#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
NBPF1	55672	broad.mit.edu	37	1	16907929	16907929	+	Silent	SNP	T	T	C			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr1:16907929T>C	ENST00000430580.2	-	15	2252	c.1365A>G	c.(1363-1365)gaA>gaG	p.E455E	NBPF1_ENST00000432949.1_5'Flank	NM_017940.3	NP_060410.2	Q3BBV0	NBPF1_HUMAN	neuroblastoma breakpoint family, member 1	455	NBPF 2. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)									UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		GGGCAGATGATTCCAGTACTT	0.433																																																0			1											277.0	309.0	297.0					1																	16907929		1493	2690	4183	16780516	SO:0001819	synonymous_variant	55672			AB051480		1p36.13	2013-01-30			ENSG00000219481	ENSG00000219481		"""neuroblastoma breakpoint family"""	26088	protein-coding gene	gene with protein product		610501				11214970, 16079250	Standard	NM_017940		Approved	FLJ20719, KIAA1693	uc001ayw.4	Q3BBV0	OTTHUMG00000002487	ENST00000430580.2:c.1365A>G	1.37:g.16907929T>C			16780516	Q8N4E8|Q9C0H0	Silent	SNP	ENST00000430580.2	37																																																																																					0.433	NBPF1-005	NOVEL	upstream_uORF|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000106436.3	NM_017940	
E2F2	1870	broad.mit.edu	37	1	23848384	23848384	+	Missense_Mutation	SNP	C	C	T			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr1:23848384C>T	ENST00000361729.2	-	3	949	c.523G>A	c.(523-525)Gtg>Atg	p.V175M	E2F2_ENST00000487237.1_5'Flank	NM_004091.3	NP_004082.1	Q14209	E2F2_HUMAN	E2F transcription factor 2	175	Leucine-zipper.				intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|lens fiber cell apoptotic process (GO:1990086)|mitotic cell cycle (GO:0000278)|regulation of cell cycle (GO:0051726)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	core promoter binding (GO:0001047)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.V175M(1)		endometrium(4)|large_intestine(2)|lung(1)|ovary(3)|skin(2)|urinary_tract(1)	13		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Breast(348;0.00262)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;1.52e-24)|Colorectal(126;6.25e-08)|COAD - Colon adenocarcinoma(152;3.42e-06)|GBM - Glioblastoma multiforme(114;8.98e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00102)|KIRC - Kidney renal clear cell carcinoma(1967;0.00366)|STAD - Stomach adenocarcinoma(196;0.0132)|READ - Rectum adenocarcinoma(331;0.0652)|Lung(427;0.0888)|LUSC - Lung squamous cell carcinoma(448;0.19)		CCTTCCAGCACGTTGGTGATG	0.587																																																1	Substitution - Missense(1)	ovary(1)	1											147.0	128.0	135.0					1																	23848384		2203	4300	6503	23720971	SO:0001583	missense	1870			L22846	CCDS236.1	1p36	2008-02-05			ENSG00000007968	ENSG00000007968			3114	protein-coding gene	gene with protein product		600426				8246995, 8246996	Standard	NM_004091		Approved	E2F-2	uc001bhe.2	Q14209	OTTHUMG00000003223	ENST00000361729.2:c.523G>A	1.37:g.23848384C>T	ENSP00000355249:p.Val175Met		23720971	B2R9W1|Q7Z6H1	Missense_Mutation	SNP	ENST00000361729.2	37	CCDS236.1	.	.	.	.	.	.	.	.	.	.	C	24.5	4.532951	0.85812	.	.	ENSG00000007968	ENST00000361729	T	0.36157	1.27	5.35	4.42	0.53409	Transcription factor E2F/dimerisation partner (TDP) (1);Winged helix-turn-helix transcription repressor DNA-binding (1);	0.076207	0.52532	D	0.000069	T	0.74207	0.3686	H	0.98333	4.205	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.84412	0.0566	10	0.87932	D	0	-29.4829	13.8731	0.63631	0.154:0.846:0.0:0.0	.	175	Q14209	E2F2_HUMAN	M	175	ENSP00000355249:V175M	ENSP00000355249:V175M	V	-	1	0	E2F2	23720971	1.000000	0.71417	0.834000	0.33040	0.980000	0.70556	7.770000	0.85390	1.212000	0.43366	0.591000	0.81541	GTG		0.587	E2F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008885.1	NM_004091	
GPATCH4	54865	broad.mit.edu	37	1	156568827	156568827	+	Silent	SNP	G	G	A			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr1:156568827G>A	ENST00000368232.4	-	2	144	c.12C>T	c.(10-12)acC>acT	p.T4T	GPATCH4_ENST00000497287.1_5'UTR|GPATCH4_ENST00000334588.7_5'UTR|GPATCH4_ENST00000438976.2_Intron	NM_015590.3|NM_182679.2	NP_056405.2|NP_872620.1	Q5T3I0	GPTC4_HUMAN	G patch domain containing 4	4							poly(A) RNA binding (GO:0044822)	p.T4T(1)		autonomic_ganglia(1)|breast(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(2)|skin(3)|stomach(1)	17	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					TGACCTCTGGGGTGACATTCA	0.483																																																1	Substitution - coding silent(1)	ovary(1)	1											93.0	83.0	86.0					1																	156568827		2203	4300	6503	154835451	SO:0001819	synonymous_variant	54865			BC056904	CCDS1146.1, CCDS44245.1	1q22	2013-01-28		2006-12-13	ENSG00000160818	ENSG00000160818		"""G patch domain containing"""	25982	protein-coding gene	gene with protein product				GPATC4		12477932	Standard	NM_015590		Approved	FLJ20249, DKFZP434F1735	uc001fpl.3	Q5T3I0	OTTHUMG00000033203	ENST00000368232.4:c.12C>T	1.37:g.156568827G>A			154835451	Q5T3I1|Q6ZUE7|Q8IWG8|Q9NXH4	Silent	SNP	ENST00000368232.4	37	CCDS1146.1																																																																																				0.483	GPATCH4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000081029.2	NM_017725	
CUBN	8029	broad.mit.edu	37	10	16911718	16911718	+	Missense_Mutation	SNP	C	C	T			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr10:16911718C>T	ENST00000377833.4	-	59	9436	c.9371G>A	c.(9370-9372)aGc>aAc	p.S3124N		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	3124	CUB 23. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)	p.S3124N(1)		breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	ACTATTATTGCTGCTCTTCAC	0.473																																																1	Substitution - Missense(1)	ovary(1)	10											154.0	163.0	160.0					10																	16911718		2203	4300	6503	16951724	SO:0001583	missense	8029			AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.9371G>A	10.37:g.16911718C>T	ENSP00000367064:p.Ser3124Asn		16951724	B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	ENST00000377833.4	37	CCDS7113.1	.	.	.	.	.	.	.	.	.	.	C	11.93	1.786409	0.31593	.	.	ENSG00000107611	ENST00000377833	T	0.19105	2.17	5.69	1.51	0.23008	CUB (5);	0.554928	0.16417	N	0.215360	T	0.39682	0.1087	M	0.70595	2.14	0.46336	D	0.998999	D	0.65815	0.995	D	0.65443	0.935	T	0.10520	-1.0626	10	0.33141	T	0.24	.	11.4046	0.49889	0.0:0.292:0.6234:0.0846	.	3124	O60494	CUBN_HUMAN	N	3124	ENSP00000367064:S3124N	ENSP00000367064:S3124N	S	-	2	0	CUBN	16951724	0.974000	0.33945	0.411000	0.26484	0.003000	0.03518	0.822000	0.27352	0.316000	0.23135	-0.172000	0.13284	AGC		0.473	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	NM_001081	
YME1L1	10730	broad.mit.edu	37	10	27425283	27425283	+	Missense_Mutation	SNP	C	C	G			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr10:27425283C>G	ENST00000326799.3	-	6	781	c.633G>C	c.(631-633)ttG>ttC	p.L211F	YME1L1_ENST00000376016.3_Missense_Mutation_p.L154F|YME1L1_ENST00000375972.3_Missense_Mutation_p.L121F|YME1L1_ENST00000463270.1_5'Flank	NM_139312.2	NP_647473.1	Q96TA2	YMEL1_HUMAN	YME1-like 1 ATPase	211					cell proliferation (GO:0008283)|misfolded or incompletely synthesized protein catabolic process (GO:0006515)|mitochondrion organization (GO:0007005)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)	p.L211F(1)		breast(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	23						TCCTTGATTTCAAAGTTTTAA	0.358																																																1	Substitution - Missense(1)	ovary(1)	10											104.0	96.0	98.0					10																	27425283		2203	4300	6503	27465289	SO:0001583	missense	10730			AJ132637	CCDS7151.1, CCDS7152.1, CCDS58072.1	10p14	2013-06-10	2013-06-10		ENSG00000136758	ENSG00000136758		"""ATPases / AAA-type"""	12843	protein-coding gene	gene with protein product		607472	"""YME1 (S.cerevisiae)-like 1"", ""YME1-like 1 (S. cerevisiae)"""			22262461	Standard	NM_139312		Approved		uc001itj.3	Q96TA2	OTTHUMG00000017853	ENST00000326799.3:c.633G>C	10.37:g.27425283C>G	ENSP00000318480:p.Leu211Phe		27465289	B4DNM1|D3DRV8|D3DRV9|Q5T8D9|Q9H1Q0|Q9UMR9	Missense_Mutation	SNP	ENST00000326799.3	37	CCDS7152.1	.	.	.	.	.	.	.	.	.	.	C	16.46	3.128541	0.56721	.	.	ENSG00000136758	ENST00000376016;ENST00000326799;ENST00000375969;ENST00000375972;ENST00000427324;ENST00000396296	D;D;D	0.93366	-3.13;-3.15;-3.21	5.46	1.56	0.23342	Peptidase M41, FtsH (1);	0.000000	0.85682	D	0.000000	D	0.91078	0.7192	L	0.46157	1.445	0.50171	D	0.999851	D;D;P	0.59767	0.986;0.96;0.781	P;P;B	0.51918	0.655;0.684;0.41	D	0.86232	0.1638	10	0.19147	T	0.46	-10.5584	9.6756	0.40039	0.0:0.7139:0.0:0.2861	.	121;154;211	B4DNM1;Q96TA2-2;Q96TA2	.;.;YMEL1_HUMAN	F	154;211;211;121;121;146	ENSP00000365184:L154F;ENSP00000318480:L211F;ENSP00000365139:L121F	ENSP00000318480:L211F	L	-	3	2	YME1L1	27465289	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	0.637000	0.24659	0.281000	0.22233	-0.140000	0.14226	TTG		0.358	YME1L1-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000047306.1	NM_139312	
ANKRD30A	91074	broad.mit.edu	37	10	37451766	37451766	+	Silent	SNP	A	A	T			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr10:37451766A>T	ENST00000602533.1	+	17	1923	c.1824A>T	c.(1822-1824)acA>acT	p.T608T	ANKRD30A_ENST00000374660.1_Silent_p.T608T|ANKRD30A_ENST00000361713.1_Silent_p.T608T			Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	664					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.T608T(1)		NS(1)|breast(8)|endometrium(14)|kidney(21)|large_intestine(13)|lung(70)|ovary(8)|pancreas(1)|prostate(3)|skin(15)|stomach(1)|urinary_tract(3)	158						ATGAACAAACATTGAGAGCAG	0.328																																																1	Substitution - coding silent(1)	ovary(1)	10											102.0	90.0	93.0					10																	37451766		1812	4065	5877	37491772	SO:0001819	synonymous_variant	91074			AF269087	CCDS7193.1	10p11.21	2013-01-10			ENSG00000148513	ENSG00000148513		"""Ankyrin repeat domain containing"""	17234	protein-coding gene	gene with protein product	"""breast cancer antigen NY-BR-1"""	610856				11280766	Standard	NM_052997		Approved	NY-BR-1	uc001iza.1	Q9BXX3	OTTHUMG00000017968	ENST00000602533.1:c.1824A>T	10.37:g.37451766A>T			37491772	Q5W025	Silent	SNP	ENST00000602533.1	37																																																																																					0.328	ANKRD30A-001	KNOWN	NMD_exception|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000047588.2	NM_052997	
ANK3	288	broad.mit.edu	37	10	61967869	61967869	+	Silent	SNP	C	C	T			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr10:61967869C>T	ENST00000280772.2	-	10	1310	c.1119G>A	c.(1117-1119)gtG>gtA	p.V373V	ANK3_ENST00000373827.2_Silent_p.V367V|ANK3_ENST00000503366.1_Silent_p.V356V	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	373					axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.V373V(1)		NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						AGTGGGCAGCCACGTGTAGGG	0.522																																																1	Substitution - coding silent(1)	ovary(1)	10											169.0	139.0	149.0					10																	61967869		2203	4300	6503	61637875	SO:0001819	synonymous_variant	288			U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.1119G>A	10.37:g.61967869C>T			61637875	B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Silent	SNP	ENST00000280772.2	37	CCDS7258.1																																																																																				0.522	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048201.4	NM_020987	
PLCE1	51196	broad.mit.edu	37	10	96006017	96006017	+	Missense_Mutation	SNP	A	A	G			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr10:96006017A>G	ENST00000371380.3	+	7	2970	c.2735A>G	c.(2734-2736)aAt>aGt	p.N912S	PLCE1_ENST00000260766.3_Missense_Mutation_p.N912S|PLCE1_ENST00000371375.1_Missense_Mutation_p.N604S|PLCE1_ENST00000371385.3_Missense_Mutation_p.N604S			Q9P212	PLCE1_HUMAN	phospholipase C, epsilon 1	912					activation of MAPK activity (GO:0000187)|calcium-mediated signaling (GO:0019722)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|diacylglycerol biosynthetic process (GO:0006651)|epidermal growth factor receptor signaling pathway (GO:0007173)|glomerulus development (GO:0032835)|heart development (GO:0007507)|inositol phosphate metabolic process (GO:0043647)|inositol phosphate-mediated signaling (GO:0048016)|lipid catabolic process (GO:0016042)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|phospholipid metabolic process (GO:0006644)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of GTPase activity (GO:0043547)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|Ras protein signal transduction (GO:0007265)|regulation of cell growth (GO:0001558)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of protein kinase activity (GO:0045859)|regulation of Ras protein signal transduction (GO:0046578)|regulation of smooth muscle contraction (GO:0006940)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)|guanyl-nucleotide exchange factor activity (GO:0005085)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|Ras GTPase binding (GO:0017016)|receptor signaling protein activity (GO:0005057)	p.N912S(1)		liver(1)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	8		Colorectal(252;0.0458)				GGTGTACTTAATAACACAGCT	0.502																																																1	Substitution - Missense(1)	ovary(1)	10											55.0	61.0	59.0					10																	96006017		1974	4152	6126	95996007	SO:0001583	missense	51196				CCDS41552.1, CCDS53555.1	10q23	2010-02-22			ENSG00000138193	ENSG00000138193	3.1.4.11		17175	protein-coding gene	gene with protein product	"""nephrosis type 3"""	608414				11022047, 11022048	Standard	NM_016341		Approved	KIAA1516, PLCE, NPHS3	uc001kjk.3	Q9P212	OTTHUMG00000018789	ENST00000371380.3:c.2735A>G	10.37:g.96006017A>G	ENSP00000360431:p.Asn912Ser		95996007	A6NGW0|A6NLA1|A7MBN7|A8K1D7|B9EIJ6|Q1X6H8|Q5VWL4|Q5VWL5|Q9H9X8|Q9HBX6|Q9HC53|Q9UHV3	Missense_Mutation	SNP	ENST00000371380.3	37	CCDS41552.1	.	.	.	.	.	.	.	.	.	.	A	0.017	-1.492994	0.01009	.	.	ENSG00000138193	ENST00000260766;ENST00000371380;ENST00000371385;ENST00000371375	T;T;T;T	0.32272	1.46;1.46;1.46;1.46	6.04	-0.309	0.12769	.	0.600185	0.17133	N	0.185758	T	0.07324	0.0185	N	0.02011	-0.69	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.31558	-0.9939	10	0.02654	T	1	.	3.0965	0.06312	0.1851:0.2188:0.483:0.1131	.	912;604;912	B7ZM61;Q9P212-2;Q9P212	.;.;PLCE1_HUMAN	S	912;912;604;604	ENSP00000260766:N912S;ENSP00000360431:N912S;ENSP00000360438:N604S;ENSP00000360426:N604S	ENSP00000260766:N912S	N	+	2	0	PLCE1	95996007	0.929000	0.31497	0.002000	0.10522	0.684000	0.39900	1.472000	0.35376	-0.310000	0.08766	-0.473000	0.04963	AAT		0.502	PLCE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049469.3	NM_016341	
SLIT1	6585	broad.mit.edu	37	10	98816965	98816965	+	Splice_Site	SNP	A	A	C			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	A	A	C	C	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr10:98816965A>C	ENST00000266058.4	-	12	1403		c.e12+1		ARHGAP19-SLIT1_ENST00000453547.2_Splice_Site|SLIT1_ENST00000371070.4_Splice_Site	NM_003061.2	NP_003052.2	O75093	SLIT1_HUMAN	slit homolog 1 (Drosophila)						axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|dorsal/ventral axon guidance (GO:0033563)|establishment of nucleus localization (GO:0040023)|forebrain morphogenesis (GO:0048853)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of synapse assembly (GO:0051964)|retinal ganglion cell axon guidance (GO:0031290)|spinal cord development (GO:0021510)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	extracellular space (GO:0005615)	calcium ion binding (GO:0005509)|Roundabout binding (GO:0048495)	p.?(1)		breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(37)|ovary(5)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	78		Colorectal(252;0.162)		Epithelial(162;2.02e-08)|all cancers(201;1.5e-06)		ATTCGTTCTTACAGGAGCTGT	0.567																																																1	Unknown(1)	ovary(1)	10											73.0	67.0	69.0					10																	98816965		2203	4300	6503	98806955	SO:0001630	splice_region_variant	6585			AB011537	CCDS7453.1	10q23.3-q24	2008-08-01	2001-11-28		ENSG00000187122	ENSG00000187122			11085	protein-coding gene	gene with protein product		603742	"""slit (Drosophila) homolog 1"""	SLIL1		9693030, 9813312	Standard	NM_003061		Approved	slit1, MEGF4, Slit-1, SLIT3	uc001kmw.2	O75093	OTTHUMG00000018843	ENST00000266058.4:c.1157+1T>G	10.37:g.98816965A>C			98806955	Q5T0V1|Q8WWZ2|Q9UIL7	Splice_Site	SNP	ENST00000266058.4	37	CCDS7453.1	.	.	.	.	.	.	.	.	.	.	A	23.8	4.458830	0.84317	.	.	ENSG00000187122	ENST00000266058;ENST00000371057;ENST00000371054;ENST00000371070;ENST00000314867;ENST00000456008	.	.	.	5.48	5.48	0.80851	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.228	0.73364	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SLIT1	98806955	1.000000	0.71417	1.000000	0.80357	0.862000	0.49288	8.802000	0.91910	2.080000	0.62538	0.459000	0.35465	.		0.567	SLIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049636.1	NM_003061	Intron
NRAP	4892	broad.mit.edu	37	10	115377234	115377234	+	Missense_Mutation	SNP	T	T	C			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr10:115377234T>C	ENST00000359988.3	-	26	3197	c.2953A>G	c.(2953-2955)Agt>Ggt	p.S985G	NRAP_ENST00000369358.4_Missense_Mutation_p.S993G|NRAP_ENST00000360478.3_Missense_Mutation_p.S950G|NRAP_ENST00000369360.3_Missense_Mutation_p.S958G	NM_001261463.1|NM_198060.3	NP_001248392.1|NP_932326.2			nebulin-related anchoring protein									p.S985G(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(18)|lung(39)|ovary(6)|prostate(3)|skin(1)|stomach(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Colorectal(252;0.0233)|Breast(234;0.188)		Epithelial(162;0.00392)|all cancers(201;0.00569)		TGGGTATAACTAATTCTGGCC	0.423																																																1	Substitution - Missense(1)	ovary(1)	10											159.0	147.0	151.0					10																	115377234		2203	4300	6503	115367224	SO:0001583	missense	4892				CCDS7578.1, CCDS7579.1, CCDS73199.1	10q24-q26	2008-08-01			ENSG00000197893	ENSG00000197893			7988	protein-coding gene	gene with protein product		602873				12789664, 10320340	Standard	NM_006175		Approved		uc001lal.4	Q86VF7	OTTHUMG00000019072	ENST00000359988.3:c.2953A>G	10.37:g.115377234T>C	ENSP00000353078:p.Ser985Gly		115367224		Missense_Mutation	SNP	ENST00000359988.3	37	CCDS7579.1	.	.	.	.	.	.	.	.	.	.	T	21.6	4.177445	0.78564	.	.	ENSG00000197893	ENST00000369358;ENST00000369360;ENST00000359988;ENST00000360478	T;T;T;T	0.49432	0.78;0.78;0.78;0.78	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.68933	0.3055	M	0.73962	2.25	0.49483	D	0.999792	D;D;D	0.89917	0.999;0.998;1.0	D;D;D	0.91635	0.999;0.998;0.987	T	0.66929	-0.5799	10	0.33940	T	0.23	.	16.8222	0.85835	0.0:0.0:0.0:1.0	.	985;950;985	A0AVL2;Q86VF7-4;Q86VF7	.;.;NRAP_HUMAN	G	993;958;985;950	ENSP00000358365:S993G;ENSP00000358367:S958G;ENSP00000353078:S985G;ENSP00000353666:S950G	ENSP00000353078:S985G	S	-	1	0	NRAP	115367224	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.370000	0.79589	2.371000	0.80710	0.533000	0.62120	AGT		0.423	NRAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050425.2	NM_006175	
MRPL23	6150	broad.mit.edu	37	11	1972164	1972164	+	Missense_Mutation	SNP	G	G	C			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr11:1972164G>C	ENST00000397298.3	+	2	138	c.53G>C	c.(52-54)cGg>cCg	p.R18P	MRPL23_ENST00000381519.1_Missense_Mutation_p.R18P|MRPL23_ENST00000486931.1_3'UTR|MRPL23_ENST00000397297.3_Missense_Mutation_p.R18P|MRPL23_ENST00000381514.3_Missense_Mutation_p.R18P|MRPL23_ENST00000397294.3_Missense_Mutation_p.R18P	NM_021134.3	NP_066957.3	Q16540	RM23_HUMAN	mitochondrial ribosomal protein L23	18					translation (GO:0006412)	mitochondrial large ribosomal subunit (GO:0005762)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)	p.R18P(1)		large_intestine(2)|lung(1)|ovary(1)	4		all_epithelial(84;6.24e-05)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.0026)|Lung(200;0.0171)|LUSC - Lung squamous cell carcinoma(625;0.0842)		CCACAACTTCGGGTGTTCCGA	0.617																																																1	Substitution - Missense(1)	ovary(1)	11																																								1928740	SO:0001583	missense	6150			AB051340	CCDS31336.1	11p15.5	2012-09-13			ENSG00000214026	ENSG00000214026		"""Mitochondrial ribosomal proteins / large subunits"""	10322	protein-coding gene	gene with protein product		600789		RPL23L		8541832	Standard	NM_021134		Approved	L23MRP	uc001lux.3	Q16540	OTTHUMG00000012476	ENST00000397298.3:c.53G>C	11.37:g.1972164G>C	ENSP00000380466:p.Arg18Pro		1928740	A8MT29|Q96Q71	Missense_Mutation	SNP	ENST00000397298.3	37	CCDS31336.1	.	.	.	.	.	.	.	.	.	.	G	17.82	3.482287	0.63962	.	.	ENSG00000214026	ENST00000397298;ENST00000381519;ENST00000397297;ENST00000381514;ENST00000397294	T;T;T;T;T	0.26223	2.2;2.2;1.9;1.75;1.9	4.46	2.57	0.30868	Ribosomal protein L23/L15e (1);	0.000000	0.64402	U	0.000001	T	0.52533	0.1740	M	0.88031	2.925	0.80722	D	1	D	0.89917	1.0	D	0.74023	0.982	T	0.55347	-0.8155	10	0.52906	T	0.07	.	10.5318	0.44981	0.1605:0.0:0.8395:0.0	.	18	Q16540	RM23_HUMAN	P	18	ENSP00000380466:R18P;ENSP00000370930:R18P;ENSP00000380465:R18P;ENSP00000370925:R18P;ENSP00000380462:R18P	ENSP00000370925:R18P	R	+	2	0	MRPL23	1928740	1.000000	0.71417	0.315000	0.25238	0.727000	0.41649	7.836000	0.86788	0.445000	0.26639	0.491000	0.48974	CGG		0.617	MRPL23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034765.2	NM_021134	
TRIM34	53840	broad.mit.edu	37	11	5653739	5653739	+	Missense_Mutation	SNP	G	G	C			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr11:5653739G>C	ENST00000514226.1	+	2	515	c.178G>C	c.(178-180)Ggt>Cgt	p.G60R	TRIM6-TRIM34_ENST00000457787.2_Missense_Mutation_p.G60R|TRIM34_ENST00000429814.2_Missense_Mutation_p.G60R|HBG2_ENST00000380259.2_Intron|TRIM6-TRIM34_ENST00000354852.5_Missense_Mutation_p.G414R	NM_001003827.1	NP_001003827.1	Q9BYJ4	TRI34_HUMAN	tripartite motif containing 34	60					positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein trimerization (GO:0070206)	cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)	p.G414R(1)|p.G60R(1)		NS(1)|kidney(1)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	17		Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)		Epithelial(150;5.72e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TCCTGTGTGTGGTATCAGTTA	0.512																																																2	Substitution - Missense(2)	ovary(2)	11											142.0	128.0	133.0					11																	5653739		2201	4297	6498	5610315	SO:0001583	missense	53840			AB039902	CCDS31391.1	11p15	2013-01-09	2011-01-25	2001-11-23		ENSG00000258659		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	10063	protein-coding gene	gene with protein product		605684	"""tripartite motif-containing 34"""	RNF21			Standard	NM_130390		Approved			Q9BYJ4	OTTHUMG00000066892	ENST00000514226.1:c.178G>C	11.37:g.5653739G>C	ENSP00000422947:p.Gly60Arg		5610315	D3DQS7|Q9C016|Q9HCR0|Q9HCR1|Q9HCR2	Missense_Mutation	SNP	ENST00000514226.1	37	CCDS31391.1	.	.	.	.	.	.	.	.	.	.	G	5.272	0.235634	0.10023	.	.	ENSG00000258659;ENSG00000258659;ENSG00000258659;ENSG00000258659;ENSG00000258588	ENST00000337072;ENST00000514226;ENST00000429814;ENST00000457787;ENST00000354852	D;D;D;D	0.81821	-1.54;-1.54;-1.54;-1.54	3.26	-1.16	0.09678	Zinc finger, RING/FYVE/PHD-type (1);	0.749095	0.10956	N	0.615493	T	0.33147	0.0853	N	0.00063	-2.32	0.09310	N	1	B;B;B	0.18610	0.001;0.0;0.029	B;B;B	0.17098	0.001;0.001;0.017	T	0.50659	-0.8802	10	0.02654	T	1	.	5.6504	0.17612	0.2102:0.5037:0.286:0.0	.	60;60;414	Q9BYJ4-2;Q9BYJ4;B2RNG4	.;TRI34_HUMAN;.	R	414;60;60;60;414	ENSP00000422947:G60R;ENSP00000402595:G60R;ENSP00000395982:G60R;ENSP00000346916:G414R	ENSP00000402595:G60R	G	+	1	0	TRIM34;TRIM6-TRIM34	5610315	0.000000	0.05858	0.012000	0.15200	0.357000	0.29423	-2.012000	0.01451	-0.209000	0.10156	0.555000	0.69702	GGT		0.512	TRIM34-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143357.2	NM_001003827	
OR5P2	120065	broad.mit.edu	37	11	7818266	7818266	+	Missense_Mutation	SNP	G	G	T			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr11:7818266G>T	ENST00000329434.2	-	1	254	c.224C>A	c.(223-225)cCc>cAc	p.P75H	RP11-35J10.5_ENST00000527565.1_lincRNA	NM_153444.1	NP_703145.1	Q8WZ92	OR5P2_HUMAN	olfactory receptor, family 5, subfamily P, member 2	75						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.P75H(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(4)	22				Epithelial(150;8.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		AAGCATGTTGGGTGTGACAGA	0.438																																																1	Substitution - Missense(1)	ovary(1)	11											86.0	105.0	99.0					11																	7818266		2097	4292	6389	7774842	SO:0001583	missense	120065			AF173006	CCDS7782.1	11p15.4	2012-08-09			ENSG00000183303	ENSG00000183303		"""GPCR / Class A : Olfactory receptors"""	14783	protein-coding gene	gene with protein product							Standard	NM_153444		Approved	JCG3	uc001mfp.1	Q8WZ92	OTTHUMG00000165668	ENST00000329434.2:c.224C>A	11.37:g.7818266G>T	ENSP00000331823:p.Pro75His		7774842	Q3MIS8	Missense_Mutation	SNP	ENST00000329434.2	37	CCDS7782.1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.105354	0.77096	.	.	ENSG00000183303	ENST00000329434	T	0.01871	4.59	5.5	5.5	0.81552	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000005	T	0.22126	0.0533	H	0.96015	3.755	0.53005	D	0.999968	D	0.89917	1.0	D	0.87578	0.998	T	0.09378	-1.0677	10	0.87932	D	0	-74.9713	16.9428	0.86222	0.0:0.0:1.0:0.0	.	75	Q8WZ92	OR5P2_HUMAN	H	75	ENSP00000331823:P75H	ENSP00000331823:P75H	P	-	2	0	OR5P2	7774842	1.000000	0.71417	1.000000	0.80357	0.795000	0.44927	9.377000	0.97184	2.868000	0.98415	0.555000	0.69702	CCC		0.438	OR5P2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385696.1	NM_153444	
HPS5	11234	broad.mit.edu	37	11	18305396	18305396	+	Missense_Mutation	SNP	C	C	T			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr11:18305396C>T	ENST00000349215.3	-	21	3281	c.3004G>A	c.(3004-3006)Gcc>Acc	p.A1002T	HPS5_ENST00000438420.2_Missense_Mutation_p.A888T|HPS5_ENST00000396253.3_Missense_Mutation_p.A888T|HPS5_ENST00000537258.1_Missense_Mutation_p.A109T|HPS5_ENST00000352460.3_5'UTR	NM_181507.1	NP_852608.1	Q9UPZ3	HPS5_HUMAN	Hermansky-Pudlak syndrome 5	1002					blood coagulation (GO:0007596)|organelle organization (GO:0006996)|pigmentation (GO:0043473)	BLOC-2 complex (GO:0031084)		p.A1002T(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(17)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	30						TTGGTGAAGGCCTCTCTTCTT	0.393									Hermansky-Pudlak syndrome																																							1	Substitution - Missense(1)	ovary(1)	11											140.0	135.0	137.0					11																	18305396		2199	4293	6492	18261972	SO:0001583	missense	11234	Familial Cancer Database	HPS, HPS1-8	AB023234	CCDS7836.1, CCDS7837.1	11p14	2014-06-18			ENSG00000110756	ENSG00000110756			17022	protein-coding gene	gene with protein product		607521				10231032, 10094488	Standard	NM_181507		Approved		uc001mod.1	Q9UPZ3	OTTHUMG00000166612	ENST00000349215.3:c.3004G>A	11.37:g.18305396C>T	ENSP00000265967:p.Ala1002Thr		18261972	A8K6J8|A8K8S1|D3DQX9|D3DQY0|O95942|Q8N4U0	Missense_Mutation	SNP	ENST00000349215.3	37	CCDS7836.1	.	.	.	.	.	.	.	.	.	.	C	34	5.364952	0.95877	.	.	ENSG00000110756	ENST00000396253;ENST00000438420;ENST00000349215;ENST00000537258	T;T;T	0.59906	0.27;0.27;0.23	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	T	0.75258	0.3825	L	0.58101	1.795	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.75485	-0.3301	10	0.87932	D	0	.	20.3068	0.98634	0.0:1.0:0.0:0.0	.	1002	Q9UPZ3	HPS5_HUMAN	T	888;888;1002;109	ENSP00000379552:A888T;ENSP00000399590:A888T;ENSP00000265967:A1002T	ENSP00000265967:A1002T	A	-	1	0	HPS5	18261972	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	4.615000	0.61190	2.803000	0.96430	0.591000	0.81541	GCC		0.393	HPS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390808.1	NM_181507	
KCNA4	3739	broad.mit.edu	37	11	30034024	30034024	+	Missense_Mutation	SNP	G	G	C			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr11:30034024G>C	ENST00000328224.6	-	2	1435	c.202C>G	c.(202-204)Cgc>Ggc	p.R68G	KCNA4_ENST00000526518.1_5'Flank	NM_002233.3	NP_002224.1	P22459	KCNA4_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 4	68					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	potassium ion binding (GO:0030955)|voltage-gated potassium channel activity (GO:0005249)	p.R68G(1)		central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(17)|lung(39)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	78					Dalfampridine(DB06637)	CAGGCCCCGCGTGACTGGTGG	0.657																																																1	Substitution - Missense(1)	ovary(1)	11											37.0	39.0	38.0					11																	30034024		1946	4128	6074	29990600	SO:0001583	missense	3739			M55514	CCDS41629.1	11p14	2012-07-05	2002-07-10			ENSG00000182255		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6222	protein-coding gene	gene with protein product		176266	"""potassium voltage-gated channel, shaker-related subfamily, member 4-like"""	KCNA4L		2263489, 16382104	Standard	NM_002233		Approved	Kv1.4, HK1, HPCN2	uc001msk.3	P22459		ENST00000328224.6:c.202C>G	11.37:g.30034024G>C	ENSP00000328511:p.Arg68Gly		29990600		Missense_Mutation	SNP	ENST00000328224.6	37	CCDS41629.1	.	.	.	.	.	.	.	.	.	.	G	15.93	2.979610	0.53827	.	.	ENSG00000182255	ENST00000328224	D	0.97328	-4.34	4.75	4.75	0.60458	Potassium channel, voltage dependent, Kv1.4, tandem inactivation (2);	841.166000	0.00166	N	0.000000	D	0.97309	0.9120	N	0.14661	0.345	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.89804	0.3977	10	0.31617	T	0.26	.	17.7598	0.88461	0.0:0.0:1.0:0.0	.	68	P22459	KCNA4_HUMAN	G	68	ENSP00000328511:R68G	ENSP00000328511:R68G	R	-	1	0	KCNA4	29990600	0.997000	0.39634	0.101000	0.21167	0.514000	0.34195	5.245000	0.65405	2.191000	0.70037	0.491000	0.48974	CGC		0.657	KCNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388074.2	NM_002233	
RAG1	5896	broad.mit.edu	37	11	36597760	36597760	+	Missense_Mutation	SNP	A	A	C			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	A	A	C	C	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr11:36597760A>C	ENST00000299440.5	+	2	3018	c.2906A>C	c.(2905-2907)aAa>aCa	p.K969T		NM_000448.2	NP_000439	P15918	RAG1_HUMAN	recombination activating gene 1	969					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|DNA recombination (GO:0006310)|histone monoubiquitination (GO:0010390)|immune response (GO:0006955)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of thymocyte apoptotic process (GO:0070244)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|pre-B cell allelic exclusion (GO:0002331)|protein autoubiquitination (GO:0051865)|regulation of T cell differentiation (GO:0045580)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|thymus development (GO:0048538)|V(D)J recombination (GO:0033151)	nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|DNA binding (GO:0003677)|endonuclease activity (GO:0004519)|histone binding (GO:0042393)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding (GO:0043565)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.K969T(1)		NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|liver(1)|lung(33)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|urinary_tract(1)	65	all_lung(20;0.226)	all_hematologic(20;0.107)				TCTGGTAACAAACTGTTTAGG	0.463									Familial Hemophagocytic Lymphohistiocytosis																												Pancreas(43;321 1249 3212 48200)|Esophageal Squamous(38;49 1003 17530 24363)											1	Substitution - Missense(1)	ovary(1)	11											98.0	104.0	102.0					11																	36597760		2202	4298	6500	36554336	SO:0001583	missense	5896	Familial Cancer Database	FHLH, FHL, Familial Hemophagocytic Reticulosis, FHR	M29474	CCDS7902.1	11p13	2014-09-17				ENSG00000166349		"""RING-type (C3HC4) zinc fingers"""	9831	protein-coding gene	gene with protein product	"""recombination activating protein 1"", ""RING finger protein 74"", ""V(D)J recombination-activating protein 1"""	179615				1612612, 1283330	Standard	NM_000448		Approved	RNF74, MGC43321	uc001mwu.4	P15918		ENST00000299440.5:c.2906A>C	11.37:g.36597760A>C	ENSP00000299440:p.Lys969Thr		36554336	E9PPC4|Q8IY72|Q8NER2	Missense_Mutation	SNP	ENST00000299440.5	37	CCDS7902.1	.	.	.	.	.	.	.	.	.	.	A	19.28	3.796342	0.70567	.	.	ENSG00000166349	ENST00000299440	T	0.80909	-1.43	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	D	0.87462	0.6183	L	0.59436	1.845	0.80722	D	1	D	0.64830	0.994	D	0.72338	0.977	D	0.86789	0.1984	9	.	.	.	.	16.1825	0.81920	1.0:0.0:0.0:0.0	.	969	P15918	RAG1_HUMAN	T	969	ENSP00000299440:K969T	.	K	+	2	0	RAG1	36554336	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.910000	0.92685	2.281000	0.76405	0.524000	0.50904	AAA		0.463	RAG1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389535.1	NM_000448	
PRPF19	27339	broad.mit.edu	37	11	60668820	60668820	+	Nonsense_Mutation	SNP	C	C	A			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr11:60668820C>A	ENST00000227524.4	-	8	794	c.589G>T	c.(589-591)Gag>Tag	p.E197*		NM_014502.4	NP_055317.1			pre-mRNA processing factor 19									p.E197*(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(10)|ovary(1)|prostate(1)|urinary_tract(1)	22						TTCACCAGCTCCTCAGGCACA	0.542																																																1	Substitution - Nonsense(1)	ovary(1)	11											57.0	55.0	56.0					11																	60668820		2203	4299	6502	60425396	SO:0001587	stop_gained	27339			BC018698	CCDS7995.1	11q12.2	2014-05-20	2013-06-10	2005-04-01	ENSG00000110107	ENSG00000110107		"""WD repeat domain containing"", ""U-box domain containing"""	17896	protein-coding gene	gene with protein product	"""nuclear matrix protein NMP200 related to splicing factor PRP19"", ""psoralen 4"""	608330	"""PRP19/PSO4 homolog (S. cerevisiae)"", ""PRP19/PSO4 pre-mRNA processing factor 19 homolog (S. cerevisiae)"""	PRP19		12960389	Standard	NM_014502		Approved	UBOX4, NMP200, PSO4, hPSO4	uc001nqf.3	Q9UMS4	OTTHUMG00000167798	ENST00000227524.4:c.589G>T	11.37:g.60668820C>A	ENSP00000227524:p.Glu197*		60425396		Nonsense_Mutation	SNP	ENST00000227524.4	37	CCDS7995.1	.	.	.	.	.	.	.	.	.	.	C	38	6.689849	0.97764	.	.	ENSG00000110107	ENST00000227524;ENST00000540473;ENST00000541371	.	.	.	5.91	5.91	0.95273	.	0.139654	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05959	T	0.93	-36.9246	19.9089	0.97019	0.0:1.0:0.0:0.0	.	.	.	.	X	197;26;197	.	ENSP00000227524:E197X	E	-	1	0	PRPF19	60425396	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.259000	0.78381	2.793000	0.96121	0.655000	0.94253	GAG		0.542	PRPF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396334.1	NM_014502	
NUMA1	4926	broad.mit.edu	37	11	71724726	71724726	+	Missense_Mutation	SNP	C	C	T			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr11:71724726C>T	ENST00000393695.3	-	15	4154	c.3823G>A	c.(3823-3825)Gag>Aag	p.E1275K	NUMA1_ENST00000351960.6_Intron|RP11-849H4.4_ENST00000502284.1_RNA|NUMA1_ENST00000358965.6_Missense_Mutation_p.E1275K	NM_006185.2	NP_006176.2			nuclear mitotic apparatus protein 1									p.E1275K(1)		central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(12)|lung(20)|ovary(5)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	65						CTGGCTGTCTCTGCCTGCAGC	0.637			T	RARA	APL																																		Dom	yes		11	11q13	4926	nuclear mitotic apparatus protein 1		L	1	Substitution - Missense(1)	ovary(1)	11											35.0	38.0	37.0					11																	71724726		2200	4293	6493	71402374	SO:0001583	missense	4926			Z11584	CCDS31633.1, CCDS66156.1	11q13	2008-02-05				ENSG00000137497			8059	protein-coding gene	gene with protein product		164009				8406455	Standard	NM_006185		Approved		uc001orl.1	Q14980		ENST00000393695.3:c.3823G>A	11.37:g.71724726C>T	ENSP00000377298:p.Glu1275Lys		71402374		Missense_Mutation	SNP	ENST00000393695.3	37	CCDS31633.1	.	.	.	.	.	.	.	.	.	.	C	18.03	3.532000	0.64972	.	.	ENSG00000137497	ENST00000358965;ENST00000393695;ENST00000359652;ENST00000536544	T;T	0.19105	2.17;2.18	5.14	5.14	0.70334	.	0.000000	0.56097	D	0.000031	T	0.44329	0.1288	L	0.53249	1.67	0.47994	D	0.999566	P;D;D;B	0.89917	0.592;1.0;1.0;0.286	B;D;D;B	0.87578	0.169;0.998;0.998;0.169	T	0.32508	-0.9904	10	0.87932	D	0	.	18.3987	0.90509	0.0:1.0:0.0:0.0	.	1281;759;1275;1275	Q4LE64;Q59HB8;Q14980-2;Q14980	.;.;.;NUMA1_HUMAN	K	1275;1275;838;244	ENSP00000351851:E1275K;ENSP00000377298:E1275K	ENSP00000351851:E1275K	E	-	1	0	NUMA1	71402374	0.985000	0.35326	0.962000	0.40283	0.922000	0.55478	2.986000	0.49370	2.665000	0.90641	0.655000	0.94253	GAG		0.637	NUMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395769.1		
NUMA1	4926	broad.mit.edu	37	11	71725594	71725594	+	Silent	SNP	C	C	A			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr11:71725594C>A	ENST00000393695.3	-	15	3286	c.2955G>T	c.(2953-2955)cgG>cgT	p.R985R	NUMA1_ENST00000351960.6_Intron|RP11-849H4.4_ENST00000502284.1_RNA|NUMA1_ENST00000358965.6_Silent_p.R985R	NM_006185.2	NP_006176.2			nuclear mitotic apparatus protein 1									p.R985R(1)		central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(12)|lung(20)|ovary(5)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	65						TCAGCGCGGCCCGCAGCCGTT	0.687			T	RARA	APL																																		Dom	yes		11	11q13	4926	nuclear mitotic apparatus protein 1		L	1	Substitution - coding silent(1)	ovary(1)	11											60.0	67.0	65.0					11																	71725594		2199	4290	6489	71403242	SO:0001819	synonymous_variant	4926			Z11584	CCDS31633.1, CCDS66156.1	11q13	2008-02-05				ENSG00000137497			8059	protein-coding gene	gene with protein product		164009				8406455	Standard	NM_006185		Approved		uc001orl.1	Q14980		ENST00000393695.3:c.2955G>T	11.37:g.71725594C>A			71403242		Silent	SNP	ENST00000393695.3	37	CCDS31633.1																																																																																				0.687	NUMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395769.1		
OR6X1	390260	broad.mit.edu	37	11	123624729	123624729	+	Silent	SNP	G	G	A			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr11:123624729G>A	ENST00000327930.2	-	1	524	c.498C>T	c.(496-498)ttC>ttT	p.F166F		NM_001005188.1	NP_001005188.1	Q8NH79	OR6X1_HUMAN	olfactory receptor, family 6, subfamily X, member 1	166						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.F166F(1)		breast(3)|endometrium(3)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(2)	23		Breast(109;0.0109)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0279)		TATTGCCACAGAATGGCAACT	0.512																																																1	Substitution - coding silent(1)	ovary(1)	11											93.0	94.0	94.0					11																	123624729		2202	4299	6501	123129939	SO:0001819	synonymous_variant	390260			AB065510	CCDS31695.1	11q24.1	2012-08-09			ENSG00000221931	ENSG00000221931		"""GPCR / Class A : Olfactory receptors"""	14737	protein-coding gene	gene with protein product							Standard	NM_001005188		Approved		uc010rzy.2	Q8NH79	OTTHUMG00000166011	ENST00000327930.2:c.498C>T	11.37:g.123624729G>A			123129939	B9EGW9|Q6IFA0	Silent	SNP	ENST00000327930.2	37	CCDS31695.1																																																																																				0.512	OR6X1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387436.1	NM_001005188	
PKNOX2	63876	broad.mit.edu	37	11	125300009	125300009	+	Silent	SNP	G	G	A			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr11:125300009G>A	ENST00000298282.9	+	12	1435	c.1164G>A	c.(1162-1164)caG>caA	p.Q388Q	PKNOX2_ENST00000530517.1_3'UTR|PKNOX2_ENST00000542175.1_Silent_p.Q324Q	NM_022062.2	NP_071345.2	Q96KN3	PKNX2_HUMAN	PBX/knotted 1 homeobox 2	388					regulation of transcription from RNA polymerase II promoter (GO:0006357)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)	p.Q388Q(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(14)|ovary(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	29		Breast(109;0.00234)|all_lung(97;0.0191)|Lung NSC(97;0.0196)|Medulloblastoma(222;0.0447)|all_neural(223;0.116)		BRCA - Breast invasive adenocarcinoma(274;5.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.117)		TGCAGCAGCAGGGCGGTGCCC	0.622																																																1	Substitution - coding silent(1)	ovary(1)	11											45.0	51.0	49.0					11																	125300009		1933	4133	6066	124805219	SO:0001819	synonymous_variant	63876			AK023136	CCDS41730.1	11q24.2	2014-09-04			ENSG00000165495	ENSG00000165495		"""Homeoboxes / TALE class"""	16714	protein-coding gene	gene with protein product		613066				11549286	Standard	NM_022062		Approved		uc001qbu.3	Q96KN3	OTTHUMG00000165884	ENST00000298282.9:c.1164G>A	11.37:g.125300009G>A			124805219	B7Z5I5|F5GZ15|Q63HL6|Q86XD1	Silent	SNP	ENST00000298282.9	37	CCDS41730.1																																																																																				0.622	PKNOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386866.3		
CCDC77	84318	broad.mit.edu	37	12	549794	549794	+	Silent	SNP	T	T	C			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr12:549794T>C	ENST00000239830.4	+	11	1232	c.1053T>C	c.(1051-1053)gaT>gaC	p.D351D	CCDC77_ENST00000412006.2_Silent_p.D319D|CCDC77_ENST00000422000.1_Silent_p.D319D|CCDC77_ENST00000540180.1_Silent_p.D319D	NM_032358.3	NP_115734.1	Q9BR77	CCD77_HUMAN	coiled-coil domain containing 77	351						centrosome (GO:0005813)|membrane (GO:0016020)		p.D351D(1)		cervix(1)|endometrium(1)|large_intestine(5)|liver(2)|lung(6)|ovary(1)|skin(2)|urinary_tract(1)	19	all_cancers(10;0.0149)|all_epithelial(11;0.035)|all_lung(10;0.111)|Ovarian(42;0.142)|Lung NSC(10;0.156)		OV - Ovarian serous cystadenocarcinoma(31;0.00123)|BRCA - Breast invasive adenocarcinoma(9;0.033)			CCCTAAAAGATAAGTTAGTAC	0.373																																																1	Substitution - coding silent(1)	ovary(1)	12											85.0	81.0	82.0					12																	549794		2203	4300	6503	420055	SO:0001819	synonymous_variant	84318			AK027638	CCDS8503.1, CCDS44781.1	12p13.33	2006-02-16			ENSG00000120647	ENSG00000120647			28203	protein-coding gene	gene with protein product						12477932	Standard	NM_001130148		Approved	MGC13183	uc001qig.3	Q9BR77	OTTHUMG00000129214	ENST00000239830.4:c.1053T>C	12.37:g.549794T>C			420055	B4DDE8	Silent	SNP	ENST00000239830.4	37	CCDS8503.1																																																																																				0.373	CCDC77-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251296.1	NM_032358	
WNK1	65125	broad.mit.edu	37	12	977829	977829	+	Intron	SNP	A	A	G			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr12:977829A>G	ENST00000315939.6	+	9	2782				WNK1_ENST00000530271.2_Silent_p.G1064G|WNK1_ENST00000340908.4_Intron|WNK1_ENST00000535572.1_Intron|WNK1_ENST00000574564.1_Silent_p.G278G|WNK1_ENST00000537687.1_Silent_p.G979G	NM_018979.3	NP_061852.3	Q9H4A3	WNK1_HUMAN	WNK lysine deficient protein kinase 1						intracellular signal transduction (GO:0035556)|ion transport (GO:0006811)|negative regulation of pancreatic juice secretion (GO:0090188)|negative regulation of phosphatase activity (GO:0010923)|neuron development (GO:0048666)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of systemic arterial blood pressure (GO:0003084)|protein phosphorylation (GO:0006468)|regulation of cellular process (GO:0050794)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|phosphatase binding (GO:0019902)|protein kinase inhibitor activity (GO:0004860)|protein serine/threonine kinase activity (GO:0004674)			breast(7)|central_nervous_system(1)|endometrium(3)|kidney(6)|large_intestine(15)|lung(43)|ovary(6)|prostate(3)|skin(7)|stomach(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	104	all_cancers(10;0.00611)|all_epithelial(11;0.00825)|all_lung(10;0.0331)|Ovarian(42;0.0512)|Lung NSC(10;0.0632)		Epithelial(1;1.74e-08)|all cancers(1;7.04e-08)|OV - Ovarian serous cystadenocarcinoma(31;0.000423)|BRCA - Breast invasive adenocarcinoma(9;0.0149)|Colorectal(1;0.0197)			CCTCTTCAGGAGAAGGAGGTG	0.443																																					Colon(19;451 567 6672 12618 28860)											0			12											45.0	45.0	45.0					12																	977829		1925	4126	6051	848090	SO:0001627	intron_variant	378465			AJ296290	CCDS8506.1, CCDS53731.1, CCDS73419.1	12p13.3	2014-09-17	2005-01-19	2005-01-21	ENSG00000060237	ENSG00000060237			14540	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 167"""	605232	"""protein kinase, lysine deficient 1"", ""hereditary sensory neuropathy, type II"""	PRKWNK1, HSN2			Standard	NM_001184985		Approved	HSAN2, PPP1R167	uc031qfk.1	Q9H4A3	OTTHUMG00000090321	ENST00000315939.6:c.2140-2602A>G	12.37:g.977829A>G			848090	A1L4B0|C5HTZ5|C5HTZ6|C5HTZ7|H6WZW3|O15052|P54963|Q4VBX9|Q6IFS5|Q86WL5|Q8N673|Q96CZ6|Q9P1S9	Silent	SNP	ENST00000315939.6	37	CCDS8506.1																																																																																				0.443	WNK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206683.1	NM_018979	
KRT78	196374	broad.mit.edu	37	12	53238393	53238393	+	Nonsense_Mutation	SNP	C	C	A			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr12:53238393C>A	ENST00000304620.4	-	5	934	c.871G>T	c.(871-873)Gag>Tag	p.E291*	KRT78_ENST00000359499.4_Nonsense_Mutation_p.E181*	NM_173352.2	NP_775487.2	Q8N1N4	K2C78_HUMAN	keratin 78	291	Coil 2.|Rod.					extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)	p.E291*(1)		endometrium(1)|kidney(1)|large_intestine(6)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	18						CGGGCGATCTCCTCGTACCGG	0.622																																																1	Substitution - Nonsense(1)	ovary(1)	12											123.0	93.0	103.0					12																	53238393		2203	4300	6503	51524660	SO:0001587	stop_gained	196374			AK096419	CCDS8840.1, CCDS73473.1	12q13.13	2013-06-25			ENSG00000170423	ENSG00000170423		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28926	protein-coding gene	gene with protein product		611159				16831889	Standard	XM_005268695		Approved	K5B	uc001sbc.1	Q8N1N4	OTTHUMG00000169880	ENST00000304620.4:c.871G>T	12.37:g.53238393C>A	ENSP00000306261:p.Glu291*		51524660	A8K4D6|Q5HYM7|Q7RTT2	Nonsense_Mutation	SNP	ENST00000304620.4	37	CCDS8840.1	.	.	.	.	.	.	.	.	.	.	C	13.24	2.179570	0.38511	.	.	ENSG00000170423	ENST00000359499;ENST00000304620;ENST00000539860;ENST00000547110	.	.	.	5.07	2.17	0.27698	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	6.8562	0.24042	0.1323:0.6651:0.1282:0.0744	.	.	.	.	X	181;291;62;62	.	ENSP00000306261:E291X	E	-	1	0	KRT78	51524660	0.770000	0.28543	0.104000	0.21259	0.000000	0.00434	0.689000	0.25437	0.647000	0.30713	-1.112000	0.02068	GAG		0.622	KRT78-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406380.1	NM_173352	
EP400	57634	broad.mit.edu	37	12	132497562	132497562	+	Silent	SNP	C	C	T			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr12:132497562C>T	ENST00000333577.4	+	18	3667	c.3558C>T	c.(3556-3558)gcC>gcT	p.A1186A	EP400_ENST00000332482.4_Silent_p.A1113A|EP400_ENST00000389562.2_Silent_p.A1149A|EP400_ENST00000389561.2_Silent_p.A1150A|EP400_ENST00000330386.6_Silent_p.A1150A			Q96L91	EP400_HUMAN	E1A binding protein p400	1186	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.|Interactions with RUVBL1 and RUVBL2.				chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.A1149A(1)		NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		AGGAGTGGGCCGAACCCAACA	0.562																																																1	Substitution - coding silent(1)	ovary(1)	12											91.0	73.0	79.0					12																	132497562		2203	4300	6503	131063515	SO:0001819	synonymous_variant	57634			U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.3558C>T	12.37:g.132497562C>T			131063515	O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Silent	SNP	ENST00000333577.4	37																																																																																					0.562	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015409	
BRCA2	675	broad.mit.edu	37	13	32914137	32914137	+	Nonsense_Mutation	SNP	C	C	A	rs80358785		TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr13:32914137C>A	ENST00000380152.3	+	11	5878	c.5645C>A	c.(5644-5646)tCa>tAa	p.S1882*	BRCA2_ENST00000544455.1_Nonsense_Mutation_p.S1882*			P51587	BRCA2_HUMAN	breast cancer 2, early onset	1882					brain development (GO:0007420)|cell aging (GO:0007569)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|female gonad development (GO:0008585)|hemopoiesis (GO:0030097)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|inner cell mass cell proliferation (GO:0001833)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|male meiosis I (GO:0007141)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|nucleotide-excision repair (GO:0006289)|oocyte maturation (GO:0001556)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokinesis (GO:0032465)|replication fork protection (GO:0048478)|response to gamma radiation (GO:0010332)|response to UV-C (GO:0010225)|response to X-ray (GO:0010165)|spermatogenesis (GO:0007283)	BRCA2-MAGE-D1 complex (GO:0033593)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|secretory granule (GO:0030141)	gamma-tubulin binding (GO:0043015)|H3 histone acetyltransferase activity (GO:0010484)|H4 histone acetyltransferase activity (GO:0010485)|protease binding (GO:0002020)|single-stranded DNA binding (GO:0003697)	p.S1882*(3)		NS(3)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(32)|liver(1)|lung(41)|oesophagus(5)|ovary(22)|pancreas(4)|prostate(3)|salivary_gland(1)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	183		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		GAGAATAAATCAAAAATTTGC	0.318			"""D, Mis, N, F, S"""		"""breast, ovarian, pancreatic"""	"""breast, ovarian, pancreatic, leukemia  (FANCB, FANCD1)"""		Homologous recombination	Pancreatic Cancer, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Prostate Cancer;Hereditary Breast-Ovarian Cancer, BRCA2 type;Fanconi Anemia type D1, bi-allelic BRCA2 mutations;Fanconi Anemia	TCGA Ovarian(8;0.087)																											Esophageal Squamous(138;838 1285 7957 30353 30468 36915 49332)	yes	Rec	yes	Hereditary breast/ovarian cancer	13	13q12	675	familial breast/ovarian cancer gene 2		"""L, E"""	3	Substitution - Nonsense(3)	endometrium(2)|ovary(1)	13	GRCh37	CM056302|CM980241	BRCA2	M	rs80358785						41.0	41.0	41.0					13																	32914137		2203	4298	6501	31812137	SO:0001587	stop_gained	675	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;HPC; ;FANCD1;Pancytopenia Dysmelia, FA (several complementation groups)	U43746	CCDS9344.1	13q12-q13	2014-09-17	2003-10-14		ENSG00000139618	ENSG00000139618		"""Fanconi anemia, complementation groups"""	1101	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 2"""	600185	"""Fanconi anemia, complementation group D1"""	FANCD1, FACD, FANCD		8091231, 7581463, 15057823	Standard	NM_000059		Approved	FAD, FAD1, BRCC2	uc001uub.1	P51587	OTTHUMG00000017411	ENST00000380152.3:c.5645C>A	13.37:g.32914137C>A	ENSP00000369497:p.Ser1882*		31812137	O00183|O15008|Q13879|Q5TBJ7	Nonsense_Mutation	SNP	ENST00000380152.3	37	CCDS9344.1	.	.	.	.	.	.	.	.	.	.	C	44	10.652856	0.99445	.	.	ENSG00000139618	ENST00000380152;ENST00000544455	.	.	.	5.71	5.71	0.89125	.	0.332700	0.26213	N	0.025673	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.1143	0.59292	0.0:0.9273:0.0:0.0727	.	.	.	.	X	1882	.	ENSP00000369497:S1882X	S	+	2	0	BRCA2	31812137	0.006000	0.16342	0.011000	0.14972	0.016000	0.09150	1.480000	0.35464	2.712000	0.92718	0.650000	0.86243	TCA		0.318	BRCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046000.2	NM_000059	
SLC39A2	29986	broad.mit.edu	37	14	21467686	21467686	+	Silent	SNP	C	C	T			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr14:21467686C>T	ENST00000298681.4	+	1	238	c.81C>T	c.(79-81)atC>atT	p.I27I	SLC39A2_ENST00000554422.1_Silent_p.I27I|RP11-84C10.4_ENST00000557335.1_RNA	NM_014579.3	NP_055394.2	Q9NP94	S39A2_HUMAN	solute carrier family 39 (zinc transporter), member 2	27					transmembrane transport (GO:0055085)|zinc ion transmembrane transport (GO:0071577)|zinc ion transport (GO:0006829)	cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	zinc ion transmembrane transporter activity (GO:0005385)	p.I27I(1)		breast(2)|central_nervous_system(1)|large_intestine(4)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	14	all_cancers(95;0.00267)		OV - Ovarian serous cystadenocarcinoma(11;1.34e-10)|Epithelial(56;1.57e-08)|all cancers(55;7.45e-08)	GBM - Glioblastoma multiforme(265;0.0187)		TTACTCCCATCTGCTTCAAAT	0.517																																																1	Substitution - coding silent(1)	ovary(1)	14											178.0	137.0	151.0					14																	21467686		2203	4300	6503	20537526	SO:0001819	synonymous_variant	29986			AF186081	CCDS9563.1, CCDS58303.1	14q11.1	2013-05-22			ENSG00000165794	ENSG00000165794		"""Solute carriers"""	17127	protein-coding gene	gene with protein product		612166				10681536, 7751801	Standard	NM_014579		Approved	ZIP2	uc001vyr.3	Q9NP94	OTTHUMG00000029616	ENST00000298681.4:c.81C>T	14.37:g.21467686C>T			20537526	B2RC76|G3V5X2|Q4QQJ1|Q4V9S4|Q96JT6|Q9UD20	Silent	SNP	ENST00000298681.4	37	CCDS9563.1																																																																																				0.517	SLC39A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073829.2	NM_014579	
LRRC16B	90668	broad.mit.edu	37	14	24525902	24525902	+	Missense_Mutation	SNP	G	G	C			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr14:24525902G>C	ENST00000342740.5	+	12	1091	c.937G>C	c.(937-939)Gcc>Ccc	p.A313P	LRRC16B_ENST00000334420.7_5'UTR	NM_138360.3	NP_612369.3	Q8ND23	LR16B_HUMAN	leucine rich repeat containing 16B	313						cytoplasm (GO:0005737)		p.A313P(1)		breast(3)|central_nervous_system(2)|cervix(3)|endometrium(7)|kidney(1)|large_intestine(9)|liver(1)|lung(15)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	52				GBM - Glioblastoma multiforme(265;0.019)		GGCCAAGACTGCCATTTCCCC	0.602																																																1	Substitution - Missense(1)	ovary(1)	14											97.0	94.0	95.0					14																	24525902		2203	4300	6503	23595742	SO:0001583	missense	90668			AI017934	CCDS32054.1	14q11.2-q12	2010-09-10	2008-02-12	2008-02-12					20272	protein-coding gene	gene with protein product		614716	"""chromosome 14 open reading frame 121"""	C14orf121		19846667	Standard	NM_138360		Approved	BC008134, crml-1, CARMIL3	uc001wlj.2	Q8ND23		ENST00000342740.5:c.937G>C	14.37:g.24525902G>C	ENSP00000340467:p.Ala313Pro		23595742	Q8TEF7|Q96HS9	Missense_Mutation	SNP	ENST00000342740.5	37	CCDS32054.1	.	.	.	.	.	.	.	.	.	.	G	13.66	2.302344	0.40694	.	.	ENSG00000186648	ENST00000342740	T	0.53206	0.63	5.78	5.78	0.91487	.	0.059292	0.64402	D	0.000002	T	0.43787	0.1263	L	0.47190	1.495	0.80722	D	1	B	0.15473	0.013	B	0.18263	0.021	T	0.19844	-1.0293	10	0.36615	T	0.2	-20.8686	15.5119	0.75789	0.0:0.0:1.0:0.0	.	313	Q8ND23	LR16B_HUMAN	P	313	ENSP00000340467:A313P	ENSP00000340467:A313P	A	+	1	0	LRRC16B	23595742	0.812000	0.29077	1.000000	0.80357	0.997000	0.91878	1.544000	0.36158	2.744000	0.94065	0.563000	0.77884	GCC		0.602	LRRC16B-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416527.1	NM_138360	
LRFN5	145581	broad.mit.edu	37	14	42373367	42373367	+	Nonsense_Mutation	SNP	G	G	T			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr14:42373367G>T	ENST00000298119.4	+	6	3338	c.2149G>T	c.(2149-2151)Gag>Tag	p.E717*	LRFN5_ENST00000554171.1_3'UTR|LRFN5_ENST00000554120.1_Missense_Mutation_p.W464C	NM_152447.3	NP_689660.2	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III domain containing 5	717						integral component of membrane (GO:0016021)		p.E717*(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(67)|ovary(5)|pancreas(3)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(2)	120			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)		tcAGAGGCTGGAGTTAATCTG	0.323										HNSCC(30;0.082)																																						1	Substitution - Nonsense(1)	ovary(1)	14											55.0	56.0	56.0					14																	42373367		2203	4300	6503	41443117	SO:0001587	stop_gained	145581			AK055365	CCDS9678.1	14q21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000165379	ENSG00000165379		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	20360	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 8"""	612811	"""chromosome 14 open reading frame 146"""	C14orf146		16828986	Standard	NM_152447		Approved	FIGLER8, SALM5	uc001wvm.3	Q96NI6	OTTHUMG00000140261	ENST00000298119.4:c.2149G>T	14.37:g.42373367G>T	ENSP00000298119:p.Glu717*		41443117	B3KU78|Q86XL2	Nonsense_Mutation	SNP	ENST00000298119.4	37	CCDS9678.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	47|47	13.499846|13.499846	0.99746|0.99746	.|.	.|.	ENSG00000165379|ENSG00000165379	ENST00000298119|ENST00000554120	.|T	.|0.50548	.|0.74	5.61|5.61	4.7|4.7	0.59300|0.59300	.|.	1.780830|.	0.04243|.	N|.	0.337292|.	.|T	.|0.52725	.|0.1752	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.44050	.|-0.9353	.|5	0.39692|.	T|.	0.17|.	.|.	10.9739|10.9739	0.47454|0.47454	0.0901:0.0:0.9099:0.0|0.0901:0.0:0.9099:0.0	.|.	.|.	.|.	.|.	X|C	717|464	.|ENSP00000451897:W464C	ENSP00000298119:E717X|.	E|W	+|+	1|3	0|0	LRFN5|LRFN5	41443117|41443117	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.851000|0.851000	0.48451|0.48451	1.552000|1.552000	0.36244|0.36244	2.804000|2.804000	0.96469|0.96469	0.462000|0.462000	0.41574|0.41574	GAG|TGG		0.323	LRFN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276786.1	NM_152447	
GOLGA5	9950	broad.mit.edu	37	14	93282701	93282701	+	Missense_Mutation	SNP	G	G	C			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr14:93282701G>C	ENST00000163416.2	+	7	1682	c.1426G>C	c.(1426-1428)Gag>Cag	p.E476Q	GOLGA5_ENST00000355976.2_Missense_Mutation_p.E476Q	NM_005113.2	NP_005104	Q8TBA6	GOGA5_HUMAN	golgin A5	476					Golgi organization (GO:0007030)|Golgi vesicle transport (GO:0048193)	cis-Golgi network (GO:0005801)|Golgi apparatus (GO:0005794)|Golgi cisterna (GO:0031985)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein homodimerization activity (GO:0042803)|Rab GTPase binding (GO:0017137)	p.E476Q(1)		large_intestine(6)|lung(1)|ovary(2)	9		all_cancers(154;0.0934)		COAD - Colon adenocarcinoma(157;0.222)		GCATGAGAAAGAGATGCAGAG	0.458			T	RET	papillary thyroid																																		Dom	yes		14	14q	9950	"""golgi autoantigen, golgin subfamily a, 5  (PTC5)"""		E	1	Substitution - Missense(1)	ovary(1)	14											125.0	121.0	123.0					14																	93282701		2203	4300	6503	92352454	SO:0001583	missense	9950			AF085199	CCDS9905.1	14q32.12	2012-05-04	2010-02-12		ENSG00000066455	ENSG00000066455			4428	protein-coding gene	gene with protein product	"""golgi integral membrane protein 5"""	606918	"""golgi autoantigen, golgin subfamily a, 5"""			2734021, 9443391, 15004235	Standard	NM_005113		Approved	ret-II, golgin-84, rfg5, GOLIM5	uc001yaz.1	Q8TBA6	OTTHUMG00000171217	ENST00000163416.2:c.1426G>C	14.37:g.93282701G>C	ENSP00000163416:p.Glu476Gln		92352454	C9JRU1|O95287|Q03962|Q2TS49|Q9UQQ7	Missense_Mutation	SNP	ENST00000163416.2	37	CCDS9905.1	.	.	.	.	.	.	.	.	.	.	G	25.3	4.625424	0.87560	.	.	ENSG00000066455	ENST00000163416;ENST00000355976;ENST00000439315	T;T	0.47528	0.84;0.84	5.28	5.28	0.74379	.	0.141724	0.31859	N	0.006954	T	0.52837	0.1759	L	0.44542	1.39	0.58432	D	0.999999	D	0.56287	0.975	P	0.50490	0.642	T	0.53493	-0.8431	10	0.49607	T	0.09	-22.6106	18.9031	0.92451	0.0:0.0:1.0:0.0	.	476	Q8TBA6	GOGA5_HUMAN	Q	476;476;385	ENSP00000163416:E476Q;ENSP00000348252:E476Q	ENSP00000163416:E476Q	E	+	1	0	GOLGA5	92352454	1.000000	0.71417	0.994000	0.49952	0.881000	0.50899	8.929000	0.92859	2.459000	0.83118	0.655000	0.94253	GAG		0.458	GOLGA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412365.1		
TMED3	23423	broad.mit.edu	37	15	79606253	79606253	+	Missense_Mutation	SNP	C	C	A			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr15:79606253C>A	ENST00000299705.5	+	2	511	c.323C>A	c.(322-324)aCc>aAc	p.T108N	TMED3_ENST00000536821.1_Missense_Mutation_p.T108N|TMED3_ENST00000424155.2_Missense_Mutation_p.T108N	NM_007364.2	NP_031390.1	Q9Y3Q3	TMED3_HUMAN	transmembrane emp24 protein transport domain containing 3	108	GOLD. {ECO:0000255|PROSITE- ProRule:PRU00096}.				protein transport (GO:0015031)	COPI vesicle coat (GO:0030126)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)		p.T108N(1)		large_intestine(3)|lung(4)|ovary(1)|skin(1)	9						GAGTTTTCCACCTTCTCTCAC	0.498																																																1	Substitution - Missense(1)	ovary(1)	15											165.0	148.0	154.0					15																	79606253		2196	4293	6489	77393308	SO:0001583	missense	23423			BC022232	CCDS10310.1, CCDS73768.1	15q24-q25	2011-02-09	2005-08-26	2005-01-07	ENSG00000166557	ENSG00000166557			28889	protein-coding gene	gene with protein product			"""chromosome 15 open reading frame 22"", ""transmembrane emp24 domain containing 3"""	C15orf22		12975309	Standard	XM_005254263		Approved	p24B	uc002beu.3	Q9Y3Q3	OTTHUMG00000144170	ENST00000299705.5:c.323C>A	15.37:g.79606253C>A	ENSP00000299705:p.Thr108Asn		77393308	A8K069|B4DN05|Q2T9F8	Missense_Mutation	SNP	ENST00000299705.5	37	CCDS10310.1	.	.	.	.	.	.	.	.	.	.	C	25.3	4.621074	0.87460	.	.	ENSG00000166557	ENST00000299705;ENST00000424155;ENST00000536821;ENST00000543455	T;T;T;T	0.18016	2.24;2.24;2.24;2.24	4.7	4.7	0.59300	GOLD (3);	0.000000	0.85682	D	0.000000	T	0.50222	0.1603	M	0.90922	3.16	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.81914	0.995;0.989	T	0.61307	-0.7089	10	0.72032	D	0.01	-38.2212	15.505	0.75731	0.0:1.0:0.0:0.0	.	108;108	B4DN05;Q9Y3Q3	.;TMED3_HUMAN	N	108	ENSP00000299705:T108N;ENSP00000414983:T108N;ENSP00000446062:T108N;ENSP00000440228:T108N	ENSP00000299705:T108N	T	+	2	0	TMED3	77393308	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.246000	0.78247	2.578000	0.87016	0.655000	0.94253	ACC		0.498	TMED3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000291369.1	NM_007364	
MPG	4350	broad.mit.edu	37	16	135510	135510	+	Missense_Mutation	SNP	G	G	T			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr16:135510G>T	ENST00000219431.4	+	5	862	c.631G>T	c.(631-633)Gac>Tac	p.D211Y	NPRL3_ENST00000405960.3_5'Flank|MPG_ENST00000397817.1_Missense_Mutation_p.D194Y	NM_002434.3	NP_002425.2	P29372	3MG_HUMAN	N-methylpurine-DNA glycosylase	211					base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|depurination (GO:0045007)|DNA dealkylation involved in DNA repair (GO:0006307)|DNA repair (GO:0006281)	mitochondrial nucleoid (GO:0042645)|nucleoplasm (GO:0005654)	alkylbase DNA N-glycosylase activity (GO:0003905)|damaged DNA binding (GO:0003684)|DNA-3-methyladenine glycosylase activity (GO:0008725)|DNA-3-methylguanine glycosylase activity (GO:0052822)|DNA-7-methyladenine glycosylase activity (GO:0052821)|DNA-7-methylguanine glycosylase activity (GO:0043916)	p.D211Y(1)		endometrium(4)|kidney(1)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	9		all_cancers(16;9.01e-08)|all_epithelial(16;7.64e-07)|Hepatocellular(780;0.000325)|Lung NSC(18;0.0104)|all_lung(18;0.0239)				TGTCCTCAAGGACCGCGAGCT	0.627								Base excision repair (BER), DNA glycosylases																																								1	Substitution - Missense(1)	ovary(1)	16											46.0	49.0	48.0					16																	135510		2203	4300	6503	75510	SO:0001583	missense	4350				CCDS32345.1, CCDS32346.1, CCDS42087.1	16p13.3	2008-07-29			ENSG00000103152	ENSG00000103152	3.2.2.21		7211	protein-coding gene	gene with protein product	"""alkyladenine DNA glycosylase"""	156565				1874728	Standard	NM_002434		Approved	MDG	uc002cfo.4	P29372	OTTHUMG00000047887	ENST00000219431.4:c.631G>T	16.37:g.135510G>T	ENSP00000219431:p.Asp211Tyr		75510	G5E9E2|Q13770|Q15275|Q15961|Q5J9I4|Q96BZ6|Q96S33|Q9NNX5	Missense_Mutation	SNP	ENST00000219431.4	37	CCDS32346.1	.	.	.	.	.	.	.	.	.	.	G	15.39	2.819717	0.50633	.	.	ENSG00000103152	ENST00000436333;ENST00000397817;ENST00000356432;ENST00000219431	T;T;T;T	0.18016	2.24;2.24;2.24;2.24	5.2	4.24	0.50183	Formyl transferase, C-terminal-like (1);	0.052654	0.85682	D	0.000000	T	0.42787	0.1218	M	0.83774	2.66	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.67548	0.952;0.937	T	0.47573	-0.9107	10	0.72032	D	0.01	-1.2206	13.0129	0.58741	0.0784:0.0:0.9216:0.0	.	206;211	Q5J9I4;P29372	.;3MG_HUMAN	Y	194;194;206;211	ENSP00000388097:D194Y;ENSP00000380918:D194Y;ENSP00000348809:D206Y;ENSP00000219431:D211Y	ENSP00000219431:D211Y	D	+	1	0	MPG	75510	1.000000	0.71417	0.973000	0.42090	0.983000	0.72400	7.904000	0.87408	1.184000	0.42957	0.462000	0.41574	GAC		0.627	MPG-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000109121.4		
GPR97	222487	broad.mit.edu	37	16	57718387	57718387	+	Silent	SNP	T	T	C			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr16:57718387T>C	ENST00000333493.4	+	10	1409	c.1248T>C	c.(1246-1248)tcT>tcC	p.S416S	GPR97_ENST00000327655.6_Silent_p.S206S|GPR97_ENST00000450388.3_Silent_p.S296S|RP11-405F3.4_ENST00000563062.1_RNA	NM_170776.4	NP_740746.4	Q86Y34	GPR97_HUMAN	G protein-coupled receptor 97	416					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.S416S(1)		breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(9)|lung(7)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						ACCGCACCTCTCTGGAGCTGT	0.632																																																1	Substitution - coding silent(1)	ovary(1)	16											46.0	41.0	42.0					16																	57718387		2198	4300	6498	56275888	SO:0001819	synonymous_variant	222487			AY140959	CCDS10786.1	16q13	2014-08-08			ENSG00000182885	ENSG00000182885		"""-"", ""GPCR / Class B : Orphans"""	13728	protein-coding gene	gene with protein product						12435584, 222487	Standard	NM_170776		Approved	Pb99, PGR26	uc002emh.3	Q86Y34	OTTHUMG00000133458	ENST00000333493.4:c.1248T>C	16.37:g.57718387T>C			56275888	Q6ZMF4|Q86SL9|Q8IZF1	Silent	SNP	ENST00000333493.4	37	CCDS10786.1																																																																																				0.632	GPR97-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257333.2	NM_170776	
CDH5	1003	broad.mit.edu	37	16	66413331	66413331	+	Missense_Mutation	SNP	G	G	A			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr16:66413331G>A	ENST00000341529.3	+	2	239	c.91G>A	c.(91-93)Gcc>Acc	p.A31T	CDH5_ENST00000563425.2_Missense_Mutation_p.A31T	NM_001795.3	NP_001786.2	P33151	CADH5_HUMAN	cadherin 5, type 2 (vascular endothelium)	31					adherens junction organization (GO:0034332)|blood vessel maturation (GO:0001955)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|negative regulation of cell proliferation (GO:0008285)|regulation of establishment of cell polarity (GO:2000114)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)|receptor binding (GO:0005102)	p.A31T(1)		central_nervous_system(1)|endometrium(3)|kidney(18)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	54		Ovarian(137;0.0955)		OV - Ovarian serous cystadenocarcinoma(108;0.107)	Lenalidomide(DB00480)	TGCTAACCCTGCCCAACGGGA	0.597																																																1	Substitution - Missense(1)	ovary(1)	16											52.0	56.0	54.0					16																	66413331		2202	4300	6502	64970832	SO:0001583	missense	1003			X79981	CCDS10804.1	16q22.1	2010-01-26	2008-07-25		ENSG00000179776	ENSG00000179776		"""CD molecules"", ""Cadherins / Major cadherins"""	1764	protein-coding gene	gene with protein product	"""VE-cadherin"""	601120	"""cadherin 5, type 2, VE-cadherin (vascular epithelium)"""			2059658	Standard	NM_001795		Approved	7B4, CD144	uc002eom.4	P33151	OTTHUMG00000137495	ENST00000341529.3:c.91G>A	16.37:g.66413331G>A	ENSP00000344115:p.Ala31Thr		64970832	Q4VAI5|Q4VAI6	Missense_Mutation	SNP	ENST00000341529.3	37	CCDS10804.1	.	.	.	.	.	.	.	.	.	.	G	10.49	1.364196	0.24684	.	.	ENSG00000179776	ENST00000341529;ENST00000379531	T	0.55760	0.5	4.38	-3.87	0.04218	.	.	.	.	.	T	0.21509	0.0518	N	0.08118	0	0.09310	N	1	B	0.09022	0.002	B	0.11329	0.006	T	0.21655	-1.0239	9	0.14252	T	0.57	.	1.1093	0.01700	0.396:0.1857:0.2778:0.1405	.	31	P33151	CADH5_HUMAN	T	31	ENSP00000344115:A31T	ENSP00000344115:A31T	A	+	1	0	CDH5	64970832	0.000000	0.05858	0.000000	0.03702	0.191000	0.23601	0.098000	0.15189	-0.192000	0.10432	0.462000	0.41574	GCC		0.597	CDH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268767.1	NM_001795	
COG8	84342	broad.mit.edu	37	16	69373397	69373397	+	Missense_Mutation	SNP	T	T	A			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	T	T	A	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr16:69373397T>A	ENST00000306875.4	-	1	173	c.59A>T	c.(58-60)gAg>gTg	p.E20V	RP11-343C2.7_ENST00000564737.1_Intron|RP11-343C2.9_ENST00000563634.1_Intron|COG8_ENST00000562081.1_Missense_Mutation_p.E20V|NIP7_ENST00000254941.6_5'Flank|NIP7_ENST00000569637.2_5'Flank|NIP7_ENST00000254940.5_5'UTR	NM_032382.4	NP_115758.3	Q96MW5	COG8_HUMAN	component of oligomeric golgi complex 8	20					protein transport (GO:0015031)	Golgi transport complex (GO:0017119)|membrane (GO:0016020)		p.E20V(1)		breast(3)|kidney(1)|large_intestine(2)|ovary(2)|skin(1)	9						ATCCTCCACCTCGCCGAGAGC	0.687																																																1	Substitution - Missense(1)	ovary(1)	16											14.0	14.0	14.0					16																	69373397		2175	4277	6452	67930898	SO:0001583	missense	84342			AK025968	CCDS10876.1	16q22.1	2011-05-31			ENSG00000213380	ENSG00000213380		"""Components of oligomeric golgi complex"""	18623	protein-coding gene	gene with protein product		606979				11980916	Standard	NM_032382		Approved	FLJ22315, DOR1	uc002ewy.2	Q96MW5	OTTHUMG00000154277	ENST00000306875.4:c.59A>T	16.37:g.69373397T>A	ENSP00000305459:p.Glu20Val		67930898	Q0VAK2|Q8WVV6|Q9H6F8	Missense_Mutation	SNP	ENST00000306875.4	37	CCDS10876.1	.	.	.	.	.	.	.	.	.	.	T	15.61	2.884936	0.51908	.	.	ENSG00000213380	ENST00000306875	T	0.50277	0.75	5.23	5.23	0.72850	.	0.155636	0.56097	D	0.000024	T	0.37461	0.1004	L	0.51422	1.61	0.80722	D	1	B;B	0.31125	0.309;0.22	B;B	0.25140	0.039;0.058	T	0.42413	-0.9453	10	0.87932	D	0	-7.0053	6.0555	0.19809	0.1466:0.079:0.0:0.7744	.	47;20	B4DYU2;Q96MW5	.;COG8_HUMAN	V	20	ENSP00000305459:E20V	ENSP00000305459:E20V	E	-	2	0	COG8	67930898	1.000000	0.71417	1.000000	0.80357	0.654000	0.38779	4.181000	0.58303	2.212000	0.71576	0.374000	0.22700	GAG		0.687	COG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268948.2	NM_032382	
TAF1C	9013	broad.mit.edu	37	16	84213193	84213193	+	Missense_Mutation	SNP	G	G	A	rs147204923		TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr16:84213193G>A	ENST00000567759.1	-	14	2146	c.1964C>T	c.(1963-1965)gCa>gTa	p.A655V	TAF1C_ENST00000570117.1_Missense_Mutation_p.A323V|TAF1C_ENST00000378541.4_Missense_Mutation_p.A655V|TAF1C_ENST00000566732.1_Missense_Mutation_p.A629V|TAF1C_ENST00000341690.6_Missense_Mutation_p.A561V|TAF1C_ENST00000541676.1_Missense_Mutation_p.A562V	NM_005679.3	NP_005670	Q15572	TAF1C_HUMAN	TATA box binding protein (TBP)-associated factor, RNA polymerase I, C, 110kDa	655					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)	p.A655V(1)		endometrium(1)|kidney(3)|large_intestine(3)|lung(11)|ovary(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	26						GAAGGTGGGTGCTGTCCACAC	0.667																																																1	Substitution - Missense(1)	ovary(1)	16											26.0	28.0	27.0					16																	84213193		2200	4298	6498	82770694	SO:0001583	missense	9013			L39059	CCDS32496.1, CCDS45535.1, CCDS58488.1, CCDS58489.1	16q24	2008-02-05	2002-08-29			ENSG00000103168			11534	protein-coding gene	gene with protein product		604905	"""TATA box binding protein (TBP)-associated factor, RNA polymerase I, C, 110kD"""			7801123	Standard	NM_005679		Approved	TAFI110, TAFI95, SL1, MGC:39976	uc010vnx.2	Q15572		ENST00000567759.1:c.1964C>T	16.37:g.84213193G>A	ENSP00000455265:p.Ala655Val		82770694	B7Z5K5|B7Z5S4|B7Z908|B7Z9L7|Q59F67|Q8N6V3	Missense_Mutation	SNP	ENST00000567759.1	37	CCDS32496.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	11.25	1.582552	0.28180	.	.	ENSG00000103168	ENST00000378541;ENST00000541676;ENST00000341690;ENST00000544090	T;T;T	0.04317	3.74;3.65;3.65	4.95	1.92	0.25849	.	0.494210	0.17937	N	0.156970	T	0.15176	0.0366	M	0.68317	2.08	0.09310	N	0.999999	D;D;D;D	0.89917	0.999;0.999;1.0;0.996	D;D;D;D	0.85130	0.996;0.996;0.997;0.99	T	0.04347	-1.0958	10	0.56958	D	0.05	-1.8941	6.9279	0.24426	0.2941:0.0:0.7059:0.0	.	629;178;655;561	Q15572-6;F5H0H4;Q15572;Q15572-2	.;.;TAF1C_HUMAN;.	V	655;562;561;178	ENSP00000367802:A655V;ENSP00000437900:A562V;ENSP00000345305:A561V	ENSP00000345305:A561V	A	-	2	0	TAF1C	82770694	0.534000	0.26362	0.106000	0.21319	0.012000	0.07955	1.710000	0.37920	0.148000	0.19059	-0.258000	0.10820	GCA		0.667	TAF1C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000433045.2	NM_139353	
PLD2	5338	broad.mit.edu	37	17	4711106	4711106	+	Silent	SNP	C	C	T			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr17:4711106C>T	ENST00000263088.6	+	2	170	c.39C>T	c.(37-39)gaC>gaT	p.D13D	RP11-81A22.5_ENST00000571067.1_lincRNA|PLD2_ENST00000572940.1_Silent_p.D13D	NM_001243108.1|NM_002663.4	NP_001230037.1|NP_002654.3	O14939	PLD2_HUMAN	phospholipase D2	13					cytoskeleton organization (GO:0007010)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|G-protein coupled receptor internalization (GO:0002031)|glycerophospholipid biosynthetic process (GO:0046474)|innate immune response (GO:0045087)|lipid catabolic process (GO:0016042)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	brush border membrane (GO:0031526)|endoplasmic reticulum membrane (GO:0005789)|plasma membrane (GO:0005886)	N-acylphosphatidylethanolamine-specific phospholipase D activity (GO:0070290)|phosphatidylinositol binding (GO:0035091)|phospholipase D activity (GO:0004630)	p.D13D(1)		autonomic_ganglia(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(3)|large_intestine(3)|lung(10)|ovary(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)	31					Choline(DB00122)	CCACTGGGGACGAACTGGACT	0.627																																																1	Substitution - coding silent(1)	ovary(1)	17											53.0	54.0	54.0					17																	4711106		2203	4300	6503	4658070	SO:0001819	synonymous_variant	5338			AF035483	CCDS11057.1, CCDS58507.1	17p13.3	2008-04-14			ENSG00000129219	ENSG00000129219	3.1.4.4		9068	protein-coding gene	gene with protein product	"""choline phosphatase 2"""	602384				9858823, 9582313	Standard	NM_002663		Approved		uc002fzc.3	O14939	OTTHUMG00000090779	ENST00000263088.6:c.39C>T	17.37:g.4711106C>T			4658070	I3L2C9|O43540|O43579|O43580|Q6PGR0|Q96BY3	Silent	SNP	ENST00000263088.6	37	CCDS11057.1																																																																																				0.627	PLD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207561.3	NM_002663	
ZBTB4	57659	broad.mit.edu	37	17	7366384	7366384	+	Silent	SNP	G	G	A	rs537131535		TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr17:7366384G>A	ENST00000311403.4	-	4	2256	c.1917C>T	c.(1915-1917)gaC>gaT	p.D639D	ZBTB4_ENST00000380599.4_Silent_p.D639D	NM_020899.3	NP_065950.2	Q9P1Z0	ZBTB4_HUMAN	zinc finger and BTB domain containing 4	639	Glu-rich.				cellular response to DNA damage stimulus (GO:0006974)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|methyl-CpG binding (GO:0008327)|methyl-CpNpG binding (GO:0010428)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|sequence-specific DNA binding (GO:0043565)	p.D639D(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(7)|kidney(1)|large_intestine(4)|lung(7)|ovary(3)|prostate(3)|skin(6)	36		Colorectal(1115;3.46e-05)|Myeloproliferative disorder(207;0.0255)		COAD - Colon adenocarcinoma(228;4.1e-06)|READ - Rectum adenocarcinoma(115;0.0642)		cctcctcttcgtcctcctcac	0.602													G|||	1	0.000199681	0.0	0.0	5008	,	,		16945	0.0		0.0	False		,,,				2504	0.001															1	Substitution - coding silent(1)	ovary(1)	17											59.0	40.0	46.0					17																	7366384		2203	4300	6503	7307108	SO:0001819	synonymous_variant	57659			AB040971	CCDS11107.1	17p13.2	2013-01-09			ENSG00000174282	ENSG00000174282		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	23847	protein-coding gene	gene with protein product		612308				12477932	Standard	NM_020899		Approved	KIAA1538, KAISO-L1, ZNF903	uc002ghd.4	Q9P1Z0	OTTHUMG00000108137	ENST00000311403.4:c.1917C>T	17.37:g.7366384G>A			7307108	B3KVL6|Q7Z697|Q86XJ4|Q8N4V8	Silent	SNP	ENST00000311403.4	37	CCDS11107.1																																																																																				0.602	ZBTB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226940.2	NM_020899	
TP53	7157	broad.mit.edu	37	17	7577511	7577511	+	Missense_Mutation	SNP	A	A	T	rs28934577		TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr17:7577511A>T	ENST00000269305.4	-	7	959	c.770T>A	c.(769-771)cTg>cAg	p.L257Q	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Missense_Mutation_p.L257Q|TP53_ENST00000455263.2_Missense_Mutation_p.L257Q|TP53_ENST00000359597.4_Missense_Mutation_p.L257Q|TP53_ENST00000420246.2_Missense_Mutation_p.L257Q|TP53_ENST00000413465.2_Missense_Mutation_p.L257Q	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	257	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		L -> P (in sporadic cancers; somatic mutation).|L -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs28934577).|L -> R (in sporadic cancers; somatic mutation).|L -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.L257Q(8)|p.L257P(8)|p.L257fs*6(2)|p.?(1)|p.T256fs*87(1)|p.L257R(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGAGTCTTCCAGTGTGATGAT	0.582		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	29	Substitution - Missense(17)|Whole gene deletion(8)|Deletion - Frameshift(3)|Unknown(1)	large_intestine(4)|oesophagus(4)|bone(4)|haematopoietic_and_lymphoid_tissue(3)|ovary(3)|central_nervous_system(2)|liver(2)|upper_aerodigestive_tract(1)|stomach(1)|biliary_tract(1)|kidney(1)|breast(1)|skin(1)|pancreas(1)	17	GRCh37	CD941800|CM941332	TP53	D|M	rs28934577						139.0	99.0	113.0					17																	7577511		2203	4300	6503	7518236	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.770T>A	17.37:g.7577511A>T	ENSP00000269305:p.Leu257Gln		7518236	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	A	16.07	3.019080	0.54576	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D;D	0.99905	-7.7;-7.7;-7.7;-7.7;-7.7;-7.7;-7.7	4.62	3.53	0.40419	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.64402	D	0.000001	D	0.99891	0.9948	M	0.88640	2.97	0.58432	A	0.999999	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.997;1.0;0.999;0.998;1.0	D	0.96301	0.9221	9	0.87932	D	0	-7.3975	9.0966	0.36642	0.8362:0.0:0.0:0.1638	rs28934577	257;257;257;257;257	P04637-2;P04637-3;P04637;Q1MSW8;E7EQX7	.;.;P53_HUMAN;.;.	Q	257;257;257;257;257;257;246;125	ENSP00000410739:L257Q;ENSP00000352610:L257Q;ENSP00000269305:L257Q;ENSP00000398846:L257Q;ENSP00000391127:L257Q;ENSP00000391478:L257Q;ENSP00000425104:L125Q	ENSP00000269305:L257Q	L	-	2	0	TP53	7518236	1.000000	0.71417	0.981000	0.43875	0.405000	0.30901	9.087000	0.94110	0.889000	0.36185	0.379000	0.24179	CTG		0.582	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
MYH2	4620	broad.mit.edu	37	17	10442604	10442604	+	Missense_Mutation	SNP	C	C	T	rs201040489		TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr17:10442604C>T	ENST00000245503.5	-	14	1718	c.1334G>A	c.(1333-1335)cGc>cAc	p.R445H	MYH2_ENST00000532183.2_Missense_Mutation_p.R445H|CTC-297N7.11_ENST00000587182.2_RNA|MYH2_ENST00000397183.2_Missense_Mutation_p.R445H|RP11-799N11.1_ENST00000399342.2_RNA	NM_017534.5	NP_060004.3	Q9UKX2	MYH2_HUMAN	myosin, heavy chain 2, skeletal muscle, adult	445	Myosin motor.				Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|plasma membrane repair (GO:0001778)|response to activity (GO:0014823)	A band (GO:0031672)|actomyosin contractile ring (GO:0005826)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|protein complex (GO:0043234)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)	p.R445H(3)		NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(99)|ovary(6)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(4)	176						CTGGTTGATGCGGGCAACCAT	0.473													C|||	1	0.000199681	0.0	0.0	5008	,	,		18714	0.001		0.0	False		,,,				2504	0.0															3	Substitution - Missense(3)	biliary_tract(1)|ovary(1)|breast(1)	17						C	HIS/ARG,HIS/ARG	0,4406		0,0,2203	172.0	166.0	168.0		1334,1334	5.4	1.0	17		168	2,8598	2.2+/-6.3	0,2,4298	yes	missense,missense	MYH2	NM_001100112.1,NM_017534.5	29,29	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	probably-damaging,probably-damaging	445/1942,445/1942	10442604	2,13004	2203	4300	6503	10383329	SO:0001583	missense	4620				CCDS11156.1	17p13.1	2014-02-04	2006-09-29		ENSG00000125414	ENSG00000125414		"""Myosins / Myosin superfamily : Class II"""	7572	protein-coding gene	gene with protein product		160740	"""myosin, heavy polypeptide 2, skeletal muscle, adult"", ""inclusion body myopathy 3, autosomal dominant"""	IBM3		7545970, 11889243	Standard	NM_001100112		Approved	MYH2A, MYHSA2, MyHC-IIa, MYHas8, MyHC-2A	uc010coi.3	Q9UKX2	OTTHUMG00000130363	ENST00000245503.5:c.1334G>A	17.37:g.10442604C>T	ENSP00000245503:p.Arg445His		10383329	A0AVL4|Q14322|Q16229|Q567P6|Q86T56	Missense_Mutation	SNP	ENST00000245503.5	37	CCDS11156.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	35	5.437302	0.96168	0.0	2.33E-4	ENSG00000125414	ENST00000532183;ENST00000245503;ENST00000397183	D;D;D	0.88741	-2.42;-2.42;-2.42	5.43	5.43	0.79202	Myosin head, motor domain (2);	0.000000	0.40144	U	0.001168	D	0.95796	0.8632	M	0.91561	3.22	0.58432	D	0.999998	D;D	0.76494	0.999;0.999	D;D	0.87578	0.998;0.985	D	0.96516	0.9382	10	0.87932	D	0	.	18.2166	0.89887	0.0:1.0:0.0:0.0	.	445;445	Q567P6;Q9UKX2	.;MYH2_HUMAN	H	445	ENSP00000433944:R445H;ENSP00000245503:R445H;ENSP00000380367:R445H	ENSP00000245503:R445H	R	-	2	0	MYH2	10383329	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.818000	0.86416	2.547000	0.85894	0.585000	0.79938	CGC		0.473	MYH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252726.3	NM_017534	
SGCA	6442	broad.mit.edu	37	17	48245919	48245919	+	Missense_Mutation	SNP	G	G	C			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr17:48245919G>C	ENST00000262018.3	+	5	606	c.570G>C	c.(568-570)gaG>gaC	p.E190D	HILS1_ENST00000504307.1_RNA|SGCA_ENST00000543315.1_Missense_Mutation_p.E190D|SGCA_ENST00000513942.1_3'UTR|SGCA_ENST00000344627.6_Missense_Mutation_p.E190D|SGCA_ENST00000451235.2_Missense_Mutation_p.E88D	NM_000023.2	NP_000014.1	Q16586	SGCA_HUMAN	sarcoglycan, alpha (50kDa dystrophin-associated glycoprotein)	190					muscle contraction (GO:0006936)|muscle organ development (GO:0007517)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|sarcoglycan complex (GO:0016012)|sarcolemma (GO:0042383)	calcium ion binding (GO:0005509)	p.E190D(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|lung(7)|ovary(2)|skin(1)	14						TTCCCATTGAGGGCCGAAAAG	0.597																																																1	Substitution - Missense(1)	ovary(1)	17											22.0	23.0	23.0					17																	48245919		2197	4295	6492	45600918	SO:0001583	missense	6442			L34355	CCDS32679.1, CCDS45729.1	17q21	2014-09-17	2002-08-29		ENSG00000108823	ENSG00000108823			10805	protein-coding gene	gene with protein product	"""50kD DAG"", ""Sarcoglycan, alpha (50kD dystrophin-associated glycoprotein; adhalin)"", ""adhalin (limb girdle muscular dystrophy 2D)"""	600119	"""sarcoglycan, alpha (50kD dystrophin-associated glycoprotein)"""	ADL		7937874	Standard	NM_000023		Approved	SCARMD1, LGMD2D, adhalin, DMDA2, A2	uc002iqi.3	Q16586	OTTHUMG00000162024	ENST00000262018.3:c.570G>C	17.37:g.48245919G>C	ENSP00000262018:p.Glu190Asp		45600918	A6NEB8|A8K3K7|Q13710|Q13712	Missense_Mutation	SNP	ENST00000262018.3	37	CCDS32679.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.90|13.90	2.373909|2.373909	0.42105|0.42105	.|.	.|.	ENSG00000108823|ENSG00000108823	ENST00000344627;ENST00000262018;ENST00000543315;ENST00000451235;ENST00000511303|ENST00000504073	D;D;D;D;D|.	0.97710|.	-4.5;-4.5;-4.5;-4.5;-4.5|.	4.58|4.58	0.227|0.227	0.15359|0.15359	.|.	0.313613|.	0.28425|.	N|.	0.015385|.	T|T	0.45558|0.45558	0.1348|0.1348	L|L	0.54323|0.54323	1.7|1.7	0.30378|0.30378	N|N	0.782263|0.782263	P;D;P|.	0.58620|.	0.912;0.983;0.549|.	P;P;P|.	0.53102|.	0.672;0.718;0.5|.	T|T	0.48479|0.48479	-0.9032|-0.9032	10|5	0.16896|.	T|.	0.51|.	-6.7071|-6.7071	7.6175|7.6175	0.28167|0.28167	0.485:0.0:0.515:0.0|0.485:0.0:0.515:0.0	.|.	88;190;190|.	B7Z1L1;Q16586-2;Q16586|.	.;.;SGCA_HUMAN|.	D|R	190;190;190;88;97|13	ENSP00000345522:E190D;ENSP00000262018:E190D;ENSP00000444539:E190D;ENSP00000390371:E88D;ENSP00000426104:E97D|.	ENSP00000262018:E190D|.	E|G	+|+	3|1	2|0	SGCA|SGCA	45600918|45600918	0.916000|0.916000	0.31088|0.31088	0.954000|0.954000	0.39281|0.39281	0.783000|0.783000	0.44284|0.44284	0.008000|0.008000	0.13197|0.13197	0.130000|0.130000	0.18549|0.18549	0.462000|0.462000	0.41574|0.41574	GAG|GGG		0.597	SGCA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366841.1	NM_000023	
SLC25A23	79085	broad.mit.edu	37	19	6454349	6454349	+	Missense_Mutation	SNP	G	G	T	rs192489049		TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr19:6454349G>T	ENST00000301454.4	-	6	886	c.780C>A	c.(778-780)ttC>ttA	p.F260L	SLC25A23_ENST00000414491.2_Missense_Mutation_p.F77L|SLC25A23_ENST00000334510.5_Missense_Mutation_p.F260L	NM_024103.2	NP_077008.2	Q9BV35	SCMC3_HUMAN	solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 23	260					adenine nucleotide transport (GO:0051503)|cellular response to calcium ion (GO:0071277)|regulation of cellular respiration (GO:0043457)|regulation of oxidative phosphorylation (GO:0002082)|regulation of sequestering of calcium ion (GO:0051282)|transmembrane transport (GO:0055085)|urea homeostasis (GO:0097274)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	calcium ion binding (GO:0005509)	p.F260L(1)		endometrium(3)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|pancreas(1)|skin(1)	17						CATAGGCCATGAACTTGATAG	0.547													G|||	1	0.000199681	0.0	0.0014	5008	,	,		21400	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	19											132.0	129.0	130.0					19																	6454349		2203	4300	6503	6405349	SO:0001583	missense	79085			AJ619962	CCDS32882.1	19p13.1	2014-02-06			ENSG00000125648	ENSG00000125648		"""Solute carriers"", ""EF-hand domain containing"""	19375	protein-coding gene	gene with protein product		608746				15123600	Standard	NM_024103		Approved	FLJ30339, MGC2615, APC2	uc002mex.1	Q9BV35	OTTHUMG00000180852	ENST00000301454.4:c.780C>A	19.37:g.6454349G>T	ENSP00000301454:p.Phe260Leu		6405349	B4DGB6|Q4LBC2|Q705K3|Q86Y43|Q8N2N4|Q96NQ4	Missense_Mutation	SNP	ENST00000301454.4	37	CCDS32882.1	4	0.0018315018315018315	1	0.0020325203252032522	2	0.0055248618784530384	1	0.0017482517482517483	0	0.0	G	21.8	4.208727	0.79240	.	.	ENSG00000125648	ENST00000264088;ENST00000301454;ENST00000414491;ENST00000334510	D;D;D;D	0.83673	-1.75;-1.75;-1.75;-1.75	5.79	4.75	0.60458	Mitochondrial carrier domain (2);	0.000000	0.85682	D	0.000000	D	0.88317	0.6404	M	0.84511	2.7	0.58432	D	0.999999	D;D	0.60575	0.988;0.975	D;P	0.67382	0.951;0.883	D	0.90209	0.4263	10	0.87932	D	0	-34.024	14.2557	0.66051	0.0746:0.0:0.9254:0.0	.	77;260	E7ESZ5;Q9BV35	.;SCMC3_HUMAN	L	307;260;77;260	ENSP00000264088:F307L;ENSP00000301454:F260L;ENSP00000408814:F77L;ENSP00000334537:F260L	ENSP00000264088:F307L	F	-	3	2	SLC25A23	6405349	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	4.481000	0.60250	2.748000	0.94277	0.655000	0.94253	TTC		0.547	SLC25A23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453325.1	NM_024103	
OR7D4	125958	broad.mit.edu	37	19	9325271	9325271	+	Missense_Mutation	SNP	C	C	T			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr19:9325271C>T	ENST00000308682.2	-	1	271	c.243G>A	c.(241-243)atG>atA	p.M81I		NM_001005191.2	NP_001005191.1	Q8NG98	OR7D4_HUMAN	olfactory receptor, family 7, subfamily D, member 4	81						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.M81I(1)		breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(10)|ovary(2)|skin(3)|stomach(1)	26						TGCTCACTAGCATCTTGGGGA	0.498																																																1	Substitution - Missense(1)	ovary(1)	19											80.0	73.0	75.0					19																	9325271		2203	4300	6503	9186271	SO:0001583	missense	125958				CCDS32901.1	19p13.2	2013-12-17		2004-03-10	ENSG00000174667	ENSG00000174667		"""GPCR / Class A : Olfactory receptors"""	8380	protein-coding gene	gene with protein product		611538		OR7D4P			Standard	NM_001005191		Approved	hg105, OR19-B	uc002mla.2	Q8NG98	OTTHUMG00000179936	ENST00000308682.2:c.243G>A	19.37:g.9325271C>T	ENSP00000310488:p.Met81Ile		9186271	A8CAH8|A8CAH9|A8CAI0|A8CAI1|B9EH79	Missense_Mutation	SNP	ENST00000308682.2	37	CCDS32901.1	.	.	.	.	.	.	.	.	.	.	C	4.701	0.130277	0.08981	.	.	ENSG00000174667	ENST00000308682	T	0.05513	3.43	3.86	2.82	0.32997	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000001	T	0.10121	0.0248	M	0.85099	2.735	0.09310	N	0.999999	B	0.22851	0.076	B	0.27608	0.081	T	0.27971	-1.0058	10	0.62326	D	0.03	.	2.8288	0.05494	0.1818:0.5367:0.177:0.1045	.	81	Q8NG98	OR7D4_HUMAN	I	81	ENSP00000310488:M81I	ENSP00000310488:M81I	M	-	3	0	OR7D4	9186271	0.176000	0.23096	0.098000	0.21074	0.010000	0.07245	0.269000	0.18589	0.988000	0.38734	0.436000	0.28706	ATG		0.498	OR7D4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449004.1		
BST2	684	broad.mit.edu	37	19	17515202	17515202	+	Missense_Mutation	SNP	T	T	G			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	T	T	G	G	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr19:17515202T>G	ENST00000252593.6	-	2	402	c.330A>C	c.(328-330)caA>caC	p.Q110H	CTD-2521M24.9_ENST00000500836.2_lincRNA|BST2_ENST00000527220.1_Intron	NM_004335.2	NP_004326.1	Q10589	BST2_HUMAN	bone marrow stromal cell antigen 2	110					B cell activation (GO:0042113)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|multicellular organismal development (GO:0007275)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of intracellular transport of viral material (GO:1901253)|negative regulation of plasmacytoid dendritic cell cytokine production (GO:0002737)|negative regulation of viral genome replication (GO:0045071)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of actin cytoskeleton organization (GO:0032956)|response to interferon-alpha (GO:0035455)|response to interferon-beta (GO:0035456)|response to interferon-gamma (GO:0034341)|response to virus (GO:0009615)|signal transduction (GO:0007165)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	metalloendopeptidase inhibitor activity (GO:0008191)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|signal transducer activity (GO:0004871)	p.Q110H(1)		endometrium(1)|large_intestine(2)|lung(1)|ovary(3)|prostate(2)	9						CCACTTTCTTTTGTCCTTGGG	0.592																																																1	Substitution - Missense(1)	ovary(1)	19											109.0	112.0	111.0					19																	17515202		2203	4300	6503	17376202	SO:0001583	missense	684				CCDS12358.1	19p13.2	2009-10-30				ENSG00000130303		"""CD molecules"""	1119	protein-coding gene	gene with protein product		600534				7607676	Standard	NM_004335		Approved	CD317, tetherin	uc002ngl.3	Q10589		ENST00000252593.6:c.330A>C	19.37:g.17515202T>G	ENSP00000252593:p.Gln110His		17376202	A8K4Y4|Q53G07	Missense_Mutation	SNP	ENST00000252593.6	37	CCDS12358.1	.	.	.	.	.	.	.	.	.	.	T	10.74	1.435452	0.25813	.	.	ENSG00000130303	ENST00000416178;ENST00000252593	T	0.78924	-1.22	2.29	-3.93	0.04143	.	.	.	.	.	T	0.53481	0.1799	N	0.19112	0.55	0.09310	N	1	P	0.45594	0.862	B	0.36092	0.217	T	0.51458	-0.8703	9	0.72032	D	0.01	-2.8422	3.3935	0.07298	0.0:0.3425:0.2117:0.4458	.	110	Q10589	BST2_HUMAN	H	110	ENSP00000252593:Q110H	ENSP00000252593:Q110H	Q	-	3	2	BST2	17376202	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.424000	0.07025	-0.591000	0.05859	-0.608000	0.04076	CAA		0.592	BST2-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000387346.1	NM_004335	
CD22	933	broad.mit.edu	37	19	35828898	35828898	+	Missense_Mutation	SNP	C	C	T			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr19:35828898C>T	ENST00000085219.5	+	5	1025	c.959C>T	c.(958-960)tCg>tTg	p.S320L	CD22_ENST00000594250.1_Intron|CD22_ENST00000341773.6_Intron|CD22_ENST00000536635.2_Missense_Mutation_p.S320L|CD22_ENST00000270311.6_Missense_Mutation_p.S200L|CD22_ENST00000419549.2_Missense_Mutation_p.S148L|CD22_ENST00000544992.2_Missense_Mutation_p.S320L	NM_001771.3	NP_001762.2	P20273	CD22_HUMAN	CD22 molecule	320	Ig-like C2-type 2.				cell adhesion (GO:0007155)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)	p.S320L(1)		breast(2)|endometrium(2)|kidney(3)|large_intestine(14)|lung(21)|ovary(5)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	54	all_lung(56;9.78e-09)|Lung NSC(56;1.46e-08)|Esophageal squamous(110;0.162)		Epithelial(14;5.83e-19)|OV - Ovarian serous cystadenocarcinoma(14;3.19e-18)|all cancers(14;3.41e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)			CCGGGAAGGTCGGAAGAAGTG	0.612																																					Ovarian(42;1009 1133 23674 26041)											1	Substitution - Missense(1)	ovary(1)	19											86.0	59.0	68.0					19																	35828898		2203	4300	6503	40520738	SO:0001583	missense	933			X52785	CCDS12457.1, CCDS54247.1, CCDS54248.1, CCDS54249.1, CCDS62634.1	19q13.1	2013-01-29	2006-03-28		ENSG00000012124	ENSG00000012124		"""CD molecules"", ""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1643	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 2"""	107266	"""CD22 antigen"""			8496602, 1691828	Standard	NM_001185099		Approved	SIGLEC-2, SIGLEC2	uc010edt.3	P20273		ENST00000085219.5:c.959C>T	19.37:g.35828898C>T	ENSP00000085219:p.Ser320Leu		40520738	F5GYU4|F5H7U3|O95699|O95701|O95702|O95703|Q01665|Q32M46|Q92872|Q92873|Q9UQA6|Q9UQA7|Q9UQA8|Q9UQA9|Q9UQB0|Q9Y2A6	Missense_Mutation	SNP	ENST00000085219.5	37	CCDS12457.1	.	.	.	.	.	.	.	.	.	.	C	18.72	3.684301	0.68157	.	.	ENSG00000012124	ENST00000085219;ENST00000536635;ENST00000544992;ENST00000270311;ENST00000419549	T;T;T;T;T	0.19938	2.11;2.11;2.11;2.11;2.11	4.81	4.81	0.61882	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.44688	D	0.000428	T	0.50137	0.1598	M	0.86502	2.82	0.09310	N	0.999993	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.997;0.999;0.999;1.0	T	0.48328	-0.9045	10	0.45353	T	0.12	.	13.3983	0.60868	0.0:1.0:0.0:0.0	.	148;320;320;320	Q32M46;F5GYU4;F5H7U3;P20273	.;.;.;CD22_HUMAN	L	320;320;320;200;148	ENSP00000085219:S320L;ENSP00000442279:S320L;ENSP00000441237:S320L;ENSP00000270311:S200L;ENSP00000403822:S148L	ENSP00000085219:S320L	S	+	2	0	CD22	40520738	0.868000	0.29978	0.034000	0.17996	0.002000	0.02628	3.790000	0.55461	2.225000	0.72522	0.467000	0.42956	TCG		0.612	CD22-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466099.1	NM_001771	
CD22	933	broad.mit.edu	37	19	35836609	35836609	+	Missense_Mutation	SNP	C	C	G			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr19:35836609C>G	ENST00000085219.5	+	12	2379	c.2313C>G	c.(2311-2313)aaC>aaG	p.N771K	CD22_ENST00000594250.1_Missense_Mutation_p.N594K|CD22_ENST00000341773.6_Missense_Mutation_p.N594K|CD22_ENST00000536635.2_Missense_Mutation_p.N683K|CD22_ENST00000270311.6_Intron|MIR5196_ENST00000578146.1_RNA|CD22_ENST00000419549.2_Missense_Mutation_p.N599K|CD22_ENST00000544992.2_Intron	NM_001771.3	NP_001762.2	P20273	CD22_HUMAN	CD22 molecule	771					cell adhesion (GO:0007155)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)	p.N771K(1)		breast(2)|endometrium(2)|kidney(3)|large_intestine(14)|lung(21)|ovary(5)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	54	all_lung(56;9.78e-09)|Lung NSC(56;1.46e-08)|Esophageal squamous(110;0.162)		Epithelial(14;5.83e-19)|OV - Ovarian serous cystadenocarcinoma(14;3.19e-18)|all cancers(14;3.41e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)			CCGAGATGAACATACCACGAA	0.602																																					Ovarian(42;1009 1133 23674 26041)											1	Substitution - Missense(1)	ovary(1)	19											142.0	125.0	131.0					19																	35836609		2203	4300	6503	40528449	SO:0001583	missense	933			X52785	CCDS12457.1, CCDS54247.1, CCDS54248.1, CCDS54249.1, CCDS62634.1	19q13.1	2013-01-29	2006-03-28		ENSG00000012124	ENSG00000012124		"""CD molecules"", ""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1643	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 2"""	107266	"""CD22 antigen"""			8496602, 1691828	Standard	NM_001185099		Approved	SIGLEC-2, SIGLEC2	uc010edt.3	P20273		ENST00000085219.5:c.2313C>G	19.37:g.35836609C>G	ENSP00000085219:p.Asn771Lys		40528449	F5GYU4|F5H7U3|O95699|O95701|O95702|O95703|Q01665|Q32M46|Q92872|Q92873|Q9UQA6|Q9UQA7|Q9UQA8|Q9UQA9|Q9UQB0|Q9Y2A6	Missense_Mutation	SNP	ENST00000085219.5	37	CCDS12457.1	.	.	.	.	.	.	.	.	.	.	C	10.69	1.422215	0.25639	.	.	ENSG00000012124	ENST00000085219;ENST00000536635;ENST00000341773;ENST00000419549	T;T;T;T	0.53423	1.07;0.68;0.62;1.15	4.01	-1.15	0.09709	.	0.644446	0.13733	N	0.366521	T	0.34745	0.0908	L	0.36672	1.1	0.09310	N	1	B;P;B;D	0.56035	0.255;0.628;0.255;0.974	B;B;B;P	0.51415	0.024;0.184;0.053;0.669	T	0.31779	-0.9931	10	0.07813	T	0.8	.	3.0524	0.06173	0.1903:0.4757:0.0:0.334	.	599;683;771;594	Q32M46;F5H7U3;P20273;P20273-2	.;.;CD22_HUMAN;.	K	771;683;594;599	ENSP00000085219:N771K;ENSP00000442279:N683K;ENSP00000339349:N594K;ENSP00000403822:N599K	ENSP00000085219:N771K	N	+	3	2	CD22	40528449	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.078000	0.11375	0.104000	0.17725	-0.448000	0.05591	AAC		0.602	CD22-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466099.1	NM_001771	
ZNF112	7771	broad.mit.edu	37	19	44831844	44831844	+	Silent	SNP	T	T	C			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr19:44831844T>C	ENST00000337401.4	-	5	2572	c.2484A>G	c.(2482-2484)acA>acG	p.T828T	ZNF112_ENST00000536500.1_Silent_p.T845T|ZNF112_ENST00000354340.4_Silent_p.T822T	NM_001083335.1	NP_001076804.1	Q9UJU3	ZN112_HUMAN	zinc finger protein 112	828					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.T822T(1)									GTTTCTCTCCTGTGTGGACTC	0.463																																																1	Substitution - coding silent(1)	ovary(1)	19											148.0	146.0	147.0					19																	44831844		2203	4300	6503	49523684	SO:0001819	synonymous_variant	7771			AF198358		19q13.2	2014-02-06	2012-11-27		ENSG00000062370	ENSG00000062370		"""Zinc fingers, C2H2-type"""	12892	protein-coding gene	gene with protein product		603994	"""zinc finger protein 112 homolog (mouse)"", ""zinc finger protein 228"""	ZFP112, ZNF228			Standard	NM_013380		Approved			Q9UJU3	OTTHUMG00000182357	ENST00000337401.4:c.2484A>G	19.37:g.44831844T>C			49523684	A4FU53|Q9HCA7	Silent	SNP	ENST00000337401.4	37	CCDS54276.1																																																																																				0.463	ZNF112-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460744.1	NM_013380	
GRIN2D	2906	broad.mit.edu	37	19	48917363	48917363	+	Splice_Site	SNP	G	G	C			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr19:48917363G>C	ENST00000263269.3	+	4	1288		c.e4+1			NM_000836.2	NP_000827.2	O15399	NMDE4_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2D						adult locomotory behavior (GO:0008344)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|regulation of sensory perception of pain (GO:0051930)|signal transduction (GO:0007165)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)	p.?(1)		autonomic_ganglia(1)|breast(6)|endometrium(2)|large_intestine(9)|lung(12)|ovary(5)|pancreas(1)|prostate(1)	37		all_epithelial(76;1.11e-06)|all_lung(116;5.79e-06)|Lung NSC(112;1.18e-05)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		all cancers(93;0.00014)|OV - Ovarian serous cystadenocarcinoma(262;0.000233)|Epithelial(262;0.0112)|GBM - Glioblastoma multiforme(486;0.0161)	Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Ketobemidone(DB06738)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	GTGGGAGGTGGTGAGTCGTAG	0.612																																																1	Unknown(1)	ovary(1)	19											58.0	46.0	50.0					19																	48917363		2203	4300	6503	53609175	SO:0001630	splice_region_variant	2906			U77783	CCDS12719.1	19q13.33	2012-08-29			ENSG00000105464	ENSG00000105464		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4588	protein-coding gene	gene with protein product	"""N-methyl-d-aspartate receptor subunit 2D"""	602717		NMDAR2D		9480759, 9418891	Standard	NM_000836		Approved	GluN2D, EB11, NR2D	uc002pjc.4	O15399		ENST00000263269.3:c.1200+1G>C	19.37:g.48917363G>C			53609175		Splice_Site	SNP	ENST00000263269.3	37	CCDS12719.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.172639	0.78452	.	.	ENSG00000105464	ENST00000263269	.	.	.	4.21	4.21	0.49690	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.8721	0.79129	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	GRIN2D	53609175	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	9.358000	0.97109	2.363000	0.80096	0.561000	0.74099	.		0.612	GRIN2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466121.1		Intron
SNTG2	54221	broad.mit.edu	37	2	1079341	1079341	+	Splice_Site	SNP	T	T	A			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	T	T	A	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr2:1079341T>A	ENST00000308624.5	+	2	339	c.210T>A	c.(208-210)aaT>aaA	p.N70K	SNTG2_ENST00000407292.1_Splice_Site_p.N70K	NM_018968.3	NP_061841.2	Q9NY99	SNTG2_HUMAN	syntrophin, gamma 2	70					central nervous system development (GO:0007417)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|syntrophin complex (GO:0016013)	PDZ domain binding (GO:0030165)	p.N70K(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|lung(20)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	52	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.00469)		all cancers(51;0.0178)|OV - Ovarian serous cystadenocarcinoma(76;0.07)|Epithelial(75;0.0864)|GBM - Glioblastoma multiforme(21;0.173)		AGGGCAGGAATGTAAGTGCCA	0.493																																																1	Substitution - Missense(1)	ovary(1)	2											112.0	110.0	111.0					2																	1079341		1985	4162	6147	1069341	SO:0001630	splice_region_variant	54221			AJ003029	CCDS46220.1	2p25	2008-05-23			ENSG00000172554	ENSG00000172554			13741	protein-coding gene	gene with protein product		608715				10747910	Standard	NM_018968		Approved	SYN5, G2SYN	uc002qwq.3	Q9NY99	OTTHUMG00000151370	ENST00000308624.5:c.210+1T>A	2.37:g.1079341T>A			1069341	Q05AH5	Missense_Mutation	SNP	ENST00000308624.5	37	CCDS46220.1	.	.	.	.	.	.	.	.	.	.	T	0.418	-0.909909	0.02434	.	.	ENSG00000172554	ENST00000308624;ENST00000407292	T;T	0.55234	1.17;0.53	4.23	-2.85	0.05734	PDZ/DHR/GLGF (1);	0.053471	0.64402	D	0.000001	T	0.37404	0.1002	L	0.59436	1.845	0.22656	N	0.998888	B;B	0.33612	0.419;0.011	B;B	0.34180	0.177;0.023	T	0.49495	-0.8934	10	0.02654	T	1	.	9.6742	0.40030	0.0:0.3712:0.0:0.6288	.	70;70	Q9NY99-2;Q9NY99	.;SNTG2_HUMAN	K	70	ENSP00000311837:N70K;ENSP00000385020:N70K	ENSP00000311837:N70K	N	+	3	2	SNTG2	1069341	1.000000	0.71417	0.060000	0.19600	0.158000	0.22134	2.285000	0.43487	-0.970000	0.03569	0.482000	0.46254	AAT		0.493	SNTG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322454.1	NM_018968	Missense_Mutation
LHCGR	3973	broad.mit.edu	37	2	48915191	48915191	+	Missense_Mutation	SNP	A	A	G			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr2:48915191A>G	ENST00000294954.7	-	11	1766	c.1745T>C	c.(1744-1746)aTg>aCg	p.M582T	LHCGR_ENST00000405626.1_Missense_Mutation_p.M555T|STON1-GTF2A1L_ENST00000402114.2_Intron|LHCGR_ENST00000401907.1_3'UTR|LHCGR_ENST00000344775.3_Missense_Mutation_p.M520T|LHCGR_ENST00000403273.1_3'UTR	NM_000233.3	NP_000224.2	P22888	LSHR_HUMAN	luteinizing hormone/choriogonadotropin receptor	582					activation of adenylate cyclase activity (GO:0007190)|cellular response to gonadotropin stimulus (GO:0071371)|cognition (GO:0050890)|development of secondary male sexual characteristics (GO:0046544)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|male genitalia development (GO:0030539)|male gonad development (GO:0008584)|ovarian follicle development (GO:0001541)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of inositol trisphosphate biosynthetic process (GO:0032962)|regulation of steroid hormone biosynthetic process (GO:0090030)|seminiferous tubule development (GO:0072520)|spermatogenesis (GO:0007283)|uterus development (GO:0060065)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	choriogonadotropin hormone binding (GO:0038106)|choriogonadotropin hormone receptor activity (GO:0035472)|luteinizing hormone receptor activity (GO:0004964)	p.M582T(1)		NS(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|liver(1)|lung(23)|ovary(3)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	56		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.176)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Buserelin(DB06719)|Cetrorelix(DB00050)|Choriogonadotropin alfa(DB00097)|Goserelin(DB00014)|Lutropin alfa(DB00044)|Menotropins(DB00032)	GATAGGTGCCATGCAGGTGAA	0.368																																																1	Substitution - Missense(1)	ovary(1)	2											105.0	105.0	105.0					2																	48915191		2203	4300	6503	48768695	SO:0001583	missense	3973				CCDS1842.1	2p21	2012-08-10			ENSG00000138039	ENSG00000138039		"""GPCR / Class A : Gonadotropin and TSH receptors"""	6585	protein-coding gene	gene with protein product		152790	"""hypergonadotropic hypogonadism"""	HHG			Standard	NM_000233		Approved	LHR, LCGR, LGR2, ULG5	uc002rwu.4	P22888	OTTHUMG00000129257	ENST00000294954.7:c.1745T>C	2.37:g.48915191A>G	ENSP00000294954:p.Met582Thr		48768695	Q14751|Q15996|Q9UEW9	Missense_Mutation	SNP	ENST00000294954.7	37	CCDS1842.1	.	.	.	.	.	.	.	.	.	.	A	17.09	3.300484	0.60195	.	.	ENSG00000138039	ENST00000344775;ENST00000294954;ENST00000405626	T;T;T	0.71934	-0.61;-0.61;-0.61	5.68	5.68	0.88126	GPCR, rhodopsin-like superfamily (1);	0.038565	0.85682	D	0.000000	D	0.88202	0.6373	H	0.94385	3.53	0.80722	D	1	D	0.63046	0.992	D	0.75020	0.985	D	0.91374	0.5122	9	.	.	.	.	15.1242	0.72469	1.0:0.0:0.0:0.0	.	582	P22888	LSHR_HUMAN	T	520;582;555	ENSP00000344301:M520T;ENSP00000294954:M582T;ENSP00000386033:M555T	.	M	-	2	0	LHCGR	48768695	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.339000	0.96797	2.176000	0.68965	0.477000	0.44152	ATG		0.368	LHCGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251364.4	NM_000233.3	
USP34	9736	broad.mit.edu	37	2	61493280	61493280	+	Missense_Mutation	SNP	T	T	A	rs199774527		TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	T	T	A	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr2:61493280T>A	ENST00000398571.2	-	42	5532	c.5456A>T	c.(5455-5457)aAt>aTt	p.N1819I		NM_014709.3	NP_055524.3	Q70CQ2	UBP34_HUMAN	ubiquitin specific peptidase 34	1819					positive regulation of canonical Wnt signaling pathway (GO:0090263)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)		cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)	p.N1819I(1)		autonomic_ganglia(1)|breast(14)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(52)|ovary(8)|prostate(10)|skin(6)|urinary_tract(2)	138			Epithelial(17;0.229)			AAACAGGAGATTGAAGATATC	0.358																																																1	Substitution - Missense(1)	ovary(1)	2											67.0	62.0	64.0					2																	61493280		1826	4075	5901	61346784	SO:0001583	missense	9736			AB011142	CCDS42686.1	2p16.1-p15	2005-08-08	2005-08-08		ENSG00000115464	ENSG00000115464		"""Ubiquitin-specific peptidases"""	20066	protein-coding gene	gene with protein product		615295	"""ubiquitin specific protease 34"""			12838346	Standard	NM_014709		Approved	KIAA0570, KIAA0729	uc002sbe.3	Q70CQ2	OTTHUMG00000152265	ENST00000398571.2:c.5456A>T	2.37:g.61493280T>A	ENSP00000381577:p.Asn1819Ile		61346784	A8MWD0|B3KWU9|O60316|O94834|Q3B777|Q6P6C9|Q7L8P6|Q8N3T9|Q8TBW2|Q9UGA1	Missense_Mutation	SNP	ENST00000398571.2	37	CCDS42686.1	.	.	.	.	.	.	.	.	.	.	T	16.39	3.108938	0.56398	.	.	ENSG00000115464	ENST00000263989;ENST00000398569;ENST00000398571;ENST00000453734	T;T	0.04317	3.8;3.65	5.44	5.44	0.79542	Armadillo-type fold (1);	0.048855	0.85682	D	0.000000	T	0.04952	0.0133	N	0.22421	0.69	0.53688	D	0.999974	B	0.15473	0.013	B	0.11329	0.006	T	0.37731	-0.9693	10	0.62326	D	0.03	.	14.0764	0.64893	0.0:0.0:0.0:1.0	.	1819	Q70CQ2	UBP34_HUMAN	I	1667;1667;1819;97	ENSP00000381577:N1819I;ENSP00000410559:N97I	ENSP00000263989:N1667I	N	-	2	0	USP34	61346784	1.000000	0.71417	1.000000	0.80357	0.654000	0.38779	8.040000	0.89188	2.065000	0.61736	0.460000	0.39030	AAT		0.358	USP34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325650.4		
WDPCP	51057	broad.mit.edu	37	2	63631555	63631555	+	Missense_Mutation	SNP	C	C	A			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr2:63631555C>A	ENST00000272321.7	-	10	1590	c.1063G>T	c.(1063-1065)Ggc>Tgc	p.G355C	WDPCP_ENST00000409835.1_5'UTR|WDPCP_ENST00000409199.1_Missense_Mutation_p.G163C|WDPCP_ENST00000409120.1_Missense_Mutation_p.G163C|WDPCP_ENST00000409562.3_Missense_Mutation_p.G355C|WDPCP_ENST00000398544.3_Missense_Mutation_p.G196C	NM_015910.5	NP_056994.3	O95876	FRITZ_HUMAN	WD repeat containing planar cell polarity effector	355					auditory receptor cell morphogenesis (GO:0002093)|camera-type eye development (GO:0043010)|cardiovascular system development (GO:0072358)|cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|digestive system development (GO:0055123)|embryonic digit morphogenesis (GO:0042733)|establishment of protein localization (GO:0045184)|glomerular visceral epithelial cell migration (GO:0090521)|kidney development (GO:0001822)|palate development (GO:0060021)|regulation of embryonic cell shape (GO:0016476)|regulation of establishment of cell polarity (GO:2000114)|regulation of fibroblast migration (GO:0010762)|regulation of focal adhesion assembly (GO:0051893)|regulation of protein localization (GO:0032880)|regulation of ruffle assembly (GO:1900027)|respiratory system development (GO:0060541)|septin cytoskeleton organization (GO:0032185)|smoothened signaling pathway (GO:0007224)	axonemal basal plate (GO:0097541)|axoneme (GO:0005930)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)		p.G355C(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(19)|ovary(1)|skin(1)	35						TCTTCACAGCCCAGAATCAGT	0.428																																																1	Substitution - Missense(1)	ovary(1)	2											126.0	121.0	123.0					2																	63631555		1950	4151	6101	63485059	SO:0001583	missense	51057				CCDS42688.1, CCDS46301.1	2p15	2014-04-24	2011-02-01	2011-02-01	ENSG00000143951	ENSG00000143951			28027	protein-coding gene	gene with protein product		613580	"""chromosome 2 open reading frame 86"""	C2orf86		15654087, 20671153	Standard	NM_015910		Approved	hFrtz, fritz, BBS15	uc002sch.3	O95876	OTTHUMG00000152566	ENST00000272321.7:c.1063G>T	2.37:g.63631555C>A	ENSP00000272321:p.Gly355Cys		63485059	Q53RW4|Q7Z2Z3	Missense_Mutation	SNP	ENST00000272321.7	37	CCDS42688.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.968126	0.74131	.	.	ENSG00000143951	ENST00000272321;ENST00000409199;ENST00000409120;ENST00000398544;ENST00000409562	T;T;T;T;T	0.70516	-0.49;-0.49;-0.49;-0.49;-0.49	5.4	5.4	0.78164	WD40/YVTN repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.82926	0.5143	M	0.61703	1.905	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;0.998	T	0.81545	-0.0884	10	0.42905	T	0.14	-11.939	19.5372	0.95257	0.0:1.0:0.0:0.0	.	163;355;355;196	E9PFG9;O95876-2;O95876;O95876-3	.;.;FRITZ_HUMAN;.	C	355;163;163;196;355	ENSP00000272321:G355C;ENSP00000386592:G163C;ENSP00000386769:G163C;ENSP00000381552:G196C;ENSP00000387222:G355C	ENSP00000272321:G355C	G	-	1	0	WDPCP	63485059	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	6.738000	0.74822	2.692000	0.91855	0.591000	0.81541	GGC		0.428	WDPCP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326820.1	NM_015910	
MARCO	8685	broad.mit.edu	37	2	119739825	119739825	+	Missense_Mutation	SNP	G	G	T	rs376777191		TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr2:119739825G>T	ENST00000327097.4	+	11	1130	c.995G>T	c.(994-996)cGa>cTa	p.R332L	MARCO_ENST00000541757.1_Missense_Mutation_p.R254L	NM_006770.3	NP_006761.1	Q9UEW3	MARCO_HUMAN	macrophage receptor with collagenous structure	332	Collagen-like.				apoptotic cell clearance (GO:0043277)|cell surface receptor signaling pathway (GO:0007166)|innate immune response (GO:0045087)|pattern recognition receptor signaling pathway (GO:0002221)	collagen trimer (GO:0005581)|endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)|transmembrane signaling receptor activity (GO:0004888)	p.R332L(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|large_intestine(12)|lung(37)|ovary(4)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	70						TCCCCTGGGCGAGCAGGTGAG	0.617																																					GBM(8;18 374 7467 11269 32796)											1	Substitution - Missense(1)	ovary(1)	2											87.0	98.0	94.0					2																	119739825		2203	4300	6503	119456295	SO:0001583	missense	8685			AF035819	CCDS2124.1	2q14.2	2011-10-11			ENSG00000019169	ENSG00000019169			6895	protein-coding gene	gene with protein product	"""scavenger receptor class A, member 2"""	604870				9468508, 7867067, 10331948	Standard	NM_006770		Approved	SCARA2	uc002tln.1	Q9UEW3	OTTHUMG00000131400	ENST00000327097.4:c.995G>T	2.37:g.119739825G>T	ENSP00000318916:p.Arg332Leu		119456295	B4DW79|Q9Y5S3	Missense_Mutation	SNP	ENST00000327097.4	37	CCDS2124.1	.	.	.	.	.	.	.	.	.	.	g	8.245	0.807679	0.16467	.	.	ENSG00000019169	ENST00000327097;ENST00000410021;ENST00000541757	D;D	0.92595	-3.07;-3.07	4.79	-5.32	0.02722	.	1.866360	0.02457	N	0.086179	T	0.73961	0.3654	N	0.01640	-0.785	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.70121	-0.4959	9	.	.	.	.	3.5564	0.07866	0.1291:0.451:0.134:0.2858	.	332	Q9UEW3	MARCO_HUMAN	L	332;332;254	ENSP00000318916:R332L;ENSP00000441769:R254L	.	R	+	2	0	MARCO	119456295	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.506000	0.00962	-0.876000	0.04017	-1.262000	0.01453	CGA		0.617	MARCO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254190.2	NM_006770	
MGAT5	4249	broad.mit.edu	37	2	135012008	135012008	+	Nonsense_Mutation	SNP	C	C	T			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr2:135012008C>T	ENST00000409645.1	+	2	286	c.34C>T	c.(34-36)Cag>Tag	p.Q12*	MGAT5_ENST00000468758.1_3'UTR|MGAT5_ENST00000281923.2_Nonsense_Mutation_p.Q12*			Q09328	MGT5A_HUMAN	mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase	12					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	alpha-1,6-mannosylglycoprotein 6-beta-N-acetylglucosaminyltransferase activity (GO:0030144)	p.Q12*(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|liver(1)|lung(18)|ovary(3)|pancreas(1)|skin(3)	36				BRCA - Breast invasive adenocarcinoma(221;0.0964)		GTTGTCCTCTCAGAAGCTGGG	0.488																																																1	Substitution - Nonsense(1)	ovary(1)	2											139.0	119.0	125.0					2																	135012008		2203	4300	6503	134728478	SO:0001587	stop_gained	4249			D17716	CCDS2171.1	2q21	2013-02-25			ENSG00000152127	ENSG00000152127	2.4.1.155	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	7049	protein-coding gene	gene with protein product		601774				8292036	Standard	NM_002410		Approved	GNT-V	uc002ttw.4	Q09328	OTTHUMG00000131681	ENST00000409645.1:c.34C>T	2.37:g.135012008C>T	ENSP00000386377:p.Gln12*		134728478	D3DP70	Nonsense_Mutation	SNP	ENST00000409645.1	37	CCDS2171.1	.	.	.	.	.	.	.	.	.	.	C	37	6.307656	0.97462	.	.	ENSG00000152127	ENST00000409645;ENST00000281923	.	.	.	4.88	4.88	0.63580	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.30078	T	0.28	-27.0265	18.5677	0.91122	0.0:1.0:0.0:0.0	.	.	.	.	X	12	.	ENSP00000281923:Q12X	Q	+	1	0	MGAT5	134728478	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.609000	0.82925	2.677000	0.91161	0.650000	0.86243	CAG		0.488	MGAT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254584.3	NM_002410	
SCN3A	6328	broad.mit.edu	37	2	165947360	165947360	+	Missense_Mutation	SNP	G	G	C			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr2:165947360G>C	ENST00000360093.3	-	28	5794	c.5303C>G	c.(5302-5304)gCg>gGg	p.A1768G	AC013463.2_ENST00000431341.1_RNA|SCN3A_ENST00000409101.3_Missense_Mutation_p.A1719G|SCN3A_ENST00000465043.1_5'Flank|SCN3A_ENST00000540861.1_Missense_Mutation_p.A251G|SCN3A_ENST00000283254.7_Missense_Mutation_p.A1768G	NM_001081677.1	NP_001075146.1	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha subunit	1768					membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.A1768G(1)		NS(1)|breast(7)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(19)|liver(2)|lung(47)|ovary(6)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(3)	120					Lacosamide(DB06218)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CAGGATGACCGCGATGTACAT	0.443																																																1	Substitution - Missense(1)	ovary(1)	2											112.0	112.0	112.0					2																	165947360		2203	4297	6500	165655606	SO:0001583	missense	6328			AF035685	CCDS33312.1, CCDS46440.1	2q24	2012-02-26	2007-01-23		ENSG00000153253	ENSG00000153253		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10590	protein-coding gene	gene with protein product		182391	"""sodium channel, voltage-gated, type III, alpha polypeptide"""			9589372, 16382098	Standard	NM_001081676		Approved	Nav1.3	uc002ucx.3	Q9NY46	OTTHUMG00000044171	ENST00000360093.3:c.5303C>G	2.37:g.165947360G>C	ENSP00000353206:p.Ala1768Gly		165655606	Q16142|Q53SX0|Q9BZB3|Q9C006|Q9NYK2|Q9P2J1|Q9UPD1|Q9Y6P4	Missense_Mutation	SNP	ENST00000360093.3	37		.	.	.	.	.	.	.	.	.	.	G	20.1	3.938246	0.73557	.	.	ENSG00000153253	ENST00000360093;ENST00000283254;ENST00000409101;ENST00000540861	D;D;D;D	0.98849	-5.18;-5.18;-5.18;-5.18	6.13	6.13	0.99165	.	0.000000	0.64402	D	0.000004	D	0.99158	0.9709	M	0.78344	2.41	0.80722	D	1	D;D;D	0.89917	0.999;0.997;1.0	D;D;D	0.91635	0.997;0.979;0.999	D	0.99663	1.0994	10	0.62326	D	0.03	.	20.8599	0.99761	0.0:0.0:1.0:0.0	.	1719;1719;1768	Q9NY46-2;Q9NY46-4;Q9NY46-3	.;.;.	G	1768;1768;1719;251	ENSP00000353206:A1768G;ENSP00000283254:A1768G;ENSP00000386726:A1719G;ENSP00000439920:A251G	ENSP00000283254:A1768G	A	-	2	0	SCN3A	165655606	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	9.865000	0.99609	2.937000	0.99478	0.650000	0.86243	GCG		0.443	SCN3A-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_006922	
TTN	7273	broad.mit.edu	37	2	179600414	179600414	+	Missense_Mutation	SNP	G	G	A	rs371455094		TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr2:179600414G>A	ENST00000591111.1	-	48	14032	c.13808C>T	c.(13807-13809)aCg>aTg	p.T4603M	TTN-AS1_ENST00000590773.1_RNA|TTN_ENST00000359218.5_Intron|TTN-AS1_ENST00000582847.1_RNA|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342175.6_Intron|TTN_ENST00000589042.1_Missense_Mutation_p.T4920M|TTN_ENST00000342992.6_Missense_Mutation_p.T3676M			Q8WZ42	TITIN_HUMAN	titin	12355	Ig-like 26.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.T3676M(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTTGCTCCACGTAACTGTGAC	0.408																																																1	Substitution - Missense(1)	ovary(1)	2						G	,,,MET/THR	3,3743		0,3,1870	95.0	89.0	91.0		,,,11027	4.0	0.0	2		91	0,8198		0,0,4099	no	intron,intron,intron,missense	TTN	NM_003319.4,NM_133432.3,NM_133437.3,NM_133378.4	,,,81	0,3,5969	AA,AG,GG		0.0,0.0801,0.0251	,,,benign	,,,3676/33424	179600414	3,11941	1873	4099	5972	179308659	SO:0001583	missense	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.13808C>T	2.37:g.179600414G>A	ENSP00000465570:p.Thr4603Met		179308659	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	G	6.120	0.390311	0.11581	8.01E-4	0.0	ENSG00000155657	ENST00000342992	T	0.68765	-0.35	5.77	3.99	0.46301	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.58821	0.2149	M	0.62088	1.915	0.21782	N	0.999546	B	0.28584	0.216	B	0.19148	0.024	T	0.56613	-0.7950	9	0.87932	D	0	.	5.5448	0.17057	0.1288:0.1129:0.6417:0.1167	.	4603	Q8WZ42	TITIN_HUMAN	M	3676	ENSP00000343764:T3676M	ENSP00000343764:T3676M	T	-	2	0	TTN	179308659	0.005000	0.15991	0.002000	0.10522	0.876000	0.50452	1.434000	0.34958	0.912000	0.36772	-0.119000	0.15052	ACG		0.408	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
PTH2R	5746	broad.mit.edu	37	2	209358310	209358310	+	Missense_Mutation	SNP	G	G	C			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr2:209358310G>C	ENST00000272847.2	+	13	1792	c.1579G>C	c.(1579-1581)Gag>Cag	p.E527Q	AC019185.4_ENST00000424628.1_RNA|PTH2R_ENST00000413482.1_3'UTR	NM_005048.2	NP_005039.1	P49190	PTH2R_HUMAN	parathyroid hormone 2 receptor	527					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	parathyroid hormone receptor activity (GO:0004991)	p.E527Q(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(21)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	43				Epithelial(149;0.0684)|Lung(261;0.0785)|LUSC - Lung squamous cell carcinoma(261;0.0836)	Preotact(DB05829)	TATTCTAATGGAGAAGCCTTC	0.493																																																1	Substitution - Missense(1)	ovary(1)	2											90.0	88.0	89.0					2																	209358310		2203	4300	6503	209066555	SO:0001583	missense	5746			BC036811	CCDS2383.1	2q33	2012-08-10	2007-08-24	2007-08-24	ENSG00000144407	ENSG00000144407		"""GPCR / Class B : Parathyroid hormone receptors"""	9609	protein-coding gene	gene with protein product		601469	"""parathyroid hormone receptor 2"""	PTHR2			Standard	NM_005048		Approved		uc002vdb.4	P49190	OTTHUMG00000132960	ENST00000272847.2:c.1579G>C	2.37:g.209358310G>C	ENSP00000272847:p.Glu527Gln		209066555	Q8N429	Missense_Mutation	SNP	ENST00000272847.2	37	CCDS2383.1	.	.	.	.	.	.	.	.	.	.	G	5.969	0.362829	0.11296	.	.	ENSG00000144407	ENST00000272847	T	0.51817	0.69	5.26	3.09	0.35607	.	2.377310	0.02316	U	0.072533	T	0.39091	0.1065	L	0.36672	1.1	0.09310	N	1	B;B	0.12013	0.002;0.005	B;B	0.08055	0.001;0.003	T	0.14364	-1.0475	9	.	.	.	.	5.2819	0.15680	0.5204:0.0:0.4796:0.0	.	416;527	B4DFN8;P49190	.;PTH2R_HUMAN	Q	527	ENSP00000272847:E527Q	.	E	+	1	0	PTH2R	209066555	0.326000	0.24669	0.001000	0.08648	0.007000	0.05969	2.261000	0.43276	0.507000	0.28148	0.591000	0.81541	GAG		0.493	PTH2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256519.2	NM_005048	
MAP2	4133	broad.mit.edu	37	2	210559403	210559403	+	Missense_Mutation	SNP	G	G	C			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr2:210559403G>C	ENST00000360351.4	+	7	3015	c.2509G>C	c.(2509-2511)Gag>Cag	p.E837Q	MAP2_ENST00000199940.6_Intron|MAP2_ENST00000392194.1_Intron|MAP2_ENST00000361559.4_Intron|MAP2_ENST00000447185.1_Missense_Mutation_p.E833Q	NM_002374.3	NP_002365.3	P11137	MTAP2_HUMAN	microtubule-associated protein 2	837					axonogenesis (GO:0007409)|cellular response to organic substance (GO:0071310)|central nervous system neuron development (GO:0021954)|dendrite morphogenesis (GO:0048813)|microtubule bundle formation (GO:0001578)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|nuclear periphery (GO:0034399)	dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)	p.E837Q(1)		breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(36)|liver(2)|lung(42)|ovary(11)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	124		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Docetaxel(DB01248)|Estramustine(DB01196)|Paclitaxel(DB01229)	AGTCCCATCAGAGACTGTGGT	0.507																																					Pancreas(27;423 979 28787 29963)											1	Substitution - Missense(1)	ovary(1)	2											120.0	118.0	119.0					2																	210559403		2203	4300	6503	210267648	SO:0001583	missense	4133				CCDS2384.1, CCDS2385.1, CCDS33369.1	2q34-q35	2008-05-27			ENSG00000078018	ENSG00000078018		"""A-kinase anchor proteins"""	6839	protein-coding gene	gene with protein product		157130				3103857, 7479905	Standard	XM_005246554		Approved	MAP2A, MAP2B, MAP2C	uc002vde.1	P11137	OTTHUMG00000132962	ENST00000360351.4:c.2509G>C	2.37:g.210559403G>C	ENSP00000353508:p.Glu837Gln		210267648	Q17S04|Q8IUX2|Q99975|Q99976	Missense_Mutation	SNP	ENST00000360351.4	37	CCDS2384.1	.	.	.	.	.	.	.	.	.	.	G	15.61	2.883917	0.51908	.	.	ENSG00000078018	ENST00000360351;ENST00000447185	T;T	0.25749	1.78;1.78	5.67	5.67	0.87782	MAP2/Tau projection (1);	0.308471	0.27856	N	0.017573	T	0.36220	0.0959	L	0.54323	1.7	0.23454	N	0.997647	P;P	0.43701	0.779;0.815	B;P	0.45377	0.346;0.478	T	0.23048	-1.0199	10	0.87932	D	0	-7.6105	19.7721	0.96370	0.0:0.0:1.0:0.0	.	833;837	P11137-3;P11137	.;MAP2_HUMAN	Q	837;833	ENSP00000353508:E837Q;ENSP00000392164:E833Q	ENSP00000353508:E837Q	E	+	1	0	MAP2	210267648	1.000000	0.71417	0.982000	0.44146	0.895000	0.52256	4.381000	0.59587	2.683000	0.91414	0.557000	0.71058	GAG		0.507	MAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256521.2	NM_001039538	
USP37	57695	broad.mit.edu	37	2	219324534	219324534	+	Silent	SNP	C	C	T	rs71415835		TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr2:219324534C>T	ENST00000258399.3	-	23	3034	c.2622G>A	c.(2620-2622)gaG>gaA	p.E874E	USP37_ENST00000418019.1_Silent_p.E874E|USP37_ENST00000415516.1_Silent_p.E780E|USP37_ENST00000454775.1_Silent_p.E874E	NM_020935.2	NP_065986	Q86T82	UBP37_HUMAN	ubiquitin specific peptidase 37	874	USP.				G1/S transition of mitotic cell cycle (GO:0000082)|mitotic nuclear division (GO:0007067)|protein deubiquitination (GO:0016579)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|protein kinase binding (GO:0019901)|ubiquitin-specific protease activity (GO:0004843)	p.E874E(1)		NS(2)|breast(3)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(1)|lung(7)|ovary(2)|prostate(3)|skin(5)|stomach(1)	35		Renal(207;0.0915)		Epithelial(149;1.08e-06)|all cancers(144;0.000197)|LUSC - Lung squamous cell carcinoma(224;0.00375)|Lung(261;0.00487)		TTTTCAGTTCCTCAGCTTCAG	0.413																																																1	Substitution - coding silent(1)	ovary(1)	2											160.0	149.0	153.0					2																	219324534		2203	4300	6503	219032778	SO:0001819	synonymous_variant	57695			AB046814	CCDS2418.1	2q35	2008-02-05	2005-08-08		ENSG00000135913	ENSG00000135913		"""Ubiquitin-specific peptidases"""	20063	protein-coding gene	gene with protein product			"""ubiquitin specific protease 37"""			12838346	Standard	NM_020935		Approved	KIAA1594	uc010fvs.1	Q86T82	OTTHUMG00000133113	ENST00000258399.3:c.2622G>A	2.37:g.219324534C>T			219032778	A2RUQ8|B7ZM38|B7ZM41|E9PHL3|Q2KHT2|Q53S10|Q7Z3A5|Q9HCH8	Silent	SNP	ENST00000258399.3	37	CCDS2418.1																																																																																				0.413	USP37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256779.3	NM_020935	
ASB18	401036	broad.mit.edu	37	2	237149994	237149994	+	Missense_Mutation	SNP	T	T	G	rs560027825		TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	T	T	G	G	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr2:237149994T>G	ENST00000409749.3	-	2	256	c.257A>C	c.(256-258)aAc>aCc	p.N86T	ASB18_ENST00000330842.6_Missense_Mutation_p.N57T|AC079135.1_ENST00000415226.1_RNA	NM_212556.2	NP_997721.2	Q6ZVZ8	ASB18_HUMAN	ankyrin repeat and SOCS box containing 18	86					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)			p.N57T(1)		large_intestine(1)|lung(3)|ovary(1)|prostate(1)	6		all_hematologic(139;0.00615)|Renal(207;0.00963)|Breast(86;0.0126)|Acute lymphoblastic leukemia(138;0.0815)		Epithelial(121;2.04e-26)|OV - Ovarian serous cystadenocarcinoma(60;1.47e-11)|BRCA - Breast invasive adenocarcinoma(100;2.88e-05)|Lung(119;0.000383)|LUSC - Lung squamous cell carcinoma(224;0.00644)|GBM - Glioblastoma multiforme(43;0.244)		AAACACCACGTTGGCATCCTG	0.532																																																1	Substitution - Missense(1)	ovary(1)	2											102.0	104.0	103.0					2																	237149994		1958	4148	6106	236814733	SO:0001583	missense	401036			AK123854	CCDS46548.1	2q37.2	2013-01-10	2011-01-25		ENSG00000182177	ENSG00000182177		"""Ankyrin repeat domain containing"""	19770	protein-coding gene	gene with protein product			"""ankyrin repeat and SOCS box-containing 18"""			12076535	Standard	NM_212556		Approved		uc010znh.2	Q6ZVZ8	OTTHUMG00000153086	ENST00000409749.3:c.257A>C	2.37:g.237149994T>G	ENSP00000386532:p.Asn86Thr		236814733	B6ZDL7	Missense_Mutation	SNP	ENST00000409749.3	37	CCDS46548.1	.	.	.	.	.	.	.	.	.	.	T	20.1	3.938592	0.73557	.	.	ENSG00000182177	ENST00000330842;ENST00000409749	T;T	0.53206	0.63;0.63	4.82	4.82	0.62117	Ankyrin repeat-containing domain (1);	0.425946	0.23426	N	0.048315	T	0.60612	0.2282	L	0.56340	1.77	0.34091	D	0.660679	D;D	0.60575	0.988;0.982	P;P	0.60473	0.875;0.837	T	0.73811	-0.3865	10	0.87932	D	0	.	14.3566	0.66742	0.0:0.0:0.0:1.0	.	86;57	Q6ZVZ8;Q6ZVZ8-2	ASB18_HUMAN;.	T	57;86	ENSP00000329970:N57T;ENSP00000386532:N86T	ENSP00000329970:N57T	N	-	2	0	ASB18	236814733	1.000000	0.71417	0.918000	0.36340	0.892000	0.51952	5.313000	0.65798	1.926000	0.55796	0.533000	0.62120	AAC		0.532	ASB18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329436.1	NM_212556	
DZANK1	55184	broad.mit.edu	37	20	18429628	18429628	+	Splice_Site	SNP	T	T	C			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr20:18429628T>C	ENST00000358866.6	-	6	651	c.629A>G	c.(628-630)aAg>aGg	p.K210R	DZANK1_ENST00000357236.4_Splice_Site_p.K96R|DZANK1_ENST00000487128.1_5'UTR|DZANK1_ENST00000329494.5_Splice_Site_p.K212R|DZANK1_ENST00000262547.5_Splice_Site_p.K210R			Q9NVP4	DZAN1_HUMAN	double zinc ribbon and ankyrin repeat domains 1	210							zinc ion binding (GO:0008270)	p.K210R(1)		NS(1)|cervix(1)|endometrium(2)|large_intestine(5)|lung(10)	19						TGATACTTACTTGAGAAAGTC	0.383																																																1	Substitution - Missense(1)	ovary(1)	20											118.0	113.0	114.0					20																	18429628		1875	4108	5983	18377628	SO:0001630	splice_region_variant	55184			AK001462	CCDS46582.1	20p11.23	2013-01-11	2011-10-03	2011-10-03	ENSG00000089091	ENSG00000089091		"""Ankyrin repeat domain containing"""	15858	protein-coding gene	gene with protein product	"""ankyrin repeat domain 64"""		"""chromosome 20 open reading frame 12"""	C20orf84, C20orf12			Standard	NM_001099407		Approved	FLJ10600, dJ568F9.2, FLJ30892, bA189K21.8, ANKRD64	uc002wqq.4	Q9NVP4	OTTHUMG00000031968	ENST00000358866.6:c.629+1A>G	20.37:g.18429628T>C			18377628	B7ZLZ4|Q4F7X1|Q5QPD9|Q5QPE0|Q68DN8|Q6ZMX9|Q96NF0|Q9H1E0|Q9H442	Missense_Mutation	SNP	ENST00000358866.6	37	CCDS46582.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	10.87|10.87	1.473605|1.473605	0.26423|0.26423	.|.	.|.	ENSG00000089091|ENSG00000089091	ENST00000377630;ENST00000262547;ENST00000329494;ENST00000414623;ENST00000377637;ENST00000357236|ENST00000358866	T;T;T;T|.	0.53640|.	0.61;0.61;0.61;0.61|.	5.0|5.0	2.71|2.71	0.32032|0.32032	.|.	0.310718|.	0.39274|.	N|.	0.001420|.	T|T	0.43077|0.43077	0.1231|0.1231	L|L	0.31664|0.31664	0.95|0.95	0.36648|0.36648	D|D	0.87725|0.87725	P;P;B|.	0.46912|.	0.818;0.886;0.438|.	B;B;B|.	0.44085|.	0.255;0.44;0.34|.	T|T	0.37174|0.37174	-0.9717|-0.9717	9|5	.|.	.|.	.|.	-12.4125|-12.4125	8.1553|8.1553	0.31165|0.31165	0.0:0.1664:0.0:0.8336|0.0:0.1664:0.0:0.8336	.|.	229;96;210|.	B7Z631;Q9NVP4-4;Q9NVP4|.	.;.;DZAN1_HUMAN|.	R|G	37;210;212;36;36;96|9	ENSP00000366857:K37R;ENSP00000262547:K210R;ENSP00000328866:K212R;ENSP00000349774:K96R|.	.|.	K|S	-|-	2|1	0|0	C20orf12|C20orf12	18377628|18377628	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.282000|0.282000	0.26991|0.26991	1.432000|1.432000	0.34936|0.34936	0.326000|0.326000	0.23384|0.23384	-0.924000|-0.924000	0.02725|0.02725	AAG|AGT		0.383	DZANK1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000471926.1	NM_001099407	Missense_Mutation
BPIFB2	80341	broad.mit.edu	37	20	31600702	31600702	+	Missense_Mutation	SNP	C	C	G	rs540459199		TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr20:31600702C>G	ENST00000170150.3	+	4	492	c.297C>G	c.(295-297)ttC>ttG	p.F99L		NM_025227.1	NP_079503.1	Q8N4F0	BPIB2_HUMAN	BPI fold containing family B, member 2	99						extracellular vesicular exosome (GO:0070062)	lipid binding (GO:0008289)	p.F99L(1)									ATTTTACTTTCAAGGTCTTTC	0.557																																																1	Substitution - Missense(1)	ovary(1)	20											118.0	114.0	115.0					20																	31600702		2203	4300	6503	31064363	SO:0001583	missense	80341			AF465765	CCDS13210.1	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000078898	ENSG00000078898		"""BPI fold containing"""	16177	protein-coding gene	gene with protein product		614108	"""bactericidal/permeability-increasing protein-like 1"""	C20orf184, BPIL1		12185532, 21787333	Standard	NM_025227		Approved	dJ726C3.2, LPLUNC2	uc002wyj.4	Q8N4F0	OTTHUMG00000032232	ENST00000170150.3:c.297C>G	20.37:g.31600702C>G	ENSP00000170150:p.Phe99Leu		31064363	Q6UWN3|Q6ZME0|Q8NFQ7	Missense_Mutation	SNP	ENST00000170150.3	37	CCDS13210.1	.	.	.	.	.	.	.	.	.	.	c	0.008	-1.866157	0.00547	.	.	ENSG00000078898	ENST00000170150	T	0.03982	3.74	3.94	0.966	0.19667	.	0.423546	0.20139	N	0.098416	T	0.03095	0.0091	N	0.20986	0.625	0.80722	D	1	B	0.14438	0.01	B	0.16289	0.015	T	0.49093	-0.8975	10	0.25751	T	0.34	-11.4731	6.1637	0.20378	0.0:0.6774:0.0:0.3226	.	99	Q8N4F0	BPIB2_HUMAN	L	99	ENSP00000170150:F99L	ENSP00000170150:F99L	F	+	3	2	BPIFB2	31064363	0.040000	0.19996	0.915000	0.36163	0.125000	0.20455	0.390000	0.20768	0.257000	0.21650	-0.766000	0.03442	TTC		0.557	BPIFB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078652.2	NM_025227	
SLC7A4	6545	broad.mit.edu	37	22	21384504	21384504	+	Silent	SNP	C	C	G	rs151143122		TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr22:21384504C>G	ENST00000382932.2	-	3	1186	c.1119G>C	c.(1117-1119)gcG>gcC	p.A373A	AC002472.11_ENST00000450652.1_RNA|SLC7A4_ENST00000403586.1_Silent_p.A373A	NM_004173.2	NP_004164.2	O43246	CTR4_HUMAN	solute carrier family 7, member 4	373					basic amino acid transport (GO:0015802)|cellular amino acid metabolic process (GO:0006520)|transport (GO:0006810)	integral component of membrane (GO:0016021)	basic amino acid transmembrane transporter activity (GO:0015174)	p.A373A(1)		breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(7)|ovary(1)|prostate(2)	18	all_cancers(11;2.85e-22)|Lung NSC(8;4.21e-14)|all_lung(8;6.08e-13)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0968)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)		L-Arginine(DB00125)|L-Lysine(DB00123)|L-Ornithine(DB00129)	GGAGCCCGAACGCCAGGGTGC	0.637																																																1	Substitution - coding silent(1)	ovary(1)	22											32.0	36.0	35.0					22																	21384504		2203	4300	6503	19714504	SO:0001819	synonymous_variant	6545			AJ000730	CCDS33608.1	22q11.21	2013-07-19	2013-07-19		ENSG00000099960	ENSG00000099960		"""Solute carriers"""	11062	protein-coding gene	gene with protein product		603752	"""solute carrier family 7 (cationic amino acid transporter, y+ system), member 4"", ""solute carrier family 7 (orphan transporter), member 4"""			9598310, 11665818	Standard	NM_004173		Approved	HCAT3, CAT-4, VH	uc002zud.3	O43246	OTTHUMG00000150896	ENST00000382932.2:c.1119G>C	22.37:g.21384504C>G			19714504	Q0P5U2|Q3KNQ6|Q4VC45|Q6IBY8|Q96H88	Silent	SNP	ENST00000382932.2	37	CCDS33608.1																																																																																				0.637	SLC7A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320467.1	NM_004173	
KLHL40	131377	broad.mit.edu	37	3	42727422	42727422	+	Missense_Mutation	SNP	G	G	T			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr3:42727422G>T	ENST00000287777.4	+	1	412	c.312G>T	c.(310-312)ttG>ttT	p.L104F		NM_152393.2	NP_689606.2	Q2TBA0	KLH40_HUMAN	kelch-like family member 40	104					multicellular organismal development (GO:0007275)	cytoplasm (GO:0005737)		p.L104F(1)									TGCAGGATTTGTTCGCCGCGG	0.617																																																1	Substitution - Missense(1)	ovary(1)	3											82.0	87.0	85.0					3																	42727422		2203	4299	6502	42702426	SO:0001583	missense	131377			AK056577	CCDS2703.1	3p21.33	2013-07-30	2013-02-22	2013-01-08	ENSG00000157119	ENSG00000157119		"""Kelch-like"", ""BTB/POZ domain containing"""	30372	protein-coding gene	gene with protein product	"""sarcosynapsin"", ""nemaline myopathy type 8"""	615340	"""kelch repeat and BTB (POZ) domain containing 5"", ""kelch-like 40 (Drosophila)"""	KBTBD5		23746549	Standard	NM_152393		Approved	SRYP, NEM8	uc003clv.1	Q2TBA0	OTTHUMG00000133045	ENST00000287777.4:c.312G>T	3.37:g.42727422G>T	ENSP00000287777:p.Leu104Phe		42702426	Q86SI1|Q96MR2	Missense_Mutation	SNP	ENST00000287777.4	37	CCDS2703.1	.	.	.	.	.	.	.	.	.	.	G	17.40	3.378989	0.61735	.	.	ENSG00000157119	ENST00000287777	T	0.71579	-0.58	4.78	3.83	0.44106	BTB/POZ-like (1);BTB/POZ (1);BTB/POZ fold (2);	0.057932	0.64402	D	0.000004	T	0.78830	0.4345	M	0.79123	2.44	0.37273	D	0.907494	D	0.60575	0.988	D	0.69479	0.964	T	0.81609	-0.0855	10	0.87932	D	0	.	3.1585	0.06512	0.0978:0.2158:0.5267:0.1597	.	104	Q2TBA0	KBTB5_HUMAN	F	104	ENSP00000287777:L104F	ENSP00000287777:L104F	L	+	3	2	KBTBD5	42702426	1.000000	0.71417	0.996000	0.52242	0.939000	0.58152	1.125000	0.31332	2.509000	0.84616	0.655000	0.94253	TTG		0.617	KLHL40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256651.1	NM_152393	
CCR3	1232	broad.mit.edu	37	3	46306815	46306815	+	Missense_Mutation	SNP	G	G	T	rs200897117		TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr3:46306815G>T	ENST00000357422.2	+	4	709	c.166G>T	c.(166-168)Gtg>Ttg	p.V56L	CCR3_ENST00000541018.1_Missense_Mutation_p.V56L|CCR3_ENST00000395940.2_Missense_Mutation_p.V56L|CCR3_ENST00000395942.2_Missense_Mutation_p.V56L|CCR3_ENST00000545097.1_Missense_Mutation_p.V77L			P51677	CCR3_HUMAN	chemokine (C-C motif) receptor 3	56					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cell adhesion (GO:0007155)|cellular defense response (GO:0006968)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|inflammatory response (GO:0006954)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of endothelial cell proliferation (GO:0001938)|viral process (GO:0016032)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|chemokine receptor activity (GO:0004950)	p.V56L(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(5)|ovary(3)|urinary_tract(1)	18				BRCA - Breast invasive adenocarcinoma(193;0.00119)|KIRC - Kidney renal clear cell carcinoma(197;0.0183)|Kidney(197;0.0216)		TGTGGTGGTGGTGATGATCCT	0.527																																																1	Substitution - Missense(1)	ovary(1)	3											158.0	127.0	138.0					3																	46306815		2203	4300	6503	46281819	SO:0001583	missense	1232			AF247361	CCDS2738.1, CCDS54574.1	3p21.3	2012-08-08			ENSG00000183625	ENSG00000183625		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1604	protein-coding gene	gene with protein product		601268		CMKBR3			Standard	NM_178328		Approved	CC-CKR-3, CKR3, CD193	uc003cpk.2	P51677	OTTHUMG00000133484	ENST00000357422.2:c.166G>T	3.37:g.46306815G>T	ENSP00000350003:p.Val56Leu		46281819	B3KVQ1|F5GWL6|Q15748|Q2YDB9|Q86WD2|Q8TDP6|Q9ULY8	Missense_Mutation	SNP	ENST00000357422.2	37	CCDS2738.1	.	.	.	.	.	.	.	.	.	.	G	10.95	1.496173	0.26861	.	.	ENSG00000183625	ENST00000357422;ENST00000545097;ENST00000541018;ENST00000395940;ENST00000452454;ENST00000395942	T;T;T;T;T;T	0.70631	-0.5;-0.5;-0.5;-0.5;-0.5;-0.5	6.07	2.08	0.27032	GPCR, rhodopsin-like superfamily (1);	0.377567	0.22261	N	0.062401	T	0.69878	0.3160	L	0.35487	1.065	0.35102	D	0.765348	B;B;B;B	0.32526	0.374;0.372;0.174;0.208	P;B;B;B	0.51135	0.66;0.309;0.159;0.246	T	0.71915	-0.4448	10	0.56958	D	0.05	.	6.9884	0.24741	0.2103:0.3722:0.4175:0.0	.	56;56;77;56	Q8TDP5;Q8TDP6;F5GWL6;P51677	.;.;.;CCR3_HUMAN	L	56;77;56;56;56;56	ENSP00000350003:V56L;ENSP00000441600:V77L;ENSP00000440097:V56L;ENSP00000379271:V56L;ENSP00000389336:V56L;ENSP00000379273:V56L	ENSP00000350003:V56L	V	+	1	0	CCR3	46281819	0.998000	0.40836	0.913000	0.36048	0.213000	0.24496	0.595000	0.24029	0.089000	0.17243	-0.345000	0.07892	GTG		0.527	CCR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257380.2		
GRK7	131890	broad.mit.edu	37	3	141526491	141526491	+	Missense_Mutation	SNP	G	G	C			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr3:141526491G>C	ENST00000264952.2	+	3	1192	c.1055G>C	c.(1054-1056)gGa>gCa	p.G352A		NM_139209.2	NP_631948.1	Q8WTQ7	GRK7_HUMAN	G protein-coupled receptor kinase 7	352	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				protein autophosphorylation (GO:0046777)|signal transduction (GO:0007165)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|visual perception (GO:0007601)	membrane (GO:0016020)	ATP binding (GO:0005524)|G-protein coupled receptor kinase activity (GO:0004703)|rhodopsin kinase activity (GO:0050254)	p.G352A(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(14)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	26						TTACAGGCTGGAACCAATGGT	0.428																																																1	Substitution - Missense(1)	ovary(1)	3											112.0	116.0	115.0					3																	141526491		2203	4300	6503	143009181	SO:0001583	missense	131890				CCDS3120.1	3q24	2004-02-04	2004-02-04	2004-02-04	ENSG00000114124	ENSG00000114124			17031	protein-coding gene	gene with protein product		606987		GPRK7		11717351, 11754336	Standard	NM_139209		Approved		uc011bnd.2	Q8WTQ7	OTTHUMG00000159068	ENST00000264952.2:c.1055G>C	3.37:g.141526491G>C	ENSP00000264952:p.Gly352Ala		143009181		Missense_Mutation	SNP	ENST00000264952.2	37	CCDS3120.1	.	.	.	.	.	.	.	.	.	.	G	24.7	4.563951	0.86335	.	.	ENSG00000114124	ENST00000264952	T	0.39592	1.07	4.41	4.41	0.53225	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.72779	0.3503	M	0.92604	3.325	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.81942	-0.0702	10	0.87932	D	0	-9.3058	17.0414	0.86490	0.0:0.0:1.0:0.0	.	352	Q8WTQ7	GRK7_HUMAN	A	352	ENSP00000264952:G352A	ENSP00000264952:G352A	G	+	2	0	GRK7	143009181	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.321000	0.96353	2.015000	0.59207	0.650000	0.86243	GGA		0.428	GRK7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353168.1	NM_139209	
WDR49	151790	broad.mit.edu	37	3	167254678	167254678	+	Missense_Mutation	SNP	G	G	T			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr3:167254678G>T	ENST00000308378.3	-	7	1183	c.878C>A	c.(877-879)cCt>cAt	p.P293H	WDR49_ENST00000479765.1_Intron|WDR49_ENST00000453925.2_Missense_Mutation_p.P357H|WDR49_ENST00000476376.1_Missense_Mutation_p.P118H	NM_178824.3	NP_849146.1	Q8IV35	WDR49_HUMAN	WD repeat domain 49	293								p.P293H(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(28)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	50						AGTTTGTGGAGGTAAAAACGC	0.388																																																1	Substitution - Missense(1)	ovary(1)	3											79.0	73.0	75.0					3																	167254678		2203	4300	6503	168737372	SO:0001583	missense	151790			AK097556	CCDS3201.1	3q26.1	2013-01-11			ENSG00000174776	ENSG00000174776		"""WD repeat domain containing"""	26587	protein-coding gene	gene with protein product						12477932	Standard	NM_178824		Approved	FLJ33620	uc003fev.1	Q8IV35	OTTHUMG00000158290	ENST00000308378.3:c.878C>A	3.37:g.167254678G>T	ENSP00000311343:p.Pro293His		168737372	Q8N297	Missense_Mutation	SNP	ENST00000308378.3	37	CCDS3201.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.48|13.48	2.250915|2.250915	0.39797|0.39797	.|.	.|.	ENSG00000174776|ENSG00000174776	ENST00000472600|ENST00000308378;ENST00000476376;ENST00000453925	.|T;T;T	.|0.70516	.|-0.49;-0.49;-0.49	5.69|5.69	5.69|5.69	0.88448|0.88448	.|WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	.|0.227351	.|0.45867	.|D	.|0.000340	D|D	0.85292|0.85292	0.5663|0.5663	M|M	0.88512|0.88512	2.96|2.96	0.27875|0.27875	N|N	0.939884|0.939884	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.79784	.|0.993;0.989	T|T	0.81309|0.81309	-0.0991|-0.0991	5|10	.|0.87932	.|D	.|0	.|.	11.9868|11.9868	0.53153|0.53153	0.08:0.0:0.92:0.0|0.08:0.0:0.92:0.0	.|.	.|357;293	.|E7EQK3;Q8IV35	.|.;WDR49_HUMAN	I|H	369|293;118;357	.|ENSP00000311343:P293H;ENSP00000420508:P118H;ENSP00000410863:P357H	.|ENSP00000311343:P293H	L|P	-|-	1|2	0|0	WDR49|WDR49	168737372|168737372	1.000000|1.000000	0.71417|0.71417	0.994000|0.994000	0.49952|0.49952	0.022000|0.022000	0.10575|0.10575	5.027000|5.027000	0.64109|0.64109	2.700000|2.700000	0.92200|0.92200	0.655000|0.655000	0.94253|0.94253	CTC|CCT		0.388	WDR49-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000350592.3	NM_178824	
TP63	8626	broad.mit.edu	37	3	189456558	189456558	+	Missense_Mutation	SNP	A	A	T			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr3:189456558A>T	ENST00000264731.3	+	3	408	c.319A>T	c.(319-321)Atg>Ttg	p.M107L	TP63_ENST00000320472.5_Missense_Mutation_p.M107L|TP63_ENST00000418709.2_Missense_Mutation_p.M107L|TP63_ENST00000382063.4_Missense_Mutation_p.M107L|TP63_ENST00000440651.2_Missense_Mutation_p.M107L|TP63_ENST00000392460.3_Missense_Mutation_p.M107L	NM_001114978.1|NM_003722.4	NP_001108450.1|NP_003713.3	Q9H3D4	P63_HUMAN	tumor protein p63	107	Transcription activation.				apoptotic process (GO:0006915)|cell aging (GO:0007569)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|chromatin remodeling (GO:0006338)|cloacal septation (GO:0060197)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|ectoderm and mesoderm interaction (GO:0007499)|embryonic limb morphogenesis (GO:0030326)|epidermal cell division (GO:0010481)|epithelial cell development (GO:0002064)|establishment of planar polarity (GO:0001736)|establishment of skin barrier (GO:0061436)|female genitalia morphogenesis (GO:0048807)|hair follicle morphogenesis (GO:0031069)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|keratinocyte differentiation (GO:0030216)|keratinocyte proliferation (GO:0043616)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organismal aging (GO:0010259)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular senescence (GO:2000773)|negative regulation of keratinocyte differentiation (GO:0045617)|negative regulation of mesoderm development (GO:2000381)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|odontogenesis of dentin-containing tooth (GO:0042475)|polarized epithelial cell differentiation (GO:0030859)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell cycle G1/S phase transition (GO:1902808)|positive regulation of fibroblast apoptotic process (GO:2000271)|positive regulation of keratinocyte proliferation (GO:0010838)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|post-anal tail morphogenesis (GO:0036342)|prostatic bud formation (GO:0060513)|protein homotetramerization (GO:0051289)|proximal/distal pattern formation (GO:0009954)|regulation of epidermal cell division (GO:0010482)|regulation of neuron apoptotic process (GO:0043523)|response to gamma radiation (GO:0010332)|response to X-ray (GO:0010165)|skeletal system development (GO:0001501)|smooth muscle tissue development (GO:0048745)|squamous basal epithelial stem cell differentiation involved in prostate gland acinus development (GO:0060529)|sympathetic nervous system development (GO:0048485)|urinary bladder development (GO:0060157)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|p53 binding (GO:0002039)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding transcription factor activity (GO:0000989)|transcription regulatory region DNA binding (GO:0044212)|WW domain binding (GO:0050699)	p.M107L(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(5)|large_intestine(12)|lung(15)|ovary(2)|skin(9)|upper_aerodigestive_tract(6)	61	all_cancers(143;3.35e-10)|Ovarian(172;0.0925)		Lung(62;3.33e-05)	GBM - Glioblastoma multiforme(93;0.0227)		GAGTGACCCCATGTGGGTGAG	0.483										HNSCC(45;0.13)																																						1	Substitution - Missense(1)	ovary(1)	3											96.0	90.0	92.0					3																	189456558		2203	4300	6503	190939252	SO:0001583	missense	8626			AB010153	CCDS3293.1, CCDS46976.1, CCDS46977.1, CCDS46978.1, CCDS46979.1, CCDS46980.1	3q27-q29	2014-09-17			ENSG00000073282	ENSG00000073282			15979	protein-coding gene	gene with protein product		603273	"""tumor protein p73-like"", ""tumor protein p53-like"", ""tumor protein p53-competing protein"""	TP73L, TP53L, TP53CP		9774969, 9662378, 11181441, 11181451	Standard	NM_003722		Approved	p51, SHFM4, EEC3, p63, p73L, OFC8, KET, p73H, NBP, p53CP	uc003fry.2	Q9H3D4	OTTHUMG00000156313	ENST00000264731.3:c.319A>T	3.37:g.189456558A>T	ENSP00000264731:p.Met107Leu		190939252	O75080|O75195|O75922|O76078|Q6VEG2|Q6VEG3|Q6VEG4|Q6VFJ1|Q6VFJ2|Q6VFJ3|Q6VH20|Q7LDI3|Q7LDI4|Q7LDI5|Q96KR0|Q9H3D2|Q9H3D3|Q9H3P8|Q9NPH7|Q9P1B4|Q9P1B5|Q9P1B6|Q9P1B7|Q9UBV9|Q9UE10|Q9UP26|Q9UP27|Q9UP28|Q9UP74	Missense_Mutation	SNP	ENST00000264731.3	37	CCDS3293.1	.	.	.	.	.	.	.	.	.	.	A	10.83	1.460177	0.26248	.	.	ENSG00000073282	ENST00000264731;ENST00000418709;ENST00000320472;ENST00000392460;ENST00000440651;ENST00000382063	D;D;D;D;D;D	0.99719	-5.83;-6.09;-6.07;-6.06;-5.83;-6.52	5.67	4.49	0.54785	.	0.152635	0.64402	D	0.000014	D	0.96750	0.8939	N	0.01874	-0.695	0.80722	D	1	B;B;B;B	0.06786	0.0;0.001;0.0;0.0	B;B;B;B	0.06405	0.002;0.0;0.0;0.0	D	0.95427	0.8513	9	.	.	.	-5.3065	12.1644	0.54120	0.8569:0.1431:0.0:0.0	.	107;107;107;107	Q9H3D4-7;Q9H3D4-3;Q9H3D4;Q9H3D4-5	.;.;P63_HUMAN;.	L	107	ENSP00000264731:M107L;ENSP00000407144:M107L;ENSP00000317510:M107L;ENSP00000376253:M107L;ENSP00000394337:M107L;ENSP00000371495:M107L	.	M	+	1	0	TP63	190939252	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	6.049000	0.71053	0.957000	0.37930	0.459000	0.35465	ATG		0.483	TP63-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000343865.1	NM_003722	
FAT4	79633	broad.mit.edu	37	4	126241852	126241852	+	Missense_Mutation	SNP	T	T	C			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr4:126241852T>C	ENST00000394329.3	+	1	4299	c.4286T>C	c.(4285-4287)aTt>aCt	p.I1429T		NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	1429	Cadherin 14. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.I1429T(2)		NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						TTCAAGTCTATTGTTGAGAAC	0.423																																																2	Substitution - Missense(2)	ovary(2)	4											143.0	134.0	137.0					4																	126241852		1884	4111	5995	126461302	SO:0001583	missense	79633			AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.4286T>C	4.37:g.126241852T>C	ENSP00000377862:p.Ile1429Thr		126461302	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	ENST00000394329.3	37	CCDS3732.3	.	.	.	.	.	.	.	.	.	.	T	18.97	3.735305	0.69189	.	.	ENSG00000196159	ENST00000394329	T	0.56776	0.44	4.87	4.87	0.63330	Cadherin (3);Cadherin-like (1);	0.000000	0.34628	U	0.003808	T	0.76292	0.3967	M	0.89414	3.03	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	T	0.81697	-0.0815	10	0.72032	D	0.01	.	14.6255	0.68618	0.0:0.0:0.0:1.0	.	1429	Q6V0I7	FAT4_HUMAN	T	1429	ENSP00000377862:I1429T	ENSP00000377862:I1429T	I	+	2	0	FAT4	126461302	1.000000	0.71417	0.295000	0.24960	0.935000	0.57460	7.708000	0.84633	2.050000	0.60909	0.533000	0.62120	ATT		0.423	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582	
IQGAP2	10788	broad.mit.edu	37	5	75989197	75989197	+	Missense_Mutation	SNP	T	T	C			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr5:75989197T>C	ENST00000274364.6	+	31	4220	c.3923T>C	c.(3922-3924)aTt>aCt	p.I1308T	IQGAP2_ENST00000396234.3_Missense_Mutation_p.I804T|IQGAP2_ENST00000379730.3_Missense_Mutation_p.I810T|CTD-2384B11.2_ENST00000507514.1_RNA|IQGAP2_ENST00000502745.1_Missense_Mutation_p.I804T	NM_006633.2	NP_006624	Q13576	IQGA2_HUMAN	IQ motif containing GTPase activating protein 2	1308					negative regulation of catalytic activity (GO:0043086)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microvillus (GO:0005902)	actin binding (GO:0003779)|GTPase inhibitor activity (GO:0005095)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|Ras GTPase activator activity (GO:0005099)	p.I1308T(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(23)|ovary(6)|prostate(1)|skin(3)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	68		all_lung(232;0.000514)|Lung NSC(167;0.00135)|Prostate(461;0.00838)|Ovarian(174;0.0149)		all cancers(79;1.38e-36)		AAGCTGATAATTGATGTGATC	0.393																																																1	Substitution - Missense(1)	ovary(1)	5											90.0	82.0	85.0					5																	75989197		2203	4300	6503	76024953	SO:0001583	missense	10788			U51903	CCDS34188.1, CCDS68897.1, CCDS68898.1, CCDS75262.1	5q	2008-07-18			ENSG00000145703	ENSG00000145703			6111	protein-coding gene	gene with protein product		605401				8756646	Standard	XM_005248409		Approved		uc003kek.3	Q13576	OTTHUMG00000162432	ENST00000274364.6:c.3923T>C	5.37:g.75989197T>C	ENSP00000274364:p.Ile1308Thr		76024953	A8K4V1|B7Z8A4|J3KR91	Missense_Mutation	SNP	ENST00000274364.6	37	CCDS34188.1	.	.	.	.	.	.	.	.	.	.	T	17.57	3.421653	0.62622	.	.	ENSG00000145703	ENST00000274364;ENST00000379730;ENST00000505766;ENST00000396234;ENST00000502745	T;T;T;T;T	0.45668	0.89;0.89;0.89;0.89;0.89	5.97	5.97	0.96955	.	0.177572	0.47852	D	0.000211	T	0.49592	0.1566	M	0.66939	2.045	0.42109	D	0.991374	B;B;B	0.33826	0.427;0.427;0.302	B;B;B	0.38985	0.287;0.287;0.15	T	0.53401	-0.8444	10	0.72032	D	0.01	-8.715	16.4361	0.83875	0.0:0.0:0.0:1.0	.	810;804;1308	F5H7S7;Q13576-2;Q13576	.;.;IQGA2_HUMAN	T	1308;810;1258;804;804	ENSP00000274364:I1308T;ENSP00000442313:I810T;ENSP00000421097:I1258T;ENSP00000379535:I804T;ENSP00000426027:I804T	ENSP00000274364:I1308T	I	+	2	0	IQGAP2	76024953	1.000000	0.71417	0.806000	0.32338	0.955000	0.61496	7.669000	0.83911	2.274000	0.75844	0.533000	0.62120	ATT		0.393	IQGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368877.1	NM_006633	
PCDHA2	56146	broad.mit.edu	37	5	140175782	140175782	+	Silent	SNP	C	C	T			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr5:140175782C>T	ENST00000526136.1	+	1	1233	c.1233C>T	c.(1231-1233)agC>agT	p.S411S	PCDHA1_ENST00000504120.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA2_ENST00000378132.1_Silent_p.S411S|PCDHA2_ENST00000520672.2_Silent_p.S411S	NM_018905.2	NP_061728.1	Q9Y5H9	PCDA2_HUMAN	protocadherin alpha 2	411	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.S411S(1)		NS(1)|breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(16)|lung(26)|ovary(4)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGCTGGACAGCGCCCTGGACC	0.617																																																1	Substitution - coding silent(1)	ovary(1)	5											153.0	135.0	141.0					5																	140175782		2203	4300	6503	140155966	SO:0001819	synonymous_variant	56146			AF152480	CCDS54914.1, CCDS64269.1	5q31	2010-11-26				ENSG00000204969		"""Cadherins / Protocadherins : Clustered"""	8668	other	complex locus constituent	"""KIAA0345-like 12"""	606308				10380929	Standard	NM_018905		Approved			Q9Y5H9		ENST00000526136.1:c.1233C>T	5.37:g.140175782C>T			140155966	O75287|Q9BTV3	Silent	SNP	ENST00000526136.1	37	CCDS54914.1																																																																																				0.617	PCDHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372877.3	NM_018905	
FBXO38	81545	broad.mit.edu	37	5	147807510	147807510	+	Splice_Site	SNP	G	G	C			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr5:147807510G>C	ENST00000340253.5	+	15	2821	c.2653G>C	c.(2653-2655)Gaa>Caa	p.E885Q	FBXO38_ENST00000394370.3_Intron|CTD-2283N19.1_ENST00000520980.2_RNA|FBXO38_ENST00000513826.1_Intron|FBXO38_ENST00000296701.6_Intron			Q6PIJ6	FBX38_HUMAN	F-box protein 38	885					cell death (GO:0008219)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.E885Q(1)	ATG4C/FBXO38(2)	NS(1)|breast(2)|endometrium(7)|kidney(5)|large_intestine(9)|lung(15)|ovary(5)|prostate(2)|skin(2)|stomach(2)|urinary_tract(1)	51			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATCTGAGTCAGGTATGACAAT	0.493																																																1	Substitution - Missense(1)	ovary(1)	5											42.0	46.0	44.0					5																	147807510		2203	4300	6503	147787703	SO:0001630	splice_region_variant	81545			BC005873	CCDS43384.1, CCDS64285.1	5q33.1	2008-02-05			ENSG00000145868	ENSG00000145868		"""F-boxes /  ""other"""""	28844	protein-coding gene	gene with protein product		608533				12477932	Standard	NM_030793		Approved	MOKA, SP329, FLJ13962, Fbx38	uc003lpg.2	Q6PIJ6	OTTHUMG00000129929	ENST00000340253.5:c.2653+1G>C	5.37:g.147807510G>C			147787703	Q6PK72|Q7Z2U0|Q86VN3|Q9BXY6|Q9H837|Q9HC40	Missense_Mutation	SNP	ENST00000340253.5	37		.	.	.	.	.	.	.	.	.	.	G	22.5	4.301004	0.81136	.	.	ENSG00000145868	ENST00000340253	T	0.36878	1.23	5.54	5.54	0.83059	.	0.154985	0.56097	D	0.000030	T	0.37433	0.1003	N	0.19112	0.55	0.80722	D	1	D	0.59767	0.986	P	0.54590	0.756	T	0.03887	-1.0995	10	0.25751	T	0.34	-14.3133	16.5672	0.84601	0.0:0.0:1.0:0.0	.	885	Q6PIJ6	FBX38_HUMAN	Q	885	ENSP00000342023:E885Q	ENSP00000342023:E885Q	E	+	1	0	FBXO38	147787703	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.148000	0.89630	2.779000	0.95612	0.591000	0.81541	GAA		0.493	FBXO38-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000252185.2	NM_030793	Missense_Mutation
LARP1	23367	broad.mit.edu	37	5	154182974	154182974	+	Splice_Site	SNP	G	G	T			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr5:154182974G>T	ENST00000336314.4	+	12	2026		c.e12+1			NM_015315.3	NP_056130.2	Q6PKG0	LARP1_HUMAN	La ribonucleoprotein domain family, member 1						cell proliferation (GO:0008283)|positive regulation of macroautophagy (GO:0016239)|positive regulation of translation (GO:0045727)|TOR signaling (GO:0031929)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	eukaryotic initiation factor 4E binding (GO:0008190)|mRNA 3'-UTR binding (GO:0003730)|mRNA 5'-UTR binding (GO:0048027)|poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation activator activity (GO:0008494)|translation initiation factor binding (GO:0031369)	p.?(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(9)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	33	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			TTCCAGCAAGGTGAGAAGCAG	0.592																																																1	Unknown(1)	ovary(1)	5											56.0	58.0	57.0					5																	154182974		2203	4300	6503	154163167	SO:0001630	splice_region_variant	23367			AB018274	CCDS4328.1	5q33.2	2014-02-12			ENSG00000155506	ENSG00000155506		"""La ribonucleoprotein domain containing"""	29531	protein-coding gene	gene with protein product		612059				9872452, 10878606	Standard	NM_015315		Approved	LARP, KIAA0731, MGC19556	uc003lvo.4	Q6PKG0	OTTHUMG00000130191	ENST00000336314.4:c.2002+1G>T	5.37:g.154182974G>T			154163167	O94836|Q8N4M2|Q8NB73|Q9UFD7	Splice_Site	SNP	ENST00000336314.4	37	CCDS4328.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.208247	0.79240	.	.	ENSG00000155506	ENST00000336314;ENST00000518297;ENST00000524248;ENST00000518677	.	.	.	5.3	5.3	0.74995	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.9495	0.92636	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	LARP1	154163167	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	9.057000	0.93889	2.463000	0.83235	0.462000	0.41574	.		0.592	LARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252509.1	NM_033551	Intron
HLA-DRA	3122	broad.mit.edu	37	6	32410436	32410436	+	Missense_Mutation	SNP	G	G	A			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr6:32410436G>A	ENST00000374982.5	+	2	367	c.294G>A	c.(292-294)atG>atA	p.M98I	HLA-DRA_ENST00000395388.2_Missense_Mutation_p.M98I			P01903	DRA_HUMAN	major histocompatibility complex, class II, DR alpha	98	Alpha-1.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide or polysaccharide antigen via MHC class II (GO:0002504)|cognition (GO:0050890)|cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|interferon-gamma-mediated signaling pathway (GO:0060333)|peptide antigen assembly with MHC class II protein complex (GO:0002503)|polysaccharide assembly with MHC class II protein complex (GO:0002506)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	cell surface (GO:0009986)|clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|ER to Golgi transport vesicle membrane (GO:0012507)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|integral component of plasma membrane (GO:0005887)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)	MHC class II protein complex binding (GO:0023026)|MHC class II receptor activity (GO:0032395)|peptide antigen binding (GO:0042605)	p.M98I(1)		NS(1)|breast(1)|large_intestine(6)|lung(5)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	19						TGGAAATCATGACAAAGCGCT	0.498									T-cell Lymphoma, (Cutaneous) , Familial Clustering of;Kaposi Sarcoma, Familial Clustering of																																							1	Substitution - Missense(1)	ovary(1)	6											218.0	202.0	207.0					6																	32410436		1511	2709	4220	32518414	SO:0001583	missense	3122	Familial Cancer Database	incl.: Mycosis Fungoides, Sezary syndrome, Adult T-cell Lymphoma;		CCDS4750.1	6p21.3	2013-01-11			ENSG00000204287	ENSG00000204287		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4947	protein-coding gene	gene with protein product		142860		HLA-DRA1			Standard	NM_019111		Approved		uc003obh.3	P01903	OTTHUMG00000031269	ENST00000374982.5:c.294G>A	6.37:g.32410436G>A	ENSP00000364121:p.Met98Ile		32518414	A2BET4|Q30160|Q6IAZ1|Q861I2|Q9TP70	Missense_Mutation	SNP	ENST00000374982.5	37		.	.	.	.	.	.	.	.	.	.	.	13.36	2.215202	0.39102	.	.	ENSG00000204287	ENST00000395388;ENST00000374982	T;T	0.00691	5.84;5.84	5.38	4.51	0.55191	MHC class II, alpha/beta chain, N-terminal (1);MHC classes I/II-like antigen recognition protein (1);MHC class II, alpha chain, N-terminal (2);	0.728382	0.14459	N	0.318329	T	0.00580	0.0019	M	0.73598	2.24	0.28419	N	0.917839	B;B	0.06786	0.0;0.001	B;B	0.14578	0.008;0.011	T	0.43147	-0.9409	10	0.66056	D	0.02	.	9.7528	0.40485	0.0921:0.0:0.9079:0.0	.	98;98	Q30118;P01903	.;DRA_HUMAN	I	98	ENSP00000378786:M98I;ENSP00000364121:M98I	ENSP00000364121:M98I	M	+	3	0	HLA-DRA	32518414	0.232000	0.23762	0.734000	0.30879	0.637000	0.38172	0.399000	0.20916	1.520000	0.48965	0.638000	0.83543	ATG		0.498	HLA-DRA-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000076587.3	NM_019111	
ANKS1A	23294	broad.mit.edu	37	6	35051281	35051281	+	Splice_Site	SNP	G	G	C			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr6:35051281G>C	ENST00000360359.3	+	20	3132		c.e20+1		ANKS1A_ENST00000535627.1_Intron	NM_015245.2	NP_056060.2	Q92625	ANS1A_HUMAN	ankyrin repeat and sterile alpha motif domain containing 1A						ephrin receptor signaling pathway (GO:0048013)|neuron remodeling (GO:0016322)|substrate-dependent cell migration (GO:0006929)	cytoplasm (GO:0005737)|neuron projection (GO:0043005)|nucleus (GO:0005634)		p.?(1)		cervix(2)|endometrium(3)|large_intestine(4)|lung(16)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31						CTCCAACAAGGTGTGCTGCTT	0.537																																																1	Unknown(1)	ovary(1)	6											190.0	146.0	161.0					6																	35051281		2203	4300	6503	35159259	SO:0001630	splice_region_variant	23294			D86982	CCDS4798.1	6p21.31	2013-01-10	2006-02-17	2006-02-17	ENSG00000064999	ENSG00000064999		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	20961	protein-coding gene	gene with protein product		608994	"""ankyrin repeat and SAM domain containing 1"", ""ankyrin repeat and sterile alpha motif domain containing 1"""	ANKS1		9039502	Standard	NM_015245		Approved	KIAA0229	uc003ojx.4	Q92625	OTTHUMG00000014559	ENST00000360359.3:c.2994+1G>C	6.37:g.35051281G>C			35159259	A2RUC1|B4DQW8|Q5JYI9|Q5SYR2|Q86WQ7	Splice_Site	SNP	ENST00000360359.3	37	CCDS4798.1	.	.	.	.	.	.	.	.	.	.	G	28.1	4.887456	0.91814	.	.	ENSG00000064999	ENST00000360359;ENST00000373990	.	.	.	4.86	4.86	0.63082	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.0077	0.89214	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ANKS1A	35159259	1.000000	0.71417	0.994000	0.49952	0.965000	0.64279	9.777000	0.99008	2.252000	0.74401	0.655000	0.94253	.		0.537	ANKS1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040262.1	XM_166478	Intron
GLO1	2739	broad.mit.edu	37	6	38670772	38670772	+	Missense_Mutation	SNP	C	C	T	rs377328531		TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr6:38670772C>T	ENST00000373365.4	-	1	145	c.59G>A	c.(58-60)tGc>tAc	p.C20Y		NM_006708.2	NP_006699.2	Q04760	LGUL_HUMAN	glyoxalase I	20					carbohydrate metabolic process (GO:0005975)|glutathione metabolic process (GO:0006749)|methylglyoxal metabolic process (GO:0009438)|negative regulation of apoptotic process (GO:0043066)|osteoclast differentiation (GO:0030316)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	lactoylglutathione lyase activity (GO:0004462)|zinc ion binding (GO:0008270)	p.C20Y(1)		lung(2)|ovary(2)|prostate(1)|urinary_tract(1)	6					Glutathione(DB00143)|Indomethacin(DB00328)	CGCGTCGGAGCAGCAACTGAG	0.697																																																1	Substitution - Missense(1)	ovary(1)	6						C	TYR/CYS	0,4398		0,0,2199	15.0	18.0	17.0		59	5.7	1.0	6		17	1,8579		0,1,4289	no	missense	GLO1	NM_006708.2	194	0,1,6488	TT,TC,CC		0.0117,0.0,0.0077	probably-damaging	20/185	38670772	1,12977	2199	4290	6489	38778750	SO:0001583	missense	2739			L07837	CCDS4837.1	6p21.3-p21.1	2012-10-02			ENSG00000124767	ENSG00000124767	4.4.1.5		4323	protein-coding gene	gene with protein product	"""glyoxalase domain containing 1"""	138750				8449929, 7684374	Standard	NM_006708		Approved	GLOD1	uc003ooc.3	Q04760	OTTHUMG00000014636	ENST00000373365.4:c.59G>A	6.37:g.38670772C>T	ENSP00000362463:p.Cys20Tyr		38778750	B2R6P7|B4DDV0|P78375|Q59EL0|Q5TZW3|Q96FC0|Q96J41	Missense_Mutation	SNP	ENST00000373365.4	37	CCDS4837.1	.	.	.	.	.	.	.	.	.	.	C	18.44	3.623398	0.66901	0.0	1.17E-4	ENSG00000124767	ENST00000373365	T	0.28895	1.59	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	T	0.08935	0.0221	N	0.08118	0	0.80722	D	1	B	0.30281	0.275	B	0.26202	0.067	T	0.09207	-1.0685	10	0.38643	T	0.18	-21.7195	15.093	0.72211	0.0:1.0:0.0:0.0	.	20	Q04760	LGUL_HUMAN	Y	20	ENSP00000362463:C20Y	ENSP00000362463:C20Y	C	-	2	0	GLO1	38778750	1.000000	0.71417	0.999000	0.59377	0.951000	0.60555	3.273000	0.51623	2.941000	0.99782	0.655000	0.94253	TGC		0.697	GLO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040438.2	NM_006708	
TCTE1	202500	broad.mit.edu	37	6	44250202	44250202	+	Missense_Mutation	SNP	A	A	C			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	A	A	C	C	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr6:44250202A>C	ENST00000371505.4	-	4	1063	c.941T>G	c.(940-942)tTg>tGg	p.L314W	TCTE1_ENST00000371504.1_Intron|RP11-444E17.6_ENST00000505802.1_Intron|TCTE1_ENST00000371503.3_Intron|TMEM151B_ENST00000438774.2_Intron	NM_182539.3	NP_872345.2	Q5JU00	TCTE1_HUMAN	t-complex-associated-testis-expressed 1	314								p.L314W(1)		breast(1)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(9)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	34	Hepatocellular(11;0.00908)|all_lung(25;0.0101)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			GTTTTGTGACAAGTCCAGCTC	0.567																																																1	Substitution - Missense(1)	ovary(1)	6											110.0	98.0	102.0					6																	44250202		2203	4300	6503	44358180	SO:0001583	missense	202500			BC035022	CCDS4910.1	6q21.1	2014-07-18			ENSG00000146221	ENSG00000146221			11693	protein-coding gene	gene with protein product		186975				2568335, 8646886	Standard	NM_182539		Approved	D6S46, MGC33600, FAP155	uc003oxi.2	Q5JU00	OTTHUMG00000014763	ENST00000371505.4:c.941T>G	6.37:g.44250202A>C	ENSP00000360560:p.Leu314Trp		44358180	B4DX59|Q8IYS6	Missense_Mutation	SNP	ENST00000371505.4	37	CCDS4910.1	.	.	.	.	.	.	.	.	.	.	A	23.3	4.399722	0.83120	.	.	ENSG00000146221	ENST00000371505	T	0.73789	-0.78	5.37	5.37	0.77165	.	0.144724	0.47455	D	0.000227	D	0.90930	0.7149	H	0.98936	4.375	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.94532	0.7737	10	0.87932	D	0	-17.9126	15.6802	0.77360	1.0:0.0:0.0:0.0	.	314	Q5JU00	TCTE1_HUMAN	W	314	ENSP00000360560:L314W	ENSP00000360560:L314W	L	-	2	0	TCTE1	44358180	1.000000	0.71417	0.994000	0.49952	0.769000	0.43574	8.896000	0.92521	2.176000	0.68965	0.374000	0.22700	TTG		0.567	TCTE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040736.1	NM_182539	
SUPT3H	8464	broad.mit.edu	37	6	44971503	44971503	+	Missense_Mutation	SNP	T	T	C			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr6:44971503T>C	ENST00000371459.1	-	6	556	c.391A>G	c.(391-393)Aac>Gac	p.N131D	SUPT3H_ENST00000371461.2_Missense_Mutation_p.N142D|SUPT3H_ENST00000306867.5_Missense_Mutation_p.N131D|SUPT3H_ENST00000371460.1_Missense_Mutation_p.N142D	NM_001261823.1|NM_003599.3	NP_001248752.1|NP_003590.1	O75486	SUPT3_HUMAN	suppressor of Ty 3 homolog (S. cerevisiae)	213					chromatin organization (GO:0006325)|histone deubiquitination (GO:0016578)|histone H3 acetylation (GO:0043966)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|STAGA complex (GO:0030914)|transcription factor TFTC complex (GO:0033276)	transcription coactivator activity (GO:0003713)	p.N142D(1)		breast(2)|kidney(1)|large_intestine(3)|lung(3)|ovary(2)|skin(1)	12						TGTCTTTTGTTCGCATTATTG	0.343																																																1	Substitution - Missense(1)	ovary(1)	6											146.0	127.0	134.0					6																	44971503		2202	4299	6501	45079481	SO:0001583	missense	8464			AF069734	CCDS34465.1, CCDS34466.1, CCDS75464.1	6p21.1-p12.3	2008-05-15	2001-11-28		ENSG00000196284	ENSG00000196284			11466	protein-coding gene	gene with protein product		602947	"""suppressor of Ty (S.cerevisiae) 3 homolog"""			9674425, 9726987	Standard	NM_003599		Approved	SPT3, SPT3L	uc003oxp.4	O75486	OTTHUMG00000014773	ENST00000371459.1:c.391A>G	6.37:g.44971503T>C	ENSP00000360514:p.Asn131Asp		45079481	A6NKG9|B2R9Q5|O76066|Q5TAV9|Q86VN7	Missense_Mutation	SNP	ENST00000371459.1	37	CCDS34465.1	.	.	.	.	.	.	.	.	.	.	T	16.44	3.122874	0.56613	.	.	ENSG00000196284	ENST00000371460;ENST00000371459;ENST00000306867;ENST00000371461	T;T;T;T	0.46063	0.88;0.9;0.9;0.88	5.66	5.66	0.87406	.	0.131133	0.64402	D	0.000002	T	0.47078	0.1426	M	0.62723	1.935	0.42061	D	0.991161	P;D	0.69078	0.813;0.997	B;D	0.73380	0.444;0.98	T	0.45527	-0.9255	10	0.10636	T	0.68	-15.2252	15.8893	0.79279	0.0:0.0:0.0:1.0	.	142;213	O75486-3;O75486	.;SUPT3_HUMAN	D	142;131;131;142	ENSP00000360515:N142D;ENSP00000360514:N131D;ENSP00000306718:N131D;ENSP00000360516:N142D	ENSP00000306718:N131D	N	-	1	0	SUPT3H	45079481	1.000000	0.71417	0.916000	0.36221	0.575000	0.36095	6.318000	0.72866	2.153000	0.67306	0.528000	0.53228	AAC		0.343	SUPT3H-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106911.2	NM_181356	
GCLC	2729	broad.mit.edu	37	6	53373417	53373417	+	Silent	SNP	T	T	C			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr6:53373417T>C	ENST00000229416.6	-	8	1404	c.921A>G	c.(919-921)agA>agG	p.R307R	RP1-27K12.4_ENST00000508884.1_RNA	NM_001197115.1|NM_001498.3	NP_001184044.1|NP_001489.1	P48506	GSH1_HUMAN	glutamate-cysteine ligase, catalytic subunit	307					apoptotic mitochondrial changes (GO:0008637)|cell redox homeostasis (GO:0045454)|cellular nitrogen compound metabolic process (GO:0034641)|cysteine metabolic process (GO:0006534)|glutamate metabolic process (GO:0006536)|glutathione biosynthetic process (GO:0006750)|glutathione derivative biosynthetic process (GO:1901687)|L-ascorbic acid metabolic process (GO:0019852)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|regulation of blood vessel size (GO:0050880)|regulation of mitochondrial depolarization (GO:0051900)|response to arsenic-containing substance (GO:0046685)|response to heat (GO:0009408)|response to hormone (GO:0009725)|response to nitrosative stress (GO:0051409)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|glutamate-cysteine ligase complex (GO:0017109)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|coenzyme binding (GO:0050662)|glutamate binding (GO:0016595)|glutamate-cysteine ligase activity (GO:0004357)|magnesium ion binding (GO:0000287)	p.R307R(1)		breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	22	Lung NSC(77;0.0137)				L-Cysteine(DB00151)|Vitamin E(DB00163)	CCTCCCGAGTTCTATCATCTA	0.433																																																1	Substitution - coding silent(1)	ovary(1)	6											132.0	129.0	130.0					6																	53373417		2203	4300	6503	53481376	SO:0001819	synonymous_variant	2729			M90656	CCDS4952.1, CCDS75471.1	6p12	2008-02-05				ENSG00000001084	6.3.2.2		4311	protein-coding gene	gene with protein product		606857		GLCLC, GLCL		1350904	Standard	NM_001498		Approved	GCS	uc003pbw.2	P48506		ENST00000229416.6:c.921A>G	6.37:g.53373417T>C			53481376	Q14399	Silent	SNP	ENST00000229416.6	37	CCDS4952.1																																																																																				0.433	GCLC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359710.2		
KIAA1244	57221	broad.mit.edu	37	6	138531163	138531163	+	Missense_Mutation	SNP	G	G	T			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr6:138531163G>T	ENST00000251691.4	+	4	502	c.336G>T	c.(334-336)caG>caT	p.Q112H		NM_020340.4	NP_065073.3			KIAA1244									p.Q41H(1)		NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(11)|lung(17)|ovary(2)|skin(2)	44	Breast(32;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00102)|GBM - Glioblastoma multiforme(68;0.00259)		AGGACCTGCAGGTGGAAGTGA	0.498																																																1	Substitution - Missense(1)	ovary(1)	6											154.0	116.0	129.0					6																	138531163		2203	4300	6503	138572856	SO:0001583	missense	57221			AB033070	CCDS5189.2	6q23.3	2012-04-17			ENSG00000112379	ENSG00000112379		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	21213	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 33"""		"""chromosome 6 open reading frame 92"""	C6orf92			Standard	NM_020340		Approved	dJ171N11.1, BIG3, PPP1R33	uc003qhu.3	Q5TH69	OTTHUMG00000015670	ENST00000251691.4:c.336G>T	6.37:g.138531163G>T	ENSP00000251691:p.Gln112His		138572856		Missense_Mutation	SNP	ENST00000251691.4	37	CCDS5189.2	.	.	.	.	.	.	.	.	.	.	G	18.45	3.626071	0.66901	.	.	ENSG00000112379	ENST00000251691	T	0.05081	3.5	5.71	4.84	0.62591	.	0.299826	0.35436	N	0.003207	T	0.09992	0.0245	L	0.52573	1.65	0.53005	D	0.99996	D	0.71674	0.998	D	0.79784	0.993	T	0.01729	-1.1286	10	0.87932	D	0	-8.1441	8.869	0.35305	0.2731:0.0:0.7269:0.0	.	112	Q5TH69	BIG3_HUMAN	H	112	ENSP00000251691:Q112H	ENSP00000251691:Q112H	Q	+	3	2	KIAA1244	138572856	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.308000	0.59129	1.416000	0.47057	0.555000	0.69702	CAG		0.498	KIAA1244-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042425.4	NM_020340	
TULP4	56995	broad.mit.edu	37	6	158910754	158910754	+	Missense_Mutation	SNP	A	A	G			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr6:158910754A>G	ENST00000367097.3	+	9	2978	c.1621A>G	c.(1621-1623)Aaa>Gaa	p.K541E	TULP4_ENST00000367094.2_Missense_Mutation_p.K541E	NM_020245.4	NP_064630.2	Q9NRJ4	TULP4_HUMAN	tubby like protein 4	541					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)|regulation of transcription, DNA-templated (GO:0006355)|response to nutrient (GO:0007584)	cytoplasm (GO:0005737)	sequence-specific DNA binding transcription factor activity (GO:0003700)	p.K541E(1)		endometrium(7)|kidney(2)|large_intestine(15)|lung(17)|ovary(1)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Breast(66;0.000781)|Ovarian(120;0.0308)|Lung SC(201;0.164)|Prostate(117;0.171)		OV - Ovarian serous cystadenocarcinoma(65;1.64e-18)|BRCA - Breast invasive adenocarcinoma(81;2.67e-05)		CAAATCACCCAAACTCCCAAG	0.483																																																1	Substitution - Missense(1)	ovary(1)	6											119.0	108.0	112.0					6																	158910754		2203	4300	6503	158830742	SO:0001583	missense	56995				CCDS34561.1, CCDS34562.1	6q25-q26	2013-01-10			ENSG00000130338	ENSG00000130338		"""WD repeat domain containing"""	15530	protein-coding gene	gene with protein product						11595174	Standard	NM_020245		Approved	TUSP, KIAA1397	uc003qrf.3	Q9NRJ4	OTTHUMG00000015910	ENST00000367097.3:c.1621A>G	6.37:g.158910754A>G	ENSP00000356064:p.Lys541Glu		158830742	Q5T3M2|Q5T3M3|Q9HD22|Q9P2F0	Missense_Mutation	SNP	ENST00000367097.3	37	CCDS34561.1	.	.	.	.	.	.	.	.	.	.	A	31	5.090961	0.94149	.	.	ENSG00000130338	ENST00000367097;ENST00000367094	T;T	0.62639	0.01;0.86	5.57	5.57	0.84162	Tubby, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.63651	0.2529	L	0.36672	1.1	0.58432	D	0.999997	D;D	0.71674	0.974;0.998	D;D	0.75484	0.969;0.986	T	0.65109	-0.6248	10	0.40728	T	0.16	-11.4375	15.7259	0.77761	1.0:0.0:0.0:0.0	.	541;541	Q9NRJ4-2;Q9NRJ4	.;TULP4_HUMAN	E	541	ENSP00000356064:K541E;ENSP00000356061:K541E	ENSP00000356061:K541E	K	+	1	0	TULP4	158830742	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.820000	0.92003	2.113000	0.64589	0.533000	0.62120	AAA		0.483	TULP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042869.1	NM_020245	
WIPF3	644150	broad.mit.edu	37	7	29915498	29915498	+	Missense_Mutation	SNP	C	C	T			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr7:29915498C>T	ENST00000409290.1	+	2	143	c.143C>T	c.(142-144)gCg>gTg	p.A48V	WIPF3_ENST00000409123.1_Missense_Mutation_p.A48V|WIPF3_ENST00000242140.5_Missense_Mutation_p.A48V	NM_001080529.2	NP_001073998.2	A6NGB9	WIPF3_HUMAN	WAS/WASL interacting protein family, member 3	48	WH2. {ECO:0000255|PROSITE- ProRule:PRU00406}.				cell differentiation (GO:0030154)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytosol (GO:0005829)		p.A48V(1)		breast(2)|large_intestine(3)|lung(6)|ovary(1)	12						GGCCGGAGTGCGCTGTTGGCT	0.542																																																1	Substitution - Missense(1)	ovary(1)	7											60.0	68.0	65.0					7																	29915498		2114	4245	6359	29882023	SO:0001583	missense	644150			AK094250	CCDS56472.1	7p15.1	2006-10-12			ENSG00000122574	ENSG00000122574			22004	protein-coding gene	gene with protein product		612432					Standard	NM_001080529		Approved	CR16, FLJ36931	uc022aaz.1	A6NGB9	OTTHUMG00000152761	ENST00000409290.1:c.143C>T	7.37:g.29915498C>T	ENSP00000386878:p.Ala48Val		29882023	B8ZZV2	Missense_Mutation	SNP	ENST00000409290.1	37	CCDS56472.1	.	.	.	.	.	.	.	.	.	.	C	17.27	3.347472	0.61183	.	.	ENSG00000122574	ENST00000409123;ENST00000409290;ENST00000242140	T;T;T	0.63255	-0.03;-0.03;-0.03	5.22	4.34	0.51931	Actin-binding WH2 (3);	0.081640	0.46442	N	0.000297	T	0.65365	0.2684	M	0.93462	3.42	0.36305	D	0.857304	P	0.41214	0.742	B	0.31191	0.125	T	0.77048	-0.2732	10	0.87932	D	0	.	9.7304	0.40357	0.0:0.9045:0.0:0.0955	.	48	A6NGB9	WIPF3_HUMAN	V	48	ENSP00000386790:A48V;ENSP00000386878:A48V;ENSP00000242140:A48V	ENSP00000242140:A48V	A	+	2	0	WIPF3	29882023	1.000000	0.71417	0.943000	0.38184	0.783000	0.44284	5.772000	0.68889	1.196000	0.43129	0.643000	0.83706	GCG		0.542	WIPF3-002	NOVEL	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000327705.1		
ELMO1	9844	broad.mit.edu	37	7	37298836	37298836	+	Silent	SNP	T	T	A			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	T	T	A	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr7:37298836T>A	ENST00000310758.4	-	6	1010	c.363A>T	c.(361-363)atA>atT	p.I121I	ELMO1_ENST00000442504.1_Silent_p.I121I|ELMO1_ENST00000448602.1_Silent_p.I121I	NM_001206480.1|NM_014800.10	NP_001193409.1|NP_055615.8	Q92556	ELMO1_HUMAN	engulfment and cell motility 1	121					actin cytoskeleton organization (GO:0030036)|apoptotic process (GO:0006915)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|phagocytosis, engulfment (GO:0006911)|Rac protein signal transduction (GO:0016601)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	SH3 domain binding (GO:0017124)	p.I121I(1)		breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(28)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	58						CGTCCAGGTTTATAAACTCCT	0.547																																																1	Substitution - coding silent(1)	ovary(1)	7											59.0	55.0	57.0					7																	37298836		2203	4300	6503	37265361	SO:0001819	synonymous_variant	9844			AF398885	CCDS5449.1, CCDS5450.1	7p14.1	2012-07-10	2006-01-20		ENSG00000155849	ENSG00000155849		"""Engulfment and cell motility proteins"""	16286	protein-coding gene	gene with protein product		606420	"""engulfment and cell motility 1 (ced-12 homolog, C. elegans)"""			11595183	Standard	NM_001039459		Approved	KIAA0281, CED12, ELMO-1, CED-12	uc003tfk.2	Q92556	OTTHUMG00000023701	ENST00000310758.4:c.363A>T	7.37:g.37298836T>A			37265361	A4D1X6|Q29R79|Q6ZTJ0|Q96PB0|Q9H0I1	Silent	SNP	ENST00000310758.4	37	CCDS5449.1																																																																																				0.547	ELMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219830.4	NM_130442	
AMPH	273	broad.mit.edu	37	7	38505849	38505849	+	Splice_Site	SNP	C	C	T			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr7:38505849C>T	ENST00000356264.2	-	8	806		c.e8-1		AMPH_ENST00000428293.2_Splice_Site|AMPH_ENST00000325590.5_Splice_Site	NM_001635.3	NP_001626.1	P49418	AMPH_HUMAN	amphiphysin						endocytosis (GO:0006897)|learning (GO:0007612)|synaptic transmission (GO:0007268)|synaptic vesicle endocytosis (GO:0048488)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|leading edge membrane (GO:0031256)|synaptic vesicle (GO:0008021)	phospholipid binding (GO:0005543)	p.?(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(12)|liver(3)|lung(27)|ovary(3)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)	62						TCCAACTCGTCTGCCATGTGG	0.368																																																1	Unknown(1)	ovary(1)	7											47.0	46.0	46.0					7																	38505849		2203	4300	6503	38472374	SO:0001630	splice_region_variant	273				CCDS5456.1, CCDS47574.1	7p14-p13	2007-06-19	2007-06-19		ENSG00000078053	ENSG00000078053			471	protein-coding gene	gene with protein product		600418	"""amphiphysin (Stiff-Mann syndrome with breast cancer 128kD autoantigen)"", ""amphiphysin (Stiff-Man syndrome with breast cancer 128kDa autoantigen)"""			8245793	Standard	NM_139316		Approved		uc003tgu.3	P49418	OTTHUMG00000023725	ENST00000356264.2:c.591-1G>A	7.37:g.38505849C>T			38472374	A4D1X8|A4D1X9|O43538|Q75MJ8|Q75MK5|Q75MM3|Q8N4G0	Splice_Site	SNP	ENST00000356264.2	37	CCDS5456.1	.	.	.	.	.	.	.	.	.	.	C	18.33	3.600260	0.66332	.	.	ENSG00000078053	ENST00000325590;ENST00000356264;ENST00000428293;ENST00000544070	.	.	.	5.73	5.73	0.89815	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.8994	0.96980	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	AMPH	38472374	1.000000	0.71417	0.995000	0.50966	0.631000	0.37964	6.599000	0.74127	2.707000	0.92482	0.555000	0.69702	.		0.368	AMPH-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000226953.2	NM_001635	Intron
MAGI2	9863	broad.mit.edu	37	7	78636415	78636415	+	Missense_Mutation	SNP	T	T	G			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	T	T	G	G	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr7:78636415T>G	ENST00000354212.4	-	2	662	c.409A>C	c.(409-411)Acg>Ccg	p.T137P	MAGI2_ENST00000419488.1_Missense_Mutation_p.T137P|MAGI2-AS2_ENST00000411616.1_RNA|MAGI2_ENST00000522391.1_Missense_Mutation_p.T137P	NM_012301.3	NP_036433.2	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 2	137	Guanylate kinase-like. {ECO:0000255|PROSITE-ProRule:PRU00100}.				cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|glomerular visceral epithelial cell development (GO:0072015)|mitotic cell cycle arrest (GO:0071850)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein kinase B signaling (GO:0051898)|nerve growth factor signaling pathway (GO:0038180)|planar cell polarity pathway involved in axis elongation (GO:0003402)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of receptor internalization (GO:0002092)|protein heterooligomerization (GO:0051291)|receptor clustering (GO:0043113)|SMAD protein signal transduction (GO:0060395)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|late endosome (GO:0005770)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)|synapse (GO:0045202)|tight junction (GO:0005923)	beta-1 adrenergic receptor binding (GO:0031697)|phosphatase binding (GO:0019902)|receptor signaling complex scaffold activity (GO:0030159)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|type II activin receptor binding (GO:0070699)	p.T137P(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(37)|ovary(5)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(3)	84		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				CATGGCACCGTGCGGAGGTAG	0.373																																																1	Substitution - Missense(1)	ovary(1)	7											148.0	129.0	136.0					7																	78636415		2203	4300	6503	78474351	SO:0001583	missense	9863			AB014605	CCDS5594.1, CCDS75623.1	7q21	2005-08-09			ENSG00000187391	ENSG00000187391			18957	protein-coding gene	gene with protein product		606382				10681527, 9734811	Standard	XM_005250725		Approved	AIP1, ARIP1, KIAA0705, ACVRIP1, MAGI-2	uc003ugx.3	Q86UL8	OTTHUMG00000130697	ENST00000354212.4:c.409A>C	7.37:g.78636415T>G	ENSP00000346151:p.Thr137Pro		78474351	A4D1C1|A7E2C3|O60434|O60510|Q86UI7|Q9NP44|Q9UDQ5|Q9UDU1	Missense_Mutation	SNP	ENST00000354212.4	37	CCDS5594.1	.	.	.	.	.	.	.	.	.	.	T	24.1	4.490741	0.84962	.	.	ENSG00000187391	ENST00000419488;ENST00000354212;ENST00000536298;ENST00000522391	T;T;T	0.39787	1.06;1.06;1.06	5.29	5.29	0.74685	Guanylate kinase/L-type calcium channel (1);Guanylate kinase (2);	.	.	.	.	T	0.66376	0.2783	M	0.81682	2.555	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	T	0.71839	-0.4471	9	0.87932	D	0	.	14.4064	0.67086	0.0:0.0:0.0:1.0	.	137;137	Q86UL8-2;Q86UL8	.;MAGI2_HUMAN	P	137	ENSP00000405766:T137P;ENSP00000346151:T137P;ENSP00000428389:T137P	ENSP00000346151:T137P	T	-	1	0	MAGI2	78474351	1.000000	0.71417	0.999000	0.59377	0.990000	0.78478	7.902000	0.87389	1.998000	0.58463	0.519000	0.50382	ACG		0.373	MAGI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253197.3	NM_012301	
SEMA3A	10371	broad.mit.edu	37	7	83764252	83764252	+	Missense_Mutation	SNP	T	T	A			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	T	T	A	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr7:83764252T>A	ENST00000265362.4	-	2	442	c.128A>T	c.(127-129)aAc>aTc	p.N43I	SEMA3A_ENST00000436949.1_Missense_Mutation_p.N43I	NM_006080.2	NP_006071.1	Q14563	SEM3A_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A	43	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				apoptotic process (GO:0006915)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis involved in innervation (GO:0060385)|branchiomotor neuron axon guidance (GO:0021785)|dendrite morphogenesis (GO:0048813)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|facial nerve structural organization (GO:0021612)|gonadotrophin-releasing hormone neuronal migration to the hypothalamus (GO:0021828)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of epithelial cell migration (GO:0010633)|nerve development (GO:0021675)|neural crest cell migration involved in autonomic nervous system development (GO:1901166)|neural crest cell migration involved in sympathetic nervous system development (GO:1903045)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of male gonad development (GO:2000020)|positive regulation of neuron migration (GO:2001224)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of heart rate (GO:0002027)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|semaphorin-plexin signaling pathway involved in neuron projection guidance (GO:1902285)|sensory system development (GO:0048880)|sympathetic ganglion development (GO:0061549)|sympathetic nervous system development (GO:0048485)|sympathetic neuron projection extension (GO:0097490)|sympathetic neuron projection guidance (GO:0097491)|trigeminal nerve structural organization (GO:0021637)	axon (GO:0030424)|dendrite (GO:0030425)|extracellular region (GO:0005576)|membrane (GO:0016020)	chemorepellent activity (GO:0045499)|neuropilin binding (GO:0038191)|receptor activity (GO:0004872)	p.N43I(1)		breast(3)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(1)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53						GATCACATTGTTGGATTCCAA	0.408																																																1	Substitution - Missense(1)	ovary(1)	7											114.0	105.0	108.0					7																	83764252		2203	4300	6503	83602188	SO:0001583	missense	10371			L26081	CCDS5599.1	7p12.1	2013-01-11			ENSG00000075213	ENSG00000075213		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10723	protein-coding gene	gene with protein product	"""sema III"""	603961		SEMAD		8269517, 7748561	Standard	NM_006080		Approved	SEMA1, SemD, coll-1, Hsema-I	uc003uhz.3	Q14563	OTTHUMG00000023443	ENST00000265362.4:c.128A>T	7.37:g.83764252T>A	ENSP00000265362:p.Asn43Ile		83602188		Missense_Mutation	SNP	ENST00000265362.4	37	CCDS5599.1	.	.	.	.	.	.	.	.	.	.	t	13.29	2.191751	0.38707	.	.	ENSG00000075213	ENST00000265362;ENST00000436949;ENST00000420047	T;T;T	0.25085	1.82;1.82;1.82	4.93	2.55	0.30701	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (2);	0.317791	0.41294	D	0.000906	T	0.33702	0.0872	M	0.85542	2.76	0.53005	D	0.999962	B	0.23591	0.088	B	0.31614	0.133	T	0.08166	-1.0735	10	0.37606	T	0.19	.	9.2697	0.37664	0.0:0.1489:0.0:0.8511	.	43	Q14563	SEM3A_HUMAN	I	43	ENSP00000265362:N43I;ENSP00000415260:N43I;ENSP00000391900:N43I	ENSP00000265362:N43I	N	-	2	0	SEMA3A	83602188	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	1.880000	0.39628	0.317000	0.23160	-0.605000	0.04089	AAC		0.408	SEMA3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253355.2	NM_006080	
PPP1R3A	5506	broad.mit.edu	37	7	113558793	113558793	+	Missense_Mutation	SNP	T	T	C			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr7:113558793T>C	ENST00000284601.3	-	1	327	c.259A>G	c.(259-261)Agt>Ggt	p.S87G		NM_002711.3	NP_002702.2	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory subunit 3A	87					glycogen metabolic process (GO:0005977)	integral component of membrane (GO:0016021)		p.S87G(1)		NS(2)|breast(8)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|liver(1)|lung(43)|ovary(10)|pancreas(7)|prostate(3)|skin(15)|stomach(1)|upper_aerodigestive_tract(2)	121						GTTGAAGCACTCGGTAATTCC	0.398																																																1	Substitution - Missense(1)	ovary(1)	7											93.0	89.0	90.0					7																	113558793		2203	4300	6503	113346029	SO:0001583	missense	5506			AF024578	CCDS5759.1	7q31.1	2012-04-17	2011-10-04	2001-07-02	ENSG00000154415	ENSG00000154415	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9291	protein-coding gene	gene with protein product	"""glycogen-associated regulatory subunit of protein phosphatase-1"", ""protein phosphatase 1 regulatory subunit GM"""	600917	"""protein phosphatase 1, regulatory (inhibitor) subunit 3A (glycogen and sarcoplasmic reticulum binding subunit, skeletal muscle)"", ""protein phosphatase 1, regulatory (inhibitor) subunit 3A"""	PPP1R3		7926294	Standard	NM_002711		Approved	GM	uc010ljy.1	Q16821	OTTHUMG00000156944	ENST00000284601.3:c.259A>G	7.37:g.113558793T>C	ENSP00000284601:p.Ser87Gly		113346029	A0AVQ2|A4D0T6|O43476|Q75LN8|Q7KYM8|Q86UI6	Missense_Mutation	SNP	ENST00000284601.3	37	CCDS5759.1	.	.	.	.	.	.	.	.	.	.	T	6.712	0.499984	0.12762	.	.	ENSG00000154415	ENST00000284601	T	0.17370	2.28	6.17	2.16	0.27623	.	0.543921	0.21018	N	0.081576	T	0.12561	0.0305	L	0.36672	1.1	0.09310	N	1	B	0.10296	0.003	B	0.09377	0.004	T	0.27088	-1.0084	10	0.21540	T	0.41	-0.1205	10.9338	0.47233	0.0:0.2029:0.0:0.7971	.	87	Q16821	PPR3A_HUMAN	G	87	ENSP00000284601:S87G	ENSP00000284601:S87G	S	-	1	0	PPP1R3A	113346029	0.036000	0.19791	0.052000	0.19188	0.849000	0.48306	2.378000	0.44309	0.569000	0.29329	0.533000	0.62120	AGT		0.398	PPP1R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346724.1	NM_002711	
UBXN2B	137886	broad.mit.edu	37	8	59358548	59358548	+	Missense_Mutation	SNP	G	G	A			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr8:59358548G>A	ENST00000399598.2	+	7	876	c.754G>A	c.(754-756)Gat>Aat	p.D252N		NM_001077619.1	NP_001071087.1	Q14CS0	UBX2B_HUMAN	UBX domain protein 2B	252	UBX. {ECO:0000255|PROSITE- ProRule:PRU00215}.					endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)		p.D252N(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	13						TCTTATTGATGATTCAGTGCC	0.363																																																1	Substitution - Missense(1)	ovary(1)	8											139.0	122.0	127.0					8																	59358548		1858	4090	5948	59521102	SO:0001583	missense	137886			AK054658	CCDS43741.1	8q12.1	2008-08-08			ENSG00000215114	ENSG00000215114		"""UBX domain containing"""	27035	protein-coding gene	gene with protein product		610686				8619474, 9110174	Standard	NM_001077619		Approved	p37	uc003xtl.3	Q14CS0	OTTHUMG00000164300	ENST00000399598.2:c.754G>A	8.37:g.59358548G>A	ENSP00000382507:p.Asp252Asn		59521102	B3KWZ3	Missense_Mutation	SNP	ENST00000399598.2	37	CCDS43741.1	.	.	.	.	.	.	.	.	.	.	G	28.0	4.886211	0.91814	.	.	ENSG00000215114	ENST00000399598	T	0.44881	0.91	5.3	5.3	0.74995	UBX (2);	0.000000	0.46145	U	0.000302	T	0.52451	0.1735	L	0.54965	1.715	0.51233	D	0.999917	P	0.43938	0.822	P	0.51055	0.657	T	0.46512	-0.9186	10	0.41790	T	0.15	1.0629	17.5613	0.87908	0.0:0.0:1.0:0.0	.	252	Q14CS0	UBX2B_HUMAN	N	252	ENSP00000382507:D252N	ENSP00000382507:D252N	D	+	1	0	UBXN2B	59521102	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.499000	0.53310	2.670000	0.90874	0.650000	0.86243	GAT		0.363	UBXN2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378184.1	NM_001077619	
VPS13B	157680	broad.mit.edu	37	8	100887770	100887770	+	Missense_Mutation	SNP	C	C	A			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr8:100887770C>A	ENST00000358544.2	+	62	12056	c.11945C>A	c.(11944-11946)gCt>gAt	p.A3982D	VPS13B_ENST00000357162.2_Missense_Mutation_p.A3957D|VPS13B_ENST00000395996.1_3'UTR	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	3982					protein transport (GO:0015031)			p.A3982D(1)		NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			CCTGTGGTGGCTGCAGAACCT	0.458																																					Colon(161;2205 2542 7338 31318)											1	Substitution - Missense(1)	ovary(1)	8											149.0	128.0	135.0					8																	100887770		2203	4300	6503	100956946	SO:0001583	missense	157680			AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.11945C>A	8.37:g.100887770C>A	ENSP00000351346:p.Ala3982Asp		100956946	C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Missense_Mutation	SNP	ENST00000358544.2	37	CCDS6280.1	.	.	.	.	.	.	.	.	.	.	C	16.63	3.177591	0.57692	.	.	ENSG00000132549	ENST00000357162;ENST00000358544	T;T	0.70164	-0.46;-0.46	5.65	4.78	0.61160	.	0.446125	0.23997	N	0.042519	T	0.59142	0.2172	N	0.19112	0.55	0.80722	D	1	P;B	0.41188	0.741;0.437	P;B	0.46110	0.504;0.143	T	0.59742	-0.7397	10	0.38643	T	0.18	.	14.6071	0.68486	0.0:0.9299:0.0:0.0701	.	3957;3982	Q7Z7G8-2;Q7Z7G8	.;VP13B_HUMAN	D	3957;3982	ENSP00000349685:A3957D;ENSP00000351346:A3982D	ENSP00000349685:A3957D	A	+	2	0	VPS13B	100956946	0.999000	0.42202	0.986000	0.45419	0.840000	0.47671	4.187000	0.58344	1.392000	0.46585	-0.140000	0.14226	GCT		0.458	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000277138.1	NM_184042	
CHRAC1	54108	broad.mit.edu	37	8	141521679	141521679	+	Silent	SNP	C	C	A			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr8:141521679C>A	ENST00000220913.5	+	1	283	c.81C>A	c.(79-81)atC>atA	p.I27I	CHRAC1_ENST00000519533.1_Silent_p.I27I	NM_017444.5	NP_059140.1	Q9NRG0	CHRC1_HUMAN	chromatin accessibility complex 1	27					chromatin remodeling (GO:0006338)|DNA-dependent DNA replication (GO:0006261)	CHRAC (GO:0008623)|epsilon DNA polymerase complex (GO:0008622)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|sequence-specific DNA binding (GO:0043565)	p.I27I(1)		ovary(2)	2	all_cancers(97;5.52e-16)|all_epithelial(106;1.22e-13)|Lung NSC(106;4.09e-06)|all_lung(105;6e-06)|Ovarian(258;0.0154)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.107)			TCCGGGTCATCATGAAGAGCT	0.687																																																1	Substitution - coding silent(1)	ovary(1)	8											24.0	21.0	22.0					8																	141521679		2200	4298	6498	141590861	SO:0001819	synonymous_variant	54108			AF226076	CCDS6379.1	8q24.3	2008-08-07				ENSG00000104472			13544	protein-coding gene	gene with protein product	"""histone-fold protein CHRAC15"""	607268				10880450, 11000277	Standard	NM_017444		Approved	CHRAC15, YCL1	uc003yvl.3	Q9NRG0		ENST00000220913.5:c.81C>A	8.37:g.141521679C>A			141590861		Silent	SNP	ENST00000220913.5	37	CCDS6379.1																																																																																				0.687	CHRAC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377816.1	NM_017444	
C8orf31	286122	broad.mit.edu	37	8	144124643	144124643	+	Silent	SNP	C	C	G			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr8:144124643C>G	ENST00000395172.1	+	3	502	c.150C>G	c.(148-150)ccC>ccG	p.P50P	C8orf31_ENST00000517653.1_3'UTR	NM_173687.2	NP_775958.1	Q8N9H6	CH031_HUMAN	chromosome 8 open reading frame 31	50								p.P50P(1)		breast(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)	10	all_cancers(97;1.89e-10)|all_epithelial(106;8.73e-09)|Lung NSC(106;0.000161)|all_lung(105;0.000447)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)					AGAGGTCTCCCTTGCAGCAAG	0.622																																																1	Substitution - coding silent(1)	ovary(1)	8											39.0	41.0	40.0					8																	144124643		2203	4300	6503	144196018	SO:0001819	synonymous_variant	286122				CCDS6395.1	8q24.3	2012-04-11			ENSG00000177335	ENSG00000177335			26731	protein-coding gene	gene with protein product							Standard	NM_173687		Approved	FLJ37131	uc003yxp.1	Q8N9H6	OTTHUMG00000164771	ENST00000395172.1:c.150C>G	8.37:g.144124643C>G			144196018	Q6GMU7	Silent	SNP	ENST00000395172.1	37	CCDS6395.1																																																																																				0.622	C8orf31-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380167.1	NM_173687	
SPATA31D1	389763	broad.mit.edu	37	9	84607573	84607573	+	Missense_Mutation	SNP	G	G	C	rs368257035		TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr9:84607573G>C	ENST00000344803.2	+	4	2235	c.2188G>C	c.(2188-2190)Gga>Cga	p.G730R		NM_001001670.2	NP_001001670.1	Q6ZQQ2	S31D1_HUMAN	SPATA31 subfamily D, member 1	730					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)		p.G730R(1)									GAGAATTCATGGACCGTTAAA	0.483																																																1	Substitution - Missense(1)	ovary(1)	9											67.0	59.0	62.0					9																	84607573		1850	4098	5948	83797393	SO:0001583	missense	389763				CCDS47986.1	9q21.32	2012-10-12	2012-10-12	2012-10-12	ENSG00000214929	ENSG00000214929			37283	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member D1"""	FAM75D1			Standard	NM_001001670		Approved	FLJ46321	uc004amn.3	Q6ZQQ2	OTTHUMG00000169122	ENST00000344803.2:c.2188G>C	9.37:g.84607573G>C	ENSP00000341988:p.Gly730Arg		83797393		Missense_Mutation	SNP	ENST00000344803.2	37	CCDS47986.1	.	.	.	.	.	.	.	.	.	.	G	11.53	1.666412	0.29604	.	.	ENSG00000214929	ENST00000344803	T	0.11604	2.76	2.64	2.64	0.31445	.	1.196360	0.06207	N	0.684414	T	0.14356	0.0347	L	0.37561	1.115	0.09310	N	1	P	0.40302	0.712	P	0.49752	0.621	T	0.17930	-1.0353	10	0.09084	T	0.74	-0.8672	8.9283	0.35655	0.0:0.0:1.0:0.0	.	730	Q6ZQQ2	F75D1_HUMAN	R	730	ENSP00000341988:G730R	ENSP00000341988:G730R	G	+	1	0	FAM75D1	83797393	0.000000	0.05858	0.015000	0.15790	0.008000	0.06430	0.154000	0.16343	1.788000	0.52465	0.511000	0.50034	GGA		0.483	SPATA31D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402325.1	NM_001001670	
GRIN3A	116443	broad.mit.edu	37	9	104432515	104432515	+	Silent	SNP	A	A	G			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr9:104432515A>G	ENST00000361820.3	-	3	2779	c.2179T>C	c.(2179-2181)Ttg>Ctg	p.L727L		NM_133445.2	NP_597702.2	Q8TCU5	NMD3A_HUMAN	glutamate receptor, ionotropic, N-methyl-D-aspartate 3A	727					calcium ion transport (GO:0006816)|dendrite development (GO:0016358)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|response to ethanol (GO:0045471)|rhythmic process (GO:0048511)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|identical protein binding (GO:0042802)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|protein phosphatase 2A binding (GO:0051721)	p.L727L(1)		breast(2)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(44)|ovary(4)|pancreas(1)|skin(7)|upper_aerodigestive_tract(1)	80		Acute lymphoblastic leukemia(62;0.0568)			Acamprosate(DB00659)|Acetylcysteine(DB06151)|Amantadine(DB00915)|Atomoxetine(DB00289)|Chloroprocaine(DB01161)|Dextromethorphan(DB00514)|Ethanol(DB00898)|Ethopropazine(DB00392)|Felbamate(DB00949)|Gabapentin(DB00996)|Halothane(DB01159)|Ketamine(DB01221)|Ketobemidone(DB06738)|Memantine(DB01043)|Methadone(DB00333)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Procaine(DB00721)|Secobarbital(DB00418)|Tramadol(DB00193)	CTGCCAAACAAGAGGGCATAA	0.423																																																1	Substitution - coding silent(1)	ovary(1)	9											107.0	105.0	106.0					9																	104432515		2203	4300	6503	103472336	SO:0001819	synonymous_variant	116443				CCDS6758.1	9q31.1	2012-08-29			ENSG00000198785	ENSG00000198785		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	16767	protein-coding gene	gene with protein product		606650					Standard	NM_133445		Approved	GluN3A	uc004bbp.2	Q8TCU5	OTTHUMG00000020387	ENST00000361820.3:c.2179T>C	9.37:g.104432515A>G			103472336	B3DLF9|Q5VTR3|Q8TF29|Q8WXI6	Silent	SNP	ENST00000361820.3	37	CCDS6758.1																																																																																				0.423	GRIN3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053453.1		
TUBB4B	10383	broad.mit.edu	37	9	140137892	140137892	+	Missense_Mutation	SNP	T	T	A			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	T	T	A	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr9:140137892T>A	ENST00000340384.4	+	4	1370	c.1222T>A	c.(1222-1224)Ttc>Atc	p.F408I		NM_006088.5	NP_006079.1	P68371	TBB4B_HUMAN	tubulin, beta 4B class IVb	408					'de novo' posttranslational protein folding (GO:0051084)|cellular component movement (GO:0006928)|cellular protein metabolic process (GO:0044267)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based process (GO:0007017)|mitotic cell cycle (GO:0000278)|natural killer cell mediated cytotoxicity (GO:0042267)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleus (GO:0005634)|vesicle (GO:0031982)	double-stranded RNA binding (GO:0003725)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|MHC class I protein binding (GO:0042288)|structural constituent of cytoskeleton (GO:0005200)|unfolded protein binding (GO:0051082)	p.F408I(1)								Albendazole(DB00518)|Mebendazole(DB00643)	CGAGATGGAGTTCACCGAGGC	0.617																																																1	Substitution - Missense(1)	ovary(1)	9											101.0	98.0	99.0					9																	140137892		2203	4297	6500	139257713	SO:0001583	missense	10383			BC019359	CCDS7039.1	9q34.3	2011-10-10	2011-10-10	2011-10-10	ENSG00000188229	ENSG00000188229		"""Tubulins"""	20771	protein-coding gene	gene with protein product	"""class IVb beta-tubulin"""	602660	"""tubulin, beta 2C"""	TUBB2C		3999141	Standard	NM_006088		Approved	Beta2	uc004cmh.1	P68371	OTTHUMG00000131783	ENST00000340384.4:c.1222T>A	9.37:g.140137892T>A	ENSP00000341289:p.Phe408Ile		139257713	A2BFA2|P05217	Missense_Mutation	SNP	ENST00000340384.4	37	CCDS7039.1	.	.	.	.	.	.	.	.	.	.	T	19.33	3.806445	0.70682	.	.	ENSG00000188229	ENST00000340384	D	0.87103	-2.21	5.57	5.57	0.84162	.	0.062592	0.64402	D	0.000006	D	0.96454	0.8843	H	0.99104	4.43	0.58432	D	0.999997	D	0.76494	0.999	D	0.91635	0.999	D	0.98068	1.0397	10	0.87932	D	0	.	14.5794	0.68274	0.0:0.0:0.0:1.0	.	408	P68371	TBB4B_HUMAN	I	408	ENSP00000341289:F408I	ENSP00000341289:F408I	F	+	1	0	TUBB2C	139257713	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	6.152000	0.71812	2.122000	0.65172	0.533000	0.62120	TTC		0.617	TUBB4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254715.1	NM_006088	
WWC3	55841	broad.mit.edu	37	X	10062214	10062214	+	Missense_Mutation	SNP	G	G	A	rs367881383		TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chrX:10062214G>A	ENST00000380861.4	+	7	941	c.550G>A	c.(550-552)Gtt>Att	p.V184I	WWC3_ENST00000454666.1_Missense_Mutation_p.V184I	NM_015691.3	NP_056506.2	Q9ULE0	WWC3_HUMAN	WWC family member 3	184					negative regulation of hippo signaling (GO:0035331)|negative regulation of organ growth (GO:0046621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	cytosol (GO:0005829)	kinase binding (GO:0019900)|protein complex scaffold (GO:0032947)	p.V184I(2)		NS(1)|breast(3)|endometrium(10)|kidney(1)|large_intestine(11)|lung(17)|ovary(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	52						CAGCTGCTCCGTTACCGACTC	0.547																																																2	Substitution - Missense(2)	ovary(1)|endometrium(1)	X											164.0	144.0	151.0					X																	10062214		2203	4300	6503	10022214	SO:0001583	missense	55841			AK091936	CCDS14136.1	Xp22.32	2008-02-05			ENSG00000047644	ENSG00000047644		"""WW, C2 and coiled-coil domain containing"""	29237	protein-coding gene	gene with protein product						10574462	Standard	NM_015691		Approved	KIAA1280, BM042	uc004csx.4	Q9ULE0	OTTHUMG00000021123	ENST00000380861.4:c.550G>A	X.37:g.10062214G>A	ENSP00000370242:p.Val184Ile		10022214	A8KA96|Q659C1|Q9BTQ1	Missense_Mutation	SNP	ENST00000380861.4	37	CCDS14136.1	.	.	.	.	.	.	.	.	.	.	G	1.796	-0.478211	0.04414	.	.	ENSG00000047644	ENST00000380861;ENST00000454666;ENST00000398613	T;T	0.04194	3.68;3.68	5.83	0.919	0.19392	.	0.332623	0.33959	N	0.004395	T	0.01189	0.0039	N	0.00182	-1.905	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.47484	-0.9114	10	0.34782	T	0.22	-7.1444	8.9308	0.35668	0.4238:0.4907:0.0854:0.0	.	184	Q9ULE0	WWC3_HUMAN	I	184	ENSP00000370242:V184I;ENSP00000399584:V184I	ENSP00000370242:V184I	V	+	1	0	WWC3	10022214	0.442000	0.25633	0.002000	0.10522	0.063000	0.16089	0.697000	0.25556	-0.145000	0.11294	-0.380000	0.06706	GTT		0.547	WWC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055725.1	NM_015691	
ELK1	2002	broad.mit.edu	37	X	47498652	47498652	+	Missense_Mutation	SNP	C	C	A			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chrX:47498652C>A	ENST00000247161.3	-	3	395	c.296G>T	c.(295-297)tGc>tTc	p.C99F	ELK1_ENST00000592066.1_Missense_Mutation_p.C45F|ELK1_ENST00000343894.4_Intron|ELK1_ENST00000376983.3_Missense_Mutation_p.C99F	NM_005229.4	NP_005220.2	P19419	ELK1_HUMAN	ELK1, member of ETS oncogene family	99					cell differentiation (GO:0030154)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription from RNA polymerase II promoter (GO:0006366)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.C99F(1)		NS(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(2)|skin(2)	10						CTGGGGCGGGCAGTCCTCAGT	0.597																																																1	Substitution - Missense(1)	ovary(1)	X											31.0	24.0	26.0					X																	47498652		2203	4300	6503	47383596	SO:0001583	missense	2002			M25269	CCDS14283.1, CCDS59165.1	Xp11.23	2010-07-20			ENSG00000126767	ENSG00000126767			3321	protein-coding gene	gene with protein product		311040				2539641	Standard	NM_001114123		Approved		uc010nhv.4	P19419	OTTHUMG00000021452	ENST00000247161.3:c.296G>T	X.37:g.47498652C>A	ENSP00000247161:p.Cys99Phe		47383596	B2R7H4|O75606|O95058|Q969X8|Q9UJM4	Missense_Mutation	SNP	ENST00000247161.3	37	CCDS14283.1	.	.	.	.	.	.	.	.	.	.	C	13.25	2.181897	0.38511	.	.	ENSG00000126767	ENST00000247161;ENST00000376983	T;T	0.54071	0.59;0.59	5.52	2.42	0.29668	.	0.573737	0.19223	N	0.119617	T	0.33556	0.0867	N	0.19112	0.55	0.09310	N	0.999995	B	0.18610	0.029	B	0.14023	0.01	T	0.18777	-1.0326	10	0.44086	T	0.13	.	7.4652	0.27318	0.0:0.6569:0.0:0.3431	.	99	P19419	ELK1_HUMAN	F	99	ENSP00000247161:C99F;ENSP00000366182:C99F	ENSP00000247161:C99F	C	-	2	0	ELK1	47383596	1.000000	0.71417	0.403000	0.26384	0.959000	0.62525	2.010000	0.40913	0.432000	0.26286	0.600000	0.82982	TGC		0.597	ELK1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056436.1	NM_005229	
HUWE1	10075	broad.mit.edu	37	X	53607799	53607799	+	Nonsense_Mutation	SNP	G	G	C			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chrX:53607799G>C	ENST00000342160.3	-	42	6165	c.5708C>G	c.(5707-5709)tCa>tGa	p.S1903*	HUWE1_ENST00000262854.6_Nonsense_Mutation_p.S1903*			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	1903					base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)	p.S1766*(1)		NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						ACCAGTTCCTGAGCCTCGAGG	0.493																																																1	Substitution - Nonsense(1)	ovary(1)	X											58.0	44.0	49.0					X																	53607799		2203	4300	6503	53624524	SO:0001587	stop_gained	10075			AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.5708C>G	X.37:g.53607799G>C	ENSP00000340648:p.Ser1903*		53624524	O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Nonsense_Mutation	SNP	ENST00000342160.3	37	CCDS35301.1	.	.	.	.	.	.	.	.	.	.	G	50	16.892027	0.99874	.	.	ENSG00000086758	ENST00000342160;ENST00000262854	.	.	.	5.84	5.84	0.93424	.	0.077230	0.53938	D	0.000048	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.19147	T	0.46	.	17.7627	0.88469	0.0:0.0:1.0:0.0	.	.	.	.	X	1903	.	ENSP00000262854:S1903X	S	-	2	0	HUWE1	53624524	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.370000	0.79589	2.467000	0.83353	0.600000	0.82982	TCA		0.493	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056766.1	XM_497119	
NONO	4841	broad.mit.edu	37	X	70511753	70511753	+	Silent	SNP	A	A	C			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	A	A	C	C	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chrX:70511753A>C	ENST00000276079.8	+	4	484	c.279A>C	c.(277-279)ctA>ctC	p.L93L	NONO_ENST00000535149.1_Silent_p.L4L|NONO_ENST00000373841.1_Silent_p.L93L|NONO_ENST00000373856.3_Silent_p.L93L	NM_007363.4	NP_031389.3	Q15233	NONO_HUMAN	non-POU domain containing, octamer-binding	93	DBHS.|RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				circadian rhythm (GO:0007623)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|mRNA processing (GO:0006397)|negative regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903377)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of circadian rhythm (GO:0042752)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|paraspeckles (GO:0042382)	core promoter binding (GO:0001047)|identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.L93L(1)	NONO/TFE3(2)	endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(2)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	19	Renal(35;0.156)					TGAGGAAACTATTTGAGAAAT	0.433			T	TFE3	papillary renal cancer																																		Dom	yes		X	Xq13.1	4841	"""non-POU domain containing, octamer-binding"""		E	1	Substitution - coding silent(1)	ovary(1)	X											94.0	91.0	92.0					X																	70511753		2203	4298	6501	70428478	SO:0001819	synonymous_variant	4841			L14599	CCDS14410.1, CCDS55445.1	Xq13.1	2014-06-13	2002-01-14		ENSG00000147140	ENSG00000147140		"""RNA binding motif (RRM) containing"""	7871	protein-coding gene	gene with protein product	"""Nuclear RNA-binding protein, 54-kD"", ""non-Pou domain-containing octamer (ATGCAAAT) binding protein"", ""protein phosphatase 1, regulatory subunit 114"""	300084	"""non-POU-domain-containing, octamer-binding"""			8371983, 9360842	Standard	NM_007363		Approved	NRB54, NMT55, P54NRB, P54, PPP1R114	uc004dzp.3	Q15233	OTTHUMG00000021798	ENST00000276079.8:c.279A>C	X.37:g.70511753A>C			70428478	B7Z4C2|D3DVV4|F5GYZ3|O00201|P30807|Q12786|Q9BQC5	Silent	SNP	ENST00000276079.8	37	CCDS14410.1	.	.	.	.	.	.	.	.	.	.	a	10.41	1.343435	0.24339	.	.	ENSG00000147140	ENST00000418921	.	.	.	4.99	-2.21	0.06973	.	.	.	.	.	T	0.47911	0.1471	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.37033	-0.9723	4	.	.	.	-8.5514	4.8359	0.13464	0.1703:0.1403:0.5482:0.1412	.	.	.	.	S	12	.	.	Y	+	2	0	NONO	70428478	0.025000	0.19082	0.994000	0.49952	0.975000	0.68041	-1.079000	0.03410	-0.425000	0.07371	-0.460000	0.05396	TAT		0.433	NONO-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057138.1	NM_007363	
PHKA1	5255	broad.mit.edu	37	X	71856224	71856224	+	Missense_Mutation	SNP	C	C	G			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chrX:71856224C>G	ENST00000373542.4	-	15	1631	c.1472G>C	c.(1471-1473)aGa>aCa	p.R491T	PHKA1_ENST00000541944.1_Missense_Mutation_p.R491T|PHKA1_ENST00000339490.3_Missense_Mutation_p.R491T|PHKA1_ENST00000373539.3_Missense_Mutation_p.R491T|PHKA1_ENST00000373545.3_Missense_Mutation_p.R491T	NM_002637.3	NP_002628.2	P46020	KPB1_HUMAN	phosphorylase kinase, alpha 1 (muscle)	491					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)	p.R491T(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(2)|lung(18)|ovary(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	52	Renal(35;0.156)					GAGTTTCATTCTATTGTTGCA	0.353																																																1	Substitution - Missense(1)	ovary(1)	X											129.0	105.0	113.0					X																	71856224		2203	4300	6503	71772949	SO:0001583	missense	5255				CCDS14421.1, CCDS48137.1, CCDS55453.1	Xq12-q13	2009-07-10			ENSG00000067177	ENSG00000067177	2.7.11.19		8925	protein-coding gene	gene with protein product		311870		PHKA			Standard	NM_002637		Approved		uc004eax.4	P46020	OTTHUMG00000022696	ENST00000373542.4:c.1472G>C	X.37:g.71856224C>G	ENSP00000362643:p.Arg491Thr		71772949	B7ZL05|B7ZL07|Q2M3D7	Missense_Mutation	SNP	ENST00000373542.4	37	CCDS14421.1	.	.	.	.	.	.	.	.	.	.	C	10.15	1.272184	0.23221	.	.	ENSG00000067177	ENST00000373545;ENST00000373542;ENST00000541944;ENST00000339490;ENST00000373539	D;D;D;D;D	0.88664	-2.41;-2.41;-2.41;-2.41;-2.41	5.71	3.03	0.35002	Glycoside hydrolase 15-related (1);	0.355818	0.31601	N	0.007379	D	0.82697	0.5093	L	0.49640	1.575	0.36873	D	0.88903	P;B;B	0.40534	0.72;0.003;0.066	B;B;B	0.35182	0.197;0.026;0.155	T	0.80495	-0.1357	10	0.72032	D	0.01	-9.2904	7.35	0.26684	0.0:0.6432:0.0:0.3568	.	491;491;491	B7ZL07;P46020-2;P46020	.;.;KPB1_HUMAN	T	491	ENSP00000362646:R491T;ENSP00000362643:R491T;ENSP00000441251:R491T;ENSP00000342469:R491T;ENSP00000362640:R491T	ENSP00000342469:R491T	R	-	2	0	PHKA1	71772949	0.339000	0.24784	0.995000	0.50966	0.413000	0.31143	-0.230000	0.09083	0.211000	0.20683	-0.926000	0.02714	AGA		0.353	PHKA1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058896.1		
ARMCX1	51309	broad.mit.edu	37	X	100808009	100808009	+	Silent	SNP	C	C	T			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chrX:100808009C>T	ENST00000372829.3	+	4	467	c.96C>T	c.(94-96)gaC>gaT	p.D32D		NM_016608.1	NP_057692.1	Q9P291	ARMX1_HUMAN	armadillo repeat containing, X-linked 1	32						integral component of membrane (GO:0016021)		p.D32D(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(2)|ovary(3)|pancreas(1)|urinary_tract(1)	19						GGGGAAGAGACGAGAACGAGA	0.567																																																1	Substitution - coding silent(1)	ovary(1)	X											78.0	69.0	72.0					X																	100808009		2203	4300	6503	100694665	SO:0001819	synonymous_variant	51309			AB039670	CCDS14487.1	Xq21.33-q22.2	2014-03-21			ENSG00000126947	ENSG00000126947		"""Armadillo repeat containing"""	18073	protein-coding gene	gene with protein product		300362				11162520, 16221301, 22569362	Standard	NM_016608		Approved	ALEX1, GASP7	uc004ehv.3	Q9P291	OTTHUMG00000022033	ENST00000372829.3:c.96C>T	X.37:g.100808009C>T			100694665	Q53HK2|Q9H2Q0	Silent	SNP	ENST00000372829.3	37	CCDS14487.1																																																																																				0.567	ARMCX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057561.1	NM_016608	
LRCH2	57631	broad.mit.edu	37	X	114404900	114404900	+	Silent	SNP	T	T	C			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chrX:114404900T>C	ENST00000317135.8	-	6	990	c.960A>G	c.(958-960)tcA>tcG	p.S320S	LRCH2_ENST00000538422.1_Silent_p.S320S	NM_020871.3	NP_065922.3	Q5VUJ6	LRCH2_HUMAN	leucine-rich repeats and calponin homology (CH) domain containing 2	320								p.S320S(1)		breast(1)|endometrium(4)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	19						GTTTACTCAATGATGGAAGAT	0.358																																																1	Substitution - coding silent(1)	ovary(1)	X											106.0	94.0	98.0					X																	114404900		1893	4094	5987	114311156	SO:0001819	synonymous_variant	57631			AB040928	CCDS48155.1, CCDS59175.1	Xq24	2008-02-05			ENSG00000130224	ENSG00000130224			29292	protein-coding gene	gene with protein product						10819331	Standard	NM_020871		Approved	KIAA1495	uc010nqe.3	Q5VUJ6	OTTHUMG00000022233	ENST00000317135.8:c.960A>G	X.37:g.114404900T>C			114311156	F5H2T1|Q08AD5|Q9HA88|Q9P233	Silent	SNP	ENST00000317135.8	37	CCDS48155.1																																																																																				0.358	LRCH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057971.2	NM_020871	
GPR119	139760	broad.mit.edu	37	X	129518830	129518830	+	Missense_Mutation	SNP	G	G	T			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chrX:129518830G>T	ENST00000276218.2	-	1	681	c.592C>A	c.(592-594)Cag>Aag	p.Q198K		NM_178471.2	NP_848566.1	Q8TDV5	GP119_HUMAN	G protein-coupled receptor 119	198					insulin secretion (GO:0030073)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)|phosphatidylcholine binding (GO:0031210)	p.Q198K(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|ovary(3)|prostate(1)	11						TTTCGAATCTGCTGGCTGTGC	0.537																																																1	Substitution - Missense(1)	ovary(1)	X											94.0	76.0	82.0					X																	129518830		2203	4300	6503	129346511	SO:0001583	missense	139760			AY288416	CCDS14625.1	Xq26.1	2014-01-30			ENSG00000147262	ENSG00000147262		"""GPCR / Class A : Orphans"""	19060	protein-coding gene	gene with protein product		300513				12044878, 14623098	Standard	NM_178471		Approved	hGPCR2, GPCR2	uc011muv.2	Q8TDV5	OTTHUMG00000022397	ENST00000276218.2:c.592C>A	X.37:g.129518830G>T	ENSP00000276218:p.Gln198Lys		129346511	Q495H7|Q4VBN3	Missense_Mutation	SNP	ENST00000276218.2	37	CCDS14625.1	.	.	.	.	.	.	.	.	.	.	G	12.55	1.970630	0.34754	.	.	ENSG00000147262	ENST00000276218	T	0.70869	-0.52	5.15	4.28	0.50868	GPCR, rhodopsin-like superfamily (1);	0.140116	0.50627	D	0.000106	T	0.56863	0.2014	L	0.36672	1.1	0.39134	D	0.961901	P	0.39352	0.669	B	0.34931	0.192	T	0.55547	-0.8124	10	0.19147	T	0.46	-2.678	12.9947	0.58640	0.0:0.0:0.837:0.163	.	198	Q8TDV5	GP119_HUMAN	K	198	ENSP00000276218:Q198K	ENSP00000276218:Q198K	Q	-	1	0	GPR119	129346511	1.000000	0.71417	1.000000	0.80357	0.728000	0.41692	8.996000	0.93539	1.135000	0.42183	-0.225000	0.12378	CAG		0.537	GPR119-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058270.1	NM_178471	
SLC9A6	10479	broad.mit.edu	37	X	135092707	135092707	+	Missense_Mutation	SNP	G	G	T			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chrX:135092707G>T	ENST00000370698.3	+	7	945	c.910G>T	c.(910-912)Gca>Tca	p.A304S	SLC9A6_ENST00000370701.1_Missense_Mutation_p.A284S|SLC9A6_ENST00000370695.4_Missense_Mutation_p.A336S	NM_006359.2	NP_006350.1	Q92581	SL9A6_HUMAN	solute carrier family 9, subfamily A (NHE6, cation proton antiporter 6), member 6	304					axon extension (GO:0048675)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|dendrite extension (GO:0097484)|dendritic spine development (GO:0060996)|ion transport (GO:0006811)|neuron projection morphogenesis (GO:0048812)|regulation of neurotrophin TRK receptor signaling pathway (GO:0051386)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|synapse organization (GO:0050808)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon terminus (GO:0043679)|axonal spine (GO:0044308)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|early endosome membrane (GO:0031901)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)|synapse (GO:0045202)	sodium:proton antiporter activity (GO:0015385)	p.A304P(1)|p.A304S(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(18)|ovary(2)|upper_aerodigestive_tract(1)	33	Acute lymphoblastic leukemia(192;0.000127)					TGGATCTTTTGCAATGGGTGC	0.403																																																2	Substitution - Missense(2)	ovary(1)|large_intestine(1)	X											236.0	183.0	201.0					X																	135092707		2203	4300	6503	134920373	SO:0001583	missense	10479			AF030409	CCDS14654.1, CCDS44003.1, CCDS55504.1	Xq26.3	2013-05-22	2012-03-22		ENSG00000198689	ENSG00000198689		"""Solute carriers"""	11079	protein-coding gene	gene with protein product		300231	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 6"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 6"""			9507001	Standard	NM_001042537		Approved	NHE6, KIAA0267	uc004ezk.3	Q92581	OTTHUMG00000022498	ENST00000370698.3:c.910G>T	X.37:g.135092707G>T	ENSP00000359732:p.Ala304Ser		134920373	A6NIQ9|A8K160|B4DU30|B7ZAE0|Q3ZCW7|Q5JPP8|Q5JPP9|Q86VS0	Missense_Mutation	SNP	ENST00000370698.3	37	CCDS14654.1	.	.	.	.	.	.	.	.	.	.	G	17.18	3.323187	0.60634	.	.	ENSG00000198689	ENST00000370701;ENST00000370698;ENST00000370695	T;T;T	0.17528	2.27;2.27;2.27	5.49	5.49	0.81192	Cation/H+ exchanger (1);	0.000000	0.85682	D	0.000000	T	0.27489	0.0675	M	0.64567	1.98	0.80722	D	1	B;B;B	0.31274	0.082;0.317;0.221	B;B;B	0.38921	0.196;0.124;0.285	T	0.03619	-1.1019	10	0.62326	D	0.03	.	17.2696	0.87097	0.0:0.0:1.0:0.0	.	284;336;304	B4DU30;Q92581-2;Q92581	.;.;SL9A6_HUMAN	S	284;304;336	ENSP00000359735:A284S;ENSP00000359732:A304S;ENSP00000359729:A336S	ENSP00000359729:A336S	A	+	1	0	SLC9A6	134920373	1.000000	0.71417	0.941000	0.38009	0.902000	0.53008	6.251000	0.72441	2.290000	0.77057	0.513000	0.50165	GCA		0.403	SLC9A6-001	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058450.1	NM_006359	
TTLL7	79739	broad.mit.edu	37	1	84408222	84408222	+	Frame_Shift_Del	DEL	A	A	-			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	A	A	-	-	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Illumina_Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr1:84408222delA	ENST00000260505.8	-	7	1024	c.647delT	c.(646-648)ctafs	p.L216fs	TTLL7_ENST00000477524.1_5'UTR	NM_024686.4	NP_078962.4	Q6ZT98	TTLL7_HUMAN	tubulin tyrosine ligase-like family, member 7	216	TTL. {ECO:0000255|PROSITE- ProRule:PRU00568}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)|protein polyglutamylation (GO:0018095)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	ligase activity (GO:0016874)	p.L216fs*26(1)		kidney(1)|large_intestine(8)|lung(15)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	29				all cancers(265;0.0126)|Epithelial(280;0.0372)|OV - Ovarian serous cystadenocarcinoma(397;0.16)		AAATATTTTTAGTGGATCACA	0.368																																																1	Deletion - Frameshift(1)	ovary(1)	1											83.0	84.0	83.0					1																	84408222		2203	4300	6503	84180810	SO:0001589	frameshift_variant	79739			AY170843	CCDS690.2	1p31.1	2013-02-14			ENSG00000137941	ENSG00000137941		"""Tubulin tyrosine ligase-like family"""	26242	protein-coding gene	gene with protein product						15890843	Standard	XM_005271208		Approved	FLJ23033	uc001djc.3	Q6ZT98	OTTHUMG00000009932	ENST00000260505.8:c.647delT	1.37:g.84408222delA	ENSP00000260505:p.Leu216fs		84180810	Q5TAX8|Q5TAX9|Q6P990|Q86YS1|Q9H5U4	Frame_Shift_Del	DEL	ENST00000260505.8	37	CCDS690.2																																																																																				0.368	TTLL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027498.1	NM_024686	
MADD	8567	broad.mit.edu	37	11	47297640	47297643	+	Frame_Shift_Del	DEL	CTTC	CTTC	-			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	CTTC	CTTC	-	-	CTTC	CTTC	Unknown	Valid	Somatic	Phase_I	Capture	Illumina_Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr11:47297640_47297643delCTTC	ENST00000311027.5	+	4	1015_1018	c.850_853delCTTC	c.(850-855)cttccafs	p.LP284fs	MADD_ENST00000395336.3_Frame_Shift_Del_p.LP284fs|MADD_ENST00000395344.3_Frame_Shift_Del_p.LP284fs|MADD_ENST00000489415.1_3'UTR|MADD_ENST00000402799.1_Frame_Shift_Del_p.LP284fs|MADD_ENST00000406482.1_Frame_Shift_Del_p.LP284fs|MADD_ENST00000342922.4_Frame_Shift_Del_p.LP284fs|MADD_ENST00000402192.2_Frame_Shift_Del_p.LP284fs|MADD_ENST00000407859.3_Frame_Shift_Del_p.LP284fs|MADD_ENST00000349238.3_Frame_Shift_Del_p.LP284fs	NM_003682.3	NP_003673.3			MAP-kinase activating death domain									p.L284fs*8(1)		breast(7)|central_nervous_system(2)|endometrium(9)|kidney(3)|large_intestine(19)|lung(26)|ovary(6)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	84				Lung(87;0.182)		GACCTTTGCTCTTCCAGACCCATC	0.554																																																1	Deletion - Frameshift(1)	ovary(1)	11																																								47254219	SO:0001589	frameshift_variant	8567			AB002356	CCDS7930.1, CCDS7931.1, CCDS7932.1, CCDS41642.1, CCDS44586.1, CCDS44587.1, CCDS44588.1, CCDS44589.1, CCDS44590.1	11p11.2	2012-10-04			ENSG00000110514	ENSG00000110514		"""DENN/MADD domain containing"""	6766	protein-coding gene	gene with protein product		603584				9115275, 9796103	Standard	NM_130476		Approved	DENN, KIAA0358, RAB3GEP	uc001ner.1	Q8WXG6	OTTHUMG00000150350	ENST00000311027.5:c.850_853delCTTC	11.37:g.47297640_47297643delCTTC	ENSP00000310933:p.Leu284fs		47254216		Frame_Shift_Del	DEL	ENST00000311027.5	37	CCDS7930.1																																																																																				0.554	MADD-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317746.1		
PRPF39	55015	broad.mit.edu	37	14	45583439	45583441	+	In_Frame_Del	DEL	TAA	TAA	-			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	TAA	TAA	-	-	TAA	TAA	Unknown	Valid	Somatic	Phase_I	Capture	Illumina_Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr14:45583439_45583441delTAA	ENST00000355765.6	+	12	1981_1983	c.1811_1813delTAA	c.(1810-1815)ttaaaa>taa	p.604_605LK>*		NM_017922.3	NP_060392.3	Q86UA1	PRP39_HUMAN	pre-mRNA processing factor 39	604					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)		p.L483_K484>*(1)		breast(2)|endometrium(2)|kidney(4)|lung(3)|ovary(1)	12						CAGGATTCTTTAAAAAGGAAAGC	0.335																																																1	Complex - deletion inframe(1)	ovary(1)	14																																								44653191	SO:0001651	inframe_deletion	55015			AK000673	CCDS9682.2	14q21.1	2013-10-03	2013-10-03		ENSG00000185246	ENSG00000185246			20314	protein-coding gene	gene with protein product		614907	"""PRP39 pre-mRNA processing factor 39 homolog (yeast)"", ""PRP39 pre-mRNA processing factor 39 homolog (S. cerevisiae)"""				Standard	NM_017922		Approved	FLJ20666, FLJ11128	uc001wvz.4	Q86UA1	OTTHUMG00000140265	ENST00000355765.6:c.1811_1813delTAA	14.37:g.45583439_45583441delTAA	ENSP00000348010:p.Leu604_Lys605delins*		44653189	Q08AL1|Q08AL2|Q9NUU5	In_Frame_Del	DEL	ENST00000355765.6	37	CCDS9682.2																																																																																				0.335	PRPF39-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319683.2		
GPR179	440435	broad.mit.edu	37	17	36483547	36483572	+	Frame_Shift_Del	DEL	CGGAATCTGCTGGGGCAGTGGTCTCC	CGGAATCTGCTGGGGCAGTGGTCTCC	-	rs144104172|rs536693144	byFrequency	TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	CGGAATCTGCTGGGGCAGTGGTCTCC	CGGAATCTGCTGGGGCAGTGGTCTCC	-	-	CGGAATCTGCTGGGGCAGTGGTCTCC	CGGAATCTGCTGGGGCAGTGGTCTCC	Unknown	Valid	Somatic	Phase_I	Capture	Illumina_Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr17:36483547_36483572delCGGAATCTGCTGGGGCAGTGGTCTCC	ENST00000342292.4	-	11	5900_5925	c.5880_5905delGGAGACCACTGCCCCAGCAGATTCCG	c.(5878-5907)tgggagaccactgccccagcagattccgtcfs	p.WETTAPADSV1960fs	GPR179_ENST00000584976.1_Intron	NM_001004334.2	NP_001004334.2	Q6PRD1	GP179_HUMAN	G protein-coupled receptor 179	1960					visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.W1960fs*10(1)|p.T1963N(1)		breast(4)|cervix(2)|endometrium(9)|kidney(3)|large_intestine(16)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	60	Breast(7;2.97e-12)	Breast(25;0.0101)|Ovarian(249;0.15)				AGGTGAGAGACGGAATCTGCTGGGGCAGTGGTCTCCCATGGACAGA	0.54																																																2	Substitution - Missense(1)|Deletion - Frameshift(1)	upper_aerodigestive_tract(1)|ovary(1)	17																																								33737098	SO:0001589	frameshift_variant	440435				CCDS42308.1	17q21.1	2014-05-06	2006-02-16	2006-02-16	ENSG00000188888	ENSG00000277399		"""GPCR / Class C : Orphans"""	31371	protein-coding gene	gene with protein product		614515	"""GPR158-like 1"", ""GPR179"""	GPR158L1			Standard	NM_001004334		Approved	CSNB1E	uc002hpz.3	Q6PRD1	OTTHUMG00000188545	ENST00000342292.4:c.5880_5905delGGAGACCACTGCCCCAGCAGATTCCG	17.37:g.36483547_36483572delCGGAATCTGCTGGGGCAGTGGTCTCC	ENSP00000345060:p.Trp1960fs		33737073		Frame_Shift_Del	DEL	ENST00000342292.4	37	CCDS42308.1																																																																																				0.540	GPR179-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255329.2		
TGM3	7053	broad.mit.edu	37	20	2320586	2320605	+	Frame_Shift_Del	DEL	GCTGATGGTGGAGGGAAGCG	GCTGATGGTGGAGGGAAGCG	-	rs367606978		TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	GCTGATGGTGGAGGGAAGCG	GCTGATGGTGGAGGGAAGCG	-	-	GCTGATGGTGGAGGGAAGCG	GCTGATGGTGGAGGGAAGCG	Unknown	Valid	Somatic	Phase_I	Capture	Illumina_Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr20:2320586_2320605delGCTGATGGTGGAGGGAAGCG	ENST00000381458.5	+	12	1950_1969	c.1887_1906delGCTGATGGTGGAGGGAAGCG	c.(1885-1908)gtgctgatggtggagggaagcggcfs	p.LMVEGSG630fs		NM_003245.3	NP_003236.3	Q08188	TGM3_HUMAN	transglutaminase 3	630					cell envelope organization (GO:0043163)|cellular protein modification process (GO:0006464)|hair follicle morphogenesis (GO:0031069)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|protein tetramerization (GO:0051262)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)	calcium ion binding (GO:0005509)|catalytic activity (GO:0003824)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)|transferase activity, transferring acyl groups (GO:0016746)	p.L630fs*5(1)		breast(3)|cervix(1)|endometrium(1)|kidney(4)|large_intestine(11)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(2)	39					L-Glutamine(DB00130)	GGGACTGCGTGCTGATGGTGGAGGGAAGCGGCCTGCTGTT	0.645																																																1	Deletion - Frameshift(1)	ovary(1)	20																																								2268605	SO:0001589	frameshift_variant	7053			L10386	CCDS33435.1	20q11.2	2013-05-02	2013-05-02		ENSG00000125780	ENSG00000125780	2.3.2.13	"""Transglutaminases"""	11779	protein-coding gene	gene with protein product	"""E polypeptide, protein-glutamine-gamma-glutamyltransferase"""	600238	"""transglutaminase 3 (E polypeptide, protein-glutamine-gamma-glutamyltransferase)"""			7851911, 9452468	Standard	NM_003245		Approved	TGE	uc002wfx.4	Q08188	OTTHUMG00000031690	ENST00000381458.5:c.1887_1906delGCTGATGGTGGAGGGAAGCG	20.37:g.2320586_2320605delGCTGATGGTGGAGGGAAGCG	ENSP00000370867:p.Leu630fs		2268586	A8K5N6|B2RCR6|D3DVX1|O95933|Q32ML9|Q32MM0	Frame_Shift_Del	DEL	ENST00000381458.5	37	CCDS33435.1																																																																																				0.645	TGM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077579.2	NM_003245	
RFTN1	23180	broad.mit.edu	37	3	16358366	16358369	+	Frame_Shift_Del	DEL	ACTT	ACTT	-			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	ACTT	ACTT	-	-	ACTT	ACTT	Unknown	Valid	Somatic	Phase_I	Capture	Illumina_Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr3:16358366_16358369delACTT	ENST00000334133.4	-	10	1975_1978	c.1703_1706delAAGT	c.(1702-1707)gaagtcfs	p.EV568fs	RP11-415F23.2_ENST00000607464.1_RNA|RFTN1_ENST00000432519.1_Frame_Shift_Del_p.EV532fs|OXNAD1_ENST00000544043.1_Intron|OXNAD1_ENST00000435829.2_Intron|OXNAD1_ENST00000605932.1_Intron|RFTN1_ENST00000483671.1_5'UTR|OXNAD1_ENST00000606098.1_Intron	NM_015150.1	NP_055965.1	Q14699	RFTN1_HUMAN	raftlin, lipid raft linker 1	568					B cell receptor signaling pathway (GO:0050853)|dsRNA transport (GO:0033227)|growth (GO:0040007)|interleukin-17 production (GO:0032620)|membrane raft assembly (GO:0001765)|protein localization to membrane raft (GO:1903044)|protein transport into membrane raft (GO:0032596)|response to exogenous dsRNA (GO:0043330)|T cell antigen processing and presentation (GO:0002457)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 3 signaling pathway (GO:0034138)	cytoplasm (GO:0005737)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	double-stranded RNA binding (GO:0003725)	p.E568fs>10(1)		central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(8)|lung(8)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	38						AAGCTCTCTGACTTCCTCAGCATC	0.544																																																1	Deletion - Frameshift(1)	ovary(1)	3																																								16333373	SO:0001589	frameshift_variant	23180			D42043	CCDS33712.1	3p24.3	2010-04-09			ENSG00000131378	ENSG00000131378			30278	protein-coding gene	gene with protein product	"""raft-linking protein"""					7788527, 12805216	Standard	NM_015150		Approved	MIG2, KIAA0084, FLJ23866, Raftlin	uc003cay.3	Q14699	OTTHUMG00000156973	ENST00000334133.4:c.1703_1706delAAGT	3.37:g.16358366_16358369delACTT	ENSP00000334153:p.Glu568fs		16333370	Q0D2G0|Q496Y2|Q4QQI7|Q5JB48|Q7Z7P2	Frame_Shift_Del	DEL	ENST00000334133.4	37	CCDS33712.1																																																																																				0.544	RFTN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000346908.1	NM_015150	
FAT4	79633	broad.mit.edu	37	4	126367536	126367541	+	In_Frame_Del	DEL	AAAGAT	AAAGAT	-			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	AAAGAT	AAAGAT	-	-	AAAGAT	AAAGAT	Unknown	Valid	Somatic	Phase_I	Capture	Illumina_Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chr4:126367536_126367541delAAAGAT	ENST00000394329.3	+	8	7295_7300	c.7282_7287delAAAGAT	c.(7282-7287)aaagatdel	p.KD2428del	FAT4_ENST00000335110.5_In_Frame_Del_p.KD726del	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	2428	Cadherin 23. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						TAGGGAAACAAAAGATAATTATACTT	0.447																																																0			4																																								126586991	SO:0001651	inframe_deletion	79633			AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.7282_7287delAAAGAT	4.37:g.126367536_126367541delAAAGAT	ENSP00000377862:p.Lys2428_Asp2429del		126586986	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	In_Frame_Del	DEL	ENST00000394329.3	37	CCDS3732.3																																																																																				0.447	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582	
MSN	4478	broad.mit.edu	37	X	64958948	64958953	+	In_Frame_Del	DEL	GGCAGA	GGCAGA	-			TCGA-09-2050-01A-01W-0799-08	TCGA-09-2050-10A-01W-0799-08	GGCAGA	GGCAGA	-	-	GGCAGA	GGCAGA	Unknown	Valid	Somatic	Phase_I	Capture	Illumina_Capture			Illumina GAIIx	4d2525bf-2a2c-4170-935a-f38e92a8bd4c	4ca1ad27-23c5-4d83-9ffd-20db10d6239c	g.chrX:64958948_64958953delGGCAGA	ENST00000360270.5	+	12	1633_1638	c.1461_1466delGGCAGA	c.(1459-1467)ggggcagag>ggg	p.AE488del		NM_002444.2	NP_002435.1	P26038	MOES_HUMAN	moesin	488					cellular component movement (GO:0006928)|establishment of endothelial barrier (GO:0061028)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|membrane to membrane docking (GO:0022614)|positive regulation of gene expression (GO:0010628)|regulation of lymphocyte migration (GO:2000401)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|uropod (GO:0001931)|vesicle (GO:0031982)	cell adhesion molecule binding (GO:0050839)|double-stranded RNA binding (GO:0003725)|protein kinase binding (GO:0019901)|receptor binding (GO:0005102)|structural constituent of cytoskeleton (GO:0005200)	p.E489_A490del(1)	MSN/ALK(6)	breast(4)|central_nervous_system(3)|endometrium(7)|kidney(5)|large_intestine(6)|lung(11)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	43						ATGAGAATGGGGCAGAGGCTAGTGCT	0.558			T	ALK	ALCL																																		Dom	yes		X	Xq11.2-q12	4478	moesin		L	1	Deletion - In frame(1)	ovary(1)	X																																								64875678	SO:0001651	inframe_deletion	4478			M69066	CCDS14382.1	Xq11.1	2010-10-20			ENSG00000147065	ENSG00000147065			7373	protein-coding gene	gene with protein product		309845				1924289, 7628534	Standard	XM_005262269		Approved		uc004dwf.3	P26038	OTTHUMG00000021723	ENST00000360270.5:c.1461_1466delGGCAGA	X.37:g.64958948_64958953delGGCAGA	ENSP00000353408:p.Ala488_Glu489del		64875673		In_Frame_Del	DEL	ENST00000360270.5	37	CCDS14382.1																																																																																				0.558	MSN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056981.1	NM_002444	
