#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	SNP	A	A	G			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	A	A					Unknown	Invalid:failed_liftOver	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chrUnknown:0A>G								None (None upstream) : None (None downstream)																								0.0																																																0			MT																																								8731	SO:0001628	intergenic_variant	4508																															Unknown.37:g.0A>G			8731		Silent	SNP	HMMPfam_ATP-synt_A,superfamily_ATPase_F0_A,PatternScan_ATPASE_A	p.W68		37	c.204		MT																																																																																			-	HMMPfam_ATP-synt_A,superfamily_ATPase_F0_A	0	0					MT-ATP6			A			8731	+1	no_errors	ENST00000361899	ensembl	human	known	54_36p	silent	SNP	NULL	G
CNTN6	27255	genome.wustl.edu	37	3	1427457	1427457	+	Missense_Mutation	SNP	G	G	A			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr3:1427457G>A	ENST00000446702.2	+	20	3307	c.2680G>A	c.(2680-2682)Gtc>Atc	p.V894I	CNTN6_ENST00000350110.2_Missense_Mutation_p.V894I|CNTN6_ENST00000539053.1_Missense_Mutation_p.V822I			Q9UQ52	CNTN6_HUMAN	contactin 6	894	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|Notch signaling pathway (GO:0007219)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(34)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	90		all_cancers(2;0.000164)|all_epithelial(2;0.107)		Epithelial(13;0.000233)|all cancers(10;0.0013)|OV - Ovarian serous cystadenocarcinoma(96;0.0139)		AAGCCCCCCAGTCAATGTTAC	0.448																																																0			3											134.0	133.0	134.0					3																	1427457		2203	4300	6503	1402457	SO:0001583	missense	27255			AB003592	CCDS2557.1	3p26-p25	2013-02-11			ENSG00000134115	ENSG00000134115		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	2176	protein-coding gene	gene with protein product	"""neural adhesion molecule"""	607220				9486763	Standard	NM_014461		Approved	NB-3	uc003bpa.3	Q9UQ52	OTTHUMG00000119030	ENST00000446702.2:c.2680G>A	3.37:g.1427457G>A	ENSP00000407822:p.Val894Ile		1402457	Q2KHM2	Missense_Mutation	SNP	superfamily_SSF48726,HMMPfam_I-set,HMMSmart_IGc2,HMMSmart_IG,superfamily_FN_III-like,HMMSmart_FN3,HMMPfam_fn3	p.V894I	ENST00000446702.2	37	c.2680	CCDS2557.1	3	.	.	.	.	.	.	.	.	.	.	G	16.38	3.107916	0.56291	.	.	ENSG00000134115	ENST00000446702;ENST00000539053;ENST00000350110	T;T;T	0.55234	0.53;0.53;0.53	5.75	5.75	0.90469	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.000000	0.53938	D	0.000059	T	0.57562	0.2062	N	0.17278	0.47	0.51767	D	0.999937	P	0.40731	0.728	P	0.59056	0.851	T	0.50701	-0.8797	10	0.22109	T	0.4	.	19.9564	0.97221	0.0:0.0:1.0:0.0	.	894	Q9UQ52	CNTN6_HUMAN	I	894;822;894	ENSP00000407822:V894I;ENSP00000442791:V822I;ENSP00000341882:V894I	ENSP00000341882:V894I	V	+	1	0	CNTN6	1402457	1.000000	0.71417	0.996000	0.52242	0.984000	0.73092	5.993000	0.70616	2.708000	0.92522	0.650000	0.86243	GTC	-	superfamily_FN_III-like		0.448	CNTN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTN6	protein_coding	OTTHUMT00000239235.2	G	NM_014461		1402457	+1	no_errors	NM_014461	genbank	human	reviewed	54_36p	missense	SNP	0.997	A
SDHAP3	728609	genome.wustl.edu	37	5	1574405	1574405	+	IGR	SNP	C	C	G			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr5:1574405C>G								CTD-2245E15.3 (22580 upstream) : SDHAP3 (14737 downstream)																							ACTCATCAATCTGCACCTGAG	0.473																																																0			5																																								1627405	SO:0001628	intergenic_variant	0																															5.37:g.1574405C>G			1627405		Missense_Mutation	SNP	HMMPfam_Succ_DH_flav_C,superfamily_Succ_DH_flav_C	p.Q82H		37	c.246		5																																																																																			-	HMMPfam_Succ_DH_flav_C,superfamily_Succ_DH_flav_C	0	0.473					ENSG00000185986			C			1627405	-1	no_errors	ENST00000354559	ensembl	human	known	54_36p	missense	SNP	0.989	G
SGSM2	9905	genome.wustl.edu	37	17	2264975	2264975	+	Missense_Mutation	SNP	G	G	T			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr17:2264975G>T	ENST00000426855.2	+	3	353	c.178G>T	c.(178-180)Gct>Tct	p.A60S	SGSM2_ENST00000574563.1_Missense_Mutation_p.A60S|SGSM2_ENST00000268989.3_Missense_Mutation_p.A60S	NM_001098509.1	NP_001091979.1	O43147	SGSM2_HUMAN	small G protein signaling modulator 2	60	RUN. {ECO:0000255|PROSITE- ProRule:PRU00178}.				late endosome to Golgi transport (GO:0034499)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)		Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			biliary_tract(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	20				Colorectal(2;5.15e-05)|READ - Rectum adenocarcinoma(2;0.000115)		ACGCCGTGCCGCTGGCTTCCT	0.612																																																0			17											64.0	55.0	58.0					17																	2264975		2203	4300	6503	2211725	SO:0001583	missense	9905			BC039204	CCDS32526.1, CCDS45570.1	17p13.3	2013-07-10	2007-08-14	2007-08-14		ENSG00000141258		"""Small G protein signaling modulators"""	29026	protein-coding gene	gene with protein product		611418	"""RUN and TBC1 domain containing 1"""	RUTBC1		9455477, 17509819, 21808068	Standard	NM_014853		Approved	KIAA0397	uc002fum.4	O43147		ENST00000426855.2:c.178G>T	17.37:g.2264975G>T	ENSP00000415107:p.Ala60Ser		2211725	A5LGW2|B4DH69|Q49AC2|Q6ZUY2|Q8IXU4	Missense_Mutation	SNP	HMMPfam_RUN,HMMSmart_RUN,superfamily_RabGAP_TBC,HMMSmart_TBC,HMMPfam_TBC	p.A60S	ENST00000426855.2	37	c.178	CCDS45570.1	17	.	.	.	.	.	.	.	.	.	.	G	27.6	4.846507	0.91277	.	.	ENSG00000141258	ENST00000268989;ENST00000426855	T;T	0.32272	1.46;1.46	5.49	5.49	0.81192	RUN (2);	0.047664	0.85682	D	0.000000	T	0.49064	0.1535	L	0.60455	1.87	0.80722	D	1	P;D;P	0.55172	0.849;0.97;0.946	B;P;B	0.58820	0.442;0.846;0.441	T	0.31223	-0.9951	10	0.37606	T	0.19	-3.0541	18.3451	0.90319	0.0:0.0:1.0:0.0	.	60;60;60	O43147-5;O43147;O43147-2	.;SGSM2_HUMAN;.	S	60	ENSP00000268989:A60S;ENSP00000415107:A60S	ENSP00000268989:A60S	A	+	1	0	SGSM2	2211725	1.000000	0.71417	0.970000	0.41538	0.951000	0.60555	9.869000	0.99810	2.582000	0.87167	0.462000	0.41574	GCT	-	HMMPfam_RUN		0.612	SGSM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SGSM2	protein_coding	OTTHUMT00000438186.1	G	NM_014853		2211725	+1	no_errors	NM_014853	genbank	human	validated	54_36p	missense	SNP	1.000	T
EIF3B	8662	genome.wustl.edu	37	7	2403340	2403340	+	Missense_Mutation	SNP	G	G	A	rs371362324		TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr7:2403340G>A	ENST00000360876.4	+	5	1000	c.944G>A	c.(943-945)cGc>cAc	p.R315H	EIF3B_ENST00000397011.2_Missense_Mutation_p.R315H	NM_001037283.1	NP_001032360.1			eukaryotic translation initiation factor 3, subunit B											breast(2)|endometrium(4)|kidney(2)|large_intestine(3)|lung(11)|ovary(1)|skin(1)	24		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0833)|OV - Ovarian serous cystadenocarcinoma(56;7.76e-14)		AGTGGAGACCGCACTTCCATA	0.458																																																0			7						G	HIS/ARG,HIS/ARG	0,4406		0,0,2203	81.0	77.0	78.0		944,944	5.8	1.0	7		78	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	EIF3B	NM_001037283.1,NM_003751.3	29,29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign,benign	315/815,315/815	2403340	1,13005	2203	4300	6503	2369866	SO:0001583	missense	8662			U62583	CCDS5332.1	7p22	2013-02-12	2007-07-27	2007-07-27	ENSG00000106263	ENSG00000106263		"""RNA binding motif (RRM) containing"""	3280	protein-coding gene	gene with protein product		603917	"""eukaryotic translation initiation factor 3, subunit 9 eta, 116kDa"""	EIF3S9		8995410	Standard	NM_001037283		Approved	PRT1, eIF3b	uc003sly.3	P55884	OTTHUMG00000022839	ENST00000360876.4:c.944G>A	7.37:g.2403340G>A	ENSP00000354125:p.Arg315His		2369866		Missense_Mutation	SNP	superfamily_RNA-binding domain RBD,HMMSmart_SM00360,HMMPfam_RRM_1,superfamily_Dipeptidyl peptidase IV/CD26 N-terminal domain,HMMPfam_eIF2A	p.R315H	ENST00000360876.4	37	c.944	CCDS5332.1	7	.	.	.	.	.	.	.	.	.	.	G	17.24	3.338643	0.60963	0.0	1.16E-4	ENSG00000106263	ENST00000431643;ENST00000314800;ENST00000360876;ENST00000413917;ENST00000397011;ENST00000489558	T;T;T;T	0.42513	2.76;0.97;0.97;0.97	5.85	5.85	0.93711	WD40/YVTN repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.39682	0.1087	L	0.36672	1.1	0.53688	D	0.999977	B;B	0.15719	0.011;0.014	B;B	0.15484	0.006;0.013	T	0.11421	-1.0588	10	0.52906	T	0.07	-27.302	20.1669	0.98153	0.0:0.0:1.0:0.0	.	276;315	A4D210;P55884	.;EIF3B_HUMAN	H	43;315;315;276;315;239	ENSP00000408062:R43H;ENSP00000354125:R315H;ENSP00000407785:R276H;ENSP00000380206:R315H	ENSP00000316638:R315H	R	+	2	0	EIF3B	2369866	1.000000	0.71417	0.999000	0.59377	0.999000	0.98932	7.610000	0.82949	2.770000	0.95276	0.650000	0.86243	CGC	-	superfamily_Dipeptidyl peptidase IV/CD26 N-terminal domain		0.458	EIF3B-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	EIF3B	protein_coding	OTTHUMT00000207006.1	G			2369866	+1	no_errors	NM_001037283	genbank	human	validated	54_36p	missense	SNP	1.000	A
THOC6	79228	genome.wustl.edu	37	16	3077645	3077645	+	Missense_Mutation	SNP	C	C	G			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr16:3077645C>G	ENST00000326266.8	+	13	1309	c.1013C>G	c.(1012-1014)tCc>tGc	p.S338C	THOC6_ENST00000253952.9_Missense_Mutation_p.S293C|THOC6_ENST00000575576.1_Missense_Mutation_p.S314C|THOC6_ENST00000574549.1_Missense_Mutation_p.S314C	NM_024339.3	NP_077315.2	Q86W42	THOC6_HUMAN	THO complex 6 homolog (Drosophila)	338					apoptotic process (GO:0006915)|central nervous system development (GO:0007417)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|RNA splicing (GO:0008380)|viral mRNA export from host cell nucleus (GO:0046784)	nucleus (GO:0005634)|THO complex (GO:0000347)|THO complex part of transcription export complex (GO:0000445)|transcription export complex (GO:0000346)	RNA binding (GO:0003723)			central_nervous_system(1)|endometrium(4)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)	13						CGAGCCTTCTCCCTGTCCTTC	0.498																																																0			16											80.0	78.0	79.0					16																	3077645		2198	4300	6498	3017646	SO:0001583	missense	79228			BC050674	CCDS10491.1, CCDS45392.1	16p13.3	2013-02-11	2006-03-02	2006-03-02		ENSG00000131652		"""WD repeat domain containing"", ""THO complex subunits"""	28369	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 35"""	615403	"""WD repeat domain 58"""	WDR58		12477932	Standard	NM_024339		Approved	MGC2655, fSAP35	uc002ctb.2	Q86W42		ENST00000326266.8:c.1013C>G	16.37:g.3077645C>G	ENSP00000326531:p.Ser338Cys		3017646	B2RA85|Q8NBR1|Q9BTV9	Missense_Mutation	SNP	superfamily_WD40 repeat-like,HMMSmart_SM00320,HMMPfam_WD40,PatternScan_WD_REPEATS_1	p.S338C	ENST00000326266.8	37	c.1013	CCDS10491.1	16	.	.	.	.	.	.	.	.	.	.	C	17.48	3.399113	0.62177	.	.	ENSG00000131652	ENST00000326266;ENST00000253952	T;T	0.74842	-0.12;-0.88	5.26	4.31	0.51392	.	0.000000	0.85682	D	0.000000	D	0.83133	0.5188	M	0.68952	2.095	0.48975	D	0.999733	D;D	0.89917	1.0;1.0	D;D	0.80764	0.994;0.963	D	0.83665	0.0163	10	0.56958	D	0.05	-22.4974	11.5133	0.50507	0.0:0.9119:0.0:0.0881	.	293;338	Q86W42-3;Q86W42	.;THOC6_HUMAN	C	338;293	ENSP00000326531:S338C;ENSP00000253952:S293C	ENSP00000253952:S293C	S	+	2	0	THOC6	3017646	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	6.652000	0.74377	1.217000	0.43442	0.462000	0.41574	TCC	-	NULL		0.498	THOC6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	THOC6	protein_coding	OTTHUMT00000436981.1	C	NM_024339		3017646	+1	no_errors	NM_024339	genbank	human	validated	54_36p	missense	SNP	1.000	G
ZNF213	7760	genome.wustl.edu	37	16	3189054	3189054	+	Missense_Mutation	SNP	C	C	G			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr16:3189054C>G	ENST00000396878.3	+	5	1151	c.676C>G	c.(676-678)Ctc>Gtc	p.L226V	ZNF213_ENST00000576416.1_Missense_Mutation_p.L226V|ZNF213_ENST00000574902.1_Missense_Mutation_p.L226V|ZNF213_ENST00000416391.2_Missense_Mutation_p.L68V	NM_001134655.1|NM_004220.2	NP_001128127.1|NP_004211.1	O14771	ZN213_HUMAN	zinc finger protein 213	226	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)	16						TCAGCGGGATCTCTTCTGGGA	0.607																																																0			16											70.0	78.0	76.0					16																	3189054		2197	4300	6497	3129055	SO:0001583	missense	7760			AF017433	CCDS10495.1	16p13.3	2014-05-13	2007-02-20	2007-02-20	ENSG00000085644	ENSG00000085644		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13005	protein-coding gene	gene with protein product		608387				9653642, 10023065	Standard	NM_004220		Approved	CR53, ZKSCAN21, ZSCAN53	uc010uws.2	O14771	OTTHUMG00000177519	ENST00000396878.3:c.676C>G	16.37:g.3189054C>G	ENSP00000380087:p.Leu226Val		3129055	A8K1B9|B4DMG6|Q96IS1	Missense_Mutation	SNP	HMMPfam_SCAN,HMMSmart_SM00431,superfamily_KRAB domain (Kruppel-associated box Pfam 01352),HMMPfam_KRAB,HMMSmart_SM00349,superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1	p.L226V	ENST00000396878.3	37	c.676	CCDS10495.1	16	.	.	.	.	.	.	.	.	.	.	C	20.6	4.018746	0.75275	.	.	ENSG00000085644	ENST00000396878;ENST00000416391	T;T	0.05081	3.5;3.5	4.99	4.99	0.66335	Krueppel-associated box (4);	0.000000	0.39759	N	0.001278	T	0.15782	0.0380	M	0.83483	2.645	0.39922	D	0.97416	B	0.19817	0.039	B	0.31751	0.135	T	0.02398	-1.1165	10	0.51188	T	0.08	.	16.1297	0.81418	0.0:1.0:0.0:0.0	.	226	O14771	ZN213_HUMAN	V	226;68	ENSP00000380087:L226V;ENSP00000403892:L68V	ENSP00000380087:L226V	L	+	1	0	ZNF213	3129055	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.042000	0.49815	2.472000	0.83506	0.655000	0.94253	CTC	-	superfamily_KRAB domain (Kruppel-associated box Pfam 01352),HMMPfam_KRAB,HMMSmart_SM00349		0.607	ZNF213-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF213	protein_coding	OTTHUMT00000437334.1	C	NM_004220		3129055	+1	no_errors	NM_004220	genbank	human	validated	54_36p	missense	SNP	1.000	G
RFX3	5991	genome.wustl.edu	37	9	3263047	3263047	+	Missense_Mutation	SNP	C	C	G			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr9:3263047C>G	ENST00000382004.3	-	14	1804	c.1493G>C	c.(1492-1494)aGa>aCa	p.R498T	RFX3_ENST00000358730.2_Missense_Mutation_p.R498T|RFX3_ENST00000302303.1_Missense_Mutation_p.R498T	NM_001282116.1|NM_134428.1	NP_001269045.1|NP_602304.1	P48380	RFX3_HUMAN	regulatory factor X, 3 (influences HLA class II expression)	498					cell maturation (GO:0048469)|cilium assembly (GO:0042384)|cilium-dependent cell motility (GO:0060285)|endocrine pancreas development (GO:0031018)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type B pancreatic cell development (GO:2000078)|regulation of insulin secretion (GO:0050796)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|type B pancreatic cell maturation (GO:0072560)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(11)|large_intestine(3)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	40				GBM - Glioblastoma multiforme(50;0.00124)|Lung(2;0.0337)		CGACGTGTATCTTCGCAGAGT	0.483																																																0			9											163.0	139.0	147.0					9																	3263047		2203	4300	6503	3253047	SO:0001583	missense	5991			AI811824	CCDS6449.1, CCDS6450.1, CCDS75809.1	9p24.2	2008-02-05			ENSG00000080298	ENSG00000080298			9984	protein-coding gene	gene with protein product		601337				8289803	Standard	XM_005251534		Approved		uc003zhr.3	P48380	OTTHUMG00000019456	ENST00000382004.3:c.1493G>C	9.37:g.3263047C>G	ENSP00000371434:p.Arg498Thr		3253047	A8K0H5|D3DRH8|D3DRH9|Q5JTL7|Q5JTL8|Q6NW13|Q8WTU4|Q95HL5|Q95HL6	Missense_Mutation	SNP	"HMMPfam_RFX1_trans_act,HMMPfam_RFX_DNA_binding,superfamily_""Winged helix"" DNA-binding domain"	p.R498T	ENST00000382004.3	37	c.1493	CCDS6449.1	9	.	.	.	.	.	.	.	.	.	.	C	34	5.336971	0.95758	.	.	ENSG00000080298	ENST00000382004;ENST00000358730;ENST00000302303;ENST00000458034	T;T;T;T	0.46451	0.87;0.87;0.87;0.87	6.16	6.16	0.99307	.	0.000000	0.85682	D	0.000000	T	0.75317	0.3833	M	0.92738	3.34	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.992	T	0.79482	-0.1785	10	0.87932	D	0	-16.1179	20.8598	0.99761	0.0:1.0:0.0:0.0	.	498;498	P48380-2;P48380	.;RFX3_HUMAN	T	498;498;498;71	ENSP00000371434:R498T;ENSP00000351574:R498T;ENSP00000303847:R498T;ENSP00000400026:R71T	ENSP00000303847:R498T	R	-	2	0	RFX3	3253047	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.937000	0.99478	0.650000	0.86243	AGA	-	NULL		0.483	RFX3-006	KNOWN	basic|appris_principal|CCDS	protein_coding	RFX3	protein_coding	OTTHUMT00000051545.1	C	NM_002919		3253047	-1	no_errors	NM_134428	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
KCNA5	3741	genome.wustl.edu	37	12	5154463	5154463	+	Missense_Mutation	SNP	G	G	A	rs76708779	byFrequency	TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr12:5154463G>A	ENST00000252321.3	+	1	1379	c.1150G>A	c.(1150-1152)Gga>Aga	p.G384R		NM_002234.3	NP_002225.2	P22460	KCNA5_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 5	384	Poly-Gly.				atrial cardiac muscle cell action potential (GO:0086014)|membrane hyperpolarization (GO:0060081)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of potassium ion transport (GO:0043267)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of myoblast proliferation (GO:2000288)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of membrane potential (GO:0042391)|regulation of potassium ion transport (GO:0043266)|regulation of vasoconstriction (GO:0019229)|response to hypoxia (GO:0001666)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|intracellular canaliculus (GO:0046691)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)|potassium channel inhibitor activity (GO:0019870)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|voltage-gated potassium channel activity involved in atrial cardiac muscle cell action potential repolarization (GO:0086089)			NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(1)|lung(21)|ovary(5)|prostate(2)|upper_aerodigestive_tract(2)	52					Dalfampridine(DB06637)	GCCAGGGGGTGGAGGAGGCGG	0.622													G|||	19	0.00379393	0.0129	0.0029	5008	,	,		17524	0.0		0.0	False		,,,				2504	0.0															0			12						G	ARG/GLY	65,4341	49.6+/-84.7	2,61,2140	56.0	52.0	53.0		1150	4.6	0.1	12	dbSNP_131	53	4,8596	2.2+/-6.3	0,4,4296	no	missense	KCNA5	NM_002234.2	125	2,65,6436	AA,AG,GG		0.0465,1.4753,0.5305	possibly-damaging	384/614	5154463	69,12937	2203	4300	6503	5024724	SO:0001583	missense	3741			M83254	CCDS8536.1	12p13	2012-07-05				ENSG00000130037		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6224	protein-coding gene	gene with protein product		176267				16382104	Standard	NM_002234		Approved	Kv1.5, HK2, HPCN1	uc001qni.4	P22460		ENST00000252321.3:c.1150G>A	12.37:g.5154463G>A	ENSP00000252321:p.Gly384Arg		5024724	Q4KKT8|Q4VAJ1|Q4VAJ2|Q9UDA4	Missense_Mutation	SNP	superfamily_POZ domain,HMMSmart_SM00225,HMMPfam_K_tetra,superfamily_Voltage-gated potassium channels,HMMPfam_Ion_trans	p.G384R	ENST00000252321.3	37	c.1150	CCDS8536.1	12	6	0.0027472527472527475	5	0.01016260162601626	1	0.0027624309392265192	0	0.0	0	0.0	G	9.502	1.103540	0.20632	0.014753	4.65E-4	ENSG00000130037	ENST00000252321	D	0.97710	-4.5	4.62	4.62	0.57501	Ion transport (1);	2.171590	0.03002	U	0.148348	D	0.94794	0.8319	N	0.05050	-0.12	0.09310	N	0.999996	D	0.54964	0.969	P	0.59288	0.855	D	0.90671	0.4598	10	0.45353	T	0.12	.	8.6668	0.34125	0.1726:0.0:0.8274:0.0	.	384	P22460	KCNA5_HUMAN	R	384	ENSP00000252321:G384R	ENSP00000252321:G384R	G	+	1	0	KCNA5	5024724	0.030000	0.19436	0.120000	0.21714	0.199000	0.23934	1.527000	0.35975	2.390000	0.81377	0.561000	0.74099	GGA	-	superfamily_Voltage-gated potassium channels,HMMPfam_Ion_trans		0.622	KCNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNA5	protein_coding	OTTHUMT00000398925.2	G	NM_002234		5024724	+1	no_errors	NM_002234	genbank	human	reviewed	54_36p	missense	SNP	0.016	A
ALG1	56052	genome.wustl.edu	37	16	5125431	5125431	+	Missense_Mutation	SNP	G	G	A			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr16:5125431G>A	ENST00000262374.5	+	4	464	c.433G>A	c.(433-435)Ggc>Agc	p.G145S	ALG1_ENST00000588623.1_Missense_Mutation_p.G34S|ALG1_ENST00000544428.1_Missense_Mutation_p.G34S	NM_019109.4	NP_061982.3	Q9BT22	ALG1_HUMAN	ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase	145					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|lipopolysaccharide biosynthetic process (GO:0009103)|mannosylation (GO:0097502)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	chitobiosyldiphosphodolichol beta-mannosyltransferase activity (GO:0004578)|mannosyltransferase activity (GO:0000030)			breast(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13		Ovarian(90;0.0164)				CTGGTTCGTGGGCTGCCTTTG	0.552																																																0			16											197.0	168.0	177.0					16																	5125431		2197	4300	6497	5065432	SO:0001583	missense	56052			AB019038	CCDS10528.1	16p13.3	2013-02-22	2013-02-22		ENSG00000033011	ENSG00000033011	2.4.1.142	"""Glycosyltransferase group 1 domain containing"""	18294	protein-coding gene	gene with protein product		605907	"""asparagine-linked glycosylation 1 homolog (yeast, beta-1,4-mannosyltransferase)"", ""asparagine-linked glycosylation 1, beta-1,4-mannosyltransferase homolog (S. cerevisiae)"""			10704531	Standard	NM_019109		Approved	HMT-1, HMAT1	uc002cym.3	Q9BT22	OTTHUMG00000129529	ENST00000262374.5:c.433G>A	16.37:g.5125431G>A	ENSP00000262374:p.Gly145Ser		5065432	B4DP08|Q6UVZ9|Q8N5Y4|Q9P2Y2	Missense_Mutation	SNP	superfamily_SSF53756,HMMPfam_Glycos_transf_1	p.G145S	ENST00000262374.5	37	c.433	CCDS10528.1	16	.	.	.	.	.	.	.	.	.	.	G	12.59	1.984193	0.35036	.	.	ENSG00000033011	ENST00000262374;ENST00000544428	T;T	0.80824	-1.42;-1.42	5.74	-0.493	0.12038	.	0.344487	0.38326	N	0.001723	T	0.49406	0.1555	N	0.02539	-0.55	0.22389	N	0.999147	B;B	0.14012	0.009;0.007	B;B	0.15052	0.012;0.008	T	0.44967	-0.9293	10	0.07030	T	0.85	-3.1769	9.2768	0.37705	0.0813:0.0:0.2401:0.6786	.	34;145	B4DP08;Q9BT22	.;ALG1_HUMAN	S	145;34	ENSP00000262374:G145S;ENSP00000440019:G34S	ENSP00000262374:G145S	G	+	1	0	ALG1	5065432	1.000000	0.71417	0.148000	0.22405	0.923000	0.55619	0.863000	0.27913	0.020000	0.15106	0.650000	0.86243	GGC	-	superfamily_SSF53756		0.552	ALG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALG1	protein_coding	OTTHUMT00000251716.2	G	NM_019109		5065432	+1	no_errors	NM_019109	genbank	human	reviewed	54_36p	missense	SNP	0.964	A
USP42	84132	genome.wustl.edu	37	7	6182631	6182631	+	Silent	SNP	G	G	C	rs376220078		TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr7:6182631G>C	ENST00000306177.5	+	8	1022	c.864G>C	c.(862-864)tcG>tcC	p.S288S		NM_032172.2	NP_115548.1	Q9H9J4	UBP42_HUMAN	ubiquitin specific peptidase 42	288	USP.				cell differentiation (GO:0030154)|protein deubiquitination (GO:0016579)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(2)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	35		Ovarian(82;0.0423)		UCEC - Uterine corpus endometrioid carcinoma (126;0.108)|OV - Ovarian serous cystadenocarcinoma(56;5.77e-14)		GAGAAAACTCGTACAAGTGCA	0.522																																																0			7											194.0	198.0	197.0					7																	6182631		2112	4231	6343	6149157	SO:0001819	synonymous_variant	84132			AK022759	CCDS47535.1	7p22.2	2005-08-08	2005-08-08		ENSG00000106346	ENSG00000106346		"""Ubiquitin-specific peptidases"""	20068	protein-coding gene	gene with protein product			"""ubiquitin specific protease 42"""			12838346	Standard	NM_032172		Approved	FLJ12697	uc011jwp.2	Q9H9J4	OTTHUMG00000151888	ENST00000306177.5:c.864G>C	7.37:g.6182631G>C			6149157	A2RUE3|B5MDA5|Q0VIN8|Q3C166|Q6P9B4	Silent	SNP	superfamily_Cysteine proteinases,HMMPfam_UCH,PatternScan_UCH_2_1,PatternScan_UCH_2_2,PatternScan_IG_MHC	p.S288	ENST00000306177.5	37	c.864	CCDS47535.1	7																																																																																			-	superfamily_Cysteine proteinases,HMMPfam_UCH		0.522	USP42-005	KNOWN	basic|appris_principal|CCDS	protein_coding	USP42	protein_coding	OTTHUMT00000324262.3	G	XM_166526		6149157	+1	no_errors	ENST00000404835	ensembl	human	known	54_36p	silent	SNP	1.000	C
CHD4	1108	genome.wustl.edu	37	12	6710173	6710173	+	Silent	SNP	A	A	G			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr12:6710173A>G	ENST00000357008.2	-	7	1009	c.846T>C	c.(844-846)gaT>gaC	p.D282D	CHD4_ENST00000309577.6_Silent_p.D282D|CHD4_ENST00000544040.1_Silent_p.D275D|CHD4_ENST00000544484.1_Silent_p.D279D	NM_001273.2	NP_001264.2	Q14839	CHD4_HUMAN	chromodomain helicase DNA binding protein 4	282					ATP-dependent chromatin remodeling (GO:0043044)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spindle assembly (GO:0051225)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|RNA polymerase II repressing transcription factor binding (GO:0001103)|zinc ion binding (GO:0008270)			central_nervous_system(2)	2						GCTTCTTGGCATCAGGTACAC	0.493																																					Colon(32;586 792 4568 16848 45314)											0			12											196.0	195.0	195.0					12																	6710173		2203	4300	6503	6580434	SO:0001819	synonymous_variant	1108			X86691	CCDS8552.1	12p13	2013-01-28				ENSG00000111642		"""Zinc fingers, PHD-type"""	1919	protein-coding gene	gene with protein product		603277				7575689, 8843877	Standard	XM_006718958		Approved	Mi-2b, Mi2-BETA	uc001qpo.3	Q14839		ENST00000357008.2:c.846T>C	12.37:g.6710173A>G			6580434	Q8IXZ5	Silent	SNP	HMMPfam_CHDNT,superfamily_FYVE/PHD zinc finger,HMMSmart_SM00249,HMMPfam_PHD,PatternScan_ZF_PHD_1,HMMSmart_SM00298,superfamily_Chromo domain-like,PatternScan_CHROMO_1,HMMPfam_Chromo,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00487,HMMPfam_SNF2_N,PatternScan_DEAH_ATP_HELICASE,HMMSmart_SM00490,HMMPfam_Helicase_C,HMMPfam_DUF1087,HMMPfam_DUF1086,HMMPfam_CHDCT2	p.D282	ENST00000357008.2	37	c.846	CCDS8552.1	12																																																																																			-	NULL		0.493	CHD4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD4	protein_coding		A	NM_001273		6580434	-1	no_errors	NM_001273	genbank	human	reviewed	54_36p	silent	SNP	0.985	G
FOXJ2	55810	genome.wustl.edu	37	12	8205406	8205406	+	Missense_Mutation	SNP	A	A	T			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr12:8205406A>T	ENST00000162391.3	+	11	2830	c.1685A>T	c.(1684-1686)gAg>gTg	p.E562V	FOXJ2_ENST00000539192.1_3'UTR	NM_018416.2	NP_060886.1	Q9P0K8	FOXJ2_HUMAN	forkhead box J2	562					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)	nucleolus (GO:0005730)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)			autonomic_ganglia(1)|large_intestine(2)|lung(6)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	16				Kidney(36;0.0944)		GGTGCCAATGAGGAGATCCCT	0.527																																																0			12											82.0	60.0	67.0					12																	8205406		2203	4300	6503	8096673	SO:0001583	missense	55810			AF155132	CCDS8587.1	12p13.31	2006-12-15				ENSG00000065970		"""Forkhead boxes"""	24818	protein-coding gene	gene with protein product						10777590, 10966786	Standard	NM_018416		Approved	FHX	uc001qtu.3	Q9P0K8		ENST00000162391.3:c.1685A>T	12.37:g.8205406A>T	ENSP00000162391:p.Glu562Val		8096673	A0AVK4|B2RMP3|Q96PS9|Q9NSN5	Missense_Mutation	SNP	"HMMSmart_SM00339,superfamily_""Winged helix"" DNA-binding domain,HMMPfam_Fork_head,PatternScan_FORK_HEAD_2"	p.E562V	ENST00000162391.3	37	c.1685	CCDS8587.1	12	.	.	.	.	.	.	.	.	.	.	A	23.4	4.410604	0.83340	.	.	ENSG00000065970	ENST00000162391	D	0.95724	-3.79	5.85	5.85	0.93711	.	0.550760	0.16255	N	0.222502	D	0.95664	0.8590	L	0.44542	1.39	0.80722	D	1	D	0.65815	0.995	P	0.56278	0.795	D	0.95495	0.8572	10	0.87932	D	0	.	14.1838	0.65592	1.0:0.0:0.0:0.0	.	562	Q9P0K8	FOXJ2_HUMAN	V	562	ENSP00000162391:E562V	ENSP00000162391:E562V	E	+	2	0	FOXJ2	8096673	1.000000	0.71417	0.997000	0.53966	0.889000	0.51656	6.561000	0.73955	2.237000	0.73441	0.528000	0.53228	GAG	-	NULL		0.527	FOXJ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXJ2	protein_coding	OTTHUMT00000400088.1	A	NM_018416		8096673	+1	no_errors	NM_018416	genbank	human	validated	54_36p	missense	SNP	1.000	T
RP11-689P11.2	0	genome.wustl.edu	37	4	8512170	8512170	+	lincRNA	SNP	C	C	T	rs78333439	byFrequency	TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr4:8512170C>T	ENST00000382488.2	+	0	1864																											ggtggcctccctccaaggtca	0.612													C|||	54	0.0107827	0.0038	0.0101	5008	,	,		17691	0.0		0.0358	False		,,,				2504	0.0061															0			4																																								8563070			0																															4.37:g.8512170C>T			8563070		Silent	SNP	NULL	p.P231	ENST00000382488.2	37	c.693		4																																																																																			-	NULL		0.612	RP11-689P11.2-001	KNOWN	basic	lincRNA	ENSG00000205959	lincRNA	OTTHUMT00000359211.3	C			8563070	+1	no_errors	ENST00000382488	ensembl	human	known	54_36p	silent	SNP	0.000	T
CPZ	8532	genome.wustl.edu	37	4	8605748	8605748	+	Missense_Mutation	SNP	C	C	T			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr4:8605748C>T	ENST00000360986.4	+	4	716	c.542C>T	c.(541-543)aCc>aTc	p.T181I	CPZ_ENST00000382480.2_Missense_Mutation_p.T44I|CPZ_ENST00000315782.6_Missense_Mutation_p.T170I|CPZ_ENST00000429646.2_5'UTR	NM_001014447.2	NP_001014447	Q66K79	CBPZ_HUMAN	carboxypeptidase Z	181					proteolysis (GO:0006508)|Wnt signaling pathway (GO:0016055)	extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(23)|ovary(3)|pancreas(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						CTGCCGCCCACCTTCATCCGC	0.697																																																0			4											30.0	24.0	26.0					4																	8605748		2178	4263	6441	8656648	SO:0001583	missense	8532			U83411	CCDS3404.1, CCDS33953.1, CCDS43212.1	4p16.1	2012-02-10			ENSG00000109625	ENSG00000109625			2333	protein-coding gene	gene with protein product	"""metallocarboxypeptidase Z"""	603105				9099699	Standard	NM_001014447		Approved		uc003glm.3	Q66K79	OTTHUMG00000090513	ENST00000360986.4:c.542C>T	4.37:g.8605748C>T	ENSP00000354255:p.Thr181Ile		8656648	O00520|Q96MX2	Missense_Mutation	SNP	HMMPfam_Fz,superfamily_Frizzled cysteine-rich domain,HMMSmart_SM00063,superfamily_Zn-dependent exopeptidases,HMMPfam_Peptidase_M14,HMMSmart_SM00631,PatternScan_CARBOXYPEPT_ZN_2,superfamily_Carboxypeptidase regulatory domain	p.T181I	ENST00000360986.4	37	c.542	CCDS33953.1	4	.	.	.	.	.	.	.	.	.	.	C	9.209	1.030366	0.19512	.	.	ENSG00000109625	ENST00000360986;ENST00000382480;ENST00000315782	T;T;T	0.03301	3.98;3.98;3.98	3.65	2.75	0.32379	.	0.629307	0.13372	N	0.392802	T	0.08268	0.0206	M	0.61703	1.905	0.39134	D	0.961917	P;P	0.47841	0.878;0.901	P;B	0.46825	0.528;0.312	T	0.22836	-1.0205	10	0.54805	T	0.06	-20.7775	11.8831	0.52586	0.1763:0.8237:0.0:0.0	.	170;181	Q66K79-2;Q66K79	.;CBPZ_HUMAN	I	181;44;170	ENSP00000354255:T181I;ENSP00000371920:T44I;ENSP00000315074:T170I	ENSP00000315074:T170I	T	+	2	0	CPZ	8656648	0.139000	0.22563	0.432000	0.26747	0.152000	0.21847	1.570000	0.36439	0.665000	0.31066	0.555000	0.69702	ACC	-	superfamily_Zn-dependent exopeptidases		0.697	CPZ-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CPZ	protein_coding	OTTHUMT00000207001.4	C	NM_003652		8656648	+1	no_errors	NM_001014447	genbank	human	reviewed	54_36p	missense	SNP	0.066	T
TARDBP	23435	genome.wustl.edu	37	1	11082199	11082199	+	Nonsense_Mutation	SNP	G	G	T			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr1:11082199G>T	ENST00000240185.3	+	6	847	c.733G>T	c.(733-735)Gga>Tga	p.G245*	TARDBP_ENST00000439080.2_Nonsense_Mutation_p.G129*|TARDBP_ENST00000315091.3_Nonsense_Mutation_p.G245*	NM_007375.3	NP_031401.1	Q13148	TADBP_HUMAN	TAR DNA binding protein	245	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				3'-UTR-mediated mRNA stabilization (GO:0070935)|cell death (GO:0008219)|mRNA processing (GO:0006397)|negative regulation by host of viral transcription (GO:0043922)|RNA splicing (GO:0008380)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(3)|ovary(2)	11	Ovarian(185;0.249)	Lung NSC(185;1.04e-05)|all_lung(284;1.31e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00262)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.0578)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.37e-07)|COAD - Colon adenocarcinoma(227;7.38e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000299)|Kidney(185;0.000754)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|READ - Rectum adenocarcinoma(331;0.0487)		GTCTCTTTGTGGAGAGGACTT	0.348																																																0			1											86.0	84.0	84.0					1																	11082199		2203	4300	6503	11004786	SO:0001587	stop_gained	23435			U23731	CCDS122.1	1p36.22	2014-09-17			ENSG00000120948	ENSG00000120948		"""RNA binding motif (RRM) containing"""	11571	protein-coding gene	gene with protein product		605078				7745706	Standard	NM_007375		Approved	TDP-43, ALS10	uc001art.3	Q13148	OTTHUMG00000002120	ENST00000240185.3:c.733G>T	1.37:g.11082199G>T	ENSP00000240185:p.Gly245*		11004786	A4GUK4|A4GUK5|A4GUK6|B2R629|B4DJ45|E2PU12|Q53H27|Q6FI92|Q96DJ0	Nonsense_Mutation	SNP	superfamily_RNA-binding domain RBD,HMMSmart_SM00360,HMMPfam_RRM_1	p.G245*	ENST00000240185.3	37	c.733	CCDS122.1	1	.	.	.	.	.	.	.	.	.	.	G	40	8.295597	0.98747	.	.	ENSG00000120948	ENST00000240185;ENST00000439080;ENST00000315091	.	.	.	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	-15.9611	20.0825	0.97783	0.0:0.0:1.0:0.0	.	.	.	.	X	245;129;245	.	ENSP00000240185:G245X	G	+	1	0	TARDBP	11004786	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.631000	0.98424	2.746000	0.94184	0.655000	0.94253	GGA	-	superfamily_RNA-binding domain RBD,HMMSmart_SM00360		0.348	TARDBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TARDBP	protein_coding	OTTHUMT00000006063.1	G	NM_007375		11004786	+1	no_errors	NM_007375	genbank	human	reviewed	54_36p	nonsense	SNP	1.000	T
ZNF44	51710	genome.wustl.edu	37	19	12384464	12384464	+	Missense_Mutation	SNP	A	A	C			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr19:12384464A>C	ENST00000356109.5	-	5	868	c.750T>G	c.(748-750)tgT>tgG	p.C250W	ZNF44_ENST00000355684.5_Missense_Mutation_p.C202W	NM_001164276.1	NP_001157748.1	P15621	ZNF44_HUMAN	zinc finger protein 44	250					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			ovary(1)	1		Renal(1328;0.157)		GBM - Glioblastoma multiforme(1328;0.0164)|Lung(535;0.179)		AGGCTTTCCCACACAATTCAC	0.398																																																0			19											89.0	94.0	92.0					19																	12384464		2203	4300	6503	12245464	SO:0001583	missense	51710			X52338	CCDS45988.1, CCDS54223.1	19p13.2	2013-01-08	2006-05-11		ENSG00000197857	ENSG00000197857		"""Zinc fingers, C2H2-type"", ""-"""	13110	protein-coding gene	gene with protein product		194542	"""zinc finger protein 58"", ""zinc finger protein 44 (KOX 7)"", ""zinc finger protein 55"""	ZNF58, ZNF55		1946370, 1505991	Standard	NM_016264		Approved	KOX7, ZNF504	uc010xmj.2	P15621	OTTHUMG00000156424	ENST00000356109.5:c.750T>G	19.37:g.12384464A>C	ENSP00000348419:p.Cys250Trp		12245464	B4DML9|B9EGJ5|B9ZVM2|P17018|Q9ULZ7	Missense_Mutation	SNP	superfamily_KRAB domain (Kruppel-associated box Pfam 01352),HMMPfam_KRAB,HMMSmart_SM00349,superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1	p.C202W	ENST00000356109.5	37	c.606	CCDS54223.1	19	.	.	.	.	.	.	.	.	.	.	A	17.05	3.288711	0.59976	.	.	ENSG00000197857	ENST00000393337;ENST00000356109;ENST00000457673;ENST00000355684	T;T;T	0.39997	1.05;1.05;1.05	1.01	-0.0591	0.13794	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.75287	0.3829	H	0.99842	4.835	.	.	.	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.71603	-0.4543	8	0.87932	D	0	.	4.0005	0.09577	0.7662:0.0:0.2338:0.0	.	250;202	P15621;F8W7T7	ZNF44_HUMAN;.	W	250;250;202;202	ENSP00000377008:C250W;ENSP00000348419:C250W;ENSP00000347910:C202W	ENSP00000347910:C202W	C	-	3	2	ZNF44	12245464	0.800000	0.28916	0.003000	0.11579	0.898000	0.52572	1.330000	0.33781	-0.061000	0.13110	0.260000	0.18958	TGT	-	superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1		0.398	ZNF44-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	ZNF44	protein_coding	OTTHUMT00000344132.1	A	NM_016264		12245464	-1	no_errors	NM_016264	genbank	human	provisional	54_36p	missense	SNP	1.000	C
NBAS	51594	genome.wustl.edu	37	2	15416994	15416994	+	Silent	SNP	C	C	T			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr2:15416994C>T	ENST00000281513.5	-	43	5395	c.5370G>A	c.(5368-5370)aaG>aaA	p.K1790K	NBAS_ENST00000441750.1_Silent_p.K1670K	NM_015909.3	NP_056993.2	A2RRP1	NBAS_HUMAN	neuroblastoma amplified sequence	1790					negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process (GO:0000956)	cytoplasm (GO:0005737)|membrane (GO:0016020)				NS(4)|breast(4)|central_nervous_system(3)|endometrium(6)|kidney(5)|large_intestine(12)|liver(1)|lung(54)|ovary(2)|pancreas(3)|prostate(9)|skin(6)|stomach(3)	112						CAACCTTAAACTTCTTCAGCA	0.398																																																0			2											91.0	84.0	86.0					2																	15416994		2203	4300	6503	15334445	SO:0001819	synonymous_variant	51594			BC051792	CCDS1685.1	2p24.3	2009-02-23			ENSG00000151779	ENSG00000151779			15625	protein-coding gene	gene with protein product		608025				9926938, 12706883	Standard	NM_015909		Approved	NAG	uc002rcc.2	A2RRP1	OTTHUMG00000121153	ENST00000281513.5:c.5370G>A	2.37:g.15416994C>T			15334445	O95790|Q2VPJ7|Q53TK6|Q86V39|Q8NFY8|Q9Y3W5	Silent	SNP	superfamily_WD40 repeat-like,HMMPfam_Sec39,PatternScan_RIBOSOMAL_S14	p.K1790	ENST00000281513.5	37	c.5370	CCDS1685.1	2	.	.	.	.	.	.	.	.	.	.	C	8.090	0.774214	0.16051	.	.	ENSG00000151779	ENST00000442506	.	.	.	5.61	-5.75	0.02384	.	.	.	.	.	T	0.66446	0.2790	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.68911	-0.5284	4	.	.	.	.	18.036	0.89302	0.0:0.6314:0.0:0.3686	.	.	.	.	N	838	.	.	S	-	2	0	NBAS	15334445	0.981000	0.34729	0.834000	0.33040	0.926000	0.56050	0.123000	0.15708	-0.930000	0.03752	-0.290000	0.09829	AGT	-	NULL		0.398	NBAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NBAS	protein_coding	OTTHUMT00000241638.1	C	NM_015909		15334445	-1	no_errors	NM_015909	genbank	human	validated	54_36p	silent	SNP	0.991	T
CELA2A	63036	genome.wustl.edu	37	1	15783628	15783628	+	Missense_Mutation	SNP	G	G	T	rs371703213		TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr1:15783628G>T	ENST00000359621.4	+	2	113	c.88G>T	c.(88-90)Gtt>Ttt	p.V30F	CELA2A_ENST00000497590.1_3'UTR	NM_033440.2	NP_254275.1	P08217	CEL2A_HUMAN	chymotrypsin-like elastase family, member 2A	30	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)|keratohyalin granule (GO:0036457)	serine hydrolase activity (GO:0017171)|serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(7)|ovary(2)|prostate(1)	16						GACTAGGGTGGTTGGCGGTGA	0.567																																																0			1											106.0	98.0	101.0					1																	15783628		2203	4300	6503	15656215	SO:0001583	missense	63036				CCDS157.1	1p36.21	2009-07-09			ENSG00000142615	ENSG00000142615	3.4.21.71		24609	protein-coding gene	gene with protein product	"""elastase 2A"""	609443				3646943, 2834346	Standard	NM_033440		Approved	ELA2A	uc001awk.3	P08217	OTTHUMG00000002258	ENST00000359621.4:c.88G>T	1.37:g.15783628G>T	ENSP00000352639:p.Val30Phe		15656215	B2R5I4|Q14243	Missense_Mutation	SNP	superfamily_Trypsin-like serine proteases,HMMSmart_SM00020,HMMPfam_Trypsin,PatternScan_TRYPSIN_HIS,PatternScan_TRYPSIN_SER	p.V30F	ENST00000359621.4	37	c.88	CCDS157.1	1	.	.	.	.	.	.	.	.	.	.	G	23.0	4.361176	0.82353	.	.	ENSG00000142615	ENST00000375924;ENST00000359621	D	0.94497	-3.44	4.28	4.28	0.50868	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.44483	U	0.000443	D	0.96947	0.9003	M	0.82056	2.57	0.54753	D	0.999988	D	0.71674	0.998	D	0.77004	0.989	D	0.97415	1.0005	10	0.87932	D	0	.	14.6524	0.68808	0.0:0.0:1.0:0.0	.	30	P08217	CEL2A_HUMAN	F	30	ENSP00000352639:V30F	ENSP00000352639:V30F	V	+	1	0	CELA2A	15656215	1.000000	0.71417	1.000000	0.80357	0.842000	0.47809	3.525000	0.53502	2.383000	0.81215	0.650000	0.86243	GTT	-	superfamily_Trypsin-like serine proteases,HMMSmart_SM00020,HMMPfam_Trypsin		0.567	CELA2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELA2A	protein_coding	OTTHUMT00000006445.1	G	NM_033440		15656215	+1	no_errors	NM_033440	genbank	human	reviewed	54_36p	missense	SNP	0.999	T
RDH14	57665	genome.wustl.edu	37	2	18737012	18737012	+	Missense_Mutation	SNP	C	C	G			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr2:18737012C>G	ENST00000381249.3	-	2	563	c.456G>C	c.(454-456)aaG>aaC	p.K152N	NT5C1B-RDH14_ENST00000532967.1_3'UTR|RDH14_ENST00000468071.1_5'UTR	NM_020905.3	NP_065956.1	Q9HBH5	RDH14_HUMAN	retinol dehydrogenase 14 (all-trans/9-cis/11-cis)	152					osteoblast differentiation (GO:0001649)	endoplasmic reticulum (GO:0005783)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	oxidoreductase activity (GO:0016491)			breast(2)|endometrium(1)|large_intestine(2)|lung(1)	6	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.177)				Vitamin A(DB00162)	CATCTTCAGTCTTCATGTAAG	0.448																																																0			2											120.0	129.0	126.0					2																	18737012		2202	4299	6501	18600493	SO:0001583	missense	57665			AF237952	CCDS1693.1	2p24.2	2011-09-14	2006-05-09		ENSG00000240857	ENSG00000240857	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	19979	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 7C, member 4"""		"""retinol dehydrogenase 14 (all-trans and 9-cis)"""			12226107, 19027726	Standard	NM_020905		Approved	PAN2, SDR7C4		Q9HBH5	OTTHUMG00000090705	ENST00000381249.3:c.456G>C	2.37:g.18737012C>G	ENSP00000370648:p.Lys152Asn		18600493		Missense_Mutation	SNP	superfamily_NAD(P)-binding Rossmann-fold domains,HMMPfam_adh_short	p.K152N	ENST00000381249.3	37	c.456	CCDS1693.1	2	.	.	.	.	.	.	.	.	.	.	C	19.30	3.801338	0.70567	.	.	ENSG00000240857;ENSG00000250741	ENST00000381249;ENST00000444297	D;T	0.87571	-2.27;1.97	5.45	3.66	0.41972	NAD(P)-binding domain (1);	.	.	.	.	D	0.89801	0.6820	L	0.46741	1.465	0.80722	D	1	D;D	0.67145	0.993;0.996	D;D	0.66847	0.934;0.947	D	0.89092	0.3483	9	0.59425	D	0.04	.	12.2208	0.54433	0.0:0.8613:0.0:0.1387	.	466;152	C9J2C7;Q9HBH5	.;RDH14_HUMAN	N	152;466	ENSP00000370648:K152N;ENSP00000412639:K466N	ENSP00000412639:K466N	K	-	3	2	NT5C1B-RDH14;RDH14	18600493	1.000000	0.71417	0.994000	0.49952	0.990000	0.78478	2.125000	0.42016	0.684000	0.31448	0.655000	0.94253	AAG	-	superfamily_NAD(P)-binding Rossmann-fold domains,HMMPfam_adh_short		0.448	RDH14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RDH14	protein_coding	OTTHUMT00000207394.1	C			18600493	-1	no_errors	NM_020905	genbank	human	validated	54_36p	missense	SNP	1.000	G
MRTO4	51154	genome.wustl.edu	37	1	19584008	19584008	+	Missense_Mutation	SNP	G	G	A			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr1:19584008G>A	ENST00000330263.4	+	5	631	c.334G>A	c.(334-336)Gtg>Atg	p.V112M		NM_016183.3	NP_057267.2	Q9UKD2	MRT4_HUMAN	mRNA turnover 4 homolog (S. cerevisiae)	112					ribosome biogenesis (GO:0042254)	nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|large_intestine(1)|liver(2)|ovary(1)|pancreas(1)|stomach(1)	8		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Breast(348;0.00049)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|BRCA - Breast invasive adenocarcinoma(304;1.87e-05)|Kidney(64;0.000171)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|GBM - Glioblastoma multiforme(114;0.00301)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		AAAGGAGGAGGTGAATGAGTA	0.522																																					GBM(192;2418 3032 7540 48714)											0			1											142.0	137.0	139.0					1																	19584008		2203	4300	6503	19456595	SO:0001583	missense	51154			AK027569	CCDS191.1	1p36.13	2008-02-05	2006-12-21	2007-01-05	ENSG00000053372	ENSG00000053372			18477	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 33"", ""MRT4, mRNA turnover 4, homolog (S. cerevisiae)"""	C1orf33			Standard	NM_016183		Approved	dJ657E11.4, MRT4	uc001bbs.3	Q9UKD2	OTTHUMG00000002496	ENST00000330263.4:c.334G>A	1.37:g.19584008G>A	ENSP00000364320:p.Val112Met		19456595	B3KNB3|Q5TG55|Q96SS6|Q9BPV9	Missense_Mutation	SNP	HMMPfam_Ribosomal_L10	p.V112M	ENST00000330263.4	37	c.334	CCDS191.1	1	.	.	.	.	.	.	.	.	.	.	G	27.1	4.804402	0.90623	.	.	ENSG00000053372	ENST00000330263	T	0.49720	0.77	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	T	0.77205	0.4096	M	0.92169	3.28	0.80722	D	1	D	0.76494	0.999	D	0.76071	0.987	T	0.82240	-0.0555	10	0.87932	D	0	-28.3833	18.6692	0.91504	0.0:0.0:1.0:0.0	.	112	Q9UKD2	MRT4_HUMAN	M	112	ENSP00000364320:V112M	ENSP00000364320:V112M	V	+	1	0	MRTO4	19456595	1.000000	0.71417	1.000000	0.80357	0.834000	0.47266	8.524000	0.90579	2.757000	0.94681	0.655000	0.94253	GTG	-	HMMPfam_Ribosomal_L10		0.522	MRTO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRTO4	protein_coding	OTTHUMT00000007075.2	G	NM_016183		19456595	+1	no_errors	NM_016183	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
CCAR2	57805	genome.wustl.edu	37	8	22463648	22463648	+	Missense_Mutation	SNP	C	C	T			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr8:22463648C>T	ENST00000308511.4	+	3	358	c.109C>T	c.(109-111)Cct>Tct	p.P37S	CCAR2_ENST00000389279.3_Missense_Mutation_p.P37S|CCAR2_ENST00000520861.1_5'Flank|CCAR2_ENST00000521301.1_Missense_Mutation_p.P37S			Q8N163	CCAR2_HUMAN	cell cycle and apoptosis regulator 2	37					cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|mRNA processing (GO:0006397)|negative regulation of catalytic activity (GO:0043086)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage checkpoint (GO:2000003)|regulation of circadian rhythm (GO:0042752)|regulation of DNA-templated transcription, elongation (GO:0032784)|regulation of protein stability (GO:0031647)|response to UV (GO:0009411)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|DBIRD complex (GO:0044609)|mitochondrial matrix (GO:0005759)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|poly(A) RNA binding (GO:0044822)|RNA polymerase II core binding (GO:0000993)										GCTCACTCCTCCTGTGGCCAC	0.552																																																0			8											238.0	242.0	241.0					8																	22463648		2203	4300	6503	22519593	SO:0001583	missense	57805			AL834351	CCDS34863.1	8p22	2013-08-22	2013-08-22	2013-08-22		ENSG00000158941			23360	protein-coding gene	gene with protein product	"""deleted in breast cancer"""	607359	"""KIAA1967"""	KIAA1967		12370419	Standard	NM_021174		Approved	DBC-1, DBC1, NET35	uc003xci.3	Q8N163		ENST00000308511.4:c.109C>T	8.37:g.22463648C>T	ENSP00000310670:p.Pro37Ser		22519593	A6NL03|B2RB79|D3DSR6|Q6P0Q9|Q8N3G7|Q8N8M1|Q8TF34|Q9H9Q9|Q9HD12|Q9NT55	Missense_Mutation	SNP	NULL	p.P37S	ENST00000308511.4	37	c.109	CCDS34863.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	24.3|24.3	4.515884|4.515884	0.85495|0.85495	.|.	.|.	ENSG00000158941|ENSG00000158941	ENST00000308511;ENST00000521301;ENST00000389279;ENST00000521837;ENST00000523349|ENST00000523801	T;T|.	0.31510|.	1.49;1.49|.	5.38|5.38	5.38|5.38	0.77491|0.77491	.|.	0.000000|.	0.56097|.	D|.	0.000024|.	T|T	0.40791|0.40791	0.1131|0.1131	N|N	0.08118|0.08118	0|0	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.80764|.	0.994|.	T|T	0.25293|0.25293	-1.0136|-1.0136	10|5	0.59425|.	D|.	0.04|.	-16.4219|-16.4219	16.9036|16.9036	0.86119|0.86119	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	37|.	Q8N163|.	K1967_HUMAN|.	S|F	37|44	ENSP00000310670:P37S;ENSP00000373930:P37S|.	ENSP00000310670:P37S|.	P|S	+|+	1|2	0|0	KIAA1967|KIAA1967	22519593|22519593	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	4.044000|4.044000	0.57361|0.57361	2.906000|2.906000	0.99361|0.99361	0.655000|0.655000	0.94253|0.94253	CCT|TCC	-	NULL		0.552	CCAR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1967	protein_coding	OTTHUMT00000375865.1	C	NM_021174		22519593	+1	no_errors	NM_021174	genbank	human	validated	54_36p	missense	SNP	1.000	T
AP1G2	8906	genome.wustl.edu	37	14	24036406	24036406	+	Missense_Mutation	SNP	G	G	A			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr14:24036406G>A	ENST00000308724.5	-	1	873	c.118C>T	c.(118-120)Cgc>Tgc	p.R40C	RP11-66N24.3_ENST00000555968.1_RNA|AP1G2_ENST00000556277.1_5'UTR|AP1G2_ENST00000397120.3_Missense_Mutation_p.R40C	NM_003917.2	NP_003908.1	O75843	AP1G2_HUMAN	adaptor-related protein complex 1, gamma 2 subunit	40					intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)|viral process (GO:0016032)	AP-1 adaptor complex (GO:0030121)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|Golgi-associated vesicle (GO:0005798)|membrane (GO:0016020)|transport vesicle (GO:0030133)	protein transporter activity (GO:0008565)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(10)|lung(4)|ovary(1)|pancreas(1)|stomach(1)	28	all_cancers(95;0.000251)			GBM - Glioblastoma multiforme(265;0.00672)		TCCCCGTCGCGGAAGGAGGCC	0.627											OREG0022606	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				0			14											70.0	60.0	63.0					14																	24036406		2203	4300	6503	23106246	SO:0001583	missense	8906			AB015318	CCDS9602.1	14q11.2	2008-07-03			ENSG00000213983	ENSG00000213983			556	protein-coding gene	gene with protein product		603534				9733768, 9762922	Standard	XM_005268167		Approved	G2AD	uc001wkl.2	O75843	OTTHUMG00000028760	ENST00000308724.5:c.118C>T	14.37:g.24036406G>A	ENSP00000312442:p.Arg40Cys	768	23106246	D3DS51|O75504	Missense_Mutation	SNP	superfamily_ARM-type_fold,HMMPfam_Adaptin_N,superfamily_Clath_adapt,HMMPfam_Alpha_adaptinC2,HMMSmart_Alpha_adaptinC2	p.R40C	ENST00000308724.5	37	c.118	CCDS9602.1	14	.	.	.	.	.	.	.	.	.	.	G	25.1	4.604407	0.87157	.	.	ENSG00000213983	ENST00000308724;ENST00000397120;ENST00000557189;ENST00000556843	T;T;T;T	0.28255	1.62;1.62;1.62;1.62	4.09	4.09	0.47781	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.64538	0.2607	M	0.93420	3.415	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.75348	-0.3349	10	0.87932	D	0	-15.1385	14.1527	0.65398	0.0:0.0:1.0:0.0	.	40	O75843	AP1G2_HUMAN	C	40	ENSP00000312442:R40C;ENSP00000380309:R40C;ENSP00000452153:R40C;ENSP00000451504:R40C	ENSP00000312442:R40C	R	-	1	0	AP1G2	23106246	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	2.779000	0.47734	2.273000	0.75805	0.436000	0.28706	CGC	-	superfamily_ARM-type_fold,HMMPfam_Adaptin_N		0.627	AP1G2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	AP1G2	protein_coding	OTTHUMT00000071812.4	G	NM_003917		23106246	-1	no_errors	NM_003917	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
PALB2	79728	genome.wustl.edu	37	16	23646369	23646369	+	Missense_Mutation	SNP	A	A	G			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr16:23646369A>G	ENST00000261584.4	-	4	1650	c.1498T>C	c.(1498-1500)Tct>Cct	p.S500P		NM_024675.3	NP_078951.2	Q86YC2	PALB2_HUMAN	partner and localizer of BRCA2	500	DNA-binding (with the preference D loop > dsDNA > ssDNA).				DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|inner cell mass cell proliferation (GO:0001833)|mesoderm development (GO:0007498)|negative regulation of apoptotic process (GO:0043066)|organ morphogenesis (GO:0009887)|post-anal tail morphogenesis (GO:0036342)|somitogenesis (GO:0001756)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(5)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(21)|ovary(3)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(3)	55				GBM - Glioblastoma multiforme(48;0.0167)		GCCTTCCTAGACAAGTCATTA	0.473			"""F, N, Mis"""			"""Wilms tumor, medulloblastoma, AML ,breast"""		Involved in tolerance or repair of DNA crosslinks																														yes	Rec		"""Fanconi anaemia N, breast cancer susceptibility """	16	16p12.1	79728	partner and localizer of BRCA2		"""L, O, E"""	0			16											146.0	143.0	144.0					16																	23646369		2197	4300	6497	23553870	SO:0001583	missense	79728				CCDS32406.1	16p12.1	2014-09-17				ENSG00000083093		"""Fanconi anemia, complementation groups"""	26144	protein-coding gene	gene with protein product	"""Fanconi anemia, complementation group N"""	610355				16793542, 17200672	Standard	NM_024675		Approved	FLJ21816, FANCN	uc002dlx.1	Q86YC2		ENST00000261584.4:c.1498T>C	16.37:g.23646369A>G	ENSP00000261584:p.Ser500Pro		23553870	A6NIE1|Q8N7Y6|Q8ND31|Q9H6W1	Missense_Mutation	SNP	PatternScan_WD_REPEATS_1,superfamily_WD40_like	p.S500P	ENST00000261584.4	37	c.1498	CCDS32406.1	16	.	.	.	.	.	.	.	.	.	.	A	20.5	3.999103	0.74818	.	.	ENSG00000083093	ENST00000261584	T	0.18338	2.22	5.2	-3.37	0.04898	.	0.782893	0.11510	N	0.556845	T	0.12220	0.0297	L	0.57536	1.79	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.33803	-0.9854	10	0.30078	T	0.28	-0.048	2.1456	0.03786	0.2392:0.4287:0.1878:0.1444	.	500	Q86YC2	PALB2_HUMAN	P	500	ENSP00000261584:S500P	ENSP00000261584:S500P	S	-	1	0	PALB2	23553870	0.000000	0.05858	0.000000	0.03702	0.606000	0.37113	-0.024000	0.12435	-0.475000	0.06852	-0.313000	0.08912	TCT	-	NULL		0.473	PALB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PALB2	protein_coding	OTTHUMT00000435287.2	A	NM_024675		23553870	-1	no_errors	NM_024675	genbank	human	reviewed	54_36p	missense	SNP	0.000	G
NINL	22981	genome.wustl.edu	37	20	25459747	25459747	+	Silent	SNP	C	C	T			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr20:25459747C>T	ENST00000278886.6	-	16	2086	c.2013G>A	c.(2011-2013)gtG>gtA	p.V671V	NINL_ENST00000422516.1_Silent_p.V671V	NM_025176.4	NP_079452.3	Q9Y2I6	NINL_HUMAN	ninein-like	671					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	cytosol (GO:0005829)|microtubule (GO:0005874)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(13)|lung(25)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	57						GACCCTCCAGCACGCTGACCT	0.592																																																0			20											68.0	66.0	67.0					20																	25459747		2203	4300	6503	25407747	SO:0001819	synonymous_variant	22981				CCDS33452.1	20p11.22-p11.1	2013-01-10			ENSG00000101004	ENSG00000101004		"""EF-hand domain containing"""	29163	protein-coding gene	gene with protein product	"""ninein-like protein"""	609580				10231032	Standard	XM_005260678		Approved	KIAA0980, NLP	uc002wux.1	Q9Y2I6	OTTHUMG00000032127	ENST00000278886.6:c.2013G>A	20.37:g.25459747C>T			25407747	A6NJN0|B3V9H6|B7Z1V8|Q5JYP0|Q8NE38|Q9NQE3	Silent	SNP	superfamily_SSF47473,HMMSmart_EFh,HMMPfam_efhand,PatternScan_EF_HAND_1	p.V671	ENST00000278886.6	37	c.2013	CCDS33452.1	20																																																																																			-	NULL		0.592	NINL-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NLP	protein_coding	OTTHUMT00000078445.3	C	NM_025176		25407747	-1	no_errors	NM_025176	genbank	human	validated	54_36p	silent	SNP	0.783	T
HIST1H1E	3008	genome.wustl.edu	37	6	26156800	26156800	+	Missense_Mutation	SNP	C	C	A			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr6:26156800C>A	ENST00000304218.3	+	1	242	c.182C>A	c.(181-183)gCt>gAt	p.A61D	HIST1H2BD_ENST00000377777.4_5'Flank|HIST1H2BD_ENST00000289316.2_5'Flank	NM_005321.2	NP_005312.1	P10412	H14_HUMAN	histone cluster 1, H1e	61	H15. {ECO:0000255|PROSITE- ProRule:PRU00837}.				nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)	extracellular vesicular exosome (GO:0070062)|nuclear heterochromatin (GO:0005720)|nucleosome (GO:0000786)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|poly(A) RNA binding (GO:0044822)			NS(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|liver(1)|lung(9)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	26						TCTTTGGCCGCTCTCAAGAAA	0.622																																																0			6											31.0	34.0	33.0					6																	26156800		2203	4300	6503	26264779	SO:0001583	missense	3008			M60748	CCDS4586.1	6p22.1	2012-05-04	2006-10-11	2003-02-21	ENSG00000168298	ENSG00000168298		"""Histones / Replication-dependent"""	4718	protein-coding gene	gene with protein product		142220	"""H1 histone family, member 4"", ""histone 1, H1e"""	H1F4		1916825, 12408966	Standard	NM_005321		Approved	H1.4, H1e, H1s-4	uc003ngq.3	P10412	OTTHUMG00000014422	ENST00000304218.3:c.182C>A	6.37:g.26156800C>A	ENSP00000307705:p.Ala61Asp		26264779	Q4VB25	Missense_Mutation	SNP	"superfamily_""Winged helix"" DNA-binding domain,HMMSmart_SM00526,HMMPfam_Linker_histone"	p.A61D	ENST00000304218.3	37	c.182	CCDS4586.1	6	.	.	.	.	.	.	.	.	.	.	.	24.0	4.487490	0.84854	.	.	ENSG00000168298	ENST00000304218	T	0.15718	2.4	5.11	5.11	0.69529	Histone H1/H5 (3);Winged helix-turn-helix transcription repressor DNA-binding (1);	0.112474	0.64402	D	0.000014	T	0.54727	0.1876	H	0.98218	4.175	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	T	0.73757	-0.3882	10	0.87932	D	0	-3.8218	17.8759	0.88825	0.0:1.0:0.0:0.0	.	61	P10412	H14_HUMAN	D	61	ENSP00000307705:A61D	ENSP00000307705:A61D	A	+	2	0	HIST1H1E	26264779	1.000000	0.71417	0.998000	0.56505	0.776000	0.43924	5.869000	0.69613	2.542000	0.85734	0.561000	0.74099	GCT	-	"superfamily_""Winged helix"" DNA-binding domain,HMMSmart_SM00526,HMMPfam_Linker_histone"		0.622	HIST1H1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H1E	protein_coding	OTTHUMT00000040084.1	C	NM_005321		26264779	+1	no_errors	NM_005321	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
KIF13B	23303	genome.wustl.edu	37	8	28976452	28976452	+	Missense_Mutation	SNP	G	G	T			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr8:28976452G>T	ENST00000524189.1	-	30	3631	c.3593C>A	c.(3592-3594)gCg>gAg	p.A1198E	CTD-2647L4.1_ENST00000523661.1_RNA	NM_015254.3	NP_056069.2	Q9NQT8	KI13B_HUMAN	kinesin family member 13B	1198					metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|protein targeting (GO:0006605)|regulation of axonogenesis (GO:0050770)|signal transduction (GO:0007165)|T cell activation (GO:0042110)	axon (GO:0030424)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	14-3-3 protein binding (GO:0071889)|ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)|protein kinase binding (GO:0019901)			endometrium(6)|kidney(1)|lung(20)|urinary_tract(1)	28		Ovarian(32;0.000536)		KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)		AGTCAAGGTCGCATCCCATCC	0.433																																																0			8											150.0	151.0	151.0					8																	28976452		1936	4144	6080	29032371	SO:0001583	missense	23303			AB014539	CCDS55217.1	8p21	2008-07-30				ENSG00000197892		"""Kinesins"""	14405	protein-coding gene	gene with protein product		607350				9734811, 10859302, 16864656	Standard	NM_015254		Approved	GAKIN, KIAA0639	uc003xhh.4	Q9NQT8		ENST00000524189.1:c.3593C>A	8.37:g.28976452G>T	ENSP00000427900:p.Ala1198Glu		29032371	B4DGY5|B5MC45|F8VPJ2|O75134|Q9BYJ6	Missense_Mutation	SNP	HMMSmart_SM00129,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMPfam_Kinesin,PatternScan_KINESIN_MOTOR_DOMAIN1,superfamily_SMAD/FHA domain,HMMPfam_FHA,superfamily_Cap-Gly domain,HMMPfam_CAP_GLY,PatternScan_CAP_GLY_1	p.A1198E	ENST00000524189.1	37	c.3593	CCDS55217.1	8	.	.	.	.	.	.	.	.	.	.	G	26.4	4.737708	0.89573	.	.	ENSG00000197892	ENST00000524189	T	0.76578	-1.03	5.19	5.19	0.71726	.	0.107611	0.64402	D	0.000006	T	0.81211	0.4775	L	0.44542	1.39	0.80722	D	1	P	0.46277	0.875	P	0.52646	0.705	T	0.83027	-0.0164	10	0.87932	D	0	.	18.9152	0.92503	0.0:0.0:1.0:0.0	.	1198	F8VPJ2	.	E	1198	ENSP00000427900:A1198E	ENSP00000427900:A1198E	A	-	2	0	KIF13B	29032371	1.000000	0.71417	0.996000	0.52242	0.766000	0.43426	9.181000	0.94874	2.684000	0.91462	0.563000	0.77884	GCG	-	NULL		0.433	KIF13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF13B	protein_coding	OTTHUMT00000376878.1	G			29032371	-1	no_errors	NM_015254	genbank	human	validated	54_36p	missense	SNP	1.000	T
TRPM1	4308	genome.wustl.edu	37	15	31334407	31334407	+	Missense_Mutation	SNP	T	T	C			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr15:31334407T>C	ENST00000256552.6	-	17	1981	c.1834A>G	c.(1834-1836)Aag>Gag	p.K612E	TRPM1_ENST00000542188.1_Missense_Mutation_p.K629E|RP11-348B17.1_ENST00000561299.1_RNA|TRPM1_ENST00000397795.2_Missense_Mutation_p.K590E	NM_001252024.1	NP_001238953.1			transient receptor potential cation channel, subfamily M, member 1											NS(2)|breast(3)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(15)|lung(48)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(3)	99		all_lung(180;1.92e-11)		all cancers(64;3.52e-16)|Epithelial(43;1.65e-11)|GBM - Glioblastoma multiforme(186;3.57e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00533)|COAD - Colon adenocarcinoma(236;0.0609)|Lung(196;0.199)		tcctttttcttctttttcttt	0.468																																																0			15											47.0	50.0	49.0					15																	31334407		2059	4215	6274	29121699	SO:0001583	missense	4308			AF071787	CCDS10024.2, CCDS58345.1, CCDS58346.1, CCDS58347.1	15q13.3	2014-01-28		2002-01-18	ENSG00000134160	ENSG00000134160		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	7146	protein-coding gene	gene with protein product		603576	"""melastatin 1"""	MLSN1		9806836, 9537257, 16382100	Standard	NM_001252020		Approved	LTRPC1, CSNB1C	uc021sia.1	Q7Z4N2	OTTHUMG00000129267	ENST00000256552.6:c.1834A>G	15.37:g.31334407T>C	ENSP00000256552:p.Lys612Glu		29121699		Missense_Mutation	SNP	HMMPfam_Ion_trans	p.K590E	ENST00000256552.6	37	c.1768	CCDS58346.1	15	.	.	.	.	.	.	.	.	.	.	T	19.88	3.909963	0.72983	.	.	ENSG00000134160	ENST00000397795;ENST00000542188;ENST00000256552;ENST00000397793	T;T;T	0.64260	-0.09;-0.09;-0.09	4.72	4.72	0.59763	.	0.049413	0.85682	D	0.000000	T	0.54143	0.1840	L	0.46157	1.445	0.54753	D	0.99998	B;P	0.37233	0.288;0.588	B;B	0.32677	0.097;0.15	T	0.61898	-0.6968	10	0.87932	D	0	-31.7136	14.1734	0.65525	0.0:0.0:0.0:1.0	.	584;590	Q7Z4N2-3;Q7Z4N2	.;TRPM1_HUMAN	E	590;629;612;590	ENSP00000380897:K590E;ENSP00000437849:K629E;ENSP00000256552:K612E	ENSP00000256552:K612E	K	-	1	0	TRPM1	29121699	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.890000	0.87313	1.869000	0.54173	0.533000	0.62120	AAG	-	NULL		0.468	TRPM1-004	PUTATIVE	basic|appris_candidate|CCDS	protein_coding	TRPM1	protein_coding	OTTHUMT00000417166.2	T	NM_002420		29121699	-1	no_errors	NM_002420	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
KLF13	51621	genome.wustl.edu	37	15	31664372	31664372	+	Missense_Mutation	SNP	C	C	T			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr15:31664372C>T	ENST00000307145.3	+	2	1095	c.737C>T	c.(736-738)gCg>gTg	p.A246V	KLF13_ENST00000560473.1_Missense_Mutation_p.A58V	NM_015995.2	NP_057079.2	Q9Y2Y9	KLF13_HUMAN	Kruppel-like factor 13	246					negative regulation of cell proliferation (GO:0008285)|negative regulation of erythrocyte differentiation (GO:0045647)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)	2		all_lung(180;3.71e-11)		all cancers(64;1.11e-18)|Epithelial(43;1.73e-14)|GBM - Glioblastoma multiforme(186;0.00016)|Colorectal(1;0.00158)|BRCA - Breast invasive adenocarcinoma(123;0.00255)|COAD - Colon adenocarcinoma(236;0.0446)|READ - Rectum adenocarcinoma(1;0.13)|Lung(196;0.171)		ACCAAGCACGCGCGCCGCCAC	0.701																																																0			15											30.0	28.0	29.0					15																	31664372		2201	4296	6497	29451664	SO:0001583	missense	51621			AF132599	CCDS10025.1	15q13.3	2013-01-08			ENSG00000169926	ENSG00000169926		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	13672	protein-coding gene	gene with protein product		605328				10415854, 10023774	Standard	NM_015995		Approved	RFLAT-1, BTEB3, NSLP1, FKLF-2	uc001zfo.3	Q9Y2Y9	OTTHUMG00000172224	ENST00000307145.3:c.737C>T	15.37:g.31664372C>T	ENSP00000302456:p.Ala246Val		29451664	Q9Y356	Missense_Mutation	SNP	HMMPfam_zf-C2H2,HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1,superfamily_SSF57667	p.A246V	ENST00000307145.3	37	c.737	CCDS10025.1	15	.	.	.	.	.	.	.	.	.	.	C	33	5.255499	0.95336	.	.	ENSG00000169926	ENST00000307145	T	0.07021	3.23	4.86	4.86	0.63082	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	U	0.000000	T	0.11750	0.0286	M	0.67397	2.05	0.58432	D	0.999996	D	0.56035	0.974	B	0.43386	0.418	T	0.15780	-1.0425	10	0.02654	T	1	.	18.3429	0.90312	0.0:1.0:0.0:0.0	.	246	Q9Y2Y9	KLF13_HUMAN	V	246	ENSP00000302456:A246V	ENSP00000302456:A246V	A	+	2	0	KLF13	29451664	1.000000	0.71417	0.997000	0.53966	0.998000	0.95712	7.344000	0.79328	2.406000	0.81754	0.655000	0.94253	GCG	-	superfamily_SSF57667,HMMPfam_zf-C2H2,HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1		0.701	KLF13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLF13	protein_coding	OTTHUMT00000251381.1	C	NM_015995		29451664	+1	no_errors	NM_015995	genbank	human	validated	54_36p	missense	SNP	1.000	T
SCRN1	9805	genome.wustl.edu	37	7	29980346	29980346	+	Missense_Mutation	SNP	C	C	G			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr7:29980346C>G	ENST00000426154.1	-	5	867	c.691G>C	c.(691-693)Gat>Cat	p.D231H	SCRN1_ENST00000242059.5_Missense_Mutation_p.D231H|SCRN1_ENST00000434476.2_Missense_Mutation_p.D251H|SCRN1_ENST00000409497.1_Missense_Mutation_p.D231H|SCRN1_ENST00000416113.2_Intron|SCRN1_ENST00000425819.2_Missense_Mutation_p.D163H	NM_001145513.1	NP_001138985.1	Q12765	SCRN1_HUMAN	secernin 1	231					exocytosis (GO:0006887)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	dipeptidase activity (GO:0016805)			breast(2)|endometrium(3)|kidney(1)|large_intestine(1)|lung(12)|ovary(2)|prostate(2)|skin(2)	25						TCTAGATGATCCTCAACTGGA	0.498																																																0			7											135.0	130.0	131.0					7																	29980346		2203	4300	6503	29946871	SO:0001583	missense	9805			D83777	CCDS5422.1, CCDS47567.1, CCDS47568.1	7p14.3-p14.1	2006-09-06			ENSG00000136193	ENSG00000136193			22192	protein-coding gene	gene with protein product		614965				12221138	Standard	NM_014766		Approved	KIAA0193	uc011kaa.2	Q12765	OTTHUMG00000097093	ENST00000426154.1:c.691G>C	7.37:g.29980346C>G	ENSP00000409068:p.Asp231His		29946871	A8K0E9|B4DHM0|B4DIP5|C9JPG0|Q25QX7|Q8IWD1	Missense_Mutation	SNP	NULL	p.D231H	ENST00000426154.1	37	c.691	CCDS5422.1	7	.	.	.	.	.	.	.	.	.	.	C	14.16	2.453711	0.43531	.	.	ENSG00000136193	ENST00000242059;ENST00000426154;ENST00000425819;ENST00000544388;ENST00000409497;ENST00000434476;ENST00000421434	T;T;T;T;T;T	0.18960	3.22;3.22;3.07;3.22;3.21;2.18	5.76	5.76	0.90799	.	0.294131	0.33553	N	0.004799	T	0.25901	0.0631	L	0.36672	1.1	0.80722	D	1	B;B;B	0.34264	0.446;0.446;0.241	P;P;B	0.46419	0.516;0.516;0.315	T	0.03608	-1.1020	9	.	.	.	-5.4687	11.9332	0.52857	0.0:0.9202:0.0:0.0798	.	251;251;231	C9JPG0;B4DHM0;Q12765	.;.;SCRN1_HUMAN	H	231;231;163;35;231;251;231	ENSP00000242059:D231H;ENSP00000409068:D231H;ENSP00000414245:D163H;ENSP00000386872:D231H;ENSP00000388942:D251H;ENSP00000413184:D231H	.	D	-	1	0	SCRN1	29946871	1.000000	0.71417	0.989000	0.46669	0.074000	0.17049	3.212000	0.51145	2.721000	0.93114	0.591000	0.81541	GAT	-	NULL		0.498	SCRN1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	SCRN1	protein_coding	OTTHUMT00000214231.2	C	NM_014766		29946871	-1	no_errors	NM_014766	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
FBXO7	25793	genome.wustl.edu	37	22	32875251	32875251	+	Missense_Mutation	SNP	G	G	T			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr22:32875251G>T	ENST00000266087.7	+	2	733	c.406G>T	c.(406-408)Gac>Tac	p.D136Y	FBXO7_ENST00000382058.3_Missense_Mutation_p.D57Y|FBXO7_ENST00000397426.1_Missense_Mutation_p.D22Y	NM_012179.3	NP_036311.3	Q9Y3I1	FBX7_HUMAN	F-box protein 7	136	Important for interaction with CDK6.				cell death (GO:0008219)|mitochondrion degradation (GO:0000422)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of lymphocyte differentiation (GO:0045620)|protein targeting to mitochondrion (GO:0006626)|protein ubiquitination (GO:0016567)|regulation of protein stability (GO:0031647)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						TGTTTGGAATGACGACAGTAT	0.433																																																0			22											56.0	56.0	56.0					22																	32875251		2203	4300	6503	31205251	SO:0001583	missense	25793			AF129537	CCDS13907.1, CCDS58806.1	22q12.3	2013-09-19	2004-06-15		ENSG00000100225	ENSG00000100225		"""F-boxes /  ""other"""", ""Parkinson disease"""	13586	protein-coding gene	gene with protein product		605648	"""F-box only protein 7"""			10531035, 10531037, 19038853	Standard	NM_001257990		Approved	FBX7, Fbx, PARK15	uc003amq.3	Q9Y3I1	OTTHUMG00000030674	ENST00000266087.7:c.406G>T	22.37:g.32875251G>T	ENSP00000266087:p.Asp136Tyr		31205251	B4DNB3|B4DWX5|Q5TGC4|Q5TI86|Q96HM6|Q9UF21|Q9UKT2	Missense_Mutation	SNP	superfamily_SSF81383,HMMPfam_F-box,HMMSmart_FBOX	p.D136Y	ENST00000266087.7	37	c.406	CCDS13907.1	22	.	.	.	.	.	.	.	.	.	.	G	11.74	1.730148	0.30684	.	.	ENSG00000100225	ENST00000266087;ENST00000452138;ENST00000382058;ENST00000397426;ENST00000444207	T;T;T;T;T	0.56776	0.44;0.44;0.44;0.44;0.44	5.36	4.34	0.51931	.	0.530473	0.18536	N	0.138342	T	0.58878	0.2153	M	0.72118	2.19	0.09310	N	1	P;P;P	0.50943	0.94;0.832;0.836	P;B;B	0.51355	0.667;0.252;0.444	T	0.55244	-0.8171	10	0.66056	D	0.02	-8.8381	7.0748	0.25199	0.2409:0.0:0.7591:0.0	.	57;136;22	Q9Y3I1-2;Q9Y3I1;Q5TI86	.;FBX7_HUMAN;.	Y	136;57;57;22;22	ENSP00000266087:D136Y;ENSP00000388547:D57Y;ENSP00000371490:D57Y;ENSP00000380571:D22Y;ENSP00000404388:D22Y	ENSP00000266087:D136Y	D	+	1	0	FBXO7	31205251	0.266000	0.24112	0.018000	0.16275	0.347000	0.29111	3.249000	0.51437	1.250000	0.43966	0.484000	0.47621	GAC	-	NULL		0.433	FBXO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO7	protein_coding	OTTHUMT00000129001.1	G			31205251	+1	no_errors	NM_012179	genbank	human	reviewed	54_36p	missense	SNP	0.016	T
PDE1C	5137	genome.wustl.edu	37	7	31877578	31877578	+	Missense_Mutation	SNP	G	G	C			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr7:31877578G>C	ENST00000396191.1	-	10	1443	c.988C>G	c.(988-990)Cga>Gga	p.R330G	PDE1C_ENST00000396182.2_Missense_Mutation_p.R330G|PDE1C_ENST00000321453.7_Missense_Mutation_p.R330G|PDE1C_ENST00000396184.3_Missense_Mutation_p.R330G|PDE1C_ENST00000396193.1_Missense_Mutation_p.R390G	NM_001191057.1	NP_001177986.1	Q14123	PDE1C_HUMAN	phosphodiesterase 1C, calmodulin-dependent 70kDa	330	Catalytic. {ECO:0000250}.				activation of phospholipase C activity (GO:0007202)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|metabolic process (GO:0008152)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)	cytosol (GO:0005829)	calmodulin-dependent cyclic-nucleotide phosphodiesterase activity (GO:0004117)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(38)|prostate(4)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	81			GBM - Glioblastoma multiforme(11;0.216)		Caffeine(DB00201)	ACCAAGGTTCGAAACTCCCTT	0.388																																																0			7											172.0	176.0	174.0					7																	31877578		2203	4300	6503	31844103	SO:0001583	missense	5137			U40371	CCDS5437.1, CCDS55099.1, CCDS55100.1	7p15.1-p14.3	2008-05-15	2002-08-29		ENSG00000154678	ENSG00000154678	3.1.4.17	"""Phosphodiesterases"""	8776	protein-coding gene	gene with protein product		602987	"""phosphodiesterase 1C, calmodulin-dependent (70kD)"""			8557689	Standard	XM_005249769		Approved	Hcam3	uc003tco.2	Q14123	OTTHUMG00000023836	ENST00000396191.1:c.988C>G	7.37:g.31877578G>C	ENSP00000379494:p.Arg330Gly		31844103	B3KPC6|E9PE92|Q14124|Q8NB10	Missense_Mutation	SNP	HMMPfam_PDEase_I_N,superfamily_SSF109604,HMMSmart_HDc,HMMPfam_PDEase_I,PatternScan_PDEASE_I	p.R330G	ENST00000396191.1	37	c.988	CCDS55099.1	7	.	.	.	.	.	.	.	.	.	.	G	17.67	3.447822	0.63178	.	.	ENSG00000154678	ENST00000396193;ENST00000396191;ENST00000321453;ENST00000396184;ENST00000396182	T;T;T;T;T	0.80480	-1.38;-1.38;-1.38;-1.38;-1.38	5.75	5.75	0.90469	Metal-dependent phosphohydrolase, HD domain (1);5&apos (2);-cyclic nucleotide phosphodiesterase, catalytic domain (2);3&apos (2);	0.000000	0.85682	D	0.000000	D	0.93465	0.7915	H	0.98048	4.135	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.996;0.998;0.997	D	0.95210	0.8324	10	0.87932	D	0	.	14.4	0.67037	0.0:0.0:0.8155:0.1845	.	330;390;330	Q14123-2;E9PE92;Q14123	.;.;PDE1C_HUMAN	G	390;330;330;330;330	ENSP00000379496:R390G;ENSP00000379494:R330G;ENSP00000318105:R330G;ENSP00000379487:R330G;ENSP00000379485:R330G	ENSP00000318105:R330G	R	-	1	2	PDE1C	31844103	1.000000	0.71417	1.000000	0.80357	0.896000	0.52359	5.152000	0.64882	2.716000	0.92895	0.655000	0.94253	CGA	-	superfamily_SSF109604,HMMSmart_HDc,HMMPfam_PDEase_I		0.388	PDE1C-006	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	PDE1C	protein_coding	OTTHUMT00000328458.1	G			31844103	-1	no_errors	NM_005020	genbank	human	provisional	54_36p	missense	SNP	1.000	C
NOTCH4	4855	genome.wustl.edu	37	6	32180911	32180911	+	Splice_Site	SNP	C	C	T			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr6:32180911C>T	ENST00000375023.3	-	15	2577		c.e15+1		NOTCH4_ENST00000465528.1_Splice_Site	NM_004557.3	NP_004548.3	Q99466	NOTC4_HUMAN	notch 4						cell differentiation (GO:0030154)|cell fate determination (GO:0001709)|embryo development (GO:0009790)|endothelial cell morphogenesis (GO:0001886)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|mammary gland development (GO:0030879)|morphogenesis of a branching structure (GO:0001763)|negative regulation of cell differentiation (GO:0045596)|negative regulation of endothelial cell differentiation (GO:0045602)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|patterning of blood vessels (GO:0001569)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(47)|ovary(5)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(1)	100						GCCCTGCTCACCTGTCTGCAC	0.647																																																0			6											47.0	52.0	50.0					6																	32180911		2203	4300	6503	32288889	SO:0001630	splice_region_variant	4855				CCDS34420.1	6p21.3	2013-01-10	2010-06-24		ENSG00000204301	ENSG00000204301		"""Ankyrin repeat domain containing"""	7884	protein-coding gene	gene with protein product		164951	"""Notch (Drosophila) homolog 4"", ""Notch homolog 4 (Drosophila)"""	INT3		7835890	Standard	NM_004557		Approved		uc003obb.3	Q99466	OTTHUMG00000031044	ENST00000375023.3:c.2438+1G>A	6.37:g.32180911C>T			32288889	B0V183|B0V1X5|O00306|Q5SSY7|Q99458|Q99940|Q9H3S8|Q9UII9|Q9UIJ0	Splice_Site	SNP	-	e15+1	ENST00000375023.3	37	c.2438+1	CCDS34420.1	6	.	.	.	.	.	.	.	.	.	.	C	13.50	2.255900	0.39896	.	.	ENSG00000204301	ENST00000375023	.	.	.	4.02	4.02	0.46733	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.8747	0.52539	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	NOTCH4	32288889	1.000000	0.71417	0.994000	0.49952	0.520000	0.34377	4.167000	0.58209	2.261000	0.74972	0.485000	0.47835	.	-	-		0.647	NOTCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH4	protein_coding	OTTHUMT00000076045.2	C		Intron	32288889	-1	no_errors	NM_004557	genbank	human	reviewed	54_36p	splice_site	SNP	0.843	T
C6orf10	10665	genome.wustl.edu	37	6	32293984	32293984	+	Intron	SNP	G	G	A			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr6:32293984G>A	ENST00000447241.2	-	17	687				C6orf10_ENST00000527965.1_Intron|C6orf10_ENST00000533191.1_Intron|C6orf10_ENST00000442822.2_Intron|C6orf10_ENST00000375015.4_Intron|C6orf10_ENST00000375007.4_Intron	NM_006781.3	NP_006772.3	Q5SRN2	CF010_HUMAN	chromosome 6 open reading frame 10							integral component of membrane (GO:0016021)|nucleus (GO:0005634)				cervix(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(12)|ovary(1)|skin(1)	25						CAGGAGAGGAGAGCCAGAGAA	0.458																																																0			6																																								32401962	SO:0001627	intron_variant	0			U60665	CCDS34422.1, CCDS69082.1, CCDS75430.1	6p21.32	2012-11-20			ENSG00000204296	ENSG00000204296			13922	protein-coding gene	gene with protein product	"""testis specific basic protein"""					10803852	Standard	XM_005248810		Approved	TSBP	uc021yvs.1	Q5SRN2	OTTHUMG00000031107	ENST00000447241.2:c.515-2593C>T	6.37:g.32293984G>A			32401962	A2BET1|A2BET2|A6NME2|B0S7R2|B0S7R3|E9PMB1|Q5SPI9|Q5SPJ0|Q5SPK9|Q5SPL0|Q5SRN3|Q5TG25|Q5TG26|Q8N4B6	RNA	SNP	-	NULL	ENST00000447241.2	37	NULL	CCDS34422.1	6																																																																																			-	-		0.458	C6orf10-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LOC100131609	protein_coding	OTTHUMT00000076178.4	G	NM_006781		32401962	+1	pseudogene	XR_039222	genbank	human	model	54_36p	rna	SNP	1.000	A
CCDC7	79741	genome.wustl.edu	37	10	33135314	33135314	+	Silent	SNP	A	A	G			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr10:33135314A>G	ENST00000375030.2	+	18	1839	c.1221A>G	c.(1219-1221)aaA>aaG	p.K407K	C10orf68_ENST00000375025.4_Silent_p.K512K|C10orf68_ENST00000375028.3_Silent_p.K452K			Q9H943	CJ068_HUMAN		448										breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|skin(4)	29						AGACTGATAAAGAACTCTTAA	0.289																																																0			10											40.0	45.0	43.0					10																	33135314		2197	4274	6471	33175320	SO:0001819	synonymous_variant	79741																														ENST00000375030.2:c.1221A>G	10.37:g.33135314A>G			33175320	B0QZ71|Q08AN7|Q8N7T7	Silent	SNP	NULL	p.K448	ENST00000375030.2	37	c.1344		10																																																																																			-	NULL		0.289	C10orf68-001	PUTATIVE	basic|appris_candidate|exp_conf	protein_coding	C10orf68	protein_coding	OTTHUMT00000313999.2	A			33175320	+1	no_errors	NM_024688	genbank	human	validated	54_36p	silent	SNP	0.001	G
IGHV3OR16-12	28304	genome.wustl.edu	37	16	33605521	33605521	+	RNA	SNP	C	C	A			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr16:33605521C>A	ENST00000570121.2	+	0	190									immunoglobulin heavy variable 3/OR16-12 (non-functional)																		AGGGAAGGGTCTGGAGTGGGT	0.542																																																0			16																																								33513022			401847			Z29609		16p11.2	2013-10-18	2008-09-11		ENSG00000270467	ENSG00000270467		"""Immunoglobulins / IGH orphons"""	5636	other	immunoglobulin gene			"""immunoglobulin heavy variable 3/OR16-12"""				Standard			Approved	IGHV3/OR16-12			OTTHUMG00000176355		16.37:g.33605521C>A			33513022		Missense_Mutation	SNP	superfamily_Alkaline phosphatase-like,HMMPfam_Phosphodiest,HMMPfam_V-set,superfamily_Immunoglobulin,HMMSmart_SM00406	p.L276M	ENST00000570121.2	37	c.826		16																																																																																			-	HMMPfam_V-set,superfamily_Immunoglobulin,HMMSmart_SM00406		0.542	IGHV3OR16-12-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	LOC401847	IG_V_gene	OTTHUMT00000431813.2	C			33513022	+1	no_errors	XM_001718104	genbank	human	model	54_36p	missense	SNP	0.997	A
ALG10	84920	genome.wustl.edu	37	12	34179087	34179087	+	Missense_Mutation	SNP	T	T	C			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr12:34179087T>C	ENST00000266483.2	+	3	978	c.659T>C	c.(658-660)cTt>cCt	p.L220P	AC046130.1_ENST00000401300.2_RNA|ALG10_ENST00000538927.1_Intron|RP11-847H18.2_ENST00000501954.2_RNA	NM_032834.3	NP_116223.3	Q5BKT4	AG10A_HUMAN	ALG10, alpha-1,2-glucosyltransferase	220					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	transferase activity, transferring hexosyl groups (GO:0016758)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	26	Lung NSC(5;3.82e-05)|Acute lymphoblastic leukemia(23;0.0142)|all_hematologic(23;0.0429)	Lung NSC(34;0.204)|all_lung(34;0.235)				GAAGACAGACTTCCACCTATT	0.378																																																0			12											98.0	104.0	102.0					12																	34179087		2203	4299	6502	34070354	SO:0001583	missense	84920			AJ312278	CCDS41769.1	12p11.21	2013-03-04	2013-03-04		ENSG00000139133	ENSG00000139133	2.4.1.256		23162	protein-coding gene	gene with protein product	"""derepression of ITR1 expression 2 homolog (S. cerevisiae)"", ""dolichyl-P-Glc:Glc(2)Man(9)GlcNAc(2)-PP-dolichol alpha-1,2- glucosyltransferase"""	603313	"""asparagine-linked glycosylation 10, alpha-1,2-glucosyltransferase homolog (yeast)"", ""asparagine-linked glycosylation 10, alpha-1,2-glucosyltransferase homolog (S. pombe)"""				Standard	NM_032834		Approved	FLJ14751, DIE2, ALG10A	uc001rlm.3	Q5BKT4	OTTHUMG00000169285	ENST00000266483.2:c.659T>C	12.37:g.34179087T>C	ENSP00000266483:p.Leu220Pro		34070354	Q6NS98|Q96DU0|Q96SM6	Missense_Mutation	SNP	HMMPfam_DIE2_ALG10	p.L220P	ENST00000266483.2	37	c.659	CCDS41769.1	12	.	.	.	.	.	.	.	.	.	.	T	0.522	-0.861682	0.02610	.	.	ENSG00000139133	ENST00000266483	T	0.33654	1.4	2.91	1.72	0.24424	.	0.478331	0.23426	N	0.048320	T	0.26448	0.0646	L	0.52126	1.63	0.50467	D	0.999873	B	0.02656	0.0	B	0.01281	0.0	T	0.05954	-1.0854	10	0.29301	T	0.29	.	4.9951	0.14235	0.0:0.1563:0.0:0.8437	.	220	Q5BKT4	AG10A_HUMAN	P	220	ENSP00000266483:L220P	ENSP00000266483:L220P	L	+	2	0	ALG10	34070354	0.584000	0.26766	0.196000	0.23383	0.026000	0.11368	1.367000	0.34204	0.194000	0.20326	0.155000	0.16302	CTT	-	HMMPfam_DIE2_ALG10		0.378	ALG10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALG10	protein_coding	OTTHUMT00000403309.1	T	NM_032834		34070354	+1	no_errors	NM_032834	genbank	human	validated	54_36p	missense	SNP	0.024	C
C9orf131	138724	genome.wustl.edu	37	9	35044783	35044783	+	Silent	SNP	C	C	T			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr9:35044783C>T	ENST00000312292.5	+	2	2204	c.2157C>T	c.(2155-2157)agC>agT	p.S719S	C9orf131_ENST00000354479.5_Silent_p.S646S|C9orf131_ENST00000421362.2_Silent_p.S671S|FLJ00273_ENST00000595331.1_5'Flank	NM_001040410.1|NM_203299.2	NP_001035500.1|NP_976044.2	Q5VYM1	CI131_HUMAN	chromosome 9 open reading frame 131	719										cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(23)|prostate(2)|skin(2)|stomach(1)	39	all_epithelial(49;0.22)		LUSC - Lung squamous cell carcinoma(32;0.00117)|Lung(28;0.00309)			AAGGCCCCAGCCCTCTGGCAG	0.552																																																0			9											63.0	62.0	62.0					9																	35044783		2203	4300	6503	35034783	SO:0001819	synonymous_variant	138724			BC045643	CCDS6572.2, CCDS47961.1, CCDS47962.1	9p13.3	2008-02-05			ENSG00000174038	ENSG00000174038			31418	protein-coding gene	gene with protein product							Standard	NM_001287391		Approved	MGC41945	uc003zvw.3	Q5VYM1	OTTHUMG00000019853	ENST00000312292.5:c.2157C>T	9.37:g.35044783C>T			35034783	A6NLE6|E9PB26|Q86XC6|Q9UF74	Silent	SNP	NULL	p.S719	ENST00000312292.5	37	c.2157	CCDS6572.2	9																																																																																			-	NULL		0.552	C9orf131-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C9orf131	protein_coding	OTTHUMT00000052283.5	C	NM_203299		35034783	+1	no_errors	NM_203299	genbank	human	validated	54_36p	silent	SNP	0.065	T
WDR70	55100	genome.wustl.edu	37	5	37505774	37505774	+	Intron	SNP	C	C	T			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr5:37505774C>T	ENST00000265107.4	+	9	996				WDR70_ENST00000504564.1_Intron|WDR70_ENST00000510699.1_Intron	NM_018034.2	NP_060504.1	Q9NW82	WDR70_HUMAN	WD repeat domain 70								enzyme binding (GO:0019899)			central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(5)|lung(18)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37	all_lung(31;0.000285)		COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			ACATCTTCCTCTAGCCCCTAA	0.383																																																0			5																																								37541531	SO:0001627	intron_variant	728707			BC009648	CCDS34147.1	5p13.2	2013-01-09			ENSG00000082068	ENSG00000082068		"""WD repeat domain containing"""	25495	protein-coding gene	gene with protein product						12477932	Standard	NM_018034		Approved	FLJ10233	uc003jkv.3	Q9NW82	OTTHUMG00000162263	ENST00000265107.4:c.841-10842C>T	5.37:g.37505774C>T			37541531	Q9H053	RNA	SNP	-	NULL	ENST00000265107.4	37	NULL	CCDS34147.1	5																																																																																			-	-		0.383	WDR70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC728707	protein_coding	OTTHUMT00000368294.1	C	NM_018034		37541531	-1	pseudogene	XR_015588	genbank	human	model	54_36p	rna	SNP	0.042	T
RUNDC1	146923	genome.wustl.edu	37	17	41143301	41143301	+	Missense_Mutation	SNP	G	G	A			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr17:41143301G>A	ENST00000361677.1	+	5	1422	c.1410G>A	c.(1408-1410)atG>atA	p.M470I		NM_173079.2	NP_775102	Q96C34	RUND1_HUMAN	RUN domain containing 1	470	RUN. {ECO:0000255|PROSITE- ProRule:PRU00178}.									breast(1)|large_intestine(2)|lung(4)|prostate(1)	8		Breast(137;0.00499)		BRCA - Breast invasive adenocarcinoma(366;0.161)		CAGAGGCCATGCACCCGTGGG	0.582																																																0			17											61.0	60.0	60.0					17																	41143301		2203	4300	6503	38396827	SO:0001583	missense	146923			AL831813	CCDS11448.1	17q21.31	2004-02-27				ENSG00000198863			25418	protein-coding gene	gene with protein product						12477932	Standard	NM_173079		Approved	DKFZp761H0421	uc002ici.1	Q96C34		ENST00000361677.1:c.1410G>A	17.37:g.41143301G>A	ENSP00000354622:p.Met470Ile		38396827	Q6Y2K8|Q8IXT9|Q8N3W1	Missense_Mutation	SNP	HMMPfam_RUN,HMMSmart_SM00593	p.M470I	ENST00000361677.1	37	c.1410	CCDS11448.1	17	.	.	.	.	.	.	.	.	.	.	G	14.18	2.457532	0.43634	.	.	ENSG00000198863	ENST00000361677	T	0.19250	2.16	4.92	4.92	0.64577	RUN (2);	0.087810	0.85682	D	0.000000	T	0.17959	0.0431	L	0.28115	0.83	0.54753	D	0.999983	B	0.29232	0.238	B	0.29267	0.1	T	0.04427	-1.0952	10	0.33141	T	0.24	-35.5706	18.3135	0.90208	0.0:0.0:1.0:0.0	.	470	Q96C34	RUND1_HUMAN	I	470	ENSP00000354622:M470I	ENSP00000354622:M470I	M	+	3	0	RUNDC1	38396827	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.289000	0.65656	2.551000	0.86045	0.655000	0.94253	ATG	-	HMMPfam_RUN		0.582	RUNDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RUNDC1	protein_coding	OTTHUMT00000452464.1	G	NM_173079		38396827	+1	no_errors	NM_173079	genbank	human	validated	54_36p	missense	SNP	1.000	A
SH3BGR	6450	genome.wustl.edu	37	21	40883698	40883698	+	Missense_Mutation	SNP	C	C	T			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr21:40883698C>T	ENST00000333634.4	+	6	794	c.716C>T	c.(715-717)tCc>tTc	p.S239F	SH3BGR_ENST00000458295.1_Missense_Mutation_p.S97F|SH3BGR_ENST00000380637.3_Missense_Mutation_p.S128F|SH3BGR_ENST00000380631.1_Missense_Mutation_p.S128F|SH3BGR_ENST00000380634.1_Missense_Mutation_p.S128F	NM_007341.2	NP_031367	P55822	SH3BG_HUMAN	SH3 domain binding glutamate-rich protein	239	Glu-rich (acidic).				positive regulation of signal transduction (GO:0009967)|protein complex assembly (GO:0006461)	cytosol (GO:0005829)	SH3/SH2 adaptor activity (GO:0005070)			NS(1)|breast(1)|kidney(1)|large_intestine(3)|lung(2)	8		all_cancers(19;1.16e-23)|all_epithelial(19;1.22e-20)|Prostate(19;2.55e-06)|Breast(209;0.0133)		STAD - Stomach adenocarcinoma(101;0.00151)		GACGAAGATTCCTAGGCCTTT	0.493																																																0			21											99.0	88.0	92.0					21																	40883698		2203	4300	6503	39805568	SO:0001583	missense	6450				CCDS13666.1, CCDS33560.1	21q22.3	2014-02-19	2014-02-19		ENSG00000185437	ENSG00000185437			10822	protein-coding gene	gene with protein product	"""21-glutamic acid-rich protein"""	602230	"""SH3 domain binding glutamic acid-rich protein"""			9050928	Standard	NM_007341		Approved	21-GARP	uc002yya.3	P55822	OTTHUMG00000074113	ENST00000333634.4:c.716C>T	21.37:g.40883698C>T	ENSP00000332513:p.Ser239Phe		39805568	A6ND59|D3DSI2|Q9BRB8	Missense_Mutation	SNP	superfamily_Thiordxn-like_fd,HMMPfam_SH3BGR	p.S239F	ENST00000333634.4	37	c.716	CCDS13666.1	21	.	.	.	.	.	.	.	.	.	.	.	6.674	0.492932	0.12702	.	.	ENSG00000185437	ENST00000380637;ENST00000380634;ENST00000458295;ENST00000380631;ENST00000333634;ENST00000423596	T;T;T;T;T	0.55052	0.86;0.86;0.86;1.6;0.54	3.47	3.47	0.39725	.	0.519756	0.15941	U	0.237184	T	0.55689	0.1936	N	0.19112	0.55	0.25777	N	0.98478	D	0.71674	0.998	D	0.77557	0.99	T	0.46162	-0.9211	10	0.87932	D	0	.	10.6918	0.45875	0.0:1.0:0.0:0.0	.	239	P55822	SH3BG_HUMAN	F	128;128;97;128;239;81	ENSP00000370011:S128F;ENSP00000370008:S128F;ENSP00000370005:S128F;ENSP00000332513:S239F;ENSP00000413981:S81F	ENSP00000332513:S239F	S	+	2	0	SH3BGR	39805568	0.459000	0.25768	0.964000	0.40570	0.345000	0.29048	2.719000	0.47244	1.948000	0.56530	0.567000	0.79289	TCC	-	NULL		0.493	SH3BGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SH3BGR	protein_coding	OTTHUMT00000157377.6	C	NM_007341		39805568	+1	no_errors	NM_007341	genbank	human	validated	54_36p	missense	SNP	0.750	T
TTC17	55761	genome.wustl.edu	37	11	43511797	43511797	+	Silent	SNP	G	G	A	rs375047326		TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr11:43511797G>A	ENST00000039989.4	+	22	3053	c.3039G>A	c.(3037-3039)acG>acA	p.T1013T		NM_018259.5	NP_060729.2	Q96AE7	TTC17_HUMAN	tetratricopeptide repeat domain 17	1013					actin filament polymerization (GO:0030041)|cilium organization (GO:0044782)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(27)|ovary(5)|prostate(3)|skin(3)	53						AGAACCAGACGTCCTGGGTCC	0.502																																																0			11											115.0	95.0	101.0					11																	43511797		2203	4300	6503	43468373	SO:0001819	synonymous_variant	55761			AK001540	CCDS31466.1	11p11.2	2013-01-10			ENSG00000052841	ENSG00000052841		"""Tetratricopeptide (TTC) repeat domain containing"""	25596	protein-coding gene	gene with protein product						12477932	Standard	NM_018259		Approved	FLJ10890	uc001mxi.3	Q96AE7	OTTHUMG00000166398	ENST00000039989.4:c.3039G>A	11.37:g.43511797G>A			43468373	G3XAB3|Q8NEC0	Silent	SNP	superfamily_SSF48452,HMMPfam_TPR_1,HMMSmart_TPR	p.T1013	ENST00000039989.4	37	c.3039	CCDS31466.1	11	.	.	.	.	.	.	.	.	.	.	G	5.748	0.322521	0.10900	.	.	ENSG00000052841	ENST00000418561	.	.	.	5.66	-11.3	0.00108	.	.	.	.	.	T	0.37679	0.1012	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.62334	-0.6876	4	.	.	.	-12.9671	2.4788	0.04582	0.4157:0.2022:0.0677:0.3144	.	.	.	.	H	44	.	.	R	+	2	0	TTC17	43468373	0.000000	0.05858	0.001000	0.08648	0.896000	0.52359	-3.651000	0.00403	-5.751000	0.00010	-1.631000	0.00782	CGT	-	superfamily_SSF48452		0.502	TTC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC17	protein_coding	OTTHUMT00000389577.2	G	NM_018259		43468373	+1	no_errors	NM_018259	genbank	human	provisional	54_36p	silent	SNP	0.035	A
NFE2L1	4779	genome.wustl.edu	37	17	46136559	46136559	+	Silent	SNP	C	C	T			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr17:46136559C>T	ENST00000362042.3	+	6	2491	c.1875C>T	c.(1873-1875)ttC>ttT	p.F625F	NFE2L1_ENST00000536222.1_Silent_p.F469F|NFE2L1_ENST00000582155.1_Silent_p.F437F|NFE2L1_ENST00000361665.3_Silent_p.F614F|NFE2L1_ENST00000583378.1_Silent_p.F426F|NFE2L1_ENST00000357480.5_Silent_p.F595F|NFE2L1_ENST00000585291.1_Silent_p.F595F|RP5-890E16.4_ENST00000583349.1_RNA	NM_003204.2	NP_003195.1	Q14494	NF2L1_HUMAN	nuclear factor, erythroid 2-like 1	625					anatomical structure morphogenesis (GO:0009653)|erythrocyte differentiation (GO:0030218)|heme biosynthetic process (GO:0006783)|inflammatory response (GO:0006954)|transcription from RNA polymerase II promoter (GO:0006366)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)			cervix(1)|endometrium(3)|kidney(9)|large_intestine(7)|lung(7)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						AGATCCCTTTCACCAATGACA	0.537																																																0			17											51.0	44.0	46.0					17																	46136559		2203	4300	6503	43491558	SO:0001819	synonymous_variant	4779			AK090459	CCDS11524.1	17q21.3	2013-08-23	2013-08-23			ENSG00000082641		"""basic leucine zipper proteins"""	7781	protein-coding gene	gene with protein product		163260	"""nuclear factor (erythroid-derived 2)-like 1"""	TCF11		8248256, 9501099	Standard	NM_003204		Approved	NRF1, LCR-F1, FLJ00380	uc002imz.4	Q14494		ENST00000362042.3:c.1875C>T	17.37:g.46136559C>T			43491558	D3DTU3|D3DTU5|Q12877|Q96FN6	Silent	SNP	superfamily_A DNA-binding domain in eukaryotic transcription factors,HMMPfam_bZIP_2,HMMSmart_SM00338,PatternScan_BZIP_BASIC	p.F625	ENST00000362042.3	37	c.1875	CCDS11524.1	17																																																																																			-	superfamily_A DNA-binding domain in eukaryotic transcription factors		0.537	NFE2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NFE2L1	protein_coding	OTTHUMT00000443019.1	C	NM_003204		43491558	+1	no_errors	NM_003204	genbank	human	validated	54_36p	silent	SNP	1.000	T
ARHGAP8	23779	genome.wustl.edu	37	22	45210590	45210590	+	Missense_Mutation	SNP	C	C	T			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr22:45210590C>T	ENST00000389774.2	+	6	572	c.431C>T	c.(430-432)cCc>cTc	p.P144L	PRR5-ARHGAP8_ENST00000361473.5_Missense_Mutation_p.P244L|ARHGAP8_ENST00000336963.4_Missense_Mutation_p.P113L|PRR5-ARHGAP8_ENST00000352766.7_Missense_Mutation_p.P323L|ARHGAP8_ENST00000389773.5_Missense_Mutation_p.P235L|ARHGAP8_ENST00000517296.3_Missense_Mutation_p.P323L|ARHGAP8_ENST00000356099.6_Missense_Mutation_p.P113L	NM_001017526.1	NP_001017526.1	P85298	RHG08_HUMAN	Rho GTPase activating protein 8	144	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.				positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho GTPase activator activity (GO:0005100)			breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(7)|lung(9)|prostate(1)|skin(7)	29		all_neural(38;0.00409)|Ovarian(80;0.00976)|Glioma(61;0.0649)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0204)		GTGGTGCACCCCACCAGCTTC	0.587																																																0			22											141.0	114.0	123.0					22																	45210590		2203	4300	6503	43589254	SO:0001583	missense	553158			AF177331	CCDS14060.2, CCDS33664.1, CCDS56233.1	22q13.3	2010-05-11			ENSG00000241484	ENSG00000241484		"""Rho GTPase activating proteins"""	677	protein-coding gene	gene with protein product		609405				10591208	Standard	NM_001198726		Approved	FLJ20185, BPGAP1		P85298	OTTHUMG00000030234	ENST00000389774.2:c.431C>T	22.37:g.45210590C>T	ENSP00000374424:p.Pro144Leu		43589254	A6ZJ79|A6ZJ80|O75983|O95695|Q96RW1|Q96RW2|Q9HA49|Q9HC46|Q9NSG0|Q9NVX8|Q9NXL1|Q9UH20	Missense_Mutation	SNP	superfamily_CRAL_TRIO_C,HMMSmart_SEC14,superfamily_Rho_GAP,HMMSmart_RhoGAP,HMMPfam_RhoGAP	p.P149L	ENST00000389774.2	37	c.446	CCDS33664.1	22	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	27.5|27.5	4.836764|4.836764	0.91117|0.91117	.|.	.|.	ENSG00000248405;ENSG00000248405;ENSG00000241484;ENSG00000241484;ENSG00000241484;ENSG00000241484;ENSG00000241484;ENSG00000241484|ENSG00000248405	ENST00000361473;ENST00000352766;ENST00000517296;ENST00000389773;ENST00000389774;ENST00000336963;ENST00000356099;ENST00000412433|ENST00000515632	T;T;T;T;T;T;T;T|T	0.68903|0.66460	-0.36;-0.36;-0.36;-0.36;-0.36;-0.36;-0.36;-0.36|-0.21	4.25|4.25	4.25|4.25	0.50352|0.50352	Cellular retinaldehyde-binding/triple function, C-terminal (5);|.	.|.	.|.	.|.	.|.	T|T	0.80964|0.80964	0.4725|0.4725	M|M	0.82193|0.82193	2.58|2.58	0.80722|0.80722	D|D	1|1	D;D;D;D;D;D;D|.	0.89917|.	0.999;0.999;0.957;1.0;0.999;1.0;0.999|.	D;D;P;D;D;D;D|.	0.91635|.	0.967;0.967;0.64;0.999;0.967;0.999;0.98|.	D|D	0.84160|0.84160	0.0428|0.0428	9|7	0.87932|0.56958	D|D	0|0.05	.|.	16.477|16.477	0.84135|0.84135	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	149;113;149;144;154;323;244|.	B7ZMA4;A6ZJ79;A2RU51;P85298;Q6PCC7;B1AHC4;B1AHC3|.	.;.;.;RHG08_HUMAN;.;.;.|.	L|S	244;323;323;235;144;113;113;113|167	ENSP00000354732:P244L;ENSP00000262731:P323L;ENSP00000429240:P323L;ENSP00000374423:P235L;ENSP00000374424:P144L;ENSP00000337287:P113L;ENSP00000348407:P113L;ENSP00000402775:P113L|ENSP00000425026:P167S	ENSP00000337287:P113L|ENSP00000425026:P167S	P|P	+|+	2|1	0|0	PRR5-ARHGAP8;ARHGAP8|PRR5-ARHGAP8	43589254|43589254	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.939000|0.939000	0.58152|0.58152	6.980000|6.980000	0.76160|0.76160	2.194000|2.194000	0.70268|0.70268	0.650000|0.650000	0.86243|0.86243	CCC|CCA	-	superfamily_CRAL_TRIO_C,HMMSmart_SEC14		0.587	ARHGAP8-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LOC553158	protein_coding	OTTHUMT00000075088.4	C	NM_017701		43589254	+1	no_errors	NM_181334	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
ZNF197	10168	genome.wustl.edu	37	3	44683800	44683800	+	Missense_Mutation	SNP	C	C	G			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr3:44683800C>G	ENST00000396058.1	+	5	1345	c.1178C>G	c.(1177-1179)aCt>aGt	p.T393S	RP11-944L7.4_ENST00000457331.1_RNA|ZNF197_ENST00000383745.2_Intron|ZNF197_ENST00000383744.4_Intron|ZNF197_ENST00000344387.4_Missense_Mutation_p.T393S			O14709	ZN197_HUMAN	zinc finger protein 197	393					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(9)|ovary(3)|prostate(1)|skin(1)	25				KIRC - Kidney renal clear cell carcinoma(197;0.0478)|Kidney(197;0.0598)		AGAATCCACACTGGTGAGAAA	0.353																																																0			3											40.0	40.0	40.0					3																	44683800		2202	4297	6499	44658804	SO:0001583	missense	10168			AF011573	CCDS2717.1, CCDS33743.1	3p21	2013-01-09	2003-10-07		ENSG00000186448	ENSG00000186448		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	12988	protein-coding gene	gene with protein product			"""zinc finger protein 166"""	ZNF166		9380504, 8353497	Standard	XM_005264783		Approved	P18, D3S1363E, ZKSCAN9, ZSCAN41	uc003cnm.3	O14709	OTTHUMG00000133089	ENST00000396058.1:c.1178C>G	3.37:g.44683800C>G	ENSP00000379370:p.Thr393Ser		44658804	B2RAH8|Q86VG0	Missense_Mutation	SNP	HMMPfam_SCAN,HMMSmart_SM00431,superfamily_KRAB domain (Kruppel-associated box Pfam 01352),HMMPfam_KRAB,HMMSmart_SM00349,superfamily_C2H2 and C2HC zinc fingers,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1,HMMPfam_zf-C2H2	p.T393S	ENST00000396058.1	37	c.1178	CCDS2717.1	3	.	.	.	.	.	.	.	.	.	.	C	15.24	2.774086	0.49786	.	.	ENSG00000186448	ENST00000344387;ENST00000396058	T;T	0.24151	1.87;1.87	4.2	2.19	0.27852	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.36409	N	0.002615	T	0.22975	0.0555	L	0.43554	1.36	0.32133	N	0.586519	B	0.20459	0.045	B	0.21917	0.037	T	0.28933	-1.0028	10	0.46703	T	0.11	.	13.72	0.62720	0.0:0.7095:0.2905:0.0	.	393	O14709	ZN197_HUMAN	S	393	ENSP00000345809:T393S;ENSP00000379370:T393S	ENSP00000345809:T393S	T	+	2	0	ZNF197	44658804	0.718000	0.27976	1.000000	0.80357	0.979000	0.70002	1.421000	0.34815	1.079000	0.41038	0.455000	0.32223	ACT	-	superfamily_C2H2 and C2HC zinc fingers		0.353	ZNF197-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF197	protein_coding	OTTHUMT00000256747.4	C	NM_006991		44658804	+1	no_errors	NM_006991	genbank	human	reviewed	54_36p	missense	SNP	0.936	G
PRX	57716	genome.wustl.edu	37	19	40902375	40902375	+	Missense_Mutation	SNP	C	C	A			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr19:40902375C>A	ENST00000324001.7	-	7	2154	c.1884G>T	c.(1882-1884)gaG>gaT	p.E628D	PRX_ENST00000291825.7_3'UTR	NM_181882.2	NP_870998.2	Q9BXM0	PRAX_HUMAN	periaxin	628	55 X 5 AA approximate tandem repeats of [LVMAG]-[PSREQC]-[EDKL]-[LIVMAP]- [AQKHRPE]; that may have a tripeptide spacer of [LV]-P-[KER].				axon ensheathment (GO:0008366)|cell death (GO:0008219)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(12)|ovary(2)|prostate(3)|skin(1)|urinary_tract(9)	47			Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)			GGAGCTTCATCTCTGGGACTT	0.582																																																0			19											95.0	107.0	103.0					19																	40902375		2202	4300	6502	45594215	SO:0001583	missense	57716			AB046840	CCDS12556.1, CCDS33028.1	19q13.2	2014-09-17				ENSG00000105227			13797	protein-coding gene	gene with protein product		605725				10839370, 9143514	Standard	NM_181882		Approved	KIAA1620	uc002onr.3	Q9BXM0		ENST00000324001.7:c.1884G>T	19.37:g.40902375C>A	ENSP00000326018:p.Glu628Asp		45594215	Q9BXL9|Q9HCF2	Missense_Mutation	SNP	HMMPfam_PDZ,superfamily_PDZ domain-like,HMMSmart_SM00228	p.E628D	ENST00000324001.7	37	c.1884	CCDS33028.1	19	.	.	.	.	.	.	.	.	.	.	C	11.99	1.804417	0.31869	.	.	ENSG00000105227	ENST00000324001;ENST00000341562	T	0.01804	4.63	4.08	0.261	0.15592	.	0.373056	0.19253	N	0.118868	T	0.01940	0.0061	M	0.62723	1.935	0.80722	D	1	B	0.17667	0.023	B	0.16289	0.015	T	0.45483	-0.9258	10	0.12103	T	0.63	.	5.5661	0.17170	0.0:0.6264:0.1607:0.2129	.	628	Q9BXM0	PRAX_HUMAN	D	628	ENSP00000326018:E628D	ENSP00000326018:E628D	E	-	3	2	PRX	45594215	0.000000	0.05858	0.943000	0.38184	0.857000	0.48899	-1.636000	0.02016	0.325000	0.23359	-0.145000	0.13849	GAG	-	NULL		0.582	PRX-001	KNOWN	basic|CCDS	protein_coding	PRX	protein_coding	OTTHUMT00000462582.1	C	NM_020956		45594215	-1	no_errors	NM_181882	genbank	human	reviewed	54_36p	missense	SNP	0.000	A
EGLN2	112398	genome.wustl.edu	37	19	41313085	41313085	+	Missense_Mutation	SNP	G	G	A			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr19:41313085G>A	ENST00000593726.1	+	3	2034	c.1006G>A	c.(1006-1008)Gtg>Atg	p.V336M	RAB4B-EGLN2_ENST00000594136.1_3'UTR|EGLN2_ENST00000594140.1_Missense_Mutation_p.V54M|CTC-490E21.12_ENST00000601627.1_Intron|EGLN2_ENST00000406058.2_Missense_Mutation_p.V336M|EGLN2_ENST00000303961.4_Missense_Mutation_p.V336M			Q96KS0	EGLN2_HUMAN	egl-9 family hypoxia-inducible factor 2	336	Fe2OG dioxygenase. {ECO:0000255|PROSITE- ProRule:PRU00805}.				cell redox homeostasis (GO:0045454)|cellular response to hypoxia (GO:0071456)|intracellular estrogen receptor signaling pathway (GO:0030520)|peptidyl-proline hydroxylation to 4-hydroxy-L-proline (GO:0018401)|positive regulation of protein catabolic process (GO:0045732)|regulation of cell growth (GO:0001558)|regulation of neuron apoptotic process (GO:0043523)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|response to hypoxia (GO:0001666)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ferrous iron binding (GO:0008198)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|oxygen sensor activity (GO:0019826)|peptidyl-proline 4-dioxygenase activity (GO:0031545)			breast(2)|endometrium(1)|large_intestine(2)|lung(3)|ovary(2)	10			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)		Vitamin C(DB00126)	GGGCCGGCCCGTGGTAGCCAA	0.637											OREG0025478	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				0			19											60.0	60.0	60.0					19																	41313085		2203	4300	6503	46004925	SO:0001583	missense	112398			AJ310544	CCDS12567.1	19q13.2	2013-08-21	2013-08-21		ENSG00000269858	ENSG00000269858			14660	protein-coding gene	gene with protein product	"""HIF prolyl hydroxylase 1"""	606424	"""EGL nine (C.elegans) homolog 2"", ""egl nine homolog 2 (C. elegans)"""				Standard	NM_080732		Approved	PHD1, HIFPH1	uc002oph.3	Q96KS0		ENST00000593726.1:c.1006G>A	19.37:g.41313085G>A	ENSP00000469686:p.Val336Met	900	46004925	A8K5S0|Q8WWY4|Q9BV14	Missense_Mutation	SNP	HMMSmart_SM00702,HMMPfam_2OG-FeII_Oxy	p.V336M	ENST00000593726.1	37	c.1006	CCDS12567.1	19	.	.	.	.	.	.	.	.	.	.	G	18.65	3.670498	0.67814	.	.	ENSG00000171570	ENST00000303961;ENST00000406058	T;T	0.60424	0.19;0.19	5.1	5.1	0.69264	Oxoglutarate/iron-dependent oxygenase (2);Prolyl 4-hydroxylase, alpha subunit (1);	0.000000	0.85682	D	0.000000	T	0.73024	0.3534	M	0.73372	2.23	0.53688	D	0.999977	D	0.67145	0.996	D	0.64877	0.93	T	0.70586	-0.4831	10	0.32370	T	0.25	-14.0045	17.456	0.87607	0.0:0.0:1.0:0.0	.	336	Q96KS0	EGLN2_HUMAN	M	336	ENSP00000307080:V336M;ENSP00000385253:V336M	ENSP00000307080:V336M	V	+	1	0	EGLN2	46004925	0.991000	0.36638	0.976000	0.42696	0.964000	0.63967	2.009000	0.40903	2.644000	0.89710	0.655000	0.94253	GTG	-	HMMSmart_SM00702,HMMPfam_2OG-FeII_Oxy		0.637	EGLN2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	EGLN2	protein_coding	OTTHUMT00000463218.1	G			46004925	+1	no_errors	NM_053046	genbank	human	reviewed	54_36p	missense	SNP	0.990	A
SETD2	29072	genome.wustl.edu	37	3	47098685	47098685	+	Missense_Mutation	SNP	C	C	G			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr3:47098685C>G	ENST00000409792.3	-	15	6631	c.6589G>C	c.(6589-6591)Gtg>Ctg	p.V2197L		NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	2197	Low charge region.|Pro-rich.				angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)			breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		GGAGAACACACTGGGTCCATG	0.562			"""N, F, S, Mis"""		clear cell renal carcinoma																																		Rec	yes		3	3p21.31	29072	SET domain containing 2		E	0			3											103.0	87.0	93.0					3																	47098685		2203	4300	6503	47073689	SO:0001583	missense	29072			AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.6589G>C	3.37:g.47098685C>G	ENSP00000386759:p.Val2197Leu		47073689	O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Missense_Mutation	SNP	superfamily_Ferritin/RR_like,superfamily_SSF82199,HMMSmart_AWS,HMMPfam_SET,HMMSmart_SET,HMMSmart_PostSET,superfamily_WW_Rsp5_WWP,HMMSmart_WW,HMMPfam_WW,PatternScan_WW_DOMAIN_1,HMMPfam_SRI_2	p.V1694L	ENST00000409792.3	37	c.5080	CCDS2749.2	3	.	.	.	.	.	.	.	.	.	.	C	14.85	2.657866	0.47467	.	.	ENSG00000181555	ENST00000451092;ENST00000409792	T	0.44083	0.93	5.25	4.37	0.52481	.	0.110089	0.39146	N	0.001452	T	0.19725	0.0474	N	0.08118	0	0.34461	D	0.701798	B;B	0.24721	0.11;0.11	B;B	0.23150	0.044;0.044	T	0.13255	-1.0516	10	0.45353	T	0.12	.	4.9172	0.13851	0.0:0.7396:0.0:0.2604	.	2197;2197	F2Z317;Q9BYW2	.;SETD2_HUMAN	L	2197	ENSP00000386759:V2197L	ENSP00000386759:V2197L	V	-	1	0	SETD2	47073689	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.504000	0.53347	2.894000	0.99253	0.655000	0.94253	GTG	-	NULL		0.562	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETD2	protein_coding	OTTHUMT00000257479.2	C	NM_014159		47073689	-1	no_errors	NM_014159	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
GPR110	266977	genome.wustl.edu	37	6	46977895	46977895	+	Missense_Mutation	SNP	G	G	A			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr6:46977895G>A	ENST00000371253.2	-	11	1491	c.1276C>T	c.(1276-1278)Cgg>Tgg	p.R426W	GPR110_ENST00000283297.5_Missense_Mutation_p.R229W|GPR110_ENST00000449332.2_5'UTR	NM_153840.2	NP_722582.2	Q5T601	GP110_HUMAN	G protein-coupled receptor 110	426					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(2)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	29						ATGAATTTCCGAGAAAAATTC	0.428																																																0			6											79.0	76.0	77.0					6																	46977895		2203	4300	6503	47085854	SO:0001583	missense	266977			AB083618	CCDS4920.1, CCDS34471.1	6p21.1	2014-08-08			ENSG00000153292	ENSG00000153292		"""-"", ""GPCR / Class B : Orphans"""	18990	protein-coding gene	gene with protein product						12435584, 14623098	Standard	XM_005249006		Approved	hGPCR36, PGR19	uc003oyt.3	Q5T601	OTTHUMG00000014795	ENST00000371253.2:c.1276C>T	6.37:g.46977895G>A	ENSP00000360299:p.Arg426Trp		47085854	Q5KU15|Q5T5Z9|Q5T600|Q86SM1|Q8IXE3|Q8IZF8|Q96DQ1|Q9H615	Missense_Mutation	SNP	superfamily_SEA domain,HMMPfam_SEA,HMMPfam_GPS,HMMSmart_SM00303,HMMPfam_7tm_2	p.R426W	ENST00000371253.2	37	c.1276	CCDS34471.1	6	.	.	.	.	.	.	.	.	.	.	G	16.44	3.122909	0.56613	.	.	ENSG00000153292	ENST00000371252;ENST00000371253;ENST00000283297	T;T	0.35048	1.33;1.33	5.35	-4.99	0.03010	.	0.603370	0.14993	N	0.286596	T	0.20170	0.0485	M	0.67953	2.075	0.19775	N	0.999951	D	0.65815	0.995	B	0.44315	0.446	T	0.45190	-0.9278	10	0.72032	D	0.01	-0.0889	12.93	0.58282	0.0:0.5137:0.2528:0.2334	.	426	Q5T601	GP110_HUMAN	W	426;426;229	ENSP00000360299:R426W;ENSP00000283297:R229W	ENSP00000283297:R229W	R	-	1	2	GPR110	47085854	0.000000	0.05858	0.143000	0.22291	0.605000	0.37080	-1.065000	0.03458	-0.511000	0.06514	-0.314000	0.08810	CGG	-	NULL		0.428	GPR110-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR110	protein_coding	OTTHUMT00000040810.2	G	NM_153840		47085854	-1	no_errors	NM_153840	genbank	human	validated	54_36p	missense	SNP	0.000	A
CALM2	805	genome.wustl.edu	37	2	47389427	47389427	+	Missense_Mutation	SNP	T	T	C			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr2:47389427T>C	ENST00000272298.7	-	4	440	c.283A>G	c.(283-285)Aag>Gag	p.K95E	CALM2_ENST00000409563.1_Missense_Mutation_p.K142E|RP11-761B3.1_ENST00000422269.1_Intron|CALM2_ENST00000484408.1_5'UTR	NM_001743.4	NP_001734.1	P62158	CALM_HUMAN	calmodulin 2 (phosphorylase kinase, delta)	95	EF-hand 3. {ECO:0000255|PROSITE- ProRule:PRU00448}.				activation of adenylate cyclase activity (GO:0007190)|activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|carbohydrate metabolic process (GO:0005975)|detection of calcium ion (GO:0005513)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|innate immune response (GO:0045087)|inositol phosphate metabolic process (GO:0043647)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|negative regulation of ryanodine-sensitive calcium-release channel activity (GO:0060315)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nitric oxide metabolic process (GO:0046209)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cyclic nucleotide metabolic process (GO:0030801)|positive regulation of cyclic-nucleotide phosphodiesterase activity (GO:0051343)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of protein autophosphorylation (GO:0031954)|positive regulation of protein dephosphorylation (GO:0035307)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of cytokinesis (GO:0032465)|regulation of heart rate (GO:0002027)|regulation of high voltage-gated calcium channel activity (GO:1901841)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|response to amphetamine (GO:0001975)|response to calcium ion (GO:0051592)|response to corticosterone (GO:0051412)|rhodopsin mediated signaling pathway (GO:0016056)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)|synaptic transmission (GO:0007268)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcomere (GO:0030017)|spindle microtubule (GO:0005876)|spindle pole (GO:0000922)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)|N-terminal myristoylation domain binding (GO:0031997)|nitric-oxide synthase regulator activity (GO:0030235)|phospholipase binding (GO:0043274)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)|protein phosphatase activator activity (GO:0072542)|protein serine/threonine kinase activator activity (GO:0043539)|thioesterase binding (GO:0031996)|titin binding (GO:0031432)	p.0?(2)		kidney(1)|large_intestine(2)|lung(1)|skin(1)	5		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)	Lung(47;0.0792)|LUSC - Lung squamous cell carcinoma(58;0.114)		Aprindine(DB01429)|Bepridil(DB01244)|Chlorpromazine(DB00477)|Cinchocaine(DB00527)|Felodipine(DB01023)|Flunarizine(DB04841)|Fluphenazine(DB00623)|Isoflurane(DB00753)|Loperamide(DB00836)|Melatonin(DB01065)|Nicardipine(DB00622)|Nifedipine(DB01115)|Perphenazine(DB00850)|Phenoxybenzamine(DB00925)|Pimozide(DB01100)|Promethazine(DB01069)|Trifluoperazine(DB00831)	TGACGTACCTTATCAAACACA	0.343																																																2	Whole gene deletion(2)	haematopoietic_and_lymphoid_tissue(2)	2											94.0	85.0	88.0					2																	47389427		2203	4300	6503	47242931	SO:0001583	missense	805				CCDS1832.1	2p21.3-p21.1	2013-02-25			ENSG00000143933	ENSG00000143933		"""EF-hand domain containing"", ""Endogenous ligands"""	1445	protein-coding gene	gene with protein product	"""prepro-calmodulin 2"""	114182					Standard	NM_001743		Approved	PHKD, CAMII	uc002rvt.2	P62158	OTTHUMG00000128850	ENST00000272298.7:c.283A>G	2.37:g.47389427T>C	ENSP00000272298:p.Lys95Glu		47242931	P02593|P70667|P99014|Q13942|Q53S29|Q61379|Q61380|Q96HK3	Missense_Mutation	SNP	superfamily_EF-hand,HMMSmart_SM00054,HMMPfam_efhand,PatternScan_EF_HAND_1	p.K95E	ENST00000272298.7	37	c.283	CCDS1832.1	2	.	.	.	.	.	.	.	.	.	.	T	22.6	4.308178	0.81247	.	.	ENSG00000143933	ENST00000272298;ENST00000456319;ENST00000409563	D;D;D	0.88431	-2.38;-2.38;-2.38	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	D	0.93331	0.7874	.	.	.	0.80722	D	1	.	.	.	.	.	.	D	0.94059	0.7325	7	0.87932	D	0	.	15.6637	0.77209	0.0:0.0:0.0:1.0	.	.	.	.	E	95;133;142	ENSP00000272298:K95E;ENSP00000411440:K133E;ENSP00000387065:K142E	ENSP00000272298:K95E	K	-	1	0	CALM2	47242931	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.766000	0.85320	2.176000	0.68965	0.482000	0.46254	AAG	-	superfamily_EF-hand,HMMSmart_SM00054,HMMPfam_efhand,PatternScan_EF_HAND_1		0.343	CALM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CALM2	protein_coding	OTTHUMT00000250789.3	T	NM_001743		47242931	-1	no_errors	NM_001743	genbank	human	provisional	54_36p	missense	SNP	1.000	C
PPP1R21	129285	genome.wustl.edu	37	2	48701829	48701829	+	Missense_Mutation	SNP	G	G	A			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr2:48701829G>A	ENST00000294952.8	+	12	1253	c.1096G>A	c.(1096-1098)Gaa>Aaa	p.E366K	PPP1R21_ENST00000281394.4_Missense_Mutation_p.E366K|PPP1R21_ENST00000449090.2_Missense_Mutation_p.E366K	NM_001135629.2	NP_001129101.1	Q6ZMI0	PPR21_HUMAN	protein phosphatase 1, regulatory subunit 21	366						membrane (GO:0016020)	phosphatase binding (GO:0019902)			endometrium(2)|kidney(4)|lung(9)	15						TAGTTTAGAAGAAGAATGTGA	0.403																																																0			2											119.0	112.0	114.0					2																	48701829		2203	4300	6503	48555333	SO:0001583	missense	129285			AY134855	CCDS1839.1, CCDS46278.1, CCDS54358.1	2p16.3	2012-04-17	2011-10-11	2011-10-11	ENSG00000162869	ENSG00000162869		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	30595	protein-coding gene	gene with protein product			"""coiled-coil domain containing 128"", ""KLRAQ motif containing 1"""	CCDC128, KLRAQ1		12477932	Standard	NM_001135629		Approved	FLJ16566	uc002rwm.3	Q6ZMI0	OTTHUMG00000129167	ENST00000294952.8:c.1096G>A	2.37:g.48701829G>A	ENSP00000294952:p.Glu366Lys		48555333	B7ZKY5|B7ZKY7|E1B6W7|Q2TA78|Q6ZMI6|Q8IW83|Q8J029|Q96ES8	Missense_Mutation	SNP	HMMPfam_KLRAQ,HMMPfam_TTKRSYEDQ	p.E366K	ENST00000294952.8	37	c.1096	CCDS46278.1	2	.	.	.	.	.	.	.	.	.	.	G	32	5.144598	0.94603	.	.	ENSG00000162869	ENST00000281394;ENST00000294952;ENST00000449090	.	.	.	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	T	0.76941	0.4058	M	0.61703	1.905	0.80722	D	1	D;D;D;D	0.89917	0.999;0.999;0.998;1.0	D;D;D;D	0.85130	0.996;0.996;0.994;0.997	T	0.72544	-0.4261	9	0.25751	T	0.34	-16.6306	19.0557	0.93064	0.0:0.0:1.0:0.0	.	366;366;366;366	E1B6W7;Q6ZMI0;Q6ZMI0-2;Q6ZMI0-3	.;PPR21_HUMAN;.;.	K	366	.	ENSP00000281394:E366K	E	+	1	0	KLRAQ1	48555333	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.950000	0.93019	2.510000	0.84645	0.650000	0.86243	GAA	-	HMMPfam_TTKRSYEDQ		0.403	PPP1R21-009	KNOWN	basic|appris_principal|CCDS	protein_coding	KLRAQ1	protein_coding	OTTHUMT00000251238.4	G	NM_152994		48555333	+1	no_errors	NM_152994	genbank	human	validated	54_36p	missense	SNP	1.000	A
GPD1	2819	genome.wustl.edu	37	12	50500685	50500685	+	Silent	SNP	C	C	A			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr12:50500685C>A	ENST00000301149.3	+	5	829	c.597C>A	c.(595-597)atC>atA	p.I199I	GPD1_ENST00000548814.1_Silent_p.I176I|GPD1_ENST00000547190.1_3'UTR	NM_001257199.1|NM_005276.3	NP_001244128.1|NP_005267.2	P21695	GPDA_HUMAN	glycerol-3-phosphate dehydrogenase 1 (soluble)	199					cellular lipid metabolic process (GO:0044255)|cellular response to cAMP (GO:0071320)|cellular response to tumor necrosis factor (GO:0071356)|gluconeogenesis (GO:0006094)|glycerol-3-phosphate catabolic process (GO:0046168)|glycerophosphate shuttle (GO:0006127)|glycerophospholipid biosynthetic process (GO:0046474)|NADH oxidation (GO:0006116)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|positive regulation of glycolytic process (GO:0045821)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycerol-3-phosphate dehydrogenase complex (GO:0009331)|mitochondrion (GO:0005739)	glycerol-3-phosphate dehydrogenase [NAD+] activity (GO:0004367)|glycerol-3-phosphate dehydrogenase activity (GO:0004368)|NAD binding (GO:0051287)			breast(1)|endometrium(1)|large_intestine(1)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	8						CAGTAGAGATCTGTGGAGCCT	0.572																																					NSCLC(141;1402 1905 9497 13391 44868)											0			12											64.0	55.0	58.0					12																	50500685		2203	4300	6503	48786952	SO:0001819	synonymous_variant	2819				CCDS8799.1, CCDS58229.1	12q13.12	2013-09-20			ENSG00000167588	ENSG00000167588	1.1.1.8		4455	protein-coding gene	gene with protein product		138420					Standard	NM_005276		Approved		uc001rvz.4	P21695	OTTHUMG00000169813	ENST00000301149.3:c.597C>A	12.37:g.50500685C>A			48786952	F8W1L5|Q8N1B0	Silent	SNP	superfamily_NAD(P)-bd,HMMPfam_NAD_Gly3P_dh_N,HMMPfam_NAD_Gly3P_dh_C,superfamily_6DGDH_C_like,PatternScan_NAD_G3PDH	p.I199	ENST00000301149.3	37	c.597	CCDS8799.1	12																																																																																			-	HMMPfam_NAD_Gly3P_dh_C,superfamily_6DGDH_C_like		0.572	GPD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPD1	protein_coding	OTTHUMT00000406018.1	C			48786952	+1	no_errors	NM_005276	genbank	human	provisional	54_36p	silent	SNP	1.000	A
CRISP3	10321	genome.wustl.edu	37	6	49704164	49704164	+	Silent	SNP	C	C	T			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr6:49704164C>T	ENST00000393666.1	-	2	135	c.129G>A	c.(127-129)gtG>gtA	p.V43V	CRISP3_ENST00000433368.2_Silent_p.V66V|CRISP3_ENST00000423399.2_Intron|CRISP3_ENST00000263045.4_Silent_p.V56V|CRISP3_ENST00000371159.4_Silent_p.V74V			P54108	CRIS3_HUMAN	cysteine-rich secretory protein 3	43	SCP.				defense response (GO:0006952)|innate immune response (GO:0045087)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|specific granule (GO:0042581)		p.V43V(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(14)|skin(6)|upper_aerodigestive_tract(1)	27	Lung NSC(77;0.0161)		KIRC - Kidney renal clear cell carcinoma(2;0.106)|Kidney(12;0.156)			TGTGCTTATTCACAATCTCCC	0.413																																																1	Substitution - coding silent(1)	lung(1)	6											212.0	191.0	198.0					6																	49704164		2203	4300	6503	49812123	SO:0001819	synonymous_variant	10321			X94323	CCDS4929.1, CCDS4929.2, CCDS55019.1	6p12.3	2008-02-05			ENSG00000096006	ENSG00000096006			16904	protein-coding gene	gene with protein product						8665901, 12223513	Standard	NM_006061		Approved	SGP28, CRISP-3, CRS3, dJ442L6.3, Aeg2	uc003ozs.3	P54108	OTTHUMG00000014823	ENST00000393666.1:c.129G>A	6.37:g.49704164C>T			49812123	A8K9S1|B2R8I8|Q15512|Q3MJ82|Q53FA9|Q5JW83|Q9H108	Silent	SNP	superfamily_SCP-like_extracellular,HMMSmart_SCP,HMMPfam_SCP,PatternScan_CRISP_1,PatternScan_CRISP_2,HMMPfam_Crisp	p.V43	ENST00000393666.1	37	c.129		6																																																																																			-	superfamily_SCP-like_extracellular,HMMSmart_SCP,HMMPfam_SCP		0.413	CRISP3-201	KNOWN	basic|appris_principal	protein_coding	CRISP3	protein_coding		C	NM_006061		49812123	-1	no_errors	NM_006061	genbank	human	provisional	54_36p	silent	SNP	0.951	T
MST1R	4486	genome.wustl.edu	37	3	49924849	49924849	+	Missense_Mutation	SNP	G	G	T			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr3:49924849G>T	ENST00000296474.3	-	20	4121	c.4094C>A	c.(4093-4095)cCc>cAc	p.P1365H	MST1R_ENST00000344206.4_Missense_Mutation_p.P1316H	NM_002447.2	NP_002438	Q04912	RON_HUMAN	macrophage stimulating 1 receptor (c-met-related tyrosine kinase)	1365					cellular component movement (GO:0006928)|defense response (GO:0006952)|innate immune response (GO:0045087)|macrophage colony-stimulating factor signaling pathway (GO:0038145)|multicellular organismal development (GO:0007275)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|response to virus (GO:0009615)|signal transduction (GO:0007165)|single fertilization (GO:0007338)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|macrophage colony-stimulating factor receptor activity (GO:0005011)			cervix(1)|endometrium(5)|large_intestine(3)|lung(17)|ovary(5)|prostate(2)|skin(1)|urinary_tract(3)	37				BRCA - Breast invasive adenocarcinoma(193;4.65e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00553)|Kidney(197;0.00625)		CGAGGTGCTGGGGCCCAAGTT	0.597																																																0			3											129.0	116.0	121.0					3																	49924849		2203	4300	6503	49899853	SO:0001583	missense	4486			X70040	CCDS2807.1, CCDS58833.1	3p21	2008-08-18			ENSG00000164078	ENSG00000164078		"""CD molecules"""	7381	protein-coding gene	gene with protein product		600168	"""PTK8 protein tyrosine kinase 8"""	RON, PTK8		8386824	Standard	NM_002447		Approved	CDw136, CD136	uc003cxy.4	Q04912	OTTHUMG00000156709	ENST00000296474.3:c.4094C>A	3.37:g.49924849G>T	ENSP00000296474:p.Pro1365His		49899853	B5A944|B5A945|B5A946|B5A947	Missense_Mutation	SNP	superfamily_Sema domain,HMMSmart_SM00630,HMMPfam_Sema,superfamily_Plexin repeat,HMMPfam_PSI,HMMSmart_SM00423,superfamily_E set domains,HMMSmart_SM00429,HMMPfam_TIG,superfamily_Protein kinase-like (PK-like),HMMPfam_Pkinase_Tyr,HMMSmart_SM00219,HMMSmart_SM00220,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_TYR	p.P1365H	ENST00000296474.3	37	c.4094	CCDS2807.1	3	.	.	.	.	.	.	.	.	.	.	G	12.66	2.005418	0.35415	.	.	ENSG00000164078	ENST00000296474;ENST00000344206	T;T	0.74947	-0.88;-0.89	5.08	4.14	0.48551	.	0.243081	0.29609	N	0.011679	T	0.79857	0.4518	M	0.62723	1.935	0.31395	N	0.677325	D	0.71674	0.998	P	0.60173	0.87	T	0.81017	-0.1123	10	0.87932	D	0	-7.2617	8.5303	0.33331	0.116:0.0:0.884:0.0	.	1365	Q04912	RON_HUMAN	H	1365;1316	ENSP00000296474:P1365H;ENSP00000341325:P1316H	ENSP00000296474:P1365H	P	-	2	0	MST1R	49899853	0.685000	0.27652	0.823000	0.32752	0.006000	0.05464	0.896000	0.28377	1.381000	0.46364	0.655000	0.94253	CCC	-	superfamily_Protein kinase-like (PK-like)		0.597	MST1R-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MST1R	protein_coding	OTTHUMT00000345403.1	G			49899853	-1	no_errors	NM_002447	genbank	human	validated	54_36p	missense	SNP	0.925	T
OR4C13	283092	genome.wustl.edu	37	11	49974161	49974161	+	Missense_Mutation	SNP	T	T	C			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr11:49974161T>C	ENST00000555099.1	+	1	219	c.187T>C	c.(187-189)Tat>Cat	p.Y63H		NM_001001955.2	NP_001001955.2	Q8NGP0	OR4CD_HUMAN	olfactory receptor, family 4, subfamily C, member 13	63						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(24)|ovary(2)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	43						TTTCCTGGCCTATCTCTCCTT	0.428																																																0			11											247.0	225.0	233.0					11																	49974161		2201	4296	6497	49930737	SO:0001583	missense	283092			AB065750	CCDS31495.1	11p11.12	2012-10-03			ENSG00000258817	ENSG00000258817		"""GPCR / Class A : Olfactory receptors"""	15169	protein-coding gene	gene with protein product							Standard	NM_001001955		Approved		uc010rhz.2	Q8NGP0	OTTHUMG00000166686	ENST00000555099.1:c.187T>C	11.37:g.49974161T>C	ENSP00000452277:p.Tyr63His		49930737	A6NJJ3|B9EH30|Q6IF48|Q96R68	Missense_Mutation	SNP	PatternScan_G_PROTEIN_RECEP_F1_1,superfamily_SSF81321,HMMPfam_7tm_1	p.Y63H	ENST00000555099.1	37	c.187	CCDS31495.1	11	.	.	.	.	.	.	.	.	.	.	.	0.022	-1.410238	0.01145	.	.	ENSG00000258817	ENST00000555099	T	0.02974	4.09	2.95	1.8	0.24995	GPCR, rhodopsin-like superfamily (1);	0.000000	0.40640	N	0.001053	T	0.01029	0.0034	N	0.02357	-0.585	0.09310	N	1	B	0.02656	0.0	B	0.08055	0.003	T	0.47100	-0.9143	9	.	.	.	.	2.4201	0.04446	0.2387:0.14:0.0:0.6213	.	63	Q8NGP0	OR4CD_HUMAN	H	63	ENSP00000452277:Y63H	.	Y	+	1	0	OR4C13	49930737	0.000000	0.05858	0.638000	0.29380	0.095000	0.18619	-1.054000	0.03496	0.359000	0.24239	0.164000	0.16699	TAT	-	superfamily_SSF81321,HMMPfam_7tm_1		0.428	OR4C13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4C13	protein_coding	OTTHUMT00000391103.1	T	NM_001001955		49930737	+1	no_errors	NM_001001955	genbank	human	provisional	54_36p	missense	SNP	0.000	C
RPL7P13	130728	genome.wustl.edu	37	2	50106105	50106105	+	IGR	SNP	A	A	G			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr2:50106105A>G								RNU6-439P (645067 upstream) : SNORA75 (9900 downstream)																							TGCAGCTTCTACGCCTTTATC	0.433																																																0			2																																								49959609	SO:0001628	intergenic_variant	130728																															2.37:g.50106105A>G			49959609		RNA	SNP	-	NULL		37	NULL		2																																																																																			-	-	0	0.433					LOC130728			A			49959609	+1	pseudogene	XR_017361	genbank	human	model	54_36p	rna	SNP	0.997	G
PKHD1	5314	genome.wustl.edu	37	6	51524437	51524437	+	Missense_Mutation	SNP	A	A	C			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr6:51524437A>C	ENST00000371117.3	-	61	10762	c.10487T>G	c.(10486-10488)tTg>tGg	p.L3496W		NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	3496					cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					GAATACAGCCAAGAGAAGCTT	0.448																																																0			6											64.0	65.0	65.0					6																	51524437		2203	4300	6503	51632396	SO:0001583	missense	5314			AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.10487T>G	6.37:g.51524437A>C	ENSP00000360158:p.Leu3496Trp		51632396	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Missense_Mutation	SNP	superfamily_E set domains,HMMSmart_SM00429,HMMPfam_TIG,HMMSmart_SM00710,HMMPfam_G8,superfamily_Pectin lyase-like	p.L3496W	ENST00000371117.3	37	c.10487	CCDS4935.1	6	.	.	.	.	.	.	.	.	.	.	A	19.32	3.805244	0.70682	.	.	ENSG00000170927	ENST00000371117	D	0.88277	-2.36	4.99	4.99	0.66335	.	0.000000	0.53938	D	0.000048	D	0.89354	0.6691	L	0.34521	1.04	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.91429	0.5164	10	0.87932	D	0	.	14.5799	0.68282	1.0:0.0:0.0:0.0	.	3496	P08F94	PKHD1_HUMAN	W	3496	ENSP00000360158:L3496W	ENSP00000360158:L3496W	L	-	2	0	PKHD1	51632396	0.567000	0.26626	0.980000	0.43619	0.937000	0.57800	5.892000	0.69790	2.177000	0.69029	0.533000	0.62120	TTG	-	NULL		0.448	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PKHD1	protein_coding	OTTHUMT00000040893.1	A	NM_138694		51632396	-1	no_errors	NM_138694	genbank	human	reviewed	54_36p	missense	SNP	0.611	C
TMEM14A	28978	genome.wustl.edu	37	6	52546692	52546692	+	Missense_Mutation	SNP	G	G	A			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr6:52546692G>A	ENST00000211314.4	+	3	305	c.152G>A	c.(151-153)cGa>cAa	p.R51Q		NM_014051.3	NP_054770.1	Q9Y6G1	TM14A_HUMAN	transmembrane protein 14A	51						integral component of membrane (GO:0016021)				endometrium(2)|lung(2)	4	Lung NSC(77;0.118)					AATGACAAACGAGATGTAAAA	0.418																																																0			6											215.0	179.0	191.0					6																	52546692		2203	4300	6503	52654651	SO:0001583	missense	28978			AF239771	CCDS4943.1	6p12.3	2008-02-05			ENSG00000096092	ENSG00000096092			21076	protein-coding gene	gene with protein product							Standard	NM_014051		Approved	PTD011, C6orf73	uc003pax.3	Q9Y6G1	OTTHUMG00000014856	ENST00000211314.4:c.152G>A	6.37:g.52546692G>A	ENSP00000211314:p.Arg51Gln		52654651	B2R552	Missense_Mutation	SNP	HMMPfam_Tmemb_14	p.R51Q	ENST00000211314.4	37	c.152	CCDS4943.1	6	.	.	.	.	.	.	.	.	.	.	G	16.45	3.126195	0.56721	.	.	ENSG00000096092	ENST00000211314	T	0.41065	1.01	5.84	4.05	0.47172	.	0.117442	0.56097	D	0.000032	T	0.10121	0.0248	.	.	.	0.30729	N	0.747468	B	0.30179	0.271	B	0.26864	0.074	T	0.15809	-1.0424	9	0.12430	T	0.62	-21.0803	11.2884	0.49234	0.1537:0.0:0.8463:0.0	.	51	Q9Y6G1	TM14A_HUMAN	Q	51	ENSP00000211314:R51Q	ENSP00000211314:R51Q	R	+	2	0	TMEM14A	52654651	1.000000	0.71417	0.997000	0.53966	0.994000	0.84299	3.457000	0.53007	1.459000	0.47892	0.655000	0.94253	CGA	-	HMMPfam_Tmemb_14		0.418	TMEM14A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM14A	protein_coding	OTTHUMT00000040916.1	G	NM_014051		52654651	+1	no_errors	NM_014051	genbank	human	validated	54_36p	missense	SNP	0.989	A
PLEKHA4	57664	genome.wustl.edu	37	19	49362849	49362849	+	Missense_Mutation	SNP	C	C	T			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr19:49362849C>T	ENST00000263265.6	-	7	1124	c.569G>A	c.(568-570)cGc>cAc	p.R190H	PLEKHA4_ENST00000596713.1_5'UTR|PLEKHA4_ENST00000355496.5_Missense_Mutation_p.R190H	NM_020904.2	NP_065955.2	Q9H4M7	PKHA4_HUMAN	pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 4	190	Pro-rich.					cytoplasm (GO:0005737)|membrane (GO:0016020)	1-phosphatidylinositol binding (GO:0005545)			NS(1)|breast(5)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|prostate(3)|skin(2)|urinary_tract(2)	30		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;0.000108)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.00027)|all cancers(93;0.00084)|GBM - Glioblastoma multiforme(486;0.0244)|Epithelial(262;0.0364)		TTCTGAGATGCGCCCCTCTTC	0.682																																																0			19											61.0	48.0	53.0					19																	49362849		2203	4300	6503	54054661	SO:0001583	missense	57664			AY007233	CCDS12737.1, CCDS54291.1	19q13.33	2013-01-10	2002-01-14			ENSG00000105559		"""Pleckstrin homology (PH) domain containing"""	14339	protein-coding gene	gene with protein product		607769	"""pleckstrin homology domain-containing, family A (phosphoinositide binding specific) member 4"""			11001876	Standard	NM_020904		Approved	PEPP1	uc002pkx.3	Q9H4M7		ENST00000263265.6:c.569G>A	19.37:g.49362849C>T	ENSP00000263265:p.Arg190His		54054661	Q8N4M8|Q8N658	Missense_Mutation	SNP	superfamily_PH domain-like,HMMPfam_PH,HMMSmart_SM00233	p.R190H	ENST00000263265.6	37	c.569	CCDS12737.1	19	.	.	.	.	.	.	.	.	.	.	C	13.71	2.319046	0.41096	.	.	ENSG00000105559	ENST00000263265;ENST00000355496	T;T	0.14893	3.0;2.47	4.7	0.827	0.18835	.	0.427985	0.20686	N	0.087544	T	0.07908	0.0198	N	0.14661	0.345	0.09310	N	1	B;B	0.15719	0.014;0.008	B;B	0.11329	0.006;0.004	T	0.24119	-1.0169	10	0.42905	T	0.14	.	3.7214	0.08457	0.0:0.5256:0.193:0.2814	.	190;190	Q9H4M7-2;Q9H4M7	.;PKHA4_HUMAN	H	190	ENSP00000263265:R190H;ENSP00000347683:R190H	ENSP00000263265:R190H	R	-	2	0	PLEKHA4	54054661	0.001000	0.12720	0.001000	0.08648	0.782000	0.44232	-0.011000	0.12721	0.131000	0.18576	0.462000	0.41574	CGC	-	NULL		0.682	PLEKHA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHA4	protein_coding	OTTHUMT00000466216.1	C			54054661	-1	no_errors	NM_020904	genbank	human	provisional	54_36p	missense	SNP	0.015	T
PMEL	6490	genome.wustl.edu	37	12	56355485	56355485	+	Silent	SNP	T	T	G			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr12:56355485T>G	ENST00000548747.1	-	2	770	c.108A>C	c.(106-108)tcA>tcC	p.S36S	PMEL_ENST00000552882.1_Silent_p.S36S|PMEL_ENST00000548689.1_5'UTR|PMEL_ENST00000360714.4_Silent_p.S36S|PMEL_ENST00000449260.2_Silent_p.S36S|PMEL_ENST00000536427.1_Silent_p.S36S|PMEL_ENST00000550447.1_Intron|PMEL_ENST00000539511.1_Intron|PMEL_ENST00000550464.1_Intron|PMEL_ENST00000548493.1_Silent_p.S36S			P40967	PMEL_HUMAN	premelanosome protein	36					melanin biosynthetic process (GO:0042438)|melanosome organization (GO:0032438)	endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|melanosome (GO:0042470)|multivesicular body membrane (GO:0032585)|plasma membrane (GO:0005886)				NS(1)|breast(2)|endometrium(2)|large_intestine(4)|lung(4)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						TGAGTTGCCTTGAGACACCAA	0.502																																																0			12											98.0	98.0	98.0					12																	56355485		2203	4300	6503	54641752	SO:0001819	synonymous_variant	6490			AK092881	CCDS8897.1, CCDS55833.1, CCDS55834.1	12q13-q14	2010-12-17	2010-12-17	2010-12-17	ENSG00000185664	ENSG00000185664			10880	protein-coding gene	gene with protein product		155550	"""silver (mouse homolog) like"", ""silver homolog (mouse)"""	SIL, SILV		8739560	Standard	NM_001200053		Approved	D12S53E, SI, Pmel17, gp100	uc001siq.3	P40967		ENST00000548747.1:c.108A>C	12.37:g.56355485T>G			54641752	B3KS57|B7Z6D7|Q12763|Q14448|Q14817|Q16565	Silent	SNP	superfamily_PKD domain,HMMPfam_PKD,HMMSmart_SM00089	p.S36	ENST00000548747.1	37	c.108	CCDS8897.1	12																																																																																			-	NULL		0.502	PMEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SILV	protein_coding	OTTHUMT00000409626.1	T	NM_006928		54641752	-1	no_errors	NM_006928	genbank	human	validated	54_36p	silent	SNP	0.979	G
HCRTR2	3062	genome.wustl.edu	37	6	55113537	55113537	+	Silent	SNP	T	T	G			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr6:55113537T>G	ENST00000370862.3	+	2	660	c.324T>G	c.(322-324)ctT>ctG	p.L108L		NM_001526.3	NP_001517.2	O43614	OX2R_HUMAN	hypocretin (orexin) receptor 2	108					circadian sleep/wake cycle process (GO:0022410)|feeding behavior (GO:0007631)|neuropeptide signaling pathway (GO:0007218)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neuropeptide receptor activity (GO:0008188)|orexin receptor activity (GO:0016499)			breast(3)|endometrium(2)|kidney(1)|large_intestine(7)|lung(23)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	46	Lung NSC(77;0.107)|Renal(3;0.122)		LUSC - Lung squamous cell carcinoma(124;0.23)			TCACCTGCCTTCCAGCCACAC	0.448																																																0			6											229.0	209.0	216.0					6																	55113537		2203	4299	6502	55221496	SO:0001819	synonymous_variant	3062			AF041245	CCDS4956.1	6p12.1	2012-09-20			ENSG00000137252	ENSG00000137252		"""GPCR / Class A : Hypocretin (orexin) receptors"""	4849	protein-coding gene	gene with protein product		602393				9491897	Standard	NM_001526		Approved	OX2R	uc003pcl.3	O43614	OTTHUMG00000016150	ENST00000370862.3:c.324T>G	6.37:g.55113537T>G			55221496	Q5VTM0	Silent	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1,HMMPfam_Orexin_rec2	p.L108	ENST00000370862.3	37	c.324	CCDS4956.1	6																																																																																			-	superfamily_SSF81321,HMMPfam_7tm_1		0.448	HCRTR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCRTR2	protein_coding	OTTHUMT00000043392.1	T			55221496	+1	no_errors	NM_001526	genbank	human	reviewed	54_36p	silent	SNP	1.000	G
ZNF83	55769	genome.wustl.edu	37	19	53117621	53117621	+	Missense_Mutation	SNP	T	T	C			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr19:53117621T>C	ENST00000597597.1	-	2	2450	c.197A>G	c.(196-198)cAc>cGc	p.H66R	ZNF83_ENST00000536937.1_Missense_Mutation_p.H66R|ZNF83_ENST00000301096.3_Missense_Mutation_p.H66R|ZNF83_ENST00000601257.1_Intron|ZNF83_ENST00000545872.1_Missense_Mutation_p.H66R|ZNF83_ENST00000544146.1_Missense_Mutation_p.H66R|ZNF83_ENST00000391789.4_Missense_Mutation_p.H66R|ZNF83_ENST00000600714.1_Intron|ZNF83_ENST00000594682.2_3'UTR|ZNF83_ENST00000541777.2_Missense_Mutation_p.H66R			P51522	ZNF83_HUMAN	zinc finger protein 83	66					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	18				OV - Ovarian serous cystadenocarcinoma(262;0.00841)|GBM - Glioblastoma multiforme(134;0.0244)		ATGAGAAATGTGGGTTTTGAC	0.358																																																0			19											77.0	80.0	79.0					19																	53117621		2203	4300	6503	57809433	SO:0001583	missense	55769			M27877	CCDS12854.1	19q13.3	2013-01-08	2006-05-12			ENSG00000167766		"""Zinc fingers, C2H2-type"""	13158	protein-coding gene	gene with protein product		194558	"""zinc finger protein 83 (HPF1)"", ""zinc finger protein 816B"""	ZNF816B		8088807	Standard	NM_018300		Approved	FLJ11015, HPF1	uc010epy.3	P51522		ENST00000597597.1:c.197A>G	19.37:g.53117621T>C	ENSP00000472619:p.His66Arg		57809433	A8MT75|Q3ZCX0|Q6PI08	Missense_Mutation	SNP	superfamily_C2H2 and C2HC zinc fingers,HMMSmart_SM00355,HMMPfam_zf-C2H2,PatternScan_ZINC_FINGER_C2H2_1	p.H66R	ENST00000597597.1	37	c.197	CCDS12854.1	19	.	.	.	.	.	.	.	.	.	.	t	5.109	0.205797	0.09704	.	.	ENSG00000167766	ENST00000536937;ENST00000301096;ENST00000544146;ENST00000434535;ENST00000545872;ENST00000541777;ENST00000391789	T;T;T;T;T;T	0.08370	3.12;3.12;3.12;3.12;3.12;3.1	2.28	1.22	0.21188	.	.	.	.	.	T	0.11410	0.0278	L	0.58354	1.805	0.09310	N	1	B;D	0.59357	0.001;0.985	B;P	0.47206	0.002;0.541	T	0.18650	-1.0330	9	0.87932	D	0	.	5.3957	0.16268	0.0:0.1581:0.0:0.8419	.	66;66	P51522-2;P51522	.;ZNF83_HUMAN	R	66	ENSP00000445993:H66R;ENSP00000301096:H66R;ENSP00000445470:H66R;ENSP00000440713:H66R;ENSP00000439681:H66R;ENSP00000375666:H66R	ENSP00000301096:H66R	H	-	2	0	ZNF83	57809433	0.001000	0.12720	0.000000	0.03702	0.005000	0.04900	0.894000	0.28350	0.136000	0.18733	-0.353000	0.07706	CAC	-	NULL		0.358	ZNF83-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF83	protein_coding	OTTHUMT00000463700.1	T	NM_018300		57809433	-1	no_errors	NM_001105549	genbank	human	validated	54_36p	missense	SNP	0.003	C
PHACTR3	116154	genome.wustl.edu	37	20	58381107	58381107	+	Missense_Mutation	SNP	C	C	T			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr20:58381107C>T	ENST00000371015.1	+	8	1653	c.1186C>T	c.(1186-1188)Cgg>Tgg	p.R396W	PHACTR3_ENST00000541461.1_Missense_Mutation_p.R355W|PHACTR3_ENST00000395636.2_Missense_Mutation_p.R355W|PHACTR3_ENST00000355648.4_Missense_Mutation_p.R355W|PHACTR3_ENST00000395639.4_Missense_Mutation_p.R285W|PHACTR3_ENST00000361300.4_Missense_Mutation_p.R285W|PHACTR3_ENST00000359926.3_Missense_Mutation_p.R393W	NM_001281507.1|NM_080672.3	NP_001268436.1|NP_542403.1	Q96KR7	PHAR3_HUMAN	phosphatase and actin regulator 3	396						nucleus (GO:0005634)	protein phosphatase inhibitor activity (GO:0004864)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|liver(2)|lung(32)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	59	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;2.76e-09)			AACACTGCCACGGAAATGCAA	0.547																																																0			20											193.0	208.0	203.0					20																	58381107		2203	4300	6503	57814502	SO:0001583	missense	116154			AJ311122	CCDS13480.1, CCDS13481.1, CCDS42895.1, CCDS56202.1	20q13.32-q13.33	2014-06-13	2004-05-20	2004-05-20	ENSG00000087495	ENSG00000087495		"""Phosphatase and actin regulators"""	15833	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 123"""	608725	"""chromosome 20 open reading frame 101"""	C20orf101		15107502	Standard	NM_001199505		Approved	PPP1R123	uc002yau.3	Q96KR7	OTTHUMG00000032869	ENST00000371015.1:c.1186C>T	20.37:g.58381107C>T	ENSP00000360054:p.Arg396Trp		57814502	B1AKX0|B1AN68|B1AN69|B2RB46|Q32P33|Q707P6|Q9H4T4	Missense_Mutation	SNP	HMMSmart_SM00707,HMMPfam_RPEL	p.R396W	ENST00000371015.1	37	c.1186	CCDS13480.1	20	.	.	.	.	.	.	.	.	.	.	C	12.73	2.024513	0.35701	.	.	ENSG00000087495	ENST00000359926;ENST00000371015;ENST00000395639;ENST00000541461;ENST00000355648;ENST00000395636;ENST00000361300	T;T;T;T;T;T;T	0.34072	1.74;1.75;1.38;1.76;1.76;1.76;1.38	5.07	2.77	0.32553	.	0.000000	0.85682	D	0.000000	T	0.57431	0.2053	M	0.74258	2.255	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.982;0.982	T	0.58233	-0.7672	10	0.87932	D	0	-25.6526	11.567	0.50811	0.5299:0.4701:0.0:0.0	.	285;396;393	Q96KR7-3;Q96KR7;B1AKX0	.;PHAR3_HUMAN;.	W	393;396;285;355;355;355;285	ENSP00000353002:R393W;ENSP00000360054:R396W;ENSP00000379001:R285W;ENSP00000442483:R355W;ENSP00000347866:R355W;ENSP00000378998:R355W;ENSP00000354555:R285W	ENSP00000347866:R355W	R	+	1	2	PHACTR3	57814502	0.954000	0.32549	0.573000	0.28510	0.168000	0.22595	2.287000	0.43505	0.259000	0.21709	-0.271000	0.10264	CGG	-	NULL		0.547	PHACTR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHACTR3	protein_coding	OTTHUMT00000079923.3	C	NM_080672		57814502	+1	no_errors	NM_080672	genbank	human	reviewed	54_36p	missense	SNP	0.957	T
ERN1	2081	genome.wustl.edu	37	17	62122769	62122769	+	Missense_Mutation	SNP	G	G	T			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr17:62122769G>T	ENST00000433197.3	-	20	2698	c.2603C>A	c.(2602-2604)gCc>gAc	p.A868D		NM_001433.3	NP_001424.3			endoplasmic reticulum to nucleus signaling 1											central_nervous_system(4)|kidney(1)|lung(2)|ovary(1)|stomach(1)	9						CTTCACCACGGCTCTCCCGCC	0.572																																																0			17											70.0	76.0	74.0					17																	62122769		2047	4192	6239	59476501	SO:0001583	missense	2081			AF059198	CCDS45762.1	17q23	2011-08-12	2007-08-14			ENSG00000178607			3449	protein-coding gene	gene with protein product	"""inositol-requiring enzyme 1"""	604033	"""ER to nucleus signalling 1"""			9637683	Standard	NM_001433		Approved	IRE1, IRE1P	uc002jdz.2	O75460		ENST00000433197.3:c.2603C>A	17.37:g.62122769G>T	ENSP00000401445:p.Ala868Asp		59476501		Missense_Mutation	SNP	superfamily_Quinoprotein alcohol dehydrogenase-like,HMMSmart_SM00564,HMMPfam_PQQ,superfamily_Protein kinase-like (PK-like),HMMSmart_SM00219,HMMSmart_SM00220,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ST,HMMPfam_Ribonuc_2-5A,HMMSmart_SM00580	p.A868D	ENST00000433197.3	37	c.2603	CCDS45762.1	17	.	.	.	.	.	.	.	.	.	.	G	13.09	2.134490	0.37630	.	.	ENSG00000178607	ENST00000433197	T	0.30182	1.54	5.29	4.25	0.50352	KEN domain, ribonuclease activator (2);	0.267712	0.36555	N	0.002539	T	0.19886	0.0478	N	0.21097	0.63	0.40895	D	0.984107	B	0.15473	0.013	B	0.11329	0.006	T	0.05435	-1.0885	10	0.12103	T	0.63	-13.476	14.4916	0.67654	0.0:0.0:0.7801:0.2199	.	868	O75460	ERN1_HUMAN	D	868	ENSP00000401445:A868D	ENSP00000401445:A868D	A	-	2	0	ERN1	59476501	0.982000	0.34865	0.952000	0.39060	0.805000	0.45488	2.465000	0.45075	2.642000	0.89623	0.561000	0.74099	GCC	-	HMMPfam_Ribonuc_2-5A		0.572	ERN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERN1	protein_coding	OTTHUMT00000443734.2	G	NM_001433		59476501	-1	no_errors	NM_001433	genbank	human	reviewed	54_36p	missense	SNP	0.912	T
KHDRBS2	202559	genome.wustl.edu	37	6	62688073	62688073	+	Missense_Mutation	SNP	C	C	G			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr6:62688073C>G	ENST00000281156.4	-	4	659	c.381G>C	c.(379-381)ttG>ttC	p.L127F		NM_152688.2	NP_689901.2	Q5VWX1	KHDR2_HUMAN	KH domain containing, RNA binding, signal transduction associated 2	127	KH. {ECO:0000255|PROSITE- ProRule:PRU00117}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	poly(A) binding (GO:0008143)|poly(U) RNA binding (GO:0008266)			NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(5)|liver(1)|lung(13)|ovary(3)|prostate(3)|skin(12)|upper_aerodigestive_tract(2)|urinary_tract(1)	49				BRCA - Breast invasive adenocarcinoma(397;0.149)		GCTCATCACTCAAGTGGGCAT	0.368																																																0			6											124.0	110.0	114.0					6																	62688073		2203	4300	6503	62746032	SO:0001583	missense	202559			BC034043	CCDS4963.1	6q11.1	2013-09-20			ENSG00000112232	ENSG00000112232			18114	protein-coding gene	gene with protein product	"""Sam68-like mammalian protein 1"""	610487					Standard	NM_152688		Approved	SLM1, SLM-1, MGC26664	uc003peg.2	Q5VWX1	OTTHUMG00000014936	ENST00000281156.4:c.381G>C	6.37:g.62688073C>G	ENSP00000281156:p.Leu127Phe		62746032	A8K7M8|Q8N4I4|Q8TCZ4	Missense_Mutation	SNP	HMMSmart_KH,superfamily_SSF54791,HMMPfam_KH_1	p.L127F	ENST00000281156.4	37	c.381	CCDS4963.1	6	.	.	.	.	.	.	.	.	.	.	C	22.6	4.307101	0.81247	.	.	ENSG00000112232	ENST00000281156;ENST00000539571	T	0.18016	2.24	5.46	5.46	0.80206	K Homology (1);K Homology, type 1 (1);	0.000000	0.64402	D	0.000001	T	0.34919	0.0914	M	0.80028	2.48	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.15723	-1.0427	10	0.87932	D	0	-1.1753	12.6326	0.56665	0.0:0.9245:0.0:0.0755	.	127	Q5VWX1	KHDR2_HUMAN	F	127	ENSP00000281156:L127F	ENSP00000281156:L127F	L	-	3	2	KHDRBS2	62746032	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.977000	0.63792	2.569000	0.86673	0.650000	0.86243	TTG	-	HMMSmart_KH,superfamily_SSF54791		0.368	KHDRBS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KHDRBS2	protein_coding	OTTHUMT00000041066.2	C	NM_152688		62746032	-1	no_errors	NM_152688	genbank	human	validated	54_36p	missense	SNP	1.000	G
ZNF551	90233	genome.wustl.edu	37	19	58197899	58197899	+	Missense_Mutation	SNP	T	T	C			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr19:58197899T>C	ENST00000282296.5	+	3	441	c.256T>C	c.(256-258)Tct>Cct	p.S86P	AC003006.7_ENST00000599221.1_Intron|AC003006.7_ENST00000594684.1_Intron|ZNF551_ENST00000596085.1_Intron|ZNF551_ENST00000599402.1_3'UTR|ZNF551_ENST00000356715.4_Missense_Mutation_p.S70P			Q7Z340	ZN551_HUMAN	zinc finger protein 551	86	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(4)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)	15		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		GCAGAGTGTATCTATACAGGT	0.448																																																0			19											107.0	101.0	103.0					19																	58197899		2203	4300	6503	62889711	SO:0001583	missense	90233			BX538151	CCDS12959.1, CCDS12959.2	19q13.43	2013-09-20			ENSG00000204519	ENSG00000204519		"""Zinc fingers, C2H2-type"", ""-"""	25108	protein-coding gene	gene with protein product							Standard	NM_138347		Approved	DKFZp686H1038	uc002qpw.5	Q7Z340	OTTHUMG00000183470	ENST00000282296.5:c.256T>C	19.37:g.58197899T>C	ENSP00000282296:p.Ser86Pro		62889711	B4DU22|P17034|Q8N246|Q9BRY1	Missense_Mutation	SNP	superfamily_KRAB domain (Kruppel-associated box Pfam 01352),HMMPfam_KRAB,HMMSmart_SM00349,superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1	p.S70P	ENST00000282296.5	37	c.208	CCDS12959.2	19	.	.	.	.	.	.	.	.	.	.	T	7.854	0.724581	0.15439	.	.	ENSG00000204519	ENST00000356715;ENST00000282296	.	.	.	2.08	2.08	0.27032	Krueppel-associated box (2);	.	.	.	.	T	0.30417	0.0764	L	0.33485	1.01	0.09310	N	1	B	0.31859	0.343	B	0.33620	0.167	T	0.21930	-1.0231	8	0.49607	T	0.09	.	6.1547	0.20330	0.0:0.0:0.0:1.0	.	86	Q7Z340	ZN551_HUMAN	P	86;70	.	ENSP00000282296:S70P	S	+	1	0	ZNF551	62889711	0.000000	0.05858	0.001000	0.08648	0.004000	0.04260	0.043000	0.13971	1.208000	0.43306	0.454000	0.30748	TCT	-	HMMSmart_SM00349		0.448	ZNF551-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF551	protein_coding	OTTHUMT00000466803.2	T	NM_138347		62889711	+1	no_errors	NM_138347	genbank	human	validated	54_36p	missense	SNP	0.071	C
EDC4	23644	genome.wustl.edu	37	16	67915978	67915978	+	Missense_Mutation	SNP	C	C	A			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr16:67915978C>A	ENST00000358933.5	+	23	3365	c.3126C>A	c.(3124-3126)agC>agA	p.S1042R	NRN1L_ENST00000339176.3_5'Flank|CTC-479C5.10_ENST00000572067.1_lincRNA	NM_014329.4	NP_055144.3	Q6P2E9	EDC4_HUMAN	enhancer of mRNA decapping 4	1042					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(4)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	41		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0042)|Epithelial(162;0.0185)|all cancers(182;0.121)		TAGAGCGCAGCATACGGGATG	0.582																																																0			16											40.0	40.0	40.0					16																	67915978		2198	4300	6498	66473479	SO:0001583	missense	23644			U17474	CCDS10849.1	16q22.1	2008-02-05			ENSG00000038358	ENSG00000038358			17157	protein-coding gene	gene with protein product		606030				9067524	Standard	NM_014329		Approved	RCD-8, Ge-1, HEDLS	uc002eur.3	Q6P2E9	OTTHUMG00000137543	ENST00000358933.5:c.3126C>A	16.37:g.67915978C>A	ENSP00000351811:p.Ser1042Arg		66473479	A6NGM1|A8K4T4|Q13025|Q13826|Q6ZR12|Q7Z6H7	Missense_Mutation	SNP	superfamily_WD40 repeat-like,HMMSmart_SM00320,HMMPfam_WD40	p.S1042R	ENST00000358933.5	37	c.3126	CCDS10849.1	16	.	.	.	.	.	.	.	.	.	.	C	12.02	1.813090	0.32053	.	.	ENSG00000038358	ENST00000358933	.	.	.	5.81	1.25	0.21368	.	0.204937	0.52532	D	0.000065	T	0.13586	0.0329	N	0.08118	0	0.19575	N	0.999964	B	0.16166	0.016	B	0.12837	0.008	T	0.17868	-1.0355	9	0.15499	T	0.54	-14.0675	4.1862	0.10398	0.1026:0.5422:0.1485:0.2067	.	1042	Q6P2E9	EDC4_HUMAN	R	1042	.	ENSP00000351811:S1042R	S	+	3	2	EDC4	66473479	0.065000	0.20965	1.000000	0.80357	0.984000	0.73092	0.329000	0.19698	0.817000	0.34445	0.558000	0.71614	AGC	-	NULL		0.582	EDC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EDC4	protein_coding	OTTHUMT00000268874.2	C	NM_014329		66473479	+1	no_errors	NM_014329	genbank	human	validated	54_36p	missense	SNP	0.590	A
HEXA	3073	genome.wustl.edu	37	15	72641522	72641522	+	Missense_Mutation	SNP	T	T	C	rs199578185		TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr15:72641522T>C	ENST00000268097.5	-	8	1387	c.884A>G	c.(883-885)aAt>aGt	p.N295S	RP11-106M3.3_ENST00000570175.1_RNA|HEXA_ENST00000566304.1_Missense_Mutation_p.N306S|RP11-106M3.2_ENST00000379915.4_RNA|HEXA_ENST00000567159.1_Missense_Mutation_p.N295S|HEXA_ENST00000457859.2_Missense_Mutation_p.N103S|HEXA_ENST00000429918.2_Missense_Mutation_p.N122S	NM_000520.4	NP_000511.2	P06865	HEXA_HUMAN	hexosaminidase A (alpha polypeptide)	295			N -> S (in GM2G1; dbSNP:rs199578185). {ECO:0000269|PubMed:14566483}.		carbohydrate metabolic process (GO:0005975)|cell death (GO:0008219)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|glycosphingolipid metabolic process (GO:0006687)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)	beta-N-acetylhexosaminidase activity (GO:0004563)|protein heterodimerization activity (GO:0046982)			breast(2)|cervix(1)|endometrium(3)|kidney(3)|lung(7)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	24						ATAGGTATTATTGAGACTGGG	0.458													T|||	1	0.000199681	0.0	0.0	5008	,	,		21876	0.001		0.0	False		,,,				2504	0.0															0			15											92.0	88.0	89.0					15																	72641522		2199	4297	6496	70428576	SO:0001583	missense	3073			M13520	CCDS10243.1	15q24.1	2012-10-02			ENSG00000213614	ENSG00000213614	3.2.1.52		4878	protein-coding gene	gene with protein product	"""Tay Sachs disease"", ""GM2 gangliosidosis"""	606869				2952641, 3013851	Standard	NM_000520		Approved		uc002aun.4	P06865	OTTHUMG00000133445	ENST00000268097.5:c.884A>G	15.37:g.72641522T>C	ENSP00000268097:p.Asn295Ser		70428576	B4DKE7|E7ENH7|Q53HS8|Q6AI32	Missense_Mutation	SNP	superfamily_beta-N-acetylhexosaminidase-like domain,HMMPfam_Glyco_hydro_20b,HMMPfam_Glyco_hydro_20,superfamily_(Trans)glycosidases	p.N295S	ENST00000268097.5	37	c.884	CCDS10243.1	15	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	T	19.33	3.806412	0.70682	.	.	ENSG00000213614	ENST00000268097;ENST00000457859;ENST00000429918	D;D;D	0.96774	-4.12;-4.12;-4.12	5.61	5.61	0.85477	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);Glycoside hydrolase, family 20, catalytic core (1);Glycoside hydrolase, family 20 (1);	0.232274	0.43416	D	0.000570	D	0.96015	0.8702	M	0.63843	1.955	0.42493	D	0.992905	B;P;B;B;B	0.38048	0.001;0.616;0.002;0.0;0.094	B;B;B;B;B	0.44224	0.01;0.444;0.006;0.006;0.078	D	0.96010	0.9001	10	0.49607	T	0.09	-32.4345	15.8024	0.78463	0.0:0.0:0.0:1.0	.	122;306;122;175;295	E9PGL4;B4DVA7;B4DVL8;Q9BVJ8;P06865	.;.;.;.;HEXA_HUMAN	S	295;103;122	ENSP00000268097:N295S;ENSP00000398026:N103S;ENSP00000416187:N122S	ENSP00000268097:N295S	N	-	2	0	HEXA	70428576	1.000000	0.71417	0.968000	0.41197	0.963000	0.63663	3.986000	0.56937	2.143000	0.66587	0.533000	0.62120	AAT	-	HMMPfam_Glyco_hydro_20,superfamily_(Trans)glycosidases		0.458	HEXA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEXA	protein_coding	OTTHUMT00000257317.2	T	NM_000520		70428576	-1	no_errors	NM_000520	genbank	human	reviewed	54_36p	missense	SNP	0.981	C
CARD14	79092	genome.wustl.edu	37	17	78169374	78169374	+	Missense_Mutation	SNP	C	C	T	rs61751630	byFrequency	TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr17:78169374C>T	ENST00000573882.1	+	13	2053	c.1517C>T	c.(1516-1518)cCg>cTg	p.P506L	CARD14_ENST00000344227.2_Missense_Mutation_p.P506L|CARD14_ENST00000570421.1_Missense_Mutation_p.P506L|CARD14_ENST00000392434.2_Missense_Mutation_p.P269L|CARD14_ENST00000573754.1_3'UTR			Q9BXL6	CAR14_HUMAN	caspase recruitment domain family, member 14	506					activation of NF-kappaB-inducing kinase activity (GO:0007250)|apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein phosphorylation (GO:0001934)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	CARD domain binding (GO:0050700)			NS(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(11)|ovary(5)|prostate(1)|skin(1)	23	all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.017)|BRCA - Breast invasive adenocarcinoma(99;0.0908)			CTGGAGATCCCGGAGGGAGAC	0.642													C|||	78	0.0155751	0.0008	0.0043	5008	,	,		16802	0.001		0.0139	False		,,,				2504	0.0603															0			17						C	LEU/PRO,LEU/PRO	15,4391		0,15,2188	23.0	24.0	24.0		1517,806	1.4	0.0	17	dbSNP_129	24	145,8453		1,143,4155	yes	missense,missense	CARD14	NM_024110.3,NM_052819.2	98,98	1,158,6343	TT,TC,CC		1.6864,0.3404,1.2304	benign,benign	506/1005,269/435	78169374	160,12844	2203	4299	6502	75783969	SO:0001583	missense	79092			AF322642	CCDS11768.1, CCDS58605.1	17q25.3	2014-09-04			ENSG00000141527	ENSG00000141527			16446	protein-coding gene	gene with protein product		607211	"""psoriasis susceptibility 2"""	PSORS2		11278692, 11356195, 22521418	Standard	NM_052819		Approved	CARMA2, BIMP2	uc031res.1	Q9BXL6	OTTHUMG00000177549	ENST00000573882.1:c.1517C>T	17.37:g.78169374C>T	ENSP00000458715:p.Pro506Leu		75783969	B8QQJ3|Q9BVB5	Missense_Mutation	SNP	superfamily_DEATH domain,HMMPfam_CARD,superfamily_PDZ domain-like,superfamily_P-loop containing nucleoside triphosphate hydrolases	p.P506L	ENST00000573882.1	37	c.1517	CCDS11768.1	17	11	0.005036630036630037	0	0.0	1	0.0027624309392265192	0	0.0	10	0.013192612137203167	C	7.121	0.577985	0.13686	0.003404	0.016864	ENSG00000141527	ENST00000344227;ENST00000392434;ENST00000309710	T;T	0.24723	1.84;2.54	3.67	1.4	0.22301	.	1.619920	0.03323	N	0.192299	T	0.04588	0.0125	N	0.00972	-1.085	0.09310	N	1	B;B;B	0.06786	0.001;0.001;0.0	B;B;B	0.04013	0.0;0.001;0.0	T	0.18493	-1.0335	10	0.49607	T	0.09	-6.1674	5.4736	0.16684	0.0:0.2412:0.0:0.7588	rs61751630	506;269;506	B8QQJ3;E7ETJ2;Q9BXL6	.;.;CAR14_HUMAN	L	506;269;269	ENSP00000344549:P506L;ENSP00000376229:P269L	ENSP00000308507:P269L	P	+	2	0	CARD14	75783969	0.006000	0.16342	0.017000	0.16124	0.001000	0.01503	-0.079000	0.11357	0.143000	0.18926	-1.267000	0.01435	CCG	-	NULL		0.642	CARD14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CARD14	protein_coding	OTTHUMT00000437507.1	C			75783969	+1	no_errors	NM_024110	genbank	human	reviewed	54_36p	missense	SNP	0.006	T
ZFHX4	79776	genome.wustl.edu	37	8	77618037	77618037	+	Missense_Mutation	SNP	G	G	T			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr8:77618037G>T	ENST00000521891.2	+	2	2162	c.1714G>T	c.(1714-1716)Gct>Tct	p.A572S	ZFHX4_ENST00000517683.1_Intron|ZFHX4_ENST00000518282.1_Missense_Mutation_p.A572S|ZFHX4_ENST00000050961.6_Missense_Mutation_p.A572S|ZFHX4_ENST00000455469.2_Missense_Mutation_p.A572S	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	572					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			TGCCACAGCTGCTCATCCAAG	0.562										HNSCC(33;0.089)																																						0			8											55.0	60.0	59.0					8																	77618037		2112	4231	6343	77780592	SO:0001583	missense	79776				CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.1714G>T	8.37:g.77618037G>T	ENSP00000430497:p.Ala572Ser		77780592	G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	HMMSmart_SM00355,PatternScan_SOMATOTROPIN_2,superfamily_C2H2 and C2HC zinc fingers,PatternScan_ZINC_FINGER_C2H2_1,HMMPfam_zf-C2H2,HMMSmart_SM00451,superfamily_Homeodomain-like,HMMSmart_SM00389,HMMPfam_Homeobox,PatternScan_HOMEOBOX_1	p.A572S	ENST00000521891.2	37	c.1714	CCDS47878.2	8	.	.	.	.	.	.	.	.	.	.	G	9.500	1.102914	0.20632	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.47528	0.84;0.89;0.86;0.85	5.49	2.64	0.31445	.	0.623232	0.13204	U	0.405738	T	0.19525	0.0469	N	0.03115	-0.41	0.25032	N	0.991264	B;B;B;B	0.09022	0.001;0.002;0.002;0.001	B;B;B;B	0.10450	0.001;0.003;0.003;0.005	T	0.26430	-1.0103	10	0.07644	T	0.81	.	6.7456	0.23460	0.1788:0.2976:0.5236:0.0	.	572;572;572;572	Q86UP3;Q86UP3-4;G3V138;Q86UP3-3	ZFHX4_HUMAN;.;.;.	S	572	ENSP00000430497:A572S;ENSP00000399605:A572S;ENSP00000050961:A572S;ENSP00000430848:A572S	ENSP00000050961:A572S	A	+	1	0	ZFHX4	77780592	0.709000	0.27886	0.030000	0.17652	0.994000	0.84299	1.589000	0.36644	0.890000	0.36211	0.655000	0.94253	GCT	-	NULL		0.562	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZFHX4	protein_coding	OTTHUMT00000379197.2	G	NM_024721		77780592	+1	no_errors	NM_024721	genbank	human	validated	54_36p	missense	SNP	0.856	T
CSNK1D	1453	genome.wustl.edu	37	17	80213347	80213347	+	Missense_Mutation	SNP	C	C	A			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr17:80213347C>A	ENST00000314028.6	-	3	643	c.294G>T	c.(292-294)agG>agT	p.R98S	CSNK1D_ENST00000398519.5_Missense_Mutation_p.R98S|AC132872.2_ENST00000598222.1_5'Flank|CSNK1D_ENST00000578904.1_5'UTR|CSNK1D_ENST00000392334.2_Missense_Mutation_p.R98S	NM_001893.4	NP_001884.2	P48730	KC1D_HUMAN	casein kinase 1, delta	98	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				circadian regulation of gene expression (GO:0032922)|DNA repair (GO:0006281)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein phosphorylation (GO:0001934)|protein phosphorylation (GO:0006468)|regulation of circadian rhythm (GO:0042752)|signal transduction (GO:0007165)|spindle assembly (GO:0051225)|Wnt signaling pathway (GO:0016055)	centrosome (GO:0005813)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|spindle (GO:0005819)|spindle microtubule (GO:0005876)	ATP binding (GO:0005524)|peptide binding (GO:0042277)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)			breast(2)|large_intestine(2)|lung(7)	11	Breast(20;0.00136)|all_neural(118;0.0804)|Lung NSC(278;0.128)|all_lung(278;0.145)|Ovarian(332;0.227)		OV - Ovarian serous cystadenocarcinoma(97;0.00463)|BRCA - Breast invasive adenocarcinoma(99;0.0155)			GGCTGAATTTCCTGGAGCAGA	0.547																																																0			17											153.0	125.0	135.0					17																	80213347		2203	4300	6503	77806636	SO:0001583	missense	1453				CCDS11805.1, CCDS11806.1	17q25	2013-01-17				ENSG00000141551			2452	protein-coding gene	gene with protein product		600864				7797465	Standard	NM_001893		Approved	HCKID, CKID, CKIdelta	uc002kej.3	P48730		ENST00000314028.6:c.294G>T	17.37:g.80213347C>A	ENSP00000324464:p.Arg98Ser		77806636	A2I2P2|Q96KZ6|Q9BTN5	Missense_Mutation	SNP	superfamily_Protein kinase-like (PK-like),HMMPfam_Pkinase,HMMSmart_SM00219,HMMSmart_SM00220,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_ST	p.R98S	ENST00000314028.6	37	c.294	CCDS11805.1	17	.	.	.	.	.	.	.	.	.	.	C	20.1	3.931536	0.73442	.	.	ENSG00000141551	ENST00000314028;ENST00000392334;ENST00000398519;ENST00000403276	T;T;T	0.64991	-0.13;-0.13;-0.13	5.63	-0.58	0.11717	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.79221	0.4409	M	0.92317	3.295	0.58432	D	0.999999	D;D;D	0.89917	0.998;1.0;1.0	D;D;D	0.97110	0.937;0.989;1.0	T	0.78041	-0.2359	10	0.87932	D	0	.	7.834	0.29360	0.0:0.6003:0.112:0.2877	.	98;98;41	P48730;P48730-2;B4E0G1	KC1D_HUMAN;.;.	S	98;98;41;98	ENSP00000324464:R98S;ENSP00000376146:R98S;ENSP00000385769:R98S	ENSP00000324464:R98S	R	-	3	2	CSNK1D	77806636	0.006000	0.16342	0.981000	0.43875	0.973000	0.67179	-1.011000	0.03652	0.044000	0.15775	-0.142000	0.14014	AGG	-	superfamily_Protein kinase-like (PK-like),HMMPfam_Pkinase,HMMSmart_SM00219,HMMSmart_SM00220		0.547	CSNK1D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CSNK1D	protein_coding	OTTHUMT00000442632.1	C	NM_139062		77806636	-1	no_errors	NM_001893	genbank	human	reviewed	54_36p	missense	SNP	0.988	A
POU4F1	5457	genome.wustl.edu	37	13	79175778	79175778	+	Missense_Mutation	SNP	C	C	G			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr13:79175778C>G	ENST00000377208.5	-	2	1243	c.1032G>C	c.(1030-1032)atG>atC	p.M344I	RNF219-AS1_ENST00000606376.1_RNA|RNF219-AS1_ENST00000560584.2_RNA|RNF219-AS1_ENST00000606124.1_RNA|RP11-52L5.6_ENST00000607269.1_RNA|RNF219-AS1_ENST00000560209.2_RNA|RNF219-AS1_ENST00000607205.1_RNA|RNF219-AS1_ENST00000607220.1_RNA|RNF219-AS1_ENST00000606429.1_RNA|RNF219-AS1_ENST00000430549.2_RNA|RNF219-AS1_ENST00000607860.1_RNA|RNF219-AS1_ENST00000444769.3_RNA	NM_006237.3	NP_006228.3	Q01851	PO4F1_HUMAN	POU class 4 homeobox 1	344					axonogenesis (GO:0007409)|cell migration in hindbrain (GO:0021535)|central nervous system neuron differentiation (GO:0021953)|habenula development (GO:0021986)|innervation (GO:0060384)|mesoderm development (GO:0007498)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron fate specification (GO:0048665)|peripheral nervous system neuron development (GO:0048935)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proprioception involved in equilibrioception (GO:0051355)|regulation of neurogenesis (GO:0050767)|sensory system development (GO:0048880)|suckling behavior (GO:0001967)|synapse assembly (GO:0007416)|transcription from RNA polymerase II promoter (GO:0006366)|trigeminal nerve development (GO:0021559)|ventricular compact myocardium morphogenesis (GO:0003223)	neuron projection (GO:0043005)|nuclear chromatin (GO:0000790)	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)			central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(4)|lung(5)|ovary(1)	16		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.0848)		GBM - Glioblastoma multiforme(99;0.129)		CAGGCTTGTTCATTTTCTCGC	0.647																																					Melanoma(109;347 2166 14574 42843)|Ovarian(81;1394 1854 22417 48351)											0			13											28.0	30.0	29.0					13																	79175778		2203	4300	6503	78073779	SO:0001583	missense	5457			X64624	CCDS31996.1	13q31.1	2011-06-20	2007-07-13		ENSG00000152192	ENSG00000152192		"""Homeoboxes / POU class"""	9218	protein-coding gene	gene with protein product		601632	"""POU domain class 4, transcription factor 1"""	BRN3A		1357630	Standard	NM_006237		Approved	RDC-1	uc001vkv.3	Q01851	OTTHUMG00000017119	ENST00000377208.5:c.1032G>C	13.37:g.79175778C>G	ENSP00000366413:p.Met344Ile		78073779	Q14986|Q15318|Q5T227	Missense_Mutation	SNP	HMMPfam_Pou,HMMSmart_SM00352,superfamily_lambda repressor-like DNA-binding domains,PatternScan_POU_1,PatternScan_POU_2,superfamily_Homeodomain-like,HMMSmart_SM00389,HMMPfam_Homeobox,PatternScan_HOMEOBOX_1	p.M344I	ENST00000377208.5	37	c.1032	CCDS31996.1	13	.	.	.	.	.	.	.	.	.	.	C	12.81	2.048216	0.36181	.	.	ENSG00000152192	ENST00000377208	D	0.83673	-1.75	4.14	1.79	0.24919	Homeodomain-related (1);Homeodomain-like (1);	0.102493	0.64402	D	0.000003	T	0.70020	0.3176	L	0.33293	1	0.38227	D	0.940935	B	0.12013	0.005	B	0.11329	0.006	T	0.58375	-0.7647	10	0.33940	T	0.23	.	6.0412	0.19736	0.0:0.541:0.3202:0.1388	.	344	Q01851	PO4F1_HUMAN	I	344	ENSP00000366413:M344I	ENSP00000366413:M344I	M	-	3	0	POU4F1	78073779	1.000000	0.71417	0.988000	0.46212	0.994000	0.84299	4.730000	0.62015	0.102000	0.17638	0.499000	0.49734	ATG	-	superfamily_Homeodomain-like		0.647	POU4F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POU4F1	protein_coding	OTTHUMT00000045360.3	C			78073779	-1	no_errors	NM_006237	genbank	human	validated	54_36p	missense	SNP	1.000	G
CMYA5	202333	genome.wustl.edu	37	5	79030432	79030432	+	Silent	SNP	G	G	A			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr5:79030432G>A	ENST00000446378.2	+	2	5875	c.5844G>A	c.(5842-5844)ccG>ccA	p.P1948P		NM_153610.3	NP_705838.3	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	1948					negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|regulation of skeletal muscle adaptation (GO:0014733)	costamere (GO:0043034)				NS(2)|breast(4)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(37)|lung(34)|ovary(6)|pancreas(2)|prostate(5)|skin(5)|stomach(11)|upper_aerodigestive_tract(3)|urinary_tract(1)	128		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		AGGTCCTGCCGCATTCTGCTG	0.463																																																0			5											64.0	62.0	63.0					5																	79030432		1940	4147	6087	79066188	SO:0001819	synonymous_variant	202333			AW755254, AL831986	CCDS47238.1	5q14.1	2013-02-11			ENSG00000164309	ENSG00000164309		"""Tripartite motif containing / Tripartite motif containing"", ""A-kinase anchor proteins"", ""Fibronectin type III domain containing"""	14305	protein-coding gene	gene with protein product	"""genethonin-3"", ""tripartite motif-containing 76"""	612193	"""chromosome 5 open reading frame 10"""	C5orf10		14688250	Standard	NM_153610		Approved	myospryn, SPRYD2, DKFZp451G223, TRIM76	uc003kgc.3	Q8N3K9	OTTHUMG00000162548	ENST00000446378.2:c.5844G>A	5.37:g.79030432G>A			79066188	A0PJB7|Q05CT4|Q2NKX1|Q2T9G9|Q69YQ8|Q69YQ9|Q6P517|Q6P5U3|Q7Z4I1|Q86T34|Q86T49|Q8N3S4|Q8N3S7|Q8NAG8|Q9UK88	Silent	SNP	superfamily_FN_III-like,HMMPfam_fn3,HMMSmart_FN3,HMMPfam_SPRY	p.P1948	ENST00000446378.2	37	c.5844	CCDS47238.1	5																																																																																			-	NULL		0.463	CMYA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CMYA5	protein_coding	OTTHUMT00000369497.1	G	NM_153610		79066188	+1	no_errors	NM_153610	genbank	human	validated	54_36p	silent	SNP	0.000	A
Unknown	0	genome.wustl.edu	37	5	86180186	86180186	+	IGR	SNP	G	G	A			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr5:86180186G>A								CTC-493L21.2 (84089 upstream) : RP11-72L22.1 (82951 downstream)																							TCATCTTCACGTGACCAACAG	0.443																																																0			5																																								86215942	SO:0001628	intergenic_variant	728979																															5.37:g.86180186G>A			86215942		RNA	SNP	-	NULL		37	NULL		5																																																																																			-	-	0	0.443					LOC728979			G			86215942	-1	pseudogene	XR_015799	genbank	human	model	54_36p	rna	SNP	1.000	A
RGPD2	729857	genome.wustl.edu	37	2	88071826	88071826	+	Missense_Mutation	SNP	C	C	T			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr2:88071826C>T	ENST00000398146.3	-	22	5320	c.5098G>A	c.(5098-5100)Gtg>Atg	p.V1700M	RGPD2_ENST00000327544.6_Missense_Mutation_p.V957M|RGPD2_ENST00000420840.2_Missense_Mutation_p.V1692M			P0DJD1	RGPD2_HUMAN	RANBP2-like and GRIP domain containing 2	1700	GRIP. {ECO:0000255|PROSITE- ProRule:PRU00250}.				protein targeting to Golgi (GO:0000042)					breast(1)|pancreas(1)	2						AAGTGTTCCACGTTAGCTGCA	0.418																																																0			2											2.0	2.0	2.0					2																	88071826		554	1364	1918	87852941	SO:0001583	missense	729857				CCDS42710.1, CCDS42710.2	2p11.2	2013-01-10			ENSG00000185304	ENSG00000185304		"""Tetratricopeptide (TTC) repeat domain containing"""	32415	protein-coding gene	gene with protein product		612705				15710750, 15815621	Standard	NM_001078170		Approved	RGP2, RANBP2L2		P0DJD1	OTTHUMG00000153276	ENST00000398146.3:c.5098G>A	2.37:g.88071826C>T	ENSP00000381214:p.Val1700Met		87852941	P0C839|Q68DN6|Q6V1X0	Missense_Mutation	SNP	superfamily_SSF50729,HMMSmart_RanBD,HMMPfam_Ran_BP1,HMMPfam_GRIP,HMMSmart_Grip	p.V957M	ENST00000398146.3	37	c.2869	CCDS42710.2	2	.	.	.	.	.	.	.	.	.	.	c	5.427	0.263841	0.10294	.	.	ENSG00000185304	ENST00000398146;ENST00000420840;ENST00000469984;ENST00000327544	T;T;T	0.36878	1.23;1.23;2.39	.	.	.	.	.	.	.	.	T	0.13157	0.0319	N	0.02751	-0.505	0.23386	N	0.99778	B	0.26744	0.158	B	0.17722	0.019	T	0.17806	-1.0357	8	0.62326	D	0.03	-2.331	3.5985	0.08016	2.0E-4:0.5013:0.4982:2.0E-4	.	1700	B4DYH0	.	M	1700;1692;611;957	ENSP00000381214:V1700M;ENSP00000413275:V1692M;ENSP00000332727:V957M	ENSP00000332727:V957M	V	-	1	0	RGPD2	87852941	1.000000	0.71417	0.356000	0.25785	0.356000	0.29392	1.646000	0.37249	0.064000	0.16427	0.064000	0.15345	GTG	-	HMMPfam_GRIP,HMMSmart_Grip		0.418	RGPD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RGPD2	protein_coding	OTTHUMT00000330534.2	C	NM_001078170		87852941	-1	no_errors	NM_001078170	genbank	human	provisional	54_36p	missense	SNP	1.000	T
ZNF804B	219578	genome.wustl.edu	37	7	88963902	88963902	+	Missense_Mutation	SNP	C	C	T			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr7:88963902C>T	ENST00000333190.4	+	4	2215	c.1606C>T	c.(1606-1608)Cca>Tca	p.P536S		NM_181646.2	NP_857597.1	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	536							metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(5)|kidney(5)|large_intestine(20)|lung(78)|ovary(5)|pancreas(5)|prostate(2)|skin(11)|soft_tissue(1)|upper_aerodigestive_tract(9)	144	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			ATATCCGAAACCAAAGACGAT	0.363										HNSCC(36;0.09)																																						0			7											48.0	50.0	49.0					7																	88963902		2202	4298	6500	88801838	SO:0001583	missense	219578			AK056672	CCDS5613.1	7q21.13	2012-10-05	2006-12-18		ENSG00000182348	ENSG00000182348			21958	protein-coding gene	gene with protein product			"""zinc finger 804B"""				Standard	NM_181646		Approved	FLJ32110	uc011khi.2	A4D1E1	OTTHUMG00000131037	ENST00000333190.4:c.1606C>T	7.37:g.88963902C>T	ENSP00000329638:p.Pro536Ser		88801838	B2RTV2|Q7Z714|Q96MN7	Missense_Mutation	SNP	HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1	p.P536S	ENST00000333190.4	37	c.1606	CCDS5613.1	7	.	.	.	.	.	.	.	.	.	.	C	16.08	3.022402	0.54683	.	.	ENSG00000182348	ENST00000333190	T	0.20332	2.08	5.35	5.35	0.76521	.	0.000000	0.64402	D	0.000005	T	0.48223	0.1488	M	0.69823	2.125	0.46416	D	0.999032	D	0.89917	1.0	D	0.74674	0.984	T	0.44711	-0.9310	10	0.72032	D	0.01	-17.7365	19.253	0.93933	0.0:1.0:0.0:0.0	.	536	A4D1E1	Z804B_HUMAN	S	536	ENSP00000329638:P536S	ENSP00000329638:P536S	P	+	1	0	ZNF804B	88801838	1.000000	0.71417	1.000000	0.80357	0.476000	0.33039	5.597000	0.67577	2.785000	0.95823	0.655000	0.94253	CCA	-	NULL		0.363	ZNF804B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF804B	protein_coding	OTTHUMT00000253683.2	C	NM_181646		88801838	+1	no_errors	NM_181646	genbank	human	provisional	54_36p	missense	SNP	1.000	T
EIF4BP3	100128771	genome.wustl.edu	37	9	98908844	98908844	+	IGR	SNP	C	C	T	rs142772007	byFrequency	TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr9:98908844C>T								Y_RNA (43388 upstream) : HSD17B3 (88743 downstream)																							TTCTTTTGGCCGTGATAGAAA	0.478													C|||	91	0.0181709	0.0651	0.0043	5008	,	,		19976	0.0		0.002	False		,,,				2504	0.0															0			9																																								97948665	SO:0001628	intergenic_variant	0																															9.37:g.98908844C>T			97948665		RNA	SNP	-	NULL		37	NULL		9																																																																																			-	-	0	0.478					LOC100128771			C			97948665	+1	pseudogene	XR_037860	genbank	human	model	54_36p	rna	SNP	0.009	T
TMEM130	222865	genome.wustl.edu	37	7	98460786	98460786	+	Nonsense_Mutation	SNP	C	C	T			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr7:98460786C>T	ENST00000416379.2	-	2	327	c.323G>A	c.(322-324)tGg>tAg	p.W108*	TMEM130_ENST00000546258.1_Nonsense_Mutation_p.W89*|TMEM130_ENST00000339375.4_Nonsense_Mutation_p.W108*|TMEM130_ENST00000345589.4_Intron|TMEM130_ENST00000450876.1_Nonsense_Mutation_p.W24*			Q8N3G9	TM130_HUMAN	transmembrane protein 130	108						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(7)|lung(6)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	25	all_cancers(62;4.05e-09)|all_epithelial(64;2.62e-09)|Lung NSC(181;0.01)|all_lung(186;0.0115)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			GGCAGTGACCCAGACAGAGAC	0.617																																																0			7											61.0	61.0	61.0					7																	98460786		2203	4300	6503	98298722	SO:0001587	stop_gained	222865				CCDS5658.1, CCDS47649.1, CCDS47650.1	7q22.1	2006-03-09			ENSG00000166448	ENSG00000166448			25429	protein-coding gene	gene with protein product						12975309	Standard	NM_152913		Approved	DKFZp761L1417, FLJ42643	uc003upo.3	Q8N3G9	OTTHUMG00000154419	ENST00000416379.2:c.323G>A	7.37:g.98460786C>T	ENSP00000413163:p.Trp108*		98298722	A4D266|B7Z364|Q8IY46|Q8N0W9|Q8N3R2	Nonsense_Mutation	SNP	superfamily_PKD domain	p.W108*	ENST00000416379.2	37	c.323	CCDS47650.1	7	.	.	.	.	.	.	.	.	.	.	C	33	5.207885	0.95033	.	.	ENSG00000166448	ENST00000416379;ENST00000339375;ENST00000450876;ENST00000546258;ENST00000445790	.	.	.	4.48	4.48	0.54585	.	0.000000	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09084	T	0.74	-15.0099	13.3884	0.60809	0.0:1.0:0.0:0.0	.	.	.	.	X	108;108;24;89;24	.	ENSP00000341256:W108X	W	-	2	0	TMEM130	98298722	1.000000	0.71417	1.000000	0.80357	0.459000	0.32528	3.807000	0.55591	2.432000	0.82394	0.505000	0.49811	TGG	-	NULL		0.617	TMEM130-008	KNOWN	basic|CCDS	protein_coding	TMEM130	protein_coding	OTTHUMT00000380713.1	C	NM_152913		98298722	-1	no_errors	NM_152913	genbank	human	validated	54_36p	nonsense	SNP	1.000	T
MITD1	129531	genome.wustl.edu	37	2	99797432	99797432	+	Missense_Mutation	SNP	C	C	T			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr2:99797432C>T	ENST00000289359.2	-	1	89	c.13G>A	c.(13-15)Ggg>Agg	p.G5R	MRPL30_ENST00000338148.3_5'Flank|C2orf15_ENST00000512183.2_5'Flank|MRPL30_ENST00000409145.1_5'Flank|MRPL30_ENST00000410042.1_Intron|MITD1_ENST00000466880.1_5'Flank	NM_138798.1	NP_620153.1	Q8WV92	MITD1_HUMAN	MIT, microtubule interacting and transport, domain containing 1	5					cytokinetic cell separation (GO:0000920)|mitotic cytokinesis (GO:0000281)|mitotic cytokinetic cell separation (GO:1902409)|negative regulation of protein binding (GO:0032091)|transport (GO:0006810)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|intracellular membrane-bounded organelle (GO:0043231)|midbody (GO:0030496)	phosphatidylinositol binding (GO:0035091)|protein domain specific binding (GO:0019904)|protein homodimerization activity (GO:0042803)			large_intestine(3)|lung(2)|ovary(1)	6						TGCCTCAGCCCGGACTTCGCC	0.587																																																0			2											40.0	38.0	38.0					2																	99797432		2203	4300	6503	99163864	SO:0001583	missense	129531			BC018453	CCDS2040.1	2q11.2	2006-07-14			ENSG00000158411	ENSG00000158411			25207	protein-coding gene	gene with protein product						16730941	Standard	NM_138798		Approved	LOC129531	uc002szs.1	Q8WV92	OTTHUMG00000130638	ENST00000289359.2:c.13G>A	2.37:g.99797432C>T	ENSP00000289359:p.Gly5Arg		99163864	Q69YV0	Missense_Mutation	SNP	HMMSmart_MIT,HMMPfam_MIT	p.G5R	ENST00000289359.2	37	c.13	CCDS2040.1	2	.	.	.	.	.	.	.	.	.	.	C	15.70	2.910339	0.52439	.	.	ENSG00000158411	ENST00000289359;ENST00000409107	T;T	0.44482	0.92;0.92	5.19	-3.12	0.05282	.	1.058890	0.07273	N	0.869490	T	0.19525	0.0469	N	0.08118	0	0.09310	N	1	B	0.14438	0.01	B	0.06405	0.002	T	0.22417	-1.0217	10	0.23891	T	0.37	.	7.2423	0.26104	0.0:0.2595:0.4254:0.3151	.	5	Q8WV92	MITD1_HUMAN	R	5	ENSP00000289359:G5R;ENSP00000387316:G5R	ENSP00000289359:G5R	G	-	1	0	MITD1	99163864	0.000000	0.05858	0.000000	0.03702	0.052000	0.14988	-0.212000	0.09319	-0.485000	0.06754	0.643000	0.83706	GGG	-	NULL		0.587	MITD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MITD1	protein_coding	OTTHUMT00000253126.1	C	NM_138798		99163864	-1	no_errors	NM_138798	genbank	human	provisional	54_36p	missense	SNP	0.000	T
GNPTAB	79158	genome.wustl.edu	37	12	102190522	102190522	+	Nonsense_Mutation	SNP	G	G	A	rs78347057	byFrequency	TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr12:102190522G>A	ENST00000299314.7	-	2	398	c.136C>T	c.(136-138)Cga>Tga	p.R46*	GNPTAB_ENST00000549940.1_Nonsense_Mutation_p.R46*|GNPTAB_ENST00000549165.1_Nonsense_Mutation_p.R46*|RNU6-172P_ENST00000411000.1_RNA|GNPTAB_ENST00000392919.4_Nonsense_Mutation_p.R46*	NM_024312.4	NP_077288.2	Q3T906	GNPTA_HUMAN	N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits	46					carbohydrate phosphorylation (GO:0046835)|cell differentiation (GO:0030154)|lysosome organization (GO:0007040)|protein secretion (GO:0009306)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|UDP-N-acetylglucosamine-lysosomal-enzyme N-acetylglucosaminephosphotransferase activity (GO:0003976)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(8)|lung(8)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	37						TATTGATCTCGGCTCCATTCC	0.323																																																0			12											107.0	107.0	107.0					12																	102190522		2203	4300	6503	100714653	SO:0001587	stop_gained	79158			AY687932	CCDS9088.1	12q23.3	2013-01-10				ENSG00000111670		"""EF-hand domain containing"""	29670	protein-coding gene	gene with protein product		607840		GNPTA		10574462, 16116615	Standard	NM_024312		Approved	KIAA1208, MGC4170	uc001tit.3	Q3T906	OTTHUMG00000170444	ENST00000299314.7:c.136C>T	12.37:g.102190522G>A	ENSP00000299314:p.Arg46*		100714653	A2RRQ9|Q3ZQK2|Q6IPW5|Q86TQ2|Q96N13|Q9ULL2	Nonsense_Mutation	SNP	HMMSmart_SM00004,HMMPfam_Notch,superfamily_Notch domain,HMMPfam_DMAP_binding,PatternScan_EF_HAND_1	p.R46*	ENST00000299314.7	37	c.136	CCDS9088.1	12	.	.	.	.	.	.	.	.	.	.	G	36	5.802943	0.96960	.	.	ENSG00000111670	ENST00000299314;ENST00000549940;ENST00000547090;ENST00000392919;ENST00000549165	.	.	.	5.83	3.97	0.46021	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-14.873	14.2421	0.65963	0.0:0.0:0.502:0.498	.	.	.	.	X	46	.	ENSP00000299314:R46X	R	-	1	2	GNPTAB	100714653	1.000000	0.71417	0.998000	0.56505	0.907000	0.53573	1.737000	0.38197	0.778000	0.33520	-0.268000	0.10319	CGA	-	NULL		0.323	GNPTAB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNPTAB	protein_coding	OTTHUMT00000409182.1	G			100714653	-1	no_errors	NM_024312	genbank	human	validated	54_36p	nonsense	SNP	1.000	A
TMEM182	130827	genome.wustl.edu	37	2	103380882	103380882	+	Silent	SNP	A	A	C			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr2:103380882A>C	ENST00000412401.2	+	3	532	c.327A>C	c.(325-327)gcA>gcC	p.A109A	TMEM182_ENST00000486293.1_3'UTR|TMEM182_ENST00000409173.1_Silent_p.A66A|TMEM182_ENST00000409528.1_Silent_p.A13A	NM_144632.3	NP_653233.3	Q6ZP80	TM182_HUMAN	transmembrane protein 182	109						integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)	11						ATGACTCTGCAGTTAGTAAGT	0.453																																																0			2											122.0	99.0	107.0					2																	103380882		2203	4300	6503	102747314	SO:0001819	synonymous_variant	130827			AK054856	CCDS2064.1	2q12.1	2009-08-25			ENSG00000170417	ENSG00000170417			26391	protein-coding gene	gene with protein product						12477932	Standard	NM_144632		Approved	FLJ30294	uc010fjb.3	Q6ZP80	OTTHUMG00000130779	ENST00000412401.2:c.327A>C	2.37:g.103380882A>C			102747314	C9JML7|Q3B7B8|Q53TT9|Q6GMU0|Q8WW45|Q96NR4	Silent	SNP	NULL	p.A109	ENST00000412401.2	37	c.327	CCDS2064.1	2																																																																																			-	NULL		0.453	TMEM182-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM182	protein_coding	OTTHUMT00000253293.1	A	NM_144632		102747314	+1	no_errors	NM_144632	genbank	human	validated	54_36p	silent	SNP	0.783	C
PDZD7	79955	genome.wustl.edu	37	10	102777951	102777951	+	Missense_Mutation	SNP	C	C	A			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr10:102777951C>A	ENST00000370215.3	-	9	1652	c.1427G>T	c.(1426-1428)cGg>cTg	p.R476L		NM_024895.4	NP_079171.1	Q9H5P4	PDZD7_HUMAN	PDZ domain containing 7	476						cilium (GO:0005929)|extracellular space (GO:0005615)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22				Epithelial(162;6.98e-09)|all cancers(201;3.55e-07)		CCTCCCCTGCCGCCCTCCCTT	0.632																																																0			10											68.0	67.0	68.0					10																	102777951		2203	4300	6503	102767941	SO:0001583	missense	79955			AK026862	CCDS31269.1, CCDS73182.1	10q24.32	2006-01-24		2006-01-24	ENSG00000186862	ENSG00000186862			26257	protein-coding gene	gene with protein product		612971		PDZK7		12477932	Standard	NM_024895		Approved	FLJ23209, bA108L7.8	uc021pxc.1	Q9H5P4	OTTHUMG00000018916	ENST00000370215.3:c.1427G>T	10.37:g.102777951C>A	ENSP00000359234:p.Arg476Leu		102767941	D5FJ77|Q8N321	Missense_Mutation	SNP	superfamily_PDZ domain-like,HMMPfam_PDZ,HMMSmart_SM00228	p.R476L	ENST00000370215.3	37	c.1427	CCDS31269.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.36|12.36	1.914014|1.914014	0.33815|0.33815	.|.	.|.	ENSG00000186862|ENSG00000186862	ENST00000433616|ENST00000393462;ENST00000370215	.|T	.|0.17854	.|2.25	4.12|4.12	3.11|3.11	0.35812|0.35812	.|.	.|2.500720	.|0.01350	.|N	.|0.011899	T|T	0.16981|0.16981	0.0408|0.0408	L|L	0.42245|0.42245	1.32|1.32	0.33396|0.33396	D|D	0.576742|0.576742	.|B;P	.|0.36438	.|0.418;0.553	.|B;B	.|0.32624	.|0.149;0.138	T|T	0.43180|0.43180	-0.9407|-0.9407	5|10	.|0.87932	.|D	.|0	.|.	6.0004|6.0004	0.19517|0.19517	0.0:0.855:0.0:0.145|0.0:0.855:0.0:0.145	.|.	.|476;476	.|Q9H5P4;Q9H5P4-2	.|PDZD7_HUMAN;.	C|L	51|476	.|ENSP00000359234:R476L	.|ENSP00000359234:R476L	G|R	-|-	1|2	0|0	PDZD7|PDZD7	102767941|102767941	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.058000|0.058000	0.15608|0.15608	2.755000|2.755000	0.47540|0.47540	2.117000|2.117000	0.64856|0.64856	0.555000|0.555000	0.69702|0.69702	GGC|CGG	-	NULL		0.632	PDZD7-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PDZD7	protein_coding	OTTHUMT00000049883.1	C	NM_024895		102767941	-1	no_errors	NM_024895	genbank	human	provisional	54_36p	missense	SNP	0.963	A
SH3PXD2A	9644	genome.wustl.edu	37	10	105362427	105362427	+	Missense_Mutation	SNP	C	C	T			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr10:105362427C>T	ENST00000369774.4	-	15	2824	c.2548G>A	c.(2548-2550)Gcc>Acc	p.A850T	SH3PXD2A_ENST00000427662.2_Intron|SH3PXD2A_ENST00000540321.1_Missense_Mutation_p.A717T|SH3PXD2A_ENST00000538130.1_Missense_Mutation_p.A685T|SH3PXD2A_ENST00000315994.6_5'UTR|SH3PXD2A_ENST00000355946.2_Missense_Mutation_p.A822T			Q5TCZ1	SPD2A_HUMAN	SH3 and PX domains 2A	850	SH3 4. {ECO:0000255|PROSITE- ProRule:PRU00192}.				superoxide metabolic process (GO:0006801)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|podosome (GO:0002102)	phosphatidylinositol binding (GO:0035091)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(8)|lung(18)|ovary(1)|skin(1)|urinary_tract(1)	38		Colorectal(252;0.0815)|Breast(234;0.131)		Epithelial(162;4.09e-10)|all cancers(201;2.73e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0119)		TTCTGGTAGGCGCTGCATGTC	0.617																																																0			10											68.0	69.0	68.0					10																	105362427		2203	4300	6503	105352417	SO:0001583	missense	9644			AB007878	CCDS31278.1	10q25.1	2006-02-13	2006-02-13	2006-02-13	ENSG00000107957	ENSG00000107957			23664	protein-coding gene	gene with protein product	"""five SH3 domains"""		"""SH3 multiple domains 1"""	SH3MD1		9687503	Standard	XM_005270297		Approved	FISH, KIAA0418	uc001kxj.1	Q5TCZ1	OTTHUMG00000018997	ENST00000369774.4:c.2548G>A	10.37:g.105362427C>T	ENSP00000358789:p.Ala850Thr		105352417	D3DR98|O43302|Q5TCZ2|Q5TDQ8	Missense_Mutation	SNP	HMMPfam_PX,HMMSmart_SM00312,superfamily_PX domain,superfamily_SH3-domain,HMMPfam_SH3_1,HMMSmart_SM00326	p.A822T	ENST00000369774.4	37	c.2464		10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	3.328|3.328	-0.137227|-0.137227	0.06711|0.06711	.|.	.|.	ENSG00000107957|ENSG00000107957	ENST00000369774;ENST00000355946;ENST00000315994;ENST00000536035;ENST00000540321;ENST00000538130|ENST00000420222	T;T;T;T|.	0.50548|.	0.74;0.74;0.74;0.74|.	4.83|4.83	2.8|2.8	0.32819|0.32819	Src homology-3 domain (3);|.	0.629728|.	0.16897|.	N|.	0.195081|.	T|T	0.34106|0.34106	0.0886|0.0886	L|L	0.38953|0.38953	1.18|1.18	0.20638|0.20638	N|N	0.999874|0.999874	D;D;P;D|.	0.56746|.	0.977;0.977;0.53;0.972|.	P;P;B;B|.	0.45998|.	0.5;0.5;0.115;0.367|.	T|T	0.19516|0.19516	-1.0303|-1.0303	10|5	0.33940|.	T|.	0.23|.	-20.9225|-20.9225	6.4044|6.4044	0.21656|0.21656	0.4904:0.4188:0.0:0.0908|0.4904:0.4188:0.0:0.0908	.|.	850;699;695;822|.	Q5TCZ1;B7Z9L8;B7Z3B0;Q5TCZ1-3|.	SPD2A_HUMAN;.;.;.|.	T|H	850;822;657;765;717;685|776	ENSP00000358789:A850T;ENSP00000348215:A822T;ENSP00000443663:A717T;ENSP00000441514:A685T|.	ENSP00000318135:A657T|.	A|R	-|-	1|2	0|0	SH3PXD2A|SH3PXD2A	105352417|105352417	0.022000|0.022000	0.18835|0.18835	0.786000|0.786000	0.31890|0.31890	0.642000|0.642000	0.38348|0.38348	0.254000|0.254000	0.18314|0.18314	1.020000|1.020000	0.39573|0.39573	0.555000|0.555000	0.69702|0.69702	GCC|CGC	-	superfamily_SH3-domain,HMMSmart_SM00326,HMMPfam_SH3_1		0.617	SH3PXD2A-001	KNOWN	basic	protein_coding	SH3PXD2A	protein_coding	OTTHUMT00000050178.1	C	NM_014631		105352417	-1	no_errors	NM_014631	genbank	human	validated	54_36p	missense	SNP	0.155	T
COL17A1	1308	genome.wustl.edu	37	10	105811961	105811961	+	Missense_Mutation	SNP	G	G	T			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr10:105811961G>T	ENST00000353479.5	-	24	2244	c.1954C>A	c.(1954-1956)Cca>Aca	p.P652T	COL17A1_ENST00000480127.1_5'Flank|COL17A1_ENST00000369733.3_Missense_Mutation_p.P652T	NM_000494.3	NP_000485.3	Q9UMD9	COHA1_HUMAN	collagen, type XVII, alpha 1	652	Triple-helical region.				cell junction assembly (GO:0034329)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|hemidesmosome (GO:0030056)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				NS(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|liver(1)|lung(22)|ovary(5)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	62		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;2.5e-09)|all cancers(201;7.94e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		TGAGGACCTGGTTCACCAGCA	0.572																																																0			10											151.0	153.0	152.0					10																	105811961		2203	4300	6503	105801951	SO:0001583	missense	1308			M91669	CCDS7554.1	10q24.3	2013-01-16			ENSG00000065618	ENSG00000065618		"""Collagens"""	2194	protein-coding gene	gene with protein product		113811		BPAG2		7916703	Standard	NM_000494		Approved	BP180	uc001kxr.3	Q9UMD9	OTTHUMG00000018998	ENST00000353479.5:c.1954C>A	10.37:g.105811961G>T	ENSP00000340937:p.Pro652Thr		105801951	Q02802|Q5JV36|Q99018|Q9NQK9|Q9UC14	Missense_Mutation	SNP	HMMPfam_Collagen	p.P652T	ENST00000353479.5	37	c.1954	CCDS7554.1	10	.	.	.	.	.	.	.	.	.	.	G	8.220	0.802289	0.16397	.	.	ENSG00000065618	ENST00000353479;ENST00000369733	D;D	0.98666	-5.06;-5.06	5.39	2.36	0.29203	.	0.305106	0.23275	N	0.049968	D	0.96361	0.8813	L	0.58101	1.795	0.19575	N	0.999967	P	0.35433	0.501	B	0.28139	0.086	D	0.89973	0.4095	10	0.34782	T	0.22	-0.8413	11.4357	0.50066	0.0705:0.4913:0.4382:0.0	.	652	Q9UMD9	COHA1_HUMAN	T	652	ENSP00000340937:P652T;ENSP00000358748:P652T	ENSP00000340937:P652T	P	-	1	0	COL17A1	105801951	0.977000	0.34250	0.001000	0.08648	0.254000	0.26022	2.369000	0.44231	0.204000	0.20548	0.555000	0.69702	CCA	-	NULL		0.572	COL17A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL17A1	protein_coding	OTTHUMT00000050181.1	G	NM_130778, NM_000494		105801951	-1	no_errors	NM_000494	genbank	human	reviewed	54_36p	missense	SNP	0.820	T
COL4A5	1287	genome.wustl.edu	37	X	107923911	107923911	+	Silent	SNP	T	T	G			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chrX:107923911T>G	ENST00000361603.2	+	43	4171	c.3927T>G	c.(3925-3927)ggT>ggG	p.G1309G	COL4A5_ENST00000328300.6_Silent_p.G1315G	NM_000495.4	NP_000486.1	P29400	CO4A5_HUMAN	collagen, type IV, alpha 5	1309	Triple-helical region.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|neuromuscular junction (GO:0031594)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(32)|ovary(4)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	99						TTATTCAGGGTAATCCTGGCC	0.428									Alport syndrome with Diffuse Leiomyomatosis																																							0			X											86.0	78.0	81.0					X																	107923911		2203	4300	6503	107810567	SO:0001819	synonymous_variant	1287	Familial Cancer Database		M90464	CCDS14543.1, CCDS35366.1	Xq22	2014-09-17	2008-07-28		ENSG00000188153	ENSG00000188153		"""Collagens"""	2207	protein-coding gene	gene with protein product		303630	"""Alport syndrome"""	ASLN, ATS			Standard	NM_000495		Approved		uc004enz.2	P29400	OTTHUMG00000022182	ENST00000361603.2:c.3927T>G	X.37:g.107923911T>G			107810567	Q16006|Q16126|Q6LD84|Q7Z700|Q9NUB7	Silent	SNP	HMMPfam_Collagen,superfamily_C-type_lectin_fold,HMMPfam_C4,HMMSmart_C4	p.G1315	ENST00000361603.2	37	c.3945	CCDS14543.1	X																																																																																			-	HMMPfam_Collagen		0.428	COL4A5-001	KNOWN	basic|CCDS	protein_coding	COL4A5	protein_coding	OTTHUMT00000057880.2	T			107810567	+1	no_errors	NM_033380	genbank	human	reviewed	54_36p	silent	SNP	0.968	G
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	SNP	G	G	A			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	G	G					Unknown	Invalid:failed_liftOver	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chrUnknown:0G>A								None (None upstream) : None (None downstream)																								0.0																																																0			13																																								113606057	SO:0001628	intergenic_variant	348013																															Unknown.37:g.0G>A			113606057		Missense_Mutation	SNP	NULL	p.P233L		37	c.698		13																																																																																			-	NULL	0	0					FAM70B			G			113606057	-1	no_errors	NM_182614	genbank	human	provisional	54_36p	missense	SNP	0.868	A
MED13L	23389	genome.wustl.edu	37	12	116675342	116675342	+	Missense_Mutation	SNP	T	T	C			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr12:116675342T>C	ENST00000281928.3	-	2	447	c.241A>G	c.(241-243)Aaa>Gaa	p.K81E	MED13L_ENST00000551197.1_5'UTR	NM_015335.4	NP_056150.1	Q71F56	MD13L_HUMAN	mediator complex subunit 13-like	81						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			NS(2)|breast(1)|endometrium(9)|kidney(3)|large_intestine(18)|lung(34)|ovary(4)|prostate(4)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	85	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0407)		CATAACTCTTTGCAATCTGGT	0.423																																																0			12											153.0	138.0	143.0					12																	116675342		2203	4300	6503	115159725	SO:0001583	missense	23389			AB028948	CCDS9177.1	12q24.22	2010-07-29	2007-07-30	2007-07-30	ENSG00000123066	ENSG00000123066			22962	protein-coding gene	gene with protein product		608771	"""thyroid hormone receptor associated protein 2"""	THRAP2			Standard	NM_015335		Approved	KIAA1025, TRAP240L	uc001tvw.3	Q71F56	OTTHUMG00000169404	ENST00000281928.3:c.241A>G	12.37:g.116675342T>C	ENSP00000281928:p.Lys81Glu		115159725	A1L469|Q68DN4|Q9H8C0|Q9NSY9|Q9UFD8|Q9UPX5	Missense_Mutation	SNP	HMMPfam_TRAP_240kDa	p.K81E	ENST00000281928.3	37	c.241	CCDS9177.1	12	.	.	.	.	.	.	.	.	.	.	T	19.20	3.781922	0.70222	.	.	ENSG00000123066	ENST00000281928;ENST00000548743	T;T	0.80480	-1.38;-1.38	5.57	5.57	0.84162	Mediator complex, subunit Med13, N-terminal, metazoa/fungi (1);	0.000000	0.64402	D	0.000002	T	0.79919	0.4529	L	0.58510	1.815	0.42842	D	0.994052	B	0.33135	0.399	B	0.35859	0.212	T	0.81488	-0.0910	10	0.87932	D	0	.	15.7209	0.77710	0.0:0.0:0.0:1.0	.	81	Q71F56	MD13L_HUMAN	E	81;71	ENSP00000281928:K81E;ENSP00000448553:K71E	ENSP00000281928:K81E	K	-	1	0	MED13L	115159725	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.210000	0.72176	2.123000	0.65237	0.459000	0.35465	AAA	-	NULL		0.423	MED13L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MED13L	protein_coding	OTTHUMT00000403879.3	T			115159725	-1	no_errors	NM_015335	genbank	human	validated	54_36p	missense	SNP	1.000	C
KSR2	283455	genome.wustl.edu	37	12	117996329	117996329	+	Missense_Mutation	SNP	G	G	C			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr12:117996329G>C	ENST00000339824.5	-	8	2102	c.1375C>G	c.(1375-1377)Ctg>Gtg	p.L459V	KSR2_ENST00000425217.1_Missense_Mutation_p.L430V|KSR2_ENST00000302438.5_Missense_Mutation_p.L156V|KSR2_ENST00000545002.1_5'UTR			Q6VAB6	KSR2_HUMAN	kinase suppressor of ras 2	459					intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(25)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	67	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					TGGATGATCAGAAGATGACAG	0.512																																																0			12											135.0	132.0	133.0					12																	117996329		1889	4127	6016	116480712	SO:0001583	missense	283455			AY345972	CCDS61250.1	12q24.22-q24.23	2014-08-12			ENSG00000171435	ENSG00000171435			18610	protein-coding gene	gene with protein product		610737				12471243	Standard	NM_173598		Approved	FLJ25965	uc001two.2	Q6VAB6	OTTHUMG00000169020	ENST00000339824.5:c.1375C>G	12.37:g.117996329G>C	ENSP00000339952:p.Leu459Val		116480712	A0PJT2|Q3B828|Q8N775	Missense_Mutation	SNP	superfamily_Cysteine-rich domain,HMMSmart_SM00109,HMMPfam_C1_1,PatternScan_ZF_DAG_PE_1,superfamily_Protein kinase-like (PK-like),HMMSmart_SM00219,HMMSmart_SM00220,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ST	p.L338V	ENST00000339824.5	37	c.1012		12	.	.	.	.	.	.	.	.	.	.	G	14.57	2.575161	0.45902	.	.	ENSG00000171435	ENST00000425217;ENST00000339824;ENST00000302438;ENST00000542378	T;T;T	0.57595	0.39;0.39;0.39	4.89	3.99	0.46301	.	0.000000	0.64402	D	0.000006	T	0.44286	0.1286	N	0.22421	0.69	0.48762	D	0.999702	P	0.42248	0.774	P	0.46510	0.519	T	0.35151	-0.9800	10	0.44086	T	0.13	.	10.5501	0.45083	0.1622:0.0:0.8378:0.0	.	459	Q6VAB6	KSR2_HUMAN	V	430;459;156;131	ENSP00000389715:L430V;ENSP00000339952:L459V;ENSP00000305466:L156V	ENSP00000305466:L156V	L	-	1	2	KSR2	116480712	1.000000	0.71417	0.999000	0.59377	0.695000	0.40330	3.745000	0.55119	1.013000	0.39391	0.462000	0.41574	CTG	-	NULL		0.512	KSR2-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	KSR2	protein_coding	OTTHUMT00000401987.2	G	NM_173598		116480712	-1	no_errors	NM_173598	genbank	human	validated	54_36p	missense	SNP	1.000	C
KSR2	283455	genome.wustl.edu	37	12	118198938	118198938	+	Silent	SNP	C	C	T			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr12:118198938C>T	ENST00000339824.5	-	4	1591	c.864G>A	c.(862-864)ccG>ccA	p.P288P	KSR2_ENST00000425217.1_Silent_p.P259P			Q6VAB6	KSR2_HUMAN	kinase suppressor of ras 2	288	Pro-rich.				intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(25)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	67	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GTGGGGTCCCCGGGGGCTTCA	0.682																																																0			12											101.0	121.0	114.0					12																	118198938		1887	4102	5989	116683321	SO:0001819	synonymous_variant	283455			AY345972	CCDS61250.1	12q24.22-q24.23	2014-08-12			ENSG00000171435	ENSG00000171435			18610	protein-coding gene	gene with protein product		610737				12471243	Standard	NM_173598		Approved	FLJ25965	uc001two.2	Q6VAB6	OTTHUMG00000169020	ENST00000339824.5:c.864G>A	12.37:g.118198938C>T			116683321	A0PJT2|Q3B828|Q8N775	Silent	SNP	HMMSmart_SM00219,HMMPfam_C1_1,HMMSmart_SM00109,PatternScan_ZF_DAG_PE_1,HMMSmart_SM00220,PatternScan_PROTEIN_KINASE_ST,superfamily_Protein kinase-like (PK-like),HMMPfam_Pkinase,superfamily_Cysteine-rich domain	p.P167	ENST00000339824.5	37	c.501		12																																																																																			-	NULL		0.682	KSR2-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	KSR2	protein_coding	OTTHUMT00000401987.2	C	NM_173598		116683321	-1	no_errors	NM_173598	genbank	human	validated	54_36p	silent	SNP	0.488	T
TMEM177	80775	genome.wustl.edu	37	2	120438940	120438940	+	Silent	SNP	C	C	T			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr2:120438940C>T	ENST00000424086.1	+	2	984	c.511C>T	c.(511-513)Ctg>Ttg	p.L171L	TMEM177_ENST00000401466.1_Silent_p.L171L|TMEM177_ENST00000496203.1_Intron|TMEM177_ENST00000409951.1_Intron|TMEM177_ENST00000272521.6_Silent_p.L171L	NM_001105198.1	NP_001098668.1	Q53S58	TM177_HUMAN	transmembrane protein 177	171						integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|large_intestine(3)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	13	Colorectal(110;0.196)					CGTGCACGCCCTGCTGGCCCC	0.642																																																0			2											53.0	58.0	56.0					2																	120438940		2203	4300	6503	120155410	SO:0001819	synonymous_variant	80775			BC004404	CCDS2128.1	2q14.2	2008-02-05			ENSG00000144120	ENSG00000144120			28143	protein-coding gene	gene with protein product						12477932	Standard	NM_001105198		Approved	MGC10993	uc002tmc.1	Q53S58	OTTHUMG00000153312	ENST00000424086.1:c.511C>T	2.37:g.120438940C>T			120155410	Q9BT20	Silent	SNP	NULL	p.L171	ENST00000424086.1	37	c.511	CCDS2128.1	2																																																																																			-	NULL		0.642	TMEM177-201	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM177	protein_coding	OTTHUMT00000330673.1	C	NM_030577		120155410	+1	no_errors	NM_001105198	genbank	human	validated	54_36p	silent	SNP	0.184	T
SORL1	6653	genome.wustl.edu	37	11	121393325	121393325	+	Missense_Mutation	SNP	C	C	A			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr11:121393325C>A	ENST00000260197.7	+	10	1564	c.1435C>A	c.(1435-1437)Cag>Aag	p.Q479K	SORL1_ENST00000532451.1_3'UTR	NM_003105.5	NP_003096	Q92673	SORL_HUMAN	sortilin-related receptor, L(DLR class) A repeats containing	479					cell death (GO:0008219)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|negative regulation of aspartic-type endopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902960)|negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of metalloendopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902963)|negative regulation of neurofibrillary tangle assembly (GO:1902997)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron death (GO:1901215)|negative regulation of protein binding (GO:0032091)|negative regulation of protein oligomerization (GO:0032460)|negative regulation of tau-protein kinase activity (GO:1902948)|positive regulation of choline O-acetyltransferase activity (GO:1902771)|positive regulation of early endosome to recycling endosome transport (GO:1902955)|positive regulation of endocytic recycling (GO:2001137)|positive regulation of ER to Golgi vesicle-mediated transport (GO:1902953)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|positive regulation of protein localization to early endosome (GO:1902966)|post-Golgi vesicle-mediated transport (GO:0006892)|protein maturation (GO:0051604)|protein retention in Golgi apparatus (GO:0045053)|protein targeting (GO:0006605)|protein targeting to Golgi (GO:0000042)|protein targeting to lysosome (GO:0006622)|receptor-mediated endocytosis (GO:0006898)|regulation of smooth muscle cell migration (GO:0014910)|signal transduction (GO:0007165)	early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi cisterna (GO:0031985)|integral component of plasma membrane (GO:0005887)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|nuclear envelope lumen (GO:0005641)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)|beta-amyloid binding (GO:0001540)|low-density lipoprotein particle binding (GO:0030169)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(2)|lung(34)|ovary(5)|pancreas(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(2)	91		Breast(109;0.00119)|Medulloblastoma(222;0.0429)|all_neural(223;0.113)		BRCA - Breast invasive adenocarcinoma(274;3.34e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.108)		TCATCTGGCTCAGCGCCTCAG	0.562																																																0			11											182.0	161.0	168.0					11																	121393325		2203	4299	6502	120898535	SO:0001583	missense	6653			Y08110	CCDS8436.1	11q23.2-q24.4	2014-06-05	2011-01-25		ENSG00000137642	ENSG00000137642		"""Fibronectin type III domain containing"""	11185	protein-coding gene	gene with protein product	"""LDLR relative with 11 ligand-binding repeats"""	602005	"""chromosome 11 open reading frame 32"", ""sortilin-related receptor, L(DLR class) A repeats-containing"""	C11orf32		9157966, 8940146	Standard	NM_003105		Approved	gp250, LR11, LRP9, SorLA, SorLA-1	uc001pxx.3	Q92673	OTTHUMG00000166057	ENST00000260197.7:c.1435C>A	11.37:g.121393325C>A	ENSP00000260197:p.Gln479Lys		120898535	B2RNX7|Q92856	Missense_Mutation	SNP	superfamily_Oligoxyloglucan reducing end-specific cellobiohydrolase,HMMSmart_SM00602,superfamily_YWTD domain,HMMSmart_SM00135,HMMPfam_Ldl_recept_b,PatternScan_EGF_2,superfamily_LDL receptor-like module,HMMPfam_Ldl_recept_a,HMMSmart_SM00192,PatternScan_LDLRA_1,PatternScan_COPPER_BLUE,superfamily_Fibronectin type III,HMMPfam_fn3,HMMSmart_SM00060	p.Q479K	ENST00000260197.7	37	c.1435	CCDS8436.1	11	.	.	.	.	.	.	.	.	.	.	C	34	5.370140	0.95900	.	.	ENSG00000137642	ENST00000260197	T	0.28895	1.59	5.48	5.48	0.80851	VPS10 (1);	0.059987	0.64402	D	0.000002	T	0.44350	0.1289	M	0.70595	2.14	0.80722	D	1	D	0.54207	0.965	P	0.46758	0.526	T	0.50065	-0.8871	10	0.87932	D	0	.	19.3435	0.94355	0.0:1.0:0.0:0.0	.	479	Q92673	SORL_HUMAN	K	479	ENSP00000260197:Q479K	ENSP00000260197:Q479K	Q	+	1	0	SORL1	120898535	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.473000	0.81007	2.569000	0.86673	0.591000	0.81541	CAG	-	superfamily_Oligoxyloglucan reducing end-specific cellobiohydrolase,HMMSmart_SM00602		0.562	SORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SORL1	protein_coding	OTTHUMT00000387626.2	C	NM_003105		120898535	+1	no_errors	NM_003105	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
WDR11	55717	genome.wustl.edu	37	10	122663571	122663571	+	Missense_Mutation	SNP	G	G	C			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr10:122663571G>C	ENST00000263461.6	+	24	3190	c.2944G>C	c.(2944-2946)Gaa>Caa	p.E982Q	WDR11_ENST00000604509.1_3'UTR	NM_018117.11	NP_060587.8	Q8WWQ0	PHIP_HUMAN	WD repeat domain 11	0	Mediates interaction with IRS1. {ECO:0000250}.				cytoskeleton organization (GO:0007010)|insulin receptor signaling pathway (GO:0008286)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell morphogenesis (GO:0022604)|regulation of growth (GO:0040008)|regulation of protein phosphorylation (GO:0001932)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	insulin receptor binding (GO:0005158)|lysine-acetylated histone binding (GO:0070577)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(9)|prostate(2)|skin(2)|stomach(5)	38						ATTTCAGCTAGAAAGGGTTAA	0.308																																																0			10											80.0	82.0	81.0					10																	122663571		2203	4300	6503	122653561	SO:0001583	missense	55717			AF320223	CCDS7619.1	10q26	2013-01-21	2010-01-06	2010-01-06	ENSG00000120008	ENSG00000120008		"""WD repeat domain containing"""	13831	protein-coding gene	gene with protein product		606417	"""bromodomain and WD repeat domain containing 2"""	BRWD2		10718198, 11536051	Standard	NM_018117		Approved	KIAA1351, FLJ10506, WDR15, HH14, DR11	uc021pzt.1	Q9BZH6	OTTHUMG00000019171	ENST00000263461.6:c.2944G>C	10.37:g.122663571G>C	ENSP00000263461:p.Glu982Gln		122653561	A7J992|B2RPK4|Q05CQ9|Q5VVH4|Q66I29|Q69YV1|Q8NBZ5|Q96H52|Q96ME2|Q9H261	Missense_Mutation	SNP	superfamily_WD40_like,HMMSmart_WD40,HMMPfam_WD40,PatternScan_WD_REPEATS_1	p.E982Q	ENST00000263461.6	37	c.2944	CCDS7619.1	10	.	.	.	.	.	.	.	.	.	.	G	22.5	4.299993	0.81136	.	.	ENSG00000120008	ENST00000263461	D	0.92099	-2.97	5.86	5.86	0.93980	.	0.053117	0.85682	D	0.000000	D	0.94328	0.8177	L	0.58101	1.795	0.80722	D	1	P;P;D;D	0.61080	0.935;0.849;0.989;0.964	P;B;P;P	0.55923	0.494;0.309;0.787;0.522	D	0.94002	0.7276	10	0.59425	D	0.04	-29.0488	20.1802	0.98196	0.0:0.0:1.0:0.0	.	982;982;273;511	Q9BZH6;B2RCJ6;Q9NWV7;Q659C9	WDR11_HUMAN;.;.;.	Q	982	ENSP00000263461:E982Q	ENSP00000263461:E982Q	E	+	1	0	WDR11	122653561	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.816000	0.91979	2.777000	0.95525	0.655000	0.94253	GAA	-	NULL		0.308	WDR11-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	BRWD2	protein_coding	OTTHUMT00000050707.2	G			122653561	+1	no_errors	NM_018117	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
OR1L4	254973	genome.wustl.edu	37	9	125486614	125486614	+	Missense_Mutation	SNP	C	C	A			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr9:125486614C>A	ENST00000259466.1	+	1	346	c.346C>A	c.(346-348)Ctg>Atg	p.L116M		NM_001005235.1	NP_001005235.1	Q8NGR5	OR1L4_HUMAN	olfactory receptor, family 1, subfamily L, member 4	116						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|large_intestine(3)|lung(13)|prostate(1)|skin(1)	20						CAGCTACCTGCTGGCCTCTAT	0.483																																																0			9											130.0	116.0	121.0					9																	125486614		2203	4300	6503	124526435	SO:0001583	missense	254973				CCDS35129.1	9q33.2	2013-09-20			ENSG00000136939	ENSG00000136939		"""GPCR / Class A : Olfactory receptors"""	8216	protein-coding gene	gene with protein product				OR1L5			Standard	NM_001005235		Approved	OR9-E	uc004bmu.1	Q8NGR5	OTTHUMG00000020620	ENST00000259466.1:c.346C>A	9.37:g.125486614C>A	ENSP00000259466:p.Leu116Met		124526435	Q6IFN0|Q96R81	Missense_Mutation	SNP	PatternScan_G_PROTEIN_RECEP_F1_1,superfamily_SSF81321,HMMPfam_7tm_1	p.L116M	ENST00000259466.1	37	c.346	CCDS35129.1	9	.	.	.	.	.	.	.	.	.	.	.	15.91	2.973120	0.53614	.	.	ENSG00000136939	ENST00000259466	T	0.02280	4.36	4.01	2.16	0.27623	GPCR, rhodopsin-like superfamily (1);	0.000000	0.42548	D	0.000695	T	0.13030	0.0316	M	0.90252	3.1	0.37281	D	0.907846	D	0.89917	1.0	D	0.87578	0.998	T	0.01140	-1.1439	10	0.72032	D	0.01	-11.9654	8.4857	0.33069	0.0:0.8046:0.0:0.1954	.	116	Q8NGR5	OR1L4_HUMAN	M	116	ENSP00000259466:L116M	ENSP00000259466:L116M	L	+	1	2	OR1L4	124526435	0.007000	0.16637	0.998000	0.56505	0.914000	0.54420	0.192000	0.17096	0.370000	0.24538	0.298000	0.19748	CTG	-	superfamily_SSF81321,HMMPfam_7tm_1		0.483	OR1L4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR1L4	protein_coding	OTTHUMT00000053951.1	C			124526435	+1	no_errors	NM_001005235	genbank	human	provisional	54_36p	missense	SNP	0.171	A
MYLK	4638	genome.wustl.edu	37	3	123457748	123457748	+	Missense_Mutation	SNP	A	A	C			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr3:123457748A>C	ENST00000475616.1	-	4	583	c.584T>G	c.(583-585)cTc>cGc	p.L195R	MYLK_ENST00000360304.3_Missense_Mutation_p.L195R|MYLK_ENST00000359169.1_Missense_Mutation_p.L195R|MYLK_ENST00000346322.5_Missense_Mutation_p.L195R|MYLK_ENST00000360772.3_Missense_Mutation_p.L195R			Q15746	MYLK_HUMAN	myosin light chain kinase	195	Ig-like C2-type 2.				actin filament organization (GO:0007015)|aorta smooth muscle tissue morphogenesis (GO:0060414)|bleb assembly (GO:0032060)|cellular hypotonic response (GO:0071476)|muscle contraction (GO:0006936)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cell migration (GO:0030335)|positive regulation of wound healing (GO:0090303)|protein phosphorylation (GO:0006468)|smooth muscle contraction (GO:0006939)|tonic smooth muscle contraction (GO:0014820)	cell-cell junction (GO:0005911)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|metal ion binding (GO:0046872)|myosin light chain kinase activity (GO:0004687)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(37)|ovary(7)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	113		Lung NSC(201;0.0496)		GBM - Glioblastoma multiforme(114;0.0736)		CCTCACCTTGAGCCAGGTGAC	0.522																																																0			3											60.0	54.0	56.0					3																	123457748		2203	4300	6503	124940438	SO:0001583	missense	4638			X85337	CCDS3023.1, CCDS43141.1, CCDS46896.1, CCDS46897.1, CCDS58849.1	3q21	2013-02-11	2008-01-23		ENSG00000065534	ENSG00000065534	2.7.11.18	"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7590	protein-coding gene	gene with protein product	"""smooth muscle myosin light chain kinase"""	600922	"""myosin, light polypeptide kinase"""			8575746	Standard	NM_053026		Approved	MLCK, smMLCK, MYLK1, MLCK1	uc003ego.3	Q15746	OTTHUMG00000141304	ENST00000475616.1:c.584T>G	3.37:g.123457748A>C	ENSP00000418335:p.Leu195Arg		124940438	B4DUE3|D3DN97|O95796|O95797|O95798|O95799|Q14844|Q16794|Q17S15|Q3ZCP9|Q5MY99|Q5MYA0|Q6P2N0|Q7Z4J0|Q9C0L5|Q9UBG5|Q9UBY6|Q9UIT9	Missense_Mutation	SNP	superfamily_Immunoglobulin,HMMPfam_I-set,HMMSmart_SM00409,HMMSmart_SM00408,superfamily_Fibronectin type III,HMMSmart_SM00060,HMMPfam_fn3,superfamily_Protein kinase-like (PK-like),HMMSmart_SM00219,HMMSmart_SM00220,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_ST	p.L195R	ENST00000475616.1	37	c.584	CCDS46896.1	3	.	.	.	.	.	.	.	.	.	.	A	19.23	3.787876	0.70337	.	.	ENSG00000065534	ENST00000360772;ENST00000360304;ENST00000359169;ENST00000346322;ENST00000475616	T;T;T;T;T	0.73681	-0.77;-0.77;-0.77;-0.77;-0.77	4.52	4.52	0.55395	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.68339	0.2990	N	0.17800	0.525	0.80722	D	1	P;D;B;D;B;D	0.54964	0.946;0.969;0.244;0.969;0.1;0.957	P;P;B;P;B;P	0.55455	0.668;0.754;0.057;0.668;0.057;0.776	T	0.65845	-0.6069	9	0.31617	T	0.26	.	8.7648	0.34696	0.8311:0.0:0.0:0.1689	.	195;195;195;195;195;195	Q15746-6;Q15746-5;Q15746-4;Q15746-3;Q15746-2;Q15746	.;.;.;.;.;MYLK_HUMAN	R	195	ENSP00000354004:L195R;ENSP00000353452:L195R;ENSP00000352088:L195R;ENSP00000320622:L195R;ENSP00000418335:L195R	ENSP00000320622:L195R	L	-	2	0	MYLK	124940438	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.024000	0.41049	2.020000	0.59435	0.533000	0.62120	CTC	-	superfamily_Immunoglobulin,HMMPfam_I-set,HMMSmart_SM00409,HMMSmart_SM00408		0.522	MYLK-004	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	MYLK	protein_coding	OTTHUMT00000356464.1	A	NM_053025		124940438	-1	no_errors	NM_053025	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
GAPVD1	26130	genome.wustl.edu	37	9	128083712	128083712	+	Splice_Site	SNP	G	G	A			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr9:128083712G>A	ENST00000495955.1	+	10	1893	c.1603G>A	c.(1603-1605)Gtc>Atc	p.V535I	GAPVD1_ENST00000297933.6_Splice_Site_p.V535I|GAPVD1_ENST00000265956.4_Splice_Site_p.V535I|GAPVD1_ENST00000312123.9_Splice_Site_p.V535I|GAPVD1_ENST00000470056.1_Splice_Site_p.V535I|GAPVD1_ENST00000394105.2_Splice_Site_p.V535I|GAPVD1_ENST00000394083.2_Splice_Site_p.V535I|GAPVD1_ENST00000394104.2_Splice_Site_p.V535I			Q14C86	GAPD1_HUMAN	GTPase activating protein and VPS9 domains 1	535					endocytosis (GO:0006897)|positive regulation of GTPase activity (GO:0043547)|regulation of protein transport (GO:0051223)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)	cytosol (GO:0005829)|endosome (GO:0005768)|membrane (GO:0016020)	GTPase activating protein binding (GO:0032794)|GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(10)|lung(11)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	44						TATTTTTTAGGTCCTAAACAT	0.353																																																0			9											105.0	98.0	101.0					9																	128083712		2203	4300	6503	127123533	SO:0001630	splice_region_variant	26130				CCDS65130.1, CCDS65131.1, CCDS65132.1	9q34.11	2008-02-05			ENSG00000165219	ENSG00000165219			23375	protein-coding gene	gene with protein product		611714					Standard	XM_005251901		Approved	DKFZP434C212, KIAA1521	uc004bpr.3	Q14C86	OTTHUMG00000020678	ENST00000495955.1:c.1603-1G>A	9.37:g.128083712G>A			127123533	A8MYK3|B0QZ62|B0QZ63|B0QZ64|Q14C76|Q2Q1W1|Q8ND92|Q8WU86|Q96CZ4|Q9NXQ1|Q9P207|Q9Y4N0	Missense_Mutation	SNP	superfamily_Rho_GAP,HMMPfam_RasGAP,superfamily_SSF109993,HMMSmart_VPS9,HMMPfam_VPS9	p.V535I	ENST00000495955.1	37	c.1603		9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.2|21.2	4.114140|4.114140	0.77210|0.77210	.|.	.|.	ENSG00000165219|ENSG00000165219	ENST00000436712|ENST00000470056;ENST00000394105;ENST00000394104;ENST00000265956;ENST00000394083;ENST00000495955;ENST00000467750;ENST00000297933;ENST00000312123	.|T;T;T;T;T;T;T;T;T	.|0.14766	.|2.48;2.48;2.48;2.48;2.48;2.48;2.48;2.48;2.48	5.53|5.53	5.53|5.53	0.82687|0.82687	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.25382|0.25382	0.0617|0.0617	L|L	0.27053|0.27053	0.805|0.805	0.80722|0.80722	D|D	1|1	.|P;P;P;P;P;D	.|0.53312	.|0.902;0.841;0.902;0.902;0.902;0.959	.|D;P;P;P;P;D	.|0.67103	.|0.927;0.846;0.893;0.893;0.893;0.949	T|T	0.01345|0.01345	-1.1379|-1.1379	5|9	.|.	.|.	.|.	.|.	18.4402|18.4402	0.90664|0.90664	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|535;535;535;535;535;535	.|Q14C86-5;Q14C86;Q14C86-3;Q14C86-4;Q14C86-2;Q14C86-6	.|.;GAPD1_HUMAN;.;.;.;.	D|I	392|535	.|ENSP00000419767:V535I;ENSP00000377665:V535I;ENSP00000377664:V535I;ENSP00000265956:V535I;ENSP00000377645:V535I;ENSP00000419063:V535I;ENSP00000418747:V535I;ENSP00000297933:V535I;ENSP00000309582:V535I	.|.	G|V	+|+	2|1	0|0	GAPVD1|GAPVD1	127123533|127123533	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.579000|0.579000	0.36224|0.36224	7.393000|7.393000	0.79851|0.79851	2.603000|2.603000	0.88011|0.88011	0.563000|0.563000	0.77884|0.77884	GGT|GTC	-	NULL		0.353	GAPVD1-014	KNOWN	alternative_5_UTR|basic	protein_coding	GAPVD1	protein_coding	OTTHUMT00000355644.1	G		Missense_Mutation	127123533	+1	no_errors	NM_015635	genbank	human	validated	54_36p	missense	SNP	1.000	A
ALDH1L1	10840	genome.wustl.edu	37	3	125872376	125872376	+	Missense_Mutation	SNP	C	C	T	rs181617166	byFrequency	TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr3:125872376C>T	ENST00000393434.2	-	7	1118	c.769G>A	c.(769-771)Gag>Aag	p.E257K	ALDH1L1_ENST00000452905.2_Missense_Mutation_p.E156K|ALDH1L1_ENST00000472186.1_Missense_Mutation_p.E257K|ALDH1L1_ENST00000455064.2_Missense_Mutation_p.E82K|ALDH1L1_ENST00000273450.3_Missense_Mutation_p.E267K|ALDH1L1_ENST00000413612.1_5'UTR|ALDH1L1_ENST00000393431.2_Missense_Mutation_p.E257K	NM_012190.3	NP_036322.2	O75891	AL1L1_HUMAN	aldehyde dehydrogenase 1 family, member L1	257					10-formyltetrahydrofolate catabolic process (GO:0009258)|biosynthetic process (GO:0009058)|one-carbon metabolic process (GO:0006730)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	catalytic activity (GO:0003824)|formyltetrahydrofolate dehydrogenase activity (GO:0016155)|hydroxymethyl-, formyl- and related transferase activity (GO:0016742)|methyltransferase activity (GO:0008168)|oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor (GO:0016620)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|kidney(5)|large_intestine(10)|lung(22)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	52				GBM - Glioblastoma multiforme(114;0.0462)	Tetrahydrofolic acid(DB00116)	GCGTCTCCCTCGGGCACCAGG	0.537													C|||	3	0.000599042	0.0	0.0	5008	,	,		20658	0.002		0.001	False		,,,				2504	0.0															0			3						C	LYS/GLU	0,4406		0,0,2203	99.0	97.0	98.0		769	2.4	0.7	3		98	1,8599	1.2+/-3.3	0,1,4299	yes	missense	ALDH1L1	NM_012190.2	56	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	257/903	125872376	1,13005	2203	4300	6503	127355066	SO:0001583	missense	10840			AF052732	CCDS3034.1, CCDS58850.1, CCDS58851.1	3q21.2	2010-07-19		2005-01-27	ENSG00000144908	ENSG00000144908	1.5.1.6	"""Aldehyde dehydrogenases"""	3978	protein-coding gene	gene with protein product	"""cytosolic 10-formyltetrahydrofolate dehydrogenase"""	600249	"""formyltetrahydrofolate dehydrogenase"""	FTHFD			Standard	NM_012190		Approved	10-fTHF	uc031sbp.1	O75891	OTTHUMG00000125551	ENST00000393434.2:c.769G>A	3.37:g.125872376C>T	ENSP00000377083:p.Glu257Lys		127355066	B4DG36|E9PBX3|Q68CS1	Missense_Mutation	SNP	PatternScan_PHOSPHOPANTETHEINE,HMMPfam_Formyl_trans_N,superfamily_formyl_transf,PatternScan_GART,superfamily_FMT_C_like,HMMPfam_Formyl_trans_C,superfamily_ACP_like,superfamily_Aldehyde_DH/Histidinol_DH,HMMPfam_Aldedh,PatternScan_ALDEHYDE_DEHYDR_GLU,PatternScan_ALDEHYDE_DEHYDR_CYS	p.E257K	ENST00000393434.2	37	c.769	CCDS3034.1	3	3	0.0013736263736263737	0	0.0	0	0.0	2	0.0034965034965034965	1	0.0013192612137203166	C	6.775	0.512001	0.12944	0.0	1.16E-4	ENSG00000144908	ENST00000273450;ENST00000472186;ENST00000452905;ENST00000393434;ENST00000393431;ENST00000455064	T;T;T;T;T;T	0.43294	0.95;0.95;0.95;0.95;0.95;0.98	4.25	2.37	0.29283	Formyl transferase, C-terminal-like (1);Formyl transferase, C-terminal (2);	0.633028	0.15907	N	0.238804	T	0.24851	0.0603	L	0.27053	0.805	0.09310	N	1	B;B;B;B;B	0.27264	0.173;0.083;0.061;0.149;0.025	B;B;B;B;B	0.21151	0.029;0.015;0.009;0.033;0.006	T	0.15065	-1.0450	10	0.23891	T	0.37	.	6.9175	0.24367	0.0:0.7198:0.1785:0.1018	.	82;156;309;162;257	B4DGC8;E9PBX3;Q59G10;Q9UFA9;O75891	.;.;.;.;AL1L1_HUMAN	K	267;257;156;257;257;82	ENSP00000273450:E267K;ENSP00000420293:E257K;ENSP00000395881:E156K;ENSP00000377083:E257K;ENSP00000377081:E257K;ENSP00000414126:E82K	ENSP00000273450:E267K	E	-	1	0	ALDH1L1	127355066	0.002000	0.14202	0.716000	0.30569	0.199000	0.23934	0.083000	0.14871	0.393000	0.25203	0.467000	0.42956	GAG	-	superfamily_FMT_C_like,HMMPfam_Formyl_trans_C		0.537	ALDH1L1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ALDH1L1	protein_coding	OTTHUMT00000354391.1	C	NM_012190		127355066	-1	no_errors	NM_012190	genbank	human	reviewed	54_36p	missense	SNP	0.003	T
ADAMTS19	171019	genome.wustl.edu	37	5	129039960	129039960	+	Missense_Mutation	SNP	G	G	A			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr5:129039960G>A	ENST00000274487.4	+	21	3315	c.3170G>A	c.(3169-3171)cGt>cAt	p.R1057H	CTC-575N7.1_ENST00000503616.1_RNA|ADAMTS19_ENST00000509467.1_3'UTR	NM_133638.3	NP_598377.3	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 19	1057	TSP type-1 4. {ECO:0000255|PROSITE- ProRule:PRU00210}.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(10)|kidney(9)|large_intestine(14)|lung(34)|ovary(6)|pancreas(1)|prostate(6)|skin(6)	91		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		AAAGGCATACGTCATCGGACC	0.423																																																0			5											241.0	216.0	225.0					5																	129039960		2203	4300	6503	129067859	SO:0001583	missense	171019			AJ311904	CCDS4146.1	5q23.3	2009-04-27	2005-08-19		ENSG00000145808	ENSG00000145808		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17111	protein-coding gene	gene with protein product		607513	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 19"""			11867212	Standard	NM_133638		Approved		uc003kvb.1	Q8TE59	OTTHUMG00000128990	ENST00000274487.4:c.3170G>A	5.37:g.129039960G>A	ENSP00000274487:p.Arg1057His		129067859		Missense_Mutation	SNP	"HMMPfam_Pep_M12B_propep,superfamily_Metalloproteases (""zincins"") catalytic domain,HMMPfam_Reprolysin,HMMSmart_SM00608,superfamily_TSP-1 type 1 repeat,HMMSmart_SM00209,HMMPfam_TSP_1,HMMPfam_ADAM_spacer1,PatternScan_ZINC_FINGER_C2H2_1,HMMPfam_PLAC"	p.R1057H	ENST00000274487.4	37	c.3170	CCDS4146.1	5	.	.	.	.	.	.	.	.	.	.	G	10.62	1.401303	0.25291	.	.	ENSG00000145808	ENST00000274487	T	0.57907	0.37	4.45	4.45	0.53987	.	0.078589	0.51477	D	0.000088	T	0.49864	0.1582	M	0.63169	1.94	0.50813	D	0.99989	B	0.30211	0.273	B	0.23275	0.045	T	0.49428	-0.8941	9	.	.	.	.	18.3946	0.90494	0.0:0.0:1.0:0.0	.	1057	Q8TE59	ATS19_HUMAN	H	1057	ENSP00000274487:R1057H	.	R	+	2	0	ADAMTS19	129067859	0.988000	0.35896	0.419000	0.26584	0.023000	0.10783	3.651000	0.54431	2.758000	0.94735	0.655000	0.94253	CGT	-	superfamily_TSP-1 type 1 repeat,HMMPfam_TSP_1,HMMSmart_SM00209		0.423	ADAMTS19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS19	protein_coding	OTTHUMT00000250979.2	G	NM_133638		129067859	+1	no_errors	NM_133638	genbank	human	reviewed	54_36p	missense	SNP	0.305	A
POTEE	445582	genome.wustl.edu	37	2	132021376	132021376	+	Missense_Mutation	SNP	A	A	G			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr2:132021376A>G	ENST00000356920.5	+	15	2442	c.2348A>G	c.(2347-2349)gAg>gGg	p.E783G	PLEKHB2_ENST00000404460.1_Intron|PLEKHB2_ENST00000303908.3_Intron|POTEE_ENST00000358087.5_3'UTR	NM_001083538.1	NP_001077007.1	Q6S8J3	POTEE_HUMAN	POTE ankyrin domain family, member E	783	Actin-like.				retina homeostasis (GO:0001895)|substantia nigra development (GO:0021762)	blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)											GATGACATGGAGAAGATCTGG	0.597																																																0			2											25.0	27.0	27.0					2																	132021376		1962	3829	5791	131737846	SO:0001583	missense	0			AY462868	CCDS46414.1	2q21.1	2014-04-10	2008-11-26	2008-11-26	ENSG00000188219	ENSG00000188219		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33895	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 2"""	608914	"""ANKRD26-like family C, member 1A"""	A26C1A			Standard	NM_001083538		Approved	POTE2, POTE-2, A26C1, POTE2gamma, CT104.2	uc002tsn.2	Q6S8J3	OTTHUMG00000186974	ENST00000356920.5:c.2348A>G	2.37:g.132021376A>G	ENSP00000439189:p.Glu783Gly		131737846	Q6S8J4|Q6S8J5|Q6S8J8	Missense_Mutation	SNP	superfamily_Ankyrin repeat,HMMPfam_Ank,HMMSmart_SM00248,superfamily_Actin-like ATPase domain,HMMPfam_Actin,HMMSmart_SM00268,PatternScan_ACTINS_ACT_LIKE,PatternScan_ACTINS_2	p.E783G	ENST00000356920.5	37	c.2348	CCDS46414.1	2	.	.	.	.	.	.	.	.	.	.	.	15.88	2.962921	0.53507	.	.	ENSG00000188219	ENST00000356920	D	0.98120	-4.73	.	.	.	.	.	.	.	.	D	0.98868	0.9617	H	0.98133	4.155	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.96831	0.9611	8	0.87932	D	0	.	4.5487	0.12098	0.9994:0.0:6.0E-4:0.0	.	783	Q6S8J3	POTEE_HUMAN	G	783	ENSP00000439189:E783G	ENSP00000439189:E783G	E	+	2	0	AC131180.1	131737846	1.000000	0.71417	0.199000	0.23439	0.201000	0.24016	6.177000	0.71961	0.103000	0.17682	0.102000	0.15555	GAG	-	superfamily_Actin-like ATPase domain,HMMPfam_Actin,HMMSmart_SM00268		0.597	POTEE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	POTEE	protein_coding		A	NM_001083538		131737846	+1	no_errors	NM_001083538	genbank	human	validated	54_36p	missense	SNP	1.000	G
HNRNPA0	10949	genome.wustl.edu	37	5	137089048	137089048	+	Silent	SNP	G	G	A			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr5:137089048G>A	ENST00000314940.4	-	1	991	c.708C>T	c.(706-708)ggC>ggT	p.G236G		NM_006805.3	NP_006796.1	Q13151	ROA0_HUMAN	heterogeneous nuclear ribonucleoprotein A0	236	Gly-rich.				3'-UTR-mediated mRNA stabilization (GO:0070935)|gene expression (GO:0010467)|inflammatory response (GO:0006954)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|response to lipopolysaccharide (GO:0032496)|RNA splicing (GO:0008380)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	AU-rich element binding (GO:0017091)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|RNA binding (GO:0003723)			large_intestine(1)|lung(2)|skin(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			cgccgccgccgcctccgtagg	0.667																																																0			5											4.0	6.0	5.0					5																	137089048		1696	3400	5096	137116947	SO:0001819	synonymous_variant	10949			U23803	CCDS4193.1	5q31	2013-02-12		2007-08-16	ENSG00000177733	ENSG00000177733		"""RNA binding motif (RRM) containing"""	5030	protein-coding gene	gene with protein product		609409		HNRPA0		7585247	Standard	NM_006805		Approved	hnRNPA0	uc003lbt.3	Q13151	OTTHUMG00000129156	ENST00000314940.4:c.708C>T	5.37:g.137089048G>A			137116947	Q6IB18	Silent	SNP	superfamily_RNA-binding domain RBD,HMMSmart_SM00360,HMMPfam_RRM_1	p.G236	ENST00000314940.4	37	c.708	CCDS4193.1	5																																																																																			-	NULL		0.667	HNRNPA0-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HNRNPA0	protein_coding	OTTHUMT00000251221.1	G	NM_006805		137116947	-1	no_errors	NM_006805	genbank	human	reviewed	54_36p	silent	SNP	0.987	A
PIK3CB	5291	genome.wustl.edu	37	3	138383926	138383926	+	Missense_Mutation	SNP	G	G	T	rs141548103		TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr3:138383926G>T	ENST00000477593.1	-	19	2697	c.2624C>A	c.(2623-2625)gCc>gAc	p.A875D	PIK3CB_ENST00000544716.1_Missense_Mutation_p.A326D|PIK3CB_ENST00000289153.2_Missense_Mutation_p.A875D			P42338	PK3CB_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit beta	875	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				activation of MAPK activity (GO:0000187)|autophagy (GO:0006914)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|cellular calcium ion homeostasis (GO:0006874)|chemotaxis (GO:0006935)|embryonic cleavage (GO:0040016)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|positive regulation of autophagy (GO:0010508)|regulation of cell-matrix adhesion (GO:0001952)|regulation of clathrin-mediated endocytosis (GO:2000369)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytosol (GO:0005829)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)			NS(1)|breast(3)|endometrium(5)|kidney(2)|large_intestine(4)|lung(17)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	41					Caffeine(DB00201)	TTTGTTGAAGGCTGCTGCAGC	0.413																																																0			3											81.0	76.0	78.0					3																	138383926		2203	4300	6503	139866616	SO:0001583	missense	5291				CCDS3104.1	3q22.3	2013-09-19	2012-07-13		ENSG00000051382	ENSG00000051382	2.7.1.153		8976	protein-coding gene	gene with protein product		602925	"""phosphoinositide-3-kinase, catalytic, beta polypeptide"""	PIK3C1		8246984	Standard	NM_006219		Approved		uc011bmq.3	P42338	OTTHUMG00000159893	ENST00000477593.1:c.2624C>A	3.37:g.138383926G>T	ENSP00000418143:p.Ala875Asp		139866616	D3DNF0|Q24JU2	Missense_Mutation	SNP	HMMPfam_PI3K_p85B,HMMSmart_PI3K_p85B,superfamily_SSF54236,HMMPfam_PI3K_rbd,HMMSmart_PI3K_rbd,HMMSmart_PI3K_C2,superfamily_C2_CaLB,HMMPfam_PI3K_C2,superfamily_ARM-type_fold,HMMSmart_PI3Ka,HMMPfam_PI3Ka,superfamily_Kinase_like,HMMPfam_PI3_PI4_kinase,HMMSmart_PI3Kc,PatternScan_PI3_4_KINASE_1,PatternScan_PI3_4_KINASE_2	p.A875D	ENST00000477593.1	37	c.2624	CCDS3104.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	31|31	5.064594|5.064594	0.93898|0.93898	.|.	.|.	ENSG00000051382|ENSG00000051382	ENST00000477593;ENST00000544716;ENST00000289153|ENST00000493568	T;T;T|.	0.75821|.	-0.97;-0.97;-0.97|.	5.46|5.46	5.46|5.46	0.80206|0.80206	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (4);|.	0.050717|.	0.85682|.	D|.	0.000000|.	T|T	0.81908|0.81908	0.4922|0.4922	M|M	0.81802|0.81802	2.56|2.56	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	0.999;1.0;0.999|.	D;D;P|.	0.81914|.	0.992;0.995;0.904|.	T|T	0.82018|0.82018	-0.0665|-0.0665	10|5	0.66056|.	D|.	0.02|.	-11.1785|-11.1785	19.6821|19.6821	0.95969|0.95969	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	875;462;326|.	P42338;B4DZI3;Q68DL0|.	PK3CB_HUMAN;.;.|.	D|T	875;326;875|507	ENSP00000418143:A875D;ENSP00000438259:A326D;ENSP00000289153:A875D|.	ENSP00000289153:A875D|.	A|P	-|-	2|1	0|0	PIK3CB|PIK3CB	139866616|139866616	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	9.869000|9.869000	0.99810|0.99810	2.719000|2.719000	0.93026|0.93026	0.555000|0.555000	0.69702|0.69702	GCC|CCT	-	superfamily_Kinase_like,HMMPfam_PI3_PI4_kinase,HMMSmart_PI3Kc		0.413	PIK3CB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIK3CB	protein_coding	OTTHUMT00000358019.1	G			139866616	-1	no_errors	NM_006219	genbank	human	provisional	54_36p	missense	SNP	1.000	T
PRKAB2	5565	genome.wustl.edu	37	1	146634112	146634112	+	Missense_Mutation	SNP	C	C	T			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr1:146634112C>T	ENST00000254101.3	-	6	717	c.579G>A	c.(577-579)atG>atA	p.M193I	PRKAB2_ENST00000425272.2_Missense_Mutation_p.M111I|PRKAB2_ENST00000496858.1_5'Flank	NM_005399.3	NP_005390.1	O43741	AAKB2_HUMAN	protein kinase, AMP-activated, beta 2 non-catalytic subunit	193					carnitine shuttle (GO:0006853)|cell cycle arrest (GO:0007050)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|insulin receptor signaling pathway (GO:0008286)|membrane organization (GO:0061024)|protein phosphorylation (GO:0006468)|regulation of fatty acid biosynthetic process (GO:0042304)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	AMP-activated protein kinase complex (GO:0031588)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)	identical protein binding (GO:0042802)			NS(1)|endometrium(1)|large_intestine(2)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	11	all_hematologic(923;0.0487)				Acetylsalicylic acid(DB00945)|Adenosine monophosphate(DB00131)	GAAACGCATACATTTCTTGAC	0.388																																																0			1											91.0	89.0	89.0					1																	146634112		2203	4300	6503	145100736	SO:0001583	missense	5565			BC053610	CCDS925.1	1q21.2	2008-02-05			ENSG00000131791	ENSG00000131791			9379	protein-coding gene	gene with protein product	"""AMPK beta 2"""	602741				8557660	Standard	NM_005399		Approved		uc001epe.3	O43741	OTTHUMG00000014032	ENST00000254101.3:c.579G>A	1.37:g.146634112C>T	ENSP00000254101:p.Met193Ile		145100736	A8K9V5|B4DH06|Q5VXY0	Missense_Mutation	SNP	HMMPfam_AMPKBI	p.M193I	ENST00000254101.3	37	c.579	CCDS925.1	1	.	.	.	.	.	.	.	.	.	.	C	8.485	0.860634	0.17178	.	.	ENSG00000131791	ENST00000254101;ENST00000425272	.	.	.	5.76	5.76	0.90799	.	0.099352	0.64402	D	0.000001	T	0.09291	0.0229	N	0.01446	-0.86	0.42614	D	0.993323	B;B	0.06786	0.0;0.001	B;B	0.10450	0.003;0.005	T	0.30880	-0.9963	9	0.06625	T	0.88	-0.3105	10.8278	0.46643	0.0:0.9146:0.0:0.0854	.	111;193	B4DH06;O43741	.;AAKB2_HUMAN	I	193;111	.	ENSP00000254101:M193I	M	-	3	0	PRKAB2	145100736	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.952000	0.40343	2.721000	0.93114	0.563000	0.77884	ATG	-	HMMPfam_AMPKBI		0.388	PRKAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKAB2	protein_coding	OTTHUMT00000039471.1	C	NM_005399		145100736	-1	no_errors	NM_005399	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
GIMAP1	170575	genome.wustl.edu	37	7	150417434	150417434	+	Silent	SNP	G	G	A			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr7:150417434G>A	ENST00000307194.5	+	3	482	c.342G>A	c.(340-342)gcG>gcA	p.A114A		NM_130759.3	NP_570115.1	Q8WWP7	GIMA1_HUMAN	GTPase, IMAP family member 1	114	AIG1-type G.				B cell differentiation (GO:0030183)|T cell differentiation (GO:0030217)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	GTP binding (GO:0005525)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(14)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	28			OV - Ovarian serous cystadenocarcinoma(82;0.0145)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GACCCCACGCGCTGCTCCTGG	0.622																																																0			7											44.0	42.0	43.0					7																	150417434		2203	4300	6503	150048367	SO:0001819	synonymous_variant	170575			AJ306287	CCDS5906.1	7q36.1	2014-04-04			ENSG00000213203	ENSG00000213203		"""GTPases, IMAP"""	23237	protein-coding gene	gene with protein product	"""immune-associated nucleotide-binding protein 2"""	608084				15474311, 18701445	Standard	NM_130759		Approved	HIMAP1, IMAP38, IMAP1, IAN2		Q8WWP7	OTTHUMG00000157489	ENST00000307194.5:c.342G>A	7.37:g.150417434G>A			150048367	B2RCI3|Q8NAZ0	Silent	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMPfam_AIG1	p.A114	ENST00000307194.5	37	c.342	CCDS5906.1	7																																																																																			-	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMPfam_AIG1		0.622	GIMAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GIMAP1	protein_coding	OTTHUMT00000348951.2	G	NM_130759		150048367	+1	no_errors	NM_130759	genbank	human	reviewed	54_36p	silent	SNP	0.012	A
CPA3	1359	genome.wustl.edu	37	3	148601470	148601470	+	Silent	SNP	G	G	C	rs200538548		TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr3:148601470G>C	ENST00000296046.3	+	9	901	c.849G>C	c.(847-849)acG>acC	p.T283T	RP11-680B3.2_ENST00000488190.1_RNA	NM_001870.2	NP_001861.2	P15088	CBPA3_HUMAN	carboxypeptidase A3 (mast cell)	283					angiotensin maturation (GO:0002003)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|secretory granule (GO:0030141)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|endometrium(1)|large_intestine(3)|lung(20)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	35			LUSC - Lung squamous cell carcinoma(72;0.0934)|Lung(72;0.115)			AGAAAGAGACGAAAGCTGTCA	0.448																																																0			3											89.0	84.0	86.0					3																	148601470		2203	4300	6503	150084160	SO:0001819	synonymous_variant	1359				CCDS3138.1	3q24	2012-02-10			ENSG00000163751	ENSG00000163751	3.4.17.1		2298	protein-coding gene	gene with protein product	"""mast cell carboxypeptidase A"", ""tissue carboxypeptidase A"""	114851					Standard	NM_001870		Approved		uc003ewm.3	P15088	OTTHUMG00000159526	ENST00000296046.3:c.849G>C	3.37:g.148601470G>C			150084160	Q96E94	Silent	SNP	superfamily_Protease propeptides/inhibitors,HMMPfam_Propep_M14,superfamily_Zn-dependent exopeptidases,HMMSmart_SM00631,HMMPfam_Peptidase_M14,PatternScan_CARBOXYPEPT_ZN_2	p.T283	ENST00000296046.3	37	c.849	CCDS3138.1	3																																																																																			-	superfamily_Zn-dependent exopeptidases,HMMSmart_SM00631,HMMPfam_Peptidase_M14		0.448	CPA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPA3	protein_coding	OTTHUMT00000355974.1	G	NM_001870		150084160	+1	no_errors	NM_001870	genbank	human	reviewed	54_36p	silent	SNP	0.992	C
RPTN	126638	genome.wustl.edu	37	1	152128184	152128184	+	Missense_Mutation	SNP	C	C	A			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr1:152128184C>A	ENST00000316073.3	-	3	1455	c.1391G>T	c.(1390-1392)gGt>gTt	p.G464V		NM_001122965.1	NP_001116437.1	Q6XPR3	RPTN_HUMAN	repetin	464	Gln-rich.					cornified envelope (GO:0001533)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|endometrium(14)|kidney(2)|large_intestine(1)|lung(32)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	59						GTCTGTCTGACCATAGTGGGA	0.507																																																0			1											787.0	696.0	723.0					1																	152128184		1568	3582	5150	150394808	SO:0001583	missense	126638			AK096436	CCDS41397.1	1q21.3	2013-01-10			ENSG00000215853	ENSG00000215853		"""EF-hand domain containing"""	26809	protein-coding gene	gene with protein product		613259				15854042	Standard	NM_001122965		Approved	FLJ39117	uc001ezs.1	Q6XPR3	OTTHUMG00000154095	ENST00000316073.3:c.1391G>T	1.37:g.152128184C>A	ENSP00000317895:p.Gly464Val		150394808	B7ZBZ3	Missense_Mutation	SNP	superfamily_EF-hand,HMMPfam_S_100,HMMPfam_efhand,PatternScan_S100_CABP,PatternScan_EF_HAND_1	p.G464V	ENST00000316073.3	37	c.1391	CCDS41397.1	1	.	.	.	.	.	.	.	.	.	.	c	16.20	3.056178	0.55325	.	.	ENSG00000215853	ENST00000316073;ENST00000541545	T	0.20738	2.05	5.32	3.44	0.39384	.	.	.	.	.	T	0.28896	0.0717	M	0.88031	2.925	0.37304	D	0.90882	D	0.59767	0.986	P	0.53450	0.726	T	0.28870	-1.0030	9	0.72032	D	0.01	-0.2689	9.8109	0.40822	0.0:0.8295:0.0:0.1705	.	464	Q6XPR3	RPTN_HUMAN	V	464;119	ENSP00000317895:G464V	ENSP00000317895:G464V	G	-	2	0	RPTN	150394808	0.000000	0.05858	0.060000	0.19600	0.024000	0.10985	0.644000	0.24766	0.615000	0.30124	0.498000	0.49722	GGT	-	NULL		0.507	RPTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPTN	protein_coding	OTTHUMT00000333867.1	C	XM_371312		150394808	-1	no_errors	ENST00000316073	ensembl	human	known	54_36p	missense	SNP	0.075	A
AGAP3	116988	genome.wustl.edu	37	7	150840640	150840640	+	Missense_Mutation	SNP	C	C	A			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr7:150840640C>A	ENST00000463381.1	+	15	1989	c.1493C>A	c.(1492-1494)tCc>tAc	p.S498Y	AGAP3_ENST00000397238.2_Missense_Mutation_p.S829Y	NM_001281300.1	NP_001268229.1	Q96P47	AGAP3_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 3	793	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				cellular response to reactive oxygen species (GO:0034614)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein import into nucleus, translocation (GO:0000060)|regulation of ARF GTPase activity (GO:0032312)|small GTPase mediated signal transduction (GO:0007264)	cell periphery (GO:0071944)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ARF GTPase activator activity (GO:0008060)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|zinc ion binding (GO:0008270)	p.S829F(1)		central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(3)|liver(2)|lung(9)|ovary(2)|prostate(3)|urinary_tract(1)	28						CTACATCTCTCCAGTGCCATG	0.582																																																1	Substitution - Missense(1)	central_nervous_system(1)	7											102.0	110.0	107.0					7																	150840640		2163	4258	6421	150471573	SO:0001583	missense	116988			AF413079	CCDS43681.1, CCDS55185.1, CCDS64802.1	7q36.1	2013-01-11	2008-09-22	2008-09-22	ENSG00000133612	ENSG00000133612		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16923	protein-coding gene	gene with protein product			"""centaurin, gamma 3"""	CENTG3			Standard	NM_001042535		Approved		uc003wjg.1	Q96P47	OTTHUMG00000158724	ENST00000463381.1:c.1493C>A	7.37:g.150840640C>A	ENSP00000418016:p.Ser498Tyr		150471573	B3KNZ8|E9PAL8|Q59EN0|Q96RK3	Missense_Mutation	SNP	HMMSmart_SM00173,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00175,HMMPfam_Miro,superfamily_PH domain-like,HMMPfam_PH,HMMSmart_SM00233,superfamily_Pyk2-associated protein beta ARF-GAP domain,HMMPfam_ArfGap,HMMSmart_SM00105,superfamily_Ankyrin repeat,HMMPfam_Ank	p.S829Y	ENST00000463381.1	37	c.2486		7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.18|17.18	3.324562|3.324562	0.60634|0.60634	.|.	.|.	ENSG00000133612|ENSG00000133612	ENST00000461065|ENST00000463381;ENST00000397232;ENST00000397238;ENST00000335355	.|T;T	.|0.65178	.|-0.14;-0.14	5.28|5.28	5.28|5.28	0.74379|0.74379	.|Ankyrin repeat-containing domain (4);	.|0.189806	.|0.47455	.|D	.|0.000235	T|T	0.78761|0.78761	0.4334|0.4334	M|M	0.70595|0.70595	2.14|2.14	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.76494	.|0.985;0.994;0.999;0.986	.|D;D;D;P	.|0.72338	.|0.956;0.961;0.977;0.876	T|T	0.80533|0.80533	-0.1340|-0.1340	5|10	.|0.87932	.|D	.|0	.|.	18.092|18.092	0.89478|0.89478	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|793;328;829;498	.|Q96P47;E7ETI2;Q96P47-4;B3KNZ8	.|AGAP3_HUMAN;.;.;.	T|Y	322|498;328;829;793	.|ENSP00000418016:S498Y;ENSP00000380413:S829Y	.|ENSP00000334157:S793Y	P|S	+|+	1|2	0|0	AGAP3|AGAP3	150471573|150471573	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.866000|0.866000	0.49608|0.49608	7.646000|7.646000	0.83445|0.83445	2.738000|2.738000	0.93877|0.93877	0.655000|0.655000	0.94253|0.94253	CCA|TCC	-	superfamily_Ankyrin repeat,HMMPfam_Ank		0.582	AGAP3-002	NOVEL	basic|exp_conf	protein_coding	AGAP3	protein_coding	OTTHUMT00000351909.2	C	NM_031946		150471573	+1	no_errors	NM_031946	genbank	human	validated	54_36p	missense	SNP	1.000	A
RIF1	55183	genome.wustl.edu	37	2	152289618	152289618	+	Missense_Mutation	SNP	A	A	G			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr2:152289618A>G	ENST00000243326.5	+	9	1436	c.953A>G	c.(952-954)aAg>aGg	p.K318R	RIF1_ENST00000430328.2_Missense_Mutation_p.K318R|RIF1_ENST00000444746.2_Missense_Mutation_p.K318R|RIF1_ENST00000453091.2_Missense_Mutation_p.K318R|RIF1_ENST00000428287.2_Missense_Mutation_p.K318R|RIF1_ENST00000433166.2_Missense_Mutation_p.K287R			Q9Y581	INSL6_HUMAN	replication timing regulatory factor 1	0					fertilization (GO:0009566)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|sperm motility (GO:0030317)|spermatid development (GO:0007286)	extracellular region (GO:0005576)	hormone activity (GO:0005179)			NS(2)|breast(8)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(19)|liver(1)|lung(34)|ovary(6)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	97				BRCA - Breast invasive adenocarcinoma(221;0.0429)		AAAAGACTCAAGTTGTTAATG	0.363																																																0			2											101.0	97.0	99.0					2																	152289618		2203	4300	6503	151997864	SO:0001583	missense	55183			AK022932	CCDS2194.1, CCDS54406.1	2q23.3	2014-06-02	2014-06-02		ENSG00000080345	ENSG00000080345			23207	protein-coding gene	gene with protein product		608952	"""RAP1 interacting factor homolog (yeast)"""			15342490, 15042697, 22850674	Standard	NM_018151		Approved	FLJ12870, FLJ10599	uc002txm.3	Q5UIP0	OTTHUMG00000131886	ENST00000243326.5:c.953A>G	2.37:g.152289618A>G	ENSP00000243326:p.Lys318Arg		151997864	A0AVS0|Q9NS16	Missense_Mutation	SNP	superfamily_ARM repeat,PatternScan_ABC_TRANSPORTER_1	p.K318R	ENST00000243326.5	37	c.953	CCDS2194.1	2	.	.	.	.	.	.	.	.	.	.	A	26.8	4.769764	0.90020	.	.	ENSG00000080345	ENST00000444746;ENST00000453091;ENST00000428287;ENST00000433166;ENST00000243326;ENST00000430328	T;T;T;T;T;T	0.49432	2.59;2.59;2.59;0.78;2.59;2.59	5.65	5.65	0.86999	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.61590	0.2359	L	0.42245	1.32	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.91635	0.977;0.999	T	0.61287	-0.7093	10	0.46703	T	0.11	-14.6204	15.5347	0.75993	1.0:0.0:0.0:0.0	.	318;318	Q5UIP0;Q5UIP0-2	RIF1_HUMAN;.	R	318;318;318;287;318;318	ENSP00000390181:K318R;ENSP00000414615:K318R;ENSP00000415691:K318R;ENSP00000396865:K287R;ENSP00000243326:K318R;ENSP00000416123:K318R	ENSP00000243326:K318R	K	+	2	0	RIF1	151997864	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.159000	0.77483	2.146000	0.66826	0.528000	0.53228	AAG	-	superfamily_ARM repeat		0.363	RIF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RIF1	protein_coding	OTTHUMT00000254836.3	A			151997864	+1	no_errors	NM_018151	genbank	human	validated	54_36p	missense	SNP	1.000	G
TRIM2	23321	genome.wustl.edu	37	4	154191630	154191630	+	Missense_Mutation	SNP	G	G	C			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr4:154191630G>C	ENST00000437508.2	+	2	294	c.93G>C	c.(91-93)aaG>aaC	p.K31N	TRIM2_ENST00000338700.5_Missense_Mutation_p.K58N|TRIM2_ENST00000494872.1_3'UTR	NM_001130067.1	NP_001123539.1	Q9C040	TRIM2_HUMAN	tripartite motif containing 2	31					cell death (GO:0008219)|regulation of neuron apoptotic process (GO:0043523)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(7)|prostate(1)	19	all_hematologic(180;0.093)	Medulloblastoma(177;0.00225)		GBM - Glioblastoma multiforme(119;0.0102)|LUSC - Lung squamous cell carcinoma(193;0.0703)		AACGGTACAAGAATCCCAAGG	0.522																																																0			4											160.0	136.0	145.0					4																	154191630		2203	4300	6503	154411080	SO:0001583	missense	23321			AF220018	CCDS3781.2, CCDS47147.1	4q31.3	2013-01-09	2011-01-25		ENSG00000109654	ENSG00000109654		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	15974	protein-coding gene	gene with protein product		614141	"""tripartite motif-containing 2"""			9628581, 11331580	Standard	NM_015271		Approved	KIAA0517, RNF86	uc003inh.2	Q9C040	OTTHUMG00000155991	ENST00000437508.2:c.93G>C	4.37:g.154191630G>C	ENSP00000415812:p.Lys31Asn		154411080	D3DP09|O60272|Q9BSI9|Q9UFZ1	Missense_Mutation	SNP	superfamily_SSF57850,HMMSmart_RING,HMMPfam_zf-C3HC4,PatternScan_ZF_RING_1,HMMPfam_zf-B_box,HMMSmart_BBOX,HMMSmart_BBC,HMMPfam_Filamin,HMMSmart_IG_FLMN,superfamily_Ig_E-set,superfamily_SSF101898,HMMPfam_NHL	p.K31N	ENST00000437508.2	37	c.93	CCDS47147.1	4	.	.	.	.	.	.	.	.	.	.	G	14.48	2.547884	0.45383	.	.	ENSG00000109654	ENST00000441616;ENST00000437508;ENST00000338700	D;D;D	0.84660	-1.88;-1.88;-1.88	5.68	5.68	0.88126	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, C3HC4 RING-type (1);	0.092101	0.85682	D	0.000000	T	0.78874	0.4352	L	0.35854	1.095	0.45979	D	0.998792	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.10450	0.005;0.002;0.001	T	0.72523	-0.4267	10	0.33940	T	0.23	-2.5424	13.0546	0.58973	0.0733:0.0:0.9267:0.0	.	31;58;31	C9JVI3;D3DP09;Q9C040	.;.;TRIM2_HUMAN	N	31;31;58	ENSP00000400879:K31N;ENSP00000415812:K31N;ENSP00000339659:K58N	ENSP00000339659:K58N	K	+	3	2	TRIM2	154411080	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.043000	0.49823	2.678000	0.91216	0.650000	0.86243	AAG	-	superfamily_SSF57850,HMMSmart_RING,HMMPfam_zf-C3HC4		0.522	TRIM2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM2	protein_coding	OTTHUMT00000342652.1	G			154411080	+1	no_errors	NM_015271	genbank	human	validated	54_36p	missense	SNP	1.000	C
FAM78B	149297	genome.wustl.edu	37	1	166039858	166039858	+	Missense_Mutation	SNP	C	C	T	rs368578294		TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr1:166039858C>T	ENST00000338353.3	-	3	995	c.406G>A	c.(406-408)Gtc>Atc	p.V136I	FAM78B_ENST00000354422.3_Missense_Mutation_p.V136I			Q5VT40	FA78B_HUMAN	family with sequence similarity 78, member B	136								p.V136I(2)		central_nervous_system(1)|endometrium(5)|large_intestine(1)|lung(8)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	19	all_hematologic(923;0.0813)|Acute lymphoblastic leukemia(8;0.155)					TTCATGCTGACGGAGAACCTG	0.522																																																2	Substitution - Missense(2)	upper_aerodigestive_tract(1)|endometrium(1)	1						C	ILE/VAL	0,4406		0,0,2203	187.0	165.0	173.0		406	5.5	1.0	1		173	1,8599	1.2+/-3.3	0,1,4299	no	missense	FAM78B	NM_001017961.3	29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	136/262	166039858	1,13005	2203	4300	6503	164306482	SO:0001583	missense	149297			AL626787	CCDS30931.1	1q24.1	2008-02-05			ENSG00000188859	ENSG00000188859			13495	protein-coding gene	gene with protein product							Standard	NM_001017961		Approved		uc021pee.1	Q5VT40	OTTHUMG00000034705	ENST00000338353.3:c.406G>A	1.37:g.166039858C>T	ENSP00000339681:p.Val136Ile		164306482	B7Z693	Missense_Mutation	SNP	NULL	p.V136I	ENST00000338353.3	37	c.406	CCDS30931.1	1	.	.	.	.	.	.	.	.	.	.	C	11.83	1.754252	0.31046	0.0	1.16E-4	ENSG00000188859	ENST00000354422;ENST00000338353	.	.	.	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	T	0.29256	0.0728	L	0.43152	1.355	0.45718	D	0.998625	B	0.31581	0.329	B	0.26969	0.075	T	0.23547	-1.0185	8	0.05833	T	0.94	-0.6844	17.3458	0.87309	0.0:1.0:0.0:0.0	.	136	Q5VT40	FA78B_HUMAN	I	136	.	ENSP00000339681:V136I	V	-	1	0	FAM78B	164306482	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.921000	0.70028	2.758000	0.94735	0.655000	0.94253	GTC	-	NULL		0.522	FAM78B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM78B	protein_coding	OTTHUMT00000343108.1	C	NM_001017961		164306482	-1	no_errors	NM_001017961	genbank	human	predicted	54_36p	missense	SNP	1.000	T
SLC38A11	151258	genome.wustl.edu	37	2	165793874	165793874	+	Silent	SNP	T	T	A			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr2:165793874T>A	ENST00000409149.3	-	6	726	c.435A>T	c.(433-435)tcA>tcT	p.S145S	SLC38A11_ENST00000409662.1_Silent_p.S145S|SLC38A11_ENST00000409058.1_Silent_p.S176S|SLC38A11_ENST00000303735.4_Silent_p.S123S|SLC38A11_ENST00000493887.1_5'UTR	NM_001199148.1	NP_001186077.1	Q08AI6	S38AB_HUMAN	solute carrier family 38, member 11	145					amino acid transport (GO:0006865)|sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)				endometrium(2)|large_intestine(4)|lung(8)|ovary(1)	15						GTGGACCCAGTGAAATTGCCC	0.353																																																0			2											128.0	127.0	127.0					2																	165793874		2203	4300	6503	165502120	SO:0001819	synonymous_variant	151258				CCDS2224.1, CCDS56142.1	2q24.3	2013-05-22			ENSG00000169507	ENSG00000169507		"""Solute carriers"""	26836	protein-coding gene	gene with protein product							Standard	NM_173512		Approved	FLJ39822, AVT2	uc002ucw.2	Q08AI6	OTTHUMG00000132144	ENST00000409149.3:c.435A>T	2.37:g.165793874T>A			165502120	B4DF99|Q8N887	Silent	SNP	HMMPfam_Aa_trans	p.S123	ENST00000409149.3	37	c.369	CCDS56142.1	2																																																																																			-	HMMPfam_Aa_trans		0.353	SLC38A11-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC38A11	protein_coding	OTTHUMT00000333390.1	T	NM_173512		165502120	-1	no_errors	NM_173512	genbank	human	provisional	54_36p	silent	SNP	0.041	A
CCDC181	57821	genome.wustl.edu	37	1	169388255	169388255	+	Missense_Mutation	SNP	C	C	T			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr1:169388255C>T	ENST00000367806.3	-	4	1363	c.1211G>A	c.(1210-1212)aGt>aAt	p.S404N	CCDC181_ENST00000545005.1_Missense_Mutation_p.S404N|CCDC181_ENST00000491570.1_5'UTR|CCDC181_ENST00000367805.3_Missense_Mutation_p.S404N	NM_021179.1	NP_067002.1	Q5TID7	CC181_HUMAN	coiled-coil domain containing 181	404						nucleus (GO:0005634)											ACTTACTCTACTGTTCATGTC	0.358																																																0			1											158.0	153.0	155.0					1																	169388255		2203	4299	6502	167654879	SO:0001583	missense	57821			AL049687	CCDS1279.1, CCDS72979.1	1q24	2013-03-14	2013-03-14	2013-03-14	ENSG00000117477	ENSG00000117477			28051	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 114"""	C1orf114			Standard	XM_005245381		Approved	FLJ25846	uc001gfz.1	Q5TID7	OTTHUMG00000035448	ENST00000367806.3:c.1211G>A	1.37:g.169388255C>T	ENSP00000356780:p.Ser404Asn		167654879	O60780|Q53FD5|Q5TID9|Q8TC48	Missense_Mutation	SNP	NULL	p.S404N	ENST00000367806.3	37	c.1211		1	.	.	.	.	.	.	.	.	.	.	C	14.79	2.639789	0.47153	.	.	ENSG00000117477	ENST00000367805;ENST00000367806;ENST00000545005	T;T;T	0.24538	1.86;1.85;1.86	6.02	4.17	0.49024	.	0.193036	0.53938	D	0.000050	T	0.08891	0.0220	L	0.43701	1.375	0.29468	N	0.857253	B;B;B	0.27140	0.169;0.026;0.026	B;B;B	0.25140	0.058;0.04;0.04	T	0.09271	-1.0682	9	0.45353	T	0.12	-4.92	7.5454	0.27764	0.1356:0.7369:0.0:0.1275	.	404;404;404	Q5TID7-2;Q5TID7;Q5TID7-3	.;CA114_HUMAN;.	N	404	ENSP00000356779:S404N;ENSP00000356780:S404N;ENSP00000442297:S404N	ENSP00000356779:S404N	S	-	2	0	C1orf114	167654879	0.272000	0.24172	0.996000	0.52242	0.991000	0.79684	0.179000	0.16840	0.880000	0.35969	0.650000	0.86243	AGT	-	NULL		0.358	CCDC181-002	KNOWN	basic|appris_candidate_longest	protein_coding	C1orf114	protein_coding	OTTHUMT00000086099.1	C	NM_021179		167654879	-1	no_errors	NM_021179	genbank	human	predicted	54_36p	missense	SNP	1.000	T
RP11-779O18.3	0	genome.wustl.edu	37	5	172190083	172190083	+	RNA	SNP	C	C	G			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr5:172190083C>G	ENST00000523005.1	+	0	69				RP11-779O18.1_ENST00000518941.1_RNA																							GTTGGTATTGCAAAAGAACTT	0.512																																																0			5																																								172122688			401218																															5.37:g.172190083C>G			172122688		RNA	SNP	-	NULL	ENST00000523005.1	37	NULL		5																																																																																			-	-		0.512	RP11-779O18.3-001	KNOWN	basic|exp_conf	antisense	LOC401218	antisense	OTTHUMT00000372516.1	C			172122688	-1	pseudogene	XR_042344	genbank	human	model	54_36p	rna	SNP	0.646	G
BRINP2	57795	genome.wustl.edu	37	1	177249882	177249882	+	Missense_Mutation	SNP	C	C	T			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr1:177249882C>T	ENST00000361539.4	+	8	1882	c.1570C>T	c.(1570-1572)Cgc>Tgc	p.R524C	BRINP2_ENST00000478325.1_3'UTR	NM_021165.2	NP_066988.1	Q9C0B6	BRNP2_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 2	524					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	extracellular region (GO:0005576)											GCAGGATAGCCGCATTGAGGT	0.567																																																0			1											42.0	38.0	39.0					1																	177249882		2203	4300	6503	175516505	SO:0001583	missense	57795				CCDS1320.1	1q24	2013-08-06	2013-08-06	2013-07-31	ENSG00000198797	ENSG00000198797			13746	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member B"""	FAM5B		15193423	Standard	NM_021165		Approved	DBCCR1L2	uc001glf.3	Q9C0B6	OTTHUMG00000034953	ENST00000361539.4:c.1570C>T	1.37:g.177249882C>T	ENSP00000354481:p.Arg524Cys		175516505	O95560|Q6ZWC1|Q7LCZ9|Q8N360	Missense_Mutation	SNP	HMMSmart_SM00457	p.R524C	ENST00000361539.4	37	c.1570	CCDS1320.1	1	.	.	.	.	.	.	.	.	.	.	C	15.20	2.761732	0.49468	.	.	ENSG00000198797	ENST00000536589;ENST00000361539	T	0.56776	0.44	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	T	0.72293	0.3442	M	0.79475	2.455	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.994	T	0.75789	-0.3194	10	0.87932	D	0	-20.1931	13.6412	0.62253	0.1549:0.8451:0.0:0.0	.	419;524	Q9C0B6-2;Q9C0B6	.;FAM5B_HUMAN	C	277;524	ENSP00000354481:R524C	ENSP00000354481:R524C	R	+	1	0	FAM5B	175516505	1.000000	0.71417	1.000000	0.80357	0.889000	0.51656	3.100000	0.50275	2.514000	0.84764	0.313000	0.20887	CGC	-	NULL		0.567	BRINP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM5B	protein_coding	OTTHUMT00000084599.1	C	NM_021165		175516505	+1	no_errors	NM_021165	genbank	human	provisional	54_36p	missense	SNP	1.000	T
SEC16B	89866	genome.wustl.edu	37	1	177901862	177901862	+	Missense_Mutation	SNP	G	G	A	rs376044643		TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr1:177901862G>A	ENST00000308284.6	-	23	2992	c.2903C>T	c.(2902-2904)cCg>cTg	p.P968L	RP4-798P15.3_ENST00000354921.3_RNA|SEC16B_ENST00000495165.1_5'UTR	NM_033127.2	NP_149118.2	Q96JE7	SC16B_HUMAN	SEC16 homolog B (S. cerevisiae)	968					COPII vesicle coating (GO:0048208)|endoplasmic reticulum organization (GO:0007029)|peroxisome fission (GO:0016559)|peroxisome organization (GO:0007031)|positive regulation of gene expression (GO:0010628)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|protein localization to endoplasmic reticulum (GO:0070972)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|intracellular membrane-bounded organelle (GO:0043231)				central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(7)|lung(14)|ovary(3)|skin(1)|stomach(1)	35						ACTAACATCCGGCAGAGGTGG	0.622													G|||	1	0.000199681	0.0008	0.0	5008	,	,		16584	0.0		0.0	False		,,,				2504	0.0															0			1						G	LEU/PRO	0,3992		0,0,1996	37.0	44.0	42.0		2903	-0.6	0.0	1		42	1,8321		0,1,4160	no	missense	SEC16B	NM_033127.2	98	0,1,6156	AA,AG,GG		0.012,0.0,0.0081	benign	968/1061	177901862	1,12313	1996	4161	6157	176168485	SO:0001583	missense	89866			AK090411	CCDS44281.1	1q25.2	2012-10-08	2007-06-20	2007-06-20	ENSG00000120341	ENSG00000120341			30301	protein-coding gene	gene with protein product	"""regucalcin gene promotor region related protein"""	612855	"""leucine zipper transcription regulator 2"""	LZTR2		11572484, 11605020	Standard	NM_033127		Approved	RGPR, PGPR-p117	uc001gli.1	Q96JE7	OTTHUMG00000167206	ENST00000308284.6:c.2903C>T	1.37:g.177901862G>A	ENSP00000308339:p.Pro968Leu		176168485	A3EYF1|Q5HYF6|Q8N7D6|Q96GX6	Missense_Mutation	SNP	PatternScan_PHOSPHOPANTETHEINE	p.P968L	ENST00000308284.6	37	c.2903	CCDS44281.1	1	.	.	.	.	.	.	.	.	.	.	G	9.096	1.003041	0.19121	0.0	1.2E-4	ENSG00000120341	ENST00000308284;ENST00000414025;ENST00000239472	T	0.15487	2.42	4.47	-0.6	0.11642	.	0.939877	0.08980	N	0.865948	T	0.09291	0.0229	N	0.17474	0.49	0.09310	N	1	B;B;B	0.18310	0.026;0.027;0.026	B;B;B	0.10450	0.005;0.003;0.005	T	0.40117	-0.9580	10	0.23891	T	0.37	-0.482	7.1344	0.25521	0.5175:0.0:0.4825:0.0	.	969;968;665	B1AM08;Q96JE7;Q96PW0	.;SC16B_HUMAN;.	L	968;653;684	ENSP00000308339:P968L	ENSP00000239472:P684L	P	-	2	0	AL359075.1	176168485	0.000000	0.05858	0.029000	0.17559	0.001000	0.01503	-0.272000	0.08560	0.009000	0.14813	-0.373000	0.07131	CCG	-	NULL		0.622	SEC16B-004	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC16B	protein_coding	OTTHUMT00000084773.16	G	NM_033127		176168485	-1	no_errors	NM_033127	genbank	human	validated	54_36p	missense	SNP	0.005	A
NPHS2	7827	genome.wustl.edu	37	1	179526170	179526170	+	Missense_Mutation	SNP	C	C	G			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr1:179526170C>G	ENST00000367615.4	-	5	798	c.730G>C	c.(730-732)Gat>Cat	p.D244H	NPHS2_ENST00000367616.4_Intron	NM_014625.2	NP_055440.1	Q9NP85	PODO_HUMAN	nephrosis 2, idiopathic, steroid-resistant (podocin)	244					actin cytoskeleton reorganization (GO:0031532)|excretion (GO:0007588)|metanephric glomerular visceral epithelial cell development (GO:0072249)	cell-cell junction (GO:0005911)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)				NS(1)|endometrium(1)|large_intestine(3)|lung(10)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	20						ACCTTTGCATCTTGGGCGATG	0.373																																																0			1											78.0	68.0	71.0					1																	179526170		2203	4300	6503	177792793	SO:0001583	missense	7827			AJ279254	CCDS1331.1, CCDS72988.1	1q25-q31	2014-06-27			ENSG00000116218	ENSG00000116218			13394	protein-coding gene	gene with protein product		604766				8589695, 10742096	Standard	XM_005245483		Approved	SRN1, PDCN	uc001gmq.4	Q9NP85	OTTHUMG00000035252	ENST00000367615.4:c.730G>C	1.37:g.179526170C>G	ENSP00000356587:p.Asp244His		177792793	B1AM32|B1AM33|Q8N6Q5	Missense_Mutation	SNP	HMMSmart_SM00244,HMMPfam_Band_7,PatternScan_BAND_7	p.D244H	ENST00000367615.4	37	c.730	CCDS1331.1	1	.	.	.	.	.	.	.	.	.	.	C	16.32	3.089854	0.55968	.	.	ENSG00000116218	ENST00000367615	D	0.94723	-3.5	5.93	5.93	0.95920	Band 7/stomatin-like, conserved site (1);	0.118857	0.64402	D	0.000018	D	0.92368	0.7578	L	0.33753	1.03	0.80722	D	1	B	0.26547	0.152	B	0.33121	0.158	D	0.89081	0.3476	10	0.49607	T	0.09	-20.209	18.9177	0.92512	0.0:1.0:0.0:0.0	.	244	Q9NP85	PODO_HUMAN	H	244	ENSP00000356587:D244H	ENSP00000356587:D244H	D	-	1	0	NPHS2	177792793	1.000000	0.71417	0.994000	0.49952	0.817000	0.46193	3.464000	0.53057	2.826000	0.97356	0.655000	0.94253	GAT	-	HMMSmart_SM00244,HMMPfam_Band_7,PatternScan_BAND_7		0.373	NPHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPHS2	protein_coding	OTTHUMT00000085283.1	C			177792793	-1	no_errors	NM_014625	genbank	human	reviewed	54_36p	missense	SNP	0.997	G
TTN	7273	genome.wustl.edu	37	2	179440136	179440136	+	Missense_Mutation	SNP	C	C	T			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr2:179440136C>T	ENST00000591111.1	-	276	66024	c.65800G>A	c.(65800-65802)Ggc>Agc	p.G21934S	TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.G23575S|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.G14635S|TTN_ENST00000460472.2_Missense_Mutation_p.G14510S|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|RP11-171I2.5_ENST00000604215.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.G14702S|TTN_ENST00000342992.6_Missense_Mutation_p.G21007S|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592600.1_RNA			Q8WZ42	TITIN_HUMAN	titin	21934	Fibronectin type-III 59. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGGTCAGAGCCTTTTCTTTGG	0.488																																																0			2											140.0	135.0	136.0					2																	179440136		2009	4195	6204	179148382	SO:0001583	missense	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.65800G>A	2.37:g.179440136C>T	ENSP00000465570:p.Gly21934Ser		179148382	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	superfamily_Immunoglobulin,HMMPfam_I-set,HMMSmart_SM00409,HMMSmart_SM00408,superfamily_Concanavalin A-like lectins/glucanases,superfamily_vWA-like,superfamily_WD40 repeat-like,superfamily_Positive stranded ssRNA viruses,HMMPfam_Titin_Z,HMMSmart_SM00406,PatternScan_IG_MHC,HMMPfam_PPAK,HMMPfam_ig,superfamily_Fibronectin type III,HMMSmart_SM00060,HMMPfam_fn3,PatternScan_FGGY_KINASES_1,PatternScan_PEROXIDASE_1,superfamily_Protein kinase-like (PK-like),HMMSmart_SM00219,HMMSmart_SM00220,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_TYR	p.G19556S	ENST00000591111.1	37	c.58666		2	.	.	.	.	.	.	.	.	.	.	C	16.03	3.007444	0.54361	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.58797	0.31;0.31;0.31;0.31	5.6	5.6	0.85130	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.69405	0.3107	L	0.45137	1.4	0.80722	D	1	P;P;P;D	0.60160	0.941;0.941;0.941;0.987	P;P;P;P	0.62184	0.639;0.639;0.639;0.899	T	0.71251	-0.4648	9	0.87932	D	0	.	19.612	0.95610	0.0:1.0:0.0:0.0	.	14510;14635;14702;21934	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	S	21007;14510;14702;14635;14508	ENSP00000343764:G21007S;ENSP00000434586:G14510S;ENSP00000340554:G14702S;ENSP00000352154:G14635S	ENSP00000340554:G14702S	G	-	1	0	TTN	179148382	1.000000	0.71417	0.998000	0.56505	0.988000	0.76386	6.070000	0.71220	2.651000	0.90000	0.585000	0.79938	GGC	-	superfamily_Concanavalin A-like lectins/glucanases,superfamily_vWA-like,superfamily_WD40 repeat-like,superfamily_Positive stranded ssRNA viruses,superfamily_Fibronectin type III,HMMSmart_SM00060,HMMPfam_fn3		0.488	TTN-019	PUTATIVE	basic	protein_coding	TTN	protein_coding	OTTHUMT00000460310.1	C	NM_133378		179148382	-1	no_errors	ENST00000375038	ensembl	human	known	54_36p	missense	SNP	1.000	T
TTN	7273	genome.wustl.edu	37	2	179486243	179486243	+	Missense_Mutation	SNP	C	C	T			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr2:179486243C>T	ENST00000591111.1	-	195	40609	c.40385G>A	c.(40384-40386)cGa>cAa	p.R13462Q	TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.R15103Q|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.R6163Q|TTN_ENST00000460472.2_Missense_Mutation_p.R6038Q|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000604956.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.R6230Q|TTN_ENST00000342992.6_Missense_Mutation_p.R12535Q			Q8WZ42	TITIN_HUMAN	titin	13462	Ig-like 90.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GCTTGGGAGTCGACAGTTGTA	0.398																																																0			2											126.0	126.0	126.0					2																	179486243		2016	4174	6190	179194488	SO:0001583	missense	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.40385G>A	2.37:g.179486243C>T	ENSP00000465570:p.Arg13462Gln		179194488	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	HMMSmart_SM00219,HMMSmart_SM00220,PatternScan_IG_MHC,HMMSmart_SM00406,HMMSmart_SM00408,HMMSmart_SM00409,HMMPfam_fn3,HMMSmart_SM00060,HMMPfam_PPAK,PatternScan_PROTEIN_KINASE_TYR,superfamily_Fibronectin type III,superfamily_Concanavalin A-like lectins/glucanases,superfamily_Protein kinase-like (PK-like),superfamily_WD40 repeat-like,HMMPfam_I-set,HMMPfam_ig,HMMPfam_Titin_Z,HMMPfam_Pkinase,PatternScan_FGGY_KINASES_1,PatternScan_PEROXIDASE_1,superfamily_Immunoglobulin,superfamily_vWA-like,superfamily_Positive stranded ssRNA viruses	p.R11085Q	ENST00000591111.1	37	c.33254		2	.	.	.	.	.	.	.	.	.	.	C	15.24	2.773611	0.49786	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.65916	-0.18;-0.18;-0.18;-0.18	6.17	6.17	0.99709	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);	.	.	.	.	T	0.62600	0.2441	L	0.38733	1.17	0.34183	D	0.671148	D;D;D;D	0.64830	0.98;0.98;0.98;0.994	P;P;P;P	0.52514	0.532;0.532;0.532;0.701	T	0.73065	-0.4100	9	0.87932	D	0	.	11.7019	0.51575	0.0:0.8958:0.0:0.1042	.	6038;6163;6230;13462	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	Q	12535;6038;6230;6163;6038	ENSP00000343764:R12535Q;ENSP00000434586:R6038Q;ENSP00000340554:R6230Q;ENSP00000352154:R6163Q	ENSP00000340554:R6230Q	R	-	2	0	TTN	179194488	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.141000	0.50593	2.941000	0.99782	0.655000	0.94253	CGA	-	HMMSmart_SM00408,HMMSmart_SM00409,superfamily_Concanavalin A-like lectins/glucanases,superfamily_WD40 repeat-like,HMMPfam_ig,superfamily_Immunoglobulin,superfamily_vWA-like,superfamily_Positive stranded ssRNA viruses		0.398	TTN-019	PUTATIVE	basic	protein_coding	TTN	protein_coding	OTTHUMT00000460310.1	C	NM_133378		179194488	-1	no_errors	ENST00000375038	ensembl	human	known	54_36p	missense	SNP	1.000	T
LAMC1	3915	genome.wustl.edu	37	1	183079714	183079714	+	Missense_Mutation	SNP	T	T	A			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr1:183079714T>A	ENST00000258341.4	+	4	1203	c.946T>A	c.(946-948)Tgt>Agt	p.C316S		NM_002293.3	NP_002284.3	P11047	LAMC1_HUMAN	laminin, gamma 1 (formerly LAMB2)	316	Laminin EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|endoderm development (GO:0007492)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|positive regulation of epithelial cell proliferation (GO:0050679)|protein complex assembly (GO:0006461)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(27)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	76						TGGAGTAGACTGTGAAAAGTG	0.478																																																0			1											192.0	187.0	188.0					1																	183079714		2203	4300	6503	181346337	SO:0001583	missense	3915			J03202	CCDS1351.1	1q31	2013-03-01			ENSG00000135862	ENSG00000135862		"""Laminins"""	6492	protein-coding gene	gene with protein product		150290		LAMB2		3234037	Standard	NM_002293		Approved		uc001gpy.4	P11047	OTTHUMG00000035418	ENST00000258341.4:c.946T>A	1.37:g.183079714T>A	ENSP00000258341:p.Cys316Ser		181346337	Q5VYE7	Missense_Mutation	SNP	HMMSmart_LamNT,HMMPfam_Laminin_N,HMMPfam_Laminin_EGF,HMMSmart_EGF_Lam,superfamily_SSF57196,PatternScan_EGF_1,PatternScan_EGF_LAM_1,superfamily_Grow_fac_recept,HMMSmart_LamB,HMMPfam_Laminin_B,PatternScan_EGF_2	p.C316S	ENST00000258341.4	37	c.946	CCDS1351.1	1	.	.	.	.	.	.	.	.	.	.	T	28.7	4.947147	0.92593	.	.	ENSG00000135862	ENST00000258341	D	0.97791	-4.54	4.87	4.87	0.63330	EGF-like, laminin (4);EGF-like region, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.99315	0.9760	H	0.99211	4.47	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98336	1.0536	10	0.87932	D	0	.	14.4557	0.67416	0.0:0.0:0.0:1.0	.	316	P11047	LAMC1_HUMAN	S	316	ENSP00000258341:C316S	ENSP00000258341:C316S	C	+	1	0	LAMC1	181346337	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.743000	0.85020	1.815000	0.52974	0.254000	0.18369	TGT	-	HMMPfam_Laminin_EGF,HMMSmart_EGF_Lam,superfamily_SSF57196,PatternScan_EGF_1,PatternScan_EGF_LAM_1		0.478	LAMC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMC1	protein_coding	OTTHUMT00000085954.2	T	NM_002293		181346337	+1	no_errors	NM_002293	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
ZNF804A	91752	genome.wustl.edu	37	2	185801312	185801312	+	Missense_Mutation	SNP	G	G	A			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr2:185801312G>A	ENST00000302277.6	+	4	1783	c.1189G>A	c.(1189-1191)Gag>Aag	p.E397K		NM_194250.1	NP_919226.1	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	397							metal ion binding (GO:0046872)			NS(5)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(22)|liver(2)|lung(79)|ovary(7)|pancreas(1)|prostate(2)|skin(12)|urinary_tract(1)	146						AAATGGTCCCGAGACATTGGC	0.378																																																0			2											69.0	72.0	71.0					2																	185801312		2203	4300	6503	185509557	SO:0001583	missense	91752			AF052145	CCDS2291.1	2q32.1	2012-10-05	2006-10-27	2006-10-27	ENSG00000170396	ENSG00000170396			21711	protein-coding gene	gene with protein product		612282		C2orf10		12970790	Standard	NM_194250		Approved		uc002uph.3	Q7Z570	OTTHUMG00000132625	ENST00000302277.6:c.1189G>A	2.37:g.185801312G>A	ENSP00000303252:p.Glu397Lys		185509557	A7E253|Q6ZN26	Missense_Mutation	SNP	HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1	p.E397K	ENST00000302277.6	37	c.1189	CCDS2291.1	2	.	.	.	.	.	.	.	.	.	.	G	4.880	0.163611	0.09287	.	.	ENSG00000170396	ENST00000302277	T	0.06933	3.24	5.6	3.8	0.43715	.	1.271890	0.05268	N	0.516962	T	0.13500	0.0327	L	0.53249	1.67	0.21782	N	0.999546	B	0.19073	0.033	B	0.12156	0.007	T	0.50171	-0.8859	10	0.23891	T	0.37	-6.0997	16.1389	0.81509	0.0721:0.0:0.9279:0.0	.	397	Q7Z570	Z804A_HUMAN	K	397	ENSP00000303252:E397K	ENSP00000303252:E397K	E	+	1	0	ZNF804A	185509557	0.999000	0.42202	0.026000	0.17262	0.003000	0.03518	3.542000	0.53625	0.730000	0.32425	-1.287000	0.01368	GAG	-	NULL		0.378	ZNF804A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF804A	protein_coding	OTTHUMT00000255871.1	G	NM_194250		185509557	+1	no_errors	NM_194250	genbank	human	provisional	54_36p	missense	SNP	0.283	A
F11	2160	genome.wustl.edu	37	4	187201536	187201536	+	Missense_Mutation	SNP	G	G	A			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr4:187201536G>A	ENST00000403665.2	+	9	1377	c.1025G>A	c.(1024-1026)gGg>gAg	p.G342E	F11_ENST00000264692.4_Missense_Mutation_p.G290E	NM_000128.3	NP_000119.1	P03951	FA11_HUMAN	coagulation factor XI	342	Apple 4. {ECO:0000255|PROSITE- ProRule:PRU00315}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|plasminogen activation (GO:0031639)|positive regulation of fibrinolysis (GO:0051919)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|serine-type aminopeptidase activity (GO:0070009)|serine-type endopeptidase activity (GO:0004252)			NS(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(15)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	32		all_cancers(14;6.2e-52)|all_epithelial(14;1.62e-38)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|Colorectal(36;0.0161)|all_neural(102;0.202)		OV - Ovarian serous cystadenocarcinoma(60;2.13e-11)|BRCA - Breast invasive adenocarcinoma(30;4.59e-06)|GBM - Glioblastoma multiforme(59;0.000149)|STAD - Stomach adenocarcinoma(60;0.000314)|LUSC - Lung squamous cell carcinoma(40;0.00112)|READ - Rectum adenocarcinoma(43;0.176)	Coagulation Factor IX(DB00100)	TGCAACGAAGGGAAGTAAGCC	0.512																																																0			4											116.0	111.0	113.0					4																	187201536		2203	4300	6503	187438530	SO:0001583	missense	2160			M13142	CCDS3847.1	4q35	2008-08-01	2008-08-01		ENSG00000088926	ENSG00000088926	3.4.21.27		3529	protein-coding gene	gene with protein product	"""plasma thromboplastin antecedent"""	264900					Standard	NM_000128		Approved	FXI	uc003iza.1	P03951	OTTHUMG00000150311	ENST00000403665.2:c.1025G>A	4.37:g.187201536G>A	ENSP00000384957:p.Gly342Glu		187438530	D3DP64|Q4W5C2|Q9Y495	Missense_Mutation	SNP	HMMSmart_SM00223,PatternScan_APPLE,HMMPfam_PAN_1,superfamily_Hairpin loop containing domain-like,superfamily_Trypsin-like serine proteases,HMMSmart_SM00020,HMMPfam_Trypsin,PatternScan_TRYPSIN_HIS,PatternScan_TRYPSIN_SER	p.G342E	ENST00000403665.2	37	c.1025	CCDS3847.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	1.956|1.956	-0.439983|-0.439983	0.04636|0.04636	.|.	.|.	ENSG00000088926|ENSG00000088926	ENST00000403665;ENST00000264692|ENST00000452239	D;D|D	0.82167|0.82167	-1.58;-1.58|-1.58	5.59|5.59	-0.416|-0.416	0.12351|0.12351	Apple domain (2);PAN-1 domain (1);Apple-like (1);|.	1.291810|1.291810	0.05005|0.05005	N|N	0.469880|0.469880	T|T	0.67173|0.67173	0.2865|0.2865	N|N	0.04636|0.04636	-0.2|-0.2	0.09310|0.09310	N|N	1|1	B|.	0.11235|.	0.004|.	B|.	0.14578|.	0.011|.	T|T	0.54846|0.54846	-0.8232|-0.8232	10|8	0.02654|0.29301	T|T	1|0.29	.|.	11.067|11.067	0.47980|0.47980	0.6422:0.0:0.3578:0.0|0.6422:0.0:0.3578:0.0	.|.	342|.	P03951|.	FA11_HUMAN|.	E|R	342;290|158	ENSP00000384957:G342E;ENSP00000264692:G290E|ENSP00000397401:G158R	ENSP00000264692:G290E|ENSP00000397401:G158R	G|G	+|+	2|1	0|0	F11|F11	187438530|187438530	0.921000|0.921000	0.31238|0.31238	0.097000|0.097000	0.21041|0.21041	0.160000|0.160000	0.22226|0.22226	0.668000|0.668000	0.25127|0.25127	-0.103000|-0.103000	0.12175|0.12175	0.655000|0.655000	0.94253|0.94253	GGG|GGA	-	HMMSmart_SM00223,PatternScan_APPLE,HMMPfam_PAN_1		0.512	F11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	F11	protein_coding	OTTHUMT00000317519.4	G			187438530	+1	no_errors	NM_000128	genbank	human	reviewed	54_36p	missense	SNP	0.759	A
LPP	4026	genome.wustl.edu	37	3	188590516	188590516	+	Missense_Mutation	SNP	G	G	C			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr3:188590516G>C	ENST00000312675.4	+	10	1921	c.1675G>C	c.(1675-1677)Gat>Cat	p.D559H	LPP_ENST00000543006.1_Missense_Mutation_p.D559H	NM_001167672.1|NM_005578.3	NP_001161144.1|NP_005569.1	Q93052	LPP_HUMAN	LIM domain containing preferred translocation partner in lipoma	559	LIM zinc-binding 3. {ECO:0000255|PROSITE- ProRule:PRU00125}.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)		HMGA2/LPP(161)	NS(1)|breast(1)|large_intestine(3)|lung(2)|ovary(1)|upper_aerodigestive_tract(2)	10	all_cancers(143;1.37e-09)|all_hematologic(3;0.0429)|Ovarian(172;0.088)	all_lung(153;0.00139)|Lung NSC(153;0.00202)		GBM - Glioblastoma multiforme(93;0.00602)		TGTGGCTTTGGATCGAGATTT	0.552			T	"""HMGA2, MLL, C12orf9"""	"""lipoma, leukemia"""																																		Dom	yes		3	3q28	4026	LIM domain containing preferred translocation partner in lipoma		"""L, M"""	0			3											142.0	113.0	123.0					3																	188590516		2203	4300	6503	190073210	SO:0001583	missense	4026			AL833171	CCDS3291.1	3q27-q28	2004-03-02	2002-01-14		ENSG00000145012	ENSG00000145012			6679	protein-coding gene	gene with protein product		600700	"""LIM domain-containing preferred translocation partner in lipoma"""			8812423	Standard	XM_005247453		Approved		uc003frs.2	Q93052	OTTHUMG00000156387	ENST00000312675.4:c.1675G>C	3.37:g.188590516G>C	ENSP00000318089:p.Asp559His		190073210	A1L4L6|D3DNV6|Q8NFX5	Missense_Mutation	SNP	superfamily_Glucocorticoid receptor-like (DNA-binding domain),HMMSmart_SM00132,PatternScan_LIM_DOMAIN_1,HMMPfam_LIM	p.D559H	ENST00000312675.4	37	c.1675	CCDS3291.1	3	.	.	.	.	.	.	.	.	.	.	G	32	5.139635	0.94560	.	.	ENSG00000145012	ENST00000312675;ENST00000543006	D;D	0.89552	-2.53;-2.53	5.51	5.51	0.81932	Zinc finger, LIM-type (4);	0.000000	0.85682	D	0.000000	D	0.96405	0.8827	H	0.95504	3.68	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.97390	0.9988	10	0.87932	D	0	.	18.4152	0.90567	0.0:0.0:1.0:0.0	.	412;559	B7Z8W0;Q93052	.;LPP_HUMAN	H	559	ENSP00000318089:D559H;ENSP00000438891:D559H	ENSP00000318089:D559H	D	+	1	0	LPP	190073210	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	9.869000	0.99810	2.603000	0.88011	0.655000	0.94253	GAT	-	superfamily_Glucocorticoid receptor-like (DNA-binding domain),HMMSmart_SM00132,HMMPfam_LIM		0.552	LPP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPP	protein_coding	OTTHUMT00000344030.1	G	NM_005578		190073210	+1	no_errors	NM_005578	genbank	human	validated	54_36p	missense	SNP	1.000	C
IPO9	55705	genome.wustl.edu	37	1	201817578	201817578	+	Missense_Mutation	SNP	G	G	A			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr1:201817578G>A	ENST00000361565.4	+	4	439	c.370G>A	c.(370-372)Gtg>Atg	p.V124M	IPO9_ENST00000464348.1_3'UTR	NM_018085.4	NP_060555.2	Q96P70	IPO9_HUMAN	importin 9	124					protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	histone binding (GO:0042393)|protein transporter activity (GO:0008565)			cervix(1)|endometrium(5)|kidney(4)|large_intestine(5)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	38						GATAAGCAAAGTGCGCTCCAG	0.488																																																0			1											131.0	114.0	120.0					1																	201817578		2203	4300	6503	200084201	SO:0001583	missense	55705			AF410465	CCDS1415.1	1q31.3	2008-02-05			ENSG00000198700	ENSG00000198700		"""Importins"""	19425	protein-coding gene	gene with protein product						11823430, 10574461	Standard	NM_018085		Approved	Imp9, FLJ10402	uc001gwz.3	Q96P70	OTTHUMG00000035805	ENST00000361565.4:c.370G>A	1.37:g.201817578G>A	ENSP00000354742:p.Val124Met		200084201	B1ASV5|Q8N1Y1|Q8N3I2|Q8NCG9|Q96SU6|Q9NW01|Q9P0A8|Q9ULM8	Missense_Mutation	SNP	superfamily_ARM repeat,HMMPfam_IBN_N	p.V124M	ENST00000361565.4	37	c.370	CCDS1415.1	1	.	.	.	.	.	.	.	.	.	.	G	24.6	4.551062	0.86127	.	.	ENSG00000198700	ENST00000361565	T	0.73152	-0.72	6.02	5.11	0.69529	Armadillo-like helical (1);Armadillo-type fold (1);	0.105080	0.64402	D	0.000004	T	0.76506	0.3997	L	0.39898	1.24	0.80722	D	1	D	0.65815	0.995	D	0.65773	0.938	T	0.78277	-0.2266	10	0.62326	D	0.03	-5.2101	12.834	0.57763	0.0781:0.0:0.9219:0.0	.	124	Q96P70	IPO9_HUMAN	M	124	ENSP00000354742:V124M	ENSP00000354742:V124M	V	+	1	0	IPO9	200084201	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	9.757000	0.98924	1.552000	0.49463	0.650000	0.86243	GTG	-	superfamily_ARM repeat		0.488	IPO9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IPO9	protein_coding	OTTHUMT00000087088.1	G	NM_018085		200084201	+1	no_errors	NM_018085	genbank	human	validated	54_36p	missense	SNP	1.000	A
CR1	1378	genome.wustl.edu	37	1	207785131	207785131	+	Silent	SNP	C	C	A			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr1:207785131C>A	ENST00000367049.4	+	38	6405	c.6405C>A	c.(6403-6405)ctC>ctA	p.L2135L	CR1_ENST00000367051.1_Silent_p.L1685L|CR1_ENST00000367053.1_Silent_p.L1685L|CR1_ENST00000367052.1_Silent_p.L1685L|CR1_ENST00000400960.2_Silent_p.L1685L	NM_000651.4	NP_000642.3	P17927	CR1_HUMAN	complement component (3b/4b) receptor 1 (Knops blood group)	1685					complement activation, classical pathway (GO:0006958)|complement receptor mediated signaling pathway (GO:0002430)|innate immune response (GO:0045087)|negative regulation of complement activation, alternative pathway (GO:0045957)|negative regulation of complement activation, classical pathway (GO:0045959)|negative regulation of serine-type endopeptidase activity (GO:1900004)|positive regulation of serine-type endopeptidase activity (GO:1900005)|regulation of complement activation (GO:0030449)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	complement component C3b binding (GO:0001851)|complement component C3b receptor activity (GO:0004877)|complement component C4b binding (GO:0001855)|complement component C4b receptor activity (GO:0001861)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(9)|kidney(11)|large_intestine(13)|lung(33)|ovary(3)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						GCTATGACCTCAGAGGGGCTG	0.572																																																0			1											120.0	121.0	120.0					1																	207785131		1943	4145	6088	205851754	SO:0001819	synonymous_variant	1378			Y00816	CCDS44308.1, CCDS44309.1	1q32	2014-07-19	2006-01-12		ENSG00000203710	ENSG00000203710		"""CD molecules"", ""Blood group antigens"", ""Complement system"""	2334	protein-coding gene	gene with protein product		120620	"""complement component (3b/4b) receptor 1, including Knops blood group system"""			1708809	Standard	XM_005273064		Approved	CD35, KN	uc001hfx.3	P17927	OTTHUMG00000036311	ENST00000367049.4:c.6405C>A	1.37:g.207785131C>A			205851754	Q16744|Q16745|Q5SR43|Q5SR45|Q9UQV2	Silent	SNP	superfamily_Complement control module/SCR domain,HMMPfam_Sushi,HMMSmart_SM00032	p.L2135	ENST00000367049.4	37	c.6405	CCDS44308.1	1																																																																																			-	superfamily_Complement control module/SCR domain,HMMPfam_Sushi,HMMSmart_SM00032		0.572	CR1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	CR1	protein_coding	OTTHUMT00000382527.1	C	NM_000573		205851754	+1	no_errors	NM_000651	genbank	human	reviewed	54_36p	silent	SNP	0.001	A
DAW1	164781	genome.wustl.edu	37	2	228769698	228769698	+	Silent	SNP	C	C	A			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr2:228769698C>A	ENST00000309931.2	+	8	785	c.702C>A	c.(700-702)atC>atA	p.I234I	DAW1_ENST00000545118.1_Silent_p.I219I|DAW1_ENST00000373666.2_Silent_p.I234I	NM_178821.1	NP_849143.1	Q8N136	DAW1_HUMAN	dynein assembly factor with WDR repeat domains 1	234						cilium (GO:0005929)											GAGACAGAATCATCACGGGGT	0.413																																																0			2											164.0	167.0	166.0					2																	228769698		2203	4300	6503	228477942	SO:0001819	synonymous_variant	164781				CCDS2470.1	2q36.3	2013-09-03	2013-02-19	2013-02-19	ENSG00000123977	ENSG00000123977		"""WD repeat domain containing"""	26383	protein-coding gene	gene with protein product	"""outer row dynein assembly 16 homolog (Chlamydomonas)"""		"""WD repeat domain 69"""	WDR69		20568242, 21953912	Standard	NM_178821		Approved	FLJ25955, ODA16	uc002vpn.1	Q8N136	OTTHUMG00000133190	ENST00000309931.2:c.702C>A	2.37:g.228769698C>A			228477942	Q6ZRY1|Q8N776	Silent	SNP	superfamily_WD40 repeat-like,HMMSmart_SM00320,HMMPfam_WD40,PatternScan_WD_REPEATS_1	p.I234	ENST00000309931.2	37	c.702	CCDS2470.1	2																																																																																			-	superfamily_WD40 repeat-like,HMMSmart_SM00320,HMMPfam_WD40,PatternScan_WD_REPEATS_1		0.413	DAW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR69	protein_coding	OTTHUMT00000331745.1	C	NM_178821		228477942	+1	no_errors	NM_178821	genbank	human	provisional	54_36p	silent	SNP	1.000	A
MAP10	54627	genome.wustl.edu	37	1	232942775	232942775	+	Missense_Mutation	SNP	G	G	C			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr1:232942775G>C	ENST00000418460.1	+	1	2133	c.2006G>C	c.(2005-2007)aGa>aCa	p.R669T		NM_019090.2	NP_061963.2	Q9P2G4	MAP10_HUMAN	microtubule-associated protein 10	527					cytoplasmic microtubule organization (GO:0031122)|positive regulation of cytokinesis (GO:0032467)|regulation of microtubule-based process (GO:0032886)|spindle midzone assembly involved in mitosis (GO:0051256)	centrosome (GO:0005813)|cytoplasmic microtubule (GO:0005881)|midbody (GO:0030496)|mitotic spindle midzone (GO:1990023)|mitotic spindle pole (GO:0097431)	microtubule binding (GO:0008017)										TATAGAAAAAGACAATCACAA	0.353																																																0			1											41.0	40.0	40.0					1																	232942775		1826	4088	5914	231009398	SO:0001583	missense	54627			AB037804	CCDS44334.1	1q42.2	2013-02-12	2013-02-12	2013-02-12	ENSG00000212916	ENSG00000212916			29265	protein-coding gene	gene with protein product	"""microtubule regulator 120 KDa"""		"""KIAA1383"""	KIAA1383		23264731	Standard	NM_019090		Approved	MTR120	uc001hvh.2	Q9P2G4	OTTHUMG00000037819	ENST00000418460.1:c.2006G>C	1.37:g.232942775G>C	ENSP00000403208:p.Arg669Thr		231009398	A8K2F1|Q32MI1|Q58EZ9|Q5VV83	Missense_Mutation	SNP	NULL	p.R669T	ENST00000418460.1	37	c.2006	CCDS44334.1	1	.	.	.	.	.	.	.	.	.	.	G	0.218	-1.031004	0.02029	.	.	ENSG00000212916	ENST00000418460	.	.	.	6.08	-6.82	0.01698	.	1.198800	0.06715	N	0.773884	T	0.07143	0.0181	N	0.02011	-0.69	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.28364	-1.0046	9	0.09590	T	0.72	-0.9473	0.895	0.01262	0.3191:0.3072:0.1693:0.2044	.	527	Q9P2G4	K1383_HUMAN	T	669	.	ENSP00000403208:R669T	R	+	2	0	KIAA1383	231009398	0.992000	0.36948	0.028000	0.17463	0.002000	0.02628	0.204000	0.17335	-0.750000	0.04740	-0.930000	0.02707	AGA	-	NULL		0.353	MAP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1383	protein_coding	OTTHUMT00000092317.3	G	NM_019090		231009398	+1	no_errors	NM_019090	genbank	human	validated	54_36p	missense	SNP	0.167	C
DGKD	8527	genome.wustl.edu	37	2	234368407	234368407	+	Missense_Mutation	SNP	G	G	T			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr2:234368407G>T	ENST00000264057.2	+	23	2711	c.2699G>T	c.(2698-2700)cGc>cTc	p.R900L	DGKD_ENST00000409813.3_Missense_Mutation_p.R856L	NM_152879.2	NP_690618.2	Q16760	DGKD_HUMAN	diacylglycerol kinase, delta 130kDa	900					blood coagulation (GO:0007596)|cell growth (GO:0016049)|diacylglycerol metabolic process (GO:0046339)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|multicellular organismal development (GO:0007275)|platelet activation (GO:0030168)|protein homooligomerization (GO:0051260)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein transport (GO:0015031)|response to organic substance (GO:0010033)|second-messenger-mediated signaling (GO:0019932)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol binding (GO:0019992)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			central_nervous_system(2)|endometrium(4)|kidney(1)|large_intestine(13)|lung(15)|ovary(1)|pancreas(1)|skin(1)	38		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0538)		Epithelial(121;1.31e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000416)|Lung(119;0.00285)|LUSC - Lung squamous cell carcinoma(224;0.00655)	Phosphatidylserine(DB00144)	GCTCAGTGTCGCACGGTGAAG	0.567																																																0			2											85.0	72.0	77.0					2																	234368407		2203	4300	6503	234033146	SO:0001583	missense	8527			D63479	CCDS2504.1, CCDS46546.1	2q37	2013-01-10	2002-08-29		ENSG00000077044	ENSG00000077044		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	2851	protein-coding gene	gene with protein product	"""diglyceride kinase"""	601826	"""diacylglycerol kinase, delta (130kD)"""			8626538, 12810723	Standard	NM_003648		Approved	KIAA0145, DGKdelta	uc002vui.1	Q16760	OTTHUMG00000133290	ENST00000264057.2:c.2699G>T	2.37:g.234368407G>T	ENSP00000264057:p.Arg900Leu		234033146	Q14158|Q6PK55|Q8NG53	Missense_Mutation	SNP	superfamily_PH domain-like,HMMPfam_PH,HMMSmart_SM00233,superfamily_Cysteine-rich domain,HMMSmart_SM00109,PatternScan_ZF_DAG_PE_1,HMMPfam_C1_1,HMMPfam_DAGK_cat,HMMSmart_SM00046,HMMPfam_DAGK_acc,HMMSmart_SM00045,superfamily_SAM/Pointed domain,HMMSmart_SM00454,HMMPfam_SAM_2	p.R900L	ENST00000264057.2	37	c.2699	CCDS2504.1	2	.	.	.	.	.	.	.	.	.	.	G	26.2	4.711233	0.89112	.	.	ENSG00000077044	ENST00000264057;ENST00000409813	T;T	0.48522	0.81;0.81	4.35	4.35	0.52113	Diacylglycerol kinase, accessory domain (2);	0.000000	0.64402	D	0.000001	T	0.73869	0.3642	M	0.88640	2.97	0.58432	D	0.999997	D;D	0.89917	0.998;1.0	D;D	0.85130	0.979;0.997	T	0.80455	-0.1375	10	0.72032	D	0.01	.	17.4273	0.87529	0.0:0.0:1.0:0.0	.	856;900	Q16760-2;Q16760	.;DGKD_HUMAN	L	900;856	ENSP00000264057:R900L;ENSP00000386455:R856L	ENSP00000264057:R900L	R	+	2	0	DGKD	234033146	1.000000	0.71417	1.000000	0.80357	0.790000	0.44656	9.540000	0.98080	2.442000	0.82660	0.462000	0.41574	CGC	-	HMMPfam_DAGK_acc,HMMSmart_SM00045		0.567	DGKD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DGKD	protein_coding	OTTHUMT00000257072.2	G	NM_003648		234033146	+1	no_errors	NM_152879	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
UGT1A6	54578	genome.wustl.edu	37	2	234681080	234681080	+	Missense_Mutation	SNP	G	G	T			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr2:234681080G>T	ENST00000305139.6	+	5	1613	c.1474G>T	c.(1474-1476)Ggt>Tgt	p.G492C	UGT1A4_ENST00000373409.3_Missense_Mutation_p.G494C|UGT1A1_ENST00000609767.1_Missense_Mutation_p.G494C|UGT1A8_ENST00000305208.5_Missense_Mutation_p.G493C|UGT1A9_ENST00000354728.4_Missense_Mutation_p.G490C|UGT1A7_ENST00000373426.3_Missense_Mutation_p.G490C|UGT1A1_ENST00000609637.1_Missense_Mutation_p.G490C|UGT1A10_ENST00000344644.5_Missense_Mutation_p.G490C|UGT1A5_ENST00000373414.3_Missense_Mutation_p.G494C|UGT1A1_ENST00000608381.1_Missense_Mutation_p.G494C|UGT1A6_ENST00000373424.1_Missense_Mutation_p.G225C|UGT1A1_ENST00000608383.1_Missense_Mutation_p.G493C|UGT1A1_ENST00000373450.4_Missense_Mutation_p.G490C|UGT1A3_ENST00000482026.1_Missense_Mutation_p.G494C	NM_001072.3	NP_001063.2	P19224	UD16_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A6	492					cellular glucuronidation (GO:0052695)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	enzyme binding (GO:0019899)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(10)|skin(1)|upper_aerodigestive_tract(1)	22		Breast(86;0.000765)|all_lung(227;0.00267)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0457)|Lung SC(224;0.128)		Epithelial(121;5.86e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000384)|Lung(119;0.00306)|LUSC - Lung squamous cell carcinoma(224;0.00702)	Acetaminophen(DB00316)|Deferiprone(DB08826)|Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|Propofol(DB00818)|Valproic Acid(DB00313)	GGACGTGATTGGTTTCCTCTT	0.547																																																0			2	GRCh37	CM066253	UGT1A1	M							182.0	147.0	159.0					2																	234681080		2203	4300	6503	234345819	SO:0001583	missense	54657			M84130	CCDS2507.1, CCDS2508.1	2q37	2010-03-05	2005-07-20		ENSG00000167165	ENSG00000167165		"""UDP glucuronosyltransferases"""	12538	other	complex locus constituent		606431	"""UDP glycosyltransferase 1 family, polypeptide A6"""			9295054, 1339448	Standard	NM_001072		Approved	HLUGP, GNT1, UGT1F		P19224	OTTHUMG00000059122	ENST00000305139.6:c.1474G>T	2.37:g.234681080G>T	ENSP00000303174:p.Gly492Cys		234345819	A6NKK6|B8K289|Q96TE7	Missense_Mutation	SNP	superfamily_UDP-Glycosyltransferase/glycogen phosphorylase,HMMPfam_UDPGT,PatternScan_UDPGT	p.G494C	ENST00000305139.6	37	c.1480	CCDS2507.1	2	.	.	.	.	.	.	.	.	.	.	G	25.3	4.621994	0.87460	.	.	ENSG00000242366;ENSG00000242515;ENSG00000241119;ENSG00000244122;ENSG00000167165;ENSG00000167165;ENSG00000240224;ENSG00000244474;ENSG00000243135;ENSG00000241635	ENST00000373450;ENST00000344644;ENST00000354728;ENST00000373426;ENST00000373424;ENST00000305139;ENST00000373414;ENST00000373409;ENST00000482026;ENST00000305208	T;T;T;T;T;T;T;T;T;T	0.69561	-0.41;-0.41;-0.41;-0.41;-0.41;-0.41;-0.41;-0.41;-0.41;-0.41	5.83	5.83	0.93111	.	0.250050	0.38897	N	0.001526	D	0.83917	0.5358	M	0.80616	2.505	0.80722	D	1	P;D;D;D;D;D;D;D;D	0.89917	0.929;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	P;D;D;D;D;D;D;D;D	0.97110	0.736;0.987;1.0;0.997;0.998;1.0;0.994;0.994;0.977	D	0.84968	0.0881	10	0.87932	D	0	.	20.1338	0.98010	0.0:0.0:1.0:0.0	.	493;494;494;494;492;490;490;490;490	P22309;P35503;P22310;P35504;P19224;Q9HAW7;O60656;Q9HAW8;Q9HAW9	UD11_HUMAN;UD13_HUMAN;UD14_HUMAN;UD15_HUMAN;UD16_HUMAN;UD17_HUMAN;UD19_HUMAN;UD110_HUMAN;UD18_HUMAN	C	490;490;490;490;225;492;494;494;494;493	ENSP00000362549:G490C;ENSP00000343838:G490C;ENSP00000346768:G490C;ENSP00000362525:G490C;ENSP00000362523:G225C;ENSP00000303174:G492C;ENSP00000362513:G494C;ENSP00000362508:G494C;ENSP00000418532:G494C;ENSP00000304845:G493C	ENSP00000343838:G490C	G	+	1	0	UGT1A7;UGT1A6;UGT1A10;UGT1A9;UGT1A8;UGT1A3;UGT1A5;UGT1A4;UGT1A1	234345819	0.999000	0.42202	0.980000	0.43619	0.821000	0.46438	4.497000	0.60367	2.770000	0.95276	0.655000	0.94253	GGT	-	HMMPfam_UDPGT		0.547	UGT1A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGT1A4	protein_coding	OTTHUMT00000130988.1	G	NM_205862		234345819	+1	no_errors	NM_007120	genbank	human	reviewed	54_36p	missense	SNP	0.986	T
FMN2	56776	genome.wustl.edu	37	1	240286639	240286639	+	Silent	SNP	G	G	A			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr1:240286639G>A	ENST00000319653.9	+	2	2006	c.1776G>A	c.(1774-1776)tcG>tcA	p.S592S		NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	592					cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			ATGCAGCTTCGTTTGATGTAA	0.448																																																0			1											110.0	97.0	102.0					1																	240286639		2203	4300	6503	238353262	SO:0001819	synonymous_variant	56776			AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.1776G>A	1.37:g.240286639G>A			238353262	B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Silent	SNP	PatternScan_LECTIN_LEGUME_BETA,HMMSmart_SM00498,HMMPfam_Drf_FH1,superfamily_Formin homology 2 domain (FH2 domain),HMMPfam_FH2	p.S735	ENST00000319653.9	37	c.2205	CCDS31069.2	1																																																																																			-	NULL		0.448	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMN2	protein_coding	OTTHUMT00000096217.2	G	XM_371352		238353262	+1	no_errors	NM_020066	genbank	human	validated	54_36p	silent	SNP	0.478	A
DESI2	51029	genome.wustl.edu	37	1	244852607	244852607	+	Missense_Mutation	SNP	G	G	A			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr1:244852607G>A	ENST00000302550.11	+	3	551	c.172G>A	c.(172-174)Gga>Aga	p.G58R	DESI2_ENST00000263831.7_Intron	NM_016076.3	NP_057160.2	Q9BSY9	DESI2_HUMAN	desumoylating isopeptidase 2	58	PPPDE peptidase.					cytoplasm (GO:0005737)	peptidase activity (GO:0008233)										AATTTCCCCAGGAAATGCTTC	0.333																																																0			1											86.0	95.0	92.0					1																	244852607		2203	4296	6499	242919230	SO:0001583	missense	51029			AK025651	CCDS1626.1, CCDS73055.1	1q44	2012-05-16	2012-05-16	2012-05-16	ENSG00000121644	ENSG00000121644			24264	protein-coding gene	gene with protein product		614638	"""chromosome 1 open reading frame 121"", ""family with sequence similarity 152, member A"", ""PPPDE peptidase domain containing 1"""	C1orf121, FAM152A, PPPDE1		10810093, 22370726	Standard	XM_005273154		Approved	CGI-146, FLJ21998	uc001iao.3	Q9BSY9	OTTHUMG00000040398	ENST00000302550.11:c.172G>A	1.37:g.244852607G>A	ENSP00000306528:p.Gly58Arg		242919230	B1APK6|Q5VVC6|Q9NYS2|Q9Y3E4	Missense_Mutation	SNP	HMMPfam_DUF862	p.G58R	ENST00000302550.11	37	c.172	CCDS1626.1	1	.	.	.	.	.	.	.	.	.	.	G	8.996	0.979021	0.18812	.	.	ENSG00000121644	ENST00000302550;ENST00000418162	.	.	.	6.17	6.17	0.99709	Domain of unknown function DUF862, eukaryotic (1);	0.088104	0.85682	D	0.000000	T	0.36026	0.0952	N	0.03967	-0.31	0.80722	D	1	B	0.02656	0.0	B	0.12156	0.007	T	0.38112	-0.9676	9	0.07175	T	0.84	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	58	Q9BSY9	PPDE1_HUMAN	R	58;75	.	ENSP00000306528:G58R	G	+	1	0	PPPDE1	242919230	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.133000	0.77259	2.941000	0.99782	0.655000	0.94253	GGA	-	HMMPfam_DUF862		0.333	DESI2-001	NOVEL	basic|appris_principal|CCDS	protein_coding	PPPDE1	protein_coding	OTTHUMT00000097168.1	G	NM_016076		242919230	+1	no_errors	NM_016076	genbank	human	validated	54_36p	missense	SNP	1.000	A
TP53	7157	genome.wustl.edu	37	17	7578287	7578288	+	Frame_Shift_Ins	INS	-	-	T			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	-	-					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr17:7578287_7578288insT	ENST00000269305.4	-	6	750_751	c.561_562insA	c.(559-564)ggtctgfs	p.L188fs	TP53_ENST00000455263.2_Frame_Shift_Ins_p.L188fs|TP53_ENST00000445888.2_Frame_Shift_Ins_p.L188fs|TP53_ENST00000413465.2_Frame_Shift_Ins_p.L188fs|TP53_ENST00000420246.2_Frame_Shift_Ins_p.L188fs|TP53_ENST00000359597.4_Frame_Shift_Ins_p.L188fs|TP53_ENST00000574684.1_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	188	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		L -> P (in a sporadic cancer; somatic mutation).|L -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.G187fs*16(2)|p.L188fs*21(2)|p.L188V(1)|p.D186_P191delDGLAPP(1)|p.?(1)|p.L188fs*19(1)|p.G187_L188delGL(1)|p.?fs(1)|p.G187fs*64(1)|p.G187G(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGAGGGGCCAGACCTAAGAGCA	0.545		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	20	Whole gene deletion(8)|Insertion - Frameshift(3)|Deletion - Frameshift(3)|Deletion - In frame(2)|Complex - frameshift(1)|Unknown(1)|Substitution - Missense(1)|Substitution - coding silent(1)	bone(4)|large_intestine(3)|central_nervous_system(2)|lung(2)|liver(2)|upper_aerodigestive_tract(1)|stomach(1)|haematopoietic_and_lymphoid_tissue(1)|urinary_tract(1)|oesophagus(1)|ovary(1)|breast(1)	17																																								7519013	SO:0001589	frameshift_variant	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.561_562insA	17.37:g.7578287_7578288insT	ENSP00000269305:p.Leu188fs		7519012	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Ins	INS	HMMPfam_P53_TAD,HMMPfam_P53,superfamily_p53-like transcription factors,PatternScan_P53,HMMPfam_P53_tetramer,superfamily_p53 tetramerization domain	p.L187fs	ENST00000269305.4	37	c.562_561	CCDS11118.1	17																																																																																			-	HMMPfam_P53,superfamily_p53-like transcription factors		0.545	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	-	NM_000546		7519013	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	frame_shift_ins	INS	0.381:0.265	T
MRTO4	51154	genome.wustl.edu	37	1	19584004	19584005	+	Frame_Shift_Del	DEL	GG	GG	-	rs1042380	byFrequency	TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	GG	GG					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr1:19584004_19584005delGG	ENST00000330263.4	+	5	627_628	c.330_331delGG	c.(328-333)gaggagfs	p.EE110fs		NM_016183.3	NP_057267.2	Q9UKD2	MRT4_HUMAN	mRNA turnover 4 homolog (S. cerevisiae)	110					ribosome biogenesis (GO:0042254)	nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|large_intestine(1)|liver(2)|ovary(1)|pancreas(1)|stomach(1)	8		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Breast(348;0.00049)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|BRCA - Breast invasive adenocarcinoma(304;1.87e-05)|Kidney(64;0.000171)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|GBM - Glioblastoma multiforme(114;0.00301)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		GCACAAAGGAGGAGGTGAATGA	0.525																																					GBM(192;2418 3032 7540 48714)											0			1																																								19456592	SO:0001589	frameshift_variant	51154			AK027569	CCDS191.1	1p36.13	2008-02-05	2006-12-21	2007-01-05	ENSG00000053372	ENSG00000053372			18477	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 33"", ""MRT4, mRNA turnover 4, homolog (S. cerevisiae)"""	C1orf33			Standard	NM_016183		Approved	dJ657E11.4, MRT4	uc001bbs.3	Q9UKD2	OTTHUMG00000002496	ENST00000330263.4:c.330_331delGG	1.37:g.19584004_19584005delGG	ENSP00000364320:p.Glu110fs		19456591	B3KNB3|Q5TG55|Q96SS6|Q9BPV9	Frame_Shift_Del	DEL	HMMPfam_Ribosomal_L10	p.E111fs	ENST00000330263.4	37	c.330_331	CCDS191.1	1																																																																																			(deletion:cds_exon[19456535,19456602])	HMMPfam_Ribosomal_L10		0.525	MRTO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRTO4	protein_coding	OTTHUMT00000007075.2	GG	NM_016183		19456592	+1	no_errors	NM_016183	genbank	human	reviewed	54_36p	frame_shift_del	DEL	0.990:1.000	-
NCOA1	8648	genome.wustl.edu	37	2	24985627	24985628	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	AG	AG					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr2:24985627_24985628delAG	ENST00000406961.1	+	22	4789_4790	c.4137_4138delAG	c.(4135-4140)acagaafs	p.E1380fs	NCOA1_ENST00000395856.3_Frame_Shift_Del_p.E1380fs|NCOA1_ENST00000538539.1_Frame_Shift_Del_p.E1380fs|NCOA1_ENST00000407230.1_Frame_Shift_Del_p.E1229fs|NCOA1_ENST00000348332.3_Frame_Shift_Del_p.E1380fs|NCOA1_ENST00000405141.1_Frame_Shift_Del_p.E1380fs|NCOA1_ENST00000288599.5_Frame_Shift_Del_p.E1380fs			Q15788	NCOA1_HUMAN	nuclear receptor coactivator 1	1380					androgen receptor signaling pathway (GO:0030521)|cellular lipid metabolic process (GO:0044255)|cellular response to hormone stimulus (GO:0032870)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|estrous cycle phase (GO:0060206)|hippocampus development (GO:0021766)|histone H4 acetylation (GO:0043967)|hypothalamus development (GO:0021854)|labyrinthine layer morphogenesis (GO:0060713)|lactation (GO:0007595)|male gonad development (GO:0008584)|male mating behavior (GO:0060179)|ovulation cycle (GO:0042698)|positive regulation of apoptotic process (GO:0043065)|positive regulation of female receptivity (GO:0045925)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter by galactose (GO:0000435)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cellular response to drug (GO:2001038)|response to estradiol (GO:0032355)|response to progesterone (GO:0032570)|response to retinoic acid (GO:0032526)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|neuron projection (GO:0043005)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region DNA binding (GO:0001012)|RNA polymerase II transcription coactivator activity (GO:0001105)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)		PAX3/NCOA1(8)	breast(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(26)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	53	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTCTCAAAACAGAAGCAGATGG	0.426			T	PAX3	alveolar rhadomyosarcoma																																		Dom	yes		2	2p23	8648	nuclear receptor coactivator 1		M	0			2																																								24839132	SO:0001589	frameshift_variant	8648			U40396	CCDS1712.1, CCDS1713.1, CCDS42660.1	2p23	2011-07-01			ENSG00000084676	ENSG00000084676		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7668	protein-coding gene	gene with protein product		602691				7481822, 9575154	Standard	XM_005264625		Approved	SRC1, F-SRC-1, NCoA-1, KAT13A, RIP160, bHLHe74	uc002rfk.3	Q15788	OTTHUMG00000125523	ENST00000406961.1:c.4137_4138delAG	2.37:g.24985627_24985628delAG	ENSP00000385216:p.Glu1380fs		24839131	O00150|O43792|O43793|Q13071|Q13420|Q2T9G5|Q53SX3|Q6GVI5|Q7KYV3	Frame_Shift_Del	DEL	superfamily_HLH helix-loop-helix DNA-binding domain,HMMPfam_HLH,HMMSmart_SM00353,HMMPfam_PAS,HMMSmart_SM00091,superfamily_PYP-like sensor domain (PAS domain),HMMPfam_SRC-1,superfamily_Nuclear receptor coactivator interlocking domain,HMMPfam_Nuc_rec_co-act,HMMPfam_DUF1518	p.E1380fs	ENST00000406961.1	37	c.4137_4138	CCDS1712.1	2																																																																																			(deletion:cds_exon[24839060,24839149])	NULL		0.426	NCOA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NCOA1	protein_coding	OTTHUMT00000246852.3	AG	NM_147223		24839132	+1	no_errors	NM_003743	genbank	human	reviewed	54_36p	frame_shift_del	DEL	1.000:1.000	-
RB1	5925	genome.wustl.edu	37	13	48951157	48951157	+	Frame_Shift_Del	DEL	A	A	-			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr13:48951157delA	ENST00000267163.4	+	13	1457	c.1319delA	c.(1318-1320)gaafs	p.E440fs		NM_000321.2	NP_000312.2	P06400	RB_HUMAN	retinoblastoma 1	440	Domain A.|Pocket; binds T and E1A.				androgen receptor signaling pathway (GO:0030521)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell morphogenesis involved in neuron differentiation (GO:0048667)|chromatin remodeling (GO:0006338)|digestive tract development (GO:0048565)|enucleate erythrocyte differentiation (GO:0043353)|G1/S transition of mitotic cell cycle (GO:0000082)|glial cell apoptotic process (GO:0034349)|hepatocyte apoptotic process (GO:0097284)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|myoblast differentiation (GO:0045445)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron maturation (GO:0042551)|neuron projection development (GO:0031175)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to chromosome, centromeric region (GO:0071459)|Ras protein signal transduction (GO:0007265)|regulation of centromere complex assembly (GO:0090230)|regulation of cohesin localization to chromatin (GO:0071922)|regulation of lipid kinase activity (GO:0043550)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|sister chromatid biorientation (GO:0031134)|skeletal muscle cell differentiation (GO:0035914)|striated muscle cell differentiation (GO:0051146)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|Rb-E2F complex (GO:0035189)|spindle (GO:0005819)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|phosphoprotein binding (GO:0051219)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.0?(15)|p.?(8)		NS(3)|adrenal_gland(1)|bone(22)|breast(30)|central_nervous_system(48)|cervix(3)|endometrium(14)|eye(95)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(20)|kidney(3)|large_intestine(10)|liver(3)|lung(153)|oesophagus(1)|ovary(13)|pancreas(5)|pituitary(1)|prostate(14)|salivary_gland(2)|skin(9)|soft_tissue(9)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(31)	496		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	GGTTGTGTCGAAATTGGATCA	0.343		6	"""D, Mis, N, F, S"""		"""retinoblastoma, sarcoma, breast, small cell lung"""	"""retinoblastoma, sarcoma, breast, small cell lung"""			Hereditary Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)																												yes	Rec	yes	Familial retinoblastoma	13	13q14	5925	retinoblastoma gene		"""L, E, M, O"""	23	Whole gene deletion(15)|Unknown(8)	bone(11)|breast(5)|central_nervous_system(2)|adrenal_gland(1)|eye(1)|soft_tissue(1)|haematopoietic_and_lymphoid_tissue(1)|endometrium(1)	13											107.0	115.0	112.0					13																	48951157		2203	4299	6502	47849158	SO:0001589	frameshift_variant	5925	Familial Cancer Database		M15400	CCDS31973.1	13q14.2	2014-09-17	2008-07-31		ENSG00000139687	ENSG00000139687		"""Endogenous ligands"""	9884	protein-coding gene	gene with protein product	"""prepro-retinoblastoma-associated protein"", ""protein phosphatase 1, regulatory subunit 130"""	614041	"""osteosarcoma"""	OSRC		1857421, 15057823	Standard	NM_000321		Approved	RB, PPP1R130	uc001vcb.3	P06400	OTTHUMG00000016900	ENST00000267163.4:c.1319delA	13.37:g.48951157delA	ENSP00000267163:p.Glu440fs		47849158	A8K5E3|P78499|Q5VW46|Q8IZL4	Frame_Shift_Del	DEL	HMMPfam_RB_A,superfamily_Cyclin-like,HMMPfam_RB_B,HMMSmart_SM00385,HMMPfam_Rb_C	p.I441fs	ENST00000267163.4	37	c.1319	CCDS31973.1	13																																																																																			(deletion:cds_exon[47849055,47849171])	HMMPfam_RB_A,superfamily_Cyclin-like		0.343	RB1-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	RB1	protein_coding	OTTHUMT00000044884.1	A			47849158	+1	no_errors	NM_000321	genbank	human	reviewed	54_36p	frame_shift_del	DEL	0.984	-
CFAP36	112942	genome.wustl.edu	37	2	55771143	55771143	+	Frame_Shift_Del	DEL	C	C	-			TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr2:55771143delC	ENST00000349456.4	+	8	858	c.710delC	c.(709-711)tccfs	p.S238fs	CCDC104_ENST00000490934.1_3'UTR|CCDC104_ENST00000407816.3_Intron|CCDC104_ENST00000339012.3_Frame_Shift_Del_p.S263fs			Q96G28	CFA36_HUMAN		238										breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|liver(2)|lung(1)|ovary(2)	14			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			TCTGAAACTTCCTCCCTCCCA	0.393																																																0			2											95.0	101.0	99.0					2																	55771143		2203	4300	6503	55624647	SO:0001589	frameshift_variant	112942																														ENST00000349456.4:c.710delC	2.37:g.55771143delC	ENSP00000295117:p.Ser238fs		55624647	Q53SF0|Q53ST9|Q6UY34	Frame_Shift_Del	DEL	NULL	p.S238fs	ENST00000349456.4	37	c.710	CCDS1854.2	2																																																																																			(deletion:cds_exon[55624578,55624714])	NULL		0.393	CCDC104-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC104	protein_coding	OTTHUMT00000319610.2	C			55624647	+1	no_errors	NM_080667	genbank	human	validated	54_36p	frame_shift_del	DEL	0.948	-
TNRC18P2	27320	genome.wustl.edu	37	7	63033298	63033299	+	IGR	INS	-	-	GCT	rs200397868|rs373581853|rs368179487	byFrequency	TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	-	-					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr7:63033298_63033299insGCT								RP11-340I6.3 (150874 upstream) : RN7SL855P (38523 downstream)																							GTCTCCGAgccgctgctgctgc	0.693														1495	0.298522	0.1778	0.3213	5008	,	,		11950	0.2966		0.33	False		,,,				2504	0.4151															0			7																																								62670734	SO:0001628	intergenic_variant	27320																															7.37:g.63033305_63033307dupGCT			62670733		In_Frame_Ins	INS	NULL	p.495in_frame_insS		37	c.1486_1485		7																																																																																			-	NULL	0	0.693					TNRC18			-			62670734	-1	pseudogene	XM_376618	genbank	human	model	54_36p	in_frame_ins	INS	1.000:1.000	GCT
HNF1A	6927	genome.wustl.edu	37	12	121434630	121434631	+	Frame_Shift_Ins	INS	-	-	TCATTCAT	rs55853809|rs75100977|rs397707647|rs371591990|rs587777932|rs58371019	byFrequency	TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	-	-					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr12:121434630_121434631insTCATTCAT	ENST00000402929.1	+	6	1529_1530	c.1394_1395insTCATTCAT	c.(1393-1398)actcatfs	p.-468fs	HNF1A_ENST00000257555.6_Intron|HNF1A_ENST00000543427.1_Frame_Shift_Ins_p.-351fs|HNF1A_ENST00000544413.1_Intron|HNF1A_ENST00000538626.1_Intron|HNF1A_ENST00000400024.2_Intron|HNF1A_ENST00000541395.1_Intron			P20823	HNF1A_HUMAN	HNF1 homeobox A						glucose homeostasis (GO:0042593)|glucose import (GO:0046323)|insulin secretion (GO:0030073)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|renal glucose absorption (GO:0035623)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(8)|large_intestine(19)|liver(175)|lung(9)|ovary(2)|prostate(1)|urinary_tract(1)	221	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					GCCACTGGGACTCATTCattca	0.53									Hepatic Adenoma, Familial Clustering of																																							0			12																																								119919014	SO:0001589	frameshift_variant	6927	Familial Cancer Database	incl. Maturity-Onset Diabetes of the Young type 3, MODY3	M57732	CCDS9209.1	12q24.31	2014-09-17	2007-08-24	2007-08-24	ENSG00000135100	ENSG00000135100		"""Homeoboxes / HNF class"""	11621	protein-coding gene	gene with protein product		142410	"""transcription factor 1, hepatic; LF-B1, hepatic nuclear factor (HNF1), albumin proximal factor"""	MODY3, TCF1		1535333, 7795649	Standard	NM_000545		Approved	HNF1, LFB1	uc001tzg.3	P20823	OTTHUMG00000151015	ENST00000402929.1:c.1403_1410dupTCATTCAT	12.37:g.121434631_121434638dupTCATTCAT	ENSP00000475300:p.Phe468fs		119919013	A5Z2R8|E0YMJ5|E0YMK0|E0YMK1|E2I9R4|E2I9R5|F5H5U3|Q2M3H2|Q99861	Frame_Shift_Ins	INS	superfamily_Dimerization cofactor of HNF-1 alpha,HMMPfam_HNF-1_N,superfamily_lambda repressor-like DNA-binding domains,superfamily_Homeodomain-like,HMMSmart_SM00389,HMMPfam_Homeobox,PatternScan_HOMEOBOX_1,HMMPfam_HNF-1B_C,HMMPfam_HNF-1A_C	p.F469fs	ENST00000402929.1	37	c.1394_1395		12																																																																																			-	HMMPfam_HNF-1B_C		0.530	HNF1A-003	PUTATIVE	basic	protein_coding	HNF1A	protein_coding	OTTHUMT00000320959.3	-	NM_000545		119919014	+1	no_errors	ENST00000344370	ensembl	human	known	54_36p	frame_shift_ins	INS	0.219:0.228	TCATTCAT
FGFR4	2264	genome.wustl.edu	37	5	176517136	176517137	+	Intron	INS	-	-	GTGT	rs397943303|rs59390048|rs536974291|rs111413202	byFrequency	TCGA-09-1674-01A-01W-0633-09	TCGA-09-1674-10A-01W-0633-09	-	-					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	d45bb919-f2fd-4ac0-ae04-fac8e2105a31	05712782-d79d-460a-9809-dded595d46fe	g.chr5:176517136_176517137insGTGT	ENST00000292408.4	+	3	336				FGFR4_ENST00000393648.2_Intron|FGFR4_ENST00000292410.3_Intron|FGFR4_ENST00000393637.1_Intron|FGFR4_ENST00000507708.1_Intron|FGFR4_ENST00000502906.1_Intron	NM_002011.3|NM_213647.1	NP_002002.3|NP_998812.1	P22455	FGFR4_HUMAN	fibroblast growth factor receptor 4						alveolar secondary septum development (GO:0061144)|cell migration (GO:0016477)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose homeostasis (GO:0042593)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ induction (GO:0001759)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphate ion homeostasis (GO:0055062)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of metalloenzyme activity (GO:0048554)|positive regulation of proteolysis (GO:0045862)|protein autophosphorylation (GO:0046777)|regulation of bile acid biosynthetic process (GO:0070857)|regulation of cholesterol homeostasis (GO:2000188)|regulation of extracellular matrix disassembly (GO:0010715)|regulation of lipid metabolic process (GO:0019216)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|heparin binding (GO:0008201)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(16)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	34	all_cancers(89;5.93e-05)|Renal(175;0.000269)|Lung NSC(126;0.0088)|all_lung(126;0.0142)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Palifermin(DB00039)|Ponatinib(DB08901)	tgtgtgtatgcgtgtgtgtgtg	0.54										TSP Lung(9;0.080)				3871	0.772963	0.5666	0.8026	5008	,	,		23021	0.9702		0.7286	False		,,,				2504	0.8732															0			5																																								176449743	SO:0001627	intron_variant	2264			AF202063	CCDS4410.1, CCDS4411.1	5q35.2	2013-09-19			ENSG00000160867	ENSG00000160867		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3691	protein-coding gene	gene with protein product		134935					Standard	XM_005265837		Approved	JTK2, CD334	uc003mfm.3	P22455	OTTHUMG00000151523	ENST00000292408.4:c.92-254->GTGT	5.37:g.176517141_176517144dupGTGT			176449742	G3JVM2|G3JVM5|G3JVM7|G3JVM9|O43785|Q14309|Q71TW8|Q8TDA0|Q96KE5	Frame_Shift_Ins	INS	PatternScan_EGF_2,superfamily_Immunoglobulin,HMMSmart_SM00409,HMMSmart_SM00408,HMMPfam_ig,HMMPfam_I-set,superfamily_Protein kinase-like (PK-like),HMMPfam_Pkinase_Tyr,HMMSmart_SM00219,HMMSmart_SM00220,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_TYR	p.V27fs	ENST00000292408.4	37	c.67_68	CCDS4410.1	5																																																																																			-	NULL		0.540	FGFR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGFR4	protein_coding	OTTHUMT00000253410.1	-			176449743	+1	no_start_codon	ENST00000377207	ensembl	human	known	54_36p	frame_shift_ins	INS	0.378:0.377	GTGT
