	NP_055676.2	O75185	AT2C2_HUMAN	ATPase, Ca++ transporting, type 2C, member 2	918					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|prostate(3)|skin(5)|urinary_tract(1)	33						TGGCCTCATCCGTCTTCATTT	0.502																																																0			16						C		1,3867		0,1,1933	108.0	115.0	113.0		2754	-8.8	0.3	16		113	1,8271		0,1,4135	no	coding-synonymous	ATP2C2	NM_014861.2		0,2,6068	TT,TC,CC		0.0121,0.0259,0.0165		918/947	84497251	2,12138	1934	4136	6070	83054752	SO:0001819	synonymous_variant	9914			AK091051	CCDS42207.1, CCDS67088.1	16q24.1	2010-04-20			ENSG00000064270	ENSG00000064270	3.6.3.8	"""ATPases / P-type"""	29103	protein-coding gene	gene with protein product	"""secretory pathway calcium ATPase 2"""	613082				9734811	Standard	XM_006721355		Approved	KIAA0703, SPCA2	uc002fhx.3	O75185		ENST00000262429.4:c.2754C>T	16.37:g.84497251C>T			83054752	B4DU76|E7ES94|Q5HYC3|Q5S053|Q68CQ2	Silent	SNP	superfamily_Calcium ATPase transmembrane domain M,HMMPfam_Cation_ATPase_N,HMMPfam_E1-E2_ATPase,superfamily_Calcium ATPase transduction domain A,superfamily_HAD-like,HMMPfam_Hydrolase,PatternScan_ATPASE_E1_E2,superfamily_Metal cation-transporting ATPase ATP-binding domain N,HMMPfam_Cation_ATPase_C	p.S918	ENST00000262429.4	37	c.2754	CCDS42207.1	16																																																																																			-	superfamily_Calcium ATPase transmembrane domain M,HMMPfam_Cation_ATPase_C		0.502	ATP2C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP2C2	protein_coding	OTTHUMT00000433404.1	C	NM_014861		83054752	+1	no_errors	NM_014861	genbank	human	validated	54_36p	silent	SNP	0.964	T
SERPINE1	5054	genome.wustl.edu	37	7	100775177	100775177	+	Missense_Mutation	SNP	G	G	C	rs538785036		TCGA-04-1648-01A-01W-0639-09	TCGA-04-1648-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cde94745-b8b6-474d-a28d-7f5548bd9f13	cc11f6ea-0d2f-476b-be91-c42f228d764a	g.chr7:100775177G>C	ENST00000223095.4	+	4	684	c.527G>C	c.(526-528)gGg>gCg	p.G176A	SERPINE1_ENST00000445463.2_Missense_Mutation_p.G161A	NM_000602.4	NP_000593.1	P05121	PAI1_HUMAN	serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1	176					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cellular response to lipopolysaccharide (GO:0071222)|chronological cell aging (GO:0001300)|defense response to Gram-negative bacterium (GO:0050829)|extracellular matrix organization (GO:0030198)|fibrinolysis (GO:0042730)|gene expression (GO:0010467)|negative regulation of blood coagulation (GO:0030195)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of cell migration (GO:0030336)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of plasminogen activation (GO:0010757)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of smooth muscle cell-matrix adhesion (GO:2000098)|negative regulation of vascular wound healing (GO:0061044)|negative regulation of wound healing (GO:0061045)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood coagulation (GO:0030194)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of leukotriene production involved in inflammatory response (GO:0035491)|positive regulation of monocyte chemotaxis (GO:0090026)|positive regulation of receptor-mediated endocytosis (GO:0048260)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell proliferation (GO:0042127)|regulation of receptor activity (GO:0010469)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	protease binding (GO:0002020)|serine-type endopeptidase inhibitor activity (GO:0004867)			central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|prostate(3)	20	Lung NSC(181;0.136)|all_lung(186;0.182)				Alteplase(DB00009)|Anistreplase(DB00029)|Drotrecogin alfa(DB00055)|Reteplase(DB00015)|Tenecteplase(DB00031)|Urokinase(DB00013)	AACTTGCTTGGGAAAGGAGCC	0.507																																																0			7											131.0	131.0	131.0					7																	100775177		2203	4300	6503	100561897	SO:0001583	missense	5054			M16006	CCDS5711.1	7q22.1	2014-02-18	2005-08-18		ENSG00000106366	ENSG00000106366		"""Serine (or cysteine) peptidase inhibitors"""	8583	protein-coding gene	gene with protein product	"""plasminogen activator inhibitor, type I"""	173360	"""serine (or cysteine) proteinase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1"""	PLANH1, PAI1		3097076, 2891140, 24172014	Standard	NM_000602		Approved	PAI	uc003uxt.4	P05121	OTTHUMG00000157107	ENST00000223095.4:c.527G>C	7.37:g.100775177G>C	ENSP00000223095:p.Gly176Ala		100561897	B7Z4S0|F8WD53	Missense_Mutation	SNP	HMMPfam_Serpin,superfamily_Prot_inh_serpin,HMMSmart_SERPIN,PatternScan_SERPIN	p.G176A	ENST00000223095.4	37	c.527	CCDS5711.1	7	.	.	.	.	.	.	.	.	.	.	G	0.007	-1.995788	0.00435	.	.	ENSG00000106366	ENST00000223095;ENST00000445463	D;D	0.83837	-1.77;-1.77	5.19	1.22	0.21188	Serpin domain (3);	0.849578	0.10676	N	0.646909	T	0.56963	0.2021	N	0.02111	-0.68	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.001;0.002	T	0.45848	-0.9233	10	0.17369	T	0.5	.	6.8811	0.24173	0.1603:0.28:0.5597:0.0	.	161;176	F8WD53;P05121	.;PAI1_HUMAN	A	176;161	ENSP00000223095:G176A;ENSP00000396766:G161A	ENSP00000223095:G176A	G	+	2	0	SERPINE1	100561897	0.023000	0.18921	0.008000	0.14137	0.003000	0.03518	0.529000	0.23019	0.326000	0.23384	-0.300000	0.09419	GGG	-	HMMPfam_Serpin,superfamily_Prot_inh_serpin,HMMSmart_SERPIN		0.507	SERPINE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPINE1	protein_coding	OTTHUMT00000347458.1	G	NM_000602		100561897	+1	no_errors	NM_000602	genbank	human	validated	54_36p	missense	SNP	0.000	C
NXF3	56000	genome.wustl.edu	37	X	102339343	102339343	+	Missense_Mutation	SNP	T	T	C			TCGA-04-1648-01A-01W-0639-09	TCGA-04-1648-11A-01W-0639-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cde94745-b8b6-474d-a28d-7f5548bd9f13	cc11f6ea-0d2f-476b-be91-c42f228d764a	g.chrX:102339343T>C	ENST00000395065.3	-	3	379	c.278A>G	c.(277-279)gAg>gGg	p.E93G	NXF3_ENST00000425463.2_Missense_Mutation_p.E4G|NXF3_ENST00000425644.1_5'UTR	NM_022052.1	NP_071335.1	Q9H4D5	NXF3_HUMAN	nuclear RNA export factor 3	93					mRNA export from nucleus (GO:0006406)|poly(A)+ mRNA export from nucleus (GO:0016973)	cytoplasm (GO:0005737)|nuclear RNA export factor complex (GO:0042272)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)			NS(1)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(2)|lung(15)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	26						AGGTTTTTGCTCTCTCTCCAT	0.468																																																0			X											229.0	177.0	194.0					X																	102339343		2203	4300	6503	102225999	SO:0001583	missense	56000			AJ277527	CCDS14503.1	Xq22	2008-02-05			ENSG00000147206	ENSG00000147206			8073	protein-coding gene	gene with protein product		300316				11073998	Standard	NM_022052		Approved		uc004eju.3	Q9H4D5	OTTHUMG00000022088	ENST00000395065.3:c.278A>G	X.37:g.102339343T>C	ENSP00000378504:p.Glu93Gly		102225999	B4DYS7|Q5H9I1|Q9H1A9	Missense_Mutation	SNP	superfamily_RNA-binding domain RBD,HMMPfam_Tap-RNA_bind,superfamily_NTF2-like,HMMPfam_NTF2	p.E93G	ENST00000395065.3	37	c.278	CCDS14503.1	X	.	.	.	.	.	.	.	.	.	.	T	7.474	0.647199	0.14516	.	.	ENSG00000147206	ENST00000395065;ENST00000425463	T;T	0.47528	0.93;0.84	3.49	2.22	0.28083	.	1.419340	0.04092	N	0.311378	T	0.30572	0.0769	N	0.19112	0.55	0.09310	N	1	B;B	0.27068	0.167;0.012	B;B	0.22152	0.038;0.009	T	0.18116	-1.0347	10	0.23302	T	0.38	-0.1068	3.8039	0.08768	0.0:0.2295:0.0:0.7705	.	93;93	B4DYI1;Q9H4D5	.;NXF3_HUMAN	G	93;4	ENSP00000378504:E93G;ENSP00000404347:E4G	ENSP00000378504:E93G	E	-	2	0	NXF3	102225999	0.000000	0.05858	0.001000	0.08648	0.004000	0.04260	-0.032000	0.12266	0.504000	0.28082	0.441000	0.28932	GAG	-	NULL		0.468	NXF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NXF3	protein_coding	OTTHUMT00000057684.1	T	NM_022052		102225999	-1	no_errors	NM_022052	genbank	human	reviewed	54_36p	missense	SNP	0.001	C
Unknown	0	genome.wustl.edu	37	11	107047617	107047617	+	IGR	SNP	C	C	T			TCGA-04-1648-01A-01W-0639-09	TCGA-04-1648-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cde94745-b8b6-474d-a28d-7f5548bd9f13	cc11f6ea-0d2f-476b-be91-c42f228d764a	g.chr11:107047617C>T								GUCY1A2 (158367 upstream) : RP11-819C21.1 (135240 downstream)																							GAGAACCAAGCGCCTCCAGCT	0.582																																																0			11																																								106552827	SO:0001628	intergenic_variant	341230																															11.37:g.107047617C>T			106552827		RNA	SNP	-	NULL		37	NULL		11																																																																																			-	-	0	0.582					LOC341230			C			106552827	+1	pseudogene	XR_016383	genbank	human	model	54_36p	rna	SNP	0.997	T
SH3RF3	344558	genome.wustl.edu	37	2	110015215	110015215	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1648-01A-01W-0639-09	TCGA-04-1648-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cde94745-b8b6-474d-a28d-7f5548bd9f13	cc11f6ea-0d2f-476b-be91-c42f228d764a	g.chr2:110015215G>T	ENST00000309415.6	+	4	1115	c.1115G>T	c.(1114-1116)gGc>gTc	p.G372V		NM_001099289.1	NP_001092759.1	Q8TEJ3	SH3R3_HUMAN	SH3 domain containing ring finger 3	372							zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(6)|liver(2)|lung(5)|ovary(2)	18						CGTGTGGATGGCAAGAAGAAC	0.612																																																0			2											51.0	60.0	57.0					2																	110015215		2203	4300	6503	109381647	SO:0001583	missense	344558			AK074131	CCDS74557.1	2q13	2013-01-11	2008-05-14	2008-05-14	ENSG00000172985	ENSG00000172985		"""RING-type (C3HC4) zinc fingers"""	24699	protein-coding gene	gene with protein product			"""SH3 multiple domains 4"""	SH3MD4		16374509	Standard	XM_006712493		Approved	FLJ00204, POSH2	uc010ywt.1	Q8TEJ3	OTTHUMG00000153439	ENST00000309415.6:c.1115G>T	2.37:g.110015215G>T	ENSP00000309186:p.Gly372Val		109381647	A0SDZ7|A8MPR1|Q8NDU1	Missense_Mutation	SNP	superfamily_RING/U-box,HMMSmart_SM00184,HMMPfam_zf-C3HC4,PatternScan_ZF_RING_1,superfamily_SH3-domain,HMMPfam_SH3_1,HMMSmart_SM00326	p.G372V	ENST00000309415.6	37	c.1115		2	.	.	.	.	.	.	.	.	.	.	G	13.22	2.172329	0.38315	.	.	ENSG00000172985	ENST00000418513;ENST00000309415	T;T	0.06142	3.34;3.34	4.85	4.85	0.62838	.	0.430556	0.26688	N	0.023019	T	0.06050	0.0157	.	.	.	0.58432	D	0.999997	B	0.27068	0.167	B	0.28784	0.094	T	0.44050	-0.9353	9	0.25751	T	0.34	-6.5317	13.155	0.59511	0.0:0.0:0.8403:0.1597	.	372	Q8TEJ3	SH3R3_HUMAN	V	372	ENSP00000414997:G372V;ENSP00000309186:G372V	ENSP00000309186:G372V	G	+	2	0	SH3RF3	109381647	1.000000	0.71417	0.996000	0.52242	0.926000	0.56050	3.134000	0.50538	2.522000	0.85027	0.561000	0.74099	GGC	-	NULL		0.612	SH3RF3-201	KNOWN	basic|appris_principal	protein_coding	SH3RF3	protein_coding		G	NM_001099289		109381647	+1	no_stop_codon	NM_001099289	genbank	human	provisional	54_36p	missense	SNP	0.878	T
EPS8L3	79574	genome.wustl.edu	37	1	110293399	110293399	+	Silent	SNP	A	A	C			TCGA-04-1648-01A-01W-0639-09	TCGA-04-1648-11A-01W-0639-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cde94745-b8b6-474d-a28d-7f5548bd9f13	cc11f6ea-0d2f-476b-be91-c42f228d764a	g.chr1:110293399A>C	ENST00000361965.4	-	18	1759	c.1653T>G	c.(1651-1653)ctT>ctG	p.L551L	EPS8L3_ENST00000361852.4_Silent_p.L521L|RP4-735C1.4_ENST00000431955.1_RNA|EPS8L3_ENST00000369805.3_Silent_p.L552L	NM_133181.3	NP_573444.2	Q8TE67	ES8L3_HUMAN	EPS8-like 3	551						cytoplasm (GO:0005737)				breast(1)|endometrium(3)|large_intestine(6)|lung(15)|ovary(5)|skin(1)|upper_aerodigestive_tract(1)	32		all_epithelial(167;1.95e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)		Lung(183;0.0245)|Colorectal(144;0.0365)|all cancers(265;0.103)|Epithelial(280;0.109)|LUSC - Lung squamous cell carcinoma(189;0.137)|COAD - Colon adenocarcinoma(174;0.141)		TCAGGGACCCAAGTGTCCTCA	0.607																																																0			1											58.0	44.0	49.0					1																	110293399		2203	4300	6503	110094922	SO:0001819	synonymous_variant	79574			AK025175	CCDS813.1, CCDS814.1, CCDS815.1	1p13.2	2008-02-05			ENSG00000198758	ENSG00000198758			21297	protein-coding gene	gene with protein product		614989				12620401	Standard	NM_139053		Approved	FLJ21522, MGC16817	uc001dyq.2	Q8TE67	OTTHUMG00000011651	ENST00000361965.4:c.1653T>G	1.37:g.110293399A>C			110094922	A8K833|Q5T8Q6|Q5T8Q7|Q5T8Q8|Q96E47|Q9H719	Silent	SNP	HMMPfam_PTB,superfamily_SH3,HMMPfam_SH3_1,HMMSmart_SH3	p.L552	ENST00000361965.4	37	c.1656	CCDS814.1	1																																																																																			-	NULL		0.607	EPS8L3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	EPS8L3	protein_coding	OTTHUMT00000032234.1	A	NM_024526		110094922	-1	no_errors	NM_139053	genbank	human	reviewed	54_36p	silent	SNP	0.505	C
RHOC	389	genome.wustl.edu	37	1	113245197	113245197	+	Silent	SNP	G	G	C			TCGA-04-1648-01A-01W-0639-09	TCGA-04-1648-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cde94745-b8b6-474d-a28d-7f5548bd9f13	cc11f6ea-0d2f-476b-be91-c42f228d764a	g.chr1:113245197G>C	ENST00000285735.2	-	5	1605	c.396C>G	c.(394-396)gcC>gcG	p.A132A	RHOC_ENST00000369632.2_Silent_p.A132A|RHOC_ENST00000369633.2_Silent_p.A132A|RHOC_ENST00000369637.1_Silent_p.A132A|RHOC_ENST00000369636.2_Intron|RHOC_ENST00000369642.3_Silent_p.A132A|RHOC_ENST00000369638.2_Silent_p.A132A|RHOC_ENST00000339083.7_Silent_p.A132A|RP11-426L16.10_ENST00000471038.2_5'Flank			P08134	RHOC_HUMAN	ras homolog family member C	132					apical junction assembly (GO:0043297)|axon guidance (GO:0007411)|cytokinesis (GO:0000910)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cleavage furrow (GO:0032154)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|signal transducer activity (GO:0004871)			endometrium(1)|large_intestine(3)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	9	Lung SC(450;0.246)	all_cancers(81;1.44e-07)|all_epithelial(167;7.64e-07)|all_lung(203;2.16e-05)|Lung NSC(69;3.86e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		GCTTCATCTTGGCCAGCTCTC	0.602																																																0			1											125.0	117.0	119.0					1																	113245197		2203	4300	6503	113046720	SO:0001819	synonymous_variant	389			BC052808	CCDS854.1	1p13.1	2012-02-27	2012-02-27	2004-03-24	ENSG00000155366	ENSG00000155366			669	protein-coding gene	gene with protein product		165380	"""ras homolog gene family, member C"""	ARH9, ARHC		3283705	Standard	NM_001042678		Approved	RhoC	uc001ecp.1	P08134	OTTHUMG00000011905	ENST00000285735.2:c.396C>G	1.37:g.113245197G>C			113046720	B3KSW1|Q6ICN3	Silent	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMPfam_Ras,HMMSmart_SM00175,HMMSmart_SM00173,HMMSmart_SM00174	p.A132	ENST00000285735.2	37	c.396	CCDS854.1	1																																																																																			-	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMPfam_Ras,HMMSmart_SM00175,HMMSmart_SM00173,HMMSmart_SM00174		0.602	RHOC-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RHOC	protein_coding	OTTHUMT00000032904.2	G	NM_175744		113046720	-1	no_errors	NM_001042678	genbank	human	reviewed	54_36p	silent	SNP	1.000	C
TBX5	6910	genome.wustl.edu	37	12	114793709	114793709	+	Silent	SNP	G	G	A			TCGA-04-1648-01A-01W-0639-09	TCGA-04-1648-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cde94745-b8b6-474d-a28d-7f5548bd9f13	cc11f6ea-0d2f-476b-be91-c42f228d764a	g.chr12:114793709G>A	ENST00000310346.4	-	9	1851	c.1185C>T	c.(1183-1185)gaC>gaT	p.D395D	TBX5_ENST00000405440.2_Silent_p.D395D|TBX5_ENST00000349716.5_Silent_p.D345D	NM_000192.3	NP_000183.2	Q99593	TBX5_HUMAN	T-box 5	395					apoptotic nuclear changes (GO:0030262)|atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|bundle of His development (GO:0003166)|cardiac left ventricle formation (GO:0003218)|cardiac muscle cell differentiation (GO:0055007)|cell migration involved in coronary vasculogenesis (GO:0060980)|cell-cell signaling (GO:0007267)|embryonic forelimb morphogenesis (GO:0035115)|embryonic limb morphogenesis (GO:0030326)|endocardial cushion development (GO:0003197)|forelimb morphogenesis (GO:0035136)|gene expression (GO:0010467)|heart development (GO:0007507)|lung development (GO:0030324)|morphogenesis of an epithelium (GO:0002009)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|pattern specification process (GO:0007389)|pericardium development (GO:0060039)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cardioblast differentiation (GO:0051891)|positive regulation of secondary heart field cardioblast proliferation (GO:0072513)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of execution phase of apoptosis (GO:1900117)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ventricular cardiac muscle tissue development (GO:0003229)|ventricular septum development (GO:0003281)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(29)|ovary(6)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	Medulloblastoma(191;0.163)|all_neural(191;0.178)			BRCA - Breast invasive adenocarcinoma(302;0.0893)		TGCAGCTGATGTCCTCTAGGC	0.637																																					NSCLC(152;1358 1980 4050 23898 40356)											0			12											67.0	57.0	60.0					12																	114793709		2203	4300	6503	113278092	SO:0001819	synonymous_variant	6910			U89353	CCDS9173.1, CCDS9174.1	12q24.1	2014-09-17			ENSG00000089225	ENSG00000089225		"""T-boxes"""	11604	protein-coding gene	gene with protein product		601620		HOS		8988165, 8054982	Standard	NM_000192		Approved		uc001tvo.4	Q99593	OTTHUMG00000166191	ENST00000310346.4:c.1185C>T	12.37:g.114793709G>A			113278092	A6ND77|O15301|Q96TB0|Q9Y4I2	Silent	SNP	superfamily_p53-like transcription factors,HMMSmart_SM00425,HMMPfam_T-box,PatternScan_TBOX_1,PatternScan_TBOX_2	p.D395	ENST00000310346.4	37	c.1185	CCDS9173.1	12																																																																																			-	NULL		0.637	TBX5-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	TBX5	protein_coding	OTTHUMT00000388297.1	G	NM_080717		113278092	-1	no_errors	NM_000192	genbank	human	reviewed	54_36p	silent	SNP	1.000	A
FAM135B	51059	genome.wustl.edu	37	8	139180268	139180268	+	Silent	SNP	G	G	A			TCGA-04-1648-01A-01W-0639-09	TCGA-04-1648-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cde94745-b8b6-474d-a28d-7f5548bd9f13	cc11f6ea-0d2f-476b-be91-c42f228d764a	g.chr8:139180268G>A	ENST00000395297.1	-	12	1298	c.1128C>T	c.(1126-1128)tcC>tcT	p.S376S		NM_015912.3	NP_056996.2	Q49AJ0	F135B_HUMAN	family with sequence similarity 135, member B	376										NS(3)|breast(9)|endometrium(21)|kidney(5)|large_intestine(28)|liver(1)|lung(135)|ovary(9)|pancreas(1)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	238	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			GGATATCCAGGGACAGCTGGC	0.597										HNSCC(54;0.14)																																						0			8											98.0	106.0	103.0					8																	139180268		2109	4227	6336	139249450	SO:0001819	synonymous_variant	51059			AB196635	CCDS6375.2	8q24.23	2008-11-05			ENSG00000147724	ENSG00000147724			28029	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_015912		Approved	C8ORFK32	uc003yuy.3	Q49AJ0	OTTHUMG00000149864	ENST00000395297.1:c.1128C>T	8.37:g.139180268G>A			139249450	B5MDB3|O95879|Q2WGJ7|Q3KP46	Silent	SNP	superfamily_alpha/beta-Hydrolases,HMMPfam_DUF676	p.S376	ENST00000395297.1	37	c.1128	CCDS6375.2	8																																																																																			-	NULL		0.597	FAM135B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM135B	protein_coding	OTTHUMT00000313590.3	G	NM_015912		139249450	-1	no_errors	NM_015912	genbank	human	validated	54_36p	silent	SNP	0.626	A
ARHGEF5	7984	genome.wustl.edu	37	7	144059983	144059983	+	Missense_Mutation	SNP	C	C	T	rs201930383		TCGA-04-1648-01A-01W-0639-09	TCGA-04-1648-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cde94745-b8b6-474d-a28d-7f5548bd9f13	cc11f6ea-0d2f-476b-be91-c42f228d764a	g.chr7:144059983C>T	ENST00000056217.5	+	2	395	c.221C>T	c.(220-222)aCg>aTg	p.T74M		NM_005435.3	NP_005426.2	Q12774	ARHG5_HUMAN	Rho guanine nucleotide exchange factor (GEF) 5	74					actin cytoskeleton organization (GO:0030036)|intracellular signal transduction (GO:0035556)|myeloid dendritic cell chemotaxis (GO:0002408)|positive regulation of podosome assembly (GO:0071803)|regulation of Rho GTPase activity (GO:0032319)		GTP binding (GO:0005525)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|endometrium(6)|kidney(8)|large_intestine(9)|liver(1)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	Melanoma(164;0.14)					GCGATTGAGACGATGCCCTCT	0.517																																																0			7											1.0	1.0	1.0					7																	144059983		266	701	967	143690916	SO:0001583	missense	7984			U02082	CCDS34771.1	7q35	2012-09-20			ENSG00000050327	ENSG00000050327		"""Rho guanine nucleotide exchange factors"""	13209	protein-coding gene	gene with protein product	"""transforming immortalized mammary oncogene"", ""guanine nucleotide regulatory protein TIM"""	600888				8134109, 7656213	Standard	NM_005435		Approved	TIM, TIM1, GEF5, P60	uc003wel.3	Q12774	OTTHUMG00000158004	ENST00000056217.5:c.221C>T	7.37:g.144059983C>T	ENSP00000056217:p.Thr74Met		143690916	A6NNJ2|Q6ZML7	Missense_Mutation	SNP	superfamily_DBL homology domain (DH-domain),HMMPfam_RhoGEF,HMMSmart_SM00325,PatternScan_DH_1,superfamily_PH domain-like,HMMPfam_PH,HMMSmart_SM00233,superfamily_SH3-domain,HMMSmart_SM00326,HMMPfam_SH3_2	p.T74M	ENST00000056217.5	37	c.221	CCDS34771.1	7	.	.	.	.	.	.	.	.	.	.	C	10.33	1.321550	0.23994	.	.	ENSG00000050327	ENST00000056217	T	0.74209	-0.82	4.1	-1.59	0.08453	.	0.814122	0.10096	U	0.716573	T	0.55337	0.1914	L	0.36672	1.1	0.09310	N	1	B	0.11235	0.004	B	0.04013	0.001	T	0.34625	-0.9821	9	.	.	.	-0.3799	1.2603	0.02000	0.2161:0.3427:0.2828:0.1584	.	74	Q12774	ARHG5_HUMAN	M	74	ENSP00000056217:T74M	.	T	+	2	0	ARHGEF5	143690916	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.306000	0.08178	-0.185000	0.10550	-2.218000	0.00297	ACG	-	NULL		0.517	ARHGEF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGEF5	protein_coding	OTTHUMT00000349981.1	C	NM_005435		143690916	+1	no_errors	NM_005435	genbank	human	reviewed	54_36p	missense	SNP	0.000	T
CSF1R	1436	genome.wustl.edu	37	5	149459728	149459728	+	Missense_Mutation	SNP	T	T	C			TCGA-04-1648-01A-01W-0639-09	TCGA-04-1648-11A-01W-0639-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cde94745-b8b6-474d-a28d-7f5548bd9f13	cc11f6ea-0d2f-476b-be91-c42f228d764a	g.chr5:149459728T>C	ENST00000286301.3	-	4	770	c.479A>G	c.(478-480)cAt>cGt	p.H160R	CSF1R_ENST00000543093.1_Missense_Mutation_p.H160R	NM_005211.3	NP_005202.2	P07333	CSF1R_HUMAN	colony stimulating factor 1 receptor	160	Ig-like C2-type 2.				cell proliferation (GO:0008283)|cell-cell junction maintenance (GO:0045217)|cellular response to cytokine stimulus (GO:0071345)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cytokine-mediated signaling pathway (GO:0019221)|hemopoiesis (GO:0030097)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|macrophage differentiation (GO:0030225)|mammary gland duct morphogenesis (GO:0060603)|monocyte differentiation (GO:0030224)|multicellular organismal development (GO:0007275)|osteoclast differentiation (GO:0030316)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol metabolic process (GO:0046488)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell migration (GO:0030335)|positive regulation of cell motility (GO:2000147)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|protein autophosphorylation (GO:0046777)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of bone resorption (GO:0045124)|regulation of cell shape (GO:0008360)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|macrophage colony-stimulating factor receptor activity (GO:0005011)|protein homodimerization activity (GO:0042803)			NS(2)|breast(2)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(38)|kidney(2)|large_intestine(6)|liver(3)|lung(23)|ovary(2)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	93			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)		Imatinib(DB00619)|Sunitinib(DB01268)	GGTGAAGCCATGCCAGGGCGA	0.612																																																0			5											77.0	63.0	68.0					5																	149459728		2203	4300	6503	149439921	SO:0001583	missense	1436			U63963	CCDS4302.1	5q32	2013-01-11	2008-08-01		ENSG00000182578	ENSG00000182578		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	2433	protein-coding gene	gene with protein product		164770	"""McDonough feline sarcoma viral (v-fms) oncogene homolog"""	FMS		1611909	Standard	NM_005211		Approved	C-FMS, CSFR, CD115	uc003lrm.3	P07333	OTTHUMG00000130050	ENST00000286301.3:c.479A>G	5.37:g.149459728T>C	ENSP00000286301:p.His160Arg		149439921	B5A955|D3DQG2|Q6LDW5|Q6LDY4|Q86VW7	Missense_Mutation	SNP	HMMPfam_V-set,superfamily_SSF48726,HMMSmart_IG,HMMSmart_IGc2,HMMPfam_ig,superfamily_Kinase_like,HMMPfam_Pkinase_Tyr,HMMSmart_TyrKc,PatternScan_PROTEIN_KINASE_ATP,PatternScan_RECEPTOR_TYR_KIN_III,PatternScan_PROTEIN_KINASE_TYR	p.H160R	ENST00000286301.3	37	c.479	CCDS4302.1	5	.	.	.	.	.	.	.	.	.	.	T	0.688	-0.795711	0.02862	.	.	ENSG00000182578	ENST00000286301;ENST00000394307;ENST00000543093;ENST00000511344	T;T	0.04551	3.6;3.6	4.72	1.63	0.23807	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	1.649280	0.03878	N	0.276735	T	0.02230	0.0069	N	0.03608	-0.345	0.09310	N	1	B;B;B;B	0.09022	0.002;0.001;0.0;0.0	B;B;B;B	0.08055	0.003;0.001;0.001;0.001	T	0.38972	-0.9636	10	0.02654	T	1	.	5.8752	0.18824	0.0:0.356:0.0:0.644	.	160;160;12;160	B4DG86;B5A955;B4E2Y8;P07333	.;.;.;CSF1R_HUMAN	R	160;12;160;12	ENSP00000286301:H160R;ENSP00000445282:H160R	ENSP00000286301:H160R	H	-	2	0	CSF1R	149439921	0.001000	0.12720	0.000000	0.03702	0.251000	0.25915	0.741000	0.26202	0.045000	0.15804	0.459000	0.35465	CAT	-	superfamily_SSF48726,HMMSmart_IG		0.612	CSF1R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSF1R	protein_coding	OTTHUMT00000252329.2	T	NM_005211		149439921	-1	no_errors	NM_005211	genbank	human	reviewed	54_36p	missense	SNP	0.002	C
TUFT1	7286	genome.wustl.edu	37	1	151530317	151530317	+	Intron	SNP	G	G	A	rs576116017		TCGA-04-1648-01A-01W-0639-09	TCGA-04-1648-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cde94745-b8b6-474d-a28d-7f5548bd9f13	cc11f6ea-0d2f-476b-be91-c42f228d764a	g.chr1:151530317G>A	ENST00000368849.3	+	2	122				TUFT1_ENST00000392712.3_Intron|RP11-74C1.4_ENST00000434112.1_RNA|TUFT1_ENST00000353024.3_Intron|TUFT1_ENST00000368848.2_Intron|TUFT1_ENST00000538902.1_Intron	NM_020127.2	NP_064512.1	Q9NNX1	TUFT1_HUMAN	tuftelin 1						bone mineralization (GO:0030282)|odontogenesis (GO:0042476)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	structural constituent of tooth enamel (GO:0030345)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(3)|prostate(1)|skin(1)	13	Ovarian(49;0.0273)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)			GTGCTGTGCCGCCTGGTGCCG	0.552																																																0			1																																								149796941	SO:0001627	intron_variant	729374			AF254260	CCDS1000.1, CCDS44223.1	1q21	2008-02-05			ENSG00000143367	ENSG00000143367			12422	protein-coding gene	gene with protein product		600087				7919663	Standard	NM_020127		Approved		uc001eyl.3	Q9NNX1	OTTHUMG00000012536	ENST00000368849.3:c.61-4250G>A	1.37:g.151530317G>A			149796941	B2RD57|D3DV21|D3DV22|Q5T384|Q5T385|Q9BU28|Q9H5L1	RNA	SNP	-	NULL	ENST00000368849.3	37	NULL	CCDS1000.1	1																																																																																			-	-		0.552	TUFT1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC729374	protein_coding	OTTHUMT00000035022.1	G	NM_020127		149796941	+1	pseudogene	XR_015991	genbank	human	model	54_36p	rna	SNP	0.998	A
DUSP9	1852	genome.wustl.edu	37	X	152915087	152915087	+	Silent	SNP	C	C	T	rs145220210	byFrequency	TCGA-04-1648-01A-01W-0639-09	TCGA-04-1648-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cde94745-b8b6-474d-a28d-7f5548bd9f13	cc11f6ea-0d2f-476b-be91-c42f228d764a	g.chrX:152915087C>T	ENST00000342782.3	+	3	1039	c.774C>T	c.(772-774)tcC>tcT	p.S258S	DUSP9_ENST00000370167.4_Silent_p.S258S			Q99956	DUS9_HUMAN	dual specificity phosphatase 9	258	Tyrosine-protein phosphatase.				inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(2)|prostate(1)	16	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					TCCCCATCTCCGACCACTGGA	0.567													c|||	1	0.000264901	0.0	0.0	3775	,	,		11562	0.001		0.0	False		,,,				2504	0.0															0			X											94.0	97.0	96.0					X																	152915087		2203	4300	6503	152568281	SO:0001819	synonymous_variant	1852			Y08302	CCDS14724.1	Xq28	2011-06-09			ENSG00000130829	ENSG00000130829		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3076	protein-coding gene	gene with protein product	"""map kinase phosphatase 4"""	300134				9030581, 9286695	Standard	NM_001395		Approved	MKP-4, MKP4	uc004fhx.4	Q99956	OTTHUMG00000024211	ENST00000342782.3:c.774C>T	X.37:g.152915087C>T			152568281	D3DWU5	Silent	SNP	PatternScan_TYR_PHOSPHATASE_1,superfamily_Rhodanese-like,HMMSmart_RHOD,superfamily_SSF52799,HMMPfam_DSPc,HMMSmart_DSPc	p.S258	ENST00000342782.3	37	c.774	CCDS14724.1	X	1	6.027727546714888E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	c	8.384	0.838095	0.16891	.	.	ENSG00000130829	ENST00000433144	.	.	.	5.4	-10.8	0.00216	.	.	.	.	.	T	0.34395	0.0896	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.50415	-0.8831	4	.	.	.	.	3.1122	0.06363	0.1402:0.1271:0.3824:0.3503	.	.	.	.	L	229	.	.	P	+	2	0	DUSP9	152568281	0.000000	0.05858	0.236000	0.24074	0.973000	0.67179	-6.618000	0.00059	-3.872000	0.00096	-1.222000	0.01597	CCG	-	superfamily_SSF52799,HMMPfam_DSPc,HMMSmart_DSPc		0.567	DUSP9-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	DUSP9	protein_coding	OTTHUMT00000061022.3	C	NM_001395		152568281	+1	no_errors	NM_001395	genbank	human	reviewed	54_36p	silent	SNP	0.053	T
FGA	2243	genome.wustl.edu	37	4	155508772	155508772	+	Silent	SNP	C	C	A			TCGA-04-1648-01A-01W-0639-09	TCGA-04-1648-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cde94745-b8b6-474d-a28d-7f5548bd9f13	cc11f6ea-0d2f-476b-be91-c42f228d764a	g.chr4:155508772C>A	ENST00000302053.3	-	4	480	c.402G>T	c.(400-402)ctG>ctT	p.L134L	FGA_ENST00000403106.3_Silent_p.L134L	NM_000508.3	NP_000499.1	P02671	FIBA_HUMAN	fibrinogen alpha chain	134					blood coagulation (GO:0007596)|blood coagulation, common pathway (GO:0072377)|cell-matrix adhesion (GO:0007160)|cellular protein complex assembly (GO:0043623)|extracellular matrix organization (GO:0030198)|negative regulation of blood coagulation, common pathway (GO:2000261)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of exocytosis (GO:0045921)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of peptide hormone secretion (GO:0090277)|positive regulation of protein secretion (GO:0050714)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of vasoconstriction (GO:0045907)|protein polymerization (GO:0051258)|response to calcium ion (GO:0051592)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|cell cortex (GO:0005938)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	structural molecule activity (GO:0005198)			NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|liver(2)|lung(20)|ovary(3)|pancreas(1)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	73	all_hematologic(180;0.215)	Renal(120;0.0458)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Sucralfate(DB00364)|Tenecteplase(DB00031)	TTCTGCTTCTCAGATCCTCTG	0.398																																					NSCLC(143;340 1922 20892 22370 48145)											0			4											178.0	162.0	167.0					4																	155508772		2203	4300	6503	155728222	SO:0001819	synonymous_variant	2243				CCDS3787.1, CCDS47152.1	4q28	2014-09-17			ENSG00000171560	ENSG00000171560		"""Fibrinogen C domain containing"", ""Endogenous ligands"""	3661	protein-coding gene	gene with protein product		134820	"""fibrinogen, A alpha polypeptide"""				Standard	NM_000508		Approved		uc003iod.1	P02671	OTTHUMG00000150330	ENST00000302053.3:c.402G>T	4.37:g.155508772C>A			155728222	A8K3E4|D3DP14|D3DP15|Q4QQH7|Q9BX62|Q9UCH2	Silent	SNP	HMMPfam_Fib_alpha,superfamily_Fibrinogen C-terminal domain-like,HMMSmart_SM00186,HMMPfam_Fibrinogen_C,PatternScan_FIBRIN_AG_C_DOMAIN	p.L134	ENST00000302053.3	37	c.402	CCDS3787.1	4																																																																																			-	HMMPfam_Fib_alpha		0.398	FGA-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	FGA	protein_coding	OTTHUMT00000317593.1	C	NM_000508		155728222	-1	no_errors	NM_000508	genbank	human	reviewed	54_36p	silent	SNP	0.996	A
RAPGEF2	9693	genome.wustl.edu	37	4	160277199	160277199	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1648-01A-01W-0639-09	TCGA-04-1648-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cde94745-b8b6-474d-a28d-7f5548bd9f13	cc11f6ea-0d2f-476b-be91-c42f228d764a	g.chr4:160277199G>A	ENST00000264431.4	+	23	4782	c.4363G>A	c.(4363-4365)Ggg>Agg	p.G1455R		NM_014247.2	NP_055062.1	Q9Y4G8	RPGF2_HUMAN	Rap guanine nucleotide exchange factor (GEF) 2	1455					adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|blood vessel development (GO:0001568)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|cellular response to nerve growth factor stimulus (GO:1990090)|establishment of endothelial barrier (GO:0061028)|forebrain neuron development (GO:0021884)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|MAPK cascade (GO:0000165)|negative regulation of cell proliferation (GO:0008285)|negative regulation of dendrite morphogenesis (GO:0050774)|negative regulation of melanin biosynthetic process (GO:0048022)|nerve growth factor signaling pathway (GO:0038180)|neuron migration (GO:0001764)|neuron projection development (GO:0031175)|neuropeptide signaling pathway (GO:0007218)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of dendritic cell apoptotic process (GO:2000670)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron migration (GO:2001224)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein binding (GO:0032092)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of Rap GTPase activity (GO:0032854)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of vasculogenesis (GO:2001214)|Rap protein signal transduction (GO:0032486)|regulation of cell junction assembly (GO:1901888)|regulation of synaptic plasticity (GO:0048167)|small GTPase mediated signal transduction (GO:0007264)|ventricular system development (GO:0021591)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|synapse (GO:0045202)	beta-1 adrenergic receptor binding (GO:0031697)|calcium ion binding (GO:0005509)|cAMP binding (GO:0030552)|diacylglycerol binding (GO:0019992)|PDZ domain binding (GO:0030165)|Rap GTPase activator activity (GO:0046582)|Rap guanyl-nucleotide exchange factor activity (GO:0017034)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|signal transducer activity (GO:0004871)|WW domain binding (GO:0050699)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	70	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.0817)		GCAGCCACATGGGCATCCCAC	0.607																																																0			4											35.0	41.0	39.0					4																	160277199		2158	4259	6417	160496649	SO:0001583	missense	9693			AB002311	CCDS43277.1	4q32.1	2004-03-01	2004-03-01	2004-03-01					16854	protein-coding gene	gene with protein product	"""Rap GEP"""	609530	"""PDZ domain containing guanine nucleotide exchange factor (GEF) 1"""	PDZGEF1		9205841, 10934204	Standard	NM_014247		Approved	PDZ-GEF1, RA-GEF, DKFZP586O1422, KIAA0313	uc003iqg.4	Q9Y4G8		ENST00000264431.4:c.4363G>A	4.37:g.160277199G>A	ENSP00000264431:p.Gly1455Arg		160496649	D3DP27	Missense_Mutation	SNP	superfamily_cNMP_binding,HMMSmart_cNMP,HMMPfam_cNMP_binding,superfamily_Ras_GEF,HMMSmart_RasGEFN,HMMPfam_RasGEF_N,superfamily_PDZ,HMMSmart_PDZ,HMMPfam_PDZ,HMMPfam_RA,HMMSmart_RA,HMMSmart_RasGEF,HMMPfam_RasGEF	p.G1455R	ENST00000264431.4	37	c.4363	CCDS43277.1	4	.	.	.	.	.	.	.	.	.	.	G	10.96	1.498647	0.26861	.	.	ENSG00000109756	ENST00000264431	T	0.36340	1.26	5.37	-0.309	0.12769	.	0.797292	0.11459	N	0.561926	T	0.14356	0.0347	N	0.08118	0	0.09310	N	1	B	0.23316	0.083	B	0.18263	0.021	T	0.26189	-1.0110	10	0.20046	T	0.44	.	3.9947	0.09553	0.1477:0.3313:0.4073:0.1138	.	1455	Q9Y4G8	RPGF2_HUMAN	R	1455	ENSP00000264431:G1455R	ENSP00000264431:G1455R	G	+	1	0	RAPGEF2	160496649	0.794000	0.28838	0.002000	0.10522	0.160000	0.22226	1.676000	0.37565	0.209000	0.20645	0.563000	0.77884	GGG	-	NULL		0.607	RAPGEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAPGEF2	protein_coding	OTTHUMT00000364980.2	G	NM_014247		160496649	+1	no_errors	NM_014247	genbank	human	validated	54_36p	missense	SNP	0.000	A
BAHD1	22893	genome.wustl.edu	37	15	40758152	40758152	+	Frame_Shift_Del	DEL	G	G	-	rs557629732		TCGA-04-1648-01A-01W-0639-09	TCGA-04-1648-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cde94745-b8b6-474d-a28d-7f5548bd9f13	cc11f6ea-0d2f-476b-be91-c42f228d764a	g.chr15:40758152delG	ENST00000416165.1	+	7	2237	c.2166delG	c.(2164-2166)atgfs	p.M722fs	BAHD1_ENST00000561234.1_Frame_Shift_Del_p.M721fs|BAHD1_ENST00000560846.1_Frame_Shift_Del_p.M719fs|RP11-64K12.8_ENST00000559730.1_RNA	NM_014952.3	NP_055767.3	Q8TBE0	BAHD1_HUMAN	bromo adjacent homology domain containing 1	722	BAH. {ECO:0000255|PROSITE- ProRule:PRU00370}.				heterochromatin assembly (GO:0031507)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	chromatin silencing complex (GO:0005677)|chromosome (GO:0005694)	chromatin binding (GO:0003682)			NS(1)|endometrium(6)|kidney(3)|large_intestine(3)|lung(10)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	28		all_cancers(109;8.28e-19)|all_epithelial(112;2.64e-15)|Lung NSC(122;5.14e-11)|all_lung(180;1.27e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;3.46e-06)|BRCA - Breast invasive adenocarcinoma(123;0.08)		TCTGTGCCATGGCCAAGCGCC	0.577																																																0			15											111.0	102.0	105.0					15																	40758152		2203	4300	6503	38545444	SO:0001589	frameshift_variant	22893			AL833923	CCDS10058.1, CCDS73705.1	15q14	2005-11-10			ENSG00000140320	ENSG00000140320			29153	protein-coding gene	gene with protein product		613880				10231032	Standard	XM_005254229		Approved	KIAA0945	uc001zlu.2	Q8TBE0	OTTHUMG00000129982	ENST00000416165.1:c.2166delG	15.37:g.40758152delG	ENSP00000396976:p.Met722fs		38545444	Q8NDF7|Q9Y2F4	Frame_Shift_Del	DEL	HMMPfam_BAH,HMMSmart_SM00439	p.A723fs	ENST00000416165.1	37	c.2166	CCDS10058.1	15																																																																																			(deletion:cds_exon[38545432,38545621])	HMMSmart_SM00439		0.577	BAHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BAHD1	protein_coding	OTTHUMT00000252248.1	G	NM_014952		38545444	+1	no_errors	NM_014952	genbank	human	validated	54_36p	frame_shift_del	DEL	1.000	-
SLC9A8	23315	genome.wustl.edu	37	20	48500588	48500588	+	Frame_Shift_Del	DEL	C	C	-			TCGA-04-1648-01A-01W-0639-09	TCGA-04-1648-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	cde94745-b8b6-474d-a28d-7f5548bd9f13	cc11f6ea-0d2f-476b-be91-c42f228d764a	g.chr20:48500588delC	ENST00000361573.2	+	14	1518	c.1476delC	c.(1474-1476)agcfs	p.S492fs	SLC9A8_ENST00000417961.1_Frame_Shift_Del_p.S508fs|SLC9A8_ENST00000541138.1_Frame_Shift_Del_p.S192fs|SLC9A8_ENST00000539601.1_Frame_Shift_Del_p.S273fs			Q9Y2E8	SL9A8_HUMAN	solute carrier family 9, subfamily A (NHE8, cation proton antiporter 8), member 8	492					ion transport (GO:0006811)|regulation of intracellular pH (GO:0051453)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	potassium:proton antiporter activity (GO:0015386)|sodium:proton antiporter activity (GO:0015385)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(8)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	30			BRCA - Breast invasive adenocarcinoma(9;3.91e-07)			TCAACCTCAGCAAGACTGAGA	0.617																																																0			20											133.0	109.0	117.0					20																	48500588		2203	4300	6503	47933995	SO:0001589	frameshift_variant	23315			AB023156	CCDS13421.1, CCDS58774.1	20q13.13	2013-05-22	2012-03-22		ENSG00000197818	ENSG00000197818		"""Solute carriers"""	20728	protein-coding gene	gene with protein product		612730	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 8"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 8"""			12409279	Standard	NM_001260491		Approved	KIAA0939, NHE8	uc002xuv.2	Q9Y2E8	OTTHUMG00000032710	ENST00000361573.2:c.1476delC	20.37:g.48500588delC	ENSP00000354966:p.Ser492fs		47933995	B4DTQ8|Q2M1U9|Q68CZ8|Q9BX15|Q9Y507	Frame_Shift_Del	DEL	HMMPfam_Na_H_Exchanger	p.S492fs	ENST00000361573.2	37	c.1476	CCDS13421.1	20																																																																																			(deletion:cds_exon[47933790,47934010])	NULL		0.617	SLC9A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9A8	protein_coding	OTTHUMT00000106483.3	C	XM_030524		47933995	+1	no_errors	NM_015266	genbank	human	validated	54_36p	frame_shift_del	DEL	1.000	-
