#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
ATXN7L2	127002	genome.wustl.edu	37	1	110033681	110033681	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0726-01A-01W-0372-09	TCGA-13-0726-10B-01W-0977-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	201415c2-5b5a-4bb8-8005-bf2c78d4d88e	df694f1a-e6a5-4c06-bf79-5fe57cfcba13	g.chr1:110033681C>T	ENST00000369870.3	+	10	1511	c.1496C>T	c.(1495-1497)cCc>cTc	p.P499L	ATXN7L2_ENST00000459635.1_3'UTR|CYB561D1_ENST00000393709.3_5'Flank	NM_153340.4	NP_699171.3	Q5T6C5	AT7L2_HUMAN	ataxin 7-like 2	499								p.P499L(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(1)|skin(1)	17		all_epithelial(167;0.00197)|all_lung(203;0.00291)|Lung NSC(277;0.00453)		Colorectal(144;0.0129)|Lung(183;0.0426)|Epithelial(280;0.0675)|READ - Rectum adenocarcinoma(129;0.0693)|all cancers(265;0.071)|LUSC - Lung squamous cell carcinoma(189;0.228)		GCCTCCATGCCCCCCACCAAG	0.667											OREG0013635	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	1											37.0	42.0	41.0					1																	110033681		2203	4300	6503	109835204	SO:0001583	missense	127002			BC037582	CCDS30794.1	1p13.2	2008-02-05			ENSG00000162650	ENSG00000162650			28713	protein-coding gene	gene with protein product						12477932	Standard	NM_153340		Approved	MGC46534, FLJ00381	uc001dxr.3	Q5T6C5	OTTHUMG00000011027	ENST00000369870.3:c.1496C>T	1.37:g.110033681C>T	ENSP00000358886:p.Pro499Leu	1424	109835204		Missense_Mutation	SNP	-	p.P499L	ENST00000369870.3	37	c.1496	CCDS30794.1	1	.	.	.	.	.	.	.	.	.	.	C	10.54	1.377455	0.24944	.	.	ENSG00000162650	ENST00000369870;ENST00000541125;ENST00000369869	T	0.33438	1.41	5.17	4.26	0.50523	.	0.509090	0.18506	N	0.139215	T	0.08358	0.0208	N	0.19112	0.55	0.36254	D	0.854088	B;B	0.34329	0.449;0.0	B;B	0.37091	0.241;0.001	T	0.09079	-1.0691	10	0.10902	T	0.67	-4.5365	10.853	0.46782	0.0:0.9119:0.0:0.0881	.	126;499	Q5T6C4;Q5T6C5	.;AT7L2_HUMAN	L	499;499;126	ENSP00000358886:P499L	ENSP00000358885:P126L	P	+	2	0	ATXN7L2	109835204	0.112000	0.22096	0.879000	0.34478	0.983000	0.72400	2.310000	0.43708	1.417000	0.47077	0.407000	0.27541	CCC	-	NULL		0.667	ATXN7L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATXN7L2	protein_coding	OTTHUMT00000030331.1	C	NM_153340		109835204	1	no_errors	NM_153340	genbank	human	validated	54_36p	missense	SNP	0.53	T
LCE1A	353131	genome.wustl.edu	37	1	152799996	152799996	+	Silent	SNP	C	C	T			TCGA-13-0726-01A-01W-0372-09	TCGA-13-0726-10B-01W-0977-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	201415c2-5b5a-4bb8-8005-bf2c78d4d88e	df694f1a-e6a5-4c06-bf79-5fe57cfcba13	g.chr1:152799996C>T	ENST00000335123.2	+	1	48	c.48C>T	c.(46-48)tgC>tgT	p.C16C		NM_178348.2	NP_848125.1	Q5T7P2	LCE1A_HUMAN	late cornified envelope 1A	16	Cys-rich.				keratinization (GO:0031424)			p.C16C(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|prostate(1)|skin(1)	8	Lung NSC(65;9.06e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			CTcccaagtgcacccccaagt	0.622																																																1	Substitution - coding silent(1)	ovary(1)	1											50.0	57.0	55.0					1																	152799996		2203	4300	6503	151066620	SO:0001819	synonymous_variant	353131				CCDS1028.1	1q21.3	2011-01-28			ENSG00000186844	ENSG00000186844		"""Late cornified envelopes"""	29459	protein-coding gene	gene with protein product		612603				11698679	Standard	NM_178348		Approved	LEP1	uc010pdw.2	Q5T7P2	OTTHUMG00000012447	ENST00000335123.2:c.48C>T	1.37:g.152799996C>T			151066620		Silent	SNP	-	p.C16	ENST00000335123.2	37	c.48	CCDS1028.1	1																																																																																			-	NULL		0.622	LCE1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCE1A	protein_coding	OTTHUMT00000034660.2	C	NM_178348		151066620	1	no_errors	NM_178348	genbank	human	validated	54_36p	silent	SNP	0.86	T
ATF6	22926	genome.wustl.edu	37	1	161736166	161736166	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0726-01A-01W-0372-09	TCGA-13-0726-10B-01W-0977-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	201415c2-5b5a-4bb8-8005-bf2c78d4d88e	df694f1a-e6a5-4c06-bf79-5fe57cfcba13	g.chr1:161736166G>A	ENST00000367942.3	+	1	83	c.16G>A	c.(16-18)Ggg>Agg	p.G6R	RP11-474I16.8_ENST00000431097.2_RNA	NM_007348.3	NP_031374.2	P18850	ATF6A_HUMAN	activating transcription factor 6	6	Transcription activation.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|positive regulation of transcription from RNA polymerase II promoter involved in unfolded protein response (GO:0006990)|protein folding (GO:0006457)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to stress (GO:0006950)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)	p.G6R(1)		breast(2)|endometrium(3)|kidney(2)|large_intestine(8)|lung(14)|ovary(3)|skin(1)|stomach(1)	34	all_hematologic(112;0.156)		BRCA - Breast invasive adenocarcinoma(70;0.00953)		Pseudoephedrine(DB00852)	GGAGCCGGCTGGGGTTGCCGG	0.572																																																1	Substitution - Missense(1)	ovary(1)	1											62.0	65.0	64.0					1																	161736166		2203	4300	6503	160002790	SO:0001583	missense	22926			AB015856	CCDS1235.1	1q22-q23	2013-01-10			ENSG00000118217	ENSG00000118217		"""basic leucine zipper proteins"""	791	protein-coding gene	gene with protein product	"""activating transcription factor 6 alpha"""	605537				9837962, 9271374, 11256944	Standard	NM_007348		Approved	ATF6A	uc001gbs.3	P18850	OTTHUMG00000023961	ENST00000367942.3:c.16G>A	1.37:g.161736166G>A	ENSP00000356919:p.Gly6Arg		160002790	O15139|Q5VW62|Q6IPB5|Q9UEC9	Missense_Mutation	SNP	-	p.G6R	ENST00000367942.3	37	c.16	CCDS1235.1	1	.	.	.	.	.	.	.	.	.	.	G	11.93	1.785900	0.31593	.	.	ENSG00000118217	ENST00000367942	T	0.16743	2.32	3.69	0.41	0.16387	.	1.240780	0.05786	N	0.609435	T	0.03305	0.0096	N	0.22421	0.69	0.24371	N	0.994835	B;B	0.29085	0.232;0.232	B;B	0.24269	0.032;0.052	T	0.43196	-0.9406	9	0.59425	D	0.04	-11.2916	3.6739	0.08284	0.1357:0.0:0.421:0.4433	.	6;7	P18850;Q59H30	ATF6A_HUMAN;.	R	6	ENSP00000356919:G6R	ENSP00000356919:G6R	G	+	1	0	ATF6	160002790	0.497000	0.26067	0.000000	0.03702	0.017000	0.09413	1.003000	0.29809	0.087000	0.17167	-0.310000	0.09108	GGG	-	NULL		0.572	ATF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATF6	protein_coding	OTTHUMT00000060304.2	G	NM_007348		160002790	1	no_errors	NM_007348	genbank	human	validated	54_36p	missense	SNP		A
PRRC2C	23215	genome.wustl.edu	37	1	171535524	171535524	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0726-01A-01W-0372-09	TCGA-13-0726-10B-01W-0977-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	201415c2-5b5a-4bb8-8005-bf2c78d4d88e	df694f1a-e6a5-4c06-bf79-5fe57cfcba13	g.chr1:171535524G>C	ENST00000338920.4	+	21	6501	c.6264G>C	c.(6262-6264)caG>caC	p.Q2088H	PRRC2C_ENST00000392078.3_Missense_Mutation_p.Q2090H|PRRC2C_ENST00000367742.3_Missense_Mutation_p.Q2090H|PRRC2C_ENST00000426496.2_Missense_Mutation_p.Q2088H	NM_015172.3	NP_055987.2	Q9Y520	PRC2C_HUMAN	proline-rich coiled-coil 2C	2088					hematopoietic progenitor cell differentiation (GO:0002244)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)	p.Q2090H(1)									AACAGCGGCAGAAGCAGCCAC	0.398																																																1	Substitution - Missense(1)	ovary(1)	1											23.0	24.0	24.0					1																	171535524		2203	4294	6497	169802148	SO:0001583	missense	23215			AL096857	CCDS1296.2	1q24.3	2012-07-18	2010-12-09	2010-12-09	ENSG00000117523	ENSG00000117523			24903	protein-coding gene	gene with protein product			"""BAT2 domain containing 1"", ""HLA-B associated transcript 2-like 2"""	BAT2D1, BAT2L2		10470851, 12443540	Standard	NM_015172		Approved	KIAA1096, XTP2	uc010pmg.2	Q9Y520	OTTHUMG00000034665	ENST00000338920.4:c.6264G>C	1.37:g.171535524G>C	ENSP00000343629:p.Gln2088His		169802148	Q05DM8|Q49A39|Q6PD54|Q9H2N2|Q9HA05|Q9NSM8|Q9NXL3|Q9UF29|Q9UPQ6	Missense_Mutation	SNP	-	p.Q2088H	ENST00000338920.4	37	c.6264	CCDS1296.2	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.37|12.37	1.918845|1.918845	0.33908|0.33908	.|.	.|.	ENSG00000117523|ENSG00000117523	ENST00000392078;ENST00000451306;ENST00000426496;ENST00000367742;ENST00000338920;ENST00000392080|ENST00000495585	T;T;T;T|.	0.02498|.	4.27;4.28;4.29;4.29|.	5.17|5.17	1.79|1.79	0.24919|0.24919	.|.	0.000000|.	0.44285|.	D|.	0.000461|.	T|T	0.49847|0.49847	0.1581|0.1581	M|M	0.66939|0.66939	2.045|2.045	0.45962|0.45962	D|D	0.998783|0.998783	D|.	0.76494|.	0.999|.	D|.	0.85130|.	0.997|.	T|T	0.49579|0.49579	-0.8925|-0.8925	10|5	0.18710|.	T|.	0.47|.	.|.	9.3298|9.3298	0.38014|0.38014	0.3892:0.0:0.6108:0.0|0.3892:0.0:0.6108:0.0	.|.	2088|.	Q9Y520-4|.	.|.	H|T	2090;2042;2088;2090;2088;1845|636	ENSP00000375928:Q2090H;ENSP00000410219:Q2088H;ENSP00000356716:Q2090H;ENSP00000343629:Q2088H|.	ENSP00000343629:Q2088H|.	Q|R	+|+	3|2	2|0	PRRC2C|PRRC2C	169802148|169802148	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.990000|0.990000	0.78478|0.78478	2.173000|2.173000	0.42472|0.42472	0.571000|0.571000	0.29365|0.29365	-0.150000|-0.150000	0.13652|0.13652	CAG|AGA	-	NULL		0.398	PRRC2C-010	KNOWN	basic|appris_candidate|CCDS	protein_coding	BAT2D1	protein_coding	OTTHUMT00000314826.4	G	NM_015172		169802148	1	no_errors	ENST00000392080	ensembl	human	known	54_36p	missense	SNP	1	C
SLC45A3	85414	genome.wustl.edu	37	1	205632105	205632105	+	Missense_Mutation	SNP	G	G	C	rs370670814		TCGA-13-0726-01A-01W-0372-09	TCGA-13-0726-10B-01W-0977-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	201415c2-5b5a-4bb8-8005-bf2c78d4d88e	df694f1a-e6a5-4c06-bf79-5fe57cfcba13	g.chr1:205632105G>C	ENST00000367145.3	-	3	1109	c.814C>G	c.(814-816)Cgc>Ggc	p.R272G	SLC45A3_ENST00000460934.1_5'Flank	NM_033102.2	NP_149093.1	Q96JT2	S45A3_HUMAN	solute carrier family 45, member 3	272					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)		p.R272G(1)	SLC45A3/BRAF(2)|SLC45A3/ELK4(18)|SLC45A3/ETV1(3)|SLC45A3/ETV5_ENST00000306376(2)|SLC45A3/ERG(50)	cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|liver(1)|lung(7)|ovary(3)|prostate(5)	21	Breast(84;0.07)		BRCA - Breast invasive adenocarcinoma(75;0.0194)			AAGAGCCGGCGCAGGGTGCGG	0.677			T	"""ETV1, ETV5, ELK4, ERG"""	prostate																																		Dom	yes		1	1q32	85414	"""solute carrier family 45, member 3"""		E	1	Substitution - Missense(1)	ovary(1)	1											26.0	32.0	30.0					1																	205632105		2202	4299	6501	203898728	SO:0001583	missense	85414			AF109301	CCDS1458.1	1q32.1	2013-05-22	2005-10-04	2005-10-04	ENSG00000158715	ENSG00000158715		"""Solute carriers"""	8642	protein-coding gene	gene with protein product		605097	"""prostate cancer associated protein 6"", ""prostate cancer associated protein 2"", ""prostate cancer associated protein 8"""	PCANAP6, PCANAP2, PCANAP8		10613842, 11245466	Standard	XM_005245556		Approved	IPCA-6, prostein, IPCA-2, IPCA-8	uc001hda.1	Q96JT2	OTTHUMG00000037223	ENST00000367145.3:c.814C>G	1.37:g.205632105G>C	ENSP00000356113:p.Arg272Gly		203898728	A8K2U9	Missense_Mutation	SNP	HMMPfam_MFS_1,superfamily_MFS general substrate transporter	p.R272G	ENST00000367145.3	37	c.814	CCDS1458.1	1	.	.	.	.	.	.	.	.	.	.	G	16.44	3.123078	0.56613	.	.	ENSG00000158715	ENST00000367145	D	0.92048	-2.96	5.37	5.37	0.77165	Major facilitator superfamily domain, general substrate transporter (1);	0.218189	0.48286	D	0.000184	D	0.91516	0.7321	M	0.69248	2.105	0.38792	D	0.955008	P;P	0.43024	0.798;0.798	P;P	0.45881	0.496;0.496	D	0.90075	0.4166	10	0.25106	T	0.35	-0.7509	12.1331	0.53955	0.0792:0.0:0.9208:0.0	.	272;272	A8K2U9;Q96JT2	.;S45A3_HUMAN	G	272	ENSP00000356113:R272G	ENSP00000356113:R272G	R	-	1	0	SLC45A3	203898728	1.000000	0.71417	1.000000	0.80357	0.871000	0.50021	1.948000	0.40303	2.505000	0.84491	0.655000	0.94253	CGC	-	NULL		0.677	SLC45A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC45A3	protein_coding	OTTHUMT00000090619.1	G	NM_033102		203898728	-1	no_errors	NM_033102	genbank	human	validated	54_36p	missense	SNP	0.998	C
TRIM17	51127	genome.wustl.edu	37	1	228595964	228595964	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0726-01A-01W-0372-09	TCGA-13-0726-10B-01W-0977-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	201415c2-5b5a-4bb8-8005-bf2c78d4d88e	df694f1a-e6a5-4c06-bf79-5fe57cfcba13	g.chr1:228595964G>T	ENST00000366697.2	-	6	2328	c.1372C>A	c.(1372-1374)Ctg>Atg	p.L458M	TRIM11_ENST00000366699.3_5'Flank|TRIM11_ENST00000493030.2_5'Flank|TRIM11_ENST00000284551.6_5'Flank|TRIM17_ENST00000366698.2_Missense_Mutation_p.L458M|TRIM17_ENST00000295033.3_Missense_Mutation_p.L458M|RP11-245P10.4_ENST00000436779.1_RNA			Q9Y577	TRI17_HUMAN	tripartite motif containing 17	458	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				protein autoubiquitination (GO:0051865)	intracellular (GO:0005622)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.L458M(1)		NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)	10		Prostate(94;0.0724)				GGAGCCCCCAGGCAGAAGAAA	0.612																																																1	Substitution - Missense(1)	ovary(1)	1																																								226662587	SO:0001583	missense	51127			AF156271	CCDS1571.1, CCDS44327.1	1q42	2013-01-09	2011-01-25	2001-11-30	ENSG00000162931	ENSG00000162931		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	13430	protein-coding gene	gene with protein product	"""ring finger protein 16"", ""RING finger protein terf"", ""testis RING finger protein"""	606123	"""tripartite motif-containing 17"""	RNF16		9792805, 10894938	Standard	NM_016102		Approved	terf, RBCC	uc001hsv.3	Q9Y577	OTTHUMG00000039974	ENST00000366697.2:c.1372C>A	1.37:g.228595964G>T	ENSP00000355658:p.Leu458Met		226662587	B4DVJ2|Q5VST8	Missense_Mutation	SNP	HMMPfam_zf-B_box;HMMPfam_zf-C3HC4;HMMPfam_SPRY;superfamily_RING/U-box	p.L458M	ENST00000366697.2	37	c.1372	CCDS1571.1	1	.	.	.	.	.	.	.	.	.	.	G	15.86	2.958615	0.53400	.	.	ENSG00000162931	ENST00000366697;ENST00000366698;ENST00000295033	T;T;T	0.74632	-0.86;-0.86;-0.86	4.92	1.99	0.26369	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);Butyrophylin-like (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.000000	0.35320	N	0.003298	T	0.81917	0.4924	M	0.76727	2.345	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.77940	-0.2399	10	0.42905	T	0.14	.	6.9849	0.24723	0.3041:0.0:0.6959:0.0	.	458	Q9Y577	TRI17_HUMAN	M	458	ENSP00000355658:L458M;ENSP00000355659:L458M;ENSP00000295033:L458M	ENSP00000295033:L458M	L	-	1	2	TRIM17	226662587	0.974000	0.33945	0.963000	0.40424	0.914000	0.54420	1.344000	0.33941	0.315000	0.23110	-0.140000	0.14226	CTG	-	HMMPfam_SPRY		0.612	TRIM17-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TRIM17	protein_coding	OTTHUMT00000096439.2	G	NM_016102		226662587	-1	no_errors	NM_001024940	genbank	human	reviewed	54_36p	missense	SNP	0.97	T
OPRD1	4985	genome.wustl.edu	37	1	29185806	29185806	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0726-01A-01W-0372-09	TCGA-13-0726-10B-01W-0977-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	201415c2-5b5a-4bb8-8005-bf2c78d4d88e	df694f1a-e6a5-4c06-bf79-5fe57cfcba13	g.chr1:29185806C>A	ENST00000234961.2	+	2	810	c.568C>A	c.(568-570)Cgt>Agt	p.R190S		NM_000911.3	NP_000902.3	P41143	OPRD_HUMAN	opioid receptor, delta 1	190					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adult locomotory behavior (GO:0008344)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hypoxia (GO:0071456)|cellular response to toxic substance (GO:0097237)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|immune response (GO:0006955)|negative regulation of gene expression (GO:0010629)|negative regulation of protein oligomerization (GO:0032460)|neuropeptide signaling pathway (GO:0007218)|opioid receptor signaling pathway (GO:0038003)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein import into nucleus, translocation (GO:0000060)|regulation of calcium ion transport (GO:0051924)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of sensory perception of pain (GO:0051930)	axon terminus (GO:0043679)|cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|vesicle (GO:0031982)	enkephalin receptor activity (GO:0038046)|opioid receptor activity (GO:0004985)	p.R190S(1)		breast(1)|central_nervous_system(1)|kidney(3)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15		Colorectal(325;3.46e-05)|Lung NSC(340;0.000947)|all_lung(284;0.00131)|Renal(390;0.00758)|Breast(348;0.00765)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;1.29e-07)|COAD - Colon adenocarcinoma(152;7.51e-06)|STAD - Stomach adenocarcinoma(196;0.00306)|BRCA - Breast invasive adenocarcinoma(304;0.0241)|READ - Rectum adenocarcinoma(331;0.0649)|KIRC - Kidney renal clear cell carcinoma(1967;0.147)	Alvimopan(DB06274)|Amitriptyline(DB00321)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Diphenoxylate(DB01081)|Fentanyl(DB00813)|Heroin(DB01452)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Ketamine(DB01221)|Ketobemidone(DB06738)|Levorphanol(DB00854)|Loperamide(DB00836)|Methadone(DB00333)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Oxycodone(DB00497)|Oxymorphone(DB01192)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tapentadol(DB06204)|Tramadol(DB00193)	GGCTGTGACCCGTCCCCGGGG	0.617																																																1	Substitution - Missense(1)	ovary(1)	1											37.0	28.0	31.0					1																	29185806		2203	4300	6503	29058393	SO:0001583	missense	4985			U10504	CCDS329.1	1p36.1-p34.3	2012-08-08			ENSG00000116329	ENSG00000116329		"""GPCR / Class A : Opioid receptors"""	8153	protein-coding gene	gene with protein product		165195				8415697	Standard	NM_000911		Approved		uc001brf.1	P41143	OTTHUMG00000003646	ENST00000234961.2:c.568C>A	1.37:g.29185806C>A	ENSP00000234961:p.Arg190Ser		29058393	B5B0B8	Missense_Mutation	SNP	-	p.R190S	ENST00000234961.2	37	c.568	CCDS329.1	1	.	.	.	.	.	.	.	.	.	.	C	12.01	1.810017	0.31961	.	.	ENSG00000116329	ENST00000234961;ENST00000536280	T	0.37058	1.22	4.57	3.66	0.41972	GPCR, rhodopsin-like superfamily (1);	0.747080	0.12250	N	0.485691	T	0.21590	0.0520	N	0.16567	0.415	0.24361	N	0.994874	B	0.02656	0.0	B	0.15484	0.013	T	0.14062	-1.0486	10	0.45353	T	0.12	.	5.7201	0.17982	0.1914:0.7095:0.0:0.099	.	190	P41143	OPRD_HUMAN	S	190	ENSP00000234961:R190S	ENSP00000234961:R190S	R	+	1	0	OPRD1	29058393	0.718000	0.27976	0.916000	0.36221	0.918000	0.54935	2.286000	0.43496	1.150000	0.42419	0.462000	0.41574	CGT	-	NULL		0.617	OPRD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OPRD1	protein_coding	OTTHUMT00000010330.1	C	NM_000911		29058393	1	no_errors	NM_000911	genbank	human	validated	54_36p	missense	SNP	0.5	A
LEPRE1	64175	genome.wustl.edu	37	1	43223532	43223532	+	Silent	SNP	G	G	A			TCGA-13-0726-01A-01W-0372-09	TCGA-13-0726-10B-01W-0977-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	201415c2-5b5a-4bb8-8005-bf2c78d4d88e	df694f1a-e6a5-4c06-bf79-5fe57cfcba13	g.chr1:43223532G>A	ENST00000296388.5	-	5	1053	c.1002C>T	c.(1000-1002)gaC>gaT	p.D334D	LEPRE1_ENST00000397054.3_Silent_p.D334D|LEPRE1_ENST00000236040.4_Silent_p.D334D			Q32P28	P3H1_HUMAN	leucine proline-enriched proteoglycan (leprecan) 1	334					bone development (GO:0060348)|cell growth (GO:0016049)|chaperone-mediated protein folding (GO:0061077)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|negative regulation of post-translational protein modification (GO:1901874)|peptidyl-proline hydroxylation (GO:0019511)|protein folding (GO:0006457)|protein hydroxylation (GO:0018126)|protein stabilization (GO:0050821)|regulation of ossification (GO:0030278)|regulation of protein secretion (GO:0050708)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|macromolecular complex (GO:0032991)|membrane (GO:0016020)|nucleus (GO:0005634)|proteinaceous extracellular matrix (GO:0005578)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen-proline 3-dioxygenase activity (GO:0019797)|protein complex binding (GO:0032403)	p.D334D(1)		large_intestine(2)|lung(15)|ovary(5)|prostate(1)|urinary_tract(3)	26	Ovarian(52;0.00744)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)			L-Proline(DB00172)|Succinic acid(DB00139)|Vitamin C(DB00126)	TCATCACCTCGTCATTGGGGA	0.463																																																1	Substitution - coding silent(1)	ovary(1)	1											254.0	221.0	232.0					1																	43223532		2203	4300	6503	42996119	SO:0001819	synonymous_variant	64175			AK027648	CCDS472.2, CCDS53307.1, CCDS57986.1	1p34.1	2014-09-17			ENSG00000117385	ENSG00000117385			19316	protein-coding gene	gene with protein product	"""prolyl 3-hydroxylase 1"", ""growth suppressor 1"""	610339				10951563	Standard	NM_022356		Approved	GROS1, P3H1, LEPRECAN, MGC117314	uc001chx.4	Q32P28	OTTHUMG00000007525	ENST00000296388.5:c.1002C>T	1.37:g.43223532G>A			42996119	Q7KZR4|Q96BR8|Q96SK8|Q96SL5|Q96SN3|Q9H6K3|Q9HC86|Q9HC87	Silent	SNP	-	p.D334	ENST00000296388.5	37	c.1002	CCDS472.2	1																																																																																			-	NULL		0.463	LEPRE1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LEPRE1	protein_coding	OTTHUMT00000019790.2	G	NM_022356		42996119	-1	no_errors	NM_022356	genbank	human	reviewed	54_36p	silent	SNP	0.99	A
OR2T35	403244	genome.wustl.edu	37	1	248801897	248801897	+	Silent	SNP	G	G	A	rs79303917	byFrequency	TCGA-13-0726-01A-01W-0372-09	TCGA-13-0726-10B-01W-0977-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	201415c2-5b5a-4bb8-8005-bf2c78d4d88e	df694f1a-e6a5-4c06-bf79-5fe57cfcba13	g.chr1:248801897G>A	ENST00000317450.3	-	1	662	c.663C>T	c.(661-663)atC>atT	p.I221I		NM_001001827.1	NP_001001827.1	Q8NGX2	O2T35_HUMAN	olfactory receptor, family 2, subfamily T, member 35	221						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.I221I(1)		endometrium(1)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)|skin(1)	6	all_cancers(71;2.04e-05)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.237)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CAGTCAGGAGGATGTGCGTGT	0.542																																																1	Substitution - coding silent(1)	ovary(1)	1						G		125,3975		2,121,1927	102.0	89.0	93.0		663	-0.2	0.0	1	dbSNP_131	93	877,7621		4,869,3376	no	coding-synonymous	OR2T35	NM_001001827.1		6,990,5303	AA,AG,GG		10.3201,3.0488,7.9536		221/324	248801897	1002,11596	2050	4249	6299	246868520	SO:0001819	synonymous_variant	403244			BK004475	CCDS31123.1	1q44	2012-08-09			ENSG00000177151	ENSG00000177151		"""GPCR / Class A : Olfactory receptors"""	31257	protein-coding gene	gene with protein product							Standard	NM_001001827		Approved		uc001ies.1	Q8NGX2	OTTHUMG00000040380	ENST00000317450.3:c.663C>T	1.37:g.248801897G>A			246868520	Q6IEY7	Silent	SNP	-	p.I221	ENST00000317450.3	37	c.663	CCDS31123.1	1																																																																																			-	NULL		0.542	OR2T35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T35	protein_coding	OTTHUMT00000097130.1	G	NM_001001827		246868520	-1	no_errors	NM_001001827	genbank	human	provisional	54_36p	silent	SNP	0.42	A
SORCS3	22986	genome.wustl.edu	37	10	107022239	107022239	+	Silent	SNP	G	G	A	rs148855365		TCGA-13-0726-01A-01W-0372-09	TCGA-13-0726-10B-01W-0977-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	201415c2-5b5a-4bb8-8005-bf2c78d4d88e	df694f1a-e6a5-4c06-bf79-5fe57cfcba13	g.chr10:107022239G>A	ENST00000369701.3	+	26	3821	c.3594G>A	c.(3592-3594)acG>acA	p.T1198T		NM_014978.1	NP_055793.1	Q9UPU3	SORC3_HUMAN	sortilin-related VPS10 domain containing receptor 3	1198					learning (GO:0007612)|memory (GO:0007613)|neuropeptide signaling pathway (GO:0007218)|regulation of long term synaptic depression (GO:1900452)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal postsynaptic density (GO:0097481)	neuropeptide receptor activity (GO:0008188)	p.T1198T(1)		autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(19)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	131		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)		AGCTGGACACGCGGGTCATAG	0.527																																					NSCLC(116;1497 1690 7108 13108 14106)											1	Substitution - coding silent(1)	ovary(1)	10											62.0	49.0	54.0					10																	107022239		2203	4300	6503	107012229	SO:0001819	synonymous_variant	22986			AB028982	CCDS7558.1	10q23-q25	2006-04-12			ENSG00000156395	ENSG00000156395			16699	protein-coding gene	gene with protein product		606285				11499680	Standard	NM_014978		Approved	KIAA1059, SORCS	uc001kyi.1	Q9UPU3	OTTHUMG00000019011	ENST00000369701.3:c.3594G>A	10.37:g.107022239G>A			107012229	Q5VXF9|Q9NQJ2	Silent	SNP	HMMPfam_PKD;superfamily_PKD domain;HMMPfam_BNR;superfamily_Oligoxyloglucan reducing end-specific cellobiohydrolase	p.T1198	ENST00000369701.3	37	c.3594	CCDS7558.1	10																																																																																			-	NULL		0.527	SORCS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SORCS3	protein_coding	OTTHUMT00000050221.1	G	NM_014978		107012229	1	no_errors	NM_014978	genbank	human	reviewed	54_36p	silent	SNP	0.88	A
HABP2	3026	genome.wustl.edu	37	10	115338451	115338451	+	Nonsense_Mutation	SNP	C	C	T			TCGA-13-0726-01A-01W-0372-09	TCGA-13-0726-10B-01W-0977-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	201415c2-5b5a-4bb8-8005-bf2c78d4d88e	df694f1a-e6a5-4c06-bf79-5fe57cfcba13	g.chr10:115338451C>T	ENST00000351270.3	+	7	730	c.634C>T	c.(634-636)Cag>Tag	p.Q212*	HABP2_ENST00000541666.1_Nonsense_Mutation_p.Q212*|HABP2_ENST00000537906.1_3'UTR|HABP2_ENST00000542051.1_Nonsense_Mutation_p.Q186*	NM_004132.3	NP_004123.1	Q14520	HABP2_HUMAN	hyaluronan binding protein 2	212	Kringle. {ECO:0000255|PROSITE- ProRule:PRU00121}.				cell adhesion (GO:0007155)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	glycosaminoglycan binding (GO:0005539)|serine-type endopeptidase activity (GO:0004252)	p.Q212*(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(5)|lung(8)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)	23		Colorectal(252;0.0233)|Breast(234;0.0672)		Epithelial(162;0.00319)|all cancers(201;0.0112)	Hyaluronan(DB08818)	GACAGTCAACCAGCATGCGTG	0.478																																																1	Substitution - Nonsense(1)	ovary(1)	10											191.0	165.0	174.0					10																	115338451		2203	4300	6503	115328441	SO:0001587	stop_gained	3026				CCDS7577.1, CCDS53579.1	10q25.3	2008-08-01	2001-11-28		ENSG00000148702	ENSG00000148702			4798	protein-coding gene	gene with protein product	"""plasma hyaluronan binding protein"", ""factor VII activating protein"""	603924	"""hyaluronan-binding protein 2"""			8827452, 12437095	Standard	NM_004132		Approved	HABP, PHBP, HGFAL, FSAP	uc001lai.4	Q14520	OTTHUMG00000019073	ENST00000351270.3:c.634C>T	10.37:g.115338451C>T	ENSP00000277903:p.Gln212*		115328441	A8K467|B7Z8U5|F5H5M6|O00663	Nonsense_Mutation	SNP	HMMPfam_Kringle;HMMPfam_Trypsin;HMMPfam_EGF;superfamily_Trypsin-like serine proteases;superfamily_Kringle-like;superfamily_EGF/Laminin	p.Q212*	ENST00000351270.3	37	c.634	CCDS7577.1	10	.	.	.	.	.	.	.	.	.	.	C	14.72	2.619980	0.46736	.	.	ENSG00000148702	ENST00000542051;ENST00000351270;ENST00000541666	.	.	.	5.66	4.73	0.59995	.	0.346354	0.31484	N	0.007580	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	.	10.7043	0.45946	0.139:0.7086:0.1524:0.0	.	.	.	.	X	186;212;212	.	ENSP00000277903:Q212X	Q	+	1	0	HABP2	115328441	0.992000	0.36948	1.000000	0.80357	0.118000	0.20060	3.553000	0.53713	1.331000	0.45412	0.462000	0.41574	CAG	-	HMMPfam_Kringle		0.478	HABP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HABP2	protein_coding	OTTHUMT00000050428.1	C	NM_004132		115328441	1	no_errors	NM_004132	genbank	human	reviewed	54_36p	nonsense	SNP	0.25	T
PFKFB3	5209	genome.wustl.edu	37	10	6261624	6261624	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0726-01A-01W-0372-09	TCGA-13-0726-10B-01W-0977-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	201415c2-5b5a-4bb8-8005-bf2c78d4d88e	df694f1a-e6a5-4c06-bf79-5fe57cfcba13	g.chr10:6261624C>G	ENST00000379775.4	+	7	921	c.591C>G	c.(589-591)agC>agG	p.S197R	PFKFB3_ENST00000379789.4_Missense_Mutation_p.S177R|PFKFB3_ENST00000379785.1_Missense_Mutation_p.S197R|PFKFB3_ENST00000317350.4_Missense_Mutation_p.S197R|PFKFB3_ENST00000540253.1_Missense_Mutation_p.S211R|PFKFB3_ENST00000536985.1_3'UTR|PFKFB3_ENST00000360521.2_Missense_Mutation_p.S197R|PFKFB3_ENST00000379782.3_Missense_Mutation_p.S197R	NM_004566.3	NP_004557.1	Q16875	F263_HUMAN	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3	197	6-phosphofructo-2-kinase.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose 2,6-bisphosphate metabolic process (GO:0006003)|fructose metabolic process (GO:0006000)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|nucleus (GO:0005634)	6-phosphofructo-2-kinase activity (GO:0003873)|ATP binding (GO:0005524)|fructose-2,6-bisphosphate 2-phosphatase activity (GO:0004331)	p.S197R(1)		central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(1)|liver(2)|lung(10)|ovary(3)|upper_aerodigestive_tract(1)	22						ATGAAGCCAGCTACCAGCCCC	0.522																																																1	Substitution - Missense(1)	ovary(1)	10											87.0	84.0	85.0					10																	6261624		2203	4300	6503	6301630	SO:0001583	missense	5209				CCDS7078.1, CCDS44353.1, CCDS60479.1	10p15.1	2008-05-14			ENSG00000170525	ENSG00000170525			8874	protein-coding gene	gene with protein product		605319				9146922, 10072580	Standard	NM_004566		Approved		uc001ije.3	Q16875	OTTHUMG00000017621	ENST00000379775.4:c.591C>G	10.37:g.6261624C>G	ENSP00000369100:p.Ser197Arg		6301630	B7Z955|O43622|O75902|Q5VX15|Q5VX18|Q5VX19	Missense_Mutation	SNP	HMMPfam_PGAM;HMMPfam_6PF2K;superfamily_P-loop containing nucleoside triphosphate hydrolases;superfamily_Phosphoglycerate mutase-like	p.S197R	ENST00000379775.4	37	c.591	CCDS7078.1	10	.	.	.	.	.	.	.	.	.	.	C	10.59	1.393479	0.25205	.	.	ENSG00000170525	ENST00000379789;ENST00000540253;ENST00000317350;ENST00000379785;ENST00000379782;ENST00000360521;ENST00000379775;ENST00000358499	.	.	.	5.56	4.66	0.58398	6-phosphofructo-2-kinase (1);	0.155419	0.64402	D	0.000001	T	0.41880	0.1178	L	0.31157	0.91	0.54753	D	0.999987	B;B;B;B	0.22800	0.075;0.012;0.007;0.007	B;B;B;B	0.24848	0.044;0.006;0.056;0.006	T	0.21008	-1.0258	9	0.16420	T	0.52	-13.5852	8.9578	0.35829	0.0:0.778:0.0:0.222	.	211;197;197;177	B7Z955;Q16875-2;Q16875;Q5VX15	.;.;F263_HUMAN;.	R	177;211;197;197;197;197;197;197	.	ENSP00000369105:S197R	S	+	3	2	PFKFB3	6301630	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	1.196000	0.32198	1.349000	0.45751	0.591000	0.81541	AGC	-	HMMPfam_6PF2K		0.522	PFKFB3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	PFKFB3	protein_coding	OTTHUMT00000046647.1	C			6301630	1	no_errors	NM_004566	genbank	human	validated	54_36p	missense	SNP	1	G
EPC1	80314	genome.wustl.edu	37	10	32581524	32581524	+	Silent	SNP	G	G	T			TCGA-13-0726-01A-01W-0372-09	TCGA-13-0726-10B-01W-0977-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	201415c2-5b5a-4bb8-8005-bf2c78d4d88e	df694f1a-e6a5-4c06-bf79-5fe57cfcba13	g.chr10:32581524G>T	ENST00000263062.8	-	5	984	c.715C>A	c.(715-717)Cga>Aga	p.R239R	EPC1_ENST00000319778.6_Silent_p.R239R|EPC1_ENST00000375110.2_Silent_p.R189R	NM_025209.2	NP_079485.1	Q9H2F5	EPC1_HUMAN	enhancer of polycomb homolog 1 (Drosophila)	239					chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of growth (GO:0040008)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Piccolo NuA4 histone acetyltransferase complex (GO:0032777)		p.R239R(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(8)|ovary(5)|urinary_tract(1)	24		Prostate(175;0.0199)				CTTAGATCTCGTCGCAGCTTA	0.343																																																1	Substitution - coding silent(1)	ovary(1)	10											99.0	94.0	96.0					10																	32581524		2202	4300	6502	32621530	SO:0001819	synonymous_variant	80314			AF277374	CCDS7172.1, CCDS60511.1, CCDS73083.1	10p11	2005-12-12			ENSG00000120616	ENSG00000120616			19876	protein-coding gene	gene with protein product		610999				10976108	Standard	NM_025209		Approved	Epl1	uc001iwg.2	Q9H2F5	OTTHUMG00000017925	ENST00000263062.8:c.715C>A	10.37:g.32581524G>T			32621530	B4DSC3|D3DRX7|Q5VW54|Q5VW56|Q5VW58|Q8NAQ4|Q8NE21|Q96LF4|Q96RR6|Q9H7T7	Silent	SNP	HMMPfam_E_Pc_C	p.R239	ENST00000263062.8	37	c.715	CCDS7172.1	10																																																																																			-	NULL		0.343	EPC1-004	KNOWN	basic|CCDS	protein_coding	EPC1	protein_coding	OTTHUMT00000047484.1	G			32621530	-1	no_errors	NM_025209	genbank	human	provisional	54_36p	silent	SNP	1	T
PCDH15	65217	genome.wustl.edu	37	10	55568558	55568558	+	Missense_Mutation	SNP	G	G	A	rs371592348		TCGA-13-0726-01A-01W-0372-09	TCGA-13-0726-10B-01W-0977-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	201415c2-5b5a-4bb8-8005-bf2c78d4d88e	df694f1a-e6a5-4c06-bf79-5fe57cfcba13	g.chr10:55568558G>A	ENST00000395445.1	-	36	5646	c.5252C>T	c.(5251-5253)tCt>tTt	p.S1751F	PCDH15_ENST00000395442.1_Missense_Mutation_p.S616F|PCDH15_ENST00000373965.2_Intron|PCDH15_ENST00000414778.1_Intron|PCDH15_ENST00000395438.1_3'UTR|PCDH15_ENST00000395446.1_Missense_Mutation_p.S947F|PCDH15_ENST00000409834.1_3'UTR|PCDH15_ENST00000395440.1_Missense_Mutation_p.S685F	NM_001142769.1	NP_001136241.1	Q96QU1	PCD15_HUMAN	protocadherin-related 15	0	Poly-Pro.				equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)			NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				TGGACCTCCAGACTGACTTTC	0.498										HNSCC(58;0.16)																																						0			10											137.0	113.0	120.0					10																	55568558		1568	3582	5150	55238564	SO:0001583	missense	65217			AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000395445.1:c.5252C>T	10.37:g.55568558G>A	ENSP00000378832:p.Ser1751Phe		55238564	A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Missense_Mutation	SNP	-	p.S1751F	ENST00000395445.1	37	c.5252		10	.	.	.	.	.	.	.	.	.	.	G	13.58	2.279641	0.40294	.	.	ENSG00000150275	ENST00000395445;ENST00000395446;ENST00000395442;ENST00000395440	T;T;T;T	0.62364	0.03;0.13;0.4;0.29	4.8	4.8	0.61643	.	.	.	.	.	T	0.47893	0.1470	N	0.14661	0.345	0.20926	N	0.999822	B;B	0.26876	0.162;0.162	B;B	0.33890	0.172;0.172	T	0.44877	-0.9299	9	0.87932	D	0	.	8.8877	0.35414	0.0992:0.0:0.9008:0.0	.	1749;1751	C6ZEF5;A2A3E2	.;.	F	1751;947;616;685	ENSP00000378832:S1751F;ENSP00000378833:S947F;ENSP00000378829:S616F;ENSP00000378827:S685F	ENSP00000378827:S685F	S	-	2	0	PCDH15	55238564	0.138000	0.22547	0.990000	0.47175	0.928000	0.56348	2.435000	0.44811	2.494000	0.84150	0.563000	0.77884	TCT	-	NULL		0.498	PCDH15-007	NOVEL	not_organism_supported|basic	protein_coding	PCDH15	protein_coding	OTTHUMT00000291335.1	G	NM_033056		55238564	-1	no_errors	ENST00000395445	ensembl	human	known	54_36p	missense	SNP		A
LRRTM3	347731	genome.wustl.edu	37	10	68857503	68857503	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0726-01A-01W-0372-09	TCGA-13-0726-10B-01W-0977-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	201415c2-5b5a-4bb8-8005-bf2c78d4d88e	df694f1a-e6a5-4c06-bf79-5fe57cfcba13	g.chr10:68857503C>A	ENST00000361320.4	+	3	2273	c.1695C>A	c.(1693-1695)agC>agA	p.S565R	CTNNA3_ENST00000433211.2_Intron|CTNNA3_ENST00000373744.4_Intron|LRRTM3_ENST00000485868.1_3'UTR	NM_178011.3	NP_821079.3	Q86VH5	LRRT3_HUMAN	leucine rich repeat transmembrane neuronal 3	565					positive regulation of beta-amyloid formation (GO:1902004)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)		p.S565R(1)		breast(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(20)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	41						TGGACCTGAGCACAATCACAA	0.473																																																1	Substitution - Missense(1)	ovary(1)	10											151.0	130.0	137.0					10																	68857503		2203	4300	6503	68527509	SO:0001583	missense	347731			BX640611	CCDS7270.1	10q22.1	2007-01-22				ENSG00000198739			19410	protein-coding gene	gene with protein product		610869				12676565	Standard	XR_247527		Approved		uc001jmz.1	Q86VH5		ENST00000361320.4:c.1695C>A	10.37:g.68857503C>A	ENSP00000355187:p.Ser565Arg		68527509	A8K2A3|Q2NKX7|Q6N0A3	Missense_Mutation	SNP	-	p.S565R	ENST00000361320.4	37	c.1695	CCDS7270.1	10	.	.	.	.	.	.	.	.	.	.	C	16.23	3.065614	0.55539	.	.	ENSG00000198739	ENST00000361320;ENST00000373722	T	0.53423	0.62	5.92	5.02	0.67125	.	0.000000	0.56097	D	0.000022	T	0.37919	0.1021	N	0.19112	0.55	0.34716	D	0.72824	D	0.56968	0.978	P	0.45998	0.5	T	0.56565	-0.7958	10	0.87932	D	0	.	12.0761	0.53644	0.0:0.9201:0.0:0.0799	.	565	Q86VH5	LRRT3_HUMAN	R	565	ENSP00000355187:S565R	ENSP00000355187:S565R	S	+	3	2	LRRTM3	68527509	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.796000	0.55507	1.518000	0.48934	0.650000	0.86243	AGC	-	NULL		0.473	LRRTM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRTM3	protein_coding	OTTHUMT00000048277.2	C	NM_178011		68527509	1	no_errors	NM_178011	genbank	human	validated	54_36p	missense	SNP	1	A
SORBS1	10580	genome.wustl.edu	37	10	97096492	97096492	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0726-01A-01W-0372-09	TCGA-13-0726-10B-01W-0977-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	201415c2-5b5a-4bb8-8005-bf2c78d4d88e	df694f1a-e6a5-4c06-bf79-5fe57cfcba13	g.chr10:97096492C>G	ENST00000361941.3	-	28	3451	c.3425G>C	c.(3424-3426)gGa>gCa	p.G1142A	SORBS1_ENST00000353505.5_Intron|SORBS1_ENST00000354106.3_Intron|SORBS1_ENST00000347291.4_Intron|SORBS1_ENST00000607232.1_Intron|SORBS1_ENST00000371239.1_Intron|SORBS1_ENST00000371241.1_Intron|SORBS1_ENST00000371247.2_Missense_Mutation_p.G1142A|SORBS1_ENST00000393949.1_Intron|SORBS1_ENST00000371249.2_Intron|SORBS1_ENST00000371246.2_Missense_Mutation_p.G1001A|SORBS1_ENST00000371227.4_Missense_Mutation_p.G1096A|SORBS1_ENST00000306402.6_Intron|SORBS1_ENST00000371245.3_Intron|SORBS1_ENST00000277982.5_Missense_Mutation_p.G1001A	NM_001034954.1	NP_001030126			sorbin and SH3 domain containing 1											NS(1)|breast(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(19)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	42		Colorectal(252;0.0429)		Epithelial(162;1.7e-06)|all cancers(201;6.52e-05)		GATCTTGGGTCCACCAGGGCC	0.557																																																0			10											82.0	82.0	82.0					10																	97096492		2203	4300	6503	97086482	SO:0001583	missense	10580			AF136381	CCDS7442.1, CCDS31252.1, CCDS31253.1, CCDS31254.1, CCDS31255.1, CCDS31256.1, CCDS73169.1	10q23.33	2011-07-25	2002-05-08		ENSG00000095637	ENSG00000095637			14565	protein-coding gene	gene with protein product	"""c-Cbl-associated protein"""	605264	"""SH3-domain protein 5 (ponsin)"""	SH3D5		10085297, 11001060	Standard	XM_005269405		Approved	FLJ12406, CAP, sh3p12, ponsin, KIAA1296	uc001kkp.3	Q9BX66	OTTHUMG00000018812	ENST00000361941.3:c.3425G>C	10.37:g.97096492C>G	ENSP00000355136:p.Gly1142Ala		97086482		Missense_Mutation	SNP	HMMPfam_SH3_1;superfamily_SH3-domain;HMMPfam_Sorb	p.G1142A	ENST00000361941.3	37	c.3425	CCDS31255.1	10	.	.	.	.	.	.	.	.	.	.	C	8.180	0.793621	0.16327	.	.	ENSG00000095637	ENST00000371247;ENST00000371227;ENST00000371246;ENST00000361941;ENST00000277982	T;T;T;T;T	0.09255	3.0;3.06;3.44;3.0;3.44	5.58	4.67	0.58626	.	0.180012	0.27113	N	0.020874	T	0.06234	0.0161	N	0.19112	0.55	0.80722	D	1	B;B;B	0.06786	0.001;0.0;0.001	B;B;B	0.09377	0.004;0.002;0.004	T	0.22730	-1.0208	10	0.09084	T	0.74	-4.8462	9.0125	0.36150	0.2129:0.5122:0.275:0.0	.	1096;1142;1001	Q9BX66-11;Q9BX66;Q9BX66-2	.;SRBS1_HUMAN;.	A	1142;1096;1001;1142;1001	ENSP00000360293:G1142A;ENSP00000360271:G1096A;ENSP00000360292:G1001A;ENSP00000355136:G1142A;ENSP00000277982:G1001A	ENSP00000277982:G1001A	G	-	2	0	SORBS1	97086482	0.002000	0.14202	1.000000	0.80357	0.851000	0.48451	-0.090000	0.11163	1.354000	0.45846	0.561000	0.74099	GGA	-	NULL		0.557	SORBS1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SORBS1	protein_coding	OTTHUMT00000049517.1	C			97086482	-1	no_errors	NM_001034954	genbank	human	validated	54_36p	missense	SNP	0.86	G
SEC23IP	11196	genome.wustl.edu	37	10	121677961	121677961	+	Missense_Mutation	SNP	T	T	G			TCGA-13-0726-01A-01W-0372-09	TCGA-13-0726-10B-01W-0977-09	T	T	T	G	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	201415c2-5b5a-4bb8-8005-bf2c78d4d88e	df694f1a-e6a5-4c06-bf79-5fe57cfcba13	g.chr10:121677961T>G	ENST00000369075.3	+	10	1882	c.1810T>G	c.(1810-1812)Tgc>Ggc	p.C604G	SEC23IP_ENST00000543134.1_Missense_Mutation_p.C393G	NM_007190.3	NP_009121.1	Q9Y6Y8	S23IP_HUMAN	SEC23 interacting protein	604					acrosome assembly (GO:0001675)|Golgi organization (GO:0007030)|intracellular protein transport (GO:0006886)|single fertilization (GO:0007338)	cis-Golgi network (GO:0005801)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum exit site (GO:0070971)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|perinuclear endoplasmic reticulum (GO:0097038)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.C604G(1)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(12)|ovary(3)|prostate(1)|stomach(3)|urinary_tract(1)	36		Lung NSC(174;0.109)|all_lung(145;0.142)|all_neural(114;0.234)		all cancers(201;0.00515)		TTTATCAAAGTGCCCTGGACC	0.353																																																1	Substitution - Missense(1)	ovary(1)	10											95.0	92.0	93.0					10																	121677961		2203	4300	6503	121667951	SO:0001583	missense	11196			AB019435	CCDS7618.1	10q26.11-q26.12	2013-01-10			ENSG00000107651	ENSG00000107651		"""Sterile alpha motif (SAM) domain containing"""	17018	protein-coding gene	gene with protein product						10400679	Standard	NM_007190		Approved	p125	uc001leu.2	Q9Y6Y8	OTTHUMG00000019161	ENST00000369075.3:c.1810T>G	10.37:g.121677961T>G	ENSP00000358071:p.Cys604Gly		121667951	D3DRD2|Q8IXH5|Q9BUK5	Missense_Mutation	SNP	HMMPfam_SAM_1;HMMPfam_DDHD;superfamily_SAM/Pointed domain	p.C604G	ENST00000369075.3	37	c.1810	CCDS7618.1	10	.	.	.	.	.	.	.	.	.	.	T	2.422	-0.332812	0.05314	.	.	ENSG00000107651	ENST00000369075;ENST00000543134	T;T	0.43688	0.94;0.94	5.29	1.55	0.23275	.	0.970432	0.08604	N	0.920987	T	0.21881	0.0527	N	0.14661	0.345	0.22034	N	0.999407	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.23619	-1.0183	10	0.30078	T	0.28	-10.3291	1.9674	0.03399	0.3295:0.0789:0.1238:0.4679	.	393;604	F5H0L8;Q9Y6Y8	.;S23IP_HUMAN	G	604;393	ENSP00000358071:C604G;ENSP00000438773:C393G	ENSP00000358071:C604G	C	+	1	0	SEC23IP	121667951	0.454000	0.25728	0.969000	0.41365	0.118000	0.20060	0.645000	0.24782	0.145000	0.18977	0.533000	0.62120	TGC	-	NULL		0.353	SEC23IP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC23IP	protein_coding	OTTHUMT00000050688.1	T			121667951	1	no_errors	NM_007190	genbank	human	reviewed	54_36p	missense	SNP	0.06	G
KCNQ1	3784	genome.wustl.edu	37	11	2604687	2604687	+	Missense_Mutation	SNP	A	A	T	rs74462309		TCGA-13-0726-01A-01W-0372-09	TCGA-13-0726-10B-01W-0977-09	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	201415c2-5b5a-4bb8-8005-bf2c78d4d88e	df694f1a-e6a5-4c06-bf79-5fe57cfcba13	g.chr11:2604687A>T	ENST00000155840.5	+	7	1052	c.944A>T	c.(943-945)tAt>tTt	p.Y315F	KCNQ1_ENST00000335475.5_Missense_Mutation_p.Y188F	NM_000218.2	NP_000209.2	P51787	KCNQ1_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 1	315			Y -> C (in LQT1). {ECO:0000269|PubMed:15840476, ECO:0000269|PubMed:9693036, ECO:0000269|PubMed:9927399}.|Y -> S (in LQT1). {ECO:0000269|PubMed:10220144}.		atrial cardiac muscle cell action potential (GO:0086014)|cardiac muscle contraction (GO:0060048)|cardiovascular system development (GO:0072358)|cellular response to cAMP (GO:0071320)|cellular response to drug (GO:0035690)|cellular response to epinephrine stimulus (GO:0071872)|gene silencing (GO:0016458)|male gonad development (GO:0008584)|membrane repolarization during action potential (GO:0086011)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of insulin secretion (GO:0046676)|positive regulation of gastric acid secretion (GO:0060454)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion export (GO:0071435)|potassium ion transmembrane transport (GO:0071805)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of heart contraction (GO:0008016)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of membrane repolarization (GO:0060306)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|sensory perception of sound (GO:0007605)|synaptic transmission (GO:0007268)|ventricular cardiac muscle cell action potential (GO:0086005)	basolateral plasma membrane (GO:0016323)|early endosome (GO:0005769)|late endosome (GO:0005770)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated potassium channel complex (GO:0008076)|zymogen granule membrane (GO:0042589)	calmodulin binding (GO:0005516)|delayed rectifier potassium channel activity (GO:0005251)|ion channel binding (GO:0044325)|outward rectifier potassium channel activity (GO:0015271)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|protein phosphatase 1 binding (GO:0008157)|scaffold protein binding (GO:0097110)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated potassium channel activity involved in atrial cardiac muscle cell action potential repolarization (GO:0086089)|voltage-gated potassium channel activity involved in cardiac muscle cell action potential repolarization (GO:0086008)|voltage-gated potassium channel activity involved in ventricular cardiac muscle cell action potential repolarization (GO:1902282)	p.Y315F(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(2)	21		all_epithelial(84;3.26e-05)|Breast(177;0.001)|Medulloblastoma(188;0.00111)|Ovarian(85;0.00158)|all_neural(188;0.00725)|all_lung(207;0.11)|Lung NSC(207;0.159)		BRCA - Breast invasive adenocarcinoma(625;0.00251)|Lung(200;0.131)	Bepridil(DB01244)|Indapamide(DB00808)	ACCATCGGCTATGGGGACAAG	0.632																																																1	Substitution - Missense(1)	ovary(1)	11	GRCh37	CM970823|CM981127	KCNQ1	M	rs74462309						194.0	161.0	172.0					11																	2604687		2202	4299	6501	2561263	SO:0001583	missense	3784			AF000571	CCDS7736.1	11p15.5	2014-09-17			ENSG00000053918	ENSG00000053918		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6294	protein-coding gene	gene with protein product	"""Jervell and Lange-Nielsen syndrome 1"""	607542		LQT, KCNA9		8528244, 16382104	Standard	NM_181798		Approved	Kv7.1, KCNA8, KVLQT1, JLNS1, LQT1	uc001lwn.3	P51787	OTTHUMG00000009900	ENST00000155840.5:c.944A>T	11.37:g.2604687A>T	ENSP00000155840:p.Tyr315Phe		2561263	O00347|O60607|O94787|Q14D14|Q7Z6G9|Q92960|Q9UMN8|Q9UMN9	Missense_Mutation	SNP	HMMPfam_Ion_trans;HMMPfam_KCNQ_channel;superfamily_Voltage-gated potassium channels	p.Y315F	ENST00000155840.5	37	c.944	CCDS7736.1	11	.	.	.	.	.	.	.	.	.	.	A	21.4	4.146212	0.77888	.	.	ENSG00000053918	ENST00000155840;ENST00000335475	D;D	0.98567	-5.0;-5.0	3.93	3.93	0.45458	Ion transport (1);	0.122813	0.56097	D	0.000024	D	0.98529	0.9509	M	0.74881	2.28	0.49051	D	0.999743	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.79784	0.984;0.991;0.993	D	0.99044	1.0825	10	0.87932	D	0	-21.1595	11.076	0.48032	1.0:0.0:0.0:0.0	.	188;188;315	P51787-2;Q14D14;P51787	.;.;KCNQ1_HUMAN	F	315;188	ENSP00000155840:Y315F;ENSP00000334497:Y188F	ENSP00000155840:Y315F	Y	+	2	0	KCNQ1	2561263	1.000000	0.71417	0.985000	0.45067	0.828000	0.46876	8.201000	0.89735	1.768000	0.52137	0.443000	0.29094	TAT	-	HMMPfam_Ion_trans		0.632	KCNQ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNQ1	protein_coding	OTTHUMT00000027382.2	A	NM_000218		2561263	1	no_errors	NM_000218	genbank	human	reviewed	54_36p	missense	SNP	1	T
OR4S1	256148	genome.wustl.edu	37	11	48328640	48328640	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0726-01A-01W-0372-09	TCGA-13-0726-10B-01W-0977-09	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	201415c2-5b5a-4bb8-8005-bf2c78d4d88e	df694f1a-e6a5-4c06-bf79-5fe57cfcba13	g.chr11:48328640A>T	ENST00000319988.1	+	1	866	c.866A>T	c.(865-867)aAc>aTc	p.N289I		NM_001004725.1	NP_001004725.1	Q8NGB4	OR4S1_HUMAN	olfactory receptor, family 4, subfamily S, member 1	289						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.N289I(1)		endometrium(1)|large_intestine(4)|lung(12)|ovary(1)|skin(3)	21						ACACTAAGGAACAACGATGTG	0.453																																																1	Substitution - Missense(1)	ovary(1)	11											96.0	88.0	91.0					11																	48328640		2201	4298	6499	48285216	SO:0001583	missense	256148			AB065908	CCDS31488.1	11p11.2	2012-08-09			ENSG00000176555	ENSG00000176555		"""GPCR / Class A : Olfactory receptors"""	14705	protein-coding gene	gene with protein product							Standard	NM_001004725		Approved		uc010rhu.2	Q8NGB4	OTTHUMG00000166578	ENST00000319988.1:c.866A>T	11.37:g.48328640A>T	ENSP00000321447:p.Asn289Ile		48285216	Q6IFB4	Missense_Mutation	SNP	-	p.N289I	ENST00000319988.1	37	c.866	CCDS31488.1	11	.	.	.	.	.	.	.	.	.	.	A	12.08	1.829255	0.32329	.	.	ENSG00000176555	ENST00000319988	T	0.48836	0.8	5.02	5.02	0.67125	.	.	.	.	.	T	0.76147	0.3947	H	0.94808	3.585	0.31676	N	0.643743	D	0.89917	1.0	D	0.76575	0.988	D	0.83439	0.0042	9	0.87932	D	0	.	12.9764	0.58540	1.0:0.0:0.0:0.0	.	289	Q8NGB4	OR4S1_HUMAN	I	289	ENSP00000321447:N289I	ENSP00000321447:N289I	N	+	2	0	OR4S1	48285216	0.970000	0.33590	0.379000	0.26080	0.079000	0.17450	2.445000	0.44899	2.020000	0.59435	0.533000	0.62120	AAC	-	NULL		0.453	OR4S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4S1	protein_coding	OTTHUMT00000390556.1	A	NM_001004725		48285216	1	no_errors	NM_001004725	genbank	human	provisional	54_36p	missense	SNP	0.33	T
MS4A1	931	genome.wustl.edu	37	11	60229852	60229852	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0726-01A-01W-0372-09	TCGA-13-0726-10B-01W-0977-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	201415c2-5b5a-4bb8-8005-bf2c78d4d88e	df694f1a-e6a5-4c06-bf79-5fe57cfcba13	g.chr11:60229852C>A	ENST00000534668.1	+	2	294	c.5C>A	c.(4-6)aCa>aAa	p.T2K	MS4A1_ENST00000528313.1_Missense_Mutation_p.T2K|MS4A1_ENST00000532073.1_Missense_Mutation_p.T2K|MS4A1_ENST00000534503.1_3'UTR|MS4A1_ENST00000389939.2_Missense_Mutation_p.T2K|MS4A1_ENST00000345732.4_Missense_Mutation_p.T2K	NM_152866.2	NP_690605.1	P11836	CD20_HUMAN	membrane-spanning 4-domains, subfamily A, member 1	2					B cell proliferation (GO:0042100)|humoral immune response (GO:0006959)	external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	MHC class II protein complex binding (GO:0023026)	p.T2K(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(10)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	24					Ibritumomab(DB00078)|Obinutuzumab(DB08935)|Rituximab(DB00073)|Tositumomab(DB00081)	AGCAAAATGACAACACCCAGA	0.403																																																1	Substitution - Missense(1)	ovary(1)	11											51.0	53.0	52.0					11																	60229852		2203	4300	6503	59986428	SO:0001583	missense	931			M27394	CCDS31570.1	11q12-q13.1	2014-09-17				ENSG00000156738		"""CD molecules"""	7315	protein-coding gene	gene with protein product		112210		CD20		2448768	Standard	NM_152866		Approved	B1, Bp35, MS4A2	uc001npq.3	P11836		ENST00000534668.1:c.5C>A	11.37:g.60229852C>A	ENSP00000433277:p.Thr2Lys		59986428	A6NMS4|B4DT24|P08984|Q13963	Missense_Mutation	SNP	HMMPfam_CD20	p.T2K	ENST00000534668.1	37	c.5	CCDS31570.1	11	.	.	.	.	.	.	.	.	.	.	C	8.030	0.761441	0.15914	.	.	ENSG00000156738	ENST00000524807;ENST00000345732;ENST00000532491;ENST00000532073;ENST00000534668;ENST00000528313;ENST00000389939	T;T;T;T	0.25085	2.42;1.82;2.42;2.42	5.13	1.13	0.20643	.	0.828632	0.11059	N	0.604183	T	0.25606	0.0623	L	0.34521	1.04	0.20403	N	0.9999	P;P;P;P	0.47762	0.9;0.845;0.845;0.845	P;B;B;B	0.49999	0.628;0.298;0.298;0.298	T	0.13176	-1.0519	10	0.62326	D	0.03	-28.6031	6.989	0.24745	0.0:0.6296:0.0:0.3704	.	2;2;2;2	B4DT24;E9PKH8;A8K803;P11836	.;.;.;CD20_HUMAN	K	2	ENSP00000314620:T2K;ENSP00000433519:T2K;ENSP00000433277:T2K;ENSP00000374589:T2K	ENSP00000314620:T2K	T	+	2	0	MS4A1	59986428	0.160000	0.22878	0.437000	0.26809	0.702000	0.40608	0.153000	0.16323	0.562000	0.29204	-0.136000	0.14681	ACA	-	NULL		0.403	MS4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MS4A1	protein_coding	OTTHUMT00000395402.1	C			59986428	1	no_errors	NM_021950	genbank	human	reviewed	54_36p	missense	SNP	0.98	A
RTN3	10313	genome.wustl.edu	37	11	63523611	63523611	+	Missense_Mutation	SNP	G	G	A	rs140229299	byFrequency	TCGA-13-0726-01A-01W-0372-09	TCGA-13-0726-10B-01W-0977-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	201415c2-5b5a-4bb8-8005-bf2c78d4d88e	df694f1a-e6a5-4c06-bf79-5fe57cfcba13	g.chr11:63523611G>A	ENST00000377819.5	+	8	3176	c.3022G>A	c.(3022-3024)Gcc>Acc	p.A1008T	RTN3_ENST00000354497.4_Silent_p.S126S|RTN3_ENST00000356000.3_Missense_Mutation_p.A231T|RTN3_ENST00000540798.1_Missense_Mutation_p.A896T|RTN3_ENST00000339997.4_Missense_Mutation_p.A989T|RTN3_ENST00000537981.1_Missense_Mutation_p.A212T|RTN3_ENST00000341307.2_Intron	NM_001265589.1	NP_001252518.1	O95197	RTN3_HUMAN	reticulon 3	1008	Interaction with FADD.|Reticulon. {ECO:0000255|PROSITE- ProRule:PRU00170}.				apoptotic process (GO:0006915)|endoplasmic reticulum tubular network organization (GO:0071786)|response to stress (GO:0006950)|vesicle-mediated transport (GO:0016192)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)		p.A989T(1)		cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|skin(1)|urinary_tract(1)	20						TGTTGGCATCGCCCGAGATCA	0.408																																																1	Substitution - Missense(1)	ovary(1)	11						G	THR/ALA,THR/ALA,THR/ALA,	0,4402		0,0,2201	202.0	176.0	185.0		634,2965,691,	4.4	1.0	11	dbSNP_134	185	3,8593	3.0+/-9.4	0,3,4295	yes	missense,missense,missense,intron	RTN3	NM_006054.2,NM_201428.1,NM_201429.1,NM_201430.1	58,58,58,	0,3,6496	AA,AG,GG		0.0349,0.0,0.0231	probably-damaging,probably-damaging,probably-damaging,	212/237,989/1014,231/256,	63523611	3,12995	2201	4298	6499	63280187	SO:0001583	missense	10313			AF059524	CCDS8048.1, CCDS8049.1, CCDS8050.1, CCDS41664.1, CCDS58141.1, CCDS58142.1, CCDS58143.1	11q13	2011-01-14			ENSG00000133318	ENSG00000133318			10469	protein-coding gene	gene with protein product	"""neuroendocrine-specific protein-like 2"", ""NSP-like protein II"", ""isoforme III"", ""ASY interacting protein"", ""homolog of ASY protein"""	604249				10331947	Standard	NM_006054		Approved	NSPL2, NSPLII, ASYIP, HAP, RTN3-A1	uc001nxq.3	O95197		ENST00000377819.5:c.3022G>A	11.37:g.63523611G>A	ENSP00000367050:p.Ala1008Thr		63280187	B3KQS2|B7Z308|B7Z4M0|F5H774|Q147U9|Q496K2|Q53GN3|Q59EP0|Q5UEP2|Q6T930|Q7RTM7|Q7RTM8|Q7RTN3	Missense_Mutation	SNP	HMMPfam_Reticulon	p.A989T	ENST00000377819.5	37	c.2965	CCDS58141.1	11	.	.	.	.	.	.	.	.	.	.	G	26.1	4.701249	0.88924	0.0	3.49E-4	ENSG00000133318	ENST00000356000;ENST00000377819;ENST00000339997;ENST00000540798;ENST00000537981	T;T;T;T;T	0.53423	0.62;0.62;0.62;0.62;0.62	5.28	4.36	0.52297	.	0.400023	0.26680	N	0.023041	T	0.56352	0.1979	L	0.53249	1.67	0.23923	N	0.996458	D;D;D;D;D	0.65815	0.991;0.987;0.988;0.984;0.995	P;P;P;P;P	0.57101	0.79;0.813;0.75;0.667;0.682	T	0.51474	-0.8701	10	0.66056	D	0.02	-0.6239	11.4294	0.50032	0.088:0.0:0.912:0.0	.	896;1008;212;989;231	F5H774;O95197;O95197-3;O95197-2;O95197-4	.;RTN3_HUMAN;.;.;.	T	231;1008;989;896;212	ENSP00000348279:A231T;ENSP00000367050:A1008T;ENSP00000344106:A989T;ENSP00000442733:A896T;ENSP00000440874:A212T	ENSP00000344106:A989T	A	+	1	0	RTN3	63280187	0.920000	0.31207	0.964000	0.40570	0.992000	0.81027	4.841000	0.62824	1.233000	0.43693	0.555000	0.69702	GCC	-	HMMPfam_Reticulon		0.408	RTN3-002	KNOWN	basic|CCDS	protein_coding	RTN3	protein_coding	OTTHUMT00000397846.1	G	NM_006054		63280187	1	no_errors	NM_201428	genbank	human	validated	54_36p	missense	SNP	0.66	A
RPS6KA4	8986	genome.wustl.edu	37	11	64129370	64129370	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0726-01A-01W-0372-09	TCGA-13-0726-10B-01W-0977-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	201415c2-5b5a-4bb8-8005-bf2c78d4d88e	df694f1a-e6a5-4c06-bf79-5fe57cfcba13	g.chr11:64129370G>A	ENST00000334205.4	+	8	867	c.802G>A	c.(802-804)Gtg>Atg	p.V268M	RPS6KA4_ENST00000294261.4_Missense_Mutation_p.V268M|RPS6KA4_ENST00000528057.1_Missense_Mutation_p.V268M	NM_003942.2	NP_003933.1	O75676	KS6A4_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 4	268	Protein kinase 1. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|histone H3-S10 phosphorylation (GO:0043987)|histone H3-S28 phosphorylation (GO:0043988)|histone phosphorylation (GO:0016572)|inflammatory response (GO:0006954)|interleukin-1-mediated signaling pathway (GO:0070498)|intracellular signal transduction (GO:0035556)|negative regulation of cytokine production (GO:0001818)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone phosphorylation (GO:0033129)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|mitogen-activated protein kinase p38 binding (GO:0048273)|protein serine/threonine kinase activity (GO:0004674)|ribosomal protein S6 kinase activity (GO:0004711)	p.V268M(1)		breast(1)|endometrium(3)|lung(7)|ovary(1)|prostate(1)	13						GATCGGGCCCGTGGCGCAGGA	0.667																																																1	Substitution - Missense(1)	ovary(1)	11											46.0	55.0	52.0					11																	64129370		2199	4292	6491	63885946	SO:0001583	missense	8986			AJ010119	CCDS8073.1, CCDS73313.1	11q11-q13	2011-04-05	2002-08-29		ENSG00000162302	ENSG00000162302			10433	protein-coding gene	gene with protein product		603606	"""ribosomal protein S6 kinase, 90kD, polypeptide 4"""			9792677, 9687510	Standard	XM_005274379		Approved	RSK-B, MSK2	uc001oae.3	O75676	OTTHUMG00000046094	ENST00000334205.4:c.802G>A	11.37:g.64129370G>A	ENSP00000333896:p.Val268Met		63885946	A8K7Z8|O75585|Q53ES8	Missense_Mutation	SNP	Pkinase;HMMPfam_Pkinase;Pkinase_C;HMMPfam_Pkinase_C;Protein kinase-like (PK-like);superfamily_Protein kinase-like (PK-like)	p.V268M	ENST00000334205.4	37	c.802	CCDS8073.1	11	.	.	.	.	.	.	.	.	.	.	N	13.43	2.236258	0.39498	.	.	ENSG00000162302	ENST00000528057;ENST00000334205;ENST00000294261;ENST00000530504	T;T;T;T	0.65364	-0.15;-0.15;-0.15;-0.15	4.01	4.01	0.46588	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.410893	0.23091	N	0.052029	T	0.57066	0.2028	L	0.43554	1.36	0.29624	N	0.845997	B;B;P;P	0.35780	0.413;0.311;0.52;0.465	B;B;B;B	0.39706	0.095;0.172;0.307;0.172	T	0.62803	-0.6777	10	0.87932	D	0	.	11.9849	0.53142	0.0:0.0:1.0:0.0	.	268;268;268;268	G3XAA9;E9PJN1;O75676;O75676-2	.;.;KS6A4_HUMAN;.	M	268;268;268;252	ENSP00000435580:V268M;ENSP00000333896:V268M;ENSP00000294261:V268M;ENSP00000432945:V252M	ENSP00000294261:V268M	V	+	1	0	RPS6KA4	63885946	0.695000	0.27747	0.995000	0.50966	0.890000	0.51754	0.973000	0.29422	1.942000	0.56320	0.511000	0.50034	GTG	-	HMMPfam_Pkinase		0.667	RPS6KA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPS6KA4	protein_coding	OTTHUMT00000106246.2	G	NM_003942		63885946	1	no_errors	NM_003942	genbank	human	reviewed	54_36p	missense	SNP	1	A
USP35	57558	genome.wustl.edu	37	11	77917031	77917031	+	Silent	SNP	C	C	G			TCGA-13-0726-01A-01W-0372-09	TCGA-13-0726-10B-01W-0977-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	201415c2-5b5a-4bb8-8005-bf2c78d4d88e	df694f1a-e6a5-4c06-bf79-5fe57cfcba13	g.chr11:77917031C>G	ENST00000529308.1	+	7	1602	c.1341C>G	c.(1339-1341)ggC>ggG	p.G447G	USP35_ENST00000530535.1_Intron|USP35_ENST00000530267.1_Silent_p.G15G|USP35_ENST00000526425.1_Silent_p.G178G|USP35_ENST00000441408.2_Missense_Mutation_p.A32G	NM_020798.2	NP_065849.1	Q9P2H5	UBP35_HUMAN	ubiquitin specific peptidase 35	447	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)	p.G447G(1)|p.G203G(1)		endometrium(6)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|prostate(3)|urinary_tract(1)	23	all_cancers(14;3.77e-18)|all_epithelial(13;6.16e-21)|Breast(9;5.6e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1.04e-25)			TCAACCTGGGCAACACATGCT	0.557																																																2	Substitution - coding silent(2)	ovary(2)	11											302.0	307.0	306.0					11																	77917031		2061	4181	6242	77594679	SO:0001819	synonymous_variant	57558			AB037793	CCDS41693.1	11q13.4	2008-02-05	2005-08-08			ENSG00000118369		"""Ubiquitin-specific peptidases"""	20061	protein-coding gene	gene with protein product			"""ubiquitin specific protease 35"""			12838346	Standard	NM_020798		Approved	KIAA1372	uc021qny.1	Q9P2H5		ENST00000529308.1:c.1341C>G	11.37:g.77917031C>G			77594679		Silent	SNP	-	p.G447	ENST00000529308.1	37	c.1341	CCDS41693.1	11	.	.	.	.	.	.	.	.	.	.	C	9.722	1.159833	0.21454	.	.	ENSG00000118369	ENST00000441408	T	0.13420	2.59	4.7	0.272	0.15645	.	.	.	.	.	T	0.10981	0.0268	.	.	.	0.23550	N	0.997436	B	0.17465	0.022	B	0.14578	0.011	T	0.29671	-1.0004	8	0.87932	D	0	-36.0128	9.5545	0.39330	0.5548:0.2472:0.198:0.0	.	32	E7EWV7	.	G	32	ENSP00000400825:A32G	ENSP00000400825:A32G	A	+	2	0	USP35	77594679	0.846000	0.29590	1.000000	0.80357	0.765000	0.43378	-0.052000	0.11865	0.175000	0.19841	-0.293000	0.09583	GCA	-	NULL		0.557	USP35-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	USP35	protein_coding	OTTHUMT00000390026.1	C	XM_290527		77594679	1	no_errors	NM_020798	genbank	human	validated	54_36p	silent	SNP	0.92	G
ATM	472	genome.wustl.edu	37	11	108153482	108153482	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0726-01A-01W-0372-09	TCGA-13-0726-10B-01W-0977-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	201415c2-5b5a-4bb8-8005-bf2c78d4d88e	df694f1a-e6a5-4c06-bf79-5fe57cfcba13	g.chr11:108153482G>C	ENST00000452508.2	+	26	3811	c.3622G>C	c.(3622-3624)Gac>Cac	p.D1208H	ATM_ENST00000278616.4_Missense_Mutation_p.D1208H			Q13315	ATM_HUMAN	ATM serine/threonine kinase	1208					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)	p.D1208H(1)		NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	ACGTTTAGAAGACTTTATGGC	0.274			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																												yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	1	Substitution - Missense(1)	ovary(1)	11											91.0	94.0	93.0					11																	108153482		2199	4293	6492	107658692	SO:0001583	missense	472	Familial Cancer Database	AT, Louis-Bar syndrome	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.3622G>C	11.37:g.108153482G>C	ENSP00000388058:p.Asp1208His		107658692	B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Missense_Mutation	SNP	superfamily_Protein kinase-like (PK-like);superfamily_ARM repeat;PI3_PI4_kinase;HMMPfam_PI3_PI4_kinase;FAT;HMMPfam_FAT;FATC;HMMPfam_FATC	p.D1208H	ENST00000452508.2	37	c.3622	CCDS31669.1	11	.	.	.	.	.	.	.	.	.	.	G	18.52	3.642246	0.67244	.	.	ENSG00000149311	ENST00000527805;ENST00000278616;ENST00000452508	T;T;T	0.75260	-0.92;-0.92;-0.92	5.38	5.38	0.77491	Armadillo-type fold (1);	0.270493	0.41097	D	0.000949	T	0.78110	0.4232	L	0.27053	0.805	0.34285	D	0.682581	D	0.76494	0.999	P	0.61132	0.884	D	0.84180	0.0439	10	0.66056	D	0.02	.	19.1226	0.93369	0.0:0.0:1.0:0.0	.	1208	Q13315	ATM_HUMAN	H	1208	ENSP00000435747:D1208H;ENSP00000278616:D1208H;ENSP00000388058:D1208H	ENSP00000278616:D1208H	D	+	1	0	ATM	107658692	1.000000	0.71417	0.998000	0.56505	0.954000	0.61252	5.143000	0.64826	2.544000	0.85801	0.591000	0.81541	GAC	-	NULL		0.274	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ATM	protein_coding	OTTHUMT00000389938.1	G	NM_000051		107658692	1	no_errors	NM_000051	genbank	human	reviewed	54_36p	missense	SNP	1	C
DYRK2	8445	genome.wustl.edu	37	12	68051876	68051876	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0726-01A-01W-0372-09	TCGA-13-0726-10B-01W-0977-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	201415c2-5b5a-4bb8-8005-bf2c78d4d88e	df694f1a-e6a5-4c06-bf79-5fe57cfcba13	g.chr12:68051876G>T	ENST00000344096.3	+	3	1602	c.1189G>T	c.(1189-1191)Gcc>Tcc	p.A397S	DYRK2_ENST00000393555.3_Missense_Mutation_p.A324S|RP11-335O4.3_ENST00000425371.2_RNA	NM_006482.2	NP_006473.2	Q92630	DYRK2_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2	397	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular response to DNA damage stimulus (GO:0006974)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|negative regulation of NFAT protein import into nucleus (GO:0051534)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of glycogen biosynthetic process (GO:0045725)|protein phosphorylation (GO:0006468)|smoothened signaling pathway (GO:0007224)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|ubiquitin ligase complex (GO:0000151)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|ubiquitin binding (GO:0043130)	p.A397S(1)		breast(2)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(7)|lung(6)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	30			Lung(24;6.81e-05)|LUAD - Lung adenocarcinoma(15;0.00107)|LUSC - Lung squamous cell carcinoma(43;0.196)	GBM - Glioblastoma multiforme(7;0.000573)		GATCCTTGGGGCCAGGTATGG	0.517																																																1	Substitution - Missense(1)	ovary(1)	12											73.0	68.0	69.0					12																	68051876		2203	4300	6503	66338143	SO:0001583	missense	8445			Y09216	CCDS8978.1, CCDS8979.1	12q15	2008-07-03				ENSG00000127334			3093	protein-coding gene	gene with protein product		603496				9748265	Standard	NM_003583		Approved		uc001str.4	Q92630		ENST00000344096.3:c.1189G>T	12.37:g.68051876G>T	ENSP00000342105:p.Ala397Ser		66338143	B2R9V9|Q9BRB5	Missense_Mutation	SNP	HMMPfam_Pkinase;superfamily_Protein kinase-like (PK-like)	p.A397S	ENST00000344096.3	37	c.1189	CCDS8978.1	12	.	.	.	.	.	.	.	.	.	.	G	9.505	1.104343	0.20632	.	.	ENSG00000127334	ENST00000344096;ENST00000393555	T;T	0.64260	-0.09;-0.09	5.05	5.05	0.67936	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.101148	0.64402	D	0.000002	T	0.43656	0.1257	N	0.05306	-0.075	0.58432	D	0.999999	B	0.06786	0.001	B	0.22601	0.04	T	0.31641	-0.9936	9	.	.	.	.	19.2898	0.94093	0.0:0.0:1.0:0.0	.	397	Q92630	DYRK2_HUMAN	S	397;324	ENSP00000342105:A397S;ENSP00000377186:A324S	.	A	+	1	0	DYRK2	66338143	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	3.716000	0.54904	2.736000	0.93811	0.305000	0.20034	GCC	-	HMMPfam_Pkinase		0.517	DYRK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DYRK2	protein_coding	OTTHUMT00000402218.1	G			66338143	1	no_errors	NM_006482	genbank	human	reviewed	54_36p	missense	SNP	1	T
TRPC4	7223	genome.wustl.edu	37	13	38225424	38225424	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0726-01A-01W-0372-09	TCGA-13-0726-10B-01W-0977-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	201415c2-5b5a-4bb8-8005-bf2c78d4d88e	df694f1a-e6a5-4c06-bf79-5fe57cfcba13	g.chr13:38225424G>T	ENST00000379705.3	-	8	2914	c.2057C>A	c.(2056-2058)cCa>cAa	p.P686Q	TRPC4_ENST00000447043.1_Missense_Mutation_p.P686Q|TRPC4_ENST00000379681.3_Missense_Mutation_p.P686Q|TRPC4_ENST00000355779.2_Missense_Mutation_p.P686Q|TRPC4_ENST00000358477.2_Missense_Mutation_p.P686Q|TRPC4_ENST00000426868.2_3'UTR|TRPC4_ENST00000338947.5_Missense_Mutation_p.P513Q|TRPC4_ENST00000379673.2_Intron|TRPC4_ENST00000379679.1_Missense_Mutation_p.P513Q			Q9UBN4	TRPC4_HUMAN	transient receptor potential cation channel, subfamily C, member 4	686	Binds to ITPR1, ITPR2 and ITPR3.				axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|gamma-aminobutyric acid secretion (GO:0014051)|ion transmembrane transport (GO:0034220)|oligodendrocyte differentiation (GO:0048709)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|calcium channel complex (GO:0034704)|caveola (GO:0005901)|cell surface (GO:0009986)|cortical cytoskeleton (GO:0030863)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)	p.P686Q(1)		NS(2)|breast(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(26)|lung(30)|ovary(4)|prostate(1)|skin(4)|urinary_tract(2)	83				all cancers(112;1.92e-08)|Epithelial(112;5.04e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000677)|GBM - Glioblastoma multiforme(144;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0126)		AAAACTTTCTGGCTTTCTTCT	0.373																																																1	Substitution - Missense(1)	ovary(1)	13											144.0	140.0	141.0					13																	38225424		2203	4300	6503	37123424	SO:0001583	missense	7223			U40983	CCDS9365.1, CCDS45035.1, CCDS45036.1, CCDS45038.1, CCDS45039.1	13q13.3	2013-01-10			ENSG00000133107	ENSG00000133107		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	12336	protein-coding gene	gene with protein product		603651				8646775, 16382100	Standard	NM_016179		Approved	HTRP4, TRP4	uc010abx.3	Q9UBN4	OTTHUMG00000016752	ENST00000379705.3:c.2057C>A	13.37:g.38225424G>T	ENSP00000369027:p.Pro686Gln		37123424	B1ALE0|B1ALE1|B1ALE2|Q15721|Q3SWS6|Q96P03|Q96P04|Q96P05|Q9UIB0|Q9UIB1|Q9UIB2	Missense_Mutation	SNP	-	p.P686Q	ENST00000379705.3	37	c.2057	CCDS9365.1	13	.	.	.	.	.	.	.	.	.	.	G	15.48	2.847004	0.51164	.	.	ENSG00000133107	ENST00000379705;ENST00000379681;ENST00000338947;ENST00000379679;ENST00000355779;ENST00000358477;ENST00000447043	D;T;D;D;D;D;D	0.83163	-1.69;-1.19;-1.69;-1.69;-1.69;-1.69;-1.69	5.7	5.7	0.88788	.	0.215828	0.49916	D	0.000127	T	0.78304	0.4262	L	0.31804	0.96	0.80722	D	1	B;P;P;B;B	0.43701	0.418;0.815;0.672;0.027;0.415	B;B;P;B;B	0.44518	0.138;0.316;0.452;0.022;0.174	T	0.73723	-0.3893	10	0.10902	T	0.67	-21.0925	19.8336	0.96646	0.0:0.0:1.0:0.0	.	686;686;513;686;686	Q9UBN4-3;Q9UBN4-5;Q9UBN4-6;Q9UBN4-2;Q9UBN4	.;.;.;.;TRPC4_HUMAN	Q	686;686;513;513;686;686;686	ENSP00000369027:P686Q;ENSP00000369003:P686Q;ENSP00000342580:P513Q;ENSP00000369001:P513Q;ENSP00000348025:P686Q;ENSP00000351264:P686Q;ENSP00000414316:P686Q	ENSP00000342580:P513Q	P	-	2	0	TRPC4	37123424	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.179000	0.58290	2.701000	0.92244	0.561000	0.74099	CCA	-	NULL		0.373	TRPC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPC4	protein_coding	OTTHUMT00000044574.2	G	NM_003306		37123424	-1	no_errors	NM_016179	genbank	human	validated	54_36p	missense	SNP	1	T
SLC38A6	145389	genome.wustl.edu	37	14	61545645	61545645	+	Splice_Site	SNP	G	G	C			TCGA-13-0726-01A-01W-0372-09	TCGA-13-0726-10B-01W-0977-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_III	Capture	454_PCR_WGA		dbGAP	Illumina GAIIx	201415c2-5b5a-4bb8-8005-bf2c78d4d88e	df694f1a-e6a5-4c06-bf79-5fe57cfcba13	g.chr14:61545645G>C	ENST00000354886.2	+	16	1572	c.1408G>C	c.(1408-1410)Gga>Cga	p.G470R	SLC38A6_ENST00000456840.2_Splice_Site_p.E447Q	NM_001172702.1	NP_001166173.1	Q8IZM9	S38A6_HUMAN	solute carrier family 38, member 6	0					amino acid transport (GO:0006865)|sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)		p.G470R(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|liver(2)|lung(5)|ovary(1)|skin(3)|stomach(1)|urinary_tract(1)	21				OV - Ovarian serous cystadenocarcinoma(108;0.0981)		tgagactacaggtatgcgcca	0.532																																																1	Substitution - Missense(1)	ovary(1)	14																																								60615398	SO:0001630	splice_region_variant	145389			AF070578	CCDS9751.1, CCDS53900.1	14q23.1	2013-05-22			ENSG00000139974	ENSG00000139974		"""Solute carriers"""	19863	protein-coding gene	gene with protein product							Standard	NM_153811		Approved	NAT-1	uc001xfh.2	Q8IZM9	OTTHUMG00000140335	ENST00000354886.2:c.1408+1G>C	14.37:g.61545645G>C			60615398	C9JWA6|Q86SY5	Missense_Mutation	SNP	HMMPfam_Aa_trans	p.G470R	ENST00000354886.2	37	c.1408	CCDS53900.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	3.812|3.812	-0.039526|-0.039526	0.07497|0.07497	.|.	.|.	ENSG00000139974|ENSG00000139974	ENST00000456840|ENST00000354886;ENST00000451406	T|T;T	0.14144|0.24151	2.53|1.87;1.87	0.225|0.225	0.225|0.225	0.15325|0.15325	.|.	.|1.932510	.|0.03092	.|N	.|0.159967	T|T	0.29652|0.29652	0.0740|0.0740	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	P|D	0.39094|0.69078	0.659|0.997	B|D	0.42959|0.72982	0.403|0.979	T|T	0.35500|0.35500	-0.9786|-0.9786	8|9	0.35671|0.59425	T|D	0.21|0.04	.|.	.|.	.|.	.|.	.|.	447|470	E7ETF2|Q8IZM9-2	.|.	Q|R	447|470;465	ENSP00000413863:E447Q|ENSP00000346959:G470R;ENSP00000395851:G465R	ENSP00000413863:E447Q|ENSP00000346959:G470R	E|G	+|+	1|1	0|0	SLC38A6|SLC38A6	60615398|60615398	0.010000|0.010000	0.17322|0.17322	0.011000|0.011000	0.14972|0.14972	0.011000|0.011000	0.07611|0.07611	0.364000|0.364000	0.20325|0.20325	0.300000|0.300000	0.22699|0.22699	0.305000|0.305000	0.20034|0.20034	GAA|GGA	-	NULL		0.532	SLC38A6-201	KNOWN	basic|CCDS	protein_coding	SLC38A6	protein_coding		G		Missense_Mutation	60615398	1	no_errors	ENST00000354886	ensembl	human	known	54_36p	missense	SNP		C
GPR132	29933	genome.wustl.edu	37	14	105518008	105518008	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0726-01A-01W-0372-09	TCGA-13-0726-10B-01W-0977-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	201415c2-5b5a-4bb8-8005-bf2c78d4d88e	df694f1a-e6a5-4c06-bf79-5fe57cfcba13	g.chr14:105518008G>A	ENST00000329797.3	-	4	1377	c.466C>T	c.(466-468)Cgg>Tgg	p.R156W	GPR132_ENST00000539291.2_Missense_Mutation_p.R156W|GPR132_ENST00000546679.1_5'UTR|GPR132_ENST00000392585.2_Missense_Mutation_p.R147W	NM_001278694.1|NM_001278696.1|NM_013345.2	NP_001265623.1|NP_001265625.1|NP_037477.1	Q9UNW8	GP132_HUMAN	G protein-coupled receptor 132	156	Poly-Arg.				G1/S transition of mitotic cell cycle (GO:0000082)|response to stress (GO:0006950)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.R156W(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(3)|stomach(1)|upper_aerodigestive_tract(1)	18		all_cancers(154;0.0953)|Melanoma(154;0.155)|all_epithelial(191;0.219)	OV - Ovarian serous cystadenocarcinoma(23;0.00778)|all cancers(16;0.00936)|Epithelial(46;0.0227)	Epithelial(152;0.02)|all cancers(159;0.0419)|OV - Ovarian serous cystadenocarcinoma(161;0.0521)		GCGGTCCTCCGGCGGCGGCGG	0.612																																																1	Substitution - Missense(1)	ovary(1)	14											59.0	56.0	57.0					14																	105518008		2203	4300	6503	104589053	SO:0001583	missense	29933			AF083955	CCDS9997.1, CCDS61567.1	14q32.3	2012-08-21			ENSG00000183484	ENSG00000183484		"""GPCR / Class A : Orphans"""	17482	protein-coding gene	gene with protein product	"""G2 accumulation"""	606167				12086852	Standard	NM_013345		Approved	G2A	uc001yqd.3	Q9UNW8	OTTHUMG00000140173	ENST00000329797.3:c.466C>T	14.37:g.105518008G>A	ENSP00000328818:p.Arg156Trp		104589053	A8K7X7|B4E144|Q9BSU2	Missense_Mutation	SNP	-	p.R156W	ENST00000329797.3	37	c.466	CCDS9997.1	14	.	.	.	.	.	.	.	.	.	.	G	14.92	2.680597	0.47886	.	.	ENSG00000183484	ENST00000329797;ENST00000392585;ENST00000539291	T;T;T	0.73152	-0.72;-0.72;-0.72	4.97	4.97	0.65823	GPCR, rhodopsin-like superfamily (1);	1.334730	0.04858	N	0.443579	T	0.76772	0.4034	L	0.54965	1.715	0.09310	N	1	P;P	0.52316	0.845;0.952	P;P	0.46975	0.533;0.533	T	0.69599	-0.5102	10	0.66056	D	0.02	.	17.2051	0.86915	0.0:0.0:1.0:0.0	.	147;156	B4E144;Q9UNW8	.;GP132_HUMAN	W	156;147;156	ENSP00000328818:R156W;ENSP00000376364:R147W;ENSP00000438094:R156W	ENSP00000328818:R156W	R	-	1	2	GPR132	104589053	0.225000	0.23685	0.266000	0.24541	0.270000	0.26580	3.499000	0.53310	2.283000	0.76528	0.563000	0.77884	CGG	-	NULL		0.612	GPR132-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR132	protein_coding	OTTHUMT00000409278.1	G	NM_013345		104589053	-1	no_errors	NM_013345	genbank	human	reviewed	54_36p	missense	SNP		A
TMEM87A	25963	genome.wustl.edu	37	15	42529628	42529628	+	Splice_Site	SNP	A	A	T			TCGA-13-0726-01A-01W-0372-09	TCGA-13-0726-10B-01W-0977-09	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	201415c2-5b5a-4bb8-8005-bf2c78d4d88e	df694f1a-e6a5-4c06-bf79-5fe57cfcba13	g.chr15:42529628A>T	ENST00000389834.4	-	9	1133		c.e9+1		TMEM87A_ENST00000448392.1_Splice_Site	NM_015497.3	NP_056312.2	Q8NBN3	TM87A_HUMAN	transmembrane protein 87A							integral component of membrane (GO:0016021)		p.?(1)		breast(1)|endometrium(4)|kidney(4)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	24		all_cancers(109;4.28e-16)|all_epithelial(112;1.04e-14)|Lung NSC(122;5.01e-09)|all_lung(180;2.24e-08)|Melanoma(134;0.0574)|Colorectal(260;0.152)		GBM - Glioblastoma multiforme(94;1.03e-06)		CTGGTTACTTACCAGATTCTC	0.398																																																1	Unknown(1)	ovary(1)	15											103.0	93.0	96.0					15																	42529628		2203	4299	6502	40316920	SO:0001630	splice_region_variant	25963			AF132733	CCDS32205.1, CCDS45243.1, CCDS66742.1	15q15.1	2005-10-30				ENSG00000103978			24522	protein-coding gene	gene with protein product						12477932	Standard	XM_005254287		Approved	DKFZP564G2022	uc021sjr.1	Q8NBN3		ENST00000389834.4:c.868+1T>A	15.37:g.42529628A>T			40316920	Q6NT77|Q8NCA4|Q9BS46|Q9P103|Q9Y3Y7	Splice_Site	SNP	-	e9+2	ENST00000389834.4	37	c.868+2	CCDS32205.1	15	.	.	.	.	.	.	.	.	.	.	A	20.9	4.071916	0.76301	.	.	ENSG00000103978	ENST00000389834;ENST00000448392;ENST00000535305	.	.	.	5.7	5.7	0.88788	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.953	0.79859	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TMEM87A	40316920	1.000000	0.71417	1.000000	0.80357	0.903000	0.53119	9.339000	0.96797	2.174000	0.68829	0.383000	0.25322	.	-	-		0.398	TMEM87A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	TMEM87A	protein_coding	OTTHUMT00000420482.2	A	NM_015497	Intron	40316920	-1	no_errors	NM_015497	genbank	human	validated	54_36p	splice_site	SNP	1	T
TUBGCP4	27229	genome.wustl.edu	37	15	43672342	43672342	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0726-01A-01W-0372-09	TCGA-13-0726-10B-01W-0977-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	201415c2-5b5a-4bb8-8005-bf2c78d4d88e	df694f1a-e6a5-4c06-bf79-5fe57cfcba13	g.chr15:43672342G>A	ENST00000260383.7	+	6	756	c.502G>A	c.(502-504)Gtt>Att	p.V168I	TUBGCP4_ENST00000564079.1_Missense_Mutation_p.V168I|TUBGCP4_ENST00000399460.3_Missense_Mutation_p.V32I			Q9UGJ1	GCP4_HUMAN	tubulin, gamma complex associated protein 4	168					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)|protein complex assembly (GO:0006461)	centrosome (GO:0005813)|cytosol (GO:0005829)|gamma-tubulin ring complex (GO:0008274)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|spindle pole (GO:0000922)	structural constituent of cytoskeleton (GO:0005200)	p.V168I(1)		breast(1)|cervix(2)|endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(4)|prostate(2)|upper_aerodigestive_tract(2)	21		all_cancers(109;1.27e-10)|all_epithelial(112;4.82e-09)|Lung NSC(122;1.72e-06)|all_lung(180;1.59e-05)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;3.53e-07)		GTTGCCTCCTGTTCGAAGTGC	0.438																																																1	Substitution - Missense(1)	ovary(1)	15											84.0	86.0	85.0					15																	43672342		1892	4106	5998	41459634	SO:0001583	missense	27229			AJ249677	CCDS42030.1, CCDS66745.1	15q15.3	2014-08-12			ENSG00000137822	ENSG00000137822			16691	protein-coding gene	gene with protein product		609610				10562286	Standard	NM_001286414		Approved	76P, FLJ14797	uc001zrn.3	Q9UGJ1	OTTHUMG00000176647	ENST00000260383.7:c.502G>A	15.37:g.43672342G>A	ENSP00000260383:p.Val168Ile		41459634	B3KNK6|Q969X3|Q9NVF0	Missense_Mutation	SNP	-	p.V168I	ENST00000260383.7	37	c.502		15	.	.	.	.	.	.	.	.	.	.	G	21.0	4.087850	0.76642	.	.	ENSG00000137822	ENST00000260383;ENST00000399460	T;T	0.07567	3.18;3.18	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	T	0.10680	0.0261	L	0.37507	1.11	0.58432	D	0.999999	B;B	0.27264	0.173;0.069	B;B	0.31101	0.124;0.076	T	0.16453	-1.0402	10	0.33940	T	0.23	-19.4403	19.2318	0.93843	0.0:0.0:1.0:0.0	.	168;168	Q9UGJ1;Q9UGJ1-2	GCP4_HUMAN;.	I	168;32	ENSP00000260383:V168I;ENSP00000382387:V32I	ENSP00000260383:V168I	V	+	1	0	TUBGCP4	41459634	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.388000	0.97237	2.865000	0.98341	0.655000	0.94253	GTT	-	NULL		0.438	TUBGCP4-001	KNOWN	basic|appris_candidate_longest	protein_coding	TUBGCP4	protein_coding	OTTHUMT00000432970.1	G	NM_014444		41459634	1	no_errors	NM_014444	genbank	human	provisional	54_36p	missense	SNP	1	A
TCF12	6938	genome.wustl.edu	37	15	57356019	57356019	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0726-01A-01W-0372-09	TCGA-13-0726-10B-01W-0977-09	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	201415c2-5b5a-4bb8-8005-bf2c78d4d88e	df694f1a-e6a5-4c06-bf79-5fe57cfcba13	g.chr15:57356019A>G	ENST00000267811.5	+	4	524	c.220A>G	c.(220-222)Aga>Gga	p.R74G	TCF12_ENST00000557843.1_Missense_Mutation_p.R74G|TCF12_ENST00000333725.5_Missense_Mutation_p.R74G|TCF12_ENST00000438423.2_Missense_Mutation_p.R74G|TCF12_ENST00000452095.2_Intron	NM_003205.3|NM_207038.1	NP_003196.1|NP_996921.1	Q99081	HTF4_HUMAN	transcription factor 12	74					immune response (GO:0006955)|muscle organ development (GO:0007517)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	bHLH transcription factor binding (GO:0043425)|E-box binding (GO:0070888)|enhancer binding (GO:0035326)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SMAD binding (GO:0046332)|transcription factor binding (GO:0008134)	p.R74G(1)	TCF12/NR4A3(2)	breast(2)|central_nervous_system(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(1)|lung(13)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	36		Colorectal(260;0.0907)		all cancers(107;0.000313)|GBM - Glioblastoma multiforme(80;0.00878)|STAD - Stomach adenocarcinoma(283;0.239)		TGATTCATCTAGAGTAAGTTT	0.323			T	TEC	extraskeletal myxoid chondrosarcoma																																		Dom	yes		15	15q21	6938	"""transcription factor 12 (HTF4, helix-loop-helix transcription factors 4)"""		M	1	Substitution - Missense(1)	ovary(1)	15											145.0	140.0	142.0					15																	57356019		2192	4292	6484	55143311	SO:0001583	missense	6938			BC050556	CCDS10159.1, CCDS10160.1, CCDS42042.1	15q21	2013-05-21	2008-07-31		ENSG00000140262	ENSG00000140262		"""Basic helix-loop-helix proteins"""	11623	protein-coding gene	gene with protein product	"""helix-loop-helix transcription factor 4"""	600480				1886779	Standard	NM_003205		Approved	HEB, HTF4, HsT17266, bHLHb20	uc002aeb.3	Q99081	OTTHUMG00000132047	ENST00000267811.5:c.220A>G	15.37:g.57356019A>G	ENSP00000267811:p.Arg74Gly		55143311	Q7Z3D9|Q86TC1|Q86VM2	Missense_Mutation	SNP	HLH;HMMPfam_HLH;HLH helix-loop-helix DNA-binding domain;superfamily_HLH helix-loop-helix DNA-binding domain	p.R74G	ENST00000267811.5	37	c.220	CCDS10159.1	15	.	.	.	.	.	.	.	.	.	.	A	17.68	3.450094	0.63290	.	.	ENSG00000140262	ENST00000543236;ENST00000267811;ENST00000438423;ENST00000333725	T;T;T	0.52526	0.66;0.66;0.66	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	T	0.66396	0.2785	M	0.72353	2.195	0.80722	D	1	D;D;D	0.57899	0.981;0.967;0.981	D;P;D	0.69142	0.962;0.879;0.943	T	0.69614	-0.5098	10	0.66056	D	0.02	-14.6528	13.5407	0.61672	1.0:0.0:0.0:0.0	.	126;74;74	F5H6Z6;Q99081;Q99081-3	.;HTF4_HUMAN;.	G	126;74;74;74	ENSP00000267811:R74G;ENSP00000388940:R74G;ENSP00000331057:R74G	ENSP00000267811:R74G	R	+	1	2	TCF12	55143311	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.126000	0.57937	2.130000	0.65690	0.477000	0.44152	AGA	-	NULL		0.323	TCF12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	TCF12	protein_coding	OTTHUMT00000255069.3	A	NM_003205		55143311	1	no_errors	NM_207036	genbank	human	reviewed	54_36p	missense	SNP	1	G
OR4F6	390648	genome.wustl.edu	37	15	102346250	102346250	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0726-01A-01W-0372-09	TCGA-13-0726-10B-01W-0977-09	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	201415c2-5b5a-4bb8-8005-bf2c78d4d88e	df694f1a-e6a5-4c06-bf79-5fe57cfcba13	g.chr15:102346250A>T	ENST00000328882.4	+	1	349	c.328A>T	c.(328-330)Act>Tct	p.T110S		NM_001005326.1	NP_001005326.1	Q8NGB9	OR4F6_HUMAN	olfactory receptor, family 4, subfamily F, member 6	110						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T110S(1)		breast(1)|large_intestine(1)|lung(16)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	22	Lung NSC(78;0.000991)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.00039)|Lung(145;0.17)|LUSC - Lung squamous cell carcinoma(107;0.187)			AGTTGGGGGAACTGAGATGGT	0.468																																																1	Substitution - Missense(1)	ovary(1)	15											206.0	187.0	194.0					15																	102346250		2203	4300	6503	100163773	SO:0001583	missense	390648			AC025234	CCDS32341.1	15q26.3	2014-02-19	2002-02-28		ENSG00000184140	ENSG00000184140		"""GPCR / Class A : Olfactory receptors"""	15372	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily F, member 12"""	OR4F12			Standard	NM_001005326		Approved		uc010utr.2	Q8NGB9	OTTHUMG00000172267	ENST00000328882.4:c.328A>T	15.37:g.102346250A>T	ENSP00000327525:p.Thr110Ser		100163773	B9EH28|Q6IF95	Missense_Mutation	SNP	-	p.T110S	ENST00000328882.4	37	c.328	CCDS32341.1	15	.	.	.	.	.	.	.	.	.	.	.	0.014	-1.598831	0.00857	.	.	ENSG00000184140	ENST00000328882	T	0.01725	4.67	4.78	-2.47	0.06442	GPCR, rhodopsin-like superfamily (1);	0.636179	0.14709	N	0.303071	T	0.01156	0.0038	N	0.25332	0.735	0.09310	N	1	B	0.18310	0.027	B	0.19946	0.027	T	0.48779	-0.9005	10	0.08599	T	0.76	.	6.2777	0.20989	0.4908:0.1353:0.3739:0.0	.	110	Q8NGB9	OR4F6_HUMAN	S	110	ENSP00000327525:T110S	ENSP00000327525:T110S	T	+	1	0	OR4F6	100163773	0.000000	0.05858	0.000000	0.03702	0.146000	0.21551	-0.669000	0.05262	-0.401000	0.07644	0.482000	0.46254	ACT	-	NULL		0.468	OR4F6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4F6	protein_coding	OTTHUMT00000417593.1	A			100163773	1	no_errors	NM_001005326	genbank	human	provisional	54_36p	missense	SNP		T
AC090954.1	0	genome.wustl.edu	37	3	15175487	15175487	+	RNA	SNP	A	A	G			TCGA-13-0726-01A-01W-0372-09	TCGA-13-0726-10B-01W-0977-09	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	201415c2-5b5a-4bb8-8005-bf2c78d4d88e	df694f1a-e6a5-4c06-bf79-5fe57cfcba13	g.chr3:15175487A>G	ENST00000408497.1	-	0	148																											GAATCCTTGAAAATATTCAAG	0.423																																																0			3																																								15150491			100130646																															3.37:g.15175487A>G			15150491		RNA	SNP	-	NULL	ENST00000408497.1	37	NULL		3																																																																																			-	-		0.423	AC090954.1-201	NOVEL	basic	miRNA	LOC100130646	miRNA		A			15150491	-1	pseudogene	XR_038601	genbank	human	model	54_36p	rna	SNP	0.005	G
NLRC5	84166	genome.wustl.edu	37	16	57070034	57070034	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0726-01A-01W-0372-09	TCGA-13-0726-10B-01W-0977-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	201415c2-5b5a-4bb8-8005-bf2c78d4d88e	df694f1a-e6a5-4c06-bf79-5fe57cfcba13	g.chr16:57070034G>A	ENST00000262510.6	+	14	2875	c.2650G>A	c.(2650-2652)Gat>Aat	p.D884N	NLRC5_ENST00000308149.7_Missense_Mutation_p.D884N|NLRC5_ENST00000539144.1_Missense_Mutation_p.D884N|NLRC5_ENST00000436936.1_Missense_Mutation_p.D884N	NM_032206.4	NP_115582.4	Q86WI3	NLRC5_HUMAN	NLR family, CARD domain containing 5	884					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)|positive regulation of interferon-gamma-mediated signaling pathway (GO:0060335)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of kinase activity (GO:0043549)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)	p.D884N(1)		NS(2)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(21)|ovary(8)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	75		all_neural(199;0.225)				CCAGCTGGAAGATGAAGGCTG	0.607																																																1	Substitution - Missense(1)	ovary(1)	16											54.0	50.0	51.0					16																	57070034		2198	4300	6498	55627535	SO:0001583	missense	84166			AF389420	CCDS10773.1	16q13	2008-02-05			ENSG00000140853	ENSG00000140853		"""Nucleotide-binding domain and leucine rich repeat containing"""	29933	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 5"", ""NOD-like receptor C5"""	613537				12615073	Standard	NM_032206		Approved	NOD27, CLR16.1, FLJ21709	uc021tiu.1	Q86WI3	OTTHUMG00000133470	ENST00000262510.6:c.2650G>A	16.37:g.57070034G>A	ENSP00000262510:p.Asp884Asn		55627535	B5MEF1|C9JMD8|Q6P4A6|Q86VM7|Q8NF42|Q8TEE2|Q8TEJ1|Q969L7	Missense_Mutation	SNP	HMMPfam_LRR_1;HMMPfam_NACHT;superfamily_RNI-like;superfamily_P-loop containing nucleoside triphosphate hydrolases	p.D884N	ENST00000262510.6	37	c.2650	CCDS10773.1	16	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.3|22.3	4.273351|4.273351	0.80580|0.80580	.|.	.|.	ENSG00000140853|ENSG00000140853	ENST00000262510;ENST00000308149;ENST00000436936;ENST00000327982;ENST00000539144;ENST00000538110;ENST00000543030|ENST00000538805	T;T;T;T;T;T|.	0.70399|.	0.36;0.36;0.36;0.36;0.36;-0.48|.	5.08|5.08	4.12|4.12	0.48240|0.48240	.|.	0.222353|.	0.22757|.	N|.	0.056012|.	T|T	0.62417|0.62417	0.2426|0.2426	M|M	0.83953|0.83953	2.67|2.67	0.25387|0.25387	N|N	0.98857|0.98857	D;D;P;D|.	0.89917|.	1.0;0.998;0.918;0.998|.	D;D;P;D|.	0.81914|.	0.995;0.985;0.896;0.982|.	T|T	0.56288|0.56288	-0.8004|-0.8004	10|5	0.54805|.	T|.	0.06|.	.|.	11.1888|11.1888	0.48673|0.48673	0.0847:0.0:0.9153:0.0|0.0847:0.0:0.9153:0.0	.|.	884;884;884;884|.	Q86WI3-5;Q86WI3-4;Q86WI3-6;Q86WI3|.	.;.;.;NLRC5_HUMAN|.	N|K	884;884;884;358;884;391;183|636	ENSP00000262510:D884N;ENSP00000308886:D884N;ENSP00000389739:D884N;ENSP00000441727:D884N;ENSP00000441597:D391N;ENSP00000440153:D183N|.	ENSP00000262510:D884N|.	D|R	+|+	1|2	0|0	NLRC5|NLRC5	55627535|55627535	1.000000|1.000000	0.71417|0.71417	0.586000|0.586000	0.28679|0.28679	0.959000|0.959000	0.62525|0.62525	3.160000|3.160000	0.50739|0.50739	1.375000|1.375000	0.46248|0.46248	0.561000|0.561000	0.74099|0.74099	GAT|AGA	-	HMMPfam_LRR_1		0.607	NLRC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRC5	protein_coding	OTTHUMT00000257346.1	G	NM_032206		55627535	1	no_errors	NM_032206	genbank	human	validated	54_36p	missense	SNP	0.98	A
CDC27	996	genome.wustl.edu	37	17	45221247	45221247	+	Splice_Site	SNP	A	A	G	rs75932008		TCGA-13-0726-01A-01W-0372-09	TCGA-13-0726-10B-01W-0977-09	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	201415c2-5b5a-4bb8-8005-bf2c78d4d88e	df694f1a-e6a5-4c06-bf79-5fe57cfcba13	g.chr17:45221247A>G	ENST00000066544.3	-	10	1264		c.e10+1		CDC27_ENST00000531206.1_Splice_Site|CDC27_ENST00000446365.2_Splice_Site|CDC27_ENST00000527547.1_Splice_Site	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)	p.?(1)		NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						TCTTTAAATTACCTTGGTTGT	0.403																																																1	Unknown(1)	ovary(1)	17											41.0	41.0	41.0					17																	45221247		2203	4300	6503	42576246	SO:0001630	splice_region_variant	996			U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.1170+1T>C	17.37:g.45221247A>G			42576246	G3V1C4|Q16349|Q96F35	Splice_Site	SNP	-	e10+2	ENST00000066544.3	37	c.1170+2	CCDS11509.1	17	.	.	.	.	.	.	.	.	.	.	A	21.5	4.157642	0.78114	.	.	ENSG00000004897	ENST00000066544;ENST00000531206;ENST00000446365;ENST00000527547	.	.	.	4.02	4.02	0.46733	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.6198	0.39714	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CDC27	42576246	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.228000	0.95250	2.048000	0.60808	0.374000	0.22700	.	-	-		0.403	CDC27-001	KNOWN	basic|CCDS	protein_coding	CDC27	protein_coding	OTTHUMT00000389742.2	A		Intron	42576246	-1	no_errors	NM_001256	genbank	human	reviewed	54_36p	splice_site	SNP	1	G
KAT7	11143	genome.wustl.edu	37	17	47893247	47893247	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0726-01A-01W-0372-09	TCGA-13-0726-10B-01W-0977-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	201415c2-5b5a-4bb8-8005-bf2c78d4d88e	df694f1a-e6a5-4c06-bf79-5fe57cfcba13	g.chr17:47893247G>C	ENST00000259021.4	+	8	1215	c.935G>C	c.(934-936)aGa>aCa	p.R312T	KAT7_ENST00000509773.1_Missense_Mutation_p.R202T|KAT7_ENST00000424009.2_Missense_Mutation_p.R282T|KAT7_ENST00000510819.1_Missense_Mutation_p.R143T|KAT7_ENST00000435742.2_Missense_Mutation_p.R126T|KAT7_ENST00000454930.2_Missense_Mutation_p.R173T|KAT7_ENST00000513980.1_3'UTR|KAT7_ENST00000503935.2_Missense_Mutation_p.R156T	NM_007067.4	NP_008998.1	O95251	KAT7_HUMAN	K(lysine) acetyltransferase 7	312					chromatin organization (GO:0006325)|DNA replication (GO:0006260)|histone H3 acetylation (GO:0043966)|histone H4-K12 acetylation (GO:0043983)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.R312T(1)									CTTTTCCGAAGAGCACAAGCC	0.458																																																1	Substitution - Missense(1)	ovary(1)	17											76.0	76.0	76.0					17																	47893247		2203	4300	6503	45248246	SO:0001583	missense	11143			AF074606	CCDS11554.1, CCDS56035.1, CCDS56036.1, CCDS56037.1, CCDS56038.1	17q21.32	2013-01-10	2011-07-21	2011-07-21	ENSG00000136504	ENSG00000136504	2.3.1.48	"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"""	17016	protein-coding gene	gene with protein product	"""histone acetyltransferase binding to ORC1"""	609880	"""MYST histone acetyltransferase 2"""	MYST2		10438470, 10930412	Standard	NM_001199155		Approved	HBOA, HBO1, ZC2HC7	uc002ipm.3	O95251	OTTHUMG00000161770	ENST00000259021.4:c.935G>C	17.37:g.47893247G>C	ENSP00000259021:p.Arg312Thr		45248246	B3KN74|B4DF85|B4DFB4|B4DFE0|B4DGY4|E7ER15|G5E9K7	Missense_Mutation	SNP	HMMPfam_zf-C2HC;HMMPfam_MOZ_SAS;superfamily_CCHHC domain;superfamily_Acyl-CoA N-acyltransferases (Nat)	p.R312T	ENST00000259021.4	37	c.935	CCDS11554.1	17	.	.	.	.	.	.	.	.	.	.	G	17.58	3.423991	0.62733	.	.	ENSG00000136504	ENST00000259021;ENST00000454930;ENST00000509773;ENST00000510819;ENST00000424009;ENST00000503935;ENST00000435742	.	.	.	5.36	5.36	0.76844	.	0.044252	0.85682	D	0.000000	T	0.41581	0.1165	N	0.11201	0.11	0.48135	D	0.999598	B;B;B;B;B;B	0.28233	0.033;0.069;0.204;0.116;0.069;0.044	B;B;B;B;B;B	0.20955	0.012;0.03;0.032;0.03;0.03;0.032	T	0.40403	-0.9565	9	0.62326	D	0.03	-16.8409	18.8697	0.92308	0.0:0.0:1.0:0.0	.	275;143;202;173;312;282	B4DGY4;B4DFE0;B4DFB4;E7ER15;O95251;G5E9K7	.;.;.;.;KAT7_HUMAN;.	T	312;173;202;143;282;156;126	.	ENSP00000259021:R312T	R	+	2	0	KAT7	45248246	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.720000	0.74723	2.788000	0.95919	0.650000	0.86243	AGA	-	NULL		0.458	KAT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYST2	protein_coding	OTTHUMT00000366032.1	G	NM_007067		45248246	1	no_errors	NM_007067	genbank	human	provisional	54_36p	missense	SNP	1	C
HLF	3131	genome.wustl.edu	37	17	53392722	53392722	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0726-01A-01W-0372-09	TCGA-13-0726-10B-01W-0977-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	201415c2-5b5a-4bb8-8005-bf2c78d4d88e	df694f1a-e6a5-4c06-bf79-5fe57cfcba13	g.chr17:53392722C>G	ENST00000226067.5	+	3	1059	c.586C>G	c.(586-588)Cgc>Ggc	p.R196G	HLF_ENST00000573945.1_Missense_Mutation_p.R111G|HLF_ENST00000430986.2_Missense_Mutation_p.R111G|HLF_ENST00000575345.1_Missense_Mutation_p.R111G	NM_002126.4	NP_002117.1	Q16534	HLF_HUMAN	hepatic leukemia factor	196	Pro-rich (proline/acidic region (PAR)).				multicellular organismal development (GO:0007275)|rhythmic process (GO:0048511)|skeletal muscle cell differentiation (GO:0035914)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R196G(1)		large_intestine(1)|ovary(2)	3						GTTTGACCCTCGCAAACGCAA	0.512			T	TCF3	ALL																																		Dom	yes		17	17q22	3131	hepatic leukemia factor		L	1	Substitution - Missense(1)	ovary(1)	17											100.0	93.0	95.0					17																	53392722		2203	4300	6503	50747721	SO:0001583	missense	3131				CCDS11585.1	17q22	2011-05-19			ENSG00000108924	ENSG00000108924			4977	protein-coding gene	gene with protein product		142385				1386162	Standard	XM_005257269		Approved	MGC33822	uc002iug.1	Q16534		ENST00000226067.5:c.586C>G	17.37:g.53392722C>G	ENSP00000226067:p.Arg196Gly		50747721	A8K1X8|Q6FHS9	Missense_Mutation	SNP	HMMPfam_bZIP_2	p.R196G	ENST00000226067.5	37	c.586	CCDS11585.1	17	.	.	.	.	.	.	.	.	.	.	C	20.3	3.963967	0.74131	.	.	ENSG00000108924	ENST00000226067;ENST00000430986	.	.	.	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	T	0.79684	0.4488	M	0.84326	2.69	0.80722	D	1	D;D	0.89917	0.977;1.0	P;D	0.81914	0.9;0.995	T	0.81389	-0.0955	9	0.56958	D	0.05	.	13.5681	0.61830	0.1552:0.8448:0.0:0.0	.	144;196	B4DIQ5;Q16534	.;HLF_HUMAN	G	196;111	.	ENSP00000226067:R196G	R	+	1	0	HLF	50747721	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.095000	0.50235	2.644000	0.89710	0.655000	0.94253	CGC	-	NULL		0.512	HLF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLF	protein_coding	OTTHUMT00000439185.1	C	NM_002126		50747721	1	no_errors	NM_002126	genbank	human	reviewed	54_36p	missense	SNP	1	G
UNK	85451	genome.wustl.edu	37	17	73816190	73816190	+	Splice_Site	SNP	G	G	C			TCGA-13-0726-01A-01W-0372-09	TCGA-13-0726-10B-01W-0977-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	201415c2-5b5a-4bb8-8005-bf2c78d4d88e	df694f1a-e6a5-4c06-bf79-5fe57cfcba13	g.chr17:73816190G>C	ENST00000589666.1	+	13	1947		c.e13+1		UNK_ENST00000293218.3_Splice_Site|RP11-552F3.4_ENST00000586808.1_RNA	NM_001080419.2	NP_001073888.2	Q9C0B0	UNK_HUMAN	unkempt family zinc finger								poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			cervix(3)|endometrium(8)|kidney(2)|large_intestine(5)|lung(3)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	25			all cancers(21;2.61e-06)|Epithelial(20;7.39e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|LUSC - Lung squamous cell carcinoma(166;0.154)			GGATCTTTGGGTAAGAGAGGG	0.577																																																0			17											69.0	70.0	69.0					17																	73816190		1994	4167	6161	71327785	SO:0001630	splice_region_variant	85451			AB051540	CCDS45778.1, CCDS45778.2	17q25.3	2013-10-17	2013-10-17	2007-02-06		ENSG00000132478		"""Zinc fingers, CCCH-type domain containing"""	29369	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 5"", ""zinc finger CCCH-type containing 5"", ""unkempt homolog (Drosophila)"""	ZC3HDC5, ZC3H5		11214970	Standard	NM_001080419		Approved	KIAA1753	uc021udd.2	Q9C0B0		ENST00000589666.1:c.1837+1G>C	17.37:g.73816190G>C			71327785		Splice_Site	SNP	-	e14+1	ENST00000589666.1	37	c.2065+1	CCDS45778.2	17	.	.	.	.	.	.	.	.	.	.	G	15.19	2.759329	0.49468	.	.	ENSG00000132478	ENST00000293218	.	.	.	4.41	4.41	0.53225	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.1961	0.86893	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	UNK	71327785	1.000000	0.71417	1.000000	0.80357	0.546000	0.35178	8.554000	0.90689	2.297000	0.77311	0.563000	0.77884	.	-	-		0.577	UNK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UNK	protein_coding	OTTHUMT00000448835.1	G	NM_001080419	Intron	71327785	1	no_errors	NM_001080419	genbank	human	provisional	54_36p	splice_site	SNP	1	C
TP53	7157	genome.wustl.edu	37	17	7577094	7577094	+	Missense_Mutation	SNP	G	G	A	rs28934574		TCGA-13-0726-01A-01W-0372-09	TCGA-13-0726-10B-01W-0977-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	201415c2-5b5a-4bb8-8005-bf2c78d4d88e	df694f1a-e6a5-4c06-bf79-5fe57cfcba13	g.chr17:7577094G>A	ENST00000269305.4	-	8	1033	c.844C>T	c.(844-846)Cgg>Tgg	p.R282W	TP53_ENST00000455263.2_Missense_Mutation_p.R282W|TP53_ENST00000359597.4_Missense_Mutation_p.R282W|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Missense_Mutation_p.R282W|TP53_ENST00000445888.2_Missense_Mutation_p.R282W|TP53_ENST00000413465.2_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	282	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		DR -> EW (in sporadic cancers; somatic mutation).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in a sporadic cancer; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|Ref.22}.|R -> W (in LFS; germline mutation and in sporadic cancers; somatic mutation; does not induce SNAI1 degradation; dbSNP:rs28934574). {ECO:0000269|PubMed:8829627}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R282W(401)|p.R282G(29)|p.0?(8)|p.R282fs*24(4)|p.R282R(3)|p.?(2)|p.D281fs*63(2)|p.D281_R282>EW(2)|p.A276_R283delACPGRDRR(1)|p.D281_R282insXX(1)|p.C275fs*20(1)|p.R282_E287delRRTEEE(1)|p.L265_K305del41(1)|p.D281_R282delDR(1)|p.G279fs*59(1)|p.R280fs*62(1)|p.S269fs*21(1)|p.R282fs*63(1)|p.V272_K292del21(1)|p.C275_R283delCACPGRDRR(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TCTGTGCGCCGGTCTCTCCCA	0.557		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	463	Substitution - Missense(430)|Whole gene deletion(8)|Deletion - In frame(6)|Deletion - Frameshift(5)|Insertion - Frameshift(4)|Substitution - coding silent(3)|Unknown(2)|Complex - frameshift(2)|Complex - compound substitution(2)|Insertion - In frame(1)	large_intestine(136)|oesophagus(49)|upper_aerodigestive_tract(43)|stomach(33)|central_nervous_system(29)|breast(29)|lung(26)|ovary(21)|skin(20)|urinary_tract(16)|haematopoietic_and_lymphoid_tissue(16)|pancreas(10)|biliary_tract(5)|liver(5)|bone(5)|vulva(4)|prostate(4)|endometrium(3)|peritoneum(2)|thyroid(2)|NS(2)|autonomic_ganglia(1)|soft_tissue(1)|salivary_gland(1)	17	GRCh37	CM056413|CM920678	TP53	M	rs28934574	G	TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG	0,4406		0,0,2203	83.0	71.0	75.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	844,844,844,844,448,448,448	1.5	0.3	17	dbSNP_125	75	2,8598	2.2+/-6.3	1,0,4299	no	missense,missense,missense,missense,missense,missense,missense	TP53	NM_000546.4,NM_001126112.1,NM_001126113.1,NM_001126114.1,NM_001126115.1,NM_001126116.1,NM_001126117.1	101,101,101,101,101,101,101	1,0,6502	AA,AG,GG		0.0233,0.0,0.0154	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	282/394,282/394,282/347,282/342,150/262,150/210,150/215	7577094	2,13004	2203	4300	6503	7517819	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.844C>T	17.37:g.7577094G>A	ENSP00000269305:p.Arg282Trp		7517819	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	superfamily_p53-like transcription factors;superfamily_p53 tetramerization domain;P53_tetramer;HMMPfam_P53_tetramer;P53;HMMPfam_P53;P53_TAD;HMMPfam_P53_TAD	p.R282W	ENST00000269305.4	37	c.844	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	G	20.8	4.057525	0.76074	0.0	2.33E-4	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99869	-7.34;-7.34;-7.34;-7.34;-7.34;-7.34	4.75	1.49	0.22878	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99825	0.9922	M	0.89968	3.075	0.58432	A	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;0.998;1.0;0.999	D	0.97713	1.0192	9	0.87932	D	0	-12.0909	8.7508	0.34613	0.0:0.1376:0.5833:0.2792	rs28934574	282;282;282;282	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	W	282;282;282;282;282;271;150	ENSP00000352610:R282W;ENSP00000269305:R282W;ENSP00000398846:R282W;ENSP00000391127:R282W;ENSP00000391478:R282W;ENSP00000425104:R150W	ENSP00000269305:R282W	R	-	1	2	TP53	7517819	1.000000	0.71417	0.327000	0.25402	0.901000	0.52897	4.477000	0.60223	0.174000	0.19809	0.462000	0.41574	CGG	-	HMMPfam_P53		0.557	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	G	NM_000546		7517819	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	missense	SNP	1	A
RNF157	114804	genome.wustl.edu	37	17	74160863	74160863	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0726-01A-01W-0372-09	TCGA-13-0726-10B-01W-0977-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	201415c2-5b5a-4bb8-8005-bf2c78d4d88e	df694f1a-e6a5-4c06-bf79-5fe57cfcba13	g.chr17:74160863G>T	ENST00000269391.6	-	8	818	c.686C>A	c.(685-687)aCt>aAt	p.T229N	RNF157_ENST00000319945.6_Missense_Mutation_p.T229N	NM_052916.2	NP_443148.1	Q96PX1	RN157_HUMAN	ring finger protein 157	229							zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|large_intestine(3)|lung(12)|ovary(2)|prostate(1)|skin(1)|stomach(2)|urinary_tract(1)	25			LUSC - Lung squamous cell carcinoma(166;0.187)			GACACAGAAAGTTCCATCTGT	0.398																																					GBM(186;507 2120 27388 27773 52994)											0			17											98.0	93.0	95.0					17																	74160863		2203	4300	6503	71672458	SO:0001583	missense	114804			AK091467	CCDS32740.1	17q25.3	2004-02-27			ENSG00000141576	ENSG00000141576		"""RING-type (C3HC4) zinc fingers"""	29402	protein-coding gene	gene with protein product						11572484	Standard	NM_052916		Approved	KIAA1917	uc002jqz.3	Q96PX1	OTTHUMG00000132627	ENST00000269391.6:c.686C>A	17.37:g.74160863G>T	ENSP00000269391:p.Thr229Asn		71672458	Q8NB72|Q96N56	Missense_Mutation	SNP	-	p.T229N	ENST00000269391.6	37	c.686	CCDS32740.1	17	.	.	.	.	.	.	.	.	.	.	G	15.83	2.947705	0.53186	.	.	ENSG00000141576	ENST00000269391;ENST00000319945;ENST00000301610	T;T	0.23754	1.89;1.91	5.58	5.58	0.84498	.	0.040960	0.85682	D	0.000000	T	0.20007	0.0481	N	0.20685	0.6	0.80722	D	1	P;B	0.44521	0.837;0.024	B;B	0.42030	0.373;0.017	T	0.01679	-1.1297	10	0.48119	T	0.1	-31.2919	14.4621	0.67456	0.0:0.2694:0.7306:0.0	.	229;229	Q96PX1-2;Q96PX1	.;RN157_HUMAN	N	229;229;191	ENSP00000269391:T229N;ENSP00000321837:T229N	ENSP00000269391:T229N	T	-	2	0	RNF157	71672458	1.000000	0.71417	0.969000	0.41365	0.998000	0.95712	4.706000	0.61845	2.598000	0.87819	0.655000	0.94253	ACT	-	NULL		0.398	RNF157-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF157	protein_coding	OTTHUMT00000255874.2	G	XM_290732		71672458	-1	no_errors	NM_052916	genbank	human	validated	54_36p	missense	SNP	1	T
LPHN1	22859	genome.wustl.edu	37	19	14263354	14263354	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0726-01A-01W-0372-09	TCGA-13-0726-10B-01W-0977-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	201415c2-5b5a-4bb8-8005-bf2c78d4d88e	df694f1a-e6a5-4c06-bf79-5fe57cfcba13	g.chr19:14263354G>C	ENST00000340736.6	-	21	3807	c.3510C>G	c.(3508-3510)atC>atG	p.I1170M	CTB-55O6.12_ENST00000588658.1_RNA|LPHN1_ENST00000361434.3_Missense_Mutation_p.I1165M|CTB-55O6.12_ENST00000588387.1_RNA|CTB-55O6.12_ENST00000592086.1_RNA	NM_001008701.2	NP_001008701.1	O94910	LPHN1_HUMAN	latrophilin 1	1170					calcium-mediated signaling using intracellular calcium source (GO:0035584)|G-protein coupled receptor signaling pathway (GO:0007186)|heterophilic cell-cell adhesion (GO:0007157)|neuropeptide signaling pathway (GO:0007218)|positive regulation of synapse maturation (GO:0090129)	axon (GO:0030424)|cell junction (GO:0030054)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|synapse (GO:0045202)	carbohydrate binding (GO:0030246)|cell adhesion molecule binding (GO:0050839)|G-protein coupled receptor activity (GO:0004930)|latrotoxin receptor activity (GO:0016524)	p.I1170M(1)		central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(3)|liver(1)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						GGGTGCTGTTGATGTCACCCG	0.567																																																1	Substitution - Missense(1)	ovary(1)	19											90.0	80.0	83.0					19																	14263354		2203	4300	6503	14124354	SO:0001583	missense	22859			AB020628	CCDS12307.1, CCDS32928.1	19p13.2	2014-08-08				ENSG00000072071		"""-"", ""GPCR / Class B : Orphans"""	20973	protein-coding gene	gene with protein product						10994649	Standard	NM_014921		Approved	KIAA0821, CIRL1, LEC2	uc010xnn.2	O94910		ENST00000340736.6:c.3510C>G	19.37:g.14263354G>C	ENSP00000340688:p.Ile1170Met		14124354	Q96IE7|Q9BU07|Q9HAR3	Missense_Mutation	SNP	-	p.I1170M	ENST00000340736.6	37	c.3510	CCDS32928.1	19	.	.	.	.	.	.	.	.	.	.	G	14.53	2.562655	0.45694	.	.	ENSG00000072071	ENST00000340736;ENST00000361434	T;T	0.77229	-1.08;-1.08	5.47	5.47	0.80525	GPCR, family 2, latrophilin, C-terminal (1);	0.059672	0.64402	D	0.000004	T	0.79058	0.4382	L	0.42245	1.32	0.40683	D	0.982321	P;P	0.48350	0.909;0.457	P;B	0.55222	0.771;0.37	T	0.79848	-0.1630	10	0.52906	T	0.07	.	10.2862	0.43568	0.0897:0.0:0.9103:0.0	.	1165;1170	O94910-2;O94910	.;LPHN1_HUMAN	M	1170;1165	ENSP00000340688:I1170M;ENSP00000355328:I1165M	ENSP00000340688:I1170M	I	-	3	3	LPHN1	14124354	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	2.314000	0.43743	2.571000	0.86741	0.561000	0.74099	ATC	-	NULL		0.567	LPHN1-001	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	LPHN1	protein_coding	OTTHUMT00000459696.1	G	NM_014921		14124354	-1	no_errors	NM_001008701	genbank	human	reviewed	54_36p	missense	SNP	1	C
KCNN1	3780	genome.wustl.edu	37	19	18100588	18100588	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0726-01A-01W-0372-09	TCGA-13-0726-10B-01W-0977-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	201415c2-5b5a-4bb8-8005-bf2c78d4d88e	df694f1a-e6a5-4c06-bf79-5fe57cfcba13	g.chr19:18100588G>C	ENST00000222249.9	+	8	1553	c.1234G>C	c.(1234-1236)Gtg>Ctg	p.V412L		NM_002248.3	NP_002239.2	Q92952	KCNN1_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 1	412	Calmodulin-binding. {ECO:0000250}.				potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)	p.V429L(1)		endometrium(1)|kidney(1)|lung(5)|urinary_tract(1)	8					Miconazole(DB01110)|Procaine(DB00721)	TACCAGGCTGGTGAAGAAGCC	0.527																																																1	Substitution - Missense(1)	ovary(1)	19											111.0	116.0	114.0					19																	18100588		2045	4235	6280	17961588	SO:0001583	missense	3780			U69883	CCDS67611.1	19p13.1	2012-07-05				ENSG00000105642		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6290	protein-coding gene	gene with protein product		602982				8781233, 10516439, 16382103	Standard	NM_002248		Approved	KCa2.1, hSK1	uc002nht.3	Q92952		ENST00000222249.9:c.1234G>C	19.37:g.18100588G>C	ENSP00000476519:p.Val412Leu		17961588	Q5KR10|Q6DJU4	Missense_Mutation	SNP	HMMPfam_CaMBD;HMMPfam_SK_channel;HMMPfam_Ion_trans_2;superfamily_Voltage-gated potassium channels;superfamily_Small-conductance potassium channel	p.V412L	ENST00000222249.9	37	c.1234		19	.	.	.	.	.	.	.	.	.	.	G	13.53	2.263827	0.39995	.	.	ENSG00000105642	ENST00000222249	.	.	.	4.61	3.42	0.39159	Calmodulin-binding domain (2);	0.000000	0.85682	D	0.000000	T	0.57592	0.2064	M	0.69823	2.125	0.80722	D	1	B	0.06786	0.001	B	0.15484	0.013	T	0.51733	-0.8668	9	0.24483	T	0.36	-16.9475	10.2844	0.43558	0.1092:0.0:0.8908:0.0	.	412	Q92952	KCNN1_HUMAN	L	429	.	ENSP00000222249:V429L	V	+	1	0	KCNN1	17961588	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	2.563000	0.45922	0.743000	0.32719	0.561000	0.74099	GTG	-	HMMPfam_CaMBD		0.527	KCNN1-001	KNOWN	basic|appris_principal	protein_coding	KCNN1	protein_coding	OTTHUMT00000471896.2	G	NM_002248		17961588	1	no_errors	NM_002248	genbank	human	reviewed	54_36p	missense	SNP	1	C
MUC16	94025	genome.wustl.edu	37	19	8998702	8998702	+	Silent	SNP	G	G	A			TCGA-13-0726-01A-01W-0372-09	TCGA-13-0726-10B-01W-0977-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	201415c2-5b5a-4bb8-8005-bf2c78d4d88e	df694f1a-e6a5-4c06-bf79-5fe57cfcba13	g.chr19:8998702G>A	ENST00000397910.4	-	58	41084	c.40881C>T	c.(40879-40881)ccC>ccT	p.P13627P	MUC16_ENST00000380951.5_Silent_p.P268P	NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	13629				Missing (in Ref. 3; AAK74120). {ECO:0000305}.	cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.P312P(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						ACTTACCCGAGGGACCAGGTT	0.458																																																1	Substitution - coding silent(1)	ovary(1)	19											52.0	48.0	49.0					19																	8998702		1860	4102	5962	8859702	SO:0001819	synonymous_variant	94025			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.40881C>T	19.37:g.8998702G>A			8859702	Q6ZQW5|Q96RK2	Silent	SNP	HMMPfam_SEA;superfamily_Immunoglobulin;superfamily_SEA domain	p.P13627	ENST00000397910.4	37	c.40881	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	.	2.054	-0.417120	0.04766	.	.	ENSG00000181143	ENST00000542240	.	.	.	0.798	-0.425	0.12317	.	.	.	.	.	T	0.36331	0.0963	.	.	.	.	.	.	.	.	.	.	.	.	T	0.45160	-0.9280	4	0.62326	D	0.03	.	3.1915	0.06619	0.3356:0.0:0.6644:0.0	.	.	.	.	L	467	.	ENSP00000370334:P467L	P	-	2	0	MUC16	8859702	0.004000	0.15560	0.001000	0.08648	0.009000	0.06853	-0.409000	0.07160	-0.080000	0.12685	0.430000	0.28490	CCT	-	NULL		0.458	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	protein_coding	OTTHUMT00000402806.1	G	NM_024690		8859702	-1	no_errors	NM_024690	genbank	human	validated	54_36p	silent	SNP		A
URI1	8725	genome.wustl.edu	37	19	30502055	30502055	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0726-01A-01W-0372-09	TCGA-13-0726-10B-01W-0977-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	201415c2-5b5a-4bb8-8005-bf2c78d4d88e	df694f1a-e6a5-4c06-bf79-5fe57cfcba13	g.chr19:30502055G>A	ENST00000542441.2	+	9	1387	c.1090G>A	c.(1090-1092)Gaa>Aaa	p.E364K	URI1_ENST00000360605.4_Missense_Mutation_p.E346K|URI1_ENST00000392271.1_Missense_Mutation_p.E288K|URI1_ENST00000312051.6_Missense_Mutation_p.E324K			O94763	RMP_HUMAN	URI1, prefoldin-like chaperone	364					cellular response to growth factor stimulus (GO:0071363)|cellular response to steroid hormone stimulus (GO:0071383)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of phosphatase activity (GO:0010923)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein folding (GO:0006457)|regulation of cell growth (GO:0001558)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to virus (GO:0009615)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, core complex (GO:0005665)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|prefoldin complex (GO:0016272)	chromatin binding (GO:0003682)|protein phosphatase inhibitor activity (GO:0004864)|RNA polymerase II transcription corepressor activity (GO:0001106)	p.E364K(1)									AAAGAAAGAAGAAGCCAAACG	0.423																																																1	Substitution - Missense(1)	ovary(1)	19											82.0	87.0	86.0					19																	30502055		2203	4300	6503	35193895	SO:0001583	missense	8725			AF091095	CCDS12420.1, CCDS58658.1	19q12	2012-04-17	2011-11-21	2011-11-21	ENSG00000105176	ENSG00000105176		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	13236	protein-coding gene	gene with protein product	"""unconventional prefoldin RPB5 interactor"", ""RPB5-mediating protein"", ""protein phosphatase 1, regulatory subunit 19"""	603494	"""chromosome 19 open reading frame 2"""	C19orf2		9878255, 9819440	Standard	NM_003796		Approved	RMP, NNX3, FLJ10575, URI, PPP1R19	uc002nsr.3	O94763		ENST00000542441.2:c.1090G>A	19.37:g.30502055G>A	ENSP00000442436:p.Glu364Lys		35193895	A8K805|H7BY42|Q8TC23|Q9UNU3	Missense_Mutation	SNP	Prefoldin;HMMPfam_Prefoldin;superfamily_Prefoldin	p.E364K	ENST00000542441.2	37	c.1090	CCDS12420.1	19	.	.	.	.	.	.	.	.	.	.	G	24.1	4.493585	0.84962	.	.	ENSG00000105176	ENST00000360605;ENST00000392271;ENST00000542441;ENST00000312051	T	0.50548	0.74	5.92	5.92	0.95590	.	0.050408	0.85682	D	0.000000	T	0.65386	0.2686	M	0.61703	1.905	0.45554	D	0.998506	D;D;D	0.63880	0.993;0.991;0.991	P;P;P	0.61275	0.886;0.867;0.867	T	0.59306	-0.7479	10	0.35671	T	0.21	-27.4409	20.3172	0.98658	0.0:0.0:1.0:0.0	.	324;364;361	F8W9T0;O94763;Q8TC23	.;RMP_HUMAN;.	K	362;288;364;324	ENSP00000442436:E364K	ENSP00000312530:E324K	E	+	1	0	C19orf2	35193895	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	6.546000	0.73887	2.801000	0.96364	0.650000	0.86243	GAA	-	NULL		0.423	URI1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C19orf2	protein_coding	OTTHUMT00000439756.1	G	NM_134447		35193895	1	no_errors	NM_003796	genbank	human	reviewed	54_36p	missense	SNP	1	A
SLC20A1	6574	genome.wustl.edu	37	2	113416546	113416546	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0726-01A-01W-0372-09	TCGA-13-0726-10B-01W-0977-09	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	201415c2-5b5a-4bb8-8005-bf2c78d4d88e	df694f1a-e6a5-4c06-bf79-5fe57cfcba13	g.chr2:113416546T>A	ENST00000272542.3	+	7	1462	c.923T>A	c.(922-924)cTc>cAc	p.L308H	SLC20A1_ENST00000480984.1_3'UTR	NM_005415.4	NP_005406.3	Q8WUM9	S20A1_HUMAN	solute carrier family 20 (phosphate transporter), member 1	308					ion transport (GO:0006811)|phosphate ion transmembrane transport (GO:0035435)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	high-affinity inorganic phosphate:sodium symporter activity (GO:0005316)|inorganic phosphate transmembrane transporter activity (GO:0005315)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)|sodium:phosphate symporter activity (GO:0005436)	p.L308H(1)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|liver(2)|lung(8)|ovary(3)|skin(1)|urinary_tract(3)	28						ACTGTGCCCCTCCAGGCTGTG	0.478																																																1	Substitution - Missense(1)	ovary(1)	2											94.0	95.0	95.0					2																	113416546		2203	4300	6503	113133017	SO:0001583	missense	6574				CCDS2099.1	2q13	2013-05-22			ENSG00000144136	ENSG00000144136		"""Solute carriers"""	10946	protein-coding gene	gene with protein product	"""gibbon ape leukemia virus receptor 1"""	137570		GLVR1		8041748	Standard	NM_005415		Approved	PiT-1, Glvr-1	uc002tib.3	Q8WUM9	OTTHUMG00000131317	ENST00000272542.3:c.923T>A	2.37:g.113416546T>A	ENSP00000272542:p.Leu308His		113133017	Q08344|Q6DHX8|Q9UQ82	Missense_Mutation	SNP	-	p.L308H	ENST00000272542.3	37	c.923	CCDS2099.1	2	.	.	.	.	.	.	.	.	.	.	T	6.424	0.446399	0.12223	.	.	ENSG00000144136	ENST00000272542;ENST00000409095	D	0.91180	-2.8	5.9	3.5	0.40072	.	0.771673	0.12222	N	0.488244	D	0.88746	0.6520	M	0.76170	2.325	0.09310	N	1	B;B	0.15719	0.014;0.014	B;B	0.24394	0.053;0.053	T	0.78725	-0.2092	10	0.41790	T	0.15	-19.1493	5.3015	0.15780	0.1557:0.083:0.0:0.7613	.	308;308	A7LNJ1;Q8WUM9	.;S20A1_HUMAN	H	308;120	ENSP00000272542:L308H	ENSP00000272542:L308H	L	+	2	0	SLC20A1	113133017	0.000000	0.05858	0.010000	0.14722	0.245000	0.25701	0.221000	0.17680	0.478000	0.27488	0.533000	0.62120	CTC	-	NULL		0.478	SLC20A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC20A1	protein_coding	OTTHUMT00000254086.2	T	NM_005415		113133017	1	no_errors	NM_005415	genbank	human	provisional	54_36p	missense	SNP	0.27	A
GLI2	2736	genome.wustl.edu	37	2	121742290	121742290	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0726-01A-01W-0372-09	TCGA-13-0726-10B-01W-0977-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	201415c2-5b5a-4bb8-8005-bf2c78d4d88e	df694f1a-e6a5-4c06-bf79-5fe57cfcba13	g.chr2:121742290G>A	ENST00000452319.1	+	12	1987	c.1927G>A	c.(1927-1929)Gtc>Atc	p.V643I	GLI2_ENST00000435313.2_3'UTR|GLI2_ENST00000314490.11_Missense_Mutation_p.V315I|GLI2_ENST00000361492.4_Missense_Mutation_p.V643I					GLI family zinc finger 2									p.V643I(1)		NS(1)|breast(3)|central_nervous_system(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|lung(24)|ovary(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	Renal(3;0.0496)	Prostate(154;0.0623)				CTGCCTGCACGTCAGAGCCAT	0.687																																																1	Substitution - Missense(1)	ovary(1)	2											24.0	25.0	25.0					2																	121742290		2200	4296	6496	121458760	SO:0001583	missense	2736				CCDS33283.1	2q14	2013-01-25	2009-03-05		ENSG00000074047	ENSG00000074047		"""Zinc fingers, C2H2-type"""	4318	protein-coding gene	gene with protein product	"""tax-responsive element-2 holding protein"", ""tax helper protein 1"", ""tax helper protein 2"""	165230	"""GLI-Kruppel family member GLI2"", ""glioma-associated oncogene family zinc finger 2"""			2850480, 9557682	Standard	NM_005270		Approved	THP2, HPE9, THP1	uc010flp.3	P10070	OTTHUMG00000153741	ENST00000452319.1:c.1927G>A	2.37:g.121742290G>A	ENSP00000390436:p.Val643Ile		121458760		Missense_Mutation	SNP	HMMPfam_zf-C2H2;superfamily_Kazal-type serine protease inhibitors;superfamily_C2H2 and C2HC zinc fingers	p.V643I	ENST00000452319.1	37	c.1927	CCDS33283.1	2	.	.	.	.	.	.	.	.	.	.	G	13.62	2.291896	0.40594	.	.	ENSG00000074047	ENST00000452319;ENST00000361492;ENST00000314490	T;T;T	0.16073	2.37;2.37;2.44	4.7	-0.447	0.12234	.	0.319820	0.32952	N	0.005456	T	0.10895	0.0266	L	0.31371	0.925	0.24058	N	0.996028	B;B;B;B;B	0.20780	0.016;0.001;0.047;0.048;0.01	B;B;B;B;B	0.20577	0.005;0.0;0.017;0.03;0.002	T	0.20571	-1.0271	10	0.42905	T	0.14	.	8.8145	0.34987	0.4092:0.0:0.5908:0.0	.	643;626;298;298;315	P10070;Q0VGA0;P10070-2;P10070-4;P10070-3	GLI2_HUMAN;.;.;.;.	I	643;643;315	ENSP00000390436:V643I;ENSP00000354586:V643I;ENSP00000312694:V315I	ENSP00000312694:V315I	V	+	1	0	GLI2	121458760	0.091000	0.21658	0.892000	0.35008	0.969000	0.65631	0.433000	0.21477	-0.304000	0.08843	-0.258000	0.10820	GTC	-	NULL		0.687	GLI2-009	NOVEL	basic|appris_principal|CCDS	protein_coding	GLI2	protein_coding	OTTHUMT00000332293.3	G	NM_005270		121458760	1	no_errors	NM_005270	genbank	human	reviewed	54_36p	missense	SNP	0.69	A
CNTNAP5	129684	genome.wustl.edu	37	2	125232356	125232356	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0726-01A-01W-0372-09	TCGA-13-0726-10B-01W-0977-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	201415c2-5b5a-4bb8-8005-bf2c78d4d88e	df694f1a-e6a5-4c06-bf79-5fe57cfcba13	g.chr2:125232356C>T	ENST00000431078.1	+	7	1323	c.959C>T	c.(958-960)aCc>aTc	p.T320I		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	320	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)		p.T320I(1)		NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		AAACCTGGGACCTTTTTAAAG	0.368																																																1	Substitution - Missense(1)	ovary(1)	2											46.0	42.0	43.0					2																	125232356		1808	4073	5881	124948826	SO:0001583	missense	129684			AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.959C>T	2.37:g.125232356C>T	ENSP00000399013:p.Thr320Ile		124948826	Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Missense_Mutation	SNP	HMMPfam_F5_F8_type_C;HMMPfam_EGF;superfamily_Galactose-binding domain-like;superfamily_Concanavalin A-like lectins/glucanases;HMMPfam_Laminin_G_2;superfamily_Fibrinogen C-terminal domain-like	p.T320I	ENST00000431078.1	37	c.959	CCDS46401.1	2	.	.	.	.	.	.	.	.	.	.	C	21.4	4.139616	0.77775	.	.	ENSG00000155052	ENST00000431078	T	0.78364	-1.17	5.67	5.67	0.87782	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.000000	0.51477	D	0.000090	D	0.85248	0.5653	L	0.48174	1.505	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	D	0.83792	0.0231	10	0.44086	T	0.13	.	19.112	0.93319	0.0:1.0:0.0:0.0	.	320	Q8WYK1	CNTP5_HUMAN	I	320	ENSP00000399013:T320I	ENSP00000399013:T320I	T	+	2	0	CNTNAP5	124948826	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.553000	0.67287	2.823000	0.97156	0.591000	0.81541	ACC	-	HMMPfam_Laminin_G_2		0.368	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP5	protein_coding	OTTHUMT00000330864.3	C			124948826	1	no_errors	NM_130773	genbank	human	reviewed	54_36p	missense	SNP	1	T
POTEE	445582	genome.wustl.edu	37	2	132021439	132021439	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0726-01A-01W-0372-09	TCGA-13-0726-10B-01W-0977-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	201415c2-5b5a-4bb8-8005-bf2c78d4d88e	df694f1a-e6a5-4c06-bf79-5fe57cfcba13	g.chr2:132021439T>C	ENST00000356920.5	+	15	2505	c.2411T>C	c.(2410-2412)cTg>cCg	p.L804P	PLEKHB2_ENST00000404460.1_Intron|PLEKHB2_ENST00000303908.3_Intron|POTEE_ENST00000358087.5_3'UTR	NM_001083538.1	NP_001077007.1	Q6S8J3	POTEE_HUMAN	POTE ankyrin domain family, member E	804	Actin-like.				retina homeostasis (GO:0001895)|substantia nigra development (GO:0021762)	blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)											CACCCCATCCTGCTGACCGAG	0.582																																																0			2											72.0	74.0	73.0					2																	132021439		2201	4295	6496	131737909	SO:0001583	missense	445582			AY462868	CCDS46414.1	2q21.1	2014-04-10	2008-11-26	2008-11-26	ENSG00000188219	ENSG00000188219		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33895	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 2"""	608914	"""ANKRD26-like family C, member 1A"""	A26C1A			Standard	NM_001083538		Approved	POTE2, POTE-2, A26C1, POTE2gamma, CT104.2	uc002tsn.2	Q6S8J3	OTTHUMG00000186974	ENST00000356920.5:c.2411T>C	2.37:g.132021439T>C	ENSP00000439189:p.Leu804Pro		131737909	Q6S8J4|Q6S8J5|Q6S8J8	Missense_Mutation	SNP	-	p.L804P	ENST00000356920.5	37	c.2411	CCDS46414.1	2	.	.	.	.	.	.	.	.	.	.	.	14.47	2.544381	0.45280	.	.	ENSG00000188219	ENST00000356920	D	0.97209	-4.29	.	.	.	Actin/actin-like conserved site (1);	.	.	.	.	D	0.98998	0.9658	H	0.99927	4.965	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.95736	0.8779	8	0.87932	D	0	.	4.5487	0.12098	0.0:6.0E-4:0.0:0.9994	.	804	Q6S8J3	POTEE_HUMAN	P	804	ENSP00000439189:L804P	ENSP00000439189:L804P	L	+	2	0	AC131180.1	131737909	1.000000	0.71417	0.309000	0.25155	0.314000	0.28054	5.388000	0.66249	0.103000	0.17682	0.102000	0.15555	CTG	-	NULL		0.582	POTEE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	POTEE	protein_coding		T	NM_001083538		131737909	1	no_errors	NM_001083538	genbank	human	validated	54_36p	missense	SNP	1	C
LRP2	4036	genome.wustl.edu	37	2	170022518	170022518	+	Missense_Mutation	SNP	A	A	C			TCGA-13-0726-01A-01W-0372-09	TCGA-13-0726-10B-01W-0977-09	A	A	A	C	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	201415c2-5b5a-4bb8-8005-bf2c78d4d88e	df694f1a-e6a5-4c06-bf79-5fe57cfcba13	g.chr2:170022518A>C	ENST00000263816.3	-	62	11967	c.11682T>G	c.(11680-11682)aaT>aaG	p.N3894K		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	3894	LDL-receptor class A 35. {ECO:0000255|PROSITE-ProRule:PRU00124}.				cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)	p.N3894K(1)		biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	AAATGCAGCGATTGTTGTCAC	0.408																																																1	Substitution - Missense(1)	ovary(1)	2											210.0	193.0	199.0					2																	170022518		2203	4300	6503	169730764	SO:0001583	missense	4036				CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.11682T>G	2.37:g.170022518A>C	ENSP00000263816:p.Asn3894Lys		169730764	O00711|Q16215	Missense_Mutation	SNP	HMMPfam_Ldl_recept_b;HMMPfam_Ldl_recept_a;HMMPfam_EGF;superfamily_Growth factor receptor domain;HMMPfam_EGF_CA;HMMPfam_EGF_2;superfamily_EGF/Laminin;superfamily_LDL receptor-like module;superfamily_YWTD domain	p.N3894K	ENST00000263816.3	37	c.11682	CCDS2232.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	20.8|20.8	4.048359|4.048359	0.75846|0.75846	.|.	.|.	ENSG00000081479|ENSG00000081479	ENST00000536293|ENST00000263816	.|D	.|0.95238	.|-3.65	6.06|6.06	-2.43|-2.43	0.06522|0.06522	.|.	.|0.091143	.|0.64402	.|D	.|0.000001	D|D	0.89375|0.89375	0.6697|0.6697	N|N	0.17872|0.17872	0.535|0.535	0.80722|0.80722	D|D	1|1	.|D	.|0.53151	.|0.958	.|P	.|0.54174	.|0.744	D|D	0.84812|0.84812	0.0791|0.0791	6|10	0.46703|0.06365	T|T	0.11|0.9	.|.	11.7747|11.7747	0.51979|0.51979	0.5406:0.0:0.4594:0.0|0.5406:0.0:0.4594:0.0	.|.	.|3894	.|P98164	.|LRP2_HUMAN	S|K	559|3894	.|ENSP00000263816:N3894K	ENSP00000438157:I559S|ENSP00000263816:N3894K	I|N	-|-	2|3	0|2	LRP2|LRP2	169730764|169730764	1.000000|1.000000	0.71417|0.71417	0.869000|0.869000	0.34112|0.34112	0.908000|0.908000	0.53690|0.53690	1.829000|1.829000	0.39121|0.39121	-0.405000|-0.405000	0.07599|0.07599	0.528000|0.528000	0.53228|0.53228	ATC|AAT	-	HMMPfam_Ldl_recept_a		0.408	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP2	protein_coding	OTTHUMT00000255231.2	A	NM_004525		169730764	-1	no_errors	NM_004525	genbank	human	validated	54_36p	missense	SNP	1	C
MCEE	84693	genome.wustl.edu	37	2	71351486	71351486	+	Silent	SNP	C	C	T			TCGA-13-0726-01A-01W-0372-09	TCGA-13-0726-10B-01W-0977-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	201415c2-5b5a-4bb8-8005-bf2c78d4d88e	df694f1a-e6a5-4c06-bf79-5fe57cfcba13	g.chr2:71351486C>T	ENST00000244217.5	-	2	245	c.228G>A	c.(226-228)gcG>gcA	p.A76A	AC007881.1_ENST00000578636.1_RNA	NM_032601.3	NP_115990.3	Q96PE7	MCEE_HUMAN	methylmalonyl CoA epimerase	76			A -> V (in dbSNP:rs11541017).		cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|L-methylmalonyl-CoA metabolic process (GO:0046491)|short-chain fatty acid catabolic process (GO:0019626)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)	metal ion binding (GO:0046872)|methylmalonyl-CoA epimerase activity (GO:0004493)	p.A76A(1)		kidney(1)|large_intestine(2)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	9						GAAGAGGGACCGCTTCACTTA	0.478																																																1	Substitution - coding silent(1)	ovary(1)	2											106.0	107.0	107.0					2																	71351486		2203	4300	6503	71204994	SO:0001819	synonymous_variant	84693			AF364547	CCDS1915.1	2p13.3	2011-05-12			ENSG00000124370	ENSG00000124370	5.1.99.1		16732	protein-coding gene	gene with protein product	"""glyoxalase domain containing 2"""	608419				16697227, 16752391, 16843692	Standard	NM_032601		Approved	GLOD2	uc002shs.2	Q96PE7	OTTHUMG00000129709	ENST00000244217.5:c.228G>A	2.37:g.71351486C>T			71204994	Q53TP1|Q8WW63	Silent	SNP	HMMPfam_Glyoxalase;superfamily_Glyoxalase/Bleomycin resistance protein/Dihydroxybiphenyl dioxygenase	p.A76	ENST00000244217.5	37	c.228	CCDS1915.1	2																																																																																			-	HMMPfam_Glyoxalase		0.478	MCEE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCEE	protein_coding	OTTHUMT00000251917.3	C	NM_032601		71204994	-1	no_errors	NM_032601	genbank	human	reviewed	54_36p	silent	SNP	0.05	T
CCDC108	255101	genome.wustl.edu	37	2	219900221	219900221	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0726-01A-01W-0372-09	TCGA-13-0726-10B-01W-0977-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	201415c2-5b5a-4bb8-8005-bf2c78d4d88e	df694f1a-e6a5-4c06-bf79-5fe57cfcba13	g.chr2:219900221G>A	ENST00000341552.5	-	5	606	c.523C>T	c.(523-525)Ctc>Ttc	p.L175F	CCDC108_ENST00000453220.1_Missense_Mutation_p.L175F|CCDC108_ENST00000324264.6_Missense_Mutation_p.L110F|CCDC108_ENST00000295729.2_Missense_Mutation_p.L110F|CCDC108_ENST00000441968.1_Missense_Mutation_p.L175F|CCDC108_ENST00000410037.1_Missense_Mutation_p.L110F|CCDC108_ENST00000409865.3_Missense_Mutation_p.L164F	NM_194302.2	NP_919278.2	Q6ZU64	CC108_HUMAN	coiled-coil domain containing 108	175						integral component of membrane (GO:0016021)	poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)	p.L175F(1)		autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(18)|liver(1)|lung(34)|ovary(2)|pancreas(1)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	80		Renal(207;0.0915)		Epithelial(149;1.12e-06)|all cancers(144;0.000196)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		ATCTTCTGGAGTTTCAAGGAT	0.488																																																1	Substitution - Missense(1)	ovary(1)	2											160.0	154.0	156.0					2																	219900221		2203	4300	6503	219608465	SO:0001583	missense	255101			NM_194302, AL833882, AK127189	CCDS2430.2, CCDS2431.2, CCDS63125.1, CCDS63126.1	2q35	2008-02-05			ENSG00000181378	ENSG00000181378			25325	protein-coding gene	gene with protein product		614270				12477932	Standard	NM_194302		Approved	DKFZp434O0527, MGC35338	uc002vjl.2	Q6ZU64	OTTHUMG00000133013	ENST00000341552.5:c.523C>T	2.37:g.219900221G>A	ENSP00000340776:p.Leu175Phe		219608465	A2BDD8|E9PCR1|E9PG25|E9PG72|Q6ZSR8|Q8N0T4|Q8NDJ3	Missense_Mutation	SNP	-	p.L175F	ENST00000341552.5	37	c.523	CCDS2430.2	2	.	.	.	.	.	.	.	.	.	.	G	15.89	2.966006	0.53507	.	.	ENSG00000181378	ENST00000341552;ENST00000441968;ENST00000453220;ENST00000409865;ENST00000410037;ENST00000441164;ENST00000457968;ENST00000436631;ENST00000295729;ENST00000324264;ENST00000458526	T;T;T;T;T;T;T;T;T;T	0.31510	1.49;1.49;1.49;1.49;1.49;1.49;1.49;1.49;1.49;1.49	5.16	4.01	0.46588	.	0.494256	0.16903	N	0.194809	T	0.19805	0.0476	N	0.19112	0.55	0.25792	N	0.984608	P;P;P	0.38767	0.646;0.589;0.646	B;B;B	0.38378	0.191;0.272;0.191	T	0.08351	-1.0726	10	0.56958	D	0.05	-12.6981	7.5429	0.27748	0.0:0.0741:0.279:0.6469	.	164;110;175	E9PG25;E9PCR1;Q6ZU64	.;.;CC108_HUMAN	F	175;175;175;164;110;109;164;110;110;110;110	ENSP00000340776:L175F;ENSP00000413377:L175F;ENSP00000409117:L175F;ENSP00000386945:L164F;ENSP00000386258:L110F;ENSP00000393483:L164F;ENSP00000396836:L110F;ENSP00000295729:L110F;ENSP00000313807:L110F;ENSP00000413746:L110F	ENSP00000295729:L110F	L	-	1	0	CCDC108	219608465	0.992000	0.36948	0.996000	0.52242	0.914000	0.54420	1.229000	0.32600	0.813000	0.34350	-0.521000	0.04368	CTC	-	NULL		0.488	CCDC108-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCDC108	protein_coding	OTTHUMT00000256598.4	G	NM_194302		219608465	-1	no_errors	NM_194302	genbank	human	provisional	54_36p	missense	SNP	0.53	A
KRTAP10-11	386678	genome.wustl.edu	37	21	46066408	46066408	+	Silent	SNP	C	C	T	rs587690905		TCGA-13-0726-01A-01W-0372-09	TCGA-13-0726-10B-01W-0977-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	201415c2-5b5a-4bb8-8005-bf2c78d4d88e	df694f1a-e6a5-4c06-bf79-5fe57cfcba13	g.chr21:46066408C>T	ENST00000334670.8	+	1	78	c.33C>T	c.(31-33)agC>agT	p.S11S	TSPEAR_ENST00000323084.4_Intron	NM_198692.2	NP_941965.2	P60412	KR10B_HUMAN	keratin associated protein 10-11	11						keratin filament (GO:0045095)		p.S11S(1)		NS(1)|endometrium(1)|large_intestine(1)|lung(6)|ovary(2)|prostate(1)	12						TCTGCTCCAGCGCTTACTCCG	0.672													C|||	1	0.000199681	0.0008	0.0	5008	,	,		14608	0.0		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	21											69.0	74.0	72.0					21																	46066408		2203	4298	6501	44890836	SO:0001819	synonymous_variant	386678			AB076359	CCDS42962.1	21q22.3	2006-03-13	2004-07-12	2004-07-14	ENSG00000243489	ENSG00000243489		"""Keratin associated proteins"""	20528	protein-coding gene	gene with protein product			"""keratin associated protein 10-11"""	KRTAP18-11			Standard	NM_198692		Approved	KRTAP18.11, KAP18.11, KAP10.11	uc002zfr.4	P60412	OTTHUMG00000057626	ENST00000334670.8:c.33C>T	21.37:g.46066408C>T			44890836	A2RRF9	Silent	SNP	HMMPfam_Keratin_B2	p.S11	ENST00000334670.8	37	c.33	CCDS42962.1	21																																																																																			-	HMMPfam_Keratin_B2		0.672	KRTAP10-11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP10-11	protein_coding	OTTHUMT00000128029.1	C	NM_198692		44890836	1	no_errors	NM_198692	genbank	human	validated	54_36p	silent	SNP	0.09	T
ZNF725P	100128853	genome.wustl.edu	37	19	23676019	23676019	+	IGR	SNP	T	T	A			TCGA-13-0726-01A-01W-0372-09	TCGA-13-0726-10B-01W-0977-09	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	201415c2-5b5a-4bb8-8005-bf2c78d4d88e	df694f1a-e6a5-4c06-bf79-5fe57cfcba13	g.chr19:23676019T>A								CTB-175P5.4 (85126 upstream) : ZNF675 (32413 downstream)																							GACTAAAAGCTTTTCTATATT	0.303																																																0			19																																								23467859	SO:0001628	intergenic_variant	100128853																															19.37:g.23676019T>A			23467859		Missense_Mutation	SNP	-	p.K53N		37	c.159		19																																																																																			-	NULL	0	0.303					LOC100128853			T			23467859	-1	pseudogene	XM_001726893	genbank	human	model	54_36p	missense	SNP	0.13	A
ZDHHC23	254887	genome.wustl.edu	37	3	113675209	113675209	+	Nonsense_Mutation	SNP	C	C	G			TCGA-13-0726-01A-01W-0372-09	TCGA-13-0726-10B-01W-0977-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	201415c2-5b5a-4bb8-8005-bf2c78d4d88e	df694f1a-e6a5-4c06-bf79-5fe57cfcba13	g.chr3:113675209C>G	ENST00000330212.3	+	4	1195	c.896C>G	c.(895-897)tCa>tGa	p.S299*	ZDHHC23_ENST00000498275.1_Nonsense_Mutation_p.S293*	NM_173570.3	NP_775841.2	Q8IYP9	ZDH23_HUMAN	zinc finger, DHHC-type containing 23	299					protein localization to plasma membrane (GO:0072659)|protein palmitoylation (GO:0018345)	integral component of membrane (GO:0016021)	protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)	p.S299*(1)		NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(2)|urinary_tract(2)	16						GTTGGAGAATCAAATCATCAA	0.358																																																1	Substitution - Nonsense(1)	ovary(1)	3											221.0	213.0	216.0					3																	113675209		2203	4300	6503	115157899	SO:0001587	stop_gained	254887			AK127025	CCDS33827.1	3q13.31	2008-05-02			ENSG00000184307	ENSG00000184307		"""Zinc fingers, DHHC-type"""	28654	protein-coding gene	gene with protein product						12477932	Standard	NM_173570		Approved	MGC42530	uc003eau.3	Q8IYP9	OTTHUMG00000159335	ENST00000330212.3:c.896C>G	3.37:g.113675209C>G	ENSP00000330485:p.Ser299*		115157899	D3DN76	Nonsense_Mutation	SNP	HMMPfam_zf-DHHC	p.S299*	ENST00000330212.3	37	c.896	CCDS33827.1	3	.	.	.	.	.	.	.	.	.	.	C	38	7.009509	0.97998	.	.	ENSG00000184307	ENST00000330212;ENST00000498275	.	.	.	5.66	4.78	0.61160	.	0.323586	0.33419	N	0.004940	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.41790	T	0.15	-4.1032	11.1588	0.48503	0.1782:0.7052:0.1166:0.0	.	.	.	.	X	299;293	.	ENSP00000330485:S299X	S	+	2	0	ZDHHC23	115157899	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	1.724000	0.38064	1.370000	0.46153	0.655000	0.94253	TCA	-	HMMPfam_zf-DHHC		0.358	ZDHHC23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDHHC23	protein_coding	OTTHUMT00000354702.1	C	NM_173570		115157899	1	no_errors	NM_173570	genbank	human	validated	54_36p	nonsense	SNP	1	G
TOPBP1	11073	genome.wustl.edu	37	3	133362902	133362902	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0726-01A-01W-0372-09	TCGA-13-0726-10B-01W-0977-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	201415c2-5b5a-4bb8-8005-bf2c78d4d88e	df694f1a-e6a5-4c06-bf79-5fe57cfcba13	g.chr3:133362902C>T	ENST00000260810.5	-	11	1941	c.1810G>A	c.(1810-1812)Gaa>Aaa	p.E604K	TOPBP1_ENST00000511439.1_5'Flank	NM_007027.3	NP_008958.2	Q92547	TOPB1_HUMAN	topoisomerase (DNA) II binding protein 1	604	BRCT 4. {ECO:0000255|PROSITE- ProRule:PRU00033}.				cellular response to DNA damage stimulus (GO:0006974)|DNA metabolic process (GO:0006259)|DNA repair (GO:0006281)|response to ionizing radiation (GO:0010212)	chromosome (GO:0005694)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|male germ cell nucleus (GO:0001673)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)	p.E517K(1)		breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(5)|lung(14)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	40						ACAGTGGCTTCCACTTCACAC	0.428								Other conserved DNA damage response genes																													Ovarian(21;193 658 4424 15423 17362)											1	Substitution - Missense(1)	ovary(1)	3											90.0	87.0	88.0					3																	133362902		1937	4152	6089	134845592	SO:0001583	missense	11073			AB019397	CCDS46919.1	3q22.1	2004-06-21			ENSG00000163781	ENSG00000163781			17008	protein-coding gene	gene with protein product		607760				9461304, 9039502	Standard	NM_007027		Approved	KIAA0259, TOP2BP1	uc003eps.3	Q92547	OTTHUMG00000159773	ENST00000260810.5:c.1810G>A	3.37:g.133362902C>T	ENSP00000260810:p.Glu604Lys		134845592	B7Z7W8|Q7LGC1|Q9UEB9	Missense_Mutation	SNP	HMMPfam_BRCT;superfamily_Uteroglobin-like;superfamily_BRCT domain	p.E517K	ENST00000260810.5	37	c.1549	CCDS46919.1	3	.	.	.	.	.	.	.	.	.	.	C	15.69	2.908062	0.52333	.	.	ENSG00000163781	ENST00000260810	T	0.11604	2.76	5.72	3.94	0.45596	BRCT (2);	0.139458	0.64402	N	0.000005	T	0.08626	0.0214	L	0.41710	1.295	0.46631	D	0.999132	B	0.23591	0.088	B	0.27170	0.077	T	0.12708	-1.0537	10	0.08837	T	0.75	.	9.0703	0.36488	0.0:0.7322:0.1298:0.1379	.	604	Q92547	TOPB1_HUMAN	K	604	ENSP00000260810:E604K	ENSP00000260810:E604K	E	-	1	0	TOPBP1	134845592	1.000000	0.71417	0.930000	0.37139	0.365000	0.29674	2.805000	0.47939	0.781000	0.33589	0.591000	0.81541	GAA	-	HMMPfam_BRCT		0.428	TOPBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOPBP1	protein_coding	OTTHUMT00000357254.1	C	NM_007027		134845592	-1	no_errors	NM_007027	genbank	human	reviewed	54_36p	missense	SNP	1	T
BRPF1	7862	genome.wustl.edu	37	3	9783744	9783744	+	Silent	SNP	G	G	T			TCGA-13-0726-01A-01W-0372-09	TCGA-13-0726-10B-01W-0977-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	201415c2-5b5a-4bb8-8005-bf2c78d4d88e	df694f1a-e6a5-4c06-bf79-5fe57cfcba13	g.chr3:9783744G>T	ENST00000457855.1	+	5	1901	c.1890G>T	c.(1888-1890)ctG>ctT	p.L630L	BRPF1_ENST00000424362.1_Silent_p.L630L|BRPF1_ENST00000383829.2_Silent_p.L630L|BRPF1_ENST00000433861.2_Silent_p.L630L|BRPF1_ENST00000302054.3_Silent_p.L630L			P55201	BRPF1_HUMAN	bromodomain and PHD finger containing, 1	630	Interaction with MEAF6 and ING5.|Required for RUNX1 and RUNX2 transcriptional activation.				chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.L630L(1)		central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(8)|lung(15)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	49	Medulloblastoma(99;0.227)					AGATGCAGCTGACTCCTTTCC	0.532																																																1	Substitution - coding silent(1)	ovary(1)	3											82.0	77.0	79.0					3																	9783744		2203	4300	6503	9758744	SO:0001819	synonymous_variant	7862			M91585	CCDS2575.1, CCDS33692.1	3p26-p25	2008-07-18			ENSG00000156983	ENSG00000156983			14255	protein-coding gene	gene with protein product	"""peregrin"", ""bromodomain-containing protein, 140kD"""	602410				8946209, 7906940	Standard	NM_001003694		Approved	BR140	uc003bsf.3	P55201	OTTHUMG00000097033	ENST00000457855.1:c.1890G>T	3.37:g.9783744G>T			9758744	B4DEZ6|Q7Z6E0|Q8TCM6|Q9UHI0	Silent	SNP	HMMPfam_PWWP;HMMPfam_Bromodomain;HMMPfam_PHD;superfamily_FYVE/PHD zinc finger;superfamily_Bromodomain;superfamily_C2H2 and C2HC zinc fingers;superfamily_Tudor/PWWP/MBT	p.L630	ENST00000457855.1	37	c.1890	CCDS2575.1	3																																																																																			-	NULL		0.532	BRPF1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BRPF1	protein_coding	OTTHUMT00000338485.1	G	NM_001003694		9758744	1	no_errors	NM_001003694	genbank	human	reviewed	54_36p	silent	SNP	1	T
LINC00886	730091	genome.wustl.edu	37	3	156527886	156527886	+	lincRNA	SNP	G	G	A			TCGA-13-0726-01A-01W-0372-09	TCGA-13-0726-10B-01W-0977-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	201415c2-5b5a-4bb8-8005-bf2c78d4d88e	df694f1a-e6a5-4c06-bf79-5fe57cfcba13	g.chr3:156527886G>A	ENST00000472943.1	-	0	148					NR_038387.1				long intergenic non-protein coding RNA 886																		CTTTTTCATGGTCCTTCTTCT	0.463																																																0			3																																								158010580			647033					3q25.31	2013-05-17			ENSG00000240875	ENSG00000240875		"""Long non-coding RNAs"""	48572	non-coding RNA	RNA, long non-coding							Standard	NR_038387		Approved				OTTHUMG00000158647		3.37:g.156527886G>A			158010580		RNA	SNP	-	NULL	ENST00000472943.1	37	NULL		3																																																																																			-	-		0.463	LINC00886-001	KNOWN	basic	lincRNA	PA2G4P4	lincRNA	OTTHUMT00000351622.1	G			158010580	-1	pseudogene	NR_003284	genbank	human	provisional	54_36p	rna	SNP	1	A
AGXT2	64902	genome.wustl.edu	37	5	35003915	35003915	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0726-01A-01W-0372-09	TCGA-13-0726-10B-01W-0977-09	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	201415c2-5b5a-4bb8-8005-bf2c78d4d88e	df694f1a-e6a5-4c06-bf79-5fe57cfcba13	g.chr5:35003915A>G	ENST00000231420.6	-	13	1590	c.1390T>C	c.(1390-1392)Tgc>Cgc	p.C464R		NM_031900.3	NP_114106.1	Q9BYV1	AGT2_HUMAN	alanine--glyoxylate aminotransferase 2	464					cellular nitrogen compound metabolic process (GO:0034641)|glycine biosynthetic process, by transamination of glyoxylate (GO:0019265)|glyoxylate catabolic process (GO:0009436)|glyoxylate metabolic process (GO:0046487)|L-alanine catabolic process, by transamination (GO:0019481)|nucleobase-containing small molecule metabolic process (GO:0055086)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	(R)-3-amino-2-methylpropionate-pyruvate transaminase activity (GO:0047305)|alanine-glyoxylate transaminase activity (GO:0008453)|beta-alanine-pyruvate transaminase activity (GO:0016223)|pyridoxal phosphate binding (GO:0030170)	p.C464R(1)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(18)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	41	all_lung(31;4.52e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)	GBM - Glioblastoma multiforme(108;0.181)	Glycine(DB00145)|L-Alanine(DB00160)|Pyruvic acid(DB00119)	ATGTGCTTGCAGTCCTCATGG	0.413											OREG0016558	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	5											141.0	136.0	138.0					5																	35003915		2203	4300	6503	35039672	SO:0001583	missense	64902			AJ292204	CCDS3908.1	5p13	2010-05-07	2010-05-07		ENSG00000113492	ENSG00000113492	2.6.1.44		14412	protein-coding gene	gene with protein product	"""beta-alanine-pyruvate aminotransferase"", ""beta-ALAAT II"""	612471	"""alanine-glyoxylate aminotransferase 2"""			15240345	Standard	NM_031900		Approved	AGT2	uc003jjf.3	Q9BYV1	OTTHUMG00000090788	ENST00000231420.6:c.1390T>C	5.37:g.35003915A>G	ENSP00000231420:p.Cys464Arg	852	35039672	B7ZM47|E9PDL7|Q53FB4|Q53FY7|Q53G03|Q5W7Q1	Missense_Mutation	SNP	HMMPfam_Aminotran_3;superfamily_PLP-dependent transferases	p.C464R	ENST00000231420.6	37	c.1390	CCDS3908.1	5	.	.	.	.	.	.	.	.	.	.	A	10.55	1.380618	0.24944	.	.	ENSG00000113492	ENST00000231420	T	0.19938	2.11	5.58	5.58	0.84498	Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.345266	0.37095	N	0.002250	T	0.52435	0.1734	M	0.89715	3.055	0.80722	D	1	D;P	0.76494	0.999;0.956	D;P	0.83275	0.996;0.499	T	0.57757	-0.7756	10	0.32370	T	0.25	-7.9195	13.9861	0.64337	1.0:0.0:0.0:0.0	.	389;464	E9PDL7;Q9BYV1	.;AGT2_HUMAN	R	464	ENSP00000231420:C464R	ENSP00000231420:C464R	C	-	1	0	AGXT2	35039672	1.000000	0.71417	1.000000	0.80357	0.147000	0.21601	4.004000	0.57068	2.111000	0.64477	0.533000	0.62120	TGC	-	NULL		0.413	AGXT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGXT2	protein_coding	OTTHUMT00000207574.2	A	NM_031900		35039672	-1	no_errors	NM_031900	genbank	human	reviewed	54_36p	missense	SNP	1	G
CTNNA1	1495	genome.wustl.edu	37	5	138118935	138118935	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0726-01A-01W-0372-09	TCGA-13-0726-10B-01W-0977-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	201415c2-5b5a-4bb8-8005-bf2c78d4d88e	df694f1a-e6a5-4c06-bf79-5fe57cfcba13	g.chr5:138118935C>T	ENST00000302763.7	+	3	265	c.175C>T	c.(175-177)Cat>Tat	p.H59Y	CTNNA1_ENST00000355078.5_Intron|CTNNA1_ENST00000518825.1_Missense_Mutation_p.H59Y	NM_001903.2	NP_001894.2	P35221	CTNA1_HUMAN	catenin (cadherin-associated protein), alpha 1, 102kDa	59	Involved in homodimerization.				adherens junction organization (GO:0034332)|aging (GO:0007568)|apical junction assembly (GO:0043297)|axon regeneration (GO:0031103)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular protein localization (GO:0034613)|cellular response to indole-3-methanol (GO:0071681)|epithelial cell-cell adhesion (GO:0090136)|establishment or maintenance of cell polarity (GO:0007163)|gap junction assembly (GO:0016264)|male gonad development (GO:0008584)|muscle cell differentiation (GO:0042692)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell motility (GO:2000146)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of integrin-mediated signaling pathway (GO:2001045)|negative regulation of neuroblast proliferation (GO:0007406)|odontogenesis of dentin-containing tooth (GO:0042475)|ovarian follicle development (GO:0001541)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of smoothened signaling pathway (GO:0045880)|protein heterooligomerization (GO:0051291)|response to estrogen (GO:0043627)	acrosomal vesicle (GO:0001669)|actin cytoskeleton (GO:0015629)|catenin complex (GO:0016342)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|intercalated disc (GO:0014704)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|zonula adherens (GO:0005915)	beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|gamma-catenin binding (GO:0045295)|poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)|vinculin binding (GO:0017166)	p.H59Y(1)		NS(1)|breast(7)|cervix(2)|endometrium(4)|kidney(6)|large_intestine(16)|lung(9)|oesophagus(2)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	52			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			TAAGAAGGCCCATGTTTTGGC	0.418																																																1	Substitution - Missense(1)	ovary(1)	5											82.0	80.0	81.0					5																	138118935		2203	4300	6503	138146834	SO:0001583	missense	1495			D13866	CCDS34243.1, CCDS75315.1	5q31.2	2008-02-05	2002-08-29			ENSG00000044115			2509	protein-coding gene	gene with protein product		116805	"""catenin (cadherin-associated protein), alpha 1 (102kD)"""			1924379	Standard	XM_005271898		Approved	CAP102	uc003ldh.3	P35221		ENST00000302763.7:c.175C>T	5.37:g.138118935C>T	ENSP00000304669:p.His59Tyr		138146834	Q12795|Q8N1C0	Missense_Mutation	SNP	HMMPfam_Vinculin;superfamily_alpha-catenin/vinculin	p.H59Y	ENST00000302763.7	37	c.175	CCDS34243.1	5	.	.	.	.	.	.	.	.	.	.	C	26.4	4.733541	0.89482	.	.	ENSG00000044115	ENST00000517980;ENST00000522227;ENST00000524127;ENST00000523912;ENST00000520339;ENST00000302763;ENST00000537034;ENST00000541863;ENST00000518245;ENST00000519113;ENST00000520158;ENST00000518825	T;T;T;T;T;T;T;T;T;T	0.41758	1.19;1.19;1.19;1.58;1.19;1.19;0.99;1.58;1.19;1.19	5.71	5.71	0.89125	.	0.046570	0.85682	D	0.000000	T	0.48786	0.1519	L	0.59436	1.845	0.80722	D	1	P;P	0.49253	0.921;0.887	B;P	0.45037	0.401;0.467	T	0.51044	-0.8755	10	0.59425	D	0.04	-6.4865	19.4583	0.94904	0.0:1.0:0.0:0.0	.	59;59	G3XAM7;P35221	.;CTNA1_HUMAN	Y	59	ENSP00000428439:H59Y;ENSP00000429636:H59Y;ENSP00000428049:H59Y;ENSP00000430304:H59Y;ENSP00000428202:H59Y;ENSP00000304669:H59Y;ENSP00000428457:H59Y;ENSP00000430078:H59Y;ENSP00000429457:H59Y;ENSP00000427821:H59Y	ENSP00000304669:H59Y	H	+	1	0	CTNNA1	138146834	1.000000	0.71417	0.997000	0.53966	0.984000	0.73092	7.776000	0.85560	2.704000	0.92352	0.561000	0.74099	CAT	-	HMMPfam_Vinculin		0.418	CTNNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTNNA1	protein_coding	OTTHUMT00000373868.1	C	NM_001903		138146834	1	no_errors	NM_001903	genbank	human	validated	54_36p	missense	SNP	1	T
GABBR1	2550	genome.wustl.edu	37	6	29577125	29577125	+	Silent	SNP	G	G	C			TCGA-13-0726-01A-01W-0372-09	TCGA-13-0726-10B-01W-0977-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	201415c2-5b5a-4bb8-8005-bf2c78d4d88e	df694f1a-e6a5-4c06-bf79-5fe57cfcba13	g.chr6:29577125G>C	ENST00000377034.4	-	15	2075	c.1740C>G	c.(1738-1740)gtC>gtG	p.V580V	GABBR1_ENST00000377012.4_Silent_p.V463V|GABBR1_ENST00000376977.3_Intron|GABBR1_ENST00000355973.3_Silent_p.V463V|GABBR1_ENST00000377016.4_Silent_p.V518V	NM_001470.2	NP_001461.1	Q9UBS5	GABR1_HUMAN	gamma-aminobutyric acid (GABA) B receptor, 1	580					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|gamma-aminobutyric acid signaling pathway (GO:0007214)|negative regulation of adenylate cyclase activity (GO:0007194)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|G-protein coupled receptor heterodimeric complex (GO:0038039)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	G-protein coupled GABA receptor activity (GO:0004965)	p.V580V(1)		endometrium(3)|kidney(1)|large_intestine(13)|liver(1)|lung(16)|ovary(5)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47					Baclofen(DB00181)|Progabide(DB00837)|Vigabatrin(DB01080)	ATGTCTTGATGACCAGGGTCT	0.537																																																1	Substitution - coding silent(1)	ovary(1)	6											97.0	80.0	86.0					6																	29577125		1509	2709	4218	29685104	SO:0001819	synonymous_variant	2550			Y11044	CCDS4663.1, CCDS4664.1, CCDS4665.1	6p21.3	2012-08-29			ENSG00000204681	ENSG00000204681		"""GABA receptors"", ""GPCR / Class C : GABA(B) receptors"""	4070	protein-coding gene	gene with protein product	"""GABA-B receptor"""	603540				9753614, 9798068	Standard	NM_001470		Approved	hGB1a, GPRC3A	uc003nmt.4	Q9UBS5	OTTHUMG00000031095	ENST00000377034.4:c.1740C>G	6.37:g.29577125G>C			29685104	B0UXY7|O95375|O95468|O95975|O96022|Q5STL4|Q5SUJ8|Q5SUL3|Q71SG6|Q86W60|Q9UQQ0	Silent	SNP	HMMPfam_7tm_3;HMMPfam_Sushi;HMMPfam_ANF_receptor;superfamily_Periplasmic binding protein-like I;superfamily_Complement control module/SCR domain	p.V580	ENST00000377034.4	37	c.1740	CCDS4663.1	6																																																																																			-	NULL		0.537	GABBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABBR1	protein_coding	OTTHUMT00000076141.3	G			29685104	-1	no_errors	NM_001470	genbank	human	reviewed	54_36p	silent	SNP	1	C
DDR1	780	genome.wustl.edu	37	6	30863207	30863207	+	Missense_Mutation	SNP	C	C	T	rs140223039		TCGA-13-0726-01A-01W-0372-09	TCGA-13-0726-10B-01W-0977-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	201415c2-5b5a-4bb8-8005-bf2c78d4d88e	df694f1a-e6a5-4c06-bf79-5fe57cfcba13	g.chr6:30863207C>T	ENST00000324771.8	+	14	2088	c.1540C>T	c.(1540-1542)Cgc>Tgc	p.R514C	DDR1_ENST00000376567.2_Intron|DDR1_ENST00000376570.4_Intron|DDR1_ENST00000376568.3_Missense_Mutation_p.R514C|DDR1_ENST00000361741.4_Silent_p.T217T|DDR1_ENST00000376569.3_Intron|DDR1_ENST00000508312.1_Intron|DDR1_ENST00000446312.1_Intron|DDR1_ENST00000513240.1_Missense_Mutation_p.R514C|DDR1_ENST00000454612.2_Intron|DDR1_ENST00000452441.1_Missense_Mutation_p.R514C|DDR1_ENST00000376575.3_Missense_Mutation_p.R514C|DDR1_ENST00000418800.2_Intron			Q08345	DDR1_HUMAN	discoidin domain receptor tyrosine kinase 1	514	Gly/Pro-rich.				branching involved in mammary gland duct morphogenesis (GO:0060444)|cell adhesion (GO:0007155)|collagen-activated tyrosine kinase receptor signaling pathway (GO:0038063)|ear development (GO:0043583)|embryo implantation (GO:0007566)|extracellular matrix organization (GO:0030198)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine autophosphorylation (GO:0038083)|protein autophosphorylation (GO:0046777)|regulation of cell growth (GO:0001558)|regulation of cell-matrix adhesion (GO:0001952)|regulation of extracellular matrix disassembly (GO:0010715)|smooth muscle cell migration (GO:0014909)|smooth muscle cell-matrix adhesion (GO:0061302)|wound healing, spreading of cells (GO:0044319)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|collagen binding (GO:0005518)|metal ion binding (GO:0046872)|protein tyrosine kinase collagen receptor activity (GO:0038062)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.R514C(1)		central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(14)|ovary(1)|prostate(1)|skin(1)	29					Imatinib(DB00619)	TCCAGCCTACCGCCTCCTTCT	0.652																																																1	Substitution - Missense(1)	ovary(1)	6						C	,,,,CYS/ARG,CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	153.0	158.0	156.0		,,,,1540,1540	4.2	1.0	6	dbSNP_134	156	2,8598	2.2+/-6.3	0,2,4298	yes	intron,intron,intron,intron,missense,missense	DDR1	NM_001202521.1,NM_001202522.1,NM_001202523.1,NM_001954.4,NM_013993.2,NM_013994.2	,,,,180,180	0,3,6500	TT,TC,CC		0.0233,0.0227,0.0231	,,,,probably-damaging,probably-damaging	,,,,514/914,514/920	30863207	3,13003	2203	4300	6503	30971186	SO:0001583	missense	780			X99031	CCDS4690.1, CCDS34385.1, CCDS47396.1, CCDS56411.1, CCDS75419.1	6p21.33	2010-02-17	2008-01-23		ENSG00000204580	ENSG00000204580	2.7.10.1	"""CD molecules"""	2730	protein-coding gene	gene with protein product		600408	"""discoidin domain receptor family, member 1"""	NTRK4, PTK3A, NEP, CAK, EDDR1		7789998	Standard	NM_001954		Approved	RTK6, CD167	uc003nrv.3	Q08345	OTTHUMG00000031236	ENST00000324771.8:c.1540C>T	6.37:g.30863207C>T	ENSP00000318217:p.Arg514Cys		30971186	B5A975|B5A976|B7Z2K0|Q14196|Q16562|Q2L6H3|Q4LE50|Q5ST11|Q5ST12|Q6NSK4|Q9UD35|Q9UD36|Q9UD37|Q9UD86|Q9UDL2	Missense_Mutation	SNP	F5_F8_type_C;HMMPfam_F5_F8_type_C;Pkinase_Tyr;HMMPfam_Pkinase_Tyr	p.R514C	ENST00000324771.8	37	c.1540	CCDS34385.1	6	.	.	.	.	.	.	.	.	.	.	C	21.3	4.135205	0.77662	2.27E-4	2.33E-4	ENSG00000204580	ENST00000324771;ENST00000376575;ENST00000376568;ENST00000452441;ENST00000513240	D;D;D;D;D	0.85773	-1.91;-2.03;-1.91;-1.91;-2.03	5.1	4.22	0.49857	.	0.285530	0.34223	N	0.004146	T	0.72622	0.3483	N	0.08118	0	0.80722	D	1	D;D	0.76494	0.999;0.988	P;B	0.54924	0.764;0.353	T	0.79569	-0.1749	10	0.54805	T	0.06	.	13.2991	0.60315	0.0:0.8397:0.1603:0.0	.	514;514	Q08345-5;Q08345	.;DDR1_HUMAN	C	514	ENSP00000318217:R514C;ENSP00000365759:R514C;ENSP00000365752:R514C;ENSP00000405039:R514C;ENSP00000427552:R514C	ENSP00000318217:R514C	R	+	1	0	DDR1	30971186	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.077000	0.57598	1.133000	0.42147	0.460000	0.39030	CGC	-	NULL		0.652	DDR1-005	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	DDR1	protein_coding	OTTHUMT00000076494.3	C	NM_013994		30971186	1	no_errors	NM_013994	genbank	human	reviewed	54_36p	missense	SNP	1	T
MDN1	23195	genome.wustl.edu	37	6	90409321	90409321	+	Splice_Site	SNP	T	T	A			TCGA-13-0726-01A-01W-0372-09	TCGA-13-0726-10B-01W-0977-09	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	201415c2-5b5a-4bb8-8005-bf2c78d4d88e	df694f1a-e6a5-4c06-bf79-5fe57cfcba13	g.chr6:90409321T>A	ENST00000369393.3	-	58	9111	c.8996A>T	c.(8995-8997)aAg>aTg	p.K2999M	MDN1_ENST00000428876.1_Splice_Site_p.K2999M			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	2999					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)	p.K2999M(1)		NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		GATTTTTACCTTCTGATGATG	0.358																																																1	Substitution - Missense(1)	ovary(1)	6											160.0	152.0	155.0					6																	90409321		2203	4300	6503	90466042	SO:0001630	splice_region_variant	23195			AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.8997+1A>T	6.37:g.90409321T>A			90466042	O15019|Q5T794	Missense_Mutation	SNP	-	p.K2999M	ENST00000369393.3	37	c.8996	CCDS5024.1	6	.	.	.	.	.	.	.	.	.	.	T	3.233	-0.156967	0.06544	.	.	ENSG00000112159	ENST00000369393;ENST00000428876	T;T	0.03831	3.79;3.79	5.77	0.195	0.15151	.	0.664334	0.16133	N	0.228115	T	0.00845	0.0028	N	0.14661	0.345	0.53688	D	0.999971	B	0.22480	0.07	B	0.15870	0.014	T	0.48019	-0.9071	10	0.46703	T	0.11	.	1.3173	0.02110	0.2351:0.1361:0.1218:0.507	.	2999	Q9NU22	MDN1_HUMAN	M	2999	ENSP00000358400:K2999M;ENSP00000413970:K2999M	ENSP00000358400:K2999M	K	-	2	0	MDN1	90466042	0.917000	0.31117	0.521000	0.27850	0.119000	0.20118	1.119000	0.31258	0.155000	0.19261	-0.264000	0.10439	AAG	-	NULL		0.358	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	MDN1	protein_coding	OTTHUMT00000041514.2	T		Missense_Mutation	90466042	-1	no_errors	NM_014611	genbank	human	provisional	54_36p	missense	SNP	0.11	A
PTPRK	5796	genome.wustl.edu	37	6	128505586	128505586	+	Nonsense_Mutation	SNP	T	T	A			TCGA-13-0726-01A-01W-0372-09	TCGA-13-0726-10B-01W-0977-09	T	T	A	T	T	T	Unknown	Valid	Somatic	Phase_III	Capture	454_PCR_WGA		dbGAP	Illumina GAIIx	201415c2-5b5a-4bb8-8005-bf2c78d4d88e	df694f1a-e6a5-4c06-bf79-5fe57cfcba13	g.chr6:128505586T>A	ENST00000368215.3	-	7	1152	c.1153A>T	c.(1153-1155)Aaa>Taa	p.K385*	PTPRK_ENST00000368227.3_Nonsense_Mutation_p.K385*|PTPRK_ENST00000368213.5_Nonsense_Mutation_p.K385*|PTPRK_ENST00000524481.1_5'UTR|PTPRK_ENST00000532331.1_Nonsense_Mutation_p.K385*|PTPRK_ENST00000368207.3_Nonsense_Mutation_p.K385*|PTPRK_ENST00000368210.3_Nonsense_Mutation_p.K385*|PTPRK_ENST00000368226.4_Nonsense_Mutation_p.K385*			Q15262	PTPRK_HUMAN	protein tyrosine phosphatase, receptor type, K	385	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to reactive oxygen species (GO:0034614)|cellular response to UV (GO:0034644)|focal adhesion assembly (GO:0048041)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of keratinocyte proliferation (GO:0010839)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|protein localization to cell surface (GO:0034394)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)	axon (GO:0030424)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|leading edge membrane (GO:0031256)|neuronal cell body (GO:0043025)|photoreceptor outer segment (GO:0001750)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.K385*(1)	PTPRK/RSPO3(10)	autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(14)|lung(24)|ovary(3)|pancreas(1)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	72				all cancers(137;0.0118)|GBM - Glioblastoma multiforme(226;0.0372)|OV - Ovarian serous cystadenocarcinoma(136;0.24)		CCTGCACATTTTGTTCTGGTG	0.433																																																1	Substitution - Nonsense(1)	ovary(1)	6											76.0	67.0	70.0					6																	128505586		2203	4300	6503	128547279	SO:0001587	stop_gained	5796			L77886	CCDS5137.1, CCDS47473.1, CCDS75517.1	6q22.2-q22.3	2013-02-11			ENSG00000152894	ENSG00000152894		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9674	protein-coding gene	gene with protein product		602545				9047348, 8663237	Standard	NM_002844		Approved	R-PTP-kappa	uc010kfc.3	Q15262	OTTHUMG00000015536	ENST00000368215.3:c.1153A>T	6.37:g.128505586T>A	ENSP00000357198:p.Lys385*		128547279	B2RTQ8|B7ZMG0|Q14763|Q5TG10|Q5TG11	Nonsense_Mutation	SNP	superfamily_Fibronectin type III;superfamily_Immunoglobulin;superfamily_(Phosphotyrosine protein) phosphatases II;HMMPfam_Y_phosphatase;HMMPfam_MAM;HMMPfam_fn3;HMMPfam_ig	p.K385*	ENST00000368215.3	37	c.1153		6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	37|37	6.320927|6.320927	0.97471|0.97471	.|.	.|.	ENSG00000152894|ENSG00000152894	ENST00000368226;ENST00000368227;ENST00000532331;ENST00000368213;ENST00000368210;ENST00000368215;ENST00000368207;ENST00000427676|ENST00000490332	.|.	.|.	.|.	5.49|5.49	5.49|5.49	0.81192|0.81192	.|.	0.057427|.	0.64402|.	D|.	0.000002|.	.|T	.|0.63177	.|0.2489	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.64976	.|-0.6280	.|3	0.02654|.	T|.	1|.	.|.	15.5912|15.5912	0.76530|0.76530	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|.	.|.	.|.	X|H	385;385;385;385;385;385;385;242|201	.|.	ENSP00000357190:K385X|.	K|Q	-|-	1|3	0|2	PTPRK|PTPRK	128547279|128547279	1.000000|1.000000	0.71417|0.71417	0.993000|0.993000	0.49108|0.49108	0.994000|0.994000	0.84299|0.84299	8.040000|8.040000	0.89188|0.89188	2.084000|2.084000	0.62774|0.62774	0.533000|0.533000	0.62120|0.62120	AAA|CAA	-	NULL		0.433	PTPRK-005	KNOWN	basic|appris_candidate	protein_coding	PTPRK	protein_coding	OTTHUMT00000042163.1	T			128547279	-1	no_errors	NM_002844	genbank	human	validated	54_36p	nonsense	SNP	1	A
ABCA13	154664	genome.wustl.edu	37	7	48285544	48285544	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0726-01A-01W-0372-09	TCGA-13-0726-10B-01W-0977-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	201415c2-5b5a-4bb8-8005-bf2c78d4d88e	df694f1a-e6a5-4c06-bf79-5fe57cfcba13	g.chr7:48285544G>T	ENST00000435803.1	+	13	1600	c.1576G>T	c.(1576-1578)Ggt>Tgt	p.G526C		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	526					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.G471C(1)		breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						CAGCATATGGGGTGGTCTCCA	0.453																																																1	Substitution - Missense(1)	ovary(1)	7											82.0	77.0	78.0					7																	48285544		1876	4108	5984	48256090	SO:0001583	missense	154664			AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.1576G>T	7.37:g.48285544G>T	ENSP00000411096:p.Gly526Cys		48256090	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	HMMPfam_ABC_tran;superfamily_P-loop containing nucleoside triphosphate hydrolases	p.G471C	ENST00000435803.1	37	c.1411	CCDS47584.1	7	.	.	.	.	.	.	.	.	.	.	G	11.40	1.628166	0.28978	.	.	ENSG00000179869	ENST00000435803	D	0.88124	-2.34	4.96	0.347	0.16022	.	1.069320	0.07371	N	0.885869	T	0.73329	0.3573	N	0.08118	0	0.21719	N	0.999573	B	0.25955	0.138	B	0.24541	0.054	T	0.63010	-0.6732	10	0.72032	D	0.01	.	6.2628	0.20910	0.5637:0.0:0.4363:0.0	.	526	Q86UQ4	ABCAD_HUMAN	C	526	ENSP00000411096:G526C	ENSP00000411096:G526C	G	+	1	0	ABCA13	48256090	0.010000	0.17322	0.003000	0.11579	0.034000	0.12701	0.638000	0.24674	0.128000	0.18479	0.655000	0.94253	GGT	-	NULL		0.453	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA13	protein_coding	OTTHUMT00000341964.2	G	NM_152701		48256090	1	no_start_codon	ENST00000319379	ensembl	human	known	54_36p	missense	SNP	0.01	T
RRM2B	50484	genome.wustl.edu	37	8	103236326	103236326	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0726-01A-01W-0372-09	TCGA-13-0726-10B-01W-0977-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	201415c2-5b5a-4bb8-8005-bf2c78d4d88e	df694f1a-e6a5-4c06-bf79-5fe57cfcba13	g.chr8:103236326C>G	ENST00000251810.3	-	5	741	c.498G>C	c.(496-498)aaG>aaC	p.K166N	RRM2B_ENST00000519962.1_Intron|RRM2B_ENST00000395912.2_Missense_Mutation_p.K114N|RRM2B_ENST00000519317.1_Intron	NM_001172478.1|NM_015713.4	NP_001165949.1|NP_056528.2	Q7LG56	RIR2B_HUMAN	ribonucleotide reductase M2 B (TP53 inducible)	166					deoxyribonucleoside diphosphate metabolic process (GO:0009186)|deoxyribonucleoside triphosphate metabolic process (GO:0009200)|deoxyribonucleotide biosynthetic process (GO:0009263)|DNA repair (GO:0006281)|kidney development (GO:0001822)|mitochondrial DNA replication (GO:0006264)|negative regulation of intrinsic apoptotic signaling pathway by p53 class mediator (GO:1902254)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|renal system process (GO:0003014)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|ribonucleoside-diphosphate reductase activity, thioredoxin disulfide as acceptor (GO:0004748)	p.K166N(1)		breast(1)|endometrium(1)|large_intestine(1)|lung(3)|ovary(2)|upper_aerodigestive_tract(1)	9	all_cancers(14;8e-07)|all_epithelial(15;2.18e-08)|Lung NSC(17;2.55e-05)|all_lung(17;8.85e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000728)		Cladribine(DB00242)	CTGCTTTTTTCTTAACATAGG	0.313								Modulation of nucleotide pools																																								1	Substitution - Missense(1)	ovary(1)	8											168.0	176.0	173.0					8																	103236326		2203	4300	6503	103305502	SO:0001583	missense	50484			AB036532	CCDS34932.1, CCDS55267.1	8q23.1	2014-09-17			ENSG00000048392	ENSG00000048392			17296	protein-coding gene	gene with protein product		604712				10716435, 10980602, 17486094	Standard	NM_015713		Approved	p53R2	uc022azl.1	Q7LG56	OTTHUMG00000164776	ENST00000251810.3:c.498G>C	8.37:g.103236326C>G	ENSP00000251810:p.Lys166Asn		103305502	B4E2N4|Q17R22|Q75PQ6|Q75PQ7|Q75PY8|Q75PY9|Q86YE3|Q9NPD6|Q9NTD8|Q9NUW3	Missense_Mutation	SNP	HMMPfam_Ribonuc_red_sm;superfamily_Ferritin-like	p.K166N	ENST00000251810.3	37	c.498	CCDS34932.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.47|16.47	3.132124|3.132124	0.56828|0.56828	.|.	.|.	ENSG00000048392|ENSG00000048392	ENST00000522368|ENST00000251810;ENST00000535248;ENST00000395912	.|D;D	.|0.97731	.|-4.51;-4.51	5.36|5.36	5.36|5.36	0.76844|0.76844	.|Ferritin/ribonucleotide reductase-like (1);Ribonucleotide reductase-related (1);	.|0.142496	.|0.64402	.|D	.|0.000004	D|D	0.98451|0.98451	0.9484|0.9484	H|H	0.98256|0.98256	4.185|4.185	0.80722|0.80722	D|D	1|1	.|B;B	.|0.25105	.|0.118;0.083	.|B;B	.|0.23150	.|0.044;0.03	D|D	0.97718|0.97718	1.0195|1.0195	5|10	.|0.72032	.|D	.|0.01	.|.	19.4331|19.4331	0.94779|0.94779	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|114;166	.|Q7LG56-2;Q7LG56	.|.;RIR2B_HUMAN	Q|N	223|166;112;114	.|ENSP00000251810:K166N;ENSP00000379248:K114N	.|ENSP00000251810:K166N	E|K	-|-	1|3	0|2	RRM2B|RRM2B	103305502|103305502	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	2.277000|2.277000	0.43417|0.43417	2.658000|2.658000	0.90341|0.90341	0.650000|0.650000	0.86243|0.86243	GAA|AAG	-	HMMPfam_Ribonuc_red_sm		0.313	RRM2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RRM2B	protein_coding	OTTHUMT00000380191.3	C			103305502	-1	no_errors	NM_015713	genbank	human	validated	54_36p	missense	SNP	1	G
TERF1	7013	genome.wustl.edu	37	8	73937056	73937056	+	Splice_Site	SNP	G	G	A			TCGA-13-0726-01A-01W-0372-09	TCGA-13-0726-10B-01W-0977-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	201415c2-5b5a-4bb8-8005-bf2c78d4d88e	df694f1a-e6a5-4c06-bf79-5fe57cfcba13	g.chr8:73937056G>A	ENST00000276603.5	+	5	647		c.e5-1		TERF1_ENST00000276602.6_Splice_Site	NM_017489.2	NP_059523.2	P54274	TERF1_HUMAN	telomeric repeat binding factor (NIMA-interacting) 1						age-dependent telomere shortening (GO:0001309)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of DNA replication (GO:0008156)|negative regulation of telomerase activity (GO:0051974)|negative regulation of telomere maintenance via semi-conservative replication (GO:0032214)|negative regulation of telomere maintenance via telomerase (GO:0032211)|positive regulation of apoptotic process (GO:0043065)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of mitosis (GO:0045840)|positive regulation of mitotic cell cycle (GO:0045931)|protein homooligomerization (GO:0051260)|response to drug (GO:0042493)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)|telomere maintenance via telomere shortening (GO:0010834)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nuclear telomere cap complex (GO:0000783)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|double-stranded telomeric DNA binding (GO:0003691)|microtubule binding (GO:0008017)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|telomeric DNA binding (GO:0042162)	p.?(1)		central_nervous_system(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	9	Breast(64;0.218)		Epithelial(68;0.0984)			GTTTTCTTTAGCCTTTCAAAA	0.274																																																1	Unknown(1)	ovary(1)	8											100.0	102.0	101.0					8																	73937056		2195	4292	6487	74099610	SO:0001630	splice_region_variant	7013			U74382	CCDS6210.1, CCDS6211.1	8q21.11	2011-05-24			ENSG00000147601	ENSG00000147601			11728	protein-coding gene	gene with protein product		600951		TRBF1		9391075	Standard	NM_003218		Approved	PIN2, TRF1, TRF	uc003xzd.2	P54274	OTTHUMG00000164522	ENST00000276603.5:c.625-1G>A	8.37:g.73937056G>A			74099610	A7XP29|Q15553|Q8NHT6|Q93029	Splice_Site	SNP	-	e5-1	ENST00000276603.5	37	c.625-1	CCDS6211.1	8	.	.	.	.	.	.	.	.	.	.	G	18.89	3.718813	0.68844	.	.	ENSG00000147601	ENST00000276603;ENST00000276602;ENST00000517390	.	.	.	5.77	5.77	0.91146	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.486	0.75569	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TERF1	74099610	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	5.246000	0.65411	2.729000	0.93468	0.655000	0.94253	.	-	-		0.274	TERF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TERF1	protein_coding	OTTHUMT00000379093.1	G	NM_017489	Intron	74099610	1	no_errors	NM_017489	genbank	human	reviewed	54_36p	splice_site	SNP	1	A
ZNF7	7553	genome.wustl.edu	37	8	146068280	146068280	+	Silent	SNP	T	T	C			TCGA-13-0726-01A-01W-0372-09	TCGA-13-0726-10B-01W-0977-09	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	201415c2-5b5a-4bb8-8005-bf2c78d4d88e	df694f1a-e6a5-4c06-bf79-5fe57cfcba13	g.chr8:146068280T>C	ENST00000528372.1	+	5	2028	c.1788T>C	c.(1786-1788)ctT>ctC	p.L596L	ZNF7_ENST00000325217.5_Intron|ZNF7_ENST00000525266.1_Intron|ZNF7_ENST00000544249.1_Silent_p.L500L|ZNF7_ENST00000446747.2_Silent_p.L607L|ZNF7_ENST00000325241.6_Silent_p.L596L			P17097	ZNF7_HUMAN	zinc finger protein 7	596			L -> F (in dbSNP:rs1735170).		multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.L596L(1)		endometrium(2)|kidney(1)|large_intestine(7)|lung(6)|ovary(5)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	all_cancers(97;1.03e-11)|all_epithelial(106;6.69e-11)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)	Breast(495;0.0812)|Ovarian(118;0.0822)|Acute lymphoblastic leukemia(644;0.143)	Epithelial(56;8.75e-39)|OV - Ovarian serous cystadenocarcinoma(54;1.13e-38)|all cancers(56;8.48e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0355)|Colorectal(110;0.055)	GBM - Glioblastoma multiforme(99;2.11e-07)		GCTCATATCTTATTGAACACC	0.463																																																1	Substitution - coding silent(1)	ovary(1)	8											80.0	84.0	83.0					8																	146068280		2203	4300	6503	146039084	SO:0001819	synonymous_variant	7553			AB209619	CCDS6435.1, CCDS64996.1, CCDS64998.1, CCDS64999.1	8q24	2013-01-08	2006-05-09		ENSG00000147789	ENSG00000147789		"""Zinc fingers, C2H2-type"", ""-"""	13139	protein-coding gene	gene with protein product		194531	"""zinc finger protein 7 (KOX 4, clone HF.16)"""			2106481, 1946370	Standard	NM_003416		Approved	KOX4, HF.16	uc003zeg.4	P17097	OTTHUMG00000165200	ENST00000528372.1:c.1788T>C	8.37:g.146068280T>C			146039084	B4DT08|D3DWN6|P17015|Q8N8Y4	Silent	SNP	-	p.L596	ENST00000528372.1	37	c.1788	CCDS6435.1	8																																																																																			-	NULL		0.463	ZNF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF7	protein_coding	OTTHUMT00000382660.1	T	NM_003416		146039084	1	no_errors	NM_003416	genbank	human	validated	54_36p	silent	SNP		C
TTC39B	158219	genome.wustl.edu	37	9	15214172	15214172	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0726-01A-01W-0372-09	TCGA-13-0726-10B-01W-0977-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	201415c2-5b5a-4bb8-8005-bf2c78d4d88e	df694f1a-e6a5-4c06-bf79-5fe57cfcba13	g.chr9:15214172G>T	ENST00000512701.2	-	4	483	c.447C>A	c.(445-447)aaC>aaA	p.N149K	TTC39B_ENST00000582994.1_5'UTR|TTC39B_ENST00000355694.2_Missense_Mutation_p.N83K|TTC39B_ENST00000507285.1_5'UTR|TTC39B_ENST00000297615.5_Intron|TTC39B_ENST00000380850.4_Missense_Mutation_p.N149K|TTC39B_ENST00000541445.1_Missense_Mutation_p.N83K|TTC39B_ENST00000507993.1_5'UTR			Q5VTQ0	TT39B_HUMAN	tetratricopeptide repeat domain 39B	149								p.N83K(1)		NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(7)|ovary(2)|prostate(1)	21						CTGTAAATTTGTTGCTTAGAA	0.368																																																1	Substitution - Missense(1)	ovary(1)	9											116.0	115.0	115.0					9																	15214172		2203	4300	6503	15204172	SO:0001583	missense	158219			AK091187	CCDS6477.1, CCDS6477.2, CCDS55294.1, CCDS55295.1, CCDS55296.1	9p22.2	2013-01-11	2008-06-23	2008-06-23	ENSG00000155158	ENSG00000155158		"""Tetratricopeptide (TTC) repeat domain containing"""	23704	protein-coding gene	gene with protein product		613574	"""chromosome 9 open reading frame 52"""	C9orf52			Standard	NM_001168339		Approved	FLJ33868	uc003zlr.2	Q5VTQ0	OTTHUMG00000019581	ENST00000512701.2:c.447C>A	9.37:g.15214172G>T	ENSP00000422496:p.Asn149Lys		15204172	A5PLN1|B4DQ10|B4DQX4|B4DW93|Q8IVR7|Q8IXZ6|Q8N267	Missense_Mutation	SNP	-	p.N83K	ENST00000512701.2	37	c.249	CCDS6477.2	9	.	.	.	.	.	.	.	.	.	.	G	20.6	4.021913	0.75275	.	.	ENSG00000155158	ENST00000380850;ENST00000355694;ENST00000512701;ENST00000541445	T;T;T;T	0.54479	0.57;0.57;0.57;0.57	5.42	4.29	0.51040	.	0.050039	0.85682	D	0.000000	T	0.71558	0.3354	M	0.87038	2.855	0.49582	D	0.999809	D;D;D;D	0.76494	0.985;0.999;0.999;0.999	D;D;D;D	0.83275	0.933;0.991;0.996;0.996	T	0.74411	-0.3674	10	0.72032	D	0.01	-19.726	7.2681	0.26242	0.2407:0.0:0.7593:0.0	.	149;149;83;83	E9PAQ9;E9PE60;A5PLN1;Q5VTQ0	.;.;.;TT39B_HUMAN	K	149;83;149;83	ENSP00000370231:N149K;ENSP00000347920:N83K;ENSP00000422496:N149K;ENSP00000442880:N83K	ENSP00000347920:N83K	N	-	3	2	TTC39B	15204172	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.317000	0.51968	2.689000	0.91719	0.655000	0.94253	AAC	-	NULL		0.368	TTC39B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TTC39B	protein_coding	OTTHUMT00000051758.3	G	NM_152574		15204172	-1	no_errors	NM_152574	genbank	human	provisional	54_36p	missense	SNP	1	T
DOCK8	81704	genome.wustl.edu	37	9	418118	418118	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0726-01A-01W-0372-09	TCGA-13-0726-10B-01W-0977-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	201415c2-5b5a-4bb8-8005-bf2c78d4d88e	df694f1a-e6a5-4c06-bf79-5fe57cfcba13	g.chr9:418118G>C	ENST00000453981.1	+	30	3863	c.3751G>C	c.(3751-3753)Gga>Cga	p.G1251R	DOCK8_ENST00000382329.1_Missense_Mutation_p.G718R|DOCK8_ENST00000432829.2_Missense_Mutation_p.G1183R|DOCK8_ENST00000469391.1_Missense_Mutation_p.G1151R			Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8	1251					blood coagulation (GO:0007596)|dendritic cell migration (GO:0036336)|immunological synapse formation (GO:0001771)|memory T cell proliferation (GO:0061485)|negative regulation of T cell apoptotic process (GO:0070233)|small GTPase mediated signal transduction (GO:0007264)	cell leading edge (GO:0031252)|cytosol (GO:0005829)|membrane (GO:0016020)	guanyl-nucleotide exchange factor activity (GO:0005085)	p.G1183R(1)		breast(1)|central_nervous_system(5)|endometrium(2)|kidney(6)|large_intestine(13)|lung(22)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	65		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)		AGAACAAGAAGGAGCCGGTGC	0.453																																																1	Substitution - Missense(1)	ovary(1)	9											136.0	134.0	135.0					9																	418118		2203	4300	6503	408118	SO:0001583	missense	81704			AK090429	CCDS6440.1, CCDS6440.2, CCDS55283.1, CCDS55284.1	9p24.3	2014-09-17			ENSG00000107099	ENSG00000107099			19191	protein-coding gene	gene with protein product		611432				11214971	Standard	NM_203447		Approved	FLJ00026, FLJ00152, ZIR8, FLJ00346	uc003zgf.2	Q8NF50	OTTHUMG00000078789	ENST00000453981.1:c.3751G>C	9.37:g.418118G>C	ENSP00000408464:p.Gly1251Arg		408118	A2A350|A2BDF2|A4FU78|B7ZLP0|E9PH09|Q3MV16|Q5JPJ1|Q8TEP1|Q8WUY2|Q9BYJ5|Q9H1Q2|Q9H1Q3|Q9H308|Q9H7P2	Missense_Mutation	SNP	HMMPfam_Ded_cyto;superfamily_ARM repeat	p.G1183R	ENST00000453981.1	37	c.3547	CCDS6440.2	9	.	.	.	.	.	.	.	.	.	.	G	11.46	1.645126	0.29246	.	.	ENSG00000107099	ENST00000453981;ENST00000287364;ENST00000432829;ENST00000469391;ENST00000382329	T;T;T;T	0.22336	1.96;1.96;1.96;1.96	5.7	5.7	0.88788	.	0.430804	0.26029	N	0.026775	T	0.15955	0.0384	L	0.41824	1.3	0.09310	N	1	B;B;B	0.10296	0.003;0.003;0.003	B;B;B	0.09377	0.002;0.004;0.002	T	0.17077	-1.0381	10	0.18710	T	0.47	.	9.0458	0.36345	0.075:0.0:0.7675:0.1575	.	1151;718;1251	E9PH09;A2A369;Q8NF50	.;.;DOCK8_HUMAN	R	1251;1219;1183;1151;718	ENSP00000408464:G1251R;ENSP00000394888:G1183R;ENSP00000419438:G1151R;ENSP00000371766:G718R	ENSP00000287364:G1219R	G	+	1	0	DOCK8	408118	0.701000	0.27806	0.159000	0.22649	0.381000	0.30169	2.874000	0.48483	2.705000	0.92388	0.650000	0.86243	GGA	-	NULL		0.453	DOCK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK8	protein_coding	OTTHUMT00000171792.5	G	XM_036307		408118	1	no_errors	NM_203447	genbank	human	validated	54_36p	missense	SNP	0.38	C
ZNF658	26149	genome.wustl.edu	37	9	40773337	40773337	+	Silent	SNP	C	C	T	rs78487056	byFrequency	TCGA-13-0726-01A-01W-0372-09	TCGA-13-0726-10B-01W-0977-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	201415c2-5b5a-4bb8-8005-bf2c78d4d88e	df694f1a-e6a5-4c06-bf79-5fe57cfcba13	g.chr9:40773337C>T	ENST00000602553.1	-	5	2232	c.1938G>A	c.(1936-1938)aaG>aaA	p.K646K	ZNF658_ENST00000441795.1_Intron|ZNF658_ENST00000377626.3_Silent_p.K646K			Q5TYW1	ZN658_HUMAN	zinc finger protein 658	646					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.K646K(1)		breast(3)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(9)|lung(21)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	46				GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)		TTTGATGTGCCTTGAGAACAG	0.418													C|||	1047	0.209065	0.0424	0.2478	5008	,	,		19384	0.3482		0.2217	False		,,,				2504	0.2505															1	Substitution - coding silent(1)	ovary(1)	9						C		300,4104	158.9+/-191.5	20,260,1922	120.0	128.0	125.0		1938	-2.4	0.0	9	dbSNP_131	125	1790,6806	315.5+/-312.3	172,1446,2680	no	coding-synonymous	ZNF658	NM_033160.5		192,1706,4602	TT,TC,CC		20.8236,6.812,16.0769		646/1060	40773337	2090,10910	2202	4298	6500	40763337	SO:0001819	synonymous_variant	26149			AA482262	CCDS75846.1	9p13.1	2013-01-08			ENSG00000196409	ENSG00000274349		"""Zinc fingers, C2H2-type"", ""-"""	25226	protein-coding gene	gene with protein product							Standard	NM_033160		Approved	MGC35232, DKFZp572C163, FLJ32813	uc004abs.2	Q5TYW1	OTTHUMG00000013392	ENST00000602553.1:c.1938G>A	9.37:g.40773337C>T			40763337	Q6PIP3|Q96M55|Q9H9S6|Q9UG02	Silent	SNP	HMMPfam_KRAB;HMMPfam_zf-C2H2;superfamily_KRAB domain (Kruppel-associated box Pfam 01352);superfamily_C2H2 and C2HC zinc fingers	p.K646	ENST00000602553.1	37	c.1938	CCDS35023.1	9																																																																																			-	HMMPfam_zf-C2H2		0.418	ZNF658-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF658	protein_coding	OTTHUMT00000467800.1	C	NM_033160		40763337	-1	no_errors	NM_033160	genbank	human	validated	54_36p	silent	SNP	0	T
HEPH	9843	genome.wustl.edu	37	X	65417690	65417690	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0726-01A-01W-0372-09	TCGA-13-0726-10B-01W-0977-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	201415c2-5b5a-4bb8-8005-bf2c78d4d88e	df694f1a-e6a5-4c06-bf79-5fe57cfcba13	g.chrX:65417690C>T	ENST00000343002.2	+	9	2331	c.1667C>T	c.(1666-1668)cCg>cTg	p.P556L	HEPH_ENST00000441993.2_Missense_Mutation_p.P559L|HEPH_ENST00000336279.5_Missense_Mutation_p.P289L|HEPH_ENST00000519389.1_Missense_Mutation_p.P610L|HEPH_ENST00000419594.1_Intron|HEPH_ENST00000374727.3_Missense_Mutation_p.P559L			Q9BQS7	HEPH_HUMAN	hephaestin	556	Plastocyanin-like 3.				cellular iron ion homeostasis (GO:0006879)|copper ion transport (GO:0006825)|iron ion transport (GO:0006826)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	copper ion binding (GO:0005507)|ferrous iron binding (GO:0008198)|ferroxidase activity (GO:0004322)	p.P556L(1)		endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(56)|ovary(5)|prostate(1)|skin(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	89						CTGGTGGGCCCGCTGCTGGTG	0.572																																																1	Substitution - Missense(1)	ovary(1)	X											53.0	41.0	45.0					X																	65417690		2203	4300	6503	65334415	SO:0001583	missense	9843			AB014598	CCDS14384.2, CCDS14385.1, CCDS48133.1, CCDS14384.3, CCDS65277.1	Xq11-q12	2008-02-05			ENSG00000089472	ENSG00000089472			4866	protein-coding gene	gene with protein product		300167				9988272, 9734811	Standard	NM_014799		Approved	KIAA0698, CPL	uc011moz.2	Q9BQS7	OTTHUMG00000021732	ENST00000343002.2:c.1667C>T	X.37:g.65417690C>T	ENSP00000343939:p.Pro556Leu		65334415	B1AJX8|D3DVT7|E9PHN8|O75180|Q6UW45|Q9C058	Missense_Mutation	SNP	-	p.P289L	ENST00000343002.2	37	c.866		X	.	.	.	.	.	.	.	.	.	.	C	18.51	3.639485	0.67244	.	.	ENSG00000089472	ENST00000519389;ENST00000374727;ENST00000336279;ENST00000441993;ENST00000343002;ENST00000425114	D;D;D;D;D;D	0.99311	-5.73;-5.73;-5.73;-5.73;-5.73;-5.73	5.62	5.62	0.85841	Cupredoxin (2);Multicopper oxidase, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.99333	0.9766	M	0.74546	2.27	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99470	1.0945	10	0.54805	T	0.06	.	17.1383	0.86745	0.0:1.0:0.0:0.0	.	610;556	E9PHN8;Q9BQS7	.;HEPH_HUMAN	L	610;559;289;559;556;513	ENSP00000430620:P610L;ENSP00000363859:P559L;ENSP00000337418:P289L;ENSP00000411687:P559L;ENSP00000343939:P556L;ENSP00000398078:P513L	ENSP00000337418:P289L	P	+	2	0	HEPH	65334415	1.000000	0.71417	0.962000	0.40283	0.262000	0.26303	7.069000	0.76755	2.370000	0.80446	0.544000	0.68410	CCG	-	NULL		0.572	HEPH-002	KNOWN	alternative_5_UTR|basic|appris_candidate	protein_coding	HEPH	protein_coding	OTTHUMT00000056995.1	C	NM_138737		65334415	1	no_errors	NM_014799	genbank	human	reviewed	54_36p	missense	SNP	1	T
FAM155B	27112	genome.wustl.edu	37	X	68749521	68749521	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0726-01A-01W-0372-09	TCGA-13-0726-10B-01W-0977-09	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	201415c2-5b5a-4bb8-8005-bf2c78d4d88e	df694f1a-e6a5-4c06-bf79-5fe57cfcba13	g.chrX:68749521A>G	ENST00000252338.4	+	3	1183	c.1141A>G	c.(1141-1143)Acc>Gcc	p.T381A		NM_015686.2	NP_056501.2	O75949	F155B_HUMAN	family with sequence similarity 155, member B	382						integral component of membrane (GO:0016021)		p.T381A(1)		autonomic_ganglia(1)|breast(2)|endometrium(4)|large_intestine(2)|lung(4)|ovary(2)|pancreas(1)	16						GGCCCCCAAAACccaccagca	0.537																																																1	Substitution - Missense(1)	ovary(1)	X											234.0	153.0	180.0					X																	68749521		2203	4299	6502	68666246	SO:0001583	missense	27112			AF087142	CCDS35317.1	Xq13.1	2008-04-15	2008-04-15	2008-04-15	ENSG00000130054	ENSG00000130054			30701	protein-coding gene	gene with protein product			"""transmembrane protein 28"", ""chromosome X open reading frame 63"""	TMEM28, CXorf63			Standard	NM_015686		Approved	TED	uc004dxk.3	O75949	OTTHUMG00000021756	ENST00000252338.4:c.1141A>G	X.37:g.68749521A>G	ENSP00000252338:p.Thr381Ala		68666246	B1ALV6|B9EGK1|D3DVU1	Missense_Mutation	SNP	-	p.T381A	ENST00000252338.4	37	c.1141	CCDS35317.1	X	.	.	.	.	.	.	.	.	.	.	A	9.500	1.103005	0.20632	.	.	ENSG00000130054	ENST00000252338	T	0.43294	0.95	2.8	2.8	0.32819	.	0.085101	0.43260	D	0.000592	T	0.21267	0.0512	N	0.12182	0.205	0.42268	D	0.992049	B	0.26602	0.154	B	0.20955	0.032	T	0.06232	-1.0838	10	0.30078	T	0.28	-6.9442	8.5491	0.33440	1.0:0.0:0.0:0.0	.	381	O75949-2	.	A	381	ENSP00000252338:T381A	ENSP00000252338:T381A	T	+	1	0	FAM155B	68666246	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.208000	0.65203	1.360000	0.45960	0.425000	0.28330	ACC	-	NULL		0.537	FAM155B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM155B	protein_coding	OTTHUMT00000057037.1	A	NM_015686		68666246	1	no_errors	NM_015686	genbank	human	validated	54_36p	missense	SNP	1	G
RAP2C	57826	genome.wustl.edu	37	X	131348288	131348288	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0726-01A-01W-0372-09	TCGA-13-0726-10B-01W-0977-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	201415c2-5b5a-4bb8-8005-bf2c78d4d88e	df694f1a-e6a5-4c06-bf79-5fe57cfcba13	g.chrX:131348288C>G	ENST00000342983.2	-	3	1206	c.460G>C	c.(460-462)Gat>Cat	p.D154H	RAP2C_ENST00000370874.1_Missense_Mutation_p.D154H|RAP2C_ENST00000460462.1_5'UTR|RAP2C-AS1_ENST00000421483.2_RNA	NM_001271187.1|NM_021183.4	NP_001258116.1|NP_067006.3	Q9Y3L5	RAP2C_HUMAN	RAP2C, member of RAS oncogene family	154					GTP catabolic process (GO:0006184)|negative regulation of cell migration (GO:0030336)|positive regulation of protein autophosphorylation (GO:0031954)|Rap protein signal transduction (GO:0032486)|regulation of protein tyrosine kinase activity (GO:0061097)|regulation of RNA biosynthetic process (GO:2001141)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|transcription coactivator activity (GO:0003713)	p.D154H(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|ovary(1)|upper_aerodigestive_tract(2)	8	Acute lymphoblastic leukemia(192;0.000127)					AAAAGTTCATCCACCATTGAT	0.448																																																1	Substitution - Missense(1)	ovary(1)	X											146.0	120.0	128.0					X																	131348288		2203	4300	6503	131175969	SO:0001583	missense	57826			BC051467	CCDS14632.1, CCDS76024.1	Xq25	2014-05-09			ENSG00000123728	ENSG00000123728			21165	protein-coding gene	gene with protein product							Standard	NM_001271186		Approved	DKFZp313B211	uc004ewp.4	Q9Y3L5	OTTHUMG00000022424	ENST00000342983.2:c.460G>C	X.37:g.131348288C>G	ENSP00000340274:p.Asp154His		131175969	B3KWD6|Q5H9H9|Q9BTS0	Missense_Mutation	SNP	-	p.D154H	ENST00000342983.2	37	c.460	CCDS14632.1	X	.	.	.	.	.	.	.	.	.	.	C	23.3	4.397259	0.83120	.	.	ENSG00000123728	ENST00000342983;ENST00000370874	T;T	0.77620	-1.11;-1.11	5.62	5.62	0.85841	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.88276	0.6393	M	0.77616	2.38	0.58432	D	0.999999	D	0.76494	0.999	D	0.68943	0.961	D	0.89272	0.3605	10	0.66056	D	0.02	.	18.7107	0.91655	0.0:1.0:0.0:0.0	.	154	Q9Y3L5	RAP2C_HUMAN	H	154	ENSP00000340274:D154H;ENSP00000359911:D154H	ENSP00000340274:D154H	D	-	1	0	RAP2C	131175969	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.448000	0.80631	2.363000	0.80096	0.556000	0.70494	GAT	-	NULL		0.448	RAP2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAP2C	protein_coding	OTTHUMT00000058312.1	C	NM_021183		131175969	-1	no_errors	NM_021183	genbank	human	provisional	54_36p	missense	SNP	1	G
CCDC136	64753	genome.wustl.edu	37	7	128450380	128450399	+	Frame_Shift_Del	DEL	ATTCCAAATTGGCTAAGTCC	ATTCCAAATTGGCTAAGTCC	TGTAA			TCGA-13-0726-01A-01W-0372-09	TCGA-13-0726-10B-01W-0977-09	ATTCCAAATTGGCTAAGTCC	ATTCCAAATTGGCTAAGTCC	ATTCCAAATTGGCTAAGTCC	TGTAA	ATTCCAAATTGGCTAAGTCC	ATTCCAAATTGGCTAAGTCC	Unknown	Valid	Somatic	Phase_III	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	201415c2-5b5a-4bb8-8005-bf2c78d4d88e	df694f1a-e6a5-4c06-bf79-5fe57cfcba13	g.chr7:128450380_128450399delATTCCAAATTGGCTAAGTCC	ENST00000297788.4	+	12	2355_2374	c.1988_2007delATTCCAAATTGGCTAAGTCC	c.(1987-2007)gattccaaattggctaagtccfs	p.DSKLAKS663fs	CCDC136_ENST00000378685.4_Intron|CCDC136_ENST00000487361.1_Intron|CCDC136_ENST00000464832.1_Intron	NM_022742.4	NP_073579	Q96JN2	CC136_HUMAN	coiled-coil domain containing 136	663						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)				breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(11)|ovary(3)	24						AATCCCGATGATTCCAAATTGGCTAAGTCCTCCAAATGTA	0.468																																																0			7																																								128237635	SO:0001589	frameshift_variant	64753				CCDS47704.1, CCDS56510.1	7q33	2007-08-01			ENSG00000128596	ENSG00000128596			22225	protein-coding gene	gene with protein product		611902				15112360	Standard	NM_022742		Approved	KIAA1793, NAG6, DKFZP434G156	uc003vnv.2	Q96JN2	OTTHUMG00000158310	ENST00000297788.4:c.1988_2007delATTCCAAATTGGCTAAGTCC	7.37:g.128450380_128450399delATTCCAAATTGGCTAAGTCC	ENSP00000297788:p.Asp663fs		128237616	A4D1K1|A7MCY7|A8MYA7|Q6ZVK7|Q9H8M3|Q9UFE1	In_Frame_Del	DEL	superfamily_Prefoldin,superfamily_Spectrin repeat	p.DSKLAKS663in_frame_del	ENST00000297788.4	37	c.1988_2005	CCDS47704.1	7																																																																																			(deletion:cds_exon[128237429,128237656])	NULL		0.468	CCDC136-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCDC136	protein_coding	OTTHUMT00000350641.1	ATTCCAAATTGGCTAAGTCC	NM_022742		128237635	1	no_errors	NM_022742	genbank	human	validated	54_36p	in_frame_del	DEL	0.003:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.001:0.258:0.264:0.450:0.488:0.616:0.617	TGTAA
