#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CHD5	26038	broad.mit.edu	37	1	6189018	6189018	+	Missense_Mutation	SNP	T	T	C			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr1:6189018T>C	ENST00000262450.3	-	23	3598	c.3499A>G	c.(3499-3501)Atg>Gtg	p.M1167V	CHD5_ENST00000378021.1_Missense_Mutation_p.M24V	NM_015557.2	NP_056372.1	O00258	WRB_HUMAN	chromodomain helicase DNA binding protein 5	0					tail-anchored membrane protein insertion into ER membrane (GO:0071816)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)		p.M1167V(1)		breast(3)|central_nervous_system(3)|liver(1)|lung(1)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	16	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)		TGGGTGAGCATCATCTTGCGC	0.637																																																1	Substitution - Missense(1)	ovary(1)	1											66.0	57.0	60.0					1																	6189018		2203	4300	6503	6111605	SO:0001583	missense	26038			AF425231	CCDS57.1	1p36.3	2013-01-28			ENSG00000116254	ENSG00000116254		"""Zinc fingers, PHD-type"""	16816	protein-coding gene	gene with protein product		610771				11889561, 12592387	Standard	NM_015557		Approved		uc001amb.2	Q8TDI0	OTTHUMG00000000952	ENST00000262450.3:c.3499A>G	1.37:g.6189018T>C	ENSP00000262450:p.Met1167Val		6111605	A8KAP8|A8MQ44|D3DSH9|O60740	Missense_Mutation	SNP	ENST00000262450.3	37	CCDS57.1	.	.	.	.	.	.	.	.	.	.	T	19.19	3.779100	0.70107	.	.	ENSG00000116254	ENST00000262450;ENST00000378006;ENST00000378021;ENST00000536802;ENST00000538279;ENST00000377999	D;T	0.95272	-3.66;2.48	4.1	4.1	0.47936	Helicase, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.92189	0.7523	N	0.16478	0.41	0.58432	D	0.999999	P;P	0.50528	0.713;0.936	P;P	0.56916	0.678;0.809	D	0.90131	0.4206	10	0.21540	T	0.41	-32.2349	13.5277	0.61605	0.0:0.0:0.0:1.0	.	1167;24	Q8TDI0;Q5TG85	CHD5_HUMAN;.	V	1167;683;24;575;575;24	ENSP00000262450:M1167V;ENSP00000367260:M24V	ENSP00000262450:M1167V	M	-	1	0	CHD5	6111605	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.975000	0.70475	1.839000	0.53478	0.459000	0.35465	ATG		0.637	CHD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002823.2	NM_015557	
LCK	3932	broad.mit.edu	37	1	32745786	32745786	+	Silent	SNP	C	C	T	rs188058742		TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr1:32745786C>T	ENST00000336890.5	+	12	1440	c.1302C>T	c.(1300-1302)gtC>gtT	p.V434V	LCK_ENST00000373564.3_Silent_p.V441V|LCK_ENST00000333070.4_Silent_p.V464V	NM_005356.3	NP_005347.3	P06239	LCK_HUMAN	LCK proto-oncogene, Src family tyrosine kinase	434	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|aging (GO:0007568)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|cellular zinc ion homeostasis (GO:0006882)|dephosphorylation (GO:0016311)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hemopoiesis (GO:0030097)|innate immune response (GO:0045087)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|positive regulation of gamma-delta T cell differentiation (GO:0045588)|positive regulation of gene expression (GO:0010628)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell receptor signaling pathway (GO:0050862)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|positive regulation of uterine smooth muscle contraction (GO:0070474)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of defense response to virus by virus (GO:0050690)|regulation of lymphocyte activation (GO:0051249)|release of sequestered calcium ion into cytosol (GO:0051209)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to mechanical stimulus (GO:0009612)|response to zinc ion (GO:0010043)|T cell costimulation (GO:0031295)|T cell differentiation (GO:0030217)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|membrane raft (GO:0045121)|pericentriolar material (GO:0000242)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|ATP binding (GO:0005524)|ATPase binding (GO:0051117)|CD4 receptor binding (GO:0042609)|CD8 receptor binding (GO:0042610)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine kinase activity (GO:0004713)|SH2 domain binding (GO:0042169)	p.V434V(1)		breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(1)|large_intestine(5)|lung(15)|ovary(2)|skin(2)|urinary_tract(1)	37		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.212)			Dasatinib(DB01254)|Ponatinib(DB08901)	CGGAAATTGTCACCCACGGCC	0.507			T	TRB@	T-ALL								.|||	1	0.000199681	0.0	0.0014	5008	,	,		18248	0.0		0.0	False		,,,				2504	0.0						Dom	yes		1	1p35-p34.3	3932	lymphocyte-specific protein tyrosine kinase		L	1	Substitution - coding silent(1)	ovary(1)	1											90.0	81.0	84.0					1																	32745786		2203	4300	6503	32518373	SO:0001819	synonymous_variant	3932			M36881	CCDS359.1	1p34.3	2014-09-17	2014-06-25		ENSG00000182866	ENSG00000182866	2.7.10.1	"""SH2 domain containing"""	6524	protein-coding gene	gene with protein product		153390	"""lymphocyte-specific protein tyrosine kinase"""			2787474	Standard	XM_005270862		Approved		uc001buy.3	P06239	OTTHUMG00000007463	ENST00000336890.5:c.1302C>T	1.37:g.32745786C>T			32518373	D3DPP8|P07100|Q12850|Q13152|Q5TDH8|Q5TDH9|Q7RTZ3|Q96DW4|Q9NYT8	Silent	SNP	ENST00000336890.5	37	CCDS359.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	.	8.590	0.884395	0.17467	.	.	ENSG00000182866	ENST00000436824	.	.	.	4.67	2.8	0.32819	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.7163	0.40276	0.0:0.771:0.0:0.229	.	.	.	.	.	-1	.	.	.	+	.	.	LCK	32518373	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	1.174000	0.31932	0.721000	0.32231	0.555000	0.69702	.		0.507	LCK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019616.4	NM_005356	
PHC2	1912	broad.mit.edu	37	1	33794643	33794643	+	Missense_Mutation	SNP	C	C	G			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr1:33794643C>G	ENST00000257118.5	-	13	2303	c.2250G>C	c.(2248-2250)ttG>ttC	p.L750F	RP11-415J8.3_ENST00000457957.2_RNA|PHC2_ENST00000373416.1_Missense_Mutation_p.L215F|PHC2_ENST00000419414.2_Missense_Mutation_p.L751F|PHC2_ENST00000373422.3_Missense_Mutation_p.L356F|PHC2_ENST00000373418.3_Missense_Mutation_p.L215F|PHC2_ENST00000431992.1_Missense_Mutation_p.L721F|PHC2_ENST00000485928.1_5'UTR	NM_198040.2	NP_932157.1	Q8IXK0	PHC2_HUMAN	polyhomeotic homolog 2 (Drosophila)	750					multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	heterochromatin (GO:0000792)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.L750F(1)		autonomic_ganglia(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|liver(1)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	31		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)				AGATGGGTGACAAGGGTTCCT	0.592																																																1	Substitution - Missense(1)	ovary(1)	1											107.0	98.0	101.0					1																	33794643		2203	4300	6503	33567230	SO:0001583	missense	1912			AJ419231	CCDS378.1, CCDS379.1	1p34.3	2013-01-10	2006-09-12	2002-11-15	ENSG00000134686	ENSG00000134686		"""Sterile alpha motif (SAM) domain containing"""	3183	protein-coding gene	gene with protein product		602979	"""early development regulator 2 (homolog of polyhomeotic 2)"", ""polyhomeotic-like 2 (Drosophila)"""	EDR2		9121482, 12384788	Standard	NM_198040		Approved	HPH2	uc001bxg.1	Q8IXK0	OTTHUMG00000004133	ENST00000257118.5:c.2250G>C	1.37:g.33794643C>G	ENSP00000257118:p.Leu750Phe		33567230	A1L4Q1|A8KA40|D3DPR2|Q2TAL3|Q5T0C1|Q6NUJ6|Q6ZQR1|Q8N306|Q8TAG8|Q96BL4|Q9Y4Y7	Missense_Mutation	SNP	ENST00000257118.5	37	CCDS378.1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.259363	0.80246	.	.	ENSG00000134686	ENST00000431992;ENST00000257118;ENST00000373422;ENST00000373418;ENST00000307890;ENST00000419414;ENST00000373416	T;T;T;T	0.50813	1.71;1.28;0.73;1.69	5.79	5.79	0.91817	.	0.235064	0.37437	N	0.002083	T	0.62380	0.2423	L	0.58810	1.83	0.49915	D	0.999833	D;D;D;D	0.71674	0.987;0.987;0.987;0.998	P;P;P;P	0.62649	0.737;0.737;0.737;0.905	T	0.54463	-0.8290	10	0.23891	T	0.37	-8.7527	17.5262	0.87801	0.0:1.0:0.0:0.0	.	751;722;750;165	A8KA40;B7ZLY0;Q8IXK0;Q8IXK0-3	.;.;PHC2_HUMAN;.	F	721;750;356;215;327;751;215	ENSP00000389436:L721F;ENSP00000257118:L750F;ENSP00000362521:L356F;ENSP00000391440:L751F	ENSP00000257118:L750F	L	-	3	2	PHC2	33567230	0.973000	0.33851	1.000000	0.80357	0.993000	0.82548	0.451000	0.21779	2.736000	0.93811	0.561000	0.74099	TTG		0.592	PHC2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000011895.1	NM_198040	
MAP7D1	55700	broad.mit.edu	37	1	36645540	36645540	+	Missense_Mutation	SNP	A	A	G			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr1:36645540A>G	ENST00000373151.2	+	16	2603	c.2387A>G	c.(2386-2388)gAg>gGg	p.E796G	MAP7D1_ENST00000373148.4_Missense_Mutation_p.E332G|MAP7D1_ENST00000316156.4_Missense_Mutation_p.E758G|MAP7D1_ENST00000373150.4_Missense_Mutation_p.E763G	NM_018067.3	NP_060537.3	Q3KQU3	MA7D1_HUMAN	MAP7 domain containing 1	796					microtubule cytoskeleton organization (GO:0000226)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)		p.E796G(1)		breast(2)|cervix(1)|endometrium(2)|large_intestine(3)|lung(3)|ovary(3)|prostate(3)|skin(1)|urinary_tract(1)	19		Myeloproliferative disorder(586;0.0393)				GCACACCAGGAGAATGGCTTC	0.592																																																1	Substitution - Missense(1)	ovary(1)	1											49.0	49.0	49.0					1																	36645540		2203	4300	6503	36418127	SO:0001583	missense	55700			AK096341	CCDS30673.1, CCDS65492.1, CCDS65493.1	1p34.3	2008-02-05	2007-02-08	2007-02-08	ENSG00000116871	ENSG00000116871			25514	protein-coding gene	gene with protein product			"""proline arginine rich coiled coil 1"", ""arginine/proline rich coiled-coil 1"""	PARCC1, RPRC1		10574461	Standard	XM_005271024		Approved	FLJ10350, FLJ39022	uc001bzz.3	Q3KQU3	OTTHUMG00000007714	ENST00000373151.2:c.2387A>G	1.37:g.36645540A>G	ENSP00000362244:p.Glu796Gly		36418127	D3DPS4|Q7L8J5|Q8N905|Q8TAK0|Q9HBQ2|Q9NW29|Q9ULN3	Missense_Mutation	SNP	ENST00000373151.2	37	CCDS30673.1	.	.	.	.	.	.	.	.	.	.	A	21.5	4.162245	0.78226	.	.	ENSG00000116871	ENST00000316156;ENST00000373150;ENST00000373151;ENST00000373153;ENST00000373148	T;T;T;T	0.17213	2.48;2.69;2.65;2.29	5.24	5.24	0.73138	.	0.000000	0.40818	N	0.001020	T	0.32224	0.0822	L	0.36672	1.1	0.46149	D	0.998891	D;D;D;D;D	0.89917	1.0;0.998;0.999;0.999;0.998	D;D;D;D;D	0.85130	0.997;0.991;0.996;0.996;0.991	T	0.03875	-1.0996	10	0.87932	D	0	-26.1033	14.1001	0.65049	1.0:0.0:0.0:0.0	.	332;795;758;763;796	Q3KQU3-3;D3DPS3;Q3KQU3-2;Q3KQU3-4;Q3KQU3	.;.;.;.;MA7D1_HUMAN	G	758;763;796;119;332	ENSP00000320228:E758G;ENSP00000362243:E763G;ENSP00000362244:E796G;ENSP00000362241:E332G	ENSP00000320228:E758G	E	+	2	0	MAP7D1	36418127	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.114000	0.71560	2.206000	0.71126	0.533000	0.62120	GAG		0.592	MAP7D1-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382095.1	NM_018067	
KLF17	128209	broad.mit.edu	37	1	44595669	44595669	+	Missense_Mutation	SNP	G	G	T			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr1:44595669G>T	ENST00000372299.3	+	2	784	c.726G>T	c.(724-726)caG>caT	p.Q242H	KLF17_ENST00000476802.1_Intron	NM_173484.3	NP_775755.3	Q5JT82	KLF17_HUMAN	Kruppel-like factor 17	242					gamete generation (GO:0007276)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.Q242H(1)		NS(1)|breast(2)|central_nervous_system(1)|large_intestine(1)|lung(6)|ovary(3)|prostate(1)|skin(2)|stomach(1)	18	Acute lymphoblastic leukemia(166;0.155)					TTGTCAGTCAGCCAGACTCTC	0.562																																																1	Substitution - Missense(1)	ovary(1)	1											68.0	67.0	68.0					1																	44595669		2203	4300	6503	44368256	SO:0001583	missense	128209			BC049844	CCDS508.1	1p34.1	2011-11-15	2006-02-17	2006-02-17	ENSG00000171872	ENSG00000171872		"""Zinc fingers, C2H2-type"", ""Kruppel-like transcription factors"""	18830	protein-coding gene	gene with protein product		609602	"""zinc finger protein 393"""	ZNF393		16460907	Standard	NM_173484		Approved	Zfp393, FLJ40160	uc001clp.3	Q5JT82	OTTHUMG00000009664	ENST00000372299.3:c.726G>T	1.37:g.44595669G>T	ENSP00000361373:p.Gln242His		44368256	Q86VQ7|Q8N805	Missense_Mutation	SNP	ENST00000372299.3	37	CCDS508.1	.	.	.	.	.	.	.	.	.	.	G	14.45	2.539831	0.45176	.	.	ENSG00000171872	ENST00000372299	T	0.11604	2.76	4.78	-0.613	0.11594	.	0.748949	0.11934	N	0.515403	T	0.06280	0.0162	L	0.34521	1.04	0.09310	N	1	B	0.30281	0.275	B	0.25140	0.058	T	0.37197	-0.9716	10	0.29301	T	0.29	.	3.5998	0.08020	0.4138:0.0:0.3907:0.1955	.	242	Q5JT82	KLF17_HUMAN	H	242	ENSP00000361373:Q242H	ENSP00000361373:Q242H	Q	+	3	2	KLF17	44368256	0.004000	0.15560	0.002000	0.10522	0.002000	0.02628	0.156000	0.16382	-0.086000	0.12550	0.650000	0.86243	CAG		0.562	KLF17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026646.1	NM_173484	
ERI3	79033	broad.mit.edu	37	1	44778840	44778840	+	Splice_Site	SNP	C	C	G			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr1:44778840C>G	ENST00000372257.2	-	5	848		c.e5+1		ERI3_ENST00000495828.1_Splice_Site|ERI3_ENST00000537474.1_Splice_Site|ERI3_ENST00000372259.5_Splice_Site	NM_024066.1	NP_076971.1	O43414	ERI3_HUMAN	ERI1 exoribonuclease family member 3								exonuclease activity (GO:0004527)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.?(1)		endometrium(2)|large_intestine(2)|lung(7)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						ACTCAACCTACCTCCAGCACT	0.498																																																1	Unknown(1)	ovary(1)	1											107.0	107.0	107.0					1																	44778840		2203	4300	6503	44551427	SO:0001630	splice_region_variant	79033			AF007157	CCDS30696.1	1p34.1	2009-10-07	2009-10-07	2008-12-16	ENSG00000117419	ENSG00000117419		"""Enhanced RNAi three prime mRNA exonucleases"""	17276	protein-coding gene	gene with protein product	"""enhanced RNAi three prime mRNA exonuclease homolog 3 (C.elegans)"", ""exoribonuclease 3"""	609917	"""prion protein interacting protein"""	PRNPIP			Standard	XM_005271184		Approved	FLJ22943, PINT1	uc001clt.3	O43414	OTTHUMG00000007637	ENST00000372257.2:c.666+1G>C	1.37:g.44778840C>G			44551427	B1AK98|Q5T2T7|Q5T2T9|Q5TG35|Q9BQA0|Q9UEB4	Splice_Site	SNP	ENST00000372257.2	37	CCDS30696.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.102402	0.76983	.	.	ENSG00000117419	ENST00000372257;ENST00000372259;ENST00000456170;ENST00000537474;ENST00000433471;ENST00000372253;ENST00000452396;ENST00000457571	.	.	.	5.43	5.43	0.79202	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.4202	0.94719	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ERI3	44551427	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.796000	0.69080	2.825000	0.97269	0.655000	0.94253	.		0.498	ERI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020243.1	NM_024066	Intron
ROR1	4919	broad.mit.edu	37	1	64644314	64644314	+	Missense_Mutation	SNP	A	A	G			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr1:64644314A>G	ENST00000371079.1	+	9	2965	c.2590A>G	c.(2590-2592)Agc>Ggc	p.S864G	ROR1_ENST00000545203.1_Missense_Mutation_p.S315G	NM_005012.3	NP_005003.2	Q01973	ROR1_HUMAN	receptor tyrosine kinase-like orphan receptor 1	864	Ser/Thr-rich.				peptidyl-tyrosine phosphorylation (GO:0018108)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|Wnt-protein binding (GO:0017147)	p.S864G(1)		breast(7)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(14)|lung(10)|ovary(6)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	51						TGGGTCGACTAGCACTGGCCA	0.527																																																1	Substitution - Missense(1)	ovary(1)	1											80.0	64.0	69.0					1																	64644314		2203	4300	6503	64416902	SO:0001583	missense	4919			M97675	CCDS626.1, CCDS41344.1	1p32-p31	2013-01-11			ENSG00000185483	ENSG00000185483		"""Immunoglobulin superfamily / I-set domain containing"""	10256	protein-coding gene	gene with protein product		602336		NTRKR1		1334494, 8875995	Standard	NM_001083592		Approved		uc001dbj.3	Q01973	OTTHUMG00000009022	ENST00000371079.1:c.2590A>G	1.37:g.64644314A>G	ENSP00000360120:p.Ser864Gly		64416902	Q5VVX6|Q66K77|Q92776	Missense_Mutation	SNP	ENST00000371079.1	37	CCDS626.1	.	.	.	.	.	.	.	.	.	.	A	23.1	4.378770	0.82682	.	.	ENSG00000185483	ENST00000371079;ENST00000544776;ENST00000545203	T;D	0.81659	-1.14;-1.52	6.17	6.17	0.99709	.	0.000000	0.51477	D	0.000087	T	0.81384	0.4811	L	0.32530	0.975	0.80722	D	1	P	0.52842	0.956	D	0.65010	0.931	D	0.84305	0.0507	10	0.72032	D	0.01	.	16.8222	0.85835	1.0:0.0:0.0:0.0	.	864	Q01973	ROR1_HUMAN	G	864;867;315	ENSP00000360120:S864G;ENSP00000441637:S315G	ENSP00000360120:S864G	S	+	1	0	ROR1	64416902	1.000000	0.71417	0.943000	0.38184	0.991000	0.79684	8.915000	0.92740	2.371000	0.80710	0.533000	0.62120	AGC		0.527	ROR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025002.1	NM_005012	
ASB17	127247	broad.mit.edu	37	1	76397959	76397959	+	Missense_Mutation	SNP	T	T	A			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	T	T	A	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr1:76397959T>A	ENST00000284142.6	-	1	157	c.18A>T	c.(16-18)aaA>aaT	p.K6N		NM_080868.2	NP_543144.1	Q8WXJ9	ASB17_HUMAN	ankyrin repeat and SOCS box containing 17	6					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)			p.K6N(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(11)|ovary(2)|urinary_tract(1)	21						TACCACATAATTTAGTAGATT	0.358																																																1	Substitution - Missense(1)	ovary(1)	1											48.0	51.0	50.0					1																	76397959		2201	4298	6499	76170547	SO:0001583	missense	127247			AF403035	CCDS671.1	1p22.3	2013-01-11	2011-01-25		ENSG00000154007	ENSG00000154007		"""Ankyrin repeat domain containing"""	19769	protein-coding gene	gene with protein product			"""ankyrin repeat and SOCS box-containing 17"""			12076535	Standard	NM_080868		Approved		uc001dhe.2	Q8WXJ9	OTTHUMG00000009787	ENST00000284142.6:c.18A>T	1.37:g.76397959T>A	ENSP00000284142:p.Lys6Asn		76170547	B1APB8|Q8N0X5	Missense_Mutation	SNP	ENST00000284142.6	37	CCDS671.1	.	.	.	.	.	.	.	.	.	.	T	12.47	1.948456	0.34377	.	.	ENSG00000154007	ENST00000284142	T	0.35789	1.29	5.98	1.93	0.25924	.	0.201943	0.34725	N	0.003730	T	0.09686	0.0238	N	0.24115	0.695	0.29581	N	0.849166	P	0.36282	0.546	B	0.35550	0.205	T	0.08186	-1.0734	10	0.66056	D	0.02	.	7.5351	0.27706	0.0:0.2953:0.0:0.7047	.	6	Q8WXJ9	ASB17_HUMAN	N	6	ENSP00000284142:K6N	ENSP00000284142:K6N	K	-	3	2	ASB17	76170547	0.991000	0.36638	1.000000	0.80357	0.368000	0.29767	-0.031000	0.12287	0.496000	0.27904	0.533000	0.62120	AAA		0.358	ASB17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026982.1	NM_080868	
LAMTOR5	10542	broad.mit.edu	37	1	110944162	110944162	+	Missense_Mutation	SNP	G	G	T			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr1:110944162G>T	ENST00000602318.1	-	4	346	c.259C>A	c.(259-261)Cac>Aac	p.H87N	LAMTOR5_ENST00000474861.2_Missense_Mutation_p.H86N|LAMTOR5-AS1_ENST00000590413.1_RNA|LAMTOR5_ENST00000602858.1_Missense_Mutation_p.H75N|LAMTOR5_ENST00000256644.4_Missense_Mutation_p.H169N|LAMTOR5_ENST00000483260.1_Missense_Mutation_p.H86N			O43504	LTOR5_HUMAN	late endosomal/lysosomal adaptor, MAPK and MTOR activator 5	87					cellular response to amino acid stimulus (GO:0071230)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|positive regulation of GTPase activity (GO:0043547)|positive regulation of TOR signaling (GO:0032008)|protein localization to lysosome (GO:0061462)|regulation of cell size (GO:0008361)|response to virus (GO:0009615)|viral genome replication (GO:0019079)	cytosol (GO:0005829)|lysosome (GO:0005764)|Ragulator complex (GO:0071986)		p.H169N(1)									GCCATTTTGTGCACTGCCACC	0.413																																																1	Substitution - Missense(1)	ovary(1)	1											107.0	93.0	98.0					1																	110944162		2203	4300	6503	110745685	SO:0001583	missense	10542			AF029890	CCDS824.1	1p12	2012-09-24	2012-09-24	2012-09-24	ENSG00000134248	ENSG00000134248			17955	protein-coding gene	gene with protein product	"""HBx-interacting protein"", ""hepatitis B virus x-interacting protein (9.6kD)"""	608521	"""hepatitis B virus x interacting protein"""	HBXIP		9499022, 22980980	Standard	NM_006402		Approved	XIP, MGC71071	uc001dzr.3	O43504	OTTHUMG00000011568	ENST00000602318.1:c.259C>A	1.37:g.110944162G>T	ENSP00000473439:p.His87Asn		110745685	Q6IBD8	Missense_Mutation	SNP	ENST00000602318.1	37		.	.	.	.	.	.	.	.	.	.	G	30	5.057832	0.93846	.	.	ENSG00000134248	ENST00000483260;ENST00000474861;ENST00000256644	.	.	.	5.85	5.85	0.93711	.	0.000000	0.85682	D	0.000000	T	0.70911	0.3278	.	.	.	0.58432	D	0.999997	D	0.53885	0.963	P	0.55455	0.776	T	0.72494	-0.4276	8	0.72032	D	0.01	-20.4354	19.3124	0.94195	0.0:0.0:1.0:0.0	.	87	O43504	HBXIP_HUMAN	N	86;86;169	.	ENSP00000256644:H169N	H	-	1	0	HBXIP	110745685	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.245000	0.89825	2.932000	0.99384	0.643000	0.83706	CAC		0.413	LAMTOR5-007	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000467909.1	NM_006402	
TDRD10	126668	broad.mit.edu	37	1	154516505	154516505	+	Missense_Mutation	SNP	T	T	G			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	T	T	G	G	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr1:154516505T>G	ENST00000368480.3	+	9	655	c.570T>G	c.(568-570)caT>caG	p.H190Q	TDRD10_ENST00000368482.4_Missense_Mutation_p.H190Q|TDRD10_ENST00000479937.1_3'UTR			Q5VZ19	TDR10_HUMAN	tudor domain containing 10	190							nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.H190Q(1)		breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	29	all_lung(78;1.72e-29)|Lung NSC(65;2.96e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)			CACTCATCCATAGCGTCCGTG	0.602																																																1	Substitution - Missense(1)	ovary(1)	1											145.0	124.0	131.0					1																	154516505		2203	4300	6503	152783129	SO:0001583	missense	126668			AL713777	CCDS30878.2, CCDS41406.1	1q21.3	2013-02-12			ENSG00000163239	ENSG00000163239		"""Tudor domain containing"", ""RNA binding motif (RRM) containing"""	25316	protein-coding gene	gene with protein product						12975309	Standard	NM_182499		Approved	DKFZp434M202	uc009wow.3	Q5VZ19	OTTHUMG00000037264	ENST00000368480.3:c.570T>G	1.37:g.154516505T>G	ENSP00000357465:p.His190Gln		152783129	A4FU09|B0QZ53|B4DXV4|Q3ZCP1|Q3ZCS7|Q5SXY7|Q6UXV2|Q8TCN3	Missense_Mutation	SNP	ENST00000368480.3	37	CCDS41406.1	.	.	.	.	.	.	.	.	.	.	T	1.422	-0.572528	0.03882	.	.	ENSG00000163239	ENST00000368482;ENST00000368480	T;T	0.22134	1.98;1.97	4.29	3.38	0.38709	.	1.683010	0.03219	N	0.177214	T	0.05593	0.0147	N	0.14661	0.345	0.09310	N	1	B;P	0.35982	0.396;0.531	B;B	0.35470	0.1;0.203	T	0.27020	-1.0086	10	0.54805	T	0.06	-0.2164	7.9155	0.29816	0.0:0.8867:0.0:0.1133	.	190;190	Q5VZ19;Q5VZ19-2	TDR10_HUMAN;.	Q	190	ENSP00000357467:H190Q;ENSP00000357465:H190Q	ENSP00000357465:H190Q	H	+	3	2	TDRD10	152783129	0.000000	0.05858	0.020000	0.16555	0.012000	0.07955	0.130000	0.15850	1.034000	0.39945	-0.239000	0.12128	CAT		0.602	TDRD10-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000090700.2	NM_182499	
PKLR	5313	broad.mit.edu	37	1	155264372	155264372	+	Missense_Mutation	SNP	C	C	A			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr1:155264372C>A	ENST00000342741.4	-	6	904	c.866G>T	c.(865-867)cGg>cTg	p.R289L	PKLR_ENST00000392414.3_Missense_Mutation_p.R258L	NM_000298.5	NP_000289.1	P30613	KPYR_HUMAN	pyruvate kinase, liver and RBC	289					ATP biosynthetic process (GO:0006754)|carbohydrate metabolic process (GO:0005975)|cellular response to insulin stimulus (GO:0032869)|endocrine pancreas development (GO:0031018)|energy reserve metabolic process (GO:0006112)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|positive regulation of cellular metabolic process (GO:0031325)|pyruvate biosynthetic process (GO:0042866)|response to ATP (GO:0033198)|response to cAMP (GO:0051591)|response to glucose (GO:0009749)|response to heat (GO:0009408)|response to hypoxia (GO:0001666)|response to lithium ion (GO:0010226)|response to nutrient (GO:0007584)|response to other organism (GO:0051707)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|potassium ion binding (GO:0030955)|pyruvate kinase activity (GO:0004743)	p.R289L(1)		NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	all_lung(78;6.99e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		Epithelial(20;3.18e-10)|all cancers(21;7.9e-10)|BRCA - Breast invasive adenocarcinoma(34;0.00116)|LUSC - Lung squamous cell carcinoma(543;0.127)		Pyruvic acid(DB00119)	GCTGGCTTTCCGCACAAAGGA	0.627																																																1	Substitution - Missense(1)	ovary(1)	1											91.0	80.0	84.0					1																	155264372		2203	4300	6503	153530996	SO:0001583	missense	5313			BC025737, M15465	CCDS1109.1, CCDS44240.1	1q22	2012-10-02			ENSG00000143627	ENSG00000143627	2.7.1.40		9020	protein-coding gene	gene with protein product		609712				3566732	Standard	NM_000298		Approved		uc001fkb.4	P30613	OTTHUMG00000035875	ENST00000342741.4:c.866G>T	1.37:g.155264372C>A	ENSP00000339933:p.Arg289Leu		153530996	O75758|P11973	Missense_Mutation	SNP	ENST00000342741.4	37	CCDS1109.1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.253688	0.80135	.	.	ENSG00000143627	ENST00000423816;ENST00000392414;ENST00000342741;ENST00000271946	D;D	0.99778	-6.73;-6.73	4.48	4.48	0.54585	Pyruvate/Phosphoenolpyruvate kinase (2);Pyruvate kinase, barrel (1);	0.000000	0.85682	D	0.000000	D	0.99594	0.9853	H	0.97023	3.925	0.80722	D	1	P;P	0.42337	0.776;0.776	B;B	0.40659	0.336;0.336	D	0.98886	1.0771	10	0.72032	D	0.01	-24.4399	15.0157	0.71581	0.0:1.0:0.0:0.0	.	289;280	P30613;B1AVT1	KPYR_HUMAN;.	L	314;258;289;203	ENSP00000376214:R258L;ENSP00000339933:R289L	ENSP00000271946:R203L	R	-	2	0	PKLR	153530996	1.000000	0.71417	1.000000	0.80357	0.865000	0.49528	5.786000	0.69006	2.485000	0.83878	0.467000	0.42956	CGG		0.627	PKLR-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000087407.2	NM_000298	
INSRR	3645	broad.mit.edu	37	1	156815493	156815493	+	Missense_Mutation	SNP	C	C	T			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr1:156815493C>T	ENST00000368195.3	-	10	2488	c.2092G>A	c.(2092-2094)Gtt>Att	p.V698I	NTRK1_ENST00000392302.2_Intron	NM_014215.2	NP_055030.1	P14616	INSRR_HUMAN	insulin receptor-related receptor	698	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				actin cytoskeleton reorganization (GO:0031532)|cellular response to alkaline pH (GO:0071469)|male sex determination (GO:0030238)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.V698I(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(13)|ovary(7)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	42	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					GGGGGCAGAACCTGACCAGGA	0.617																																																1	Substitution - Missense(1)	ovary(1)	1											46.0	45.0	45.0					1																	156815493		2203	4300	6503	155082117	SO:0001583	missense	3645			J05046	CCDS1160.1	1q21-q23	2013-02-11			ENSG00000027644	ENSG00000027644		"""Fibronectin type III domain containing"""	6093	protein-coding gene	gene with protein product		147671				2768234, 2249481	Standard	NM_014215		Approved	IRR	uc010pht.2	P14616	OTTHUMG00000041291	ENST00000368195.3:c.2092G>A	1.37:g.156815493C>T	ENSP00000357178:p.Val698Ile		155082117	O60724|Q5VZS3	Missense_Mutation	SNP	ENST00000368195.3	37	CCDS1160.1	.	.	.	.	.	.	.	.	.	.	C	9.021	0.984873	0.18889	.	.	ENSG00000027644	ENST00000368195	T	0.73681	-0.77	4.58	3.59	0.41128	Fibronectin, type III (2);	1.122080	0.06836	N	0.794908	T	0.51500	0.1678	.	.	.	0.21553	N	0.999646	B	0.16166	0.016	B	0.12156	0.007	T	0.50381	-0.8835	9	0.56958	D	0.05	.	12.559	0.56271	0.0:0.8305:0.1695:0.0	.	698	P14616	INSRR_HUMAN	I	698	ENSP00000357178:V698I	ENSP00000357178:V698I	V	-	1	0	INSRR	155082117	0.941000	0.31946	0.958000	0.39756	0.615000	0.37417	1.612000	0.36889	2.535000	0.85469	0.561000	0.74099	GTT		0.617	INSRR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098929.1	NM_014215	
HMCN1	83872	broad.mit.edu	37	1	185897763	185897763	+	Missense_Mutation	SNP	G	G	T			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr1:185897763G>T	ENST00000271588.4	+	10	1745	c.1516G>T	c.(1516-1518)Ggt>Tgt	p.G506C	HMCN1_ENST00000367492.2_Missense_Mutation_p.G506C	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	506	Ig-like C2-type 1.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)	p.G506C(1)		NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						CAGCAGTGCAGGTACTGGACG	0.413																																																1	Substitution - Missense(1)	ovary(1)	1											197.0	178.0	184.0					1																	185897763		2203	4300	6503	184164386	SO:0001583	missense	83872			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.1516G>T	1.37:g.185897763G>T	ENSP00000271588:p.Gly506Cys		184164386	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	ENST00000271588.4	37	CCDS30956.1	.	.	.	.	.	.	.	.	.	.	G	19.02	3.746224	0.69418	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.58940	0.3;0.3	5.42	5.42	0.78866	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.80003	0.4544	M	0.84948	2.725	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.82853	-0.0252	10	0.72032	D	0.01	.	19.299	0.94136	0.0:0.0:1.0:0.0	.	506	Q96RW7	HMCN1_HUMAN	C	506	ENSP00000271588:G506C;ENSP00000356462:G506C	ENSP00000271588:G506C	G	+	1	0	HMCN1	184164386	1.000000	0.71417	0.974000	0.42286	0.333000	0.28666	9.101000	0.94219	2.549000	0.85964	0.644000	0.83932	GGT		0.413	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935	
MDM4	4194	broad.mit.edu	37	1	204515957	204515957	+	Silent	SNP	G	G	A			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr1:204515957G>A	ENST00000367182.3	+	10	1017	c.855G>A	c.(853-855)gaG>gaA	p.E285E	MDM4_ENST00000391947.2_3'UTR|MDM4_ENST00000454264.2_Silent_p.E235E|MDM4_ENST00000367183.3_Intron|MDM4_ENST00000463049.1_3'UTR|MDM4_ENST00000507825.2_Intron	NM_001204171.1|NM_001278516.1|NM_001278517.1|NM_001278518.1|NM_001278519.1|NM_002393.4	NP_001191100.1|NP_001265445.1|NP_001265446.1|NP_001265447.1|NP_001265448.1|NP_002384.2	O15151	MDM4_HUMAN	MDM4, p53 regulator	285	Asp/Glu-rich (acidic).|Region II.				cell proliferation (GO:0008283)|cellular response to hypoxia (GO:0071456)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|G0 to G1 transition (GO:0045023)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell proliferation (GO:0008284)|protein complex assembly (GO:0006461)|protein stabilization (GO:0050821)	nucleus (GO:0005634)	enzyme binding (GO:0019899)|zinc ion binding (GO:0008270)	p.E285E(1)		central_nervous_system(2)|endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	16	all_cancers(21;0.00146)|all_neural(3;0.0218)|Glioma(3;0.0382)|Breast(84;0.112)|all_epithelial(62;0.118)|Prostate(682;0.227)		GBM - Glioblastoma multiforme(2;3.15e-47)|all cancers(3;3.56e-32)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|Epithelial(59;0.143)|BRCA - Breast invasive adenocarcinoma(75;0.143)			ATGACCTGGAGGACTCTAAGT	0.388			A		"""GBM, bladder, retinoblastoma"""																																		Dom	yes		1	1q32	4194	Mdm4 p53 binding protein homolog		M	1	Substitution - coding silent(1)	ovary(1)	1											129.0	123.0	125.0					1																	204515957		2203	4300	6503	202782580	SO:0001819	synonymous_variant	4194			AF007111	CCDS1447.1, CCDS55674.1, CCDS55675.1, CCDS60396.1, CCDS73007.1, CCDS73008.1, CCDS73009.1	1q32	2014-03-03	2014-03-03		ENSG00000198625	ENSG00000198625			6974	protein-coding gene	gene with protein product		602704	"""mouse double minute 4, human homolog of; p53-binding protein"", ""Mdm4, transformed 3T3 cell double minute 4, p53 binding protein (mouse)"", ""Mdm4 p53 binding protein homolog (mouse)"""			9226370, 14660608	Standard	NM_002393		Approved	MDMX, HDMX	uc001hba.3	O15151	OTTHUMG00000035877	ENST00000367182.3:c.855G>A	1.37:g.204515957G>A			202782580	Q2M2Y2|Q32SL2|Q6GS18|Q8IV83	Silent	SNP	ENST00000367182.3	37	CCDS1447.1																																																																																				0.388	MDM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087415.2	NM_002393	
PLXNA2	5362	broad.mit.edu	37	1	208269462	208269462	+	Missense_Mutation	SNP	C	C	G			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr1:208269462C>G	ENST00000367033.3	-	8	2651	c.1894G>C	c.(1894-1896)Ggg>Cgg	p.G632R		NM_025179.3	NP_079455.3	O75051	PLXA2_HUMAN	plexin A2	632					axon guidance (GO:0007411)|centrosome localization (GO:0051642)|cerebellar granule cell precursor tangential migration (GO:0021935)|limb bud formation (GO:0060174)|neural tube development (GO:0021915)|pharyngeal system development (GO:0060037)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|somitogenesis (GO:0001756)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)	p.G632R(1)		NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)	80				OV - Ovarian serous cystadenocarcinoma(81;0.199)		AGCTCCAGCCCAAACCAGTCT	0.468																																																1	Substitution - Missense(1)	ovary(1)	1											166.0	178.0	174.0					1																	208269462		2203	4300	6503	206336085	SO:0001583	missense	5362			X87831	CCDS31013.1	1q32.2	2008-07-18			ENSG00000076356	ENSG00000076356		"""Plexins"""	9100	protein-coding gene	gene with protein product	"""plexin 2"", ""plexin-A2"", ""semaphorin receptor OCT"", ""transmembrane protein OCT"""	601054		PLXN2		8570614	Standard	NM_025179		Approved	OCT, FLJ11751, FLJ30634, KIAA0463	uc001hgz.3	O75051	OTTHUMG00000036564	ENST00000367033.3:c.1894G>C	1.37:g.208269462C>G	ENSP00000356000:p.Gly632Arg		206336085	A2RTX9|B2RMX7|Q6UX61|Q96GN9|Q9BRL1|Q9UIW1	Missense_Mutation	SNP	ENST00000367033.3	37	CCDS31013.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.991073	0.74703	.	.	ENSG00000076356	ENST00000367033	T	0.00848	5.62	5.07	5.07	0.68467	.	0.000000	0.85682	D	0.000000	T	0.01627	0.0052	M	0.63428	1.95	0.80722	D	1	D	0.54964	0.969	B	0.38225	0.268	T	0.72221	-0.4356	10	0.30854	T	0.27	.	18.6344	0.91371	0.0:1.0:0.0:0.0	.	632	O75051	PLXA2_HUMAN	R	632	ENSP00000356000:G632R	ENSP00000356000:G632R	G	-	1	0	PLXNA2	206336085	1.000000	0.71417	1.000000	0.80357	0.795000	0.44927	7.516000	0.81772	2.635000	0.89317	0.650000	0.86243	GGG		0.468	PLXNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088932.6	NM_025179	
EPHX1	2052	broad.mit.edu	37	1	226027540	226027540	+	Missense_Mutation	SNP	G	G	C			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr1:226027540G>C	ENST00000366837.4	+	6	929	c.733G>C	c.(733-735)Ggc>Cgc	p.G245R	RP11-285F7.2_ENST00000424332.1_RNA|EPHX1_ENST00000272167.5_Missense_Mutation_p.G245R	NM_000120.3	NP_000111.1	P07099	HYEP_HUMAN	epoxide hydrolase 1, microsomal (xenobiotic)	245					aromatic compound catabolic process (GO:0019439)|response to toxic substance (GO:0009636)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	cis-stilbene-oxide hydrolase activity (GO:0033961)|epoxide hydrolase activity (GO:0004301)	p.G245R(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(7)|ovary(3)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	28	Breast(184;0.197)					CCACGTGAAAGGCCTGCACTT	0.592																																																1	Substitution - Missense(1)	ovary(1)	1											156.0	151.0	153.0					1																	226027540		2203	4300	6503	224094163	SO:0001583	missense	2052			J03518	CCDS1547.1	1q42.1	2009-07-10			ENSG00000143819	ENSG00000143819	3.3.2.9		3401	protein-coding gene	gene with protein product		132810		EPHX		9925921	Standard	NM_000120		Approved		uc001hpk.3	P07099	OTTHUMG00000037743	ENST00000366837.4:c.733G>C	1.37:g.226027540G>C	ENSP00000355802:p.Gly245Arg		224094163	B2R8N0|Q5VTJ6|Q9NP75|Q9NPE7|Q9NQU6|Q9NQU7|Q9NQU8|Q9NQU9|Q9NQV0|Q9NQV1|Q9NQV2	Missense_Mutation	SNP	ENST00000366837.4	37	CCDS1547.1	.	.	.	.	.	.	.	.	.	.	G	31	5.063541	0.93898	.	.	ENSG00000143819	ENST00000272167;ENST00000366837	T;T	0.61859	0.07;0.07	5.42	5.42	0.78866	Alpha/beta hydrolase fold-1 (1);	0.000000	0.85682	D	0.000000	T	0.76744	0.4030	M	0.73319	2.225	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.78917	-0.2015	10	0.87932	D	0	-12.1183	19.2242	0.93812	0.0:0.0:1.0:0.0	.	245	P07099	HYEP_HUMAN	R	245	ENSP00000272167:G245R;ENSP00000355802:G245R	ENSP00000272167:G245R	G	+	1	0	EPHX1	224094163	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	9.828000	0.99408	2.553000	0.86117	0.591000	0.81541	GGC		0.592	EPHX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092064.1	NM_000120	
OR2M3	127062	broad.mit.edu	37	1	248366767	248366767	+	Missense_Mutation	SNP	C	C	A			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr1:248366767C>A	ENST00000456743.1	+	1	436	c.398C>A	c.(397-399)aCc>aAc	p.T133N		NM_001004689.1	NP_001004689.1	Q8NG83	OR2M3_HUMAN	olfactory receptor, family 2, subfamily M, member 3	133						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T133N(1)		endometrium(6)|large_intestine(4)|lung(33)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	50	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			CTAAGATACACCAATCTCATG	0.428																																																1	Substitution - Missense(1)	ovary(1)	1											222.0	222.0	222.0					1																	248366767		2203	4300	6503	246433390	SO:0001583	missense	127062				CCDS31107.1	1q44	2012-08-09		2004-03-10	ENSG00000228198	ENSG00000228198		"""GPCR / Class A : Olfactory receptors"""	8269	protein-coding gene	gene with protein product				OR2M6, OR2M3P			Standard	NM_001004689		Approved	OST003	uc010pzg.2	Q8NG83	OTTHUMG00000040459	ENST00000456743.1:c.398C>A	1.37:g.248366767C>A	ENSP00000389625:p.Thr133Asn		246433390	B9EH06|Q6IEY0	Missense_Mutation	SNP	ENST00000456743.1	37	CCDS31107.1	.	.	.	.	.	.	.	.	.	.	C	6.785	0.513879	0.12944	.	.	ENSG00000228198	ENST00000456743	T	0.19532	2.14	2.55	-0.726	0.11170	GPCR, rhodopsin-like superfamily (1);	0.669759	0.11450	U	0.562904	T	0.15998	0.0385	L	0.52206	1.635	0.09310	N	1	B	0.26845	0.161	B	0.29598	0.104	T	0.36720	-0.9736	10	0.72032	D	0.01	.	0.9542	0.01382	0.2846:0.363:0.1406:0.2117	.	133	Q8NG83	OR2M3_HUMAN	N	133	ENSP00000389625:T133N	ENSP00000389625:T133N	T	+	2	0	OR2M3	246433390	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-2.774000	0.00777	-0.012000	0.14223	-0.491000	0.04670	ACC		0.428	OR2M3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097355.1	NM_001004689	
HNRNPH3	3189	broad.mit.edu	37	10	70101810	70101810	+	Nonstop_Mutation	SNP	G	G	C			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr10:70101810G>C	ENST00000265866.7	+	10	1205	c.1040G>C	c.(1039-1041)tGa>tCa	p.*347S	HNRNPH3_ENST00000441000.2_Nonstop_Mutation_p.*239S|HNRNPH3_ENST00000354695.5_Nonstop_Mutation_p.*332S|HNRNPH3_ENST00000469172.1_3'UTR	NM_012207.2|NM_021644.3	NP_036339.1|NP_067676.2	P31942	HNRH3_HUMAN	heterogeneous nuclear ribonucleoprotein H3 (2H9)	0					epithelial cell differentiation (GO:0030855)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.*347S(2)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(5)|ovary(2)|prostate(2)	11						GGGATGTACTGAAAGCAAAAA	0.403																																																2	Nonstop extension(2)	ovary(1)|prostate(1)	10											120.0	101.0	107.0					10																	70101810		2203	4300	6503	69771816	SO:0001578	stop_lost	3189				CCDS7278.1, CCDS7279.1	10q22	2013-02-12		2008-04-18	ENSG00000096746	ENSG00000096746		"""RNA binding motif (RRM) containing"""	5043	protein-coding gene	gene with protein product		602324		HNRPH3		8999868	Standard	NM_021644		Approved	2H9	uc001jnw.4	P31942	OTTHUMG00000018349	ENST00000265866.7:c.1040G>C	10.37:g.70101810G>C	ENSP00000265866:p.*347Serext*32		69771816	A8K682|B3KRE1|Q9BSX1|Q9NP53|Q9NP96|Q9NPA7|Q9NPI4|Q9UFU4|Q9Y4J5	Nonstop_Mutation	SNP	ENST00000265866.7	37	CCDS7278.1	.	.	.	.	.	.	.	.	.	.	G	8.476	0.858729	0.17178	.	.	ENSG00000096746	ENST00000265866;ENST00000441000;ENST00000354695	.	.	.	2.45	0.542	0.17174	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.1682	0.20402	0.2872:0.0:0.7128:0.0	.	.	.	.	S	347;239;332	.	.	X	+	2	2	HNRNPH3	69771816	0.999000	0.42202	0.467000	0.27180	0.971000	0.66376	0.268000	0.18571	0.136000	0.18733	0.563000	0.77884	TGA		0.403	HNRNPH3-012	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090165.1		
VDAC2	7417	broad.mit.edu	37	10	76973800	76973800	+	Missense_Mutation	SNP	A	A	G			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr10:76973800A>G	ENST00000332211.6	+	4	335	c.122A>G	c.(121-123)gAt>gGt	p.D41G	VDAC2_ENST00000313132.4_Missense_Mutation_p.D56G|VDAC2_ENST00000543351.1_Missense_Mutation_p.D41G|VDAC2_ENST00000535553.1_5'UTR|VDAC2_ENST00000472137.1_3'UTR	NM_003375.3	NP_003366.2	P45880	VDAC2_HUMAN	voltage-dependent anion channel 2	41					anion transport (GO:0006820)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of protein polymerization (GO:0032272)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|pore complex (GO:0046930)	nucleotide binding (GO:0000166)|porin activity (GO:0015288)|voltage-gated anion channel activity (GO:0008308)	p.D41G(1)		breast(1)|cervix(1)|endometrium(1)|kidney(1)|lung(1)|ovary(1)|pancreas(2)|prostate(1)|urinary_tract(1)	10	all_cancers(46;0.0642)|all_epithelial(25;0.00604)|Prostate(51;0.0112)|Ovarian(15;0.183)				Dihydroxyaluminium(DB01375)	GTGAAACTGGATGTGAAAACA	0.328																																																1	Substitution - Missense(1)	ovary(1)	10											282.0	258.0	266.0					10																	76973800		2203	4300	6503	76643806	SO:0001583	missense	7417			BC000165	CCDS7348.1, CCDS53544.1	10q22	2011-11-15			ENSG00000165637	ENSG00000165637		"""Voltage-dependent anion channels"""	12672	protein-coding gene	gene with protein product		193245				7517385, 10049775	Standard	NM_003375		Approved		uc021ptp.1	P45880	OTTHUMG00000018517	ENST00000332211.6:c.122A>G	10.37:g.76973800A>G	ENSP00000361686:p.Asp41Gly		76643806	Q5VWK1|Q5VWK3|Q6IB40|Q7L3J5|Q9BWK8|Q9Y5I6	Missense_Mutation	SNP	ENST00000332211.6	37	CCDS7348.1	.	.	.	.	.	.	.	.	.	.	A	22.7	4.323788	0.81580	.	.	ENSG00000165637	ENST00000298468;ENST00000543351;ENST00000344036;ENST00000332211;ENST00000313132;ENST00000447677;ENST00000413289	T;T;T;T;T;T;T	0.52295	0.67;0.67;0.67;0.67;0.67;0.67;0.67	4.5	4.5	0.54988	.	0.000000	0.85682	D	0.000000	T	0.75598	0.3871	H	0.94847	3.59	0.80722	D	1	B;B	0.29936	0.055;0.262	B;P	0.51945	0.357;0.685	T	0.79629	-0.1724	10	0.62326	D	0.03	-2.6197	14.1183	0.65169	1.0:0.0:0.0:0.0	.	56;41	P45880-1;P45880	.;VDAC2_HUMAN	G	41;41;41;41;56;41;56	ENSP00000298468:D41G;ENSP00000443092:D41G;ENSP00000344876:D41G;ENSP00000361686:D41G;ENSP00000361635:D56G;ENSP00000401492:D41G;ENSP00000389551:D56G	ENSP00000298468:D41G	D	+	2	0	VDAC2	76643806	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.259000	0.95561	1.792000	0.52537	0.448000	0.29417	GAT		0.328	VDAC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048792.1	NM_003375	
ATRNL1	26033	broad.mit.edu	37	10	117040934	117040934	+	Missense_Mutation	SNP	A	A	T			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr10:117040934A>T	ENST00000355044.3	+	14	2296	c.2170A>T	c.(2170-2172)Agc>Tgc	p.S724C		NM_207303.2	NP_997186.1	Q5VV63	ATRN1_HUMAN	attractin-like 1	724	PSI 3.				G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)	p.S724C(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(11)|liver(2)|lung(44)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)		CAGCTGTAAAAGCTGTTCACT	0.353																																																1	Substitution - Missense(1)	ovary(1)	10											91.0	88.0	89.0					10																	117040934		2203	4300	6503	117030924	SO:0001583	missense	26033			AB011106	CCDS7592.1, CCDS73204.1	10q26	2004-03-04			ENSG00000107518	ENSG00000107518			29063	protein-coding gene	gene with protein product		612869				9628581	Standard	NM_001276282		Approved	KIAA0534, FLJ45344, ALP	uc001lcg.3	Q5VV63	OTTHUMG00000019096	ENST00000355044.3:c.2170A>T	10.37:g.117040934A>T	ENSP00000347152:p.Ser724Cys		117030924	O60283|Q5JSE8|Q5T5Y9|Q6T256|Q6ZSN4|Q86WX2	Missense_Mutation	SNP	ENST00000355044.3	37	CCDS7592.1	.	.	.	.	.	.	.	.	.	.	A	24.8	4.566696	0.86439	.	.	ENSG00000107518	ENST00000355044	T	0.18960	2.18	5.64	5.64	0.86602	C-type lectin-like (1);	0.072732	0.85682	D	0.000000	T	0.44726	0.1307	M	0.63843	1.955	0.80722	D	1	D	0.76494	0.999	D	0.72982	0.979	T	0.40175	-0.9577	10	0.87932	D	0	-21.1961	15.8713	0.79122	1.0:0.0:0.0:0.0	.	724	Q5VV63	ATRN1_HUMAN	C	724	ENSP00000347152:S724C	ENSP00000347152:S724C	S	+	1	0	ATRNL1	117030924	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.712000	0.74681	2.144000	0.66660	0.533000	0.62120	AGC		0.353	ATRNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050507.3	XM_049349	
OR1S2	219958	broad.mit.edu	37	11	57971087	57971087	+	Silent	SNP	G	G	A	rs149451220	byFrequency	TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr11:57971087G>A	ENST00000302592.6	-	1	566	c.567C>T	c.(565-567)caC>caT	p.H189H		NM_001004459.1	NP_001004459.1	Q8NGQ3	OR1S2_HUMAN	olfactory receptor, family 1, subfamily S, member 2	189						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.H189H(1)		endometrium(11)|kidney(1)|large_intestine(4)|lung(23)|ovary(2)|skin(2)|stomach(2)|urinary_tract(1)	46		Breast(21;0.0589)				CACAGAAGAAGTGTGGGAGAG	0.433																																																1	Substitution - coding silent(1)	ovary(1)	11						G		1,4401	2.1+/-5.4	0,1,2200	242.0	224.0	230.0		567	4.8	1.0	11	dbSNP_134	230	1,8591	1.2+/-3.3	0,1,4295	no	coding-synonymous	OR1S2	NM_001004459.1		0,2,6495	AA,AG,GG		0.0116,0.0227,0.0154		189/326	57971087	2,12992	2201	4296	6497	57727663	SO:0001819	synonymous_variant	219958			BK004297	CCDS31545.1	11q12.1	2012-08-09			ENSG00000197887	ENSG00000197887		"""GPCR / Class A : Olfactory receptors"""	15141	protein-coding gene	gene with protein product							Standard	NM_001004459		Approved		uc010rkb.2	Q8NGQ3	OTTHUMG00000167541	ENST00000302592.6:c.567C>T	11.37:g.57971087G>A			57727663	Q6IFG5|Q96R85	Silent	SNP	ENST00000302592.6	37	CCDS31545.1																																																																																				0.433	OR1S2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394703.2	NM_001004459	
CD5	921	broad.mit.edu	37	11	60889194	60889194	+	Missense_Mutation	SNP	C	C	A			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr11:60889194C>A	ENST00000347785.3	+	6	1083	c.917C>A	c.(916-918)gCc>gAc	p.A306D		NM_014207.3	NP_055022.2	P06127	CD5_HUMAN	CD5 molecule	306	SRCR 3. {ECO:0000255|PROSITE- ProRule:PRU00196}.				apoptotic signaling pathway (GO:0097190)|cell proliferation (GO:0008283)|cell recognition (GO:0008037)|T cell costimulation (GO:0031295)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|scavenger receptor activity (GO:0005044)|transmembrane signaling receptor activity (GO:0004888)	p.A306D(1)		central_nervous_system(1)|large_intestine(4)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		all_lung(304;5.94e-05)|Lung NSC(402;7.26e-05)		BRCA - Breast invasive adenocarcinoma(625;0.000946)|Lung(977;0.0086)|LUSC - Lung squamous cell carcinoma(625;0.0528)		AGCTCTTCAGCCAGGAGCTCG	0.667																																																1	Substitution - Missense(1)	ovary(1)	11											55.0	48.0	51.0					11																	60889194		2203	4299	6502	60645770	SO:0001583	missense	921			X04391	CCDS8000.1	11q13	2008-07-18	2006-03-28		ENSG00000110448	ENSG00000110448		"""CD molecules"""	1685	protein-coding gene	gene with protein product		153340	"""CD5 antigen (p56-62)"""	LEU1		1711157	Standard	NM_014207		Approved	T1	uc009ynk.3	P06127	OTTHUMG00000167825	ENST00000347785.3:c.917C>A	11.37:g.60889194C>A	ENSP00000342681:p.Ala306Asp		60645770	A0N0P4|A8K9I3	Missense_Mutation	SNP	ENST00000347785.3	37	CCDS8000.1	.	.	.	.	.	.	.	.	.	.	C	0.515	-0.864718	0.02590	.	.	ENSG00000110448	ENST00000347785	T	0.01185	5.21	5.42	-1.25	0.09405	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	1.222010	0.05725	N	0.598405	T	0.00998	0.0033	L	0.36672	1.1	0.09310	N	1	B	0.10296	0.003	B	0.09377	0.004	T	0.49588	-0.8924	10	0.10111	T	0.7	-8.1449	2.1449	0.03784	0.1232:0.422:0.2401:0.2147	.	306	P06127	CD5_HUMAN	D	306	ENSP00000342681:A306D	ENSP00000342681:A306D	A	+	2	0	CD5	60645770	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-0.277000	0.08502	0.080000	0.16959	-0.997000	0.02515	GCC		0.667	CD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396465.2	NM_014207	
INTS5	80789	broad.mit.edu	37	11	62416832	62416832	+	Silent	SNP	G	G	A			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr11:62416832G>A	ENST00000330574.2	-	2	772	c.720C>T	c.(718-720)tcC>tcT	p.S240S	GANAB_ENST00000534779.1_5'Flank|GANAB_ENST00000540933.1_5'Flank|GANAB_ENST00000356638.3_5'Flank|GANAB_ENST00000346178.4_5'Flank	NM_030628.1	NP_085131.1	Q6P9B9	INT5_HUMAN	integrator complex subunit 5	240					snRNA processing (GO:0016180)	integral component of membrane (GO:0016021)|integrator complex (GO:0032039)|membrane (GO:0016020)		p.S240S(1)		breast(1)|endometrium(4)|large_intestine(6)|lung(20)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	36						AGAGAACCCGGGAAATGATGG	0.542																																																1	Substitution - coding silent(1)	ovary(1)	11											113.0	99.0	104.0					11																	62416832		2202	4299	6501	62173408	SO:0001819	synonymous_variant	80789			AK123587	CCDS8027.1	11q12.3	2006-04-26	2006-03-15	2006-03-15	ENSG00000185085	ENSG00000185085			29352	protein-coding gene	gene with protein product		611349	"""KIAA1698"""	KIAA1698		16239144	Standard	NM_030628		Approved	INT5	uc001nud.3	Q6P9B9	OTTHUMG00000167605	ENST00000330574.2:c.720C>T	11.37:g.62416832G>A			62173408	Q8N6W5|Q9C0G5	Silent	SNP	ENST00000330574.2	37	CCDS8027.1																																																																																				0.542	INTS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395327.1	NM_030628	
MAP4K2	5871	broad.mit.edu	37	11	64557096	64557096	+	Splice_Site	SNP	T	T	C			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr11:64557096T>C	ENST00000294066.2	-	32	2467	c.2376A>G	c.(2374-2376)agA>agG	p.R792R	MAP4K2_ENST00000377350.3_Splice_Site_p.R784R	NM_004579.3	NP_004570.2	Q12851	M4K2_HUMAN	mitogen-activated protein kinase kinase kinase kinase 2	792	CNH. {ECO:0000255|PROSITE- ProRule:PRU00795}.				activation of JUN kinase activity (GO:0007257)|immune response (GO:0006955)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|positive regulation of JNK cascade (GO:0046330)|protein phosphorylation (GO:0006468)|vesicle targeting (GO:0006903)	Golgi membrane (GO:0000139)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)	p.R792R(1)		cervix(1)|lung(3)|ovary(1)|pancreas(1)|urinary_tract(2)	8						GGATGATGTCTCTGGAGGAGA	0.612																																																1	Substitution - coding silent(1)	ovary(1)	11											83.0	74.0	77.0					11																	64557096		2201	4297	6498	64313672	SO:0001630	splice_region_variant	5871			BC047865	CCDS8082.1	11q13.1	2011-06-09			ENSG00000168067	ENSG00000168067		"""Mitogen-activated protein kinase cascade / Kinase kinase kinase kinases"""	6864	protein-coding gene	gene with protein product		603166		RAB8IP		7515885	Standard	NM_004579		Approved	GCK, BL44	uc001obh.3	Q12851	OTTHUMG00000045328	ENST00000294066.2:c.2376-1A>G	11.37:g.64557096T>C			64313672	Q86VU3	Silent	SNP	ENST00000294066.2	37	CCDS8082.1																																																																																				0.612	MAP4K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000105239.1	NM_004579	Silent
MTL5	9633	broad.mit.edu	37	11	68478348	68478348	+	Missense_Mutation	SNP	T	T	A			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	T	T	A	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr11:68478348T>A	ENST00000255087.5	-	9	1511	c.1328A>T	c.(1327-1329)cAc>cTc	p.H443L		NM_004923.3	NP_004914.2	Q9Y4I5	MTL5_HUMAN	metallothionein-like 5, testis-specific (tesmin)	443					cell differentiation (GO:0030154)|cellular metal ion homeostasis (GO:0006875)|multicellular organismal development (GO:0007275)|response to metal ion (GO:0010038)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)	p.H443L(1)		breast(2)|cervix(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)	15	Esophageal squamous(3;4.37e-12)		LUAD - Lung adenocarcinoma(13;0.0676)|STAD - Stomach adenocarcinoma(18;0.185)			CTACCTATCGTGACTGAATCT	0.418																																																1	Substitution - Missense(1)	ovary(1)	11											126.0	111.0	116.0					11																	68478348		2200	4294	6494	68234924	SO:0001583	missense	9633			U86074	CCDS8184.1, CCDS44661.1	11q13.2-q13.3	2007-01-03			ENSG00000132749	ENSG00000132749			7446	protein-coding gene	gene with protein product	"""CXC domain containing 2"""	604374				1091092	Standard	XR_428932		Approved	CXCDC2	uc001ooc.3	Q9Y4I5	OTTHUMG00000167891	ENST00000255087.5:c.1328A>T	11.37:g.68478348T>A	ENSP00000255087:p.His443Leu		68234924	A8K8J3|Q4G182|Q6P2E2|Q8NCC8	Missense_Mutation	SNP	ENST00000255087.5	37	CCDS8184.1	.	.	.	.	.	.	.	.	.	.	T	7.832	0.720126	0.15372	.	.	ENSG00000132749	ENST00000255087	T	0.29397	1.57	5.02	2.5	0.30297	.	0.500624	0.19987	N	0.101651	T	0.11707	0.0285	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.31081	-0.9956	10	0.10902	T	0.67	-10.3214	9.6774	0.40050	0.0:0.0:0.3364:0.6636	.	443	Q9Y4I5	MTL5_HUMAN	L	443	ENSP00000255087:H443L	ENSP00000255087:H443L	H	-	2	0	MTL5	68234924	0.000000	0.05858	0.001000	0.08648	0.000000	0.00434	0.288000	0.18939	0.751000	0.32900	-0.501000	0.04562	CAC		0.418	MTL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396844.1	NM_004923	
FAT3	120114	broad.mit.edu	37	11	92534512	92534512	+	Missense_Mutation	SNP	C	C	G			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr11:92534512C>G	ENST00000298047.6	+	9	8350	c.8333C>G	c.(8332-8334)gCt>gGt	p.A2778G	FAT3_ENST00000525166.1_Missense_Mutation_p.A2628G|FAT3_ENST00000409404.2_Missense_Mutation_p.A2778G			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	2778	Cadherin 25. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A2778G(1)		NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				ACCAGCCCAGCTTTCCACTTT	0.438										TCGA Ovarian(4;0.039)																																						1	Substitution - Missense(1)	ovary(1)	11											66.0	67.0	67.0					11																	92534512		1903	4123	6026	92174160	SO:0001583	missense	120114			AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.8333C>G	11.37:g.92534512C>G	ENSP00000298047:p.Ala2778Gly		92174160	B5MDB0|Q96AU6	Missense_Mutation	SNP	ENST00000298047.6	37		.	.	.	.	.	.	.	.	.	.	C	11.36	1.616769	0.28801	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166	T;T;T	0.61158	0.13;0.13;0.13	5.98	5.07	0.68467	.	.	.	.	.	T	0.42040	0.1185	N	0.21583	0.68	0.36241	D	0.853259	B	0.09022	0.002	B	0.11329	0.006	T	0.43925	-0.9361	9	0.25106	T	0.35	.	11.0611	0.47948	0.0:0.8596:0.0:0.1404	.	2778	Q8TDW7-3	.	G	2778;2778;2628	ENSP00000298047:A2778G;ENSP00000387040:A2778G;ENSP00000432586:A2628G	ENSP00000298047:A2778G	A	+	2	0	FAT3	92174160	0.024000	0.19004	0.611000	0.29010	0.920000	0.55202	0.855000	0.27805	1.541000	0.49316	0.591000	0.81541	GCT		0.438	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781	
KDM5A	5927	broad.mit.edu	37	12	416865	416865	+	Missense_Mutation	SNP	G	G	A			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr12:416865G>A	ENST00000399788.2	-	23	4047	c.3685C>T	c.(3685-3687)Ctc>Ttc	p.L1229F	KDM5A_ENST00000382815.4_Missense_Mutation_p.L1229F	NM_001042603.1	NP_001036068.1	P29375	KDM5A_HUMAN	lysine (K)-specific demethylase 5A	1229					chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|multicellular organismal development (GO:0007275)|negative regulation of histone deacetylase activity (GO:1901726)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)	p.L1229F(1)		NS(2)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(29)|ovary(1)|prostate(5)|skin(6)|stomach(1)|urinary_tract(2)	77						GATACCAGGAGTGACAGAATA	0.502			T	NUP98	AML																																		Dom	yes		12	12p11	5927	"""lysine (K)-specific demethylase 5A, JARID1A"""		L	1	Substitution - Missense(1)	ovary(1)	12											75.0	75.0	75.0					12																	416865		1907	4108	6015	287126	SO:0001583	missense	5927				CCDS41736.1	12p13.33	2013-01-28	2009-04-06	2009-04-06	ENSG00000073614	ENSG00000073614		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	9886	protein-coding gene	gene with protein product		180202	"""retinoblastoma-binding protein 2"", ""Jumonji, AT rich interactive domain 1A (RBBP2-like)"", ""jumonji, AT rich interactive domain 1A"""	RBBP2, JARID1A		1857421	Standard	NM_001042603		Approved		uc001qif.1	P29375	OTTHUMG00000168055	ENST00000399788.2:c.3685C>T	12.37:g.416865G>A	ENSP00000382688:p.Leu1229Phe		287126	A8MV76|Q4LE72|Q86XZ1	Missense_Mutation	SNP	ENST00000399788.2	37	CCDS41736.1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.277862	0.80692	.	.	ENSG00000073614	ENST00000399788;ENST00000382815	T;T	0.01197	5.19;5.19	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	T	0.06371	0.0164	M	0.69823	2.125	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	T	0.01256	-1.1404	10	0.87932	D	0	-11.0479	14.2971	0.66321	0.0712:0.0:0.9288:0.0	.	1229;1229	P29375;P29375-2	KDM5A_HUMAN;.	F	1229	ENSP00000382688:L1229F;ENSP00000372265:L1229F	ENSP00000372265:L1229F	L	-	1	0	KDM5A	287126	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.510000	0.60455	2.830000	0.97506	0.585000	0.79938	CTC		0.502	KDM5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397812.1	NM_005056	
KIAA1551	55196	broad.mit.edu	37	12	32135646	32135646	+	Missense_Mutation	SNP	C	C	G			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr12:32135646C>G	ENST00000312561.4	+	4	2171	c.1757C>G	c.(1756-1758)gCt>gGt	p.A586G	KIAA1551_ENST00000535596.1_Intron	NM_018169.3	NP_060639	Q9HCM1	K1551_HUMAN	KIAA1551	586								p.A586G(1)									CTACTTCTCGCTTTGCTTTCA	0.348																																																1	Substitution - Missense(1)	ovary(1)	12											38.0	39.0	38.0					12																	32135646		2203	4299	6502	32026913	SO:0001583	missense	55196			AK001514	CCDS8725.2	12p11.21	2012-08-14	2012-08-14	2012-08-14	ENSG00000174718	ENSG00000174718			25559	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 35"""	C12orf35		10997877	Standard	NM_018169		Approved	FLJ20696, FLJ10652	uc001rks.3	Q9HCM1	OTTHUMG00000128501	ENST00000312561.4:c.1757C>G	12.37:g.32135646C>G	ENSP00000310338:p.Ala586Gly		32026913	B2RTU5|Q4KN17|Q9NVL6|Q9NWP9	Missense_Mutation	SNP	ENST00000312561.4	37	CCDS8725.2	.	.	.	.	.	.	.	.	.	.	C	9.530	1.110513	0.20714	.	.	ENSG00000174718	ENST00000312561;ENST00000381054	T;T	0.06142	3.97;3.34	4.46	-6.9	0.01655	.	5.264380	0.00496	N	0.000142	T	0.02610	0.0079	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.39683	-0.9602	9	.	.	.	.	2.2689	0.04086	0.5166:0.1932:0.1531:0.1371	.	586	Q9HCM1	CL035_HUMAN	G	586	ENSP00000310338:A586G;ENSP00000370442:A586G	.	A	+	2	0	C12orf35	32026913	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.208000	0.09371	-0.972000	0.03559	-1.208000	0.01637	GCT		0.348	KIAA1551-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250307.2	NM_018169	
DNAJC22	79962	broad.mit.edu	37	12	49743189	49743189	+	Silent	SNP	C	C	T			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr12:49743189C>T	ENST00000549441.2	+	3	1738	c.534C>T	c.(532-534)ctC>ctT	p.L178L	DNAJC22_ENST00000395069.3_Silent_p.L178L			Q8N4W6	DJC22_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 22	178						integral component of membrane (GO:0016021)		p.L178L(2)		breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|liver(2)|lung(1)|ovary(1)|pancreas(1)	10						CAGAGCCGCTCAGTGTGCGGC	0.587																																																2	Substitution - coding silent(2)	ovary(2)	12											68.0	67.0	67.0					12																	49743189		2203	4300	6503	48029456	SO:0001819	synonymous_variant	79962			AK055747	CCDS8785.1	12q13.12	2011-09-02		2008-07-08	ENSG00000178401	ENSG00000178401		"""Heat shock proteins / DNAJ (HSP40)"""	25802	protein-coding gene	gene with protein product	"""wurst homolog (Drosophila)"""					17558392	Standard	NM_024902		Approved	wus, FLJ13236	uc001rua.3	Q8N4W6		ENST00000549441.2:c.534C>T	12.37:g.49743189C>T			48029456	B3KP54	Silent	SNP	ENST00000549441.2	37	CCDS8785.1																																																																																				0.587	DNAJC22-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404302.2	NM_024902	
AQP2	359	broad.mit.edu	37	12	50348438	50348438	+	Missense_Mutation	SNP	A	A	T			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr12:50348438A>T	ENST00000199280.3	+	3	636	c.551A>T	c.(550-552)aAt>aTt	p.N184I	RP11-469H8.6_ENST00000550530.1_RNA|RP11-469H8.6_ENST00000552379.1_RNA|RP11-469H8.8_ENST00000552806.1_RNA	NM_000486.5	NP_000477.1	P41181	AQP2_HUMAN	aquaporin 2 (collecting duct)	184					actin filament depolymerization (GO:0030042)|aging (GO:0007568)|apoptotic process (GO:0006915)|cell volume homeostasis (GO:0006884)|cellular response to copper ion (GO:0071280)|cellular response to mercury ion (GO:0071288)|cellular response to water deprivation (GO:0042631)|excretion (GO:0007588)|female pregnancy (GO:0007565)|glycerol transport (GO:0015793)|hyperosmotic response (GO:0006972)|metanephric collecting duct development (GO:0072205)|positive regulation of calcium ion transport (GO:0051928)|renal water transport (GO:0003097)|response to calcium ion (GO:0051592)|response to glucagon (GO:0033762)|response to lipopolysaccharide (GO:0032496)|response to lithium ion (GO:0010226)|response to salt stress (GO:0009651)|response to starvation (GO:0042594)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|clathrin-coated vesicle (GO:0030136)|early endosome (GO:0005769)|exocytic vesicle (GO:0070382)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|recycling endosome (GO:0055037)|rough endoplasmic reticulum (GO:0005791)|trans-Golgi network (GO:0005802)|transport vesicle membrane (GO:0030658)	glycerol transmembrane transporter activity (GO:0015168)|water channel activity (GO:0015250)|water transmembrane transporter activity (GO:0005372)	p.N184I(1)		breast(1)|central_nervous_system(1)|cervix(1)|large_intestine(1)|lung(4)|ovary(2)	10						TGCTCTATGAATCCTGCCCGC	0.567																																																1	Substitution - Missense(1)	ovary(1)	12											150.0	128.0	136.0					12																	50348438		2203	4300	6503	48634705	SO:0001583	missense	359				CCDS8792.1	12q12-q13	2014-09-17				ENSG00000167580		"""Ion channels / Aquaporins"""	634	protein-coding gene	gene with protein product		107777				7512890	Standard	NM_000486		Approved		uc001rvn.3	P41181		ENST00000199280.3:c.551A>T	12.37:g.50348438A>T	ENSP00000199280:p.Asn184Ile		48634705	Q9UD68	Missense_Mutation	SNP	ENST00000199280.3	37	CCDS8792.1	.	.	.	.	.	.	.	.	.	.	a	26.5	4.745913	0.89663	.	.	ENSG00000167580	ENST00000199280;ENST00000550862	D;D	0.99791	-6.76;-1.71	5.3	5.3	0.74995	Aquaporin-like (2);	0.000000	0.64402	D	0.000001	D	0.99902	0.9953	H	0.99900	4.915	0.53005	D	0.999963	D	0.89917	1.0	D	0.91635	0.999	D	0.96062	0.9039	10	0.87932	D	0	-12.1494	13.5008	0.61454	1.0:0.0:0.0:0.0	.	184	P41181	AQP2_HUMAN	I	184;226	ENSP00000199280:N184I;ENSP00000450022:N226I	ENSP00000199280:N184I	N	+	2	0	AQP2	48634705	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	8.916000	0.92745	2.143000	0.66587	0.454000	0.30748	AAT		0.567	AQP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405540.1	NM_000486	
FRY	10129	broad.mit.edu	37	13	32811670	32811670	+	Missense_Mutation	SNP	G	G	T			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr13:32811670G>T	ENST00000380250.3	+	44	6461	c.5965G>T	c.(5965-5967)Ggt>Tgt	p.G1989C		NM_023037.2	NP_075463.2	Q5TBA9	FRY_HUMAN	furry homolog (Drosophila)	1989						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.G1989C(1)		NS(3)|breast(4)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(31)|lung(50)|ovary(5)|pancreas(1)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	132		Lung SC(185;0.0271)		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)		CAAGAAGTTTGGTGTCATCGA	0.547																																																1	Substitution - Missense(1)	ovary(1)	13											77.0	83.0	81.0					13																	32811670		2034	4202	6236	31709670	SO:0001583	missense	10129			AL049784	CCDS41875.1	13q13.1	2008-02-05	2005-11-24	2005-11-24	ENSG00000073910	ENSG00000073910			20367	protein-coding gene	gene with protein product		614818	"""chromosome 13 open reading frame 14"""	C13orf14		14702039, 8812419	Standard	NM_023037		Approved	bA37E23.1, 13CDNA73, CG003	uc001utx.3	Q5TBA9	OTTHUMG00000016696	ENST00000380250.3:c.5965G>T	13.37:g.32811670G>T	ENSP00000369600:p.Gly1989Cys		31709670	Q9Y3N6	Missense_Mutation	SNP	ENST00000380250.3	37	CCDS41875.1	.	.	.	.	.	.	.	.	.	.	G	18.56	3.649491	0.67358	.	.	ENSG00000073910	ENST00000380250;ENST00000380257	T	0.23950	1.88	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.47875	0.1469	L	0.54323	1.7	0.80722	D	1	D	0.89917	1.0	D	0.68192	0.956	T	0.03453	-1.1035	10	0.27785	T	0.31	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	1989	Q5TBA9	FRY_HUMAN	C	1989;826	ENSP00000369600:G1989C	ENSP00000369600:G1989C	G	+	1	0	FRY	31709670	1.000000	0.71417	0.994000	0.49952	0.969000	0.65631	7.632000	0.83247	2.941000	0.99782	0.655000	0.94253	GGT		0.547	FRY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044405.1	NM_023037	
PCDH9	5101	broad.mit.edu	37	13	67477733	67477733	+	Missense_Mutation	SNP	T	T	C			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr13:67477733T>C	ENST00000377865.2	-	2	3175	c.3041A>G	c.(3040-3042)aAc>aGc	p.N1014S	PCDH9-AS2_ENST00000419371.2_RNA|PCDH9_ENST00000328454.5_Intron|PCDH9_ENST00000544246.1_Missense_Mutation_p.N1014S|PCDH9_ENST00000456367.1_Intron			Q9HC56	PCDH9_HUMAN	protocadherin 9	1014					forebrain development (GO:0030900)|homophilic cell adhesion (GO:0007156)	cell-cell contact zone (GO:0044291)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.N1014S(1)		breast(2)|central_nervous_system(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(33)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	103		Hepatocellular(98;0.0906)|Breast(118;0.107)		GBM - Glioblastoma multiforme(99;0.00819)		GCTGTGTGAGTTACACTGAAA	0.408																																																1	Substitution - Missense(1)	ovary(1)	13											103.0	94.0	97.0					13																	67477733		2203	4300	6503	66375734	SO:0001583	missense	5101			AF169692	CCDS9443.1, CCDS9444.1	13q21.32	2010-02-22			ENSG00000184226	ENSG00000184226		"""Cadherins / Protocadherins : Non-clustered"""	8661	protein-coding gene	gene with protein product		603581				9787079	Standard	NM_020403		Approved		uc001vik.3	Q9HC56	OTTHUMG00000017040	ENST00000377865.2:c.3041A>G	13.37:g.67477733T>C	ENSP00000367096:p.Asn1014Ser		66375734	A2A6U1|Q5VT83|Q7Z3U0|Q8N3K7	Missense_Mutation	SNP	ENST00000377865.2	37	CCDS9444.1	.	.	.	.	.	.	.	.	.	.	T	8.469	0.857117	0.17106	.	.	ENSG00000184226	ENST00000544246;ENST00000377865	T;T	0.50548	0.74;0.74	5.5	5.5	0.81552	.	0.359865	0.32273	N	0.006333	T	0.24928	0.0605	N	0.08118	0	0.80722	D	1	B;B	0.24768	0.0;0.111	B;B	0.19666	0.0;0.026	T	0.13495	-1.0507	10	0.09338	T	0.73	.	12.0013	0.53232	0.0:0.0:0.0:1.0	.	1014;1014	B7ZM79;Q9HC56	.;PCDH9_HUMAN	S	1014	ENSP00000442186:N1014S;ENSP00000367096:N1014S	ENSP00000367096:N1014S	N	-	2	0	PCDH9	66375734	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.909000	0.48758	2.087000	0.62958	0.533000	0.62120	AAC		0.408	PCDH9-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276387.1	NM_203487	
RNASE7	84659	broad.mit.edu	37	14	21511530	21511530	+	Missense_Mutation	SNP	A	A	C			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	A	A	C	C	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr14:21511530A>C	ENST00000298690.4	+	2	636	c.379A>C	c.(379-381)Aac>Cac	p.N127H	NDRG2_ENST00000403829.3_Intron	NM_032572.3	NP_115961	Q9H1E1	RNAS7_HUMAN	ribonuclease, RNase A family, 7	127					antibacterial humoral response (GO:0019731)|defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response (GO:0045087)|membrane disruption in other organism (GO:0051673)|response to bacterium (GO:0009617)|RNA phosphodiester bond hydrolysis (GO:0090501)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	endonuclease activity (GO:0004519)|lipopolysaccharide binding (GO:0001530)|nucleic acid binding (GO:0003676)|peptidoglycan binding (GO:0042834)|ribonuclease activity (GO:0004540)	p.N127H(1)		endometrium(2)|large_intestine(2)|lung(1)|ovary(1)	6	all_cancers(95;0.000759)		OV - Ovarian serous cystadenocarcinoma(11;3.42e-11)|Epithelial(56;5.57e-09)|all cancers(55;2.36e-08)	GBM - Glioblastoma multiforme(265;0.0191)		GAAGCGACAGAACAAGTCTTA	0.522																																																1	Substitution - Missense(1)	ovary(1)	14											137.0	133.0	134.0					14																	21511530		2202	4300	6502	20581370	SO:0001583	missense	84659			AJ131212	CCDS41914.1	14q11.1	2013-02-15			ENSG00000165799	ENSG00000165799		"""Ribonucleases, RNase A"""	19278	protein-coding gene	gene with protein product		612484				12244054, 12527768	Standard	NM_032572		Approved		uc001vzk.4	Q9H1E1	OTTHUMG00000171358	ENST00000298690.4:c.379A>C	14.37:g.21511530A>C	ENSP00000298690:p.Asn127His		20581370	P80927|P83685|Q546N3	Missense_Mutation	SNP	ENST00000298690.4	37	CCDS41914.1	.	.	.	.	.	.	.	.	.	.	A	10.33	1.319377	0.23994	.	.	ENSG00000165799	ENST00000298690	T	0.73363	-0.74	5.19	-2.09	0.07232	Ribonuclease A, domain (4);	1.687450	0.03585	N	0.230783	T	0.68100	0.2964	M	0.65975	2.015	0.09310	N	1	B	0.10296	0.003	B	0.15870	0.014	T	0.36359	-0.9751	10	0.18276	T	0.48	3.2437	5.3746	0.16158	0.3987:0.1575:0.4437:0.0	.	127	Q9H1E1	RNAS7_HUMAN	H	127	ENSP00000298690:N127H	ENSP00000298690:N127H	N	+	1	0	RNASE7	20581370	0.000000	0.05858	0.000000	0.03702	0.237000	0.25408	-0.518000	0.06267	-0.212000	0.10109	0.533000	0.62120	AAC		0.522	RNASE7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313936.1	NM_032572	
CTSG	1511	broad.mit.edu	37	14	25043625	25043625	+	Silent	SNP	C	C	T			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr14:25043625C>T	ENST00000216336.2	-	4	456	c.420G>A	c.(418-420)acG>acA	p.T140T		NM_001911.2	NP_001902.1	P08311	CATG_HUMAN	cathepsin G	140	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				angiotensin maturation (GO:0002003)|cellular protein metabolic process (GO:0044267)|defense response to fungus (GO:0050832)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|immune response (GO:0006955)|negative regulation of growth of symbiont in host (GO:0044130)|neutrophil mediated killing of gram-positive bacterium (GO:0070946)|positive regulation of immune response (GO:0050778)|proteolysis (GO:0006508)|response to lipopolysaccharide (GO:0032496)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)	heparin binding (GO:0008201)|peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)	p.T140T(1)		autonomic_ganglia(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(1)|urinary_tract(1)	25				GBM - Glioblastoma multiforme(265;0.0269)		CAGTGCACAGCGTCCCGGGTC	0.612																																																1	Substitution - coding silent(1)	ovary(1)	14											109.0	102.0	104.0					14																	25043625		2203	4300	6503	24113465	SO:0001819	synonymous_variant	1511			M16117	CCDS9631.1	14q12	2013-02-25			ENSG00000100448	ENSG00000100448		"""Cathepsins"", ""Endogenous ligands"""	2532	protein-coding gene	gene with protein product		116830				2569462	Standard	NM_001911		Approved	CG	uc001wpq.3	P08311	OTTHUMG00000140182	ENST00000216336.2:c.420G>A	14.37:g.25043625C>T			24113465	Q6IBJ6|Q9UCA5|Q9UCU6	Silent	SNP	ENST00000216336.2	37	CCDS9631.1																																																																																				0.612	CTSG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276536.2	NM_001911	
ZFYVE26	23503	broad.mit.edu	37	14	68264945	68264945	+	Silent	SNP	A	A	G			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr14:68264945A>G	ENST00000347230.4	-	11	2172	c.2034T>C	c.(2032-2034)ttT>ttC	p.F678F	ZFYVE26_ENST00000555452.1_Silent_p.F678F	NM_015346.3	NP_056161.2	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26	678					cell death (GO:0008219)|cytokinesis (GO:0000910)|double-strand break repair via homologous recombination (GO:0000724)	centrosome (GO:0005813)|lysosomal membrane (GO:0005765)|midbody (GO:0030496)	metal ion binding (GO:0046872)|phosphatidylinositol-3-phosphate binding (GO:0032266)	p.F678F(1)		NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(8)|lung(39)|ovary(12)|pancreas(1)|prostate(7)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	94				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)		CATCAGCCAGAAATCCACTGA	0.488																																																1	Substitution - coding silent(1)	ovary(1)	14											77.0	83.0	81.0					14																	68264945		2203	4300	6503	67334698	SO:0001819	synonymous_variant	23503			AB002319	CCDS9788.1	14q23.3	2012-11-23				ENSG00000072121		"""Zinc fingers, FYVE domain containing"""	20761	protein-coding gene	gene with protein product	"""spastizin"", ""FYVE-CENT"""	612012	"""spastic paraplegia 15 (complicated, autosomal recessive)"""	SPG15		9205841, 18394578	Standard	NM_015346		Approved	KIAA0321	uc001xka.2	Q68DK2		ENST00000347230.4:c.2034T>C	14.37:g.68264945A>G			67334698	B1B5Y3|B4E2U3|O15035|Q68DT9|Q6AW90|Q6ZR50|Q7Z3A4|Q7Z3I1|Q8N4W7	Silent	SNP	ENST00000347230.4	37	CCDS9788.1																																																																																				0.488	ZFYVE26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412736.2	NM_015346	
FAM161B	145483	broad.mit.edu	37	14	74411263	74411263	+	Missense_Mutation	SNP	T	T	C	rs560808582		TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr14:74411263T>C	ENST00000534936.1	-	3	805	c.700A>G	c.(700-702)Atg>Gtg	p.M234V	FAM161B_ENST00000286544.3_Missense_Mutation_p.M297V			Q96MY7	F161B_HUMAN	family with sequence similarity 161, member B	234								p.M234V(1)		breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(2)|skin(2)	21						CTGCGCTCCATGATCTCTTGG	0.617													T|||	1	0.000199681	0.0	0.0014	5008	,	,		20032	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	14											50.0	51.0	50.0					14																	74411263		2203	4300	6503	73481016	SO:0001583	missense	145483			AA356453	CCDS9822.1, CCDS9822.2	14q24.2	2008-06-05	2008-06-05	2008-06-05		ENSG00000156050			19854	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 44"""	C14orf44			Standard	NM_152445		Approved	FLJ31697	uc001xpd.3	Q96MY7		ENST00000534936.1:c.700A>G	14.37:g.74411263T>C	ENSP00000445326:p.Met234Val		73481016	B7Z882|J3KNA2	Missense_Mutation	SNP	ENST00000534936.1	37		.	.	.	.	.	.	.	.	.	.	T	6.279	0.419675	0.11928	.	.	ENSG00000156050	ENST00000286544;ENST00000534936	T;T	0.23552	1.9;1.9	5.26	0.0817	0.14425	.	0.418350	0.24859	N	0.035038	T	0.10895	0.0266	N	0.12887	0.27	0.37220	D	0.905229	B	0.12013	0.005	B	0.10450	0.005	T	0.32107	-0.9919	10	0.08837	T	0.75	-1.2262	9.2946	0.37808	0.0:0.3898:0.0:0.6102	.	234	Q96MY7	F161B_HUMAN	V	297;234	ENSP00000286544:M297V;ENSP00000445326:M234V	ENSP00000286544:M297V	M	-	1	0	FAM161B	73481016	0.774000	0.28592	0.987000	0.45799	0.982000	0.71751	0.038000	0.13862	-0.123000	0.11745	0.460000	0.39030	ATG		0.617	FAM161B-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_152445	
TJP1	7082	broad.mit.edu	37	15	29993876	29993876	+	Missense_Mutation	SNP	G	G	C			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr15:29993876G>C	ENST00000346128.6	-	28	5644	c.5170C>G	c.(5170-5172)Caa>Gaa	p.Q1724E	TJP1_ENST00000356107.6_Missense_Mutation_p.Q1744E|TJP1_ENST00000545208.2_Missense_Mutation_p.Q1644E|TJP1_ENST00000400011.2_Missense_Mutation_p.Q1668E	NM_003257.3|NM_175610.2	NP_003248.3|NP_783297.2	Q07157	ZO1_HUMAN	tight junction protein 1	1724	ZU5. {ECO:0000255|PROSITE- ProRule:PRU00485}.				apoptotic process (GO:0006915)|blastocyst formation (GO:0001825)|cell-cell junction assembly (GO:0007043)|cell-cell signaling involved in cell-cell junction organization (GO:1901350)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to glucose stimulus (GO:0071333)|hippo signaling (GO:0035329)|membrane organization (GO:0061024)|negative regulation of vascular permeability (GO:0043116)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to magnetism (GO:0071000)|sensory perception of sound (GO:0007605)	apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|basolateral plasma membrane (GO:0016323)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|gap junction (GO:0005921)|intercalated disc (GO:0014704)|intercellular canaliculus (GO:0046581)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)		p.Q1724E(1)		breast(4)|central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(12)|liver(1)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|urinary_tract(1)	68		all_lung(180;7.48e-11)|Breast(32;0.000153)		all cancers(64;3.29e-10)|Epithelial(43;5.34e-09)|BRCA - Breast invasive adenocarcinoma(123;0.0034)|GBM - Glioblastoma multiforme(186;0.0139)|Lung(196;0.186)		CACTTGTTTTGCCAGGTTTTA	0.368																																					Melanoma(77;681 1843 6309 6570)											1	Substitution - Missense(1)	ovary(1)	15											96.0	91.0	93.0					15																	29993876		1836	4084	5920	27781168	SO:0001583	missense	7082				CCDS42007.1, CCDS45199.1, CCDS73702.1	15q13	2012-07-12	2012-07-12		ENSG00000104067	ENSG00000104067			11827	protein-coding gene	gene with protein product	"""zona occludens 1"", ""tight junction protein ZO-1"""	601009				8825647	Standard	XM_005254616		Approved	ZO-1, MGC133289, DKFZp686M05161	uc001zcr.3	Q07157	OTTHUMG00000137397	ENST00000346128.6:c.5170C>G	15.37:g.29993876G>C	ENSP00000281537:p.Gln1724Glu		27781168	B4E3K1|Q2NKP3|Q4ZGJ6	Missense_Mutation	SNP	ENST00000346128.6	37	CCDS42007.1	.	.	.	.	.	.	.	.	.	.	G	19.70	3.875755	0.72180	.	.	ENSG00000104067	ENST00000346128;ENST00000400011;ENST00000545208;ENST00000400007;ENST00000356107	T;T	0.08370	3.1;3.3	5.75	5.75	0.90469	ZU5 (2);	0.054276	0.85682	D	0.000000	T	0.21387	0.0515	L	0.29908	0.895	0.80722	D	1	D;P;P;P	0.53462	0.96;0.937;0.887;0.837	D;D;D;P	0.72625	0.957;0.96;0.978;0.625	T	0.00496	-1.1705	10	0.62326	D	0.03	.	19.9381	0.97149	0.0:0.0:1.0:0.0	.	1737;1644;1724;1668	A9CQZ8;Q07157-2;Q07157;G5E9E7	.;.;ZO1_HUMAN;.	E	1724;1668;1744;1644;1644	ENSP00000281537:Q1724E;ENSP00000382890:Q1668E	ENSP00000281537:Q1724E	Q	-	1	0	TJP1	27781168	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.824000	0.99380	2.709000	0.92574	0.557000	0.71058	CAA		0.368	TJP1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000268237.3	NM_003257	
CHRNA3	1136	broad.mit.edu	37	15	78893716	78893716	+	Missense_Mutation	SNP	G	G	A	rs551101196		TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr15:78893716G>A	ENST00000326828.5	-	5	1652	c.1268C>T	c.(1267-1269)tCt>tTt	p.S423F	CHRNA3_ENST00000348639.3_Missense_Mutation_p.S423F	NM_000743.4	NP_000734.2	P32297	ACHA3_HUMAN	cholinergic receptor, nicotinic, alpha 3 (neuronal)	423					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|behavioral response to nicotine (GO:0035095)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|locomotory behavior (GO:0007626)|nervous system development (GO:0007399)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of dendrite morphogenesis (GO:0048814)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of membrane potential (GO:0042391)|regulation of smooth muscle contraction (GO:0006940)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission involved in micturition (GO:0060084)|synaptic transmission, cholinergic (GO:0007271)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ligand-gated ion channel activity (GO:0015276)	p.S423F(1)		central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18					Bupropion(DB01156)|Dextromethorphan(DB00514)|Galantamine(DB00674)|Levomethadyl Acetate(DB01227)|Nicotine(DB00184)|Pentolinium(DB01090)|Varenicline(DB01273)	TTCAGAACTAGAGCTTCTCGT	0.473													G|||	1	0.000199681	0.0	0.0	5008	,	,		20998	0.0		0.0	False		,,,				2504	0.001															1	Substitution - Missense(1)	ovary(1)	15											160.0	145.0	150.0					15																	78893716		2196	4293	6489	76680771	SO:0001583	missense	1136				CCDS10305.1, CCDS53964.1	15q24	2012-02-11	2012-02-07		ENSG00000080644	ENSG00000080644		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1957	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 3 (neuronal)"""	118503	"""cholinergic receptor, nicotinic, alpha polypeptide 3"""			2004777	Standard	NM_000743		Approved		uc002bec.3	P32297	OTTHUMG00000143863	ENST00000326828.5:c.1268C>T	15.37:g.78893716G>A	ENSP00000315602:p.Ser423Phe		76680771	Q15823|Q4KMN8|Q86U77|Q96RH3|Q99553|Q9BQ93|Q9BRR4	Missense_Mutation	SNP	ENST00000326828.5	37	CCDS10305.1	.	.	.	.	.	.	.	.	.	.	G	13.15	2.151957	0.38021	.	.	ENSG00000080644	ENST00000348639;ENST00000326828	D;D	0.86164	-2.08;-2.08	5.79	4.85	0.62838	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.402626	0.26307	N	0.025124	D	0.90239	0.6948	M	0.70275	2.135	0.58432	D	0.999999	P;P	0.47034	0.844;0.889	P;P	0.51135	0.616;0.66	D	0.90572	0.4523	10	0.54805	T	0.06	.	15.9715	0.80025	0.0:0.0:0.8642:0.1358	.	423;423	P32297;P32297-3	ACHA3_HUMAN;.	F	423	ENSP00000267951:S423F;ENSP00000315602:S423F	ENSP00000315602:S423F	S	-	2	0	CHRNA3	76680771	1.000000	0.71417	1.000000	0.80357	0.819000	0.46315	6.401000	0.73256	1.381000	0.46364	0.591000	0.81541	TCT		0.473	CHRNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000290111.3		
HDDC3	374659	broad.mit.edu	37	15	91474979	91474979	+	Missense_Mutation	SNP	C	C	G			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr15:91474979C>G	ENST00000394272.3	-	3	392	c.364G>C	c.(364-366)Gac>Cac	p.D122H	AC068831.3_ENST00000438890.1_RNA|HDDC3_ENST00000330334.3_Missense_Mutation_p.D122H|AC068831.3_ENST00000448987.1_RNA|UNC45A_ENST00000394275.2_Intron|HDDC3_ENST00000559898.1_Missense_Mutation_p.D122H			Q8N4P3	MESH1_HUMAN	HD domain containing 3	122	HD.						guanosine-3',5'-bis(diphosphate) 3'-diphosphatase activity (GO:0008893)|metal ion binding (GO:0046872)	p.D122H(1)		NS(1)|ovary(1)	2	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.189)			TACAGCTTGTCTGCCAGCTTC	0.582											OREG0023475	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	15											84.0	90.0	88.0					15																	91474979		2198	4298	6496	89275983	SO:0001583	missense	374659			AK057584	CCDS10366.1, CCDS66866.1	15q26.1	2005-08-22			ENSG00000184508	ENSG00000184508			30522	protein-coding gene	gene with protein product						12477932	Standard	NM_001286451		Approved	MGC45386	uc002bqe.4	Q8N4P3	OTTHUMG00000141260	ENST00000394272.3:c.364G>C	15.37:g.91474979C>G	ENSP00000377814:p.Asp122His	1282	89275983		Missense_Mutation	SNP	ENST00000394272.3	37		.	.	.	.	.	.	.	.	.	.	C	27.1	4.797411	0.90538	.	.	ENSG00000184508	ENST00000394272;ENST00000330334	.	.	.	4.58	4.58	0.56647	Metal-dependent phosphohydrolase, HD domain (1);Metal-dependent phosphohydrolase, HD subdomain (1);HD domain (1);	0.000000	0.85682	D	0.000000	D	0.91446	0.7300	H	0.99746	4.745	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.95254	0.8362	9	0.87932	D	0	-21.2533	16.1919	0.81996	0.0:1.0:0.0:0.0	.	122;122	Q8N4P3;Q8N4P3-2	MESH1_HUMAN;.	H	122	.	ENSP00000330721:D122H	D	-	1	0	HDDC3	89275983	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.991000	0.76232	2.388000	0.81334	0.555000	0.69702	GAC		0.582	HDDC3-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000280403.2	NM_198527	
LRRK1	79705	broad.mit.edu	37	15	101595299	101595299	+	Missense_Mutation	SNP	G	G	C			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr15:101595299G>C	ENST00000388948.3	+	27	4562	c.4203G>C	c.(4201-4203)gaG>gaC	p.E1401D	LRRK1_ENST00000284395.5_Missense_Mutation_p.E1398D|RP11-505E24.2_ENST00000559857.1_RNA	NM_024652.3	NP_078928.3			leucine-rich repeat kinase 1									p.E1413D(1)		breast(2)|central_nervous_system(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(25)|ovary(4)|prostate(1)|skin(1)	72	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			ACGTCAAGGAGCACATCAACA	0.557																																																1	Substitution - Missense(1)	ovary(1)	15											137.0	134.0	135.0					15																	101595299		2062	4198	6260	99412822	SO:0001583	missense	79705			AB058693	CCDS42086.1	15q26.3	2007-01-29			ENSG00000154237	ENSG00000154237			18608	protein-coding gene	gene with protein product		610986				11347906, 14654223	Standard	XM_005254979		Approved	FLJ23119, KIAA1790, Roco1, RIPK6	uc002bwr.3	Q38SD2	OTTHUMG00000165514	ENST00000388948.3:c.4203G>C	15.37:g.101595299G>C	ENSP00000373600:p.Glu1401Asp		99412822		Missense_Mutation	SNP	ENST00000388948.3	37	CCDS42086.1	.	.	.	.	.	.	.	.	.	.	G	9.111	1.006649	0.19199	.	.	ENSG00000154237	ENST00000388948;ENST00000284395;ENST00000529762	D;D	0.93488	-3.23;-3.23	4.78	0.636	0.17729	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.116059	0.56097	D	0.000021	T	0.81054	0.4743	N	0.04880	-0.145	0.22947	N	0.998522	B	0.19331	0.035	B	0.20184	0.028	T	0.69986	-0.4996	10	0.35671	T	0.21	.	5.2992	0.15768	0.2944:0.0:0.5727:0.1329	.	1401	Q38SD2	LRRK1_HUMAN	D	1401;1398;92	ENSP00000373600:E1401D;ENSP00000284395:E1398D	ENSP00000284395:E1398D	E	+	3	2	LRRK1	99412822	0.047000	0.20315	0.810000	0.32431	0.703000	0.40648	-0.216000	0.09266	0.169000	0.19679	0.591000	0.81541	GAG		0.557	LRRK1-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384567.2	NM_024652	
CREBBP	1387	broad.mit.edu	37	16	3786810	3786810	+	Silent	SNP	C	C	G			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr16:3786810C>G	ENST00000262367.5	-	27	5210	c.4401G>C	c.(4399-4401)gtG>gtC	p.V1467V	CREBBP_ENST00000382070.3_Silent_p.V1429V	NM_004380.2	NP_004371.2	Q92793	CBP_HUMAN	CREB binding protein	1467	CBP/p300-type HAT. {ECO:0000255|PROSITE- ProRule:PRU01065}.|Cys/His-rich.|Interaction with TRERF1.				cellular lipid metabolic process (GO:0044255)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|embryonic digit morphogenesis (GO:0042733)|gene expression (GO:0010467)|germ-line stem cell maintenance (GO:0030718)|histone acetylation (GO:0016573)|homeostatic process (GO:0042592)|innate immune response (GO:0045087)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein complex assembly (GO:0006461)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|histone acetyltransferase activity (GO:0004402)|MRF binding (GO:0043426)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.V1467V(1)		NS(1)|breast(5)|central_nervous_system(4)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(125)|kidney(5)|large_intestine(32)|lung(43)|ovary(18)|pancreas(2)|prostate(6)|skin(9)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(21)	295		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		TGTGCCCTGTCACATACCTGC	0.517			"""T, N, F, Mis, O"""	"""MLL, MORF, RUNXBP2"""	"""ALL, AML, DLBCL, B-NHL """		Rubinstein-Taybi syndrome																																Dom/Rec	yes		16	16p13.3	1387	CREB binding protein (CBP)	yes	L	1	Substitution - coding silent(1)	ovary(1)	16											145.0	121.0	129.0					16																	3786810		2197	4300	6497	3726811	SO:0001819	synonymous_variant	1387			U85962	CCDS10509.1, CCDS45399.1	16p13.3	2011-07-01	2008-08-01		ENSG00000005339	ENSG00000005339		"""Chromatin-modifying enzymes / K-acetyltransferases"""	2348	protein-coding gene	gene with protein product		600140	"""Rubinstein-Taybi syndrome"""	RSTS		8413673	Standard	NM_001079846		Approved	RTS, CBP, KAT3A	uc002cvv.3	Q92793	OTTHUMG00000129431	ENST00000262367.5:c.4401G>C	16.37:g.3786810C>G			3726811	D3DUC9|O00147|Q16376|Q4LE28	Silent	SNP	ENST00000262367.5	37	CCDS10509.1																																																																																				0.517	CREBBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251591.2	NM_004380	
USP7	7874	broad.mit.edu	37	16	9014258	9014258	+	Missense_Mutation	SNP	G	G	A			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr16:9014258G>A	ENST00000344836.4	-	5	767	c.569C>T	c.(568-570)aCc>aTc	p.T190I	USP7_ENST00000566224.1_5'Flank|USP7_ENST00000535863.1_Missense_Mutation_p.T91I|USP7_ENST00000381886.4_Missense_Mutation_p.T174I	NM_003470.2	NP_003461.2	Q93009	UBP7_HUMAN	ubiquitin specific peptidase 7 (herpes virus-associated)	190	Interaction with TSPYL5.|Interaction with p53/TP53, MDM2 and EBNA1.|MATH. {ECO:0000255|PROSITE- ProRule:PRU00129}.|Necessary for nuclear localization.				maintenance of DNA methylation (GO:0010216)|multicellular organismal development (GO:0007275)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|protein deubiquitination (GO:0016579)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|transcription-coupled nucleotide-excision repair (GO:0006283)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|p53 binding (GO:0002039)|protein C-terminus binding (GO:0008022)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)	p.T190I(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(13)|lung(20)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	48						GACTTCAAAGGTAACTTTGTC	0.363																																																1	Substitution - Missense(1)	ovary(1)	16											101.0	97.0	98.0					16																	9014258		2197	4300	6497	8921759	SO:0001583	missense	7874			Z72499	CCDS32385.1, CCDS66941.1	16p13.3	2008-04-11	2005-08-08			ENSG00000187555		"""Ubiquitin-specific peptidases"""	12630	protein-coding gene	gene with protein product		602519	"""ubiquitin specific protease 7 (herpes virus-associated)"""	HAUSP		12838346, 9925944	Standard	NM_003470		Approved		uc002czl.2	Q93009		ENST00000344836.4:c.569C>T	16.37:g.9014258G>A	ENSP00000343535:p.Thr190Ile		8921759	A6NMY8|B7Z815|H0Y3G8	Missense_Mutation	SNP	ENST00000344836.4	37	CCDS32385.1	.	.	.	.	.	.	.	.	.	.	G	15.91	2.972383	0.53614	.	.	ENSG00000187555	ENST00000344836;ENST00000381886;ENST00000535863;ENST00000544549;ENST00000542333	T;T;T	0.38887	1.11;1.11;1.11	5.63	5.63	0.86233	TRAF-like (1);MATH (2);	0.000000	0.85682	D	0.000000	T	0.29588	0.0738	N	0.11427	0.14	0.80722	D	1	P;P	0.43024	0.798;0.798	B;B	0.40038	0.317;0.317	T	0.08207	-1.0733	10	0.33940	T	0.23	.	19.6876	0.95986	0.0:0.0:1.0:0.0	.	190;174	Q93009;B7Z815	UBP7_HUMAN;.	I	190;198;91;91;132	ENSP00000343535:T190I;ENSP00000443646:T91I;ENSP00000439272:T132I	ENSP00000343535:T190I	T	-	2	0	USP7	8921759	1.000000	0.71417	0.573000	0.28510	0.942000	0.58702	7.914000	0.87478	2.659000	0.90383	0.655000	0.94253	ACC		0.363	USP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434268.2		
ERN2	10595	broad.mit.edu	37	16	23712287	23712287	+	Missense_Mutation	SNP	A	A	G			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr16:23712287A>G	ENST00000256797.4	-	12	1664	c.1496T>C	c.(1495-1497)aTg>aCg	p.M499T	ERN2_ENST00000457008.2_Intron	NM_033266.3	NP_150296.3			endoplasmic reticulum to nucleus signaling 2											large_intestine(2)|lung(2)|ovary(2)	6				GBM - Glioblastoma multiforme(48;0.0156)		TACCTGCCTCATCACAAAGAG	0.577																																																0			16											84.0	79.0	80.0					16																	23712287		2197	4300	6497	23619788	SO:0001583	missense	10595			AA527544	CCDS32407.1	16p12.2	2008-02-05	2007-08-14			ENSG00000134398			16942	protein-coding gene	gene with protein product		604034	"""ER to nucleus signalling 2"""			9755171, 11175748	Standard	NM_033266		Approved	IRE1b	uc002dma.4	Q76MJ5		ENST00000256797.4:c.1496T>C	16.37:g.23712287A>G	ENSP00000256797:p.Met499Thr		23619788		Missense_Mutation	SNP	ENST00000256797.4	37	CCDS32407.1	.	.	.	.	.	.	.	.	.	.	A	4.849	0.157773	0.09236	.	.	ENSG00000134398	ENST00000256797	T	0.59083	0.29	5.25	4.16	0.48862	.	0.472269	0.23949	N	0.042964	T	0.40498	0.1119	L	0.27053	0.805	0.09310	N	1	B;B	0.18610	0.01;0.029	B;B	0.20184	0.028;0.016	T	0.21314	-1.0249	10	0.23891	T	0.37	.	7.8834	0.29635	0.9052:0.0:0.0948:0.0	.	451;451	Q76MJ5;A5YM65	ERN2_HUMAN;.	T	499	ENSP00000256797:M499T	ENSP00000256797:M499T	M	-	2	0	ERN2	23619788	0.985000	0.35326	0.508000	0.27688	0.029000	0.11900	3.786000	0.55431	0.942000	0.37525	0.459000	0.35465	ATG		0.577	ERN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434887.1		
CES4A	283848	broad.mit.edu	37	16	67029723	67029723	+	Missense_Mutation	SNP	A	A	C			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	A	A	C	C	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr16:67029723A>C	ENST00000326686.5	+	2	251	c.251A>C	c.(250-252)tAc>tCc	p.Y84S	CES4A_ENST00000540947.2_Missense_Mutation_p.Y84S|CES4A_ENST00000338718.4_Missense_Mutation_p.Y107S|CES4A_ENST00000541479.1_Missense_Mutation_p.Y107S|CES4A_ENST00000398354.1_Missense_Mutation_p.Y84S			Q5XG92	EST4A_HUMAN	carboxylesterase 4A	84						extracellular region (GO:0005576)	carboxylic ester hydrolase activity (GO:0052689)	p.Y84S(1)		large_intestine(2)|liver(2)|lung(4)|ovary(1)	9						GCTACCACCTACCCGCCTGGG	0.572																																																1	Substitution - Missense(1)	ovary(1)	16											53.0	55.0	54.0					16																	67029723		1909	4119	6028	65587224	SO:0001583	missense	283848			AK094783	CCDS42174.1, CCDS42174.2, CCDS54024.1, CCDS54025.1, CCDS42174.3	16q22.1	2011-10-25	2010-10-12	2010-10-12	ENSG00000172824	ENSG00000172824		"""Carboxylesterases"""	26741	protein-coding gene	gene with protein product			"""carboxylesterase 8 (putative)"""	CES8		12975309, 17364878, 20931200	Standard	NM_001190201		Approved	FLJ37464	uc010vix.2	Q5XG92		ENST00000326686.5:c.251A>C	16.37:g.67029723A>C	ENSP00000314145:p.Tyr84Ser		65587224	A8KAJ6|B7Z349|B7Z3L2|B7Z6R3|Q6UX55|Q8N9F4	Missense_Mutation	SNP	ENST00000326686.5	37		.	.	.	.	.	.	.	.	.	.	A	15.62	2.887543	0.52014	.	.	ENSG00000172824	ENST00000540947;ENST00000541479;ENST00000338718;ENST00000543913;ENST00000398354;ENST00000326686;ENST00000538199	T;T;T;T;T;T	0.60672	0.17;0.17;0.17;0.17;3.0;0.17	4.93	4.93	0.64822	Carboxylesterase, type B (1);	.	.	.	.	T	0.68577	0.3016	L	0.61387	1.9	0.09310	N	1	P;B;D	0.65815	0.902;0.22;0.995	B;P;P	0.62014	0.268;0.593;0.897	T	0.60551	-0.7241	9	0.72032	D	0.01	.	8.7948	0.34872	0.8095:0.1905:0.0:0.0	.	107;84;107	F8WEE9;Q5XG92;F5H5S4	.;EST4A_HUMAN;.	S	84;107;107;84;84;84;47	ENSP00000444052:Y84S;ENSP00000443175:Y107S;ENSP00000340714:Y107S;ENSP00000381397:Y84S;ENSP00000314145:Y84S;ENSP00000441103:Y47S	ENSP00000314145:Y84S	Y	+	2	0	CES4A	65587224	0.326000	0.24669	0.004000	0.12327	0.001000	0.01503	3.015000	0.49599	2.060000	0.61445	0.533000	0.62120	TAC		0.572	CES4A-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_173815	
AARS	16	broad.mit.edu	37	16	70304134	70304134	+	Missense_Mutation	SNP	C	C	G			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr16:70304134C>G	ENST00000261772.8	-	6	924	c.781G>C	c.(781-783)Gac>Cac	p.D261H		NM_001605.2	NP_001596.2			alanyl-tRNA synthetase											breast(3)|cervix(2)|endometrium(5)|large_intestine(7)|lung(7)|ovary(1)|pancreas(1)|prostate(1)	27		Ovarian(137;0.0365)		BRCA - Breast invasive adenocarcinoma(221;0.161)		ACAAAAAGGTCAGTGTCATAG	0.443																																																0			16											191.0	148.0	163.0					16																	70304134		2198	4300	6498	68861635	SO:0001583	missense	16			D32050	CCDS32474.1	16q22.1	2014-09-17			ENSG00000090861	ENSG00000090861	6.1.1.7	"""Aminoacyl tRNA synthetases / Class II"""	20	protein-coding gene	gene with protein product	"""alanine tRNA ligase 1, cytoplasmic"""	601065				8595897	Standard	NM_001605		Approved		uc002eyn.1	P49588	OTTHUMG00000177042	ENST00000261772.8:c.781G>C	16.37:g.70304134C>G	ENSP00000261772:p.Asp261His		68861635		Missense_Mutation	SNP	ENST00000261772.8	37	CCDS32474.1	.	.	.	.	.	.	.	.	.	.	C	26.8	4.768730	0.90020	.	.	ENSG00000090861	ENST00000261772	T	0.66638	-0.22	5.91	5.91	0.95273	Alanyl-tRNA synthetase, class IIc, anti-codon-binding domain (1);Alanyl-tRNA synthetase, class IIc, core domain (1);Alanyl-tRNA synthetase, class IIc, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.90386	0.6991	H	0.99507	4.6	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.94059	0.7325	10	0.87932	D	0	-33.2078	17.7902	0.88550	0.0:1.0:0.0:0.0	.	269;261	E7ETK8;P49588	.;SYAC_HUMAN	H	261	ENSP00000261772:D261H	ENSP00000261772:D261H	D	-	1	0	AARS	68861635	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.818000	0.86416	2.813000	0.96785	0.655000	0.94253	GAC		0.443	AARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435021.2	NM_001605	
TP53	7157	broad.mit.edu	37	17	7577548	7577548	+	Missense_Mutation	SNP	C	C	T	rs28934575|rs397516437		TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr17:7577548C>T	ENST00000269305.4	-	7	922	c.733G>A	c.(733-735)Ggc>Agc	p.G245S	TP53_ENST00000413465.2_Missense_Mutation_p.G245S|TP53_ENST00000445888.2_Missense_Mutation_p.G245S|TP53_ENST00000455263.2_Missense_Mutation_p.G245S|TP53_ENST00000420246.2_Missense_Mutation_p.G245S|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Missense_Mutation_p.G245S	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	245	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		G -> A (in sporadic cancers; somatic mutation).|G -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:1978757}.|G -> D (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:2259385}.|G -> E (in a sporadic cancer; somatic mutation).|G -> F (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> H (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|G -> L (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> N (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> R (in sporadic cancers; somatic mutation).|G -> S (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs28934575). {ECO:0000269|PubMed:8829627}.|G -> V (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:2263646}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.G245S(304)|p.G245C(59)|p.G245R(10)|p.G152S(8)|p.0?(8)|p.?(5)|p.G152C(4)|p.G244_M246>V(3)|p.G245N(2)|p.G245fs*2(2)|p.G245H(1)|p.G245L(1)|p.G244fs*17(1)|p.G245F(1)|p.C242_M246>L(1)|p.C238_M246delCNSSCMGGM(1)|p.G245fs*22(1)|p.S241_G245delSCMGG(1)|p.C242fs*98(1)|p.M243fs*18(1)|p.G151_M153>V(1)|p.G245del(1)|p.G245fs*14(1)|p.G245fs*17(1)|p.G245fs*16(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CGGTTCATGCCGCCCATGCAG	0.577	G245S(LS1034_LARGE_INTESTINE)|G245S(NUGC2_STOMACH)|G245S(PANC0403_PANCREAS)|G245S(SKLMS1_SOFT_TISSUE)|G245S(SKMEL2_SKIN)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	420	Substitution - Missense(390)|Deletion - Frameshift(8)|Whole gene deletion(8)|Complex - deletion inframe(5)|Unknown(5)|Deletion - In frame(3)|Insertion - Frameshift(1)	large_intestine(119)|lung(51)|breast(38)|ovary(29)|central_nervous_system(27)|upper_aerodigestive_tract(25)|stomach(25)|haematopoietic_and_lymphoid_tissue(23)|oesophagus(22)|urinary_tract(14)|skin(9)|liver(7)|prostate(7)|biliary_tract(5)|bone(5)|pancreas(4)|soft_tissue(3)|vulva(2)|endometrium(2)|kidney(1)|cervix(1)|salivary_gland(1)	17	GRCh37	CM010463|CM900210|CM920674	TP53	M	rs28934575	C	SER/GLY,SER/GLY,SER/GLY,SER/GLY,SER/GLY,SER/GLY,SER/GLY	0,4406		0,0,2203	149.0	112.0	125.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	733,733,733,733,337,337,337	4.6	1.0	17	dbSNP_125	125	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense,missense,missense,missense	TP53	NM_000546.4,NM_001126112.1,NM_001126113.1,NM_001126114.1,NM_001126115.1,NM_001126116.1,NM_001126117.1	56,56,56,56,56,56,56	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	245/394,245/394,245/347,245/342,113/262,113/210,113/215	7577548	1,13005	2203	4300	6503	7518273	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.733G>A	17.37:g.7577548C>T	ENSP00000269305:p.Gly245Ser		7518273	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	33	5.259904	0.95368	0.0	1.16E-4	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99894	-7.58;-7.58;-7.58;-7.58;-7.58;-7.58;-7.58;-7.58	4.62	4.62	0.57501	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99878	0.9942	M	0.84585	2.705	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;0.999;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.999;0.976;0.992;0.999;0.999;1.0	D	0.96039	0.9023	10	0.87932	D	0	-19.4293	15.3618	0.74483	0.0:1.0:0.0:0.0	rs28934575	245;245;152;245;245;245	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	S	245;245;245;245;245;245;234;152;113;152	ENSP00000410739:G245S;ENSP00000352610:G245S;ENSP00000269305:G245S;ENSP00000398846:G245S;ENSP00000391127:G245S;ENSP00000391478:G245S;ENSP00000425104:G113S;ENSP00000423862:G152S	ENSP00000269305:G245S	G	-	1	0	TP53	7518273	1.000000	0.71417	0.965000	0.40720	0.974000	0.67602	7.609000	0.82925	2.564000	0.86499	0.462000	0.41574	GGC		0.577	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
MC5R	4161	broad.mit.edu	37	18	13826276	13826276	+	Missense_Mutation	SNP	C	C	T			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr18:13826276C>T	ENST00000324750.3	+	1	734	c.512C>T	c.(511-513)aCg>aTg	p.T171M	AP001525.1_ENST00000390194.2_RNA	NM_005913.2	NP_005904.1	P33032	MC5R_HUMAN	melanocortin 5 receptor	171					G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|positive regulation of cAMP biosynthetic process (GO:0030819)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hormone binding (GO:0042562)|melanocortin receptor activity (GO:0004977)	p.T171M(1)		NS(1)|breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(23)|ovary(4)|upper_aerodigestive_tract(1)	41						GCTTTCTGCACGGGCTGCGGC	0.572																																																1	Substitution - Missense(1)	ovary(1)	18											332.0	296.0	308.0					18																	13826276		2203	4300	6503	13816276	SO:0001583	missense	4161			AY268429	CCDS11868.1	18p11.2	2012-08-10			ENSG00000176136	ENSG00000176136		"""GPCR / Class A : Melanocortin receptors"""	6933	protein-coding gene	gene with protein product		600042				8396929	Standard	NM_005913		Approved		uc010xaf.2	P33032	OTTHUMG00000131720	ENST00000324750.3:c.512C>T	18.37:g.13826276C>T	ENSP00000318077:p.Thr171Met		13816276	B0YJ34|Q502V1	Missense_Mutation	SNP	ENST00000324750.3	37	CCDS11868.1	.	.	.	.	.	.	.	.	.	.	C	13.61	2.287294	0.40494	.	.	ENSG00000176136	ENST00000324750	T	0.37584	1.19	5.01	3.18	0.36537	GPCR, rhodopsin-like superfamily (1);	0.147287	0.64402	D	0.000011	T	0.47930	0.1472	M	0.69463	2.115	0.53005	D	0.999969	D	0.59357	0.985	P	0.55391	0.775	T	0.44952	-0.9294	10	0.66056	D	0.02	.	9.6124	0.39670	0.0:0.8255:0.0:0.1745	.	171	P33032	MC5R_HUMAN	M	171	ENSP00000318077:T171M	ENSP00000318077:T171M	T	+	2	0	MC5R	13816276	0.993000	0.37304	0.419000	0.26584	0.011000	0.07611	3.062000	0.49971	0.479000	0.27511	0.455000	0.32223	ACG		0.572	MC5R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254638.1	NM_005913	
ANKRD24	170961	broad.mit.edu	37	19	4200140	4200140	+	Silent	SNP	C	C	A			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr19:4200140C>A	ENST00000600132.1	+	5	591	c.315C>A	c.(313-315)ggC>ggA	p.G105G	ANKRD24_ENST00000318934.4_Silent_p.G105G|ANKRD24_ENST00000262970.5_Silent_p.G195G	NM_133475.1	NP_597732.1	Q8TF21	ANR24_HUMAN	ankyrin repeat domain 24	105								p.G195G(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(9)|prostate(1)|skin(1)	21				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0233)|STAD - Stomach adenocarcinoma(1328;0.181)		TAGCTCATGGCAGCAATGTCA	0.657																																																1	Substitution - coding silent(1)	ovary(1)	19											26.0	28.0	28.0					19																	4200140		1974	4147	6121	4151140	SO:0001819	synonymous_variant	170961			AB075861	CCDS45925.1	19p13.3	2013-01-10				ENSG00000089847		"""Ankyrin repeat domain containing"""	29424	protein-coding gene	gene with protein product						11853319	Standard	NM_133475		Approved	KIAA1981	uc010dtt.1	Q8TF21		ENST00000600132.1:c.315C>A	19.37:g.4200140C>A			4151140	O75268|O95781	Silent	SNP	ENST00000600132.1	37	CCDS45925.1																																																																																				0.657	ANKRD24-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000458188.1	XM_114000	
ACSBG2	81616	broad.mit.edu	37	19	6182869	6182869	+	Silent	SNP	C	C	T			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr19:6182869C>T	ENST00000586696.1	+	9	1290	c.1014C>T	c.(1012-1014)tcC>tcT	p.S338S	ACSBG2_ENST00000252669.5_Silent_p.S338S|ACSBG2_ENST00000591741.1_3'UTR|ACSBG2_ENST00000588304.1_Silent_p.S288S|ACSBG2_ENST00000588485.1_Silent_p.S151S|ACSBG2_ENST00000591403.1_Silent_p.S338S			Q5FVE4	ACBG2_HUMAN	acyl-CoA synthetase bubblegum family member 2	338					cell differentiation (GO:0030154)|fatty acid metabolic process (GO:0006631)|long-chain fatty acid metabolic process (GO:0001676)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)	acyl-CoA hydrolase activity (GO:0047617)|ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)	p.S338S(1)		breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(12)|lung(3)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						GTGCCAAGTCCATGGGCTTGA	0.453																																																1	Substitution - coding silent(1)	ovary(1)	19											95.0	87.0	90.0					19																	6182869		2203	4300	6503	6133869	SO:0001819	synonymous_variant	81616				CCDS12159.1, CCDS74269.1	19p13.3	2012-10-02			ENSG00000130377	ENSG00000130377		"""Acyl-CoA synthetase family"""	24174	protein-coding gene	gene with protein product	"""bubblegum related protein"""	614363				11230166	Standard	XM_005259653		Approved	BGR, PRTD-NY3, DKFZp434K1635	uc002meh.1	Q5FVE4	OTTHUMG00000180754	ENST00000586696.1:c.1014C>T	19.37:g.6182869C>T			6133869	B3KSF2|Q6UWJ3|Q7Z5A0|Q8WW03|Q96M36|Q9BYZ3|Q9H0C4	Silent	SNP	ENST00000586696.1	37	CCDS12159.1																																																																																				0.453	ACSBG2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452898.1	NM_030924	
PSENEN	55851	broad.mit.edu	37	19	36237709	36237709	+	Silent	SNP	G	G	C			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr19:36237709G>C	ENST00000587708.2	+	4	950	c.267G>C	c.(265-267)ggG>ggC	p.G89G	AC002398.11_ENST00000591091.1_RNA|U2AF1L4_ENST00000378975.3_5'Flank|U2AF1L4_ENST00000292879.5_5'Flank|PSENEN_ENST00000222266.2_Silent_p.G89G|LIN37_ENST00000301159.9_5'Flank|U2AF1L4_ENST00000412391.2_5'Flank|PSENEN_ENST00000591949.1_3'UTR|AC002398.9_ENST00000591613.2_Intron|AC002398.11_ENST00000585365.1_RNA|U2AF1L4_ENST00000588100.1_5'Flank|AD000671.6_ENST00000589807.1_5'Flank			Q9NZ42	PEN2_HUMAN	presenilin enhancer gamma secretase subunit	89					amyloid precursor protein catabolic process (GO:0042987)|apoptotic signaling pathway (GO:0097190)|membrane protein ectodomain proteolysis (GO:0006509)|membrane protein intracellular domain proteolysis (GO:0031293)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of apoptotic process (GO:0043065)|positive regulation of catalytic activity (GO:0043085)|protein processing (GO:0016485)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)		p.G89G(1)		central_nervous_system(1)|kidney(1)|liver(1)|lung(2)|ovary(2)|prostate(1)	8	all_lung(56;3.33e-07)|Lung NSC(56;5.02e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			GTGCCCTTGGGGACTACCTCT	0.592																																																1	Substitution - coding silent(1)	ovary(1)	19											51.0	53.0	52.0					19																	36237709		2203	4300	6503	40929549	SO:0001819	synonymous_variant	55851			AF220053	CCDS12474.1	19q13.12	2014-09-17	2013-09-12			ENSG00000205155			30100	protein-coding gene	gene with protein product		607632	"""presenilin enhancer 2 homolog (C. elegans)"""			12110170, 12660785	Standard	NM_172341		Approved	PEN2	uc002obi.1	Q9NZ42		ENST00000587708.2:c.267G>C	19.37:g.36237709G>C			40929549	B2R5L9	Silent	SNP	ENST00000587708.2	37	CCDS12474.1																																																																																				0.592	PSENEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459101.2	NM_172341	
PXDN	7837	broad.mit.edu	37	2	1680797	1680797	+	Silent	SNP	G	G	C			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr2:1680797G>C	ENST00000252804.4	-	8	800	c.750C>G	c.(748-750)tcC>tcG	p.S250S	PXDN_ENST00000483018.1_5'Flank	NM_012293.1	NP_036425.1	Q92626	PXDN_HUMAN	peroxidasin homolog (Drosophila)	250	Ig-like C2-type 1.				extracellular matrix organization (GO:0030198)|hydrogen peroxide catabolic process (GO:0042744)|immune response (GO:0006955)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|oxidation-reduction process (GO:0055114)	endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|heme binding (GO:0020037)|interleukin-1 receptor antagonist activity (GO:0005152)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)	p.S250S(2)		breast(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(24)|lung(48)|ovary(3)|pancreas(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	112	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)		CCTGGGGCTCGGAGGTGATCC	0.517																																																2	Substitution - coding silent(2)	ovary(1)|lung(1)	2											48.0	54.0	52.0					2																	1680797		1944	4137	6081	1659804	SO:0001819	synonymous_variant	7837			AF200348	CCDS46221.1	2p25.3	2013-01-11			ENSG00000130508	ENSG00000130508		"""Immunoglobulin superfamily / I-set domain containing"""	14966	protein-coding gene	gene with protein product		605158				10441517, 9039502	Standard	XM_005264707		Approved	KIAA0230, PRG2, MG50, D2S448, D2S448E, PXN	uc002qxa.3	Q92626	OTTHUMG00000059697	ENST00000252804.4:c.750C>G	2.37:g.1680797G>C			1659804	A8QM65|D6W4Y0|Q4KMG2	Silent	SNP	ENST00000252804.4	37	CCDS46221.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	7.847|7.847	0.723083|0.723083	0.15439|0.15439	.|.	.|.	ENSG00000130508|ENSG00000130508	ENST00000433670|ENST00000447941	.|.	.|.	.|.	4.77|4.77	-8.27|-8.27	0.01017|0.01017	.|.	.|.	.|.	.|.	.|.	T|T	0.35068|0.35068	0.0919|0.0919	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.42120|0.42120	-0.9470|-0.9470	4|4	.|.	.|.	.|.	-7.7603|-7.7603	2.5215|2.5215	0.04681|0.04681	0.1025:0.188:0.3619:0.3476|0.1025:0.188:0.3619:0.3476	.|.	.|.	.|.	.|.	R|G	246|174	.|.	.|.	P|R	-|-	2|1	0|2	PXDN|PXDN	1659804|1659804	0.000000|0.000000	0.05858|0.05858	0.664000|0.664000	0.29753|0.29753	0.754000|0.754000	0.42855|0.42855	-1.750000|-1.750000	0.01822|0.01822	-1.314000|-1.314000	0.02300|0.02300	0.449000|0.449000	0.29647|0.29647	CCG|CGA		0.517	PXDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322505.1	XM_056455	
C2orf16	84226	broad.mit.edu	37	2	27803057	27803057	+	Silent	SNP	A	A	G			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr2:27803057A>G	ENST00000408964.2	+	1	3669	c.3618A>G	c.(3616-3618)caA>caG	p.Q1206Q	ZNF512_ENST00000556601.1_5'Flank|AC074091.1_ENST00000408604.1_RNA|ZNF512_ENST00000413371.2_5'Flank|RP11-158I13.2_ENST00000505973.1_RNA|ZNF512_ENST00000379717.1_5'Flank|ZNF512_ENST00000355467.4_5'Flank|ZNF512_ENST00000416005.2_5'Flank	NM_032266.3	NP_115642.3	Q68DN1	CB016_HUMAN	chromosome 2 open reading frame 16	1206						extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(33)|urinary_tract(1)	47	Acute lymphoblastic leukemia(172;0.155)					TCTATACTCAAGCTTCCAAGA	0.473																																																0			2											105.0	104.0	104.0					2																	27803057		1904	4119	6023	27656561	SO:0001819	synonymous_variant	84226			AL136898	CCDS42666.1	2p23.3	2013-09-20			ENSG00000221843	ENSG00000221843			25275	protein-coding gene	gene with protein product	"""P-S-E-R-S-H-H-S repeats containing"""						Standard	NM_032266		Approved	DKFZp434G118	uc002rkz.4	Q68DN1	OTTHUMG00000159099	ENST00000408964.2:c.3618A>G	2.37:g.27803057A>G			27656561	B9EIQ4|Q53S01|Q8ND64|Q9H088	Silent	SNP	ENST00000408964.2	37	CCDS42666.1																																																																																				0.473	C2orf16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353292.1	NM_032266	
HEATR5B	54497	broad.mit.edu	37	2	37230724	37230724	+	Missense_Mutation	SNP	C	C	T			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr2:37230724C>T	ENST00000233099.5	-	31	5106	c.5011G>A	c.(5011-5013)Gct>Act	p.A1671T	HEATR5B_ENST00000354531.2_Missense_Mutation_p.A1671T	NM_019024.1	NP_061897.1	Q9P2D3	HTR5B_HUMAN	HEAT repeat containing 5B	1671						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)		p.A1671T(1)		breast(3)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(11)|lung(31)|ovary(5)|pancreas(1)|prostate(1)|skin(10)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	77		all_hematologic(82;0.21)				TCCTGAGCAGCTCTTACTATC	0.363																																																1	Substitution - Missense(1)	ovary(1)	2											86.0	86.0	86.0					2																	37230724		2203	4300	6503	37084228	SO:0001583	missense	54497			AB037835	CCDS33181.1	2p22.2	2007-01-02			ENSG00000008869	ENSG00000008869			29273	protein-coding gene	gene with protein product						10718198	Standard	XM_005264379		Approved	KIAA1414, DKFZp686P15184	uc002rpp.1	Q9P2D3	OTTHUMG00000152158	ENST00000233099.5:c.5011G>A	2.37:g.37230724C>T	ENSP00000233099:p.Ala1671Thr		37084228	B5MDU8|Q7Z3B2|Q9NVL7	Missense_Mutation	SNP	ENST00000233099.5	37	CCDS33181.1	.	.	.	.	.	.	.	.	.	.	C	33	5.231011	0.95207	.	.	ENSG00000008869	ENST00000233099;ENST00000354531	T;T	0.65916	-0.18;-0.18	5.51	5.51	0.81932	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.79953	0.4535	M	0.74467	2.265	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	T	0.79193	-0.1904	10	0.48119	T	0.1	-21.2915	19.7818	0.96418	0.0:1.0:0.0:0.0	.	1671	Q9P2D3	HTR5B_HUMAN	T	1671	ENSP00000233099:A1671T;ENSP00000346531:A1671T	ENSP00000233099:A1671T	A	-	1	0	HEATR5B	37084228	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.250000	0.65432	2.736000	0.93811	0.655000	0.94253	GCT		0.363	HEATR5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325492.1	NM_019024	
AFTPH	54812	broad.mit.edu	37	2	64819122	64819122	+	Missense_Mutation	SNP	G	G	A			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr2:64819122G>A	ENST00000422803.1	+	10	3081	c.2767G>A	c.(2767-2769)Gcc>Acc	p.A923T	AFTPH_ENST00000409933.1_Missense_Mutation_p.A922T|AFTPH_ENST00000238856.4_Missense_Mutation_p.A895T|AFTPH_ENST00000238855.7_Missense_Mutation_p.A922T|AFTPH_ENST00000409183.1_Missense_Mutation_p.A554T			Q6ULP2	AFTIN_HUMAN	aftiphilin	923					protein transport (GO:0015031)	AP-1 adaptor complex (GO:0030121)|cytosol (GO:0005829)	clathrin binding (GO:0030276)	p.A895T(1)		breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	35						GATGTTCCCAGCCACGTTAAC	0.443																																																1	Substitution - Missense(1)	ovary(1)	2											191.0	169.0	176.0					2																	64819122		2203	4300	6503	64672626	SO:0001583	missense	54812			AB073356	CCDS1878.1, CCDS46303.1	2p14	2008-02-05			ENSG00000119844	ENSG00000119844			25951	protein-coding gene	gene with protein product						14665628, 15758025, 15811338	Standard	NM_017657		Approved	MGC33965, FLJ20080, FLJ23793, Nbla10388	uc002scz.3	Q6ULP2	OTTHUMG00000129539	ENST00000422803.1:c.2767G>A	2.37:g.64819122G>A	ENSP00000397726:p.Ala923Thr		64672626	D6W5E9|Q6ZM66|Q86VW3|Q8TCF3|Q9H7E3|Q9HAB9|Q9NXS4	Missense_Mutation	SNP	ENST00000422803.1	37		.	.	.	.	.	.	.	.	.	.	G	14.23	2.472527	0.43942	.	.	ENSG00000119844	ENST00000238856;ENST00000422803;ENST00000238855;ENST00000409933;ENST00000409183	T;T;T;T;T	0.52983	1.68;1.64;1.64;1.64;0.64	5.91	2.99	0.34606	.	0.054481	0.64402	N	0.000001	T	0.44180	0.1281	M	0.64997	1.995	0.46028	D	0.998829	B;B;B;B	0.18461	0.028;0.028;0.003;0.011	B;B;B;B	0.19946	0.027;0.027;0.004;0.01	T	0.38265	-0.9669	10	0.44086	T	0.13	-0.8887	11.1386	0.48390	0.2089:0.0:0.7911:0.0	.	923;895;894;922	Q6ULP2;Q6ULP2-2;Q6ULP2-5;Q6ULP2-4	AFTIN_HUMAN;.;.;.	T	895;923;922;922;554	ENSP00000238856:A895T;ENSP00000397726:A923T;ENSP00000238855:A922T;ENSP00000387071:A922T;ENSP00000386913:A554T	ENSP00000238855:A922T	A	+	1	0	AFTPH	64672626	1.000000	0.71417	0.956000	0.39512	0.997000	0.91878	2.866000	0.48420	0.753000	0.32945	0.655000	0.94253	GCC		0.443	AFTPH-202	KNOWN	basic	protein_coding	protein_coding		NM_017657	
NAT8	9027	broad.mit.edu	37	2	73868394	73868394	+	Missense_Mutation	SNP	A	A	T	rs62000430	byFrequency	TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr2:73868394A>T	ENST00000272425.3	-	2	511	c.362T>A	c.(361-363)aTg>aAg	p.M121K		NM_003960.3|NM_016347.2	NP_003951.3|NP_057431.2			N-acetyltransferase 8 (GCN5-related, putative)									p.M121K(1)		breast(1)|endometrium(2)|kidney(2)|lung(2)|ovary(1)|prostate(1)	9						AGCTCCTACCATGCCCACCAC	0.532																																																1	Substitution - Missense(1)	ovary(1)	2											92.0	90.0	91.0					2																	73868394		2203	4300	6503	73721902	SO:0001583	missense	9027			AB013094	CCDS1926.1	2p13.2	2012-03-20	2008-09-24		ENSG00000144035	ENSG00000144035			18069	protein-coding gene	gene with protein product		606716	"""N-acetyltransferase 8"""			11397015, 9852678, 19011241	Standard	NM_003960		Approved	Hcml1, TSC501, GLA, ATase2	uc002sji.1	Q9UHE5	OTTHUMG00000129818	ENST00000272425.3:c.362T>A	2.37:g.73868394A>T	ENSP00000272425:p.Met121Lys		73721902		Missense_Mutation	SNP	ENST00000272425.3	37	CCDS1926.1	.	.	.	.	.	.	.	.	.	.	A	12.15	1.851466	0.32699	.	.	ENSG00000144035	ENST00000272425	T	0.22539	1.95	3.86	-1.95	0.07548	GCN5-related N-acetyltransferase (GNAT) domain (2);Acyl-CoA N-acyltransferase (2);	0.596637	0.18180	N	0.149173	T	0.23886	0.0578	M	0.79123	2.44	0.27161	N	0.96116	B	0.29590	0.25	B	0.35813	0.211	T	0.24799	-1.0150	10	0.31617	T	0.26	-0.2375	8.5516	0.33455	0.5877:0.0:0.4123:0.0	.	121	Q9UHE5	NAT8_HUMAN	K	121	ENSP00000272425:M121K	ENSP00000272425:M121K	M	-	2	0	NAT8	73721902	0.001000	0.12720	0.042000	0.18584	0.030000	0.12068	-0.031000	0.12287	-0.445000	0.07159	-1.292000	0.01352	ATG		0.532	NAT8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327854.1	NM_003960	
SLC4A5	57835	broad.mit.edu	37	2	74479378	74479378	+	Missense_Mutation	SNP	C	C	A			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr2:74479378C>A	ENST00000377634.4	-	16	1805	c.1406G>T	c.(1405-1407)gGa>gTa	p.G469V	SLC4A5_ENST00000358683.4_Missense_Mutation_p.G405V|SLC4A5_ENST00000423644.1_Missense_Mutation_p.G469V|SLC4A5_ENST00000357822.5_Missense_Mutation_p.G469V|SLC4A5_ENST00000359484.4_Missense_Mutation_p.G405V|SLC4A5_ENST00000346834.4_Missense_Mutation_p.G469V|SLC4A5_ENST00000483195.1_5'UTR|SLC4A5_ENST00000394019.2_Missense_Mutation_p.G469V|RP11-287D1.3_ENST00000451608.2_3'UTR|SLC4A5_ENST00000377632.1_Missense_Mutation_p.G469V					solute carrier family 4 (sodium bicarbonate cotransporter), member 5									p.G469V(1)		breast(5)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(12)|lung(13)|ovary(5)|pancreas(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	48						GCTGCTTGTTCCGCCGGCCcc	0.662																																																1	Substitution - Missense(1)	ovary(1)	2											63.0	53.0	56.0					2																	74479378		2203	4300	6503	74332886	SO:0001583	missense	57835			AF243499	CCDS1936.1, CCDS1937.1	2p13.1	2013-07-19	2013-07-19		ENSG00000188687	ENSG00000188687		"""Solute carriers"""	18168	protein-coding gene	gene with protein product		606757	"""solute carrier family 4, sodium bicarbonate cotransporter, member 5"""			10978526, 11087115	Standard	NM_133478		Approved	NBC4	uc002sko.1	Q9BY07	OTTHUMG00000090263	ENST00000377634.4:c.1406G>T	2.37:g.74479378C>A	ENSP00000366861:p.Gly469Val		74332886		Missense_Mutation	SNP	ENST00000377634.4	37	CCDS1936.1	.	.	.	.	.	.	.	.	.	.	C	15.20	2.763700	0.49574	.	.	ENSG00000188687	ENST00000394019;ENST00000451608;ENST00000346834;ENST00000359484;ENST00000423644;ENST00000358683;ENST00000357822;ENST00000377632;ENST00000377634;ENST00000425249	D;D;D;D;D;D;D;D;D	0.98666	-5.06;-5.06;-5.06;-5.06;-5.06;-5.06;-5.06;-5.06;-5.06	4.99	2.97	0.34412	.	0.138350	0.33401	N	0.004959	D	0.97498	0.9181	N	0.19112	0.55	0.29702	N	0.840095	B;P;P;D;D	0.54601	0.4;0.848;0.932;0.967;0.959	B;P;P;P;P	0.62184	0.379;0.521;0.899;0.801;0.675	D	0.94867	0.8027	10	0.59425	D	0.04	.	12.3711	0.55256	0.0:0.4799:0.5201:0.0	.	469;469;405;469;469	Q9BY07-4;E7EQT3;Q9BY07-7;Q9BY07;Q9BY07-3	.;.;.;S4A5_HUMAN;.	V	469;469;469;405;469;405;469;469;469;469	ENSP00000377587:G469V;ENSP00000251768:G469V;ENSP00000352461:G405V;ENSP00000395804:G469V;ENSP00000351513:G405V;ENSP00000350475:G469V;ENSP00000366859:G469V;ENSP00000366861:G469V;ENSP00000405678:G469V	ENSP00000251768:G469V	G	-	2	0	SLC4A5	74332886	.	.	0.035000	0.18076	0.037000	0.13140	.	.	1.212000	0.43366	0.442000	0.29010	GGA		0.662	SLC4A5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206583.3		
DCTN1	1639	broad.mit.edu	37	2	74593456	74593456	+	Nonsense_Mutation	SNP	G	G	C			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr2:74593456G>C	ENST00000361874.3	-	23	2992	c.2675C>G	c.(2674-2676)tCa>tGa	p.S892*	DCTN1_ENST00000409868.1_Nonsense_Mutation_p.S875*|DCTN1_ENST00000495643.1_5'UTR|DCTN1_ENST00000407639.2_Nonsense_Mutation_p.S758*|DCTN1_ENST00000409567.3_Nonsense_Mutation_p.S872*|DCTN1_ENST00000409240.1_Nonsense_Mutation_p.S855*|DCTN1_ENST00000394003.3_Nonsense_Mutation_p.S885*|RP11-287D1.3_ENST00000451608.2_5'Flank|DCTN1_ENST00000409438.1_Nonsense_Mutation_p.S758*	NM_004082.4	NP_004073.2	Q14203	DCTN1_HUMAN	dynactin 1	892					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|G2/M transition of mitotic cell cycle (GO:0000086)|melanosome transport (GO:0032402)|microtubule-based transport (GO:0010970)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|nervous system development (GO:0007399)	cell leading edge (GO:0031252)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dynactin complex (GO:0005869)|dynein complex (GO:0030286)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|spindle pole (GO:0000922)	motor activity (GO:0003774)	p.S892*(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(20)|ovary(4)|prostate(1)|skin(3)	45						GATGTTGCATGACTGGCGCAG	0.577																																																1	Substitution - Nonsense(1)	ovary(1)	2											67.0	69.0	68.0					2																	74593456		2203	4300	6503	74446964	SO:0001587	stop_gained	1639				CCDS1939.1, CCDS46341.1, CCDS46342.1, CCDS54368.1, CCDS54369.1	2p13	2014-09-17	2010-06-24		ENSG00000204843	ENSG00000204843			2711	protein-coding gene	gene with protein product	"""p150 glued homolog (Drosophila)"""	601143	"""dynactin 1 (p150, Glued (Drosophila) homolog)"""			1828535	Standard	NM_001190836		Approved		uc002skx.3	Q14203	OTTHUMG00000129963	ENST00000361874.3:c.2675C>G	2.37:g.74593456G>C	ENSP00000354791:p.Ser892*		74446964	A8MY36|B4DM45|E9PFS5|E9PGE1|G5E9H4|O95296|Q6IQ37|Q9BRM9|Q9UIU1|Q9UIU2	Nonsense_Mutation	SNP	ENST00000361874.3	37	CCDS1939.1	.	.	.	.	.	.	.	.	.	.	G	43	9.852681	0.99280	.	.	ENSG00000204843	ENST00000361874;ENST00000394003;ENST00000393999;ENST00000407639;ENST00000409438;ENST00000409240;ENST00000409868;ENST00000409567	.	.	.	5.44	5.44	0.79542	.	0.000000	0.33382	N	0.004965	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.33141	T	0.24	-3.597	18.2031	0.89846	0.0:0.0:1.0:0.0	.	.	.	.	X	892;885;875;758;758;855;875;872	.	ENSP00000354791:S892X	S	-	2	0	DCTN1	74446964	1.000000	0.71417	0.969000	0.41365	0.974000	0.67602	9.372000	0.97165	2.837000	0.97791	0.655000	0.94253	TCA		0.577	DCTN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252227.3	NM_004082	
TACR1	6869	broad.mit.edu	37	2	75276651	75276651	+	Missense_Mutation	SNP	A	A	C			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	A	A	C	C	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr2:75276651A>C	ENST00000305249.5	-	5	1897	c.1132T>G	c.(1132-1134)Tcg>Gcg	p.S378A		NM_001058.3	NP_001049.1	P25103	NK1R_HUMAN	tachykinin receptor 1	378					acute inflammatory response (GO:0002526)|aggressive behavior (GO:0002118)|angiotensin-mediated drinking behavior (GO:0003051)|associative learning (GO:0008306)|behavioral response to pain (GO:0048266)|detection of abiotic stimulus (GO:0009582)|eating behavior (GO:0042755)|inflammatory response (GO:0006954)|long-term memory (GO:0007616)|operant conditioning (GO:0035106)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of action potential (GO:0045760)|positive regulation of blood pressure (GO:0045777)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of hormone secretion (GO:0046887)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of lymphocyte proliferation (GO:0050671)|positive regulation of ossification (GO:0045778)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of saliva secretion (GO:0046878)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of uterine smooth muscle contraction (GO:0070474)|positive regulation of vascular permeability (GO:0043117)|positive regulation of vasoconstriction (GO:0045907)|regulation of smooth muscle cell migration (GO:0014910)|regulation of smooth muscle cell proliferation (GO:0048660)|response to auditory stimulus (GO:0010996)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to heat (GO:0009408)|response to morphine (GO:0043278)|response to nicotine (GO:0035094)|response to ozone (GO:0010193)|response to progesterone (GO:0032570)|smooth muscle contraction involved in micturition (GO:0060083)|sperm ejaculation (GO:0042713)|tachykinin receptor signaling pathway (GO:0007217)	cell body (GO:0044297)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	substance P receptor activity (GO:0016496)|tachykinin receptor activity (GO:0004995)	p.S378A(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(8)|ovary(1)|skin(1)	24					Aprepitant(DB00673)|Ketamine(DB01221)|Vapreotide(DB04894)	TCCAGGGACGAGGGTGTGGCC	0.612																																					Pancreas(64;62 1268 3653 14826 43765)											1	Substitution - Missense(1)	ovary(1)	2											115.0	113.0	114.0					2																	75276651		2203	4300	6503	75130159	SO:0001583	missense	6869			M76675	CCDS1958.1, CCDS46345.1	2p13.1-p12	2012-08-08			ENSG00000115353	ENSG00000115353		"""GPCR / Class A : Tachykinin receptors"""	11526	protein-coding gene	gene with protein product		162323		TAC1R		1657150	Standard	NM_001058		Approved	SPR, NK1R, NKIR	uc002sng.2	P25103	OTTHUMG00000129973	ENST00000305249.5:c.1132T>G	2.37:g.75276651A>C	ENSP00000303522:p.Ser378Ala		75130159	A8K150	Missense_Mutation	SNP	ENST00000305249.5	37	CCDS1958.1	.	.	.	.	.	.	.	.	.	.	A	0.011	-1.733988	0.00687	.	.	ENSG00000115353	ENST00000305249	T	0.69561	-0.41	4.81	2.35	0.29111	.	0.622890	0.16884	N	0.195589	T	0.34542	0.0901	N	0.05124	-0.11	0.09310	N	0.999999	B	0.02656	0.0	B	0.06405	0.002	T	0.21999	-1.0229	10	0.06891	T	0.86	.	3.7102	0.08417	0.5679:0.0:0.0909:0.3412	.	378	P25103	NK1R_HUMAN	A	378	ENSP00000303522:S378A	ENSP00000303522:S378A	S	-	1	0	TACR1	75130159	1.000000	0.71417	0.001000	0.08648	0.015000	0.08874	3.576000	0.53878	0.308000	0.22923	-0.695000	0.03696	TCG		0.612	TACR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252239.3	NM_001058	
KCMF1	56888	broad.mit.edu	37	2	85280328	85280328	+	Silent	SNP	A	A	C			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	A	A	C	C	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr2:85280328A>C	ENST00000409785.4	+	7	1301	c.942A>C	c.(940-942)gcA>gcC	p.A314A		NM_020122.4	NP_064507.3	Q9P0J7	KCMF1_HUMAN	potassium channel modulatory factor 1	314							ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.A314A(1)		ovary(3)	3						GCGAGCGTGCAGACCGCAGCC	0.463																																																1	Substitution - coding silent(1)	ovary(1)	2											49.0	53.0	52.0					2																	85280328		1973	4173	6146	85133839	SO:0001819	synonymous_variant	56888			AF155652	CCDS46350.1	2p11.2	2010-11-23			ENSG00000176407	ENSG00000176407		"""Zinc fingers, ZZ-type"""	20589	protein-coding gene	gene with protein product		614719					Standard	NM_020122		Approved	DEBT91, PCMF, DKFZP434L1021, ZZZ1	uc002sox.4	Q9P0J7	OTTHUMG00000153004	ENST00000409785.4:c.942A>C	2.37:g.85280328A>C			85133839	Q4ZG04|Q53SC7|Q9BWK2|Q9H8P5|Q9UFE8	Silent	SNP	ENST00000409785.4	37	CCDS46350.1																																																																																				0.463	KCMF1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328942.4	NM_020122	
TEKT4	150483	broad.mit.edu	37	2	95539776	95539776	+	Silent	SNP	C	C	A	rs186821220		TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr2:95539776C>A	ENST00000295201.4	+	3	773	c.636C>A	c.(634-636)atC>atA	p.I212I	AC097374.2_ENST00000568768.1_RNA	NM_144705.2	NP_653306.1	Q8WW24	TEKT4_HUMAN	tektin 4	212					cell projection organization (GO:0030030)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|motile cilium (GO:0031514)|nucleus (GO:0005634)		p.I212I(1)		NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(15)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	28						CCTACAACATCGACGAGACCT	0.647																																																1	Substitution - coding silent(1)	ovary(1)	2											87.0	85.0	85.0					2																	95539776		2203	4300	6503	94903503	SO:0001819	synonymous_variant	150483			AK097438	CCDS2005.1	2q11.2	2008-02-05			ENSG00000163060	ENSG00000163060			31012	protein-coding gene	gene with protein product							Standard	XM_005263876		Approved	MGC27019	uc002stw.1	Q8WW24	OTTHUMG00000130396	ENST00000295201.4:c.636C>A	2.37:g.95539776C>A			94903503		Silent	SNP	ENST00000295201.4	37	CCDS2005.1																																																																																				0.647	TEKT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252777.1	NM_144705	
HNMT	3176	broad.mit.edu	37	2	138771422	138771422	+	Missense_Mutation	SNP	T	T	A			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	T	T	A	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr2:138771422T>A	ENST00000280097.3	+	6	783	c.601T>A	c.(601-603)Tca>Aca	p.S201T	HNMT_ENST00000410115.1_Missense_Mutation_p.S201T|HNMT_ENST00000485653.1_3'UTR	NM_006895.2	NP_008826.1	P50135	HNMT_HUMAN	histamine N-methyltransferase	201					brain development (GO:0007420)|hyperosmotic response (GO:0006972)|respiratory gaseous exchange (GO:0007585)|response to amine (GO:0014075)|response to cocaine (GO:0042220)|response to glucocorticoid (GO:0051384)|response to interleukin-1 (GO:0070555)|response to tumor cell (GO:0002347)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|neuron projection (GO:0043005)|nucleus (GO:0005634)	histamine N-methyltransferase activity (GO:0046539)	p.S201T(1)		NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13				BRCA - Breast invasive adenocarcinoma(221;0.125)	Amodiaquine(DB00613)|Chlorhexidine(DB00878)|Histamine Phosphate(DB00667)|Quinacrine(DB01103)	GTATATCACATCAGATGACCT	0.453																																																1	Substitution - Missense(1)	ovary(1)	2											136.0	132.0	133.0					2																	138771422		2203	4300	6503	138487892	SO:0001583	missense	3176				CCDS2181.1, CCDS33296.1, CCDS33297.1	2q22.1	2008-02-05			ENSG00000150540	ENSG00000150540	2.1.1.8		5028	protein-coding gene	gene with protein product		605238					Standard	NM_001024074		Approved		uc002tvf.3	P50135	OTTHUMG00000131751	ENST00000280097.3:c.601T>A	2.37:g.138771422T>A	ENSP00000280097:p.Ser201Thr		138487892	B2R9J3|Q546Z6|Q7Z7I2|Q8IU56|Q8WW98|Q9BRW6	Missense_Mutation	SNP	ENST00000280097.3	37	CCDS2181.1	.	.	.	.	.	.	.	.	.	.	T	5.741	0.321100	0.10845	.	.	ENSG00000150540	ENST00000410115;ENST00000280097	T;T	0.28255	1.62;1.62	5.98	4.77	0.60923	.	0.158492	0.56097	D	0.000024	T	0.25005	0.0607	L	0.52364	1.645	0.80722	D	1	P	0.35684	0.515	B	0.33121	0.158	T	0.03413	-1.1039	10	0.14656	T	0.56	-4.2244	11.8533	0.52423	0.0:0.0:0.2673:0.7327	.	201	P50135	HNMT_HUMAN	T	201	ENSP00000386940:S201T;ENSP00000280097:S201T	ENSP00000280097:S201T	S	+	1	0	HNMT	138487892	0.997000	0.39634	0.929000	0.37066	0.030000	0.12068	2.612000	0.46343	2.296000	0.77279	0.482000	0.46254	TCA		0.453	HNMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254673.1		
PKP4	8502	broad.mit.edu	37	2	159519565	159519565	+	Nonsense_Mutation	SNP	A	A	T			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr2:159519565A>T	ENST00000389759.3	+	14	2480	c.2368A>T	c.(2368-2370)Aag>Tag	p.K790*	AC005042.4_ENST00000342892.4_RNA|PKP4_ENST00000495123.1_3'UTR|PKP4_ENST00000389757.3_Nonsense_Mutation_p.K790*	NM_003628.3	NP_003619.2	Q99569	PKP4_HUMAN	plakophilin 4	790	Poly-Lys.				cell-cell junction assembly (GO:0007043)|cell-cell signaling (GO:0007267)|positive regulation of cytokinesis (GO:0032467)|positive regulation of gene expression (GO:0010628)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell adhesion (GO:0030155)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)|desmosome (GO:0030057)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)		p.K790*(1)		breast(2)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(9)|lung(21)|ovary(6)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	61						GGGGAAGAAGAAGAAAAAGAA	0.428										HNSCC(62;0.18)																																						1	Substitution - Nonsense(1)	ovary(1)	2											31.0	35.0	34.0					2																	159519565		2202	4299	6501	159227811	SO:0001587	stop_gained	8502			X81889	CCDS33305.1, CCDS33306.1	2q24.1	2013-02-14			ENSG00000144283	ENSG00000144283		"""Armadillo repeat containing"""	9026	protein-coding gene	gene with protein product		604276				9342840, 8937994	Standard	NM_003628		Approved	p0071	uc002tzv.3	Q99569	OTTHUMG00000153969	ENST00000389759.3:c.2368A>T	2.37:g.159519565A>T	ENSP00000374409:p.Lys790*		159227811	Q86W91	Nonsense_Mutation	SNP	ENST00000389759.3	37	CCDS33305.1	.	.	.	.	.	.	.	.	.	.	A	41	8.640024	0.98897	.	.	ENSG00000144283	ENST00000389757;ENST00000389759	.	.	.	5.72	5.72	0.89469	.	0.051239	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-16.5422	16.0204	0.80478	1.0:0.0:0.0:0.0	.	.	.	.	X	790	.	ENSP00000374407:K790X	K	+	1	0	PKP4	159227811	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.306000	0.78905	2.174000	0.68829	0.533000	0.62120	AAG		0.428	PKP4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333250.1		
FAP	2191	broad.mit.edu	37	2	163027550	163027550	+	Missense_Mutation	SNP	G	G	T	rs138652824	byFrequency	TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr2:163027550G>T	ENST00000188790.4	-	26	2429	c.2222C>A	c.(2221-2223)aCg>aAg	p.T741K	FAP_ENST00000443424.1_Missense_Mutation_p.T716K|AC007750.5_ENST00000609668.1_RNA|AC007750.5_ENST00000418968.3_RNA	NM_004460.2	NP_004451.2			fibroblast activation protein, alpha									p.T741K(1)		NS(2)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(5)|lung(34)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(4)	63						TAAGTGGTTCGTGGACAGGCC	0.433																																																1	Substitution - Missense(1)	ovary(1)	2											147.0	147.0	147.0					2																	163027550		2203	4300	6503	162735796	SO:0001583	missense	2191			U09278	CCDS33311.1	2q23	2008-02-05			ENSG00000078098	ENSG00000078098			3590	protein-coding gene	gene with protein product	"""seprase"""	600403				9247085, 14707457	Standard	NM_004460		Approved	DPPIV	uc002ucd.3	Q12884	OTTHUMG00000153890	ENST00000188790.4:c.2222C>A	2.37:g.163027550G>T	ENSP00000188790:p.Thr741Lys		162735796		Missense_Mutation	SNP	ENST00000188790.4	37	CCDS33311.1	.	.	.	.	.	.	.	.	.	.	G	11.19	1.565030	0.27915	.	.	ENSG00000078098	ENST00000188790;ENST00000443424	T;T	0.25912	1.77;1.77	5.6	3.75	0.43078	Peptidase S9, prolyl oligopeptidase, catalytic domain (1);	0.591873	0.18039	N	0.153678	T	0.09202	0.0227	N	0.11673	0.155	0.09310	N	0.999999	B;B;B	0.09022	0.001;0.0;0.002	B;B;B	0.14023	0.01;0.0;0.003	T	0.37865	-0.9687	10	0.05436	T	0.98	-22.0058	1.9767	0.03417	0.1524:0.1394:0.4388:0.2694	.	716;220;741	B4DLR2;Q12884-2;Q12884	.;.;SEPR_HUMAN	K	741;716	ENSP00000188790:T741K;ENSP00000411391:T716K	ENSP00000188790:T741K	T	-	2	0	FAP	162735796	0.058000	0.20735	0.978000	0.43139	0.607000	0.37147	0.616000	0.24344	0.687000	0.31509	0.655000	0.94253	ACG		0.433	FAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332852.2		
EVX2	344191	broad.mit.edu	37	2	176945477	176945477	+	Nonsense_Mutation	SNP	G	G	T			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr2:176945477G>T	ENST00000308618.4	-	3	925	c.789C>A	c.(787-789)taC>taA	p.Y263*		NM_001080458.1	NP_001073927.1	Q03828	EVX2_HUMAN	even-skipped homeobox 2	263					limb morphogenesis (GO:0035108)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.Y263*(1)		kidney(1)|large_intestine(3)|liver(1)|lung(8)|ovary(3)	16			OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.18)	READ - Rectum adenocarcinoma(9;0.0678)|Colorectal(32;0.115)		GCGTCATCATGTAGGTGTAGA	0.692																																																1	Substitution - Nonsense(1)	ovary(1)	2											30.0	36.0	34.0					2																	176945477		2182	4254	6436	176653723	SO:0001587	stop_gained	344191				CCDS33333.1	2q31.1	2012-03-09	2007-02-15		ENSG00000174279	ENSG00000174279		"""Homeoboxes / ANTP class : HOXL subclass"""	3507	protein-coding gene	gene with protein product		142991	"""eve, even-skipped homeobox homolog 2 (Drosophila)"""			1675198	Standard	NM_001080458		Approved		uc010zeu.2	Q03828	OTTHUMG00000154173	ENST00000308618.4:c.789C>A	2.37:g.176945477G>T	ENSP00000312385:p.Tyr263*		176653723		Nonsense_Mutation	SNP	ENST00000308618.4	37	CCDS33333.1	.	.	.	.	.	.	.	.	.	.	G	37	6.607650	0.97701	.	.	ENSG00000174279	ENST00000308618	.	.	.	4.51	3.61	0.41365	.	0.124393	0.56097	D	0.000030	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-23.3904	12.5848	0.56410	0.0834:0.0:0.9166:0.0	.	.	.	.	X	263	.	ENSP00000312385:Y263X	Y	-	3	2	EVX2	176653723	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.418000	0.59828	2.355000	0.79922	0.462000	0.41574	TAC		0.692	EVX2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359252.1		
ZNF385B	151126	broad.mit.edu	37	2	180409567	180409567	+	Missense_Mutation	SNP	G	G	C			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr2:180409567G>C	ENST00000410066.1	-	4	986	c.383C>G	c.(382-384)cCa>cGa	p.P128R	ZNF385B_ENST00000409692.1_Missense_Mutation_p.P26R|ZNF385B_ENST00000466398.1_5'UTR|ZNF385B_ENST00000409343.1_Missense_Mutation_p.P52R|ZNF385B_ENST00000336917.5_Missense_Mutation_p.P26R	NM_152520.4	NP_689733.3	Q569K4	Z385B_HUMAN	zinc finger protein 385B	128	Interaction with p53/TP53.				intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|p53 binding (GO:0002039)|zinc ion binding (GO:0008270)	p.P128R(1)		breast(1)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)	26			Epithelial(96;0.174)|OV - Ovarian serous cystadenocarcinoma(117;0.201)			GTTAAAATTTGGAAAGAGCCC	0.393																																					Colon(155;204 2491 32774 51842)											1	Substitution - Missense(1)	ovary(1)	2											132.0	137.0	135.0					2																	180409567		2203	4300	6503	180117812	SO:0001583	missense	151126			AK057999	CCDS33339.1, CCDS46463.1, CCDS46464.1	2q31.3-q32.1	2012-10-05	2007-12-06	2007-12-06	ENSG00000144331	ENSG00000144331			26332	protein-coding gene	gene with protein product		612344	"""zinc finger protein 533"""	ZNF533		12477932	Standard	NM_152520		Approved	FLJ25270	uc002unn.4	Q569K4	OTTHUMG00000154559	ENST00000410066.1:c.383C>G	2.37:g.180409567G>C	ENSP00000386845:p.Pro128Arg		180117812	Q49A04|Q6ZMZ7|Q8IY01|Q8N8H2|Q96DK4	Missense_Mutation	SNP	ENST00000410066.1	37	CCDS33339.1	.	.	.	.	.	.	.	.	.	.	G	25.3	4.627661	0.87560	.	.	ENSG00000144331	ENST00000410066;ENST00000336917;ENST00000409343;ENST00000409692;ENST00000457304;ENST00000439340	T;T;T;T;T;T	0.51574	0.94;0.94;0.94;0.94;0.94;0.7	5.97	5.97	0.96955	.	0.047601	0.85682	D	0.000000	T	0.69006	0.3063	M	0.67397	2.05	0.58432	D	0.999998	D;D	0.71674	0.991;0.998	P;D	0.69142	0.881;0.962	T	0.69292	-0.5183	10	0.87932	D	0	-6.6726	20.4387	0.99107	0.0:0.0:1.0:0.0	.	128;52	Q569K4;Q569K4-2	Z385B_HUMAN;.	R	128;26;52;26;26;46	ENSP00000386845:P128R;ENSP00000338225:P26R;ENSP00000386379:P52R;ENSP00000386507:P26R;ENSP00000394038:P26R;ENSP00000399198:P46R	ENSP00000338225:P26R	P	-	2	0	ZNF385B	180117812	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.923000	0.87546	2.836000	0.97738	0.655000	0.94253	CCA		0.393	ZNF385B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335972.1	NM_152520	
ITGA4	3676	broad.mit.edu	37	2	182350655	182350655	+	Missense_Mutation	SNP	A	A	T			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr2:182350655A>T	ENST00000397033.2	+	10	1519	c.1089A>T	c.(1087-1089)aaA>aaT	p.K363N		NM_000885.4	NP_000876.3	P13612	ITA4_HUMAN	integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA-4 receptor)	363					B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|blood vessel remodeling (GO:0001974)|cell-matrix adhesion (GO:0007160)|cell-matrix adhesion involved in ameboidal cell migration (GO:0003366)|chorio-allantoic fusion (GO:0060710)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|face development (GO:0060324)|heart development (GO:0007507)|heterophilic cell-cell adhesion (GO:0007157)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|negative regulation of protein homodimerization activity (GO:0090074)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|substrate adhesion-dependent cell spreading (GO:0034446)|T cell migration (GO:0072678)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alpha4-beta7 complex (GO:0034669)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)	p.K363N(1)		breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(27)|ovary(3)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	58			OV - Ovarian serous cystadenocarcinoma(117;0.0593)		Natalizumab(DB00108)|Tinzaparin(DB06822)	GAAGTGACAAATATGCTGCAA	0.368																																																1	Substitution - Missense(1)	ovary(1)	2											170.0	160.0	163.0					2																	182350655		1862	4107	5969	182058900	SO:0001583	missense	3676				CCDS42788.1	2q31-q32	2010-03-23			ENSG00000115232	ENSG00000115232		"""CD molecules"", ""Integrins"""	6140	protein-coding gene	gene with protein product		192975		CD49D		1537388	Standard	NM_000885		Approved	CD49d	uc002unu.3	P13612	OTTHUMG00000154212	ENST00000397033.2:c.1089A>T	2.37:g.182350655A>T	ENSP00000380227:p.Lys363Asn		182058900	D3DPG4|Q7Z4L6	Missense_Mutation	SNP	ENST00000397033.2	37	CCDS42788.1	.	.	.	.	.	.	.	.	.	.	A	11.01	1.512730	0.27123	.	.	ENSG00000115232	ENST00000425522;ENST00000397033;ENST00000233573	T;T	0.11063	2.81;2.81	5.87	5.87	0.94306	.	0.291855	0.39615	N	0.001306	T	0.07369	0.0186	L	0.27053	0.805	0.31310	N	0.68721	B;P	0.40000	0.409;0.698	B;B	0.36030	0.216;0.115	T	0.15578	-1.0432	10	0.19147	T	0.46	.	10.3294	0.43814	0.8838:0.0:0.1162:0.0	.	363;363	E7EP60;P13612	.;ITA4_HUMAN	N	363	ENSP00000380227:K363N;ENSP00000233573:K363N	ENSP00000233573:K363N	K	+	3	2	ITGA4	182058900	0.996000	0.38824	1.000000	0.80357	0.967000	0.64934	0.472000	0.22116	2.234000	0.73211	0.477000	0.44152	AAA		0.368	ITGA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334427.1		
CERKL	375298	broad.mit.edu	37	2	182423358	182423358	+	Missense_Mutation	SNP	C	C	G			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr2:182423358C>G	ENST00000339098.5	-	6	832	c.833G>C	c.(832-834)gGg>gCg	p.G278A	CERKL_ENST00000409440.3_Missense_Mutation_p.G234A|CERKL_ENST00000410087.3_Missense_Mutation_p.G252A|CERKL_ENST00000374970.2_Intron|CERKL_ENST00000374969.2_Intron|CERKL_ENST00000479558.1_5'UTR			Q49MI3	CERKL_HUMAN	ceramide kinase-like	278	DAGKc. {ECO:0000255|PROSITE- ProRule:PRU00783}.				negative regulation of apoptotic process (GO:0043066)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)	p.G252A(1)		NS(1)|breast(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(13)|ovary(3)|skin(3)	32			OV - Ovarian serous cystadenocarcinoma(117;0.088)			TGTTTCCATCCCAGCATTCTT	0.473																																																1	Substitution - Missense(1)	ovary(1)	2											111.0	115.0	114.0					2																	182423358		2014	4166	6180	182131603	SO:0001583	missense	375298			BC020465	CCDS33340.1, CCDS33341.1, CCDS42789.1, CCDS46466.1, CCDS54425.1	2q31.3	2005-01-04			ENSG00000188452	ENSG00000188452			21699	protein-coding gene	gene with protein product			"""retinitis pigmentosa 26 (autosomal recessive)"""	RP26		14681825	Standard	NR_027689		Approved		uc002uny.3	Q49MI3	OTTHUMG00000154315	ENST00000339098.5:c.833G>C	2.37:g.182423358C>G	ENSP00000341159:p.Gly278Ala		182131603	B2RPL2|B4DEY1|Q49MH9|Q49MI0|Q49MI1|Q49MI2|Q5DVJ2|Q5DVJ4|Q5DVJ5|Q6UZF6|Q6ZP59	Missense_Mutation	SNP	ENST00000339098.5	37	CCDS42789.1	.	.	.	.	.	.	.	.	.	.	C	28.5	4.928409	0.92389	.	.	ENSG00000188452	ENST00000410087;ENST00000409440;ENST00000339098	T;T;T	0.18338	2.22;2.41;2.48	5.93	5.93	0.95920	Diacylglycerol kinase, catalytic domain (2);	0.162184	0.48767	D	0.000161	T	0.30541	0.0768	L	0.37507	1.11	0.80722	D	1	D;D;D	0.89917	1.0;0.998;0.993	D;D;P	0.85130	0.997;0.954;0.846	T	0.01456	-1.1350	10	0.05351	T	0.99	.	20.3495	0.98807	0.0:1.0:0.0:0.0	.	234;252;278	B4DEY1;Q49MI3-2;Q49MI3	.;.;CERKL_HUMAN	A	252;234;278	ENSP00000386725:G252A;ENSP00000387080:G234A;ENSP00000341159:G278A	ENSP00000341159:G278A	G	-	2	0	CERKL	182131603	1.000000	0.71417	0.342000	0.25602	0.989000	0.77384	6.207000	0.72159	2.814000	0.96858	0.591000	0.81541	GGG		0.473	CERKL-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334811.1		
MDH1B	130752	broad.mit.edu	37	2	207613841	207613841	+	Silent	SNP	T	T	C			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr2:207613841T>C	ENST00000374412.3	-	7	1394	c.1119A>G	c.(1117-1119)ggA>ggG	p.G373G	MDH1B_ENST00000454776.2_Silent_p.G373G|MDH1B_ENST00000449792.1_Silent_p.G275G|MDH1B_ENST00000392214.2_Silent_p.G160G	NM_001039845.1|NM_001282940.1	NP_001034934.1|NP_001269869.1	Q5I0G3	MDH1B_HUMAN	malate dehydrogenase 1B, NAD (soluble)	373					carbohydrate metabolic process (GO:0005975)|malate metabolic process (GO:0006108)|tricarboxylic acid cycle (GO:0006099)		malate dehydrogenase activity (GO:0016615)|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor (GO:0016616)	p.G373G(1)		NS(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(14)|ovary(4)|stomach(1)	34				LUSC - Lung squamous cell carcinoma(261;0.0763)|Epithelial(149;0.131)|Lung(261;0.145)		CCAAAATGCCTCCAAATTGTC	0.403																																					Pancreas(76;29 1355 28675 37177 51207)											1	Substitution - coding silent(1)	ovary(1)	2											139.0	113.0	122.0					2																	207613841		2203	4300	6503	207322086	SO:0001819	synonymous_variant	130752				CCDS33365.1, CCDS63102.1	2q33.3	2008-05-27			ENSG00000138400	ENSG00000138400			17836	protein-coding gene	gene with protein product							Standard	NM_001039845		Approved	FLJ25341, RP11-95H11	uc002vbs.3	Q5I0G3	OTTHUMG00000132918	ENST00000374412.3:c.1119A>G	2.37:g.207613841T>C			207322086	A8K8M1|Q53TK9|Q8IV51	Silent	SNP	ENST00000374412.3	37	CCDS33365.1																																																																																				0.403	MDH1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256429.2	NM_001039845	
TRAF3IP1	26146	broad.mit.edu	37	2	239264709	239264709	+	Missense_Mutation	SNP	A	A	T			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr2:239264709A>T	ENST00000373327.4	+	15	1899	c.1677A>T	c.(1675-1677)aaA>aaT	p.K559N	TRAF3IP1_ENST00000391994.2_Missense_Mutation_p.K559N|TRAF3IP1_ENST00000391993.3_Missense_Mutation_p.K493N	NM_015650.3	NP_056465.2	Q8TDR0	MIPT3_HUMAN	TNF receptor-associated factor 3 interacting protein 1	559	DISC1-interaction domain.				cilium assembly (GO:0042384)|embryonic camera-type eye development (GO:0031076)|embryonic digit morphogenesis (GO:0042733)|embryonic heart tube development (GO:0035050)|intraciliary transport (GO:0042073)|negative regulation of defense response to virus (GO:0050687)|negative regulation of interferon-beta production (GO:0032688)|negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:1901621)|neural tube patterning (GO:0021532)|post-anal tail morphogenesis (GO:0036342)	axoneme (GO:0005930)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)		p.K559N(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(9)|ovary(2)|prostate(1)|skin(2)	23		all_epithelial(40;3.22e-10)|Breast(86;0.000523)|Renal(207;0.00571)|Ovarian(221;0.156)|all_hematologic(139;0.182)		Epithelial(121;9.92e-24)|OV - Ovarian serous cystadenocarcinoma(60;7.85e-12)|Kidney(56;3.21e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.01e-07)|BRCA - Breast invasive adenocarcinoma(100;7.72e-05)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.0184)		AGTCACCCAAACCTGGGGAGA	0.348																																																1	Substitution - Missense(1)	ovary(1)	2											49.0	49.0	49.0					2																	239264709		2203	4300	6503	238929448	SO:0001583	missense	26146			AF230877	CCDS33415.1, CCDS46557.1	2q37.3	2014-02-21			ENSG00000204104	ENSG00000204104		"""Intraflagellar transport homologs"""	17861	protein-coding gene	gene with protein product	"""microtubule interacting protein that associates with TRAF3"""	607380				10791955, 12935900	Standard	NM_015650		Approved	MIP-T3, DKFZP434F124, MIPT3, IFT54	uc002vye.3	Q8TDR0	OTTHUMG00000152872	ENST00000373327.4:c.1677A>T	2.37:g.239264709A>T	ENSP00000362424:p.Lys559Asn		238929448	Q6PCT1|Q7L8N9|Q9NRD6|Q9Y4Q1	Missense_Mutation	SNP	ENST00000373327.4	37	CCDS33415.1	.	.	.	.	.	.	.	.	.	.	a	16.69	3.193651	0.58017	.	.	ENSG00000204104	ENST00000391993;ENST00000373327;ENST00000391994;ENST00000440998	T;T;T	0.15139	2.45;2.45;2.45	5.52	-0.659	0.11424	.	0.413038	0.26394	N	0.024624	T	0.29256	0.0728	M	0.71036	2.16	0.09310	N	1	D;D	0.60160	0.963;0.987	P;P	0.60286	0.723;0.872	T	0.10706	-1.0618	10	0.33141	T	0.24	-9.3265	9.0606	0.36431	0.5265:0.0:0.4735:0.0	.	493;559	Q8TDR0-2;Q8TDR0	.;MIPT3_HUMAN	N	493;559;559;493	ENSP00000375851:K493N;ENSP00000362424:K559N;ENSP00000375852:K559N	ENSP00000362424:K559N	K	+	3	2	TRAF3IP1	238929448	0.000000	0.05858	0.002000	0.10522	0.895000	0.52256	-0.028000	0.12350	-0.013000	0.14199	0.529000	0.55759	AAA		0.348	TRAF3IP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000328312.1	NM_015650	
DEFB129	140881	broad.mit.edu	37	20	210247	210247	+	Silent	SNP	C	C	A			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr20:210247C>A	ENST00000246105.4	+	2	418	c.387C>A	c.(385-387)acC>acA	p.T129T		NM_080831.3	NP_543021.1	Q9H1M3	DB129_HUMAN	defensin, beta 129	129					defense response to bacterium (GO:0042742)	extracellular region (GO:0005576)		p.T129T(1)		endometrium(2)|kidney(1)|large_intestine(2)|liver(1)|lung(1)|ovary(1)|stomach(1)	9		all_cancers(10;7.65e-05)|Lung NSC(37;0.0417)|all_epithelial(17;0.0676)|all_lung(30;0.0713)|Breast(17;0.231)	OV - Ovarian serous cystadenocarcinoma(29;0.122)			ACTCTGCCACCATCAGCACTA	0.448																																																1	Substitution - coding silent(1)	ovary(1)	20											126.0	117.0	120.0					20																	210247		2203	4300	6503	158247	SO:0001819	synonymous_variant	140881			AY358186	CCDS12992.1	20p13	2010-03-30	2002-05-09	2002-05-10	ENSG00000125903	ENSG00000125903		"""Defensins, beta"""	16218	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 87"""	C20orf87		11854508	Standard	NM_080831		Approved	bA530N10.3, DEFB-29	uc002wda.3	Q9H1M3	OTTHUMG00000031618	ENST00000246105.4:c.387C>A	20.37:g.210247C>A			158247	Q8NES7	Silent	SNP	ENST00000246105.4	37	CCDS12992.1																																																																																				0.448	DEFB129-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077430.2	NM_080831	
NDRG3	57446	broad.mit.edu	37	20	35282008	35282008	+	Missense_Mutation	SNP	G	G	T			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr20:35282008G>T	ENST00000349004.1	-	16	1124	c.1043C>A	c.(1042-1044)aCc>aAc	p.T348N	NDRG3_ENST00000373803.2_Missense_Mutation_p.T361N|NDRG3_ENST00000540765.1_Missense_Mutation_p.T244N|NDRG3_ENST00000373773.3_Missense_Mutation_p.T253N|NDRG3_ENST00000359675.2_Missense_Mutation_p.T336N	NM_032013.3	NP_114402.1	Q9UGV2	NDRG3_HUMAN	NDRG family member 3	348					cell differentiation (GO:0030154)|negative regulation of cell growth (GO:0030308)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)		p.T348N(1)		endometrium(4)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)	12		Myeloproliferative disorder(115;0.00878)				CTGATTGCTGGTGACAGACCG	0.567																																																1	Substitution - Missense(1)	ovary(1)	20											100.0	74.0	83.0					20																	35282008		2203	4300	6503	34715422	SO:0001583	missense	57446			AL031662	CCDS13284.1, CCDS13285.1	20q11.21-q11.23	2008-07-28			ENSG00000101079	ENSG00000101079			14462	protein-coding gene	gene with protein product		605273				10831399, 17998568	Standard	NM_032013		Approved		uc002xfw.3	Q9UGV2	OTTHUMG00000032398	ENST00000349004.1:c.1043C>A	20.37:g.35282008G>T	ENSP00000345292:p.Thr348Asn		34715422	A2A2S8|E1P5U7|E1P5U8|Q5TH32|Q96PL8|Q96SM2|Q9BXY7|Q9H3N7|Q9H411|Q9H8J6	Missense_Mutation	SNP	ENST00000349004.1	37	CCDS13285.1	.	.	.	.	.	.	.	.	.	.	G	13.07	2.127869	0.37533	.	.	ENSG00000101079	ENST00000349004;ENST00000373803;ENST00000359675;ENST00000373773;ENST00000540765	T;T;T;T;T	0.52295	1.9;2.02;1.93;0.67;0.7	5.65	3.66	0.41972	.	0.407476	0.30252	N	0.010055	T	0.39682	0.1087	L	0.48642	1.525	0.46028	D	0.998827	B;P;P	0.37955	0.004;0.514;0.612	B;B;B	0.38056	0.005;0.264;0.143	T	0.23583	-1.0184	10	0.51188	T	0.08	.	8.6202	0.33855	0.1944:0.0:0.8056:0.0	.	253;336;348	F8WBF9;Q9UGV2-2;Q9UGV2	.;.;NDRG3_HUMAN	N	348;361;336;253;244	ENSP00000345292:T348N;ENSP00000362909:T361N;ENSP00000352703:T336N;ENSP00000362878:T253N;ENSP00000442813:T244N	ENSP00000345292:T348N	T	-	2	0	NDRG3	34715422	1.000000	0.71417	0.997000	0.53966	0.996000	0.88848	2.386000	0.44380	0.868000	0.35678	0.655000	0.94253	ACC		0.567	NDRG3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079053.2		
TMPRSS15	5651	broad.mit.edu	37	21	19715882	19715882	+	Missense_Mutation	SNP	T	T	A			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	T	T	A	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr21:19715882T>A	ENST00000284885.3	-	12	1402	c.1369A>T	c.(1369-1371)Aat>Tat	p.N457Y		NM_002772.2	NP_002763	P98073	ENTK_HUMAN	transmembrane protease, serine 15	457	MAM. {ECO:0000255|PROSITE- ProRule:PRU00128}.					brush border (GO:0005903)|integral component of membrane (GO:0016021)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)	p.N457Y(1)		NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(7)|large_intestine(19)|lung(36)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	85						TCTCCATAATTTCCTTCCTTT	0.289																																																1	Substitution - Missense(1)	ovary(1)	21											94.0	81.0	85.0					21																	19715882		2201	4294	6495	18637753	SO:0001583	missense	5651				CCDS13571.1	21q21	2010-12-09	2010-04-21	2010-04-21	ENSG00000154646	ENSG00000154646		"""Serine peptidases / Transmembrane"""	9490	protein-coding gene	gene with protein product	"""proenterokinase"", ""enteropeptidase"""	606635	"""protease, serine, 7 (enterokinase)"""	PRSS7		8052624	Standard	NM_002772		Approved	ENTK, MGC133046	uc002ykw.3	P98073	OTTHUMG00000074518	ENST00000284885.3:c.1369A>T	21.37:g.19715882T>A	ENSP00000284885:p.Asn457Tyr		18637753	Q2NKL7	Missense_Mutation	SNP	ENST00000284885.3	37	CCDS13571.1	.	.	.	.	.	.	.	.	.	.	T	19.70	3.876106	0.72180	.	.	ENSG00000154646	ENST00000284885	T	0.02421	4.3	5.33	5.33	0.75918	Concanavalin A-like lectin/glucanase (1);MAM domain (3);	0.000000	0.85682	D	0.000000	T	0.20577	0.0495	M	0.91663	3.23	0.51012	D	0.999905	D	0.89917	1.0	D	0.91635	0.999	T	0.02190	-1.1198	9	.	.	.	.	14.7774	0.69740	0.0:0.0:0.0:1.0	.	457	P98073	ENTK_HUMAN	Y	457	ENSP00000284885:N457Y	.	N	-	1	0	TMPRSS15	18637753	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	6.029000	0.70895	2.150000	0.67090	0.455000	0.32223	AAT		0.289	TMPRSS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000158231.2	NM_002772	
KRTAP12-4	386684	broad.mit.edu	37	21	46074521	46074521	+	Missense_Mutation	SNP	G	G	A			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr21:46074521G>A	ENST00000391618.1	-	1	55	c.11C>T	c.(10-12)aCc>aTc	p.T4I	TSPEAR_ENST00000323084.4_Intron	NM_198698.1	NP_941971.1	P60329	KR124_HUMAN	keratin associated protein 12-4	4						keratin filament (GO:0045095)		p.T4I(1)		lung(4)|ovary(1)|prostate(1)	6						AGAGTGGCTGGTGTGGCACAT	0.652																																																1	Substitution - Missense(1)	ovary(1)	21											10.0	15.0	13.0					21																	46074521		2036	4174	6210	44898949	SO:0001583	missense	386684			AB076360	CCDS42963.1	21q22.3	2006-03-13			ENSG00000212933	ENSG00000212933		"""Keratin associated proteins"""	20532	protein-coding gene	gene with protein product							Standard	NM_198698		Approved	KRTAP12.4	uc002zfs.1	P60329	OTTHUMG00000057633	ENST00000391618.1:c.11C>T	21.37:g.46074521G>A	ENSP00000375476:p.Thr4Ile		44898949	Q08AF5	Missense_Mutation	SNP	ENST00000391618.1	37	CCDS42963.1	.	.	.	.	.	.	.	.	.	.	g	11.45	1.641869	0.29157	.	.	ENSG00000212933	ENST00000391618	T	0.02121	4.44	4.93	3.98	0.46160	.	.	.	.	.	T	0.09113	0.0225	M	0.62266	1.93	0.32783	N	0.502249	D	0.71674	0.998	D	0.75020	0.985	T	0.01319	-1.1386	9	0.87932	D	0	.	10.0417	0.42162	0.0:0.0:0.7992:0.2008	.	4	P60329	KR124_HUMAN	I	4	ENSP00000375476:T4I	ENSP00000375476:T4I	T	-	2	0	KRTAP12-4	44898949	0.015000	0.18098	0.984000	0.44739	0.030000	0.12068	-0.040000	0.12104	2.434000	0.82447	0.467000	0.42956	ACC		0.652	KRTAP12-4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128036.1		
ZNF280A	129025	broad.mit.edu	37	22	22869652	22869652	+	Missense_Mutation	SNP	C	C	T			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr22:22869652C>T	ENST00000302097.3	-	2	555	c.303G>A	c.(301-303)atG>atA	p.M101I	snoU13_ENST00000459485.1_RNA	NM_080740.3	NP_542778.1	P59817	Z280A_HUMAN	zinc finger protein 280A	101					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.M101I(1)		endometrium(1)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	18	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.74e-30)|Acute lymphoblastic leukemia(6;7.75e-22)		READ - Rectum adenocarcinoma(21;0.145)		GAGAAACGGGCATGATGGCTT	0.473																																																1	Substitution - Missense(1)	ovary(1)	22											169.0	141.0	151.0					22																	22869652		2203	4300	6503	21199652	SO:0001583	missense	129025			D87009	CCDS13800.1	22q11.21	2007-09-20	2007-09-20	2007-09-20	ENSG00000169548	ENSG00000169548			18597	protein-coding gene	gene with protein product			"""zinc finger protein 280"", ""suppressor of hairy wing homolog 1 (Drosophila)"""	ZNF280, SUHW1		9074928	Standard	NM_080740		Approved	3'OY11.1, ZNF636	uc002zwe.3	P59817	OTTHUMG00000030545	ENST00000302097.3:c.303G>A	22.37:g.22869652C>T	ENSP00000302855:p.Met101Ile		21199652		Missense_Mutation	SNP	ENST00000302097.3	37	CCDS13800.1	.	.	.	.	.	.	.	.	.	.	C	10.23	1.293865	0.23564	.	.	ENSG00000169548	ENST00000302097	T	0.20738	2.05	3.8	-7.59	0.01308	.	.	.	.	.	T	0.09113	0.0225	N	0.22421	0.69	0.09310	N	1	B	0.06786	0.001	B	0.09377	0.004	T	0.29518	-1.0009	9	0.45353	T	0.12	13.5491	0.327	0.00312	0.226:0.1867:0.2238:0.3635	.	101	P59817	Z280A_HUMAN	I	101	ENSP00000302855:M101I	ENSP00000302855:M101I	M	-	3	0	ZNF280A	21199652	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.232000	0.01205	-2.150000	0.00796	0.650000	0.86243	ATG		0.473	ZNF280A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075433.3	NM_080740	
MYO18B	84700	broad.mit.edu	37	22	26422607	26422607	+	Missense_Mutation	SNP	C	C	A			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr22:26422607C>A	ENST00000407587.2	+	43	6839	c.6670C>A	c.(6670-6672)Cct>Act	p.P2224T	MYO18B_ENST00000536101.1_Missense_Mutation_p.P2223T|MYO18B_ENST00000335473.7_Missense_Mutation_p.P2223T			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	2223						cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.P2224T(1)		NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						GAGATTAGAACCTGCTTCCTC	0.562																																																1	Substitution - Missense(1)	ovary(1)	22											31.0	34.0	33.0					22																	26422607		1925	4119	6044	24752607	SO:0001583	missense	84700			AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.6670C>A	22.37:g.26422607C>A	ENSP00000386096:p.Pro2224Thr		24752607	B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Missense_Mutation	SNP	ENST00000407587.2	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	4.398|4.398	0.073513|0.073513	0.08485|0.08485	.|.	.|.	ENSG00000133454|ENSG00000133454	ENST00000543971|ENST00000536101;ENST00000335473;ENST00000407587	.|D;D;D	.|0.85702	.|-2.0;-2.0;-2.02	4.5|4.5	-0.336|-0.336	0.12658|0.12658	.|.	.|0.636710	.|0.13077	.|N	.|0.415562	T|T	0.68439|0.68439	0.3001|0.3001	N|N	0.22421|0.22421	0.69|0.69	0.09310|0.09310	N|N	1|1	.|B;B;B;B;B	.|0.02656	.|0.0;0.0;0.0;0.0;0.0	.|B;B;B;B;B	.|0.04013	.|0.0;0.0;0.0;0.0;0.001	T|T	0.50684|0.50684	-0.8799|-0.8799	5|10	.|0.22706	.|T	.|0.39	.|.	2.5897|2.5897	0.04839|0.04839	0.1359:0.3044:0.4065:0.1532|0.1359:0.3044:0.4065:0.1532	.|.	.|1736;2225;2223;2224;2223	.|Q8IUG5-2;B0QYF5;Q8IUG5;F5GXR6;F5GYU7	.|.;.;MY18B_HUMAN;.;.	K|T	172|2223;2223;2224	.|ENSP00000441229:P2223T;ENSP00000334563:P2223T;ENSP00000386096:P2224T	.|ENSP00000334563:P2223T	N|P	+|+	3|1	2|0	MYO18B|MYO18B	24752607|24752607	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.025000|0.025000	0.11179|0.11179	-0.026000|-0.026000	0.12392|0.12392	0.081000|0.081000	0.16988|0.16988	-0.197000|-0.197000	0.12766|0.12766	AAC|CCT		0.562	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000400691.1	NM_032608	
ANO10	55129	broad.mit.edu	37	3	43618190	43618190	+	Missense_Mutation	SNP	A	A	C			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	A	A	C	C	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr3:43618190A>C	ENST00000292246.3	-	6	1326	c.1156T>G	c.(1156-1158)Tca>Gca	p.S386A	ANO10_ENST00000451430.2_Missense_Mutation_p.S275A|ANO10_ENST00000350459.4_Intron|ANO10_ENST00000414522.2_Missense_Mutation_p.S386A|ANO10_ENST00000396091.3_Missense_Mutation_p.S320A	NM_018075.3	NP_060545.3	Q9NW15	ANO10_HUMAN	anoctamin 10	386					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|cell death (GO:0008219)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|intracellular calcium activated chloride channel activity (GO:0005229)	p.S386A(1)		NS(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(9)|ovary(3)|prostate(3)|skin(3)	29						TTACCCCATGAAGTTAAAAAC	0.428																																																1	Substitution - Missense(1)	ovary(1)	3											50.0	48.0	48.0					3																	43618190		2203	4300	6503	43593194	SO:0001583	missense	55129			AL832508	CCDS2710.2, CCDS56247.1, CCDS56248.1, CCDS56249.1, CCDS56250.1	3p22.1-p21.33	2014-04-09	2008-08-28	2008-08-28	ENSG00000160746	ENSG00000160746		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	25519	protein-coding gene	gene with protein product		613726	"""transmembrane protein 16K"""	TMEM16K		12477932, 24692353	Standard	NM_001204831		Approved	FLJ10375, MGC47890, SCAR10	uc003cmv.3	Q9NW15	OTTHUMG00000133044	ENST00000292246.3:c.1156T>G	3.37:g.43618190A>C	ENSP00000292246:p.Ser386Ala		43593194	A8K8K3|A8MV74|B3KTZ1|B3KY93|B4DJ83|B4DNK2|B7WP12|C9JHS1|Q8IXX9	Missense_Mutation	SNP	ENST00000292246.3	37	CCDS2710.2	.	.	.	.	.	.	.	.	.	.	A	12.06	1.825257	0.32237	.	.	ENSG00000160746	ENST00000292246;ENST00000396091;ENST00000414522;ENST00000451430	T;T;T;T	0.63096	-0.02;-0.02;-0.02;-0.02	5.83	3.42	0.39159	.	0.239254	0.43579	D	0.000544	T	0.51500	0.1678	L	0.43152	1.355	0.09310	N	0.999998	B;B;B;B	0.09022	0.002;0.0;0.0;0.0	B;B;B;B	0.12837	0.007;0.008;0.005;0.008	T	0.48896	-0.8994	10	0.66056	D	0.02	.	8.4919	0.33106	0.8009:0.1319:0.0673:0.0	.	275;386;320;386	Q9NW15-4;C9JHS1;Q9NW15-3;Q9NW15	.;.;.;ANO10_HUMAN	A	386;320;386;275	ENSP00000292246:S386A;ENSP00000379398:S320A;ENSP00000396990:S386A;ENSP00000394119:S275A	ENSP00000292246:S386A	S	-	1	0	ANO10	43593194	0.997000	0.39634	0.012000	0.15200	0.978000	0.69477	3.816000	0.55658	0.462000	0.27095	0.533000	0.62120	TCA		0.428	ANO10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256649.2	NM_018075	
VPRBP	9730	broad.mit.edu	37	3	51517772	51517772	+	Missense_Mutation	SNP	G	G	A			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr3:51517772G>A	ENST00000335891.5	-	1	82	c.73C>T	c.(73-75)Cat>Tat	p.H25Y				Q9Y4B6	VPRBP_HUMAN	Vpr (HIV-1) binding protein	25					B cell differentiation (GO:0030183)|cell competition in a multicellular organism (GO:0035212)|histone H2A-T120 phosphorylation (GO:1990245)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein ubiquitination (GO:0016567)|transcription, DNA-templated (GO:0006351)|V(D)J recombination (GO:0033151)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|histone kinase activity (H2A-T120 specific) (GO:1990244)	p.H25Y(1)		breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(6)|lung(12)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	41				BRCA - Breast invasive adenocarcinoma(193;0.000272)|Kidney(197;0.000729)|KIRC - Kidney renal clear cell carcinoma(197;0.000875)		CCACTGCCATGTTCCTTTTCC	0.428																																																1	Substitution - Missense(1)	ovary(1)	3											148.0	133.0	138.0					3																	51517772		1925	4128	6053	51492812	SO:0001583	missense	9730			AB018343	CCDS74943.1, CCDS74944.1	3p21.2	2011-06-17			ENSG00000145041	ENSG00000145041		"""DDB1 and CUL4 associated factors"""	30911	protein-coding gene	gene with protein product	"""DDB1 and CUL4 associated factor 1"""					8195203, 11223251	Standard	NM_014703		Approved	KIAA0800, MGC102804, DCAF1	uc003dbe.2	Q9Y4B6	OTTHUMG00000156895	ENST00000335891.5:c.73C>T	3.37:g.51517772G>A	ENSP00000338857:p.His25Tyr		51492812	Q2YD74|Q8TBD9|Q9HCA1|Q9UG37	Missense_Mutation	SNP	ENST00000335891.5	37		.	.	.	.	.	.	.	.	.	.	G	17.22	3.333180	0.60853	.	.	ENSG00000145041	ENST00000335891;ENST00000504652	T;T	0.58060	0.36;0.79	5.77	4.9	0.64082	.	0.141403	0.64402	D	0.000005	T	0.51109	0.1655	L	0.58810	1.83	0.23712	N	0.997048	B	0.25105	0.118	B	0.25884	0.064	T	0.51764	-0.8664	10	0.66056	D	0.02	-17.2361	14.3458	0.66662	0.0716:0.0:0.9284:0.0	.	25	Q9Y4B6	VPRBP_HUMAN	Y	25	ENSP00000338857:H25Y;ENSP00000421724:H25Y	ENSP00000338857:H25Y	H	-	1	0	VPRBP	51492812	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.380000	0.79704	1.451000	0.47736	0.655000	0.94253	CAT		0.428	VPRBP-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_014703	
GPR15	2838	broad.mit.edu	37	3	98251890	98251890	+	Missense_Mutation	SNP	C	C	A			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr3:98251890C>A	ENST00000284311.3	+	1	1148	c.1013C>A	c.(1012-1014)aCt>aAt	p.T338N		NM_005290.1	NP_005281.1	P49685	GPR15_HUMAN	G protein-coupled receptor 15	338					G-protein coupled receptor signaling pathway (GO:0007186)|T cell migration (GO:0072678)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)	p.T338N(1)		endometrium(1)|kidney(3)|large_intestine(1)|lung(11)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		Lung NSC(201;7.93e-06)|all_neural(597;0.00172)|Hepatocellular(537;0.00825)|Myeloproliferative disorder(1037;0.0255)		Lung(72;0.246)		AGTCACCTCACTAAGGCTCTC	0.493																																																1	Substitution - Missense(1)	ovary(1)	3											80.0	83.0	82.0					3																	98251890		2203	4300	6503	99734580	SO:0001583	missense	2838				CCDS2931.1	3q11.2-q13.1	2014-01-30			ENSG00000154165	ENSG00000154165		"""GPCR / Class A : Orphans"""	4469	protein-coding gene	gene with protein product		601166				8838812	Standard	NM_005290		Approved		uc011bgy.3	P49685	OTTHUMG00000160017	ENST00000284311.3:c.1013C>A	3.37:g.98251890C>A	ENSP00000284311:p.Thr338Asn		99734580	Q3MIL4|Q6ISN6	Missense_Mutation	SNP	ENST00000284311.3	37	CCDS2931.1	.	.	.	.	.	.	.	.	.	.	C	11.70	1.717678	0.30413	.	.	ENSG00000154165	ENST00000284311	T	0.68025	-0.3	5.08	3.16	0.36331	.	0.275700	0.25442	N	0.030645	T	0.52108	0.1714	N	0.24115	0.695	0.29851	N	0.828422	B	0.24092	0.097	B	0.26770	0.073	T	0.57934	-0.7725	10	0.72032	D	0.01	-8.9357	11.4748	0.50291	0.0:0.6308:0.3692:0.0	.	338	P49685	GPR15_HUMAN	N	338	ENSP00000284311:T338N	ENSP00000284311:T338N	T	+	2	0	GPR15	99734580	0.000000	0.05858	0.995000	0.50966	0.951000	0.60555	0.648000	0.24828	1.495000	0.48549	0.655000	0.94253	ACT		0.493	GPR15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358907.1		
TMEM45A	55076	broad.mit.edu	37	3	100287741	100287741	+	Missense_Mutation	SNP	A	A	T			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr3:100287741A>T	ENST00000323523.4	+	5	977	c.664A>T	c.(664-666)Acc>Tcc	p.T222S	TMEM45A_ENST00000403410.1_Missense_Mutation_p.T238S	NM_018004.1	NP_060474.1	Q9NWC5	TM45A_HUMAN	transmembrane protein 45A	222						integral component of membrane (GO:0016021)		p.T222S(1)		breast(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|skin(2)	11						TTTGTTTCTCACCATATGCTT	0.373																																																1	Substitution - Missense(1)	ovary(1)	3											250.0	241.0	244.0					3																	100287741		2203	4300	6503	101770431	SO:0001583	missense	55076			AK000996	CCDS2937.1	3q12.2	2005-02-04			ENSG00000181458	ENSG00000181458			25480	protein-coding gene	gene with protein product						12477932	Standard	XM_005247568		Approved	FLJ10134, DERP7	uc003dtz.1	Q9NWC5	OTTHUMG00000150327	ENST00000323523.4:c.664A>T	3.37:g.100287741A>T	ENSP00000319009:p.Thr222Ser		101770431	Q53YW5	Missense_Mutation	SNP	ENST00000323523.4	37	CCDS2937.1	.	.	.	.	.	.	.	.	.	.	A	12.03	1.817000	0.32145	.	.	ENSG00000181458	ENST00000323523;ENST00000403410	T;T	0.49720	0.77;0.77	5.81	0.492	0.16872	.	0.237699	0.49305	N	0.000144	T	0.29783	0.0744	L	0.28649	0.875	0.29306	N	0.868322	B	0.32302	0.363	B	0.31812	0.136	T	0.13683	-1.0500	10	0.45353	T	0.12	-1.7304	5.9822	0.19413	0.5561:0.0:0.0687:0.3752	.	222	Q9NWC5	TM45A_HUMAN	S	222;238	ENSP00000319009:T222S;ENSP00000385089:T238S	ENSP00000319009:T222S	T	+	1	0	TMEM45A	101770431	0.977000	0.34250	0.660000	0.29694	0.649000	0.38597	2.301000	0.43628	-0.133000	0.11537	0.454000	0.30748	ACC		0.373	TMEM45A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317571.1	NM_018004	
GOLGB1	2804	broad.mit.edu	37	3	121416134	121416134	+	Missense_Mutation	SNP	T	T	G			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	T	T	G	G	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr3:121416134T>G	ENST00000340645.5	-	13	3346	c.3221A>C	c.(3220-3222)cAg>cCg	p.Q1074P	GOLGB1_ENST00000393667.3_Missense_Mutation_p.Q1079P	NM_001256487.1|NM_001256488.1|NM_004487.4	NP_001243416.1|NP_001243417.1|NP_004478.3	Q14789	GOGB1_HUMAN	golgin B1	1074					Golgi organization (GO:0007030)	cis-Golgi network (GO:0005801)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)	p.Q1074P(1)		NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(2)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(26)|liver(2)|lung(36)|ovary(7)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(13)	119				GBM - Glioblastoma multiforme(114;0.0989)		CCTTATATGCTGTAGTTCCAC	0.353																																																1	Substitution - Missense(1)	ovary(1)	3											112.0	113.0	113.0					3																	121416134		2203	4299	6502	122898824	SO:0001583	missense	2804			X75304	CCDS3004.1, CCDS58847.1, CCDS74989.1	3q13	2010-02-12	2010-02-12	2007-07-27	ENSG00000173230	ENSG00000173230			4429	protein-coding gene	gene with protein product	"""macrogolgin"", ""golgi integral membrane protein 1"""	602500	"""golgi autoantigen, golgin subfamily b, macrogolgin (with transmembrane signal), 1"", ""golgin B1, golgi integral membrane protein"""			7691276, 15004235	Standard	NM_001256486		Approved	GCP, GCP372, giantin, GOLIM1	uc010hrc.4	Q14789	OTTHUMG00000159411	ENST00000340645.5:c.3221A>C	3.37:g.121416134T>G	ENSP00000341848:p.Gln1074Pro		122898824	B2ZZ91|D3DN92|E7EP74|Q14398	Missense_Mutation	SNP	ENST00000340645.5	37	CCDS3004.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.014|0.014	-1.597949|-1.597949	0.00857|0.00857	.|.	.|.	ENSG00000173230|ENSG00000173230	ENST00000340645;ENST00000393667;ENST00000494517;ENST00000426235|ENST00000489400	T;T;T|.	0.24908|.	2.42;2.42;1.83|.	5.23|5.23	2.74|2.74	0.32292|0.32292	.|.	0.453943|.	0.20585|.	N|.	0.089454|.	T|T	0.22205|0.22205	0.0535|0.0535	N|N	0.14661|0.14661	0.345|0.345	0.09310|0.09310	N|N	1|1	B;B;B;B;B|.	0.23540|.	0.087;0.022;0.087;0.022;0.087|.	B;B;B;B;B|.	0.27796|.	0.083;0.036;0.083;0.036;0.083|.	T|T	0.23691|0.23691	-1.0181|-1.0181	10|5	0.51188|.	T|.	0.08|.	.|.	8.9934|8.9934	0.36037|0.36037	0.293:0.0:0.0:0.707|0.293:0.0:0.0:0.707	.|.	999;1038;1079;1079;1074|.	F1T0J2;E7EU81;E7EP74;B2ZZ91;Q14789|.	.;.;.;.;GOGB1_HUMAN|.	P|R	1074;1079;1038;886|945	ENSP00000341848:Q1074P;ENSP00000377275:Q1079P;ENSP00000418231:Q1038P|.	ENSP00000341848:Q1074P|.	Q|S	-|-	2|1	0|0	GOLGB1|GOLGB1	122898824|122898824	0.368000|0.368000	0.25031|0.25031	0.028000|0.028000	0.17463|0.17463	0.188000|0.188000	0.23474|0.23474	2.716000|2.716000	0.47219|0.47219	0.388000|0.388000	0.25054|0.25054	0.533000|0.533000	0.62120|0.62120	CAG|AGC		0.353	GOLGB1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000355159.1	NM_004487	
COL6A6	131873	broad.mit.edu	37	3	130300562	130300562	+	Silent	SNP	T	T	A	rs373427912		TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	T	T	A	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr3:130300562T>A	ENST00000358511.6	+	8	3736	c.3705T>A	c.(3703-3705)acT>acA	p.T1235T	COL6A6_ENST00000453409.2_Silent_p.T1235T	NM_001102608.1	NP_001096078.1	A6NMZ7	CO6A6_HUMAN	collagen, type VI, alpha 6	1235	Nonhelical region.|VWFA 7. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)		p.T1235T(1)		NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(30)|lung(57)|ovary(8)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	134						GCACAGAGACTCAGGTCAGTG	0.443																																																1	Substitution - coding silent(1)	ovary(1)	3											97.0	96.0	96.0					3																	130300562		2016	4174	6190	131783252	SO:0001819	synonymous_variant	131873			AL713792	CCDS46911.1	3q22.1	2013-01-16			ENSG00000206384	ENSG00000206384		"""Collagens"""	27023	protein-coding gene	gene with protein product							Standard	NM_001102608		Approved		uc010htl.3	A6NMZ7	OTTHUMG00000159653	ENST00000358511.6:c.3705T>A	3.37:g.130300562T>A			131783252	A7DZQ0|A7DZQ1|A7DZQ2|Q69YT0	Silent	SNP	ENST00000358511.6	37	CCDS46911.1																																																																																				0.443	COL6A6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356705.5	NM_001102608	
PCOLCE2	26577	broad.mit.edu	37	3	142542456	142542456	+	Splice_Site	SNP	A	A	G			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr3:142542456A>G	ENST00000295992.3	-	7	1173	c.867T>C	c.(865-867)ggT>ggC	p.G289G	PCOLCE2_ENST00000485766.1_Intron	NM_013363.3	NP_037495.1	Q9UKZ9	PCOC2_HUMAN	procollagen C-endopeptidase enhancer 2	289					positive regulation of peptidase activity (GO:0010952)	extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|peptidase activator activity (GO:0016504)	p.G289G(1)		NS(1)|endometrium(1)|large_intestine(11)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	32						TGGGTTTTAAACCTTAATTCA	0.363																																																1	Substitution - coding silent(1)	ovary(1)	3											61.0	65.0	64.0					3																	142542456		2203	4300	6503	144025146	SO:0001630	splice_region_variant	26577			AF098269	CCDS3127.1	3q21-q24	2008-07-18			ENSG00000163710	ENSG00000163710			8739	protein-coding gene	gene with protein product		607064				10873381	Standard	NM_013363		Approved	PCPE2	uc003evd.3	Q9UKZ9	OTTHUMG00000159312	ENST00000295992.3:c.866-1T>C	3.37:g.142542456A>G			144025146	B2RCH9|D3DNG4|Q9BRH3	Silent	SNP	ENST00000295992.3	37	CCDS3127.1																																																																																				0.363	PCOLCE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354509.1	NM_013363	Silent
IGSF10	285313	broad.mit.edu	37	3	151166477	151166477	+	Missense_Mutation	SNP	T	T	C			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr3:151166477T>C	ENST00000282466.3	-	4	1291	c.1292A>G	c.(1291-1293)cAa>cGa	p.Q431R		NM_001178145.1|NM_001178146.1|NM_178822.4	NP_001171616.1|NP_001171617.1|NP_849144.2	Q6WRI0	IGS10_HUMAN	immunoglobulin superfamily, member 10	431					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)	extracellular region (GO:0005576)		p.Q431R(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(24)|liver(4)|lung(43)|ovary(8)|prostate(4)|skin(9)|stomach(1)|urinary_tract(3)	116			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			AATTTGGTCTTGCATTAACCA	0.438																																																1	Substitution - Missense(1)	ovary(1)	3											124.0	113.0	117.0					3																	151166477		2203	4300	6503	152649167	SO:0001583	missense	285313			AY273815	CCDS3160.1	3q25.1	2013-01-11			ENSG00000152580	ENSG00000152580		"""Immunoglobulin superfamily / I-set domain containing"""	26384	protein-coding gene	gene with protein product						12477932	Standard	NM_178822		Approved	FLJ25972, CMF608	uc011bod.2	Q6WRI0	OTTHUMG00000159856	ENST00000282466.3:c.1292A>G	3.37:g.151166477T>C	ENSP00000282466:p.Gln431Arg		152649167	Q86YJ9|Q8N772|Q8NA84	Missense_Mutation	SNP	ENST00000282466.3	37	CCDS3160.1	.	.	.	.	.	.	.	.	.	.	T	21.1	4.102702	0.76983	.	.	ENSG00000152580	ENST00000282466	D	0.92149	-2.98	5.08	5.08	0.68730	.	0.000000	0.44688	D	0.000428	D	0.95667	0.8591	M	0.81802	2.56	0.47949	D	0.999556	D	0.89917	1.0	D	0.83275	0.996	D	0.94842	0.8006	10	0.30854	T	0.27	.	14.8499	0.70289	0.0:0.0:0.0:1.0	.	431	Q6WRI0	IGS10_HUMAN	R	431	ENSP00000282466:Q431R	ENSP00000282466:Q431R	Q	-	2	0	IGSF10	152649167	1.000000	0.71417	0.971000	0.41717	0.928000	0.56348	7.698000	0.84413	1.925000	0.55765	0.454000	0.30748	CAA		0.438	IGSF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357782.1	NM_178822	
ZDHHC19	131540	broad.mit.edu	37	3	195925218	195925218	+	Missense_Mutation	SNP	G	G	A			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr3:195925218G>A	ENST00000296326.3	-	7	957	c.878C>T	c.(877-879)gCc>gTc	p.A293V		NM_001039617.1	NP_001034706.1	Q8WVZ1	ZDH19_HUMAN	zinc finger, DHHC-type containing 19	293						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)	p.A293V(1)		breast(1)|endometrium(1)|large_intestine(1)|liver(1)|lung(7)|ovary(3)	14	all_cancers(143;1.68e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;1.89e-25)|all cancers(36;1.46e-23)|OV - Ovarian serous cystadenocarcinoma(49;2.1e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.0022)		AGAGGTTGGGGCTGGGGGGTT	0.627																																																1	Substitution - Missense(1)	ovary(1)	3											30.0	34.0	33.0					3																	195925218		1989	4167	6156	197409615	SO:0001583	missense	131540			BC022078	CCDS43190.1	3q29	2008-05-02			ENSG00000163958	ENSG00000163958		"""Zinc fingers, DHHC-type"""	20713	protein-coding gene	gene with protein product							Standard	XR_246038		Approved	MGC33345	uc003fwc.3	Q8WVZ1	OTTHUMG00000133642	ENST00000296326.3:c.878C>T	3.37:g.195925218G>A	ENSP00000296326:p.Ala293Val		197409615	A8MSY6|B3KVI1	Missense_Mutation	SNP	ENST00000296326.3	37	CCDS43190.1	.	.	.	.	.	.	.	.	.	.	G	9.538	1.112626	0.20795	.	.	ENSG00000163958	ENST00000296326	T	0.32515	1.45	4.81	-7.05	0.01573	.	1.163700	0.06511	N	0.738060	T	0.21841	0.0526	L	0.60455	1.87	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.26467	-1.0102	10	0.33141	T	0.24	-4.319	2.4929	0.04615	0.3961:0.3168:0.1833:0.1037	.	293	Q8WVZ1	ZDH19_HUMAN	V	293	ENSP00000296326:A293V	ENSP00000296326:A293V	A	-	2	0	ZDHHC19	197409615	0.004000	0.15560	0.000000	0.03702	0.001000	0.01503	0.406000	0.21032	-1.557000	0.01692	-0.302000	0.09304	GCC		0.627	ZDHHC19-007	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341533.1	NM_144637	
GNRHR	2798	broad.mit.edu	37	4	68619928	68619928	+	Silent	SNP	A	A	G			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr4:68619928A>G	ENST00000226413.4	-	1	150	c.126T>C	c.(124-126)acT>acC	p.T42T	GNRHR_ENST00000420975.2_Silent_p.T42T|UBA6-AS1_ENST00000502758.1_RNA|UBA6-AS1_ENST00000500538.2_RNA	NM_000406.2	NP_000397.1	P30968	GNRHR_HUMAN	gonadotropin-releasing hormone receptor	42					cellular response to gonadotropin-releasing hormone (GO:0097211)|G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	gonadotropin-releasing hormone receptor activity (GO:0004968)	p.T42T(1)		endometrium(2)|large_intestine(4)|liver(1)|lung(4)|ovary(1)|urinary_tract(1)	13					Abarelix(DB00106)|Buserelin(DB06719)|Cetrorelix(DB00050)|Danazol(DB01406)|Degarelix(DB06699)|Gonadorelin(DB00644)|Goserelin(DB00014)|Leuprolide(DB00007)|Nafarelin(DB00666)	AAAGGAAGAAAGTAACCGTCA	0.443																																																1	Substitution - coding silent(1)	ovary(1)	4											90.0	97.0	95.0					4																	68619928		2203	4300	6503	68302523	SO:0001819	synonymous_variant	2798				CCDS3517.1, CCDS47064.1	4q21.2	2012-08-08			ENSG00000109163	ENSG00000109163		"""GPCR / Class A : Gonadotropin-releasing hormone receptors"""	4421	protein-coding gene	gene with protein product		138850		GRHR		8386108	Standard	NM_000406		Approved	LHRHR	uc003hdn.3	P30968	OTTHUMG00000129302	ENST00000226413.4:c.126T>C	4.37:g.68619928A>G			68302523	O75793|Q14D13|Q92644	Silent	SNP	ENST00000226413.4	37	CCDS3517.1																																																																																				0.443	GNRHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251432.2		
MMAA	166785	broad.mit.edu	37	4	146575150	146575150	+	Missense_Mutation	SNP	T	T	C			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr4:146575150T>C	ENST00000281317.5	+	6	2034	c.824T>C	c.(823-825)aTc>aCc	p.I275T	MMAA_ENST00000541599.1_5'UTR	NM_172250.2	NP_758454.1	Q8IVH4	MMAA_HUMAN	methylmalonic aciduria (cobalamin deficiency) cblA type	275					cellular lipid metabolic process (GO:0044255)|cobalamin biosynthetic process (GO:0009236)|cobalamin metabolic process (GO:0009235)|fatty acid beta-oxidation (GO:0006635)|short-chain fatty acid catabolic process (GO:0019626)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	mitochondrial matrix (GO:0005759)	GTP binding (GO:0005525)|hydrolase activity (GO:0016787)	p.I275T(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(8)|ovary(1)	17	all_hematologic(180;0.151)				Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	CTTTAGGGTATCAAAAGGGGT	0.368																																																1	Substitution - Missense(1)	ovary(1)	4											182.0	180.0	181.0					4																	146575150		2203	4300	6503	146794600	SO:0001583	missense	166785			AF524841	CCDS3766.1	4q31.1	2011-05-12	2005-07-11			ENSG00000151611			18871	protein-coding gene	gene with protein product		607481	"""methylmalonic aciduria (cobalamin deficiency) type A"""			12438653	Standard	NM_172250		Approved	cblA	uc003ikh.4	Q8IVH4		ENST00000281317.5:c.824T>C	4.37:g.146575150T>C	ENSP00000281317:p.Ile275Thr		146794600	B3KX40|Q495G7	Missense_Mutation	SNP	ENST00000281317.5	37	CCDS3766.1	.	.	.	.	.	.	.	.	.	.	T	25.7	4.665883	0.88251	.	.	ENSG00000151611	ENST00000281317;ENST00000537246	D	0.91295	-2.82	5.78	5.78	0.91487	ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	D	0.96849	0.8971	H	0.96748	3.875	0.80722	D	1	D	0.58970	0.984	D	0.64687	0.928	D	0.98128	1.0429	10	0.87932	D	0	-13.1358	16.1215	0.81361	0.0:0.0:0.0:1.0	.	275	Q8IVH4	MMAA_HUMAN	T	275	ENSP00000281317:I275T	ENSP00000281317:I275T	I	+	2	0	MMAA	146794600	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.665000	0.83852	2.208000	0.71279	0.528000	0.53228	ATC		0.368	MMAA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364668.2		
PDLIM3	27295	broad.mit.edu	37	4	186429471	186429471	+	Missense_Mutation	SNP	C	C	G			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr4:186429471C>G	ENST00000284770.5	-	5	717	c.644G>C	c.(643-645)gGg>gCg	p.G215A	PDLIM3_ENST00000284767.5_3'UTR|PDLIM3_ENST00000284771.6_Intron	NM_014476.5	NP_055291.2	Q53GG5	PDLI3_HUMAN	PDZ and LIM domain 3	215					actin filament organization (GO:0007015)|heart development (GO:0007507)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	structural constituent of muscle (GO:0008307)|zinc ion binding (GO:0008270)	p.G215A(1)		breast(2)|endometrium(1)|large_intestine(1)|lung(5)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	17		all_lung(41;1.03e-13)|Lung NSC(41;2.49e-13)|Melanoma(20;1.91e-06)|Hepatocellular(41;0.00826)|Renal(120;0.00988)|Prostate(90;0.00996)|Colorectal(36;0.0161)|all_hematologic(60;0.0592)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.4e-10)|BRCA - Breast invasive adenocarcinoma(30;8.64e-05)|GBM - Glioblastoma multiforme(59;0.000167)|STAD - Stomach adenocarcinoma(60;0.000828)|LUSC - Lung squamous cell carcinoma(40;0.00984)|COAD - Colon adenocarcinoma(29;0.0115)|READ - Rectum adenocarcinoma(43;0.171)		AGGTGTTTCCCCTAGGGCTGT	0.408																																																1	Substitution - Missense(1)	ovary(1)	4											135.0	126.0	129.0					4																	186429471		2203	4300	6503	186666465	SO:0001583	missense	27295			AF002280	CCDS3844.1, CCDS47172.1, CCDS75218.1, CCDS75219.1	4q35	2014-09-17			ENSG00000154553	ENSG00000154553			20767	protein-coding gene	gene with protein product		605889				10063829, 8828038	Standard	NM_014476		Approved	ALP	uc003ixw.4	Q53GG5	OTTHUMG00000160412	ENST00000284770.5:c.644G>C	4.37:g.186429471C>G	ENSP00000284770:p.Gly215Ala		186666465	B2R866|O43590|O60439|O60440|Q8N6Y6|Q9BVP4	Missense_Mutation	SNP	ENST00000284770.5	37	CCDS3844.1	.	.	.	.	.	.	.	.	.	.	C	9.956	1.221561	0.22457	.	.	ENSG00000154553	ENST00000284770	T	0.36699	1.24	5.95	5.95	0.96441	.	0.435309	0.28706	N	0.014415	T	0.31765	0.0807	L	0.42245	1.32	0.80722	D	1	B	0.24882	0.113	B	0.22753	0.041	T	0.21245	-1.0251	10	0.05620	T	0.96	-7.8792	20.3748	0.98911	0.0:1.0:0.0:0.0	.	215	Q53GG5	PDLI3_HUMAN	A	215	ENSP00000284770:G215A	ENSP00000284770:G215A	G	-	2	0	PDLIM3	186666465	1.000000	0.71417	1.000000	0.80357	0.920000	0.55202	5.359000	0.66074	2.817000	0.96982	0.563000	0.77884	GGG		0.408	PDLIM3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000360499.2	NM_014476	
OTULIN	90268	broad.mit.edu	37	5	14681611	14681611	+	Silent	SNP	G	G	T			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr5:14681611G>T	ENST00000284274.4	+	4	441	c.363G>T	c.(361-363)cgG>cgT	p.R121R		NM_138348.4	NP_612357.4	Q96BN8	OTUL_HUMAN		121	OTU.				canonical Wnt signaling pathway (GO:0060070)|innate immune response (GO:0045087)|negative regulation of inflammatory response (GO:0050728)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070431)|protein linear deubiquitination (GO:1990108)|sprouting angiogenesis (GO:0002040)	cytoplasm (GO:0005737)|LUBAC complex (GO:0071797)	cysteine-type peptidase activity (GO:0008234)|ubiquitin-specific protease activity (GO:0004843)	p.R121R(1)		breast(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(2)|upper_aerodigestive_tract(1)	14	Lung NSC(4;0.00696)					CCTCCATACGGCGAGTCCGTG	0.532																																																1	Substitution - coding silent(1)	ovary(1)	5											94.0	102.0	99.0					5																	14681611		2046	4197	6243	14734611	SO:0001819	synonymous_variant	90268																														ENST00000284274.4:c.363G>T	5.37:g.14681611G>T			14734611	D3DTD3|Q8NAS0|Q96IA3	Silent	SNP	ENST00000284274.4	37	CCDS43302.1																																																																																				0.532	FAM105B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366012.1		
RICTOR	253260	broad.mit.edu	37	5	38949832	38949832	+	Missense_Mutation	SNP	G	G	A			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr5:38949832G>A	ENST00000357387.3	-	31	4148	c.4118C>T	c.(4117-4119)tCc>tTc	p.S1373F	RICTOR_ENST00000296782.5_Missense_Mutation_p.S1373F	NM_152756.3	NP_689969.2			RPTOR independent companion of MTOR, complex 2									p.S1373F(1)		NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(33)|ovary(3)|prostate(3)|skin(5)	75	all_lung(31;0.000396)					TGTTAATCTGGACTCAAAACT	0.363																																																1	Substitution - Missense(1)	ovary(1)	5											164.0	155.0	158.0					5																	38949832		2203	4299	6502	38985589	SO:0001583	missense	253260				CCDS34148.1, CCDS68861.1	5p13.1	2009-07-09			ENSG00000164327	ENSG00000164327			28611	protein-coding gene	gene with protein product	"""rapamycin-insensitive companion of mTOR"", ""pianissimo"""	609022				12477932	Standard	XM_005248278		Approved	MGC39830, AVO3, PIA, KIAA1999	uc003jlp.2	Q6R327	OTTHUMG00000162037	ENST00000357387.3:c.4118C>T	5.37:g.38949832G>A	ENSP00000349959:p.Ser1373Phe		38985589		Missense_Mutation	SNP	ENST00000357387.3	37	CCDS34148.1	.	.	.	.	.	.	.	.	.	.	G	19.11	3.763697	0.69878	.	.	ENSG00000164327	ENST00000357387;ENST00000296782	T;T	0.62639	0.01;0.24	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	T	0.78559	0.4302	L	0.56769	1.78	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.83275	0.996;0.996	T	0.78196	-0.2298	10	0.87932	D	0	-8.0177	20.5752	0.99366	0.0:0.0:1.0:0.0	.	1373;1373	Q6R327;Q6R327-3	RICTR_HUMAN;.	F	1373	ENSP00000349959:S1373F;ENSP00000296782:S1373F	ENSP00000296782:S1373F	S	-	2	0	RICTOR	38985589	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	7.572000	0.82409	2.868000	0.98415	0.557000	0.71058	TCC		0.363	RICTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366985.1	NM_152756	
TRIM36	55521	broad.mit.edu	37	5	114469806	114469806	+	Missense_Mutation	SNP	C	C	T			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr5:114469806C>T	ENST00000282369.3	-	8	1406	c.1285G>A	c.(1285-1287)Gtt>Att	p.V429I	TRIM36_ENST00000513154.1_Missense_Mutation_p.V417I|TRIM36_ENST00000514154.1_Missense_Mutation_p.V274I	NM_018700.3	NP_061170.2	Q9NQ86	TRI36_HUMAN	tripartite motif containing 36	429	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				acrosome reaction (GO:0007340)|regulation of cell cycle (GO:0051726)	acrosomal vesicle (GO:0001669)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.V429I(1)|p.V429F(1)		breast(3)|endometrium(1)|kidney(2)|large_intestine(4)|lung(15)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	37		all_cancers(142;0.00133)|all_epithelial(76;2.41e-05)|Prostate(80;0.00955)|Ovarian(225;0.0443)|Breast(839;0.195)		OV - Ovarian serous cystadenocarcinoma(64;3.62e-08)|Epithelial(69;7.69e-08)|all cancers(49;9.33e-06)		TTGTTATAAACTTTGCTCTGT	0.328																																																2	Substitution - Missense(2)	ovary(1)|lung(1)	5											95.0	88.0	90.0					5																	114469806		2202	4300	6502	114497705	SO:0001583	missense	55521			AJ272269	CCDS4115.1, CCDS34211.1, CCDS34212.1, CCDS75287.1	5q22	2013-02-11	2011-01-25		ENSG00000152503	ENSG00000152503		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Fibronectin type III domain containing"""	16280	protein-coding gene	gene with protein product	"""zinc-binding protein Rbcc728"", ""tripartite motif protein 36"", ""RING finger protein 98"""	609317	"""tripartite motif-containing 36"""			11331580	Standard	XM_005272031		Approved	RBCC728, RNF98, HAPRIN	uc003kqs.3	Q9NQ86	OTTHUMG00000128892	ENST00000282369.3:c.1285G>A	5.37:g.114469806C>T	ENSP00000282369:p.Val429Ile		114497705	A1L3Z1|A6NDD0|B7Z3V4|B7ZAV7|E9PFI8|Q0P5Z9	Missense_Mutation	SNP	ENST00000282369.3	37	CCDS4115.1	.	.	.	.	.	.	.	.	.	.	C	10.97	1.502929	0.26949	.	.	ENSG00000152503	ENST00000282369;ENST00000513154;ENST00000514154	T;T;T	0.64991	0.56;0.68;-0.13	5.28	4.29	0.51040	Fibronectin, type III (3);	0.218661	0.47455	D	0.000236	T	0.35480	0.0933	N	0.05383	-0.06	0.80722	D	1	B;B	0.10296	0.001;0.003	B;B	0.15052	0.006;0.012	T	0.30179	-0.9987	10	0.41790	T	0.15	.	3.4177	0.07381	0.0:0.6229:0.0:0.3771	.	417;429	E9PFI8;Q9NQ86	.;TRI36_HUMAN	I	429;417;274	ENSP00000282369:V429I;ENSP00000423934:V417I;ENSP00000424259:V274I	ENSP00000282369:V429I	V	-	1	0	TRIM36	114497705	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	1.485000	0.35519	2.467000	0.83353	0.563000	0.77884	GTT		0.328	TRIM36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250854.2	NM_018700	
CHSY3	337876	broad.mit.edu	37	5	129521388	129521388	+	Missense_Mutation	SNP	A	A	T			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr5:129521388A>T	ENST00000305031.4	+	3	2911	c.2553A>T	c.(2551-2553)ttA>ttT	p.L851F		NM_175856.4	NP_787052.3	Q70JA7	CHSS3_HUMAN	chondroitin sulfate synthase 3	851					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047238)|metal ion binding (GO:0046872)|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity (GO:0050510)	p.L851F(1)		central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|urinary_tract(1)	28		all_cancers(142;0.0227)|Breast(839;0.198)|Prostate(80;0.215)|Lung NSC(810;0.239)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.136)		AGATGTGCTTAGGATCCAAGG	0.448																																																1	Substitution - Missense(1)	ovary(1)	5											81.0	78.0	79.0					5																	129521388		2203	4300	6503	129549287	SO:0001583	missense	337876			AB086062	CCDS34223.1	5q13	2013-02-19			ENSG00000198108	ENSG00000198108	2.4.1.175, 2.4.1.226	"""Beta 3-glycosyltransferases"", ""Beta 4-glycosyltransferases"""	24293	protein-coding gene	gene with protein product		609963				12907687	Standard	XM_005271982		Approved	CSS3, CHSY-2	uc003kvd.3	Q70JA7	OTTHUMG00000163043	ENST00000305031.4:c.2553A>T	5.37:g.129521388A>T	ENSP00000302629:p.Leu851Phe		129549287	B2RP97|Q76L22|Q86Y52	Missense_Mutation	SNP	ENST00000305031.4	37	CCDS34223.1	.	.	.	.	.	.	.	.	.	.	A	13.62	2.291775	0.40594	.	.	ENSG00000198108	ENST00000305031	T	0.36157	1.27	4.06	0.253	0.15551	.	0.000000	0.38217	N	0.001761	T	0.53610	0.1807	M	0.79926	2.475	0.42842	D	0.99405	D	0.63046	0.992	D	0.66497	0.944	T	0.52881	-0.8516	9	.	.	.	.	8.9557	0.35816	0.6956:0.0:0.3044:0.0	.	851	Q70JA7	CHSS3_HUMAN	F	851	ENSP00000302629:L851F	.	L	+	3	2	CHSY3	129549287	0.997000	0.39634	1.000000	0.80357	0.999000	0.98932	0.586000	0.23894	0.045000	0.15804	0.528000	0.53228	TTA		0.448	CHSY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371453.1	NM_175856	
GLRA1	2741	broad.mit.edu	37	5	151234691	151234691	+	Missense_Mutation	SNP	C	C	A			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr5:151234691C>A	ENST00000455880.2	-	6	893	c.607G>T	c.(607-609)Gcc>Tcc	p.A203S	GLRA1_ENST00000545569.1_Missense_Mutation_p.A120S|GLRA1_ENST00000274576.4_Missense_Mutation_p.A203S|GLRA1_ENST00000471351.2_5'UTR			P23415	GLRA1_HUMAN	glycine receptor, alpha 1	203					acrosome reaction (GO:0007340)|action potential (GO:0001508)|adult walking behavior (GO:0007628)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|muscle contraction (GO:0006936)|negative regulation of transmission of nerve impulse (GO:0051970)|neuromuscular process controlling posture (GO:0050884)|neuropeptide signaling pathway (GO:0007218)|positive regulation of acrosome reaction (GO:2000344)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of membrane potential (GO:0042391)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|righting reflex (GO:0060013)|startle response (GO:0001964)|synaptic transmission, glycinergic (GO:0060012)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|external side of plasma membrane (GO:0009897)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glycine-gated chloride channel activity (GO:0016934)|glycine binding (GO:0016594)|taurine binding (GO:0030977)|transmitter-gated ion channel activity (GO:0022824)	p.A203S(1)		breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	23		all_hematologic(541;0.0341)|Medulloblastoma(196;0.0912)	Kidney(363;0.000171)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Ethanol(DB00898)|Ginkgo biloba(DB01381)|Glycine(DB00145)|Halothane(DB01159)|Isoflurane(DB00753)|Lindane(DB00431)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	ACCTGCACGGCTCCCTGTTCC	0.478																																																1	Substitution - Missense(1)	ovary(1)	5											158.0	159.0	158.0					5																	151234691		2203	4300	6503	151214884	SO:0001583	missense	2741				CCDS4320.1, CCDS54942.1	5q33.1	2012-02-07	2008-01-24		ENSG00000145888	ENSG00000145888		"""Ligand-gated ion channels / Glycine receptors"""	4326	protein-coding gene	gene with protein product	"""startle disease/hyperekplexia"", ""stiff person syndrome"""	138491	"""glycine receptor, alpha 1 (startle disease/hyperekplexia)"""	STHE		1355335, 8298642	Standard	NM_000171		Approved		uc003lut.3	P23415	OTTHUMG00000130121	ENST00000455880.2:c.607G>T	5.37:g.151234691C>A	ENSP00000411593:p.Ala203Ser		151214884	B2R6T3|Q14C77|Q6DJV9	Missense_Mutation	SNP	ENST00000455880.2	37	CCDS54942.1	.	.	.	.	.	.	.	.	.	.	C	19.40	3.819882	0.71028	.	.	ENSG00000145888	ENST00000274576;ENST00000455880;ENST00000545569	T;T;T	0.78595	-1.19;-1.19;-1.19	4.51	4.51	0.55191	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	T	0.66713	0.2817	N	0.21194	0.64	0.58432	D	0.999999	B;B;B	0.20988	0.05;0.025;0.041	B;B;B	0.26517	0.07;0.052;0.042	T	0.61496	-0.7051	10	0.14656	T	0.56	.	17.6102	0.88050	0.0:1.0:0.0:0.0	.	203;120;203	P23415;Q14C71;P23415-2	GLRA1_HUMAN;.;.	S	203;203;120	ENSP00000274576:A203S;ENSP00000411593:A203S;ENSP00000445913:A120S	ENSP00000274576:A203S	A	-	1	0	GLRA1	151214884	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.835000	0.69368	2.217000	0.71921	0.491000	0.48974	GCC		0.478	GLRA1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000373959.1		
OR12D3	81797	broad.mit.edu	37	6	29342727	29342727	+	Missense_Mutation	SNP	A	A	T			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr6:29342727A>T	ENST00000396806.3	-	1	341	c.338T>A	c.(337-339)cTg>cAg	p.L113Q	OR5V1_ENST00000377154.1_Intron	NM_030959.2	NP_112221.1	Q9UGF7	O12D3_HUMAN	olfactory receptor, family 12, subfamily D, member 3	113						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L113Q(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(6)|ovary(2)|skin(1)|upper_aerodigestive_tract(3)	23						CATGATAGCCAGTAAAATGGC	0.502																																																1	Substitution - Missense(1)	ovary(1)	6											55.0	57.0	57.0					6																	29342727		1510	2709	4219	29450706	SO:0001583	missense	81797				CCDS4658.1	6p22.1	2013-09-24			ENSG00000112462	ENSG00000112462		"""GPCR / Class A : Olfactory receptors"""	13963	protein-coding gene	gene with protein product							Standard	NM_030959		Approved	hs6M1-27	uc003nme.3	Q9UGF7	OTTHUMG00000031051	ENST00000396806.3:c.338T>A	6.37:g.29342727A>T	ENSP00000380023:p.Leu113Gln		29450706	A2BDZ1|Q5SQI8|Q6IF23	Missense_Mutation	SNP	ENST00000396806.3	37	CCDS4658.1	.	.	.	.	.	.	.	.	.	.	A	14.69	2.611762	0.46631	.	.	ENSG00000112462	ENST00000377143;ENST00000396806	T	0.02345	4.33	4.18	4.18	0.49190	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.15349	0.0370	H	0.96111	3.77	0.38716	D	0.95332	D	0.76494	0.999	D	0.73380	0.98	T	0.12293	-1.0553	9	0.87932	D	0	-4.9813	13.0217	0.58791	1.0:0.0:0.0:0.0	.	113	Q9UGF7	O12D3_HUMAN	Q	113	ENSP00000380023:L113Q	ENSP00000366348:L113Q	L	-	2	0	OR12D3	29450706	0.932000	0.31603	0.082000	0.20525	0.172000	0.22775	6.500000	0.73687	1.738000	0.51689	0.164000	0.16699	CTG		0.502	OR12D3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076056.3		
GABBR1	2550	broad.mit.edu	37	6	29589568	29589568	+	Silent	SNP	T	T	A			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	T	T	A	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr6:29589568T>A	ENST00000377034.4	-	10	1427	c.1092A>T	c.(1090-1092)ggA>ggT	p.G364G	GABBR1_ENST00000377012.4_Silent_p.G247G|GABBR1_ENST00000355973.3_Silent_p.G247G|GABBR1_ENST00000377016.4_Silent_p.G302G|GABBR1_ENST00000376977.3_Silent_p.G364G	NM_001470.2	NP_001461.1	Q9UBS5	GABR1_HUMAN	gamma-aminobutyric acid (GABA) B receptor, 1	364					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|gamma-aminobutyric acid signaling pathway (GO:0007214)|negative regulation of adenylate cyclase activity (GO:0007194)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|G-protein coupled receptor heterodimeric complex (GO:0038039)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	G-protein coupled GABA receptor activity (GO:0004965)	p.G364G(1)		endometrium(3)|kidney(1)|large_intestine(13)|liver(1)|lung(16)|ovary(5)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47					Baclofen(DB00181)|Progabide(DB00837)|Vigabatrin(DB01080)	CATAGAAAAGTCCCACGATGA	0.532																																																1	Substitution - coding silent(1)	ovary(1)	6											59.0	62.0	61.0					6																	29589568		2203	4300	6503	29697547	SO:0001819	synonymous_variant	2550			Y11044	CCDS4663.1, CCDS4664.1, CCDS4665.1	6p21.3	2012-08-29			ENSG00000204681	ENSG00000204681		"""GABA receptors"", ""GPCR / Class C : GABA(B) receptors"""	4070	protein-coding gene	gene with protein product	"""GABA-B receptor"""	603540				9753614, 9798068	Standard	NM_001470		Approved	hGB1a, GPRC3A	uc003nmt.4	Q9UBS5	OTTHUMG00000031095	ENST00000377034.4:c.1092A>T	6.37:g.29589568T>A			29697547	B0UXY7|O95375|O95468|O95975|O96022|Q5STL4|Q5SUJ8|Q5SUL3|Q71SG6|Q86W60|Q9UQQ0	Silent	SNP	ENST00000377034.4	37	CCDS4663.1																																																																																				0.532	GABBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076141.3		
VPS52	6293	broad.mit.edu	37	6	33236364	33236364	+	Missense_Mutation	SNP	G	G	C			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr6:33236364G>C	ENST00000445902.2	-	7	829	c.611C>G	c.(610-612)gCc>gGc	p.A204G	VPS52_ENST00000436044.2_Missense_Mutation_p.A79G|VPS52_ENST00000482399.1_3'UTR|VPS52_ENST00000478934.1_5'UTR	NM_022553.4	NP_072047.4	Q8N1B4	VPS52_HUMAN	vacuolar protein sorting 52 homolog (S. cerevisiae)	204					ectodermal cell differentiation (GO:0010668)|embryonic ectodermal digestive tract development (GO:0048611)|protein transport (GO:0015031)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)		p.A204G(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(8)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)	28						GGCTGCCTTGGCATCCAGCTC	0.607																																																1	Substitution - Missense(1)	ovary(1)	6											68.0	63.0	65.0					6																	33236364		1510	2707	4217	33344342	SO:0001583	missense	6293			AJ223319	CCDS4770.2	6p21.3	2010-02-17	2006-12-19	2003-09-05	ENSG00000223501	ENSG00000223501			10518	protein-coding gene	gene with protein product		603443	"""SAC2 suppressor of actin mutations 2-like (yeast)"", ""vacuolar protein sorting 52 (yeast)"""	SACM2L		9790748	Standard	NM_022553		Approved	ARE1	uc003odm.1	Q8N1B4	OTTHUMG00000031276	ENST00000445902.2:c.611C>G	6.37:g.33236364G>C	ENSP00000409952:p.Ala204Gly		33344342	A2BF38|B0UZZ4|B4DNI9|Q53GR4|Q5JPA0|Q5SQW1|Q8IUN6|Q9NPT5	Missense_Mutation	SNP	ENST00000445902.2	37	CCDS4770.2	.	.	.	.	.	.	.	.	.	.	G	13.98	2.397937	0.42512	.	.	ENSG00000223501	ENST00000445902;ENST00000418054;ENST00000436044	.	.	.	5.1	5.1	0.69264	.	0.282046	0.40385	N	0.001119	T	0.10637	0.0260	N	0.04508	-0.205	0.31186	N	0.701512	B;B;B	0.25563	0.129;0.046;0.129	B;B;B	0.30251	0.113;0.061;0.113	T	0.09975	-1.0650	9	0.30078	T	0.28	-15.4145	11.3212	0.49424	0.0:0.0:0.8186:0.1814	.	182;79;204	B4DS44;B3KMF7;Q8N1B4	.;.;VPS52_HUMAN	G	204;182;79	.	ENSP00000414785:A182G	A	-	2	0	VPS52	33344342	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.090000	0.41682	2.834000	0.97654	0.573000	0.79308	GCC		0.607	VPS52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076598.2	NM_022553	
TAPBP	6892	broad.mit.edu	37	6	33272149	33272149	+	Missense_Mutation	SNP	G	G	A	rs145933787		TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr6:33272149G>A	ENST00000489157.1	-	4	1086	c.874C>T	c.(874-876)Cgc>Tgc	p.R292C	TAPBP_ENST00000456592.2_Missense_Mutation_p.R379C|TAPBP_ENST00000475304.1_Missense_Mutation_p.R397C|TAPBP_ENST00000434618.2_Missense_Mutation_p.R379C|TAPBP_ENST00000426633.2_Missense_Mutation_p.R379C			O15533	TPSN_HUMAN	TAP binding protein (tapasin)	379	Ig-like C1-type.				amide transport (GO:0042886)|antigen processing and presentation of endogenous peptide antigen via MHC class I (GO:0019885)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|immune response (GO:0006955)|peptide antigen stabilization (GO:0050823)|peptide transport (GO:0015833)|protein complex assembly (GO:0006461)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|integral component of membrane (GO:0016021)|MHC class I peptide loading complex (GO:0042824)	MHC class I protein binding (GO:0042288)|peptide antigen binding (GO:0042605)|peptide antigen-transporting ATPase activity (GO:0015433)|TAP1 binding (GO:0046978)|TAP2 binding (GO:0046979)|unfolded protein binding (GO:0051082)	p.R379C(1)		endometrium(2)|large_intestine(5)|lung(8)|ovary(3)	18						CAGGCATAGCGTGCCCCATGC	0.652																																																1	Substitution - Missense(1)	ovary(1)	6						G	CYS/ARG,CYS/ARG,CYS/ARG	0,4406		0,0,2203	43.0	44.0	44.0		1135,1135,874	4.7	0.7	6	dbSNP_134	44	1,8597	1.2+/-3.3	0,1,4298	yes	missense,missense,missense	TAPBP	NM_003190.4,NM_172208.2,NM_172209.2	180,180,180	0,1,6501	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging	379/449,379/505,292/362	33272149	1,13003	2203	4299	6502	33380127	SO:0001583	missense	6892			Y13582	CCDS34426.1, CCDS34427.1, CCDS34428.1, CCDS34427.2, CCDS34428.2	6p21.3	2014-09-17			ENSG00000231925	ENSG00000231925		"""Immunoglobulin superfamily / C1-set domain containing"""	11566	protein-coding gene	gene with protein product		601962				9238042	Standard	NM_003190		Approved	TAPA	uc003odz.3	O15533	OTTHUMG00000031090	ENST00000489157.1:c.874C>T	6.37:g.33272149G>A	ENSP00000419659:p.Arg292Cys		33380127	A2AB91|A2ABC0|B0V003|B0V0A6|B2ZUA4|E9PGM2|O15210|O15272|Q5STJ8|Q5STK6|Q5STQ5|Q5STQ6|Q66K65|Q96KK7|Q9HAN8|Q9UEE0|Q9UEE4|Q9UIZ6|Q9Y6K2	Missense_Mutation	SNP	ENST00000489157.1	37	CCDS34427.2	.	.	.	.	.	.	.	.	.	.	G	18.46	3.629014	0.67015	0.0	1.16E-4	ENSG00000231925	ENST00000434618;ENST00000475304;ENST00000489157;ENST00000426633;ENST00000456592;ENST00000449540	T;T;T;T;T	0.03035	4.07;4.07;4.07;4.07;4.07	5.57	4.68	0.58851	Immunoglobulin-like (1);Immunoglobulin C1-set (1);Immunoglobulin-like fold (1);	0.511841	0.21547	N	0.072781	T	0.07458	0.0188	M	0.62723	1.935	0.32513	N	0.537274	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	P;D;D;P;P	0.70935	0.777;0.94;0.971;0.83;0.857	T	0.03034	-1.1080	10	0.62326	D	0.03	-11.1366	11.6206	0.51115	0.0:0.0:0.822:0.178	.	379;292;397;379;379	G5E9H8;E9PGM2;A2AB90;O15533-3;O15533	.;.;.;.;TPSN_HUMAN	C	379;397;292;379;379;379	ENSP00000395701:R379C;ENSP00000417949:R397C;ENSP00000419659:R292C;ENSP00000404833:R379C;ENSP00000387803:R379C	ENSP00000404833:R379C	R	-	1	0	TAPBP	33380127	0.191000	0.23288	0.660000	0.29694	0.840000	0.47671	1.214000	0.32419	1.321000	0.45227	0.549000	0.68633	CGC		0.652	TAPBP-006	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000276425.2		
GFRAL	389400	broad.mit.edu	37	6	55216051	55216051	+	Splice_Site	SNP	G	G	T	rs368896330		TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr6:55216051G>T	ENST00000340465.2	+	5	457	c.371G>T	c.(370-372)gGa>gTa	p.G124V		NM_207410.2	NP_997293.2	Q6UXV0	GFRAL_HUMAN	GDNF family receptor alpha like	124					negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of neuron apoptotic process (GO:0043524)|stress-activated protein kinase signaling cascade (GO:0031098)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.G124V(1)		NS(1)|breast(1)|endometrium(2)|kidney(5)|large_intestine(2)|liver(1)|lung(31)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	48	Lung NSC(77;0.0875)|Renal(3;0.122)		LUSC - Lung squamous cell carcinoma(124;0.23)			TTGCTTTCAGGATTCAAAGGG	0.433																																																1	Substitution - Missense(1)	ovary(1)	6											200.0	176.0	184.0					6																	55216051		2203	4300	6503	55324010	SO:0001630	splice_region_variant	389400			AY358198	CCDS4957.1	6p12.1	2007-06-22			ENSG00000187871	ENSG00000187871			32789	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 144"""	C6orf144		16086688	Standard	NM_207410		Approved	GRAL, UNQ9356, bA360D14.1	uc003pcm.1	Q6UXV0	OTTHUMG00000014900	ENST00000340465.2:c.371-1G>T	6.37:g.55216051G>T			55324010	Q5VTF6	Missense_Mutation	SNP	ENST00000340465.2	37	CCDS4957.1	.	.	.	.	.	.	.	.	.	.	G	4.724	0.134587	0.09032	.	.	ENSG00000187871	ENST00000340465	T	0.30981	1.51	5.73	3.96	0.45880	.	0.444395	0.23894	N	0.043511	T	0.13372	0.0324	M	0.61703	1.905	0.80722	D	1	B	0.14805	0.011	B	0.15484	0.013	T	0.04242	-1.0966	9	.	.	.	.	7.3059	0.26447	0.1565:0.1761:0.6675:0.0	.	124	Q6UXV0	GFRAL_HUMAN	V	124	ENSP00000343636:G124V	.	G	+	2	0	GFRAL	55324010	0.135000	0.22499	0.281000	0.24762	0.066000	0.16364	0.349000	0.20055	0.881000	0.35993	-0.137000	0.14449	GGA		0.433	GFRAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040995.2	NM_207410	Missense_Mutation
DST	667	broad.mit.edu	37	6	56471961	56471961	+	Missense_Mutation	SNP	G	G	T			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr6:56471961G>T	ENST00000361203.3	-	36	6839	c.6832C>A	c.(6832-6834)Cag>Aag	p.Q2278K	DST_ENST00000370769.4_Missense_Mutation_p.Q2278K|DST_ENST00000421834.2_Intron|DST_ENST00000312431.6_Missense_Mutation_p.Q2278K|DST_ENST00000370788.2_Intron|DST_ENST00000370754.5_Missense_Mutation_p.Q2456K|DST_ENST00000446842.2_Missense_Mutation_p.Q1952K|DST_ENST00000244364.6_Intron			Q03001	DYST_HUMAN	dystonin	2278					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)	p.Q2278K(1)		NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			CCCAGAAACTGGTCTTGAAAT	0.383																																																1	Substitution - Missense(1)	ovary(1)	6											48.0	47.0	47.0					6																	56471961		1821	4077	5898	56579920	SO:0001583	missense	667			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.6832C>A	6.37:g.56471961G>T	ENSP00000354508:p.Gln2278Lys		56579920	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	ENST00000361203.3	37		.	.	.	.	.	.	.	.	.	.	G	15.00	2.702470	0.48307	.	.	ENSG00000151914	ENST00000370754;ENST00000370769;ENST00000446842;ENST00000312431;ENST00000361203;ENST00000439203	T;T;T;D;T;T	0.81821	-0.03;-0.05;0.9;-1.54;-0.07;-0.34	5.37	3.3	0.37823	.	0.431369	0.19531	N	0.112059	T	0.54351	0.1853	.	.	.	0.26648	N	0.972156	B	0.20671	0.047	B	0.15484	0.013	T	0.52555	-0.8560	8	0.48119	T	0.1	.	7.621	0.28185	0.0:0.1307:0.5751:0.2942	.	1952	Q03001-9	.	K	2456;2278;1952;2278;2278;1952	ENSP00000359790:Q2456K;ENSP00000359805:Q2278K;ENSP00000393645:Q1952K;ENSP00000307959:Q2278K;ENSP00000354508:Q2278K;ENSP00000404924:Q1952K	ENSP00000307959:Q2278K	Q	-	1	0	DST	56579920	0.943000	0.32029	0.998000	0.56505	0.917000	0.54804	0.575000	0.23729	1.395000	0.46643	0.462000	0.41574	CAG		0.383	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000041021.3	NM_001723	
EPHA7	2045	broad.mit.edu	37	6	94120729	94120729	+	Missense_Mutation	SNP	C	C	T			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr6:94120729C>T	ENST00000369303.4	-	3	506	c.322G>A	c.(322-324)Gat>Aat	p.D108N	EPHA7_ENST00000369297.1_Missense_Mutation_p.D108N	NM_004440.3	NP_004431.1	Q15375	EPHA7_HUMAN	EPH receptor A7	108	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.				brain development (GO:0007420)|branching morphogenesis of a nerve (GO:0048755)|ephrin receptor signaling pathway (GO:0048013)|negative chemotaxis (GO:0050919)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of neuron apoptotic process (GO:0043525)|regulation of cell-cell adhesion (GO:0022407)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|regulation of protein autophosphorylation (GO:0031952)|retinal ganglion cell axon guidance (GO:0031290)	dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|chemorepellent activity (GO:0045499)|GPI-linked ephrin receptor activity (GO:0005004)|protein tyrosine kinase activity (GO:0004713)	p.D108N(1)		NS(1)|breast(1)|central_nervous_system(7)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(16)|lung(43)|ovary(8)|pancreas(1)|prostate(1)|skin(8)|stomach(1)|upper_aerodigestive_tract(13)|urinary_tract(1)	112		all_cancers(76;7.47e-10)|Acute lymphoblastic leukemia(125;1.88e-09)|all_hematologic(75;1.75e-07)|all_epithelial(107;3.6e-05)|Lung NSC(302;0.0368)|all_lung(197;0.0509)|Colorectal(196;0.142)		BRCA - Breast invasive adenocarcinoma(108;0.0847)		CTGTTACAATCCCTCAGGGTG	0.403																																																1	Substitution - Missense(1)	ovary(1)	6											118.0	120.0	119.0					6																	94120729		2203	4299	6502	94177450	SO:0001583	missense	2045			L36642	CCDS5031.1, CCDS75494.1	6q16.3	2013-02-11	2004-10-28		ENSG00000135333	ENSG00000135333		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3390	protein-coding gene	gene with protein product		602190	"""EphA7"""			9267020	Standard	NM_004440		Approved	Hek11	uc003poe.3	Q15375	OTTHUMG00000015228	ENST00000369303.4:c.322G>A	6.37:g.94120729C>T	ENSP00000358309:p.Asp108Asn		94177450	A0AUX7|B2R8W1|B7ZLJ9|B7ZLK0|Q59G40|Q5VTU0|Q8N368|Q9H124	Missense_Mutation	SNP	ENST00000369303.4	37	CCDS5031.1	.	.	.	.	.	.	.	.	.	.	C	29.9	5.043749	0.93685	.	.	ENSG00000135333	ENST00000369303;ENST00000369297	T;T	0.05139	3.49;3.49	5.51	5.51	0.81932	Ephrin receptor, ligand binding (2);Galactose-binding domain-like (1);	0.000000	0.85682	D	0.000000	T	0.29945	0.0749	M	0.92970	3.365	0.80722	D	1	D;D;D;D	0.89917	0.996;1.0;1.0;1.0	D;D;D;D	0.97110	0.981;0.999;1.0;1.0	T	0.34304	-0.9834	10	0.87932	D	0	.	19.7654	0.96337	0.0:1.0:0.0:0.0	.	108;108;108;108	Q15375-4;Q15375-3;Q15375-2;Q15375	.;.;.;EPHA7_HUMAN	N	108	ENSP00000358309:D108N;ENSP00000358303:D108N	ENSP00000358303:D108N	D	-	1	0	EPHA7	94177450	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.776000	0.85560	2.750000	0.94351	0.655000	0.94253	GAT		0.403	EPHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041545.1		
VNN1	8876	broad.mit.edu	37	6	133004390	133004390	+	Silent	SNP	C	C	T			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr6:133004390C>T	ENST00000367928.4	-	7	1444	c.1431G>A	c.(1429-1431)ggG>ggA	p.G477G		NM_004666.2	NP_004657.2	O95497	VNN1_HUMAN	vanin 1	477					acute inflammatory response (GO:0002526)|cellular component movement (GO:0006928)|chronic inflammatory response (GO:0002544)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|pantothenate metabolic process (GO:0015939)|positive regulation of T cell differentiation in thymus (GO:0033089)|response to oxidative stress (GO:0006979)|single organismal cell-cell adhesion (GO:0016337)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	GPI anchor binding (GO:0034235)|pantetheine hydrolase activity (GO:0017159)	p.G477G(1)		NS(2)|endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|ovary(4)|prostate(1)|upper_aerodigestive_tract(1)	31	Breast(56;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.0027)|GBM - Glioblastoma multiforme(226;0.0189)		CATACAACCTCCCAAACAGAG	0.423																																																1	Substitution - coding silent(1)	ovary(1)	6											130.0	120.0	123.0					6																	133004390		2203	4300	6503	133046083	SO:0001819	synonymous_variant	8876			AJ132099	CCDS5159.1	6q23-q24	2013-02-13			ENSG00000112299	ENSG00000112299	3.5.1.92	"""Vanins"""	12705	protein-coding gene	gene with protein product		603570				9790769	Standard	NM_004666		Approved	Tiff66	uc003qdo.3	O95497	OTTHUMG00000015587	ENST00000367928.4:c.1431G>A	6.37:g.133004390C>T			133046083	A8K310|Q4JFW6|Q4VAS7|Q4VAS8|Q4VAS9|Q9UF16|Q9UJF4	Silent	SNP	ENST00000367928.4	37	CCDS5159.1																																																																																				0.423	VNN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042263.1		
ZNF680	340252	broad.mit.edu	37	7	64004785	64004785	+	Missense_Mutation	SNP	G	G	T			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr7:64004785G>T	ENST00000309683.6	-	2	207	c.56C>A	c.(55-57)gCc>gAc	p.A19D	ZNF680_ENST00000476563.1_Intron|ZNF680_ENST00000447137.2_Missense_Mutation_p.A19D	NM_178558.4	NP_848653.2	Q8NEM1	ZN680_HUMAN	zinc finger protein 680	19	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.A19D(1)		breast(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)	27		Lung NSC(55;0.118)|all_lung(88;0.243)				GAATTCTATGGCCACATCCCT	0.423																																																1	Substitution - Missense(1)	ovary(1)	7											111.0	115.0	114.0					7																	64004785		2203	4298	6501	63642220	SO:0001583	missense	340252			AK074911	CCDS34644.1, CCDS47594.1	7q11.21	2013-01-08			ENSG00000173041	ENSG00000173041		"""Zinc fingers, C2H2-type"", ""-"""	26897	protein-coding gene	gene with protein product	"""hypothetical protein FLJ90430"""					12477932	Standard	NM_178558		Approved	FLJ90430	uc003tta.2	Q8NEM1	OTTHUMG00000156542	ENST00000309683.6:c.56C>A	7.37:g.64004785G>T	ENSP00000309330:p.Ala19Asp		63642220	B3KVJ4|Q6ZNF3|Q8NC79	Missense_Mutation	SNP	ENST00000309683.6	37	CCDS34644.1	.	.	.	.	.	.	.	.	.	.	N	12.50	1.957986	0.34565	.	.	ENSG00000173041	ENST00000309683;ENST00000447137	T;T	0.03358	3.96;3.96	0.665	-0.353	0.12594	Krueppel-associated box (4);	.	.	.	.	T	0.21674	0.0522	H	0.95402	3.665	0.09310	N	1	D;P	0.89917	1.0;0.922	D;P	0.76071	0.987;0.657	T	0.02893	-1.1097	8	0.87932	D	0	.	.	.	.	.	19;19	Q6ZNF3;Q8NEM1	.;ZN680_HUMAN	D	19	ENSP00000309330:A19D;ENSP00000393506:A19D	ENSP00000309330:A19D	A	-	2	0	ZNF680	63642220	0.916000	0.31088	0.056000	0.19401	0.227000	0.25037	2.237000	0.43061	-0.182000	0.10602	0.484000	0.47621	GCC		0.423	ZNF680-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344568.1	NM_178558	
ELN	2006	broad.mit.edu	37	7	73471993	73471993	+	Missense_Mutation	SNP	G	G	T			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr7:73471993G>T	ENST00000252034.7	+	22	1780	c.1381G>T	c.(1381-1383)Gct>Tct	p.A461S	ELN_ENST00000380562.4_Missense_Mutation_p.A461S|ELN_ENST00000320492.7_Intron|ELN_ENST00000458204.1_Missense_Mutation_p.A451S|ELN_ENST00000357036.5_Missense_Mutation_p.A466S|ELN_ENST00000358929.4_Missense_Mutation_p.A490S|ELN_ENST00000380553.4_Intron|ELN_ENST00000414324.1_Intron|ELN_ENST00000380584.4_Intron|ELN_ENST00000380575.4_Intron|ELN_ENST00000380576.5_Intron|ELN_ENST00000429192.1_Intron|ELN_ENST00000320399.6_Missense_Mutation_p.A461S|CTB-51J22.1_ENST00000435932.1_RNA|ELN_ENST00000445912.1_Missense_Mutation_p.A461S	NM_000501.2|NM_001278915.1	NP_000492.2|NP_001265844.1	P15502	ELN_HUMAN	elastin	0	Ala-rich.				blood circulation (GO:0008015)|blood vessel remodeling (GO:0001974)|cell proliferation (GO:0008283)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|organ morphogenesis (GO:0009887)|regulation of actin filament polymerization (GO:0030833)|respiratory gaseous exchange (GO:0007585)|skeletal muscle tissue development (GO:0007519)|stress fiber assembly (GO:0043149)	elastic fiber (GO:0071953)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix binding (GO:0050840)|extracellular matrix constituent conferring elasticity (GO:0030023)|extracellular matrix structural constituent (GO:0005201)	p.A461S(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(10)|ovary(4)|pancreas(2)|prostate(1)|skin(2)|stomach(1)	32		Lung NSC(55;0.159)				AGCAGCTGCAGCTGCTAAAGC	0.607			T	PAX5	B-ALL		"""Supravalvular Aortic Stenosis, Cutis laxa , Williams-Beuren Syndrome"""																																Dom	yes		7	7q11.23	2006	elastin	yes	L	1	Substitution - Missense(1)	ovary(1)	7											35.0	39.0	38.0					7																	73471993		2202	4299	6501	73109929	SO:0001583	missense	2006				CCDS5562.2, CCDS43598.1, CCDS43599.1, CCDS47611.1, CCDS47612.1, CCDS64673.1, CCDS64674.1, CCDS64675.1, CCDS64676.1, CCDS64677.1, CCDS64678.1, CCDS75616.1, CCDS75617.1	7q11.1-q21.1	2008-08-01	2008-08-01		ENSG00000049540	ENSG00000049540			3327	protein-coding gene	gene with protein product	"""tropoelastin"", ""supravalvular aortic stenosis"", ""Williams-Beuren syndrome"""	130160				8096434	Standard	NM_001278939		Approved	WBS, WS, SVAS	uc003tzn.3	P15502	OTTHUMG00000150229	ENST00000252034.7:c.1381G>T	7.37:g.73471993G>T	ENSP00000252034:p.Ala461Ser		73109929	B3KTS6|O15336|O15337|Q14233|Q14234|Q14235|Q14238|Q6P0L4|Q6ZWJ6|Q75MU5|Q7Z316|Q7Z3F5|Q9UMF5	Missense_Mutation	SNP	ENST00000252034.7	37	CCDS5562.2	.	.	.	.	.	.	.	.	.	.	g	10.85	1.466240	0.26335	.	.	ENSG00000049540	ENST00000445912;ENST00000252034;ENST00000358929;ENST00000380562;ENST00000458204;ENST00000357036;ENST00000442462;ENST00000320399	T;T;T;T;T;T;T	0.34072	1.44;1.43;1.38;1.42;1.43;1.44;1.43	4.32	4.32	0.51571	.	.	.	.	.	T	0.56717	0.2004	.	.	.	0.35129	D	0.767775	D;D;D;D;D;D	0.67145	0.996;0.996;0.996;0.996;0.996;0.996	D;D;D;D;D;D	0.75484	0.986;0.986;0.986;0.986;0.986;0.986	T	0.67654	-0.5615	8	0.46703	T	0.11	.	12.3887	0.55347	0.0:0.0:1.0:0.0	.	461;430;451;461;466;461	E7ENM0;E9PBM4;E7EN65;P15502-1;P15502-5;P15502-2	.;.;.;.;.;.	S	461;461;490;461;451;466;430;461	ENSP00000389857:A461S;ENSP00000252034:A461S;ENSP00000351807:A490S;ENSP00000369936:A461S;ENSP00000403162:A451S;ENSP00000349540:A466S;ENSP00000313565:A461S	ENSP00000252034:A461S	A	+	1	0	ELN	73109929	0.891000	0.30450	0.782000	0.31804	0.439000	0.31926	4.570000	0.60872	1.972000	0.57404	0.450000	0.29827	GCT		0.607	ELN-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000316913.1	NM_000501	
CLCN1	1180	broad.mit.edu	37	7	143018909	143018909	+	Missense_Mutation	SNP	G	G	T			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr7:143018909G>T	ENST00000343257.2	+	5	751	c.664G>T	c.(664-666)Ggc>Tgc	p.G222C	CLCN1_ENST00000495612.1_3'UTR	NM_000083.2	NP_000074	P35523	CLCN1_HUMAN	chloride channel, voltage-sensitive 1	222					chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|neuronal action potential propagation (GO:0019227)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	adenyl nucleotide binding (GO:0030554)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)	p.G222C(1)		breast(4)|central_nervous_system(1)|endometrium(1)|large_intestine(11)|lung(26)|ovary(3)|prostate(2)|skin(7)|stomach(1)|upper_aerodigestive_tract(2)	58	Melanoma(164;0.205)					CCTGACTGCGGGCCTGGGCAG	0.587																																																1	Substitution - Missense(1)	ovary(1)	7											55.0	47.0	50.0					7																	143018909		2203	4300	6503	142729031	SO:0001583	missense	1180			Z25884	CCDS5881.1	7q12	2012-09-26	2012-02-23		ENSG00000188037	ENSG00000188037		"""Ion channels / Chloride channels : Voltage-sensitive"""	2019	protein-coding gene	gene with protein product	"""Thomsen disease, autosomal dominant"""	118425	"""chloride channel 1, skeletal muscle"""			1379744	Standard	NM_000083		Approved	CLC1, ClC-1	uc003wcr.1	P35523	OTTHUMG00000152695	ENST00000343257.2:c.664G>T	7.37:g.143018909G>T	ENSP00000339867:p.Gly222Cys		142729031	A4D2H5|Q2M202	Missense_Mutation	SNP	ENST00000343257.2	37	CCDS5881.1	.	.	.	.	.	.	.	.	.	.	.	20.9	4.060694	0.76074	.	.	ENSG00000188037	ENST00000343257	D	0.94232	-3.38	5.02	5.02	0.67125	Chloride channel, core (2);	0.109676	0.64402	D	0.000008	D	0.95519	0.8544	L	0.48642	1.525	0.46586	D	0.999116	D	0.89917	1.0	D	0.85130	0.997	D	0.96154	0.9110	10	0.87932	D	0	.	18.4127	0.90558	0.0:0.0:1.0:0.0	.	222	P35523	CLCN1_HUMAN	C	222	ENSP00000339867:G222C	ENSP00000339867:G222C	G	+	1	0	CLCN1	142729031	1.000000	0.71417	0.867000	0.34043	0.849000	0.48306	6.677000	0.74503	2.357000	0.79964	0.555000	0.69702	GGC		0.587	CLCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327420.1	NM_000083	
HMBOX1	79618	broad.mit.edu	37	8	28876381	28876381	+	Missense_Mutation	SNP	C	C	G			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr8:28876381C>G	ENST00000397358.3	+	7	1506	c.802C>G	c.(802-804)Cga>Gga	p.R268G	HMBOX1_ENST00000287701.10_Missense_Mutation_p.R268G|HMBOX1_ENST00000355231.5_Missense_Mutation_p.R268G|HMBOX1_ENST00000519047.1_Missense_Mutation_p.R268G|HMBOX1_ENST00000524238.1_Missense_Mutation_p.R268G|HMBOX1_ENST00000523613.1_Missense_Mutation_p.R268G|HMBOX1_ENST00000444075.1_Missense_Mutation_p.R268G|HMBOX1_ENST00000558662.1_Missense_Mutation_p.R268G|HMBOX1_ENST00000403668.2_Missense_Mutation_p.R268G	NM_024567.3	NP_078843.2	Q6NT76	HMBX1_HUMAN	homeobox containing 1	268					negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.R268G(1)		cervix(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)	11		Ovarian(32;0.0192)		KIRC - Kidney renal clear cell carcinoma(542;0.135)|Kidney(114;0.161)		CCGACTGCGACGAGGGAGTCG	0.498																																																1	Substitution - Missense(1)	ovary(1)	8											133.0	118.0	123.0					8																	28876381		2203	4300	6503	28932300	SO:0001583	missense	79618			AY522342	CCDS6071.1	8p12	2013-05-23			ENSG00000147421	ENSG00000147421		"""Homeoboxes / HNF class"""	26137	protein-coding gene	gene with protein product	"""homeobox telomere-binding protein 1"""					16825764	Standard	NM_024567		Approved	HNF1LA, PBHNF, FLJ21616, HOT1	uc003xhd.4	Q6NT76	OTTHUMG00000172138	ENST00000397358.3:c.802C>G	8.37:g.28876381C>G	ENSP00000380516:p.Arg268Gly		28932300	A4K385|A8K3R8|B4DHY5|D3DSU0|Q3Y6P1|Q96GS5|Q9H701	Missense_Mutation	SNP	ENST00000397358.3	37	CCDS6071.1	.	.	.	.	.	.	.	.	.	.	C	22.7	4.329592	0.81690	.	.	ENSG00000147421	ENST00000287701;ENST00000444075;ENST00000403668;ENST00000519047;ENST00000397358;ENST00000524238;ENST00000517340;ENST00000355231	D;D;D;D;D;D	0.99888	-4.1;-4.1;-7.54;-4.1;-4.1;-4.1	5.79	4.89	0.63831	Homeobox (2);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.99891	0.9948	M	0.90369	3.11	0.58432	D	0.999997	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.994;1.0	D;D;D;D;D;D	0.91635	0.999;0.997;0.999;0.998;0.982;0.999	D	0.96136	0.9096	10	0.87932	D	0	-6.5205	13.7255	0.62756	0.2804:0.7196:0.0:0.0	.	268;268;268;268;268;268	Q6NT76-5;D3DSU2;Q6NT76-2;Q6NT76-3;Q6NT76;E5RGZ2	.;.;.;.;HMBX1_HUMAN;.	G	268	ENSP00000287701:R268G;ENSP00000401769:R268G;ENSP00000384261:R268G;ENSP00000430059:R268G;ENSP00000380516:R268G;ENSP00000430110:R268G	ENSP00000287701:R268G	R	+	1	2	HMBOX1	28932300	0.963000	0.33076	1.000000	0.80357	0.952000	0.60782	2.215000	0.42862	1.392000	0.46585	0.655000	0.94253	CGA		0.498	HMBOX1-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255267.4	NM_024567	
KAT6A	7994	broad.mit.edu	37	8	41805418	41805418	+	Missense_Mutation	SNP	C	C	T			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr8:41805418C>T	ENST00000396930.3	-	12	2296	c.1753G>A	c.(1753-1755)Gtg>Atg	p.V585M	KAT6A_ENST00000485568.1_Missense_Mutation_p.V585M|KAT6A_ENST00000406337.1_Missense_Mutation_p.V585M|KAT6A_ENST00000265713.2_Missense_Mutation_p.V585M	NM_001099412.1	NP_001092882.1	Q92794	KAT6A_HUMAN	K(lysine) acetyltransferase 6A	585	Catalytic.|Interaction with PML.|Interaction with RUNX1-1.|MYST-type HAT.|Mediates interaction with BRPF1, required for histone H3 acetyltransferase activity.				aorta morphogenesis (GO:0035909)|cellular senescence (GO:0090398)|chromatin organization (GO:0006325)|DNA packaging (GO:0006323)|embryonic hemopoiesis (GO:0035162)|face morphogenesis (GO:0060325)|heart morphogenesis (GO:0003007)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|myeloid cell differentiation (GO:0030099)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|protein acetylation (GO:0006473)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|PML body (GO:0016605)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.V585M(1)									ATGGTACTCACATTCCCATCA	0.348																																																1	Substitution - Missense(1)	ovary(1)	8											78.0	75.0	76.0					8																	41805418		2203	4300	6503	41924575	SO:0001583	missense	7994			U47742	CCDS6124.1	8p11	2013-01-28	2011-07-21	2011-07-21	ENSG00000083168	ENSG00000083168		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	13013	protein-coding gene	gene with protein product	"""Monocytic leukemia zinc finger protein"""	601408	"""runt-related transcription factor binding protein 2"", ""MYST histone acetyltransferase (monocytic leukemia) 3"""	ZNF220, RUNXBP2, MYST3		8849440, 8782817	Standard	NM_001099412		Approved	MOZ, ZC2HC6A	uc003xon.4	Q92794	OTTHUMG00000150453	ENST00000396930.3:c.1753G>A	8.37:g.41805418C>T	ENSP00000380136:p.Val585Met		41924575	Q76L81	Missense_Mutation	SNP	ENST00000396930.3	37	CCDS6124.1	.	.	.	.	.	.	.	.	.	.	C	9.446	1.089246	0.20390	.	.	ENSG00000083168	ENST00000265713;ENST00000406337;ENST00000396930;ENST00000418721;ENST00000485568	T;T;T;D	0.84223	0.2;0.2;0.2;-1.82	5.61	5.61	0.85477	.	0.086699	0.48286	D	0.000190	D	0.90242	0.6949	L	0.56769	1.78	0.80722	D	1	D;D	0.61697	0.975;0.99	P;P	0.62560	0.759;0.904	D	0.88322	0.2963	10	0.34782	T	0.22	-20.4715	19.6419	0.95762	0.0:1.0:0.0:0.0	.	585;585	A5PLL3;Q92794	.;KAT6A_HUMAN	M	585;585;585;165;585	ENSP00000265713:V585M;ENSP00000385888:V585M;ENSP00000380136:V585M;ENSP00000430606:V585M	ENSP00000265713:V585M	V	-	1	0	KAT6A	41924575	1.000000	0.71417	0.999000	0.59377	0.014000	0.08584	5.757000	0.68766	2.640000	0.89533	0.655000	0.94253	GTG		0.348	KAT6A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318163.1	NM_006766	
SLC20A2	6575	broad.mit.edu	37	8	42287737	42287737	+	Missense_Mutation	SNP	C	C	A			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr8:42287737C>A	ENST00000342228.3	-	9	1923	c.1554G>T	c.(1552-1554)tgG>tgT	p.W518C	SLC20A2_ENST00000520179.1_Missense_Mutation_p.W518C|SLC20A2_ENST00000520262.1_Missense_Mutation_p.W518C	NM_006749.4	NP_006740.1	Q08357	S20A2_HUMAN	solute carrier family 20 (phosphate transporter), member 2	518					ion transport (GO:0006811)|phosphate ion transmembrane transport (GO:0035435)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	inorganic phosphate transmembrane transporter activity (GO:0005315)|receptor activity (GO:0004872)|sodium:phosphate symporter activity (GO:0005436)|virus receptor activity (GO:0001618)	p.W518C(1)		breast(1)|endometrium(6)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|stomach(1)	26	all_lung(13;8.33e-12)|Lung NSC(13;1.41e-10)|Ovarian(28;0.00579)|Prostate(17;0.0119)|Lung SC(25;0.211)	all_lung(54;0.00671)|Lung NSC(58;0.0184)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	BRCA - Breast invasive adenocarcinoma(8;5.73e-10)|OV - Ovarian serous cystadenocarcinoma(14;0.00419)|Lung(22;0.0302)|LUSC - Lung squamous cell carcinoma(45;0.0869)			TGTAAATCAGCCACAAGGCTA	0.473																																																1	Substitution - Missense(1)	ovary(1)	8											53.0	53.0	53.0					8																	42287737		2203	4300	6503	42406894	SO:0001583	missense	6575				CCDS6132.1	8p11.21	2013-05-22			ENSG00000168575	ENSG00000168575		"""Solute carriers"""	10947	protein-coding gene	gene with protein product		158378		MLVAR, GLVR2		7745689, 16790504	Standard	NM_001257180		Approved	PiT-2, Glvr-2	uc010lxm.4	Q08357	OTTHUMG00000164169	ENST00000342228.3:c.1554G>T	8.37:g.42287737C>A	ENSP00000340465:p.Trp518Cys		42406894		Missense_Mutation	SNP	ENST00000342228.3	37	CCDS6132.1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.259553	0.80246	.	.	ENSG00000168575	ENST00000342228;ENST00000520262;ENST00000520179	D;D;D	0.90069	-2.61;-2.61;-2.61	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	D	0.86912	0.6047	M	0.77712	2.385	0.80722	D	1	P	0.48694	0.914	B	0.28916	0.096	D	0.89744	0.3935	10	0.87932	D	0	-15.4643	17.3708	0.87377	0.0:1.0:0.0:0.0	.	518	Q08357	S20A2_HUMAN	C	518	ENSP00000340465:W518C;ENSP00000429754:W518C;ENSP00000429712:W518C	ENSP00000340465:W518C	W	-	3	0	SLC20A2	42406894	1.000000	0.71417	1.000000	0.80357	0.813000	0.45954	7.818000	0.86416	2.709000	0.92574	0.561000	0.74099	TGG		0.473	SLC20A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377578.1		
PLEKHF2	79666	broad.mit.edu	37	8	96166990	96166990	+	Missense_Mutation	SNP	G	G	A			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr8:96166990G>A	ENST00000315367.3	+	2	959	c.718G>A	c.(718-720)Gat>Aat	p.D240N	PLEKHF2_ENST00000519516.1_Missense_Mutation_p.D240N	NM_024613.3	NP_078889.1	Q9H8W4	PKHF2_HUMAN	pleckstrin homology domain containing, family F (with FYVE domain) member 2	240					protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|membrane (GO:0016020)|transport vesicle (GO:0030133)	metal ion binding (GO:0046872)	p.D240N(1)		breast(1)|large_intestine(1)|lung(1)|ovary(2)	5	Breast(36;3.18e-05)					TGATATGTCTGATGATGATGA	0.438																																																1	Substitution - Missense(1)	ovary(1)	8											77.0	74.0	75.0					8																	96166990		2203	4300	6503	96236166	SO:0001583	missense	79666			AF434819	CCDS6267.1	8q22.1	2013-01-10				ENSG00000175895		"""Zinc fingers, FYVE domain containing"", ""Pleckstrin homology (PH) domain containing"""	20757	protein-coding gene	gene with protein product		615208					Standard	NM_024613		Approved	ZFYVE18, PHAFIN2, FLJ13187	uc003yhn.2	Q9H8W4		ENST00000315367.3:c.718G>A	8.37:g.96166990G>A	ENSP00000322373:p.Asp240Asn		96236166		Missense_Mutation	SNP	ENST00000315367.3	37	CCDS6267.1	.	.	.	.	.	.	.	.	.	.	G	7.500	0.652502	0.14580	.	.	ENSG00000175895	ENST00000315367;ENST00000519516	T;T	0.80824	-1.42;-1.42	5.81	5.81	0.92471	.	0.090894	0.64402	D	0.000001	T	0.77003	0.4067	N	0.08118	0	0.80722	D	1	D	0.57571	0.98	P	0.57009	0.811	T	0.75093	-0.3439	10	0.20046	T	0.44	-19.809	20.0925	0.97824	0.0:0.0:1.0:0.0	.	240	Q9H8W4	PKHF2_HUMAN	N	240	ENSP00000322373:D240N;ENSP00000427792:D240N	ENSP00000322373:D240N	D	+	1	0	PLEKHF2	96236166	1.000000	0.71417	0.997000	0.53966	0.971000	0.66376	9.080000	0.94040	2.756000	0.94617	0.557000	0.71058	GAT		0.438	PLEKHF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379666.1	NM_024613	
DEPTOR	64798	broad.mit.edu	37	8	121061814	121061814	+	Splice_Site	SNP	G	G	T			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr8:121061814G>T	ENST00000286234.5	+	9	1231		c.e9-1		DEPTOR_ENST00000523492.1_Splice_Site|DEPTOR_ENST00000518057.1_Splice_Site	NM_022783.2	NP_073620.2	Q8TB45	DPTOR_HUMAN	DEP domain containing MTOR-interacting protein						intracellular signal transduction (GO:0035556)|negative regulation of cell size (GO:0045792)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of TOR signaling (GO:0032007)|regulation of extrinsic apoptotic signaling pathway (GO:2001236)	intracellular (GO:0005622)		p.?(1)		endometrium(1)|kidney(1)|large_intestine(5)|lung(5)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)	18						CTTTCCTTTAGGTCTGTCAGT	0.458																																																1	Unknown(1)	ovary(1)	8											174.0	156.0	162.0					8																	121061814		2203	4300	6503	121130995	SO:0001630	splice_region_variant	64798				CCDS6331.1, CCDS64960.1	8q24.12	2011-12-13	2010-12-08	2010-12-08	ENSG00000155792	ENSG00000155792			22953	protein-coding gene	gene with protein product		612974	"""DEP domain containing 6"""	DEPDC6		19446321	Standard	NM_022783		Approved	DEP.6, FLJ12428	uc003yow.4	Q8TB45	OTTHUMG00000165052	ENST00000286234.5:c.1102-1G>T	8.37:g.121061814G>T			121130995	B2RCL9|B4DN97|E7EV87|Q96EQ1|Q9H0R7|Q9H894|Q9HA07	Splice_Site	SNP	ENST00000286234.5	37	CCDS6331.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.982197	0.74474	.	.	ENSG00000155792	ENST00000523492;ENST00000286234	.	.	.	6.01	6.01	0.97437	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.1162	0.97934	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	DEPTOR	121130995	1.000000	0.71417	1.000000	0.80357	0.608000	0.37181	8.997000	0.93544	2.861000	0.98227	0.650000	0.86243	.		0.458	DEPTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381601.1	NM_022783	Intron
KIFC2	90990	broad.mit.edu	37	8	145694904	145694904	+	Silent	SNP	A	A	C			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	A	A	C	C	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr8:145694904A>C	ENST00000301332.2	+	12	1631	c.1254A>C	c.(1252-1254)ccA>ccC	p.P418P	KIFC2_ENST00000301331.5_Silent_p.P166P	NM_145754.2	NP_665697.1	Q96AC6	KIFC2_HUMAN	kinesin family member C2	418	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.P418P(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|lung(7)|ovary(3)|prostate(3)|skin(2)|urinary_tract(1)	19	all_cancers(97;4.61e-11)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;8.67e-41)|all cancers(56;1.1e-35)|BRCA - Breast invasive adenocarcinoma(115;0.035)|Colorectal(110;0.055)			GGCTGAGGCCAGGGACATCTT	0.597																																																1	Substitution - coding silent(1)	ovary(1)	8											68.0	59.0	62.0					8																	145694904		2203	4300	6503	145665712	SO:0001819	synonymous_variant	90990			AY007121	CCDS6427.1	8q24.3	2007-02-13			ENSG00000167702	ENSG00000167702		"""Kinesins"""	29530	protein-coding gene	gene with protein product						9115737	Standard	NM_145754		Approved		uc003zcz.3	Q96AC6	OTTHUMG00000165133	ENST00000301332.2:c.1254A>C	8.37:g.145694904A>C			145665712	E9PHB2|Q96NN6	Silent	SNP	ENST00000301332.2	37	CCDS6427.1																																																																																				0.597	KIFC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382052.2	NM_145754	
DFNB31	25861	broad.mit.edu	37	9	117266603	117266603	+	Missense_Mutation	SNP	G	G	C			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr9:117266603G>C	ENST00000362057.3	-	1	647	c.479C>G	c.(478-480)tCg>tGg	p.S160W	DFNB31_ENST00000480518.1_5'UTR|DFNB31_ENST00000374057.3_Missense_Mutation_p.S160W|DFNB31_ENST00000265134.6_5'Flank	NM_001173425.1|NM_015404.3	NP_001166896.1|NP_056219	Q9P202	WHRN_HUMAN	deafness, autosomal recessive 31	160	PDZ 1. {ECO:0000255|PROSITE- ProRule:PRU00143}.				inner ear receptor stereocilium organization (GO:0060122)|retina homeostasis (GO:0001895)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	actin filament (GO:0005884)|cilium (GO:0005929)|cytoplasm (GO:0005737)|stereocilia ankle link complex (GO:0002142)|stereocilium (GO:0032420)		p.S160W(1)		central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(9)|liver(1)|lung(14)|ovary(5)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						GCCGTGCTCCGAGCCCCCACG	0.682																																																1	Substitution - Missense(1)	ovary(1)	9											63.0	66.0	65.0					9																	117266603		2203	4300	6503	116306424	SO:0001583	missense	25861			AK056190	CCDS6806.1, CCDS43870.1	9q32	2013-06-19			ENSG00000095397	ENSG00000095397			16361	protein-coding gene	gene with protein product	"""whirlin"""	607928				12833159, 17171570	Standard	NM_015404		Approved	CIP98, WHRN, USH2D, PDZD7B	uc004biz.4	Q9P202	OTTHUMG00000020539	ENST00000362057.3:c.479C>G	9.37:g.117266603G>C	ENSP00000354623:p.Ser160Trp		116306424	A5PKU1|A5PKZ9|Q5TAU9|Q5TAV0|Q5TAV1|Q5TAV2|Q96MZ9|Q9H9F4|Q9UFZ3	Missense_Mutation	SNP	ENST00000362057.3	37	CCDS6806.1	.	.	.	.	.	.	.	.	.	.	G	18.46	3.629019	0.67015	.	.	ENSG00000095397	ENST00000362057;ENST00000374057	T;T	0.30714	1.52;1.52	5.79	5.79	0.91817	PDZ/DHR/GLGF (4);	0.267486	0.38605	N	0.001627	T	0.52996	0.1769	M	0.72118	2.19	0.80722	D	1	P;D;P	0.69078	0.473;0.997;0.5	B;D;B	0.69654	0.067;0.965;0.367	T	0.53676	-0.8405	10	0.66056	D	0.02	-9.4147	13.26	0.60101	0.0721:0.0:0.9279:0.0	.	160;160;160	Q9P202-2;B9EGE6;Q9P202	.;.;WHRN_HUMAN	W	160	ENSP00000354623:S160W;ENSP00000363170:S160W	ENSP00000354623:S160W	S	-	2	0	DFNB31	116306424	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.122000	0.77169	2.733000	0.93635	0.655000	0.94253	TCG		0.682	DFNB31-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053776.2	NM_015404	
RXRA	6256	broad.mit.edu	37	9	137326002	137326002	+	Missense_Mutation	SNP	A	A	G			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr9:137326002A>G	ENST00000481739.1	+	9	1242	c.1190A>G	c.(1189-1191)tAt>tGt	p.Y397C	RXRA_ENST00000356384.4_3'UTR|RXRA_ENST00000540193.1_Missense_Mutation_p.Y300C	NM_002957.4	NP_002948.1	P19793	RXRA_HUMAN	retinoid X receptor, alpha	397	Ligand-binding.				camera-type eye development (GO:0043010)|cardiac muscle cell proliferation (GO:0060038)|cellular lipid metabolic process (GO:0044255)|cholesterol metabolic process (GO:0008203)|embryo implantation (GO:0007566)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|maternal placenta development (GO:0001893)|modulation by virus of host morphology or physiology (GO:0019048)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peroxisome proliferator activated receptor signaling pathway (GO:0035357)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homotetramerization (GO:0051289)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|response to retinoic acid (GO:0032526)|retinoic acid receptor signaling pathway (GO:0048384)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ventricular cardiac muscle cell differentiation (GO:0055012)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|vitamin metabolic process (GO:0006766)	nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	9-cis retinoic acid receptor activity (GO:0004886)|chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein heterodimerization activity (GO:0046982)|retinoic acid receptor activity (GO:0003708)|retinoic acid-responsive element binding (GO:0044323)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|vitamin D receptor binding (GO:0042809)|zinc ion binding (GO:0008270)	p.Y397C(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	19				OV - Ovarian serous cystadenocarcinoma(145;4.66e-08)|Epithelial(140;6.72e-08)|all cancers(34;2.22e-07)	Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Bexarotene(DB00307)|Etodolac(DB00749)	GAGAAGGTCTATGCGTCCTTG	0.637																																																1	Substitution - Missense(1)	ovary(1)	9											76.0	74.0	74.0					9																	137326002		2203	4300	6503	136465823	SO:0001583	missense	6256			X52773	CCDS35172.1	9q34	2013-01-16			ENSG00000186350	ENSG00000186350		"""Nuclear hormone receptors"""	10477	protein-coding gene	gene with protein product	"""nuclear receptor subfamily 2 group B member 1"""	180245				2159111	Standard	XM_005263409		Approved	NR2B1	uc004cfa.1	P19793	OTTHUMG00000020887	ENST00000481739.1:c.1190A>G	9.37:g.137326002A>G	ENSP00000419692:p.Tyr397Cys		136465823	B3KY83|Q2NL52|Q2V504	Missense_Mutation	SNP	ENST00000481739.1	37	CCDS35172.1	.	.	.	.	.	.	.	.	.	.	A	17.34	3.365328	0.61513	.	.	ENSG00000186350	ENST00000481739;ENST00000540193	D;D	0.96619	-4.07;-4.07	4.3	4.3	0.51218	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.067294	0.64402	D	0.000009	D	0.98251	0.9421	M	0.90019	3.08	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99289	1.0898	10	0.87932	D	0	.	13.7357	0.62815	1.0:0.0:0.0:0.0	.	397	P19793	RXRA_HUMAN	C	397;300	ENSP00000419692:Y397C;ENSP00000442123:Y300C	ENSP00000419692:Y397C	Y	+	2	0	RXRA	136465823	1.000000	0.71417	0.200000	0.23457	0.575000	0.36095	8.878000	0.92393	1.708000	0.51301	0.402000	0.26972	TAT		0.637	RXRA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054949.1	NM_002957	
CXorf23	256643	broad.mit.edu	37	X	19983772	19983772	+	Missense_Mutation	SNP	T	T	C			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chrX:19983772T>C	ENST00000379682.4	-	3	697	c.664A>G	c.(664-666)Aaa>Gaa	p.K222E	CXorf23_ENST00000356980.3_Missense_Mutation_p.K222E|CXorf23_ENST00000379687.3_Missense_Mutation_p.K222E			A2AJT9	CX023_HUMAN	chromosome X open reading frame 23	222						mitochondrion (GO:0005739)		p.K222E(1)		endometrium(2)|large_intestine(1)|lung(6)|skin(1)|urinary_tract(1)	11						TCCACGTCTTTAGGTCTTTTT	0.463																																																1	Substitution - Missense(1)	ovary(1)	X											167.0	148.0	154.0					X																	19983772		1913	4119	6032	19893693	SO:0001583	missense	256643			AL833278	CCDS14194.2	Xp22.13	2012-11-27			ENSG00000173681	ENSG00000173681			27413	protein-coding gene	gene with protein product						14702039	Standard	NM_198279		Approved		uc004czp.3	A2AJT9	OTTHUMG00000021226	ENST00000379682.4:c.664A>G	X.37:g.19983772T>C	ENSP00000369004:p.Lys222Glu		19893693	A1A4E8|Q5VSM7|Q5VSN1|Q6ZS60|Q8N1W7	Missense_Mutation	SNP	ENST00000379682.4	37		.	.	.	.	.	.	.	.	.	.	T	10.88	1.474975	0.26511	.	.	ENSG00000173681	ENST00000379687;ENST00000379682;ENST00000356980;ENST00000539038	T;T;T	0.15718	2.4;2.4;2.4	5.78	0.461	0.16689	.	.	.	.	.	T	0.09158	0.0226	L	0.27053	0.805	0.19775	N	0.999951	B;B	0.18166	0.023;0.026	B;B	0.17433	0.018;0.015	T	0.38887	-0.9640	8	.	.	.	.	1.8424	0.03153	0.1193:0.207:0.1305:0.5432	.	222;222	A2AJT9-2;A2AJT9	.;CX023_HUMAN	E	222;222;222;110	ENSP00000369009:K222E;ENSP00000369004:K222E;ENSP00000349470:K222E	.	K	-	1	0	CXorf23	19893693	0.985000	0.35326	0.033000	0.17914	0.960000	0.62799	0.657000	0.24963	-0.275000	0.09219	0.446000	0.29264	AAA		0.463	CXorf23-006	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000055991.2	NM_198279	
KLF8	11279	broad.mit.edu	37	X	56291712	56291712	+	Missense_Mutation	SNP	G	G	A			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chrX:56291712G>A	ENST00000468660.1	+	3	469	c.181G>A	c.(181-183)Gca>Aca	p.A61T	KLF8_ENST00000374928.3_Missense_Mutation_p.A61T	NM_007250.4	NP_009181.2	O95600	KLF8_HUMAN	Kruppel-like factor 8	61					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.A61T(1)		kidney(4)|large_intestine(6)|lung(5)|ovary(1)	16						GGAGAACCCAGCACTGTTTAA	0.488																																																1	Substitution - Missense(1)	ovary(1)	X											49.0	42.0	44.0					X																	56291712		2203	4300	6503	56308437	SO:0001583	missense	11279			U28282	CCDS14373.1, CCDS55428.1	Xp11.21	2013-01-08			ENSG00000102349	ENSG00000102349		"""Zinc fingers, C2H2-type"", ""Kruppel-like transcription factors"""	6351	protein-coding gene	gene with protein product		300286					Standard	NM_007250		Approved	BKLF3, ZNF741, DXS741	uc004dur.3	O95600	OTTHUMG00000021666	ENST00000468660.1:c.181G>A	X.37:g.56291712G>A	ENSP00000417303:p.Ala61Thr		56308437	B4DJN3|E7EQQ8|L0R3U8|L0R4U2|Q2M246|Q59GV5|Q5HYQ5|Q5JXP7|Q6MZJ7|Q9UGC4	Missense_Mutation	SNP	ENST00000468660.1	37	CCDS14373.1	.	.	.	.	.	.	.	.	.	.	G	7.890	0.732069	0.15507	.	.	ENSG00000102349	ENST00000374928;ENST00000468660	T;T	0.30448	1.53;1.53	4.68	1.8	0.24995	.	0.667620	0.14482	N	0.316902	T	0.25644	0.0624	L	0.53249	1.67	0.24003	N	0.996205	B;B;B	0.23058	0.063;0.079;0.0	B;B;B	0.23419	0.033;0.046;0.0	T	0.23261	-1.0193	10	0.28530	T	0.3	.	6.5092	0.22212	0.0925:0.0:0.5912:0.3162	.	61;61;61	E7EQQ8;B4DJN3;O95600	.;.;KLF8_HUMAN	T	61	ENSP00000364063:A61T;ENSP00000417303:A61T	ENSP00000431911:A61T	A	+	1	0	KLF8	56308437	0.496000	0.26059	0.533000	0.28001	0.595000	0.36748	1.009000	0.29886	0.103000	0.17682	-0.199000	0.12753	GCA		0.488	KLF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056887.2	NM_007250	
RGAG4	340526	broad.mit.edu	37	X	71351055	71351055	+	Silent	SNP	G	G	A	rs199597770		TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chrX:71351055G>A	ENST00000545866.1	-	1	703	c.336C>T	c.(334-336)agC>agT	p.S112S	NHSL2_ENST00000373677.1_5'Flank|RGAG4_ENST00000609883.1_Silent_p.S112S|NHSL2_ENST00000540800.1_Intron|NHSL2_ENST00000510661.1_5'Flank|NHSL2_ENST00000535692.1_5'Flank	NM_001024455.3	NP_001019626.1	Q5HYW3	RGAG4_HUMAN	retrotransposon gag domain containing 4	112								p.S185S(1)		cervix(2)|endometrium(2)|kidney(3)|large_intestine(5)|lung(8)|ovary(3)|skin(1)	24	Renal(35;0.156)					CGTCGGGGGTGCTGCGATCCT	0.697																																																1	Substitution - coding silent(1)	ovary(1)	X											12.0	15.0	14.0					X																	71351055		1887	4069	5956	71267780	SO:0001819	synonymous_variant	340526			AB082532	CCDS55446.1	Xq13.1	2008-02-05			ENSG00000242732	ENSG00000242732			29430	protein-coding gene	gene with protein product						12056414, 15716091, 16093683	Standard	NM_001024455		Approved	KIAA2001, Mar5, Mart5	uc004eaj.2	Q5HYW3	OTTHUMG00000021808	ENST00000545866.1:c.336C>T	X.37:g.71351055G>A			71267780	A7E2W7|Q8NCM4|Q9NPX1	Silent	SNP	ENST00000545866.1	37	CCDS55446.1																																																																																				0.697	RGAG4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057171.1	NM_001024455	
MAGEC1	9947	broad.mit.edu	37	X	140995759	140995759	+	Missense_Mutation	SNP	T	T	A			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	T	T	A	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chrX:140995759T>A	ENST00000285879.4	+	4	2855	c.2569T>A	c.(2569-2571)Tcc>Acc	p.S857T	MAGEC1_ENST00000406005.2_Intron	NM_005462.4	NP_005453.2	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	857								p.S857T(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(22)|lung(60)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(1)	127	Acute lymphoblastic leukemia(192;6.56e-05)					TCCTGTGATCTCCTTCTCCTC	0.507										HNSCC(15;0.026)																																						1	Substitution - Missense(1)	ovary(1)	X											122.0	128.0	126.0					X																	140995759		2203	4300	6503	140823425	SO:0001583	missense	9947			AF064589	CCDS35417.1	Xq26	2009-03-18			ENSG00000155495	ENSG00000155495			6812	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 1"""	300223				9485030, 9618514	Standard	NM_005462		Approved	MAGE-C1, CT7, MGC39366, CT7.1	uc004fbt.3	O60732	OTTHUMG00000022569	ENST00000285879.4:c.2569T>A	X.37:g.140995759T>A	ENSP00000285879:p.Ser857Thr		140823425	A0PK03|O75451|Q8TCV4	Missense_Mutation	SNP	ENST00000285879.4	37	CCDS35417.1	.	.	.	.	.	.	.	.	.	.	N	6.366	0.435605	0.12104	.	.	ENSG00000155495	ENST00000285879	T	0.02140	4.43	0.98	-1.26	0.09376	.	.	.	.	.	T	0.01353	0.0044	N	0.14661	0.345	0.09310	N	1	B	0.13145	0.007	B	0.08055	0.003	T	0.47100	-0.9143	9	0.36615	T	0.2	.	2.9625	0.05897	0.3941:0.0:0.0:0.6059	.	857	O60732	MAGC1_HUMAN	T	857	ENSP00000285879:S857T	ENSP00000285879:S857T	S	+	1	0	MAGEC1	140823425	0.026000	0.19158	0.001000	0.08648	0.004000	0.04260	0.215000	0.17562	-0.237000	0.09739	0.225000	0.17782	TCC		0.507	MAGEC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058604.1	NM_005462	
HCFC1	3054	broad.mit.edu	37	X	153236183	153236183	+	Missense_Mutation	SNP	G	G	A			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chrX:153236183G>A	ENST00000310441.7	-	1	1075	c.109C>T	c.(109-111)Cgc>Tgc	p.R37C	HCFC1-AS1_ENST00000438219.1_RNA|HCFC1_ENST00000354233.3_Missense_Mutation_p.R37C|HCFC1_ENST00000369984.4_Missense_Mutation_p.R37C|TMEM187_ENST00000369982.4_5'Flank	NM_005334.2	NP_005325.2	P51610	HCFC1_HUMAN	host cell factor C1	37					cell cycle (GO:0007049)|chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell cycle (GO:0045787)|positive regulation of gene expression (GO:0010628)|protein stabilization (GO:0050821)|regulation of protein complex assembly (GO:0043254)|regulation of transcription, DNA-templated (GO:0006355)|release from viral latency (GO:0019046)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|membrane (GO:0016020)|mitochondrion (GO:0005739)|MLL1 complex (GO:0071339)|MLL5-L complex (GO:0070688)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	chromatin binding (GO:0003682)|identical protein binding (GO:0042802)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)	p.R37C(1)		NS(1)|breast(2)|central_nervous_system(2)|endometrium(12)|kidney(3)|large_intestine(3)|lung(18)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	all_cancers(53;6.23e-16)|all_epithelial(53;5.61e-10)|all_lung(58;3.99e-07)|Lung NSC(58;5.02e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GCCACGGCGCGGTGGCCGTGG	0.682																																																1	Substitution - Missense(1)	ovary(1)	X											45.0	43.0	43.0					X																	153236183		1990	4124	6114	152889377	SO:0001583	missense	3054				CCDS44020.1	Xq28	2014-06-12	2014-06-09		ENSG00000172534	ENSG00000172534			4839	protein-coding gene	gene with protein product	"""VP16-accessory protein"", ""protein phosphatase 1, regulatory subunit 89"""	300019	"""mental retardation, X-linked 3"", ""host cell factor C1 (VP16-accessory protein)"""	HFC1, MRX3		8392914, 23000143	Standard	XM_005274664		Approved	HCF-1, HCF1, CFF, VCAF, MGC70925, PPP1R89	uc004fjp.3	P51610	OTTHUMG00000024222	ENST00000310441.7:c.109C>T	X.37:g.153236183G>A	ENSP00000309555:p.Arg37Cys		152889377	Q6P4G5	Missense_Mutation	SNP	ENST00000310441.7	37	CCDS44020.1	.	.	.	.	.	.	.	.	.	.	G	16.31	3.088180	0.55968	.	.	ENSG00000172534	ENST00000310441;ENST00000369984;ENST00000354233	T;T;T	0.77489	-1.1;-1.1;-1.1	3.72	3.72	0.42706	.	0.000000	0.85682	D	0.000000	D	0.85075	0.5614	M	0.71036	2.16	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.85930	0.1451	10	0.87932	D	0	.	9.4327	0.38620	0.0:0.0:0.7876:0.2124	.	37	P51610	HCFC1_HUMAN	C	37	ENSP00000309555:R37C;ENSP00000359001:R37C;ENSP00000346174:R37C	ENSP00000309555:R37C	R	-	1	0	HCFC1	152889377	1.000000	0.71417	0.999000	0.59377	0.557000	0.35523	5.094000	0.64523	1.840000	0.53500	0.436000	0.28706	CGC		0.682	HCFC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061099.4	NM_005334	
CUBN	8029	broad.mit.edu	37	10	16955948	16955948	+	Frame_Shift_Del	DEL	A	A	-			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	A	A	-	-	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Illumina_Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr10:16955948delA	ENST00000377833.4	-	48	7460	c.7395delT	c.(7393-7395)tctfs	p.S2465fs		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	2465	CUB 18. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)	p.N2467fs*26(1)		breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	GGTAGTTGGGAGAAGTAAATG	0.488																																																1	Deletion - Frameshift(1)	ovary(1)	10											89.0	87.0	88.0					10																	16955948		2203	4300	6503	16995954	SO:0001589	frameshift_variant	8029			AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.7395delT	10.37:g.16955948delA	ENSP00000367064:p.Ser2465fs		16995954	B0YIZ4|Q5VTA6|Q96RU9	Frame_Shift_Del	DEL	ENST00000377833.4	37	CCDS7113.1																																																																																				0.488	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	NM_001081	
ZNF264	9422	broad.mit.edu	37	19	57724268	57724284	+	Frame_Shift_Del	DEL	AAATATTTTGCCAGAGG	AAATATTTTGCCAGAGG	-	rs539762505|rs150134841		TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	AAATATTTTGCCAGAGG	AAATATTTTGCCAGAGG	-	-	AAATATTTTGCCAGAGG	AAATATTTTGCCAGAGG	Unknown	Valid	Somatic	Phase_I	Capture	Illumina_Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr19:57724268_57724284delAAATATTTTGCCAGAGG	ENST00000263095.6	+	4	2217_2233	c.1803_1819delAAATATTTTGCCAGAGG	c.(1801-1821)gcaaatattttgccagaggaafs	p.NILPEE602fs	ZNF264_ENST00000536056.1_Frame_Shift_Del_p.NILPEE602fs	NM_003417.4	NP_003408.1	O43296	ZN264_HUMAN	zinc finger protein 264	602					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.L604fs*5(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(8)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	27		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0135)		CCACTGAGGCAAATATTTTGCCAGAGGAAACATCTTC	0.41																																																1	Deletion - Frameshift(1)	ovary(1)	19																																								62416096	SO:0001589	frameshift_variant	9422			AB007872	CCDS33127.1	19q13.4	2013-01-08				ENSG00000083844		"""Zinc fingers, C2H2-type"", ""-"""	13057	protein-coding gene	gene with protein product		604668				9455477	Standard	NM_003417		Approved	KIAA0412	uc002qob.3	O43296		ENST00000263095.6:c.1803_1819delAAATATTTTGCCAGAGG	19.37:g.57724268_57724284delAAATATTTTGCCAGAGG	ENSP00000263095:p.Asn602fs		62416080	A8K8Y9|Q9P1V0	Frame_Shift_Del	DEL	ENST00000263095.6	37	CCDS33127.1																																																																																				0.410	ZNF264-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465080.1		
MYO7B	4648	broad.mit.edu	37	2	128366397	128366397	+	Frame_Shift_Del	DEL	G	G	-			TCGA-09-2049-01D-01W-0799-08	TCGA-09-2049-10A-01W-0799-08	G	G	-	-	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina_Capture			Illumina GAIIx	85345835-e470-4a69-a1b7-45baff9a83d0	83836b9c-ed54-44a2-9938-396efbd69330	g.chr2:128366397delG	ENST00000409816.2	+	21	2790	c.2758delG	c.(2758-2760)ggcfs	p.G920fs	MYO7B_ENST00000389524.4_Frame_Shift_Del_p.G920fs|MYO7B_ENST00000428314.1_Frame_Shift_Del_p.G920fs			Q6PIF6	MYO7B_HUMAN	myosin VIIB	920						extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(46)|ovary(3)|pancreas(1)|prostate(3)|urinary_tract(1)	75	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0753)		GAAGGTGTTCGGCTTCCTCCC	0.637																																																0			2											34.0	41.0	39.0					2																	128366397		2094	4203	6297	128082867	SO:0001589	frameshift_variant	4648				CCDS46405.1	2q21.1	2011-09-27			ENSG00000169994	ENSG00000169994		"""Myosins / Myosin superfamily : Class VII"""	7607	protein-coding gene	gene with protein product		606541				8022818, 8884266	Standard	NM_001080527		Approved		uc002top.3	Q6PIF6	OTTHUMG00000153419	ENST00000409816.2:c.2758delG	2.37:g.128366397delG	ENSP00000386461:p.Gly920fs		128082867	Q14786|Q8TEE1	Frame_Shift_Del	DEL	ENST00000409816.2	37	CCDS46405.1																																																																																				0.637	MYO7B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000331124.3	XM_291001	
