#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
NTNG1	22854	genome.wustl.edu	37	1	107867515	107867515	+	Nonsense_Mutation	SNP	C	C	G			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr1:107867515C>G	ENST00000370068.1	+	3	1704	c.858C>G	c.(856-858)taC>taG	p.Y286*	NTNG1_ENST00000370070.2_Nonsense_Mutation_p.Y286*|NTNG1_ENST00000370065.1_Nonsense_Mutation_p.Y286*|NTNG1_ENST00000542803.1_Nonsense_Mutation_p.Y286*|NTNG1_ENST00000370066.1_Nonsense_Mutation_p.Y286*|NTNG1_ENST00000370067.1_Nonsense_Mutation_p.Y286*|NTNG1_ENST00000370071.2_Nonsense_Mutation_p.Y286*|NTNG1_ENST00000370072.3_Nonsense_Mutation_p.Y286*|NTNG1_ENST00000370073.2_Nonsense_Mutation_p.Y286*|NTNG1_ENST00000370074.4_Nonsense_Mutation_p.Y286*|NTNG1_ENST00000477948.1_3'UTR|NTNG1_ENST00000370061.3_Nonsense_Mutation_p.Y286*			Q9Y2I2	NTNG1_HUMAN	netrin G1	286	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				axonogenesis (GO:0007409)	anchored component of plasma membrane (GO:0046658)		p.Y286*(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(8)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(3)|soft_tissue(1)|urinary_tract(1)	37		all_epithelial(167;1.39e-05)|all_lung(203;0.000115)|Lung NSC(277;0.000238)|Breast(1374;0.243)		Lung(183;0.0946)|BRCA - Breast invasive adenocarcinoma(282;0.237)|Epithelial(280;0.245)		GCTACTTTTACGCGATCTCAG	0.458																																																1	Substitution - Nonsense(1)	ovary(1)	1											62.0	64.0	63.0					1																	107867515		2203	4298	6501	107669038	SO:0001587	stop_gained	22854			AB023193	CCDS30785.1, CCDS44179.1, CCDS44180.1	1p13.2-p13.1	2013-03-01			ENSG00000162631	ENSG00000162631		"""Netrins"""	23319	protein-coding gene	gene with protein product	"""netrin G1f"", ""Netrin-G1"""	608818				10964959	Standard	NM_001113226		Approved	KIAA0976, Lmnt1	uc001dvh.4	Q9Y2I2	OTTHUMG00000010965	ENST00000370068.1:c.858C>G	1.37:g.107867515C>G	ENSP00000359085:p.Tyr286*		107669038	Q5VU86|Q5VU87|Q5VU89|Q5VU90|Q5VU91|Q7Z2Y3|Q8N633	Nonsense_Mutation	SNP	HMMPfam_Laminin_EGF;HMMPfam_Laminin_N;superfamily_Galactose-binding domain-like;HMMPfam_EGF_2;superfamily_EGF/Laminin	p.Y286*	ENST00000370068.1	37	c.858	CCDS44180.1	1	.	.	.	.	.	.	.	.	.	.	C	41	8.754386	0.98941	.	.	ENSG00000162631	ENST00000370076;ENST00000370073;ENST00000370071;ENST00000542803;ENST00000370061;ENST00000370072;ENST00000370070;ENST00000535584;ENST00000370064;ENST00000370062;ENST00000370074;ENST00000370068;ENST00000294649;ENST00000370067;ENST00000370066;ENST00000370065	.	.	.	6.05	-1.29	0.09288	.	0.000000	0.56097	D	0.000040	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.9886	0.47537	0.0:0.2295:0.0:0.7705	.	.	.	.	X	286;286;286;286;286;286;286;286;47;47;286;286;286;286;286;286	.	ENSP00000294649:Y286X	Y	+	3	2	NTNG1	107669038	0.715000	0.27946	0.986000	0.45419	0.999000	0.98932	-0.131000	0.10482	-0.095000	0.12351	0.655000	0.94253	TAC	-	HMMPfam_Laminin_N		0.458	NTNG1-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NTNG1	protein_coding	OTTHUMT00000030340.1	C	NM_014917		107669038	1	no_errors	NM_014917	genbank	human	provisional	54_36p	nonsense	SNP	1	G
RBM15	64783	genome.wustl.edu	37	1	110888225	110888225	+	Silent	SNP	G	G	A			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr1:110888225G>A	ENST00000369784.3	+	2	3828	c.2928G>A	c.(2926-2928)ctG>ctA	p.L976L	RBM15_ENST00000487146.2_Intron	NM_022768.4	NP_073605.4	Q96T37	RBM15_HUMAN	RNA binding motif protein 15	976					negative regulation of myeloid cell differentiation (GO:0045638)|patterning of blood vessels (GO:0001569)|placenta blood vessel development (GO:0060674)|positive regulation of transcription of Notch receptor target (GO:0007221)|spleen development (GO:0048536)|ventricular septum morphogenesis (GO:0060412)|viral process (GO:0016032)	membrane (GO:0016020)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.L976L(1)		ovary(3)	3		all_cancers(81;2.89e-06)|all_epithelial(167;2.96e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)|Breast(1374;0.0634)		BRCA - Breast invasive adenocarcinoma(282;0.000224)|Epithelial(280;0.000476)|Kidney(133;0.000539)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|all cancers(265;0.00144)|Lung(183;0.0238)|Colorectal(144;0.103)|LUSC - Lung squamous cell carcinoma(189;0.135)		CGCTGACCCTGTTATAGTGGT	0.373			T	MKL1	acute megakaryocytic leukemia																																		Dom	yes		1	1p13	64783	RNA binding motif protein 15		L	1	Substitution - coding silent(1)	ovary(1)	1											213.0	236.0	228.0					1																	110888225		2203	4300	6503	110689748	SO:0001819	synonymous_variant	64783			AF368063	CCDS822.1, CCDS59198.1	1p13	2013-02-12			ENSG00000162775	ENSG00000162775		"""RNA binding motif (RRM) containing"""	14959	protein-coding gene	gene with protein product	"""one twenty-two"""	606077				11431691, 11344311	Standard	NM_001201545		Approved	OTT, OTT1	uc001dzl.1	Q96T37	OTTHUMG00000011284	ENST00000369784.3:c.2928G>A	1.37:g.110888225G>A			110689748	A1A693|Q3ZB86|Q4V760|Q5D058|Q5T613|Q86VW9|Q96PE4|Q96SC5|Q96SC6|Q96SC9|Q96SD0|Q96T38|Q9BRA5|Q9H6R8|Q9H9Y0	Silent	SNP	HMMPfam_RRM_1;HMMPfam_SPOC;superfamily_SPOC domain-like;superfamily_RNA-binding domain RBD	p.L976	ENST00000369784.3	37	c.2928	CCDS822.1	1																																																																																			-	NULL		0.373	RBM15-001	KNOWN	basic|CCDS	protein_coding	RBM15	protein_coding	OTTHUMT00000031114.2	G	NM_022768		110689748	1	no_errors	NM_022768	genbank	human	validated	54_36p	silent	SNP		A
FAM212B	55924	genome.wustl.edu	37	1	112270206	112270206	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr1:112270206G>C	ENST00000357260.5	-	2	459	c.278C>G	c.(277-279)cCc>cGc	p.P93R	FAM212B_ENST00000534365.1_Missense_Mutation_p.P93R|FAM212B_ENST00000444059.2_Missense_Mutation_p.P78R	NM_019099.4	NP_061972.1	Q9NTI7	F212B_HUMAN	family with sequence similarity 212, member B	93								p.P93R(1)		cervix(1)|endometrium(1)	2						TTGACTGGAGGGGGAACAGAC	0.612																																																1	Substitution - Missense(1)	ovary(1)	1											86.0	81.0	83.0					1																	112270206		2203	4300	6503	112071729	SO:0001583	missense	55924			AK055667	CCDS841.1, CCDS44195.1	1p13.2	2011-11-24	2011-11-24	2011-11-24	ENSG00000197852	ENSG00000197852			28045	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 183"""	C1orf183			Standard	NM_019099		Approved	FLJ31105	uc001ebo.2	Q9NTI7	OTTHUMG00000011953	ENST00000357260.5:c.278C>G	1.37:g.112270206G>C	ENSP00000349805:p.Pro93Arg		112071729	B3KP38|B4DF94|Q9NTI6	Missense_Mutation	SNP	-	p.P93R	ENST00000357260.5	37	c.278	CCDS841.1	1	.	.	.	.	.	.	.	.	.	.	G	7.719	0.696794	0.15106	.	.	ENSG00000197852	ENST00000357260;ENST00000534365;ENST00000444059;ENST00000527621	.	.	.	4.5	3.57	0.40892	.	0.179966	0.48767	D	0.000161	T	0.26340	0.0643	L	0.58810	1.83	0.09310	N	1	B;B	0.21520	0.057;0.033	B;B	0.21360	0.034;0.034	T	0.30966	-0.9960	9	0.72032	D	0.01	-11.7755	11.5791	0.50881	0.0899:0.0:0.9101:0.0	.	78;93	Q9NTI7-2;Q9NTI7	.;CA183_HUMAN	R	93;93;78;102	.	ENSP00000349805:P93R	P	-	2	0	C1orf183	112071729	0.145000	0.22656	0.009000	0.14445	0.019000	0.09904	1.267000	0.33050	1.057000	0.40506	0.491000	0.48974	CCC	-	NULL		0.612	FAM212B-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	C1orf183	protein_coding	OTTHUMT00000033060.2	G	NM_019099		112071729	-1	no_errors	NM_019099	genbank	human	validated	54_36p	missense	SNP	0.05	C
AP4B1	10717	genome.wustl.edu	37	1	114444379	114444379	+	Missense_Mutation	SNP	A	A	C			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	A	A	A	C	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr1:114444379A>C	ENST00000369569.1	-	3	747	c.467T>G	c.(466-468)gTa>gGa	p.V156G	AP4B1_ENST00000369567.1_Intron|AP4B1_ENST00000256658.4_Missense_Mutation_p.V156G|AP4B1-AS1_ENST00000419536.1_RNA|AP4B1_ENST00000369566.3_Intron	NM_001253852.1	NP_001240781.1	Q9Y6B7	AP4B1_HUMAN	adaptor-related protein complex 4, beta 1 subunit	156					intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	clathrin adaptor complex (GO:0030131)|coated pit (GO:0005905)|trans-Golgi network (GO:0005802)	protein transporter activity (GO:0008565)|transporter activity (GO:0005215)	p.V156G(1)		breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(9)|ovary(3)|prostate(3)	25	Lung SC(450;0.184)	all_cancers(81;4.5e-08)|all_epithelial(167;1.1e-07)|all_lung(203;1.53e-05)|Lung NSC(69;2.76e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		GAACTTACCTACTTCAGAGTC	0.418																																																1	Substitution - Missense(1)	ovary(1)	1											143.0	125.0	131.0					1																	114444379		2203	4300	6503	114245902	SO:0001583	missense	10717			AF092094	CCDS865.1	1p13.2	2012-03-30			ENSG00000134262	ENSG00000134262			572	protein-coding gene	gene with protein product	"""beta 4 subunit of AP-4"""	607245	"""spastic paraplegia 47"""	SPG47		10066790	Standard	NM_006594		Approved	BETA-4	uc001eeb.3	Q9Y6B7	OTTHUMG00000011943	ENST00000369569.1:c.467T>G	1.37:g.114444379A>C	ENSP00000358582:p.Val156Gly		114245902	B7Z4X3|Q59EJ4|Q96CL6	Missense_Mutation	SNP	-	p.V156G	ENST00000369569.1	37	c.467	CCDS865.1	1	.	.	.	.	.	.	.	.	.	.	A	18.47	3.629956	0.67015	.	.	ENSG00000134262	ENST00000369569;ENST00000256658;ENST00000369564;ENST00000369571	T;T;T;T	0.25579	1.79;1.79;1.79;1.79	5.36	4.24	0.50183	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.055499	0.64402	D	0.000001	T	0.14743	0.0356	L	0.47016	1.485	0.80722	D	1	D	0.54601	0.967	P	0.47015	0.534	T	0.02190	-1.1198	10	0.30854	T	0.27	-9.4721	11.3059	0.49334	0.9284:0.0:0.0716:0.0	.	156	Q9Y6B7	AP4B1_HUMAN	G	156;156;81;156	ENSP00000358582:V156G;ENSP00000256658:V156G;ENSP00000358577:V81G;ENSP00000358584:V156G	ENSP00000256658:V156G	V	-	2	0	AP4B1	114245902	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	8.108000	0.89559	0.982000	0.38575	-0.250000	0.11733	GTA	-	NULL		0.418	AP4B1-009	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	AP4B1	protein_coding	OTTHUMT00000033037.1	A	NM_006594		114245902	-1	no_errors	NM_006594	genbank	human	validated	54_36p	missense	SNP	1	C
HIPK1	204851	genome.wustl.edu	37	1	114483215	114483215	+	Nonsense_Mutation	SNP	C	C	G	rs370037970		TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr1:114483215C>G	ENST00000369558.1	+	2	442	c.210C>G	c.(208-210)taC>taG	p.Y70*	HIPK1_ENST00000369561.4_Nonsense_Mutation_p.Y70*|HIPK1_ENST00000369555.2_Nonsense_Mutation_p.Y70*|HIPK1_ENST00000426820.2_Nonsense_Mutation_p.Y70*|HIPK1_ENST00000369554.2_Nonsense_Mutation_p.Y70*|HIPK1_ENST00000369559.4_Nonsense_Mutation_p.Y70*			Q86Z02	HIPK1_HUMAN	homeodomain interacting protein kinase 1	70					anterior/posterior pattern specification (GO:0009952)|definitive hemopoiesis (GO:0060216)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endothelial cell apoptotic process (GO:0072577)|extrinsic apoptotic signaling pathway (GO:0097191)|eye development (GO:0001654)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|iris morphogenesis (GO:0061072)|lens induction in camera-type eye (GO:0060235)|neuron differentiation (GO:0030182)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tumor necrosis factor-mediated signaling pathway (GO:0010803)|retina layer formation (GO:0010842)|smoothened signaling pathway (GO:0007224)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.Y70*(1)		breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(15)|ovary(4)|prostate(2)	39	Lung SC(450;0.184)	all_cancers(81;4.5e-08)|all_epithelial(167;1.09e-07)|all_lung(203;1.53e-05)|Lung NSC(69;2.76e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TCCCTGCTTACGACCAGGGCC	0.532																																																1	Substitution - Nonsense(1)	ovary(1)	1											153.0	153.0	153.0					1																	114483215		2203	4300	6503	114284738	SO:0001587	stop_gained	204851			AB089957	CCDS867.1, CCDS868.1, CCDS869.1, CCDS41370.1	1p13.1	2008-02-05			ENSG00000163349	ENSG00000163349			19006	protein-coding gene	gene with protein product		608003					Standard	NM_198268		Approved	KIAA0630, Myak, MGC26642, Nbak2, MGC33446, MGC33548	uc001eem.3	Q86Z02	OTTHUMG00000011983	ENST00000369558.1:c.210C>G	1.37:g.114483215C>G	ENSP00000358571:p.Tyr70*		114284738	A6NJ34|O75125|Q5SQL2|Q5SQL4|Q5SQL5|Q8IYD7|Q8NDN5|Q8NEB6|Q8TBZ1	Nonsense_Mutation	SNP	HMMPfam_Pkinase;superfamily_Protein kinase-like (PK-like)	p.Y70*	ENST00000369558.1	37	c.210	CCDS867.1	1	.	.	.	.	.	.	.	.	.	.	C	18.94	3.729510	0.69074	.	.	ENSG00000163349	ENST00000426820;ENST00000369559;ENST00000443627;ENST00000369554;ENST00000369555;ENST00000369558;ENST00000369561;ENST00000514621;ENST00000503968	.	.	.	5.22	4.31	0.51392	.	0.000000	0.56097	D	0.000024	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.9612	0.47387	0.0:0.85:0.0:0.15	.	.	.	.	X	141;70;70;70;70;70;70;70;70	.	ENSP00000358567:Y70X	Y	+	3	2	HIPK1	114284738	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.208000	0.32345	1.194000	0.43101	0.650000	0.86243	TAC	-	NULL		0.532	HIPK1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	HIPK1	protein_coding	OTTHUMT00000033127.1	C	NM_198268		114284738	1	no_errors	NM_198268	genbank	human	reviewed	54_36p	nonsense	SNP	1	G
KAZN	23254	genome.wustl.edu	37	1	15392125	15392125	+	Splice_Site	SNP	G	G	T			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr1:15392125G>T	ENST00000376030.2	+	8	1392		c.e8-1		KAZN_ENST00000422387.2_Splice_Site|KAZN_ENST00000361144.5_Splice_Site|KAZN_ENST00000400797.3_Splice_Site|KAZN_ENST00000503743.1_Splice_Site|KAZN_ENST00000400798.2_Splice_Site	NM_201628.2	NP_963922.2	Q674X7	KAZRN_HUMAN	kazrin, periplakin interacting protein						keratinization (GO:0031424)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|desmosome (GO:0030057)|nucleus (GO:0005634)		p.?(2)		central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(9)|liver(1)|lung(6)|ovary(1)|prostate(2)	25						TGACTCCTCAGTCACTAGAGG	0.557																																																2	Unknown(2)	ovary(2)	1											60.0	69.0	66.0					1																	15392125		2203	4300	6503	15264712	SO:0001630	splice_region_variant	23254			AY505119	CCDS30604.1, CCDS41267.1, CCDS152.2, CCDS41268.1	1p36.21	2014-02-12	2011-01-31		ENSG00000189337	ENSG00000189337		"""Sterile alpha motif (SAM) domain containing"""	29173	protein-coding gene	gene with protein product						15337775, 18840647	Standard	NM_015209		Approved	KIAA1026, KAZRIN, FLJ43806	uc001avm.4	Q674X7	OTTHUMG00000002042	ENST00000376030.2:c.1099-1G>T	1.37:g.15392125G>T			15264712	B0QYQ0|B1AK78|Q5TGF1|Q674X4|Q674X6|Q6ZUD1|Q8IYN7|Q8N409|Q9UIL2|Q9UPX4	Splice_Site	SNP	-	e8-1	ENST00000376030.2	37	c.1099-1	CCDS152.2	1	.	.	.	.	.	.	.	.	.	.	G	19.16	3.774442	0.70107	.	.	ENSG00000189337	ENST00000376030;ENST00000503743;ENST00000422387;ENST00000361144;ENST00000400798;ENST00000400797	.	.	.	4.94	4.94	0.65067	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.1442	0.86762	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	KAZN	15264712	1.000000	0.71417	1.000000	0.80357	0.896000	0.52359	9.193000	0.94954	2.284000	0.76573	0.305000	0.20034	.	-	-		0.557	KAZN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1026	protein_coding	OTTHUMT00000005690.2	G	NM_001017999	Intron	15264712	1	no_errors	NM_201628	genbank	human	validated	54_36p	splice_site	SNP	1	T
FLG2	388698	genome.wustl.edu	37	1	152325901	152325901	+	Missense_Mutation	SNP	T	T	C			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr1:152325901T>C	ENST00000388718.5	-	3	4433	c.4361A>G	c.(4360-4362)cAt>cGt	p.H1454R	FLG-AS1_ENST00000445097.1_RNA|FLG-AS1_ENST00000392688.2_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	1454					establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.H1454R(1)		NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGACTCTCCATGTTGAGATCC	0.502																																																1	Substitution - Missense(1)	ovary(1)	1											398.0	356.0	370.0					1																	152325901		2203	4300	6503	150592525	SO:0001583	missense	388698			AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.4361A>G	1.37:g.152325901T>C	ENSP00000373370:p.His1454Arg		150592525	Q9H4U1	Missense_Mutation	SNP	-	p.H1454R	ENST00000388718.5	37	c.4361	CCDS30861.1	1	.	.	.	.	.	.	.	.	.	.	T	8.628	0.893008	0.17613	.	.	ENSG00000143520	ENST00000388718	T	0.28666	1.6	3.53	2.35	0.29111	.	.	.	.	.	T	0.09555	0.0235	L	0.60845	1.875	0.09310	N	1	B	0.34103	0.437	B	0.29862	0.108	T	0.27226	-1.0080	9	0.15952	T	0.53	-0.1859	7.2572	0.26183	0.0:0.0:0.2269:0.7731	.	1454	Q5D862	FILA2_HUMAN	R	1454	ENSP00000373370:H1454R	ENSP00000373370:H1454R	H	-	2	0	FLG2	150592525	0.000000	0.05858	0.001000	0.08648	0.034000	0.12701	0.336000	0.19823	0.519000	0.28406	0.246000	0.17985	CAT	-	NULL		0.502	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG2	protein_coding	OTTHUMT00000034018.5	T	NM_001014342		150592525	-1	no_errors	NM_001014342	genbank	human	provisional	54_36p	missense	SNP		C
UBR4	23352	genome.wustl.edu	37	1	19480386	19480386	+	Missense_Mutation	SNP	T	T	G			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	T	T	T	G	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr1:19480386T>G	ENST00000375254.3	-	45	6533	c.6506A>C	c.(6505-6507)gAg>gCg	p.E2169A	UBR4_ENST00000375217.2_Missense_Mutation_p.E2169A|UBR4_ENST00000375267.2_Missense_Mutation_p.E2169A|UBR4_ENST00000375226.2_Missense_Mutation_p.E2169A	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	2169					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.E2169A(1)		breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		GTTCATCACCTCAGACCACTG	0.483																																																1	Substitution - Missense(1)	ovary(1)	1											100.0	93.0	95.0					1																	19480386		2203	4300	6503	19352973	SO:0001583	missense	23352			AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.6506A>C	1.37:g.19480386T>G	ENSP00000364403:p.Glu2169Ala		19352973	A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Missense_Mutation	SNP	-	p.E2169A	ENST00000375254.3	37	c.6506	CCDS189.1	1	.	.	.	.	.	.	.	.	.	.	T	27.8	4.860021	0.91433	.	.	ENSG00000127481	ENST00000375254;ENST00000375267;ENST00000375217;ENST00000375226;ENST00000417040;ENST00000419533	T;T;T;T	0.35048	1.36;1.36;1.36;1.33	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	T	0.58538	0.2129	M	0.65975	2.015	0.80722	D	1	D;P	0.89917	1.0;0.956	D;D	0.85130	0.997;0.931	T	0.62267	-0.6890	10	0.87932	D	0	.	14.6112	0.68517	0.0:0.0:0.0:1.0	.	2170;2169	Q5T4S7-5;Q5T4S7	.;UBR4_HUMAN	A	2169;2169;2169;2169;879;1386	ENSP00000364403:E2169A;ENSP00000364416:E2169A;ENSP00000364365:E2169A;ENSP00000364374:E2169A	ENSP00000364365:E2169A	E	-	2	0	UBR4	19352973	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.330000	0.79181	2.243000	0.73865	0.482000	0.46254	GAG	-	NULL		0.483	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBR4	protein_coding	OTTHUMT00000007085.1	T	NM_020765		19352973	-1	no_errors	NM_020765	genbank	human	validated	54_36p	missense	SNP	1	G
IGSF9	57549	genome.wustl.edu	37	1	159900062	159900062	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr1:159900062G>A	ENST00000368094.1	-	15	2178	c.1981C>T	c.(1981-1983)Cgg>Tgg	p.R661W	IGSF9_ENST00000493195.1_5'UTR|IGSF9_ENST00000361509.3_Missense_Mutation_p.R645W	NM_001135050.1	NP_001128522.1	Q9P2J2	TUTLA_HUMAN	immunoglobulin superfamily, member 9	661	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				dendrite development (GO:0016358)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synapse (GO:0045202)		p.R645W(1)		central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(13)|lung(17)|ovary(3)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	all_hematologic(112;0.0597)	Breast(1374;0.000126)	BRCA - Breast invasive adenocarcinoma(70;0.111)			GAGCCTTGCCGGCCTTCCAAG	0.642																																																1	Substitution - Missense(1)	ovary(1)	1											80.0	87.0	84.0					1																	159900062		2203	4300	6503	158166686	SO:0001583	missense	57549			AB037776	CCDS1190.1, CCDS44254.1	1q22-q23	2013-02-11			ENSG00000085552	ENSG00000085552		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	18132	protein-coding gene	gene with protein product		609738				11991715	Standard	NM_020789		Approved	KIAA1355, Nrt1, IGSF9A	uc001fur.2	Q9P2J2	OTTHUMG00000022794	ENST00000368094.1:c.1981C>T	1.37:g.159900062G>A	ENSP00000357073:p.Arg661Trp		158166686		Missense_Mutation	SNP	-	p.R645W	ENST00000368094.1	37	c.1933	CCDS44254.1	1	.	.	.	.	.	.	.	.	.	.	G	16.21	3.058372	0.55325	.	.	ENSG00000085552	ENST00000361509;ENST00000368094	T;T	0.58652	0.32;0.32	5.15	0.754	0.18410	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.39210	N	0.001433	T	0.59582	0.2204	M	0.70595	2.14	0.35237	D	0.777449	D	0.89917	1.0	D	0.97110	1.0	T	0.61118	-0.7127	9	.	.	.	-20.5484	9.0499	0.36369	0.0:0.1344:0.451:0.4146	.	661	Q9P2J2	TUTLA_HUMAN	W	645;661	ENSP00000355049:R645W;ENSP00000357073:R661W	.	R	-	1	2	IGSF9	158166686	0.875000	0.30112	0.239000	0.24122	0.871000	0.50021	1.074000	0.30703	0.161000	0.19458	0.555000	0.69702	CGG	-	NULL		0.642	IGSF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGSF9	protein_coding	OTTHUMT00000059115.1	G	NM_020789		158166686	-1	no_errors	NM_020789	genbank	human	validated	54_36p	missense	SNP	0.8	A
KCNT2	343450	genome.wustl.edu	37	1	196367692	196367692	+	Splice_Site	SNP	C	C	T			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr1:196367692C>T	ENST00000294725.9	-	13	2210		c.e13+1		KCNT2_ENST00000367431.4_Splice_Site|KCNT2_ENST00000367433.5_Splice_Site|KCNT2_ENST00000451324.2_Splice_Site|KCNT2_ENST00000609185.1_Splice_Site|KCNT2_ENST00000498426.1_Splice_Site			Q6UVM3	KCNT2_HUMAN	potassium channel, subfamily T, member 2						potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)	p.?(1)		NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(16)|lung(43)|ovary(5)|pancreas(1)|prostate(1)|skin(11)|stomach(2)|upper_aerodigestive_tract(1)	97						TAAAAACTTACCAGCAAATTT	0.348																																																1	Unknown(1)	ovary(1)	1											49.0	50.0	50.0					1																	196367692		2201	4298	6499	194634315	SO:0001630	splice_region_variant	343450			BX647852, AY359444, AK127807	CCDS1384.1, CCDS72994.1, CCDS72995.1	1q31.3	2012-07-05			ENSG00000162687	ENSG00000162687		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18866	protein-coding gene	gene with protein product	"""sodium and chloride activated ATP sensitive potassium channel"""	610044				16382103	Standard	NM_198503		Approved	KCa4.2, SLICK, SLO2.1	uc001gtd.1	Q6UVM3	OTTHUMG00000035611	ENST00000294725.9:c.1294+1G>A	1.37:g.196367692C>T			194634315	Q3SY59|Q5VTN1|Q6ZMT3	Splice_Site	SNP	-	e13+1	ENST00000294725.9	37	c.1294+1	CCDS1384.1	1	.	.	.	.	.	.	.	.	.	.	C	26.4	4.729535	0.89390	.	.	ENSG00000162687	ENST00000367433;ENST00000367431;ENST00000535608;ENST00000451324;ENST00000294725	.	.	.	5.29	5.29	0.74685	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.8961	0.92424	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	KCNT2	194634315	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.545000	0.82128	2.629000	0.89072	0.585000	0.79938	.	-	-		0.348	KCNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNT2	protein_coding	OTTHUMT00000086418.2	C	NM_198503	Intron	194634315	-1	no_errors	NM_198503	genbank	human	validated	54_36p	splice_site	SNP	1	T
DLGAP3	58512	genome.wustl.edu	37	1	35332721	35332721	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr1:35332721G>C	ENST00000373347.1	-	11	2917	c.2649C>G	c.(2647-2649)atC>atG	p.I883M	DLGAP3_ENST00000235180.4_Missense_Mutation_p.I883M			O95886	DLGP3_HUMAN	discs, large (Drosophila) homolog-associated protein 3	883					cell-cell signaling (GO:0007267)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)	beta-amyloid binding (GO:0001540)	p.I883M(1)		central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(23)|ovary(4)|prostate(3)|skin(3)|urinary_tract(1)	46		Myeloproliferative disorder(586;0.0393)				TCACATCCTCGATGGAGAGCT	0.582											OREG0013353	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	1											110.0	113.0	112.0					1																	35332721		2203	4300	6503	35105308	SO:0001583	missense	58512			AF131778	CCDS30670.1	1p35.3-p34.1	2008-02-05			ENSG00000116544	ENSG00000116544			30368	protein-coding gene	gene with protein product		611413				8619474, 9110174	Standard	NM_001080418		Approved	SAPAP3, DAP3	uc001byc.3	O95886	OTTHUMG00000004049	ENST00000373347.1:c.2649C>G	1.37:g.35332721G>C	ENSP00000362444:p.Ile883Met	854	35105308	Q5TDD5|Q9H3X7	Missense_Mutation	SNP	-	p.I883M	ENST00000373347.1	37	c.2649	CCDS30670.1	1	.	.	.	.	.	.	.	.	.	.	G	17.75	3.467511	0.63625	.	.	ENSG00000116544	ENST00000373347;ENST00000235180;ENST00000542913	T;T	0.27104	1.69;1.69	4.91	-4.26	0.03755	.	0.104471	0.64402	D	0.000005	T	0.45756	0.1358	M	0.88775	2.98	0.48135	D	0.999598	D	0.76494	0.999	D	0.72982	0.979	T	0.49790	-0.8902	10	0.87932	D	0	-1.2981	6.4896	0.22107	0.606:0.0:0.1726:0.2215	.	883	O95886	DLGP3_HUMAN	M	883;883;221	ENSP00000362444:I883M;ENSP00000235180:I883M	ENSP00000235180:I883M	I	-	3	3	DLGAP3	35105308	0.013000	0.17824	0.967000	0.41034	0.996000	0.88848	-0.942000	0.03921	-0.695000	0.05105	-0.145000	0.13849	ATC	-	NULL		0.582	DLGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLGAP3	protein_coding	OTTHUMT00000011554.1	G	NM_021234		35105308	-1	no_errors	NM_001080418	genbank	human	provisional	54_36p	missense	SNP	0.99	C
AHCTF1	25909	genome.wustl.edu	37	1	247014367	247014367	+	Missense_Mutation	SNP	A	A	T			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr1:247014367A>T	ENST00000391829.2	-	33	5064	c.4941T>A	c.(4939-4941)agT>agA	p.S1647R	AHCTF1_ENST00000326225.3_Missense_Mutation_p.S1656R|AHCTF1_ENST00000470300.1_5'UTR|AHCTF1_ENST00000366508.1_Missense_Mutation_p.S1682R			Q8WYP5	ELYS_HUMAN	AT hook containing transcription factor 1	1647	Disordered. {ECO:0000250}.|Mediates transcriptional activity. {ECO:0000250}.|Necessary for nuclear localization. {ECO:0000250}.				cytokinesis (GO:0000910)|mitotic cell cycle (GO:0000278)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S1647R(1)		NS(1)|breast(6)|cervix(3)|endometrium(8)|kidney(6)|large_intestine(12)|liver(2)|lung(21)|ovary(5)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	74	all_cancers(71;3.05e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			ACTTTTGGTCACTAGTTACGG	0.358																																					Colon(145;197 1800 4745 15099 26333)											1	Substitution - Missense(1)	ovary(1)	1											117.0	115.0	116.0					1																	247014367		2203	4300	6503	245080990	SO:0001583	missense	25909				CCDS1629.1, CCDS1629.2	1q44	2008-09-09			ENSG00000153207	ENSG00000153207			24618	protein-coding gene	gene with protein product	"""ELYS transcription factor like protein TMBS62"""	610853				11952839	Standard	NM_015446		Approved	ELYS	uc001ibv.2	Q8WYP5	OTTHUMG00000040706	ENST00000391829.2:c.4941T>A	1.37:g.247014367A>T	ENSP00000375705:p.Ser1647Arg		245080990	A6NGM0|A8MSG9|A8MZ86|Q7Z4E3|Q8IZA4|Q96EH9|Q9Y4Q6	Missense_Mutation	SNP	-	p.S1647R	ENST00000391829.2	37	c.4941		1	.	.	.	.	.	.	.	.	.	.	A	13.20	2.166058	0.38217	.	.	ENSG00000153207	ENST00000366508;ENST00000326225;ENST00000391829	T;T;T	0.35605	1.3;1.31;1.31	5.95	2.39	0.29439	.	0.338343	0.32918	N	0.005491	T	0.49779	0.1577	M	0.64997	1.995	0.29814	N	0.831396	D;D;P	0.71674	0.998;0.96;0.933	D;P;P	0.69142	0.962;0.684;0.486	T	0.47058	-0.9146	10	0.33940	T	0.23	-5.0371	8.8218	0.35030	0.7934:0.0:0.2066:0.0	.	508;1682;1647	B3KTD2;Q8WYP5-2;Q8WYP5	.;.;ELYS_HUMAN	R	1682;1656;1647	ENSP00000355464:S1682R;ENSP00000355465:S1656R;ENSP00000375705:S1647R	ENSP00000355465:S1656R	S	-	3	2	AHCTF1	245080990	0.996000	0.38824	0.506000	0.27664	0.461000	0.32589	2.030000	0.41108	0.158000	0.19367	0.533000	0.62120	AGT	-	NULL		0.358	AHCTF1-201	KNOWN	basic|appris_candidate	protein_coding	AHCTF1	protein_coding		A	NM_015446		245080990	-1	no_errors	NM_015446	genbank	human	validated	54_36p	missense	SNP	0.86	T
KIAA1462	57608	genome.wustl.edu	37	10	30317209	30317210	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	CT	CT	CT	-	CT	CT	Unknown	Valid	Somatic	Phase_III	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr10:30317209_30317210delCT	ENST00000375377.1	-	3	1968_1969	c.1867_1868delAG	c.(1867-1869)agtfs	p.S623fs		NM_020848.2	NP_065899.1	Q9P266	JCAD_HUMAN	KIAA1462	623					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)		p.L624fs*39(1)		breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|lung(23)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	75						GCTCAGCAGACTCTGTTCTTGC	0.5																																																1	Deletion - Frameshift(1)	ovary(1)	10																																								30357216	SO:0001589	frameshift_variant	57608			AB040895	CCDS41500.1	10p12.1	2013-04-23			ENSG00000165757	ENSG00000165757			29283	protein-coding gene	gene with protein product	"""junctional protein associated with coronary artery disease"""	614398				10819331, 21884682	Standard	NM_020848		Approved	JCAD	uc001iux.3	Q9P266	OTTHUMG00000017885	ENST00000375377.1:c.1867_1868delAG	10.37:g.30317211_30317212delCT	ENSP00000364526:p.Ser623fs		30357215	Q5HYA7|Q5T992|Q86WZ9|Q9BYJ2	Frame_Shift_Del	DEL	-	p.L624fs	ENST00000375377.1	37	c.1868_1867	CCDS41500.1	10																																																																																			(deletion:cds_exon[30355038,30358801])	NULL		0.500	KIAA1462-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1462	protein_coding	OTTHUMT00000047409.1	CT	NM_020848		30357216	-1	no_errors	NM_020848	genbank	human	validated	54_36p	frame_shift_del	DEL	1.000:1.000	-
ZNF32	7580	genome.wustl.edu	37	10	44140100	44140100	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr10:44140100G>T	ENST00000395797.1	-	3	408	c.220C>A	c.(220-222)Caa>Aaa	p.Q74K	ZNF32_ENST00000485351.1_5'UTR|ZNF32-AS3_ENST00000458063.1_RNA|ZNF32-AS2_ENST00000418966.1_RNA|ZNF32-AS1_ENST00000453284.1_RNA|ZNF32_ENST00000374433.2_Missense_Mutation_p.Q74K	NM_001005368.1	NP_001005368.1	P17041	ZNF32_HUMAN	zinc finger protein 32	74					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Q74K(1)		NS(1)|endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(2)|ovary(1)|pancreas(1)|urinary_tract(1)	14		all_neural(218;0.0182)|Ovarian(717;0.0443)|Renal(717;0.157)		Lung(62;0.179)		TAGACCCTTTGTCTCACTCCA	0.443																																																1	Substitution - Missense(1)	ovary(1)	10											140.0	138.0	138.0					10																	44140100		2203	4300	6503	43460106	SO:0001583	missense	7580			U69645	CCDS7206.1	10q22-q25	2013-01-08	2006-05-11		ENSG00000169740	ENSG00000169740		"""Zinc fingers, C2H2-type"""	13095	protein-coding gene	gene with protein product		194539	"""zinc finger protein 32 (KOX 30)"""				Standard	XM_005271822		Approved	KOX30	uc001jbc.3	P17041	OTTHUMG00000018043	ENST00000395797.1:c.220C>A	10.37:g.44140100G>T	ENSP00000379143:p.Gln74Lys		43460106	Q92951	Missense_Mutation	SNP	-	p.Q74K	ENST00000395797.1	37	c.220	CCDS7206.1	10	.	.	.	.	.	.	.	.	.	.	G	9.875	1.199912	0.22121	.	.	ENSG00000169740	ENST00000374433;ENST00000395797	T;T	0.04194	3.68;3.68	4.52	4.52	0.55395	.	0.163795	0.29266	N	0.012650	T	0.03263	0.0095	N	0.08118	0	0.32468	N	0.543253	B	0.28933	0.228	B	0.27608	0.081	T	0.17319	-1.0373	10	0.59425	D	0.04	-13.0695	13.0593	0.58997	0.0:0.0:1.0:0.0	.	74	P17041	ZNF32_HUMAN	K	74	ENSP00000363556:Q74K;ENSP00000379143:Q74K	ENSP00000363556:Q74K	Q	-	1	0	ZNF32	43460106	1.000000	0.71417	1.000000	0.80357	0.505000	0.33919	3.388000	0.52509	2.796000	0.96246	0.655000	0.94253	CAA	-	NULL		0.443	ZNF32-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF32	protein_coding	OTTHUMT00000047723.1	G	NM_006973		43460106	-1	no_errors	NM_001005368	genbank	human	validated	54_36p	missense	SNP	1	T
TUBB8	347688	genome.wustl.edu	37	10	93295	93295	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr10:93295G>C	ENST00000309812.4	-	4	1099	c.1037C>G	c.(1036-1038)cCc>cGc	p.P346R	TUBB8_ENST00000447903.2_Missense_Mutation_p.P274R|TUBB8_ENST00000413237.3_5'Flank	NM_177987.2	NP_817124.1	Q3ZCM7	TBB8_HUMAN	tubulin, beta 8 class VIII	346					microtubule-based process (GO:0007017)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)	p.P346R(1)		NS(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(12)|ovary(2)|prostate(3)|skin(3)|stomach(1)	32		all_cancers(4;0.00131)|all_lung(4;0.000777)|Lung NSC(4;0.0043)|all_epithelial(10;0.0154)|Colorectal(49;0.235)		Epithelial(11;0.00341)|all cancers(11;0.00922)|OV - Ovarian serous cystadenocarcinoma(14;0.0508)|Lung(33;0.132)		TACGTTGTTGGGGAGCCAGTC	0.502																																					Pancreas(192;2041 3010 9013 18103)											1	Substitution - Missense(1)	ovary(1)	10											93.0	102.0	99.0					10																	93295		2203	4300	6503	83295	SO:0001583	missense	347688			AF355127	CCDS7051.1	10p15.3	2014-05-06			ENSG00000173876			"""Tubulins"""	20773	protein-coding gene	gene with protein product	"""class VIII beta-tubulin"""						Standard	NM_177987		Approved	bA631M21.2	uc001ifi.2	Q3ZCM7	OTTHUMG00000174803	ENST00000309812.4:c.1037C>G	10.37:g.93295G>C	ENSP00000311042:p.Pro346Arg		83295	Q5SQX9|Q8WZ78	Missense_Mutation	SNP	-	p.P346R	ENST00000309812.4	37	c.1037	CCDS7051.1	10	.	.	.	.	.	.	.	.	.	.	G	9.208	1.030115	0.19512	.	.	ENSG00000173876	ENST00000447903;ENST00000272035;ENST00000440680;ENST00000328974	D	0.90133	-2.62	.	.	.	Tubulin/FtsZ, 2-layer sandwich domain (3);Tubulin/FtsZ, C-terminal (1);	0.000000	0.64402	U	0.000017	D	0.97031	0.9030	H	0.99916	4.945	0.39056	D	0.960423	D;D	0.89917	0.999;1.0	D;D	0.97110	0.997;1.0	D	0.93478	0.6825	9	0.87932	D	0	.	5.9051	0.18992	8.0E-4:0.0:0.9992:0.0	.	309;346	C9JAA5;Q3ZCM7	.;TBB8_HUMAN	R	274;312;309;346	ENSP00000403895:P274R	ENSP00000272035:P312R	P	-	2	0	RP11-631M21.2	83295	1.000000	0.71417	0.123000	0.21794	0.124000	0.20399	6.543000	0.73874	0.119000	0.18210	0.121000	0.15741	CCC	-	NULL		0.502	TUBB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBB8	protein_coding	OTTHUMT00000467795.1	G	NM_177987		83295	-1	no_errors	NM_177987	genbank	human	provisional	54_36p	missense	SNP	1	C
ZMIZ1	57178	genome.wustl.edu	37	10	81064923	81064923	+	Nonsense_Mutation	SNP	C	C	A			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr10:81064923C>A	ENST00000334512.5	+	20	2861	c.2289C>A	c.(2287-2289)tgC>tgA	p.C763*	ZMIZ1_ENST00000446377.2_5'Flank	NM_020338.3	NP_065071.1	Q9ULJ6	ZMIZ1_HUMAN	zinc finger, MIZ-type containing 1	763					artery morphogenesis (GO:0048844)|cell aging (GO:0007569)|developmental growth (GO:0048589)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)|vitellogenesis (GO:0007296)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)	p.C763*(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(14)|ovary(2)|prostate(3)|skin(1)	30	all_cancers(46;0.0292)|Breast(12;8.52e-05)|all_epithelial(25;0.000854)|Prostate(51;0.00985)		Epithelial(14;0.00256)|all cancers(16;0.00726)|Colorectal(32;0.229)			GTCTGCAGTGCTTTGATCTGG	0.562																																																1	Substitution - Nonsense(1)	ovary(1)	10											109.0	91.0	97.0					10																	81064923		2203	4300	6503	80734929	SO:0001587	stop_gained	57178			AB033050	CCDS7357.1	10q22.3	2012-11-30	2006-10-24	2006-10-24	ENSG00000108175	ENSG00000108175		"""Zinc fingers, MIZ-type"""	16493	protein-coding gene	gene with protein product		607159	"""retinoic acid induced 17"""	RAI17		15626329	Standard	NM_020338		Approved	RP11-519K18.1, KIAA1224, FLJ13541, hZIMP10, Zimp10, MIZ	uc001kaf.2	Q9ULJ6	OTTHUMG00000018560	ENST00000334512.5:c.2289C>A	10.37:g.81064923C>A	ENSP00000334474:p.Cys763*		80734929	Q5JSH9|Q7Z7E6	Nonsense_Mutation	SNP	HMMPfam_zf-MIZ;superfamily_RING/U-box	p.C763*	ENST00000334512.5	37	c.2289	CCDS7357.1	10	.	.	.	.	.	.	.	.	.	.	C	44	10.884706	0.99483	.	.	ENSG00000108175	ENST00000334512;ENST00000360331;ENST00000372347	.	.	.	5.27	4.17	0.49024	.	0.000000	0.46145	D	0.000320	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-14.0627	9.7167	0.40278	0.0:0.7825:0.0:0.2175	.	.	.	.	X	763;693;667	.	ENSP00000334474:C763X	C	+	3	2	ZMIZ1	80734929	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	1.478000	0.35442	2.475000	0.83589	0.591000	0.81541	TGC	-	HMMPfam_zf-MIZ		0.562	ZMIZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZMIZ1	protein_coding	OTTHUMT00000048944.2	C	NM_020338		80734929	1	no_errors	NM_020338	genbank	human	validated	54_36p	nonsense	SNP	1	A
YAP1	10413	genome.wustl.edu	37	11	102100666	102100666	+	Missense_Mutation	SNP	T	T	A			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr11:102100666T>A	ENST00000282441.5	+	9	1898	c.1510T>A	c.(1510-1512)Tta>Ata	p.L504I	YAP1_ENST00000528834.1_3'UTR|YAP1_ENST00000537274.1_Missense_Mutation_p.L492I|YAP1_ENST00000345877.2_Missense_Mutation_p.L454I|YAP1_ENST00000526343.1_Missense_Mutation_p.L450I|YAP1_ENST00000531439.1_Missense_Mutation_p.L488I|YAP1_ENST00000524575.1_Missense_Mutation_p.L326I|RP11-864G5.3_ENST00000526310.1_RNA	NM_001130145.2|NM_001282101.1	NP_001123617.1|NP_001269030.1	P46937	YAP1_HUMAN	Yes-associated protein 1	504	Transactivation domain.				cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|contact inhibition (GO:0060242)|embryonic heart tube morphogenesis (GO:0003143)|gene expression (GO:0010467)|hippo signaling (GO:0035329)|keratinocyte differentiation (GO:0030216)|lateral mesoderm development (GO:0048368)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|notochord development (GO:0030903)|paraxial mesoderm development (GO:0048339)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell proliferation (GO:0008284)|positive regulation of organ growth (GO:0046622)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of keratinocyte proliferation (GO:0010837)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)|regulation of stem cell proliferation (GO:0072091)|somatic stem cell maintenance (GO:0035019)|transcription initiation from RNA polymerase II promoter (GO:0006367)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)	p.L454I(1)		central_nervous_system(1)|large_intestine(1)|lung(1)|ovary(1)	4	all_cancers(8;0.000575)|all_epithelial(12;0.00564)	Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.00936)	Lung(13;0.245)	BRCA - Breast invasive adenocarcinoma(274;0.0189)		TCTTACATGGTTATAGAGCCC	0.433																																					Colon(50;247 1103 7861 28956)											1	Substitution - Missense(1)	ovary(1)	11											94.0	99.0	97.0					11																	102100666		2203	4299	6502	101605876	SO:0001583	missense	10413				CCDS8314.1, CCDS44716.1, CCDS8314.2, CCDS53699.1, CCDS53700.1, CCDS60944.1, CCDS73373.1, CCDS73374.1	11q13	2010-03-19	2010-03-19		ENSG00000137693	ENSG00000137693			16262	protein-coding gene	gene with protein product		606608	"""Yes-associated protein 1, 65kDa"""			7782338	Standard	NM_001130145		Approved	YAP65	uc001pgt.3	P46937	OTTHUMG00000167322	ENST00000282441.5:c.1510T>A	11.37:g.102100666T>A	ENSP00000282441:p.Leu504Ile		101605876	B4DTY1|B7ZA01|E3WEB5|E3WEB6|E9PRV2|F5H202|K0KQ18|K0KYZ8|K0L195|K0L1G3|Q7Z574|Q8IUY9	Missense_Mutation	SNP	HMMPfam_WW,superfamily_WW domain	p.L454I	ENST00000282441.5	37	c.1360	CCDS44716.1	11	.	.	.	.	.	.	.	.	.	.	T	21.1	4.096689	0.76870	.	.	ENSG00000137693	ENST00000526343;ENST00000282441;ENST00000537274;ENST00000345877;ENST00000445250;ENST00000531439;ENST00000524575	T;T;T	0.67523	-0.27;-0.24;-0.12	6.17	3.87	0.44632	.	0.000000	0.85682	D	0.000000	T	0.67878	0.2940	N	0.24115	0.695	0.58432	D	0.999996	P;D;D;D;D;D	0.89917	0.956;0.999;0.997;1.0;0.998;0.998	D;D;D;D;D;D	0.91635	0.931;0.995;0.978;0.999;0.984;0.99	T	0.63274	-0.6674	10	0.30854	T	0.27	.	10.6706	0.45755	0.0:0.1283:0.0:0.8717	.	326;421;450;488;504;454	B4DTY1;F5GWC5;E9PRV2;P46937-2;P46937;P46937-3	.;.;.;.;YAP1_HUMAN;.	I	450;504;492;454;421;488;326	ENSP00000434134:L450I;ENSP00000331023:L454I;ENSP00000435602:L326I	ENSP00000282441:L504I	L	+	1	2	YAP1	101605876	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.956000	0.40382	0.567000	0.29293	0.533000	0.62120	TTA	-	NULL		0.433	YAP1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	YAP1	protein_coding	OTTHUMT00000394151.1	T	NM_006106		101605876	1	no_errors	NM_006106	genbank	human	reviewed	54_36p	missense	SNP	1	A
NUP160	23279	genome.wustl.edu	37	11	47830021	47830021	+	Missense_Mutation	SNP	G	G	A	rs577593068		TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr11:47830021G>A	ENST00000378460.2	-	18	2348	c.2302C>T	c.(2302-2304)Ccc>Tcc	p.P768S	NUP160_ENST00000528071.1_Missense_Mutation_p.P654S|NUP160_ENST00000530326.1_Missense_Mutation_p.P654S	NM_015231.1	NP_056046.1	Q12769	NU160_HUMAN	nucleoporin 160kDa	768					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)|nuclear pore outer ring (GO:0031080)	nucleocytoplasmic transporter activity (GO:0005487)	p.P768S(1)		NS(1)|biliary_tract(2)|breast(7)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(15)|ovary(6)|prostate(2)|skin(2)|urinary_tract(2)	53						AAGAGTAGGGGAGCTGTTCGA	0.413																																																1	Substitution - Missense(1)	ovary(1)	11											112.0	97.0	102.0					11																	47830021		2201	4298	6499	47786597	SO:0001583	missense	23279			D83781	CCDS31484.1	11p11.12	2008-07-21	2002-08-29		ENSG00000030066	ENSG00000030066			18017	protein-coding gene	gene with protein product		607614	"""nucleoporin 160kD"""			11684705	Standard	NM_015231		Approved	KIAA0197, FLJ22583	uc001ngm.3	Q12769	OTTHUMG00000166534	ENST00000378460.2:c.2302C>T	11.37:g.47830021G>A	ENSP00000367721:p.Pro768Ser		47786597	B4DYE8|B4E2J9|Q08AD3|Q7Z5X6|Q96GB3|Q9H660	Missense_Mutation	SNP	superfamily_TPR-like	p.P768S	ENST00000378460.2	37	c.2302	CCDS31484.1	11	.	.	.	.	.	.	.	.	.	.	G	16.54	3.151543	0.57151	.	.	ENSG00000030066	ENST00000378460;ENST00000530326;ENST00000528071	T;T;T	0.40225	1.61;1.04;1.04	6.02	6.02	0.97574	.	0.302747	0.36374	N	0.002621	T	0.31575	0.0801	L	0.27053	0.805	0.80722	D	1	B	0.31435	0.323	B	0.27380	0.079	T	0.10567	-1.0624	10	0.09843	T	0.71	.	20.5373	0.99239	0.0:0.0:1.0:0.0	.	768	Q12769	NU160_HUMAN	S	768;654;654	ENSP00000367721:P768S;ENSP00000433590:P654S;ENSP00000432367:P654S	ENSP00000367721:P768S	P	-	1	0	NUP160	47786597	1.000000	0.71417	0.989000	0.46669	0.996000	0.88848	5.384000	0.66225	2.857000	0.98124	0.650000	0.86243	CCC	-	NULL		0.413	NUP160-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP160	protein_coding	OTTHUMT00000390239.2	G	NM_015231		47786597	-1	no_errors	NM_015231	genbank	human	validated	54_36p	missense	SNP	0.98	A
CCDC87	55231	genome.wustl.edu	37	11	66360237	66360237	+	Missense_Mutation	SNP	T	T	A			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr11:66360237T>A	ENST00000333861.3	-	1	317	c.250A>T	c.(250-252)Atc>Ttc	p.I84F	CCS_ENST00000310190.4_5'Flank|CCS_ENST00000533244.1_5'Flank	NM_018219.2	NP_060689.2	Q9NVE4	CCD87_HUMAN	coiled-coil domain containing 87	84					cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)			p.I84F(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	28						ATGACCTTGATGAGACGTAGT	0.647											OREG0021111	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	11											37.0	38.0	38.0					11																	66360237		2200	4295	6495	66116813	SO:0001583	missense	55231			BC034469	CCDS8145.1	11q13.2	2006-03-15			ENSG00000182791	ENSG00000182791			25579	protein-coding gene	gene with protein product						12477932	Standard	NM_018219		Approved	FLJ10786	uc001oiq.4	Q9NVE4	OTTHUMG00000167237	ENST00000333861.3:c.250A>T	11.37:g.66360237T>A	ENSP00000328487:p.Ile84Phe	1091	66116813	Q8NE76	Missense_Mutation	SNP	-	p.I84F	ENST00000333861.3	37	c.250	CCDS8145.1	11	.	.	.	.	.	.	.	.	.	.	T	12.81	2.048588	0.36181	.	.	ENSG00000182791	ENST00000333861	T	0.30182	1.54	5.39	3.01	0.34805	.	0.813328	0.10027	N	0.725253	T	0.17916	0.0430	N	0.22421	0.69	0.09310	N	0.999999	P	0.39964	0.697	B	0.35353	0.201	T	0.13575	-1.0504	10	0.56958	D	0.05	-0.3396	4.3894	0.11332	0.0:0.1038:0.2042:0.692	.	84	Q9NVE4	CCD87_HUMAN	F	84	ENSP00000328487:I84F	ENSP00000328487:I84F	I	-	1	0	CCDC87	66116813	0.616000	0.27035	0.333000	0.25482	0.400000	0.30750	0.656000	0.24948	1.037000	0.40024	0.533000	0.62120	ATC	-	NULL		0.647	CCDC87-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC87	protein_coding	OTTHUMT00000393825.1	T	NM_018219		66116813	-1	no_errors	NM_018219	genbank	human	validated	54_36p	missense	SNP	0.03	A
PHLDB1	23187	genome.wustl.edu	37	11	118501932	118501933	+	Missense_Mutation	DNP	GC	GC	CT			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	GC	GC					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr11:118501932_118501933GC>CT	ENST00000361417.2	+	8	2247_2248	c.1836_1837GC>CT	c.(1834-1839)caGCgc>caCTgc	p.612_613QR>HC	PHLDB1_ENST00000534672.1_3'UTR|PHLDB1_ENST00000356063.5_Missense_Mutation_p.612_613QR>HC	NM_015157.3	NP_055972.1	Q86UU1	PHLB1_HUMAN	pleckstrin homology-like domain, family B, member 1	612								p.Q612_R613>HC(1)		breast(3)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(10)|liver(3)|lung(14)|ovary(2)|pancreas(1)|prostate(3)|skin(1)	46	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_hematologic(192;0.0735)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)		AGGAACGCCAGCGCCTGGAGAC	0.624																																																1	Complex - compound substitution(1)	ovary(1)	11																																								118007143	SO:0001583	missense	23187				CCDS8401.1, CCDS44750.1	11q23.3	2013-01-10			ENSG00000019144	ENSG00000019144		"""Pleckstrin homology (PH) domain containing"""	23697	protein-coding gene	gene with protein product		612834				14532993	Standard	NM_015157		Approved	FLJ00141, LL5a, KIAA0638	uc001pts.3	Q86UU1	OTTHUMG00000166341	Exception_encountered	11.37:g.118501932_118501933delinsCT	ENSP00000354498:p.Q612_R613delinsHC		118007142	B0YJ63|B0YJ64|O75133|Q4KMF8|Q8TEQ2	Missense_Mutation	DNP	-	p.QR612HC	ENST00000361417.2	37	c.1836_1837	CCDS8401.1	11																																																																																			-	NULL		0.624	PHLDB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHLDB1	protein_coding	OTTHUMT00000389279.1	GC	NM_015157		118007143	1	no_errors	NM_015157	genbank	human	validated	54_36p	missense	DNP	1.000:1.000	CT
OAS1	4938	genome.wustl.edu	37	12	113348909	113348909	+	Missense_Mutation	SNP	G	G	A	rs148820389		TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr12:113348909G>A	ENST00000202917.5	+	3	786	c.523G>A	c.(523-525)Gag>Aag	p.E175K	RP1-71H24.1_ENST00000552784.1_RNA|OAS1_ENST00000452357.2_Missense_Mutation_p.E175K|OAS1_ENST00000551241.1_Missense_Mutation_p.E175K|OAS1_ENST00000445409.2_Missense_Mutation_p.E175K	NM_016816.2	NP_058132.2	P00973	OAS1_HUMAN	2'-5'-oligoadenylate synthetase 1, 40/46kDa	175					cellular response to interferon-alpha (GO:0035457)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of viral genome replication (GO:0045071)|protein oligomerization (GO:0051259)|purine nucleotide biosynthetic process (GO:0006164)|regulation of ribonuclease activity (GO:0060700)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	2'-5'-oligoadenylate synthetase activity (GO:0001730)|ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)|zinc ion binding (GO:0008270)	p.E175K(1)		cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|liver(2)|lung(4)|ovary(2)|skin(1)	16						CAAGCTCATCGAGGAGTGCAC	0.512																																																1	Substitution - Missense(1)	ovary(1)	12						G	LYS/GLU,LYS/GLU,LYS/GLU	0,4406		0,0,2203	102.0	89.0	94.0		523,523,523	-8.6	0.0	12	dbSNP_134	94	2,8598	2.2+/-6.3	0,2,4298	no	missense,missense,missense	OAS1	NM_001032409.1,NM_002534.2,NM_016816.2	56,56,56	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	benign,benign,benign	175/415,175/365,175/401	113348909	2,13004	2203	4300	6503	111833292	SO:0001583	missense	4938			X04371	CCDS31905.1, CCDS41838.1, CCDS44980.1	12q24.2	2014-05-21	2011-07-21				2.7.7.-		8086	protein-coding gene	gene with protein product		164350	"""2',5'-oligoadenylate synthetase 1 (40-46 kD)"""	OIAS		9344649, 9325053	Standard	XM_006719434		Approved	OIASI, IFI-4	uc001tud.3	P00973		ENST00000202917.5:c.523G>A	12.37:g.113348909G>A	ENSP00000202917:p.Glu175Lys		111833292	A8K4N8|P04820|P29080|P29081|P78485|P78486|Q16700|Q16701|Q1PG42|Q3ZM01|Q53GC5|Q53YA4|Q6A1Z3|Q6IPC6|Q6P7N9|Q96J61	Missense_Mutation	SNP	superfamily_Nucleotidyltransferase;superfamily_PAP/OAS1 substrate-binding domain	p.E175K	ENST00000202917.5	37	c.523	CCDS41838.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	2.042|2.042	-0.419783|-0.419783	0.04734|0.04734	0.0|0.0	2.33E-4|2.33E-4	ENSG00000089127|ENSG00000089127	ENST00000202917;ENST00000445409;ENST00000452357;ENST00000551241;ENST00000377508;ENST00000550689|ENST00000549820	T;T;T;T;T|.	0.06449|.	3.3;3.3;3.3;3.3;3.3|.	4.31|4.31	-8.63|-8.63	0.00878|0.00878	-oligoadenylate synthetase 1, domain 2/C-terminal (2);-5&apos (2);2&apos (2);|.	5.377260|.	0.00508|.	N|.	0.000166|.	T|T	0.09949|0.09949	0.0244|0.0244	N|N	0.03983|0.03983	-0.305|-0.305	0.09310|0.09310	N|N	1|1	B;B;B;B;B|P	0.10296|0.34587	0.0;0.001;0.0;0.003;0.001|0.458	B;B;B;B;B|B	0.08055|0.31245	0.001;0.001;0.002;0.003;0.001|0.126	T|T	0.45469|0.45469	-0.9259|-0.9259	10|8	0.20519|0.87932	T|D	0.43|0	3.8379|3.8379	5.0312|5.0312	0.14411|0.14411	0.5684:0.0952:0.2104:0.126|0.5684:0.0952:0.2104:0.126	.|.	175;175;175;175;175|159	E7EMI9;F8VXY3;P00973;P00973-3;P00973-2|B4DWE7	.;.;OAS1_HUMAN;.;.|.	K|Q	175;175;175;175;175;171|159	ENSP00000202917:E175K;ENSP00000388001:E175K;ENSP00000415721:E175K;ENSP00000448790:E175K;ENSP00000448348:E171K|.	ENSP00000202917:E175K|ENSP00000449348:R159Q	E|R	+|+	1|2	0|0	OAS1|OAS1	111833292|111833292	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.002000|0.002000	0.02628|0.02628	-6.883000|-6.883000	0.00050|0.00050	-4.590000|-4.590000	0.00041|0.00041	-3.586000|-3.586000	0.00029|0.00029	GAG|CGA	-	NULL		0.512	OAS1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	OAS1	protein_coding	OTTHUMT00000405896.2	G			111833292	1	no_errors	NM_001032409	genbank	human	reviewed	54_36p	missense	SNP		A
ANKRD33	341405	genome.wustl.edu	37	12	52284732	52284732	+	Silent	SNP	G	G	A			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr12:52284732G>A	ENST00000340970.4	+	5	998	c.627G>A	c.(625-627)tcG>tcA	p.S209S	ANKRD33_ENST00000538991.1_Silent_p.S140S|ANKRD33_ENST00000301190.6_Silent_p.S334S|ANKRD33_ENST00000547119.1_3'UTR			Q7Z3H0	ANR33_HUMAN	ankyrin repeat domain 33	209					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|skeletal muscle cell differentiation (GO:0035914)	cytosol (GO:0005829)|nucleus (GO:0005634)		p.S334S(1)		endometrium(2)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|skin(1)|urinary_tract(1)	22				BRCA - Breast invasive adenocarcinoma(357;0.0969)		ATCCACCTTCGCTGGGCACCC	0.662																																																1	Substitution - coding silent(1)	ovary(1)	12											50.0	34.0	39.0					12																	52284732		2203	4299	6502	50570999	SO:0001819	synonymous_variant	341405				CCDS8815.1, CCDS44892.1	12q13.13	2013-01-10	2005-01-07	2005-01-07		ENSG00000167612		"""Ankyrin repeat domain containing"""	13788	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 7"""	C12orf7		20026326	Standard	NM_182608		Approved	DKFZp686O1689, PANKY	uc001rzd.3	Q7Z3H0	OTTHUMG00000169506	ENST00000340970.4:c.627G>A	12.37:g.52284732G>A			50570999	Q0VAA7|Q5K619|Q5K621|Q5K622|Q5K623|Q5K624|Q6ZUN0	Silent	SNP	-	p.S334	ENST00000340970.4	37	c.1002	CCDS44892.1	12																																																																																			-	NULL		0.662	ANKRD33-005	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD33	protein_coding	OTTHUMT00000404515.1	G	NM_182608		50570999	1	no_errors	NM_182608	genbank	human	validated	54_36p	silent	SNP	0	A
NACA	4666	genome.wustl.edu	37	12	57106972	57106972	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr12:57106972G>C	ENST00000454682.1	-	7	6254	c.5973C>G	c.(5971-5973)atC>atG	p.I1991M	NACA_ENST00000550952.1_Missense_Mutation_p.I838M|NACA_ENST00000393891.4_Missense_Mutation_p.I128M|NACA_ENST00000548563.1_Missense_Mutation_p.I49M|NACA_ENST00000356769.3_Missense_Mutation_p.I128M|NACA_ENST00000546392.1_Missense_Mutation_p.I128M|NACA_ENST00000552540.1_Missense_Mutation_p.I128M|NACA_ENST00000551793.1_5'Flank	NM_001113203.2	NP_001106674.2	E9PAV3	NACAM_HUMAN	nascent polypeptide-associated complex alpha subunit	1991	NAC-A/B. {ECO:0000255|PROSITE- ProRule:PRU00507}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.I128M(1)		breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|ovary(2)|upper_aerodigestive_tract(1)	10						ATAAATCTTCGATCTACAGGG	0.383			T	BCL6	NHL																																		Dom	yes		12	12q23-q24.1	4666	nascent-polypeptide-associated complex alpha polypeptide		L	1	Substitution - Missense(1)	ovary(1)	12											51.0	47.0	48.0					12																	57106972		2203	4300	6503	55393239	SO:0001583	missense	4666			X80909	CCDS31837.1, CCDS44925.1, CCDS44925.2	12q23-q24.1	2008-09-05	2007-04-20		ENSG00000196531	ENSG00000196531			7629	protein-coding gene	gene with protein product		601234	"""nascent-polypeptide-associated complex alpha polypeptide"""			8047162	Standard	NM_001113202		Approved	NACA1	uc001sma.2	E9PAV3		ENST00000454682.1:c.5973C>G	12.37:g.57106972G>C	ENSP00000403817:p.Ile1991Met		55393239		Missense_Mutation	SNP	HMMPfam_UBA;HMMPfam_NAC	p.I128M	ENST00000454682.1	37	c.384		12	.	.	.	.	.	.	.	.	.	.	G	15.88	2.964661	0.53507	.	.	ENSG00000196531	ENST00000550920;ENST00000454682;ENST00000550952;ENST00000356769;ENST00000552540;ENST00000393891;ENST00000548563;ENST00000546392;ENST00000549259;ENST00000552055;ENST00000546862	T;T;T;T;T;T;T;T;T	0.56103	0.69;0.56;0.48;0.69;0.69;0.69;0.69;0.69;0.65	5.31	-9.06	0.00727	Nascent polypeptide-associated complex NAC (2);	0.000000	0.85682	D	0.000000	T	0.63141	0.2486	M	0.83118	2.625	0.51012	D	0.999903	P;D;B	0.54964	0.953;0.969;0.093	D;D;B	0.64776	0.929;0.912;0.162	T	0.76121	-0.3075	10	0.62326	D	0.03	.	11.5927	0.50955	0.7838:0.0:0.1336:0.0826	.	1991;838;128	E9PAV3;F8VU71;Q13765	.;.;NACA_HUMAN	M	126;1991;838;128;128;128;49;128;128;124;49	ENSP00000448039:I126M;ENSP00000403817:I1991M;ENSP00000448035:I838M;ENSP00000349212:I128M;ENSP00000447821:I128M;ENSP00000377469:I128M;ENSP00000446801:I128M;ENSP00000447133:I128M;ENSP00000450383:I124M	ENSP00000349212:I128M	I	-	3	3	NACA	55393239	0.072000	0.21174	0.833000	0.33012	0.316000	0.28119	-0.544000	0.06077	-1.273000	0.02424	-0.259000	0.10710	ATC	-	HMMPfam_NAC		0.383	NACA-201	KNOWN	basic	protein_coding	NACA	protein_coding		G	NM_005594		55393239	-1	no_errors	NM_005594	genbank	human	validated	54_36p	missense	SNP	0.86	C
GLI1	2735	genome.wustl.edu	37	12	57864419	57864419	+	Missense_Mutation	SNP	T	T	A	rs140787723	byFrequency	TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr12:57864419T>A	ENST00000228682.2	+	12	1987	c.1896T>A	c.(1894-1896)aaT>aaA	p.N632K	GLI1_ENST00000546141.1_Missense_Mutation_p.N591K|GLI1_ENST00000543426.1_Missense_Mutation_p.N504K	NM_005269.2	NP_005260.1	P08151	GLI1_HUMAN	GLI family zinc finger 1	632					cerebellar cortex morphogenesis (GO:0021696)|digestive tract morphogenesis (GO:0048546)|dorsal/ventral pattern formation (GO:0009953)|epidermal cell differentiation (GO:0009913)|lung development (GO:0030324)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|notochord regression (GO:0060032)|osteoblast differentiation (GO:0001649)|pituitary gland development (GO:0021983)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA replication (GO:0045740)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proximal/distal pattern formation (GO:0009954)|regulation of smoothened signaling pathway (GO:0008589)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in regulation of cerebellar granule cell precursor cell proliferation (GO:0021938)|spermatogenesis (GO:0007283)|ventral midline development (GO:0007418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|primary cilium (GO:0072372)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|transcription regulatory region DNA binding (GO:0044212)	p.N632K(1)		NS(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(8)|lung(22)|ovary(6)|pancreas(2)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69			GBM - Glioblastoma multiforme(3;3.99e-32)			ACAACCCCAATGCAGGGGTCA	0.617																																					Pancreas(157;841 1936 10503 41495 50368)											1	Substitution - Missense(1)	ovary(1)	12											42.0	43.0	43.0					12																	57864419		2203	4300	6503	56150686	SO:0001583	missense	2735				CCDS8940.1, CCDS53806.1, CCDS53807.1	12q13.2-q13.3	2013-01-25	2009-03-05	2005-01-14		ENSG00000111087		"""Zinc fingers, C2H2-type"""	4317	protein-coding gene	gene with protein product		165220	"""glioma-associated oncogene homolog 1 (zinc finger protein)"", ""glioma-associated oncogene family zinc finger 1"""	GLI		2850480	Standard	NM_005269		Approved		uc001snx.3	P08151		ENST00000228682.2:c.1896T>A	12.37:g.57864419T>A	ENSP00000228682:p.Asn632Lys		56150686	D0EUY3|E9PQQ9|F5H6H8|Q8TDN9	Missense_Mutation	SNP	zf-C2H2;HMMPfam_zf-C2H2;C2H2 and C2HC zinc fingers;superfamily_C2H2 and C2HC zinc fingers	p.N632K	ENST00000228682.2	37	c.1896	CCDS8940.1	12	.	.	.	.	.	.	.	.	.	.	T	12.01	1.809588	0.31961	.	.	ENSG00000111087	ENST00000543426;ENST00000228682;ENST00000546141;ENST00000528467	T;T;T;T	0.12361	2.78;2.69;2.77;2.77	4.39	2.01	0.26516	.	0.132195	0.34725	N	0.003722	T	0.04543	0.0124	N	0.14661	0.345	0.35482	D	0.798213	P	0.48764	0.915	B	0.31946	0.138	T	0.47774	-0.9091	10	0.33940	T	0.23	.	3.2479	0.06803	0.1709:0.2824:0.0:0.5467	.	632	P08151	GLI1_HUMAN	K	504;632;591;591	ENSP00000437607:N504K;ENSP00000228682:N632K;ENSP00000441006:N591K;ENSP00000434408:N591K	ENSP00000228682:N632K	N	+	3	2	GLI1	56150686	0.005000	0.15991	0.998000	0.56505	0.967000	0.64934	-1.009000	0.03660	0.319000	0.23209	0.402000	0.26972	AAT	-	NULL		0.617	GLI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLI1	protein_coding	OTTHUMT00000394197.1	T	NM_005269		56150686	1	no_errors	NM_005269	genbank	human	reviewed	54_36p	missense	SNP	0.78	A
MGAT4C	25834	genome.wustl.edu	37	12	86373591	86373591	+	Missense_Mutation	SNP	T	T	C			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr12:86373591T>C	ENST00000604798.1	-	8	2117	c.913A>G	c.(913-915)Aaa>Gaa	p.K305E	MGAT4C_ENST00000548651.1_Missense_Mutation_p.K305E|MGAT4C_ENST00000549405.2_Missense_Mutation_p.K305E|MGAT4C_ENST00000552808.2_Missense_Mutation_p.K305E|MGAT4C_ENST00000552435.2_Intron|MGAT4C_ENST00000332156.1_Missense_Mutation_p.K305E|MGAT4C_ENST00000393205.2_Missense_Mutation_p.K334E			Q9UBM8	MGT4C_HUMAN	MGAT4 family, member C	305					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity (GO:0008454)|metal ion binding (GO:0046872)	p.K305E(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(17)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	41						AGAGATGGTTTAAAACGGATC	0.378																																																1	Substitution - Missense(1)	ovary(1)	12											83.0	80.0	81.0					12																	86373591		2203	4300	6503	84897722	SO:0001583	missense	25834				CCDS9030.1	12q21	2014-07-14	2014-07-14		ENSG00000182050	ENSG00000182050		"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	30871	protein-coding gene	gene with protein product		607385	"""mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme C (putative)"""			10570912	Standard	NM_013244		Approved	HGNT-IV-H	uc001tal.4	Q9UBM8	OTTHUMG00000169846	ENST00000604798.1:c.913A>G	12.37:g.86373591T>C	ENSP00000474896:p.Lys305Glu		84897722	B4DRH2|Q4G199|Q9UIU5	Missense_Mutation	SNP	HMMPfam_Glyco_transf_54;superfamily_Sm-like ribonucleoproteins	p.K305E	ENST00000604798.1	37	c.913	CCDS9030.1	12	.	.	.	.	.	.	.	.	.	.	T	10.08	1.253576	0.22965	.	.	ENSG00000182050	ENST00000332156;ENST00000393205;ENST00000549405;ENST00000550460;ENST00000552808;ENST00000548651;ENST00000547225	T;T;T;T;T;T	0.51071	0.72;0.72;0.72;0.72;0.72;0.72	5.75	4.6	0.57074	.	0.104283	0.64402	D	0.000006	T	0.57961	0.2089	M	0.83774	2.66	0.43771	D	0.996296	P;P	0.48640	0.913;0.855	P;P	0.48334	0.574;0.574	T	0.60632	-0.7225	10	0.39692	T	0.17	-4.0852	12.3605	0.55201	0.1264:0.0:0.0:0.8736	.	334;305	B4DRH2;Q9UBM8	.;MGT4C_HUMAN	E	305;334;305;305;305;305;305	ENSP00000331664:K305E;ENSP00000376900:K334E;ENSP00000449022:K305E;ENSP00000446647:K305E;ENSP00000447253:K305E;ENSP00000449172:K305E	ENSP00000331664:K305E	K	-	1	0	MGAT4C	84897722	1.000000	0.71417	0.998000	0.56505	0.005000	0.04900	8.033000	0.88852	0.989000	0.38761	-0.335000	0.08231	AAA	-	HMMPfam_Glyco_transf_54		0.378	MGAT4C-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MGAT4C	protein_coding	OTTHUMT00000406212.2	T	NM_013244		84897722	-1	no_errors	NM_013244	genbank	human	validated	54_36p	missense	SNP	1	C
FBXW8	26259	genome.wustl.edu	37	12	117365883	117365883	+	Missense_Mutation	SNP	T	T	C			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr12:117365883T>C	ENST00000309909.5	+	2	456	c.374T>C	c.(373-375)aTc>aCc	p.I125T	FBXW8_ENST00000455858.2_Missense_Mutation_p.I59T			Q8N3Y1	FBXW8_HUMAN	F-box and WD repeat domain containing 8	125	F-box. {ECO:0000255|PROSITE- ProRule:PRU00080}.				cell proliferation (GO:0008283)|Golgi organization (GO:0007030)|labyrinthine layer blood vessel development (GO:0060716)|positive regulation of dendrite morphogenesis (GO:0050775)|protein ubiquitination (GO:0016567)|spongiotrophoblast layer development (GO:0060712)	Cul7-RING ubiquitin ligase complex (GO:0031467)|Golgi apparatus (GO:0005794)|perinuclear region of cytoplasm (GO:0048471)|SCF ubiquitin ligase complex (GO:0019005)		p.I125T(1)		endometrium(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(2)|pancreas(1)|skin(1)|stomach(1)	22	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0353)		GAATTGGCAATCAATATATTT	0.348																																																1	Substitution - Missense(1)	ovary(1)	12											116.0	107.0	110.0					12																	117365883		2203	4300	6503	115850266	SO:0001583	missense	26259			AF176707	CCDS9182.1, CCDS44988.1	12q24.23	2013-01-09	2007-02-08	2003-06-13				"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	13597	protein-coding gene	gene with protein product		609073	"""F-box only protein 29"", ""F-box and WD-40 domain protein 8"""	FBXO29		10531035, 10531037	Standard	NM_012174		Approved	FBX29, FBW6, FBW8	uc001twg.1	Q8N3Y1	OTTHUMG00000169329	ENST00000309909.5:c.374T>C	12.37:g.117365883T>C	ENSP00000310686:p.Ile125Thr		115850266	Q9UK95	Missense_Mutation	SNP	HMMPfam_WD40;HMMPfam_F-box;superfamily_YVTN repeat-like/Quinoprotein amine dehydrogenase;superfamily_F-box domain	p.I125T	ENST00000309909.5	37	c.374	CCDS9182.1	12	.	.	.	.	.	.	.	.	.	.	T	20.5	4.004634	0.74932	.	.	ENSG00000174989	ENST00000309909;ENST00000455858;ENST00000505227	T;T	0.46819	0.86;0.86	5.73	5.73	0.89815	F-box domain, cyclin-like (3);F-box domain, Skp2-like (1);	0.242952	0.32416	N	0.006122	T	0.46210	0.1381	L	0.43152	1.355	0.40557	D	0.981177	P;P	0.44521	0.837;0.763	B;B	0.43225	0.412;0.229	T	0.52609	-0.8553	10	0.87932	D	0	-15.9761	15.2004	0.73132	0.0:0.0:0.0:1.0	.	125;59	Q8N3Y1;Q8N3Y1-2	FBXW8_HUMAN;.	T	125;59;59	ENSP00000310686:I125T;ENSP00000389144:I59T	ENSP00000310686:I125T	I	+	2	0	FBXW8	115850266	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.886000	0.75611	2.186000	0.69663	0.454000	0.30748	ATC	-	HMMPfam_F-box		0.348	FBXW8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXW8	protein_coding	OTTHUMT00000403561.1	T	NM_012174		115850266	1	no_errors	NM_153348	genbank	human	reviewed	54_36p	missense	SNP	1	C
BRCA2	675	genome.wustl.edu	37	13	32937426	32937441	+	Frame_Shift_Del	DEL	TGAGCGCAAATATATC	TGAGCGCAAATATATC	-	rs80359053|rs80359052|rs80359051|rs80359050|rs587782781|rs587782365|rs140782158		TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	TGAGCGCAAATATATC	TGAGCGCAAATATATC	TGAGCGCAAATATATC	-	TGAGCGCAAATATATC	TGAGCGCAAATATATC	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr13:32937426_32937441delTGAGCGCAAATATATC	ENST00000380152.3	+	18	8320_8335	c.8087_8102delTGAGCGCAAATATATC	c.(8086-8103)ttgagcgcaaatatatctfs	p.LSANIS2696fs	BRCA2_ENST00000544455.1_Frame_Shift_Del_p.LSANIS2696fs			P51587	BRCA2_HUMAN	breast cancer 2, early onset	2696					brain development (GO:0007420)|cell aging (GO:0007569)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|female gonad development (GO:0008585)|hemopoiesis (GO:0030097)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|inner cell mass cell proliferation (GO:0001833)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|male meiosis I (GO:0007141)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|nucleotide-excision repair (GO:0006289)|oocyte maturation (GO:0001556)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokinesis (GO:0032465)|replication fork protection (GO:0048478)|response to gamma radiation (GO:0010332)|response to UV-C (GO:0010225)|response to X-ray (GO:0010165)|spermatogenesis (GO:0007283)	BRCA2-MAGE-D1 complex (GO:0033593)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|secretory granule (GO:0030141)	gamma-tubulin binding (GO:0043015)|H3 histone acetyltransferase activity (GO:0010484)|H4 histone acetyltransferase activity (GO:0010485)|protease binding (GO:0002020)|single-stranded DNA binding (GO:0003697)	p.S2697fs*31(1)		NS(3)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(32)|liver(1)|lung(41)|oesophagus(5)|ovary(22)|pancreas(4)|prostate(3)|salivary_gland(1)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	183		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		ATAATTTCATTGAGCGCAAATATATCTGAAACTTCT	0.375			"""D, Mis, N, F, S"""		"""breast, ovarian, pancreatic"""	"""breast, ovarian, pancreatic, leukemia  (FANCB, FANCD1)"""		Homologous recombination	Pancreatic Cancer, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Prostate Cancer;Hereditary Breast-Ovarian Cancer, BRCA2 type;Fanconi Anemia type D1, bi-allelic BRCA2 mutations;Fanconi Anemia	TCGA Ovarian(8;0.087)																											Esophageal Squamous(138;838 1285 7957 30353 30468 36915 49332)	yes	Rec	yes	Hereditary breast/ovarian cancer	13	13q12	675	familial breast/ovarian cancer gene 2		"""L, E"""	1	Deletion - Frameshift(1)	ovary(1)	13																																								31835441	SO:0001589	frameshift_variant	675	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;HPC; ;FANCD1;Pancytopenia Dysmelia, FA (several complementation groups)	U43746	CCDS9344.1	13q12-q13	2014-09-17	2003-10-14		ENSG00000139618	ENSG00000139618		"""Fanconi anemia, complementation groups"""	1101	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 2"""	600185	"""Fanconi anemia, complementation group D1"""	FANCD1, FACD, FANCD		8091231, 7581463, 15057823	Standard	NM_000059		Approved	FAD, FAD1, BRCC2	uc001uub.1	P51587	OTTHUMG00000017411	ENST00000380152.3:c.8087_8102delTGAGCGCAAATATATC	13.37:g.32937426_32937441delTGAGCGCAAATATATC	ENSP00000369497:p.Leu2696fs		31835426	O00183|O15008|Q13879|Q5TBJ7	Frame_Shift_Del	DEL	superfamily_Nucleic acid-binding proteins;superfamily_BRCA2 helical domain;superfamily_BRCA2 tower domain;BRCA2;HMMPfam_BRCA2;BRCA-2_OB1;HMMPfam_BRCA-2_OB1;BRCA-2_OB3;HMMPfam_BRCA-2_OB3;Tower;HMMPfam_Tower;BRCA-2_helical;HMMPfam_BRCA-2_helical	p.S2697fs	ENST00000380152.3	37	c.8087_8102	CCDS9344.1	13																																																																																			(deletion:cds_exon[31835316;31835670])	HMMPfam_BRCA-2_OB1		0.375	BRCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRCA2	protein_coding	OTTHUMT00000046000.2	TGAGCGCAAATATATC	NM_000059		31835441	1	no_errors	NM_000059	genbank	human	reviewed	54_36p	frame_shift_del	DEL	0.000:0.000:0.002:0.003:0.004:0.003:0.005:0.002:0.001:0.001:0.001:0.001:0.001:0.001:0.000:0.003	-
FGF13	2258	genome.wustl.edu	37	X	137749954	137749954	+	Intron	SNP	C	C	A			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chrX:137749954C>A	ENST00000315930.6	-	4	1064				FGF13_ENST00000541469.1_Intron|FGF13_ENST00000305414.4_Intron|FGF13_ENST00000370603.3_Intron|FGF13_ENST00000441825.2_Intron|MIR504_ENST00000385065.1_RNA	NM_004114.3	NP_004105.1	Q92913	FGF13_HUMAN	fibroblast growth factor 13						cell-cell signaling (GO:0007267)|cerebral cortex cell migration (GO:0021795)|establishment of neuroblast polarity (GO:0045200)|hippocampus development (GO:0021766)|learning (GO:0007612)|MAPK cascade (GO:0000165)|memory (GO:0007613)|microtubule polymerization (GO:0046785)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of microtubule depolymerization (GO:0007026)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|positive regulation of protein kinase activity (GO:0045860)|protein localization to plasma membrane (GO:0072659)|signal transduction (GO:0007165)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular region (GO:0005576)|filopodium (GO:0030175)|growth cone (GO:0030426)|intercalated disc (GO:0014704)|microtubule (GO:0005874)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	beta-tubulin binding (GO:0048487)|growth factor activity (GO:0008083)|ion channel binding (GO:0044325)|microtubule binding (GO:0008017)|protein kinase activator activity (GO:0030295)|sodium channel regulator activity (GO:0017080)			breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(10)|ovary(1)|prostate(1)	24	Acute lymphoblastic leukemia(192;0.000127)					CCAACAGCAGCTGATTCAACA	0.463																																																0			X											81.0	66.0	70.0					X																	137749954		1567	3581	5148	137577620	SO:0001627	intron_variant	574507			BC034340	CCDS14664.1, CCDS14665.1, CCDS55511.1	Xq26.3	2008-02-05			ENSG00000129682	ENSG00000129682			3670	protein-coding gene	gene with protein product	"""fibroblast growth factor homologous factor 2"""	300070				8790420	Standard	NM_033642		Approved	FHF2, FGF2	uc011mwj.2	Q92913	OTTHUMG00000022532	ENST00000315930.6:c.403-32138G>T	X.37:g.137749954C>A			137577620	B1AK18|B7Z4M7|B7Z8N0|D3DWH4|O95830|Q9NZH9|Q9NZI0	RNA	SNP	-	NULL	ENST00000315930.6	37	NULL	CCDS14665.1	X																																																																																			-	-		0.463	FGF13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIRN504	protein_coding	OTTHUMT00000058534.2	C	NM_004114		137577620	-1	no_errors	ENST00000385065	ensembl	human	known	54_36p	rna	SNP	0.86	A
OR4K2	390431	genome.wustl.edu	37	14	20345280	20345280	+	Missense_Mutation	SNP	T	T	A			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr14:20345280T>A	ENST00000298642.2	+	1	890	c.854T>A	c.(853-855)aTa>aAa	p.I285K		NM_001005501.1	NP_001005501.1	Q8NGD2	OR4K2_HUMAN	olfactory receptor, family 4, subfamily K, member 2	285						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.I285K(1)		NS(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(16)|ovary(2)|skin(9)|upper_aerodigestive_tract(2)	43	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		CTGAACCCAATAATCTATACT	0.373																																																1	Substitution - Missense(1)	ovary(1)	14											104.0	109.0	107.0					14																	20345280		2203	4300	6503	19415120	SO:0001583	missense	390431				CCDS32023.1	14q11.2	2013-09-23			ENSG00000165762	ENSG00000165762		"""GPCR / Class A : Olfactory receptors"""	14728	protein-coding gene	gene with protein product							Standard	NM_001005501		Approved		uc001vwh.1	Q8NGD2	OTTHUMG00000170624	ENST00000298642.2:c.854T>A	14.37:g.20345280T>A	ENSP00000298642:p.Ile285Lys		19415120	B2RNK8|Q6IFA5	Missense_Mutation	SNP	-	p.I285K	ENST00000298642.2	37	c.854	CCDS32023.1	14	.	.	.	.	.	.	.	.	.	.	.	10.39	1.338268	0.24253	.	.	ENSG00000165762	ENST00000298642	T	0.48201	0.82	5.16	5.16	0.70880	GPCR, rhodopsin-like superfamily (1);	0.823370	0.10208	N	0.702471	T	0.59224	0.2178	M	0.80982	2.52	0.24667	N	0.99344	B	0.26081	0.141	B	0.36289	0.221	T	0.57021	-0.7882	10	0.87932	D	0	.	12.9843	0.58583	0.0:0.0:0.0:1.0	.	285	Q8NGD2	OR4K2_HUMAN	K	285	ENSP00000298642:I285K	ENSP00000298642:I285K	I	+	2	0	OR4K2	19415120	0.957000	0.32711	0.110000	0.21437	0.054000	0.15201	7.454000	0.80714	2.165000	0.68154	0.482000	0.46254	ATA	-	NULL		0.373	OR4K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4K2	protein_coding	OTTHUMT00000409864.1	T			19415120	1	no_errors	NM_001005501	genbank	human	provisional	54_36p	missense	SNP	0.12	A
PSME1	5720	genome.wustl.edu	37	14	24607315	24607315	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr14:24607315G>T	ENST00000206451.6	+	7	553	c.448G>T	c.(448-450)Gtg>Ttg	p.V150L	EMC9_ENST00000558200.1_5'Flank|PSME1_ENST00000561435.1_Missense_Mutation_p.V150L|RP11-468E2.5_ENST00000558478.1_lincRNA|PSME1_ENST00000559123.1_5'UTR|PSME1_ENST00000382708.3_Missense_Mutation_p.V150L	NM_001281528.1|NM_006263.2	NP_001268457.1|NP_006254.1	Q06323	PSME1_HUMAN	proteasome (prosome, macropain) activator subunit 1 (PA28 alpha)	150					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|proteasome activator complex (GO:0008537)|proteasome complex (GO:0000502)	endopeptidase activator activity (GO:0061133)	p.V150L(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	11				GBM - Glioblastoma multiforme(265;0.00831)		CAATTTTGGAGTGGCTGTCCA	0.527																																																1	Substitution - Missense(1)	ovary(1)	14											132.0	125.0	127.0					14																	24607315		2203	4300	6503	23677155	SO:0001583	missense	5720				CCDS9612.1, CCDS41930.1, CCDS61415.1	14q11.2	2008-08-29			ENSG00000092010	ENSG00000092010		"""Proteasome (prosome, macropain) subunits"""	9568	protein-coding gene	gene with protein product		600654				8269930	Standard	NM_006263		Approved	IFI5111, PA28alpha	uc001wmh.3	Q06323	OTTHUMG00000028795	ENST00000206451.6:c.448G>T	14.37:g.24607315G>T	ENSP00000206451:p.Val150Leu		23677155	A6NJG9|H0YNE3|Q6IBM2|Q9UEF4	Missense_Mutation	SNP	-	p.V150L	ENST00000206451.6	37	c.448	CCDS9612.1	14	.	.	.	.	.	.	.	.	.	.	g	15.90	2.969840	0.53614	.	.	ENSG00000092010	ENST00000206451;ENST00000382708	T;T	0.55234	0.53;0.53	5.14	5.14	0.70334	Proteasome activator pa28, REG beta subunit (2);	0.000000	0.85682	D	0.000000	T	0.78817	0.4343	M	0.92738	3.34	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.78314	0.991;0.991	D	0.83937	0.0309	10	0.87932	D	0	-12.4076	16.156	0.81666	0.0:0.0:1.0:0.0	.	150;150	A6NJG9;Q06323	.;PSME1_HUMAN	L	150	ENSP00000206451:V150L;ENSP00000372155:V150L	ENSP00000206451:V150L	V	+	1	0	PSME1	23677155	1.000000	0.71417	1.000000	0.80357	0.090000	0.18270	7.728000	0.84847	2.687000	0.91594	0.655000	0.94253	GTG	-	NULL		0.527	PSME1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSME1	protein_coding	OTTHUMT00000071910.2	G	NM_006263		23677155	1	no_errors	NM_176783	genbank	human	reviewed	54_36p	missense	SNP	1	T
ARHGAP5	394	genome.wustl.edu	37	14	32560545	32560545	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr14:32560545G>T	ENST00000345122.3	+	2	985	c.670G>T	c.(670-672)Gta>Tta	p.V224L	ARHGAP5_ENST00000396582.2_Intron|ARHGAP5_ENST00000556611.1_Missense_Mutation_p.V224L|ARHGAP5_ENST00000433497.1_Intron|ARHGAP5_ENST00000539826.2_Missense_Mutation_p.V224L|ARHGAP5_ENST00000432921.1_Missense_Mutation_p.V224L	NM_001030055.1	NP_001025226.1	Q13017	RHG05_HUMAN	Rho GTPase activating protein 5	224					cell adhesion (GO:0007155)|GTP catabolic process (GO:0006184)|mammary gland development (GO:0030879)|positive regulation of cell migration (GO:0030335)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell size (GO:0008361)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)	p.V224L(1)		NS(2)|breast(10)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(12)|ovary(4)|skin(1)|stomach(1)|urinary_tract(4)	55	Hepatocellular(127;0.0604)|Prostate(35;0.15)|Breast(36;0.186)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.00714)|BRCA - Breast invasive adenocarcinoma(188;0.0952)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00566)		GAACCTTCTTGTAGTGGAAAC	0.338																																					NSCLC(9;77 350 3443 29227 41353)											1	Substitution - Missense(1)	ovary(1)	14											80.0	86.0	84.0					14																	32560545		2202	4298	6500	31630296	SO:0001583	missense	394			U17032	CCDS32062.1, CCDS45095.1	14q12	2010-02-05						"""Rho GTPase activating proteins"""	675	protein-coding gene	gene with protein product		602680	"""growth factor independent 2"""	GFI2		8537347	Standard	XM_005267635		Approved	RhoGAP5, p190-B, p190BRhoGAP	uc001wrn.3	Q13017		ENST00000345122.3:c.670G>T	14.37:g.32560545G>T	ENSP00000371897:p.Val224Leu		31630296	A1L375|A1L376|A8KAA1|D3DS89|D3DS90|Q05BE8|Q05BU8|Q59ER0|Q6DHZ3	Missense_Mutation	SNP	HMMPfam_RhoGAP;HMMPfam_FF;superfamily_FF domain;superfamily_GTPase activation domain GAP;HMMPfam_Ras;superfamily_P-loop containing nucleoside triphosphate hydrolases	p.V224L	ENST00000345122.3	37	c.670	CCDS32062.1	14	.	.	.	.	.	.	.	.	.	.	G	4.838	0.155846	0.09236	.	.	ENSG00000100852	ENST00000556611;ENST00000539826;ENST00000345122;ENST00000432921	T;T;T;T	0.75938	-0.98;-0.98;-0.98;-0.98	5.78	5.78	0.91487	.	0.064498	0.64402	D	0.000008	T	0.60117	0.2244	N	0.10782	0.045	0.45452	D	0.998423	B;B	0.15930	0.012;0.015	B;B	0.23275	0.026;0.045	T	0.54503	-0.8284	10	0.17832	T	0.49	.	20.0086	0.97443	0.0:0.0:1.0:0.0	.	224;224	Q13017-2;Q13017	.;RHG05_HUMAN	L	224	ENSP00000452222:V224L;ENSP00000441692:V224L;ENSP00000371897:V224L;ENSP00000393307:V224L	ENSP00000371897:V224L	V	+	1	0	ARHGAP5	31630296	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	4.292000	0.59031	2.717000	0.92951	0.655000	0.94253	GTA	-	HMMPfam_Ras		0.338	ARHGAP5-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARHGAP5	protein_coding	OTTHUMT00000409735.1	G	NM_001030055		31630296	1	no_errors	NM_001030055	genbank	human	reviewed	54_36p	missense	SNP	1	T
FRMD6	122786	genome.wustl.edu	37	14	52194515	52194515	+	Missense_Mutation	SNP	A	A	G			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr14:52194515A>G	ENST00000344768.5	+	14	1833	c.1637A>G	c.(1636-1638)gAt>gGt	p.D546G	FRMD6_ENST00000554167.1_Missense_Mutation_p.D469G|FRMD6_ENST00000553556.1_Missense_Mutation_p.D188G|FRMD6_ENST00000395718.2_Missense_Mutation_p.D538G|FRMD6_ENST00000356218.4_Missense_Mutation_p.D538G			Q96NE9	FRMD6_HUMAN	FERM domain containing 6	546					apical constriction (GO:0003383)|cellular protein localization (GO:0034613)|regulation of actin filament-based process (GO:0032970)	apical junction complex (GO:0043296)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)		p.D538G(1)		breast(2)|central_nervous_system(1)|endometrium(7)|large_intestine(7)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34	all_epithelial(31;0.0163)|Breast(41;0.089)					TTGAGCCTCGATGACATCAGA	0.458																																																1	Substitution - Missense(1)	ovary(1)	14											163.0	139.0	147.0					14																	52194515		2203	4300	6503	51264265	SO:0001583	missense	122786			BI465118	CCDS9704.1, CCDS58318.1, CCDS58319.1	14q22.1	2011-06-22	2005-07-20	2005-07-20	ENSG00000139926	ENSG00000139926			19839	protein-coding gene	gene with protein product	"""expanded homolog"""	614555	"""chromosome 14 open reading frame 31"""	C14orf31			Standard	NM_152330		Approved	MGC17921, willin, EX1	uc001wzd.3	Q96NE9	OTTHUMG00000140294	ENST00000344768.5:c.1637A>G	14.37:g.52194515A>G	ENSP00000343899:p.Asp546Gly		51264265	D3DSB9|Q5HYF2|Q8N2X1|Q8WUH7	Missense_Mutation	SNP	-	p.D538G	ENST00000344768.5	37	c.1613	CCDS58318.1	14	.	.	.	.	.	.	.	.	.	.	A	25.4	4.632903	0.87660	.	.	ENSG00000139926	ENST00000356218;ENST00000395718;ENST00000344768;ENST00000554167;ENST00000553556	D;D;D;D	0.88431	-2.38;-2.38;-2.15;-1.98	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	D	0.92685	0.7675	L	0.55481	1.735	0.80722	D	1	D;D;D	0.76494	0.997;0.994;0.999	D;P;D	0.66979	0.94;0.822;0.948	D	0.93238	0.6623	10	0.72032	D	0.01	.	16.1099	0.81255	1.0:0.0:0.0:0.0	.	469;546;538	G3V4T7;Q96NE9;Q96NE9-2	.;FRMD6_HUMAN;.	G	538;538;546;469;188	ENSP00000348550:D538G;ENSP00000379068:D538G;ENSP00000343899:D546G;ENSP00000451977:D469G	ENSP00000343899:D546G	D	+	2	0	FRMD6	51264265	1.000000	0.71417	0.991000	0.47740	0.736000	0.42039	9.339000	0.96797	2.285000	0.76669	0.533000	0.62120	GAT	-	NULL		0.458	FRMD6-002	KNOWN	basic|CCDS	protein_coding	FRMD6	protein_coding	OTTHUMT00000276881.1	A	NM_152330		51264265	1	no_errors	NM_001042481	genbank	human	validated	54_36p	missense	SNP	1	G
FBLN5	10516	genome.wustl.edu	37	14	92347652	92347652	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr14:92347652G>C	ENST00000342058.4	-	9	1566	c.973C>G	c.(973-975)Ctg>Gtg	p.L325V	FBLN5_ENST00000267620.10_Missense_Mutation_p.L366V|FBLN5_ENST00000556154.1_Missense_Mutation_p.L330V	NM_006329.3	NP_006320.2	Q9UBX5	FBLN5_HUMAN	fibulin 5	325	EGF-like 6; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cell-matrix adhesion (GO:0007160)|elastic fiber assembly (GO:0048251)|extracellular matrix organization (GO:0030198)|protein localization to cell surface (GO:0034394)|regulation of cell growth (GO:0001558)|regulation of removal of superoxide radicals (GO:2000121)	elastic fiber (GO:0071953)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|protein C-terminus binding (GO:0008022)	p.L325V(1)		breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(11)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	28		all_cancers(154;0.0722)				CTGATCCTCAGATAAGGCTCC	0.537																																																1	Substitution - Missense(1)	ovary(1)	14											92.0	75.0	81.0					14																	92347652		2203	4300	6503	91417405	SO:0001583	missense	10516			AJ133490	CCDS9898.1	14q31	2014-09-17				ENSG00000140092		"""Fibulins"""	3602	protein-coding gene	gene with protein product		604580				10640802	Standard	NM_006329		Approved	EVEC, UP50, DANCE, ARMD3	uc001xzx.4	Q9UBX5		ENST00000342058.4:c.973C>G	14.37:g.92347652G>C	ENSP00000345008:p.Leu325Val		91417405	O75966|Q6IAL4|Q6UWA3	Missense_Mutation	SNP	superfamily_Serine proterase inhibitors,HMMPfam_EGF_CA,superfamily_EGF/Laminin	p.L325V	ENST00000342058.4	37	c.973	CCDS9898.1	14	.	.	.	.	.	.	.	.	.	.	G	0.015	-1.554217	0.00918	.	.	ENSG00000140092	ENST00000267620;ENST00000342058;ENST00000556154	D;D;D	0.91945	-2.94;-2.94;-2.94	5.5	2.36	0.29203	.	0.133960	0.46442	D	0.000293	T	0.77198	0.4095	N	0.02247	-0.625	0.31457	N	0.669983	B;B;B	0.13145	0.007;0.001;0.0	B;B;B	0.16289	0.015;0.002;0.001	T	0.66176	-0.5989	10	0.02654	T	1	.	15.0794	0.72103	0.0:0.0:0.4229:0.5771	.	366;330;325	G3XA98;G3V4U0;Q9UBX5	.;.;FBLN5_HUMAN	V	366;325;330	ENSP00000267620:L366V;ENSP00000345008:L325V;ENSP00000451982:L330V	ENSP00000267620:L422V	L	-	1	2	FBLN5	91417405	1.000000	0.71417	0.339000	0.25562	0.452000	0.32318	0.997000	0.29731	0.727000	0.32360	0.655000	0.94253	CTG	-	HMMPfam_EGF_CA		0.537	FBLN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBLN5	protein_coding	OTTHUMT00000411787.1	G			91417405	-1	no_errors	NM_006329	genbank	human	reviewed	54_36p	missense	SNP	1	C
BDKRB2	624	genome.wustl.edu	37	14	96707828	96707828	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr14:96707828G>A	ENST00000306005.3	+	3	1359	c.1163G>A	c.(1162-1164)gGg>gAg	p.G388E	BDKRB2_ENST00000539359.1_Missense_Mutation_p.G361E|BDKRB2_ENST00000554311.1_Missense_Mutation_p.G388E|BDKRB2_ENST00000542454.2_Missense_Mutation_p.G361E|RP11-404P21.8_ENST00000553811.1_Intron	NM_000623.3	NP_000614.1	P30411	BKRB2_HUMAN	bradykinin receptor B2	388					arachidonic acid secretion (GO:0050482)|blood circulation (GO:0008015)|cell surface receptor signaling pathway (GO:0007166)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|metabolic process (GO:0008152)|negative regulation of intrinsic apoptotic signaling pathway in response to osmotic stress by p53 class mediator (GO:1902239)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of vascular permeability (GO:0043114)|regulation of vasoconstriction (GO:0019229)|response to salt stress (GO:0009651)|smooth muscle contraction (GO:0006939)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vasoconstriction (GO:0042310)|vasodilation (GO:0042311)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	bradykinin receptor activity (GO:0004947)|phosphatidylinositol phospholipase C activity (GO:0004435)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|type 1 angiotensin receptor binding (GO:0031702)	p.G388E(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(5)|lung(7)|ovary(3)|skin(1)	24		all_cancers(154;0.0678)|Melanoma(154;0.155)|all_epithelial(191;0.179)		COAD - Colon adenocarcinoma(157;0.226)	Icatibant(DB06196)	GACTGGGCAGGGAGCAGACAG	0.557																																																1	Substitution - Missense(1)	ovary(1)	14											38.0	42.0	41.0					14																	96707828		2203	4300	6503	95777581	SO:0001583	missense	624			S56772	CCDS9942.1	14q32.1-q32.2	2012-08-08				ENSG00000168398		"""GPCR / Class A : Bradykinin receptors"""	1030	protein-coding gene	gene with protein product		113503				7916737	Standard	NM_000623		Approved	BK-2	uc010avm.1	P30411		ENST00000306005.3:c.1163G>A	14.37:g.96707828G>A	ENSP00000307713:p.Gly388Glu		95777581		Missense_Mutation	SNP	HMMPfam_7tm_1;superfamily_Family A G protein-coupled receptor-like	p.G388E	ENST00000306005.3	37	c.1163	CCDS9942.1	14	.	.	.	.	.	.	.	.	.	.	G	0.003	-2.400341	0.00195	.	.	ENSG00000168398	ENST00000542454;ENST00000554311;ENST00000306005;ENST00000539359	T;T;T;T	0.71579	-0.58;-0.57;-0.57;-0.58	3.93	-0.46	0.12175	.	1.165010	0.06534	N	0.742018	T	0.44829	0.1312	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.29671	-1.0004	10	0.46703	T	0.11	-9.8017	0.5599	0.00677	0.1951:0.2448:0.2837:0.2763	.	388	P30411	BKRB2_HUMAN	E	361;388;388;361	ENSP00000439459:G361E;ENSP00000450482:G388E;ENSP00000307713:G388E;ENSP00000438376:G361E	ENSP00000307713:G388E	G	+	2	0	BDKRB2	95777581	0.000000	0.05858	0.003000	0.11579	0.363000	0.29612	0.578000	0.23773	0.093000	0.17368	0.491000	0.48974	GGG	-	NULL		0.557	BDKRB2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	BDKRB2	protein_coding	OTTHUMT00000413294.1	G			95777581	1	no_errors	NM_000623	genbank	human	reviewed	54_36p	missense	SNP		A
CDAN1	146059	genome.wustl.edu	37	15	43017413	43017413	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr15:43017413C>G	ENST00000356231.3	-	27	3510	c.3487G>C	c.(3487-3489)Gag>Cag	p.E1163Q		NM_138477.2	NP_612486.2	Q8IWY9	CDAN1_HUMAN	codanin 1	1163					chromatin assembly (GO:0031497)|chromatin organization (GO:0006325)|negative regulation of DNA replication (GO:0008156)|protein localization (GO:0008104)	cytoplasm (GO:0005737)|endomembrane system (GO:0012505)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.E1163Q(1)		endometrium(2)|kidney(4)|large_intestine(3)|lung(6)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(3)	24		all_cancers(109;5.4e-16)|all_epithelial(112;2.97e-14)|Lung NSC(122;1.75e-08)|all_lung(180;5.99e-08)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;2.49e-07)		AGACCCTTCTCCACCAGCTCC	0.577																																																1	Substitution - Missense(1)	ovary(1)	15											69.0	65.0	66.0					15																	43017413		2203	4299	6502	40804705	SO:0001583	missense	146059			AF525398	CCDS32209.1	15q15.2	2012-04-25	2012-04-25			ENSG00000140326			1713	protein-coding gene	gene with protein product		607465	"""congenital dyserythropoietic anemia, type I"""			8634422, 12434312	Standard	XM_005254177		Approved	CDA-I, CDAI	uc001zql.3	Q8IWY9		ENST00000356231.3:c.3487G>C	15.37:g.43017413C>G	ENSP00000348564:p.Glu1163Gln		40804705	Q6NYD0|Q7Z7L5|Q969N3	Missense_Mutation	SNP	-	p.E1163Q	ENST00000356231.3	37	c.3487	CCDS32209.1	15	.	.	.	.	.	.	.	.	.	.	C	25.6	4.658315	0.88154	.	.	ENSG00000140326	ENST00000356231;ENST00000267892	D	0.88896	-2.44	6.07	5.16	0.70880	.	0.180420	0.64402	D	0.000014	D	0.91811	0.7409	M	0.61703	1.905	0.43485	D	0.995713	D;P	0.61080	0.989;0.933	P;P	0.58266	0.836;0.542	D	0.92380	0.5912	10	0.72032	D	0.01	-9.1808	13.1502	0.59484	0.0:0.9233:0.0:0.0767	.	1163;1161	Q8IWY9;C9K0H8	CDAN1_HUMAN;.	Q	1163;1161	ENSP00000348564:E1163Q	ENSP00000267892:E1161Q	E	-	1	0	CDAN1	40804705	0.920000	0.31207	0.998000	0.56505	0.982000	0.71751	1.994000	0.40757	1.583000	0.49898	0.655000	0.94253	GAG	-	NULL		0.577	CDAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDAN1	protein_coding	OTTHUMT00000431103.1	C	XM_085300		40804705	-1	no_errors	NM_138477	genbank	human	validated	54_36p	missense	SNP	0.96	G
TUBGCP4	27229	genome.wustl.edu	37	15	43668412	43668412	+	Silent	SNP	T	T	C			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr15:43668412T>C	ENST00000260383.7	+	2	449	c.195T>C	c.(193-195)caT>caC	p.H65H	TUBGCP4_ENST00000570081.1_3'UTR|TUBGCP4_ENST00000399460.3_5'Flank|TUBGCP4_ENST00000564079.1_Silent_p.H65H			Q9UGJ1	GCP4_HUMAN	tubulin, gamma complex associated protein 4	65					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)|protein complex assembly (GO:0006461)	centrosome (GO:0005813)|cytosol (GO:0005829)|gamma-tubulin ring complex (GO:0008274)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|spindle pole (GO:0000922)	structural constituent of cytoskeleton (GO:0005200)	p.H65H(1)		breast(1)|cervix(2)|endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(4)|prostate(2)|upper_aerodigestive_tract(2)	21		all_cancers(109;1.27e-10)|all_epithelial(112;4.82e-09)|Lung NSC(122;1.72e-06)|all_lung(180;1.59e-05)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;3.53e-07)		ACACGGGCCATGTGCAACAGC	0.542											OREG0023088	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - coding silent(1)	ovary(1)	15											95.0	93.0	94.0					15																	43668412		1958	4162	6120	41455704	SO:0001819	synonymous_variant	27229			AJ249677	CCDS42030.1, CCDS66745.1	15q15.3	2014-08-12			ENSG00000137822	ENSG00000137822			16691	protein-coding gene	gene with protein product		609610				10562286	Standard	NM_001286414		Approved	76P, FLJ14797	uc001zrn.3	Q9UGJ1	OTTHUMG00000176647	ENST00000260383.7:c.195T>C	15.37:g.43668412T>C		918	41455704	B3KNK6|Q969X3|Q9NVF0	Silent	SNP	-	p.H65	ENST00000260383.7	37	c.195		15																																																																																			-	NULL		0.542	TUBGCP4-001	KNOWN	basic|appris_candidate_longest	protein_coding	TUBGCP4	protein_coding	OTTHUMT00000432970.1	T	NM_014444		41455704	1	no_errors	NM_014444	genbank	human	provisional	54_36p	silent	SNP	1	C
CSPG4	1464	genome.wustl.edu	37	15	75969142	75969142	+	Silent	SNP	G	G	A			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr15:75969142G>A	ENST00000308508.5	-	10	5810	c.5718C>T	c.(5716-5718)ttC>ttT	p.F1906F	CTD-2026K11.1_ENST00000569467.1_RNA|AC105020.1_ENST00000435356.1_5'Flank	NM_001897.4	NP_001888.2	Q6UVK1	CSPG4_HUMAN	chondroitin sulfate proteoglycan 4	1906	Cysteine-containing.|Neurite growth inhibition. {ECO:0000250}.				activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|cell proliferation (GO:0008283)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|intracellular signal transduction (GO:0035556)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|small molecule metabolic process (GO:0044281)|tissue remodeling (GO:0048771)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell projection (GO:0042995)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)	p.F1906F(1)		breast(1)|cervix(2)|endometrium(5)|kidney(5)|large_intestine(3)|liver(2)|lung(18)|ovary(2)|pancreas(2)|prostate(4)|skin(4)	48						CGTTGGCCACGAAGGCCAGCC	0.667																																																1	Substitution - coding silent(1)	ovary(1)	15											28.0	29.0	29.0					15																	75969142		2197	4290	6487	73756197	SO:0001819	synonymous_variant	1464			X96753, AY359468	CCDS10284.1	15q24.2	2010-04-19	2007-02-16		ENSG00000173546	ENSG00000173546		"""Proteoglycans / Cell surface : Other"""	2466	protein-coding gene	gene with protein product	"""melanoma-associated chondroitin sulfate proteoglycan"""	601172	"""chondroitin sulfate proteoglycan 4 (melanoma-associated)"""			8790396, 16407841	Standard	NM_001897		Approved	MCSPG, MEL-CSPG, MSK16, NG2, MCSP, HMW-MAA	uc002baw.3	Q6UVK1	OTTHUMG00000142836	ENST00000308508.5:c.5718C>T	15.37:g.75969142G>A			73756197	D3DW77|Q92675	Silent	SNP	superfamily_Concanavalin A-like lectins/glucanases,HMMPfam_Laminin_G_1,HMMPfam_Laminin_G_2	p.F1906	ENST00000308508.5	37	c.5718	CCDS10284.1	15																																																																																			-	NULL		0.667	CSPG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSPG4	protein_coding	OTTHUMT00000286472.1	G	NM_001897		73756197	-1	no_errors	NM_001897	genbank	human	reviewed	54_36p	silent	SNP	0.949	A
ABHD2	11057	genome.wustl.edu	37	15	89719205	89719205	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr15:89719205G>C	ENST00000352732.5	+	6	1221	c.701G>C	c.(700-702)tGc>tCc	p.C234S	ABHD2_ENST00000565973.1_Missense_Mutation_p.C234S|ABHD2_ENST00000355100.3_Missense_Mutation_p.C234S	NM_152924.4	NP_690888.1	P08910	ABHD2_HUMAN	abhydrolase domain containing 2	234					negative regulation of cell migration (GO:0030336)|response to wounding (GO:0009611)	integral component of membrane (GO:0016021)	carboxylic ester hydrolase activity (GO:0052689)	p.C234S(1)		NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|soft_tissue(1)	23	Lung NSC(78;0.0472)|all_lung(78;0.089)					GTCAGCGTGTGCCAGGGGTAC	0.552																																					Colon(11;252 417 24570 33239 41878)											1	Substitution - Missense(1)	ovary(1)	15											117.0	100.0	106.0					15																	89719205		2200	4299	6499	87520209	SO:0001583	missense	11057			X12433	CCDS10348.1	15q26.1	2006-10-06			ENSG00000140526	ENSG00000140526		"""Abhydrolase domain containing"""	18717	protein-coding gene	gene with protein product		612196					Standard	NM_152924		Approved	LABH2	uc002bnk.2	P08910	OTTHUMG00000148684	ENST00000352732.5:c.701G>C	15.37:g.89719205G>C	ENSP00000268129:p.Cys234Ser		87520209	Q53G48|Q53GU0|Q5FVD9|Q8TC79	Missense_Mutation	SNP	-	p.C234S	ENST00000352732.5	37	c.701	CCDS10348.1	15	.	.	.	.	.	.	.	.	.	.	G	23.5	4.428135	0.83667	.	.	ENSG00000140526	ENST00000352732;ENST00000355100	T;T	0.34859	1.34;1.34	5.55	5.55	0.83447	Alpha/beta hydrolase fold-1 (1);	0.000000	0.85682	D	0.000000	T	0.39064	0.1064	L	0.52759	1.655	0.80722	D	1	P	0.36683	0.565	B	0.40659	0.336	T	0.09292	-1.0681	10	0.13108	T	0.6	-0.6583	19.5044	0.95110	0.0:0.0:1.0:0.0	.	234	P08910	ABHD2_HUMAN	S	234	ENSP00000268129:C234S;ENSP00000347217:C234S	ENSP00000268129:C234S	C	+	2	0	ABHD2	87520209	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.859000	0.99545	2.591000	0.87537	0.643000	0.83706	TGC	-	NULL		0.552	ABHD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABHD2	protein_coding	OTTHUMT00000309074.2	G			87520209	1	no_errors	NM_007011	genbank	human	reviewed	54_36p	missense	SNP	1	C
MKL2	57496	genome.wustl.edu	37	16	14234531	14234542	+	In_Frame_Del	DEL	CTCAGAGTGAAG	CTCAGAGTGAAG	-			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	CTCAGAGTGAAG	CTCAGAGTGAAG	CTCAGAGTGAAG	-	CTCAGAGTGAAG	CTCAGAGTGAAG	Unknown	Valid	Somatic	Phase_III	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr16:14234531_14234542delCTCAGAGTGAAG	ENST00000574045.1	+	3	223_234	c.68_79delCTCAGAGTGAAG	c.(67-81)cctcagagtgaagct>cct	p.QSEA24del	MKL2_ENST00000575537.1_3'UTR|MKL2_ENST00000318282.5_In_Frame_Del_p.QSEA24del|MKL2_ENST00000571589.1_In_Frame_Del_p.QSEA24del			Q9ULH7	MKL2_HUMAN	MKL/myocardin-like 2	0					blood vessel morphogenesis (GO:0048514)|cardiac muscle tissue development (GO:0048738)|embryonic organ development (GO:0048568)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|liver development (GO:0001889)|muscle organ development (GO:0007517)|positive regulation of striated muscle tissue development (GO:0045844)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|smooth muscle cell differentiation (GO:0051145)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)	p.Q24_A27del(1)		breast(3)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(6)|liver(2)|lung(7)|ovary(4)|pancreas(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						GCTCCAAGTCCTCAGAGTGAAGCTGTGGCTCA	0.505																																																1	Deletion - In frame(1)	ovary(1)	16																																								14142043	SO:0001651	inframe_deletion	57496			AB033069	CCDS32391.1	16p13.12	2012-11-29			ENSG00000186260	ENSG00000186260			29819	protein-coding gene	gene with protein product		609463				10574462	Standard	NM_014048		Approved	MRTF-B, FLJ31823	uc002dcg.3	Q9ULH7	OTTHUMG00000177379	ENST00000574045.1:c.68_79delCTCAGAGTGAAG	16.37:g.14234531_14234542delCTCAGAGTGAAG	ENSP00000459205:p.Gln24_Ala27del		14142032	A6ND53|B4DGT8|Q68CT1|Q6UB16|Q86WW2|Q8N226	In_Frame_Del	DEL	HMMPfam_SAP,superfamily_SAP domain	p.QSEA24in_frame_del	ENST00000574045.1	37	c.68_79	CCDS32391.1	16																																																																																			(deletion:cds_exon[14141965,14142118])	NULL		0.505	MKL2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	MKL2	protein_coding	OTTHUMT00000436622.1	CTCAGAGTGAAG	NM_014048		14142043	1	no_errors	NM_014048	genbank	human	validated	54_36p	in_frame_del	DEL	1.000:1.000:1.000:1.000:0.993:1.000:1.000:1.000:1.000:1.000:1.000:1.000	-
NLRC5	84166	genome.wustl.edu	37	16	57099195	57099195	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr16:57099195G>T	ENST00000262510.6	+	33	4451	c.4226G>T	c.(4225-4227)aGt>aTt	p.S1409I	NLRC5_ENST00000436936.1_Missense_Mutation_p.S1409I|NLRC5_ENST00000308149.7_Missense_Mutation_p.S1380I|NLRC5_ENST00000539144.1_Missense_Mutation_p.S1380I	NM_032206.4	NP_115582.4	Q86WI3	NLRC5_HUMAN	NLR family, CARD domain containing 5	1409					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)|positive regulation of interferon-gamma-mediated signaling pathway (GO:0060335)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of kinase activity (GO:0043549)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)	p.S1409I(1)		NS(2)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(21)|ovary(8)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	75		all_neural(199;0.225)				GCCTCAGGCAGTGTCACTGAA	0.552																																																1	Substitution - Missense(1)	ovary(1)	16											31.0	33.0	32.0					16																	57099195		2198	4300	6498	55656696	SO:0001583	missense	84166			AF389420	CCDS10773.1	16q13	2008-02-05			ENSG00000140853	ENSG00000140853		"""Nucleotide-binding domain and leucine rich repeat containing"""	29933	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 5"", ""NOD-like receptor C5"""	613537				12615073	Standard	NM_032206		Approved	NOD27, CLR16.1, FLJ21709	uc021tiu.1	Q86WI3	OTTHUMG00000133470	ENST00000262510.6:c.4226G>T	16.37:g.57099195G>T	ENSP00000262510:p.Ser1409Ile		55656696	B5MEF1|C9JMD8|Q6P4A6|Q86VM7|Q8NF42|Q8TEE2|Q8TEJ1|Q969L7	Missense_Mutation	SNP	HMMPfam_LRR_1;HMMPfam_NACHT;superfamily_RNI-like;superfamily_P-loop containing nucleoside triphosphate hydrolases	p.S1409I	ENST00000262510.6	37	c.4226	CCDS10773.1	16	.	.	.	.	.	.	.	.	.	.	G	9.483	1.098698	0.20552	.	.	ENSG00000140853	ENST00000262510;ENST00000308149;ENST00000436936;ENST00000539144	T;T;T;T	0.71579	0.47;-0.58;0.47;-0.58	3.71	-1.59	0.08453	.	.	.	.	.	T	0.44201	0.1282	N	0.14661	0.345	0.09310	N	1	B	0.24823	0.112	B	0.22386	0.039	T	0.24368	-1.0162	9	0.14656	T	0.56	.	3.9495	0.09363	0.4431:0.1991:0.3578:0.0	.	1409	Q86WI3	NLRC5_HUMAN	I	1409;1380;1409;1380	ENSP00000262510:S1409I;ENSP00000308886:S1380I;ENSP00000389739:S1409I;ENSP00000441727:S1380I	ENSP00000262510:S1409I	S	+	2	0	NLRC5	55656696	0.014000	0.17966	0.051000	0.19133	0.962000	0.63368	-0.051000	0.11885	-0.278000	0.09180	-0.321000	0.08615	AGT	-	NULL		0.552	NLRC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRC5	protein_coding	OTTHUMT00000257346.1	G	NM_032206		55656696	1	no_errors	NM_032206	genbank	human	validated	54_36p	missense	SNP	0.42	T
NECAB2	54550	genome.wustl.edu	37	16	84035482	84035482	+	Silent	SNP	C	C	T			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr16:84035482C>T	ENST00000305202.4	+	12	1110	c.1093C>T	c.(1093-1095)Ctg>Ttg	p.L365L	NECAB2_ENST00000565691.1_Silent_p.L282L	NM_019065.2	NP_061938.2	Q7Z6G3	NECA2_HUMAN	N-terminal EF-hand calcium binding protein 2	365	ABM.					cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)	p.L365L(1)		endometrium(1)|large_intestine(3)|lung(9)|ovary(2)|prostate(1)|stomach(2)|urinary_tract(1)	19						GGTGGACACACTGAGCCAGCC	0.627																																																1	Substitution - coding silent(1)	ovary(1)	16											60.0	51.0	54.0					16																	84035482		2200	4300	6500	82592983	SO:0001819	synonymous_variant	54550			AY299331	CCDS10940.1	16q23.3-q24.1	2013-01-10	2007-12-06	2007-12-06	ENSG00000103154	ENSG00000103154		"""N-terminal EF-hand calcium binding proteins"", ""EF-hand domain containing"""	23746	protein-coding gene	gene with protein product			"""EF-hand calcium binding protein 2"""	EFCBP2		12044471	Standard	NM_019065		Approved		uc002fhd.3	Q7Z6G3	OTTHUMG00000137636	ENST00000305202.4:c.1093C>T	16.37:g.84035482C>T			82592983	A2RRG3|O75547|Q6ZSK0	Silent	SNP	-	p.L365	ENST00000305202.4	37	c.1093	CCDS10940.1	16																																																																																			-	NULL		0.627	NECAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NECAB2	protein_coding	OTTHUMT00000269077.2	C	NM_019065		82592983	1	no_errors	NM_019065	genbank	human	provisional	54_36p	silent	SNP	1	T
DNAAF1	123872	genome.wustl.edu	37	16	84203530	84203530	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr16:84203530C>A	ENST00000378553.5	+	8	1220	c.1096C>A	c.(1096-1098)Ccc>Acc	p.P366T	DNAAF1_ENST00000563818.1_3'UTR|DNAAF1_ENST00000334315.5_Missense_Mutation_p.P366T	NM_178452.4	NP_848547.4	Q8NEP3	DAAF1_HUMAN	dynein, axonemal, assembly factor 1	366				P -> L (in Ref. 4; CAH10394). {ECO:0000305}.	axonemal dynein complex assembly (GO:0070286)|cilium morphogenesis (GO:0060271)|cilium movement (GO:0003341)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|inner dynein arm assembly (GO:0036159)|left/right pattern formation (GO:0060972)|lung development (GO:0030324)|motile cilium assembly (GO:0044458)|outer dynein arm assembly (GO:0036158)|regulation of cilium beat frequency (GO:0003356)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	dynein binding (GO:0045502)	p.P366T(1)		NS(1)|endometrium(7)|kidney(1)|large_intestine(6)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|stomach(4)|urinary_tract(1)	41						GGAGGAGCCTCCCGGGGACAG	0.532																																																1	Substitution - Missense(1)	ovary(1)	16											70.0	74.0	73.0					16																	84203530		2200	4300	6500	82761031	SO:0001583	missense	123872			BC024009	CCDS10943.2	16q24.1	2012-05-03	2011-06-09	2011-06-09	ENSG00000154099	ENSG00000154099			30539	protein-coding gene	gene with protein product	"""outer row dynein assembly 7 homolog (Chlamydomonas)"""	613190	"""leucine rich repeat containing 50"""	LRRC50		19944405	Standard	NM_178452		Approved	FLJ25330, ODA7, CILD13	uc002fhl.4	Q8NEP3	OTTHUMG00000128517	ENST00000378553.5:c.1096C>A	16.37:g.84203530C>A	ENSP00000367815:p.Pro366Thr		82761031	B4DJA3|Q69YI8|Q69YJ0|Q69YW5|Q96LP3|Q96MB6	Missense_Mutation	SNP	HMMPfam_LRR_1;superfamily_Outer arm dynein light chain 1	p.P366T	ENST00000378553.5	37	c.1096	CCDS10943.2	16	.	.	.	.	.	.	.	.	.	.	C	10.92	1.487205	0.26686	.	.	ENSG00000154099	ENST00000334315;ENST00000378553	T;T	0.34275	1.37;1.81	5.05	-3.85	0.04243	.	1.508580	0.04162	N	0.323144	T	0.28830	0.0715	L	0.51422	1.61	0.09310	N	1	B;B	0.34015	0.435;0.302	B;B	0.29785	0.107;0.068	T	0.18777	-1.0326	10	0.17832	T	0.49	0.2299	9.8746	0.41195	0.0:0.2344:0.6046:0.161	.	130;366	Q8NEP3-2;Q8NEP3	.;DAAF1_HUMAN	T	366	ENSP00000334593:P366T;ENSP00000367815:P366T	ENSP00000334593:P366T	P	+	1	0	DNAAF1	82761031	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.393000	0.07305	-0.907000	0.03862	-0.941000	0.02677	CCC	-	NULL		0.532	DNAAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC50	protein_coding	OTTHUMT00000250328.3	C	NM_178452		82761031	1	no_errors	NM_178452	genbank	human	validated	54_36p	missense	SNP		A
RARA	5914	genome.wustl.edu	37	17	38511642	38511642	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr17:38511642G>C	ENST00000254066.5	+	8	1595	c.1140G>C	c.(1138-1140)aaG>aaC	p.K380N	RARA_ENST00000394086.3_Missense_Mutation_p.K396N|RARA_ENST00000420042.1_3'UTR|RARA_ENST00000394089.2_Missense_Mutation_p.K380N|RARA_ENST00000394081.3_Missense_Mutation_p.K375N|RARA_ENST00000425707.3_Missense_Mutation_p.K283N	NM_000964.3	NP_000955.1	P10276	RARA_HUMAN	retinoic acid receptor, alpha	380	Ligand-binding.				apoptotic cell clearance (GO:0043277)|cellular response to estrogen stimulus (GO:0071391)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to retinoic acid (GO:0071300)|chondroblast differentiation (GO:0060591)|embryonic camera-type eye development (GO:0031076)|face development (GO:0060324)|female pregnancy (GO:0007565)|gene expression (GO:0010467)|germ cell development (GO:0007281)|glandular epithelial cell development (GO:0002068)|growth plate cartilage development (GO:0003417)|intracellular estrogen receptor signaling pathway (GO:0030520)|limb development (GO:0060173)|liver development (GO:0001889)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cartilage development (GO:0061037)|negative regulation of cell proliferation (GO:0008285)|negative regulation of granulocyte differentiation (GO:0030853)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translational initiation (GO:0045947)|negative regulation of tumor necrosis factor production (GO:0032720)|neural tube closure (GO:0001843)|outflow tract septum morphogenesis (GO:0003148)|positive regulation of binding (GO:0051099)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of interleukin-13 production (GO:0032736)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-5 production (GO:0032754)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of T-helper 2 cell differentiation (GO:0045630)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein phosphorylation (GO:0006468)|regulation of myelination (GO:0031641)|regulation of synaptic plasticity (GO:0048167)|response to cytokine (GO:0034097)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to retinoic acid (GO:0032526)|response to vitamin A (GO:0033189)|retinoic acid receptor signaling pathway (GO:0048384)|Sertoli cell fate commitment (GO:0060010)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|trachea cartilage development (GO:0060534)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ureteric bud development (GO:0001657)|ventricular cardiac muscle cell differentiation (GO:0055012)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	chromatin DNA binding (GO:0031490)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|mRNA 5'-UTR binding (GO:0048027)|phosphatidylinositol 3-kinase regulator activity (GO:0035014)|protein domain specific binding (GO:0019904)|protein heterodimerization activity (GO:0046982)|protein kinase A binding (GO:0051018)|protein kinase B binding (GO:0043422)|receptor binding (GO:0005102)|retinoic acid binding (GO:0001972)|retinoic acid receptor activity (GO:0003708)|retinoic acid-responsive element binding (GO:0044323)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|translation repressor activity, nucleic acid binding (GO:0000900)|zinc ion binding (GO:0008270)	p.K380N(1)		breast(1)|kidney(4)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)|urinary_tract(2)	16		Breast(137;0.00328)	STAD - Stomach adenocarcinoma(5;0.00143)		Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Isotretinoin(DB00982)|Tamibarotene(DB04942)|Tazarotene(DB00799)	TGCTAATGAAGATTACTGACC	0.647			T	"""PML, ZNF145, TIF1, NUMA1, NPM1"""	APL						OREG0024394	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											Dom	yes		17	17q12	5914	"""retinoic acid receptor, alpha"""		L	1	Substitution - Missense(1)	ovary(1)	17											47.0	44.0	45.0					17																	38511642		2203	4300	6503	35765168	SO:0001583	missense	5914			X06538	CCDS11366.1, CCDS42317.1, CCDS45671.1	17q21.1	2014-01-20			ENSG00000131759	ENSG00000131759		"""Nuclear hormone receptors"""	9864	protein-coding gene	gene with protein product		180240				2825036, 8244378	Standard	NM_001145301		Approved	RAR, NR1B1	uc002huk.2	P10276	OTTHUMG00000133328	ENST00000254066.5:c.1140G>C	17.37:g.38511642G>C	ENSP00000254066:p.Lys380Asn	878	35765168	B8Y636|P78456|Q13440|Q13441|Q96S41|Q9NQS0	Missense_Mutation	SNP	HMMPfam_Hormone_recep;HMMPfam_zf-C4;superfamily_Nuclear receptor ligand-binding domain;superfamily_Glucocorticoid receptor-like (DNA-binding domain)	p.K380N	ENST00000254066.5	37	c.1140	CCDS11366.1	17	.	.	.	.	.	.	.	.	.	.	G	26.5	4.746039	0.89663	.	.	ENSG00000131759	ENST00000254066;ENST00000425707;ENST00000394089;ENST00000394086;ENST00000394081;ENST00000319149;ENST00000420042	D;D;D;D;D	0.96745	-4.11;-4.11;-4.11;-4.11;-4.11	5.31	3.32	0.38043	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.101684	0.64402	D	0.000003	D	0.98160	0.9392	M	0.91406	3.205	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.987;0.997;0.995	D	0.98192	1.0463	10	0.87932	D	0	.	10.8109	0.46547	0.1559:0.0:0.8441:0.0	.	283;375;380	B8Y636;F1D8N9;P10276	.;.;RARA_HUMAN	N	380;283;380;396;375;373;267	ENSP00000254066:K380N;ENSP00000389993:K283N;ENSP00000377649:K380N;ENSP00000377648:K396N;ENSP00000377643:K375N	ENSP00000254066:K380N	K	+	3	2	RARA	35765168	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	1.510000	0.35790	0.808000	0.34231	0.561000	0.74099	AAG	-	HMMPfam_Hormone_recep		0.647	RARA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RARA	protein_coding	OTTHUMT00000257136.2	G			35765168	1	no_errors	NM_000964	genbank	human	validated	54_36p	missense	SNP	1	C
NKIRAS2	28511	genome.wustl.edu	37	17	40174624	40174624	+	Missense_Mutation	SNP	A	A	T			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr17:40174624A>T	ENST00000307641.5	+	3	923	c.302A>T	c.(301-303)aAg>aTg	p.K101M	ZNF385C_ENST00000461831.1_5'Flank|NKIRAS2_ENST00000449471.4_Intron|NKIRAS2_ENST00000462043.2_Intron|NKIRAS2_ENST00000393884.2_Missense_Mutation_p.K99M|NKIRAS2_ENST00000393881.3_Missense_Mutation_p.K101M|NKIRAS2_ENST00000316082.4_Missense_Mutation_p.K101M|NKIRAS2_ENST00000479407.1_Nonsense_Mutation_p.R69*|NKIRAS2_ENST00000393880.1_Missense_Mutation_p.K101M|NKIRAS2_ENST00000393885.4_Missense_Mutation_p.K101M	NM_001001349.2	NP_001001349.1	Q9NYR9	KBRS2_HUMAN	NFKB inhibitor interacting Ras-like 2	101	Small GTPase-like.				I-kappaB kinase/NF-kappaB signaling (GO:0007249)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.K101M(1)		large_intestine(2)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	9		all_cancers(22;1.1e-05)|Breast(137;0.000143)|all_epithelial(22;0.000319)				GAGCTGCTCAAGAAGGAGATT	0.552																																																1	Substitution - Missense(1)	ovary(1)	17											91.0	83.0	86.0					17																	40174624		2203	4300	6503	37428150	SO:0001583	missense	28511			AF229840	CCDS11415.1, CCDS45679.1, CCDS45680.1	17q21.31	2014-05-09	2004-05-20		ENSG00000168256	ENSG00000168256			17898	protein-coding gene	gene with protein product		604497	"""NFKB inhibitor interacting Ras-like protein 2"""			10657303	Standard	NM_001001349		Approved	KBRAS2, DKFZP434N1526, kappaB-Ras2	uc002hys.3	Q9NYR9	OTTHUMG00000133503	ENST00000307641.5:c.302A>T	17.37:g.40174624A>T	ENSP00000303580:p.Lys101Met		37428150	A6NCZ5|B3KNN0|B4DNM3|Q6PK52|Q96KC7|Q9NSX1	Missense_Mutation	SNP	HMMPfam_Miro;superfamily_P-loop containing nucleoside triphosphate hydrolases	p.K101M	ENST00000307641.5	37	c.302	CCDS11415.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	35|35	5.541289|5.541289	0.96474|0.96474	.|.	.|.	ENSG00000168256|ENSG00000168256	ENST00000307641;ENST00000393884;ENST00000393880;ENST00000393881;ENST00000393885;ENST00000316082|ENST00000449471	T;T;T;T;T;T|.	0.79653|.	-1.29;-1.29;-1.29;-1.29;-1.29;-0.22|.	5.33|5.33	5.33|5.33	0.75918|0.75918	Small GTP-binding protein domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.75917|.	0.3915|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.87578|.	0.998|.	T|.	0.79451|.	-0.1798|.	9|.	0.87932|0.87932	D|D	0|0	-13.1669|-13.1669	15.5894|15.5894	0.76512|0.76512	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	101|.	Q9NYR9|.	KBRS2_HUMAN|.	M|X	101;99;101;101;101;101|69	ENSP00000303580:K101M;ENSP00000377462:K99M;ENSP00000377458:K101M;ENSP00000377459:K101M;ENSP00000377463:K101M;ENSP00000312773:K101M|.	ENSP00000303580:K101M|ENSP00000401976:R69X	K|R	+|+	2|1	0|2	NKIRAS2|NKIRAS2	37428150|37428150	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.832000|0.832000	0.47134|0.47134	9.339000|9.339000	0.96797|0.96797	2.157000|2.157000	0.67596|0.67596	0.477000|0.477000	0.44152|0.44152	AAG|AGA	-	HMMPfam_Miro		0.552	NKIRAS2-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	NKIRAS2	protein_coding	OTTHUMT00000257457.1	A	NM_017595		37428150	1	no_errors	NM_001001349	genbank	human	validated	54_36p	missense	SNP	1	T
MPO	4353	genome.wustl.edu	37	17	56351009	56351009	+	Silent	SNP	G	G	A			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr17:56351009G>A	ENST00000225275.3	-	9	1563	c.1387C>T	c.(1387-1389)Ctg>Ttg	p.L463L	MPO_ENST00000340482.3_Silent_p.L495L|MPO_ENST00000578493.1_5'Flank	NM_000250.1	NP_000241.1	P05164	PERM_HUMAN	myeloperoxidase	463					aging (GO:0007568)|defense response (GO:0006952)|defense response to fungus (GO:0050832)|hydrogen peroxide catabolic process (GO:0042744)|hypochlorous acid biosynthetic process (GO:0002149)|low-density lipoprotein particle remodeling (GO:0034374)|negative regulation of apoptotic process (GO:0043066)|negative regulation of growth of symbiont in host (GO:0044130)|oxidation-reduction process (GO:0055114)|removal of superoxide radicals (GO:0019430)|respiratory burst involved in defense response (GO:0002679)|response to food (GO:0032094)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|response to oxidative stress (GO:0006979)|response to yeast (GO:0001878)	azurophil granule (GO:0042582)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|secretory granule (GO:0030141)	chromatin binding (GO:0003682)|heme binding (GO:0020037)|heparin binding (GO:0008201)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)	p.L463L(1)		breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(8)|liver(1)|lung(13)|ovary(2)|pancreas(1)|skin(4)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	46					Aminosalicylic Acid(DB00233)|Bivalirudin(DB00006)|Calcipotriol(DB02300)|Carboplatin(DB00958)|Cefaclor(DB00833)|Cefdinir(DB00535)|Cisplatin(DB00515)|Cysteamine(DB00847)|Dapsone(DB00250)|Enoxaparin(DB01225)|Human Serum Albumin(DB00062)|L-Carnitine(DB00583)|Melatonin(DB01065)|Mesalazine(DB00244)|Nabumetone(DB00461)|Octreotide(DB00104)|Oxaliplatin(DB00526)|Propylthiouracil(DB00550)|Ticlopidine(DB00208)|Tolmetin(DB00500)	ACCAGGGGCAGGTAGTCCCGG	0.577																																																1	Substitution - coding silent(1)	ovary(1)	17											183.0	148.0	160.0					17																	56351009		2203	4300	6503	53706008	SO:0001819	synonymous_variant	4353				CCDS11604.1	17q21.3-q23	2014-09-17				ENSG00000005381	1.11.1.7		7218	protein-coding gene	gene with protein product		606989					Standard	NM_000250		Approved		uc002ivu.1	P05164		ENST00000225275.3:c.1387C>T	17.37:g.56351009G>A			53706008	A1L4B8|Q14862|Q4PJH5|Q9UCL7	Silent	SNP	HMMPfam_An_peroxidase;superfamily_Heme-dependent peroxidases	p.L463	ENST00000225275.3	37	c.1387	CCDS11604.1	17																																																																																			-	HMMPfam_An_peroxidase		0.577	MPO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MPO	protein_coding	OTTHUMT00000443971.1	G			53706008	-1	no_errors	NM_000250	genbank	human	reviewed	54_36p	silent	SNP	1	A
ERN1	2081	genome.wustl.edu	37	17	62175507	62175507	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr17:62175507C>G	ENST00000433197.3	-	2	244	c.149G>C	c.(148-150)gGc>gCc	p.G50A		NM_001433.3	NP_001424.3			endoplasmic reticulum to nucleus signaling 1									p.G50A(1)		central_nervous_system(4)|kidney(1)|lung(2)|ovary(1)|stomach(1)	9						TTTGATTGAGCCTGTCCTCTT	0.433																																																1	Substitution - Missense(1)	ovary(1)	17											124.0	121.0	122.0					17																	62175507		1986	4155	6141	59529239	SO:0001583	missense	2081			AF059198	CCDS45762.1	17q23	2011-08-12	2007-08-14			ENSG00000178607			3449	protein-coding gene	gene with protein product	"""inositol-requiring enzyme 1"""	604033	"""ER to nucleus signalling 1"""			9637683	Standard	NM_001433		Approved	IRE1, IRE1P	uc002jdz.2	O75460		ENST00000433197.3:c.149G>C	17.37:g.62175507C>G	ENSP00000401445:p.Gly50Ala		59529239		Missense_Mutation	SNP	HMMPfam_Pkinase;HMMPfam_PQQ;HMMPfam_Ribonuc_2-5A;superfamily_Protein kinase-like (PK-like);superfamily_Quinoprotein alcohol dehydrogenase-like	p.G50A	ENST00000433197.3	37	c.149	CCDS45762.1	17	.	.	.	.	.	.	.	.	.	.	C	28.4	4.917326	0.92249	.	.	ENSG00000178607	ENST00000433197	D	0.85258	-1.96	5.64	5.64	0.86602	Quinonprotein alcohol dehydrogenase-like (2);	0.000000	0.85682	D	0.000000	D	0.92734	0.7690	M	0.83312	2.635	0.80722	D	1	D	0.76494	0.999	D	0.81914	0.995	D	0.93323	0.6694	10	0.72032	D	0.01	-28.1004	16.6188	0.84924	0.0:1.0:0.0:0.0	.	50	O75460	ERN1_HUMAN	A	50	ENSP00000401445:G50A	ENSP00000401445:G50A	G	-	2	0	ERN1	59529239	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.824000	0.75288	2.669000	0.90835	0.561000	0.74099	GGC	-	HMMPfam_PQQ		0.433	ERN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERN1	protein_coding	OTTHUMT00000443734.2	C	NM_001433		59529239	-1	no_errors	NM_001433	genbank	human	reviewed	54_36p	missense	SNP	1	G
TP53	7157	genome.wustl.edu	37	17	7578400	7578400	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr17:7578400G>C	ENST00000269305.4	-	5	719	c.530C>G	c.(529-531)cCc>cGc	p.P177R	TP53_ENST00000445888.2_Missense_Mutation_p.P177R|TP53_ENST00000359597.4_Missense_Mutation_p.P177R|TP53_ENST00000420246.2_Missense_Mutation_p.P177R|TP53_ENST00000413465.2_Missense_Mutation_p.P177R|TP53_ENST00000574684.1_5'UTR|TP53_ENST00000455263.2_Missense_Mutation_p.P177R	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	177	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		CP -> FS (in a sporadic cancer; somatic mutation).|P -> A (in a sporadic cancer; somatic mutation).|P -> F (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|P -> H (in sporadic cancers; somatic mutation).|P -> I (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|P -> L (in sporadic cancers; somatic mutation).|P -> R (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|P -> S (in sporadic cancers; somatic mutation).|P -> T (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.P177R(18)|p.P177L(17)|p.P177_C182delPHHERC(8)|p.0?(8)|p.C176_R181delCPHHER(3)|p.R174fs*24(3)|p.P177H(3)|p.R175_E180delRCPHHE(3)|p.P177fs*3(2)|p.V173fs*59(2)|p.R174fs*1(2)|p.C176fs*65(1)|p.C176_P177delCP(1)|p.V173fs*69(1)|p.C176fs*68(1)|p.P177_H179delPHH(1)|p.V173fs*23(1)|p.R174_H178>S(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171fs*1(1)|p.P177fs*69(1)|p.R175_H178>X(1)|p.H168fs*69(1)|p.E171_H179delEVVRRCPHH(1)|p.P45R(1)|p.R81fs*24(1)|p.R174_E180>K(1)|p.P177I(1)|p.P177_E180delPHHE(1)|p.R42fs*24(1)|p.P84R(1)|p.R174fs*3(1)|p.E171fs*61(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CTCATGGTGGGGGCAGCGCCT	0.647		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	92	Substitution - Missense(41)|Deletion - In frame(20)|Deletion - Frameshift(20)|Whole gene deletion(8)|Complex - deletion inframe(3)	large_intestine(15)|breast(12)|upper_aerodigestive_tract(10)|skin(8)|ovary(8)|haematopoietic_and_lymphoid_tissue(7)|stomach(5)|central_nervous_system(5)|lung(4)|liver(4)|oesophagus(4)|bone(4)|pancreas(3)|prostate(3)	17											48.0	48.0	48.0					17																	7578400		2203	4300	6503	7519125	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.530C>G	17.37:g.7578400G>C	ENSP00000269305:p.Pro177Arg		7519125	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	superfamily_p53-like transcription factors;superfamily_p53 tetramerization domain;P53_tetramer;HMMPfam_P53_tetramer;P53;HMMPfam_P53;P53_TAD;HMMPfam_P53_TAD	p.P177R	ENST00000269305.4	37	c.530	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	G	24.5	4.535580	0.85812	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99885	-7.5;-7.5;-7.5;-7.5;-7.5;-7.5;-7.5;-7.5	5.59	4.61	0.57282	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.052869	0.85682	N	0.000000	D	0.99894	0.9949	M	0.90082	3.085	0.80722	D	1	D;D;D;D;P;D;D	0.89917	0.999;0.962;0.974;1.0;0.882;0.97;0.998	D;P;P;D;P;P;D	0.87578	0.99;0.79;0.86;0.998;0.78;0.867;0.978	D	0.96047	0.9028	10	0.87932	D	0	-24.4396	14.492	0.67657	0.0:0.1481:0.8519:0.0	.	138;177;177;84;177;177;177	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	R	177;177;177;177;177;177;166;84;45;84;45	ENSP00000410739:P177R;ENSP00000352610:P177R;ENSP00000269305:P177R;ENSP00000398846:P177R;ENSP00000391127:P177R;ENSP00000391478:P177R;ENSP00000425104:P45R;ENSP00000423862:P84R	ENSP00000269305:P177R	P	-	2	0	TP53	7519125	1.000000	0.71417	1.000000	0.80357	0.883000	0.51084	9.813000	0.99286	1.475000	0.48197	0.655000	0.94253	CCC	-	HMMPfam_P53		0.647	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	G	NM_000546		7519125	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	missense	SNP	1	C
COG1	9382	genome.wustl.edu	37	17	71196786	71196786	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr17:71196786C>G	ENST00000299886.4	+	6	1232	c.1152C>G	c.(1150-1152)gaC>gaG	p.D384E		NM_018714.2	NP_061184.1	Q8WTW3	COG1_HUMAN	component of oligomeric golgi complex 1	384					Golgi organization (GO:0007030)|intra-Golgi vesicle-mediated transport (GO:0006891)|protein transport (GO:0015031)	Golgi apparatus (GO:0005794)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)		p.D384E(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18			LUSC - Lung squamous cell carcinoma(166;0.197)			GAATCCGGGACGCCATGTGGG	0.498																																																1	Substitution - Missense(1)	ovary(1)	17											112.0	105.0	107.0					17																	71196786		2203	4300	6503	68708381	SO:0001583	missense	9382				CCDS11692.1	17q25.1	2008-05-14	2002-05-28	2002-05-31		ENSG00000166685		"""Components of oligomeric golgi complex"""	6545	protein-coding gene	gene with protein product		606973	"""low density lipoprotein receptor defect B complementing"""	LDLB		9927668	Standard	NM_018714		Approved	KIAA1381	uc002jjg.3	Q8WTW3		ENST00000299886.4:c.1152C>G	17.37:g.71196786C>G	ENSP00000299886:p.Asp384Glu		68708381	Q9NPV9|Q9P2G6	Missense_Mutation	SNP	-	p.D384E	ENST00000299886.4	37	c.1152	CCDS11692.1	17	.	.	.	.	.	.	.	.	.	.	C	9.350	1.065357	0.20067	.	.	ENSG00000166685	ENST00000438720;ENST00000299886	T;T	0.22539	1.95;1.95	5.53	-9.96	0.00443	.	0.096908	0.64402	D	0.000002	T	0.37919	0.1021	M	0.77616	2.38	0.42570	D	0.993178	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.75020	0.985;0.927;0.985	T	0.76599	-0.2900	10	0.15952	T	0.53	-25.3942	20.6786	0.99705	0.0:0.1774:0.0:0.8226	.	384;384;384	E9PBL8;Q8WTW3;Q4G0L8	.;COG1_HUMAN;.	E	384	ENSP00000400111:D384E;ENSP00000299886:D384E	ENSP00000299886:D384E	D	+	3	2	COG1	68708381	0.000000	0.05858	0.066000	0.19879	0.428000	0.31595	-2.180000	0.01258	-2.136000	0.00810	-0.251000	0.11542	GAC	-	NULL		0.498	COG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COG1	protein_coding	OTTHUMT00000441638.1	C			68708381	1	no_errors	NM_018714	genbank	human	reviewed	54_36p	missense	SNP	0.98	G
NAA38	84316	genome.wustl.edu	37	17	7760635	7760635	+	Intron	SNP	G	G	A			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr17:7760635G>A	ENST00000335155.5	-	1	81				LSMD1_ENST00000576861.1_Intron|LSMD1_ENST00000333775.5_Missense_Mutation_p.T36I|LSMD1_ENST00000575771.1_Intron|LSMD1_ENST00000570555.1_5'Flank|CYB5D1_ENST00000571846.1_5'Flank|LSMD1_ENST00000575208.1_Intron|LSMD1_ENST00000575071.1_Intron|LSMD1_ENST00000576384.1_5'Flank|CYB5D1_ENST00000332439.4_5'Flank|CYB5D1_ENST00000570446.1_5'Flank			Q9BRA0	LSMD1_HUMAN							negative regulation of apoptotic process (GO:0043066)	cytoplasm (GO:0005737)|NatC complex (GO:0031417)|nucleus (GO:0005634)		p.T36I(1)		endometrium(1)|lung(2)|ovary(1)	4		all_cancers(10;0.11)|Prostate(122;0.219)				GGGAGCTGCAGTTCCCCACCC	0.692																																					GBM(66;626 1401 29924 42527)											1	Substitution - Missense(1)	ovary(1)	17											20.0	27.0	24.0					17																	7760635		2197	4296	6493	7701360	SO:0001627	intron_variant	84316																														ENST00000335155.5:c.81+65C>T	17.37:g.7760635G>A			7701360	Q8N4M0	Missense_Mutation	SNP	-	p.T36I	ENST00000335155.5	37	c.107		17	.	.	.	.	.	.	.	.	.	.	G	17.14	3.314595	0.60524	.	.	ENSG00000183011	ENST00000333775	T	0.51071	0.72	5.73	5.73	0.89815	.	0.850908	0.10544	N	0.662327	T	0.69233	0.3088	.	.	.	0.80722	D	1	D	0.76494	0.999	D	0.72075	0.976	T	0.62709	-0.6797	8	.	.	.	.	15.3956	0.74790	0.0:0.0:1.0:0.0	.	36	Q9BRA0-2	.	I	36	ENSP00000332103:T36I	.	T	-	2	0	LSMD1	7701360	1.000000	0.71417	0.998000	0.56505	0.951000	0.60555	4.335000	0.59298	2.711000	0.92665	0.561000	0.74099	ACT	-	NULL		0.692	LSMD1-201	KNOWN	basic|appris_principal	protein_coding	LSMD1	protein_coding		G			7701360	-1	no_errors	NM_032356	genbank	human	provisional	54_36p	missense	SNP	1	A
RNF213	57674	genome.wustl.edu	37	17	78320139	78320139	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr17:78320139G>T	ENST00000582970.1	+	29	8147	c.8004G>T	c.(8002-8004)aaG>aaT	p.K2668N	RNF213_ENST00000508628.2_Missense_Mutation_p.K2717N|RNF213_ENST00000336301.6_Missense_Mutation_p.K741N	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	2668					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.K741N(1)		NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			TTCTCTCCAAGTCCAGCGTCA	0.532																																																1	Substitution - Missense(1)	ovary(1)	17											67.0	65.0	66.0					17																	78320139		2203	4300	6503	75934734	SO:0001583	missense	57674			AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.8004G>T	17.37:g.78320139G>T	ENSP00000464087:p.Lys2668Asn		75934734	C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Missense_Mutation	SNP	HMMPfam_zf-C3HC4,superfamily_P-loop containing nucleoside triphosphate hydrolases,superfamily_Nickel-iron hydrogenase small subunit,superfamily_RING/U-box	p.K741N	ENST00000582970.1	37	c.2223	CCDS58606.1	17	.	.	.	.	.	.	.	.	.	.	G	1.269	-0.613608	0.03690	.	.	ENSG00000173821	ENST00000508628;ENST00000411702;ENST00000336301	T	0.25250	1.81	5.37	2.3	0.28687	.	1.196700	0.05917	N	0.632790	T	0.21590	0.0520	L	0.29908	0.895	0.09310	N	1	B	0.13145	0.007	B	0.10450	0.005	T	0.31998	-0.9923	10	0.42905	T	0.14	.	9.6642	0.39974	0.2942:0.0:0.7058:0.0	.	741	Q63HN8	RN213_HUMAN	N	2668;2717;741	ENSP00000338218:K741N	ENSP00000338218:K741N	K	+	3	2	RNF213	75934734	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	0.850000	0.27737	0.242000	0.21303	0.563000	0.77884	AAG	-	NULL		0.532	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	RNF213	protein_coding	OTTHUMT00000443298.1	G	NM_020914		75934734	1	no_errors	NM_020914	genbank	human	validated	54_36p	missense	SNP	0	T
OSBPL1A	114876	genome.wustl.edu	37	18	21897130	21897130	+	Missense_Mutation	SNP	T	T	G			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	T	T	T	G	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr18:21897130T>G	ENST00000319481.3	-	11	1059	c.853A>C	c.(853-855)Act>Cct	p.T285P		NM_080597.3	NP_542164.2	Q9BXW6	OSBL1_HUMAN	oxysterol binding protein-like 1A	285	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)	cholesterol binding (GO:0015485)|phospholipid binding (GO:0005543)	p.T285P(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(16)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	36	all_cancers(21;0.000396)|all_epithelial(16;4.36e-06)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0505)|Ovarian(20;0.17)					ACTGCTTGAGTCAGGTGTTTG	0.368																																																1	Substitution - Missense(1)	ovary(1)	18											109.0	106.0	107.0					18																	21897130		2203	4300	6503	20151128	SO:0001583	missense	114876			AF392449, AF274714	CCDS11884.1, CCDS11885.1, CCDS56056.1	18q11.2	2014-06-03	2014-06-03	2014-06-03	ENSG00000141447	ENSG00000141447		"""Oxysterol binding proteins"", ""Ankyrin repeat domain containing"""	16398	protein-coding gene	gene with protein product		606730	"""oxysterol binding protein-like 1B"""	OSBPL1B		11279184, 10588946	Standard	NM_080597		Approved	ORP-1, ORP1	uc002kve.3	Q9BXW6	OTTHUMG00000131944	ENST00000319481.3:c.853A>C	18.37:g.21897130T>G	ENSP00000320291:p.Thr285Pro		20151128	B7Z7D3|Q9BZF5|Q9NW87	Missense_Mutation	SNP	HMMPfam_Oxysterol_BP;HMMPfam_Ank;superfamily_Ankyrin repeat;superfamily_PH domain-like	p.T285P	ENST00000319481.3	37	c.853	CCDS11884.1	18	.	.	.	.	.	.	.	.	.	.	T	22.7	4.319917	0.81469	.	.	ENSG00000141447	ENST00000319481	T	0.45276	0.9	5.73	5.73	0.89815	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.048710	0.85682	D	0.000000	T	0.65729	0.2719	M	0.77820	2.39	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.83275	0.996;0.991	T	0.66156	-0.5994	10	0.39692	T	0.17	-23.2478	16.0013	0.80294	0.0:0.0:0.0:1.0	.	285;285	B0YJ56;Q9BXW6	.;OSBL1_HUMAN	P	285	ENSP00000320291:T285P	ENSP00000320291:T285P	T	-	1	0	OSBPL1A	20151128	1.000000	0.71417	0.998000	0.56505	0.985000	0.73830	6.896000	0.75665	2.180000	0.69256	0.528000	0.53228	ACT	-	NULL		0.368	OSBPL1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OSBPL1A	protein_coding	OTTHUMT00000254902.1	T	NM_080597		20151128	-1	no_errors	NM_080597	genbank	human	reviewed	54_36p	missense	SNP	1	G
RIT2	6014	genome.wustl.edu	37	18	40554110	40554110	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr18:40554110C>T	ENST00000326695.5	-	3	334	c.163G>A	c.(163-165)Gat>Aat	p.D55N	RIT2_ENST00000282028.4_Missense_Mutation_p.D55N|RIT2_ENST00000589109.1_Missense_Mutation_p.D55N|RIT2_ENST00000590910.1_Missense_Mutation_p.D55N	NM_002930.2	NP_002921.1	Q99578	RIT2_HUMAN	Ras-like without CAAX 2	55					neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	nucleus (GO:0005634)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.D55N(1)		endometrium(1)|large_intestine(2)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						TTATAAGCATCTTCTGAAAAA	0.363																																																1	Substitution - Missense(1)	ovary(1)	18											70.0	60.0	64.0					18																	40554110		2203	4300	6503	38808108	SO:0001583	missense	6014			BC018060	CCDS11921.1, CCDS62431.1	18q12.3	2014-05-09	2002-09-11	2002-09-13	ENSG00000152214	ENSG00000152214			10017	protein-coding gene	gene with protein product		609592	"""Ric (Drosophila)-like, expressed in neurons"""	RIN		8824319, 8918462	Standard	NM_002930		Approved	RIBA	uc002lav.4	Q99578	OTTHUMG00000132611	ENST00000326695.5:c.163G>A	18.37:g.40554110C>T	ENSP00000321805:p.Asp55Asn		38808108	B2R9L1|O15295|Q8TD69|Q8WVF6|Q92964	Missense_Mutation	SNP	HMMPfam_Ras;superfamily_P-loop containing nucleoside triphosphate hydrolases	p.D55N	ENST00000326695.5	37	c.163	CCDS11921.1	18	.	.	.	.	.	.	.	.	.	.	C	25.8	4.676071	0.88445	.	.	ENSG00000152214	ENST00000326695;ENST00000282028	D;T	0.83335	-1.71;-1.31	5.44	5.44	0.79542	Small GTP-binding protein domain (1);	0.000000	0.64402	D	0.000006	D	0.88771	0.6527	L	0.49778	1.585	0.43381	D	0.99548	D;D	0.89917	1.0;0.994	D;D	0.85130	0.997;0.993	D	0.89143	0.3518	10	0.66056	D	0.02	.	16.3346	0.83053	0.0:1.0:0.0:0.0	.	55;55	Q99578-2;Q99578	.;RIT2_HUMAN	N	55	ENSP00000321805:D55N;ENSP00000282028:D55N	ENSP00000282028:D55N	D	-	1	0	RIT2	38808108	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.453000	0.60061	2.700000	0.92200	0.655000	0.94253	GAT	-	HMMPfam_Ras		0.363	RIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RIT2	protein_coding	OTTHUMT00000255852.1	C	NM_002930		38808108	-1	no_errors	NM_002930	genbank	human	provisional	54_36p	missense	SNP	1	T
DPY19L3	147991	genome.wustl.edu	37	19	32973053	32973053	+	Silent	SNP	G	G	A			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr19:32973053G>A	ENST00000342179.5	+	19	2273	c.2058G>A	c.(2056-2058)gaG>gaA	p.E686E	DPY19L3_ENST00000392250.2_Silent_p.E686E|DPY19L3_ENST00000586987.1_3'UTR	NM_207325.2	NP_997208.2	Q6ZPD9	D19L3_HUMAN	dpy-19-like 3 (C. elegans)	686						integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)	p.E686E(1)		breast(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(17)|ovary(4)|pancreas(1)	32	Esophageal squamous(110;0.162)					TCTGTGAAGAGATCAAAAGAA	0.458																																																1	Substitution - coding silent(1)	ovary(1)	19											167.0	168.0	168.0					19																	32973053		2203	4300	6503	37664893	SO:0001819	synonymous_variant	147991				CCDS12422.1	19q13.11	2008-02-05				ENSG00000178904			27120	protein-coding gene	gene with protein product		613894					Standard	NM_207325		Approved		uc002ntg.3	Q6ZPD9		ENST00000342179.5:c.2058G>A	19.37:g.32973053G>A			37664893	Q68DC7|Q6ZTB7|Q6ZTS2	Silent	SNP	-	p.E686	ENST00000342179.5	37	c.2058	CCDS12422.1	19																																																																																			-	NULL		0.458	DPY19L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPY19L3	protein_coding	OTTHUMT00000450311.1	G	NM_207325		37664893	1	no_errors	NM_207325	genbank	human	provisional	54_36p	silent	SNP	1	A
ANGPTL4	51129	genome.wustl.edu	37	19	8431185	8431185	+	Missense_Mutation	SNP	A	A	C			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	A	A	A	C	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr19:8431185A>C	ENST00000301455.2	+	3	700	c.529A>C	c.(529-531)Aat>Cat	p.N177H	ANGPTL4_ENST00000541807.1_Missense_Mutation_p.N10H|ANGPTL4_ENST00000393962.2_Missense_Mutation_p.N177H	NM_139314.1	NP_647475.1	Q9BY76	ANGL4_HUMAN	angiopoietin-like 4	177					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|cellular lipid metabolic process (GO:0044255)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of lipoprotein lipase activity (GO:0051005)|positive regulation of angiogenesis (GO:0045766)|protein homooligomerization (GO:0051260)|response to hypoxia (GO:0001666)|small molecule metabolic process (GO:0044281)|triglyceride homeostasis (GO:0070328)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	enzyme inhibitor activity (GO:0004857)	p.N177H(1)		large_intestine(1)|lung(1)|ovary(2)|skin(2)	6						CCCGGCTCACAATGTCAGCCG	0.637																																																1	Substitution - Missense(1)	ovary(1)	19											66.0	70.0	69.0					19																	8431185		2203	4300	6503	8337185	SO:0001583	missense	51129			AF202636	CCDS12200.1, CCDS42493.1	19p13.3	2013-10-07				ENSG00000167772		"""Fibrinogen C domain containing"""	16039	protein-coding gene	gene with protein product	"""fasting-induced adipose factor"", ""hepatic angiopoietin-related protein"", ""PPARG angiopoietin related protein"", ""hepatic fibrinogen/angiopoietin-related protein"", ""peroxisome proliferator-activated receptor (PPAR) gamma induced angiopoietin-related protein"", ""angiopoietin-related protein 4"""	605910				10698685, 10866690, 23960078	Standard	NM_139314		Approved	pp1158, PGAR, ARP4, HFARP, FIAF, NL2	uc002mjq.1	Q9BY76		ENST00000301455.2:c.529A>C	19.37:g.8431185A>C	ENSP00000301455:p.Asn177His		8337185	A8MY84|B4E089|D6W670|F5H0I2|Q53HQ6|Q53HU1|Q6UXN0|Q9HBV4|Q9NZU4|Q9Y5B3	Missense_Mutation	SNP	HMMPfam_Fibrinogen_C;superfamily_Fibrinogen C-terminal domain-like	p.N177H	ENST00000301455.2	37	c.529	CCDS12200.1	19	.	.	.	.	.	.	.	.	.	.	A	10.09	1.254507	0.22965	.	.	ENSG00000167772	ENST00000301455;ENST00000393962;ENST00000541807	T;T;T	0.57107	0.56;0.42;0.59	4.19	4.19	0.49359	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (1);	26.062600	0.00166	N	0.000000	T	0.60650	0.2285	L	0.32530	0.975	0.09310	N	1	D;D	0.67145	0.996;0.985	P;P	0.56700	0.804;0.753	T	0.50972	-0.8764	10	0.66056	D	0.02	.	9.8385	0.40985	1.0:0.0:0.0:0.0	.	177;177	A8MY84;Q9BY76	.;ANGL4_HUMAN	H	177;177;10	ENSP00000301455:N177H;ENSP00000377534:N177H;ENSP00000439833:N10H	ENSP00000301455:N177H	N	+	1	0	ANGPTL4	8337185	0.758000	0.28405	0.155000	0.22561	0.595000	0.36748	3.864000	0.56024	1.887000	0.54652	0.533000	0.62120	AAT	-	NULL		0.637	ANGPTL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANGPTL4	protein_coding	OTTHUMT00000460322.1	A	NM_139314		8337185	1	no_errors	NM_139314	genbank	human	reviewed	54_36p	missense	SNP	0.04	C
MUC16	94025	genome.wustl.edu	37	19	8993365	8993371	+	Splice_Site	DEL	CCGCTCA	CCGCTCA	-	rs7255615|rs552400788	byFrequency	TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	CCGCTCA	CCGCTCA	CCGCTCA	-	CCGCTCA	CCGCTCA	Unknown	Valid	Somatic	Phase_III	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr19:8993365_8993371delCCGCTCA	ENST00000397910.4	-	66	41920		c.e66+1		MUC16_ENST00000380951.5_Splice_Site	NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated						cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CACATCACAGCCGCTCACCATTGACAT	0.531																																																0			19																																								8854371	SO:0001630	splice_region_variant	94025			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.41716+1TGAGCGG>-	19.37:g.8993365_8993371delCCGCTCA			8854365	Q6ZQW5|Q96RK2	Splice_Site	DEL	-	e66+2	ENST00000397910.4	37	c.NULL	CCDS54212.1	19																																																																																			(deletion:intron[8854043,8854372])	-		0.531	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	protein_coding	OTTHUMT00000402806.1	CCGCTCA	NM_024690	Intron	8854371	-1	no_errors	NM_024690	genbank	human	validated	54_36p	splice_site_del	DEL	0.000:0.001:0.004:0.244:0.794:0.911:0.982	-
CCDC114	93233	genome.wustl.edu	37	19	48801337	48801337	+	Silent	SNP	G	G	A	rs141720286		TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr19:48801337G>A	ENST00000315396.7	-	12	1993	c.1311C>T	c.(1309-1311)gcC>gcT	p.A437A		NM_144577.3	NP_653178.3	Q96M63	CC114_HUMAN	coiled-coil domain containing 114	437					outer dynein arm assembly (GO:0036158)	cilium (GO:0005929)|outer dynein arm (GO:0036157)		p.A230A(1)		cervix(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|stomach(1)	24		all_epithelial(76;9.64e-05)|all_lung(116;0.000147)|Lung NSC(112;0.000251)|Prostate(7;0.0187)|all_neural(266;0.0228)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000134)|all cancers(93;0.000162)|Epithelial(262;0.0134)|GBM - Glioblastoma multiforme(486;0.0143)		GGGCAGCGTCGGCCAGGGAGG	0.692																																																1	Substitution - coding silent(1)	ovary(1)	19											41.0	42.0	42.0					19																	48801337		2203	4300	6503	53493149	SO:0001819	synonymous_variant	93233			BC025752	CCDS12714.2	19q13.32	2013-02-22			ENSG00000105479	ENSG00000105479			26560	protein-coding gene	gene with protein product		615038				23261302, 23261303	Standard	NM_144577		Approved	FLJ32926, CILD20	uc002pir.2	Q96M63	OTTHUMG00000156161	ENST00000315396.7:c.1311C>T	19.37:g.48801337G>A			53493149	Q6ZRL4|Q96M06|Q9UFG8	Silent	SNP	-	p.A230	ENST00000315396.7	37	c.690	CCDS12714.2	19																																																																																			-	NULL		0.692	CCDC114-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC114	protein_coding	OTTHUMT00000343207.1	G	NM_144577		53493149	-1	no_errors	NM_144577	genbank	human	validated	54_36p	silent	SNP		A
MYT1L	23040	genome.wustl.edu	37	2	1926084	1926084	+	Missense_Mutation	SNP	T	T	A			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr2:1926084T>A	ENST00000399161.2	-	10	2204	c.1457A>T	c.(1456-1458)cAt>cTt	p.H486L	MYT1L_ENST00000428368.2_Missense_Mutation_p.H486L	NM_015025.2	NP_055840.2	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	486					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.H486L(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(16)|lung(50)|ovary(5)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	97	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		CTTTTTGACATGGCTGTCACT	0.463																																																1	Substitution - Missense(1)	ovary(1)	2											130.0	121.0	124.0					2																	1926084		1930	4129	6059	1905091	SO:0001583	missense	23040			AF036943	CCDS46222.1	2p25.3	2013-01-10			ENSG00000186487	ENSG00000186487		"""Zinc fingers, C2HC-type containing"""	7623	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 1"""	613084				9373037	Standard	XM_006711862		Approved	KIAA1106, NZF1, ZC2HC4B	uc002qxd.3	Q9UL68	OTTHUMG00000151407	ENST00000399161.2:c.1457A>T	2.37:g.1926084T>A	ENSP00000382114:p.His486Leu		1905091	A7E2C7|B2RP54|Q6IQ17|Q9UPP6	Missense_Mutation	SNP	HMMPfam_zf-C2HC;superfamily_WD40 repeat-like;HMMPfam_MYT1;superfamily_CCHHC domain	p.H486L	ENST00000399161.2	37	c.1457		2	.	.	.	.	.	.	.	.	.	.	T	10.86	1.469342	0.26423	.	.	ENSG00000186487	ENST00000399161;ENST00000295067;ENST00000428368	T;T	0.44083	0.94;0.93	5.91	3.47	0.39725	.	0.289069	0.39909	N	0.001227	T	0.23451	0.0567	N	0.24115	0.695	0.47949	D	0.999553	P;B	0.36483	0.555;0.355	B;B	0.33799	0.17;0.107	T	0.03503	-1.1030	10	0.10636	T	0.68	-34.027	9.4351	0.38635	0.1208:0.0:0.127:0.7523	.	486;486	Q9UL68;Q9UL68-4	MYT1L_HUMAN;.	L	486;434;486	ENSP00000382114:H486L;ENSP00000396103:H486L	ENSP00000295067:H434L	H	-	2	0	MYT1L	1905091	1.000000	0.71417	1.000000	0.80357	0.544000	0.35116	4.408000	0.59761	0.457000	0.26962	-0.316000	0.08728	CAT	-	NULL		0.463	MYT1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	MYT1L	protein_coding	OTTHUMT00000322493.1	T	NM_015025		1905091	-1	no_errors	NM_015025	genbank	human	validated	54_36p	missense	SNP	1	A
MYT1L	23040	genome.wustl.edu	37	2	1926830	1926830	+	Missense_Mutation	SNP	A	A	C			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	A	A	A	C	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr2:1926830A>C	ENST00000399161.2	-	10	1458	c.711T>G	c.(709-711)agT>agG	p.S237R	MYT1L_ENST00000428368.2_Missense_Mutation_p.S237R	NM_015025.2	NP_055840.2	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	237					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.S237R(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(16)|lung(50)|ovary(5)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	97	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		CGTTTTTGTCACTATCGTCTT	0.448																																																1	Substitution - Missense(1)	ovary(1)	2											160.0	149.0	153.0					2																	1926830		1911	4126	6037	1905837	SO:0001583	missense	23040			AF036943	CCDS46222.1	2p25.3	2013-01-10			ENSG00000186487	ENSG00000186487		"""Zinc fingers, C2HC-type containing"""	7623	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 1"""	613084				9373037	Standard	XM_006711862		Approved	KIAA1106, NZF1, ZC2HC4B	uc002qxd.3	Q9UL68	OTTHUMG00000151407	ENST00000399161.2:c.711T>G	2.37:g.1926830A>C	ENSP00000382114:p.Ser237Arg		1905837	A7E2C7|B2RP54|Q6IQ17|Q9UPP6	Missense_Mutation	SNP	HMMPfam_zf-C2HC;superfamily_WD40 repeat-like;HMMPfam_MYT1;superfamily_CCHHC domain	p.S237R	ENST00000399161.2	37	c.711		2	.	.	.	.	.	.	.	.	.	.	A	7.274	0.607692	0.14002	.	.	ENSG00000186487	ENST00000399161;ENST00000295067;ENST00000428368	T;T	0.51071	0.72;0.72	6.07	-9.0	0.00747	.	0.402882	0.32533	N	0.005969	T	0.29783	0.0744	L	0.27053	0.805	0.27607	N	0.948796	P;B	0.34462	0.454;0.052	B;B	0.32805	0.153;0.018	T	0.01428	-1.1357	10	0.37606	T	0.19	-14.0431	20.2159	0.98296	0.7744:0.0:0.2256:0.0	.	237;237	Q9UL68;Q9UL68-4	MYT1L_HUMAN;.	R	237;185;237	ENSP00000382114:S237R;ENSP00000396103:S237R	ENSP00000295067:S185R	S	-	3	2	MYT1L	1905837	0.018000	0.18449	0.007000	0.13788	0.059000	0.15707	-0.665000	0.05286	-1.791000	0.01261	-0.904000	0.02843	AGT	-	NULL		0.448	MYT1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	MYT1L	protein_coding	OTTHUMT00000322493.1	A	NM_015025		1905837	-1	no_errors	NM_015025	genbank	human	validated	54_36p	missense	SNP	0.05	C
NCKAP5	344148	genome.wustl.edu	37	2	133541588	133541588	+	Silent	SNP	A	A	T			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr2:133541588A>T	ENST00000409261.1	-	14	3169	c.2796T>A	c.(2794-2796)ccT>ccA	p.P932P	NCKAP5_ENST00000473859.1_5'Flank|NCKAP5_ENST00000405974.3_Intron|NCKAP5_ENST00000317721.6_Silent_p.P932P|NCKAP5_ENST00000409213.1_Intron	NM_207363.2	NP_997246.2	O14513	NCKP5_HUMAN	NCK-associated protein 5	932	Poly-Pro.			PP -> QS (in Ref. 5; BAA22433). {ECO:0000305}.						NS(4)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(29)|lung(51)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	118						ACCTGCCTGGAGGGGGCGGAG	0.617																																																0			2											17.0	19.0	19.0					2																	133541588		1935	4108	6043	133258058	SO:0001819	synonymous_variant	344148			AB005217	CCDS46417.1, CCDS46418.1	2q21.2	2010-02-17			ENSG00000176771	ENSG00000176771			29847	protein-coding gene	gene with protein product	"""Nck associated protein 5"", ""peripheral clock protein"""	608789				9344857	Standard	NM_207363		Approved	NAP5, ERIH1, ERIH2	uc002ttp.3	O14513	OTTHUMG00000153573	ENST00000409261.1:c.2796T>A	2.37:g.133541588A>T			133258058	B8ZZL0|Q29SS9|Q29ST0|Q2NL90|Q6ZVE2|Q8NAS3	Silent	SNP	-	p.P932	ENST00000409261.1	37	c.2796	CCDS46418.1	2																																																																																			-	NULL		0.617	NCKAP5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NAP5	protein_coding	OTTHUMT00000331663.1	A	NM_207481		133258058	-1	no_errors	NM_207363	genbank	human	validated	54_36p	silent	SNP	1	T
NRP2	8828	genome.wustl.edu	37	2	206641109	206641109	+	Silent	SNP	C	C	T			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr2:206641109C>T	ENST00000357118.4	+	16	2596	c.2565C>T	c.(2563-2565)caC>caT	p.H855H	NRP2_ENST00000540178.1_Intron|NRP2_ENST00000357785.5_Intron|NRP2_ENST00000360409.3_Intron|NRP2_ENST00000540841.1_Intron|NRP2_ENST00000272849.3_Silent_p.H860H|NRP2_ENST00000412873.2_Intron	NM_201267.1	NP_957719	Q99435	NELL2_HUMAN	neuropilin 2	0						extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(14)|lung(19)|ovary(1)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	52						TGGTGCTCCACTACCACCGGT	0.657											OREG0015157	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				0			2											84.0	73.0	77.0					2																	206641109		2203	4300	6503	206349354	SO:0001819	synonymous_variant	8828			AF016098	CCDS2364.1, CCDS2365.1, CCDS46496.1, CCDS46497.1, CCDS46498.1, CCDS46499.1	2q33.3	2008-05-23			ENSG00000118257	ENSG00000118257			8005	protein-coding gene	gene with protein product		602070				9529250, 9331348	Standard	NM_003872		Approved	VEGF165R2	uc002vaw.3	O60462	OTTHUMG00000132893	ENST00000357118.4:c.2565C>T	2.37:g.206641109C>T		2161	206349354	B7Z2U7|B7Z5Q4|B7Z9J5|B7Z9U3|Q96JS2	Silent	SNP	-	p.H860	ENST00000357118.4	37	c.2580	CCDS46498.1	2																																																																																			-	NULL		0.657	NRP2-003	KNOWN	basic|CCDS	protein_coding	NRP2	protein_coding	OTTHUMT00000336465.1	C			206349354	1	no_errors	NM_018534	genbank	human	reviewed	54_36p	silent	SNP	1	T
SLC11A1	6556	genome.wustl.edu	37	2	219254616	219254616	+	Silent	SNP	C	C	T			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr2:219254616C>T	ENST00000233202.6	+	9	1159	c.819C>T	c.(817-819)cgC>cgT	p.R273R	SLC11A1_ENST00000539932.1_Silent_p.R155R	NM_000578.3	NP_000569.3	P49279	NRAM1_HUMAN	solute carrier family 11 (proton-coupled divalent metal ion transporter), member 1	273					activation of protein kinase activity (GO:0032147)|antigen processing and presentation of peptide antigen (GO:0048002)|cadmium ion transmembrane transport (GO:0070574)|cellular cadmium ion homeostasis (GO:0006876)|cellular iron ion homeostasis (GO:0006879)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|defense response to protozoan (GO:0042832)|divalent metal ion export (GO:0070839)|inflammatory response (GO:0006954)|interaction with host (GO:0051701)|interleukin-2 production (GO:0032623)|interleukin-3 production (GO:0032632)|iron ion homeostasis (GO:0055072)|iron ion transport (GO:0006826)|L-arginine import (GO:0043091)|macrophage activation (GO:0042116)|manganese ion transport (GO:0006828)|MHC class II biosynthetic process (GO:0045342)|mRNA stabilization (GO:0048255)|multicellular organismal iron ion homeostasis (GO:0060586)|negative regulation of cytokine production (GO:0001818)|nitrite transport (GO:0015707)|phagocytosis (GO:0006909)|phagosome maturation (GO:0090382)|positive regulation of cytokine production (GO:0001819)|positive regulation of dendritic cell antigen processing and presentation (GO:0002606)|positive regulation of gene expression (GO:0010628)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of phagocytosis (GO:0050766)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein import into nucleus, translocation (GO:0000060)|respiratory burst (GO:0045730)|response to bacterium (GO:0009617)|response to interferon-gamma (GO:0034341)|response to lipopolysaccharide (GO:0032496)|T cell cytokine production (GO:0002369)|T cell proliferation involved in immune response (GO:0002309)|transmembrane transport (GO:0055085)|vacuolar acidification (GO:0007035)|wound healing (GO:0042060)	cell outer membrane (GO:0009279)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|late endosome membrane (GO:0031902)|lysosome (GO:0005764)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|tertiary granule membrane (GO:0070821)	manganese ion transmembrane transporter activity (GO:0005384)|metal ion:proton antiporter activity (GO:0051139)|protein homodimerization activity (GO:0042803)|transition metal ion transmembrane transporter activity (GO:0046915)	p.R273R(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	19		Renal(207;0.0474)		Epithelial(149;1.16e-06)|all cancers(144;0.000195)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		ACCGGGCCCGCCGAGCAGACA	0.537																																																1	Substitution - coding silent(1)	ovary(1)	2											123.0	96.0	105.0					2																	219254616		2203	4300	6503	218962860	SO:0001819	synonymous_variant	6556			D38171	CCDS2415.1	2q35	2013-07-18	2013-07-18		ENSG00000018280	ENSG00000018280		"""Solute carriers"""	10907	protein-coding gene	gene with protein product	"""natural resistance-associated macrophage protein 1"""	600266		LSH, NRAMP, NRAMP1		7964458, 7980580	Standard	NM_000578		Approved		uc002vhv.3	P49279	OTTHUMG00000086747	ENST00000233202.6:c.819C>T	2.37:g.219254616C>T			218962860	C0H5Y3	Silent	SNP	HMMPfam_Nramp	p.R273	ENST00000233202.6	37	c.819	CCDS2415.1	2																																																																																			-	HMMPfam_Nramp		0.537	SLC11A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC11A1	protein_coding	OTTHUMT00000195076.2	C	NM_000578		218962860	1	no_errors	NM_000578	genbank	human	reviewed	54_36p	silent	SNP	0.01	T
ITSN2	50618	genome.wustl.edu	37	2	24433676	24433676	+	Silent	SNP	C	C	T			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr2:24433676C>T	ENST00000355123.4	-	34	4673	c.4230G>A	c.(4228-4230)gcG>gcA	p.A1410A	ITSN2_ENST00000361999.3_Silent_p.A1383A	NM_006277.2	NP_006268.2	Q9NZM3	ITSN2_HUMAN	intersectin 2	1410					endocytosis (GO:0006897)|positive regulation of signal transduction (GO:0009967)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|SH3/SH2 adaptor activity (GO:0005070)	p.A1409A(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(8)|large_intestine(11)|liver(3)|lung(28)|ovary(2)|stomach(1)	61	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ACTGCACGTGCGCCTGGATCC	0.637																																																1	Substitution - coding silent(1)	ovary(1)	2											81.0	70.0	74.0					2																	24433676		2203	4300	6503	24287180	SO:0001819	synonymous_variant	50618			AB033082	CCDS1710.2, CCDS1711.2, CCDS46230.1	2p23.3	2013-09-19	2002-10-30		ENSG00000198399	ENSG00000198399		"""Rho guanine nucleotide exchange factors"", ""EF-hand domain containing"""	6184	protein-coding gene	gene with protein product	"""SH3 domain protein 1B"", ""SH3P18-like WASP associated protein"""	604464	"""SH3 domain protein 1B"""	SH3D1B		10922467, 11748279	Standard	NM_006277		Approved	KIAA1256, SWAP, SH3P18, SWA, PRO2015	uc002rfe.2	Q9NZM3	OTTHUMG00000090818	ENST00000355123.4:c.4230G>A	2.37:g.24433676C>T			24287180	O95062|Q15812|Q9HAK4|Q9NXE6|Q9NYG0|Q9NZM2|Q9ULG4	Silent	SNP	-	p.A1409	ENST00000355123.4	37	c.4227	CCDS1710.2	2																																																																																			-	NULL		0.637	ITSN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ITSN2	protein_coding	OTTHUMT00000207620.2	C	NM_006277		24287180	-1	no_errors	NM_006277	genbank	human	reviewed	54_36p	silent	SNP	0.52	T
ATRAID	51374	genome.wustl.edu	37	2	27440863	27440863	+	IGR	SNP	G	G	C			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr2:27440863G>C	ENST00000606999.1	+	0	956				CAD_ENST00000403525.1_Missense_Mutation_p.M67I|CAD_ENST00000264705.4_Missense_Mutation_p.M67I	NM_001170795.1	NP_001164266.1	Q6UW56	ARAID_HUMAN	all-trans retinoic acid-induced differentiation factor						cell differentiation (GO:0030154)|negative regulation of cyclin catabolic process (GO:2000599)|negative regulation of osteoblast proliferation (GO:0033689)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of gene expression (GO:0010468)	integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)		p.M67I(1)									CAGATGAAATGGATGAGTTCG	0.498																																																1	Substitution - Missense(1)	ovary(1)	2											101.0	89.0	93.0					2																	27440863		2203	4300	6503	27294367	SO:0001628	intergenic_variant	790			BC021237	CCDS1741.1, CCDS46243.1, CCDS62877.1	2p23.3	2012-08-01	2012-07-30	2012-07-30	ENSG00000138085	ENSG00000138085			24090	protein-coding gene	gene with protein product	"""apoptosis-related protein 3"""		"""chromosome 2 open reading frame 28"""	C2orf28		17524364, 21723284	Standard	NM_016085		Approved	HSPC013, p18, APR3	uc002rjf.3	Q6UW56	OTTHUMG00000128405		2.37:g.27440863G>C			27294367	A8C1S2|A8K779|Q96FF6|Q96RT2|Q9Y2R7|Q9Y5L7	Missense_Mutation	SNP	HMMPfam_GATase;HMMPfam_CPSase_sm_chain;superfamily_Carbamoyl phosphate synthetase small subunit N-terminal domain;HMMPfam_CPSase_L_D2;HMMPfam_CPSase_L_D3;HMMPfam_CPSase_L_chain;superfamily_Aspartate/ornithine carbamoyltransferase;HMMPfam_OTCace;HMMPfam_OTCace_N;HMMPfam_Amidohydro_1;superfamily_Composite domain of metallo-dependent hydrolases;HMMPfam_MGS;superfamily_Carbamoyl phosphate synthetase large subunit connection domain;superfamily_Metallo-dependent hydrolases;superfamily_Class I glutamine amidotransferase-like;superfamily_Methylglyoxal synthase-like;superfamily_PreATP-grasp domain;superfamily_Glutathione synthetase ATP-binding domain-like	p.M67I	ENST00000606999.1	37	c.201		2	.	.	.	.	.	.	.	.	.	.	G	13.30	2.196040	0.38806	.	.	ENSG00000084774	ENST00000264705;ENST00000403525	D;D	0.98207	-4.79;-4.74	4.98	4.08	0.47627	Carbamoyl-phosphate synthase, small subunit, N-terminal (3);	1.038250	0.07619	N	0.926670	D	0.93194	0.7832	N	0.03016	-0.435	0.25994	N	0.982205	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	D	0.84395	0.0557	10	0.25106	T	0.35	1.1598	12.5543	0.56244	0.0833:0.0:0.9167:0.0	.	67;67	F8VPD4;P27708	.;PYR1_HUMAN	I	67	ENSP00000264705:M67I;ENSP00000384510:M67I	ENSP00000264705:M67I	M	+	3	0	CAD	27294367	0.837000	0.29446	0.986000	0.45419	0.945000	0.59286	0.940000	0.28992	2.590000	0.87494	0.430000	0.28490	ATG	-	HMMPfam_CPSase_sm_chain		0.498	ATRAID-007	NOVEL	basic|appris_principal	protein_coding	CAD	protein_coding	OTTHUMT00000470709.1	G	NM_016085		27294367	1	no_errors	NM_004341	genbank	human	reviewed	54_36p	missense	SNP	0.7	C
GTF2A1L	11036	genome.wustl.edu	37	2	48873704	48873704	+	Silent	SNP	A	A	G			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr2:48873704A>G	ENST00000403751.3	+	6	538	c.501A>G	c.(499-501)gtA>gtG	p.V167V	LHCGR_ENST00000420913.3_5'UTR|STON1-GTF2A1L_ENST00000309827.2_Silent_p.V871V|GTF2A1L_ENST00000430487.2_Silent_p.V133V|STON1-GTF2A1L_ENST00000394754.1_Silent_p.V871V|STON1-GTF2A1L_ENST00000402114.2_Silent_p.V871V|STON1-GTF2A1L_ENST00000394751.3_Silent_p.V824V|STON1-GTF2A1L_ENST00000405008.1_Silent_p.V871V	NM_006872.3	NP_006863.2	Q9UNN4	TF2AY_HUMAN	general transcription factor IIA, 1-like	167					cognition (GO:0050890)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|transcription factor TFIIA complex (GO:0005672)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)	p.V871V(1)		lung(7)	7		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			AGCCTTCAGTAATACAAACTA	0.413																																																1	Substitution - coding silent(1)	ovary(1)	2											99.0	98.0	98.0					2																	48873704		2203	4300	6503	48727208	SO:0001819	synonymous_variant	11036			AF106857	CCDS46281.1, CCDS54359.1	2p16.3	2007-08-02			ENSG00000242441	ENSG00000242441			30727	protein-coding gene	gene with protein product	"""TFIIA alpha/beta like factor"""	605358				10364255, 11889132, 16525715	Standard	NM_006872		Approved	ALF		Q9UNN4	OTTHUMG00000152038	ENST00000403751.3:c.501A>G	2.37:g.48873704A>G			48727208	B4DY14|Q53FD9|Q5D050	Silent	SNP	-	p.V871	ENST00000403751.3	37	c.2613	CCDS46281.1	2																																																																																			-	NULL		0.413	GTF2A1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTF2A1L	protein_coding	OTTHUMT00000323852.4	A	NM_006872		48727208	1	no_errors	NM_172311	genbank	human	reviewed	54_36p	silent	SNP	0.02	G
CCDC88A	55704	genome.wustl.edu	37	2	55589505	55589505	+	Missense_Mutation	SNP	A	A	G			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr2:55589505A>G	ENST00000436346.1	-	7	1407	c.566T>C	c.(565-567)cTc>cCc	p.L189P	CCDC88A_ENST00000413716.2_Missense_Mutation_p.L189P|CCDC88A_ENST00000336838.6_Missense_Mutation_p.L189P|CCDC88A_ENST00000263630.8_Missense_Mutation_p.L189P	NM_001135597.1|NM_001254943.1	NP_001129069.1|NP_001241872.1	Q3V6T2	GRDN_HUMAN	coiled-coil domain containing 88A	189					activation of protein kinase B activity (GO:0032148)|cell migration (GO:0016477)|DNA replication (GO:0006260)|lamellipodium assembly (GO:0030032)|membrane organization (GO:0061024)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell proliferation (GO:0042127)|regulation of DNA replication (GO:0006275)|regulation of neuron projection development (GO:0010975)|regulation of protein phosphorylation (GO:0001932)|TOR signaling (GO:0031929)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|membrane (GO:0016020)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|microtubule binding (GO:0008017)|phosphatidylinositol binding (GO:0035091)|protein homodimerization activity (GO:0042803)|protein kinase B binding (GO:0043422)	p.L189P(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(22)|lung(23)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|urinary_tract(1)	69						ATTTTTCAAGAGTGGTTCTAT	0.348																																																1	Substitution - Missense(1)	ovary(1)	2											106.0	103.0	104.0					2																	55589505		2203	4300	6503	55443009	SO:0001583	missense	55704			AB033038, AF112218	CCDS33203.1, CCDS46288.1, CCDS58710.1	2p16.3	2013-03-13	2007-05-31	2007-05-31	ENSG00000115355	ENSG00000115355			25523	protein-coding gene	gene with protein product	"""Galpha-interacting vesicle-associated protein"", ""Akt-phosphorylation enhancer"", ""girdin"", ""girders of actin filaments"""	609736	"""KIAA1212"""	KIAA1212		15749703, 15753085	Standard	NM_001135597		Approved	FLJ10392, APE, GIV, HkRP1, GRDN	uc002ryv.2	Q3V6T2	OTTHUMG00000151915	ENST00000436346.1:c.566T>C	2.37:g.55589505A>G	ENSP00000410608:p.Leu189Pro		55443009	A1IGE7|B7ZM78|C9JG83|Q53SF1|Q581G3|Q5HYD0|Q7Z339|Q7Z3C5	Missense_Mutation	SNP	-	p.L189P	ENST00000436346.1	37	c.566		2	.	.	.	.	.	.	.	.	.	.	A	18.59	3.656351	0.67586	.	.	ENSG00000115355	ENST00000336838;ENST00000263630;ENST00000436346;ENST00000413716;ENST00000430086	T;T;T;T;T	0.17054	2.3;2.3;2.3;2.3;2.3	4.72	3.56	0.40772	.	0.000000	0.39210	U	0.001434	T	0.39436	0.1078	M	0.78049	2.395	0.80722	D	1	D;D;D	0.76494	0.999;0.983;0.992	D;P;P	0.73708	0.981;0.851;0.843	T	0.18524	-1.0334	10	0.62326	D	0.03	-2.6162	10.3114	0.43710	0.921:0.0:0.079:0.0	.	189;189;189	B7ZM78;Q3V6T2-2;Q3V6T2-3	.;.;.	P	189;189;189;189;114	ENSP00000338728:L189P;ENSP00000263630:L189P;ENSP00000410608:L189P;ENSP00000404431:L189P;ENSP00000399237:L114P	ENSP00000263630:L189P	L	-	2	0	CCDC88A	55443009	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.725000	0.91468	0.774000	0.33427	0.533000	0.62120	CTC	-	NULL		0.348	CCDC88A-203	KNOWN	basic	protein_coding	CCDC88A	protein_coding		A	NM_017571		55443009	-1	no_errors	NM_018084	genbank	human	validated	54_36p	missense	SNP	1	G
MRPS5	64969	genome.wustl.edu	37	2	95753174	95753174	+	Silent	SNP	G	G	A			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr2:95753174G>A	ENST00000272418.2	-	12	1429	c.1221C>T	c.(1219-1221)gaC>gaT	p.D407D		NM_031902.3	NP_114108.1	P82675	RT05_HUMAN	mitochondrial ribosomal protein S5	407					translation (GO:0006412)	mitochondrion (GO:0005739)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)	p.D407D(1)		central_nervous_system(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	20						CATCTTCCCAGTCCAGTTTGA	0.572																																																1	Substitution - coding silent(1)	ovary(1)	2											104.0	94.0	98.0					2																	95753174		2203	4300	6503	95116901	SO:0001819	synonymous_variant	64969			AB049940	CCDS2010.1	2p11.2-q11.2	2012-09-13			ENSG00000144029	ENSG00000144029		"""Mitochondrial ribosomal proteins / small subunits"""	14498	protein-coding gene	gene with protein product	"""mitochondrial 28S ribosomal protein S5"""	611972					Standard	NM_031902		Approved	MRP-S5, S5mt	uc002sub.3	P82675	OTTHUMG00000130394	ENST00000272418.2:c.1221C>T	2.37:g.95753174G>A			95116901	Q4ZFY5|Q96LJ6|Q9BWI4|Q9BYC4	Silent	SNP	-	p.D407	ENST00000272418.2	37	c.1221	CCDS2010.1	2																																																																																			-	NULL		0.572	MRPS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPS5	protein_coding	OTTHUMT00000252772.1	G	NM_031902		95116901	-1	no_errors	NM_031902	genbank	human	reviewed	54_36p	silent	SNP	1	A
CAPN10	11132	genome.wustl.edu	37	2	241534125	241534125	+	Splice_Site	SNP	A	A	G			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr2:241534125A>G	ENST00000391984.2	+	6	1192	c.996A>G	c.(994-996)acA>acG	p.T332T	CAPN10_ENST00000354082.4_Splice_Site_p.T332T|CAPN10_ENST00000270364.7_Intron|CAPN10_ENST00000391982.2_Splice_Site_p.T332T|CAPN10_ENST00000352879.4_Intron|CAPN10_ENST00000404753.3_Splice_Site_p.T332T	NM_023083.3	NP_075571	Q9HC96	CAN10_HUMAN	calpain 10	332	Domain III 1.				actin cytoskeleton reorganization (GO:0031532)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to insulin stimulus (GO:0032869)|positive regulation of glucose import (GO:0046326)|positive regulation of insulin secretion (GO:0032024)|positive regulation of intracellular transport (GO:0032388)|positive regulation of type B pancreatic cell apoptotic process (GO:2000676)|proteolysis (GO:0006508)|type B pancreatic cell apoptotic process (GO:0097050)	cell (GO:0005623)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|cytoskeletal protein binding (GO:0008092)|SNARE binding (GO:0000149)	p.T332T(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(11)|ovary(3)|urinary_tract(1)	27		all_epithelial(40;1.72e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0294)|all_neural(83;0.0459)|Lung NSC(271;0.094)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;1.13e-31)|all cancers(36;3.24e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.82e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;5.1e-06)|Lung(119;0.00168)|Colorectal(34;0.00495)|LUSC - Lung squamous cell carcinoma(224;0.00813)|COAD - Colon adenocarcinoma(134;0.032)		GCCTCTACACAGGTAGTGCCC	0.662																																																1	Substitution - coding silent(1)	ovary(1)	2											51.0	50.0	51.0					2																	241534125		2203	4300	6503	241182798	SO:0001630	splice_region_variant	11132			AF089088	CCDS33420.1, CCDS42838.1	2q37.3	2008-05-22			ENSG00000142330	ENSG00000142330			1477	protein-coding gene	gene with protein product		605286				11017071, 11018080	Standard	NM_023083		Approved		uc002vzk.2	Q9HC96	OTTHUMG00000133358	ENST00000391984.2:c.997+1A>G	2.37:g.241534125A>G			241182798	A8MVS7|Q4ZFV1|Q8NCD4|Q96IG4|Q96JI2|Q9HC89|Q9HC90|Q9HC91|Q9HC92|Q9HC93|Q9HC94|Q9HC95	Silent	SNP	-	p.T332	ENST00000391984.2	37	c.996	CCDS42838.1	2																																																																																			-	NULL		0.662	CAPN10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAPN10	protein_coding	OTTHUMT00000257191.3	A	NM_023083	Silent	241182798	1	no_errors	NM_023083	genbank	human	reviewed	54_36p	silent	SNP	1	G
TMEM74B	55321	genome.wustl.edu	37	20	1162098	1162098	+	Silent	SNP	G	G	T			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr20:1162098G>T	ENST00000381894.3	-	2	836	c.165C>A	c.(163-165)acC>acA	p.T55T	TMEM74B_ENST00000481747.1_5'UTR	NM_018354.1	NP_060824.1	Q9NUR3	TM74B_HUMAN	transmembrane protein 74B	55						integral component of membrane (GO:0016021)		p.T55T(1)									CACCCTCCCTGGTTGGGGCCA	0.612																																																1	Substitution - coding silent(1)	ovary(1)	20											35.0	35.0	35.0					20																	1162098		2203	4299	6502	1110098	SO:0001819	synonymous_variant	55321			AK002052	CCDS13011.1	20p13	2011-11-23	2011-11-23	2011-11-23	ENSG00000125895	ENSG00000125895			15893	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 46"""	C20orf46			Standard	XM_005260748		Approved	FLJ11190	uc002weq.1	Q9NUR3	OTTHUMG00000031655	ENST00000381894.3:c.165C>A	20.37:g.1162098G>T			1110098	D3DVW5	Silent	SNP	-	p.T55	ENST00000381894.3	37	c.165	CCDS13011.1	20																																																																																			-	NULL		0.612	TMEM74B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C20orf46	protein_coding	OTTHUMT00000077496.2	G	NM_018354		1110098	-1	no_errors	NM_018354	genbank	human	predicted	54_36p	silent	SNP	0.29	T
RASSF2	9770	genome.wustl.edu	37	20	4770300	4770300	+	Missense_Mutation	SNP	C	C	T	rs369276882		TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr20:4770300C>T	ENST00000379400.3	-	8	776	c.581G>A	c.(580-582)cGc>cAc	p.R194H	RASSF2_ENST00000379376.2_Missense_Mutation_p.R194H|RASSF2_ENST00000478553.1_5'UTR	NM_014737.2	NP_055552.1	P50749	RASF2_HUMAN	Ras association (RalGDS/AF-6) domain family member 2	194	Ras-associating. {ECO:0000255|PROSITE- ProRule:PRU00166}.				bone remodeling (GO:0046849)|cell cycle (GO:0007049)|epidermal growth factor receptor signaling pathway via I-kappaB kinase/NF-kappaB cascade (GO:0038168)|homeostasis of number of cells (GO:0048872)|negative regulation of NIK/NF-kappaB signaling (GO:1901223)|ossification (GO:0001503)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.R194L(2)|p.R194H(1)		endometrium(3)|kidney(2)|large_intestine(8)|lung(12)|ovary(3)|pancreas(2)|prostate(2)|skin(2)	34						GCTGTTGATGCGGACGTTGGT	0.547																																					Melanoma(158;1891 3343 50738)											3	Substitution - Missense(3)	lung(2)|ovary(1)	20						C	HIS/ARG,HIS/ARG	0,4406		0,0,2203	160.0	139.0	146.0		581,581	5.0	1.0	20		146	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	RASSF2	NM_014737.2,NM_170774.1	29,29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging	194/327,194/327	4770300	1,13005	2203	4300	6503	4718300	SO:0001583	missense	9770			D79990	CCDS13083.1	20p13	2011-08-12	2008-02-22		ENSG00000101265	ENSG00000101265			9883	protein-coding gene	gene with protein product	"""centromere protein 34"""	609492				8724849, 15806169	Standard	NM_014737		Approved	KIAA0168, CENP-34	uc002wld.3	P50749	OTTHUMG00000031790	ENST00000379400.3:c.581G>A	20.37:g.4770300C>T	ENSP00000368710:p.Arg194His		4718300	A6NIX9|A8K5Z3|Q17S06|Q53HD0|Q6AHZ2|Q8IZA5	Missense_Mutation	SNP	RA;HMMPfam_RA	p.R194H	ENST00000379400.3	37	c.581	CCDS13083.1	20	.	.	.	.	.	.	.	.	.	.	C	31	5.096093	0.94197	0.0	1.16E-4	ENSG00000101265	ENST00000379400;ENST00000379376	T;T	0.18016	2.24;2.24	5.04	5.04	0.67666	Ras-association (3);	0.000000	0.85682	D	0.000000	T	0.34542	0.0901	L	0.49571	1.57	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.01972	-1.1237	10	0.15952	T	0.53	.	17.1313	0.86727	0.0:1.0:0.0:0.0	.	194	P50749	RASF2_HUMAN	H	194	ENSP00000368710:R194H;ENSP00000368684:R194H	ENSP00000368684:R194H	R	-	2	0	RASSF2	4718300	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.604000	0.82830	2.622000	0.88805	0.655000	0.94253	CGC	-	HMMPfam_RA		0.547	RASSF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RASSF2	protein_coding	OTTHUMT00000077828.1	C	NM_014737		4718300	-1	no_errors	NM_014737	genbank	human	reviewed	54_36p	missense	SNP	1	T
SLC13A3	64849	genome.wustl.edu	37	20	45239128	45239128	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr20:45239128C>A	ENST00000279027.4	-	3	516	c.498G>T	c.(496-498)aaG>aaT	p.K166N	SLC13A3_ENST00000290317.5_Missense_Mutation_p.K119N|SLC13A3_ENST00000372121.1_Missense_Mutation_p.K166N|SLC13A3_ENST00000396360.1_Missense_Mutation_p.K119N|SLC13A3_ENST00000417157.2_Missense_Mutation_p.K119N|SLC13A3_ENST00000435032.1_De_novo_Start_InFrame|SLC13A3_ENST00000472148.1_Missense_Mutation_p.K119N|SLC13A3_ENST00000495082.1_Missense_Mutation_p.K119N|SLC13A3_ENST00000413164.2_Missense_Mutation_p.K166N|SLC13A3_ENST00000339636.3_Missense_Mutation_p.K166N	NM_001193342.1|NM_022829.5	NP_001180271.1|NP_073740.2	Q8WWT9	S13A3_HUMAN	solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 3	166					transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	high-affinity sodium:dicarboxylate symporter activity (GO:0015362)	p.K166N(1)		breast(2)|endometrium(2)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31		Myeloproliferative disorder(115;0.0122)			Succinic acid(DB00139)	TTCGAACCTCCTTCTGGCCAA	0.542																																																1	Substitution - Missense(1)	ovary(1)	20											239.0	224.0	229.0					20																	45239128		2203	4300	6503	44672535	SO:0001583	missense	64849			AF154121	CCDS13400.1, CCDS42886.1, CCDS54469.1, CCDS54470.1	20q13.12	2013-05-22			ENSG00000158296	ENSG00000158296		"""Solute carriers"""	14430	protein-coding gene	gene with protein product		606411				10794676, 10992006	Standard	NM_001011554		Approved	NADC3, SDCT2	uc002xsf.2	Q8WWT9	OTTHUMG00000033042	ENST00000279027.4:c.498G>T	20.37:g.45239128C>A	ENSP00000279027:p.Lys166Asn		44672535	B4DIR8|E1P5U4|F6WI18|Q5JYC9|Q5JYD0|Q5JYD1|Q5TCQ2|Q8IVB1|Q8N8K4|Q96MM5|Q9BR25|Q9H1G1|Q9H3W4|Q9NQN5|Q9NS04	Missense_Mutation	SNP	HMMPfam_Na_sulph_symp	p.K166N	ENST00000279027.4	37	c.498	CCDS13400.1	20	.	.	.	.	.	.	.	.	.	.	C	8.085	0.773344	0.16051	.	.	ENSG00000158296	ENST00000290317;ENST00000396360;ENST00000279027;ENST00000472148;ENST00000413164;ENST00000495082;ENST00000468915;ENST00000420568;ENST00000372121;ENST00000417157;ENST00000339636	T;T;T;T;T;T;T;T;T;T;T	0.07021	3.79;3.81;4.0;3.81;4.25;3.79;3.23;4.25;4.25;4.25;4.25	5.4	2.19	0.27852	.	0.810490	0.11763	N	0.531863	T	0.07548	0.0190	N	0.16478	0.41	0.31811	N	0.627107	P;P;P;P;B	0.42161	0.772;0.677;0.677;0.737;0.25	P;B;B;B;B	0.48738	0.588;0.377;0.355;0.422;0.388	T	0.25916	-1.0118	10	0.26408	T	0.33	-5.5217	5.7913	0.18361	0.0:0.4737:0.352:0.1742	.	166;119;119;119;166	B4DIR8;Q8WWT9-3;F6WI18;C9J4A3;Q8WWT9	.;.;.;.;S13A3_HUMAN	N	119;119;166;119;166;119;119;129;166;119;166	ENSP00000290317:K119N;ENSP00000379648:K119N;ENSP00000279027:K166N;ENSP00000420177:K119N;ENSP00000415852:K166N;ENSP00000419621:K119N;ENSP00000417784:K119N;ENSP00000395095:K129N;ENSP00000361193:K166N;ENSP00000397955:K119N;ENSP00000344912:K166N	ENSP00000279027:K166N	K	-	3	2	SLC13A3	44672535	1.000000	0.71417	0.461000	0.27105	0.131000	0.20780	0.867000	0.27968	1.373000	0.46208	0.467000	0.42956	AAG	-	HMMPfam_Na_sulph_symp		0.542	SLC13A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC13A3	protein_coding	OTTHUMT00000080329.2	C			44672535	-1	no_errors	NM_022829	genbank	human	reviewed	54_36p	missense	SNP	0.88	A
SAMSN1	64092	genome.wustl.edu	37	21	15873052	15873052	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr21:15873052C>T	ENST00000400566.1	-	6	647	c.566G>A	c.(565-567)gGa>gAa	p.G189E	SAMSN1_ENST00000285670.2_Missense_Mutation_p.G257E|SAMSN1_ENST00000463807.1_5'Flank|SAMSN1_ENST00000400564.1_Missense_Mutation_p.G21E	NM_022136.4	NP_071419.3	Q9NSI8	SAMN1_HUMAN	SAM domain, SH3 domain and nuclear localization signals 1	189	SH3.				negative regulation of adaptive immune response (GO:0002820)|negative regulation of B cell activation (GO:0050869)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)	cell projection (GO:0042995)|cytosol (GO:0005829)|nucleus (GO:0005634)	phosphotyrosine binding (GO:0001784)|poly(A) RNA binding (GO:0044822)	p.G189E(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(9)|ovary(3)|pancreas(1)|prostate(3)|urinary_tract(1)	24				Epithelial(23;0.000155)|COAD - Colon adenocarcinoma(22;0.00118)|Colorectal(24;0.00961)|Lung(58;0.164)		TATGATGTCTCCTTTCTAAGG	0.348																																																1	Substitution - Missense(1)	ovary(1)	21											157.0	138.0	144.0					21																	15873052		1848	4102	5950	14794923	SO:0001583	missense	64092			AF222927	CCDS42906.1, CCDS58786.1, CCDS74774.1	21q11	2013-01-10	2006-12-13		ENSG00000155307	ENSG00000155307		"""SAM and SH3 domain containing"", ""Sterile alpha motif (SAM) domain containing"""	10528	protein-coding gene	gene with protein product	"""nuclear localization signals, SAM and SH3 domain containing 1"", ""SAM and SH3 domain containing 2"", ""hematopoietic adapter-containing SH3 and sterile &#945;-motif (SAM) domains 1"", ""Src homology domain 3 (SH3)-containing adapter protein SH3 lymphocyte protein 2"""	607978				11536050, 11594764	Standard	NM_022136		Approved	NASH1, SASH2, SH3D6B, HACS1, SLy2	uc002yjv.1	Q9NSI8	OTTHUMG00000074317	ENST00000400566.1:c.566G>A	21.37:g.15873052C>T	ENSP00000383411:p.Gly189Glu		14794923	B3KWJ3|F8WAA1|Q8NFF7|Q9C041	Missense_Mutation	SNP	superfamily_SH3-domain;superfamily_SAM/Pointed domain;HMMPfam_SAM_2;HMMPfam_SH3_2	p.G189E	ENST00000400566.1	37	c.566	CCDS42906.1	21	.	.	.	.	.	.	.	.	.	.	C	29.3	4.992161	0.93167	.	.	ENSG00000155307	ENST00000285670;ENST00000400566;ENST00000400564	T;T;T	0.58210	1.17;1.17;0.35	5.77	5.77	0.91146	Src homology-3 domain (2);Variant SH3 (1);	0.000000	0.85682	D	0.000000	D	0.84156	0.5410	H	0.98178	4.165	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.89575	0.3816	10	0.87932	D	0	-20.0316	19.9883	0.97356	0.0:1.0:0.0:0.0	.	21;257;189	Q9NSI8-2;F8WAA1;Q9NSI8	.;.;SAMN1_HUMAN	E	257;189;21	ENSP00000285670:G257E;ENSP00000383411:G189E;ENSP00000383409:G21E	ENSP00000285670:G257E	G	-	2	0	SAMSN1	14794923	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.487000	0.81328	2.717000	0.92951	0.650000	0.86243	GGA	-	HMMPfam_SH3_2		0.348	SAMSN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SAMSN1	protein_coding	OTTHUMT00000157914.1	C			14794923	-1	no_errors	NM_022136	genbank	human	validated	54_36p	missense	SNP	1	T
IGLV3-22	28795	genome.wustl.edu	37	22	23047142	23047142	+	RNA	SNP	G	G	C	rs386819979		TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr22:23047142G>C	ENST00000390307.2	+	0	244									immunoglobulin lambda variable 3-22 (gene/pseudogene)																		AGCCAGGCCAGGCCCCTGAGT	0.562																																																0			22											55.0	65.0	62.0					22																	23047142		1906	4098	6004	21377142			28795			Z73666		22q11.2	2012-02-08	2008-09-12		ENSG00000211661	ENSG00000211661		"""Immunoglobulins / IGL locus"""	5906	other	immunoglobulin gene			"""immunoglobulin lambda variable 3-22"""				Standard	NG_000002		Approved				OTTHUMG00000151229		22.37:g.23047142G>C			21377142		Missense_Mutation	SNP	-	p.Q60H	ENST00000390307.2	37	c.180		22																																																																																			-	NULL		0.562	IGLV3-22-001	KNOWN	not_best_in_genome_evidence|mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IGLV3-22	IG_V_gene	OTTHUMT00000321833.2	G	NG_000002		21377142	1	no_stop_codon	ENST00000390307	ensembl	human	known	54_36p	missense	SNP	0.88	C
PKDREJ	10343	genome.wustl.edu	37	22	46655066	46655066	+	Missense_Mutation	SNP	T	T	C			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr22:46655066T>C	ENST00000253255.5	-	1	4153	c.4154A>G	c.(4153-4155)aAt>aGt	p.N1385S		NM_006071.1	NP_006062.1	Q9NTG1	PKDRE_HUMAN	polycystin (PKD) family receptor for egg jelly	1385					acrosome reaction (GO:0007340)|calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)|neuropeptide signaling pathway (GO:0007218)|regulation of acrosome reaction (GO:0060046)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)	p.N1385S(1)		NS(2)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(4)|kidney(5)|large_intestine(21)|lung(16)|ovary(2)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)	73		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00459)		CTGGAGCCTATTGAATGTTTT	0.343																																																1	Substitution - Missense(1)	ovary(1)	22											75.0	77.0	77.0					22																	46655066		2203	4300	6503	45033730	SO:0001583	missense	10343			AF116458	CCDS14073.1	22q13.31	2013-07-31	2013-07-31		ENSG00000130943	ENSG00000130943			9015	protein-coding gene	gene with protein product		604670	"""polycystic kidney disease (polycystin) and REJ (sperm receptor for egg jelly, sea urchin homolog)-like"", ""polycystic kidney disease (polycystin) and REJ (sperm receptor for egg jelly homolog, sea urchin)-like"", ""polycystic kidney disease (polycystin) and REJ homolog (sperm receptor for egg jelly homolog, sea urchin)"""			9949214, 10591208	Standard	NM_006071		Approved		uc003bhh.3	Q9NTG1	OTTHUMG00000150493	ENST00000253255.5:c.4154A>G	22.37:g.46655066T>C	ENSP00000253255:p.Asn1385Ser		45033730	B1AJY3|O95850	Missense_Mutation	SNP	superfamily_MFS general substrate transporter;superfamily_Lipase/lipooxygenase domain (PLAT/LH2 domain);superfamily_Voltage-gated potassium channels;HMMPfam_PLAT;HMMPfam_REJ;HMMPfam_PKD_channel	p.N1385S	ENST00000253255.5	37	c.4154	CCDS14073.1	22	.	.	.	.	.	.	.	.	.	.	T	0.222	-1.027587	0.02045	.	.	ENSG00000130943	ENST00000253255	T	0.33216	1.42	5.09	-3.96	0.04106	.	0.309092	0.28803	N	0.014095	T	0.11067	0.0270	N	0.05280	-0.08	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.22521	-1.0214	10	0.20519	T	0.43	-19.4058	9.4924	0.38967	0.0:0.3897:0.4144:0.1959	.	1385	Q9NTG1	PKDRE_HUMAN	S	1385	ENSP00000253255:N1385S	ENSP00000253255:N1385S	N	-	2	0	PKDREJ	45033730	0.000000	0.05858	0.014000	0.15608	0.150000	0.21749	-2.476000	0.00986	-0.917000	0.03813	-2.038000	0.00419	AAT	-	NULL		0.343	PKDREJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKDREJ	protein_coding	OTTHUMT00000318466.1	T	NM_006071		45033730	-1	no_errors	NM_006071	genbank	human	reviewed	54_36p	missense	SNP		C
NKTR	4820	genome.wustl.edu	37	3	42678485	42678485	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr3:42678485G>A	ENST00000232978.8	+	13	1477	c.1289G>A	c.(1288-1290)cGc>cAc	p.R430H	RP4-613B23.1_ENST00000445452.1_RNA|RP4-613B23.1_ENST00000438017.1_RNA|RP4-613B23.1_ENST00000434363.1_RNA	NM_005385.3	NP_005376.2	P30414	NKTR_HUMAN	natural killer cell triggering receptor	430	Arg/Lys-rich (basic).				protein folding (GO:0006457)	membrane (GO:0016020)	cyclosporin A binding (GO:0016018)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)	p.R430H(1)		breast(3)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	41				KIRC - Kidney renal clear cell carcinoma(284;0.24)		CATAAAAAACGCAGAAAAGAA	0.378																																																1	Substitution - Missense(1)	ovary(1)	3											55.0	55.0	55.0					3																	42678485		2203	4300	6503	42653489	SO:0001583	missense	4820				CCDS2702.1	3p22.1	2014-01-20	2014-01-20		ENSG00000114857	ENSG00000114857			7833	protein-coding gene	gene with protein product	"""NK-tumor recognition protein"", ""natural-killer cells cyclophilin-related protein"", ""NK-TR protein"""	161565	"""natural killer-tumor recognition sequence"""			8314596, 8144875	Standard	XM_005265173		Approved	p104	uc003clo.3	P30414	OTTHUMG00000133037	ENST00000232978.8:c.1289G>A	3.37:g.42678485G>A	ENSP00000232978:p.Arg430His		42653489		Missense_Mutation	SNP	-	p.R430H	ENST00000232978.8	37	c.1289	CCDS2702.1	3	.	.	.	.	.	.	.	.	.	.	G	1.232	-0.623744	0.03636	.	.	ENSG00000114857	ENST00000232978	T	0.12039	2.72	5.72	1.02	0.19986	.	0.438117	0.27464	N	0.019253	T	0.04092	0.0114	N	0.02916	-0.46	0.80722	D	1	B;B	0.13145	0.007;0.001	B;B	0.04013	0.001;0.001	T	0.41893	-0.9483	10	0.06625	T	0.88	-0.5124	8.4658	0.32956	0.5879:0.0:0.4121:0.0	.	130;430	Q6M1B8;P30414	.;NKTR_HUMAN	H	430	ENSP00000232978:R430H	ENSP00000232978:R430H	R	+	2	0	NKTR	42653489	0.986000	0.35501	0.997000	0.53966	0.534000	0.34807	0.373000	0.20484	0.098000	0.17522	0.655000	0.94253	CGC	-	NULL		0.378	NKTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NKTR	protein_coding	OTTHUMT00000256642.2	G	NM_005385		42653489	1	no_errors	NM_005385	genbank	human	reviewed	54_36p	missense	SNP	1	A
ALPK1	80216	genome.wustl.edu	37	4	113353247	113353247	+	Silent	SNP	C	C	T			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr4:113353247C>T	ENST00000458497.1	+	11	2823	c.2544C>T	c.(2542-2544)gcC>gcT	p.A848A	ALPK1_ENST00000177648.9_Silent_p.A848A|ALPK1_ENST00000504176.2_Silent_p.A770A	NM_001102406.1|NM_025144.3	NP_001095876.1|NP_079420.3	Q96QP1	ALPK1_HUMAN	alpha-kinase 1	848							ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.A848A(1)		NS(1)|breast(1)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(11)|lung(20)|ovary(6)|prostate(2)|urinary_tract(1)	53		Ovarian(17;0.0446)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00325)		ACCCTGATGCCTCCACAGTGG	0.562																																																1	Substitution - coding silent(1)	ovary(1)	4											45.0	41.0	42.0					4																	113353247		2203	4300	6503	113572696	SO:0001819	synonymous_variant	80216			AY044164	CCDS3697.1, CCDS58923.1	4q26	2008-02-05			ENSG00000073331	ENSG00000073331			20917	protein-coding gene	gene with protein product	"""lymphocyte alpha-kinase"""	607347				10021370, 10819331	Standard	NM_025144		Approved	Lak, FLJ22670, KIAA1527	uc003ian.4	Q96QP1	OTTHUMG00000132911	ENST00000458497.1:c.2544C>T	4.37:g.113353247C>T			113572696	B4E3G1|F5H138|Q68CI9|Q6P9F9|Q6ZNK4|Q9P201	Silent	SNP	-	p.A848	ENST00000458497.1	37	c.2544	CCDS3697.1	4																																																																																			-	NULL		0.562	ALPK1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ALPK1	protein_coding	OTTHUMT00000256421.2	C	NM_025144		113572696	1	no_errors	NM_001102406	genbank	human	validated	54_36p	silent	SNP	0.02	T
WDR1	9948	genome.wustl.edu	37	4	10079011	10079011	+	Missense_Mutation	SNP	T	T	C			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr4:10079011T>C	ENST00000499869.2	-	14	1824	c.1631A>G	c.(1630-1632)aAt>aGt	p.N544S	WDR1_ENST00000382451.2_Missense_Mutation_p.N404S|WDR1_ENST00000382452.2_Missense_Mutation_p.N544S|MIR3138_ENST00000585238.1_RNA|WDR1_ENST00000515743.1_5'UTR|WDR1_ENST00000502702.1_Missense_Mutation_p.N404S			O75083	WDR1_HUMAN	WD repeat domain 1	544					blood coagulation (GO:0007596)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|sensory perception of sound (GO:0007605)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)		p.N545S(1)		endometrium(3)|lung(5)|ovary(2)|pancreas(1)|urinary_tract(1)	12				STAD - Stomach adenocarcinoma(129;0.000703)|Colorectal(103;0.0057)|LUSC - Lung squamous cell carcinoma(721;0.0232)		AAAGTGTTCATTGTCTGGGGA	0.517																																																1	Substitution - Missense(1)	ovary(1)	4											137.0	144.0	142.0					4																	10079011		2111	4232	6343	9688109	SO:0001583	missense	9948			AF020260	CCDS54739.1, CCDS54740.1	4p16.1	2013-01-09			ENSG00000071127	ENSG00000071127		"""WD repeat domain containing"""	12754	protein-coding gene	gene with protein product		604734				10036186	Standard	NM_017491		Approved		uc021xlv.1	O75083	OTTHUMG00000160253	ENST00000499869.2:c.1631A>G	4.37:g.10079011T>C	ENSP00000427687:p.Asn544Ser		9688109	A8K6E9|A8MPU4|O75313|Q8N6E5|Q9UG05|Q9UG78|Q9UQE0	Missense_Mutation	SNP	HMMPfam_WD40;superfamily_WD40 repeat-like	p.N544S	ENST00000499869.2	37	c.1631	CCDS54740.1	4	.	.	.	.	.	.	.	.	.	.	T	8.666	0.901662	0.17760	.	.	ENSG00000071127	ENST00000499869;ENST00000382452;ENST00000382451;ENST00000502702;ENST00000439733	T;T;T;T	0.57907	0.82;0.82;0.37;0.37	5.85	4.67	0.58626	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.54111	0.1838	N	0.16790	0.44	0.58432	D	0.999999	D;P	0.89917	1.0;0.659	D;B	0.83275	0.996;0.333	T	0.52071	-0.8624	10	0.32370	T	0.25	-50.5302	11.0798	0.48053	0.0:0.072:0.0:0.928	.	404;544	O75083-3;O75083	.;WDR1_HUMAN	S	544;544;404;404;379	ENSP00000427687:N544S;ENSP00000371890:N544S;ENSP00000371889:N404S;ENSP00000426725:N404S	ENSP00000371889:N404S	N	-	2	0	WDR1	9688109	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	5.932000	0.70121	1.044000	0.40200	0.533000	0.62120	AAT	-	HMMPfam_WD40		0.517	WDR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR1	protein_coding	OTTHUMT00000359877.1	T			9688109	-1	no_errors	NM_017491	genbank	human	reviewed	54_36p	missense	SNP	1	C
MMAA	166785	genome.wustl.edu	37	4	146546271	146546271	+	Intron	SNP	G	G	A			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr4:146546271G>A	ENST00000281317.5	+	1	1145					NM_172250.2	NP_758454.1	Q8IVH4	MMAA_HUMAN	methylmalonic aciduria (cobalamin deficiency) cblA type						cellular lipid metabolic process (GO:0044255)|cobalamin biosynthetic process (GO:0009236)|cobalamin metabolic process (GO:0009235)|fatty acid beta-oxidation (GO:0006635)|short-chain fatty acid catabolic process (GO:0019626)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	mitochondrial matrix (GO:0005759)	GTP binding (GO:0005525)|hydrolase activity (GO:0016787)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(8)|ovary(1)	17	all_hematologic(180;0.151)				Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	CAATCTGATAGGTTCATCTCA	0.443																																																0			4																																								146765721	SO:0001627	intron_variant	729497			AF524841	CCDS3766.1	4q31.1	2011-05-12	2005-07-11			ENSG00000151611			18871	protein-coding gene	gene with protein product		607481	"""methylmalonic aciduria (cobalamin deficiency) type A"""			12438653	Standard	NM_172250		Approved	cblA	uc003ikh.4	Q8IVH4		ENST00000281317.5:c.-66+5712G>A	4.37:g.146546271G>A			146765721	B3KX40|Q495G7	RNA	SNP	-	NULL	ENST00000281317.5	37	NULL	CCDS3766.1	4																																																																																			-	-		0.443	MMAA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC729497	protein_coding	OTTHUMT00000364668.2	G			146765721	-1	pseudogene	XR_015940	genbank	human	model	54_36p	rna	SNP	0.92	A
PCDHGA5	56110	genome.wustl.edu	37	5	140746157	140746157	+	Missense_Mutation	SNP	T	T	G			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	T	T	T	G	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr5:140746157T>G	ENST00000518069.1	+	1	2260	c.2260T>G	c.(2260-2262)Tcc>Gcc	p.S754A	PCDHGB2_ENST00000522605.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA4_ENST00000571252.1_Intron	NM_018918.2|NM_032054.1	NP_061741.1|NP_114443.1	Q9Y5G8	PCDG5_HUMAN	protocadherin gamma subfamily A, 5	754					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.S754A(1)		endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(5)|upper_aerodigestive_tract(3)	18			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCAGACCTATTCCCACGAGGT	0.602																																																1	Substitution - Missense(1)	ovary(1)	5											103.0	111.0	108.0					5																	140746157		2203	4300	6503	140726341	SO:0001583	missense	56110			AF152512	CCDS54925.1, CCDS75333.1	5q31	2010-01-26				ENSG00000253485		"""Cadherins / Protocadherins : Clustered"""	8703	other	protocadherin	"""cadherin ME3"""	606292				10380929	Standard	NM_018918		Approved	CDH-GAMMA-A5, ME3, PCDH-GAMMA-A5		Q9Y5G8		ENST00000518069.1:c.2260T>G	5.37:g.140746157T>G	ENSP00000429834:p.Ser754Ala		140726341	Q2M3F5|Q9Y5D2	Missense_Mutation	SNP	-	p.S754A	ENST00000518069.1	37	c.2260	CCDS54925.1	5	.	.	.	.	.	.	.	.	.	.	.	16.80	3.223505	0.58668	.	.	ENSG00000253485	ENST00000518069	T	0.47177	0.85	5.17	3.93	0.45458	.	.	.	.	.	T	0.67543	0.2904	M	0.90759	3.145	0.19945	N	0.99994	D;P	0.53885	0.963;0.861	P;P	0.55055	0.767;0.728	T	0.61917	-0.6964	9	0.56958	D	0.05	.	12.3153	0.54953	0.0:0.0:0.1404:0.8596	.	754;754	Q9Y5G8-2;Q9Y5G8	.;PCDG5_HUMAN	A	754	ENSP00000429834:S754A	ENSP00000429834:S754A	S	+	1	0	PCDHGA5	140726341	0.998000	0.40836	1.000000	0.80357	0.925000	0.55904	4.074000	0.57577	2.071000	0.62044	0.460000	0.39030	TCC	-	NULL		0.602	PCDHGA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA5	protein_coding	OTTHUMT00000374742.1	T	NM_018918		140726341	1	no_errors	NM_018918	genbank	human	reviewed	54_36p	missense	SNP	1	G
PAPD4	167153	genome.wustl.edu	37	5	78977828	78977828	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr5:78977828G>T	ENST00000296783.3	+	15	1623	c.1324G>T	c.(1324-1326)Gcc>Tcc	p.A442S	PAPD4_ENST00000428308.2_Missense_Mutation_p.A442S|PAPD4_ENST00000504233.1_Missense_Mutation_p.A399S|PAPD4_ENST00000423041.2_Missense_Mutation_p.A438S|PAPD4_ENST00000453514.1_Missense_Mutation_p.A442S			Q6PIY7	GLD2_HUMAN	PAP associated domain containing 4	442					hematopoietic progenitor cell differentiation (GO:0002244)|histone mRNA catabolic process (GO:0071044)|mRNA processing (GO:0006397)|RNA polyadenylation (GO:0043631)	cytoplasm (GO:0005737)|nuclear RNA-directed RNA polymerase complex (GO:0031380)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|polynucleotide adenylyltransferase activity (GO:0004652)	p.A442S(1)		biliary_tract(1)|breast(2)|endometrium(4)|kidney(3)|large_intestine(9)|lung(4)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	29		Lung NSC(167;0.00293)|all_lung(232;0.00323)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;8.61e-47)|Epithelial(54;1.32e-41)|all cancers(79;2.45e-36)		AACAAATACAGCCAGAGCAGT	0.318																																																1	Substitution - Missense(1)	ovary(1)	5											66.0	65.0	65.0					5																	78977828		2203	4299	6502	79013584	SO:0001583	missense	167153			AL833136	CCDS4048.1, CCDS75265.1, CCDS75266.1	5q14.1	2014-03-21			ENSG00000164329	ENSG00000164329			26776	protein-coding gene	gene with protein product	"""TUTase2"""	614121				12477932	Standard	NM_173797		Approved	FLJ38499, GLD2, TUT2	uc003kgb.2	Q6PIY7	OTTHUMG00000108163	ENST00000296783.3:c.1324G>T	5.37:g.78977828G>T	ENSP00000296783:p.Ala442Ser		79013584	Q86WZ2|Q8N927	Missense_Mutation	SNP	-	p.A442S	ENST00000296783.3	37	c.1324	CCDS4048.1	5	.	.	.	.	.	.	.	.	.	.	G	25.5	4.642820	0.87859	.	.	ENSG00000164329	ENST00000453514;ENST00000423041;ENST00000504233;ENST00000428308;ENST00000296783	T;T;T;T;T	0.60424	0.19;0.19;0.19;0.19;0.19	5.92	5.92	0.95590	.	0.207171	0.49916	D	0.000136	T	0.66336	0.2779	L	0.29908	0.895	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.996;1.0;0.996	T	0.59794	-0.7387	10	0.24483	T	0.36	-5.3854	18.4957	0.90864	0.0:0.0:1.0:0.0	.	442;438;399	Q6PIY7;Q6PIY7-2;D6RAF2	GLD2_HUMAN;.;.	S	442;438;399;442;442	ENSP00000397563:A442S;ENSP00000393412:A438S;ENSP00000421966:A399S;ENSP00000396861:A442S;ENSP00000296783:A442S	ENSP00000296783:A442S	A	+	1	0	PAPD4	79013584	1.000000	0.71417	1.000000	0.80357	0.890000	0.51754	7.336000	0.79245	2.809000	0.96659	0.467000	0.42956	GCC	-	NULL		0.318	PAPD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAPD4	protein_coding	OTTHUMT00000226967.1	G	NM_173797		79013584	1	no_errors	NM_173797	genbank	human	validated	54_36p	missense	SNP	1	T
Unknown	0	genome.wustl.edu	37	5	84845804	84845804	+	IGR	SNP	C	C	T			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr5:84845804C>T								AC026700.1 (21852 upstream) : AC010595.1 (84425 downstream)																							ATGCCGGGGACCTGGGCCGCG	0.617																																																0			5																																								84881560	SO:0001628	intergenic_variant	645181																															5.37:g.84845804C>T			84881560		RNA	SNP	-	NULL		37	NULL		5																																																																																			-	-	0	0.617					LOC645181			C			84881560	1	pseudogene	XR_017382	genbank	human	model	54_36p	rna	SNP	0.98	T
RAB5CP2	133789	genome.wustl.edu	37	5	90772463	90772464	+	IGR	INS	-	-	G			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	-	-					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr5:90772463_90772464insG								ARRDC3 (93287 upstream) : RP11-348J24.2 (722889 downstream)																							CATGTACTCTTGGGGGGGCCCA	0.55																																																0			5																																								90808220	SO:0001628	intergenic_variant	0																															5.37:g.90772470_90772470dupG			90808219		Splice_Site	INS	-	NULL		37	c.NULL		5																																																																																			-	-	0	0.550					ENSG00000213731			-			90808220	1	no_coding_region:pseudogene	ENST00000395972	ensembl	human	novel	54_36p	splice_site_ins	INS	0.983:0.990	G
PCDH12	51294	genome.wustl.edu	37	5	141331060	141331060	+	Silent	SNP	G	G	A			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr5:141331060G>A	ENST00000231484.3	-	2	4186	c.2976C>T	c.(2974-2976)agC>agT	p.S992S	AC005740.6_ENST00000607378.1_RNA	NM_016580.2	NP_057664.1	Q9NPG4	PCD12_HUMAN	protocadherin 12	992					calcium-dependent cell-cell adhesion (GO:0016339)|glycogen metabolic process (GO:0005977)|homophilic cell adhesion (GO:0007156)|labyrinthine layer development (GO:0060711)|neuron recognition (GO:0008038)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.S992S(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(3)|prostate(2)|skin(1)	38		all_hematologic(541;0.0999)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTGCTTACCTGCTGCCTCCTG	0.577											OREG0016877	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - coding silent(1)	ovary(1)	5											94.0	83.0	87.0					5																	141331060		2203	4300	6503	141311244	SO:0001819	synonymous_variant	51294			AF231025	CCDS4269.1	5q31.3	2010-01-26			ENSG00000113555	ENSG00000113555		"""Cadherins / Protocadherins : Non-clustered"""	8657	protein-coding gene	gene with protein product		605622				10716726, 10380929	Standard	NM_016580		Approved	VE-cadherin-2	uc003llx.3	Q9NPG4	OTTHUMG00000129658	ENST00000231484.3:c.2976C>T	5.37:g.141331060G>A		1663	141311244	Q6UXB6|Q96KB8|Q9H7Y6|Q9H8E0	Silent	SNP	-	p.S992	ENST00000231484.3	37	c.2976	CCDS4269.1	5																																																																																			-	NULL		0.577	PCDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDH12	protein_coding	OTTHUMT00000251858.1	G	NM_016580		141311244	-1	no_errors	NM_016580	genbank	human	reviewed	54_36p	silent	SNP	1	A
GCNT2	2651	genome.wustl.edu	37	6	10529538	10529546	+	In_Frame_Del	DEL	GCGACGGAT	GCGACGGAT	-	rs377718959|rs535220376		TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	GCGACGGAT	GCGACGGAT	GCGACGGAT	-	GCGACGGAT	GCGACGGAT	Unknown	Valid	Somatic	Phase_III	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr6:10529538_10529546delGCGACGGAT	ENST00000379597.3	+	1	950_958	c.394_402delGCGACGGAT	c.(394-402)gcgacggatdel	p.ATD132del	GCNT2_ENST00000397423.2_Intron|GCNT2_ENST00000410107.1_Intron|GCNT2_ENST00000495262.1_In_Frame_Del_p.ATD132del			Q8N0V5	GNT2A_HUMAN	glucosaminyl (N-acetyl) transferase 2, I-branching enzyme (I blood group)	132					maintenance of lens transparency (GO:0036438)|negative regulation of cell-substrate adhesion (GO:0010812)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of protein kinase B signaling (GO:0051897)|posttranscriptional regulation of gene expression (GO:0010608)|protein glycosylation (GO:0006486)|transforming growth factor beta receptor signaling pathway (GO:0007179)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	N-acetyllactosaminide beta-1,6-N-acetylglucosaminyltransferase activity (GO:0008109)			endometrium(2)|kidney(1)|large_intestine(5)|lung(2)|ovary(2)	12	Ovarian(93;0.107)|Breast(50;0.148)	all_hematologic(90;0.107)		KIRC - Kidney renal clear cell carcinoma(1;0.099)|Kidney(1;0.119)		GGATCAGAAGGCGACGGATGCCTTTAAAG	0.498																																																0			6																																								10637532	SO:0001651	inframe_deletion	2651			L41605	CCDS4512.1, CCDS4513.1, CCDS34338.1	6p24.2	2014-07-18	2006-02-23		ENSG00000111846	ENSG00000111846	2.4.1.150	"""Blood group antigens"", ""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	4204	protein-coding gene	gene with protein product	"""Ii blood group"", ""unassigned linkage group 3"""	600429	"""glucosaminyl (N-acetyl) transferase 5"", ""glucosaminyl (N-acetyl) transferase 2, I-branching enzyme"", ""glucosaminyl (N-acetyl) transferase 2, I-branching enzyme (Ii blood group)"", ""cataract, congenital"""	NACGT1, II, GCNT5, CCAT		8449405, 9915862	Standard	NM_145649		Approved	IGNT, NAGCT1, bA421M1.1, bA360O19.2, ULG3	uc003mze.3	Q06430	OTTHUMG00000014244	ENST00000379597.3:c.394_402delGCGACGGAT	6.37:g.10529538_10529546delGCGACGGAT	ENSP00000368917:p.Ala132_Asp134del		10637524		In_Frame_Del	DEL	HMMPfam_Branch	p.TDA133in_frame_del	ENST00000379597.3	37	c.394_402	CCDS34338.1	6																																																																																			(deletion:cds_exon[10637131,10638055])	HMMPfam_Branch		0.498	GCNT2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GCNT2	protein_coding	OTTHUMT00000327912.3	GCGACGGAT	NM_145649		10637532	1	no_errors	NM_145649	genbank	human	reviewed	54_36p	in_frame_del	DEL	0.997:0.983:0.000:0.000:0.001:0.000:0.000:0.000:0.000	-
ZDHHC14	79683	genome.wustl.edu	37	6	158074597	158074597	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr6:158074597C>G	ENST00000359775.5	+	8	1895	c.1006C>G	c.(1006-1008)Cag>Gag	p.Q336E	ZDHHC14_ENST00000414563.2_Missense_Mutation_p.Q336E|ZDHHC14_ENST00000341375.8_3'UTR			Q8IZN3	ZDH14_HUMAN	zinc finger, DHHC-type containing 14	336					protein palmitoylation (GO:0018345)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)	p.Q336E(1)		central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(8)|ovary(1)|skin(1)	17		Breast(66;0.00586)|Ovarian(120;0.123)		OV - Ovarian serous cystadenocarcinoma(65;2.9e-17)|BRCA - Breast invasive adenocarcinoma(81;5.8e-05)		CGACACGCCGCAGCCAGCAGC	0.582																																																1	Substitution - Missense(1)	ovary(1)	6											78.0	69.0	72.0					6																	158074597		2203	4300	6503	157994585	SO:0001583	missense	79683			AF542388	CCDS5252.1, CCDS47510.1	6q25.3	2008-05-02			ENSG00000175048	ENSG00000175048		"""Zinc fingers, DHHC-type"""	20341	protein-coding gene	gene with protein product							Standard	NM_024630		Approved	FLJ20984, NEW1CP	uc003qqt.3	Q8IZN3	OTTHUMG00000015896	ENST00000359775.5:c.1006C>G	6.37:g.158074597C>G	ENSP00000352821:p.Gln336Glu		157994585	A6NDB7|Q5JS07|Q5JS08|Q6PHS4|Q8IZN2|Q9H7F1	Missense_Mutation	SNP	-	p.Q336E	ENST00000359775.5	37	c.1006	CCDS5252.1	6	.	.	.	.	.	.	.	.	.	.	C	11.13	1.549273	0.27652	.	.	ENSG00000175048	ENST00000359775;ENST00000414563;ENST00000538483	T;T	0.46451	0.88;0.87	5.29	5.29	0.74685	.	0.622757	0.16039	N	0.232514	T	0.18299	0.0439	L	0.47716	1.5	0.54753	D	0.999985	B;B	0.19706	0.038;0.019	B;B	0.20955	0.032;0.032	T	0.28490	-1.0042	10	0.05525	T	0.97	-9.9553	17.7178	0.88342	0.0:1.0:0.0:0.0	.	336;336	Q8IZN3;Q8IZN3-2	ZDH14_HUMAN;.	E	336;336;340	ENSP00000352821:Q336E;ENSP00000410713:Q336E	ENSP00000352821:Q336E	Q	+	1	0	ZDHHC14	157994585	1.000000	0.71417	0.982000	0.44146	0.659000	0.38960	6.815000	0.75242	0.842000	0.35045	0.460000	0.39030	CAG	-	NULL		0.582	ZDHHC14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDHHC14	protein_coding	OTTHUMT00000042841.2	C	NM_153746		157994585	1	no_errors	NM_024630	genbank	human	provisional	54_36p	missense	SNP	1	G
HIST1H3H	8357	genome.wustl.edu	37	6	27777876	27777876	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr6:27777876C>G	ENST00000369163.2	+	1	35	c.25C>G	c.(25-27)Cgc>Ggc	p.R9G	HIST1H2BL_ENST00000377401.2_5'Flank	NM_003536.2	NP_003527.1	P68431	H31_HUMAN	histone cluster 1, H3h	9					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)	p.R9G(1)		haematopoietic_and_lymphoid_tissue(1)|lung(4)|ovary(2)|upper_aerodigestive_tract(3)	10						GCAGACTGCTCGCAAGTCCAC	0.587																																																1	Substitution - Missense(1)	ovary(1)	6											42.0	47.0	45.0					6																	27777876		2201	4299	6500	27885855	SO:0001583	missense	8357			Z83735	CCDS4627.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000203813	ENSG00000278828		"""Histones / Replication-dependent"""	4775	protein-coding gene	gene with protein product		602818	"""H3 histone family, member K"", ""histone 1, H3h"""	H3FK		9439656, 12408966	Standard	NM_003536		Approved	H3/k, H3F1K	uc003njm.3	P68431	OTTHUMG00000014483	ENST00000369163.2:c.25C>G	6.37:g.27777876C>G	ENSP00000358160:p.Arg9Gly		27885855	A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Missense_Mutation	SNP	-	p.R9G	ENST00000369163.2	37	c.25	CCDS4627.1	6	.	.	.	.	.	.	.	.	.	.	.	11.05	1.525016	0.27299	.	.	ENSG00000203813	ENST00000369163	T	0.48522	0.81	4.18	4.18	0.49190	.	.	.	.	.	T	0.57858	0.2082	.	.	.	0.46499	D	0.999074	.	.	.	.	.	.	T	0.65134	-0.6242	6	0.87932	D	0	.	16.3581	0.83244	0.0:1.0:0.0:0.0	.	.	.	.	G	9	ENSP00000358160:R9G	ENSP00000358160:R9G	R	+	1	0	HIST1H3H	27885855	1.000000	0.71417	0.926000	0.36857	0.245000	0.25701	7.462000	0.80851	2.258000	0.74832	0.655000	0.94253	CGC	-	NULL		0.587	HIST1H3H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H3H	protein_coding	OTTHUMT00000040151.1	C	NM_003536		27885855	1	no_errors	NM_003536	genbank	human	reviewed	54_36p	missense	SNP	1	G
HIST1H4J	8363	genome.wustl.edu	37	6	27792189	27792189	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr6:27792189G>T	ENST00000355057.1	+	1	306	c.287G>T	c.(286-288)cGc>cTc	p.R96L		NM_021968.3	NP_068803.1	P62805	H4_HUMAN	histone cluster 1, H4j	96					CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of megakaryocyte differentiation (GO:0045653)|nucleosome assembly (GO:0006334)|telomere maintenance (GO:0000723)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|histone demethylase activity (H4-K20 specific) (GO:0035575)|poly(A) RNA binding (GO:0044822)	p.R96L(1)		lung(2)|ovary(1)|pancreas(1)	4						CGCCAGGGCCGCACCCTCTAC	0.577																																																1	Substitution - Missense(1)	ovary(1)	6											26.0	28.0	27.0					6																	27792189		2202	4291	6493	27900168	SO:0001583	missense	8363			J00188	CCDS4630.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000197238	ENSG00000197238		"""Histones / Replication-dependent"""	4785	protein-coding gene	gene with protein product		602826	"""H4 histone family, member E"", ""histone 1, H4j"""	H4FE		6265100, 9439656, 12408966	Standard	NM_021968		Approved	H4/e, H4F2iv	uc003njp.3	P62805	OTTHUMG00000014487	ENST00000355057.1:c.287G>T	6.37:g.27792189G>T	ENSP00000347168:p.Arg96Leu		27900168	A2VCL0|P02304|P02305|Q6DRA9|Q6FGB8|Q6NWP7	Missense_Mutation	SNP	-	p.R96L	ENST00000355057.1	37	c.287	CCDS4630.1	6	.	.	.	.	.	.	.	.	.	.	.	22.7	4.326957	0.81690	.	.	ENSG00000197238	ENST00000355057	.	.	.	3.93	3.93	0.45458	.	0.000000	0.64402	U	0.000001	T	0.67363	0.2885	.	.	.	0.50039	D	0.999847	.	.	.	.	.	.	T	0.73036	-0.4109	6	0.87932	D	0	.	13.9744	0.64262	0.0:0.0:1.0:0.0	.	.	.	.	L	96	.	ENSP00000347168:R96L	R	+	2	0	HIST1H4J	27900168	1.000000	0.71417	0.997000	0.53966	0.352000	0.29268	9.241000	0.95402	2.134000	0.65973	0.585000	0.79938	CGC	-	NULL		0.577	HIST1H4J-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H4J	protein_coding	OTTHUMT00000040155.1	G	NM_021968		27900168	1	no_errors	NM_021968	genbank	human	reviewed	54_36p	missense	SNP	1	T
HLA-G	3135	genome.wustl.edu	37	6	29797709	29797709	+	Splice_Site	SNP	G	G	T			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr6:29797709G>T	ENST00000360323.6	+	5	1036	c.1012G>T	c.(1012-1014)Gat>Tat	p.D338Y	HLA-G_ENST00000376818.3_Splice_Site_p.D246Y|HLA-G_ENST00000428701.1_Splice_Site_p.D338Y|HLA-G_ENST00000376828.2_Splice_Site_p.D343Y|HLA-G_ENST00000376815.3_Splice_Site_p.D154Y			P17693	HLAG_HUMAN	major histocompatibility complex, class I, G	338					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular defense response (GO:0006968)|cytokine-mediated signaling pathway (GO:0019221)|immune response-inhibiting cell surface receptor signaling pathway (GO:0002767)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of dendritic cell differentiation (GO:2001199)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of regulatory T cell differentiation (GO:0045591)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|positive regulation of T cell tolerance induction (GO:0002666)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)	early endosome membrane (GO:0031901)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|membrane (GO:0016020)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	peptide antigen binding (GO:0042605)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)	p.D338Y(1)		central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(4)|ovary(3)|pancreas(1)|prostate(5)|skin(1)	21						GAAGAGCTCAGGTAAGGAAGG	0.567																																																1	Substitution - Missense(1)	ovary(1)	6											73.0	68.0	69.0					6																	29797709		2203	4300	6503	29905688	SO:0001630	splice_region_variant	3135				CCDS4668.1	6p21.3	2013-01-11	2007-12-12		ENSG00000204632	ENSG00000204632		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4964	protein-coding gene	gene with protein product	"""b2 microglobulin"""	142871	"""HLA-G histocompatibility antigen, class I, G"""				Standard	NM_002127		Approved		uc003nnw.2	P17693	OTTHUMG00000031157	ENST00000360323.6:c.1012+1G>T	6.37:g.29797709G>T			29905688		Missense_Mutation	SNP	-	p.D338Y	ENST00000360323.6	37	c.1012	CCDS4668.1	6	.	.	.	.	.	.	.	.	.	.	.	13.09	2.133573	0.37630	.	.	ENSG00000204632	ENST00000376828;ENST00000428701;ENST00000360323;ENST00000376818;ENST00000376815	T;T;T;T;T	0.00958	5.8;5.77;5.77;5.56;5.5	2.23	2.23	0.28157	.	.	.	.	.	T	0.01905	0.0060	M	0.77616	2.38	0.20975	N	0.999817	P;D;P;D	0.89917	0.842;1.0;0.842;1.0	B;D;B;D	0.91635	0.144;0.999;0.144;0.998	T	0.43245	-0.9403	9	0.87932	D	0	.	8.1654	0.31224	0.0:0.0:1.0:0.0	.	154;343;246;338	Q29897;Q5RJ85;Q31611;P17693	.;.;.;HLAG_HUMAN	Y	343;338;338;246;154	ENSP00000366024:D343Y;ENSP00000412927:D338Y;ENSP00000353472:D338Y;ENSP00000366014:D246Y;ENSP00000366011:D154Y	ENSP00000353472:D338Y	D	+	1	0	HLA-G	29905688	0.079000	0.21365	0.052000	0.19188	0.057000	0.15508	0.699000	0.25586	0.948000	0.37687	0.291000	0.19559	GAT	-	NULL		0.567	HLA-G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLA-G	protein_coding	OTTHUMT00000076286.2	G	NM_002127	Missense_Mutation	29905688	1	no_errors	NM_002127	genbank	human	reviewed	54_36p	missense	SNP	1	T
PRRC2A	7916	genome.wustl.edu	37	6	31594906	31594906	+	Silent	SNP	C	C	G			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr6:31594906C>G	ENST00000376033.2	+	11	1455	c.1221C>G	c.(1219-1221)gcC>gcG	p.A407A	PRRC2A_ENST00000376007.4_Silent_p.A407A	NM_004638.3	NP_004629.3	P48634	PRC2A_HUMAN	proline-rich coiled-coil 2A	407	2 X type B repeats.|4 X 57 AA type A repeats.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.A407A(1)		breast(6)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|lung(19)|ovary(3)|pancreas(2)|prostate(4)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	70						GACCTCCTGCCCCAAAGCCTC	0.652																																																1	Substitution - coding silent(1)	ovary(1)	6											22.0	24.0	24.0					6																	31594906		2203	4300	6503	31702885	SO:0001819	synonymous_variant	7916			M31293	CCDS4708.1	6p21.3	2010-12-09	2010-12-09	2010-12-09	ENSG00000204469	ENSG00000204469			13918	protein-coding gene	gene with protein product		142580	"""HLA-B associated transcript 2"""	BAT2		2156268, 8499947	Standard	NM_080686		Approved	G2, D6S51E	uc003nvc.4	P48634	OTTHUMG00000031168	ENST00000376033.2:c.1221C>G	6.37:g.31594906C>G			31702885	B0UX77|B0UZE9|B0UZL3|O95875|Q05BK4|Q4LE37|Q5SQ29|Q5SQ30|Q5ST84|Q5STX6|Q5STX7|Q68DW9|Q6P9P7|Q6PIN1|Q8MGQ9|Q96QC6	Silent	SNP	HMMPfam_BAT2_N	p.A407	ENST00000376033.2	37	c.1221	CCDS4708.1	6																																																																																			-	NULL		0.652	PRRC2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	BAT2	protein_coding	OTTHUMT00000259319.1	C	NM_080686		31702885	1	no_errors	NM_080686	genbank	human	reviewed	54_36p	silent	SNP	1	G
TAPBP	6892	genome.wustl.edu	37	6	33272224	33272224	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr6:33272224G>A	ENST00000489157.1	-	4	1011	c.799C>T	c.(799-801)Cac>Tac	p.H267Y	TAPBP_ENST00000475304.1_Missense_Mutation_p.H372Y|TAPBP_ENST00000456592.2_Missense_Mutation_p.H354Y|TAPBP_ENST00000426633.2_Missense_Mutation_p.H354Y|TAPBP_ENST00000434618.2_Missense_Mutation_p.H354Y			O15533	TPSN_HUMAN	TAP binding protein (tapasin)	354					amide transport (GO:0042886)|antigen processing and presentation of endogenous peptide antigen via MHC class I (GO:0019885)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|immune response (GO:0006955)|peptide antigen stabilization (GO:0050823)|peptide transport (GO:0015833)|protein complex assembly (GO:0006461)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|integral component of membrane (GO:0016021)|MHC class I peptide loading complex (GO:0042824)	MHC class I protein binding (GO:0042288)|peptide antigen binding (GO:0042605)|peptide antigen-transporting ATPase activity (GO:0015433)|TAP1 binding (GO:0046978)|TAP2 binding (GO:0046979)|unfolded protein binding (GO:0051082)	p.H354Y(1)		endometrium(2)|large_intestine(5)|lung(8)|ovary(3)	18						TCGGAATGGTGGCGCAGGGCC	0.672																																																1	Substitution - Missense(1)	ovary(1)	6											27.0	30.0	29.0					6																	33272224		2202	4299	6501	33380202	SO:0001583	missense	6892			Y13582	CCDS34426.1, CCDS34427.1, CCDS34428.1, CCDS34427.2, CCDS34428.2	6p21.3	2014-09-17			ENSG00000231925	ENSG00000231925		"""Immunoglobulin superfamily / C1-set domain containing"""	11566	protein-coding gene	gene with protein product		601962				9238042	Standard	NM_003190		Approved	TAPA	uc003odz.3	O15533	OTTHUMG00000031090	ENST00000489157.1:c.799C>T	6.37:g.33272224G>A	ENSP00000419659:p.His267Tyr		33380202	A2AB91|A2ABC0|B0V003|B0V0A6|B2ZUA4|E9PGM2|O15210|O15272|Q5STJ8|Q5STK6|Q5STQ5|Q5STQ6|Q66K65|Q96KK7|Q9HAN8|Q9UEE0|Q9UEE4|Q9UIZ6|Q9Y6K2	Missense_Mutation	SNP	-	p.H354Y	ENST00000489157.1	37	c.1060	CCDS34427.2	6	.	.	.	.	.	.	.	.	.	.	G	16.44	3.124791	0.56613	.	.	ENSG00000231925	ENST00000434618;ENST00000475304;ENST00000489157;ENST00000426633;ENST00000456592;ENST00000449540	T;T;T;T;T	0.16457	2.34;2.34;2.34;2.34;2.34	5.51	3.48	0.39840	Immunoglobulin-like (1);Immunoglobulin C1-set (1);Immunoglobulin-like fold (1);	0.280380	0.38663	N	0.001606	T	0.05960	0.0155	L	0.36672	1.1	0.27136	N	0.961776	B;P;B;B;B	0.51933	0.003;0.949;0.005;0.003;0.004	B;P;B;B;B	0.46659	0.003;0.523;0.006;0.003;0.005	T	0.18713	-1.0328	10	0.30854	T	0.27	-17.3499	5.4805	0.16721	0.276:0.0:0.724:0.0	.	354;267;372;354;354	G5E9H8;E9PGM2;A2AB90;O15533-3;O15533	.;.;.;.;TPSN_HUMAN	Y	354;372;267;354;354;354	ENSP00000395701:H354Y;ENSP00000417949:H372Y;ENSP00000419659:H267Y;ENSP00000404833:H354Y;ENSP00000387803:H354Y	ENSP00000404833:H354Y	H	-	1	0	TAPBP	33380202	0.984000	0.35163	0.856000	0.33681	0.814000	0.46013	1.769000	0.38522	1.343000	0.45638	0.498000	0.49722	CAC	-	NULL		0.672	TAPBP-006	NOVEL	basic|exp_conf|CCDS	protein_coding	TAPBP	protein_coding	OTTHUMT00000276425.2	G			33380202	-1	no_errors	NM_003190	genbank	human	reviewed	54_36p	missense	SNP	0.29	A
C6orf222	389384	genome.wustl.edu	37	6	36297864	36297864	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr6:36297864G>C	ENST00000437635.2	-	2	781	c.604C>G	c.(604-606)Cgc>Ggc	p.R202G		NM_001010903.4	NP_001010903.3	P0C671	CF222_HUMAN	chromosome 6 open reading frame 222	202								p.R202G(1)		breast(4)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|skin(4)|urinary_tract(4)	26						TCACCCCTGCGAGCTGGGCCC	0.642																																																1	Substitution - Missense(1)	ovary(1)	6											54.0	54.0	54.0					6																	36297864		2203	4300	6503	36405842	SO:0001583	missense	389384				CCDS34439.1	6p21.31	2012-02-22			ENSG00000189325	ENSG00000189325			33769	protein-coding gene	gene with protein product							Standard	NM_001010903		Approved	DKFZp779B1540	uc003oly.3	P0C671	OTTHUMG00000014591	ENST00000437635.2:c.604C>G	6.37:g.36297864G>C	ENSP00000418983:p.Arg202Gly		36405842	B2RTY8	Missense_Mutation	SNP	-	p.R202G	ENST00000437635.2	37	c.604	CCDS34439.1	6	.	.	.	.	.	.	.	.	.	.	G	4.911	0.169292	0.09339	.	.	ENSG00000189325	ENST00000437635	T	0.42900	0.96	4.35	-0.585	0.11698	.	1.683590	0.03348	N	0.195779	T	0.08714	0.0216	N	0.22421	0.69	0.09310	N	1	B	0.23377	0.084	B	0.20767	0.031	T	0.10405	-1.0631	10	0.13470	T	0.59	-40.4977	4.031	0.09710	0.3012:0.4073:0.2915:0.0	.	202	P0C671	CF222_HUMAN	G	202	ENSP00000418983:R202G	ENSP00000418983:R202G	R	-	1	0	C6orf222	36405842	0.000000	0.05858	0.000000	0.03702	0.233000	0.25261	-0.753000	0.04792	0.084000	0.17077	0.442000	0.29010	CGC	-	NULL		0.642	C6orf222-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C6orf222	protein_coding	OTTHUMT00000040338.2	G	NM_001010903		36405842	-1	no_errors	NM_001010903	genbank	human	predicted	54_36p	missense	SNP		C
LPA	4018	genome.wustl.edu	37	6	161010635	161010635	+	Silent	SNP	G	G	T	rs201133663		TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr6:161010635G>T	ENST00000316300.5	-	24	3941	c.3897C>A	c.(3895-3897)tcC>tcA	p.S1299S	LPA_ENST00000447678.1_Silent_p.S1299S			P08519	APOA_HUMAN	lipoprotein, Lp(a)	3807	Kringle 12. {ECO:0000255|PROSITE- ProRule:PRU00121}.				blood circulation (GO:0008015)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|negative regulation of endopeptidase activity (GO:0010951)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|plasma lipoprotein particle (GO:0034358)	apolipoprotein binding (GO:0034185)|endopeptidase inhibitor activity (GO:0004866)|fibronectin binding (GO:0001968)|heparin binding (GO:0008201)|serine-type endopeptidase activity (GO:0004252)	p.S1299S(1)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|lung(54)|ovary(4)|pancreas(1)|prostate(2)|skin(10)|stomach(1)|urinary_tract(1)	107		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	Aminocaproic Acid(DB00513)	GTGTCATAGAGGACCAAGACT	0.478																																																1	Substitution - coding silent(1)	ovary(1)	6											162.0	167.0	165.0					6																	161010635		2170	4294	6464	160930625	SO:0001819	synonymous_variant	4018			X06290	CCDS43523.1	6q25-q26	2012-10-02			ENSG00000198670	ENSG00000198670			6667	protein-coding gene	gene with protein product		152200		LP		3670400	Standard	NM_005577		Approved		uc003qtl.3	P08519	OTTHUMG00000015956	ENST00000316300.5:c.3897C>A	6.37:g.161010635G>T			160930625	Q5VTD7|Q9UD88	Silent	SNP	-	p.S1299	ENST00000316300.5	37	c.3897	CCDS43523.1	6																																																																																			-	NULL		0.478	LPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPA	protein_coding	OTTHUMT00000042957.1	G	NM_005577		160930625	-1	no_errors	NM_005577	genbank	human	validated	54_36p	silent	SNP	0.64	T
MUC17	140453	genome.wustl.edu	37	7	100663431	100663431	+	Silent	SNP	G	G	A			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr7:100663431G>A	ENST00000306151.4	+	1	79	c.15G>A	c.(13-15)ggG>ggA	p.G5G	RP11-395B7.4_ENST00000441882.1_RNA|RP11-395B7.4_ENST00000448513.1_RNA	NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	5					cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)	p.G5G(1)		NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					CAAGGCCAGGGACCATGGCGC	0.597																																																1	Substitution - coding silent(1)	ovary(1)	7											110.0	80.0	90.0					7																	100663431		2203	4300	6503	100450151	SO:0001819	synonymous_variant	140453			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.15G>A	7.37:g.100663431G>A			100450151	O14761|Q685J2|Q8TDH7	Silent	SNP	HMMPfam_SEA;superfamily_EGF/Laminin;superfamily_SEA domain	p.G5	ENST00000306151.4	37	c.15	CCDS34711.1	7																																																																																			-	NULL		0.597	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC17	protein_coding	OTTHUMT00000347161.1	G	NM_001040105		100450151	1	no_errors	NM_001040105	genbank	human	provisional	54_36p	silent	SNP	0.01	A
CPED1	79974	genome.wustl.edu	37	7	120686959	120686959	+	Missense_Mutation	SNP	A	A	G			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr7:120686959A>G	ENST00000310396.5	+	4	919	c.452A>G	c.(451-453)gAt>gGt	p.D151G	CPED1_ENST00000340646.5_Missense_Mutation_p.D151G|CPED1_ENST00000495036.1_3'UTR|CPED1_ENST00000450913.2_Missense_Mutation_p.D151G	NM_024913.4	NP_079189.4	A4D0V7	CPED1_HUMAN	cadherin-like and PC-esterase domain containing 1	151						endoplasmic reticulum (GO:0005783)		p.D151G(1)									GGCTCTTGGGATCTGCTCATT	0.333																																																1	Substitution - Missense(1)	ovary(1)	7											146.0	146.0	146.0					7																	120686959		2203	4300	6503	120474195	SO:0001583	missense	79974				CCDS34739.1, CCDS47690.1	7q31.31	2012-06-12	2012-06-12	2012-06-12	ENSG00000106034	ENSG00000106034			26159	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 58"""	C7orf58		20056006	Standard	NM_024913		Approved	FLJ21986	uc003vjq.4	A4D0V7	OTTHUMG00000156982	ENST00000310396.5:c.452A>G	7.37:g.120686959A>G	ENSP00000309772:p.Asp151Gly		120474195	A8K1R3|Q6UXT1|Q86T76|Q86T84|Q8N2T5|Q96NC9	Missense_Mutation	SNP	-	p.D151G	ENST00000310396.5	37	c.452	CCDS34739.1	7	.	.	.	.	.	.	.	.	.	.	A	18.22	3.576713	0.65878	.	.	ENSG00000106034	ENST00000310396;ENST00000428526;ENST00000450913;ENST00000340646	T;T;T;T	0.48522	0.81;0.81;0.81;0.81	4.86	4.86	0.63082	.	0.444484	0.25497	N	0.030263	T	0.62356	0.2421	L	0.59436	1.845	0.36170	D	0.848696	D;P	0.89917	1.0;0.841	D;B	0.87578	0.998;0.355	T	0.69702	-0.5074	10	0.51188	T	0.08	.	10.8019	0.46493	1.0:0.0:0.0:0.0	.	151;151	A4D0V7-2;A4D0V7	.;CG058_HUMAN	G	151	ENSP00000309772:D151G;ENSP00000398082:D151G;ENSP00000406122:D151G;ENSP00000345235:D151G	ENSP00000309772:D151G	D	+	2	0	C7orf58	120474195	1.000000	0.71417	1.000000	0.80357	0.871000	0.50021	4.303000	0.59098	2.043000	0.60533	0.482000	0.46254	GAT	-	NULL		0.333	CPED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C7orf58	protein_coding	OTTHUMT00000346959.1	A	NM_024913		120474195	1	no_errors	NM_024913	genbank	human	validated	54_36p	missense	SNP	1	G
TBXAS1	6916	genome.wustl.edu	37	7	139653250	139653250	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr7:139653250C>G	ENST00000336425.5	+	10	923	c.534C>G	c.(532-534)atC>atG	p.I178M	TBXAS1_ENST00000458722.1_Missense_Mutation_p.I224M|TBXAS1_ENST00000416849.2_Missense_Mutation_p.I225M|TBXAS1_ENST00000425687.1_Missense_Mutation_p.I111M|TBXAS1_ENST00000462275.1_3'UTR|TBXAS1_ENST00000414508.2_Missense_Mutation_p.I179M|TBXAS1_ENST00000411653.1_Missense_Mutation_p.I178M|TBXAS1_ENST00000436047.2_Missense_Mutation_p.I179M|TBXAS1_ENST00000448866.1_Missense_Mutation_p.I178M|TBXAS1_ENST00000263552.6_Missense_Mutation_p.I179M			P24557	THAS_HUMAN	thromboxane A synthase 1 (platelet)	178					arachidonic acid metabolic process (GO:0019369)|cellular chloride ion homeostasis (GO:0030644)|cyclooxygenase pathway (GO:0019371)|icosanoid metabolic process (GO:0006690)|positive regulation of vasoconstriction (GO:0045907)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)|thromboxane-A synthase activity (GO:0004796)	p.I179M(1)		breast(3)|endometrium(1)|kidney(1)|large_intestine(5)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	28	Melanoma(164;0.0142)				Ridogrel(DB01207)|Sulfasalazine(DB00795)	CATTTGACATCCAGAGGTAAG	0.443																																																1	Substitution - Missense(1)	ovary(1)	7											103.0	93.0	96.0					7																	139653250		2203	4300	6503	139299719	SO:0001583	missense	6916			L36085	CCDS5855.1, CCDS5856.1, CCDS55174.1, CCDS55175.1	7q34-q35	2014-09-17	2008-07-31		ENSG00000059377	ENSG00000059377	5.3.99.5	"""Cytochrome P450s"""	11609	protein-coding gene	gene with protein product	"""cytochrome P450, family 5, subfamily A, polypeptide 1"""	274180	"""thromboxane A synthase 1 (platelet, cytochrome P450, subfamily V)"""			1714723, 8964509	Standard	NM_001061		Approved	CYP5, CYP5A1, THAS, TXS, TXAS, TS	uc011kqv.2	P24557	OTTHUMG00000157302	ENST00000336425.5:c.534C>G	7.37:g.139653250C>G	ENSP00000338087:p.Ile178Met		139299719	B4DJG6|E7EMU9|E7EP08|E7ESB5|O14987|Q16843|Q16844|Q8IUN1|Q96CN2|Q9GZW4|Q9HD77|Q9HD78|Q9HD79|Q9HD80|Q9HD81|Q9HD82|Q9HD83|Q9HD84	Missense_Mutation	SNP	-	p.I179M	ENST00000336425.5	37	c.537		7	.	.	.	.	.	.	.	.	.	.	C	5.229	0.227757	0.09916	.	.	ENSG00000059377	ENST00000425687;ENST00000263552;ENST00000336425;ENST00000416849;ENST00000436047;ENST00000414508;ENST00000448866;ENST00000458722;ENST00000411653	T;T;T;T;T;T;T;T;T	0.69435	-0.4;-0.4;-0.4;-0.4;-0.4;-0.4;-0.4;-0.4;-0.4	5.43	2.57	0.30868	.	0.142348	0.64402	N	0.000007	T	0.52289	0.1725	N	0.20881	0.62	0.80722	D	1	B;P;B;P;B;B;B	0.47604	0.223;0.832;0.201;0.898;0.223;0.119;0.119	B;P;B;P;B;B;B	0.47346	0.17;0.544;0.088;0.447;0.162;0.062;0.062	T	0.39901	-0.9591	10	0.11182	T	0.66	.	10.0373	0.42135	0.0:0.5346:0.3939:0.0715	.	159;225;130;111;179;179;178	B4DVP1;E7EP08;B4E0M5;E7ESB5;E7EMU9;Q53F23;P24557	.;.;.;.;.;.;THAS_HUMAN	M	111;179;178;225;179;179;178;224;178	ENSP00000388736:I111M;ENSP00000263552:I179M;ENSP00000338087:I178M;ENSP00000389414:I225M;ENSP00000392361:I179M;ENSP00000392702:I179M;ENSP00000402536:I178M;ENSP00000411274:I224M;ENSP00000411326:I178M	ENSP00000263552:I179M	I	+	3	3	TBXAS1	139299719	1.000000	0.71417	0.954000	0.39281	0.307000	0.27823	1.735000	0.38176	0.241000	0.21283	-0.136000	0.14681	ATC	-	NULL		0.443	TBXAS1-001	KNOWN	basic|appris_candidate	protein_coding	TBXAS1	protein_coding	OTTHUMT00000348373.1	C			139299719	1	no_errors	NM_001061	genbank	human	reviewed	54_36p	missense	SNP	1	G
TYW1B	441250	genome.wustl.edu	37	7	72285959	72285959	+	RNA	SNP	C	C	A			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr7:72285959C>A	ENST00000435769.2	-	0	359				TYW1B_ENST00000438125.1_RNA|TYW1B_ENST00000438904.2_RNA			Q6NUM6	TYW1B_HUMAN	tRNA-yW synthesizing protein 1 homolog B (S. cerevisiae)						tRNA processing (GO:0008033)		4 iron, 4 sulfur cluster binding (GO:0051539)|FMN binding (GO:0010181)|iron ion binding (GO:0005506)|lyase activity (GO:0016829)|oxidoreductase activity (GO:0016491)										AATTACCAACCTCTTCTATCA	0.333																																																0			7											132.0	114.0	119.0					7																	72285959		692	1591	2283	71923895			0			BC068520	CCDS69309.1	7q11.23	2011-08-11	2009-07-28		ENSG00000254184	ENSG00000277149			33908	protein-coding gene	gene with protein product	"""radical S-adenosyl methionine and flavodoxin domains 1"", ""non-protein coding RNA 69"", ""long intergenic non-protein coding RNA 69"""		"""tRNA-yW synthesizing protein 1 homolog B (non-protein coding)"""				Standard	NM_001145440		Approved	RSAFD2, MGC87315, NCRNA00069, LINC00069	uc011kej.2	Q6NUM6	OTTHUMG00000157067		7.37:g.72285959C>A			71923895	A6NG09|B4DFY2|Q3KQX2	Missense_Mutation	SNP	-	p.E79D	ENST00000435769.2	37	c.237		7																																																																																			-	NULL		0.333	TYW1B-001	KNOWN	basic	polymorphic_pseudogene	ENSG00000188463	polymorphic_pseudogene	OTTHUMT00000347346.2	C	NM_001145440		71923895	-1	no_errors	ENST00000389196	ensembl	human	known	54_36p	missense	SNP	1	A
STEAP2	261729	genome.wustl.edu	37	7	89859252	89859252	+	Missense_Mutation	SNP	T	T	A			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr7:89859252T>A	ENST00000287908.3	+	4	1480	c.1087T>A	c.(1087-1089)Ttt>Att	p.F363I	STEAP2_ENST00000394629.2_Missense_Mutation_p.F363I|STEAP2_ENST00000394626.1_Missense_Mutation_p.F363I|STEAP2_ENST00000394621.2_Missense_Mutation_p.F363I|STEAP2_ENST00000394622.2_Missense_Mutation_p.F363I|STEAP2_ENST00000402625.2_Missense_Mutation_p.F363I|STEAP2_ENST00000394632.1_Missense_Mutation_p.F363I	NM_001244944.1|NM_152999.3	NP_001231873.1|NP_694544.2	Q8NFT2	STEA2_HUMAN	STEAP family member 2, metalloreductase	363	Ferric oxidoreductase.				copper ion import (GO:0015677)|endocytosis (GO:0006897)|ferric iron import into cell (GO:0097461)|Golgi to plasma membrane transport (GO:0006893)|iron ion homeostasis (GO:0055072)|regulated secretory pathway (GO:0045055)|response to hormone (GO:0009725)	cytosol (GO:0005829)|early endosome (GO:0005769)|integral component of Golgi membrane (GO:0030173)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)|trans-Golgi network transport vesicle (GO:0030140)	cupric reductase activity (GO:0008823)|ferric-chelate reductase (NADPH) activity (GO:0052851)|metal ion binding (GO:0046872)|transporter activity (GO:0005215)	p.F363I(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|prostate(1)|skin(1)	15	all_hematologic(106;0.112)					GTATATCTCCTTTGGCATAAT	0.373																																																1	Substitution - Missense(1)	ovary(1)	7											171.0	174.0	173.0					7																	89859252		2203	4300	6503	89697188	SO:0001583	missense	261729			AF455138	CCDS5615.1, CCDS43612.1, CCDS59064.1	7q21.13	2011-09-30	2011-09-30		ENSG00000157214	ENSG00000157214			17885	protein-coding gene	gene with protein product		605094	"""prostate cancer associated protein 1"", ""six transmembrane epithelial antigen of the prostate 2"""	PCANAP1		10613842, 12095985	Standard	NM_001040665		Approved	IPCA-1, STAMP1, STMP	uc003ujz.3	Q8NFT2	OTTHUMG00000023341	ENST00000287908.3:c.1087T>A	7.37:g.89859252T>A	ENSP00000287908:p.Phe363Ile		89697188	A4D1F1|G5E9C6|Q6UXN6|Q6YPB1|Q8IUE7	Missense_Mutation	SNP	-	p.F363I	ENST00000287908.3	37	c.1087	CCDS5615.1	7	.	.	.	.	.	.	.	.	.	.	T	27.7	4.854984	0.91355	.	.	ENSG00000157214	ENST00000287908;ENST00000394626;ENST00000394622;ENST00000394632;ENST00000394624;ENST00000394621;ENST00000402625;ENST00000394629	D;D;D;D;D;D;D	0.90788	-2.73;-2.73;-2.73;-2.73;-2.73;-2.73;-2.73	5.93	5.93	0.95920	Flavoprotein transmembrane component (1);	0.000000	0.85682	D	0.000000	D	0.90652	0.7068	L	0.34521	1.04	0.52501	D	0.999958	P;P;P	0.46706	0.7;0.883;0.599	B;P;B	0.52909	0.368;0.713;0.356	D	0.91418	0.5156	10	0.59425	D	0.04	-24.2807	16.3839	0.83495	0.0:0.0:0.0:1.0	.	363;363;363	G5E9C6;Q6YPB2;Q8NFT2	.;.;STEA2_HUMAN	I	363	ENSP00000287908:F363I;ENSP00000378123:F363I;ENSP00000378120:F363I;ENSP00000378128:F363I;ENSP00000378119:F363I;ENSP00000384191:F363I;ENSP00000378125:F363I	ENSP00000287908:F363I	F	+	1	0	STEAP2	89697188	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.291000	0.72719	2.258000	0.74832	0.533000	0.62120	TTT	-	NULL		0.373	STEAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STEAP2	protein_coding	OTTHUMT00000059662.4	T	NM_152999		89697188	1	no_errors	NM_001040665	genbank	human	reviewed	54_36p	missense	SNP	1	A
SAMD9	54809	genome.wustl.edu	37	7	92733460	92733460	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr7:92733460C>A	ENST00000379958.2	-	3	2220	c.1951G>T	c.(1951-1953)Gct>Tct	p.A651S		NM_001193307.1|NM_017654.3	NP_001180236.1|NP_060124.2	Q5K651	SAMD9_HUMAN	sterile alpha motif domain containing 9	651						cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)		p.A651S(1)		NS(1)|breast(4)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(20)|lung(32)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	88	all_cancers(62;5.71e-11)|all_epithelial(64;3.25e-10)|Breast(17;0.000675)|Lung NSC(181;0.0969)|all_lung(186;0.125)		STAD - Stomach adenocarcinoma(171;0.000302)			ATTTCCAGAGCAGTCATGATA	0.343																																																1	Substitution - Missense(1)	ovary(1)	7											100.0	103.0	102.0					7																	92733460		2203	4299	6502	92571396	SO:0001583	missense	54809			AB095925	CCDS34680.1	7q21.2	2013-01-10	2004-07-15	2004-07-16	ENSG00000205413	ENSG00000205413		"""Sterile alpha motif (SAM) domain containing"""	1348	protein-coding gene	gene with protein product		610456	"""chromosome 7 open reading frame 5"""	C7orf5			Standard	NM_017654		Approved	KIAA2004, FLJ20073	uc003umg.3	Q5K651	OTTHUMG00000155809	ENST00000379958.2:c.1951G>T	7.37:g.92733460C>A	ENSP00000369292:p.Ala651Ser		92571396	A2RU68|Q5K649|Q6P080|Q75N21|Q8IVG6|Q9NXS8	Missense_Mutation	SNP	-	p.A651S	ENST00000379958.2	37	c.1951	CCDS34680.1	7	.	.	.	.	.	.	.	.	.	.	C	1.130	-0.652706	0.03480	.	.	ENSG00000205413	ENST00000379958;ENST00000446617	T;T	0.21191	2.02;2.81	4.35	1.5	0.22942	.	0.401465	0.22932	N	0.053900	T	0.11196	0.0273	N	0.20986	0.625	0.09310	N	1	B	0.14805	0.011	B	0.10450	0.005	T	0.32481	-0.9905	10	0.20519	T	0.43	.	6.218	0.20665	0.2658:0.5773:0.0:0.157	.	651	Q5K651	SAMD9_HUMAN	S	651	ENSP00000369292:A651S;ENSP00000414529:A651S	ENSP00000369292:A651S	A	-	1	0	SAMD9	92571396	0.004000	0.15560	0.939000	0.37840	0.449000	0.32228	0.021000	0.13489	-0.032000	0.13758	-1.195000	0.01675	GCT	-	NULL		0.343	SAMD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAMD9	protein_coding	OTTHUMT00000341761.1	C	NM_017654		92571396	-1	no_errors	NM_017654	genbank	human	validated	54_36p	missense	SNP	0.14	A
ZSCAN25	221785	genome.wustl.edu	37	7	99227356	99227356	+	Missense_Mutation	SNP	C	C	G	rs554988594		TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr7:99227356C>G	ENST00000394152.2	+	8	1675	c.1348C>G	c.(1348-1350)Cgg>Ggg	p.R450G	ZSCAN25_ENST00000262941.6_Missense_Mutation_p.R378G|ZSCAN25_ENST00000334715.3_Missense_Mutation_p.R450G|ZSCAN25_ENST00000466948.1_Intron	NM_145115.2	NP_660090.2	Q6NSZ9	ZSC25_HUMAN	zinc finger and SCAN domain containing 25	450					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R450G(1)									GCAGGTGCACCGGAGGACGCA	0.657																																																1	Substitution - Missense(1)	ovary(1)	7											44.0	46.0	46.0					7																	99227356		2203	4300	6503	99065292	SO:0001583	missense	221785			AK057030	CCDS5671.2	7q22.1	2013-01-09	2013-01-09	2013-01-09	ENSG00000197037	ENSG00000197037		"""-"", ""Zinc fingers, C2H2-type"""	21961	protein-coding gene	gene with protein product			"""zinc finger protein 498"""	ZNF498		11179890	Standard	XM_005250194		Approved	FLJ32468	uc003url.1	Q6NSZ9	OTTHUMG00000074055	ENST00000394152.2:c.1348C>G	7.37:g.99227356C>G	ENSP00000377708:p.Arg450Gly		99065292	A4D290|D6W5T5|Q14C82|Q14C99|Q5EBM9|Q6DJZ0|Q6N032|Q6ZML3	Missense_Mutation	SNP	-	p.R450G	ENST00000394152.2	37	c.1348	CCDS5671.2	7	.	.	.	.	.	.	.	.	.	.	C	17.48	3.399830	0.62177	.	.	ENSG00000197037	ENST00000394152;ENST00000334715;ENST00000262941	T;T;T	0.07444	3.19;3.19;3.19	3.93	3.02	0.34903	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.42420	D	0.000702	T	0.19208	0.0461	L	0.53671	1.685	0.32443	N	0.546424	D;D	0.63880	0.991;0.993	P;P	0.62014	0.835;0.897	T	0.10683	-1.0619	10	0.87932	D	0	-30.4113	11.0019	0.47611	0.1877:0.8123:0.0:0.0	.	378;450	Q6NSZ9-2;Q6NSZ9	.;ZN498_HUMAN	G	450;450;378	ENSP00000377708:R450G;ENSP00000334800:R450G;ENSP00000262941:R378G	ENSP00000262941:R378G	R	+	1	2	ZNF498	99065292	0.000000	0.05858	0.877000	0.34402	0.972000	0.66771	0.634000	0.24614	1.177000	0.42855	0.561000	0.74099	CGG	-	NULL		0.657	ZSCAN25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF498	protein_coding	OTTHUMT00000157203.4	C	NM_145115		99065292	1	no_errors	NM_145115	genbank	human	validated	54_36p	missense	SNP	0.22	G
KEL	3792	genome.wustl.edu	37	7	142641484	142641484	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr7:142641484C>A	ENST00000355265.2	-	13	1891	c.1417G>T	c.(1417-1419)Gct>Tct	p.A473S	KEL_ENST00000479768.2_5'Flank	NM_000420.2	NP_000411.1	P23276	KELL_HUMAN	Kell blood group, metallo-endopeptidase	473					vasoconstriction (GO:0042310)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)	p.A473S(1)		central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(11)|lung(34)|ovary(3)|prostate(2)|skin(1)	60	Melanoma(164;0.059)					TGCAGTTGAGCAACCTGGAGA	0.547																																																1	Substitution - Missense(1)	ovary(1)	7											73.0	75.0	75.0					7																	142641484		2203	4300	6503	142351606	SO:0001583	missense	3792			BC003135	CCDS34766.1	7q33	2014-07-19	2006-10-10		ENSG00000197993	ENSG00000197993		"""CD molecules"", ""Blood group antigens"""	6308	protein-coding gene	gene with protein product		613883	"""Kell blood group"", ""Kell blood group, metalloendopeptidase"""			1712490, 7683930	Standard	NM_000420		Approved	ECE3, CD238	uc003wcb.3	P23276	OTTHUMG00000157159	ENST00000355265.2:c.1417G>T	7.37:g.142641484C>A	ENSP00000347409:p.Ala473Ser		142351606	B2RBV4|Q96RS8|Q99885	Missense_Mutation	SNP	-	p.A473S	ENST00000355265.2	37	c.1417	CCDS34766.1	7	.	.	.	.	.	.	.	.	.	.	C	2.206	-0.381727	0.04966	.	.	ENSG00000197993	ENST00000355265	T	0.73789	-0.78	4.85	-3.19	0.05171	Peptidase M13 (1);	0.492928	0.18638	N	0.135366	T	0.41834	0.1176	N	0.08118	0	0.09310	N	1	B	0.12013	0.005	B	0.09377	0.004	T	0.26780	-1.0093	10	0.14252	T	0.57	-9.7942	3.3819	0.07257	0.477:0.1958:0.0:0.3272	.	473	P23276	KELL_HUMAN	S	473	ENSP00000347409:A473S	ENSP00000347409:A473S	A	-	1	0	KEL	142351606	0.005000	0.15991	0.208000	0.23602	0.010000	0.07245	-0.060000	0.11712	-0.263000	0.09378	-1.057000	0.02308	GCT	-	NULL		0.547	KEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KEL	protein_coding	OTTHUMT00000347671.2	C	NM_000420		142351606	-1	no_errors	NM_000420	genbank	human	reviewed	54_36p	missense	SNP	0.11	A
SPAG1	6674	genome.wustl.edu	37	8	101237454	101237454	+	Nonsense_Mutation	SNP	C	C	A			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr8:101237454C>A	ENST00000388798.2	+	14	1933	c.1742C>A	c.(1741-1743)tCa>tAa	p.S581*	SPAG1_ENST00000523302.1_3'UTR|SPAG1_ENST00000251809.3_Nonsense_Mutation_p.S581*	NM_003114.4	NP_003105.2	Q07617	SPAG1_HUMAN	sperm associated antigen 1	581					axonemal dynein complex assembly (GO:0070286)|single fertilization (GO:0007338)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	GTP binding (GO:0005525)|hydrolase activity (GO:0016787)	p.S581*(1)		central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(10)|ovary(2)|pancreas(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	30	all_cancers(14;2.35e-05)|all_epithelial(15;5.2e-08)|Lung NSC(17;0.000283)|all_lung(17;0.000823)	Breast(495;0.195)	Epithelial(11;1.12e-09)|all cancers(13;1.26e-07)|OV - Ovarian serous cystadenocarcinoma(57;4.37e-05)|STAD - Stomach adenocarcinoma(118;0.0525)	KIRC - Kidney renal clear cell carcinoma(542;0.00178)|READ - Rectum adenocarcinoma(644;0.236)		GAGAAGCTGTCACCTATTCCT	0.458																																																1	Substitution - Nonsense(1)	ovary(1)	8											63.0	59.0	61.0					8																	101237454		2203	4300	6503	101306630	SO:0001587	stop_gained	6674			AF311312	CCDS34930.1	8q22	2014-01-21			ENSG00000104450	ENSG00000104450		"""Tetratricopeptide (TTC) repeat domain containing"""	11212	protein-coding gene	gene with protein product		603395				16368546	Standard	NM_172218		Approved	SP75, FLJ32920, HSD-3.8, TPIS, CT140	uc003yjh.2	Q07617	OTTHUMG00000164706	ENST00000388798.2:c.1742C>A	8.37:g.101237454C>A	ENSP00000373450:p.Ser581*		101306630	A6NP70|B3KQ58|G3XAM3|Q7Z5G1	Nonsense_Mutation	SNP	HMMPfam_TPR_1;superfamily_Protein prenylyltransferase;superfamily_TPR-like	p.S581*	ENST00000388798.2	37	c.1742	CCDS34930.1	8	.	.	.	.	.	.	.	.	.	.	C	40	8.361695	0.98777	.	.	ENSG00000104450	ENST00000251809;ENST00000388798	.	.	.	5.46	5.46	0.80206	.	0.281448	0.39985	N	0.001218	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.15066	T	0.55	-0.0026	16.6255	0.84969	0.0:1.0:0.0:0.0	.	.	.	.	X	581	.	ENSP00000251809:S581X	S	+	2	0	SPAG1	101306630	0.707000	0.27866	0.990000	0.47175	0.992000	0.81027	4.954000	0.63631	2.731000	0.93534	0.650000	0.86243	TCA	-	NULL		0.458	SPAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPAG1	protein_coding	OTTHUMT00000379853.2	C	NM_172218		101306630	1	no_errors	NM_003114	genbank	human	reviewed	54_36p	nonsense	SNP	0.9	A
HR	55806	genome.wustl.edu	37	8	21981313	21981313	+	Silent	SNP	G	G	A			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	G	G	A	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr8:21981313G>A	ENST00000381418.4	-	6	3244	c.1764C>T	c.(1762-1764)gcC>gcT	p.A588A	HR_ENST00000312841.8_Silent_p.A588A	NM_005144.4	NP_005135.2	O43593	HAIR_HUMAN	hair growth associated	588					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nuclear body (GO:0016604)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|oxidoreductase activity (GO:0016491)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.A588A(1)		central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(12)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	27		Breast(100;0.000162)|Acute lymphoblastic leukemia(644;0.0775)|Prostate(55;0.116)		KIRC - Kidney renal clear cell carcinoma(542;1.19e-05)|BRCA - Breast invasive adenocarcinoma(99;3.56e-05)|Colorectal(74;0.00191)|COAD - Colon adenocarcinoma(73;0.0615)|READ - Rectum adenocarcinoma(644;0.1)		CCTCTGTCACGGCTGGCCCTT	0.637																																																1	Substitution - coding silent(1)	ovary(1)	8											46.0	28.0	34.0					8																	21981313		2201	4297	6498	22037258	SO:0001819	synonymous_variant	55806			AF039196	CCDS6022.1, CCDS6023.1	8p12	2012-12-07	2012-12-07		ENSG00000168453	ENSG00000168453			5172	protein-coding gene	gene with protein product		602302	"""hairless (mouse) homolog"", ""hairless homolog (mouse)"""	ALUNC		10051399, 9463324	Standard	NM_018411		Approved	AU	uc003xas.3	O43593	OTTHUMG00000097089	ENST00000381418.4:c.1764C>T	8.37:g.21981313G>A			22037258	Q6GS30|Q96H33|Q9NPE1	Silent	SNP	HMMPfam_JmjC,superfamily_Clavaminate synthase-like,superfamily_Zinc beta-ribbon	p.A588	ENST00000381418.4	37	c.1764	CCDS6022.1	8																																																																																			-	NULL		0.637	HR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HR	protein_coding	OTTHUMT00000214213.1	G			22037258	-1	no_errors	NM_005144	genbank	human	reviewed	54_36p	silent	SNP	0.001	A
EBF2	64641	genome.wustl.edu	37	8	25744284	25744284	+	Missense_Mutation	SNP	C	C	A	rs557856249		TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr8:25744284C>A	ENST00000520164.1	-	10	1533	c.996G>T	c.(994-996)agG>agT	p.R332S	EBF2_ENST00000408929.3_Missense_Mutation_p.R184S|EBF2_ENST00000535548.1_Missense_Mutation_p.R63S	NM_022659.3	NP_073150.2	Q9HAK2	COE2_HUMAN	early B-cell factor 2	332	IPT/TIG.				adipose tissue development (GO:0060612)|brown fat cell differentiation (GO:0050873)|cell fate determination (GO:0001709)|positive regulation of chromatin binding (GO:0035563)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R332S(5)		endometrium(3)|kidney(2)|large_intestine(3)|lung(22)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	39		all_cancers(63;0.0989)|Ovarian(32;2.74e-05)|all_epithelial(46;0.0608)|Prostate(55;0.0845)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0277)|Epithelial(17;3.29e-10)|Colorectal(74;0.00383)|COAD - Colon adenocarcinoma(73;0.00738)		TGTAAATGAACCTTCCTGGGG	0.483													C|||	1	0.000199681	0.0008	0.0	5008	,	,		19473	0.0		0.0	False		,,,				2504	0.0				Esophageal Squamous(166;1018 1046 3854 8328 13429 13634 14071 26624 32918)											5	Substitution - Missense(5)	lung(4)|ovary(1)	8											96.0	94.0	95.0					8																	25744284		1863	4098	5961	25800201	SO:0001583	missense	64641			AK021562, AK001144	CCDS43726.1	8p21.1	2007-07-26			ENSG00000221818	ENSG00000221818			19090	protein-coding gene	gene with protein product		609934				9151732	Standard	NM_022659		Approved	FLJ11500, COE2	uc003xes.2	Q9HAK2	OTTHUMG00000163838	ENST00000520164.1:c.996G>T	8.37:g.25744284C>A	ENSP00000430241:p.Arg332Ser		25800201	A0PJM4|A6NMF7|F5H645|Q66VZ3|Q6DK36|Q6IS86|Q6ISA4	Missense_Mutation	SNP	-	p.R332S	ENST00000520164.1	37	c.996	CCDS43726.1	8	.	.	.	.	.	.	.	.	.	.	C	14.48	2.548384	0.45383	.	.	ENSG00000221818	ENST00000520164;ENST00000408929;ENST00000535548	T;T;T	0.76186	-1.0;-1.0;0.94	5.58	1.81	0.25067	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.80974	0.4727	M	0.72894	2.215	0.80722	D	1	D	0.56521	0.976	P	0.61328	0.887	T	0.79325	-0.1850	10	0.52906	T	0.07	-15.817	10.1416	0.42738	0.0:0.6707:0.0:0.3293	.	332	Q9HAK2	COE2_HUMAN	S	332;184;63	ENSP00000430241:R332S;ENSP00000386178:R184S;ENSP00000437909:R63S	ENSP00000386178:R184S	R	-	3	2	EBF2	25800201	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	1.851000	0.39338	0.340000	0.23745	-0.993000	0.02533	AGG	-	NULL		0.483	EBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EBF2	protein_coding	OTTHUMT00000375886.2	C	NM_022659		25800201	-1	no_errors	NM_022659	genbank	human	validated	54_36p	missense	SNP	1	A
POTEA	340441	genome.wustl.edu	37	8	43152267	43152267	+	RNA	SNP	C	C	A			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr8:43152267C>A	ENST00000522175.2	+	0	406							Q6S8J7	POTEA_HUMAN	POTE ankyrin domain family, member A									p.A135D(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(27)|ovary(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						AAGAGGACAGCTCTGATAAAG	0.373																																																1	Substitution - Missense(1)	ovary(1)	8											92.0	88.0	89.0					8																	43152267		2177	4287	6464	43271424			340441			AY462869		8p11.1	2013-01-11	2008-11-26	2008-11-26	ENSG00000188877	ENSG00000188877		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33893	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 3"""	608915	"""ANKRD26-like family A, member 1"""	A26A1			Standard	NM_001002920		Approved	POTE8, POTE-8, CT104.3	uc003xpz.1	Q6S8J7	OTTHUMG00000164111		8.37:g.43152267C>A			43271424	A6ND17|A6ND71|Q6S8J6	Missense_Mutation	SNP	-	p.A135D	ENST00000522175.2	37	c.404		8																																																																																			-	NULL		0.373	POTEA-003	KNOWN	basic	processed_transcript	POTEA	pseudogene	OTTHUMT00000383492.1	C	NM_001002920		43271424	1	no_errors	NM_001005365	genbank	human	provisional	54_36p	missense	SNP	0.99	A
KHDRBS3	10656	genome.wustl.edu	37	8	136657328	136657328	+	Missense_Mutation	SNP	A	A	G			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr8:136657328A>G	ENST00000355849.5	+	8	1327	c.917A>G	c.(916-918)cAt>cGt	p.H306R	KHDRBS3_ENST00000520981.1_Missense_Mutation_p.H79R	NM_006558.1	NP_006549.1	O75525	KHDR3_HUMAN	KH domain containing, RNA binding, signal transduction associated 3	306	Tyr-rich.				regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.H306R(1)		NS(1)|endometrium(1)|large_intestine(5)|lung(12)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	26	all_epithelial(106;2.85e-16)|all_neural(2;2.72e-06)|Lung NSC(106;3.95e-06)|all_lung(105;1.11e-05)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.247)			GATTACGGACATGGACTCAGT	0.423																																																1	Substitution - Missense(1)	ovary(1)	8											153.0	146.0	148.0					8																	136657328		2203	4300	6503	136726510	SO:0001583	missense	10656			AF069681	CCDS6374.1	8q24.23	2008-05-15			ENSG00000131773	ENSG00000131773			18117	protein-coding gene	gene with protein product		610421				10332027, 10564820	Standard	XR_242372		Approved	T-STAR, Etle, etoile, SALP, SLM2, SLM-2	uc003yuv.3	O75525	OTTHUMG00000164164	ENST00000355849.5:c.917A>G	8.37:g.136657328A>G	ENSP00000348108:p.His306Arg		136726510	Q6NUL8|Q9UPA8	Missense_Mutation	SNP	-	p.H306R	ENST00000355849.5	37	c.917	CCDS6374.1	8	.	.	.	.	.	.	.	.	.	.	A	27.1	4.801116	0.90538	.	.	ENSG00000131773	ENST00000355849;ENST00000520981	T;T	0.50277	0.82;0.75	5.77	5.77	0.91146	.	0.152849	0.64402	D	0.000014	T	0.67832	0.2935	M	0.71206	2.165	0.52501	D	0.999958	D	0.89917	1.0	D	0.74023	0.982	T	0.70999	-0.4719	10	0.72032	D	0.01	-33.2834	15.5753	0.76373	1.0:0.0:0.0:0.0	.	306	O75525	KHDR3_HUMAN	R	306;79	ENSP00000348108:H306R;ENSP00000428607:H79R	ENSP00000348108:H306R	H	+	2	0	KHDRBS3	136726510	1.000000	0.71417	0.899000	0.35326	0.996000	0.88848	5.413000	0.66399	2.326000	0.78906	0.533000	0.62120	CAT	-	NULL		0.423	KHDRBS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KHDRBS3	protein_coding	OTTHUMT00000377529.1	A			136726510	1	no_errors	NM_006558	genbank	human	provisional	54_36p	missense	SNP	1	G
OR13C5	138799	genome.wustl.edu	37	9	107361263	107361263	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr9:107361263C>A	ENST00000374779.2	-	1	525	c.432G>T	c.(430-432)atG>atT	p.M144I		NM_001004482.1	NP_001004482.1	Q8NGS8	O13C5_HUMAN	olfactory receptor, family 13, subfamily C, member 5	144						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.M144I(1)		endometrium(4)|kidney(1)|large_intestine(2)|lung(11)|ovary(2)|pancreas(2)|prostate(2)|skin(4)	28						ACCCAGCTGCCATGGGTACAT	0.468																																																1	Substitution - Missense(1)	ovary(1)	9											103.0	102.0	103.0					9																	107361263		2203	4298	6501	106401084	SO:0001583	missense	138799				CCDS35091.1	9q31.1	2012-10-03			ENSG00000255800	ENSG00000277556		"""GPCR / Class A : Olfactory receptors"""	15100	protein-coding gene	gene with protein product							Standard	NM_001004482		Approved		uc011lvp.2	Q8NGS8	OTTHUMG00000020408	ENST00000374779.2:c.432G>T	9.37:g.107361263C>A	ENSP00000363911:p.Met144Ile		106401084	B2RNE5|B9EGW5|Q6IF53	Missense_Mutation	SNP	-	p.M144I	ENST00000374779.2	37	c.432	CCDS35091.1	9	.	.	.	.	.	.	.	.	.	.	C	13.04	2.118085	0.37339	.	.	ENSG00000255800	ENST00000374779	T	0.35605	1.3	4.17	-3.39	0.04868	GPCR, rhodopsin-like superfamily (1);	0.000000	0.44902	U	0.000405	T	0.43322	0.1242	L	0.57130	1.785	0.09310	N	1	D	0.63046	0.992	D	0.62955	0.909	T	0.40194	-0.9576	10	0.87932	D	0	.	6.3813	0.21536	0.6385:0.1945:0.0:0.167	.	144	Q8NGS8	O13C5_HUMAN	I	144	ENSP00000363911:M144I	ENSP00000363911:M144I	M	-	3	0	OR13C5	106401084	0.000000	0.05858	0.044000	0.18714	0.194000	0.23727	-1.137000	0.03219	-1.034000	0.03295	-0.347000	0.07816	ATG	-	NULL		0.468	OR13C5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR13C5	protein_coding	OTTHUMT00000053479.2	C	NM_001004482		106401084	-1	no_errors	NM_001004482	genbank	human	provisional	54_36p	missense	SNP		A
ZNF462	58499	genome.wustl.edu	37	9	109689704	109689704	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr9:109689704G>A	ENST00000277225.5	+	3	3800	c.3511G>A	c.(3511-3513)Gcc>Acc	p.A1171T	ZNF462_ENST00000457913.1_Missense_Mutation_p.A1171T|ZNF462_ENST00000441147.2_Missense_Mutation_p.A16T			Q96JM2	ZN462_HUMAN	zinc finger protein 462	1171					chromatin organization (GO:0006325)|negative regulation of DNA binding (GO:0043392)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.A1171T(1)		NS(2)|autonomic_ganglia(2)|breast(5)|central_nervous_system(4)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(20)|lung(32)|ovary(5)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	119						CCGGCCACCCGCCCCCATACA	0.557																																																1	Substitution - Missense(1)	ovary(1)	9											88.0	98.0	95.0					9																	109689704		2203	4300	6503	108729525	SO:0001583	missense	58499			AB058706	CCDS35096.1	9q31.3	2008-02-05			ENSG00000148143	ENSG00000148143		"""Zinc fingers, C2H2-type"""	21684	protein-coding gene	gene with protein product							Standard	NM_021224		Approved	DKFZP762N2316, KIAA1803, Zfp462	uc004bcz.3	Q96JM2	OTTHUMG00000020438	ENST00000277225.5:c.3511G>A	9.37:g.109689704G>A	ENSP00000277225:p.Ala1171Thr		108729525	Q5T0T4|Q8N408	Missense_Mutation	SNP	-	p.A1171T	ENST00000277225.5	37	c.3511	CCDS35096.1	9	.	.	.	.	.	.	.	.	.	.	G	13.29	2.192381	0.38707	.	.	ENSG00000148143	ENST00000277225;ENST00000457913;ENST00000374686;ENST00000441147	T;T;T;T	0.05319	3.46;3.91;4.03;3.99	5.22	4.33	0.51752	.	0.366735	0.32106	N	0.006571	T	0.04497	0.0123	L	0.36672	1.1	0.80722	D	1	D;B	0.53312	0.959;0.016	B;B	0.36418	0.224;0.004	T	0.54022	-0.8355	10	0.18710	T	0.47	.	9.9058	0.41375	0.1553:0.0:0.8447:0.0	.	1171;1171	Q96JM2-3;Q96JM2	.;ZN462_HUMAN	T	1171;1171;54;16	ENSP00000277225:A1171T;ENSP00000414570:A1171T;ENSP00000363818:A54T;ENSP00000397306:A16T	ENSP00000277225:A1171T	A	+	1	0	ZNF462	108729525	0.050000	0.20438	0.876000	0.34364	0.931000	0.56810	1.394000	0.34509	1.201000	0.43203	0.561000	0.74099	GCC	-	NULL		0.557	ZNF462-001	KNOWN	basic|CCDS	protein_coding	ZNF462	protein_coding	OTTHUMT00000053532.2	G	NM_021224		108729525	1	no_errors	NM_021224	genbank	human	validated	54_36p	missense	SNP	0.91	A
AKAP2	11217	genome.wustl.edu	37	9	112899700	112899700	+	Missense_Mutation	SNP	G	G	C	rs367729276		TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr9:112899700G>C	ENST00000259318.7	+	2	1390	c.1183G>C	c.(1183-1185)Ggt>Cgt	p.G395R	PALM2-AKAP2_ENST00000302798.7_Missense_Mutation_p.G626R|AKAP2_ENST00000374525.1_Missense_Mutation_p.G484R|AKAP2_ENST00000510514.5_Missense_Mutation_p.G626R|AKAP2_ENST00000434623.2_Missense_Mutation_p.G484R|PALM2-AKAP2_ENST00000374530.3_Missense_Mutation_p.G626R|AKAP2_ENST00000555236.1_Missense_Mutation_p.G626R	NM_001136562.2	NP_001130034.1	Q9Y2D5	AKAP2_HUMAN	A kinase (PRKA) anchor protein 2	395								p.G484R(1)|p.G626R(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(16)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	33						GAAATCCCCCGGTGCCCTGGA	0.607																																																2	Substitution - Missense(2)	ovary(2)	9											54.0	60.0	58.0					9																	112899700		2203	4300	6503	111939521	SO:0001583	missense	445815			AB023137	CCDS43861.1, CCDS48003.1, CCDS56581.1	9q31.3	2009-10-16			ENSG00000241978	ENSG00000241978		"""A-kinase anchor proteins"""	372	protein-coding gene	gene with protein product	"""protein kinase A2"""	604582		PRKA2		10231032	Standard	NM_001136562		Approved	AKAP-KL, KIAA0920, DKFZp564L0716		Q9Y2D5	OTTHUMG00000156811	ENST00000259318.7:c.1183G>C	9.37:g.112899700G>C	ENSP00000259318:p.Gly395Arg		111939521	B1ALX9|B2RTU4|B3KQ00|B4DTZ2|B7ZW07|B9EJB5|Q9UG26	Missense_Mutation	SNP	-	p.G626R	ENST00000259318.7	37	c.1876	CCDS48003.1	9	.	.	.	.	.	.	.	.	.	.	g	7.003	0.555176	0.13436	.	.	ENSG00000157654;ENSG00000157654;ENSG00000241978;ENSG00000241978;ENSG00000241978;ENSG00000241978;ENSG00000241978;ENSG00000241978	ENST00000374530;ENST00000302798;ENST00000555236;ENST00000510514;ENST00000434623;ENST00000374525;ENST00000480388;ENST00000259318	T;T;T;T;T;T;T;T	0.42513	2.31;2.31;2.31;2.31;1.55;0.97;0.98;1.57	5.64	-11.3	0.00108	.	0.713130	0.13867	N	0.357243	T	0.23649	0.0572	N	0.08118	0	0.09310	N	1	P;D;D;D;P;P;P;D	0.54964	0.874;0.968;0.969;0.96;0.932;0.603;0.603;0.969	P;P;P;P;P;B;B;B	0.55161	0.47;0.77;0.512;0.706;0.512;0.173;0.173;0.389	T	0.50065	-0.8871	10	0.25106	T	0.35	2.2553	9.1788	0.37129	0.4258:0.0:0.3664:0.2078	.	395;484;478;484;485;626;626;444	Q9Y2D5;Q9Y2D5-7;B4E2K2;Q9Y2D5-5;B1ALY1;Q9Y2D5-6;Q9Y2D5-4;C9JVY5	AKAP2_HUMAN;.;.;.;.;.;.;.	R	626;626;626;626;484;484;444;395	ENSP00000363654:G626R;ENSP00000305861:G626R;ENSP00000451476:G626R;ENSP00000421522:G626R;ENSP00000404782:G484R;ENSP00000363649:G484R;ENSP00000419268:G444R;ENSP00000259318:G395R	ENSP00000259318:G395R	G	+	1	0	PALM2-AKAP2;AKAP2	111939521	0.011000	0.17503	0.000000	0.03702	0.002000	0.02628	0.092000	0.15066	-2.350000	0.00617	-2.717000	0.00132	GGT	-	NULL		0.607	AKAP2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	PALM2-AKAP2	protein_coding	OTTHUMT00000346067.3	G	NM_001004065		111939521	1	no_errors	NM_007203	genbank	human	validated	54_36p	missense	SNP	0.01	C
NR6A1	2649	genome.wustl.edu	37	9	127298392	127298392	+	Nonsense_Mutation	SNP	C	C	A			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr9:127298392C>A	ENST00000487099.2	-	7	1001	c.844G>T	c.(844-846)Gaa>Taa	p.E282*	NR6A1_ENST00000373584.3_Nonsense_Mutation_p.E278*|NR6A1_ENST00000344523.4_Nonsense_Mutation_p.E281*|NR6A1_ENST00000416460.2_Nonsense_Mutation_p.E277*	NM_001278546.1	NP_001265475.1	Q15406	NR6A1_HUMAN	nuclear receptor subfamily 6, group A, member 1	282					cell proliferation (GO:0008283)|gamete generation (GO:0007276)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|spermatogenesis (GO:0007283)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)	p.E282*(1)		NS(1)|breast(1)|cervix(1)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)|skin(1)	17						GCAAATAGTTCTGCCTGTGTC	0.537																																					Esophageal Squamous(192;272 2884 6208 20560)											1	Substitution - Nonsense(1)	ovary(1)	9											89.0	91.0	90.0					9																	127298392		2203	4300	6503	126338213	SO:0001587	stop_gained	2649			U64876	CCDS35137.1, CCDS55340.1, CCDS65127.1	9q33.3	2014-01-21			ENSG00000148200	ENSG00000148200		"""Nuclear hormone receptors"""	7985	protein-coding gene	gene with protein product		602778		GCNF		9134503, 8982251	Standard	NM_001489		Approved	GCNF1, RTR, CT150	uc004bor.1	Q15406	OTTHUMG00000020661	ENST00000487099.2:c.844G>T	9.37:g.127298392C>A	ENSP00000420267:p.Glu282*		126338213	O00551|O00603|Q5T6F4|Q8NHQ0|Q92898|Q99802	Nonsense_Mutation	SNP	HMMPfam_Hormone_recep,HMMPfam_zf-C4,superfamily_Nuclear receptor ligand-binding domain,superfamily_Glucocorticoid receptor-like (DNA-binding domain)	p.E282*	ENST00000487099.2	37	c.844	CCDS35137.1	9	.	.	.	.	.	.	.	.	.	.	C	38	6.949765	0.97956	.	.	ENSG00000148200	ENST00000487099;ENST00000373584;ENST00000416460;ENST00000344523	.	.	.	5.17	5.17	0.71159	.	0.211642	0.48767	D	0.000175	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.17369	T	0.5	.	18.5492	0.91057	0.0:1.0:0.0:0.0	.	.	.	.	X	282;278;277;281	.	ENSP00000341135:E281X	E	-	1	0	NR6A1	126338213	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.627000	0.83176	2.793000	0.96121	0.563000	0.77884	GAA	-	NULL		0.537	NR6A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NR6A1	protein_coding	OTTHUMT00000054043.4	C			126338213	-1	no_errors	NM_033334	genbank	human	reviewed	54_36p	nonsense	SNP	1	A
TEK	7010	genome.wustl.edu	37	9	27217734	27217734	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr9:27217734G>T	ENST00000380036.4	+	19	3482	c.3040G>T	c.(3040-3042)Gtg>Ttg	p.V1014L	TEK_ENST00000519097.1_Missense_Mutation_p.V866L|TEK_ENST00000406359.4_Missense_Mutation_p.V971L	NM_000459.3	NP_000450	Q02763	TIE2_HUMAN	TEK tyrosine kinase, endothelial	1014	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|cell-matrix adhesion (GO:0007160)|definitive hemopoiesis (GO:0060216)|endochondral ossification (GO:0001958)|endothelial cell proliferation (GO:0001935)|glomerulus vasculature development (GO:0072012)|heart development (GO:0007507)|heart trabecula formation (GO:0060347)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|negative regulation of angiogenesis (GO:0016525)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of inflammatory response (GO:0050728)|organ regeneration (GO:0031100)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|protein autophosphorylation (GO:0046777)|protein oligomerization (GO:0051259)|regulation of endothelial cell apoptotic process (GO:2000351)|regulation of establishment or maintenance of cell polarity (GO:0032878)|regulation of vascular permeability (GO:0043114)|response to cAMP (GO:0051591)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|response to peptide hormone (GO:0043434)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|sprouting angiogenesis (GO:0002040)|substrate adhesion-dependent cell spreading (GO:0034446)|Tie signaling pathway (GO:0048014)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|receptor activity (GO:0004872)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.V1014L(1)		breast(3)|central_nervous_system(3)|kidney(1)|lung(2)|ovary(3)|skin(3)	15		all_neural(11;7.57e-10)|Myeloproliferative disorder(762;0.0255)		Lung(218;4.08e-05)|LUSC - Lung squamous cell carcinoma(38;0.00027)	Ponatinib(DB08901)|Regorafenib(DB08896)|Vandetanib(DB05294)	GAATTACAGTGTGTACACAAC	0.428																																																1	Substitution - Missense(1)	ovary(1)	9											124.0	126.0	126.0					9																	27217734		2203	4300	6503	27207734	SO:0001583	missense	7010			L06139	CCDS6519.1, CCDS75825.1	9p21	2013-02-11	2008-07-31		ENSG00000120156	ENSG00000120156		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	11724	protein-coding gene	gene with protein product		600221	"""venous malformations, multiple cutaneous and mucosal"""	VMCM		1312667, 7833915	Standard	XM_005251561		Approved	TIE2, TIE-2, VMCM1, CD202b	uc003zqi.4	Q02763	OTTHUMG00000019712	ENST00000380036.4:c.3040G>T	9.37:g.27217734G>T	ENSP00000369375:p.Val1014Leu		27207734	A8K6W0|B4DH20|B4DHD3|D3DRK5|E7EWI2|Q5TCU2|Q8IV34	Missense_Mutation	SNP	superfamily_Fibronectin type III;superfamily_Protein kinase-like (PK-like);superfamily_Immunoglobulin;superfamily_EGF/Laminin;Pkinase_Tyr;HMMPfam_Pkinase_Tyr;fn3;HMMPfam_fn3;EGF_2;HMMPfam_EGF_2	p.V1014L	ENST00000380036.4	37	c.3040	CCDS6519.1	9	.	.	.	.	.	.	.	.	.	.	G	27.5	4.834374	0.91036	.	.	ENSG00000120156	ENST00000519097;ENST00000380036;ENST00000406359	D;D;D	0.82433	-1.61;-1.61;-1.61	4.36	4.36	0.52297	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.40908	D	0.000982	D	0.85371	0.5681	N	0.25286	0.73	0.80722	D	1	D;D;D	0.61697	0.988;0.99;0.988	D;D;D	0.72982	0.971;0.969;0.979	D	0.87853	0.2659	10	0.72032	D	0.01	.	17.4452	0.87577	0.0:0.0:1.0:0.0	.	866;1047;1014	E7EWI2;Q59HG2;Q02763	.;.;TIE2_HUMAN	L	866;1014;971	ENSP00000430686:V866L;ENSP00000369375:V1014L;ENSP00000383977:V971L	ENSP00000369375:V1014L	V	+	1	0	TEK	27207734	1.000000	0.71417	0.965000	0.40720	0.970000	0.65996	9.540000	0.98080	2.414000	0.81942	0.591000	0.81541	GTG	-	HMMPfam_Pkinase_Tyr		0.428	TEK-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TEK	protein_coding	OTTHUMT00000051965.3	G			27207734	1	no_errors	NM_000459	genbank	human	reviewed	54_36p	missense	SNP	1	T
NPR2	4882	genome.wustl.edu	37	9	35808671	35808671	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr9:35808671G>T	ENST00000342694.2	+	19	3133	c.2878G>T	c.(2878-2880)Gtc>Ttc	p.V960F	SPAG8_ENST00000479751.1_5'Flank|AL133410.1_ENST00000582432.1_RNA|SPAG8_ENST00000340291.2_Intron	NM_003995.3	NP_003986.2	P20594	ANPRB_HUMAN	natriuretic peptide receptor 2	960	Guanylate cyclase. {ECO:0000255|PROSITE- ProRule:PRU00099}.				bone development (GO:0060348)|cell surface receptor signaling pathway (GO:0007166)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cGMP biosynthetic process (GO:0006182)|intracellular signal transduction (GO:0035556)|negative regulation of meiotic cell cycle (GO:0051447)|negative regulation of oocyte maturation (GO:1900194)|ossification (GO:0001503)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of blood pressure (GO:0008217)|signal transduction (GO:0007165)|single organism reproductive process (GO:0044702)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)	p.V960F(1)		NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(2)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	45	all_epithelial(49;0.161)		LUSC - Lung squamous cell carcinoma(32;0.00521)|Lung(28;0.00697)|STAD - Stomach adenocarcinoma(86;0.194)		Erythrityl Tetranitrate(DB01613)|Nesiritide(DB04899)	ACGCATAGGGGTCCATACTGG	0.542																																																1	Substitution - Missense(1)	ovary(1)	9											86.0	81.0	83.0					9																	35808671		2203	4300	6503	35798671	SO:0001583	missense	4882			AJ005282	CCDS6590.1	9p21-p12	2014-03-03	2014-03-03		ENSG00000159899	ENSG00000159899			7944	protein-coding gene	gene with protein product	"""guanylate cyclase B"""	108961	"""acromesomelic dysplasia, Maroteaux type"", ""atrionatriuretic peptide receptor B"", ""natriuretic peptide receptor B"""	ANPRB, NPRB, AMDM		9634515, 15146390	Standard	XM_005251478		Approved	GUCY2B, ANPb	uc003zyd.3	P20594	OTTHUMG00000019871	ENST00000342694.2:c.2878G>T	9.37:g.35808671G>T	ENSP00000341083:p.Val960Phe		35798671	B0ZBF2|B0ZBF3|D3DRP3|D3DRP4|O60871|Q4VAK7|Q5TCV2|Q8TA93|Q9UQ50	Missense_Mutation	SNP	HMMPfam_Pkinase;HMMPfam_Guanylate_cyc;HMMPfam_ANF_receptor;superfamily_Protein kinase-like (PK-like);superfamily_Periplasmic binding protein-like I;superfamily_Adenylyl and guanylyl cyclase catalytic domain	p.V960F	ENST00000342694.2	37	c.2878	CCDS6590.1	9	.	.	.	.	.	.	.	.	.	.	G	22.8	4.336362	0.81801	.	.	ENSG00000159899	ENST00000342694	D	0.84298	-1.83	5.63	5.63	0.86233	Adenylyl cyclase class-3/4/guanylyl cyclase (5);	0.000000	0.39020	N	0.001493	T	0.80529	0.4640	L	0.35723	1.085	0.80722	D	1	P;B	0.39940	0.696;0.205	B;B	0.43990	0.438;0.139	T	0.79063	-0.1957	10	0.41790	T	0.15	.	8.7666	0.34706	0.1589:0.0:0.8411:0.0	.	960;960	P20594-2;P20594	.;ANPRB_HUMAN	F	960	ENSP00000341083:V960F	ENSP00000341083:V960F	V	+	1	0	NPR2	35798671	1.000000	0.71417	0.998000	0.56505	0.982000	0.71751	3.272000	0.51616	2.636000	0.89361	0.655000	0.94253	GTC	-	HMMPfam_Guanylate_cyc		0.542	NPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPR2	protein_coding	OTTHUMT00000052345.1	G			35798671	1	no_errors	NM_003995	genbank	human	reviewed	54_36p	missense	SNP	0.99	T
RPS10P3	158104	genome.wustl.edu	37	9	90631349	90631349	+	IGR	SNP	C	C	A			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr9:90631349C>A								U6 (18099 upstream) : U3 (357834 downstream)																							ACCTTCATGTCATGAAGGCCA	0.488																																																0			9																																								89821169	SO:0001628	intergenic_variant	158104																															9.37:g.90631349C>A			89821169		RNA	SNP	-	NULL		37	NULL		9																																																																																			-	-	0	0.488					RPS10P3			C			89821169	1	pseudogene	XR_016556	genbank	human	model	54_36p	rna	SNP	1	A
ZNF169	169841	genome.wustl.edu	37	9	97062517	97062517	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr9:97062517G>C	ENST00000395395.2	+	5	767	c.677G>C	c.(676-678)aGc>aCc	p.S226T	ZNF169_ENST00000340911.4_3'UTR	NM_194320.2	NP_919301.2	Q14929	ZN169_HUMAN	zinc finger protein 169	226					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S226T(1)		endometrium(1)|kidney(2)|large_intestine(3)|lung(8)|ovary(2)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	24		Acute lymphoblastic leukemia(62;0.136)				AAAAAGTCAAGCCTGTTCAGC	0.512																																																1	Substitution - Missense(1)	ovary(1)	9											65.0	59.0	61.0					9																	97062517		2203	4300	6503	96102338	SO:0001583	missense	169841			U28322	CCDS6709.2	9q22.32	2014-07-30			ENSG00000175787	ENSG00000175787		"""Zinc fingers, C2H2-type"", ""-"""	12957	protein-coding gene	gene with protein product		603404				9186526, 9071574	Standard	NM_001301275		Approved	MGC51961	uc004aum.1	Q14929	OTTHUMG00000020264	ENST00000395395.2:c.677G>C	9.37:g.97062517G>C	ENSP00000378792:p.Ser226Thr		96102338	A2AGP5|A8K127|Q6PI28	Missense_Mutation	SNP	-	p.S226T	ENST00000395395.2	37	c.677	CCDS6709.2	9	.	.	.	.	.	.	.	.	.	.	G	1.590	-0.529414	0.04112	.	.	ENSG00000175787	ENST00000395395;ENST00000340911	T	0.07216	3.21	2.59	1.67	0.24075	.	.	.	.	.	T	0.07954	0.0199	L	0.39245	1.2	0.58432	D	0.999998	B	0.31040	0.305	B	0.34873	0.191	T	0.22417	-1.0217	9	0.56958	D	0.05	.	6.666	0.23041	0.1601:0.0:0.8399:0.0	.	226	Q14929	ZN169_HUMAN	T	226;35	ENSP00000378792:S226T	ENSP00000340711:S35T	S	+	2	0	ZNF169	96102338	0.000000	0.05858	0.875000	0.34327	0.471000	0.32888	-1.626000	0.02035	0.643000	0.30638	0.505000	0.49811	AGC	-	NULL		0.512	ZNF169-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF169	protein_coding	OTTHUMT00000253714.1	G	NM_194320		96102338	1	no_errors	NM_194320	genbank	human	validated	54_36p	missense	SNP		C
QSOX2	169714	genome.wustl.edu	37	9	139103240	139103240	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chr9:139103240G>T	ENST00000358701.5	-	11	1456	c.1419C>A	c.(1417-1419)ttC>ttA	p.F473L		NM_181701.3	NP_859052.3	Q6ZRP7	QSOX2_HUMAN	quiescin Q6 sulfhydryl oxidase 2	473	ERV/ALR sulfhydryl oxidase. {ECO:0000255|PROSITE-ProRule:PRU00654}.				cell redox homeostasis (GO:0045454)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	thiol oxidase activity (GO:0016972)	p.F473L(1)		NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(10)|ovary(4)|prostate(1)|upper_aerodigestive_tract(1)	22		Myeloproliferative disorder(178;0.0511)		Epithelial(140;7.78e-08)|OV - Ovarian serous cystadenocarcinoma(145;1.55e-07)		TACACCCAAAGAAGGTGTGAA	0.537																																																1	Substitution - Missense(1)	ovary(1)	9											134.0	101.0	112.0					9																	139103240		2203	4300	6503	138243061	SO:0001583	missense	169714			AJ318051	CCDS35178.1	9q34.3	2008-02-05	2007-04-23	2007-04-23	ENSG00000165661	ENSG00000165661			30249	protein-coding gene	gene with protein product		612860	"""quiescin Q6-like 1"""	QSCN6L1		12176051	Standard	NM_181701		Approved	SOXN, DKFZp762A2013	uc010nbi.2	Q6ZRP7	OTTHUMG00000020923	ENST00000358701.5:c.1419C>A	9.37:g.139103240G>T	ENSP00000351536:p.Phe473Leu		138243061	A2CEE0|A6NLB0|Q5TB37|Q7Z7B6|Q86VV7|Q8N3G2	Missense_Mutation	SNP	HMMPfam_Evr1_Alr;superfamily_Thioredoxin-like;HMMPfam_Thioredoxin;superfamily_FAD-dependent thiol oxidase	p.F473L	ENST00000358701.5	37	c.1419	CCDS35178.1	9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.78|15.78	2.935607|2.935607	0.52972|0.52972	.|.	.|.	ENSG00000165661|ENSG00000165661	ENST00000358701;ENST00000389471|ENST00000455222	T|.	0.55052|.	0.54|.	4.72|4.72	3.55|3.55	0.40652|0.40652	Erv1/Alr (3);ERV/ALR sulphydryl oxidase (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.72285|0.72285	0.3441|0.3441	M|M	0.79123|0.79123	2.44|2.44	0.80722|0.80722	D|D	1|1	D|.	0.69078|.	0.997|.	D|.	0.71870|.	0.975|.	T|T	0.73294|0.73294	-0.4028|-0.4028	10|5	0.62326|.	D|.	0.03|.	-28.1458|-28.1458	10.7183|10.7183	0.46026|0.46026	0.1362:0.0:0.8638:0.0|0.1362:0.0:0.8638:0.0	.|.	473|.	Q6ZRP7|.	QSOX2_HUMAN|.	L|I	473;272|241	ENSP00000351536:F473L|.	ENSP00000351536:F473L|.	F|L	-|-	3|1	2|0	QSOX2|QSOX2	138243061|138243061	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.151000|0.151000	0.21798|0.21798	2.011000|2.011000	0.40922|0.40922	2.330000|2.330000	0.79161|0.79161	0.609000|0.609000	0.83330|0.83330	TTC|CTT	-	HMMPfam_Evr1_Alr		0.537	QSOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	QSOX2	protein_coding	OTTHUMT00000055046.2	G	NM_181701		138243061	-1	no_errors	NM_181701	genbank	human	validated	54_36p	missense	SNP	1	T
PHKA1	5255	genome.wustl.edu	37	X	71831000	71831000	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chrX:71831000G>A	ENST00000373542.4	-	22	2563	c.2404C>T	c.(2404-2406)Cgg>Tgg	p.R802W	PHKA1_ENST00000541944.1_Missense_Mutation_p.R743W|PHKA1_ENST00000373539.3_Missense_Mutation_p.R802W|PHKA1_ENST00000373545.3_Missense_Mutation_p.R743W|PHKA1_ENST00000339490.3_Missense_Mutation_p.R802W	NM_002637.3	NP_002628.2	P46020	KPB1_HUMAN	phosphorylase kinase, alpha 1 (muscle)	802					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)	p.R802W(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(2)|lung(18)|ovary(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	52	Renal(35;0.156)					GTAGCACTCCGTTCATTATAC	0.423																																																1	Substitution - Missense(1)	ovary(1)	X											80.0	70.0	74.0					X																	71831000		2203	4300	6503	71747725	SO:0001583	missense	5255				CCDS14421.1, CCDS48137.1, CCDS55453.1	Xq12-q13	2009-07-10			ENSG00000067177	ENSG00000067177	2.7.11.19		8925	protein-coding gene	gene with protein product		311870		PHKA			Standard	NM_002637		Approved		uc004eax.4	P46020	OTTHUMG00000022696	ENST00000373542.4:c.2404C>T	X.37:g.71831000G>A	ENSP00000362643:p.Arg802Trp		71747725	B7ZL05|B7ZL07|Q2M3D7	Missense_Mutation	SNP	HMMPfam_PHK_AB;superfamily_Six-hairpin glycosidases	p.R802W	ENST00000373542.4	37	c.2404	CCDS14421.1	X	.	.	.	.	.	.	.	.	.	.	C	26.0	4.697080	0.88830	.	.	ENSG00000067177	ENST00000373545;ENST00000373542;ENST00000541944;ENST00000339490;ENST00000373539	D;D;D;D;D	0.91180	-2.8;-2.79;-2.8;-2.79;-2.8	5.85	2.87	0.33458	Glycoside hydrolase 15-related (1);	0.923503	0.09445	N	0.801259	D	0.88651	0.6494	L	0.49126	1.545	0.09310	N	1	P;B;P	0.51057	0.941;0.282;0.507	B;B;P	0.46144	0.269;0.291;0.505	T	0.76602	-0.2899	10	0.59425	D	0.04	-3.2086	6.6993	0.23217	0.0:0.4301:0.3998:0.1701	.	743;802;802	B7ZL07;P46020-2;P46020	.;.;KPB1_HUMAN	W	743;802;743;802;802	ENSP00000362646:R743W;ENSP00000362643:R802W;ENSP00000441251:R743W;ENSP00000342469:R802W;ENSP00000362640:R802W	ENSP00000342469:R802W	R	-	1	2	PHKA1	71747725	0.000000	0.05858	0.072000	0.20136	0.917000	0.54804	0.518000	0.22847	-0.067000	0.12976	-0.170000	0.13304	CGG	-	HMMPfam_PHK_AB		0.423	PHKA1-001	KNOWN	basic|CCDS	protein_coding	PHKA1	protein_coding	OTTHUMT00000058896.1	G			71747725	-1	no_errors	NM_002637	genbank	human	validated	54_36p	missense	SNP	0.07	A
DIAPH2	1730	genome.wustl.edu	37	X	96396767	96396767	+	Missense_Mutation	SNP	T	T	C			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chrX:96396767T>C	ENST00000324765.8	+	22	3040	c.2693T>C	c.(2692-2694)cTg>cCg	p.L898P	DIAPH2_ENST00000373054.4_Missense_Mutation_p.L894P|DIAPH2_ENST00000373061.3_Missense_Mutation_p.L898P|DIAPH2_ENST00000355827.4_Missense_Mutation_p.L898P|DIAPH2_ENST00000373049.4_Missense_Mutation_p.L898P			O60879	DIAP2_HUMAN	diaphanous-related formin 2	898	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				actin filament polymerization (GO:0030041)|cytokinesis (GO:0000910)|female gamete generation (GO:0007292)|multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)	endosome (GO:0005768)	receptor binding (GO:0005102)	p.L898P(1)		breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	51						CCTGAAGAACTGGAACACGTA	0.323																																																1	Substitution - Missense(1)	ovary(1)	X											69.0	64.0	66.0					X																	96396767		2203	4300	6503	96283423	SO:0001583	missense	1730			Y15909	CCDS14467.1, CCDS14468.1	Xq22	2013-05-24	2013-05-24		ENSG00000147202	ENSG00000147202			2877	protein-coding gene	gene with protein product		300108	"""diaphanous (Drosophila, homolog) 2"", ""diaphanous homolog 2 (Drosophila)"""			9360932	Standard	NM_006729		Approved	POF, DIA, POF2, DIA2	uc004efu.4	O60879	OTTHUMG00000022689	ENST00000324765.8:c.2693T>C	X.37:g.96396767T>C	ENSP00000321348:p.Leu898Pro		96283423	A6NG19|O60878|Q8WX06|Q8WX48|Q9UJL2	Missense_Mutation	SNP	HMMPfam_Drf_DAD;HMMPfam_Drf_FH3;HMMPfam_Drf_GBD;HMMPfam_FH2;superfamily_Formin homology 2 domain (FH2 domain)	p.L898P	ENST00000324765.8	37	c.2693	CCDS14467.1	X	.	.	.	.	.	.	.	.	.	.	T	20.9	4.069614	0.76301	.	.	ENSG00000147202	ENST00000373061;ENST00000373054;ENST00000355827;ENST00000373049;ENST00000324765;ENST00000537885	T;T;T;T;T	0.62498	0.02;0.02;0.02;0.02;0.02	5.46	5.46	0.80206	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.000000	0.56097	D	0.000038	T	0.81564	0.4849	M	0.86953	2.85	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.85166	0.0995	10	0.87932	D	0	.	14.5822	0.68300	0.0:0.0:0.0:1.0	.	898;898	O60879;O60879-2	DIAP2_HUMAN;.	P	898;894;898;898;898;905	ENSP00000362152:L898P;ENSP00000362145:L894P;ENSP00000348082:L898P;ENSP00000362140:L898P;ENSP00000321348:L898P	ENSP00000321348:L898P	L	+	2	0	DIAPH2	96283423	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.357000	0.79456	1.824000	0.53156	0.486000	0.48141	CTG	-	HMMPfam_FH2		0.323	DIAPH2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DIAPH2	protein_coding	OTTHUMT00000058871.2	T	NM_006729, NM_007309		96283423	1	no_errors	NM_006729	genbank	human	reviewed	54_36p	missense	SNP	1	C
GABRE	2564	genome.wustl.edu	37	X	151138159	151138159	+	Silent	SNP	A	A	T			TCGA-13-1481-01A-01W-0549-09	TCGA-13-1481-10A-01W-0549-09	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f9eab025-5518-4240-b1a8-19f8ff8354f0	01361f79-f17b-431a-a658-e8f4d1df7636	g.chrX:151138159A>T	ENST00000370328.3	-	3	377	c.324T>A	c.(322-324)ccT>ccA	p.P108P	GABRE_ENST00000393914.3_5'UTR|GABRE_ENST00000370325.1_Silent_p.P108P	NM_004961.3	NP_004952.2	P78334	GBRE_HUMAN	gamma-aminobutyric acid (GABA) A receptor, epsilon	108					gamma-aminobutyric acid signaling pathway (GO:0007214)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)	p.P108P(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|skin(1)	27	Acute lymphoblastic leukemia(192;6.56e-05)				Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	GGATAGAGAGAGGACCAAGGC	0.502																																																1	Substitution - coding silent(1)	ovary(1)	X											99.0	83.0	88.0					X																	151138159		2203	4300	6503	150888815	SO:0001819	synonymous_variant	2564			Y09765	CCDS14703.1	Xq28	2012-06-22			ENSG00000102287	ENSG00000102287		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4085	protein-coding gene	gene with protein product	"""GABA(A) receptor, epsilon"""	300093				9039914, 9084408	Standard	NM_004961		Approved		uc004ffi.3	P78334	OTTHUMG00000024176	ENST00000370328.3:c.324T>A	X.37:g.151138159A>T			150888815	E7ET93|O15345|O15346|Q6PCD2|Q99520	Silent	SNP	-	p.P108	ENST00000370328.3	37	c.324	CCDS14703.1	X																																																																																			-	NULL		0.502	GABRE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABRE	protein_coding	OTTHUMT00000060903.1	A	NM_004961, NM_021990, NM_021984		150888815	-1	no_errors	NM_004961	genbank	human	reviewed	54_36p	silent	SNP	0.63	T
