#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	SNP	G	G	A			TCGA-04-1651-01A-01W-0639-09	TCGA-04-1651-11A-01W-0639-09	G	G					Unknown	Invalid:failed_liftOver	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f02d550d-d80c-449f-9d69-37ffb1e649b6	8e8ba185-6faf-49df-9784-594e179731c5	g.chrUnknown:0G>A								None (None upstream) : None (None downstream)																								0.0																																																0			MT																																								2708	SO:0001628	intergenic_variant	0																															Unknown.37:g.0G>A			2708		RNA	SNP	-	NULL		37	NULL		MT																																																																																			-	-	0	0					ENSG00000210082			G			2708	+1	no_errors	ENST00000387347	ensembl	human	known	54_36p	rna	SNP	NULL	A
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	SNP	T	T	C			TCGA-04-1651-01A-01W-0639-09	TCGA-04-1651-11A-01W-0639-09	T	T					Unknown	Invalid:failed_liftOver	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f02d550d-d80c-449f-9d69-37ffb1e649b6	8e8ba185-6faf-49df-9784-594e179731c5	g.chrUnknown:0T>C								None (None upstream) : None (None downstream)																								0.0																																																0			MT																																								6777	SO:0001628	intergenic_variant	4512																															Unknown.37:g.0T>C			6777		Silent	SNP	superfamily_Cytochrome c oxidase subunit I-like,HMMPfam_COX1,PatternScan_COX1_CUB	p.H291		37	c.873		MT																																																																																			-	superfamily_Cytochrome c oxidase subunit I-like,HMMPfam_COX1,PatternScan_COX1_CUB	0	0					MT-CO1			T			6777	+1	no_stop_codon	ENST00000361624	ensembl	human	known	54_36p	silent	SNP	NULL	C
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	SNP	T	T	C			TCGA-04-1651-01A-01W-0639-09	TCGA-04-1651-11A-01W-0639-09	T	T					Unknown	Invalid:failed_liftOver	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f02d550d-d80c-449f-9d69-37ffb1e649b6	8e8ba185-6faf-49df-9784-594e179731c5	g.chrUnknown:0T>C								None (None upstream) : None (None downstream)																								0.0																																																0			MT																																								7029	SO:0001628	intergenic_variant	4512																															Unknown.37:g.0T>C			7029		Silent	SNP	HMMPfam_COX1,PatternScan_COX1_CUB,superfamily_Cytochrome c oxidase subunit I-like	p.A375		37	c.1125		MT																																																																																			-	HMMPfam_COX1,superfamily_Cytochrome c oxidase subunit I-like	0	0					MT-CO1			T			7029	+1	no_stop_codon	ENST00000361624	ensembl	human	known	54_36p	silent	SNP	NULL	C
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	SNP	T	T	C			TCGA-04-1651-01A-01W-0639-09	TCGA-04-1651-11A-01W-0639-09	T	T					Unknown	Invalid:failed_liftOver	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f02d550d-d80c-449f-9d69-37ffb1e649b6	8e8ba185-6faf-49df-9784-594e179731c5	g.chrUnknown:0T>C								None (None upstream) : None (None downstream)																								0.0																																																0			MT																																								9707	SO:0001628	intergenic_variant	4514																															Unknown.37:g.0T>C			9707		Missense_Mutation	SNP	superfamily_CytC_oxdse_III,HMMPfam_COX3	p.I167T		37	c.500		MT																																																																																			-	superfamily_CytC_oxdse_III,HMMPfam_COX3	0	0					MT-CO3			T			9707	+1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000362079	ensembl	human	known	54_36p	missense	SNP	NULL	C
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	SNP	A	A	G			TCGA-04-1651-01A-01W-0639-09	TCGA-04-1651-11A-01W-0639-09	A	A					Unknown	Invalid:failed_liftOver	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f02d550d-d80c-449f-9d69-37ffb1e649b6	8e8ba185-6faf-49df-9784-594e179731c5	g.chrUnknown:0A>G								None (None upstream) : None (None downstream)																								0.0																																																0			MT																																								11720	SO:0001628	intergenic_variant	4538																															Unknown.37:g.0A>G			11720		Silent	SNP	HMMPfam_Oxidored_q5_N,HMMPfam_Oxidored_q1	p.G320		37	c.960		MT																																																																																			-	HMMPfam_Oxidored_q1	0	0					MT-ND4			A			11720	+1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000361381	ensembl	human	known	54_36p	silent	SNP	NULL	G
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	SNP	T	T	C			TCGA-04-1651-01A-01W-0639-09	TCGA-04-1651-11A-01W-0639-09	T	T					Unknown	Invalid:failed_liftOver	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f02d550d-d80c-449f-9d69-37ffb1e649b6	8e8ba185-6faf-49df-9784-594e179731c5	g.chrUnknown:0T>C								None (None upstream) : None (None downstream)																								0.0																																																0			MT																																								13405	SO:0001628	intergenic_variant	4540																															Unknown.37:g.0T>C			13405		Silent	SNP	HMMPfam_Oxidored_q1_N,HMMPfam_Oxidored_q1,HMMPfam_NADH5_C	p.I356		37	c.1068		MT																																																																																			-	HMMPfam_Oxidored_q1	0	0					MT-ND5			T			13405	+1	no_errors	ENST00000361567	ensembl	human	known	54_36p	silent	SNP	NULL	C
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	SNP	C	C	T			TCGA-04-1651-01A-01W-0639-09	TCGA-04-1651-11A-01W-0639-09	C	C					Unknown	Invalid:failed_liftOver	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f02d550d-d80c-449f-9d69-37ffb1e649b6	8e8ba185-6faf-49df-9784-594e179731c5	g.chrUnknown:0C>T								None (None upstream) : None (None downstream)																								0.0																																																0			MT																																								14126	SO:0001628	intergenic_variant	4540																															Unknown.37:g.0C>T			14126		Silent	SNP	HMMPfam_Oxidored_q1_N,HMMPfam_Oxidored_q1,HMMPfam_NADH5_C	p.L597		37	c.1789		MT																																																																																			-	HMMPfam_NADH5_C	0	0					MT-ND5			C			14126	+1	no_errors	ENST00000361567	ensembl	human	known	54_36p	silent	SNP	NULL	T
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	SNP	T	T	C			TCGA-04-1651-01A-01W-0639-09	TCGA-04-1651-11A-01W-0639-09	T	T					Unknown	Invalid:failed_liftOver	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f02d550d-d80c-449f-9d69-37ffb1e649b6	8e8ba185-6faf-49df-9784-594e179731c5	g.chrUnknown:0T>C								None (None upstream) : None (None downstream)																								0.0																																																0			MT																																								14767	SO:0001628	intergenic_variant	4519																															Unknown.37:g.0T>C			14767		Missense_Mutation	SNP	superfamily_Transmembr_di-haem_cytochrome,HMMPfam_Cytochrom_B_N,HMMPfam_Cytochrom_B_C,superfamily_Cytochrome_b/b6_C	p.I7T		37	c.20		MT																																																																																			-	superfamily_Transmembr_di-haem_cytochrome	0	0					MT-CYB			T			14767	+1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000361789	ensembl	human	known	54_36p	missense	SNP	NULL	C
CLCN7	1186	genome.wustl.edu	37	16	1507737	1507737	+	Silent	SNP	G	G	A	rs117183989	byFrequency	TCGA-04-1651-01A-01W-0639-09	TCGA-04-1651-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f02d550d-d80c-449f-9d69-37ffb1e649b6	8e8ba185-6faf-49df-9784-594e179731c5	g.chr16:1507737G>A	ENST00000382745.4	-	8	1301	c.696C>T	c.(694-696)tcC>tcT	p.S232S	CLCN7_ENST00000448525.1_Silent_p.S208S|CLCN7_ENST00000262318.8_Silent_p.S208S	NM_001287.5	NP_001278.1	P51798	CLCN7_HUMAN	chloride channel, voltage-sensitive 7	232					chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|response to pH (GO:0009268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)			breast(2)|central_nervous_system(3)|endometrium(3)|kidney(3)|large_intestine(2)|lung(8)|ovary(1)|skin(2)	24		Hepatocellular(780;0.0893)				GGATCACACCGGACACTTTGA	0.607													G|||	25	0.00499201	0.0	0.0101	5008	,	,		17715	0.0		0.0169	False		,,,				2504	0.001															0			16						G	,	12,4386	19.1+/-41.9	0,12,2187	87.0	77.0	80.0		624,696	-10.8	0.4	16	dbSNP_132	80	121,8479	62.4+/-124.4	0,121,4179	no	coding-synonymous,coding-synonymous	CLCN7	NM_001114331.1,NM_001287.4	,	0,133,6366	AA,AG,GG		1.407,0.2729,1.0232	,	208/782,232/806	1507737	133,12865	2199	4300	6499	1447738	SO:0001819	synonymous_variant	1186			Z67743	CCDS32361.1, CCDS45378.1	16p13	2012-09-26	2012-02-23		ENSG00000103249	ENSG00000103249		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ion channels / Chloride channels : Voltage-sensitive"""	2025	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 63"""	602727	"""chloride channel 7"""			8543009	Standard	NM_001114331		Approved	CLC-7, OPTA2, CLC7, ClC-7, PPP1R63	uc002clv.3	P51798	OTTHUMG00000044467	ENST00000382745.4:c.696C>T	16.37:g.1507737G>A			1447738	A6NEJ7|A8K5T9|A8K7X1|B3KPN3|E9PDB9|Q9NYX5	Silent	SNP	superfamily_Cl-channel_core,HMMPfam_Voltage_CLC,HMMPfam_CBS,HMMSmart_CBS,superfamily_SSF54631	p.S232	ENST00000382745.4	37	c.696	CCDS32361.1	16																																																																																			-	superfamily_Cl-channel_core,HMMPfam_Voltage_CLC		0.607	CLCN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLCN7	protein_coding	OTTHUMT00000103598.2	G	NM_001287		1447738	-1	no_errors	NM_001287	genbank	human	reviewed	54_36p	silent	SNP	0.344	A
MYOM2	9172	genome.wustl.edu	37	8	2000340	2000340	+	Missense_Mutation	SNP	T	T	A			TCGA-04-1651-01A-01W-0639-09	TCGA-04-1651-11A-01W-0639-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f02d550d-d80c-449f-9d69-37ffb1e649b6	8e8ba185-6faf-49df-9784-594e179731c5	g.chr8:2000340T>A	ENST00000262113.4	+	3	313	c.172T>A	c.(172-174)Tcc>Acc	p.S58T	MYOM2_ENST00000523438.1_Intron	NM_003970.2	NP_003961.2	P54296	MYOM2_HUMAN	myomesin 2	58					muscle contraction (GO:0006936)	M band (GO:0031430)|mitochondrion (GO:0005739)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)			autonomic_ganglia(2)|breast(4)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(11)|kidney(2)|large_intestine(17)|lung(39)|ovary(5)|prostate(1)|skin(10)|upper_aerodigestive_tract(3)	104		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)		ACAGAGAGCCTCCAGCCAGAC	0.572																																																0			8											156.0	144.0	148.0					8																	2000340		2203	4300	6503	1987747	SO:0001583	missense	9172				CCDS5957.1	8p23.3	2014-06-06	2012-10-17		ENSG00000036448	ENSG00000036448		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7614	protein-coding gene	gene with protein product		603509	"""myomesin (M-protein) 2 (165kD)"", ""myomesin (M-protein) 2, 165kDa"""				Standard	XM_006716237		Approved		uc003wpx.4	P54296	OTTHUMG00000129175	ENST00000262113.4:c.172T>A	8.37:g.2000340T>A	ENSP00000262113:p.Ser58Thr		1987747	Q7Z3Y2	Missense_Mutation	SNP	superfamily_SSF48726,HMMPfam_I-set,HMMSmart_IG,superfamily_FN_III-like,HMMSmart_FN3,HMMPfam_fn3,HMMPfam_ig,HMMSmart_IGc2	p.S58T	ENST00000262113.4	37	c.172	CCDS5957.1	8	.	.	.	.	.	.	.	.	.	.	T	12.24	1.878209	0.33162	.	.	ENSG00000036448	ENST00000262113	T	0.52057	0.68	4.71	0.913	0.19354	.	0.319699	0.27315	N	0.019928	T	0.36991	0.0987	L	0.59436	1.845	0.21220	N	0.99976	B	0.29037	0.231	B	0.27608	0.081	T	0.21861	-1.0233	10	0.41790	T	0.15	.	5.1725	0.15118	0.0:0.0948:0.3584:0.5468	.	58	P54296	MYOM2_HUMAN	T	58	ENSP00000262113:S58T	ENSP00000262113:S58T	S	+	1	0	MYOM2	1987747	0.001000	0.12720	0.002000	0.10522	0.103000	0.19146	0.067000	0.14510	0.010000	0.14839	-0.313000	0.08912	TCC	-	NULL		0.572	MYOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYOM2	protein_coding	OTTHUMT00000251249.1	T	NM_003970		1987747	+1	no_errors	NM_003970	genbank	human	validated	54_36p	missense	SNP	0.109	A
C20orf194	25943	genome.wustl.edu	37	20	3329236	3329236	+	Missense_Mutation	SNP	A	A	C			TCGA-04-1651-01A-01W-0639-09	TCGA-04-1651-11A-01W-0639-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f02d550d-d80c-449f-9d69-37ffb1e649b6	8e8ba185-6faf-49df-9784-594e179731c5	g.chr20:3329236A>C	ENST00000252032.9	-	8	792	c.725T>G	c.(724-726)tTc>tGc	p.F242C		NM_001009984.2	NP_001009984.1	Q5TEA3	CT194_HUMAN	chromosome 20 open reading frame 194	242										NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(15)|prostate(2)|skin(1)	39						ATTAGCGAAGAAGCTAGTCCA	0.383																																																0			20											73.0	67.0	69.0					20																	3329236		1820	4081	5901	3277236	SO:0001583	missense	25943			AL110249	CCDS42851.1	20p13	2012-10-30			ENSG00000088854	ENSG00000088854			17721	protein-coding gene	gene with protein product		614146					Standard	NM_001009984		Approved	DKFZp434N061	uc002wii.3	Q5TEA3	OTTHUMG00000031742	ENST00000252032.9:c.725T>G	20.37:g.3329236A>C	ENSP00000252032:p.Phe242Cys		3277236	Q66K86|Q6P2R9|Q9UFX9	Missense_Mutation	SNP	PatternScan_ZINC_FINGER_C2H2_1	p.F242C	ENST00000252032.9	37	c.725	CCDS42851.1	20	.	.	.	.	.	.	.	.	.	.	A	17.05	3.290055	0.59976	.	.	ENSG00000088854	ENST00000252032	T	0.20463	2.07	5.16	5.16	0.70880	.	0.055839	0.64402	D	0.000001	T	0.35799	0.0944	L	0.38531	1.155	0.80722	D	1	D	0.89917	1.0	D	0.69479	0.964	T	0.10222	-1.0639	10	0.72032	D	0.01	.	14.842	0.70233	1.0:0.0:0.0:0.0	.	242	Q5TEA3	CT194_HUMAN	C	242	ENSP00000252032:F242C	ENSP00000252032:F242C	F	-	2	0	C20orf194	3277236	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.315000	0.78998	2.185000	0.69588	0.454000	0.30748	TTC	-	NULL		0.383	C20orf194-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C20orf194	protein_coding	OTTHUMT00000077734.1	A	NM_001009984		3277236	-1	no_errors	NM_001009984	genbank	human	validated	54_36p	missense	SNP	1.000	C
ADCY9	115	genome.wustl.edu	37	16	4164238	4164238	+	Silent	SNP	G	G	C			TCGA-04-1651-01A-01W-0639-09	TCGA-04-1651-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f02d550d-d80c-449f-9d69-37ffb1e649b6	8e8ba185-6faf-49df-9784-594e179731c5	g.chr16:4164238G>C	ENST00000294016.3	-	2	1744	c.1206C>G	c.(1204-1206)ggC>ggG	p.G402G		NM_001116.3	NP_001107.2	O60503	ADCY9_HUMAN	adenylate cyclase 9	402	Guanylate cyclase 1. {ECO:0000255|PROSITE-ProRule:PRU00099}.				activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(11)|lung(9)|ovary(5)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	47						TCTTGGTGAAGCCCACGATAT	0.502																																																0			16											78.0	80.0	79.0					16																	4164238		2197	4300	6497	4104239	SO:0001819	synonymous_variant	115			AF036927	CCDS32382.1	16p13.3	2013-02-04				ENSG00000162104	4.6.1.1	"""Adenylate cyclases"""	240	protein-coding gene	gene with protein product		603302				9628827	Standard	NM_001116		Approved	AC9	uc002cvx.3	O60503		ENST00000294016.3:c.1206C>G	16.37:g.4164238G>C			4104239	A7E2V5|A7E2X2|D3DUD1|O60273|Q4ZHT9|Q4ZIR5|Q9BWT4|Q9UGP2	Silent	SNP	HMMSmart_SM00044,superfamily_Adenylyl and guanylyl cyclase catalytic domain,HMMPfam_Guanylate_cyc,PatternScan_GUANYLATE_CYCLASE_1	p.G402	ENST00000294016.3	37	c.1206	CCDS32382.1	16																																																																																			-	HMMSmart_SM00044,superfamily_Adenylyl and guanylyl cyclase catalytic domain,HMMPfam_Guanylate_cyc		0.502	ADCY9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY9	protein_coding	OTTHUMT00000438076.1	G			4104239	-1	no_errors	NM_001116	genbank	human	reviewed	54_36p	silent	SNP	0.994	C
TP53	7157	genome.wustl.edu	37	17	7574000	7574000	+	Nonsense_Mutation	SNP	C	C	A	rs375573770		TCGA-04-1651-01A-01W-0639-09	TCGA-04-1651-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f02d550d-d80c-449f-9d69-37ffb1e649b6	8e8ba185-6faf-49df-9784-594e179731c5	g.chr17:7574000C>A	ENST00000269305.4	-	10	1216	c.1027G>T	c.(1027-1029)Gag>Tag	p.E343*	TP53_ENST00000359597.4_Intron|TP53_ENST00000413465.2_Intron|TP53_ENST00000420246.2_3'UTR|TP53_ENST00000445888.2_Nonsense_Mutation_p.E343*|TP53_ENST00000455263.2_3'UTR	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	343	Interaction with CARM1.|Interaction with HIPK1. {ECO:0000250}.|Interaction with HIPK2.|Oligomerization.		E -> G (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.E343*(8)|p.0?(8)|p.R342_N345delRELN(1)|p.I332fs*5(1)|p.?(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TCATTCAGCTCTCGGAACATC	0.567		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	19	Substitution - Nonsense(8)|Whole gene deletion(8)|Unknown(1)|Deletion - In frame(1)|Deletion - Frameshift(1)	bone(4)|lung(3)|large_intestine(2)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|biliary_tract(2)|oesophagus(2)|stomach(1)|breast(1)	17											63.0	49.0	54.0					17																	7574000		2203	4300	6503	7514725	SO:0001587	stop_gained	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.1027G>T	17.37:g.7574000C>A	ENSP00000269305:p.Glu343*		7514725	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	HMMPfam_P53_TAD,HMMPfam_P53,superfamily_p53-like transcription factors,PatternScan_P53,HMMPfam_P53_tetramer,superfamily_p53 tetramerization domain	p.E343*	ENST00000269305.4	37	c.1027	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	35	5.416742	0.96092	.	.	ENSG00000141510	ENST00000269305;ENST00000445888;ENST00000396473	.	.	.	5.43	0.0488	0.14286	.	0.424710	0.26746	N	0.022702	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.3598	8.103	0.30868	0.0:0.4892:0.0:0.5108	.	.	.	.	X	343;343;332	.	ENSP00000269305:E343X	E	-	1	0	TP53	7514725	0.924000	0.31332	0.029000	0.17559	0.870000	0.49936	2.211000	0.42825	0.026000	0.15269	-0.291000	0.09656	GAG	-	HMMPfam_P53_tetramer,superfamily_p53 tetramerization domain		0.567	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	C	NM_000546		7514725	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	nonsense	SNP	0.805	A
GRM7	2917	genome.wustl.edu	37	3	7620823	7620823	+	Silent	SNP	A	A	C			TCGA-04-1651-01A-01W-0639-09	TCGA-04-1651-11A-01W-0639-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f02d550d-d80c-449f-9d69-37ffb1e649b6	8e8ba185-6faf-49df-9784-594e179731c5	g.chr3:7620823A>C	ENST00000357716.4	+	8	2504	c.2230A>C	c.(2230-2232)Aga>Cga	p.R744R	GRM7_ENST00000403881.1_Silent_p.R744R|GRM7_ENST00000402647.2_Silent_p.R744R|GRM7_ENST00000486284.1_Silent_p.R744R|GRM7_ENST00000389336.4_Silent_p.R744R|GRM7_ENST00000458641.2_3'UTR	NM_000844.3	NP_000835.1	Q14831	GRM7_HUMAN	glutamate receptor, metabotropic 7	744					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|adult behavior (GO:0030534)|conditioned taste aversion (GO:0001661)|multicellular organismal response to stress (GO:0033555)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of glutamate secretion (GO:0014050)|regulation of cyclase activity (GO:0031279)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of smell (GO:0007608)|sensory perception of sound (GO:0007605)|short-term memory (GO:0007614)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)	asymmetric synapse (GO:0032279)|axon (GO:0030424)|cell cortex (GO:0005938)|dendrite (GO:0030425)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)|receptor complex (GO:0043235)	adenylate cyclase inhibitor activity (GO:0010855)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|glutamate binding (GO:0016595)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)|PDZ domain binding (GO:0030165)|serine binding (GO:0070905)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(35)|ovary(4)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	76						TGAGCAAGCCAGAGGGGTTCT	0.433																																																0			3											127.0	113.0	118.0					3																	7620823		2203	4300	6503	7595823	SO:0001819	synonymous_variant	2917			U92458	CCDS43042.1	3p26-p25	2014-06-12			ENSG00000196277	ENSG00000196277		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4599	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 87"""	604101				8288585, 8840028	Standard	NM_000844		Approved	GLUR7, GPRC1G, mGlu7, MGLUR7, PPP1R87	uc003bql.2	Q14831	OTTHUMG00000125549	ENST00000357716.4:c.2230A>C	3.37:g.7620823A>C			7595823	Q8NFS2|Q8NFS3|Q8NFS4	Silent	SNP	superfamily_SSF53822,HMMPfam_ANF_receptor,PatternScan_G_PROTEIN_RECEP_F3_1,HMMPfam_NCD3G,PatternScan_G_PROTEIN_RECEP_F3_2,HMMPfam_7tm_3,PatternScan_G_PROTEIN_RECEP_F3_3	p.R744	ENST00000357716.4	37	c.2230	CCDS43042.1	3																																																																																			-	HMMPfam_7tm_3		0.433	GRM7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRM7	protein_coding	OTTHUMT00000246895.3	A	NM_000844		7595823	+1	no_errors	NM_181874	genbank	human	reviewed	54_36p	silent	SNP	1.000	C
GDF3	9573	genome.wustl.edu	37	12	7842869	7842869	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1651-01A-01W-0639-09	TCGA-04-1651-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f02d550d-d80c-449f-9d69-37ffb1e649b6	8e8ba185-6faf-49df-9784-594e179731c5	g.chr12:7842869G>T	ENST00000329913.3	-	2	747	c.700C>A	c.(700-702)Ctg>Atg	p.L234M		NM_020634.1	NP_065685.1	Q9NR23	GDF3_HUMAN	growth differentiation factor 3	234					endoderm development (GO:0007492)|eye development (GO:0001654)|formation of anatomical boundary (GO:0048859)|growth (GO:0040007)|in utero embryonic development (GO:0001701)|mesoderm development (GO:0007498)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of epidermal cell differentiation (GO:0045605)|notochord development (GO:0030903)|primitive streak formation (GO:0090009)|regulation of cell fate commitment (GO:0010453)|response to dietary excess (GO:0002021)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|somite rostral/caudal axis specification (GO:0032525)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	protein kinase binding (GO:0019901)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	28						GTCACCACCAGCAGGGAAGCA	0.517																																																0			12											101.0	93.0	96.0					12																	7842869		2203	4300	6503	7734136	SO:0001583	missense	9573			AF263538	CCDS8581.1	12p13.1	2014-01-30			ENSG00000184344	ENSG00000184344		"""Endogenous ligands"""	4218	protein-coding gene	gene with protein product		606522				9467948	Standard	NM_020634		Approved		uc001qte.3	Q9NR23	OTTHUMG00000168433	ENST00000329913.3:c.700C>A	12.37:g.7842869G>T	ENSP00000331745:p.Leu234Met		7734136	Q8NEJ4	Missense_Mutation	SNP	superfamily_SSF57501,HMMPfam_TGF_beta,HMMSmart_TGFB,PatternScan_TGF_BETA_1	p.L234M	ENST00000329913.3	37	c.700	CCDS8581.1	12	.	.	.	.	.	.	.	.	.	.	G	12.18	1.861604	0.32884	.	.	ENSG00000184344	ENST00000329913	D	0.83419	-1.72	4.61	2.65	0.31530	.	0.288762	0.33401	N	0.004959	D	0.85234	0.5650	M	0.61703	1.905	0.41589	D	0.988785	D	0.60575	0.988	D	0.63381	0.914	T	0.81422	-0.0940	10	0.20046	T	0.44	.	8.1557	0.31167	0.0908:0.0:0.7542:0.1549	.	234	Q9NR23	GDF3_HUMAN	M	234	ENSP00000331745:L234M	ENSP00000331745:L234M	L	-	1	2	GDF3	7734136	1.000000	0.71417	0.998000	0.56505	0.407000	0.30961	1.404000	0.34623	1.077000	0.40990	0.561000	0.74099	CTG	-	NULL		0.517	GDF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GDF3	protein_coding	OTTHUMT00000399717.1	G			7734136	-1	no_errors	NM_020634	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
ZNF700	90592	genome.wustl.edu	37	19	12060471	12060471	+	Silent	SNP	C	C	G			TCGA-04-1651-01A-01W-0639-09	TCGA-04-1651-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f02d550d-d80c-449f-9d69-37ffb1e649b6	8e8ba185-6faf-49df-9784-594e179731c5	g.chr19:12060471C>G	ENST00000254321.5	+	4	1775	c.1632C>G	c.(1630-1632)gcC>gcG	p.A544A	ZNF763_ENST00000538752.1_Intron|ZNF700_ENST00000482090.1_Silent_p.A526A|ZNF763_ENST00000590798.1_Intron|CTD-2006C1.12_ENST00000586394.1_RNA|ZNF763_ENST00000591944.1_Intron	NM_001271848.1|NM_144566.1	NP_001258777.1|NP_653167.1	Q9H0M5	ZN700_HUMAN	zinc finger protein 700	544					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)		ZNF700/MAST1_ENST00000251472(2)	breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(13)|pancreas(1)|prostate(1)|urinary_tract(1)	33						GTGGTAAAGCCTTCAGATGTT	0.418																																																0			19											99.0	94.0	96.0					19																	12060471		2203	4300	6503	11921471	SO:0001819	synonymous_variant	90592			AL136732	CCDS32915.1, CCDS74289.1	19p13.2	2013-01-08			ENSG00000196757	ENSG00000196757		"""Zinc fingers, C2H2-type"", ""-"""	25292	protein-coding gene	gene with protein product							Standard	NM_144566		Approved	DKFZp434I1610	uc031rjk.1	Q9H0M5	OTTHUMG00000156421	ENST00000254321.5:c.1632C>G	19.37:g.12060471C>G			11921471	B9EGU4	Silent	SNP	superfamily_KRAB domain (Kruppel-associated box Pfam 01352),HMMPfam_KRAB,HMMSmart_SM00349,superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1	p.A544	ENST00000254321.5	37	c.1632	CCDS32915.1	19																																																																																			-	superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1		0.418	ZNF700-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF700	protein_coding	OTTHUMT00000344126.2	C	NM_144566		11921471	+1	no_errors	NM_144566	genbank	human	provisional	54_36p	silent	SNP	0.684	G
ZNF355P	100505852	genome.wustl.edu	37	21	14468789	14468789	+	IGR	SNP	C	C	A			TCGA-04-1651-01A-01W-0639-09	TCGA-04-1651-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f02d550d-d80c-449f-9d69-37ffb1e649b6	8e8ba185-6faf-49df-9784-594e179731c5	g.chr21:14468789C>A								RNU6-614P (48779 upstream) : AL050302.1 (273141 downstream)																							AGTACGAATTCTCTGATGTAT	0.358																																																0			21																																								13390660	SO:0001628	intergenic_variant	0																															21.37:g.14468789C>A			13390660		Missense_Mutation	SNP	superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1	p.R351I		37	c.1052		21																																																																																			-	superfamily_C2H2 and C2HC zinc fingers,HMMSmart_SM00355,HMMPfam_zf-C2H2	0	0.358					ZNF834			C			13390660	-1	no_start_codon	ENST00000305570	ensembl	human	known	54_36p	missense	SNP	0.038	A
CD97	976	genome.wustl.edu	37	19	14507970	14507970	+	Missense_Mutation	SNP	G	G	A	rs376892799		TCGA-04-1651-01A-01W-0639-09	TCGA-04-1651-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f02d550d-d80c-449f-9d69-37ffb1e649b6	8e8ba185-6faf-49df-9784-594e179731c5	g.chr19:14507970G>A	ENST00000242786.5	+	6	640	c.560G>A	c.(559-561)cGc>cAc	p.R187H	CD97_ENST00000357355.3_Intron|CD97_ENST00000587728.1_Intron|CD97_ENST00000358600.3_Intron	NM_078481.3	NP_510966.1	P48960	CD97_HUMAN	CD97 molecule	187	EGF-like 4; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular component movement (GO:0006928)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|neuropeptide signaling pathway (GO:0007218)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|liver(1)|lung(9)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30						TATCAGTGCCGCTGCCGCCCG	0.597																																																0			19						G	,,HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	87.0	88.0	88.0		,,560	-4.4	0.0	19		88	0,8594		0,0,4297	no	intron,intron,missense	CD97	NM_001025160.2,NM_001784.4,NM_078481.3	,,29	0,1,6499	AA,AG,GG		0.0,0.0227,0.0077	,,benign	,,187/836	14507970	1,12999	2203	4297	6500	14368970	SO:0001583	missense	976				CCDS32929.1, CCDS32930.1, CCDS32931.1	19p13	2014-08-08	2006-03-28			ENSG00000123146		"""CD molecules"", ""-"", ""GPCR / Class B : Orphans"""	1711	protein-coding gene	gene with protein product	"""leukocyte antigen CD97"", ""seven-span transmembrane protein"", ""seven-transmembrane, heterodimeric receptor associated with inflammation"", ""seven transmembrane helix receptor"""	601211	"""CD97 antigen"""			7636245, 8786105	Standard	NM_078481		Approved	TM7LN1	uc002myl.3	P48960		ENST00000242786.5:c.560G>A	19.37:g.14507970G>A	ENSP00000242786:p.Arg187His		14368970	A8K7Z4|B2RBJ9|O00718|O76101|Q8NG72|Q8TBQ7	Missense_Mutation	SNP	HMMSmart_SM00181,PatternScan_EGF_CA,HMMPfam_EGF_CA,HMMSmart_SM00179,superfamily_EGF/Laminin,PatternScan_ASX_HYDROXYL,HMMPfam_GPS,HMMSmart_SM00303,superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_2,PatternScan_G_PROTEIN_RECEP_F2_2	p.R187H	ENST00000242786.5	37	c.560	CCDS32929.1	19	.	.	.	.	.	.	.	.	.	.	g	5.183	0.219334	0.09863	2.27E-4	0.0	ENSG00000123146	ENST00000242786	D	0.92545	-3.06	3.53	-4.36	0.03645	EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	.	.	.	.	D	0.86213	0.5879	N	0.20685	0.6	0.09310	N	1	D	0.54601	0.967	P	0.53954	0.738	T	0.77191	-0.2678	9	0.40728	T	0.16	.	3.2302	0.06746	0.4123:0.0:0.266:0.3217	.	187	P48960	CD97_HUMAN	H	187	ENSP00000242786:R187H	ENSP00000242786:R187H	R	+	2	0	CD97	14368970	0.000000	0.05858	0.001000	0.08648	0.143000	0.21401	-2.026000	0.01434	-0.779000	0.04560	-0.275000	0.10095	CGC	-	HMMPfam_EGF_CA,HMMSmart_SM00179,superfamily_EGF/Laminin,HMMSmart_SM00181,PatternScan_ASX_HYDROXYL		0.597	CD97-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CD97	protein_coding	OTTHUMT00000459821.2	G	NM_078481		14368970	+1	no_errors	NM_078481	genbank	human	reviewed	54_36p	missense	SNP	0.031	A
SREBF1	6720	genome.wustl.edu	37	17	17722368	17722368	+	Missense_Mutation	SNP	T	T	C			TCGA-04-1651-01A-01W-0639-09	TCGA-04-1651-11A-01W-0639-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f02d550d-d80c-449f-9d69-37ffb1e649b6	8e8ba185-6faf-49df-9784-594e179731c5	g.chr17:17722368T>C	ENST00000261646.5	-	5	1211	c.1027A>G	c.(1027-1029)Atc>Gtc	p.I343V	SREBF1_ENST00000435530.2_Missense_Mutation_p.I343V|SREBF1_ENST00000355815.4_Missense_Mutation_p.I373V|SREBF1_ENST00000395757.1_Missense_Mutation_p.I89V|SREBF1_ENST00000583732.1_5'Flank|SREBF1_ENST00000338854.5_Missense_Mutation_p.I343V	NM_004176.4	NP_004167.3	P36956	SRBP1_HUMAN	sterol regulatory element binding transcription factor 1	343	Interaction with LMNA. {ECO:0000250}.|bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				aging (GO:0007568)|cellular lipid metabolic process (GO:0044255)|cellular response to fatty acid (GO:0071398)|cellular response to starvation (GO:0009267)|cholesterol metabolic process (GO:0008203)|circadian rhythm (GO:0007623)|insulin receptor signaling pathway (GO:0008286)|lipid biosynthetic process (GO:0008610)|lipid metabolic process (GO:0006629)|lung development (GO:0030324)|negative regulation of insulin secretion (GO:0046676)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cholesterol biosynthetic process (GO:0045542)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of triglyceride biosynthetic process (GO:0010867)|regulation of fatty acid metabolic process (GO:0019217)|regulation of heart rate by chemical signal (GO:0003062)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cAMP (GO:0051591)|response to drug (GO:0042493)|response to food (GO:0032094)|response to glucagon (GO:0033762)|response to glucose (GO:0009749)|response to progesterone (GO:0032570)|response to retinoic acid (GO:0032526)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|sterol response element binding (GO:0032810)			cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(5)|skin(1)|urinary_tract(1)	14						AGCTCAATGATTTTGTCATTG	0.607																																																0			17											95.0	90.0	91.0					17																	17722368		2203	4300	6503	17663093	SO:0001583	missense	6720			BC057388	CCDS11189.1, CCDS32583.1	17p11.2	2013-05-21			ENSG00000072310	ENSG00000072310		"""Basic helix-loop-helix proteins"""	11289	protein-coding gene	gene with protein product		184756				8402897, 7759101	Standard	NM_001005291		Approved	SREBP1, bHLHd1, SREBP-1c	uc002grt.2	P36956	OTTHUMG00000059313	ENST00000261646.5:c.1027A>G	17.37:g.17722368T>C	ENSP00000261646:p.Ile343Val		17663093	B0I4X3|B0I4X4|D3DXC4|Q16062|Q59F52|Q6P4R7|Q6PFW7|Q6PJ36|Q8TAK9	Missense_Mutation	SNP	superfamily_HLH_basic,HMMPfam_HLH,HMMSmart_HLH	p.I373V	ENST00000261646.5	37	c.1117	CCDS11189.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	13.65|13.65	2.301812|2.301812	0.40694|0.40694	.|.	.|.	ENSG00000072310|ENSG00000072310	ENST00000338854;ENST00000355815;ENST00000261646;ENST00000395757;ENST00000418712;ENST00000423161;ENST00000435530|ENST00000395751	D;D;D;D;D|.	0.98493|.	-4.96;-4.96;-4.96;-4.96;-4.96|.	4.62|4.62	4.62|4.62	0.57501|0.57501	Helix-loop-helix DNA-binding (5);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.83908|0.83908	0.5356|0.5356	M|M	0.92604|0.92604	3.325|3.325	0.80722|0.80722	D|D	1|1	D;D;D;D|.	0.71674|.	0.996;0.996;0.998;0.998|.	D;D;D;D|.	0.91635|.	0.994;0.999;0.997;0.995|.	D|D	0.87984|0.87984	0.2745|0.2745	10|5	0.87932|.	D|.	0|.	-7.1875|-7.1875	13.6947|13.6947	0.62569|0.62569	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	343;319;343;373|.	B0I4X3;B0I4X4;P36956;P36956-4|.	.;.;SRBP1_HUMAN;.|.	V|S	343;373;343;89;180;269;343|350	ENSP00000345822:I343V;ENSP00000348069:I373V;ENSP00000261646:I343V;ENSP00000379106:I89V;ENSP00000413389:I343V|.	ENSP00000261646:I343V|.	I|N	-|-	1|2	0|0	SREBF1|SREBF1	17663093|17663093	1.000000|1.000000	0.71417|0.71417	0.964000|0.964000	0.40570|0.40570	0.753000|0.753000	0.42808|0.42808	7.876000|7.876000	0.87215|0.87215	1.707000|1.707000	0.51288|0.51288	0.459000|0.459000	0.35465|0.35465	ATC|AAT	-	superfamily_HLH_basic,HMMPfam_HLH,HMMSmart_HLH		0.607	SREBF1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SREBF1	protein_coding	OTTHUMT00000131771.1	T	NM_004176		17663093	-1	no_errors	NM_001005291	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
RP11-146E13.4	0	genome.wustl.edu	37	14	19855290	19855290	+	lincRNA	SNP	G	G	A			TCGA-04-1651-01A-01W-0639-09	TCGA-04-1651-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f02d550d-d80c-449f-9d69-37ffb1e649b6	8e8ba185-6faf-49df-9784-594e179731c5	g.chr14:19855290G>A	ENST00000548109.1	+	0	72																											GCTGGGCCCCGGTCTCAGGTC	0.607																																																0			14																																								18925290			727980																															14.37:g.19855290G>A			18925290		RNA	SNP	-	NULL	ENST00000548109.1	37	NULL		14																																																																																			-	-		0.607	RP11-146E13.4-001	KNOWN	basic	lincRNA	LOC727980	lincRNA	OTTHUMT00000409408.1	G			18925290	+1	pseudogene	XR_036910	genbank	human	model	54_36p	rna	SNP	0.086	A
ZNF737	100129842	genome.wustl.edu	37	19	20748472	20748472	+	5'UTR	SNP	C	C	A			TCGA-04-1651-01A-01W-0639-09	TCGA-04-1651-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f02d550d-d80c-449f-9d69-37ffb1e649b6	8e8ba185-6faf-49df-9784-594e179731c5	g.chr19:20748472C>A	ENST00000427401.4	-	0	69				ZNF737_ENST00000596797.1_5'UTR|CTC-513N18.7_ENST00000595094.1_lincRNA	NM_001159293.1	NP_001152765.1	O75373	ZN737_HUMAN	zinc finger protein 737						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|kidney(1)|lung(7)|ovary(1)|stomach(1)|urinary_tract(1)	13						GGCTCCCGGGCGTCTTAGCTG	0.617																																																0			19											48.0	45.0	46.0					19																	20748472		692	1591	2283	20540312	SO:0001623	5_prime_UTR_variant	0			BC015765	CCDS54238.1	19p12	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	32468	protein-coding gene	gene with protein product		603984					Standard	NM_001159293		Approved	ZNF102	uc002npa.3	O75373		ENST00000427401.4:c.-26G>T	19.37:g.20748472C>A			20540312	C9JHM3	RNA	SNP	-	NULL	ENST00000427401.4	37	NULL	CCDS54238.1	19																																																																																			-	-		0.617	ZNF737-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC100129842	protein_coding	OTTHUMT00000447844.2	C	NM_145289		20540312	-1	no_errors	XR_042310	genbank	human	model	54_36p	rna	SNP	0.000	A
PINK1	65018	genome.wustl.edu	37	1	20971140	20971140	+	Silent	SNP	C	C	A	rs536146282		TCGA-04-1651-01A-01W-0639-09	TCGA-04-1651-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f02d550d-d80c-449f-9d69-37ffb1e649b6	8e8ba185-6faf-49df-9784-594e179731c5	g.chr1:20971140C>A	ENST00000321556.4	+	4	1028	c.934C>A	c.(934-936)Cgg>Agg	p.R312R	PINK1_ENST00000492302.1_3'UTR|PINK1-AS_ENST00000451424.1_RNA	NM_032409.2	NP_115785.1	Q9BXM7	PINK1_HUMAN	PTEN induced putative kinase 1	312	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159, ECO:0000305}.				activation of protein kinase B activity (GO:0032148)|cell death (GO:0008219)|cellular response to hypoxia (GO:0071456)|cellular response to toxic substance (GO:0097237)|intracellular signal transduction (GO:0035556)|mitochondrion degradation (GO:0000422)|mitochondrion organization (GO:0007005)|negative regulation of gene expression (GO:0010629)|negative regulation of hydrogen peroxide-induced neuron intrinsic apoptotic signaling pathway (GO:1903384)|negative regulation of JNK cascade (GO:0046329)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of oxidative stress-induced cell death (GO:1903202)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|negative regulation of oxidative stress-induced neuron death (GO:1903204)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|peptidyl-serine autophosphorylation (GO:0036289)|peptidyl-serine phosphorylation (GO:0018105)|phosphorylation (GO:0016310)|positive regulation of dopamine secretion (GO:0033603)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of mitochondrial electron transport, NADH to ubiquinone (GO:1902958)|positive regulation of peptidase activity (GO:0010952)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of synaptic transmission, dopaminergic (GO:0032226)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of mitochondrion degradation (GO:1903146)|regulation of protein complex assembly (GO:0043254)|regulation of protein ubiquitination (GO:0031396)|regulation of reactive oxygen species metabolic process (GO:2000377)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|response to stress (GO:0006950)|TORC2 signaling (GO:0038203)|ubiquitin-dependent protein catabolic process (GO:0006511)	astrocyte projection (GO:0097449)|axon (GO:0030424)|cell body (GO:0044297)|chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of mitochondrial outer membrane (GO:0031307)|Lewy body (GO:0097413)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|C3HC4-type RING finger domain binding (GO:0055131)|calcium-dependent protein kinase activity (GO:0010857)|kinase activity (GO:0016301)|magnesium ion binding (GO:0000287)|peptidase activator activity (GO:0016504)|protease binding (GO:0002020)|protein kinase B binding (GO:0043422)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(4)|ovary(2)	14		all_lung(284;2.72e-05)|Lung NSC(340;2.94e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000147)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(152;1.21e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000146)|Kidney(64;0.000182)|GBM - Glioblastoma multiforme(114;0.000497)|KIRC - Kidney renal clear cell carcinoma(64;0.00269)|STAD - Stomach adenocarcinoma(196;0.00308)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		GGGCCATGGCCGGACGCTGTT	0.647																																					Esophageal Squamous(145;853 1803 8146 34412 35011)											0			1											63.0	58.0	60.0					1																	20971140		2203	4300	6503	20843727	SO:0001819	synonymous_variant	65018			AB053323	CCDS211.1	1p36.12	2011-07-21			ENSG00000158828	ENSG00000158828		"""Parkinson disease"""	14581	protein-coding gene	gene with protein product		608309	"""Parkinson disease (autosomal recessive) 6"""	PARK6		11494141, 15349860	Standard	NM_032409		Approved		uc001bdm.3	Q9BXM7	OTTHUMG00000002841	ENST00000321556.4:c.934C>A	1.37:g.20971140C>A			20843727	Q8N6T9|Q8NBU3|Q96DE4	Silent	SNP	superfamily_Protein kinase-like (PK-like),HMMSmart_SM00219,HMMSmart_SM00220,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ST	p.R312	ENST00000321556.4	37	c.934	CCDS211.1	1																																																																																			-	superfamily_Protein kinase-like (PK-like),HMMSmart_SM00219,HMMSmart_SM00220,HMMPfam_Pkinase		0.647	PINK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PINK1	protein_coding	OTTHUMT00000007954.1	C	NM_032409		20843727	+1	no_errors	NM_032409	genbank	human	reviewed	54_36p	silent	SNP	0.993	A
KIZ-AS1	101929591	genome.wustl.edu	37	20	21143060	21143060	+	RNA	SNP	G	G	A	rs190940090	byFrequency	TCGA-04-1651-01A-01W-0639-09	TCGA-04-1651-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f02d550d-d80c-449f-9d69-37ffb1e649b6	8e8ba185-6faf-49df-9784-594e179731c5	g.chr20:21143060G>A	ENST00000591761.1	-	0	5142				RP5-872K7.7_ENST00000425746.2_RNA|PLK1S1_ENST00000457464.1_RNA																							GAGCCAGCCCGCCAGTCTCTC	0.453													G|||	3	0.000599042	0.0008	0.0	5008	,	,		17848	0.0		0.002	False		,,,				2504	0.0															0			20											28.0	31.0	30.0					20																	21143060		1857	4100	5957	21091060			55857																															20.37:g.21143060G>A			21091060		Silent	SNP	NULL	p.P318	ENST00000591761.1	37	c.954		20																																																																																			-	NULL		0.453	RP4-777D9.2-002	KNOWN	basic	antisense	NCRNA00153	antisense	OTTHUMT00000078258.2	G			21091060	+1	no_errors	ENST00000246027	ensembl	human	known	54_36p	silent	SNP	0.002	A
SPX	80763	genome.wustl.edu	37	12	21681938	21681938	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1651-01A-01W-0639-09	TCGA-04-1651-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f02d550d-d80c-449f-9d69-37ffb1e649b6	8e8ba185-6faf-49df-9784-594e179731c5	g.chr12:21681938G>C	ENST00000256969.2	+	5	378	c.212G>C	c.(211-213)aGa>aCa	p.R71T	C12orf39_ENST00000543800.1_3'UTR	NM_030572.2	NP_085049.1	Q9BT56	SPXN_HUMAN		71					long-chain fatty acid import (GO:0044539)|negative regulation of appetite (GO:0032099)|negative regulation of heart rate (GO:0010459)|negative regulation of renal sodium excretion (GO:0035814)|positive regulation of systemic arterial blood pressure (GO:0003084)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of sensory perception of pain (GO:0051930)	cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)	neuropeptide hormone activity (GO:0005184)|type 2 galanin receptor binding (GO:0031765)|type 3 galanin receptor binding (GO:0031766)			endometrium(3)|large_intestine(1)|lung(2)|urinary_tract(1)	7						TCTGCAGAAAGACGAAGCCCA	0.398																																																0			12											166.0	173.0	171.0					12																	21681938		2203	4300	6503	21573205	SO:0001583	missense	80763																														ENST00000256969.2:c.212G>C	12.37:g.21681938G>C	ENSP00000256969:p.Arg71Thr		21573205	B3KND6	Missense_Mutation	SNP	NULL	p.R71T	ENST00000256969.2	37	c.212	CCDS31757.1	12	.	.	.	.	.	.	.	.	.	.	G	14.36	2.511686	0.44660	.	.	ENSG00000134548	ENST00000256969	.	.	.	4.94	4.05	0.47172	.	0.200282	0.41294	D	0.000904	T	0.21227	0.0511	L	0.38175	1.15	0.25132	N	0.990562	P	0.37731	0.607	B	0.36418	0.224	T	0.13791	-1.0496	9	0.07990	T	0.79	-21.9354	6.4185	0.21730	0.0957:0.1863:0.718:0.0	.	71	Q9BT56	SPXN_HUMAN	T	71	.	ENSP00000256969:R71T	R	+	2	0	C12orf39	21573205	1.000000	0.71417	1.000000	0.80357	0.855000	0.48748	1.898000	0.39809	2.726000	0.93360	0.650000	0.86243	AGA	-	NULL		0.398	C12orf39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C12orf39	protein_coding	OTTHUMT00000402389.1	G			21573205	+1	no_errors	NM_030572	genbank	human	predicted	54_36p	missense	SNP	1.000	C
RAPGEF5	9771	genome.wustl.edu	37	7	22165226	22165226	+	Silent	SNP	C	C	T			TCGA-04-1651-01A-01W-0639-09	TCGA-04-1651-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f02d550d-d80c-449f-9d69-37ffb1e649b6	8e8ba185-6faf-49df-9784-594e179731c5	g.chr7:22165226C>T	ENST00000401957.2	-	15	1870	c.1623G>A	c.(1621-1623)caG>caA	p.Q541Q	RAPGEF5_ENST00000344041.6_Silent_p.Q691Q			Q92565	RPGF5_HUMAN	Rap guanine nucleotide exchange factor (GEF) 5	541	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				nervous system development (GO:0007399)|positive regulation of Rap GTPase activity (GO:0032854)|positive regulation of Ras GTPase activity (GO:0032320)|small GTPase mediated signal transduction (GO:0007264)	nucleus (GO:0005634)	GTP-dependent protein binding (GO:0030742)|Rap guanyl-nucleotide exchange factor activity (GO:0017034)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			central_nervous_system(1)|endometrium(1)|kidney(1)|lung(2)|ovary(1)	6						ACTCACCAAACTGGTTAGTCC	0.438																																																0			7											148.0	141.0	143.0					7																	22165226		1965	4143	6108	22131751	SO:0001819	synonymous_variant	9771			D87467	CCDS55093.1	7p15.3	2004-03-01			ENSG00000136237	ENSG00000136237			16862	protein-coding gene	gene with protein product	"""M-Ras-regulated GEF"""	609527				9039502, 10486569	Standard	NM_012294		Approved	KIAA0277, GFR, MR-GEF	uc003svg.3	Q92565	OTTHUMG00000152525	ENST00000401957.2:c.1623G>A	7.37:g.22165226C>T			22131751	A4D140|Q8IXU5	Silent	SNP	"superfamily_""Winged helix"" DNA-binding domain,superfamily_Ras GEF,HMMSmart_SM00229,HMMPfam_RasGEF_N,HMMSmart_SM00147,HMMPfam_RasGEF,PatternScan_RASGEF"	p.Q691	ENST00000401957.2	37	c.2073		7																																																																																			-	superfamily_Ras GEF,HMMSmart_SM00147		0.438	RAPGEF5-001	KNOWN	basic	protein_coding	RAPGEF5	protein_coding	OTTHUMT00000326590.2	C	NM_012294		22131751	-1	no_errors	NM_012294	genbank	human	validated	54_36p	silent	SNP	1.000	T
GPR158	57512	genome.wustl.edu	37	10	25887337	25887337	+	Missense_Mutation	SNP	C	C	T	rs149419744		TCGA-04-1651-01A-01W-0639-09	TCGA-04-1651-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f02d550d-d80c-449f-9d69-37ffb1e649b6	8e8ba185-6faf-49df-9784-594e179731c5	g.chr10:25887337C>T	ENST00000376351.3	+	11	3141	c.2782C>T	c.(2782-2784)Cgc>Tgc	p.R928C	GPR158_ENST00000490549.1_3'UTR	NM_020752.2	NP_065803.2	Q5T848	GP158_HUMAN	G protein-coupled receptor 158	928					protein localization to plasma membrane (GO:0072659)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(5)|cervix(1)|endometrium(9)|kidney(10)|large_intestine(20)|lung(56)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	119						TGTGGAAGAACGCACTAAATC	0.438													C|||	1	0.000199681	0.0008	0.0	5008	,	,		19033	0.0		0.0	False		,,,				2504	0.0															0			10						C	CYS/ARG	0,4406		0,0,2203	128.0	141.0	137.0		2782	2.4	0.0	10	dbSNP_134	137	1,8599	1.2+/-3.3	0,1,4299	no	missense	GPR158	NM_020752.2	180	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging	928/1216	25887337	1,13005	2203	4300	6503	25927343	SO:0001583	missense	57512			AB032962	CCDS31166.1	10p12.31	2012-08-21			ENSG00000151025	ENSG00000151025		"""GPCR / Class C : Orphans"""	23689	protein-coding gene	gene with protein product		614573					Standard	NM_020752		Approved	KIAA1136	uc001isj.3	Q5T848	OTTHUMG00000017832	ENST00000376351.3:c.2782C>T	10.37:g.25887337C>T	ENSP00000365529:p.Arg928Cys		25927343	Q6QR81|Q9ULT3	Missense_Mutation	SNP	PatternScan_G_PROTEIN_RECEP_F3_1,PatternScan_G_PROTEIN_RECEP_F3_2,PatternScan_G_PROTEIN_RECEP_F3_3,HMMPfam_7tm_3	p.R928C	ENST00000376351.3	37	c.2782	CCDS31166.1	10	.	.	.	.	.	.	.	.	.	.	C	7.477	0.647797	0.14516	0.0	1.16E-4	ENSG00000151025	ENST00000376351	T	0.32023	1.47	5.52	2.36	0.29203	.	0.368550	0.25726	N	0.028709	T	0.31888	0.0811	L	0.44542	1.39	0.09310	N	1	D	0.53312	0.959	P	0.49361	0.608	T	0.10823	-1.0613	10	0.56958	D	0.05	.	10.0004	0.41924	0.4333:0.4747:0.092:0.0	.	928	Q5T848	GP158_HUMAN	C	928	ENSP00000365529:R928C	ENSP00000365529:R928C	R	+	1	0	GPR158	25927343	0.001000	0.12720	0.027000	0.17364	0.115000	0.19883	1.462000	0.35266	0.303000	0.22785	-2.122000	0.00348	CGC	-	NULL		0.438	GPR158-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR158	protein_coding	OTTHUMT00000047248.2	C	XM_166110		25927343	+1	no_errors	NM_020752	genbank	human	validated	54_36p	missense	SNP	0.011	T
MASTL	84930	genome.wustl.edu	37	10	27454367	27454367	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1651-01A-01W-0639-09	TCGA-04-1651-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f02d550d-d80c-449f-9d69-37ffb1e649b6	8e8ba185-6faf-49df-9784-594e179731c5	g.chr10:27454367C>T	ENST00000375940.4	+	6	767	c.710C>T	c.(709-711)gCc>gTc	p.A237V	MASTL_ENST00000375946.4_Missense_Mutation_p.A237V|MASTL_ENST00000342386.6_Missense_Mutation_p.A237V			Q96GX5	GWL_HUMAN	microtubule associated serine/threonine kinase-like	237	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular response to DNA damage stimulus (GO:0006974)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of protein phosphatase type 2A activity (GO:0034048)|regulation of cell cycle (GO:0051726)	centrosome (GO:0005813)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|protein phosphatase 2A binding (GO:0051721)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|cervix(2)|endometrium(2)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						ATCCTTTCAGCCTGTCTGTCT	0.378																																																0			10											134.0	124.0	128.0					10																	27454367		2203	4300	6503	27494373	SO:0001583	missense	84930			BC009107	CCDS7153.1, CCDS53502.1, CCDS53503.1	10p12.1	2005-11-03			ENSG00000120539	ENSG00000120539			19042	protein-coding gene	gene with protein product		608221					Standard	NM_001172303		Approved	FLJ14813, THC2	uc001itm.3	Q96GX5	OTTHUMG00000017855	ENST00000375940.4:c.710C>T	10.37:g.27454367C>T	ENSP00000365107:p.Ala237Val		27494373	Q5T8D5|Q5T8D7|Q8NCD6|Q96SJ5	Missense_Mutation	SNP	superfamily_Kinase_like,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ST,HMMSmart_S_TK_X	p.A237V	ENST00000375940.4	37	c.710	CCDS53502.1	10	.	.	.	.	.	.	.	.	.	.	C	10.71	1.428064	0.25726	.	.	ENSG00000120539	ENST00000375946;ENST00000342386;ENST00000375940	D;D;D	0.83591	-1.74;-1.74;-1.74	5.97	3.03	0.35002	Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.491079	0.26582	N	0.023565	T	0.73329	0.3573	L	0.36672	1.1	0.09310	N	1	B;B;B	0.24368	0.102;0.062;0.102	B;B;B	0.23852	0.049;0.024;0.049	T	0.62539	-0.6833	10	0.40728	T	0.16	-0.0155	9.1902	0.37195	0.0:0.4554:0.4572:0.0874	.	237;237;237	Q96GX5-2;Q96GX5;Q96GX5-3	.;GWL_HUMAN;.	V	237	ENSP00000365113:A237V;ENSP00000343446:A237V;ENSP00000365107:A237V	ENSP00000343446:A237V	A	+	2	0	MASTL	27494373	0.020000	0.18652	0.005000	0.12908	0.074000	0.17049	1.874000	0.39568	0.855000	0.35359	0.591000	0.81541	GCC	-	superfamily_Kinase_like		0.378	MASTL-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MASTL	protein_coding	OTTHUMT00000047320.1	C	NM_032844		27494373	+1	no_errors	NM_032844	genbank	human	validated	54_36p	missense	SNP	0.014	T
HIST1H4K	8362	genome.wustl.edu	37	6	27799038	27799038	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1651-01A-01W-0639-09	TCGA-04-1651-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f02d550d-d80c-449f-9d69-37ffb1e649b6	8e8ba185-6faf-49df-9784-594e179731c5	g.chr6:27799038C>T	ENST00000357549.2	-	1	267	c.268G>A	c.(268-270)Gcg>Acg	p.A90T		NM_003541.2	NP_003532.1	P62805	H4_HUMAN	histone cluster 1, H4k	90					CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of megakaryocyte differentiation (GO:0045653)|nucleosome assembly (GO:0006334)|telomere maintenance (GO:0000723)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|histone demethylase activity (H4-K20 specific) (GO:0035575)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|lung(3)|ovary(1)|prostate(1)	7						CGCTTGAGCGCGTAGACCACA	0.597																																																0			6											26.0	30.0	29.0					6																	27799038		2202	4296	6498	27907017	SO:0001583	missense	8362			X60483	CCDS4631.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000197914	ENSG00000273542		"""Histones / Replication-dependent"""	4784	protein-coding gene	gene with protein product		602825	"""H4 histone family, member D"", ""histone 1, H4k"""	H4FD		9439656, 12408966	Standard	NM_003541		Approved	H4/d, H4F2iii, dJ160A22.1	uc003njr.3	P62805	OTTHUMG00000014488	ENST00000357549.2:c.268G>A	6.37:g.27799038C>T	ENSP00000350159:p.Ala90Thr		27907017	A2VCL0|P02304|P02305|Q6DRA9|Q6FGB8|Q6NWP7	Missense_Mutation	SNP	superfamily_Histone-fold,PatternScan_HISTONE_H4,HMMSmart_SM00417,HMMPfam_Histone,HMMSmart_SM00803	p.A90T	ENST00000357549.2	37	c.268	CCDS4631.1	6	.	.	.	.	.	.	.	.	.	.	.	26.9	4.785946	0.90282	.	.	ENSG00000197914	ENST00000357549	T	0.80033	-1.33	4.25	4.25	0.50352	.	0.000000	0.52532	U	0.000074	D	0.84642	0.5517	.	.	.	0.43152	D	0.994923	.	.	.	.	.	.	D	0.86883	0.2043	7	0.62326	D	0.03	.	16.0265	0.80548	0.0:1.0:0.0:0.0	.	.	.	.	T	90	ENSP00000350159:A90T	ENSP00000350159:A90T	A	-	1	0	HIST1H4K	27907017	1.000000	0.71417	1.000000	0.80357	0.820000	0.46376	5.277000	0.65586	2.064000	0.61679	0.650000	0.86243	GCG	-	superfamily_Histone-fold,HMMSmart_SM00417,HMMPfam_Histone,HMMSmart_SM00803		0.597	HIST1H4K-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H4K	protein_coding	OTTHUMT00000040156.1	C	NM_003541		27907017	-1	no_errors	NM_003541	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
EWSR1	2130	genome.wustl.edu	37	22	29688506	29688506	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1651-01A-01W-0639-09	TCGA-04-1651-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f02d550d-d80c-449f-9d69-37ffb1e649b6	8e8ba185-6faf-49df-9784-594e179731c5	g.chr22:29688506G>A	ENST00000397938.2	+	11	1394	c.1075G>A	c.(1075-1077)Gac>Aac	p.D359N	EWSR1_ENST00000406548.1_Missense_Mutation_p.D358N|EWSR1_ENST00000332050.6_Missense_Mutation_p.D286N|EWSR1_ENST00000332035.6_Missense_Mutation_p.D303N|EWSR1_ENST00000331029.7_Missense_Mutation_p.D321N|EWSR1_ENST00000414183.2_Missense_Mutation_p.D364N	NM_001163285.1|NM_001163286.1|NM_005243.3|NM_013986.3	NP_001156757.1|NP_001156758.1|NP_005234.1|NP_053733.2	Q01844	EWS_HUMAN	EWS RNA-binding protein 1	359					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)		EWSR1/ATF1(347)|EWSR1/POU5F1(10)|EWSR1/PBX1(3)|EWSR1/DDIT3(45)|EWSR1/FEV(11)|EWSR1/CREB1(44)|EWSR1/SMARCA5(2)|EWSR1/ETV4(6)|EWSR1/ERG(178)|EWSR1/ZNF384(4)|EWSR1/ETV1(7)|EWSR1/FLI1(2569)|EWSR1/NR4A3(146)|EWSR1/SP3(3)|EWSR1/PATZ1(2)|EWSR1/WT1(234)|EWSR1/NFATC2(9)	breast(2)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|liver(1)|lung(6)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26						TGAAGACTCTGACAACAGTGC	0.398			T	"""FLI1, ERG, ZNF278, NR4A3, FEV, ATF1, ETV1, ETV4, WT1, ZNF384, CREB1, POU5F1,  PBX1"""	"""Ewing sarcoma,  desmoplastic small round cell tumor , ALL, clear cell sarcoma, sarcoma, myoepithelioma"""																																		Dom	yes		22	22q12	2130	Ewing sarcoma breakpoint region 1 (EWS)		"""L, M"""	0			22											167.0	153.0	158.0					22																	29688506		2203	4300	6503	28018506	SO:0001583	missense	2130				CCDS13851.1, CCDS13852.1, CCDS13852.2, CCDS54512.1, CCDS54513.1, CCDS54514.1	22q12.2	2013-05-24	2013-05-24		ENSG00000182944	ENSG00000182944		"""RNA binding motif (RRM) containing"""	3508	protein-coding gene	gene with protein product		133450	"""Ewing sarcoma breakpoint region 1"""			1522903	Standard	NM_005243		Approved	EWS	uc003aev.3	Q01844	OTTHUMG00000151107	ENST00000397938.2:c.1075G>A	22.37:g.29688506G>A	ENSP00000381031:p.Asp359Asn		28018506	B0QYK1|Q5THL0|Q92635|Q96FE8|Q96MN4|Q96MX4|Q9BWA2	Missense_Mutation	SNP	HMMPfam_SVS_QK,superfamily_RNA-binding domain RBD,HMMSmart_SM00360,HMMPfam_RRM_1,superfamily_Znf265 first zinc-finger domain,HMMPfam_zf-RanBP,HMMSmart_SM00547,PatternScan_ZF_RANBP2_1	p.D359N	ENST00000397938.2	37	c.1075	CCDS13851.1	22	.	.	.	.	.	.	.	.	.	.	G	36	5.619178	0.96649	.	.	ENSG00000182944	ENST00000332050;ENST00000397938;ENST00000406548;ENST00000331029;ENST00000414183;ENST00000332035	T;T;T;T;T;T	0.74737	1.29;-0.87;-0.87;-0.87;-0.87;-0.87	5.77	5.77	0.91146	Nucleotide-binding, alpha-beta plait (1);	0.059144	0.64402	U	0.000005	T	0.80783	0.4689	L	0.52573	1.65	0.58432	D	0.999997	P;P;P;B;P	0.46578	0.766;0.88;0.766;0.006;0.88	P;P;P;B;P	0.53313	0.723;0.723;0.723;0.042;0.723	T	0.81362	-0.0967	10	0.72032	D	0.01	.	20.0007	0.97408	0.0:0.0:1.0:0.0	.	303;358;303;364;359	Q96MN4;Q96FE8;B0QYK1;Q96MX4;Q01844	.;.;.;.;EWS_HUMAN	N	286;359;358;321;364;303	ENSP00000330896:D286N;ENSP00000381031:D359N;ENSP00000385726:D358N;ENSP00000330516:D321N;ENSP00000400142:D364N;ENSP00000331699:D303N	ENSP00000330516:D321N	D	+	1	0	EWSR1	28018506	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.434000	0.97515	2.726000	0.93360	0.650000	0.86243	GAC	-	superfamily_RNA-binding domain RBD		0.398	EWSR1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	EWSR1	protein_coding	OTTHUMT00000321345.1	G	NM_005243		28018506	+1	no_errors	NM_005243	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
PRR14L	253143	genome.wustl.edu	37	22	32113269	32113269	+	Missense_Mutation	SNP	C	C	A	rs112531886	byFrequency	TCGA-04-1651-01A-01W-0639-09	TCGA-04-1651-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f02d550d-d80c-449f-9d69-37ffb1e649b6	8e8ba185-6faf-49df-9784-594e179731c5	g.chr22:32113269C>A	ENST00000327423.6	-	4	745	c.556G>T	c.(556-558)Gta>Tta	p.V186L	PRR14L_ENST00000461722.1_5'UTR|PRR14L_ENST00000397493.2_Missense_Mutation_p.V186L|PRR14L_ENST00000434485.1_Missense_Mutation_p.V186L	NM_173566.2	NP_775837.2	Q5THK1	PR14L_HUMAN	proline rich 14-like	186										endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(5)|skin(1)|urinary_tract(2)	14						GTAATCTGTACATTTCCTTCT	0.353													C|||	166	0.033147	0.0015	0.0173	5008	,	,		20285	0.0268		0.0388	False		,,,				2504	0.0879															0			22											161.0	118.0	131.0					22																	32113269		692	1591	2283	30443269	SO:0001583	missense	253143			BC040859	CCDS13900.2	22q12.2	2011-01-25	2011-01-25	2011-01-25	ENSG00000183530	ENSG00000183530			28738	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 30"""	C22orf30		12477932	Standard	NM_173566		Approved	MGC50372	uc003alp.4	Q5THK1	OTTHUMG00000030139	ENST00000327423.6:c.556G>T	22.37:g.32113269C>A	ENSP00000331845:p.Val186Leu		30443269	Q5THK4|Q6ZNN1|Q6ZWH0|Q8IW74|Q9H5T4	Missense_Mutation	SNP	NULL	p.V186L	ENST00000327423.6	37	c.556	CCDS13900.2	22	65	0.02976190476190476	3	0.006097560975609756	10	0.027624309392265192	20	0.03496503496503497	32	0.04221635883905013	C	15.04	2.715474	0.48622	.	.	ENSG00000183530	ENST00000397493;ENST00000327423;ENST00000434485	T;T;T	0.09630	2.96;2.98;2.96	5.21	4.19	0.49359	.	0.154521	0.29806	N	0.011152	T	0.04407	0.0121	M	0.62723	1.935	0.80722	D	1	D	0.57571	0.98	P	0.50934	0.654	T	0.00299	-1.1836	10	0.56958	D	0.05	-8.4182	11.3719	0.49704	0.0:0.9163:0.0:0.0837	.	186	Q5THK1	PR14L_HUMAN	L	186	ENSP00000380630:V186L;ENSP00000331845:V186L;ENSP00000388314:V186L	ENSP00000331845:V186L	V	-	1	0	PRR14L	30443269	1.000000	0.71417	0.956000	0.39512	0.199000	0.23934	1.154000	0.31688	1.195000	0.43115	0.650000	0.86243	GTA	-	NULL		0.353	PRR14L-001	NOVEL	basic|appris_principal|CCDS	protein_coding	C22orf30	protein_coding	OTTHUMT00000074993.2	C	NM_173566		30443269	-1	no_errors	ENST00000327423	ensembl	human	known	54_36p	missense	SNP	1.000	A
CCL15	6359	genome.wustl.edu	37	17	34328515	34328515	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1651-01A-01W-0639-09	TCGA-04-1651-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f02d550d-d80c-449f-9d69-37ffb1e649b6	8e8ba185-6faf-49df-9784-594e179731c5	g.chr17:34328515G>A	ENST00000354059.4	-	1	569	c.17C>T	c.(16-18)gCt>gTt	p.A6V	RP11-104J23.1_ENST00000590192.1_RNA|CCL15-CCL14_ENST00000481427.2_Missense_Mutation_p.A6V|CCL14_ENST00000536149.1_5'UTR	NM_032965.4	NP_116741.1	Q16663	CCL15_HUMAN	chemokine (C-C motif) ligand 15	6					cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|cellular calcium ion homeostasis (GO:0006874)|chemotaxis (GO:0006935)|immune response (GO:0006955)|positive chemotaxis (GO:0050918)|signal transduction (GO:0007165)	extracellular space (GO:0005615)	chemoattractant activity (GO:0042056)|chemokine activity (GO:0008009)|heparin binding (GO:0008201)|receptor binding (GO:0005102)			large_intestine(2)|lung(4)|ovary(1)|urinary_tract(1)	8		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		GGAGAGGGCAGCCACGGAGAC	0.612																																																0			17											83.0	63.0	70.0					17																	34328515		2203	4300	6503	31352628	SO:0001583	missense	6359			AF031587	CCDS11304.1	17q11.2	2014-05-06	2002-08-22	2002-08-23	ENSG00000267596	ENSG00000275718		"""Chemokine ligands"", ""Endogenous ligands"""	10613	protein-coding gene	gene with protein product	"""leukotactin 1"", ""CC chemokine 3"", ""macrophage inflammatory protein 5"", ""chemokine CC-2"", ""MIP-1 delta"""	601393	"""small inducible cytokine subfamily A (Cys-Cys), member 15"""	SCYA15		8661057	Standard	NM_032965		Approved	HCC-2, NCC-3, SCYL3, MIP-5, Lkn-1, MIP-1d, HMRP-2B	uc010wcu.2	Q16663	OTTHUMG00000188406	ENST00000354059.4:c.17C>T	17.37:g.34328515G>A	ENSP00000293276:p.Ala6Val		31352628	B2RU34|E1P651|Q9UM74	Missense_Mutation	SNP	superfamily_Chemokine_IL8,HMMPfam_IL8,HMMSmart_SCY,PatternScan_SMALL_CYTOKINES_CC	p.A6V	ENST00000354059.4	37	c.17	CCDS11304.1	17	.	.	.	.	.	.	.	.	.	.	G	17.31	3.356084	0.61293	.	.	ENSG00000161574	ENST00000354059	T	0.08102	3.13	3.32	3.32	0.38043	.	1.276180	0.05818	N	0.615141	T	0.20659	0.0497	L	0.51422	1.61	0.09310	N	1	D	0.69078	0.997	P	0.59424	0.857	T	0.18967	-1.0320	10	0.48119	T	0.1	.	10.4158	0.44320	0.0:0.0:1.0:0.0	.	6	Q16663	CCL15_HUMAN	V	6	ENSP00000293276:A6V	ENSP00000293276:A6V	A	-	2	0	CCL15	31352628	0.004000	0.15560	0.062000	0.19696	0.002000	0.02628	0.478000	0.22212	2.137000	0.66172	0.603000	0.83216	GCT	-	NULL		0.612	CCL15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCL15	protein_coding	OTTHUMT00000256584.2	G	NM_004167		31352628	-1	no_errors	NM_032965	genbank	human	reviewed	54_36p	missense	SNP	0.039	A
LY6G6F	259215	genome.wustl.edu	37	6	31675350	31675350	+	Silent	SNP	C	C	A			TCGA-04-1651-01A-01W-0639-09	TCGA-04-1651-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f02d550d-d80c-449f-9d69-37ffb1e649b6	8e8ba185-6faf-49df-9784-594e179731c5	g.chr6:31675350C>A	ENST00000375832.4	+	2	190	c.168C>A	c.(166-168)ggC>ggA	p.G56G	XXbac-BPG32J3.20_ENST00000461287.1_Intron|LY6G6F_ENST00000556581.1_Silent_p.G56G|MEGT1_ENST00000503322.1_Silent_p.G56G	NM_001003693.1	NP_001003693.1	Q5SQ64	LY66F_HUMAN	lymphocyte antigen 6 complex, locus G6F	56	Ig-like V-type.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(4)	12						CTGCAGCAGGCTCCTTCACCA	0.592																																																0			6											49.0	43.0	45.0					6																	31675350		2203	4300	6503	31783329	SO:0001819	synonymous_variant	259215				CCDS34403.1	6p21	2013-01-11	2008-05-21	2008-05-21		ENSG00000204424		"""Immunoglobulin superfamily / V-set domain containing"""	13933	protein-coding gene	gene with protein product		611404	"""chromosome 6 open reading frame 21"""	LY6G6D, C6orf21		12852788	Standard	NM_001003693		Approved	G6f, NG32	uc003nwa.1	Q5SQ64	OTTHUMG00000031252	ENST00000375832.4:c.168C>A	6.37:g.31675350C>A			31783329	B0UXB7|O95869|Q7Z5H2|Q96QC7|Q9NZJ1	Silent	SNP	superfamily_Immunoglobulin,HMMSmart_SM00409	p.G56	ENST00000375832.4	37	c.168	CCDS34403.1	6																																																																																			-	superfamily_Immunoglobulin,HMMSmart_SM00409		0.592	LY6G6F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LY6G6F	protein_coding	OTTHUMT00000076532.2	C	NM_001003693		31783329	+1	no_errors	NM_001003693	genbank	human	provisional	54_36p	silent	SNP	0.116	A
PDZD2	23037	genome.wustl.edu	37	5	31983260	31983260	+	Splice_Site	SNP	G	G	T			TCGA-04-1651-01A-01W-0639-09	TCGA-04-1651-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f02d550d-d80c-449f-9d69-37ffb1e649b6	8e8ba185-6faf-49df-9784-594e179731c5	g.chr5:31983260G>T	ENST00000438447.1	+	3	864		c.e3-1		PDZD2_ENST00000282493.3_Splice_Site			O15018	PDZD2_HUMAN	PDZ domain containing 2						cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)				NS(2)|breast(4)|central_nervous_system(5)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(31)|lung(58)|ovary(6)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	148						GTCTGTTGCAGTTACCTGGCT	0.532																																																0			5											94.0	99.0	98.0					5																	31983260		2203	4300	6503	32019017	SO:0001630	splice_region_variant	23037			AB002298	CCDS34137.1	5p14.1	2008-02-05	2006-01-24	2006-01-24		ENSG00000133401			18486	protein-coding gene	gene with protein product		610697	"""PDZ domain containing 3"""	PDZK3		9205841	Standard	XM_005248271		Approved	KIAA0300	uc003jhm.3	O15018		ENST00000438447.1:c.477-1G>T	5.37:g.31983260G>T			32019017	Q9BXD4	Splice_Site	SNP	-	e2-1	ENST00000438447.1	37	c.477-1	CCDS34137.1	5	.	.	.	.	.	.	.	.	.	.	G	22.2	4.252076	0.80135	.	.	ENSG00000133401	ENST00000438447;ENST00000382161;ENST00000282493	.	.	.	5.23	5.23	0.72850	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.3449	0.83120	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PDZD2	32019017	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	8.796000	0.91877	2.722000	0.93159	0.650000	0.86243	.	-	-		0.532	PDZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDZD2	protein_coding	OTTHUMT00000366608.1	G		Intron	32019017	+1	no_errors	NM_178140	genbank	human	reviewed	54_36p	splice_site	SNP	1.000	T
SON	6651	genome.wustl.edu	37	21	34915420	34915420	+	Missense_Mutation	SNP	A	A	C			TCGA-04-1651-01A-01W-0639-09	TCGA-04-1651-11A-01W-0639-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f02d550d-d80c-449f-9d69-37ffb1e649b6	8e8ba185-6faf-49df-9784-594e179731c5	g.chr21:34915420A>C	ENST00000356577.4	+	1	497	c.22A>C	c.(22-24)Att>Ctt	p.I8L	GART_ENST00000361093.5_5'Flank|SON_ENST00000381692.2_Missense_Mutation_p.I8L|SON_ENST00000300278.4_Missense_Mutation_p.I8L|GART_ENST00000381839.3_5'Flank|SON_ENST00000290239.6_Missense_Mutation_p.I8L|GART_ENST00000381831.3_5'Flank|SON_ENST00000381679.4_Missense_Mutation_p.I8L|GART_ENST00000381815.4_5'Flank	NM_138927.1	NP_620305	P18583	SON_HUMAN	SON DNA binding protein	8					cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|regulation of cell cycle (GO:0051726)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleic acid binding (GO:0003676)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(3)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(25)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	72						CATCGAGCAGATTTTTAGGTC	0.577											OREG0003561	type=REGULATORY REGION|Gene=GART|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																																				0			21											137.0	125.0	129.0					21																	34915420		2203	4300	6503	33837290	SO:0001583	missense	6651			AF380181	CCDS13629.1, CCDS13631.1, CCDS74784.1	21q22.1-q22.2	2013-01-28			ENSG00000159140	ENSG00000159140		"""G patch domain containing"""	11183	protein-coding gene	gene with protein product	"""NRE-binding protein"", ""negative regulatory element-binding protein"", ""Bax antagonist selected in Saccharomyces 1"""	182465		C21orf50		8318737, 21551269	Standard	NM_032195		Approved	DBP-5, NREBP, KIAA1019, BASS1, FLJ21099, FLJ33914	uc002yse.1	P18583	OTTHUMG00000065806	ENST00000356577.4:c.22A>C	21.37:g.34915420A>C	ENSP00000348984:p.Ile8Leu	851	33837290	D3DSF5|D3DSF6|E7ETE8|E7EU67|E7EVW3|E9PFQ2|O14487|O95981|Q14120|Q6PKE0|Q9H7B1|Q9P070|Q9P072|Q9UKP9|Q9UPY0	Missense_Mutation	SNP	HMMSmart_SM00443,HMMPfam_G-patch,superfamily_dsRNA-binding domain-like,HMMPfam_dsrm	p.I8L	ENST00000356577.4	37	c.22	CCDS13629.1	21	.	.	.	.	.	.	.	.	.	.	A	17.77	3.471578	0.63737	.	.	ENSG00000159140	ENST00000356577;ENST00000290239;ENST00000381692;ENST00000300278;ENST00000381679	T;T;T;T;T	0.15487	2.42;2.42;2.42;2.42;2.42	5.14	2.83	0.33086	.	0.253365	0.28241	N	0.016072	T	0.11580	0.0282	L	0.29908	0.895	0.21950	N	0.999456	B;P;P;P	0.39352	0.001;0.539;0.669;0.499	B;B;B;B	0.38880	0.001;0.147;0.284;0.175	T	0.13124	-1.0521	10	0.51188	T	0.08	.	6.0589	0.19826	0.7499:0.0:0.2501:0.0	.	8;8;8;8	Q6ZRV7;P18583;P18583-3;P18583-6	.;SON_HUMAN;.;.	L	8	ENSP00000348984:I8L;ENSP00000290239:I8L;ENSP00000371111:I8L;ENSP00000300278:I8L;ENSP00000371095:I8L	ENSP00000290239:I8L	I	+	1	0	SON	33837290	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.899000	0.48679	0.464000	0.27142	0.533000	0.62120	ATT	-	NULL		0.577	SON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SON	protein_coding	OTTHUMT00000140978.2	A	NM_138927		33837290	+1	no_errors	NM_138927	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
AGGF1P6	106481737	genome.wustl.edu	37	16	34724394	34724394	+	lincRNA	SNP	T	T	G			TCGA-04-1651-01A-01W-0639-09	TCGA-04-1651-11A-01W-0639-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f02d550d-d80c-449f-9d69-37ffb1e649b6	8e8ba185-6faf-49df-9784-594e179731c5	g.chr16:34724394T>G	ENST00000566562.1	-	0	960																											AAACTCCAATTTTGCTTTAGC	0.428																																																0			16																																								34581895			0																															16.37:g.34724394T>G			34581895		RNA	SNP	-	NULL	ENST00000566562.1	37	NULL		16																																																																																			-	-		0.428	RP11-80F22.14-001	KNOWN	basic	lincRNA	LOC100130041	lincRNA	OTTHUMT00000431377.1	T			34581895	+1	pseudogene	XR_037947	genbank	human	model	54_36p	rna	SNP	0.998	G
KRT9	3857	genome.wustl.edu	37	17	39724760	39724760	+	Splice_Site	SNP	C	C	G			TCGA-04-1651-01A-01W-0639-09	TCGA-04-1651-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f02d550d-d80c-449f-9d69-37ffb1e649b6	8e8ba185-6faf-49df-9784-594e179731c5	g.chr17:39724760C>G	ENST00000246662.4	-	5	1235	c.1170G>C	c.(1168-1170)aaG>aaC	p.K390N	KRT9_ENST00000588431.1_Splice_Site_p.K157N	NM_000226.3	NP_000217.2	P35527	K1C9_HUMAN	keratin 9	390	Coil 2.|Rod.				epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|skin development (GO:0043588)|spermatogenesis (GO:0007283)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25		Breast(137;0.000307)				AACTACCAACCTTGCTGAGCT	0.557																																																0			17											244.0	237.0	239.0					17																	39724760		2203	4300	6503	36978286	SO:0001630	splice_region_variant	3857				CCDS32654.1	17q21.2	2013-06-20	2008-08-01		ENSG00000171403	ENSG00000171403		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6447	protein-coding gene	gene with protein product	"""cytokeratin 9"", ""type I cytoskeletal 9"", ""epidermolytic palmoplantar keratoderma"""	607606				7512862, 16831889	Standard	NM_000226		Approved	EPPK, K9, CK-9	uc002hxe.4	P35527	OTTHUMG00000133599	ENST00000246662.4:c.1170+1G>C	17.37:g.39724760C>G			36978286	O00109|Q0IJ47|Q14665	Missense_Mutation	SNP	HMMPfam_Filament,PatternScan_IF	p.K390N	ENST00000246662.4	37	c.1170	CCDS32654.1	17	.	.	.	.	.	.	.	.	.	.	C	19.20	3.780891	0.70222	.	.	ENSG00000171403	ENST00000246662	D	0.88046	-2.33	5.15	3.01	0.34805	Filament (1);	0.909326	0.08925	N	0.873807	T	0.81108	0.4754	L	0.50333	1.59	0.30651	N	0.755444	P	0.35612	0.512	B	0.33121	0.158	T	0.74954	-0.3488	9	.	.	.	.	4.5826	0.12266	0.1528:0.5998:0.1643:0.0831	.	390	P35527	K1C9_HUMAN	N	390	ENSP00000246662:K390N	.	K	-	3	2	KRT9	36978286	0.998000	0.40836	0.956000	0.39512	0.919000	0.55068	3.813000	0.55636	1.131000	0.42111	0.561000	0.74099	AAG	-	HMMPfam_Filament		0.557	KRT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT9	protein_coding	OTTHUMT00000257707.1	C	NM_000226	Missense_Mutation	36978286	-1	no_errors	NM_000226	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
ALG10B	144245	genome.wustl.edu	37	12	38714298	38714298	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1651-01A-01W-0639-09	TCGA-04-1651-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f02d550d-d80c-449f-9d69-37ffb1e649b6	8e8ba185-6faf-49df-9784-594e179731c5	g.chr12:38714298G>C	ENST00000308742.4	+	3	1021	c.705G>C	c.(703-705)caG>caC	p.Q235H	ALG10B_ENST00000551464.1_Intron|AC117372.1_ENST00000401168.2_RNA	NM_001013620.3	NP_001013642.1	Q5I7T1	AG10B_HUMAN	ALG10B, alpha-1,2-glucosyltransferase	235					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transferase activity, transferring hexosyl groups (GO:0016758)			breast(2)|kidney(3)|large_intestine(7)|lung(8)|ovary(4)|skin(1)	25	Esophageal squamous(101;0.187)	Lung NSC(34;0.204)|all_lung(34;0.235)				AAATTCTTCAGTTTCTTTTGG	0.373																																																0			12											105.0	114.0	111.0					12																	38714298		2203	4297	6500	37000565	SO:0001583	missense	144245			AY845858	CCDS31772.1	12q12	2013-03-04	2013-03-04		ENSG00000175548	ENSG00000175548	2.4.1.256		31088	protein-coding gene	gene with protein product	"""potassium channel regulator 1"", ""dolichyl-P-Glc:Glc(2)Man(9)GlcNAc(2)-PP-dolichol alpha-1,2- glucosyltransferase"""		"""asparagine-linked glycosylation 10, alpha-1,2-glucosyltransferase homolog B (yeast)"""				Standard	NM_001013620		Approved	KCR1	uc001rln.4	Q5I7T1	OTTHUMG00000169298	ENST00000308742.4:c.705G>C	12.37:g.38714298G>C	ENSP00000310120:p.Gln235His		37000565	B2RPF4	Missense_Mutation	SNP	HMMPfam_DIE2_ALG10	p.Q235H	ENST00000308742.4	37	c.705	CCDS31772.1	12	.	.	.	.	.	.	.	.	.	.	N	0.127	-1.118847	0.01785	.	.	ENSG00000175548	ENST00000308742	T	0.56103	0.48	3.23	0.275	0.15659	.	0.704402	0.14176	N	0.336348	T	0.43942	0.1270	L	0.42245	1.32	0.58432	D	0.999993	P	0.41345	0.746	P	0.44359	0.447	T	0.28681	-1.0036	10	0.45353	T	0.12	.	5.2277	0.15404	0.2126:0.1706:0.6168:0.0	.	235	Q5I7T1	AG10B_HUMAN	H	235	ENSP00000310120:Q235H	ENSP00000310120:Q235H	Q	+	3	2	ALG10B	37000565	0.016000	0.18221	0.056000	0.19401	0.506000	0.33950	0.048000	0.14078	0.047000	0.15862	-0.163000	0.13421	CAG	-	HMMPfam_DIE2_ALG10		0.373	ALG10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALG10B	protein_coding	OTTHUMT00000403349.1	G	NM_001013620		37000565	+1	no_errors	NM_001013620	genbank	human	validated	54_36p	missense	SNP	0.180	C
DDX17	10521	genome.wustl.edu	37	22	38895460	38895460	+	Missense_Mutation	SNP	C	C	G	rs146518587	byFrequency	TCGA-04-1651-01A-01W-0639-09	TCGA-04-1651-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f02d550d-d80c-449f-9d69-37ffb1e649b6	8e8ba185-6faf-49df-9784-594e179731c5	g.chr22:38895460C>G	ENST00000396821.3	-	3	582	c.483G>C	c.(481-483)agG>agC	p.R161S	DDX17_ENST00000381633.3_Missense_Mutation_p.R82S|DDX17_ENST00000432525.1_5'UTR	NM_001098504.1|NM_006386.4	NP_001091974|NP_006377.2	Q92841	DDX17_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 17	161					ATP catabolic process (GO:0006200)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of skeletal muscle cell differentiation (GO:2001014)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|RNA helicase activity (GO:0003724)|RNA-dependent ATPase activity (GO:0008186)|transcription coactivator activity (GO:0003713)			breast(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(6)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	25	Melanoma(58;0.0286)					CATCTCCCCCCCTCACTGTAA	0.373																																					Ovarian(55;1085 1454 6392 21425)											0			22											163.0	149.0	154.0					22																	38895460		2203	4300	6503	37225406	SO:0001583	missense	10521			U59321	CCDS33646.1, CCDS46706.1	22q13.1	2012-02-23	2012-02-23		ENSG00000100201	ENSG00000100201		"""DEAD-boxes"""	2740	protein-coding gene	gene with protein product		608469	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 17 (72kD)"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 17"""			8871553, 17226766	Standard	NM_006386		Approved	P72	uc003avy.4	Q92841	OTTHUMG00000151136	ENST00000396821.3:c.483G>C	22.37:g.38895460C>G	ENSP00000380033:p.Arg161Ser		37225406	B1AHM0|Q69YT1|Q6ICD6	Missense_Mutation	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00487,HMMPfam_DEAD,PatternScan_DEAD_ATP_HELICASE,HMMSmart_SM00490,HMMPfam_Helicase_C	p.R161S	ENST00000396821.3	37	c.483	CCDS46706.1	22	.	.	.	.	.	.	.	.	.	.	C	11.58	1.679757	0.29783	.	.	ENSG00000100201	ENST00000396821;ENST00000381633;ENST00000403230;ENST00000404499	T;T;T	0.26223	1.75;1.76;1.76	5.44	3.25	0.37280	.	0.044866	0.85682	D	0.000000	T	0.14830	0.0358	L	0.36672	1.1	0.80722	D	1	B;B;B	0.22480	0.07;0.016;0.027	B;B;B	0.21917	0.016;0.016;0.037	T	0.11817	-1.0572	10	0.11485	T	0.65	-12.2355	3.3477	0.07141	0.1267:0.0705:0.2631:0.5398	.	82;163;161	Q92841;Q59F66;Q92841-4	DDX17_HUMAN;.;.	S	161;82;161;163	ENSP00000380033:R161S;ENSP00000371046:R82S;ENSP00000385536:R161S	ENSP00000371046:R82S	R	-	3	2	DDX17	37225406	0.581000	0.26741	1.000000	0.80357	0.972000	0.66771	-0.111000	0.10807	0.341000	0.23771	-0.458000	0.05436	AGG	-	superfamily_P-loop containing nucleoside triphosphate hydrolases		0.373	DDX17-001	KNOWN	basic|CCDS	protein_coding	DDX17	protein_coding	OTTHUMT00000321476.2	C	NM_030881		37225406	-1	no_errors	NM_001098504	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
RPGR	6103	genome.wustl.edu	37	X	38145034	38145034	+	Intron	SNP	C	C	G			TCGA-04-1651-01A-01W-0639-09	TCGA-04-1651-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f02d550d-d80c-449f-9d69-37ffb1e649b6	8e8ba185-6faf-49df-9784-594e179731c5	g.chrX:38145034C>G	ENST00000339363.3	-	14	2688				RPGR_ENST00000318842.7_Intron|TM4SF2_ENST00000465127.1_Intron|RPGR_ENST00000309513.3_Intron|RPGR_ENST00000338898.3_Intron|RPGR_ENST00000378505.2_Missense_Mutation_p.G1073A|RPGR_ENST00000342811.3_Intron			Q92834	RPGR_HUMAN	retinitis pigmentosa GTPase regulator						cilium assembly (GO:0042384)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|intraciliary transport (GO:0042073)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|Golgi apparatus (GO:0005794)|photoreceptor outer segment (GO:0001750)|sperm flagellum (GO:0036126)	guanyl-nucleotide exchange factor activity (GO:0005085)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	25						CTCTTCTTCGCCTGTCTCCTG	0.428																																																0			X											377.0	295.0	323.0					X																	38145034		2202	4300	6502	38029978	SO:0001627	intron_variant	6103			U57629	CCDS14246.1, CCDS35229.1	Xp11.4	2013-06-06	2004-02-13		ENSG00000156313	ENSG00000156313			10295	protein-coding gene	gene with protein product		312610	"""retinitis pigmentosa 15"", ""cone dystrophy 1 (X-linked)"""	CRD, RP3, RP15, COD1		8673101, 8817343	Standard	XM_005272633		Approved	CORDX1	uc004ded.1	Q92834	OTTHUMG00000021361	ENST00000339363.3:c.2520+1312G>C	X.37:g.38145034C>G			38029978	B1ARN3|E9PE28|O00702|O00737|Q3KN84|Q8N5T6|Q93039|Q9HD29|Q9UMR1	Missense_Mutation	SNP	superfamily_RCC1/BLIP-II,PatternScan_RCC1_2,HMMPfam_RCC1	p.G1073A	ENST00000339363.3	37	c.3218		X	.	.	.	.	.	.	.	.	.	.	c	6.732	0.503906	0.12822	.	.	ENSG00000156313	ENST00000378505	T	0.02369	4.32	2.84	1.89	0.25635	.	0.438446	0.20009	U	0.101167	T	0.04092	0.0114	M	0.61703	1.905	0.09310	N	1	P	0.35923	0.528	B	0.34779	0.189	T	0.27673	-1.0067	10	0.87932	D	0	.	8.3797	0.32463	0.4171:0.5829:0.0:0.0	.	1073	E9PE28	.	A	1073	ENSP00000367766:G1073A	ENSP00000367766:G1073A	G	-	2	0	RPGR	38029978	0.068000	0.21057	0.001000	0.08648	0.356000	0.29392	1.453000	0.35167	0.315000	0.23110	0.339000	0.21740	GGC	-	NULL		0.428	RPGR-203	KNOWN	basic|appris_candidate	protein_coding	RPGR	protein_coding		C	NM_000328		38029978	-1	no_errors	NM_001034853	genbank	human	reviewed	54_36p	missense	SNP	0.014	G
CHD6	84181	genome.wustl.edu	37	20	40049694	40049694	+	Nonsense_Mutation	SNP	G	G	A			TCGA-04-1651-01A-01W-0639-09	TCGA-04-1651-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f02d550d-d80c-449f-9d69-37ffb1e649b6	8e8ba185-6faf-49df-9784-594e179731c5	g.chr20:40049694G>A	ENST00000373233.3	-	31	5758	c.5581C>T	c.(5581-5583)Cag>Tag	p.Q1861*		NM_032221.3	NP_115597.3	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6	1861					ATP catabolic process (GO:0006200)|chromatin modification (GO:0016568)|positive regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0036091)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|transcription cofactor binding (GO:0001221)			breast(8)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(24)|lung(53)|ovary(8)|prostate(5)|skin(8)|stomach(1)|urinary_tract(9)	129		Myeloproliferative disorder(115;0.00425)				CTGTGGTTCTGACTCAAAATC	0.418																																																0			20											83.0	88.0	86.0					20																	40049694		2203	4300	6503	39483108	SO:0001587	stop_gained	84181			AF525085	CCDS13317.1	20q12	2003-03-07			ENSG00000124177	ENSG00000124177			19057	protein-coding gene	gene with protein product						11889561	Standard	NM_032221		Approved	KIAA1335, FLJ22369, dJ620E11.1, CHD5, RIGB	uc002xka.1	Q8TD26	OTTHUMG00000032487	ENST00000373233.3:c.5581C>T	20.37:g.40049694G>A	ENSP00000362330:p.Gln1861*		39483108	Q5JYQ0|Q5TGZ9|Q5TH00|Q5TH01|Q8IZR2|Q8WTY0|Q9H4H6|Q9H6D4|Q9NTT7|Q9P2L1	Nonsense_Mutation	SNP	superfamily_Chromo domain-like,HMMSmart_SM00298,HMMPfam_Chromo,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00487,HMMPfam_SNF2_N,PatternScan_DEAH_ATP_HELICASE,HMMSmart_SM00490,HMMPfam_Helicase_C,HMMPfam_BRK,HMMSmart_SM00592	p.Q1861*	ENST00000373233.3	37	c.5581	CCDS13317.1	20	.	.	.	.	.	.	.	.	.	.	G	45	11.995545	0.99625	.	.	ENSG00000124177	ENST00000373233	.	.	.	5.86	4.91	0.64330	.	0.229535	0.31092	N	0.008262	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	-3.224	15.4885	0.75587	0.0:0.1377:0.8623:0.0	.	.	.	.	X	1861	.	ENSP00000362330:Q1861X	Q	-	1	0	CHD6	39483108	1.000000	0.71417	0.997000	0.53966	0.989000	0.77384	4.270000	0.58896	1.474000	0.48178	-0.165000	0.13383	CAG	-	NULL		0.418	CHD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD6	protein_coding	OTTHUMT00000079270.1	G			39483108	-1	no_errors	NM_032221	genbank	human	reviewed	54_36p	nonsense	SNP	1.000	A
TMEM62	80021	genome.wustl.edu	37	15	43438759	43438759	+	Nonsense_Mutation	SNP	C	C	A			TCGA-04-1651-01A-01W-0639-09	TCGA-04-1651-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f02d550d-d80c-449f-9d69-37ffb1e649b6	8e8ba185-6faf-49df-9784-594e179731c5	g.chr15:43438759C>A	ENST00000260403.2	+	5	824	c.545C>A	c.(544-546)tCg>tAg	p.S182*		NM_024956.3	NP_079232.3	Q0P6H9	TMM62_HUMAN	transmembrane protein 62	182						integral component of membrane (GO:0016021)				breast(1)|cervix(1)|endometrium(3)|large_intestine(3)|lung(4)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	18		all_cancers(109;1.16e-10)|all_epithelial(112;2.01e-09)|Lung NSC(122;8.91e-07)|all_lung(180;8.8e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;4.23e-07)		GGCAACTATTCGTTCATCTGT	0.393																																																0			15											227.0	222.0	224.0					15																	43438759		2203	4299	6502	41226051	SO:0001587	stop_gained	80021			BC009981	CCDS32210.1	15q15.2	2014-09-11			ENSG00000137842	ENSG00000137842			26269	protein-coding gene	gene with protein product							Standard	NM_024956		Approved	FLJ23375	uc001zqr.3	Q0P6H9	OTTHUMG00000176485	ENST00000260403.2:c.545C>A	15.37:g.43438759C>A	ENSP00000260403:p.Ser182*		41226051	Q6I9Y5|Q9H5J6	Nonsense_Mutation	SNP	superfamily_SSF56300	p.S182*	ENST00000260403.2	37	c.545	CCDS32210.1	15	.	.	.	.	.	.	.	.	.	.	C	37	6.527541	0.97637	.	.	ENSG00000137842	ENST00000260403	.	.	.	5.19	5.19	0.71726	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-15.8109	18.9054	0.92458	0.0:1.0:0.0:0.0	.	.	.	.	X	182	.	ENSP00000260403:S182X	S	+	2	0	TMEM62	41226051	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.392000	0.79840	2.691000	0.91804	0.563000	0.77884	TCG	-	superfamily_SSF56300		0.393	TMEM62-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM62	protein_coding	OTTHUMT00000432227.1	C	NM_024956		41226051	+1	no_errors	NM_024956	genbank	human	provisional	54_36p	nonsense	SNP	1.000	A
EPB42	2038	genome.wustl.edu	37	15	43500972	43500972	+	Splice_Site	SNP	C	C	A			TCGA-04-1651-01A-01W-0639-09	TCGA-04-1651-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f02d550d-d80c-449f-9d69-37ffb1e649b6	8e8ba185-6faf-49df-9784-594e179731c5	g.chr15:43500972C>A	ENST00000441366.2	-	7	1059	c.834G>T	c.(832-834)gtG>gtT	p.V278V	EPB42_ENST00000563128.1_5'Flank|EPB42_ENST00000300215.3_Splice_Site_p.V308V|EPB42_ENST00000540029.1_Splice_Site_p.V200V	NM_000119.2|NM_001114134.1	NP_000110.2|NP_001107606.1	P16452	EPB42_HUMAN	erythrocyte membrane protein band 4.2	278					cell morphogenesis (GO:0000902)|erythrocyte maturation (GO:0043249)|hemoglobin metabolic process (GO:0020027)|iron ion homeostasis (GO:0055072)|peptide cross-linking (GO:0018149)|regulation of cell shape (GO:0008360)|spleen development (GO:0048536)	cortical cytoskeleton (GO:0030863)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)|structural constituent of cytoskeleton (GO:0005200)			endometrium(3)|large_intestine(6)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20		all_cancers(109;1.37e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;8.7e-07)		GGCATCGCAGCACTGTGAGAA	0.597																																																0			15											33.0	33.0	33.0					15																	43500972		2203	4299	6502	41288264	SO:0001630	splice_region_variant	2038			M60298	CCDS10093.1, CCDS45249.1	15q15-q21	2013-05-02			ENSG00000166947	ENSG00000166947		"""Transglutaminases"""	3381	protein-coding gene	gene with protein product	"""Erythrocyte surface protein band 4.2"""	177070				1284644	Standard	NM_000119		Approved	PA, MGC116735, MGC116737	uc001zrb.4	P16452	OTTHUMG00000130701	ENST00000441366.2:c.833-1G>T	15.37:g.43500972C>A			41288264	Q4KKX0|Q4VB97	Silent	SNP	superfamily_Ig_E-set,HMMPfam_Transglut_N,superfamily_SSF54001,HMMSmart_TGc,PatternScan_TRANSGLUTAMINASES,HMMPfam_Transglut_core,superfamily_Transglut_C,HMMPfam_Transglut_C	p.V308	ENST00000441366.2	37	c.924	CCDS45249.1	15																																																																																			-	superfamily_SSF54001,HMMSmart_TGc,PatternScan_TRANSGLUTAMINASES,HMMPfam_Transglut_core		0.597	EPB42-003	KNOWN	basic|appris_principal|CCDS	protein_coding	EPB42	protein_coding	OTTHUMT00000432219.1	C	NM_000119	Silent	41288264	-1	no_errors	NM_000119	genbank	human	reviewed	54_36p	silent	SNP	0.998	A
ZNF345	25850	genome.wustl.edu	37	19	37368864	37368864	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1651-01A-01W-0639-09	TCGA-04-1651-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f02d550d-d80c-449f-9d69-37ffb1e649b6	8e8ba185-6faf-49df-9784-594e179731c5	g.chr19:37368864G>T	ENST00000529555.1	+	2	1920	c.1132G>T	c.(1132-1134)Gcc>Tcc	p.A378S	ZNF345_ENST00000432005.2_Intron|ZNF345_ENST00000420450.1_Missense_Mutation_p.A378S|ZNF345_ENST00000589046.1_Missense_Mutation_p.A378S|ZNF345_ENST00000526123.1_Intron			Q14585	ZN345_HUMAN	zinc finger protein 345	378					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A378S(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(13)|lung(5)|ovary(2)|prostate(1)	24	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			ATGTGGGAAGGCCTTTGGTAG	0.413																																																1	Substitution - Missense(1)	prostate(1)	19											88.0	84.0	85.0					19																	37368864		2203	4300	6503	42060704	SO:0001583	missense	25850			X78933	CCDS12497.1	19q13.12	2013-01-08			ENSG00000251247	ENSG00000251247		"""Zinc fingers, C2H2-type"""	16367	protein-coding gene	gene with protein product						7865130	Standard	NM_003419		Approved	HZF10	uc002oey.4	Q14585	OTTHUMG00000048162	ENST00000529555.1:c.1132G>T	19.37:g.37368864G>T	ENSP00000431202:p.Ala378Ser		42060704		Missense_Mutation	SNP	superfamily_SSF57667,HMMPfam_zf-C2H2,HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1	p.A378S	ENST00000529555.1	37	c.1132	CCDS12497.1	19	.	.	.	.	.	.	.	.	.	.	G	7.678	0.688312	0.14973	.	.	ENSG00000251247	ENST00000420450;ENST00000529555;ENST00000344705	T;T	0.35973	1.28;1.28	3.8	0.0882	0.14454	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.17619	0.0423	N	0.12422	0.21	0.09310	N	1	B	0.10296	0.003	B	0.13407	0.009	T	0.21109	-1.0255	9	0.54805	T	0.06	.	3.1051	0.06339	0.2285:0.0:0.4679:0.3036	.	378	Q14585	ZN345_HUMAN	S	378;378;142	ENSP00000431216:A378S;ENSP00000431202:A378S	ENSP00000442320:A142S	A	+	1	0	ZNF345	42060704	0.000000	0.05858	0.991000	0.47740	0.705000	0.40729	-0.498000	0.06420	0.369000	0.24510	0.462000	0.41574	GCC	-	superfamily_SSF57667,HMMPfam_zf-C2H2,HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1		0.413	ZNF345-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF345	protein_coding	OTTHUMT00000388258.1	G			42060704	+1	no_errors	NM_003419	genbank	human	provisional	54_36p	missense	SNP	0.107	T
SLC24A5	283652	genome.wustl.edu	37	15	48414182	48414182	+	Missense_Mutation	SNP	T	T	A			TCGA-04-1651-01A-01W-0639-09	TCGA-04-1651-11A-01W-0639-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f02d550d-d80c-449f-9d69-37ffb1e649b6	8e8ba185-6faf-49df-9784-594e179731c5	g.chr15:48414182T>A	ENST00000341459.3	+	2	323	c.250T>A	c.(250-252)Tct>Act	p.S84T	SLC24A5_ENST00000482911.2_Missense_Mutation_p.S84T|SLC24A5_ENST00000449382.2_Intron	NM_205850.2	NP_995322.1	Q71RS6	NCKX5_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 5	84					ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|negative regulation of melanin biosynthetic process (GO:0048022)|response to stimulus (GO:0050896)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	calcium, potassium:sodium antiporter activity (GO:0008273)|symporter activity (GO:0015293)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(17)|skin(1)|upper_aerodigestive_tract(1)	27		all_lung(180;0.00217)		all cancers(107;3.29e-10)|GBM - Glioblastoma multiforme(94;7.32e-07)		CATGGCCATATCTATTGTCTG	0.448																																																0			15											213.0	203.0	206.0					15																	48414182		2198	4297	6495	46201474	SO:0001583	missense	283652			AF348468	CCDS10128.1	15q21.1	2014-01-28	2013-07-18		ENSG00000188467	ENSG00000188467		"""Solute carriers"""	20611	protein-coding gene	gene with protein product	"""oculocutaneous albinism 6 (autosomal recessive)"""	609802	"""solute carrier family 24, member 5"""			23364476	Standard	XM_005254308		Approved	JSX, OCA6	uc001zwe.3	Q71RS6	OTTHUMG00000131494	ENST00000341459.3:c.250T>A	15.37:g.48414182T>A	ENSP00000341550:p.Ser84Thr		46201474	A5X8Z8|A5X8Z9|Q14CT4|Q6DKH3	Missense_Mutation	SNP	HMMPfam_Na_Ca_ex	p.S84T	ENST00000341459.3	37	c.250	CCDS10128.1	15	.	.	.	.	.	.	.	.	.	.	T	19.99	3.929038	0.73327	.	.	ENSG00000188467	ENST00000341459	T	0.62639	0.01	5.63	5.63	0.86233	Sodium/calcium exchanger membrane region (1);	0.179618	0.50627	D	0.000120	T	0.67221	0.2870	L	0.53249	1.67	0.80722	D	1	P;P	0.51351	0.939;0.944	P;P	0.53360	0.67;0.724	T	0.68530	-0.5384	10	0.49607	T	0.09	.	11.7544	0.51868	0.0:0.0:0.1471:0.8529	.	84;84	Q71RS6;A5X8Z8	NCKX5_HUMAN;.	T	84	ENSP00000341550:S84T	ENSP00000341550:S84T	S	+	1	0	SLC24A5	46201474	1.000000	0.71417	0.836000	0.33094	0.856000	0.48823	1.497000	0.35649	2.271000	0.75665	0.533000	0.62120	TCT	-	HMMPfam_Na_Ca_ex		0.448	SLC24A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC24A5	protein_coding	OTTHUMT00000254340.2	T	NM_205850		46201474	+1	no_errors	NM_205850	genbank	human	reviewed	54_36p	missense	SNP	0.988	A
CCR3	1232	genome.wustl.edu	37	3	46307410	46307410	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1651-01A-01W-0639-09	TCGA-04-1651-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f02d550d-d80c-449f-9d69-37ffb1e649b6	8e8ba185-6faf-49df-9784-594e179731c5	g.chr3:46307410C>A	ENST00000357422.2	+	4	1304	c.761C>A	c.(760-762)cCc>cAc	p.P254H	CCR3_ENST00000395942.2_Missense_Mutation_p.P254H|CCR3_ENST00000545097.1_Missense_Mutation_p.P275H|CCR3_ENST00000395940.2_Missense_Mutation_p.P254H|CCR3_ENST00000541018.1_Missense_Mutation_p.P254H			P51677	CCR3_HUMAN	chemokine (C-C motif) receptor 3	254					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cell adhesion (GO:0007155)|cellular defense response (GO:0006968)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|inflammatory response (GO:0006954)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of endothelial cell proliferation (GO:0001938)|viral process (GO:0016032)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|chemokine receptor activity (GO:0004950)			breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(5)|ovary(3)|urinary_tract(1)	18				BRCA - Breast invasive adenocarcinoma(193;0.00119)|KIRC - Kidney renal clear cell carcinoma(197;0.0183)|Kidney(197;0.0216)		TTCTGGACACCCTACAATGTG	0.463																																																0			3											90.0	89.0	90.0					3																	46307410		2203	4300	6503	46282414	SO:0001583	missense	1232			AF247361	CCDS2738.1, CCDS54574.1	3p21.3	2012-08-08			ENSG00000183625	ENSG00000183625		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1604	protein-coding gene	gene with protein product		601268		CMKBR3			Standard	NM_178328		Approved	CC-CKR-3, CKR3, CD193	uc003cpk.2	P51677	OTTHUMG00000133484	ENST00000357422.2:c.761C>A	3.37:g.46307410C>A	ENSP00000350003:p.Pro254His		46282414	B3KVQ1|F5GWL6|Q15748|Q2YDB9|Q86WD2|Q8TDP6|Q9ULY8	Missense_Mutation	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.P254H	ENST00000357422.2	37	c.761	CCDS2738.1	3	.	.	.	.	.	.	.	.	.	.	C	26.8	4.771301	0.90108	.	.	ENSG00000183625	ENST00000357422;ENST00000545097;ENST00000541018;ENST00000395940;ENST00000395942	T;T;T;T;T	0.80393	-1.37;-1.37;-1.37;-1.37;-1.37	5.73	5.73	0.89815	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000015	D	0.94820	0.8327	H	0.99347	4.525	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96694	0.9513	10	0.87932	D	0	.	19.9065	0.97010	0.0:1.0:0.0:0.0	.	275;254	F5GWL6;P51677	.;CCR3_HUMAN	H	254;275;254;254;254	ENSP00000350003:P254H;ENSP00000441600:P275H;ENSP00000440097:P254H;ENSP00000379271:P254H;ENSP00000379273:P254H	ENSP00000350003:P254H	P	+	2	0	CCR3	46282414	1.000000	0.71417	0.984000	0.44739	0.976000	0.68499	7.814000	0.86154	2.696000	0.92011	0.655000	0.94253	CCC	-	superfamily_SSF81321,HMMPfam_7tm_1		0.463	CCR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCR3	protein_coding	OTTHUMT00000257380.2	C			46282414	+1	no_errors	NM_001837	genbank	human	reviewed	54_36p	missense	SNP	0.998	A
COL2A1	1280	genome.wustl.edu	37	12	48369838	48369838	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1651-01A-01W-0639-09	TCGA-04-1651-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f02d550d-d80c-449f-9d69-37ffb1e649b6	8e8ba185-6faf-49df-9784-594e179731c5	g.chr12:48369838C>T	ENST00000380518.3	-	50	3669	c.3505G>A	c.(3505-3507)Gtc>Atc	p.V1169I	COL2A1_ENST00000337299.6_Missense_Mutation_p.V1100I|COL2A1_ENST00000493991.1_5'UTR	NM_001844.4|NM_033150.2	NP_001835.3|NP_149162.2	P02458	CO2A1_HUMAN	collagen, type II, alpha 1	1169	Triple-helical region.		Missing (in SEDC).		axon guidance (GO:0007411)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|cellular response to BMP stimulus (GO:0071773)|central nervous system development (GO:0007417)|chondrocyte differentiation (GO:0002062)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|embryonic skeletal joint morphogenesis (GO:0060272)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart morphogenesis (GO:0003007)|inner ear morphogenesis (GO:0042472)|limb bud formation (GO:0060174)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|notochord development (GO:0030903)|otic vesicle development (GO:0071599)|palate development (GO:0060021)|proteoglycan metabolic process (GO:0006029)|regulation of gene expression (GO:0010468)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|tissue homeostasis (GO:0001894)|visual perception (GO:0007601)	basement membrane (GO:0005604)|collagen type II trimer (GO:0005585)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(25)|ovary(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(3)	64		Acute lymphoblastic leukemia(13;0.108)|all_hematologic(14;0.214)			Collagenase(DB00048)	GAGGGACCGACGGGGCCAGGA	0.632																																																0			12											79.0	81.0	80.0					12																	48369838		2203	4300	6503	46656105	SO:0001583	missense	1280			X16468	CCDS8759.1, CCDS41778.1	12q12-q13.2	2013-11-14	2008-02-04		ENSG00000139219	ENSG00000139219		"""Collagens"""	2200	protein-coding gene	gene with protein product		120140	"""collagen, type II, alpha 1 (primary osteoarthritis, spondyloepiphyseal dysplasia, congenital)"", ""arthroophthalmopathy, progressive (Stickler syndrome)"""	SEDC, AOM		1677770	Standard	NM_033150		Approved	STL1	uc001rqu.3	P02458	OTTHUMG00000149896	ENST00000380518.3:c.3505G>A	12.37:g.48369838C>T	ENSP00000369889:p.Val1169Ile		46656105	A6NGA0|Q12985|Q14009|Q14044|Q14045|Q14046|Q14047|Q14056|Q14058|Q16672|Q1JQ82|Q2V4X7|Q6LBY1|Q6LBY2|Q6LBY3|Q96IT5|Q99227|Q9UE38|Q9UE39|Q9UE40|Q9UE41|Q9UE42|Q9UE43	Missense_Mutation	SNP	HMMPfam_VWC,HMMSmart_SM00214,PatternScan_VWFC_1,HMMPfam_Collagen,HMMSmart_SM00038,HMMPfam_COLFI	p.V1169I	ENST00000380518.3	37	c.3505	CCDS41778.1	12	.	.	.	.	.	.	.	.	.	.	C	13.76	2.333912	0.41297	.	.	ENSG00000139219	ENST00000380518;ENST00000395281;ENST00000337299	D;D	0.93307	-3.2;-3.2	5.0	5.0	0.66597	.	0.000000	0.64402	D	0.000001	D	0.86944	0.6055	N	0.25890	0.77	0.51482	D	0.999925	P;P	0.38110	0.564;0.618	B;B	0.26614	0.043;0.071	D	0.87132	0.2197	10	0.37606	T	0.19	.	17.064	0.86555	0.0:1.0:0.0:0.0	.	1100;1169	P02458-1;P02458	.;CO2A1_HUMAN	I	1169;1100;1100	ENSP00000369889:V1169I;ENSP00000338213:V1100I	ENSP00000338213:V1100I	V	-	1	0	COL2A1	46656105	0.004000	0.15560	0.967000	0.41034	0.688000	0.40055	2.089000	0.41672	2.318000	0.78349	0.462000	0.41574	GTC	-	HMMPfam_Collagen		0.632	COL2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL2A1	protein_coding	OTTHUMT00000313810.2	C	NM_001844		46656105	-1	no_errors	NM_001844	genbank	human	reviewed	54_36p	missense	SNP	0.998	T
KCNG1	3755	genome.wustl.edu	37	20	49626873	49626873	+	Start_Codon_SNP	SNP	C	C	T			TCGA-04-1651-01A-01W-0639-09	TCGA-04-1651-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f02d550d-d80c-449f-9d69-37ffb1e649b6	8e8ba185-6faf-49df-9784-594e179731c5	g.chr20:49626873C>T	ENST00000371571.4	-	2	288	c.3G>A	c.(1-3)atG>atA	p.M1I	KCNG1_ENST00000396017.3_Start_Codon_SNP_p.M1I|KCNG1_ENST00000506387.1_5'Flank|RP5-955M13.4_ENST00000424566.1_RNA	NM_002237.3	NP_002228.2	Q9UIX4	KCNG1_HUMAN	potassium voltage-gated channel, subfamily G, member 1	1					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|liver(1)|lung(11)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	35						GTAAGAGGGTCATTTTGGGCC	0.617																																																0			20											37.0	40.0	39.0					20																	49626873		2031	3970	6001	49060280	SO:0001582	initiator_codon_variant	3755			AF033383	CCDS13436.1	20q13	2011-07-05			ENSG00000026559	ENSG00000026559		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6248	protein-coding gene	gene with protein product		603788		KCNG		9434767, 16382104	Standard	NM_002237		Approved	Kv6.1, kH2, K13	uc002xwa.4	Q9UIX4	OTTHUMG00000032745	ENST00000371571.4:c.3G>A	20.37:g.49626873C>T	ENSP00000360626:p.Met1Ile		49060280	A8K3S4|O43528|Q5JXL5|Q9BRC1	Missense_Mutation	SNP	superfamily_POZ domain,HMMSmart_SM00225,HMMPfam_K_tetra,superfamily_Voltage-gated potassium channels,HMMPfam_Ion_trans	p.M1I	ENST00000371571.4	37	c.3	CCDS13436.1	20	.	.	.	.	.	.	.	.	.	.	C	26.6	4.749759	0.89753	.	.	ENSG00000026559	ENST00000371571;ENST00000396017;ENST00000439216;ENST00000424171;ENST00000433903;ENST00000447736	D;D;D;D	0.97731	-4.51;-2.61;-3.18;-3.53	5.73	5.73	0.89815	.	0.188275	0.56097	D	0.000035	D	0.98695	0.9562	.	.	.	0.80722	D	1	D;D	0.58268	0.982;0.969	D;D	0.68943	0.961;0.914	D	0.98880	1.0769	8	.	.	.	.	19.9786	0.97317	0.0:1.0:0.0:0.0	.	1;1	Q9UIX4-2;Q9UIX4	.;KCNG1_HUMAN	I	1	ENSP00000360626:M1I;ENSP00000379338:M1I;ENSP00000394075:M1I;ENSP00000394093:M1I	.	M	-	3	0	KCNG1	49060280	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	7.294000	0.78760	2.720000	0.93068	0.555000	0.69702	ATG	-	NULL		0.617	KCNG1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	KCNG1	protein_coding	OTTHUMT00000079726.4	C	NM_002237	Missense_Mutation	49060280	-1	no_errors	NM_002237	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
BSN	8927	genome.wustl.edu	37	3	49699454	49699454	+	Silent	SNP	A	A	T			TCGA-04-1651-01A-01W-0639-09	TCGA-04-1651-11A-01W-0639-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f02d550d-d80c-449f-9d69-37ffb1e649b6	8e8ba185-6faf-49df-9784-594e179731c5	g.chr3:49699454A>T	ENST00000296452.4	+	6	10290	c.10176A>T	c.(10174-10176)gcA>gcT	p.A3392A		NM_003458.3	NP_003449.2	Q9UPA5	BSN_HUMAN	bassoon presynaptic cytomatrix protein	3392					synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuron projection terminus (GO:0044306)|nucleus (GO:0005634)|presynaptic cytoskeletal matrix assembled at active zones (GO:0048788)	metal ion binding (GO:0046872)			breast(8)|central_nervous_system(2)|cervix(2)|endometrium(16)|kidney(3)|large_intestine(17)|lung(37)|ovary(7)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	106				BRCA - Breast invasive adenocarcinoma(193;6.66e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0032)|Kidney(197;0.00336)		CCCCACCTGCAGTCAGCAGCA	0.527																																																0			3											74.0	80.0	78.0					3																	49699454		2203	4300	6503	49674458	SO:0001819	synonymous_variant	8927			AF052224	CCDS2800.1	3p21	2013-01-07	2013-01-07		ENSG00000164061	ENSG00000164061			1117	protein-coding gene	gene with protein product	"""zinc finger protein 231"", ""neuronal double zinc finger protein"""	604020	"""bassoon (presynaptic cytomatrix protein)"""	ZNF231		9806829, 10329005	Standard	NM_003458		Approved		uc003cxe.4	Q9UPA5	OTTHUMG00000133750	ENST00000296452.4:c.10176A>T	3.37:g.49699454A>T			49674458	O43161|Q7LGH3	Silent	SNP	HMMPfam_zf-piccolo,superfamily_FYVE_PHD_ZnF	p.A3392	ENST00000296452.4	37	c.10176	CCDS2800.1	3																																																																																			-	NULL		0.527	BSN-001	KNOWN	NMD_exception|basic|appris_principal|exp_conf|CCDS	protein_coding	BSN	protein_coding	OTTHUMT00000258164.1	A	NM_003458		49674458	+1	no_errors	NM_003458	genbank	human	validated	54_36p	silent	SNP	0.981	T
SYT3	84258	genome.wustl.edu	37	19	51135630	51135630	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1651-01A-01W-0639-09	TCGA-04-1651-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f02d550d-d80c-449f-9d69-37ffb1e649b6	8e8ba185-6faf-49df-9784-594e179731c5	g.chr19:51135630G>C	ENST00000338916.4	-	2	1220	c.587C>G	c.(586-588)tCt>tGt	p.S196C	SYT3_ENST00000544769.1_Missense_Mutation_p.S196C|SYT3_ENST00000593901.1_Missense_Mutation_p.S196C|SYT3_ENST00000600079.1_Missense_Mutation_p.S196C	NM_032298.2	NP_115674.1	Q9BQG1	SYT3_HUMAN	synaptotagmin III	196					calcium ion-dependent exocytosis (GO:0017156)|positive regulation of vesicle fusion (GO:0031340)|response to calcium ion (GO:0051592)	cell junction (GO:0030054)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	calcium-dependent phospholipid binding (GO:0005544)|metal ion binding (GO:0046872)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)			breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(16)|ovary(2)|prostate(2)|skin(3)|urinary_tract(2)	35		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00462)|GBM - Glioblastoma multiforme(134;0.0188)		GAGCAACCCAGAGCCTGCTCC	0.637																																																0			19											40.0	43.0	42.0					19																	51135630		2203	4300	6503	55827442	SO:0001583	missense	84258			AL136594	CCDS12798.1	19q13.33	2014-07-02			ENSG00000213023	ENSG00000213023		"""Synaptotagmins"""	11511	protein-coding gene	gene with protein product		600327				7749232	Standard	NM_032298		Approved		uc002psv.3	Q9BQG1	OTTHUMG00000183064	ENST00000338916.4:c.587C>G	19.37:g.51135630G>C	ENSP00000340914:p.Ser196Cys		55827442	Q8N5Z1|Q8N640	Missense_Mutation	SNP	superfamily_C2_CaLB,HMMSmart_C2,HMMPfam_C2	p.S196C	ENST00000338916.4	37	c.587	CCDS12798.1	19	.	.	.	.	.	.	.	.	.	.	G	13.67	2.305998	0.40795	.	.	ENSG00000213023	ENST00000338916;ENST00000544769	T;T	0.60672	0.17;0.17	5.24	4.2	0.49525	.	0.112586	0.36519	U	0.002549	T	0.40398	0.1115	N	0.24115	0.695	0.23636	N	0.997235	B	0.06786	0.001	B	0.04013	0.001	T	0.26710	-1.0095	10	0.56958	D	0.05	.	8.3738	0.32432	0.0851:0.1587:0.7562:0.0	.	196	Q9BQG1	SYT3_HUMAN	C	196	ENSP00000340914:S196C;ENSP00000438883:S196C	ENSP00000340914:S196C	S	-	2	0	SYT3	55827442	0.790000	0.28787	0.975000	0.42487	0.941000	0.58515	2.782000	0.47758	2.605000	0.88082	0.655000	0.94253	TCT	-	NULL		0.637	SYT3-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SYT3	protein_coding	OTTHUMT00000464910.1	G	NM_032298		55827442	-1	no_errors	NM_032298	genbank	human	provisional	54_36p	missense	SNP	0.733	C
PLEK	5341	genome.wustl.edu	37	2	68607905	68607905	+	Silent	SNP	A	A	T			TCGA-04-1651-01A-01W-0639-09	TCGA-04-1651-11A-01W-0639-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f02d550d-d80c-449f-9d69-37ffb1e649b6	8e8ba185-6faf-49df-9784-594e179731c5	g.chr2:68607905A>T	ENST00000234313.7	+	3	428	c.249A>T	c.(247-249)gcA>gcT	p.A83A		NM_002664.2	NP_002655.2	P08567	PLEK_HUMAN	pleckstrin	83	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin cytoskeleton reorganization (GO:0031532)|blood coagulation (GO:0007596)|cell projection organization (GO:0030030)|cortical actin cytoskeleton organization (GO:0030866)|hematopoietic progenitor cell differentiation (GO:0002244)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of calcium-mediated signaling (GO:0050849)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|negative regulation of inositol phosphate biosynthetic process (GO:0010920)|phosphatidylinositol metabolic process (GO:0046488)|phospholipase C-inhibiting G-protein coupled receptor signaling pathway (GO:0030845)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of actin filament bundle assembly (GO:0032233)|positive regulation of actin filament depolymerization (GO:0030836)|positive regulation of inositol-polyphosphate 5-phosphatase activity (GO:0010925)|positive regulation of integrin activation (GO:0033625)|positive regulation of platelet activation (GO:0010572)|protein kinase C signaling (GO:0070528)|protein secretion by platelet (GO:0070560)|regulation of cell diameter (GO:0060305)|ruffle organization (GO:0031529)|thrombin receptor signaling pathway (GO:0070493)|vesicle docking involved in exocytosis (GO:0006904)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|membrane (GO:0016020)|ruffle membrane (GO:0032587)	phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|protein homodimerization activity (GO:0042803)|protein kinase C binding (GO:0005080)			autonomic_ganglia(1)|endometrium(3)|large_intestine(6)|lung(12)|ovary(1)|skin(1)	24		Ovarian(717;0.0129)		STAD - Stomach adenocarcinoma(1183;0.00159)|READ - Rectum adenocarcinoma(193;0.0419)		TCTTCCAGGCAGCCTTCCTGG	0.458																																																0			2											131.0	131.0	131.0					2																	68607905		2203	4300	6503	68461409	SO:0001819	synonymous_variant	5341			X07743	CCDS1887.1	2p13.3	2013-01-10			ENSG00000115956	ENSG00000115956		"""Pleckstrin homology (PH) domain containing"""	9070	protein-coding gene	gene with protein product		173570				2897630, 12054651	Standard	NM_002664		Approved	P47	uc002sen.4	P08567	OTTHUMG00000129562	ENST00000234313.7:c.249A>T	2.37:g.68607905A>T			68461409	B2R9E8|Q53SU8|Q6FGM8|Q6FGQ1|Q8WV81	Silent	SNP	superfamily_SSF50729,HMMPfam_PH,HMMSmart_PH,superfamily_SSF46785,HMMPfam_DEP,HMMSmart_DEP	p.A83	ENST00000234313.7	37	c.249	CCDS1887.1	2																																																																																			-	superfamily_SSF50729,HMMPfam_PH,HMMSmart_PH		0.458	PLEK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEK	protein_coding	OTTHUMT00000251755.1	A	NM_002664		68461409	+1	no_errors	NM_002664	genbank	human	validated	54_36p	silent	SNP	0.990	T
PPFIA1	8500	genome.wustl.edu	37	11	70194363	70194363	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1651-01A-01W-0639-09	TCGA-04-1651-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f02d550d-d80c-449f-9d69-37ffb1e649b6	8e8ba185-6faf-49df-9784-594e179731c5	g.chr11:70194363G>C	ENST00000253925.7	+	16	2215	c.2000G>C	c.(1999-2001)gGa>gCa	p.G667A	AP000487.6_ENST00000528607.1_RNA|PPFIA1_ENST00000389547.3_Missense_Mutation_p.G667A	NM_003626.3	NP_003617.1	Q13136	LIPA1_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1	667					cell-matrix adhesion (GO:0007160)|negative regulation of establishment of protein localization to plasma membrane (GO:0090005)|negative regulation of stress fiber assembly (GO:0051497)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|presynaptic active zone (GO:0048786)	signal transducer activity (GO:0004871)	p.G667V(1)		breast(3)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(11)|lung(31)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	65			BRCA - Breast invasive adenocarcinoma(2;1.04e-44)|LUSC - Lung squamous cell carcinoma(11;1.46e-14)|STAD - Stomach adenocarcinoma(18;0.0513)			GTTGGCAGTGGAAGTCTAGAC	0.502																																																1	Substitution - Missense(1)	skin(1)	11											208.0	169.0	182.0					11																	70194363		2200	4294	6494	69872011	SO:0001583	missense	8500			U22816	CCDS31627.1, CCDS31628.1	11q13.3	2013-01-10			ENSG00000131626	ENSG00000131626		"""Sterile alpha motif (SAM) domain containing"""	9245	protein-coding gene	gene with protein product	"""Liprin-alpha1"""	611054				7796809, 9624153	Standard	NM_003626		Approved	LIP.1, LIPRIN	uc001opo.3	Q13136	OTTHUMG00000167266	ENST00000253925.7:c.2000G>C	11.37:g.70194363G>C	ENSP00000253925:p.Gly667Ala		69872011	A6NLE3|Q13135|Q14567|Q8N4I2	Missense_Mutation	SNP	superfamily_SAM/Pointed domain,HMMSmart_SM00454,HMMPfam_SAM_1,HMMPfam_SAM_2	p.G667A	ENST00000253925.7	37	c.2000	CCDS31627.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	1.601|1.601	-0.526621|-0.526621	0.04141|0.04141	.|.	.|.	ENSG00000131626|ENSG00000131626	ENST00000528750|ENST00000253925;ENST00000389547;ENST00000544950	.|T;T	.|0.41758	.|0.99;0.99	5.65|5.65	4.73|4.73	0.59995|0.59995	.|.	.|0.134219	.|0.48767	.|D	.|0.000172	T|T	0.39517|0.39517	0.1081|0.1081	M|M	0.62723|0.62723	1.935|1.935	0.38303|0.38303	D|D	0.943031|0.943031	.|B;B	.|0.25441	.|0.039;0.126	.|B;B	.|0.29077	.|0.045;0.098	T|T	0.39333|0.39333	-0.9619|-0.9619	5|10	.|0.02654	.|T	.|1	.|.	16.0425|16.0425	0.80695|0.80695	0.0:0.0:0.8647:0.1353|0.0:0.0:0.8647:0.1353	.|.	.|667;667	.|Q13136;Q13136-2	.|LIPA1_HUMAN;.	Q|A	71|667;667;154	.|ENSP00000253925:G667A;ENSP00000374198:G667A	.|ENSP00000253925:G667A	E|G	+|+	1|2	0|0	PPFIA1|PPFIA1	69872011|69872011	1.000000|1.000000	0.71417|0.71417	0.043000|0.043000	0.18650|0.18650	0.068000|0.068000	0.16541|0.16541	6.267000|6.267000	0.72546|0.72546	1.370000|1.370000	0.46153|0.46153	0.655000|0.655000	0.94253|0.94253	GAA|GGA	-	NULL		0.502	PPFIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PPFIA1	protein_coding	OTTHUMT00000393905.1	G	NM_003626		69872011	+1	no_errors	NM_003626	genbank	human	reviewed	54_36p	missense	SNP	0.850	C
UGT2B4	7363	genome.wustl.edu	37	4	70346374	70346374	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1651-01A-01W-0639-09	TCGA-04-1651-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f02d550d-d80c-449f-9d69-37ffb1e649b6	8e8ba185-6faf-49df-9784-594e179731c5	g.chr4:70346374C>A	ENST00000305107.6	-	6	1611	c.1565G>T	c.(1564-1566)gGa>gTa	p.G522V	UGT2B4_ENST00000506580.1_5'UTR|UGT2B4_ENST00000381096.3_Missense_Mutation_p.G386V|UGT2B4_ENST00000512583.1_3'UTR|AC108078.1_ENST00000583573.1_RNA	NM_021139.2	NP_066962.2	P06133	UD2B4_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B4	522					cellular glucuronidation (GO:0052695)|estrogen catabolic process (GO:0006711)|metabolic process (GO:0008152)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(29)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	47					Canagliflozin(DB08907)|Codeine(DB00318)|Dapagliflozin(DB06292)|Flurbiprofen(DB00712)|Ibuprofen(DB01050)|Morphine(DB00295)	CCCCTTCTTTCCTGTTCTAAC	0.413																																																0			4											142.0	143.0	143.0					4																	70346374		2203	4300	6503	70380963	SO:0001583	missense	7363			BC026264	CCDS43234.1, CCDS75137.1	4q13	2008-02-05	2005-07-20			ENSG00000156096		"""UDP glucuronosyltransferases"""	12553	protein-coding gene	gene with protein product		600067	"""UDP glycosyltransferase 2 family, polypeptide B4"""			3109396, 7835904	Standard	NM_021139		Approved	UGT2B11	uc003hek.4	P06133		ENST00000305107.6:c.1565G>T	4.37:g.70346374C>A	ENSP00000305221:p.Gly522Val		70380963	A6NCP7|B4DT75|G5E9X8|O60731|O60867|O75614|P36538|Q1HBF9|Q6QQX7	Missense_Mutation	SNP	superfamily_UDP-Glycosyltransferase/glycogen phosphorylase,HMMPfam_UDPGT,PatternScan_UDPGT	p.G522V	ENST00000305107.6	37	c.1565	CCDS43234.1	4	.	.	.	.	.	.	.	.	.	.	G	4.162	0.028489	0.08054	.	.	ENSG00000156096	ENST00000305107;ENST00000381096	T;T	0.59083	0.29;0.29	2.11	-0.827	0.10802	.	0.739627	0.11200	U	0.588891	T	0.53658	0.1810	M	0.79011	2.435	0.22199	N	0.9993	B;B	0.15473	0.013;0.013	B;B	0.26693	0.072;0.046	T	0.53056	-0.8492	10	0.51188	T	0.08	.	3.7793	0.08674	0.0:0.3119:0.4049:0.2832	.	386;522	A6NCP7;P06133	.;UD2B4_HUMAN	V	522;386	ENSP00000305221:G522V;ENSP00000370486:G386V	ENSP00000305221:G522V	G	-	2	0	UGT2B4	70380963	0.000000	0.05858	0.017000	0.16124	0.016000	0.09150	-1.069000	0.03444	-0.278000	0.09180	-0.680000	0.03767	GGA	-	HMMPfam_UDPGT		0.413	UGT2B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGT2B4	protein_coding	OTTHUMT00000365526.1	C	NM_021139		70380963	-1	no_errors	NM_021139	genbank	human	validated	54_36p	missense	SNP	0.004	A
Unknown	0	genome.wustl.edu	37	12	77054361	77054361	+	IGR	SNP	C	C	A			TCGA-04-1651-01A-01W-0639-09	TCGA-04-1651-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f02d550d-d80c-449f-9d69-37ffb1e649b6	8e8ba185-6faf-49df-9784-594e179731c5	g.chr12:77054361C>A								RP11-20E24.1 (45150 upstream) : ZDHHC17 (103006 downstream)																							GTTACCATGGCAAAACTGGAA	0.398																																																0			12																																								75578492	SO:0001628	intergenic_variant	653079																															12.37:g.77054361C>A			75578492		RNA	SNP	-	NULL		37	NULL		12																																																																																			-	-	0	0.398					LOC653079			C			75578492	+1	pseudogene	XR_016115	genbank	human	model	54_36p	rna	SNP	1.000	A
DUPD1	338599	genome.wustl.edu	37	10	76797756	76797756	+	Silent	SNP	G	G	A			TCGA-04-1651-01A-01W-0639-09	TCGA-04-1651-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f02d550d-d80c-449f-9d69-37ffb1e649b6	8e8ba185-6faf-49df-9784-594e179731c5	g.chr10:76797756G>A	ENST00000338487.5	-	3	500	c.501C>T	c.(499-501)gaC>gaT	p.D167D		NM_001003892.1	NP_001003892.1	Q68J44	DUPD1_HUMAN	dual specificity phosphatase and pro isomerase domain containing 1	167	Tyrosine-protein phosphatase.				protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)	protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			breast(1)|endometrium(2)|lung(5)|ovary(2)|urinary_tract(1)	11	all_cancers(46;0.0207)|all_epithelial(25;0.00126)|Prostate(51;0.0112)|Ovarian(15;0.0348)					CCAGGGTCATGTCCTTGTGGA	0.622																																																0			10											76.0	63.0	67.0					10																	76797756		2203	4300	6503	76467762	SO:0001819	synonymous_variant	338599				CCDS31223.1	10q22.3	2011-06-09			ENSG00000188716	ENSG00000188716		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	23481	protein-coding gene	gene with protein product							Standard	NM_001003892		Approved	DUSP27	uc001jwq.1	Q68J44	OTTHUMG00000018512	ENST00000338487.5:c.501C>T	10.37:g.76797756G>A			76467762	B2RP93	Silent	SNP	superfamily_SSF52799,HMMPfam_DSPc,HMMSmart_DSPc,PatternScan_TYR_PHOSPHATASE_1	p.D167	ENST00000338487.5	37	c.501	CCDS31223.1	10																																																																																			-	superfamily_SSF52799,HMMPfam_DSPc,HMMSmart_DSPc		0.622	DUPD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUPD1	protein_coding	OTTHUMT00000048777.2	G	XM_291741		76467762	-1	no_errors	NM_001003892	genbank	human	provisional	54_36p	silent	SNP	1.000	A
ARSB	411	genome.wustl.edu	37	5	78076318	78076318	+	Silent	SNP	G	G	A			TCGA-04-1651-01A-01W-0639-09	TCGA-04-1651-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f02d550d-d80c-449f-9d69-37ffb1e649b6	8e8ba185-6faf-49df-9784-594e179731c5	g.chr5:78076318G>A	ENST00000264914.4	-	8	2040	c.1504C>T	c.(1504-1506)Cta>Tta	p.L502L		NM_000046.3	NP_000037.2	P15848	ARSB_HUMAN	arylsulfatase B	502					autophagy (GO:0006914)|carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|central nervous system development (GO:0007417)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|glycosphingolipid metabolic process (GO:0006687)|lysosomal transport (GO:0007041)|lysosome organization (GO:0007040)|post-translational protein modification (GO:0043687)|response to estrogen (GO:0043627)|response to methylmercury (GO:0051597)|response to nutrient (GO:0007584)|response to pH (GO:0009268)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|rough endoplasmic reticulum (GO:0005791)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)|N-acetylgalactosamine-4-sulfatase activity (GO:0003943)			breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18		all_lung(232;0.000637)|Lung NSC(167;0.00173)|Ovarian(174;0.0105)|Prostate(461;0.192)		OV - Ovarian serous cystadenocarcinoma(54;4.24e-44)|Epithelial(54;3.12e-39)|all cancers(79;3.02e-34)		TAGAACTGTAGGCGGGACAGG	0.542																																					Melanoma(169;563 1968 25780 26156 52266)											0			5											107.0	89.0	95.0					5																	78076318		2203	4300	6503	78112074	SO:0001819	synonymous_variant	411			M32373	CCDS4043.1, CCDS43334.1	5q14.1	2013-02-14			ENSG00000113273	ENSG00000113273	3.1.6.1	"""Arylsulfatase family"""	714	protein-coding gene	gene with protein product		611542				2303452	Standard	NM_000046		Approved		uc003kfq.3	P15848	OTTHUMG00000108129	ENST00000264914.4:c.1504C>T	5.37:g.78076318G>A			78112074	B2RC20|Q8N322|Q9UDI9	Silent	SNP	HMMPfam_Sulfatase,superfamily_Alkaline_phosphatase_core,PatternScan_SULFATASE_1,PatternScan_SULFATASE_2	p.L502	ENST00000264914.4	37	c.1504	CCDS4043.1	5																																																																																			-	superfamily_Alkaline_phosphatase_core		0.542	ARSB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARSB	protein_coding	OTTHUMT00000226932.2	G	NM_000046		78112074	-1	no_errors	NM_000046	genbank	human	reviewed	54_36p	silent	SNP	0.960	A
SEC31A	22872	genome.wustl.edu	37	4	83742214	83742214	+	Silent	SNP	C	C	G	rs184276133		TCGA-04-1651-01A-01W-0639-09	TCGA-04-1651-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f02d550d-d80c-449f-9d69-37ffb1e649b6	8e8ba185-6faf-49df-9784-594e179731c5	g.chr4:83742214C>G	ENST00000395310.2	-	26	3641	c.3459G>C	c.(3457-3459)ctG>ctC	p.L1153L	SEC31A_ENST00000311785.7_Silent_p.L1039L|SEC31A_ENST00000508502.1_Silent_p.L1138L|SEC31A_ENST00000500777.2_Silent_p.L1000L|SEC31A_ENST00000355196.2_Silent_p.L1153L|SEC31A_ENST00000448323.1_Silent_p.L1153L|SEC31A_ENST00000443462.2_Silent_p.L1133L|SEC31A_ENST00000505472.1_Silent_p.L1184L|SEC31A_ENST00000432794.1_Silent_p.L1166L|SEC31A_ENST00000326950.5_Silent_p.L1114L|SEC31A_ENST00000513858.1_Silent_p.L1000L|SEC31A_ENST00000505984.1_Silent_p.L1099L|SEC31A_ENST00000348405.4_Silent_p.L1114L|SEC31A_ENST00000509142.1_Silent_p.L1039L|SEC31A_ENST00000264405.5_Silent_p.L902L	NM_001077207.2|NM_001077208.2|NM_014933.3	NP_001070675.1|NP_001070676.1|NP_055748.2	O94979	SC31A_HUMAN	SEC31 homolog A (S. cerevisiae)	1153					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER to Golgi vesicle-mediated transport (GO:0006888)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|protein transport (GO:0015031)|response to calcium ion (GO:0051592)	COPII vesicle coat (GO:0030127)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum exit site (GO:0070971)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle (GO:0030134)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|vesicle coat (GO:0030120)	calcium-dependent protein binding (GO:0048306)		SEC31A/ALK(3)|SEC31A/JAK2(4)	breast(1)	1		Hepatocellular(203;0.114)				GTTTATCATACAGAAACTCCA	0.338																																																0			4											203.0	213.0	209.0					4																	83742214		2203	4300	6503	83961238	SO:0001819	synonymous_variant	22872			AB018358	CCDS3596.1, CCDS3597.1, CCDS43244.1, CCDS47088.1, CCDS54773.1, CCDS75155.1, CCDS75156.1	4q21.3	2013-01-10	2006-10-05	2006-09-07	ENSG00000138674	ENSG00000138674		"""WD repeat domain containing"""	17052	protein-coding gene	gene with protein product		610257	"""SEC31-like 1 (S. cerevisiae)"", ""Sec31 homolog A (S. cerevisiae)"""	SEC31L1		10048485, 10788476	Standard	NM_001077206		Approved	KIAA0905, ABP125, ABP130	uc003hnh.3	O94979	OTTHUMG00000130297	ENST00000395310.2:c.3459G>C	4.37:g.83742214C>G			83961238	B4DIW6|B7ZKZ7|B7ZL00|H7C2W3|Q17RR5|Q5H9P6|Q5XG74|Q659G7|Q6ZU90|Q7LCX9|Q86TJ0|Q8IZH4|Q9P048|Q9P0A6|Q9UM05|Q9UM06	Silent	SNP	superfamily_WD40 repeat-like,HMMSmart_SM00320,HMMPfam_WD40	p.L1153	ENST00000395310.2	37	c.3459	CCDS3596.1	4	.	.	.	.	.	.	.	.	.	.	C	7.682	0.689224	0.14973	.	.	ENSG00000138674	ENST00000503937	.	.	.	5.62	-11.2	0.00127	.	.	.	.	.	T	0.49660	0.1570	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.63910	-0.6530	4	.	.	.	-10.1639	11.606	0.51033	0.0803:0.6046:0.1626:0.1525	.	.	.	.	S	316	.	.	C	-	2	0	SEC31A	83961238	0.000000	0.05858	0.425000	0.26659	0.995000	0.86356	-2.339000	0.01102	-2.230000	0.00719	0.655000	0.94253	TGT	-	NULL		0.338	SEC31A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SEC31A	protein_coding	OTTHUMT00000252640.1	C	NM_016211		83961238	-1	no_errors	NM_001077207	genbank	human	reviewed	54_36p	silent	SNP	0.996	G
SPATA31E1	286234	genome.wustl.edu	37	9	90502907	90502907	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1651-01A-01W-0639-09	TCGA-04-1651-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f02d550d-d80c-449f-9d69-37ffb1e649b6	8e8ba185-6faf-49df-9784-594e179731c5	g.chr9:90502907G>C	ENST00000325643.5	+	4	3571	c.3505G>C	c.(3505-3507)Gcc>Ccc	p.A1169P		NM_178828.4	NP_849150.3	Q6ZUB1	S31E1_HUMAN	SPATA31 subfamily E, member 1	1169					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											GGGGCCATGTGCCCTCCTATG	0.617																																																0			9											23.0	25.0	25.0					9																	90502907		2203	4300	6503	89692727	SO:0001583	missense	286234			AK093185	CCDS6676.1	9q22.1-q22.2	2012-10-12	2012-10-12	2012-10-12	ENSG00000177992	ENSG00000177992			26672	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 79"", ""family with sequence similarity 75, member E1"""	C9orf79, FAM75E1			Standard	NM_178828		Approved	FLJ35866	uc004app.4	Q6ZUB1	OTTHUMG00000020157	ENST00000325643.5:c.3505G>C	9.37:g.90502907G>C	ENSP00000322640:p.Ala1169Pro		89692727	B2RPB1|Q5SQC9|Q8NA41|Q8ND27	Missense_Mutation	SNP	NULL	p.A1169P	ENST00000325643.5	37	c.3505	CCDS6676.1	9	.	.	.	.	.	.	.	.	.	.	g	6.637	0.485985	0.12641	.	.	ENSG00000177992	ENST00000325643	T	0.03717	3.83	2.82	0.865	0.19074	.	1.790470	0.03167	N	0.170198	T	0.02888	0.0086	N	0.14661	0.345	0.09310	N	1	B	0.18166	0.026	B	0.17979	0.02	T	0.42464	-0.9450	10	0.39692	T	0.17	.	4.0544	0.09810	0.1445:0.2453:0.6102:0.0	.	1169	Q6ZUB1	CI079_HUMAN	P	1169	ENSP00000322640:A1169P	ENSP00000322640:A1169P	A	+	1	0	C9orf79	89692727	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.416000	0.07097	0.230000	0.21059	0.563000	0.77884	GCC	-	NULL		0.617	SPATA31E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf79	protein_coding	OTTHUMT00000052954.2	G	NM_178828		89692727	+1	no_errors	NM_178828	genbank	human	validated	54_36p	missense	SNP	0.001	C
UNC5C	8633	genome.wustl.edu	37	4	96222851	96222851	+	Silent	SNP	T	T	C			TCGA-04-1651-01A-01W-0639-09	TCGA-04-1651-11A-01W-0639-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f02d550d-d80c-449f-9d69-37ffb1e649b6	8e8ba185-6faf-49df-9784-594e179731c5	g.chr4:96222851T>C	ENST00000453304.1	-	3	744	c.396A>G	c.(394-396)gaA>gaG	p.E132E	UNC5C_ENST00000504962.1_Silent_p.E132E|UNC5C_ENST00000506749.1_Silent_p.E132E	NM_003728.3	NP_003719.3	O95185	UNC5C_HUMAN	unc-5 homolog C (C. elegans)	132	Ig-like.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|brain development (GO:0007420)|positive regulation of apoptotic process (GO:0043065)|regulation of cell migration (GO:0030334)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(14)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	55		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;8.72e-10)		CAAAGAGTTCTTCCACTTGCT	0.483																																																0			4											80.0	66.0	71.0					4																	96222851		2203	4300	6503	96441874	SO:0001819	synonymous_variant	8633			AF055634	CCDS3643.1	4q21-q23	2013-01-11	2001-11-28		ENSG00000182168	ENSG00000182168		"""Immunoglobulin superfamily / I-set domain containing"""	12569	protein-coding gene	gene with protein product		603610	"""unc5 (C.elegans homolog) c"""			9126742, 9782087	Standard	NM_003728		Approved		uc003hto.3	O95185	OTTHUMG00000130989	ENST00000453304.1:c.396A>G	4.37:g.96222851T>C			96441874	Q8IUT0	Silent	SNP	superfamily_Immunoglobulin,HMMPfam_I-set,HMMSmart_SM00409,HMMSmart_SM00408,superfamily_TSP-1 type 1 repeat,HMMSmart_SM00209,HMMPfam_TSP_1,HMMPfam_ZU5,HMMSmart_SM00218,superfamily_DEATH domain,HMMSmart_SM00005,HMMPfam_Death	p.E132	ENST00000453304.1	37	c.396	CCDS3643.1	4																																																																																			-	superfamily_Immunoglobulin		0.483	UNC5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UNC5C	protein_coding	OTTHUMT00000253607.1	T	NM_003728		96441874	-1	no_errors	NM_003728	genbank	human	reviewed	54_36p	silent	SNP	0.996	C
VPS13B	157680	genome.wustl.edu	37	8	100403887	100403887	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1651-01A-01W-0639-09	TCGA-04-1651-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f02d550d-d80c-449f-9d69-37ffb1e649b6	8e8ba185-6faf-49df-9784-594e179731c5	g.chr8:100403887G>T	ENST00000358544.2	+	21	3148	c.3037G>T	c.(3037-3039)Gcc>Tcc	p.A1013S	VPS13B_ENST00000395996.1_Missense_Mutation_p.A1013S|VPS13B_ENST00000357162.2_Missense_Mutation_p.A1013S	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	1013					protein transport (GO:0015031)					NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			ATCATATCAGGCCTCTGAATA	0.448																																					Colon(161;2205 2542 7338 31318)											0			8											97.0	94.0	95.0					8																	100403887		2203	4300	6503	100473063	SO:0001583	missense	157680			AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.3037G>T	8.37:g.100403887G>T	ENSP00000351346:p.Ala1013Ser		100473063	C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Missense_Mutation	SNP	PatternScan_ZINC_PROTEASE	p.A1013S	ENST00000358544.2	37	c.3037	CCDS6280.1	8	.	.	.	.	.	.	.	.	.	.	G	20.7	4.034387	0.75617	.	.	ENSG00000132549	ENST00000357162;ENST00000358544;ENST00000395996	T;T;T	0.51071	0.72;0.72;0.72	5.78	5.78	0.91487	.	0.063180	0.64402	D	0.000011	T	0.47728	0.1461	L	0.29908	0.895	0.44908	D	0.997921	P;D;P;B	0.55385	0.873;0.971;0.952;0.211	B;P;P;B	0.53224	0.359;0.721;0.53;0.066	T	0.21518	-1.0243	10	0.22706	T	0.39	.	15.4758	0.75478	0.0:0.138:0.862:0.0	.	1012;1013;1013;1013	Q7Z7G8-6;Q7Z7G8-2;Q7Z7G8;Q7Z7G8-3	.;.;VP13B_HUMAN;.	S	1013	ENSP00000349685:A1013S;ENSP00000351346:A1013S;ENSP00000379318:A1013S	ENSP00000349685:A1013S	A	+	1	0	VPS13B	100473063	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.963000	0.76055	2.737000	0.93849	0.585000	0.79938	GCC	-	NULL		0.448	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13B	protein_coding	OTTHUMT00000277138.1	G	NM_184042		100473063	+1	no_errors	NM_017890	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
SORCS1	114815	genome.wustl.edu	37	10	108489822	108489822	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1651-01A-01W-0639-09	TCGA-04-1651-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f02d550d-d80c-449f-9d69-37ffb1e649b6	8e8ba185-6faf-49df-9784-594e179731c5	g.chr10:108489822C>T	ENST00000263054.6	-	6	1017	c.1010G>A	c.(1009-1011)aGa>aAa	p.R337K	SORCS1_ENST00000344440.6_Missense_Mutation_p.R337K	NM_001206570.1|NM_052918.4	NP_001193499.1|NP_443150.3	Q8WY21	SORC1_HUMAN	sortilin-related VPS10 domain containing receptor 1	337					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	neuropeptide receptor activity (GO:0008188)			breast(5)|central_nervous_system(1)|cervix(2)|endometrium(9)|kidney(2)|large_intestine(24)|lung(69)|ovary(1)|prostate(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	127		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		ATCCACAGTTCTGGCCTCAAG	0.373																																																0			10											150.0	126.0	134.0					10																	108489822		2203	4300	6503	108479812	SO:0001583	missense	114815			AF284756	CCDS7559.1	10q23-q25	2004-04-20			ENSG00000108018	ENSG00000108018			16697	protein-coding gene	gene with protein product		606283				11499680	Standard	NM_001206570		Approved	sorCS1	uc001kyl.3	Q8WY21	OTTHUMG00000019018	ENST00000263054.6:c.1010G>A	10.37:g.108489822C>T	ENSP00000263054:p.Arg337Lys		108479812	A2RRF4|Q59GG7|Q5JVT7|Q5JVT8|Q5VY14|Q86WQ1|Q86WQ2|Q9H1Y1|Q9H1Y2	Missense_Mutation	SNP	superfamily_SSF110296,HMMSmart_VPS10,HMMSmart_PKD,superfamily_PKD,HMMPfam_PKD	p.R337K	ENST00000263054.6	37	c.1010	CCDS7559.1	10	.	.	.	.	.	.	.	.	.	.	C	12.89	2.074339	0.36566	.	.	ENSG00000108018	ENST00000263054;ENST00000344440	T;T	0.32988	1.43;1.43	5.79	3.95	0.45737	VPS10 (1);	0.350098	0.32488	N	0.006023	T	0.23289	0.0563	L	0.43152	1.355	0.27222	N	0.959643	B;B;B;B;B	0.14012	0.005;0.004;0.009;0.005;0.009	B;B;B;B;B	0.17098	0.008;0.017;0.012;0.008;0.012	T	0.12218	-1.0556	9	.	.	.	-19.607	7.8835	0.29635	0.0:0.8194:0.0:0.1806	.	337;337;337;337;337	A8K182;Q8WY21-4;Q8WY21-3;Q8WY21;Q8WY21-2	.;.;.;SORC1_HUMAN;.	K	337	ENSP00000263054:R337K;ENSP00000345964:R337K	.	R	-	2	0	SORCS1	108479812	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	1.111000	0.31159	1.462000	0.47948	0.585000	0.79938	AGA	-	superfamily_SSF110296,HMMSmart_VPS10		0.373	SORCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SORCS1	protein_coding	OTTHUMT00000050232.4	C	NM_052918		108479812	-1	no_errors	NM_001013031	genbank	human	reviewed	54_36p	missense	SNP	0.988	T
PITX2	5308	genome.wustl.edu	37	4	111539315	111539315	+	Missense_Mutation	SNP	C	C	G	rs571758306		TCGA-04-1651-01A-01W-0639-09	TCGA-04-1651-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f02d550d-d80c-449f-9d69-37ffb1e649b6	8e8ba185-6faf-49df-9784-594e179731c5	g.chr4:111539315C>G	ENST00000354925.2	-	7	2625	c.920G>C	c.(919-921)aGt>aCt	p.S307T	PITX2_ENST00000394598.2_Missense_Mutation_p.S307T|PITX2_ENST00000394595.3_3'UTR|RP11-380D23.2_ENST00000503456.1_lincRNA|PITX2_ENST00000306732.3_Missense_Mutation_p.S314T|PITX2_ENST00000355080.5_Missense_Mutation_p.S261T|PITX2_ENST00000556049.1_5'Flank	NM_001204397.1	NP_001191326.1	Q99697	PITX2_HUMAN	paired-like homeodomain 2	307					atrial cardiac muscle tissue morphogenesis (GO:0055009)|atrioventricular valve development (GO:0003171)|camera-type eye development (GO:0043010)|cardiac neural crest cell migration involved in outflow tract morphogenesis (GO:0003253)|cell proliferation involved in outflow tract morphogenesis (GO:0061325)|deltoid tuberosity development (GO:0035993)|determination of left/right symmetry (GO:0007368)|embryonic camera-type eye development (GO:0031076)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic hindlimb morphogenesis (GO:0035116)|endodermal digestive tract morphogenesis (GO:0061031)|extraocular skeletal muscle development (GO:0002074)|female gonad development (GO:0008585)|hair cell differentiation (GO:0035315)|hypothalamus cell migration (GO:0021855)|in utero embryonic development (GO:0001701)|iris morphogenesis (GO:0061072)|left lung morphogenesis (GO:0060460)|left/right axis specification (GO:0070986)|male gonad development (GO:0008584)|myoblast fusion (GO:0007520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|odontogenesis (GO:0042476)|odontogenesis of dentin-containing tooth (GO:0042475)|patterning of blood vessels (GO:0001569)|positive regulation of DNA binding (GO:0043388)|positive regulation of myoblast proliferation (GO:2000288)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prolactin secreting cell differentiation (GO:0060127)|pulmonary myocardium development (GO:0003350)|pulmonary vein morphogenesis (GO:0060577)|regulation of cell migration (GO:0030334)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to hormone (GO:0009725)|response to vitamin A (GO:0033189)|somatotropin secreting cell differentiation (GO:0060126)|spleen development (GO:0048536)|subthalamic nucleus development (GO:0021763)|superior vena cava morphogenesis (GO:0060578)|vascular smooth muscle cell differentiation (GO:0035886)|vasculogenesis (GO:0001570)|ventricular cardiac muscle cell development (GO:0055015)|ventricular septum morphogenesis (GO:0060412)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin DNA binding (GO:0031490)|phosphoprotein binding (GO:0051219)|protein homodimerization activity (GO:0042803)|ribonucleoprotein complex binding (GO:0043021)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			breast(1)|endometrium(3)|large_intestine(1)|lung(5)	10		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00222)		CTGGCAAGCACTCAGGTTGGA	0.632																																																0			4											48.0	46.0	47.0					4																	111539315		2203	4300	6503	111758764	SO:0001583	missense	5308			U69961	CCDS3692.1, CCDS3693.1, CCDS3694.1	4q25	2011-06-20	2007-07-12		ENSG00000164093	ENSG00000164093		"""Homeoboxes / PRD class"""	9005	protein-coding gene	gene with protein product		601542	"""paired-like homeodomain transcription factor 2"""	IRID2, IHG2, RIEG, RIEG1, RGS		9539779, 7581385	Standard	NM_000325		Approved	IGDS, RS, Brx1, Otlx2, ARP1	uc021xqr.1	Q99697	OTTHUMG00000132837	ENST00000354925.2:c.920G>C	4.37:g.111539315C>G	ENSP00000347004:p.Ser307Thr		111758764	A8K6C6|B2RA02|B3KXS0|O60578|O60579|O60580|Q3KQX9|Q9BY17	Missense_Mutation	SNP	superfamily_Homeodomain-like,HMMSmart_SM00389,HMMPfam_Homeobox,PatternScan_HOMEOBOX_1,HMMPfam_OAR	p.S314T	ENST00000354925.2	37	c.941	CCDS3692.1	4	.	.	.	.	.	.	.	.	.	.	C	20.2	3.953182	0.73902	.	.	ENSG00000164093	ENST00000306732;ENST00000394598;ENST00000355080;ENST00000354925	D;D;D;D	0.94497	-3.26;-3.34;-3.44;-3.34	5.68	5.68	0.88126	.	0.035417	0.85682	D	0.000000	D	0.96685	0.8918	M	0.82323	2.585	0.80722	D	1	P;P;D;D	0.55172	0.584;0.75;0.97;0.969	B;B;P;P	0.53912	0.338;0.306;0.718;0.737	D	0.96784	0.9577	10	0.66056	D	0.02	.	19.7959	0.96481	0.0:1.0:0.0:0.0	.	261;261;307;314	A8K6C6;Q99697-3;Q99697;Q99697-2	.;.;PITX2_HUMAN;.	T	314;307;261;307	ENSP00000304169:S314T;ENSP00000378097:S307T;ENSP00000347192:S261T;ENSP00000347004:S307T	ENSP00000304169:S314T	S	-	2	0	PITX2	111758764	1.000000	0.71417	0.990000	0.47175	0.994000	0.84299	7.818000	0.86416	2.689000	0.91719	0.655000	0.94253	AGT	-	NULL		0.632	PITX2-003	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	PITX2	protein_coding	OTTHUMT00000256308.2	C			111758764	-1	no_errors	NM_000325	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
USP28	57646	genome.wustl.edu	37	11	113674595	113674595	+	Nonsense_Mutation	SNP	C	C	T			TCGA-04-1651-01A-01W-0639-09	TCGA-04-1651-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f02d550d-d80c-449f-9d69-37ffb1e649b6	8e8ba185-6faf-49df-9784-594e179731c5	g.chr11:113674595C>T	ENST00000003302.4	-	22	2731	c.2663G>A	c.(2662-2664)tGg>tAg	p.W888*	USP28_ENST00000260188.5_Nonsense_Mutation_p.W856*|USP28_ENST00000545540.1_Nonsense_Mutation_p.W731*|USP28_ENST00000544967.1_Nonsense_Mutation_p.W564*	NM_020886.2	NP_065937.1	Q96RU2	UBP28_HUMAN	ubiquitin specific peptidase 28	888					cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|protein deubiquitination (GO:0016579)|response to ionizing radiation (GO:0010212)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(4)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(12)|lung(24)|ovary(1)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	59		all_cancers(61;3.74e-18)|all_epithelial(67;3.75e-11)|Melanoma(852;1.46e-05)|all_hematologic(158;4.65e-05)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|Prostate(24;0.0153)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;3.93e-06)|Epithelial(105;0.000122)|all cancers(92;0.00104)		ATCTTCATGCCACTTCTGAAA	0.313																																					Melanoma(4;162 555 7664)|GBM(79;500 2010 17506)|Esophageal Squamous(9;463 924 15765)											0			11											70.0	70.0	70.0					11																	113674595		2201	4296	6497	113179805	SO:0001587	stop_gained	57646			AB040948	CCDS31680.1, CCDS73394.1	11q23	2008-04-11	2005-08-08		ENSG00000048028	ENSG00000048028		"""Ubiquitin-specific peptidases"""	12625	protein-coding gene	gene with protein product		610748	"""ubiquitin specific protease 28"""			12838346, 11597335	Standard	XM_005271630		Approved	KIAA1515	uc001poh.3	Q96RU2	OTTHUMG00000168205	ENST00000003302.4:c.2663G>A	11.37:g.113674595C>T	ENSP00000003302:p.Trp888*		113179805	B0YJC0|B0YJC1|Q9P213	Nonsense_Mutation	SNP	superfamily_UBA-like,superfamily_Cysteine proteinases,HMMPfam_UCH,PatternScan_UCH_2_1,PatternScan_UCH_2_2,PatternScan_CPSASE_2	p.W888*	ENST00000003302.4	37	c.2663	CCDS31680.1	11	.	.	.	.	.	.	.	.	.	.	C	41	8.717300	0.98927	.	.	ENSG00000048028	ENST00000003302;ENST00000260188;ENST00000544967;ENST00000545540	.	.	.	5.89	5.89	0.94794	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.7941	20.2618	0.98447	0.0:1.0:0.0:0.0	.	.	.	.	X	888;856;564;731	.	ENSP00000003302:W888X	W	-	2	0	USP28	113179805	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.301000	0.78850	2.793000	0.96121	0.655000	0.94253	TGG	-	NULL		0.313	USP28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP28	protein_coding	OTTHUMT00000398789.1	C			113179805	-1	no_errors	NM_020886	genbank	human	validated	54_36p	nonsense	SNP	1.000	T
RPL23AP7	118433	genome.wustl.edu	37	2	114369591	114369591	+	RNA	SNP	A	A	T			TCGA-04-1651-01A-01W-0639-09	TCGA-04-1651-11A-01W-0639-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f02d550d-d80c-449f-9d69-37ffb1e649b6	8e8ba185-6faf-49df-9784-594e179731c5	g.chr2:114369591A>T	ENST00000416673.2	-	0	565					NR_000029.3				ribosomal protein L23a pseudogene 7																		GTCAGCGGAAACTTGATGATA	0.527																																																0			2																																								114086061			118433			BC000596		2q14	2009-03-11				ENSG00000240356		"""L ribosomal proteins"""	17336	pseudogene	pseudogene						19123937	Standard	NR_000029		Approved	RPL23AL1, bA395L14.9	uc010yxy.1				2.37:g.114369591A>T			114086061		RNA	SNP	-	NULL	ENST00000416673.2	37	NULL		2																																																																																			-	-		0.527	RPL23AP7-003	KNOWN	basic	processed_transcript	RPL23AP7	pseudogene	OTTHUMT00000397215.1	A			114086061	-1	pseudogene	NR_000029	genbank	human	validated	54_36p	rna	SNP	1.000	T
CD1C	911	genome.wustl.edu	37	1	158263248	158263248	+	Silent	SNP	A	A	C			TCGA-04-1651-01A-01W-0639-09	TCGA-04-1651-11A-01W-0639-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f02d550d-d80c-449f-9d69-37ffb1e649b6	8e8ba185-6faf-49df-9784-594e179731c5	g.chr1:158263248A>C	ENST00000368170.3	+	6	1263	c.984A>C	c.(982-984)tcA>tcC	p.S328S		NM_001765.2	NP_001756.2	P29017	CD1C_HUMAN	CD1c molecule	328				CSYQDIL -> W (in Ref. 1; AAA51942). {ECO:0000305}.	antigen processing and presentation (GO:0019882)|T cell activation involved in immune response (GO:0002286)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	endogenous lipid antigen binding (GO:0030883)|exogenous lipid antigen binding (GO:0030884)|glycolipid binding (GO:0051861)|lipopeptide binding (GO:0071723)			NS(1)|endometrium(3)|large_intestine(4)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	39	all_hematologic(112;0.0378)					TTCACAGCTCATATCAGGACA	0.478																																																0			1											139.0	124.0	129.0					1																	158263248		2203	4300	6503	156529872	SO:0001819	synonymous_variant	911			M28827	CCDS1175.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158481	ENSG00000158481		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1636	protein-coding gene	gene with protein product		188340	"""CD1C antigen, c polypeptide"", ""CD1c antigen"""	CD1		2447586	Standard	NM_001765		Approved		uc001fru.3	P29017	OTTHUMG00000017514	ENST00000368170.3:c.984A>C	1.37:g.158263248A>C			156529872	Q5TDJ7|Q6IAS4|Q9UMM0|Q9UN96	Missense_Mutation	SNP	superfamily_MHC antigen-recognition domain,HMMPfam_MHC_I,superfamily_Immunoglobulin,HMMPfam_C1-set,HMMSmart_SM00407	p.H298P	ENST00000368170.3	37	c.893	CCDS1175.1	1	.	.	.	.	.	.	.	.	.	.	A	2.927	-0.222007	0.06061	.	.	ENSG00000158481	ENST00000368169	.	.	.	2.94	-5.88	0.02290	.	.	.	.	.	T	0.07818	0.0196	.	.	.	0.09310	N	0.999996	B	0.15719	0.014	B	0.18871	0.023	T	0.08249	-1.0731	7	0.46703	T	0.11	.	1.5756	0.02624	0.1379:0.3541:0.1803:0.3276	.	298	E9PGC9	.	P	298	.	ENSP00000357151:H298P	H	+	2	0	CD1C	156529872	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-0.924000	0.03996	-3.348000	0.00182	-1.310000	0.01310	CAT	-	superfamily_Immunoglobulin		0.478	CD1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD1C	protein_coding	OTTHUMT00000046351.2	A	NM_001765		156529872	+1	no_errors	ENST00000368169	ensembl	human	known	54_36p	missense	SNP	0.005	C
LRRIQ4	344657	genome.wustl.edu	37	3	169548389	169548389	+	Missense_Mutation	SNP	A	A	T			TCGA-04-1651-01A-01W-0639-09	TCGA-04-1651-11A-01W-0639-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f02d550d-d80c-449f-9d69-37ffb1e649b6	8e8ba185-6faf-49df-9784-594e179731c5	g.chr3:169548389A>T	ENST00000340806.6	+	3	1304	c.1304A>T	c.(1303-1305)cAa>cTa	p.Q435L		NM_001080460.1	NP_001073929.1	A6NIV6	LRIQ4_HUMAN	leucine-rich repeats and IQ motif containing 4	435										breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	30						TTGCTTAAGCAACTTCCAGAT	0.458																																																0			3											72.0	71.0	71.0					3																	169548389		1899	4113	6012	171031083	SO:0001583	missense	344657				CCDS46951.1	3q26.2	2008-08-08	2008-06-12	2008-06-12	ENSG00000188306	ENSG00000188306			34298	protein-coding gene	gene with protein product	"""leucine rich repeat containing 64"""						Standard	NM_001080460		Approved	LRRC64	uc003fgb.3	A6NIV6	OTTHUMG00000164420	ENST00000340806.6:c.1304A>T	3.37:g.169548389A>T	ENSP00000342188:p.Gln435Leu		171031083		Missense_Mutation	SNP	superfamily_SSF52058,HMMPfam_LRR_1,HMMSmart_IQ,HMMPfam_IQ	p.Q435L	ENST00000340806.6	37	c.1304	CCDS46951.1	3	.	.	.	.	.	.	.	.	.	.	A	15.23	2.772126	0.49680	.	.	ENSG00000188306	ENST00000340806	T	0.56444	0.46	5.69	3.24	0.37175	.	0.490245	0.20353	N	0.094017	T	0.43656	0.1257	N	0.21097	0.63	0.21527	N	0.999655	P	0.48998	0.918	P	0.49140	0.601	T	0.24048	-1.0171	10	0.23891	T	0.37	.	10.8254	0.46629	0.7478:0.0:0.0:0.2522	.	435	A6NIV6	LRIQ4_HUMAN	L	435	ENSP00000342188:Q435L	ENSP00000342188:Q435L	Q	+	2	0	LRRIQ4	171031083	0.660000	0.27420	0.285000	0.24819	0.441000	0.31987	2.546000	0.45778	0.398000	0.25338	-0.336000	0.08194	CAA	-	superfamily_SSF52058		0.458	LRRIQ4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRIQ4	protein_coding	OTTHUMT00000378698.1	A	NM_001080460		171031083	+1	no_errors	NM_001080460	genbank	human	inferred	54_36p	missense	SNP	0.834	T
SERPINC1	462	genome.wustl.edu	37	1	173873124	173873124	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1651-01A-01W-0639-09	TCGA-04-1651-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f02d550d-d80c-449f-9d69-37ffb1e649b6	8e8ba185-6faf-49df-9784-594e179731c5	g.chr1:173873124G>C	ENST00000367698.3	-	7	1416	c.1298C>G	c.(1297-1299)aCt>aGt	p.T433S		NM_000488.3	NP_000479.1	P01008	ANT3_HUMAN	serpin peptidase inhibitor, clade C (antithrombin), member 1	433					blood coagulation (GO:0007596)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of inflammatory response (GO:0050728)|regulation of blood coagulation, intrinsic pathway (GO:2000266)|regulation of proteolysis (GO:0030162)|response to nutrient (GO:0007584)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protease binding (GO:0002020)|serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|endometrium(2)|large_intestine(5)|liver(1)|lung(15)|ovary(1)	25					Ardeparin(DB00407)|Dalteparin(DB06779)|Enoxaparin(DB01225)|Fondaparinux sodium(DB00569)|Heparin(DB01109)|Nadroparin(DB08813)|Sulodexide(DB06271)|Tinzaparin(DB06822)	GGCCTTGAAAGTCACCCTGTT	0.458																																																0			1											82.0	81.0	81.0					1																	173873124		2203	4300	6503	172139747	SO:0001583	missense	462			X68793	CCDS1313.1	1q25.1	2014-02-18	2005-08-18		ENSG00000117601	ENSG00000117601		"""Serine (or cysteine) peptidase inhibitors"""	775	protein-coding gene	gene with protein product	"""antithrombin III"", ""signal peptide antithrombin part 1"", ""coding sequence signal peptide antithrombin part 1"", ""antithrombin (aa 375-432)"""	107300	"""serine (or cysteine) proteinase inhibitor, clade C (antithrombin), member 1"""	AT3		3979120, 24172014	Standard	NM_000488		Approved	ATIII, MGC22579	uc001gjt.3	P01008	OTTHUMG00000037276	ENST00000367698.3:c.1298C>G	1.37:g.173873124G>C	ENSP00000356671:p.Thr433Ser		172139747	B2R6P0|P78439|P78447|Q13815|Q5TC78|Q7KZ43|Q7KZ97|Q9UC78	Missense_Mutation	SNP	superfamily_Prot_inh_serpin,HMMPfam_Serpin,HMMSmart_SERPIN,PatternScan_SERPIN	p.T433S	ENST00000367698.3	37	c.1298	CCDS1313.1	1	.	.	.	.	.	.	.	.	.	.	G	10.26	1.301085	0.23650	.	.	ENSG00000117601	ENST00000367698;ENST00000351522	D	0.84070	-1.8	5.74	3.89	0.44902	Serpin domain (3);	0.412612	0.28815	N	0.014057	T	0.49423	0.1556	L	0.28192	0.835	0.33371	D	0.573568	B	0.02656	0.0	B	0.04013	0.001	T	0.15178	-1.0446	10	0.09084	T	0.74	.	8.98	0.35959	0.2751:0.0:0.7249:0.0	.	433	P01008	ANT3_HUMAN	S	433;228	ENSP00000356671:T433S	ENSP00000307953:T228S	T	-	2	0	SERPINC1	172139747	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.464000	0.35288	0.786000	0.33708	0.650000	0.86243	ACT	-	superfamily_Prot_inh_serpin,HMMPfam_Serpin,HMMSmart_SERPIN		0.458	SERPINC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPINC1	protein_coding	OTTHUMT00000090734.1	G	NM_000488		172139747	-1	no_errors	NM_000488	genbank	human	validated	54_36p	missense	SNP	0.993	C
MSX2	4488	genome.wustl.edu	37	5	174156278	174156278	+	Missense_Mutation	SNP	T	T	A			TCGA-04-1651-01A-01W-0639-09	TCGA-04-1651-11A-01W-0639-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f02d550d-d80c-449f-9d69-37ffb1e649b6	8e8ba185-6faf-49df-9784-594e179731c5	g.chr5:174156278T>A	ENST00000239243.6	+	2	623	c.496T>A	c.(496-498)Tac>Aac	p.Y166N	MSX2_ENST00000507785.1_3'UTR	NM_002449.4	NP_002440.2	P35548	MSX2_HUMAN	msh homeobox 2	166					activation of meiosis (GO:0090427)|anagen (GO:0042640)|anterior/posterior pattern specification (GO:0009952)|BMP signaling pathway involved in heart development (GO:0061312)|bone trabecula formation (GO:0060346)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cellular response to estradiol stimulus (GO:0071392)|cellular response to growth factor stimulus (GO:0071363)|chondrocyte development (GO:0002063)|cranial suture morphogenesis (GO:0060363)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic nail plate morphogenesis (GO:0035880)|enamel mineralization (GO:0070166)|endochondral bone growth (GO:0003416)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|frontal suture morphogenesis (GO:0060364)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of CREB transcription factor activity (GO:0032792)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of keratinocyte differentiation (GO:0045617)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoblast development (GO:0002076)|osteoblast differentiation (GO:0001649)|outflow tract septum morphogenesis (GO:0003148)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of catagen (GO:0051795)|positive regulation of mesenchymal cell apoptotic process (GO:2001055)|positive regulation of osteoblast differentiation (GO:0045669)|signal transduction involved in regulation of gene expression (GO:0023019)|wound healing, spreading of epidermal cells (GO:0035313)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding (GO:0043565)|transcription cofactor activity (GO:0003712)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)	10	Renal(175;0.000159)|Lung NSC(126;0.0196)|all_lung(126;0.0303)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			TCAGAAACAGTACCTCTCCAT	0.567																																																0			5											69.0	63.0	65.0					5																	174156278		2203	4300	6503	174088884	SO:0001583	missense	4488			D26145	CCDS4392.1	5q35.2	2011-06-20	2006-11-21		ENSG00000120149	ENSG00000120149		"""Homeoboxes / ANTP class : NKL subclass"""	7392	protein-coding gene	gene with protein product	"""craniosynostosis, type 2"""	123101	"""msh (Drosophila) homeo box homolog 2"", ""parietal foramina 1"", ""msh homeobox homolog 2 (Drosophila)"""	PFM1		8668339, 8786091	Standard	XM_006714868		Approved	CRS2, FPP, HOX8, MSH, PFM	uc003mcy.3	P35548	OTTHUMG00000130556	ENST00000239243.6:c.496T>A	5.37:g.174156278T>A	ENSP00000239243:p.Tyr166Asn		174088884	D3DQN1|Q53XM4|Q9UD60	Missense_Mutation	SNP	superfamily_Homeodomain-like,HMMSmart_SM00389,HMMPfam_Homeobox,PatternScan_HOMEOBOX_1	p.Y166N	ENST00000239243.6	37	c.496	CCDS4392.1	5	.	.	.	.	.	.	.	.	.	.	T	28.0	4.878951	0.91740	.	.	ENSG00000120149	ENST00000239243	D	0.97161	-4.27	5.72	5.72	0.89469	Homeobox, eukaryotic (1);Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.99149	0.9706	H	0.98351	4.21	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98965	1.0799	10	0.87932	D	0	-14.494	15.9791	0.80094	0.0:0.0:0.0:1.0	.	166	P35548	MSX2_HUMAN	N	166	ENSP00000239243:Y166N	ENSP00000239243:Y166N	Y	+	1	0	MSX2	174088884	1.000000	0.71417	1.000000	0.80357	0.912000	0.54170	7.991000	0.88244	2.182000	0.69389	0.482000	0.46254	TAC	-	superfamily_Homeodomain-like,HMMSmart_SM00389,HMMPfam_Homeobox		0.567	MSX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MSX2	protein_coding	OTTHUMT00000252981.3	T			174088884	+1	no_errors	NM_002449	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
LMAN2	10960	genome.wustl.edu	37	5	176759244	176759244	+	Missense_Mutation	SNP	T	T	C	rs371597149		TCGA-04-1651-01A-01W-0639-09	TCGA-04-1651-11A-01W-0639-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f02d550d-d80c-449f-9d69-37ffb1e649b6	8e8ba185-6faf-49df-9784-594e179731c5	g.chr5:176759244T>C	ENST00000303127.7	-	8	1118	c.914A>G	c.(913-915)aAc>aGc	p.N305S	LMAN2_ENST00000515209.1_Missense_Mutation_p.T313A	NM_006816.2	NP_006807.1	Q12907	LMAN2_HUMAN	lectin, mannose-binding 2	305					positive regulation of phagocytosis (GO:0050766)|protein transport (GO:0015031)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|glycoprotein binding (GO:0001948)|heat shock protein binding (GO:0031072)|mannose binding (GO:0005537)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|upper_aerodigestive_tract(1)	16	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GTCGTCCACGTTGTCTGGGGG	0.692																																																0			5						T	SER/ASN	0,4378		0,0,2189	11.0	16.0	15.0		914	4.2	1.0	5		15	1,8553		0,1,4276	no	missense	LMAN2	NM_006816.2	46	0,1,6465	CC,CT,TT		0.0117,0.0,0.0077	benign	305/357	176759244	1,12931	2189	4277	6466	176691850	SO:0001583	missense	10960			U10362	CCDS4417.1	5q35	2008-02-05		2003-07-04	ENSG00000169223	ENSG00000169223			16986	protein-coding gene	gene with protein product		609551	"""chromosome 5 open reading frame 8"""	C5orf8		12609988	Standard	NM_006816		Approved	GP36B, VIP36	uc003mge.3	Q12907	OTTHUMG00000130860	ENST00000303127.7:c.914A>G	5.37:g.176759244T>C	ENSP00000303366:p.Asn305Ser		176691850	Q53HH1	Missense_Mutation	SNP	superfamily_ConA_like_lec_gl,HMMPfam_Lectin_leg-like	p.N305S	ENST00000303127.7	37	c.914	CCDS4417.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	20.7|20.7	4.037946|4.037946	0.75617|0.75617	0.0|0.0	1.17E-4|1.17E-4	ENSG00000169223|ENSG00000169223	ENST00000303127;ENST00000539488|ENST00000515209	T|T	0.63417|0.62788	-0.04|0.0	5.37|5.37	4.22|4.22	0.49857|0.49857	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.57740|0.57740	0.2074|0.2074	L|L	0.57536|0.57536	1.79|1.79	0.25591|0.25591	N|N	0.986697|0.986697	B|B	0.17038|0.02656	0.02|0.0	B|B	0.11329|0.01281	0.006|0.0	T|T	0.50575|0.50575	-0.8812|-0.8812	10|9	0.12766|0.42905	T|T	0.61|0.14	-15.3819|-15.3819	10.8076|10.8076	0.46527|0.46527	0.0:0.0751:0.0:0.9249|0.0:0.0751:0.0:0.9249	.|.	305|313	Q12907|D6RBV2	LMAN2_HUMAN|.	S|A	305;234|313	ENSP00000303366:N305S|ENSP00000423998:T313A	ENSP00000303366:N305S|ENSP00000423998:T313A	N|T	-|-	2|1	0|0	LMAN2|LMAN2	176691850|176691850	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.786000|0.786000	0.44442|0.44442	7.698000|7.698000	0.84413|0.84413	0.886000|0.886000	0.36113|0.36113	-0.250000|-0.250000	0.11733|0.11733	AAC|ACG	-	NULL		0.692	LMAN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LMAN2	protein_coding	OTTHUMT00000253434.1	T	NM_006816		176691850	-1	no_errors	NM_006816	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
LRRN2	10446	genome.wustl.edu	37	1	204587842	204587842	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1651-01A-01W-0639-09	TCGA-04-1651-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f02d550d-d80c-449f-9d69-37ffb1e649b6	8e8ba185-6faf-49df-9784-594e179731c5	g.chr1:204587842G>C	ENST00000367175.1	-	1	3491	c.1279C>G	c.(1279-1281)Cga>Gga	p.R427G	LRRN2_ENST00000367177.3_Missense_Mutation_p.R427G|LRRN2_ENST00000496057.1_5'Flank|RP11-430C7.4_ENST00000453895.1_RNA|LRRN2_ENST00000367176.3_Missense_Mutation_p.R427G			O75325	LRRN2_HUMAN	leucine rich repeat neuronal 2	427	Ig-like C2-type.				cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|liver(1)|lung(22)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	38	all_cancers(21;0.0519)|Breast(84;0.112)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)			GGGAAGCTTCGTGGGGAGATG	0.652																																																0			1											35.0	32.0	33.0					1																	204587842		2203	4300	6503	202854465	SO:0001583	missense	10446			AF030435	CCDS1448.1	1q32.1	2013-01-11	2007-01-31	2007-01-31	ENSG00000170382	ENSG00000170382		"""Immunoglobulin superfamily / I-set domain containing"""	16914	protein-coding gene	gene with protein product	"""leucine rich and ankyrin repeats 1"", ""fibronectin type III, immunoglobulin and leucine rich repeat domain 7"""	605492	"""leucine rich repeat neuronal 5"""	LRRN5		9662332	Standard	NM_006338		Approved	GAC1, LRANK1, FIGLER7	uc001hbf.1	O75325	OTTHUMG00000035989	ENST00000367175.1:c.1279C>G	1.37:g.204587842G>C	ENSP00000356143:p.Arg427Gly		202854465	B2R624|Q5T0Y0|Q6UXM0|Q8N182	Missense_Mutation	SNP	superfamily_L domain-like,HMMSmart_SM00365,HMMSmart_SM00369,HMMPfam_LRR_1,HMMSmart_SM00082,HMMPfam_LRRCT,superfamily_Immunoglobulin,HMMPfam_I-set,HMMSmart_SM00409,HMMSmart_SM00408	p.R427G	ENST00000367175.1	37	c.1279	CCDS1448.1	1	.	.	.	.	.	.	.	.	.	.	G	9.244	1.039007	0.19669	.	.	ENSG00000170382	ENST00000367176;ENST00000367177;ENST00000367175	T;T;T	0.60548	0.18;0.18;0.18	5.37	5.37	0.77165	Immunoglobulin-like (1);	0.000000	0.41396	D	0.000894	T	0.46983	0.1421	L	0.39245	1.2	0.36751	D	0.882747	B	0.14012	0.009	B	0.15484	0.013	T	0.50346	-0.8839	10	0.37606	T	0.19	.	10.3305	0.43820	0.0:0.1454:0.7042:0.1503	.	427	O75325	LRRN2_HUMAN	G	427	ENSP00000356144:R427G;ENSP00000356145:R427G;ENSP00000356143:R427G	ENSP00000356143:R427G	R	-	1	2	LRRN2	202854465	0.004000	0.15560	0.996000	0.52242	0.930000	0.56654	1.260000	0.32968	2.518000	0.84900	0.467000	0.42956	CGA	-	superfamily_Immunoglobulin,HMMPfam_I-set		0.652	LRRN2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LRRN2	protein_coding	OTTHUMT00000089894.1	G	NM_006338		202854465	-1	no_errors	NM_006338	genbank	human	reviewed	54_36p	missense	SNP	0.992	C
TRPM8	79054	genome.wustl.edu	37	2	234869689	234869689	+	Silent	SNP	C	C	T	rs142882642		TCGA-04-1651-01A-01W-0639-09	TCGA-04-1651-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f02d550d-d80c-449f-9d69-37ffb1e649b6	8e8ba185-6faf-49df-9784-594e179731c5	g.chr2:234869689C>T	ENST00000324695.4	+	12	1672	c.1632C>T	c.(1630-1632)gaC>gaT	p.D544D	TRPM8_ENST00000433712.2_Silent_p.D232D	NM_024080.4	NP_076985.4	Q7Z2W7	TRPM8_HUMAN	transient receptor potential cation channel, subfamily M, member 8	544					calcium ion transmembrane transport (GO:0070588)|cellular calcium ion homeostasis (GO:0006874)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|protein homotetramerization (GO:0051289)|protein homotrimerization (GO:0070207)|response to cold (GO:0009409)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)			breast(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|liver(2)|lung(27)|prostate(2)|skin(7)|stomach(2)	66		Breast(86;0.00205)|Renal(207;0.00694)|all_lung(227;0.0129)|Lung NSC(271;0.0408)|all_hematologic(139;0.0753)|Acute lymphoblastic leukemia(138;0.224)		Epithelial(121;1.19e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000139)|Lung(119;0.00758)|LUSC - Lung squamous cell carcinoma(224;0.0108)	Menthol(DB00825)	ATGGCCGGGACGAGATGGACA	0.488																																																0			2						C		0,4406		0,0,2203	58.0	53.0	55.0		1632	-11.3	0.0	2	dbSNP_134	55	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	TRPM8	NM_024080.4		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		544/1105	234869689	1,13005	2203	4300	6503	234534428	SO:0001819	synonymous_variant	79054			AC005538	CCDS33407.1	2q37	2011-12-14			ENSG00000144481	ENSG00000144481		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17961	protein-coding gene	gene with protein product		606678				16382100	Standard	NM_024080		Approved		uc002vvh.3	Q7Z2W7	OTTHUMG00000059129	ENST00000324695.4:c.1632C>T	2.37:g.234869689C>T			234534428	A0AVG2|Q3YFM7|Q6QNH9|Q8TAC3|Q8TDX8|Q9BVK1	Silent	SNP	HMMPfam_Ion_trans	p.D544	ENST00000324695.4	37	c.1632	CCDS33407.1	2																																																																																			-	NULL		0.488	TRPM8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPM8	protein_coding	OTTHUMT00000131005.4	C	NM_024080		234534428	+1	no_errors	NM_024080	genbank	human	validated	54_36p	silent	SNP	0.046	T
HEATR1	55127	genome.wustl.edu	37	1	236718741	236718741	+	Silent	SNP	T	T	C			TCGA-04-1651-01A-01W-0639-09	TCGA-04-1651-11A-01W-0639-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f02d550d-d80c-449f-9d69-37ffb1e649b6	8e8ba185-6faf-49df-9784-594e179731c5	g.chr1:236718741T>C	ENST00000366582.3	-	41	5892	c.5778A>G	c.(5776-5778)gaA>gaG	p.E1926E	HEATR1_ENST00000366581.2_Silent_p.E1845E	NM_018072.5	NP_060542.4	Q9H583	HEAT1_HUMAN	HEAT repeat containing 1	1926					rRNA processing (GO:0006364)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(18)|lung(28)|ovary(3)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	87	Ovarian(103;0.0634)|Breast(184;0.133)	all_cancers(173;0.0255)|Prostate(94;0.175)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			TTGGGGCATCTTCTGTTTTAG	0.413																																																0			1											94.0	92.0	93.0					1																	236718741		2203	4300	6503	234785364	SO:0001819	synonymous_variant	55127			BC065205	CCDS31066.1	1q43	2011-08-12			ENSG00000119285	ENSG00000119285			25517	protein-coding gene	gene with protein product	"""UTP10, small subunit (SSU) processome component, homolog (yeast)"""					17699751	Standard	NM_018072		Approved	FLJ10359, BAP28, UTP10	uc001hyd.2	Q9H583	OTTHUMG00000040061	ENST00000366582.3:c.5778A>G	1.37:g.236718741T>C			234785364	Q5T3Q8|Q6P197|Q9NW23	Silent	SNP	superfamily_ARM-type_fold,HMMPfam_HEAT,HMMPfam_BP28CT	p.E1926	ENST00000366582.3	37	c.5778	CCDS31066.1	1																																																																																			-	superfamily_ARM-type_fold,HMMPfam_BP28CT		0.413	HEATR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEATR1	protein_coding	OTTHUMT00000096635.1	T	XM_375853		234785364	-1	no_errors	NM_018072	genbank	human	validated	54_36p	silent	SNP	0.996	C
CAPG	822	genome.wustl.edu	37	2	85629035	85629036	+	Frame_Shift_Ins	INS	-	-	A			TCGA-04-1651-01A-01W-0639-09	TCGA-04-1651-11A-01W-0639-09	-	-					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f02d550d-d80c-449f-9d69-37ffb1e649b6	8e8ba185-6faf-49df-9784-594e179731c5	g.chr2:85629035_85629036insA	ENST00000409921.1	-	3	134_135	c.68_69insT	c.(67-69)gtgfs	p.V23fs	CAPG_ENST00000409724.1_Frame_Shift_Ins_p.V23fs|CAPG_ENST00000263867.4_Frame_Shift_Ins_p.V23fs|CAPG_ENST00000483659.1_5'Flank|CAPG_ENST00000409670.1_Frame_Shift_Ins_p.V23fs			Q9BPX3	CND3_HUMAN	capping protein (actin filament), gelsolin-like	0					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(6)	11						CCACCCGCCACACATGCAGGCC	0.619																																																0			2																																								85482547	SO:0001589	frameshift_variant	822			M94345	CCDS1974.1, CCDS58715.1	2p11.2	2008-06-04			ENSG00000042493	ENSG00000042493			1474	protein-coding gene	gene with protein product	"""macrophage capping protein"""	153615		AFCP		1322908, 12754261	Standard	NM_001747		Approved	MCP	uc010fgi.2	P40121	OTTHUMG00000130183	ENST00000409921.1:c.69dupT	2.37:g.85629036_85629036dupA	ENSP00000387063:p.Val23fs		85482546	Q3MJE0|Q96SV9|Q9BUR3|Q9BVY1|Q9H914|Q9H9Z6|Q9HBI9	Frame_Shift_Ins	INS	superfamily_Actin depolymerizing proteins,HMMSmart_SM00262,HMMPfam_Gelsolin	p.W24fs	ENST00000409921.1	37	c.69_68	CCDS58715.1	2																																																																																			-	superfamily_Actin depolymerizing proteins,HMMSmart_SM00262		0.619	CAPG-004	NOVEL	basic|exp_conf|CCDS	protein_coding	CAPG	protein_coding	OTTHUMT00000329383.1	-	NM_001747		85482547	-1	no_errors	NM_001747	genbank	human	reviewed	54_36p	frame_shift_ins	INS	0.145:0.187	A
FAM58BP	339521	genome.wustl.edu	37	1	200182704	200182727	+	IGR	DEL	GAGGACGCCGGAGAGGAGGCCGGA	GAGGACGCCGGAGAGGAGGCCGGA	-	rs550334629|rs565394962|rs141962771|rs61826220|rs386638409|rs535415213|rs372169225|rs76632737|rs369891064|rs369919899	byFrequency	TCGA-04-1651-01A-01W-0639-09	TCGA-04-1651-11A-01W-0639-09	GAGGACGCCGGAGAGGAGGCCGGA	GAGGACGCCGGAGAGGAGGCCGGA					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f02d550d-d80c-449f-9d69-37ffb1e649b6	8e8ba185-6faf-49df-9784-594e179731c5	g.chr1:200182704_200182727delGAGGACGCCGGAGAGGAGGCCGGA								NR5A2 (36152 upstream) : RP11-532L16.3 (101835 downstream)																							GGAAGGCATGgaggacgccggagaggaggccggagaggacgccg	0.665														664	0.132588	0.205	0.111	5008	,	,		16484	0.0595		0.0497	False		,,,				2504	0.2106															0			1								2024,2136		516,992,572						-2.0	0.0		dbSNP_134	15	2214,5898		306,1602,2148	no	coding	FAM58BP	NM_001105517.1		822,2594,2720	A1A1,A1R,RR		27.2929,48.6538,34.5339				4238,8034				198449350	SO:0001628	intergenic_variant	339521																															1.37:g.200182704_200182727delGAGGACGCCGGAGAGGAGGCCGGA			198449327		In_Frame_Del	DEL	PatternScan_CYCLINS,superfamily_Cyclin_like,HMMSmart_CYCLIN	p.GEEAGEDA8in_frame_del		37	c.13_36		1																																																																																			(deletion:cds_exon[198449315,198450073])	NULL	0	0.665					FAM58B			GAGGACGCCGGAGAGGAGGCCGGA			198449350	+1	no_errors	NM_001105517	genbank	human	inferred	54_36p	in_frame_del	DEL	0.017:0.005:0.003:0.002:0.001:0.001:0.001:0.000:0.001:0.001:0.005:0.006:0.008:0.007:0.007:0.007:0.005:0.005:0.007:0.009:0.009:0.008:0.007:0.007	-
