#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
DUSP27	92235	genome.wustl.edu	37	1	167095999	167095999	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0894-01B-01W-0494-09	TCGA-13-0894-10A-01W-0494-09	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	eb57990e-702f-4fac-9ef5-7447ecb45cec	5781f8d8-a30f-4eee-acc8-c513e7872d10	g.chr1:167095999T>A	ENST00000361200.2	+	6	1797	c.1631T>A	c.(1630-1632)cTg>cAg	p.L544Q	DUSP27_ENST00000443333.1_Missense_Mutation_p.L544Q|DUSP27_ENST00000271385.5_Missense_Mutation_p.L544Q|DUSP27_ENST00000485151.1_Intron			Q5VZP5	DUS27_HUMAN	dual specificity phosphatase 27 (putative)	544					protein dephosphorylation (GO:0006470)		protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.L544Q(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(11)|liver(1)|lung(46)|ovary(5)|prostate(5)|skin(4)|upper_aerodigestive_tract(3)	89						CTCACTGCCCTGGAAAGATGG	0.562																																																1	Substitution - Missense(1)	ovary(1)	1											90.0	89.0	89.0					1																	167095999		2203	4300	6503	165362623	SO:0001583	missense	92235			AF119045	CCDS30932.1	1q22-q24	2008-02-05			ENSG00000198842	ENSG00000198842			25034	protein-coding gene	gene with protein product							Standard	NM_001080426		Approved		uc001geb.1	Q5VZP5	OTTHUMG00000034434	ENST00000361200.2:c.1631T>A	1.37:g.167095999T>A	ENSP00000354483:p.Leu544Gln		165362623	A0AUM4|Q9C074	Missense_Mutation	SNP	-	p.L544Q	ENST00000361200.2	37	c.1631	CCDS30932.1	1	.	.	.	.	.	.	.	.	.	.	T	19.74	3.882949	0.72410	.	.	ENSG00000198842	ENST00000361200;ENST00000271385;ENST00000443333	T;T;T	0.10960	2.82;2.82;2.82	5.29	5.29	0.74685	.	0.000000	0.47852	D	0.000209	T	0.24005	0.0581	M	0.71581	2.175	0.49687	D	0.999811	D	0.89917	1.0	D	0.87578	0.998	T	0.01839	-1.1263	10	0.87932	D	0	-12.563	15.2516	0.73552	0.0:0.0:0.0:1.0	.	544	Q5VZP5	DUS27_HUMAN	Q	544	ENSP00000354483:L544Q;ENSP00000271385:L544Q;ENSP00000404874:L544Q	ENSP00000271385:L544Q	L	+	2	0	DUSP27	165362623	1.000000	0.71417	0.999000	0.59377	0.957000	0.61999	7.690000	0.84178	1.987000	0.57996	0.523000	0.50628	CTG	-	NULL		0.562	DUSP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUSP27	protein_coding	OTTHUMT00000083244.1	T	NM_001080426		165362623	1	no_errors	NM_001080426	genbank	human	provisional	54_36p	missense	SNP	1	A
SLC9C2	284525	genome.wustl.edu	37	1	173545823	173545823	+	Silent	SNP	C	C	T			TCGA-13-0894-01B-01W-0494-09	TCGA-13-0894-10A-01W-0494-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	eb57990e-702f-4fac-9ef5-7447ecb45cec	5781f8d8-a30f-4eee-acc8-c513e7872d10	g.chr1:173545823C>T	ENST00000367714.3	-	8	1301	c.879G>A	c.(877-879)ccG>ccA	p.P293P	RP3-436N22.3_ENST00000431459.1_RNA|SLC9C2_ENST00000466087.1_5'UTR|SLC9C2_ENST00000536496.1_Silent_p.P191P	NM_178527.3	NP_848622.2	Q5TAH2	SL9C2_HUMAN	solute carrier family 9, member C2 (putative)	293					sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)	solute:proton antiporter activity (GO:0015299)	p.P293P(1)									GTTCGATCTTCGGTTTAAAAG	0.403																																																1	Substitution - coding silent(1)	ovary(1)	1											77.0	74.0	75.0					1																	173545823		2203	4300	6503	171812446	SO:0001819	synonymous_variant	284525			AK128104	CCDS1308.1	1q25.1	2013-07-18	2013-07-18	2012-03-22	ENSG00000162753	ENSG00000162753		"""Solute carriers"""	28664	protein-coding gene	gene with protein product			"""solute carrier family 9, isoform 11"", ""solute carrier family 9, member 11"", ""solute carrier family 9, member C2"""	SLC9A11			Standard	NM_178527		Approved	MGC43026	uc001giz.2	Q5TAH2	OTTHUMG00000034800	ENST00000367714.3:c.879G>A	1.37:g.173545823C>T			171812446	Q86UF3	Silent	SNP	-	p.P293	ENST00000367714.3	37	c.879	CCDS1308.1	1																																																																																			-	NULL		0.403	SLC9C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9A11	protein_coding	OTTHUMT00000084205.1	C	NM_178527		171812446	-1	no_errors	NM_178527	genbank	human	validated	54_36p	silent	SNP	0.02	T
IVNS1ABP	10625	genome.wustl.edu	37	1	185278530	185278530	+	Nonsense_Mutation	SNP	A	A	T			TCGA-13-0894-01B-01W-0494-09	TCGA-13-0894-10A-01W-0494-09	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	eb57990e-702f-4fac-9ef5-7447ecb45cec	5781f8d8-a30f-4eee-acc8-c513e7872d10	g.chr1:185278530A>T	ENST00000367498.3	-	3	718	c.96T>A	c.(94-96)tgT>tgA	p.C32*	IVNS1ABP_ENST00000392007.3_5'UTR|IVNS1ABP_ENST00000367497.1_Nonsense_Mutation_p.C32*|IVNS1ABP_ENST00000459929.1_5'UTR	NM_006469.4	NP_006460.2	Q9Y6Y0	NS1BP_HUMAN	influenza virus NS1A binding protein	32	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|response to virus (GO:0009615)|RNA splicing (GO:0008380)|transcription from RNA polymerase III promoter (GO:0006383)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|spliceosomal complex (GO:0005681)|transcription factor complex (GO:0005667)		p.C32*(1)		breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(11)|ovary(4)|prostate(2)	29						GTCGAACATCACAGAACTGGC	0.294																																																1	Substitution - Nonsense(1)	ovary(1)	1											69.0	73.0	72.0					1																	185278530		2203	4299	6502	183545153	SO:0001587	stop_gained	10625			AB020657	CCDS1368.1	1q25.1-q31.1	2013-01-30			ENSG00000116679	ENSG00000116679		"""Kelch-like"", ""BTB/POZ domain containing"""	16951	protein-coding gene	gene with protein product	"""kelch-like family member 39"""	609209				9696811, 10048485	Standard	NM_006469		Approved	NS1-BP, HSPC068, NS-1, KIAA0850, ND1, KLHL39	uc001grl.3	Q9Y6Y0	OTTHUMG00000035384	ENST00000367498.3:c.96T>A	1.37:g.185278530A>T	ENSP00000356468:p.Cys32*		183545153	A8K8R6|Q1G4T6|Q1G4T7|Q5TF75|Q6NW38|Q7LCG2|Q9NZX0|Q9Y480	Nonsense_Mutation	SNP	-	p.C32*	ENST00000367498.3	37	c.96	CCDS1368.1	1	.	.	.	.	.	.	.	.	.	.	A	41	8.763458	0.98943	.	.	ENSG00000116679	ENST00000367498;ENST00000367497	.	.	.	5.62	3.27	0.37495	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.9168	0.41439	0.7995:0.0:0.2005:0.0	.	.	.	.	X	32	.	ENSP00000356467:C32X	C	-	3	2	IVNS1ABP	183545153	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.446000	0.35090	0.969000	0.38237	0.533000	0.62120	TGT	-	NULL		0.294	IVNS1ABP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IVNS1ABP	protein_coding	OTTHUMT00000085774.1	A	NM_006469		183545153	-1	no_errors	NM_006469	genbank	human	validated	54_36p	nonsense	SNP	1	T
CRB1	23418	genome.wustl.edu	37	1	197325987	197325987	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0894-01B-01W-0494-09	TCGA-13-0894-10A-01W-0494-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	eb57990e-702f-4fac-9ef5-7447ecb45cec	5781f8d8-a30f-4eee-acc8-c513e7872d10	g.chr1:197325987G>A	ENST00000367400.3	+	5	1150	c.1015G>A	c.(1015-1017)Gac>Aac	p.D339N	CRB1_ENST00000535699.1_Missense_Mutation_p.D270N|CRB1_ENST00000543483.1_Missense_Mutation_p.D38N|CRB1_ENST00000538660.1_Missense_Mutation_p.D339N|CRB1_ENST00000367399.2_Missense_Mutation_p.D227N	NM_201253.2	NP_957705.1	P82279	CRUM1_HUMAN	crumbs family member 1, photoreceptor morphogenesis associated	339	EGF-like 9. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|plasma membrane organization (GO:0007009)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.D339N(1)		NS(1)|breast(4)|central_nervous_system(2)|cervix(3)|endometrium(13)|kidney(4)|large_intestine(21)|lung(58)|ovary(7)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	132						GTGTGAGATCGACCTCAATGA	0.458																																																1	Substitution - Missense(1)	ovary(1)	1											140.0	122.0	128.0					1																	197325987		2203	4300	6503	195592610	SO:0001583	missense	23418				CCDS1390.1, CCDS53454.1, CCDS58052.1, CCDS58053.1	1q31-q32.1	2014-02-06	2014-02-06		ENSG00000134376	ENSG00000134376			2343	protein-coding gene	gene with protein product		604210	"""crumbs (Drosophila) homolog 1"", ""crumbs homolog 1 (Drosophila)"""	RP12		10373321, 10508521	Standard	NM_201253		Approved	LCA8	uc001gtz.3	P82279	OTTHUMG00000035663	ENST00000367400.3:c.1015G>A	1.37:g.197325987G>A	ENSP00000356370:p.Asp339Asn		195592610	A2A308|B7Z5T2|B9EG71|Q5K3A6|Q5TC28|Q5VUT1|Q6N027|Q8WWY0|Q8WWY1	Missense_Mutation	SNP	HMMPfam_EGF;superfamily_Concanavalin A-like lectins/glucanases;HMMPfam_Laminin_G_2;superfamily_EGF/Laminin	p.D339N	ENST00000367400.3	37	c.1015	CCDS1390.1	1	.	.	.	.	.	.	.	.	.	.	G	9.884	1.202499	0.22121	.	.	ENSG00000134376	ENST00000535699;ENST00000538660;ENST00000367400;ENST00000367399;ENST00000543483	D;D;D;D;D	0.94184	-2.24;-2.24;-2.24;-3.37;-3.37	5.18	-0.33	0.12683	Epidermal growth factor-like, type 3 (1);	.	.	.	.	D	0.86871	0.6037	L	0.45422	1.42	0.54753	D	0.999981	P;P;P;P;D	0.57899	0.878;0.878;0.857;0.841;0.981	B;B;B;B;P	0.44447	0.399;0.294;0.199;0.241;0.45	T	0.80051	-0.1544	9	0.14656	T	0.56	.	4.0116	0.09624	0.074:0.2574:0.4033:0.2653	.	339;270;227;339;364	B7Z5T2;F5H0L2;P82279-3;P82279;Q59H36	.;.;.;CRUM1_HUMAN;.	N	270;339;339;227;38	ENSP00000438786:D270N;ENSP00000438091:D339N;ENSP00000356370:D339N;ENSP00000356369:D227N;ENSP00000439579:D38N	ENSP00000356369:D227N	D	+	1	0	CRB1	195592610	0.978000	0.34361	0.000000	0.03702	0.007000	0.05969	1.719000	0.38011	-0.246000	0.09611	-1.509000	0.00949	GAC	-	NULL		0.458	CRB1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	CRB1	protein_coding	OTTHUMT00000086565.2	G	NM_201253		195592610	1	no_errors	NM_201253	genbank	human	reviewed	54_36p	missense	SNP	0.96	A
PLXNA2	5362	genome.wustl.edu	37	1	208390402	208390402	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0894-01B-01W-0494-09	TCGA-13-0894-10A-01W-0494-09	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	eb57990e-702f-4fac-9ef5-7447ecb45cec	5781f8d8-a30f-4eee-acc8-c513e7872d10	g.chr1:208390402T>A	ENST00000367033.3	-	2	1623	c.866A>T	c.(865-867)aAg>aTg	p.K289M		NM_025179.3	NP_079455.3	O75051	PLXA2_HUMAN	plexin A2	289	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|centrosome localization (GO:0051642)|cerebellar granule cell precursor tangential migration (GO:0021935)|limb bud formation (GO:0060174)|neural tube development (GO:0021915)|pharyngeal system development (GO:0060037)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|somitogenesis (GO:0001756)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)	p.K289M(1)		NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)	80				OV - Ovarian serous cystadenocarcinoma(81;0.199)		TGAGTGGAACTTGGGGTCATC	0.637																																																1	Substitution - Missense(1)	ovary(1)	1											87.0	85.0	85.0					1																	208390402		2203	4300	6503	206457025	SO:0001583	missense	5362			X87831	CCDS31013.1	1q32.2	2008-07-18			ENSG00000076356	ENSG00000076356		"""Plexins"""	9100	protein-coding gene	gene with protein product	"""plexin 2"", ""plexin-A2"", ""semaphorin receptor OCT"", ""transmembrane protein OCT"""	601054		PLXN2		8570614	Standard	NM_025179		Approved	OCT, FLJ11751, FLJ30634, KIAA0463	uc001hgz.3	O75051	OTTHUMG00000036564	ENST00000367033.3:c.866A>T	1.37:g.208390402T>A	ENSP00000356000:p.Lys289Met		206457025	A2RTX9|B2RMX7|Q6UX61|Q96GN9|Q9BRL1|Q9UIW1	Missense_Mutation	SNP	-	p.K289M	ENST00000367033.3	37	c.866	CCDS31013.1	1	.	.	.	.	.	.	.	.	.	.	T	18.99	3.738888	0.69304	.	.	ENSG00000076356	ENST00000367033	T	0.11712	2.75	5.69	5.69	0.88448	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.000000	0.85682	D	0.000000	T	0.30262	0.0759	M	0.63843	1.955	0.58432	D	0.999998	D;D	0.69078	0.997;0.996	D;D	0.67231	0.95;0.918	T	0.01136	-1.1440	10	0.66056	D	0.02	.	15.9451	0.79787	0.0:0.0:0.0:1.0	.	343;289	O75051-2;O75051	.;PLXA2_HUMAN	M	289	ENSP00000356000:K289M	ENSP00000356000:K289M	K	-	2	0	PLXNA2	206457025	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	7.747000	0.85070	2.177000	0.69029	0.533000	0.62120	AAG	-	NULL		0.637	PLXNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNA2	protein_coding	OTTHUMT00000088932.6	T	NM_025179		206457025	-1	no_errors	NM_025179	genbank	human	reviewed	54_36p	missense	SNP	1	A
CENPF	1063	genome.wustl.edu	37	1	214820500	214820500	+	Missense_Mutation	SNP	T	T	G			TCGA-13-0894-01B-01W-0494-09	TCGA-13-0894-10A-01W-0494-09	T	T	T	G	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	eb57990e-702f-4fac-9ef5-7447ecb45cec	5781f8d8-a30f-4eee-acc8-c513e7872d10	g.chr1:214820500T>G	ENST00000366955.3	+	13	7755	c.7587T>G	c.(7585-7587)aaT>aaG	p.N2529K		NM_016343.3	NP_057427.3	P49454	CENPF_HUMAN	centromere protein F, 350/400kDa	2625	2 X 177 AA tandem repeats.|Sufficient for centromere localization.|Sufficient for self-association.				cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|kinetochore assembly (GO:0051382)|metaphase plate congression (GO:0051310)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|muscle organ development (GO:0007517)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of striated muscle tissue development (GO:0016202)|response to drug (GO:0042493)	chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|pronucleus (GO:0045120)|spindle (GO:0005819)|spindle pole (GO:0000922)	chromatin binding (GO:0003682)|dynein binding (GO:0045502)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)	p.N2529K(1)		NS(2)|breast(2)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(37)|lung(47)|ovary(7)|prostate(3)|skin(6)|stomach(1)|urinary_tract(1)	126				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		GACTGAAAAATCAAATTCAAG	0.408																																					Colon(80;575 1284 11000 14801 43496)											1	Substitution - Missense(1)	ovary(1)	1											89.0	94.0	92.0					1																	214820500		2203	4300	6503	212887123	SO:0001583	missense	1063			U30872	CCDS31023.1	1q41	2013-11-05	2013-01-17		ENSG00000117724	ENSG00000117724			1857	protein-coding gene	gene with protein product	"""mitosin"""	600236	"""centromere protein F, 350/400kDa (mitosin)"""			7904902, 7851898	Standard	NM_016343		Approved	hcp-1	uc001hkm.3	P49454	OTTHUMG00000036955	ENST00000366955.3:c.7587T>G	1.37:g.214820500T>G	ENSP00000355922:p.Asn2529Lys		212887123	Q13171|Q13246|Q5VVM7	Missense_Mutation	SNP	Spectrin repeat;superfamily_Spectrin repeat;BAG domain;superfamily_BAG domain	p.N2529K	ENST00000366955.3	37	c.7587	CCDS31023.1	1	.	.	.	.	.	.	.	.	.	.	T	9.804	1.181329	0.21787	.	.	ENSG00000117724	ENST00000366955	T	0.02837	4.14	5.34	-4.69	0.03299	.	1.294670	0.05726	N	0.598740	T	0.01870	0.0059	L	0.34521	1.04	0.09310	N	1	B	0.16802	0.019	B	0.09377	0.004	T	0.48614	-0.9020	10	0.10377	T	0.69	.	1.8757	0.03217	0.2089:0.285:0.3482:0.1579	.	2625	P49454	CENPF_HUMAN	K	2529	ENSP00000355922:N2529K	ENSP00000355922:N2529K	N	+	3	2	CENPF	212887123	0.002000	0.14202	0.001000	0.08648	0.788000	0.44548	-0.130000	0.10498	-0.419000	0.07439	0.496000	0.49642	AAT	-	NULL		0.408	CENPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPF	protein_coding	OTTHUMT00000089749.1	T	NM_016343		212887123	1	no_errors	NM_016343	genbank	human	reviewed	54_36p	missense	SNP		G
TRIM67	440730	genome.wustl.edu	37	1	231344752	231344752	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0894-01B-01W-0494-09	TCGA-13-0894-10A-01W-0494-09	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	eb57990e-702f-4fac-9ef5-7447ecb45cec	5781f8d8-a30f-4eee-acc8-c513e7872d10	g.chr1:231344752A>G	ENST00000366653.5	+	8	1879	c.1879A>G	c.(1879-1881)Aac>Gac	p.N627D	TRIM67_ENST00000449018.3_Missense_Mutation_p.N565D|TRIM67_ENST00000444294.3_Missense_Mutation_p.N625D|TRIM67_ENST00000366652.2_Missense_Mutation_p.N627D			Q6ZTA4	TRI67_HUMAN	tripartite motif containing 67	627	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	zinc ion binding (GO:0008270)	p.N627D(1)		breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29	Breast(184;0.0871)	all_cancers(173;0.189)|Prostate(94;0.167)				ATCCAATGACAACCAGACAGC	0.582																																																1	Substitution - Missense(1)	ovary(1)	1											89.0	98.0	95.0					1																	231344752		2153	4272	6425	229411375	SO:0001583	missense	440730			AK126782	CCDS44333.1, CCDS73048.1	1q42.2	2014-02-17	2011-01-25		ENSG00000119283	ENSG00000119283		"""Tripartite motif containing / Tripartite motif containing"", ""Fibronectin type III domain containing"", ""RING-type (C3HC4) zinc fingers"""	31859	protein-coding gene	gene with protein product		610584	"""tripartite motif-containing 67"""				Standard	NM_001004342		Approved	TNL	uc009xfn.1	Q6ZTA4	OTTHUMG00000037958	ENST00000366653.5:c.1879A>G	1.37:g.231344752A>G	ENSP00000355613:p.Asn627Asp		229411375	Q5TER7|Q5TER8|Q7Z4K7	Missense_Mutation	SNP	-	p.N627D	ENST00000366653.5	37	c.1879	CCDS44333.1	1	.	.	.	.	.	.	.	.	.	.	A	28.8	4.951628	0.92660	.	.	ENSG00000119283	ENST00000444294;ENST00000366652;ENST00000449018;ENST00000366653	T;T;T;T	0.74209	-0.82;-0.82;-0.82;-0.82	5.73	5.73	0.89815	Concanavalin A-like lectin/glucanase (1);B30.2/SPRY domain (1);	0.000000	0.85682	D	0.000000	D	0.83257	0.5215	M	0.64404	1.975	0.80722	D	1	D	0.71674	0.998	D	0.67900	0.954	T	0.81604	-0.0857	10	0.32370	T	0.25	.	16.3197	0.82945	1.0:0.0:0.0:0.0	.	627	Q6ZTA4	TRI67_HUMAN	D	625;627;565;627	ENSP00000412124:N625D;ENSP00000355612:N627D;ENSP00000400163:N565D;ENSP00000355613:N627D	ENSP00000355612:N627D	N	+	1	0	TRIM67	229411375	1.000000	0.71417	1.000000	0.80357	0.833000	0.47200	9.185000	0.94900	2.302000	0.77476	0.533000	0.62120	AAC	-	NULL		0.582	TRIM67-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	TRIM67	protein_coding	OTTHUMT00000092649.3	A	NM_001004342		229411375	1	no_errors	NM_001004342	genbank	human	validated	54_36p	missense	SNP	1	G
TFB2M	64216	genome.wustl.edu	37	1	246704364	246704364	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0894-01B-01W-0494-09	TCGA-13-0894-10A-01W-0494-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	eb57990e-702f-4fac-9ef5-7447ecb45cec	5781f8d8-a30f-4eee-acc8-c513e7872d10	g.chr1:246704364C>G	ENST00000366514.4	-	8	1345	c.1160G>C	c.(1159-1161)tGg>tCg	p.W387S		NM_022366.2	NP_071761.1	Q9H5Q4	TFB2M_HUMAN	transcription factor B2, mitochondrial	387					gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from mitochondrial promoter (GO:0006390)|transcription initiation from mitochondrial promoter (GO:0006391)	mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)	poly(A) RNA binding (GO:0044822)|rRNA (adenine-N6,N6-)-dimethyltransferase activity (GO:0000179)|transcription cofactor activity (GO:0003712)	p.W387S(1)		breast(1)|endometrium(1)|kidney(12)|large_intestine(3)|lung(5)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	28	all_cancers(71;4.25e-05)|all_epithelial(71;4.92e-06)|Ovarian(71;0.0254)|all_lung(81;0.0272)|Breast(184;0.0318)|Lung NSC(105;0.0376)		OV - Ovarian serous cystadenocarcinoma(106;0.00358)			ATCATACAGCCATTTATAAGC	0.373																																																1	Substitution - Missense(1)	ovary(1)	1											134.0	121.0	126.0					1																	246704364		2203	4300	6503	244770987	SO:0001583	missense	64216			AK026835	CCDS1627.1	1q44	2008-02-05			ENSG00000162851	ENSG00000162851			18559	protein-coding gene	gene with protein product		607055					Standard	NM_022366		Approved	FLJ23182, FLJ22661, Hkp1	uc001ibn.3	Q9H5Q4	OTTHUMG00000040091	ENST00000366514.4:c.1160G>C	1.37:g.246704364C>G	ENSP00000355471:p.Trp387Ser		244770987	Q9H626	Missense_Mutation	SNP	-	p.W387S	ENST00000366514.4	37	c.1160	CCDS1627.1	1	.	.	.	.	.	.	.	.	.	.	C	13.81	2.348913	0.41599	.	.	ENSG00000162851	ENST00000366514	T	0.55413	0.52	5.23	5.23	0.72850	.	0.000000	0.85682	D	0.000000	T	0.70046	0.3179	M	0.63843	1.955	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.72293	-0.4336	10	0.72032	D	0.01	-12.0249	15.8708	0.79117	0.0:1.0:0.0:0.0	.	387	Q9H5Q4	TFB2M_HUMAN	S	387	ENSP00000355471:W387S	ENSP00000355471:W387S	W	-	2	0	TFB2M	244770987	1.000000	0.71417	0.736000	0.30914	0.023000	0.10783	3.971000	0.56831	2.608000	0.88229	0.650000	0.86243	TGG	-	NULL		0.373	TFB2M-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFB2M	protein_coding	OTTHUMT00000096673.1	C	NM_022366		244770987	-1	no_errors	NM_022366	genbank	human	validated	54_36p	missense	SNP	0.31	G
OR2T33	391195	genome.wustl.edu	37	1	248436166	248436166	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0894-01B-01W-0494-09	TCGA-13-0894-10A-01W-0494-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	eb57990e-702f-4fac-9ef5-7447ecb45cec	5781f8d8-a30f-4eee-acc8-c513e7872d10	g.chr1:248436166G>T	ENST00000318021.2	-	1	972	c.951C>A	c.(949-951)caC>caA	p.H317Q		NM_001004695.1	NP_001004695.1	Q8NG76	O2T33_HUMAN	olfactory receptor, family 2, subfamily T, member 33	317						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.H317Q(1)		NS(2)|breast(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(41)|ovary(1)|prostate(1)|skin(4)	67	all_cancers(71;0.000124)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			ATCTTGACCTGTGGGCCTCAT	0.413																																																1	Substitution - Missense(1)	ovary(1)	1											138.0	140.0	139.0					1																	248436166		2203	4300	6503	246502789	SO:0001583	missense	391195				CCDS31109.1	1q44	2012-08-09			ENSG00000177212	ENSG00000177212		"""GPCR / Class A : Olfactory receptors"""	31255	protein-coding gene	gene with protein product							Standard	NM_001004695		Approved		uc010pzi.2	Q8NG76	OTTHUMG00000040458	ENST00000318021.2:c.951C>A	1.37:g.248436166G>T	ENSP00000324687:p.His317Gln		246502789	B2RNN0	Missense_Mutation	SNP	-	p.H317Q	ENST00000318021.2	37	c.951	CCDS31109.1	1	.	.	.	.	.	.	.	.	.	.	-	8.598	0.886283	0.17540	.	.	ENSG00000177212	ENST00000318021	T	0.00626	6.13	1.54	-0.785	0.10950	.	.	.	.	.	T	0.00412	0.0013	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.43845	-0.9366	9	0.41790	T	0.15	.	2.6157	0.04902	0.3706:0.265:0.3645:0.0	.	317	Q8NG76	O2T33_HUMAN	Q	317	ENSP00000324687:H317Q	ENSP00000324687:H317Q	H	-	3	2	OR2T33	246502789	0.000000	0.05858	0.000000	0.03702	0.035000	0.12851	-0.277000	0.08502	-0.202000	0.10268	0.175000	0.17021	CAC	-	NULL		0.413	OR2T33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T33	protein_coding	OTTHUMT00000097354.1	G	NM_001004695		246502789	-1	no_errors	NM_001004695	genbank	human	provisional	54_36p	missense	SNP		T
ZNF248	57209	genome.wustl.edu	37	10	38126603	38126603	+	Silent	SNP	G	G	A			TCGA-13-0894-01B-01W-0494-09	TCGA-13-0894-10A-01W-0494-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	eb57990e-702f-4fac-9ef5-7447ecb45cec	5781f8d8-a30f-4eee-acc8-c513e7872d10	g.chr10:38126603G>A	ENST00000395867.3	-	5	730	c.180C>T	c.(178-180)atC>atT	p.I60I	ZNF248_ENST00000494133.1_5'UTR|ZNF248_ENST00000374648.3_Silent_p.I60I|ZNF248_ENST00000357328.4_Silent_p.I60I	NM_001267605.1|NM_001267606.1|NM_001267607.1|NM_021045.2	NP_001254534.1|NP_001254535.1|NP_001254536.1|NP_066383.1	Q8NDW4	ZN248_HUMAN	zinc finger protein 248	60	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.I60I(1)		NS(1)|endometrium(2)|large_intestine(5)|lung(9)|ovary(2)|urinary_tract(1)	20						CTCCTTGCTCGATCTTAAAGA	0.428																																																1	Substitution - coding silent(1)	ovary(1)	10											106.0	93.0	97.0					10																	38126603		2203	4300	6503	38166609	SO:0001819	synonymous_variant	57209			AJ491695	CCDS7194.1, CCDS58077.1, CCDS73087.1	10p11.21	2013-01-08			ENSG00000198105	ENSG00000198105		"""Zinc fingers, C2H2-type"", ""-"""	13041	protein-coding gene	gene with protein product						12566394	Standard	NM_021045		Approved	bA162G10.3	uc010qeu.2	Q8NDW4	OTTHUMG00000017980	ENST00000395867.3:c.180C>T	10.37:g.38126603G>A			38166609	Q8NDV8|Q9UMP3	Silent	SNP	HMMPfam_KRAB;HMMPfam_zf-C2H2;superfamily_KRAB domain (Kruppel-associated box Pfam 01352);superfamily_C2H2 and C2HC zinc fingers	p.I60	ENST00000395867.3	37	c.180	CCDS7194.1	10																																																																																			-	NULL		0.428	ZNF248-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF248	protein_coding	OTTHUMT00000047609.1	G	NM_021045		38166609	-1	no_errors	NM_021045	genbank	human	provisional	54_36p	silent	SNP	0.86	A
ADAMTS14	140766	genome.wustl.edu	37	10	72503414	72503414	+	Missense_Mutation	SNP	G	G	A	rs149001845		TCGA-13-0894-01B-01W-0494-09	TCGA-13-0894-10A-01W-0494-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_III	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	eb57990e-702f-4fac-9ef5-7447ecb45cec	5781f8d8-a30f-4eee-acc8-c513e7872d10	g.chr10:72503414G>A	ENST00000373207.1	+	13	2035	c.2035G>A	c.(2035-2037)Gtc>Atc	p.V679I	ADAMTS14_ENST00000373208.1_Missense_Mutation_p.V682I	NM_080722.3	NP_542453.2	Q8WXS8	ATS14_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 14	679	Cys-rich.				collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.V682I(2)		NS(1)|autonomic_ganglia(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(15)|ovary(7)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50						CCCATACAGCGTCTGTGCGCG	0.657																																																2	Substitution - Missense(2)	ovary(1)|lung(1)	10						G	ILE/VAL,ILE/VAL	2,4404	4.2+/-10.8	0,2,2201	89.0	64.0	73.0		2035,2044	-1.6	0.4	10	dbSNP_134	73	0,8600		0,0,4300	no	missense,missense	ADAMTS14	NM_080722.3,NM_139155.2	29,29	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	benign,benign	679/1224,682/1227	72503414	2,13004	2203	4300	6503	72173420	SO:0001583	missense	140766			AF358666	CCDS7306.1, CCDS7307.1	10q21	2008-08-01	2005-08-19		ENSG00000138316	ENSG00000138316		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14899	protein-coding gene	gene with protein product		607506	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 14"""			11779638	Standard	NM_139155		Approved		uc001jrg.3	Q8WXS8	OTTHUMG00000018414	ENST00000373207.1:c.2035G>A	10.37:g.72503414G>A	ENSP00000362303:p.Val679Ile		72173420	Q5T4G0|Q5T4G1|Q8TE55|Q8TEY8	Missense_Mutation	SNP	"HMMPfam_TSP_1,HMMPfam_Reprolysin,HMMPfam_Pep_M12B_propep,HMMPfam_ADAM_spacer1,superfamily_Metalloproteases (""zincins"") catalytic domain,superfamily_TSP-1 type 1 repeat"	p.V682I	ENST00000373207.1	37	c.2044	CCDS7306.1	10	.	.	.	.	.	.	.	.	.	.	G	4.882	0.163977	0.09287	4.54E-4	0.0	ENSG00000138316	ENST00000373208;ENST00000373207	T;T	0.66099	-0.19;-0.19	4.92	-1.61	0.08399	.	0.250357	0.31636	N	0.007311	T	0.30854	0.0778	N	0.11789	0.175	0.24623	N	0.993664	B;B;B	0.20164	0.042;0.014;0.014	B;B;B	0.20577	0.03;0.012;0.014	T	0.32534	-0.9903	10	0.02654	T	1	.	6.274	0.20971	0.3347:0.2292:0.4361:0.0	.	612;679;682	Q8WXS8-2;Q8WXS8;Q5T4G1	.;ATS14_HUMAN;.	I	682;679	ENSP00000362304:V682I;ENSP00000362303:V679I	ENSP00000362303:V679I	V	+	1	0	ADAMTS14	72173420	0.982000	0.34865	0.370000	0.25965	0.914000	0.54420	1.836000	0.39191	-0.524000	0.06400	0.655000	0.94253	GTC	-	NULL		0.657	ADAMTS14-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ADAMTS14	protein_coding	OTTHUMT00000048522.1	G	NM_080722		72173420	1	no_errors	NM_139155	genbank	human	reviewed	54_36p	missense	SNP	0.974	A
PNLIPRP1	5407	genome.wustl.edu	37	10	118355832	118355832	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0894-01B-01W-0494-09	TCGA-13-0894-10A-01W-0494-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	eb57990e-702f-4fac-9ef5-7447ecb45cec	5781f8d8-a30f-4eee-acc8-c513e7872d10	g.chr10:118355832C>A	ENST00000528052.1	+	6	643	c.572C>A	c.(571-573)aCa>aAa	p.T191K	PNLIPRP1_ENST00000534537.1_Missense_Mutation_p.T191K|PNLIPRP1_ENST00000358834.4_Missense_Mutation_p.T191K			P54315	LIPR1_HUMAN	pancreatic lipase-related protein 1	191					lipid metabolic process (GO:0006629)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|triglyceride lipase activity (GO:0004806)	p.T191K(1)		breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(1)|lung(23)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	38				all cancers(201;0.0161)		AGCAGGATTACAGGTAAGGCC	0.582																																																1	Substitution - Missense(1)	ovary(1)	10											88.0	93.0	91.0					10																	118355832		2203	4300	6503	118345822	SO:0001583	missense	5407			BC025784	CCDS7595.1	10q26.12	2006-07-04			ENSG00000187021	ENSG00000187021			9156	protein-coding gene	gene with protein product		604422				1379598	Standard	NM_006229		Approved	PLRP1	uc001lco.1	P54315	OTTHUMG00000019109	ENST00000528052.1:c.572C>A	10.37:g.118355832C>A	ENSP00000433933:p.Thr191Lys		118345822	Q68D83|Q68DR6|Q8TAU2|Q9BS82	Missense_Mutation	SNP	HMMPfam_PLAT;HMMPfam_Lipase;superfamily_Lipase/lipooxygenase domain (PLAT/LH2 domain);superfamily_alpha/beta-Hydrolases	p.T191K	ENST00000528052.1	37	c.572	CCDS7595.1	10	.	.	.	.	.	.	.	.	.	.	C	15.63	2.890931	0.52014	.	.	ENSG00000187021	ENST00000531984;ENST00000358834;ENST00000528052;ENST00000530319;ENST00000527980;ENST00000534537	D;D;D;D;D;D	0.96334	-3.98;-3.98;-3.98;-3.98;-3.98;-3.98	5.1	3.24	0.37175	Lipase, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.98880	0.9621	H	0.99498	4.595	0.80722	D	1	D	0.89917	1.0	D	0.76575	0.988	D	0.98005	1.0362	10	0.87932	D	0	-3.6402	10.9434	0.47287	0.0:0.8446:0.0:0.1554	.	191	P54315	LIPR1_HUMAN	K	191;191;191;146;118;191	ENSP00000436123:T191K;ENSP00000351695:T191K;ENSP00000433933:T191K;ENSP00000437263:T146K;ENSP00000433785:T118K;ENSP00000434159:T191K	ENSP00000351695:T191K	T	+	2	0	PNLIPRP1	118345822	1.000000	0.71417	0.818000	0.32626	0.673000	0.39480	6.543000	0.73874	0.649000	0.30751	0.655000	0.94253	ACA	-	HMMPfam_Lipase		0.582	PNLIPRP1-011	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	PNLIPRP1	protein_coding	OTTHUMT00000384633.1	C	NM_006229		118345822	1	no_errors	NM_006229	genbank	human	provisional	54_36p	missense	SNP	1	A
ACAT1	38	genome.wustl.edu	37	11	108005924	108005924	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0894-01B-01W-0494-09	TCGA-13-0894-10A-01W-0494-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	eb57990e-702f-4fac-9ef5-7447ecb45cec	5781f8d8-a30f-4eee-acc8-c513e7872d10	g.chr11:108005924G>T	ENST00000265838.4	+	5	481	c.390G>T	c.(388-390)atG>atT	p.M130I	ACAT1_ENST00000299355.6_Missense_Mutation_p.M130I	NM_000019.3	NP_000010.1	P24752	THIL_HUMAN	acetyl-CoA acetyltransferase 1	130					adipose tissue development (GO:0060612)|brain development (GO:0007420)|branched-chain amino acid catabolic process (GO:0009083)|cellular ketone body metabolic process (GO:0046950)|cellular lipid metabolic process (GO:0044255)|cellular nitrogen compound metabolic process (GO:0034641)|ketone body biosynthetic process (GO:0046951)|ketone body catabolic process (GO:0046952)|liver development (GO:0001889)|metanephric proximal convoluted tubule development (GO:0072229)|protein homooligomerization (GO:0051260)|response to hormone (GO:0009725)|response to organic cyclic compound (GO:0014070)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	acetyl-CoA C-acetyltransferase activity (GO:0003985)|coenzyme binding (GO:0050662)|metal ion binding (GO:0046872)	p.M130I(1)		endometrium(1)|large_intestine(1)|lung(3)|ovary(3)|prostate(2)	10		all_cancers(61;6.41e-10)|all_epithelial(67;2.83e-06)|Melanoma(852;1.46e-05)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		BRCA - Breast invasive adenocarcinoma(274;2.96e-05)|Epithelial(105;4.35e-05)|all cancers(92;0.00108)|OV - Ovarian serous cystadenocarcinoma(223;0.192)	Sulfasalazine(DB00795)	CTTCAGGAATGAAAGCCATCA	0.383																																																1	Substitution - Missense(1)	ovary(1)	11											129.0	119.0	123.0					11																	108005924		2201	4298	6499	107511134	SO:0001583	missense	38			D90228	CCDS8339.1	11q22.3	2010-04-30	2010-04-30		ENSG00000075239	ENSG00000075239	2.3.1.9		93	protein-coding gene	gene with protein product	"""acetoacetyl Coenzyme A thiolase"""	607809	"""acetyl-Coenzyme A acetyltransferase 1"""	ACAT		1979337	Standard	NM_000019		Approved	THIL	uc001pjy.3	P24752	OTTHUMG00000166381	ENST00000265838.4:c.390G>T	11.37:g.108005924G>T	ENSP00000265838:p.Met130Ile		107511134	B2R6H1|G3XAB4|Q96FG8	Missense_Mutation	SNP	HMMPfam_Thiolase_N;HMMPfam_Thiolase_C;superfamily_Thiolase-like	p.M130I	ENST00000265838.4	37	c.390	CCDS8339.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	33|33	5.217725|5.217725	0.95104|0.95104	.|.	.|.	ENSG00000075239|ENSG00000075239	ENST00000528370|ENST00000265838;ENST00000299355;ENST00000527942	.|D;D;D	.|0.90444	.|-2.67;-2.67;-2.67	5.66|5.66	5.66|5.66	0.87406|0.87406	.|Thiolase-like, subgroup (1);Thiolase, N-terminal (1);Thiolase-like (1);	.|0.000000	.|0.85682	.|D	.|0.000000	.|D	.|0.93455	.|0.7912	M|M	0.78344|0.78344	2.41|2.41	0.80722|0.80722	D|D	1|1	.|B;P	.|0.51240	.|0.247;0.943	.|B;P	.|0.50049	.|0.44;0.629	.|D	.|0.93812	.|0.7111	.|10	.|0.66056	.|D	.|0.02	-11.3771|-11.3771	19.7534|19.7534	0.96277|0.96277	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|130;130	.|P24752;G3XAB4	.|THIL_HUMAN;.	X|I	66|130;130;40	.|ENSP00000265838:M130I;ENSP00000299355:M130I;ENSP00000433568:M40I	.|ENSP00000265838:M130I	E|M	+|+	1|3	0|0	ACAT1|ACAT1	107511134|107511134	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	9.515000|9.515000	0.98015|0.98015	2.673000|2.673000	0.90976|0.90976	0.650000|0.650000	0.86243|0.86243	GAA|ATG	-	HMMPfam_Thiolase_N		0.383	ACAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACAT1	protein_coding	OTTHUMT00000389474.1	G	NM_000019		107511134	1	no_errors	NM_000019	genbank	human	reviewed	54_36p	missense	SNP	1	T
ACAT1	38	genome.wustl.edu	37	11	108005950	108005950	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0894-01B-01W-0494-09	TCGA-13-0894-10A-01W-0494-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	eb57990e-702f-4fac-9ef5-7447ecb45cec	5781f8d8-a30f-4eee-acc8-c513e7872d10	g.chr11:108005950G>A	ENST00000265838.4	+	5	507	c.416G>A	c.(415-417)aGt>aAt	p.S139N	ACAT1_ENST00000299355.6_Missense_Mutation_p.S139N	NM_000019.3	NP_000010.1	P24752	THIL_HUMAN	acetyl-CoA acetyltransferase 1	139					adipose tissue development (GO:0060612)|brain development (GO:0007420)|branched-chain amino acid catabolic process (GO:0009083)|cellular ketone body metabolic process (GO:0046950)|cellular lipid metabolic process (GO:0044255)|cellular nitrogen compound metabolic process (GO:0034641)|ketone body biosynthetic process (GO:0046951)|ketone body catabolic process (GO:0046952)|liver development (GO:0001889)|metanephric proximal convoluted tubule development (GO:0072229)|protein homooligomerization (GO:0051260)|response to hormone (GO:0009725)|response to organic cyclic compound (GO:0014070)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	acetyl-CoA C-acetyltransferase activity (GO:0003985)|coenzyme binding (GO:0050662)|metal ion binding (GO:0046872)	p.S139N(1)		endometrium(1)|large_intestine(1)|lung(3)|ovary(3)|prostate(2)	10		all_cancers(61;6.41e-10)|all_epithelial(67;2.83e-06)|Melanoma(852;1.46e-05)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		BRCA - Breast invasive adenocarcinoma(274;2.96e-05)|Epithelial(105;4.35e-05)|all cancers(92;0.00108)|OV - Ovarian serous cystadenocarcinoma(223;0.192)	Sulfasalazine(DB00795)	GCCTCTCAAAGTCTTATGTGT	0.373																																																1	Substitution - Missense(1)	ovary(1)	11											112.0	104.0	107.0					11																	108005950		2201	4298	6499	107511160	SO:0001583	missense	38			D90228	CCDS8339.1	11q22.3	2010-04-30	2010-04-30		ENSG00000075239	ENSG00000075239	2.3.1.9		93	protein-coding gene	gene with protein product	"""acetoacetyl Coenzyme A thiolase"""	607809	"""acetyl-Coenzyme A acetyltransferase 1"""	ACAT		1979337	Standard	NM_000019		Approved	THIL	uc001pjy.3	P24752	OTTHUMG00000166381	ENST00000265838.4:c.416G>A	11.37:g.108005950G>A	ENSP00000265838:p.Ser139Asn		107511160	B2R6H1|G3XAB4|Q96FG8	Missense_Mutation	SNP	HMMPfam_Thiolase_N;HMMPfam_Thiolase_C;superfamily_Thiolase-like	p.S139N	ENST00000265838.4	37	c.416	CCDS8339.1	11	.	.	.	.	.	.	.	.	.	.	G	7.057	0.565597	0.13560	.	.	ENSG00000075239	ENST00000265838;ENST00000299355;ENST00000527942	D;T;D	0.94758	-3.51;0.89;-2.39	5.66	-1.15	0.09709	Thiolase-like, subgroup (1);Thiolase, N-terminal (1);Thiolase-like (1);	0.170130	0.64402	N	0.000007	D	0.90287	0.6962	L	0.49571	1.57	0.58432	D	0.999995	B;B	0.10296	0.0;0.003	B;B	0.12837	0.003;0.008	T	0.78534	-0.2167	10	0.22706	T	0.39	-11.1278	13.2563	0.60081	0.3634:0.0:0.6366:0.0	.	139;139	P24752;G3XAB4	THIL_HUMAN;.	N	139;139;49	ENSP00000265838:S139N;ENSP00000299355:S139N;ENSP00000433568:S49N	ENSP00000265838:S139N	S	+	2	0	ACAT1	107511160	0.973000	0.33851	0.957000	0.39632	0.979000	0.70002	1.033000	0.30191	-0.399000	0.07668	-0.300000	0.09419	AGT	-	HMMPfam_Thiolase_N		0.373	ACAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACAT1	protein_coding	OTTHUMT00000389474.1	G	NM_000019		107511160	1	no_errors	NM_000019	genbank	human	reviewed	54_36p	missense	SNP	1	A
SYT10	341359	genome.wustl.edu	37	12	33579432	33579432	+	Splice_Site	SNP	T	T	C			TCGA-13-0894-01B-01W-0494-09	TCGA-13-0894-10A-01W-0494-09	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	eb57990e-702f-4fac-9ef5-7447ecb45cec	5781f8d8-a30f-4eee-acc8-c513e7872d10	g.chr12:33579432T>C	ENST00000228567.3	-	2	448		c.e2-2		SYT10_ENST00000567656.1_5'Flank|SYT10_ENST00000535526.1_Splice_Site	NM_198992.3	NP_945343.1	Q6XYQ8	SYT10_HUMAN	synaptotagmin X						regulation of calcium ion-dependent exocytosis (GO:0017158)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	metal ion binding (GO:0046872)|transporter activity (GO:0005215)	p.?(1)		NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(18)|ovary(1)|prostate(3)|skin(4)|urinary_tract(1)	42	Lung NSC(5;8.37e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0334)					CTGAAATATCTGGAAAAATTA	0.333																																																1	Unknown(1)	ovary(1)	12											29.0	29.0	29.0					12																	33579432		2203	4299	6502	33470699	SO:0001630	splice_region_variant	341359			AY198413	CCDS8732.1	12p11	2013-01-21			ENSG00000110975	ENSG00000110975		"""Synaptotagmins"""	19266	protein-coding gene	gene with protein product							Standard	NM_198992		Approved		uc001rll.1	Q6XYQ8	OTTHUMG00000169269	ENST00000228567.3:c.152-2A>G	12.37:g.33579432T>C			33470699	Q495U2	Splice_Site	SNP	-	e2-2	ENST00000228567.3	37	c.152-2	CCDS8732.1	12	.	.	.	.	.	.	.	.	.	.	T	16.34	3.097153	0.56075	.	.	ENSG00000110975	ENST00000228567	.	.	.	3.86	3.86	0.44501	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.889	0.58061	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	SYT10	33470699	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	6.994000	0.76251	1.990000	0.58119	0.533000	0.62120	.	-	-		0.333	SYT10-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SYT10	protein_coding	OTTHUMT00000403222.1	T	NM_198992	Intron	33470699	-1	no_errors	NM_198992	genbank	human	provisional	54_36p	splice_site	SNP	1	C
R3HDM2	22864	genome.wustl.edu	37	12	57651826	57651826	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0894-01B-01W-0494-09	TCGA-13-0894-10A-01W-0494-09	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	eb57990e-702f-4fac-9ef5-7447ecb45cec	5781f8d8-a30f-4eee-acc8-c513e7872d10	g.chr12:57651826A>T	ENST00000347140.3	-	21	2744	c.2354T>A	c.(2353-2355)cTc>cAc	p.L785H	RP11-123K3.4_ENST00000548184.1_3'UTR|R3HDM2_ENST00000403821.2_Missense_Mutation_p.L819H|R3HDM2_ENST00000546843.1_5'Flank|R3HDM2_ENST00000402412.1_Missense_Mutation_p.L799H|R3HDM2_ENST00000441731.2_Missense_Mutation_p.L480H|R3HDM2_ENST00000358907.2_Missense_Mutation_p.L785H|R3HDM2_ENST00000413953.2_Missense_Mutation_p.L512H			Q9Y2K5	R3HD2_HUMAN	R3H domain containing 2	785						nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.L446H(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(3)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	22						CAGGGGACTGAGTCCTGTGCA	0.587																																																1	Substitution - Missense(1)	ovary(1)	12											95.0	65.0	75.0					12																	57651826		2203	4300	6503	55938093	SO:0001583	missense	22864			AB023219	CCDS8937.2	12q13.3	2012-11-19			ENSG00000179912	ENSG00000179912			29167	protein-coding gene	gene with protein product							Standard	NM_014925		Approved	KIAA1002	uc009zpm.1	Q9Y2K5	OTTHUMG00000171568	ENST00000347140.3:c.2354T>A	12.37:g.57651826A>T	ENSP00000317903:p.Leu785His		55938093	Q2M1T9|Q3ZCT5	Missense_Mutation	SNP	-	p.L446H	ENST00000347140.3	37	c.1337	CCDS8937.2	12	.	.	.	.	.	.	.	.	.	.	A	19.79	3.892536	0.72524	.	.	ENSG00000179912	ENST00000413953;ENST00000393811;ENST00000347140;ENST00000402412;ENST00000358907;ENST00000441731;ENST00000429355;ENST00000403821;ENST00000548161	T;T;T;T;T;T;T;T	0.51325	0.73;0.71;1.7;1.7;1.7;0.72;1.3;1.7	5.16	5.16	0.70880	.	0.000000	0.85682	D	0.000000	T	0.53867	0.1823	L	0.31065	0.9	0.43734	D	0.99622	D;D;D;D	0.89917	1.0;1.0;0.999;1.0	D;D;D;D	0.87578	0.997;0.997;0.995;0.998	T	0.44251	-0.9340	10	0.15499	T	0.54	-12.1242	14.4076	0.67093	1.0:0.0:0.0:0.0	.	819;799;785;512	B5MCG9;B5MCU0;Q9Y2K5;E9PAL1	.;.;R3HD2_HUMAN;.	H	512;512;785;799;785;480;550;819;174	ENSP00000409146:L512H;ENSP00000377400:L512H;ENSP00000317903:L785H;ENSP00000385839:L799H;ENSP00000351784:L785H;ENSP00000408536:L480H;ENSP00000394676:L550H;ENSP00000385169:L819H	ENSP00000317903:L785H	L	-	2	0	R3HDM2	55938093	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.312000	0.89976	2.299000	0.77371	0.533000	0.62120	CTC	-	NULL		0.587	R3HDM2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	R3HDM2	protein_coding	OTTHUMT00000326570.2	A	NM_014925		55938093	-1	no_errors	NM_014925	genbank	human	validated	54_36p	missense	SNP	1	T
OR11H6	122748	genome.wustl.edu	37	14	20691877	20691877	+	Missense_Mutation	SNP	T	T	G			TCGA-13-0894-01B-01W-0494-09	TCGA-13-0894-10A-01W-0494-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_III	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	eb57990e-702f-4fac-9ef5-7447ecb45cec	5781f8d8-a30f-4eee-acc8-c513e7872d10	g.chr14:20691877T>G	ENST00000315519.2	+	1	87	c.9T>G	c.(7-9)ttT>ttG	p.F3L		NM_001004480.1	NP_001004480.1	Q8NGC7	O11H6_HUMAN	olfactory receptor, family 11, subfamily H, member 6	3						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.F3L(1)		cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(13)|ovary(2)|prostate(1)|skin(2)	29	all_cancers(95;0.00108)		Epithelial(56;1.75e-06)|all cancers(55;1.22e-05)	GBM - Glioblastoma multiforme(265;0.0143)		aaatgttctttattattCATT	0.373																																																1	Substitution - Missense(1)	ovary(1)	14											60.0	65.0	63.0					14																	20691877		2202	4299	6501	19761717	SO:0001583	missense	122748				CCDS32033.1	14q11.2	2013-09-24			ENSG00000176219	ENSG00000176219		"""GPCR / Class A : Olfactory receptors"""	15349	protein-coding gene	gene with protein product							Standard	NM_001004480		Approved		uc010tlc.2	Q8NGC7	OTTHUMG00000170850	ENST00000315519.2:c.9T>G	14.37:g.20691877T>G	ENSP00000319071:p.Phe3Leu		19761717	Q6IF08	Missense_Mutation	SNP	-	p.F3L	ENST00000315519.2	37	c.9	CCDS32033.1	14	.	.	.	.	.	.	.	.	.	.	t	11.59	1.685176	0.29872	.	.	ENSG00000176219	ENST00000315519	T	0.00522	6.84	4.75	-9.08	0.00720	.	.	.	.	.	T	0.00178	0.0005	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.43877	-0.9364	9	0.10377	T	0.69	.	0.4228	0.00459	0.3199:0.1371:0.219:0.324	.	3	Q8NGC7	O11H6_HUMAN	L	3	ENSP00000319071:F3L	ENSP00000319071:F3L	F	+	3	2	OR11H6	19761717	0.009000	0.17119	0.000000	0.03702	0.102000	0.19082	0.489000	0.22387	-1.638000	0.01529	0.363000	0.22086	TTT	-	NULL		0.373	OR11H6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR11H6	protein_coding	OTTHUMT00000410676.1	T			19761717	1	no_errors	NM_001004480	genbank	human	provisional	54_36p	missense	SNP	0.001	G
PPP2R3C	55012	genome.wustl.edu	37	14	35564333	35564333	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0894-01B-01W-0494-09	TCGA-13-0894-10A-01W-0494-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	eb57990e-702f-4fac-9ef5-7447ecb45cec	5781f8d8-a30f-4eee-acc8-c513e7872d10	g.chr14:35564333G>A	ENST00000261475.5	-	10	1249	c.896C>T	c.(895-897)tCa>tTa	p.S299L		NM_017917.2	NP_060387.2	Q969Q6	P2R3C_HUMAN	protein phosphatase 2, regulatory subunit B'', gamma	299	EF-hand 1.				activation of protein kinase activity (GO:0032147)|B cell homeostasis (GO:0001782)|positive regulation of B cell differentiation (GO:0045579)|regulation of antimicrobial humoral response (GO:0002759)|regulation of mitochondrial depolarization (GO:0051900)|spleen development (GO:0048536)|T cell homeostasis (GO:0043029)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)	p.S299L(1)		central_nervous_system(1)|kidney(1)|large_intestine(8)|lung(4)|ovary(1)	15	Breast(36;0.0545)|Hepatocellular(127;0.158)|Prostate(35;0.184)		Lung(238;8.62e-06)|LUAD - Lung adenocarcinoma(48;1.42e-05)|Epithelial(34;0.0177)|all cancers(34;0.0491)	GBM - Glioblastoma multiforme(112;0.0803)		TCCATAGCGTGAGAGTTCTTC	0.388																																																1	Substitution - Missense(1)	ovary(1)	14											131.0	119.0	123.0					14																	35564333		2203	4300	6503	34634084	SO:0001583	missense	55012			AK000651	CCDS9654.1	14q13.2	2010-06-18	2010-06-18	2007-01-22	ENSG00000092020	ENSG00000092020		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	17485	protein-coding gene	gene with protein product		615902	"""chromosome 14 open reading frame 10"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B'', gamma"""	C14orf10		12167160, 16129705	Standard	NM_017917		Approved	FLJ20644, G4-1, G5PR	uc001wss.3	Q969Q6	OTTHUMG00000140224	ENST00000261475.5:c.896C>T	14.37:g.35564333G>A	ENSP00000261475:p.Ser299Leu		34634084	B4DEN7|D3DS97|D3DS98|Q5GJ55|Q5GJ56|Q6P4G2|Q86TZ3|Q9NWR9	Missense_Mutation	SNP	superfamily_EF-hand	p.S299L	ENST00000261475.5	37	c.896	CCDS9654.1	14	.	.	.	.	.	.	.	.	.	.	G	21.9	4.216085	0.79352	.	.	ENSG00000092020	ENST00000261475;ENST00000555219	T;T	0.66815	-0.18;-0.23	5.25	5.25	0.73442	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	T	0.59404	0.2191	L	0.41492	1.28	0.80722	D	1	B	0.23128	0.08	B	0.20767	0.031	T	0.54139	-0.8338	10	0.19147	T	0.46	-4.6698	19.203	0.93719	0.0:0.0:1.0:0.0	.	299	Q969Q6	P2R3C_HUMAN	L	299;20	ENSP00000261475:S299L;ENSP00000452173:S20L	ENSP00000261475:S299L	S	-	2	0	PPP2R3C	34634084	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.751000	0.98889	2.611000	0.88343	0.655000	0.94253	TCA	-	NULL		0.388	PPP2R3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP2R3C	protein_coding	OTTHUMT00000276687.1	G	NM_017917		34634084	-1	no_errors	NM_017917	genbank	human	provisional	54_36p	missense	SNP	1	A
C14orf39	317761	genome.wustl.edu	37	14	60903693	60903693	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0894-01B-01W-0494-09	TCGA-13-0894-10A-01W-0494-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	eb57990e-702f-4fac-9ef5-7447ecb45cec	5781f8d8-a30f-4eee-acc8-c513e7872d10	g.chr14:60903693G>A	ENST00000321731.3	-	18	1793	c.1634C>T	c.(1633-1635)aCa>aTa	p.T545I		NM_174978.2	NP_777638	Q8N1H7	S6OS1_HUMAN	chromosome 14 open reading frame 39	545					multicellular organismal development (GO:0007275)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)			p.T545I(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	30				OV - Ovarian serous cystadenocarcinoma(108;0.0448)		AGCTCCAAATGTATGAGTTGA	0.333																																																1	Substitution - Missense(1)	ovary(1)	14											149.0	165.0	160.0					14																	60903693		2203	4296	6499	59973446	SO:0001583	missense	317761			AK098187	CCDS9746.1	14q23.1	2012-11-05	2012-11-05	2012-11-05	ENSG00000179008	ENSG00000179008			19849	protein-coding gene	gene with protein product							Standard	NM_174978		Approved	SIX6OS1	uc001xez.4	Q8N1H7	OTTHUMG00000140332	ENST00000321731.3:c.1634C>T	14.37:g.60903693G>A	ENSP00000324920:p.Thr545Ile		59973446	Q08AQ4	Missense_Mutation	SNP	-	p.T545I	ENST00000321731.3	37	c.1634	CCDS9746.1	14	.	.	.	.	.	.	.	.	.	.	G	12.78	2.040742	0.35989	.	.	ENSG00000179008	ENST00000321731	T	0.25250	1.81	5.17	4.22	0.49857	.	0.601838	0.15593	N	0.254310	T	0.22513	0.0543	L	0.36672	1.1	0.27726	N	0.944972	P	0.43701	0.815	P	0.45681	0.49	T	0.03139	-1.1068	10	0.14252	T	0.57	-1.3508	9.5613	0.39371	0.0:0.1537:0.6874:0.1589	.	545	Q8N1H7	S6OS1_HUMAN	I	545	ENSP00000324920:T545I	ENSP00000324920:T545I	T	-	2	0	C14orf39	59973446	0.990000	0.36364	1.000000	0.80357	0.990000	0.78478	1.886000	0.39688	2.408000	0.81797	0.557000	0.71058	ACA	-	NULL		0.333	C14orf39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C14orf39	protein_coding	OTTHUMT00000276948.1	G	NM_174978		59973446	-1	no_errors	NM_174978	genbank	human	validated	54_36p	missense	SNP	1	A
CGNL1	84952	genome.wustl.edu	37	15	57731660	57731660	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0894-01B-01W-0494-09	TCGA-13-0894-10A-01W-0494-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	eb57990e-702f-4fac-9ef5-7447ecb45cec	5781f8d8-a30f-4eee-acc8-c513e7872d10	g.chr15:57731660G>A	ENST00000281282.5	+	2	1541	c.1463G>A	c.(1462-1464)gGt>gAt	p.G488D		NM_001252335.1|NM_032866.4	NP_001239264.1|NP_116255.2	Q0VF96	CGNL1_HUMAN	cingulin-like 1	488	Head.					myosin complex (GO:0016459)|tight junction (GO:0005923)	motor activity (GO:0003774)	p.G488D(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(14)|ovary(4)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(1)	60				all cancers(107;0.121)|GBM - Glioblastoma multiforme(80;0.186)		CCCTCCCTTGGTGCACAGAGT	0.537																																																1	Substitution - Missense(1)	ovary(1)	15											67.0	69.0	68.0					15																	57731660		2192	4292	6484	55518952	SO:0001583	missense	84952			AY274808	CCDS10161.1	15q21.3	2011-06-10			ENSG00000128849	ENSG00000128849			25931	protein-coding gene	gene with protein product		607856				11214970	Standard	NM_001252335		Approved	FLJ14957, JACOP, KIAA1749, paracingulin	uc002aeg.3	Q0VF96	OTTHUMG00000166485	ENST00000281282.5:c.1463G>A	15.37:g.57731660G>A	ENSP00000281282:p.Gly488Asp		55518952	Q05BZ4|Q52LR0|Q695C7|Q7Z2L3|Q96JV2|Q96MN6|Q9C0B4	Missense_Mutation	SNP	HMMPfam_Myosin_tail_1	p.G488D	ENST00000281282.5	37	c.1463	CCDS10161.1	15	.	.	.	.	.	.	.	.	.	.	G	5.839	0.339023	0.11069	.	.	ENSG00000128849	ENST00000281282	T	0.75589	-0.95	5.63	1.43	0.22495	.	1.685090	0.03447	N	0.210115	T	0.53417	0.1795	N	0.08118	0	0.09310	N	1	B	0.28552	0.215	B	0.23275	0.045	T	0.45862	-0.9232	10	0.35671	T	0.21	-4.656	4.9639	0.14080	0.121:0.626:0.1205:0.1325	.	488	Q0VF96	CGNL1_HUMAN	D	488	ENSP00000281282:G488D	ENSP00000281282:G488D	G	+	2	0	CGNL1	55518952	0.009000	0.17119	0.003000	0.11579	0.027000	0.11550	0.925000	0.28791	0.324000	0.23333	-0.825000	0.03093	GGT	-	NULL		0.537	CGNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CGNL1	protein_coding	OTTHUMT00000255482.2	G	NM_032866		55518952	1	no_errors	NM_032866	genbank	human	validated	54_36p	missense	SNP	0.09	A
KCNJ12	3768	genome.wustl.edu	37	17	21319721	21319721	+	Missense_Mutation	SNP	G	G	A	rs138394714	byFrequency	TCGA-13-0894-01B-01W-0494-09	TCGA-13-0894-10A-01W-0494-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	eb57990e-702f-4fac-9ef5-7447ecb45cec	5781f8d8-a30f-4eee-acc8-c513e7872d10	g.chr17:21319721G>A	ENST00000583088.1	+	3	1962	c.1067G>A	c.(1066-1068)cGc>cAc	p.R356H	KCNJ12_ENST00000331718.5_Missense_Mutation_p.R356H	NM_021012.4	NP_066292.2	Q14500	KCJ12_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 12	356					muscle contraction (GO:0006936)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|protein homotetramerization (GO:0051289)|regulation of heart contraction (GO:0008016)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|intrinsic component of membrane (GO:0031224)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)	p.R356H(1)		NS(1)|breast(4)|endometrium(4)|kidney(1)|large_intestine(5)|lung(39)|ovary(5)|skin(8)|stomach(3)	70				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)|Yohimbine(DB01392)	TCTACGCCCCGCTGCAGTGCG	0.577										Prostate(3;0.18)																																						1	Substitution - Missense(1)	ovary(1)	17						G	HIS/ARG	14,4392	17.9+/-39.9	0,14,2189	110.0	108.0	109.0		1067	5.7	1.0	17	dbSNP_134	109	3,8597	2.2+/-6.3	0,3,4297	yes	missense	KCNJ12	NM_021012.4	29	0,17,6486	AA,AG,GG		0.0349,0.3177,0.1307	benign	356/434	21319721	17,12989	2203	4300	6503	21260314	SO:0001583	missense	3768			L36069	CCDS11219.1	17p11.1	2011-07-05	2004-01-13		ENSG00000184185	ENSG00000184185		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6258	protein-coding gene	gene with protein product		602323	"""potassium inwardly-rectifying channel, subfamily J, inhibitor 1"""	KCNJN1		7859381, 12417321, 16382105	Standard	NM_021012		Approved	Kir2.2, Kir2.2v, IRK2, hIRK1	uc021tss.1	Q14500	OTTHUMG00000132039	ENST00000583088.1:c.1067G>A	17.37:g.21319721G>A	ENSP00000463778:p.Arg356His		21260314	O43401|Q15756|Q8NG63	Missense_Mutation	SNP	HMMPfam_IRK;HMMPfam_IRK_N;superfamily_E set domains;superfamily_Voltage-gated potassium channels	p.R356H	ENST00000583088.1	37	c.1067	CCDS11219.1	17	.	.	.	.	.	.	.	.	.	.	G	7.237	0.600460	0.13939	0.003177	3.49E-4	ENSG00000184185	ENST00000331718	D	0.94000	-3.33	5.65	5.65	0.86999	Immunoglobulin E-set (1);Potassium channel, inwardly rectifying, Kir, conserved region 2 (1);Potassium channel, inwardly rectifying, Kir, cytoplasmic (1);	0.111349	0.64402	D	0.000005	D	0.86422	0.5929	N	0.11131	0.1	0.58432	D	0.999999	B	0.06786	0.001	B	0.04013	0.001	T	0.81169	-0.1055	10	0.14252	T	0.57	.	19.713	0.96103	0.0:0.0:1.0:0.0	.	356	Q14500	IRK12_HUMAN	H	356	ENSP00000328150:R356H	ENSP00000328150:R356H	R	+	2	0	KCNJ12	21260314	1.000000	0.71417	1.000000	0.80357	0.218000	0.24690	5.475000	0.66787	2.667000	0.90743	0.643000	0.83706	CGC	-	HMMPfam_IRK		0.577	KCNJ12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNJ12	protein_coding	OTTHUMT00000255060.2	G	NM_021012		21260314	1	no_errors	NM_021012	genbank	human	validated	54_36p	missense	SNP	1	A
ATAD5	79915	genome.wustl.edu	37	17	29219769	29219769	+	Missense_Mutation	SNP	T	T	G			TCGA-13-0894-01B-01W-0494-09	TCGA-13-0894-10A-01W-0494-09	T	T	T	G	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	eb57990e-702f-4fac-9ef5-7447ecb45cec	5781f8d8-a30f-4eee-acc8-c513e7872d10	g.chr17:29219769T>G	ENST00000321990.4	+	20	4781	c.4403T>G	c.(4402-4404)aTt>aGt	p.I1468S		NM_024857.3	NP_079133.3	Q96QE3	ATAD5_HUMAN	ATPase family, AAA domain containing 5	1468					cellular response to DNA damage stimulus (GO:0006974)	nucleus (GO:0005634)	ATP binding (GO:0005524)	p.I1468S(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(18)|lung(13)|ovary(3)|pancreas(1)	51		all_hematologic(16;0.0202)|Acute lymphoblastic leukemia(14;0.0238)|Myeloproliferative disorder(56;0.0393)				CTTAAGAACATTTTTTCCCCA	0.323																																																1	Substitution - Missense(1)	ovary(1)	17											154.0	152.0	153.0					17																	29219769		2203	4300	6503	26243895	SO:0001583	missense	79915				CCDS11260.1	17q11.2	2010-04-21	2007-02-08	2007-02-08	ENSG00000176208	ENSG00000176208		"""ATPases / AAA-type"""	25752	protein-coding gene	gene with protein product	"""enhanced level of genomic instability 1 homolog (S. cerevisiae)"""	609534	"""chromosome 17 open reading frame 41"""	C17orf41		15983387, 11468690, 19755857	Standard	NM_024857		Approved	FLJ12735, FRAG1, ELG1	uc002hfs.1	Q96QE3	OTTHUMG00000132794	ENST00000321990.4:c.4403T>G	17.37:g.29219769T>G	ENSP00000313171:p.Ile1468Ser		26243895	Q05DH0|Q69YR6|Q9H9I1	Missense_Mutation	SNP	HMMPfam_AAA;superfamily_P-loop containing nucleoside triphosphate hydrolases	p.I1468S	ENST00000321990.4	37	c.4403	CCDS11260.1	17	.	.	.	.	.	.	.	.	.	.	T	19.55	3.849216	0.71603	.	.	ENSG00000176208	ENST00000321990	T	0.17691	2.26	4.84	4.84	0.62591	.	0.412785	0.27531	N	0.018952	T	0.40040	0.1101	M	0.66939	2.045	0.49687	D	0.999814	D	0.89917	1.0	D	0.74023	0.982	T	0.30909	-0.9962	10	0.87932	D	0	.	14.733	0.69397	0.0:0.0:0.0:1.0	.	1468	Q96QE3	ATAD5_HUMAN	S	1468	ENSP00000313171:I1468S	ENSP00000313171:I1468S	I	+	2	0	ATAD5	26243895	1.000000	0.71417	0.997000	0.53966	0.879000	0.50718	5.546000	0.67243	1.939000	0.56221	0.260000	0.18958	ATT	-	NULL		0.323	ATAD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATAD5	protein_coding	OTTHUMT00000256206.2	T	NM_024857		26243895	1	no_errors	NM_024857	genbank	human	provisional	54_36p	missense	SNP	0.99	G
TP53	7157	genome.wustl.edu	37	17	7578272	7578272	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0894-01B-01W-0494-09	TCGA-13-0894-10A-01W-0494-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	eb57990e-702f-4fac-9ef5-7447ecb45cec	5781f8d8-a30f-4eee-acc8-c513e7872d10	g.chr17:7578272G>A	ENST00000269305.4	-	6	766	c.577C>T	c.(577-579)Cat>Tat	p.H193Y	TP53_ENST00000420246.2_Missense_Mutation_p.H193Y|TP53_ENST00000455263.2_Missense_Mutation_p.H193Y|TP53_ENST00000413465.2_Missense_Mutation_p.H193Y|TP53_ENST00000574684.1_Intron|TP53_ENST00000359597.4_Missense_Mutation_p.H193Y|TP53_ENST00000445888.2_Missense_Mutation_p.H193Y	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	193	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		H -> D (in sporadic cancers; somatic mutation).|H -> L (in sporadic cancers; somatic mutation).|H -> N (in sporadic cancers; somatic mutation).|H -> P (in sporadic cancers; somatic mutation).|H -> Q (in sporadic cancers; somatic mutation).|H -> R (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7887414}.|H -> Y (in sporadic cancers; somatic mutation).|QH -> HN (in a sporadic cancer; somatic mutation).|QH -> HY (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.H193Y(29)|p.H193D(13)|p.0?(8)|p.?(6)|p.H193N(4)|p.A189_V197delAPPQHLIRV(4)|p.H193fs*16(3)|p.P191_E198>Q(3)|p.P191fs*53(2)|p.H61D(2)|p.H100D(2)|p.P191fs*15(1)|p.H61Y(1)|p.P191fs*6(1)|p.H100Y(1)|p.P98_E105>Q(1)|p.H193_I195delHLI(1)|p.P59_E66>Q(1)|p.H193_I195>AP(1)|p.A189fs*53(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CGGATAAGATGCTGAGGAGGG	0.557		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	85	Substitution - Missense(52)|Whole gene deletion(8)|Complex - deletion inframe(6)|Unknown(6)|Deletion - In frame(5)|Deletion - Frameshift(4)|Insertion - Frameshift(3)|Complex - frameshift(1)	breast(14)|lung(12)|haematopoietic_and_lymphoid_tissue(8)|biliary_tract(7)|ovary(6)|upper_aerodigestive_tract(5)|liver(5)|oesophagus(5)|central_nervous_system(4)|skin(4)|bone(4)|large_intestine(3)|stomach(2)|urinary_tract(2)|pancreas(2)|adrenal_gland(1)|soft_tissue(1)	17											95.0	85.0	88.0					17																	7578272		2203	4300	6503	7518997	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.577C>T	17.37:g.7578272G>A	ENSP00000269305:p.His193Tyr		7518997	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	superfamily_p53-like transcription factors;superfamily_p53 tetramerization domain;P53_tetramer;HMMPfam_P53_tetramer;P53;HMMPfam_P53;P53_TAD;HMMPfam_P53_TAD	p.H193Y	ENST00000269305.4	37	c.577	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	G	17.43	3.387715	0.61956	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99851	-7.17;-7.17;-7.17;-7.17;-7.17;-7.17;-7.17;-7.17	5.41	5.41	0.78517	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99873	0.9940	M	0.88906	2.99	0.58432	D	0.999999	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D	0.96559	0.9414	10	0.87932	D	0	-29.0766	17.0767	0.86588	0.0:0.0:1.0:0.0	.	154;193;193;100;193;193;193	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	Y	193;193;193;193;193;193;182;100;61;100;61	ENSP00000410739:H193Y;ENSP00000352610:H193Y;ENSP00000269305:H193Y;ENSP00000398846:H193Y;ENSP00000391127:H193Y;ENSP00000391478:H193Y;ENSP00000425104:H61Y;ENSP00000423862:H100Y	ENSP00000269305:H193Y	H	-	1	0	TP53	7518997	1.000000	0.71417	0.971000	0.41717	0.032000	0.12392	9.813000	0.99286	2.702000	0.92279	0.655000	0.94253	CAT	-	HMMPfam_P53		0.557	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	G	NM_000546		7518997	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	missense	SNP	1	A
WNT9B	7484	genome.wustl.edu	37	17	44952406	44952406	+	Intron	SNP	C	C	G	rs34802615		TCGA-13-0894-01B-01W-0494-09	TCGA-13-0894-10A-01W-0494-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	eb57990e-702f-4fac-9ef5-7447ecb45cec	5781f8d8-a30f-4eee-acc8-c513e7872d10	g.chr17:44952406C>G	ENST00000290015.2	+	3	387				WNT9B_ENST00000393461.2_Intron	NM_003396.1	NP_003387.1	O14905	WNT9B_HUMAN	wingless-type MMTV integration site family, member 9B						branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|cell fate commitment (GO:0045165)|cell-cell signaling (GO:0007267)|cellular response to retinoic acid (GO:0071300)|cellular response to starvation (GO:0009267)|collecting duct development (GO:0072044)|cornea development in camera-type eye (GO:0061303)|embryonic cranial skeleton morphogenesis (GO:0048701)|establishment of planar polarity involved in nephron morphogenesis (GO:0072046)|in utero embryonic development (GO:0001701)|kidney rudiment formation (GO:0072003)|male genitalia development (GO:0030539)|mesenchymal stem cell maintenance involved in nephron morphogenesis (GO:0072038)|mesonephric duct formation (GO:0072181)|metanephric tubule formation (GO:0072174)|multicellular organismal development (GO:0007275)|neuron differentiation (GO:0030182)|palate development (GO:0060021)|positive regulation of catalytic activity (GO:0043085)|regulation of asymmetric cell division (GO:0009786)|regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003339)|regulation of protein phosphorylation (GO:0001932)|regulation of tube size (GO:0035150)|response to retinoic acid (GO:0032526)|uterus morphogenesis (GO:0061038)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)			large_intestine(2)|lung(8)	10			BRCA - Breast invasive adenocarcinoma(9;0.0257)			AACCTCTAAGcttcctccttt	0.617																																																0			17																																								42307405	SO:0001627	intron_variant	7484			AF028703	CCDS11506.1	17q21	2008-01-07	2003-03-11	2003-03-14		ENSG00000158955		"""Wingless-type MMTV integration sites"""	12779	protein-coding gene	gene with protein product		602864	"""wingless-type MMTV integration site family, member 15"""	WNT15		9441749, 11713592	Standard	NM_003396		Approved	WNT14B	uc002ikw.1	O14905		ENST00000290015.2:c.335-61C>G	17.37:g.44952406C>G			42307405	Q6UXT4|Q96Q09	Missense_Mutation	SNP	-	p.L86V	ENST00000290015.2	37	c.256	CCDS11506.1	17	.	.	.	.	.	.	.	.	.	.	C	7.886	0.731298	0.15507	.	.	ENSG00000158955	ENST00000376843	.	.	.	4.4	1.11	0.20524	.	.	.	.	.	T	0.26846	0.0657	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.27020	-1.0086	5	0.46703	T	0.11	.	1.7971	0.03063	0.1652:0.4754:0.1614:0.198	.	.	.	.	V	86	.	ENSP00000366039:L86V	L	+	1	0	WNT9B	42307405	0.000000	0.05858	0.001000	0.08648	0.060000	0.15804	0.519000	0.22862	0.373000	0.24621	0.462000	0.41574	CTT	-	NULL		0.617	WNT9B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WNT9B	protein_coding	OTTHUMT00000440433.1	C	NM_003396		42307405	1	no_errors	ENST00000376843	ensembl	human	known	54_36p	missense	SNP		G
SAFB	6294	genome.wustl.edu	37	19	5641841	5641841	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0894-01B-01W-0494-09	TCGA-13-0894-10A-01W-0494-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	eb57990e-702f-4fac-9ef5-7447ecb45cec	5781f8d8-a30f-4eee-acc8-c513e7872d10	g.chr19:5641841G>A	ENST00000292123.5	+	4	537	c.430G>A	c.(430-432)Gtt>Att	p.V144I	SAFB_ENST00000586934.1_3'UTR|SAFB_ENST00000454510.1_Intron|SAFB_ENST00000433404.1_De_novo_Start_OutOfFrame|SAFB_ENST00000592224.1_Missense_Mutation_p.V144I|SAFB_ENST00000588852.1_Missense_Mutation_p.V144I|SAFB_ENST00000538656.1_Intron	NM_001201338.1|NM_001201339.1|NM_002967.3	NP_001188267.1|NP_001188268.1|NP_002958.2	Q15424	SAFB1_HUMAN	scaffold attachment factor B	144					chromatin organization (GO:0006325)|growth (GO:0040007)|hormone metabolic process (GO:0042445)|intracellular estrogen receptor signaling pathway (GO:0030520)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|core promoter binding (GO:0001047)|double-stranded DNA binding (GO:0003690)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.V144I(1)		breast(3)|central_nervous_system(1)|endometrium(5)|large_intestine(4)|liver(1)|lung(6)|ovary(2)|skin(1)	23				UCEC - Uterine corpus endometrioid carcinoma (162;0.000222)		TAATGGAAGCGTTGCAGATTG	0.483																																					Colon(88;338 1345 6184 8214 20897)											1	Substitution - Missense(1)	ovary(1)	19											158.0	155.0	156.0					19																	5641841		2203	4300	6503	5592841	SO:0001583	missense	6294			L43631	CCDS12142.1, CCDS56077.1, CCDS59339.1, CCDS59340.1	19p13.3-p13.2	2013-02-12				ENSG00000160633		"""RNA binding motif (RRM) containing"""	10520	protein-coding gene	gene with protein product	"""Hsp27 ERE-TATA binding protein"""	602895				9605873, 8600450	Standard	NM_002967		Approved	HET, SAFB1	uc002mcg.3	Q15424		ENST00000292123.5:c.430G>A	19.37:g.5641841G>A	ENSP00000292123:p.Val144Ile		5592841	A0AV56|B7Z5B6|B7ZLP6|F5H0H3|O60406|Q59HH8	Missense_Mutation	SNP	HMMPfam_RRM_1;HMMPfam_SAP;superfamily_RNA-binding domain RBD;superfamily_SAP domain	p.V144I	ENST00000292123.5	37	c.430	CCDS12142.1	19	.	.	.	.	.	.	.	.	.	.	G	9.501	1.103163	0.20632	.	.	ENSG00000160633	ENST00000292123	T	0.10288	2.89	5.7	4.67	0.58626	.	0.122641	0.36303	N	0.002678	T	0.08447	0.0210	L	0.34521	1.04	0.80722	D	1	B;B;B;B;B	0.32365	0.367;0.013;0.367;0.236;0.367	B;B;B;B;B	0.20577	0.03;0.002;0.03;0.03;0.03	T	0.19289	-1.0310	10	0.40728	T	0.16	-17.463	13.0308	0.58840	0.0745:0.0:0.9255:0.0	.	144;144;144;144;144	B7ZLP5;B7Z2H3;A0AV56;Q15424;B7ZLP6	.;.;.;SAFB1_HUMAN;.	I	144	ENSP00000292123:V144I	ENSP00000292123:V144I	V	+	1	0	SAFB	5592841	0.826000	0.29277	0.076000	0.20297	0.234000	0.25298	2.253000	0.43205	1.411000	0.46957	0.557000	0.71058	GTT	-	NULL		0.483	SAFB-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	SAFB	protein_coding	OTTHUMT00000451641.2	G			5592841	1	no_errors	NM_002967	genbank	human	reviewed	54_36p	missense	SNP	0.72	A
ILVBL	10994	genome.wustl.edu	37	19	15233783	15233783	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0894-01B-01W-0494-09	TCGA-13-0894-10A-01W-0494-09	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	eb57990e-702f-4fac-9ef5-7447ecb45cec	5781f8d8-a30f-4eee-acc8-c513e7872d10	g.chr19:15233783A>T	ENST00000263383.3	-	5	663	c.524T>A	c.(523-525)tTt>tAt	p.F175Y	ILVBL_ENST00000531635.1_5'UTR|ILVBL_ENST00000534378.1_Missense_Mutation_p.F68Y|AC003956.1_ENST00000598450.1_RNA	NM_006844.3	NP_006835.2	A1L0T0	ILVBL_HUMAN	ilvB (bacterial acetolactate synthase)-like	175						integral component of membrane (GO:0016021)|membrane (GO:0016020)	magnesium ion binding (GO:0000287)|thiamine pyrophosphate binding (GO:0030976)|transferase activity (GO:0016740)	p.F175Y(1)		NS(3)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(5)|ovary(2)|skin(1)	26						AGACACACAAAACTTACAGAG	0.622																																																1	Substitution - Missense(1)	ovary(1)	19											67.0	71.0	70.0					19																	15233783		2203	4300	6503	15094783	SO:0001583	missense	10994			U61263	CCDS12325.1	19p13.1	2008-07-16			ENSG00000105135	ENSG00000105135			6041	protein-coding gene	gene with protein product	"""acetolactate synthase homolog"""	605770				8954801	Standard	NM_006844		Approved	209L8, AHAS, ILV2H, MGC1269, FLJ39061, MGC19535	uc002nam.3	A1L0T0	OTTHUMG00000165630	ENST00000263383.3:c.524T>A	19.37:g.15233783A>T	ENSP00000263383:p.Phe175Tyr		15094783	O43341|Q96F08|Q99651|Q9BWN5|Q9UEB2	Missense_Mutation	SNP	HMMPfam_TPP_enzyme_C;HMMPfam_TPP_enzyme_M;HMMPfam_TPP_enzyme_N;superfamily_DHS-like NAD/FAD-binding domain;superfamily_Thiamin diphosphate-binding fold (THDP-binding)	p.F175Y	ENST00000263383.3	37	c.524	CCDS12325.1	19	.	.	.	.	.	.	.	.	.	.	A	7.213	0.595898	0.13875	.	.	ENSG00000105135	ENST00000263383;ENST00000527093	T	0.26373	1.74	4.23	4.23	0.50019	Thiamine pyrophosphate enzyme, N-terminal TPP-binding domain (1);	0.195954	0.56097	D	0.000034	T	0.08582	0.0213	N	0.01761	-0.735	0.47153	D	0.999331	B	0.06786	0.001	B	0.11329	0.006	T	0.17653	-1.0362	10	0.21014	T	0.42	-18.0133	6.2546	0.20867	0.8883:0.0:0.1117:0.0	.	175	A1L0T0	ILVBL_HUMAN	Y	175	ENSP00000263383:F175Y	ENSP00000263383:F175Y	F	-	2	0	ILVBL	15094783	1.000000	0.71417	0.887000	0.34795	0.187000	0.23431	5.822000	0.69265	1.788000	0.52465	0.379000	0.24179	TTT	-	HMMPfam_TPP_enzyme_N		0.622	ILVBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ILVBL	protein_coding	OTTHUMT00000385439.1	A	NM_006844		15094783	-1	no_errors	NM_006844	genbank	human	reviewed	54_36p	missense	SNP	0.99	T
ZNF561	93134	genome.wustl.edu	37	19	9721465	9721465	+	Missense_Mutation	SNP	C	C	G	rs146348381	byFrequency	TCGA-13-0894-01B-01W-0494-09	TCGA-13-0894-10A-01W-0494-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	eb57990e-702f-4fac-9ef5-7447ecb45cec	5781f8d8-a30f-4eee-acc8-c513e7872d10	g.chr19:9721465C>G	ENST00000302851.3	-	6	1235	c.872G>C	c.(871-873)aGa>aCa	p.R291T	ZNF561_ENST00000424629.1_Missense_Mutation_p.R222T|ZNF561_ENST00000495503.1_5'Flank|ZNF561_ENST00000354661.4_Missense_Mutation_p.R155T|ZNF561_ENST00000326044.5_3'UTR	NM_152289.2	NP_689502.2	Q8N587	ZN561_HUMAN	zinc finger protein 561	291					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R222T(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)	14						TGAGGAATTTCTAAAGGATCT	0.363																																																1	Substitution - Missense(1)	ovary(1)	19											100.0	99.0	99.0					19																	9721465		2203	4300	6503	9582465	SO:0001583	missense	93134			AK074787	CCDS12216.2	19p13.2	2013-09-20			ENSG00000171469	ENSG00000171469		"""Zinc fingers, C2H2-type"", ""-"""	28684	protein-coding gene	gene with protein product						12477932	Standard	NM_152289		Approved	MGC45408	uc002mlu.3	Q8N587	OTTHUMG00000157054	ENST00000302851.3:c.872G>C	19.37:g.9721465C>G	ENSP00000303915:p.Arg291Thr		9582465	B4E2Q8|Q6PJS0	Missense_Mutation	SNP	-	p.R222T	ENST00000302851.3	37	c.665	CCDS12216.2	19	.	.	.	.	.	.	.	.	.	.	C	8.148	0.786691	0.16189	.	.	ENSG00000171469	ENST00000424629;ENST00000302851;ENST00000354661	T;T;T	0.16073	2.37;2.37;2.37	1.1	-2.19	0.07015	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.10852	0.0265	N	0.02103	-0.685	0.09310	N	1	D	0.59357	0.985	D	0.72338	0.977	T	0.10359	-1.0633	9	0.15499	T	0.54	.	3.8619	0.08999	0.0:0.4848:0.2103:0.3049	.	291	Q8N587	ZN561_HUMAN	T	222;291;155	ENSP00000393074:R222T;ENSP00000303915:R291T;ENSP00000346687:R155T	ENSP00000303915:R291T	R	-	2	0	ZNF561	9582465	0.000000	0.05858	0.000000	0.03702	0.764000	0.43329	-1.747000	0.01827	-1.153000	0.02829	0.298000	0.19748	AGA	-	NULL		0.363	ZNF561-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF561	protein_coding	OTTHUMT00000347272.2	C	NM_152289		9582465	-1	no_errors	NM_152289	genbank	human	validated	54_36p	missense	SNP		G
PEG3	5178	genome.wustl.edu	37	19	57328633	57328633	+	Missense_Mutation	SNP	G	G	A	rs146466276		TCGA-13-0894-01B-01W-0494-09	TCGA-13-0894-10A-01W-0494-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	eb57990e-702f-4fac-9ef5-7447ecb45cec	5781f8d8-a30f-4eee-acc8-c513e7872d10	g.chr19:57328633G>A	ENST00000326441.9	-	10	1540	c.1177C>T	c.(1177-1179)Cgc>Tgc	p.R393C	ZIM2_ENST00000391708.3_Intron|ZIM2_ENST00000599935.1_Intron|PEG3_ENST00000593695.1_Missense_Mutation_p.R267C|ZIM2_ENST00000221722.5_Intron|PEG3_ENST00000598410.1_Missense_Mutation_p.R269C|PEG3_ENST00000423103.2_Missense_Mutation_p.R393C|ZIM2_ENST00000593711.1_Intron|ZIM2_ENST00000601070.1_Intron	NM_006210.2	NP_006201.1	Q9GZU2	PEG3_HUMAN	paternally expressed 3	393					apoptotic process (GO:0006915)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.R393C(1)		NS(1)|biliary_tract(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(27)|lung(84)|ovary(8)|pancreas(5)|prostate(6)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)	170		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		AAATGATAGCGCCTCTTTCTT	0.448																																																1	Substitution - Missense(1)	ovary(1)	19						G	CYS/ARG,CYS/ARG,CYS/ARG,CYS/ARG,,,CYS/ARG,	0,4406		0,0,2203	106.0	110.0	109.0		1177,799,1177,805,,,1177,	3.3	1.0	19	dbSNP_134	109	2,8598	1.2+/-3.3	0,2,4298	yes	missense,missense,missense,missense,intron,intron,missense,intron	PEG3,ZIM2	NM_001146184.1,NM_001146185.1,NM_001146186.1,NM_001146187.1,NM_001146326.1,NM_001146327.1,NM_006210.2,NM_015363.4	180,180,180,180,,,180,	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	probably-damaging,probably-damaging,probably-damaging,probably-damaging,,,probably-damaging,	393/1589,267/1463,393/1589,269/1465,,,393/1589,	57328633	2,13004	2203	4300	6503	62020445	SO:0001583	missense	5178			AB006625	CCDS12948.1, CCDS58684.1, CCDS58685.1	19q13.4	2013-01-09				ENSG00000198300		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	8826	protein-coding gene	gene with protein product		601483				9149948	Standard	NM_006210		Approved	ZKSCAN22, KIAA0287, ZNF904, ZSCAN24	uc010etr.2	Q9GZU2		ENST00000326441.9:c.1177C>T	19.37:g.57328633G>A	ENSP00000326581:p.Arg393Cys		62020445	A7E2B8|B4DIM4|C9JP50|P78418|Q5H9P9|Q7Z7H7|Q8TF75|Q9GZY2	Missense_Mutation	SNP	HMMPfam_SCAN;HMMPfam_zf-C2H2;superfamily_C2H2 and C2HC zinc fingers	p.R393C	ENST00000326441.9	37	c.1177	CCDS12948.1	19	.	.	.	.	.	.	.	.	.	.	G	13.47	2.248251	0.39697	0.0	2.33E-4	ENSG00000198300	ENST00000326441;ENST00000423103;ENST00000292074	T;T	0.02682	4.2;4.2	4.35	3.29	0.37713	.	0.000000	0.45361	D	0.000378	T	0.06508	0.0167	L	0.34521	1.04	.	.	.	D;D;P	0.76494	0.999;0.999;0.626	P;P;B	0.59487	0.858;0.764;0.085	T	0.40794	-0.9544	9	0.44086	T	0.13	-26.0019	12.5874	0.56424	0.0:0.1688:0.8312:0.0	.	269;393;328	A7E2B8;Q9GZU2;Q96Q96	.;PEG3_HUMAN;.	C	393;393;363	ENSP00000326581:R393C;ENSP00000403051:R393C	ENSP00000292074:R363C	R	-	1	0	ZIM2	62020445	0.527000	0.26306	0.999000	0.59377	0.938000	0.57974	3.678000	0.54627	1.396000	0.46663	0.655000	0.94253	CGC	-	NULL		0.448	PEG3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PEG3	protein_coding	OTTHUMT00000416099.2	G			62020445	-1	no_errors	NM_006210	genbank	human	provisional	54_36p	missense	SNP	1	A
GTDC1	79712	genome.wustl.edu	37	2	144764886	144764886	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0894-01B-01W-0494-09	TCGA-13-0894-10A-01W-0494-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	eb57990e-702f-4fac-9ef5-7447ecb45cec	5781f8d8-a30f-4eee-acc8-c513e7872d10	g.chr2:144764886C>G	ENST00000392869.2	-	6	890	c.738G>C	c.(736-738)ttG>ttC	p.L246F	GTDC1_ENST00000344850.4_Missense_Mutation_p.L246F|GTDC1_ENST00000409214.1_Missense_Mutation_p.L246F|GTDC1_ENST00000392867.3_Missense_Mutation_p.L246F|GTDC1_ENST00000463875.2_Missense_Mutation_p.L117F|GTDC1_ENST00000542155.1_Missense_Mutation_p.L246F|GTDC1_ENST00000241391.5_Missense_Mutation_p.L246F|GTDC1_ENST00000409298.1_Intron	NM_001284234.1	NP_001271163.1	Q4AE62	GTDC1_HUMAN	glycosyltransferase-like domain containing 1	246					biosynthetic process (GO:0009058)		transferase activity, transferring glycosyl groups (GO:0016757)	p.L246F(1)		central_nervous_system(1)|endometrium(1)|large_intestine(4)|liver(1)|lung(17)|ovary(1)	25				BRCA - Breast invasive adenocarcinoma(221;0.0914)		TGGATTTTTTCAAGTCTGATT	0.363																																																1	Substitution - Missense(1)	ovary(1)	2											116.0	112.0	113.0					2																	144764886		2203	4300	6503	144481356	SO:0001583	missense	79712			AY281366	CCDS2185.1, CCDS33300.1, CCDS63029.1, CCDS74582.1, CCDS74583.1	2q22.3	2013-02-22			ENSG00000121964	ENSG00000121964		"""Glycosyltransferase group 1 domain containing"""	20887	protein-coding gene	gene with protein product	"""mannosyltransferase-like"""	610165				15068588, 21821951	Standard	NM_024659		Approved	FLJ11753, Hmat-Xa	uc010fnn.3	Q4AE62	OTTHUMG00000131835	ENST00000392869.2:c.738G>C	2.37:g.144764886C>G	ENSP00000376608:p.Leu246Phe		144481356	A8K5P2|D3DP81|Q53SM7|Q53TC5|Q6P7E7|Q6PJB6|Q6WKW6|Q9HAE5	Missense_Mutation	SNP	-	p.L246F	ENST00000392869.2	37	c.738	CCDS33300.1	2	.	.	.	.	.	.	.	.	.	.	C	18.44	3.624001	0.66901	.	.	ENSG00000121964	ENST00000392869;ENST00000409214;ENST00000392867;ENST00000542155;ENST00000241391;ENST00000344850;ENST00000463875	T;T;T;T;T;T;T	0.50548	0.78;0.78;0.76;0.78;0.76;0.78;0.74	5.03	4.14	0.48551	.	0.708493	0.14055	N	0.344469	T	0.50394	0.1613	M	0.63843	1.955	0.09310	N	1	B;D;B;P	0.55172	0.019;0.97;0.003;0.631	B;P;B;B	0.44696	0.022;0.458;0.007;0.332	T	0.46803	-0.9165	10	0.62326	D	0.03	-14.1466	13.7789	0.63071	0.0:0.846:0.1539:0.0	.	246;246;246;246	G1UFN1;Q4AE62-2;Q4AE62;Q4AE62-3	.;.;GTDC1_HUMAN;.	F	246;246;246;246;246;246;117	ENSP00000376608:L246F;ENSP00000386581:L246F;ENSP00000376606:L246F;ENSP00000438323:L246F;ENSP00000241391:L246F;ENSP00000339750:L246F;ENSP00000437964:L117F	ENSP00000241391:L246F	L	-	3	2	GTDC1	144481356	0.010000	0.17322	0.164000	0.22755	0.873000	0.50193	1.174000	0.31932	1.217000	0.43442	0.655000	0.94253	TTG	-	NULL		0.363	GTDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTDC1	protein_coding	OTTHUMT00000254779.2	C	NM_024659		144481356	-1	no_errors	NM_001006636	genbank	human	provisional	54_36p	missense	SNP	0.03	G
DYNC1I2	1781	genome.wustl.edu	37	2	172569285	172569285	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0894-01B-01W-0494-09	TCGA-13-0894-10A-01W-0494-09	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	eb57990e-702f-4fac-9ef5-7447ecb45cec	5781f8d8-a30f-4eee-acc8-c513e7872d10	g.chr2:172569285A>T	ENST00000397119.3	+	6	511	c.344A>T	c.(343-345)cAt>cTt	p.H115L	DYNC1I2_ENST00000410079.3_Intron|DYNC1I2_ENST00000534253.2_Missense_Mutation_p.H115L|DYNC1I2_ENST00000409197.1_Intron|DYNC1I2_ENST00000340296.4_Intron|DYNC1I2_ENST00000409317.1_Missense_Mutation_p.H109L|DYNC1I2_ENST00000409453.1_Missense_Mutation_p.H115L|DYNC1I2_ENST00000263811.4_Missense_Mutation_p.H109L|DYNC1I2_ENST00000508530.1_Intron|DYNC1I2_ENST00000409773.1_Missense_Mutation_p.H115L|AC068039.1_ENST00000598148.1_5'Flank|DYNC1I2_ENST00000358002.6_Intron	NM_001378.1	NP_001369.1	Q13409	DC1I2_HUMAN	dynein, cytoplasmic 1, intermediate chain 2	115					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|G2/M transition of mitotic cell cycle (GO:0000086)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|transport (GO:0006810)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|microtubule (GO:0005874)|vesicle (GO:0031982)	microtubule motor activity (GO:0003777)	p.H115L(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(2)|ovary(1)	15			OV - Ovarian serous cystadenocarcinoma(117;0.198)			AGGACGCTGCATTGGGATACA	0.358																																																1	Substitution - Missense(1)	ovary(1)	2											191.0	179.0	182.0					2																	172569285		1852	4103	5955	172277531	SO:0001583	missense	1781			AK055491	CCDS46450.1, CCDS63054.1, CCDS63056.1, CCDS63057.1	2q31.1	2013-01-10	2005-11-24	2005-11-24	ENSG00000077380	ENSG00000077380		"""Cytoplasmic dyneins"", ""WD repeat domain containing"""	2964	protein-coding gene	gene with protein product		603331	"""dynein, cytoplasmic, intermediate polypeptide 2"""	DNCI2		10049579, 16260502	Standard	NM_001378		Approved		uc002uha.2	Q13409	OTTHUMG00000154061	ENST00000397119.3:c.344A>T	2.37:g.172569285A>T	ENSP00000380308:p.His115Leu		172277531	B7ZA04|D3DPD4|D3DPD5|D3DPD6|Q32LY9|Q53S84|Q5BJF8|Q7Z4X1|Q96NG7|Q96S87|Q9BXZ5|Q9NT58	Missense_Mutation	SNP	-	p.H115L	ENST00000397119.3	37	c.344	CCDS46450.1	2	.	.	.	.	.	.	.	.	.	.	A	24.3	4.512405	0.85389	.	.	ENSG00000077380	ENST00000452242;ENST00000534253;ENST00000263811;ENST00000397119;ENST00000438879;ENST00000409317;ENST00000409773;ENST00000411953;ENST00000409453;ENST00000443458;ENST00000430778;ENST00000422646	T;T;T;T;T;T	0.75154	-0.91;-0.78;-0.69;-0.78;-0.69;-0.56	4.94	4.94	0.65067	.	0.000000	0.85682	D	0.000000	T	0.57080	0.2029	N	0.14661	0.345	0.80722	D	1	B;P	0.38020	0.228;0.615	B;B	0.35039	0.146;0.194	T	0.58544	-0.7618	10	0.27082	T	0.32	-10.3485	14.5922	0.68373	1.0:0.0:0.0:0.0	.	109;115	Q13409-2;Q13409	.;DC1I2_HUMAN	L	109;115;109;115;127;109;115;127;115;115;109;109	ENSP00000433791:H115L;ENSP00000263811:H109L;ENSP00000380308:H115L;ENSP00000386591:H109L;ENSP00000386415:H115L;ENSP00000386886:H115L	ENSP00000263811:H109L	H	+	2	0	DYNC1I2	172277531	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.076000	0.94009	1.868000	0.54150	0.482000	0.46254	CAT	-	NULL		0.358	DYNC1I2-001	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	DYNC1I2	protein_coding	OTTHUMT00000333683.2	A	NM_001378		172277531	1	no_errors	NM_001378	genbank	human	provisional	54_36p	missense	SNP	1	T
TTN	7273	genome.wustl.edu	37	2	179559383	179559383	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0894-01B-01W-0494-09	TCGA-13-0894-10A-01W-0494-09	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	eb57990e-702f-4fac-9ef5-7447ecb45cec	5781f8d8-a30f-4eee-acc8-c513e7872d10	g.chr2:179559383T>C	ENST00000591111.1	-	115	30642	c.30418A>G	c.(30418-30420)Att>Gtt	p.I10140V	TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000342175.6_Intron|TTN_ENST00000342992.6_Missense_Mutation_p.I9213V|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.I10457V|TTN-AS1_ENST00000431752.1_RNA			Q8WZ42	TITIN_HUMAN	titin	0	Glu-rich.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.I9213V(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGTGGAACAATCTTCTTTGAA	0.274																																																1	Substitution - Missense(1)	ovary(1)	2											33.0	29.0	30.0					2																	179559383		1771	4039	5810	179267628	SO:0001583	missense	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.30418A>G	2.37:g.179559383T>C	ENSP00000465570:p.Ile10140Val		179267628	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	-	p.I9213V	ENST00000591111.1	37	c.27637		2	.	.	.	.	.	.	.	.	.	.	T	13.18	2.160787	0.38119	.	.	ENSG00000155657	ENST00000342992;ENST00000414766	T	0.67345	-0.26	6.07	6.07	0.98685	Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);	.	.	.	.	T	0.54598	0.1868	N	0.24115	0.695	0.80722	D	1	B;B	0.12630	0.0;0.006	B;B	0.18263	0.0;0.021	T	0.53599	-0.8416	9	0.87932	D	0	.	13.0325	0.58851	0.0:0.0:0.0:1.0	.	10140;10140	Q8WZ42;Q8WZ42-5	TITIN_HUMAN;.	V	9213;335	ENSP00000343764:I9213V	ENSP00000343764:I9213V	I	-	1	0	TTN	179267628	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.147000	0.50639	2.326000	0.78906	0.533000	0.62120	ATT	-	NULL		0.274	TTN-019	PUTATIVE	basic	protein_coding	TTN	protein_coding	OTTHUMT00000460310.1	T	NM_133378		179267628	-1	pseudogene:no_stop_codon:bad_bp_length_for_coding_region	NM_133378	genbank	human	reviewed	54_36p	missense	SNP	1	C
PPM1G	5496	genome.wustl.edu	37	2	27605444	27605444	+	Silent	SNP	G	G	A			TCGA-13-0894-01B-01W-0494-09	TCGA-13-0894-10A-01W-0494-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	eb57990e-702f-4fac-9ef5-7447ecb45cec	5781f8d8-a30f-4eee-acc8-c513e7872d10	g.chr2:27605444G>A	ENST00000344034.4	-	8	1494	c.1230C>T	c.(1228-1230)aaC>aaT	p.N410N	ZNF513_ENST00000323703.6_5'Flank|PPM1G_ENST00000350803.4_Silent_p.N410N|ZNF513_ENST00000407879.1_5'Flank	NM_177983.2	NP_817092.1	O15355	PPM1G_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1G	410					cell cycle arrest (GO:0007050)|peptidyl-threonine dephosphorylation (GO:0035970)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)	p.N410N(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(2)|urinary_tract(2)	19	Acute lymphoblastic leukemia(172;0.155)					CAGGTGGCAGGTTCTTGTTTC	0.473																																																1	Substitution - coding silent(1)	ovary(1)	2											310.0	296.0	301.0					2																	27605444		2203	4300	6503	27458948	SO:0001819	synonymous_variant	5496			Y13936	CCDS1752.1	2p23.3	2012-04-17	2010-03-05		ENSG00000115241	ENSG00000115241	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	9278	protein-coding gene	gene with protein product	"""PP2C, gamma"", ""protein phosphatase 2C, gamma isoform"""	605119	"""protein phosphatase 1G (formerly 2C), magnesium-dependent, gamma isoform"""			9276438	Standard	NM_177983		Approved	PP2CG, PP2Cgamma	uc002rkl.4	O15355	OTTHUMG00000097788	ENST00000344034.4:c.1230C>T	2.37:g.27605444G>A			27458948		Silent	SNP	HMMPfam_PP2C;superfamily_Protein serine/threonine phosphatase 2C catalytic domain	p.N410	ENST00000344034.4	37	c.1230	CCDS1752.1	2																																																																																			-	HMMPfam_PP2C		0.473	PPM1G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPM1G	protein_coding	OTTHUMT00000215032.1	G	NM_002707		27458948	-1	no_errors	NM_002707	genbank	human	reviewed	54_36p	silent	SNP	1	A
MAP4K3	8491	genome.wustl.edu	37	2	39485580	39485580	+	Splice_Site	SNP	A	A	G			TCGA-13-0894-01B-01W-0494-09	TCGA-13-0894-10A-01W-0494-09	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	eb57990e-702f-4fac-9ef5-7447ecb45cec	5781f8d8-a30f-4eee-acc8-c513e7872d10	g.chr2:39485580A>G	ENST00000263881.3	-	31	2703	c.2379T>C	c.(2377-2379)tgT>tgC	p.C793C	MAP4K3_ENST00000536018.1_Splice_Site_p.C346C|MAP4K3_ENST00000437545.1_Splice_Site_p.C709C|MAP4K3_ENST00000341681.5_Splice_Site_p.C772C	NM_003618.3	NP_003609.2	Q8IVH8	M4K3_HUMAN	mitogen-activated protein kinase kinase kinase kinase 3	793	CNH. {ECO:0000255|PROSITE- ProRule:PRU00795}.				intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|protein phosphorylation (GO:0006468)|response to tumor necrosis factor (GO:0034612)|response to UV (GO:0009411)		ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)	p.C793C(1)		NS(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	44		all_hematologic(82;0.211)				TTTTTATACAACCTAGAGGAA	0.308																																																1	Substitution - coding silent(1)	ovary(1)	2											49.0	53.0	52.0					2																	39485580		2199	4297	6496	39339084	SO:0001630	splice_region_variant	8491			AF000145	CCDS1803.1, CCDS58707.1	2p22.3	2011-06-09			ENSG00000011566	ENSG00000011566		"""Mitogen-activated protein kinase cascade / Kinase kinase kinase kinases"""	6865	protein-coding gene	gene with protein product		604921		RAB8IPL1		9275185	Standard	NM_003618		Approved	GLK, MAPKKKK3	uc002rro.4	Q8IVH8	OTTHUMG00000102127	ENST00000263881.3:c.2378-1T>C	2.37:g.39485580A>G			39339084	Q6IQ39|Q8IVH7|Q9UDM5|Q9Y6R5	Silent	SNP	Pkinase;HMMPfam_Pkinase;CNH;HMMPfam_CNH	p.C793	ENST00000263881.3	37	c.2379	CCDS1803.1	2																																																																																			-	HMMPfam_CNH		0.308	MAP4K3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP4K3	protein_coding	OTTHUMT00000219966.2	A	NM_003618	Silent	39339084	-1	no_errors	NM_003618	genbank	human	reviewed	54_36p	silent	SNP	1	G
CCDC108	255101	genome.wustl.edu	37	2	219892423	219892423	+	Silent	SNP	A	A	C			TCGA-13-0894-01B-01W-0494-09	TCGA-13-0894-10A-01W-0494-09	A	A	A	C	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	eb57990e-702f-4fac-9ef5-7447ecb45cec	5781f8d8-a30f-4eee-acc8-c513e7872d10	g.chr2:219892423A>C	ENST00000341552.5	-	13	2243	c.2160T>G	c.(2158-2160)ccT>ccG	p.P720P	CCDC108_ENST00000453220.1_Silent_p.P720P|CCDC108_ENST00000441968.1_Silent_p.P720P|CCDC108_ENST00000409865.3_Silent_p.P709P|CCDC108_ENST00000410037.1_Silent_p.P655P	NM_194302.2	NP_919278.2	Q6ZU64	CC108_HUMAN	coiled-coil domain containing 108	720						integral component of membrane (GO:0016021)	poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)	p.P720P(1)		autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(18)|liver(1)|lung(34)|ovary(2)|pancreas(1)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	80		Renal(207;0.0915)		Epithelial(149;1.12e-06)|all cancers(144;0.000196)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		AGTTGGGGTGAGGCGGCTGGA	0.612																																																1	Substitution - coding silent(1)	ovary(1)	2											80.0	81.0	81.0					2																	219892423		2203	4300	6503	219600667	SO:0001819	synonymous_variant	255101			NM_194302, AL833882, AK127189	CCDS2430.2, CCDS2431.2, CCDS63125.1, CCDS63126.1	2q35	2008-02-05			ENSG00000181378	ENSG00000181378			25325	protein-coding gene	gene with protein product		614270				12477932	Standard	NM_194302		Approved	DKFZp434O0527, MGC35338	uc002vjl.2	Q6ZU64	OTTHUMG00000133013	ENST00000341552.5:c.2160T>G	2.37:g.219892423A>C			219600667	A2BDD8|E9PCR1|E9PG25|E9PG72|Q6ZSR8|Q8N0T4|Q8NDJ3	Silent	SNP	-	p.P720	ENST00000341552.5	37	c.2160	CCDS2430.2	2																																																																																			-	NULL		0.612	CCDC108-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCDC108	protein_coding	OTTHUMT00000256598.4	A	NM_194302		219600667	-1	no_errors	NM_194302	genbank	human	provisional	54_36p	silent	SNP		C
RASSF2	9770	genome.wustl.edu	37	20	4776554	4776554	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0894-01B-01W-0494-09	TCGA-13-0894-10A-01W-0494-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_III	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	eb57990e-702f-4fac-9ef5-7447ecb45cec	5781f8d8-a30f-4eee-acc8-c513e7872d10	g.chr20:4776554G>T	ENST00000379400.3	-	5	389	c.194C>A	c.(193-195)cCc>cAc	p.P65H	RASSF2_ENST00000379376.2_Missense_Mutation_p.P65H|RASSF2_ENST00000478553.1_5'Flank	NM_014737.2	NP_055552.1	P50749	RASF2_HUMAN	Ras association (RalGDS/AF-6) domain family member 2	65					bone remodeling (GO:0046849)|cell cycle (GO:0007049)|epidermal growth factor receptor signaling pathway via I-kappaB kinase/NF-kappaB cascade (GO:0038168)|homeostasis of number of cells (GO:0048872)|negative regulation of NIK/NF-kappaB signaling (GO:1901223)|ossification (GO:0001503)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.P65H(1)		endometrium(3)|kidney(2)|large_intestine(8)|lung(12)|ovary(3)|pancreas(2)|prostate(2)|skin(2)	34						CAGGCGAATGGGCCGGCGCAG	0.597																																					Melanoma(158;1891 3343 50738)											1	Substitution - Missense(1)	ovary(1)	20											93.0	90.0	91.0					20																	4776554		2203	4300	6503	4724554	SO:0001583	missense	9770			D79990	CCDS13083.1	20p13	2011-08-12	2008-02-22		ENSG00000101265	ENSG00000101265			9883	protein-coding gene	gene with protein product	"""centromere protein 34"""	609492				8724849, 15806169	Standard	NM_014737		Approved	KIAA0168, CENP-34	uc002wld.3	P50749	OTTHUMG00000031790	ENST00000379400.3:c.194C>A	20.37:g.4776554G>T	ENSP00000368710:p.Pro65His		4724554	A6NIX9|A8K5Z3|Q17S06|Q53HD0|Q6AHZ2|Q8IZA5	Missense_Mutation	SNP	RA,HMMPfam_RA	p.P65H	ENST00000379400.3	37	c.194	CCDS13083.1	20	.	.	.	.	.	.	.	.	.	.	G	27.5	4.835299	0.91117	.	.	ENSG00000101265	ENST00000379400;ENST00000379376	T;T	0.35421	1.31;1.31	5.13	5.13	0.70059	.	0.050816	0.85682	D	0.000000	T	0.66356	0.2781	M	0.87180	2.865	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.72523	-0.4267	10	0.87932	D	0	.	17.3318	0.87267	0.0:0.0:1.0:0.0	.	65	P50749	RASF2_HUMAN	H	65	ENSP00000368710:P65H;ENSP00000368684:P65H	ENSP00000368684:P65H	P	-	2	0	RASSF2	4724554	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	9.275000	0.95738	2.665000	0.90641	0.563000	0.77884	CCC	-	NULL		0.597	RASSF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RASSF2	protein_coding	OTTHUMT00000077828.1	G	NM_014737		4724554	-1	no_errors	NM_014737	genbank	human	reviewed	54_36p	missense	SNP	1	T
TRAV19	28664	genome.wustl.edu	37	14	22476235	22476235	+	RNA	SNP	C	C	T			TCGA-13-0894-01B-01W-0494-09	TCGA-13-0894-10A-01W-0494-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	eb57990e-702f-4fac-9ef5-7447ecb45cec	5781f8d8-a30f-4eee-acc8-c513e7872d10	g.chr14:22476235C>T	ENST00000390447.3	+	0	282									T cell receptor alpha variable 19																		ATTACTTATTCTGGTACAAGC	0.418																																																0			14											68.0	67.0	67.0					14																	22476235		1889	4110	5999	21546075			0			AE000660		14q11.2	2012-02-07			ENSG00000211799	ENSG00000211799		"""T cell receptors / TRA locus"""	12115	other	T cell receptor gene						8188290	Standard	NG_001332		Approved	TCRAV12S1, TCRAV19S1			OTTHUMG00000170645		14.37:g.22476235C>T			21546075		Silent	SNP	-	p.F55	ENST00000390447.3	37	c.165		14																																																																																			-	NULL		0.418	TRAV19-001	KNOWN	upstream_ATG|mRNA_end_NF|cds_end_NF|basic|appris_principal	TR_V_gene	uc001wcu.2	TR_V_gene	OTTHUMT00000409893.1	C	NG_001332		21546075	1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000390447	ensembl	human	known	54_36p	silent	SNP	0.99	T
PPARA	5465	genome.wustl.edu	37	22	46594453	46594453	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0894-01B-01W-0494-09	TCGA-13-0894-10A-01W-0494-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	eb57990e-702f-4fac-9ef5-7447ecb45cec	5781f8d8-a30f-4eee-acc8-c513e7872d10	g.chr22:46594453G>C	ENST00000396000.2	+	3	438	c.173G>C	c.(172-174)gGa>gCa	p.G58A	PPARA_ENST00000402126.1_Missense_Mutation_p.G58A|PPARA_ENST00000407236.1_Missense_Mutation_p.G58A|PPARA_ENST00000262735.5_Missense_Mutation_p.G58A|PPARA_ENST00000434345.2_Missense_Mutation_p.G58A			Q07869	PPARA_HUMAN	peroxisome proliferator-activated receptor alpha	58					behavioral response to nicotine (GO:0035095)|cellular lipid metabolic process (GO:0044255)|circadian regulation of gene expression (GO:0032922)|enamel mineralization (GO:0070166)|epidermis development (GO:0008544)|fatty acid metabolic process (GO:0006631)|fatty acid transport (GO:0015908)|gene expression (GO:0010467)|heart development (GO:0007507)|intracellular receptor signaling pathway (GO:0030522)|lipid metabolic process (GO:0006629)|lipoprotein metabolic process (GO:0042157)|negative regulation of appetite (GO:0032099)|negative regulation of blood pressure (GO:0045776)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of glycolytic process (GO:0045820)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|negative regulation of neuron death (GO:1901215)|negative regulation of protein binding (GO:0032091)|negative regulation of receptor biosynthetic process (GO:0010871)|negative regulation of sequestering of triglyceride (GO:0010891)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of fatty acid oxidation (GO:0046321)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cellular ketone metabolic process by positive regulation of transcription from RNA polymerase II promoter (GO:0072366)|regulation of circadian rhythm (GO:0042752)|regulation of glycolytic by positive regulation of transcription from RNA polymerase II promoter (GO:0072363)|regulation of lipid transport by positive regulation of transcription from RNA polymerase II promoter (GO:0072369)|response to hypoxia (GO:0001666)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|wound healing (GO:0042060)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|drug binding (GO:0008144)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|lipid binding (GO:0008289)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|ubiquitin conjugating enzyme binding (GO:0031624)|zinc ion binding (GO:0008270)	p.G58A(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	15		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00522)	Bezafibrate(DB01393)|Clofibrate(DB00636)|Fenofibrate(DB01039)|Gemfibrozil(DB01241)|Indomethacin(DB00328)	CAGTATTTAGGAAGCTGTCCT	0.443																																																1	Substitution - Missense(1)	ovary(1)	22											80.0	85.0	83.0					22																	46594453		2203	4300	6503	44973117	SO:0001583	missense	5465			L02932	CCDS33669.1	22q12-q13.1	2013-01-16	2006-10-17		ENSG00000186951	ENSG00000186951		"""Nuclear hormone receptors"""	9232	protein-coding gene	gene with protein product		170998	"""peroxisome proliferative activated receptor, alpha"""	PPAR		7684926, 10591208	Standard	XM_005261655		Approved	hPPAR, NR1C1	uc003bgx.1	Q07869	OTTHUMG00000150443	ENST00000396000.2:c.173G>C	22.37:g.46594453G>C	ENSP00000379322:p.Gly58Ala		44973117	B0G0X3|Q16241|Q6I9S0|Q92486|Q92689|Q9Y3N1	Missense_Mutation	SNP	HMMPfam_Hormone_recep;HMMPfam_zf-C4;superfamily_Nuclear receptor ligand-binding domain;superfamily_Glucocorticoid receptor-like (DNA-binding domain)	p.G58A	ENST00000396000.2	37	c.173	CCDS33669.1	22	.	.	.	.	.	.	.	.	.	.	G	11.77	1.737267	0.30774	.	.	ENSG00000186951	ENST00000415785;ENST00000396000;ENST00000262735;ENST00000420804;ENST00000407236;ENST00000402126;ENST00000434345	D;D;D;D;D;D	0.96913	-3.3;-3.3;-4.17;-3.3;-3.3;-3.1	5.7	5.7	0.88788	.	0.132588	0.51477	D	0.000084	D	0.94644	0.8273	M	0.69823	2.125	0.43868	D	0.996472	B;B	0.29481	0.245;0.245	B;B	0.27500	0.08;0.08	D	0.92663	0.6143	10	0.08599	T	0.76	.	16.9911	0.86354	0.0:0.0:1.0:0.0	.	58;58	F1D8S4;Q07869	.;PPARA_HUMAN	A	58	ENSP00000379322:G58A;ENSP00000262735:G58A;ENSP00000414752:G58A;ENSP00000385523:G58A;ENSP00000385246:G58A;ENSP00000408149:G58A	ENSP00000262735:G58A	G	+	2	0	PPARA	44973117	1.000000	0.71417	0.190000	0.23270	0.093000	0.18481	5.833000	0.69349	2.687000	0.91594	0.655000	0.94253	GGA	-	NULL		0.443	PPARA-202	KNOWN	basic|appris_principal|CCDS	protein_coding	PPARA	protein_coding	OTTHUMT00000318129.3	G	NM_001001928		44973117	1	no_errors	NM_001001928	genbank	human	reviewed	54_36p	missense	SNP	0.17	C
GSTM5P1	100505557	genome.wustl.edu	37	3	12299643	12299643	+	IGR	SNP	G	G	T			TCGA-13-0894-01B-01W-0494-09	TCGA-13-0894-10A-01W-0494-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	eb57990e-702f-4fac-9ef5-7447ecb45cec	5781f8d8-a30f-4eee-acc8-c513e7872d10	g.chr3:12299643G>T								SYN2 (72415 upstream) : PPARG (29223 downstream)																							GTTGTCCATGGTCTGGTTCTC	0.512																																																0			3																																								12274643	SO:0001628	intergenic_variant	2945																															3.37:g.12299643G>T			12274643		RNA	SNP	-	NULL		37	NULL		3																																																																																			-	-	0	0.512					GSTM1L			G			12274643	-1	pseudogene	NR_003112	genbank	human	provisional	54_36p	rna	SNP	0.99	T
POLQ	10721	genome.wustl.edu	37	3	121228536	121228536	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0894-01B-01W-0494-09	TCGA-13-0894-10A-01W-0494-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	eb57990e-702f-4fac-9ef5-7447ecb45cec	5781f8d8-a30f-4eee-acc8-c513e7872d10	g.chr3:121228536G>C	ENST00000264233.5	-	12	1959	c.1831C>G	c.(1831-1833)Cca>Gca	p.P611A		NM_199420.3	NP_955452.3	O75417	DPOLQ_HUMAN	polymerase (DNA directed), theta	611					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|single-stranded DNA-dependent ATPase activity (GO:0043142)	p.P746A(1)		NS(2)|breast(7)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(55)|ovary(5)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	120				GBM - Glioblastoma multiforme(114;0.0915)		AGATGTGTTGGATGATACACC	0.373								DNA polymerases (catalytic subunits)																													Pancreas(152;907 1925 26081 31236 36904)											1	Substitution - Missense(1)	ovary(1)	3											106.0	116.0	112.0					3																	121228536		2202	4300	6502	122711226	SO:0001583	missense	10721			AF052573	CCDS33833.1	3q13.3	2012-05-18			ENSG00000051341	ENSG00000051341	2.7.7.7	"""DNA polymerases"""	9186	protein-coding gene	gene with protein product		604419				10395804	Standard	NM_199420		Approved	POLH	uc003eee.4	O75417	OTTHUMG00000159396	ENST00000264233.5:c.1831C>G	3.37:g.121228536G>C	ENSP00000264233:p.Pro611Ala		122711226	O95160|Q6VMB5	Missense_Mutation	SNP	HMMPfam_DNA_pol_A;HMMPfam_Helicase_C;HMMPfam_DEAD;superfamily_Ribonuclease H-like;superfamily_Immunoglobulin;superfamily_P-loop containing nucleoside triphosphate hydrolases;superfamily_DNA/RNA polymerases	p.P611A	ENST00000264233.5	37	c.1831	CCDS33833.1	3	.	.	.	.	.	.	.	.	.	.	G	10.63	1.403047	0.25291	.	.	ENSG00000051341	ENST00000543272;ENST00000264233;ENST00000393672	T	0.37584	1.19	5.16	4.28	0.50868	.	0.056165	0.64402	D	0.000001	T	0.26810	0.0656	L	0.35644	1.08	0.52501	D	0.999951	B	0.06786	0.001	B	0.12837	0.008	T	0.05784	-1.0864	10	0.23302	T	0.38	.	10.1717	0.42913	0.0747:0.1371:0.7882:0.0	.	611	O75417	DPOLQ_HUMAN	A	234;611;747	ENSP00000264233:P611A	ENSP00000264233:P611A	P	-	1	0	POLQ	122711226	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.196000	0.72094	1.299000	0.44798	0.585000	0.79938	CCA	-	NULL		0.373	POLQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLQ	protein_coding	OTTHUMT00000355097.1	G	NM_199420		122711226	-1	no_errors	NM_199420	genbank	human	validated	54_36p	missense	SNP	1	C
GFM1	85476	genome.wustl.edu	37	3	158371186	158371186	+	Silent	SNP	T	T	C			TCGA-13-0894-01B-01W-0494-09	TCGA-13-0894-10A-01W-0494-09	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	eb57990e-702f-4fac-9ef5-7447ecb45cec	5781f8d8-a30f-4eee-acc8-c513e7872d10	g.chr3:158371186T>C	ENST00000486715.1	+	7	1285	c.928T>C	c.(928-930)Tta>Cta	p.L310L	GFM1_ENST00000264263.5_Silent_p.L329L|GFM1_ENST00000478576.1_Silent_p.L310L	NM_024996.5	NP_079272.4			G elongation factor, mitochondrial 1									p.L310L(1)		breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(9)|ovary(3)|urinary_tract(2)	22			Lung(72;0.00309)|LUSC - Lung squamous cell carcinoma(72;0.0043)			TCAGCCTCTTTTAGATGCTGT	0.358																																																1	Substitution - coding silent(1)	ovary(1)	3											96.0	96.0	96.0					3																	158371186		2203	4300	6503	159853880	SO:0001819	synonymous_variant	85476			AF309777	CCDS33885.1	3q25	2008-02-05			ENSG00000168827	ENSG00000168827			13780	protein-coding gene	gene with protein product		606639	"""G translation elongation factor, mitochondrial"""			11374907, 11735030	Standard	NM_024996		Approved	EFGM, GFM, EGF1	uc003fce.3	Q96RP9	OTTHUMG00000158804	ENST00000486715.1:c.928T>C	3.37:g.158371186T>C			159853880		Silent	SNP	-	p.L310	ENST00000486715.1	37	c.928	CCDS33885.1	3																																																																																			-	NULL		0.358	GFM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GFM1	protein_coding	OTTHUMT00000352271.1	T	NM_024996		159853880	1	no_errors	NM_024996	genbank	human	reviewed	54_36p	silent	SNP	0.01	C
GOLGA4	2803	genome.wustl.edu	37	3	37367018	37367018	+	Missense_Mutation	SNP	C	C	G	rs141111369		TCGA-13-0894-01B-01W-0494-09	TCGA-13-0894-10A-01W-0494-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	eb57990e-702f-4fac-9ef5-7447ecb45cec	5781f8d8-a30f-4eee-acc8-c513e7872d10	g.chr3:37367018C>G	ENST00000361924.2	+	14	4015	c.3641C>G	c.(3640-3642)gCg>gGg	p.A1214G	GOLGA4_ENST00000444882.1_Intron|GOLGA4_ENST00000356847.4_Missense_Mutation_p.A1236G	NM_002078.4	NP_002069.2	Q13439	GOGA4_HUMAN	golgin A4	1214	Glu-rich.				Golgi to plasma membrane protein transport (GO:0043001)|protein targeting to Golgi (GO:0000042)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	GTPase binding (GO:0051020)	p.A1214G(1)		NS(2)|breast(3)|central_nervous_system(3)|endometrium(6)|kidney(2)|large_intestine(17)|liver(2)|lung(16)|ovary(4)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	65						GAGGAACTAGCGATTCAGCTA	0.338																																																1	Substitution - Missense(1)	ovary(1)	3											50.0	52.0	51.0					3																	37367018		2203	4299	6502	37342022	SO:0001583	missense	2803			U31906	CCDS2666.1, CCDS54564.1	3p22-p21.3	2010-02-12	2010-02-12		ENSG00000144674	ENSG00000144674			4427	protein-coding gene	gene with protein product	"""golgin 245"""	602509	"""golgi autoantigen, golgin subfamily a, 4"""			8626529	Standard	NM_002078		Approved	GOLG, GCP2, p230, golgin-240	uc003cgw.3	Q13439	OTTHUMG00000130799	ENST00000361924.2:c.3641C>G	3.37:g.37367018C>G	ENSP00000354486:p.Ala1214Gly		37342022	F8W8Q7|Q13270|Q13654|Q14436|Q59EW8	Missense_Mutation	SNP	-	p.A1214G	ENST00000361924.2	37	c.3641	CCDS2666.1	3	.	.	.	.	.	.	.	.	.	.	C	6.046	0.376760	0.11466	.	.	ENSG00000144674	ENST00000361924;ENST00000356847;ENST00000437131	T;T;T	0.25085	1.83;1.82;1.83	5.1	4.23	0.50019	.	0.496580	0.15105	N	0.280274	T	0.26955	0.0660	L	0.53249	1.67	0.09310	N	1	P;P;P;P	0.44690	0.841;0.712;0.712;0.796	P;B;B;B	0.46685	0.524;0.324;0.324;0.225	T	0.09707	-1.0662	10	0.24483	T	0.36	.	5.6027	0.17363	0.1465:0.6422:0.0:0.2113	.	1214;1214;1236;1214	Q13439-3;Q13439-4;F8W8Q7;Q13439	.;.;.;GOGA4_HUMAN	G	1214;1236;1085	ENSP00000354486:A1214G;ENSP00000349305:A1236G;ENSP00000405842:A1085G	ENSP00000349305:A1236G	A	+	2	0	GOLGA4	37342022	0.000000	0.05858	0.005000	0.12908	0.120000	0.20174	-0.018000	0.12568	1.153000	0.42468	0.563000	0.77884	GCG	-	NULL		0.338	GOLGA4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GOLGA4	protein_coding	OTTHUMT00000253339.2	C	NM_002078		37342022	1	no_errors	NM_002078	genbank	human	reviewed	54_36p	missense	SNP	0.09	G
EHHADH	1962	genome.wustl.edu	37	3	184910026	184910026	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0894-01B-01W-0494-09	TCGA-13-0894-10A-01W-0494-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	eb57990e-702f-4fac-9ef5-7447ecb45cec	5781f8d8-a30f-4eee-acc8-c513e7872d10	g.chr3:184910026G>C	ENST00000231887.3	-	7	2235	c.2160C>G	c.(2158-2160)agC>agG	p.S720R	EHHADH_ENST00000456310.1_Missense_Mutation_p.S624R|EHHADH-AS1_ENST00000417720.1_RNA	NM_001166415.1|NM_001966.3	NP_001159887.1|NP_001957.2	Q08426	ECHP_HUMAN	enoyl-CoA, hydratase/3-hydroxyacyl CoA dehydrogenase	720					fatty acid beta-oxidation (GO:0006635)|internal protein amino acid acetylation (GO:0006475)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|peroxisome (GO:0005777)	3-hydroxyacyl-CoA dehydrogenase activity (GO:0003857)|coenzyme binding (GO:0050662)|dodecenoyl-CoA delta-isomerase activity (GO:0004165)|enoyl-CoA hydratase activity (GO:0004300)|enzyme binding (GO:0019899)|receptor binding (GO:0005102)	p.S720R(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(3)|prostate(2)|skin(3)	24	all_cancers(143;4.04e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.98e-32)|OV - Ovarian serous cystadenocarcinoma(80;5.55e-21)			ACAATTTACTGCTAGGGGAGC	0.423																																																1	Substitution - Missense(1)	ovary(1)	3											68.0	73.0	71.0					3																	184910026		2203	4300	6503	186392720	SO:0001583	missense	1962			L07077	CCDS33901.1, CCDS54694.1	3q26.3-q28	2012-07-13	2010-04-30		ENSG00000113790	ENSG00000113790	4.2.1.17, 1.1.1.35, 5.3.3.8		3247	protein-coding gene	gene with protein product		607037	"""enoyl-Coenzyme A, hydratase/3-hydroxyacyl Coenzyme A dehydrogenase"""	ECHD		8188243	Standard	NM_001966		Approved		uc003fpf.3	Q08426	OTTHUMG00000156698	ENST00000231887.3:c.2160C>G	3.37:g.184910026G>C	ENSP00000231887:p.Ser720Arg		186392720	A8K6Y3|B4DWG3|D3DNU0|Q58EZ5	Missense_Mutation	SNP	HMMPfam_ECH;HMMPfam_3HCDH;HMMPfam_3HCDH_N;superfamily_6-phosphogluconate dehydrogenase C-terminal domain-like;superfamily_NAD(P)-binding Rossmann-fold domains;superfamily_ClpP/crotonase	p.S720R	ENST00000231887.3	37	c.2160	CCDS33901.1	3	.	.	.	.	.	.	.	.	.	.	G	1.682	-0.506170	0.04231	.	.	ENSG00000113790	ENST00000231887;ENST00000456310	T;T	0.75154	-0.5;-0.91	5.91	4.06	0.47325	.	0.949217	0.08976	N	0.866543	T	0.58323	0.2114	N	0.14661	0.345	0.80722	D	1	B	0.10296	0.003	B	0.04013	0.001	T	0.51896	-0.8647	10	0.44086	T	0.13	-1.928	8.2207	0.31539	0.1355:0.1293:0.7351:0.0	.	720	Q08426	ECHP_HUMAN	R	720;624	ENSP00000231887:S720R;ENSP00000387746:S624R	ENSP00000231887:S720R	S	-	3	2	EHHADH	186392720	0.983000	0.35010	0.886000	0.34754	0.193000	0.23685	1.825000	0.39081	1.498000	0.48600	0.655000	0.94253	AGC	-	NULL		0.423	EHHADH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EHHADH	protein_coding	OTTHUMT00000345326.1	G			186392720	-1	no_errors	NM_001966	genbank	human	validated	54_36p	missense	SNP	0.94	C
AASDH	132949	genome.wustl.edu	37	4	57217538	57217538	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0894-01B-01W-0494-09	TCGA-13-0894-10A-01W-0494-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	eb57990e-702f-4fac-9ef5-7447ecb45cec	5781f8d8-a30f-4eee-acc8-c513e7872d10	g.chr4:57217538G>T	ENST00000205214.6	-	10	1842	c.1662C>A	c.(1660-1662)gaC>gaA	p.D554E	AASDH_ENST00000602986.1_Missense_Mutation_p.D401E|AASDH_ENST00000502617.1_Missense_Mutation_p.D554E|AASDH_ENST00000451613.1_Missense_Mutation_p.D554E|AASDH_ENST00000434343.2_Missense_Mutation_p.D69E|AASDH_ENST00000513376.1_Missense_Mutation_p.D454E	NM_181806.2	NP_861522.2	Q4L235	ACSF4_HUMAN	aminoadipate-semialdehyde dehydrogenase	554					fatty acid metabolic process (GO:0006631)		acid-thiol ligase activity (GO:0016878)|ATP binding (GO:0005524)	p.D554E(1)		endometrium(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	40	Glioma(25;0.08)|all_neural(26;0.101)	all_hematologic(202;0.0017)				TTTCCCAAAGGTCCTCTTTCC	0.284																																																1	Substitution - Missense(1)	ovary(1)	4											53.0	59.0	57.0					4																	57217538		2199	4272	6471	56912295	SO:0001583	missense	132949			AF516672	CCDS3504.1, CCDS68705.1, CCDS68706.1, CCDS75126.1, CCDS75127.1	4q12	2010-12-14			ENSG00000157426	ENSG00000157426	1.2.1.31	"""Acyl-CoA synthetase family"""	23993	protein-coding gene	gene with protein product	"""acyl-CoA synthetase family member 4"""	614365				15865210, 12712191, 17762044	Standard	XM_005265721		Approved	NRPS998, LYS2, ACSF4	uc003hbn.3	Q4L235	OTTHUMG00000128841	ENST00000205214.6:c.1662C>A	4.37:g.57217538G>T	ENSP00000205214:p.Asp554Glu		56912295	A5D8V3|A5PL22|Q63HK2|Q63HR7|Q6IPP8|Q6TFZ6|Q7Z5Y3|Q96BW4|Q9P064	Missense_Mutation	SNP	-	p.D554E	ENST00000205214.6	37	c.1662	CCDS3504.1	4	.	.	.	.	.	.	.	.	.	.	G	2.355	-0.347967	0.05208	.	.	ENSG00000157426	ENST00000205214;ENST00000513376;ENST00000434343;ENST00000451613;ENST00000503808;ENST00000502617	T;T;T;T;T	0.61274	0.12;0.27;2.35;0.71;0.71	5.25	-2.17	0.07059	Acyl carrier protein-like (1);	0.557597	0.21936	N	0.066942	T	0.16854	0.0405	N	0.01705	-0.755	0.26328	N	0.977564	B;B;B;B	0.09022	0.002;0.001;0.001;0.0	B;B;B;B	0.09377	0.004;0.003;0.003;0.0	T	0.22208	-1.0223	10	0.02654	T	1	-9.1322	0.9255	0.01324	0.3367:0.1336:0.1243:0.4054	.	401;554;554;554	E9PH98;Q4L235-4;Q4L235-3;Q4L235	.;.;.;ACSF4_HUMAN	E	554;454;69;554;401;554	ENSP00000205214:D554E;ENSP00000423760:D454E;ENSP00000392158:D69E;ENSP00000409656:D554E;ENSP00000421171:D554E	ENSP00000205214:D554E	D	-	3	2	AASDH	56912295	1.000000	0.71417	0.989000	0.46669	0.970000	0.65996	0.530000	0.23036	-0.500000	0.06614	-1.058000	0.02302	GAC	-	NULL		0.284	AASDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AASDH	protein_coding	OTTHUMT00000250780.1	G	NM_181806		56912295	-1	no_errors	NM_181806	genbank	human	validated	54_36p	missense	SNP	1	T
Unknown	0	genome.wustl.edu	37	4	83502065	83502065	+	IGR	SNP	A	A	G			TCGA-13-0894-01B-01W-0494-09	TCGA-13-0894-10A-01W-0494-09	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	eb57990e-702f-4fac-9ef5-7447ecb45cec	5781f8d8-a30f-4eee-acc8-c513e7872d10	g.chr4:83502065A>G								TMEM150C (18555 upstream) : LINC00575 (32200 downstream)																							TTGTGTGGCAATGTAACTCTT	0.428																																																0			4																																								83721089	SO:0001628	intergenic_variant	442113																															4.37:g.83502065A>G			83721089		RNA	SNP	-	NULL		37	NULL		4																																																																																			-	-	0	0.428					LOC442113			A			83721089	-1	pseudogene	XR_016390	genbank	human	model	54_36p	rna	SNP	1	G
TRPC3	7222	genome.wustl.edu	37	4	122846207	122846207	+	Missense_Mutation	SNP	C	C	G	rs201312365		TCGA-13-0894-01B-01W-0494-09	TCGA-13-0894-10A-01W-0494-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	eb57990e-702f-4fac-9ef5-7447ecb45cec	5781f8d8-a30f-4eee-acc8-c513e7872d10	g.chr4:122846207C>G	ENST00000379645.3	-	3	1215	c.1142G>C	c.(1141-1143)cGt>cCt	p.R381P	TRPC3_ENST00000264811.5_Missense_Mutation_p.R308P|TRPC3_ENST00000513531.1_Missense_Mutation_p.R308P	NM_001130698.1	NP_001124170.1	Q13507	TRPC3_HUMAN	transient receptor potential cation channel, subfamily C, member 3	296					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|phototransduction (GO:0007602)|platelet activation (GO:0030168)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of cardiac muscle hypertrophy in response to stress (GO:1903244)|response to ATP (GO:0033198)|response to calcium ion (GO:0051592)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)	p.R308P(1)		NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(1)|large_intestine(12)|lung(13)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	51						AAGTTTGACACGACTTAATGA	0.423																																																1	Substitution - Missense(1)	ovary(1)	4											211.0	188.0	196.0					4																	122846207		2203	4300	6503	123065657	SO:0001583	missense	7222			Y13758	CCDS3725.1, CCDS47130.1	4q27	2011-12-14			ENSG00000138741	ENSG00000138741		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12335	protein-coding gene	gene with protein product		602345				8646775, 16382100	Standard	NM_003305		Approved		uc003ieg.2	Q13507	OTTHUMG00000133069	ENST00000379645.3:c.1142G>C	4.37:g.122846207C>G	ENSP00000368966:p.Arg381Pro		123065657	A7VJS1|E9PCJ9|O00593|Q15660|Q52M35|Q5G1L5	Missense_Mutation	SNP	-	p.R308P	ENST00000379645.3	37	c.923	CCDS47130.1	4	.	.	.	.	.	.	.	.	.	.	C	29.5	5.007380	0.93287	.	.	ENSG00000138741	ENST00000264811;ENST00000379645;ENST00000513531	T;T;T	0.74315	-0.83;-0.83;-0.83	5.92	5.92	0.95590	.	0.075570	0.56097	D	0.000024	D	0.88640	0.6491	M	0.87547	2.89	0.80722	D	1	P;D;D	0.67145	0.943;0.996;0.989	P;D;P	0.71870	0.796;0.975;0.905	D	0.89477	0.3747	10	0.87932	D	0	-16.1466	20.3081	0.98638	0.0:1.0:0.0:0.0	.	296;308;381	Q13507;E9PCJ9;Q5G1L5	TRPC3_HUMAN;.;.	P	308;381;308	ENSP00000264811:R308P;ENSP00000368966:R381P;ENSP00000426899:R308P	ENSP00000264811:R308P	R	-	2	0	TRPC3	123065657	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	7.755000	0.85180	2.795000	0.96236	0.655000	0.94253	CGT	-	NULL		0.423	TRPC3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRPC3	protein_coding	OTTHUMT00000364252.1	C	NM_003305		123065657	-1	no_errors	NM_003305	genbank	human	validated	54_36p	missense	SNP	1	G
GPR98	84059	genome.wustl.edu	37	5	90049489	90049489	+	Silent	SNP	C	C	A			TCGA-13-0894-01B-01W-0494-09	TCGA-13-0894-10A-01W-0494-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	eb57990e-702f-4fac-9ef5-7447ecb45cec	5781f8d8-a30f-4eee-acc8-c513e7872d10	g.chr5:90049489C>A	ENST00000405460.2	+	54	11316	c.11220C>A	c.(11218-11220)acC>acA	p.T3740T		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	3740					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)	p.T3740T(1)		NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		TAACCCTCACCCGTATCACCA	0.408																																																1	Substitution - coding silent(1)	ovary(1)	5											103.0	99.0	100.0					5																	90049489		1885	4125	6010	90085245	SO:0001819	synonymous_variant	84059			AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.11220C>A	5.37:g.90049489C>A			90085245	O75171|Q8TF58|Q9H0X5|Q9UL61	Silent	SNP	HMMPfam_GPS;HMMPfam_Calx-beta;HMMPfam_EPTP;superfamily_Concanavalin A-like lectins/glucanases;superfamily_Phosphoglucomutase first 3 domains	p.T3740	ENST00000405460.2	37	c.11220	CCDS47246.1	5	.	.	.	.	.	.	.	.	.	.	C	0.023	-1.395769	0.01175	.	.	ENSG00000164199	ENST00000509621	.	.	.	5.53	-0.771	0.11002	.	.	.	.	.	T	0.19967	0.0480	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.23190	-1.0195	4	.	.	.	.	1.3946	0.02257	0.1238:0.3542:0.2411:0.2809	.	.	.	.	H	1306	.	.	P	+	2	0	GPR98	90085245	0.000000	0.05858	0.000000	0.03702	0.033000	0.12548	-0.084000	0.11268	-0.506000	0.06558	0.557000	0.71058	CCC	-	NULL		0.408	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR98	protein_coding	OTTHUMT00000369993.2	C	NM_032119		90085245	1	no_errors	NM_032119	genbank	human	reviewed	54_36p	silent	SNP		A
GABRA6	2559	genome.wustl.edu	37	5	161119060	161119060	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0894-01B-01W-0494-09	TCGA-13-0894-10A-01W-0494-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	eb57990e-702f-4fac-9ef5-7447ecb45cec	5781f8d8-a30f-4eee-acc8-c513e7872d10	g.chr5:161119060G>A	ENST00000274545.5	+	8	1373	c.940G>A	c.(940-942)Gtc>Atc	p.V314I	RP11-348M17.2_ENST00000521984.1_RNA|GABRA6_ENST00000523217.1_Missense_Mutation_p.V304I			Q16445	GBRA6_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 6	314					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)	p.V314I(1)		breast(1)|central_nervous_system(2)|endometrium(6)|large_intestine(9)|liver(2)|lung(22)|ovary(7)|skin(6)|urinary_tract(2)	57	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Acamprosate(DB00659)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)	CTTTGCATTCGTCTTCTCTGC	0.478										TCGA Ovarian(5;0.080)																																						1	Substitution - Missense(1)	ovary(1)	5											176.0	146.0	156.0					5																	161119060		2203	4300	6503	161051638	SO:0001583	missense	2559				CCDS4356.1	5q34	2012-06-22			ENSG00000145863	ENSG00000145863		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4080	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 6"""	137143				8020978	Standard	NM_000811		Approved		uc003lyu.2	Q16445	OTTHUMG00000130351	ENST00000274545.5:c.940G>A	5.37:g.161119060G>A	ENSP00000274545:p.Val314Ile		161051638	A8K096|Q4VAV2	Missense_Mutation	SNP	-	p.V314I	ENST00000274545.5	37	c.940	CCDS4356.1	5	.	.	.	.	.	.	.	.	.	.	G	31	5.062912	0.93898	.	.	ENSG00000145863	ENST00000274545;ENST00000523217	D;D	0.88354	-2.37;-2.37	5.32	5.32	0.75619	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.000000	0.85682	D	0.000000	D	0.93798	0.8017	M	0.61703	1.905	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.94268	0.7508	10	0.87932	D	0	.	18.9984	0.92822	0.0:0.0:1.0:0.0	.	314	Q16445	GBRA6_HUMAN	I	314;304	ENSP00000274545:V314I;ENSP00000430527:V304I	ENSP00000274545:V314I	V	+	1	0	GABRA6	161051638	1.000000	0.71417	0.995000	0.50966	0.986000	0.74619	9.751000	0.98889	2.468000	0.83385	0.650000	0.86243	GTC	-	NULL		0.478	GABRA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABRA6	protein_coding	OTTHUMT00000252707.2	G			161051638	1	no_errors	NM_000811	genbank	human	reviewed	54_36p	missense	SNP	1	A
L3MBTL3	84456	genome.wustl.edu	37	6	130387570	130387570	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0894-01B-01W-0494-09	TCGA-13-0894-10A-01W-0494-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	eb57990e-702f-4fac-9ef5-7447ecb45cec	5781f8d8-a30f-4eee-acc8-c513e7872d10	g.chr6:130387570G>A	ENST00000529410.1	+	13	1416	c.937G>A	c.(937-939)Gct>Act	p.A313T	L3MBTL3_ENST00000526019.1_Missense_Mutation_p.A288T|L3MBTL3_ENST00000368139.2_Missense_Mutation_p.A288T|L3MBTL3_ENST00000368136.2_Missense_Mutation_p.A313T|L3MBTL3_ENST00000361794.2_Missense_Mutation_p.A313T|L3MBTL3_ENST00000533560.1_Missense_Mutation_p.A288T			Q96JM7	LMBL3_HUMAN	l(3)mbt-like 3 (Drosophila)	313					chromatin modification (GO:0016568)|erythrocyte maturation (GO:0043249)|granulocyte differentiation (GO:0030851)|macrophage differentiation (GO:0030225)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)		p.A313T(1)		cervix(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(22)|ovary(5)|skin(4)|stomach(1)|urinary_tract(1)	43				GBM - Glioblastoma multiforme(226;0.0266)|OV - Ovarian serous cystadenocarcinoma(155;0.154)		GAATGCAGACGCTCTGGATAT	0.403																																																1	Substitution - Missense(1)	ovary(1)	6											90.0	90.0	90.0					6																	130387570		2203	4300	6503	130429263	SO:0001583	missense	84456			AB058701	CCDS34537.1, CCDS34538.1	6q23	2013-01-10			ENSG00000198945	ENSG00000198945		"""Sterile alpha motif (SAM) domain containing"""	23035	protein-coding gene	gene with protein product							Standard	NM_032438		Approved	KIAA1798	uc003qbt.3	Q96JM7	OTTHUMG00000015554	ENST00000529410.1:c.937G>A	6.37:g.130387570G>A	ENSP00000431962:p.Ala313Thr		130429263	Q4VXE1|Q5VUM9|Q6P9B5	Missense_Mutation	SNP	-	p.A313T	ENST00000529410.1	37	c.937	CCDS34537.1	6	.	.	.	.	.	.	.	.	.	.	G	20.8	4.046354	0.75846	.	.	ENSG00000198945	ENST00000529410;ENST00000533560;ENST00000361794;ENST00000368139;ENST00000526019;ENST00000368136	T;T;T;T;T;T	0.29655	1.56;1.56;1.56;1.56;1.56;1.56	5.62	5.62	0.85841	.	0.050649	0.85682	D	0.000000	T	0.08223	0.0205	N	0.05330	-0.07	0.50632	D	0.999884	D;P	0.59767	0.986;0.851	B;B	0.37451	0.25;0.202	T	0.04708	-1.0932	10	0.59425	D	0.04	.	13.036	0.58873	0.0:0.0:0.7358:0.2642	.	288;313	Q96JM7-2;Q96JM7	.;LMBL3_HUMAN	T	313;288;313;288;288;313	ENSP00000431962:A313T;ENSP00000437185:A288T;ENSP00000354526:A313T;ENSP00000357121:A288T;ENSP00000436706:A288T;ENSP00000357118:A313T	ENSP00000354526:A313T	A	+	1	0	L3MBTL3	130429263	1.000000	0.71417	0.914000	0.36105	0.781000	0.44180	6.949000	0.75971	2.797000	0.96272	0.555000	0.69702	GCT	-	NULL		0.403	L3MBTL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	L3MBTL3	protein_coding	OTTHUMT00000042195.2	G	XM_027074		130429263	1	no_errors	NM_032438	genbank	human	validated	54_36p	missense	SNP	1	A
OPN5	221391	genome.wustl.edu	37	6	47763300	47763300	+	Splice_Site	SNP	G	G	C			TCGA-13-0894-01B-01W-0494-09	TCGA-13-0894-10A-01W-0494-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	eb57990e-702f-4fac-9ef5-7447ecb45cec	5781f8d8-a30f-4eee-acc8-c513e7872d10	g.chr6:47763300G>C	ENST00000371211.2	+	4	784		c.e4+1		OPN5_ENST00000244799.4_Splice_Site|OPN5_ENST00000393699.2_Splice_Site|OPN5_ENST00000489301.2_Splice_Site	NM_181744.3	NP_859528.1	Q6U736	OPN5_HUMAN	opsin 5						phototransduction (GO:0007602)|protein-chromophore linkage (GO:0018298)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)	G-protein coupled receptor activity (GO:0004930)|photoreceptor activity (GO:0009881)	p.?(1)		endometrium(1)|large_intestine(3)|lung(14)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(2)	29						ACTGACAAAGGTAAGTGCACT	0.408																																					Melanoma(28;740 973 10870 42660 45347)											1	Unknown(1)	ovary(1)	6											79.0	70.0	73.0					6																	47763300		2203	4300	6503	47871259	SO:0001630	splice_region_variant	221391			AY288419	CCDS4923.1	6p12.3	2012-08-08	2004-01-23		ENSG00000124818	ENSG00000124818		"""GPCR / Class A : Opsin receptors"""	19992	protein-coding gene	gene with protein product	"""neuropsin"""	609042	"""transmembrane protein 13"""	TMEM13		14623103, 14623098	Standard	NR_033806		Approved	neuropsin, dJ402H5.1	uc003ozc.3	Q6U736	OTTHUMG00000014803	ENST00000371211.2:c.756+1G>C	6.37:g.47763300G>C			47871259	A0AV33|Q5T5B9|Q5T886|Q7Z603|Q86SL5	Splice_Site	SNP	-	e4+1	ENST00000371211.2	37	c.756+1	CCDS4923.1	6	.	.	.	.	.	.	.	.	.	.	G	19.04	3.749982	0.69533	.	.	ENSG00000124818	ENST00000489301;ENST00000371211;ENST00000393699	.	.	.	5.18	5.18	0.71444	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.0535	0.93054	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	OPN5	47871259	1.000000	0.71417	1.000000	0.80357	0.870000	0.49936	9.420000	0.97426	2.567000	0.86603	0.555000	0.69702	.	-	-		0.408	OPN5-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OPN5	protein_coding	OTTHUMT00000359451.1	G	NM_181744	Intron	47871259	1	no_errors	NM_181744	genbank	human	reviewed	54_36p	splice_site	SNP	1	C
GPR126	57211	genome.wustl.edu	37	6	142688960	142688960	+	Missense_Mutation	SNP	T	T	G			TCGA-13-0894-01B-01W-0494-09	TCGA-13-0894-10A-01W-0494-09	T	T	T	G	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	eb57990e-702f-4fac-9ef5-7447ecb45cec	5781f8d8-a30f-4eee-acc8-c513e7872d10	g.chr6:142688960T>G	ENST00000230173.6	+	3	834	c.358T>G	c.(358-360)Ttt>Gtt	p.F120V	GPR126_ENST00000545477.1_3'UTR|GPR126_ENST00000296932.8_Missense_Mutation_p.F120V|GPR126_ENST00000367609.3_Missense_Mutation_p.F120V|GPR126_ENST00000367608.2_Missense_Mutation_p.F120V	NM_020455.5	NP_065188	Q86SQ4	GP126_HUMAN	G protein-coupled receptor 126	120	CUB. {ECO:0000255|PROSITE- ProRule:PRU00059}.				G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.F119V(1)		cervix(1)|endometrium(1)|kidney(3)|large_intestine(12)|lung(10)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	36	Breast(32;0.176)			OV - Ovarian serous cystadenocarcinoma(155;9.33e-06)|GBM - Glioblastoma multiforme(68;0.00121)		AGGCCTATCATTTAACTCAAG	0.403																																																1	Substitution - Missense(1)	ovary(1)	6											81.0	78.0	79.0					6																	142688960		1880	4102	5982	142730653	SO:0001583	missense	57211			AK027843	CCDS47489.1, CCDS47490.1, CCDS47491.1, CCDS55064.1	6q23.1-q24.3	2014-08-08			ENSG00000112414	ENSG00000112414		"""-"", ""GPCR / Class B : Orphans"""	13841	protein-coding gene	gene with protein product		612243				12565841	Standard	NM_001032395		Approved	FLJ14937	uc010khe.3	Q86SQ4	OTTHUMG00000015709	ENST00000230173.6:c.358T>G	6.37:g.142688960T>G	ENSP00000230173:p.Phe120Val		142730653	Q5TGN7|Q6DHZ4|Q6F3F5|Q6F3F6|Q6F3F7|Q6F3F8|Q6MZU7|Q8IXA4|Q8NC14|Q96JW0	Missense_Mutation	SNP	-	p.F120V	ENST00000230173.6	37	c.358	CCDS47490.1	6	.	.	.	.	.	.	.	.	.	.	T	22.2	4.256797	0.80246	.	.	ENSG00000112414	ENST00000230173;ENST00000367608;ENST00000296932;ENST00000367609;ENST00000541199;ENST00000435011	T;T;T;T;T;T	0.15139	2.45;2.45;2.45;2.45;2.45;2.45	5.72	5.72	0.89469	CUB (5);	0.092939	0.47852	D	0.000219	T	0.09335	0.0230	N	0.05306	-0.075	0.32112	N	0.589196	P;P;P;P;D	0.56287	0.878;0.935;0.935;0.947;0.975	P;P;P;P;P	0.54100	0.487;0.487;0.625;0.742;0.719	T	0.09818	-1.0657	10	0.72032	D	0.01	.	15.999	0.80275	0.0:0.0:0.0:1.0	.	120;120;120;120;119	Q86SQ4-4;Q86SQ4-3;Q86SQ4-2;Q86SQ4;F5H2L1	.;.;.;GP126_HUMAN;.	V	120;120;120;120;119;120	ENSP00000230173:F120V;ENSP00000356580:F120V;ENSP00000296932:F120V;ENSP00000356581:F120V;ENSP00000446287:F119V;ENSP00000438366:F120V	ENSP00000230173:F120V	F	+	1	0	GPR126	142730653	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	5.657000	0.67996	2.176000	0.68965	0.528000	0.53228	TTT	-	NULL		0.403	GPR126-001	KNOWN	basic|CCDS	protein_coding	GPR126	protein_coding	OTTHUMT00000042487.2	T			142730653	1	no_errors	NM_198569	genbank	human	validated	54_36p	missense	SNP	1	G
SPAM1	6677	genome.wustl.edu	37	7	123599954	123599954	+	Silent	SNP	C	C	T			TCGA-13-0894-01B-01W-0494-09	TCGA-13-0894-10A-01W-0494-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	eb57990e-702f-4fac-9ef5-7447ecb45cec	5781f8d8-a30f-4eee-acc8-c513e7872d10	g.chr7:123599954C>T	ENST00000439500.1	+	6	2074	c.1461C>T	c.(1459-1461)tcC>tcT	p.S487S	SPAM1_ENST00000223028.7_Silent_p.S487S|SPAM1_ENST00000460182.1_Silent_p.S487S|SPAM1_ENST00000340011.5_Silent_p.S487S|SPAM1_ENST00000402183.2_Silent_p.S487S	NM_001174045.1|NM_001174046.1	NP_001167516.1|NP_001167517.1	P38567	HYALP_HUMAN	sperm adhesion molecule 1 (PH-20 hyaluronidase, zona pellucida binding)	487					binding of sperm to zona pellucida (GO:0007339)|carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)	hyalurononglucosaminidase activity (GO:0004415)	p.S487S(1)		breast(1)|cervix(1)|endometrium(3)|kidney(5)|large_intestine(5)|lung(23)|ovary(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						CTTCACCCTCCACACTATCTG	0.378																																																1	Substitution - coding silent(1)	ovary(1)	7											125.0	117.0	120.0					7																	123599954		2203	4300	6503	123387190	SO:0001819	synonymous_variant	6677			L13781	CCDS5790.1, CCDS5791.1	7q31	2008-05-02			ENSG00000106304	ENSG00000106304			11217	protein-coding gene	gene with protein product		600930				8282124, 8575780	Standard	NM_153189		Approved	HYAL5, PH-20, SPAG15	uc003vle.3	P38567	OTTHUMG00000157284	ENST00000439500.1:c.1461C>T	7.37:g.123599954C>T			123387190	Q8TC30	Silent	SNP	HMMPfam_Glyco_hydro_56;superfamily_(Trans)glycosidases	p.S487	ENST00000439500.1	37	c.1461	CCDS5791.1	7																																																																																			-	NULL		0.378	SPAM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SPAM1	protein_coding	OTTHUMT00000348309.1	C			123387190	1	no_errors	NM_003117	genbank	human	reviewed	54_36p	silent	SNP		T
IGF2BP3	10643	genome.wustl.edu	37	7	23391065	23391065	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0894-01B-01W-0494-09	TCGA-13-0894-10A-01W-0494-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	eb57990e-702f-4fac-9ef5-7447ecb45cec	5781f8d8-a30f-4eee-acc8-c513e7872d10	g.chr7:23391065C>A	ENST00000258729.3	-	6	898	c.542G>T	c.(541-543)aGg>aTg	p.R181M	IGF2BP3_ENST00000491719.1_5'UTR	NM_006547.2	NP_006538.2	O00425	IF2B3_HUMAN	insulin-like growth factor 2 mRNA binding protein 3	181					anatomical structure morphogenesis (GO:0009653)|gene expression (GO:0010467)|mRNA transport (GO:0051028)|negative regulation of translation (GO:0017148)|regulation of cytokine biosynthetic process (GO:0042035)|translation (GO:0006412)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	mRNA 3'-UTR binding (GO:0003730)|mRNA 5'-UTR binding (GO:0048027)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|translation regulator activity (GO:0045182)	p.R181M(1)|p.R181K(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(14)|ovary(2)|prostate(2)|skin(4)|stomach(1)	34						AGACCCCTGCCTTGAGGAGCC	0.567																																																2	Substitution - Missense(2)	ovary(1)|skin(1)	7											54.0	53.0	53.0					7																	23391065		2203	4300	6503	23357590	SO:0001583	missense	10643			AF117108	CCDS5382.1	7p15.3	2014-02-19			ENSG00000136231	ENSG00000136231		"""RNA binding motif (RRM) containing"""	28868	protein-coding gene	gene with protein product	"""IGF II mRNA binding protein 3"", ""cancer/testis antigen 98"""	608259				9891060, 9178771	Standard	NM_006547		Approved	IMP-3, CT98, IMP3	uc003swg.3	O00425	OTTHUMG00000128445	ENST00000258729.3:c.542G>T	7.37:g.23391065C>A	ENSP00000258729:p.Arg181Met		23357590	A0A4Z5|Q63HM0|Q6MZZ2|Q86VB1	Missense_Mutation	SNP	HMMPfam_RRM_1;HMMPfam_KH_1;superfamily_Eukaryotic type KH-domain (KH-domain type I);superfamily_RNA-binding domain RBD	p.R181M	ENST00000258729.3	37	c.542	CCDS5382.1	7	.	.	.	.	.	.	.	.	.	.	C	35	5.550663	0.96501	.	.	ENSG00000136231	ENST00000258729	T	0.17213	2.29	5.88	5.88	0.94601	.	0.000000	0.85682	D	0.000000	T	0.31670	0.0804	M	0.61703	1.905	0.80722	D	1	D	0.54047	0.964	P	0.49361	0.608	T	0.00926	-1.1512	10	0.56958	D	0.05	-10.6987	20.2405	0.98372	0.0:1.0:0.0:0.0	.	181	O00425	IF2B3_HUMAN	M	181	ENSP00000258729:R181M	ENSP00000258729:R181M	R	-	2	0	IGF2BP3	23357590	0.993000	0.37304	0.944000	0.38274	0.961000	0.63080	7.770000	0.85390	2.797000	0.96272	0.561000	0.74099	AGG	-	NULL		0.567	IGF2BP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGF2BP3	protein_coding	OTTHUMT00000250243.2	C	NM_006547		23357590	-1	no_errors	NM_006547	genbank	human	reviewed	54_36p	missense	SNP	1	A
CD36	948	genome.wustl.edu	37	7	80303418	80303418	+	Silent	SNP	T	T	C			TCGA-13-0894-01B-01W-0494-09	TCGA-13-0894-10A-01W-0494-09	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	eb57990e-702f-4fac-9ef5-7447ecb45cec	5781f8d8-a30f-4eee-acc8-c513e7872d10	g.chr7:80303418T>C	ENST00000435819.1	+	17	2058	c.1374T>C	c.(1372-1374)gcT>gcC	p.A458A	CD36_ENST00000433696.2_Silent_p.A419A|CD36_ENST00000447544.2_Silent_p.A458A|CD36_ENST00000544133.1_3'UTR|CD36_ENST00000534394.1_Silent_p.A382A|CD36_ENST00000394788.3_Silent_p.A458A|CD36_ENST00000538969.1_Silent_p.A398A|CD36_ENST00000309881.7_Silent_p.A458A|CD36_ENST00000432207.1_Silent_p.A458A			P16671	CD36_HUMAN	CD36 molecule (thrombospondin receptor)	458					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic cell clearance (GO:0043277)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|cellular lipid metabolic process (GO:0044255)|cellular response to bacterial lipopeptide (GO:0071221)|cellular response to hydroperoxide (GO:0071447)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to lipoteichoic acid (GO:0071223)|cGMP-mediated signaling (GO:0019934)|cholesterol transport (GO:0030301)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response (GO:0045087)|lipid metabolic process (GO:0006629)|lipid storage (GO:0019915)|lipoprotein transport (GO:0042953)|long-chain fatty acid import (GO:0044539)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle mediated signaling (GO:0055096)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of transcription factor import into nucleus (GO:0042992)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nitric oxide mediated signal transduction (GO:0007263)|phagocytosis, recognition (GO:0006910)|plasma lipoprotein particle clearance (GO:0034381)|plasma membrane long-chain fatty acid transport (GO:0015911)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of blood coagulation (GO:0030194)|positive regulation of blood microparticle formation (GO:2000334)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phagocytosis, engulfment (GO:0060100)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of removal of superoxide radicals (GO:2000121)|response to stilbenoid (GO:0035634)|small molecule metabolic process (GO:0044281)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)	cell surface (GO:0009986)|endocytic vesicle membrane (GO:0030666)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|membrane raft (GO:0045121)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|platelet alpha granule membrane (GO:0031092)	high-density lipoprotein particle binding (GO:0008035)|lipid binding (GO:0008289)|lipoprotein particle binding (GO:0071813)|lipoteichoic acid receptor activity (GO:0070892)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein receptor activity (GO:0005041)|thrombospondin receptor activity (GO:0070053)|transforming growth factor beta binding (GO:0050431)	p.A458A(2)		breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(10)|large_intestine(1)|lung(6)|ovary(1)	21						TGTTTGTTGCTTTTATGATTT	0.313																																																2	Substitution - coding silent(2)	ovary(2)	7											149.0	146.0	147.0					7																	80303418		2202	4300	6502	80141354	SO:0001819	synonymous_variant	948			Z32770	CCDS34673.1	7q11.2	2010-02-26	2006-03-28		ENSG00000135218	ENSG00000135218		"""CD molecules"""	1663	protein-coding gene	gene with protein product		173510	"""CD36 antigen (collagen type I receptor, thrombospondin receptor)"""			7503937	Standard	NM_001001548		Approved	SCARB3, GPIV, FAT, GP4, GP3B	uc003uhg.4	P16671	OTTHUMG00000155383	ENST00000435819.1:c.1374T>C	7.37:g.80303418T>C			80141354	D9IX66|D9IX67|D9IX68|D9IX69|Q13966|Q16093|Q8TCV7|Q9BPZ8|Q9BQC2|Q9BZM8|Q9BZN3|Q9BZN4|Q9BZN5	Silent	SNP	HMMPfam_CD36	p.A458	ENST00000435819.1	37	c.1374	CCDS34673.1	7	.	.	.	.	.	.	.	.	.	.	T	9.994	1.231717	0.22626	.	.	ENSG00000135218	ENST00000488048	.	.	.	5.84	-2.97	0.05530	.	.	.	.	.	T	0.47967	0.1474	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.44097	-0.9350	4	.	.	.	-26.4173	5.4806	0.16721	0.5064:0.288:0.0:0.2056	.	.	.	.	L	52	.	.	F	+	1	0	CD36	80141354	0.002000	0.14202	0.997000	0.53966	0.876000	0.50452	-0.805000	0.04530	-0.103000	0.12175	0.459000	0.35465	TTT	-	NULL		0.313	CD36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD36	protein_coding	OTTHUMT00000339767.6	T	NM_001001547		80141354	1	no_errors	NM_000072	genbank	human	reviewed	54_36p	silent	SNP	1	C
PTCD1	26024	genome.wustl.edu	37	7	99032479	99032479	+	Missense_Mutation	SNP	C	C	A	rs575061663		TCGA-13-0894-01B-01W-0494-09	TCGA-13-0894-10A-01W-0494-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	eb57990e-702f-4fac-9ef5-7447ecb45cec	5781f8d8-a30f-4eee-acc8-c513e7872d10	g.chr7:99032479C>A	ENST00000292478.4	-	2	637	c.387G>T	c.(385-387)tgG>tgT	p.W129C	PTCD1_ENST00000485746.1_5'UTR|ATP5J2-PTCD1_ENST00000413834.1_Missense_Mutation_p.W178C|PTCD1_ENST00000555673.1_Missense_Mutation_p.W178C|ATP5J2-PTCD1_ENST00000437572.1_5'Flank	NM_015545.3	NP_056360.2	O75127	PTCD1_HUMAN	pentatricopeptide repeat domain 1	129					tRNA 3'-end processing (GO:0042780)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|tRNA binding (GO:0000049)	p.W129C(1)		endometrium(5)|large_intestine(3)|lung(16)|ovary(2)|skin(1)	27	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		STAD - Stomach adenocarcinoma(171;0.215)			TCCGGCCTCGCCATAATTTGG	0.552																																																1	Substitution - Missense(1)	ovary(1)	7											160.0	168.0	165.0					7																	99032479		2203	4300	6503	98870415	SO:0001583	missense	26024			AB014532	CCDS34691.1	7q22.1	2006-01-27				ENSG00000106246			22198	protein-coding gene	gene with protein product		614774					Standard	NM_015545		Approved	KIAA0632		O75127		ENST00000292478.4:c.387G>T	7.37:g.99032479C>A	ENSP00000292478:p.Trp129Cys		98870415	Q3ZB78|Q66K60|Q9UDV2	Missense_Mutation	SNP	HMMPfam_PPR;superfamily_TPR-like	p.W129C	ENST00000292478.4	37	c.387	CCDS34691.1	7	.	.	.	.	.	.	.	.	.	.	C	12.57	1.977785	0.34942	.	.	ENSG00000106246;ENSG00000106246;ENSG00000106246;ENSG00000106246;ENSG00000248919	ENST00000292478;ENST00000555673;ENST00000430982;ENST00000430029;ENST00000413834	T;T;D;D;T	0.85556	-0.18;-0.16;-1.86;-2.0;-0.16	5.97	5.97	0.96955	.	0.103684	0.64402	D	0.000001	D	0.90338	0.6977	M	0.73598	2.24	0.80722	D	1	D;D	0.76494	0.999;0.995	D;P	0.65323	0.934;0.781	D	0.88949	0.3385	10	0.38643	T	0.18	-10.229	11.7402	0.51788	0.0:0.8071:0.125:0.0679	.	178;129	G3V325;O75127	.;PTCD1_HUMAN	C	129;178;129;129;178	ENSP00000292478:W129C;ENSP00000450995:W178C;ENSP00000390530:W129C;ENSP00000408059:W129C;ENSP00000400168:W178C	ENSP00000400168:W178C	W	-	3	0	ATP5J2-PTCD1;PTCD1	98870415	0.542000	0.26426	0.810000	0.32431	0.008000	0.06430	0.960000	0.29253	2.837000	0.97791	0.655000	0.94253	TGG	-	NULL		0.552	PTCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTCD1	protein_coding	OTTHUMT00000336391.1	C	NM_015545		98870415	-1	no_errors	NM_015545	genbank	human	validated	54_36p	missense	SNP	0.84	A
OR2A12	346525	genome.wustl.edu	37	7	143792990	143792990	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0894-01B-01W-0494-09	TCGA-13-0894-10A-01W-0494-09	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	eb57990e-702f-4fac-9ef5-7447ecb45cec	5781f8d8-a30f-4eee-acc8-c513e7872d10	g.chr7:143792990A>G	ENST00000408949.2	+	1	850	c.790A>G	c.(790-792)Agc>Ggc	p.S264G		NM_001004135.1	NP_001004135.1	Q8NGT7	O2A12_HUMAN	olfactory receptor, family 2, subfamily A, member 12	264						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S264G(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(14)|ovary(2)	25	Melanoma(164;0.0783)					CCCCAAGTCAAGCCATTCTCA	0.542																																																1	Substitution - Missense(1)	ovary(1)	7											171.0	164.0	166.0					7																	143792990		1908	4140	6048	143423923	SO:0001583	missense	346525				CCDS43670.1	7q35	2013-09-20	2002-11-13	2002-11-13	ENSG00000221858	ENSG00000221858		"""GPCR / Class A : Olfactory receptors"""	15082	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily A, member 12 pseudogene"""	OR2A12P			Standard	NM_001004135		Approved		uc011kty.2	Q8NGT7	OTTHUMG00000157996	ENST00000408949.2:c.790A>G	7.37:g.143792990A>G	ENSP00000386174:p.Ser264Gly		143423923	Q6IF43	Missense_Mutation	SNP	-	p.S264G	ENST00000408949.2	37	c.790	CCDS43670.1	7	.	.	.	.	.	.	.	.	.	.	A	3.191	-0.165820	0.06461	.	.	ENSG00000221858	ENST00000408949	T	0.77877	-1.13	4.33	1.81	0.25067	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.68403	0.2997	L	0.28740	0.885	0.09310	N	1	B	0.23058	0.079	B	0.33121	0.158	T	0.58306	-0.7659	9	0.39692	T	0.17	0.4492	9.5092	0.39067	0.7037:0.2963:0.0:0.0	.	264	Q8NGT7	O2A12_HUMAN	G	264	ENSP00000386174:S264G	ENSP00000386174:S264G	S	+	1	0	OR2A12	143423923	0.000000	0.05858	0.038000	0.18304	0.199000	0.23934	-0.678000	0.05209	0.182000	0.20032	0.413000	0.27773	AGC	-	NULL		0.542	OR2A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2A12	protein_coding	OTTHUMT00000349969.1	A			143423923	1	no_errors	NM_001004135	genbank	human	provisional	54_36p	missense	SNP		G
OIT3	170392	genome.wustl.edu	37	10	74678221	74678221	+	Intron	SNP	C	C	G			TCGA-13-0894-01B-01W-0494-09	TCGA-13-0894-10A-01W-0494-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	eb57990e-702f-4fac-9ef5-7447ecb45cec	5781f8d8-a30f-4eee-acc8-c513e7872d10	g.chr10:74678221C>G	ENST00000334011.5	+	6	1169					NM_152635.1	NP_689848.1	Q8WWZ8	OIT3_HUMAN	oncoprotein induced transcript 3							nucleus (GO:0005634)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|liver(2)|lung(14)|ovary(2)|prostate(1)|skin(2)	35	Prostate(51;0.0198)					TCTTTGTCAGCCTTAATTCAC	0.453																																					Colon(7;19 345 13446 17537)											0			10																																								74348227	SO:0001627	intron_variant	100131044				CCDS7318.1	10q22.2-q22.3	2004-04-21			ENSG00000138315	ENSG00000138315			29953	protein-coding gene	gene with protein product		609330				12975309, 12939600	Standard	NM_152635		Approved	LZP, FLJ39116	uc001jte.1	Q8WWZ8	OTTHUMG00000018444	ENST00000334011.5:c.951+4995C>G	10.37:g.74678221C>G			74348227	A0AVP3|Q8N1M8	RNA	SNP	-	NULL	ENST00000334011.5	37	NULL	CCDS7318.1	10																																																																																			-	-		0.453	OIT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC100131044	protein_coding	OTTHUMT00000048596.1	C	NM_152635		74348227	-1	pseudogene	XR_038799	genbank	human	model	54_36p	rna	SNP	0.51	G
PKHD1L1	93035	genome.wustl.edu	37	8	110453043	110453043	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0894-01B-01W-0494-09	TCGA-13-0894-10A-01W-0494-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	eb57990e-702f-4fac-9ef5-7447ecb45cec	5781f8d8-a30f-4eee-acc8-c513e7872d10	g.chr8:110453043G>C	ENST00000378402.5	+	33	4165	c.4061G>C	c.(4060-4062)gGa>gCa	p.G1354A		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	1354	IPT/TIG 7.				immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.G1356A(1)		NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			AGGGGTTTTGGATTCAGCACA	0.373										HNSCC(38;0.096)																																						1	Substitution - Missense(1)	ovary(1)	8											172.0	164.0	167.0					8																	110453043		1834	4092	5926	110522219	SO:0001583	missense	93035			AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.4061G>C	8.37:g.110453043G>C	ENSP00000367655:p.Gly1354Ala		110522219	Q567P2|Q9UF27	Missense_Mutation	SNP	HMMPfam_TIG;superfamily_Cupredoxins;superfamily_Pectin lyase-like;superfamily_Composite domain of metallo-dependent hydrolases;superfamily_E set domains;superfamily_Anthrax protective antigen	p.G1354A	ENST00000378402.5	37	c.4061	CCDS47911.1	8	.	.	.	.	.	.	.	.	.	.	G	18.57	3.651727	0.67472	.	.	ENSG00000205038	ENST00000378402	T	0.79554	-1.28	6.17	6.17	0.99709	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.91365	0.7276	M	0.86864	2.845	0.46396	D	0.999028	D	0.89917	1.0	D	0.91635	0.999	D	0.91695	0.5369	10	0.72032	D	0.01	.	18.3732	0.90420	0.0:0.0:1.0:0.0	.	1354	Q86WI1	PKHL1_HUMAN	A	1354	ENSP00000367655:G1354A	ENSP00000367655:G1354A	G	+	2	0	PKHD1L1	110522219	1.000000	0.71417	0.970000	0.41538	0.163000	0.22366	6.582000	0.74049	2.941000	0.99782	0.655000	0.94253	GGA	-	HMMPfam_TIG		0.373	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKHD1L1	protein_coding	OTTHUMT00000381017.1	G	NM_177531		110522219	1	no_errors	NM_177531	genbank	human	validated	54_36p	missense	SNP	1	C
CHMP4C	92421	genome.wustl.edu	37	8	82665358	82665358	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0894-01B-01W-0494-09	TCGA-13-0894-10A-01W-0494-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	eb57990e-702f-4fac-9ef5-7447ecb45cec	5781f8d8-a30f-4eee-acc8-c513e7872d10	g.chr8:82665358G>T	ENST00000297265.4	+	2	443	c.250G>T	c.(250-252)Ggc>Tgc	p.G84C		NM_152284.3	NP_689497.1	Q96CF2	CHM4C_HUMAN	charged multivesicular body protein 4C	84	Intramolecular interaction with C- terminus. {ECO:0000250}.				abscission (GO:0009838)|cytokinesis checkpoint (GO:0031565)|endosomal transport (GO:0016197)|membrane organization (GO:0061024)|negative regulation of cytokinesis (GO:0032466)|positive regulation of viral release from host cell (GO:1902188)|protein transport (GO:0015031)|regulation of viral process (GO:0050792)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Flemming body (GO:0090543)|membrane (GO:0016020)|midbody (GO:0030496)	protein homodimerization activity (GO:0042803)	p.G84C(1)		NS(1)|breast(2)|endometrium(2)|large_intestine(1)|lung(1)|ovary(2)|skin(1)	10						TCAGATTGATGGCACACTTTC	0.438																																																1	Substitution - Missense(1)	ovary(1)	8											101.0	97.0	99.0					8																	82665358		2203	4300	6503	82827913	SO:0001583	missense	92421			AK000049	CCDS6233.1	8q21.13	2011-09-21	2011-09-21		ENSG00000164695	ENSG00000164695		"""Charged multivesicular body proteins"""	30599	protein-coding gene	gene with protein product	"""Snf7 homologue associated with Alix 3"""	610899	"""chromatin modifying protein 4C"""			12860994 , 14678797	Standard	NM_152284		Approved	MGC22825, Shax3, VPS32C	uc003ycl.3	Q96CF2	OTTHUMG00000164726	ENST00000297265.4:c.250G>T	8.37:g.82665358G>T	ENSP00000297265:p.Gly84Cys		82827913	B2RBZ1	Missense_Mutation	SNP	HMMPfam_Snf7	p.G84C	ENST00000297265.4	37	c.250	CCDS6233.1	8	.	.	.	.	.	.	.	.	.	.	G	27.9	4.872930	0.91664	.	.	ENSG00000164695	ENST00000297265	T	0.73469	-0.75	5.8	5.8	0.92144	.	0.043804	0.85682	D	0.000000	D	0.89798	0.6819	M	0.91196	3.185	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.90850	0.4730	10	0.62326	D	0.03	-18.6473	20.0471	0.97613	0.0:0.0:1.0:0.0	.	84	Q96CF2	CHM4C_HUMAN	C	84	ENSP00000297265:G84C	ENSP00000297265:G84C	G	+	1	0	CHMP4C	82827913	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	9.864000	0.99589	2.731000	0.93534	0.655000	0.94253	GGC	-	HMMPfam_Snf7		0.438	CHMP4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHMP4C	protein_coding	OTTHUMT00000379927.1	G	NM_152284		82827913	1	no_errors	NM_152284	genbank	human	validated	54_36p	missense	SNP	1	T
EFR3A	23167	genome.wustl.edu	37	8	132958828	132958828	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0894-01B-01W-0494-09	TCGA-13-0894-10A-01W-0494-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	eb57990e-702f-4fac-9ef5-7447ecb45cec	5781f8d8-a30f-4eee-acc8-c513e7872d10	g.chr8:132958828C>T	ENST00000254624.5	+	4	539	c.314C>T	c.(313-315)gCa>gTa	p.A105V	EFR3A_ENST00000519656.1_Missense_Mutation_p.A69V|EFR3A_ENST00000334503.4_Missense_Mutation_p.A105V	NM_015137.4	NP_055952.2	Q14156	EFR3A_HUMAN	EFR3 homolog A (S. cerevisiae)	105						extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|plasma membrane (GO:0005886)		p.A105V(1)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(14)|ovary(3)|skin(1)|stomach(2)	35	Esophageal squamous(12;0.00693)|Ovarian(258;0.00769)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000805)|LUAD - Lung adenocarcinoma(14;0.102)			CATATGGTGGCAAAGCTGCTG	0.393																																																1	Substitution - Missense(1)	ovary(1)	8											70.0	66.0	67.0					8																	132958828		2202	4300	6502	133028010	SO:0001583	missense	23167			D63477	CCDS34942.2	8q24.22	2008-10-23			ENSG00000132294	ENSG00000132294			28970	protein-coding gene	gene with protein product		611798				15363888	Standard	NM_015137		Approved	KIAA0143	uc003yte.3	Q14156	OTTHUMG00000150552	ENST00000254624.5:c.314C>T	8.37:g.132958828C>T	ENSP00000254624:p.Ala105Val		133028010	A7MD19|Q2VPK2|Q63HL7|Q68DX1|Q6IQ18	Missense_Mutation	SNP	-	p.A105V	ENST00000254624.5	37	c.314	CCDS34942.2	8	.	.	.	.	.	.	.	.	.	.	C	27.5	4.836486	0.91117	.	.	ENSG00000132294	ENST00000254624;ENST00000522709;ENST00000377917;ENST00000334503;ENST00000519656	T;T;T;T	0.19250	2.16;2.16;2.16;2.16	5.47	5.47	0.80525	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.30479	0.0766	M	0.61703	1.905	0.53005	D	0.99996	B	0.33345	0.409	B	0.38458	0.274	T	0.03750	-1.1007	10	0.48119	T	0.1	-17.2104	18.3132	0.90208	0.0:1.0:0.0:0.0	.	105	Q14156	EFR3A_HUMAN	V	105;69;105;105;69	ENSP00000254624:A105V;ENSP00000430512:A69V;ENSP00000334769:A105V;ENSP00000428086:A69V	ENSP00000254624:A105V	A	+	2	0	EFR3A	133028010	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.805000	0.62561	2.572000	0.86782	0.655000	0.94253	GCA	-	NULL		0.393	EFR3A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EFR3A	protein_coding	OTTHUMT00000318886.1	C	NM_015137		133028010	1	no_errors	NM_015137	genbank	human	validated	54_36p	missense	SNP	1	T
TLR8	51311	genome.wustl.edu	37	X	12938695	12938695	+	Silent	SNP	G	G	T			TCGA-13-0894-01B-01W-0494-09	TCGA-13-0894-10A-01W-0494-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	eb57990e-702f-4fac-9ef5-7447ecb45cec	5781f8d8-a30f-4eee-acc8-c513e7872d10	g.chrX:12938695G>T	ENST00000218032.6	+	2	1623	c.1536G>T	c.(1534-1536)ctG>ctT	p.L512L	TLR8_ENST00000311912.5_Silent_p.L530L	NM_138636.4	NP_619542.1	Q9NR97	TLR8_HUMAN	toll-like receptor 8	512					cellular response to mechanical stimulus (GO:0071260)|defense response to virus (GO:0051607)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|immunoglobulin mediated immune response (GO:0016064)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of innate immune response (GO:0045089)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|regulation of cytokine secretion (GO:0050707)|response to virus (GO:0009615)|toll-like receptor 8 signaling pathway (GO:0034158)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	endolysosome membrane (GO:0036020)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|drug binding (GO:0008144)|receptor activity (GO:0004872)|RNA binding (GO:0003723)|single-stranded RNA binding (GO:0003727)	p.L530L(1)		breast(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(21)|ovary(4)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	50					Imiquimod(DB00724)	GTTTAAATCTGTCTGCAAATA	0.358																																																1	Substitution - coding silent(1)	ovary(1)	X											50.0	45.0	47.0					X																	12938695		2203	4300	6503	12848616	SO:0001819	synonymous_variant	51311			AF246971	CCDS14152.1, CCDS14153.1	Xp22	2009-11-23			ENSG00000101916	ENSG00000101916		"""CD molecules"""	15632	protein-coding gene	gene with protein product		300366				11022119	Standard	NM_138636		Approved	CD288	uc004cve.3	Q9NR97	OTTHUMG00000021145	ENST00000218032.6:c.1536G>T	X.37:g.12938695G>T			12848616	B3Y654|D1CS70|D1CS76|Q495P4|Q6UXL6|Q9NYG9	Silent	SNP	-	p.L512	ENST00000218032.6	37	c.1536	CCDS14152.1	X																																																																																			-	NULL		0.358	TLR8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TLR8	protein_coding	OTTHUMT00000055784.2	G	NM_016610		12848616	1	no_errors	NM_138636	genbank	human	reviewed	54_36p	silent	SNP	1	T
SLC9A7	84679	genome.wustl.edu	37	X	46466493	46466493	+	Missense_Mutation	SNP	G	G	A	rs371727694		TCGA-13-0894-01B-01W-0494-09	TCGA-13-0894-10A-01W-0494-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	eb57990e-702f-4fac-9ef5-7447ecb45cec	5781f8d8-a30f-4eee-acc8-c513e7872d10	g.chrX:46466493G>A	ENST00000328306.4	-	17	2097	c.2072C>T	c.(2071-2073)aCg>aTg	p.T691M	SLC9A7_ENST00000464933.1_5'UTR	NM_001257291.1|NM_032591.2	NP_001244220.1|NP_115980.1	Q96T83	SL9A7_HUMAN	solute carrier family 9, subfamily A (NHE7, cation proton antiporter 7), member 7	691					ion transport (GO:0006811)|potassium ion transmembrane transport (GO:0071805)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|recycling endosome membrane (GO:0055038)|trans-Golgi network (GO:0005802)	potassium:proton antiporter activity (GO:0015386)|protein homodimerization activity (GO:0042803)|sodium:proton antiporter activity (GO:0015385)	p.T691M(1)		breast(2)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|prostate(1)|skin(1)	21						GCTGCTCTTCGTTCTCCGGCT	0.597																																					Pancreas(118;454 1696 1930 13865 39976)											1	Substitution - Missense(1)	ovary(1)	X						A	MET/THR	1,3834		0,1,1631,571	57.0	47.0	50.0		2072	1.0	0.3	X		50	0,6728		0,0,2428,1872	no	missense	SLC9A7	NM_032591.1	81	0,1,4059,2443	AA,AG,GG,G		0.0,0.0261,0.0095	benign	691/726	46466493	1,10562	2203	4300	6503	46351437	SO:0001583	missense	84679			AF298591	CCDS14269.1, CCDS75967.1	Xp11.3	2013-05-22	2012-03-22		ENSG00000065923	ENSG00000065923		"""Solute carriers"""	17123	protein-coding gene	gene with protein product		300368	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 7"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 7"""			11279194	Standard	NM_001257291		Approved	NHE7	uc004dgv.2	Q96T83	OTTHUMG00000021428	ENST00000328306.4:c.2072C>T	X.37:g.46466493G>A	ENSP00000330320:p.Thr691Met		46351437	O75827|Q5JXP9	Missense_Mutation	SNP	HMMPfam_Na_H_Exchanger	p.T691M	ENST00000328306.4	37	c.2072	CCDS14269.1	X	.	.	.	.	.	.	.	.	.	.	g	0.143	-1.099783	0.01843	2.61E-4	0.0	ENSG00000065923	ENST00000328306	T	0.31510	1.49	4.73	1.01	0.19927	.	0.439260	0.19813	N	0.105486	T	0.14356	0.0347	N	0.08118	0	0.31406	N	0.676096	B	0.19583	0.037	B	0.14578	0.011	T	0.10965	-1.0607	10	0.38643	T	0.18	.	9.3883	0.38356	0.3035:0.0:0.6965:0.0	.	691	Q96T83	SL9A7_HUMAN	M	691	ENSP00000330320:T691M	ENSP00000330320:T691M	T	-	2	0	SLC9A7	46351437	0.999000	0.42202	0.325000	0.25375	0.117000	0.20001	2.011000	0.40922	-0.036000	0.13669	-0.864000	0.03007	ACG	-	NULL		0.597	SLC9A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9A7	protein_coding	OTTHUMT00000056370.1	G	NM_032591		46351437	-1	no_errors	NM_032591	genbank	human	reviewed	54_36p	missense	SNP	0.85	A
Unknown	0	genome.wustl.edu	37	X	92477907	92477907	+	IGR	SNP	G	G	C			TCGA-13-0894-01B-01W-0494-09	TCGA-13-0894-10A-01W-0494-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	eb57990e-702f-4fac-9ef5-7447ecb45cec	5781f8d8-a30f-4eee-acc8-c513e7872d10	g.chrX:92477907G>C								PCDH11X (599678 upstream) : NAP1L3 (448021 downstream)																							TACCCACCGGGTGCCATGCCT	0.522																																																0			X																																								92364563	SO:0001628	intergenic_variant	401602																															X.37:g.92477907G>C			92364563		RNA	SNP	-	NULL		37	NULL		X																																																																																			-	-	0	0.522					LOC401602			G			92364563	-1	pseudogene	XR_016272	genbank	human	model	54_36p	rna	SNP	0.57	C
