#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
CRNN	49860	genome.wustl.edu	37	1	152383392	152383392	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1491-01A-01W-0549-09	TCGA-13-1491-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fb7d1c2b-3e87-4d05-a58b-92d0e1016986	95848a3e-2292-4a0a-ace2-683e70709a56	g.chr1:152383392C>T	ENST00000271835.3	-	3	228	c.166G>A	c.(166-168)Gag>Aag	p.E56K	RP1-91G5.3_ENST00000411804.1_RNA	NM_016190.2	NP_057274.1	Q9UBG3	CRNN_HUMAN	cornulin	56	EF-hand. {ECO:0000255|PROSITE- ProRule:PRU00448}.				response to heat (GO:0009408)|single organismal cell-cell adhesion (GO:0016337)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	calcium ion binding (GO:0005509)	p.E56K(1)		breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(16)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			CGCAGGACCTCATCCACAGTT	0.532																																																1	Substitution - Missense(1)	ovary(1)	1											39.0	40.0	40.0					1																	152383392		2185	4275	6460	150650016	SO:0001583	missense	49860			AF077831	CCDS1010.1	1q21	2014-01-28	2005-06-13	2005-06-13	ENSG00000143536	ENSG00000143536		"""EF-hand domain containing"""	1230	protein-coding gene	gene with protein product		611312	"""chromosome 1 open reading frame 10"""	C1orf10		11056050, 15854041	Standard	NM_016190		Approved	SEP53	uc001ezx.2	Q9UBG3	OTTHUMG00000012383	ENST00000271835.3:c.166G>A	1.37:g.152383392C>T	ENSP00000271835:p.Glu56Lys		150650016	B2RE60|Q8N613	Missense_Mutation	SNP	-	p.E56K	ENST00000271835.3	37	c.166	CCDS1010.1	1	.	.	.	.	.	.	.	.	.	.	C	10.88	1.476249	0.26511	.	.	ENSG00000143536	ENST00000271835;ENST00000451038	T	0.13196	2.61	4.73	2.73	0.32206	EF-hand-like domain (1);	0.298666	0.23803	N	0.044401	T	0.02610	0.0079	N	0.20401	0.57	0.31320	N	0.686174	B	0.34200	0.441	B	0.28638	0.092	T	0.44467	-0.9326	10	0.23891	T	0.37	.	11.2329	0.48923	0.0:0.6444:0.3556:0.0	.	56	Q9UBG3	CRNN_HUMAN	K	56	ENSP00000271835:E56K	ENSP00000271835:E56K	E	-	1	0	CRNN	150650016	0.834000	0.29399	0.998000	0.56505	0.103000	0.19146	0.322000	0.19576	1.180000	0.42898	0.305000	0.20034	GAG	-	NULL		0.532	CRNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRNN	protein_coding	OTTHUMT00000034503.1	C	NM_016190		150650016	-1	no_errors	NM_016190	genbank	human	reviewed	54_36p	missense	SNP	0.98	T
IFI16	3428	genome.wustl.edu	37	1	159023472	159023472	+	Silent	SNP	G	G	A			TCGA-13-1491-01A-01W-0549-09	TCGA-13-1491-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fb7d1c2b-3e87-4d05-a58b-92d0e1016986	95848a3e-2292-4a0a-ace2-683e70709a56	g.chr1:159023472G>A	ENST00000295809.7	+	11	2490	c.2235G>A	c.(2233-2235)ggG>ggA	p.G745G	IFI16_ENST00000368132.3_Silent_p.G689G|IFI16_ENST00000448393.2_Silent_p.G633G|IFI16_ENST00000359709.3_Silent_p.G689G|IFI16_ENST00000340979.6_Silent_p.G633G|IFI16_ENST00000430894.2_Silent_p.G693G|IFI16_ENST00000368131.4_Silent_p.G689G			Q16666	IF16_HUMAN	interferon, gamma-inducible protein 16	745	HIN-200 2. {ECO:0000255|PROSITE- ProRule:PRU00106}.|Interaction with TP53 core domain.				activation of cysteine-type endopeptidase activity (GO:0097202)|activation of innate immune response (GO:0002218)|autophagy (GO:0006914)|cell proliferation (GO:0008283)|cellular response to glucose starvation (GO:0042149)|cellular response to ionizing radiation (GO:0071479)|defense response to virus (GO:0051607)|hemopoiesis (GO:0030097)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|monocyte differentiation (GO:0030224)|myeloid cell differentiation (GO:0030099)|negative regulation of cysteine-type endopeptidase activity (GO:2000117)|negative regulation of DNA binding (GO:0043392)|negative regulation of innate immune response (GO:0045824)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral genome replication (GO:0045071)|positive regulation of cytokine production (GO:0001819)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of autophagy (GO:0010506)|regulation of gene expression, epigenetic (GO:0040029)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter binding (GO:0001047)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)	p.G689G(1)		cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|prostate(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_hematologic(112;0.0429)					CGAAAAGTGGGAATACCGGGG	0.418																																																1	Substitution - coding silent(1)	ovary(1)	1											135.0	131.0	133.0					1																	159023472		2203	4300	6503	157290096	SO:0001819	synonymous_variant	3428			M63838	CCDS1180.3, CCDS58039.1	1q22	2008-02-05			ENSG00000163565	ENSG00000163565			5395	protein-coding gene	gene with protein product		147586				1526658, 7959953	Standard	NM_005531		Approved	IFNGIP1, PYHIN2	uc010pis.2	Q16666	OTTHUMG00000037108	ENST00000295809.7:c.2235G>A	1.37:g.159023472G>A			157290096	B4DJT8|H3BLV7|Q59GX0|Q5T3W7|Q5T3W8|Q5T3X0|Q5T3X1|Q5T3X2|Q8N9E5|Q8NEQ7|Q96AJ5|Q9UH78	Silent	SNP	-	p.G689	ENST00000295809.7	37	c.2067		1	.	.	.	.	.	.	.	.	.	.	G	3.063	-0.192754	0.06259	.	.	ENSG00000163565	ENST00000448393	.	.	.	4.83	-6.51	0.01878	.	.	.	.	.	T	0.03095	0.0091	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.31558	-0.9939	5	0.10636	T	0.68	.	2.2821	0.04117	0.3449:0.3032:0.2512:0.1008	.	.	.	.	E	454	.	ENSP00000404325:G454E	G	+	2	0	IFI16	157290096	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.437000	0.02419	-1.717000	0.01385	-2.139000	0.00339	GGA	-	NULL		0.418	IFI16-013	KNOWN	basic	protein_coding	IFI16	protein_coding	OTTHUMT00000421720.1	G	NM_005531		157290096	1	no_errors	NM_005531	genbank	human	reviewed	54_36p	silent	SNP		A
MPZL1	9019	genome.wustl.edu	37	1	167734930	167734930	+	Missense_Mutation	SNP	G	G	A	rs146968580		TCGA-13-1491-01A-01W-0549-09	TCGA-13-1491-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fb7d1c2b-3e87-4d05-a58b-92d0e1016986	95848a3e-2292-4a0a-ace2-683e70709a56	g.chr1:167734930G>A	ENST00000359523.2	+	2	404	c.202G>A	c.(202-204)Ggg>Agg	p.G68R	MPZL1_ENST00000474859.1_Missense_Mutation_p.G68R|MPZL1_ENST00000392121.3_Missense_Mutation_p.G68R	NM_003953.5|NM_024569.4	NP_003944.1|NP_078845.3	O95297	MPZL1_HUMAN	myelin protein zero-like 1	68	Ig-like V-type.				cell-cell signaling (GO:0007267)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)	structural molecule activity (GO:0005198)	p.G68R(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(2)	15	all_hematologic(923;0.215)					TACGACTGGCGGGTTGACCTC	0.507																																																1	Substitution - Missense(1)	ovary(1)	1						G	ARG/GLY,ARG/GLY,ARG/GLY	0,4406		0,0,2203	64.0	60.0	62.0		202,202,202	-1.5	0.0	1	dbSNP_134	62	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	MPZL1	NM_001146191.1,NM_003953.5,NM_024569.4	125,125,125	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign,benign,benign	68/120,68/270,68/210	167734930	1,13005	2203	4300	6503	166001554	SO:0001583	missense	9019			AF087020	CCDS1264.1, CCDS44273.1, CCDS53425.1	1q24.2	2013-01-11			ENSG00000197965	ENSG00000197965		"""Immunoglobulin superfamily / V-set domain containing"""	7226	protein-coding gene	gene with protein product		604376				9792637	Standard	NM_003953		Approved	PZR, FLJ21047	uc001geo.3	O95297	OTTHUMG00000034571	ENST00000359523.2:c.202G>A	1.37:g.167734930G>A	ENSP00000352513:p.Gly68Arg		166001554	B2REB9|B2REC0|Q5R332|Q8IX11|Q9BWZ3|Q9NYK4|Q9UL20	Missense_Mutation	SNP	HMMPfam_V-set;superfamily_Immunoglobulin	p.G68R	ENST00000359523.2	37	c.202	CCDS1264.1	1	.	.	.	.	.	.	.	.	.	.	G	2.232	-0.375936	0.05034	0.0	1.16E-4	ENSG00000197965	ENST00000359523;ENST00000392121;ENST00000474859;ENST00000367853	T;D;T;T	0.94576	-0.14;-3.46;-0.14;-0.14	4.79	-1.53	0.08611	Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin V-set, subgroup (1);Immunoglobulin-like fold (1);	0.624596	0.16673	N	0.204264	T	0.67970	0.2950	N	0.08118	0	0.25095	N	0.990826	B;B;B	0.11235	0.003;0.0;0.004	B;B;B	0.04013	0.001;0.001;0.001	T	0.52525	-0.8564	9	0.17832	T	0.49	.	3.6584	0.08229	0.6381:0.1291:0.0993:0.1336	.	68;68;68	B2REC0;O95297-3;O95297	.;.;MPZL1_HUMAN	R	68;68;68;42	ENSP00000352513:G68R;ENSP00000375968:G68R;ENSP00000420455:G68R;ENSP00000356827:G42R	ENSP00000352513:G68R	G	+	1	0	MPZL1	166001554	0.386000	0.25180	0.000000	0.03702	0.319000	0.28217	0.927000	0.28818	-0.340000	0.08388	-0.137000	0.14449	GGG	-	HMMPfam_V-set		0.507	MPZL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MPZL1	protein_coding	OTTHUMT00000083655.2	G	NM_024569		166001554	1	no_errors	NM_003953	genbank	human	validated	54_36p	missense	SNP	0.16	A
GBP2	2634	genome.wustl.edu	37	1	89585952	89585952	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1491-01A-01W-0549-09	TCGA-13-1491-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fb7d1c2b-3e87-4d05-a58b-92d0e1016986	95848a3e-2292-4a0a-ace2-683e70709a56	g.chr1:89585952G>A	ENST00000370466.3	-	4	606	c.338C>T	c.(337-339)tCc>tTc	p.S113F	GBP2_ENST00000463660.1_5'Flank	NM_004120.3	NP_004111.2	P32456	GBP2_HUMAN	guanylate binding protein 2, interferon-inducible	113	GB1/RHD3-type G.|GTPase domain (Globular). {ECO:0000250}.				cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|interferon-gamma-mediated signaling pathway (GO:0060333)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.S113F(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(2)|skin(1)	20		Lung NSC(277;0.0908)		all cancers(265;0.0151)|Epithelial(280;0.0284)		AAAGATCCAGGAGTCATTCTC	0.453																																																1	Substitution - Missense(1)	ovary(1)	1											195.0	178.0	184.0					1																	89585952		2203	4300	6503	89358540	SO:0001583	missense	2634			BC073163	CCDS719.1	1p22.2	2008-02-05			ENSG00000162645	ENSG00000162645			4183	protein-coding gene	gene with protein product		600412				1715024	Standard	NM_004120		Approved		uc001dmz.1	P32456	OTTHUMG00000010662	ENST00000370466.3:c.338C>T	1.37:g.89585952G>A	ENSP00000359497:p.Ser113Phe		89358540	Q6GPH0|Q6IAU2|Q86TB0	Missense_Mutation	SNP	HMMPfam_GBP_C;HMMPfam_GBP;superfamily_Interferon-induced guanylate-binding protein 1 (GBP1) C-terminal domain;superfamily_P-loop containing nucleoside triphosphate hydrolases	p.S113F	ENST00000370466.3	37	c.338	CCDS719.1	1	.	.	.	.	.	.	.	.	.	.	G	14.24	2.477493	0.44044	.	.	ENSG00000162645	ENST00000370466	T	0.75477	-0.94	3.45	2.48	0.30137	Guanylate-binding protein, N-terminal (1);	0.295679	0.23881	U	0.043643	D	0.82669	0.5087	M	0.92077	3.27	0.24021	N	0.996143	D	0.65815	0.995	D	0.71184	0.972	T	0.75235	-0.3389	10	0.72032	D	0.01	-5.8833	10.2696	0.43475	0.0:0.2142:0.7858:0.0	.	113	P32456	GBP2_HUMAN	F	113	ENSP00000359497:S113F	ENSP00000359497:S113F	S	-	2	0	GBP2	89358540	0.045000	0.20229	1.000000	0.80357	0.695000	0.40330	0.827000	0.27421	0.726000	0.32339	0.644000	0.83932	TCC	-	HMMPfam_GBP		0.453	GBP2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	GBP2	protein_coding	OTTHUMT00000029406.2	G	NM_004120		89358540	-1	no_errors	NM_004120	genbank	human	reviewed	54_36p	missense	SNP	1	A
RNASEL	6041	genome.wustl.edu	37	1	182544694	182544694	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1491-01A-01W-0549-09	TCGA-13-1491-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fb7d1c2b-3e87-4d05-a58b-92d0e1016986	95848a3e-2292-4a0a-ace2-683e70709a56	g.chr1:182544694C>T	ENST00000367559.3	-	7	2312	c.2059G>A	c.(2059-2061)Gac>Aac	p.D687N	RNASEL_ENST00000444138.1_Missense_Mutation_p.D687N	NM_021133.3	NP_066956.1	Q05823	RN5A_HUMAN	ribonuclease L (2',5'-oligoisoadenylate synthetase-dependent)	687	KEN. {ECO:0000255|PROSITE- ProRule:PRU00725}.				cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|mRNA processing (GO:0006397)|negative regulation of viral genome replication (GO:0045071)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|rRNA processing (GO:0006364)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nuclear matrix (GO:0016363)	ATP binding (GO:0005524)|endoribonuclease activity (GO:0004521)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|RNA binding (GO:0003723)|rRNA binding (GO:0019843)	p.D687N(1)		NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(9)|ovary(4)|prostate(1)|stomach(1)|urinary_tract(1)	27						AGGGAAGGGTCTCCAATTTTT	0.398																																																1	Substitution - Missense(1)	ovary(1)	1											81.0	78.0	79.0					1																	182544694		2203	4300	6503	180811317	SO:0001583	missense	6041			L10381	CCDS1347.1	1q25	2013-01-10			ENSG00000135828	ENSG00000135828	3.1.26.-	"""Ankyrin repeat domain containing"""	10050	protein-coding gene	gene with protein product		180435	"""prostate cancer 1"""	RNS4, PRCA1		7514564	Standard	NM_021133		Approved		uc009wxz.2	Q05823	OTTHUMG00000035213	ENST00000367559.3:c.2059G>A	1.37:g.182544694C>T	ENSP00000356530:p.Asp687Asn		180811317	Q5W0L2|Q6AI46	Missense_Mutation	SNP	-	p.D687N	ENST00000367559.3	37	c.2059	CCDS1347.1	1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.943203	0.73672	.	.	ENSG00000135828	ENST00000367559;ENST00000444138	T;T	0.30714	1.52;1.52	5.11	4.2	0.49525	PUG domain (1);KEN domain, ribonuclease activator (2);	0.654660	0.14485	N	0.316728	T	0.45135	0.1327	L	0.56769	1.78	0.80722	D	1	D	0.54772	0.968	P	0.56960	0.81	T	0.35919	-0.9769	10	0.66056	D	0.02	-7.2216	10.9806	0.47492	0.0:0.9121:0.0:0.0879	.	687	Q05823	RN5A_HUMAN	N	687	ENSP00000356530:D687N;ENSP00000411147:D687N	ENSP00000356530:D687N	D	-	1	0	RNASEL	180811317	0.770000	0.28543	0.581000	0.28614	0.046000	0.14306	1.683000	0.37638	1.287000	0.44583	0.655000	0.94253	GAC	-	NULL		0.398	RNASEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNASEL	protein_coding	OTTHUMT00000085189.1	C	NM_021133		180811317	-1	no_errors	NM_021133	genbank	human	reviewed	54_36p	missense	SNP	0.23	T
SVIL	6840	genome.wustl.edu	37	10	29759392	29759392	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1491-01A-01W-0549-09	TCGA-13-1491-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fb7d1c2b-3e87-4d05-a58b-92d0e1016986	95848a3e-2292-4a0a-ace2-683e70709a56	g.chr10:29759392C>T	ENST00000355867.4	-	32	6408	c.5656G>A	c.(5656-5658)Gtg>Atg	p.V1886M	PTCHD3P1_ENST00000414457.1_RNA|SVIL_ENST00000535393.1_Missense_Mutation_p.V800M|SVIL_ENST00000375398.2_Missense_Mutation_p.V1886M|PTCHD3P1_ENST00000423223.1_RNA|SVIL_ENST00000375400.3_Missense_Mutation_p.V1460M|PTCHD3P1_ENST00000413405.1_RNA|PTCHD3P1_ENST00000446807.1_RNA|PTCHD3P1_ENST00000455774.1_RNA	NM_021738.2	NP_068506.2	O95425	SVIL_HUMAN	supervillin	1886					cytoskeleton organization (GO:0007010)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|costamere (GO:0043034)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)	p.V1886M(1)		breast(1)|central_nervous_system(3)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(24)|lung(35)|ovary(8)|prostate(2)|skin(4)|stomach(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	112		Breast(68;0.103)				TCTCCACGCACGCAGTACAGC	0.617																																																1	Substitution - Missense(1)	ovary(1)	10											56.0	51.0	53.0					10																	29759392		2203	4300	6503	29799398	SO:0001583	missense	6840			AF051851	CCDS7163.1, CCDS7164.1	10p11.2	2008-07-29			ENSG00000197321	ENSG00000197321			11480	protein-coding gene	gene with protein product	"""archvillin"""	604126				9382871	Standard	NM_003174		Approved		uc001iut.1	O95425	OTTHUMG00000017882	ENST00000355867.4:c.5656G>A	10.37:g.29759392C>T	ENSP00000348128:p.Val1886Met		29799398	D3DRW9|M1J557|O60611|O60612|Q5VZK5|Q5VZK6|Q9H1R7	Missense_Mutation	SNP	HMMPfam_VHP,superfamily_VHP Villin headpiece domain,HMMPfam_Gelsolin,superfamily_Actin depolymerizing proteins	p.V1886M	ENST00000355867.4	37	c.5656	CCDS7164.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	31|31	5.067637|5.067637	0.93898|0.93898	.|.	.|.	ENSG00000197321|ENSG00000197321	ENST00000535994|ENST00000375400;ENST00000375398;ENST00000355867;ENST00000535393	.|T;T;T;T	.|0.27256	.|1.68;1.68;1.68;1.68	5.61|5.61	5.61|5.61	0.85477|0.85477	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.57888|0.57888	0.2084|0.2084	M|M	0.86097|0.86097	2.795|2.795	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|1.0;0.995;0.985	.|D;P;P	.|0.70227	.|0.968;0.891;0.604	T|T	0.63659|0.63659	-0.6587|-0.6587	6|10	0.41790|0.87932	T|D	0.15|0	-12.7604|-12.7604	19.6337|19.6337	0.95721|0.95721	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|800;1460;1886	.|F5H2Q5;O95425-2;O95425	.|.;.;SVIL_HUMAN	H|M	749|1460;1886;1886;800	.|ENSP00000364549:V1460M;ENSP00000364547:V1886M;ENSP00000348128:V1886M;ENSP00000445472:V800M	ENSP00000440120:R749H|ENSP00000348128:V1886M	R|V	-|-	2|1	0|0	SVIL|SVIL	29799398|29799398	1.000000|1.000000	0.71417|0.71417	0.957000|0.957000	0.39632|0.39632	0.763000|0.763000	0.43281|0.43281	7.681000|7.681000	0.84073|0.84073	2.633000|2.633000	0.89246|0.89246	0.650000|0.650000	0.86243|0.86243	CGT|GTG	-	NULL		0.617	SVIL-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SVIL	protein_coding	OTTHUMT00000047395.1	C			29799398	-1	no_errors	NM_021738	genbank	human	reviewed	54_36p	missense	SNP	1	T
MALAT1	378938	genome.wustl.edu	37	11	65271687	65271688	+	lincRNA	INS	-	-	GA			TCGA-13-1491-01A-01W-0549-09	TCGA-13-1491-10A-01W-0549-09	-	-	-	GA	-	-	Unknown	Valid	Somatic	4	Capture	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	fb7d1c2b-3e87-4d05-a58b-92d0e1016986	95848a3e-2292-4a0a-ace2-683e70709a56	g.chr11:65271687_65271688insGA	ENST00000534336.1	+	0	6455_6456					NR_002819.2		Q9UHZ2	MALAT_HUMAN	metastasis associated lung adenocarcinoma transcript 1 (non-protein coding)																		AGTGAGTGTATGAGACCTTGCA	0.411																																																0			11																																								65028264			378938			AF001540		11q13.1	2013-12-11	2007-11-20		ENSG00000251562	ENSG00000251562		"""Long non-coding RNAs"", ""-"""	29665	non-coding RNA	RNA, long non-coding	"""metastasis associated in lung adenocarcinoma transcript 1"", ""non-protein coding RNA 47"", ""hepcarcin"", ""nuclear enriched abundant transcript 2"", ""nuclear paraspeckle assembly transcript 2 (non-protein coding)"", ""long intergenic non-protein coding RNA 47"""	607924				12970751, 22560368	Standard	NR_002819		Approved	PRO1073, MALAT-1, NCRNA00047, HCN, NEAT2, LINC00047, mascRNA	uc010roh.3	Q9UHZ2	OTTHUMG00000166322		11.37:g.65271690_65271691dupGA			65028263		RNA	INS	-	NULL	ENST00000534336.1	37	NULL		11																																																																																			-	-		0.411	MALAT1-001	KNOWN	basic	lincRNA	MALAT1	lincRNA	OTTHUMT00000389143.1	-	NR_002819		65028264	1	no_errors	NR_002819	genbank	human	provisional	54_36p	rna	INS	0.996:1.000	GA
PELI3	246330	genome.wustl.edu	37	11	66240744	66240744	+	Silent	SNP	C	C	T			TCGA-13-1491-01A-01W-0549-09	TCGA-13-1491-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fb7d1c2b-3e87-4d05-a58b-92d0e1016986	95848a3e-2292-4a0a-ace2-683e70709a56	g.chr11:66240744C>T	ENST00000320740.7	+	6	649	c.489C>T	c.(487-489)ttC>ttT	p.F163F	CTD-3074O7.5_ENST00000533502.1_RNA|CTD-3074O7.5_ENST00000527092.1_RNA|PELI3_ENST00000349459.6_Silent_p.F139F|CTD-3074O7.5_ENST00000602951.1_RNA|PELI3_ENST00000524466.1_Silent_p.F163F|PELI3_ENST00000531856.1_Intron	NM_001243136.1|NM_145065.2	NP_001230065.1|NP_659502.2	Q8N2H9	PELI3_HUMAN	pellino E3 ubiquitin protein ligase family member 3	163					defense response to Gram-negative bacterium (GO:0050829)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of Toll signaling pathway (GO:0045751)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|negative regulation of type I interferon production (GO:0032480)|positive regulation of nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070434)|protein K63-linked ubiquitination (GO:0070534)|regulation of nucleotide-binding oligomerization domain containing 1 signaling pathway (GO:0070428)|Toll signaling pathway (GO:0008063)	cytosol (GO:0005829)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.F163F(1)		breast(1)|endometrium(2)|large_intestine(4)|lung(4)|ovary(2)|prostate(1)|skin(1)	15						TGATTGACTTCGTGGTAACAG	0.612																																																1	Substitution - coding silent(1)	ovary(1)	11											68.0	68.0	68.0					11																	66240744		2200	4295	6495	65997320	SO:0001819	synonymous_variant	246330			AL834395	CCDS31615.1, CCDS41675.1, CCDS73328.1	11q13.2	2012-02-23	2012-02-23		ENSG00000174516	ENSG00000174516		"""Pellino homologs"""	30010	protein-coding gene	gene with protein product		609827	"""pellino homolog 3 (Drosophila)"""			12874243, 15917247	Standard	NM_145065		Approved	MGC35521	uc001oic.4	Q8N2H9	OTTHUMG00000167109	ENST00000320740.7:c.489C>T	11.37:g.66240744C>T			65997320	Q8N3E1|Q8N9Q6|Q8TAW7|Q8TED5	Silent	SNP	HMMPfam_Pellino;superfamily_RING/U-box	p.F163	ENST00000320740.7	37	c.489	CCDS31615.1	11																																																																																			-	HMMPfam_Pellino		0.612	PELI3-001	KNOWN	basic|CCDS	protein_coding	PELI3	protein_coding	OTTHUMT00000393226.1	C	NM_145065		65997320	1	no_errors	NM_145065	genbank	human	validated	54_36p	silent	SNP	0.92	T
CCDC63	160762	genome.wustl.edu	37	12	111296397	111296397	+	Missense_Mutation	SNP	A	A	C			TCGA-13-1491-01A-01W-0549-09	TCGA-13-1491-10A-01W-0549-09	A	A	A	C	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fb7d1c2b-3e87-4d05-a58b-92d0e1016986	95848a3e-2292-4a0a-ace2-683e70709a56	g.chr12:111296397A>C	ENST00000308208.5	+	4	429	c.187A>C	c.(187-189)Atc>Ctc	p.I63L	CCDC63_ENST00000545036.1_Missense_Mutation_p.I23L|CCDC63_ENST00000552694.1_5'UTR|CCDC63_ENST00000550317.1_3'UTR	NM_152591.1	NP_689804.1	Q8NA47	CCD63_HUMAN	coiled-coil domain containing 63	63								p.I63L(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(15)|ovary(1)|pancreas(1)|prostate(2)|skin(7)|urinary_tract(1)	39						CAGCAAGGAGATCAAGACCCT	0.502																																																1	Substitution - Missense(1)	ovary(1)	12											78.0	74.0	76.0					12																	111296397		2203	4300	6503	109780780	SO:0001583	missense	160762			AK093162	CCDS9151.1, CCDS66470.1, CCDS73528.1	12q24.11	2013-02-19				ENSG00000173093			26669	protein-coding gene	gene with protein product	"""outer row dynein assembly 5 homolog (Chlamydomonas)"""						Standard	NM_001286243		Approved	ODA5, FLJ35843	uc001trv.1	Q8NA47	OTTHUMG00000169534	ENST00000308208.5:c.187A>C	12.37:g.111296397A>C	ENSP00000312399:p.Ile63Leu		109780780	B4DY03|Q0P603|Q6P2E1	Missense_Mutation	SNP	-	p.I63L	ENST00000308208.5	37	c.187	CCDS9151.1	12	.	.	.	.	.	.	.	.	.	.	A	17.56	3.419436	0.62622	.	.	ENSG00000173093	ENST00000545036;ENST00000308208	T;T	0.52057	0.9;0.68	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	T	0.66117	0.2757	M	0.79475	2.455	0.80722	D	1	D	0.71674	0.998	D	0.71870	0.975	T	0.65545	-0.6142	10	0.30078	T	0.28	.	12.2005	0.54321	1.0:0.0:0.0:0.0	.	63	Q8NA47	CCD63_HUMAN	L	23;63	ENSP00000445881:I23L;ENSP00000312399:I63L	ENSP00000312399:I63L	I	+	1	0	CCDC63	109780780	1.000000	0.71417	0.987000	0.45799	0.268000	0.26511	4.850000	0.62889	2.136000	0.66102	0.454000	0.30748	ATC	-	NULL		0.502	CCDC63-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCDC63	protein_coding	OTTHUMT00000404673.2	A	NM_152591		109780780	1	no_errors	NM_152591	genbank	human	provisional	54_36p	missense	SNP	0.27	C
ZMYM2	7750	genome.wustl.edu	37	13	20641011	20641011	+	Silent	SNP	A	A	G			TCGA-13-1491-01A-01W-0549-09	TCGA-13-1491-10A-01W-0549-09	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	fb7d1c2b-3e87-4d05-a58b-92d0e1016986	95848a3e-2292-4a0a-ace2-683e70709a56	g.chr13:20641011A>G	ENST00000382874.2	+	21	3343	c.3153A>G	c.(3151-3153)gtA>gtG	p.V1051V	ZMYM2_ENST00000382869.3_Silent_p.V1051V|ZMYM2_ENST00000382871.2_Silent_p.V1051V|ZMYM2_ENST00000494061.2_3'UTR	NM_001190964.1	NP_001177893.1	Q9UBW7	ZMYM2_HUMAN	zinc finger, MYM-type 2	1051					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|PML body (GO:0016605)	ubiquitin conjugating enzyme binding (GO:0031624)|zinc ion binding (GO:0008270)	p.V1049V(1)		large_intestine(3)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	10		all_cancers(29;8.65e-21)|all_epithelial(30;1.04e-18)|all_lung(29;6.75e-18)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;0.000148)|Epithelial(112;0.000249)|OV - Ovarian serous cystadenocarcinoma(117;0.00816)|Lung(94;0.0173)|LUSC - Lung squamous cell carcinoma(192;0.0856)		GAAAGGCTGTATCAGGATACC	0.348																																																1	Substitution - coding silent(1)	ovary(1)	13											99.0	90.0	93.0					13																	20641011		1843	4084	5927	19539011	SO:0001819	synonymous_variant	7750			AF012126	CCDS45016.1	13q11-q12	2013-01-08	2006-07-13	2006-07-13	ENSG00000121741	ENSG00000121741		"""Zinc fingers, MYM type"""	12989	protein-coding gene	gene with protein product		602221	"""zinc finger protein 198"""	ZNF198		9499416, 9425908	Standard	XM_005266517		Approved	RAMP, FIM, MYM	uc001ums.3	Q9UBW7	OTTHUMG00000016507	ENST00000382874.2:c.3153A>G	13.37:g.20641011A>G			19539011	A6NDG0|A6NI02|O43212|O43434|O60898|Q5W0Q4|Q5W0T3|Q63HP0|Q8NE39|Q9H0V5|Q9H538|Q9UEU2	Silent	SNP	superfamily_Ferritin-like;HMMPfam_zf-MYM;superfamily_RING/U-box	p.V1051	ENST00000382874.2	37	c.3153	CCDS45016.1	13																																																																																			-	NULL		0.348	ZMYM2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZMYM2	protein_coding	OTTHUMT00000044051.2	A	NM_003453		19539011	1	no_errors	NM_003453	genbank	human	validated	54_36p	silent	SNP	1	G
UFM1	51569	genome.wustl.edu	37	13	38928430	38928441	+	Splice_Site	DEL	AGAAGTAAGTAC	AGAAGTAAGTAC	-			TCGA-13-1491-01A-01W-0549-09	TCGA-13-1491-10A-01W-0549-09	AGAAGTAAGTAC	AGAAGTAAGTAC					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	fb7d1c2b-3e87-4d05-a58b-92d0e1016986	95848a3e-2292-4a0a-ace2-683e70709a56	g.chr13:38928430_38928441delAGAAGTAAGTAC	ENST00000239878.4	+	3	153_156	c.114_117delAGAAGTAAGTAC	c.(112-117)gaagaa>ga	p.EE38del	UFM1_ENST00000379641.1_Splice_Site_p.EE56del|UFM1_ENST00000379649.1_Splice_Site_p.EE56del	NM_016617.2	NP_057701.1	P61960	UFM1_HUMAN	ubiquitin-fold modifier 1	38					protein ufmylation (GO:0071569)|response to endoplasmic reticulum stress (GO:0034976)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)		p.?(1)		lung(2)|ovary(1)	3		Lung NSC(96;3.18e-06)|Prostate(109;0.00314)|Breast(139;0.0199)|Lung SC(185;0.0743)		all cancers(112;1.05e-08)|Epithelial(112;1.44e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000855)|BRCA - Breast invasive adenocarcinoma(63;0.00342)|GBM - Glioblastoma multiforme(144;0.0132)		TTGCAGCAGAAGAAGTAAGTACAGaagttgga	0.377																																																1	Unknown(1)	ovary(1)	13																																								37826441	SO:0001630	splice_region_variant	51569			AF208844	CCDS9366.1, CCDS66533.1	13q13.3	2008-02-05	2005-05-27	2005-05-27	ENSG00000120686	ENSG00000120686			20597	protein-coding gene	gene with protein product		610553	"""chromosome 13 open reading frame 20"""	C13orf20		15071506	Standard	NM_001286706		Approved	bA131P10.1	uc001uwu.3	P61960	OTTHUMG00000017409	ENST00000239878.4:c.117+1AGAAGTAAGTAC>-	13.37:g.38928430_38928441delAGAAGTAAGTAC			37826430	Q14346|Q5VXS0|Q6IAG6|Q9CPX2|Q9NZF2	Frame_Shift_Del	DEL	HMMPfam_UPF0185;superfamily_Ubiquitin-like	p.E38fs	ENST00000239878.4	37	c.114_117	CCDS9366.1	13																																																																																			(deletion:cds_exon[37826376;37826433]; intron[37826434;37830229])	HMMPfam_UPF0185		0.377	UFM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UFM1	protein_coding	OTTHUMT00000045989.1	AGAAGTAAGTAC	NM_016617	In_Frame_Del	37826441	1	no_errors	NM_016617	genbank	human	validated	54_36p	frame_shift_del	DEL	1.000:1.000:1.000:1.000	-
CHD8	57680	genome.wustl.edu	37	14	21870533	21870533	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1491-01A-01W-0549-09	TCGA-13-1491-10A-01W-0549-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fb7d1c2b-3e87-4d05-a58b-92d0e1016986	95848a3e-2292-4a0a-ace2-683e70709a56	g.chr14:21870533G>C	ENST00000557364.1	-	19	4107	c.3844C>G	c.(3844-3846)Ctt>Gtt	p.L1282V	CHD8_ENST00000399982.2_Missense_Mutation_p.L1282V|CHD8_ENST00000430710.3_Missense_Mutation_p.L1003V|CHD8_ENST00000555962.1_5'UTR			Q9HCK8	CHD8_HUMAN	chromodomain helicase DNA binding protein 8	1282	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|canonical Wnt signaling pathway (GO:0060070)|DNA duplex unwinding (GO:0032508)|in utero embryonic development (GO:0001701)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	MLL1 complex (GO:0071339)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|beta-catenin binding (GO:0008013)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA-dependent ATPase activity (GO:0008094)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)	p.L1282V(1)		NS(2)|breast(1)|central_nervous_system(1)|cervix(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(33)|ovary(6)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	85	all_cancers(95;0.00121)		Epithelial(56;2.55e-06)|all cancers(55;1.73e-05)	GBM - Glioblastoma multiforme(265;0.00424)		ATGGATTGAAGCACAGCCTTA	0.448																																																1	Substitution - Missense(1)	ovary(1)	14											112.0	112.0	112.0					14																	21870533		2201	4299	6500	20940373	SO:0001583	missense	57680			AB046784	CCDS45081.1, CCDS53885.1	14q11.2	2008-02-05	2004-06-22	2004-06-23		ENSG00000100888			20153	protein-coding gene	gene with protein product		610528	"""helicase with SNF2 domain 1"""	HELSNF1		10997877	Standard	NM_020920		Approved	KIAA1564, DUPLIN	uc001war.2	Q9HCK8		ENST00000557364.1:c.3844C>G	14.37:g.21870533G>C	ENSP00000451601:p.Leu1282Val		20940373	Q4G0D8|Q68DQ0|Q6DKH9|Q6P440|Q6ZNL7|Q8N3Z9|Q8NCY4|Q8TBR9|Q96F26	Missense_Mutation	SNP	HMMPfam_SNF2_N;HMMPfam_Chromo;HMMPfam_Helicase_C;HMMPfam_TCH;superfamily_P-loop containing nucleoside triphosphate hydrolases;superfamily_Chromo domain-like	p.L1003V	ENST00000557364.1	37	c.3007	CCDS53885.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.45|17.45	3.393525|3.393525	0.62066|0.62066	.|.	.|.	ENSG00000100888|ENSG00000100888	ENST00000555935|ENST00000430710;ENST00000399982;ENST00000262707;ENST00000557364	.|T;T;T	.|0.78003	.|-1.14;-1.14;-1.14	5.65|5.65	5.65|5.65	0.86999|0.86999	.|Helicase, C-terminal (1);	.|0.000000	.|0.64402	.|D	.|0.000001	T|T	0.82089|0.82089	0.4961|0.4961	L|L	0.47190|0.47190	1.495|1.495	0.58432|0.58432	D|D	0.999999|0.999999	.|D;D	.|0.89917	.|0.999;1.0	.|D;D	.|0.91635	.|0.998;0.999	T|T	0.80654|0.80654	-0.1286|-0.1286	5|10	.|0.46703	.|T	.|0.11	-17.3333|-17.3333	8.4119|8.4119	0.32648|0.32648	0.1574:0.0:0.8426:0.0|0.1574:0.0:0.8426:0.0	.|.	.|1282;1003	.|Q9HCK8;Q9HCK8-2	.|CHD8_HUMAN;.	G|V	507|1003;1282;1002;1282	.|ENSP00000406288:L1003V;ENSP00000382863:L1282V;ENSP00000451601:L1282V	.|ENSP00000262707:L1002V	A|L	-|-	2|1	0|0	CHD8|CHD8	20940373|20940373	0.954000|0.954000	0.32549|0.32549	1.000000|1.000000	0.80357|0.80357	0.990000|0.990000	0.78478|0.78478	1.601000|1.601000	0.36773|0.36773	2.941000|2.941000	0.99782|0.99782	0.655000|0.655000	0.94253|0.94253	GCT|CTT	-	NULL		0.448	CHD8-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CHD8	protein_coding	OTTHUMT00000410436.1	G	NM_020920		20940373	-1	no_errors	NM_020920	genbank	human	validated	54_36p	missense	SNP	0.99	C
FOXN3	1112	genome.wustl.edu	37	14	89628930	89628930	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1491-01A-01W-0549-09	TCGA-13-1491-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fb7d1c2b-3e87-4d05-a58b-92d0e1016986	95848a3e-2292-4a0a-ace2-683e70709a56	g.chr14:89628930G>A	ENST00000345097.4	-	7	1417	c.1301C>T	c.(1300-1302)aCa>aTa	p.T434I	FOXN3_ENST00000557258.1_Missense_Mutation_p.T412I|FOXN3_ENST00000261302.5_Missense_Mutation_p.T434I|FOXN3_ENST00000555353.1_Missense_Mutation_p.T412I	NM_001085471.1	NP_001078940.1	O00409	FOXN3_HUMAN	forkhead box N3	434					mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	protein C-terminus binding (GO:0008022)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.T412I(1)		endometrium(4)|large_intestine(4)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						GAGGGGCAGTGTGTCGCTGGG	0.612																																																1	Substitution - Missense(1)	ovary(1)	14											94.0	86.0	89.0					14																	89628930		2203	4300	6503	88698683	SO:0001583	missense	1112				CCDS32138.1, CCDS41977.1	14q32.11	2012-04-17	2007-05-02	2007-05-02	ENSG00000053254	ENSG00000053254		"""Forkhead boxes"""	1928	protein-coding gene	gene with protein product		602628	"""chromosome 14 open reading frame 116"", ""checkpoint suppressor 1"""	C14orf116, CHES1		9154802	Standard	NM_005197		Approved		uc001xxo.4	O00409	OTTHUMG00000170898	ENST00000345097.4:c.1301C>T	14.37:g.89628930G>A	ENSP00000343288:p.Thr434Ile		88698683	Q96II7|Q9UIE7	Missense_Mutation	SNP	-	p.T434I	ENST00000345097.4	37	c.1301	CCDS41977.1	14	.	.	.	.	.	.	.	.	.	.	G	16.81	3.225331	0.58668	.	.	ENSG00000053254	ENST00000345097;ENST00000261302;ENST00000557258;ENST00000555353	T;T;T;T	0.62941	-0.01;-0.01;-0.01;-0.01	5.95	5.95	0.96441	.	0.114128	0.64402	D	0.000017	T	0.66406	0.2786	L	0.50333	1.59	0.58432	D	0.999997	P;P	0.44478	0.818;0.836	B;P	0.46758	0.3;0.526	T	0.63065	-0.6720	10	0.38643	T	0.18	.	19.9882	0.97356	0.0:0.0:1.0:0.0	.	434;412	O00409;O00409-2	FOXN3_HUMAN;.	I	434;434;412;412	ENSP00000343288:T434I;ENSP00000261302:T434I;ENSP00000452005:T412I;ENSP00000452227:T412I	ENSP00000261302:T434I	T	-	2	0	FOXN3	88698683	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	9.816000	0.99350	2.824000	0.97209	0.655000	0.94253	ACA	-	NULL		0.612	FOXN3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXN3	protein_coding	OTTHUMT00000410902.2	G	NM_005197		88698683	-1	no_errors	NM_001085471	genbank	human	reviewed	54_36p	missense	SNP	1	A
IL16	3603	genome.wustl.edu	37	15	81585210	81585210	+	Silent	SNP	G	G	A			TCGA-13-1491-01A-01W-0549-09	TCGA-13-1491-10A-01W-0549-09	G	G	A	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fb7d1c2b-3e87-4d05-a58b-92d0e1016986	95848a3e-2292-4a0a-ace2-683e70709a56	g.chr15:81585210G>A	ENST00000302987.4	+	11	1734	c.1734G>A	c.(1732-1734)ccG>ccA	p.P578P	IL16_ENST00000394660.2_Silent_p.P578P			Q14005	IL16_HUMAN	interleukin 16	578					immune response (GO:0006955)|induction of positive chemotaxis (GO:0050930)|leukocyte chemotaxis (GO:0030595)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.P578P(1)		NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(12)|lung(20)|ovary(3)|skin(3)|stomach(1)|urinary_tract(1)	57						GCCACCCGCCGCTGAGACTGA	0.567																																																1	Substitution - coding silent(1)	ovary(1)	15											29.0	33.0	32.0					15																	81585210		1870	4095	5965	79372265	SO:0001819	synonymous_variant	3603			U82972	CCDS10317.1, CCDS42069.1, CCDS53966.1	15q26.3	2011-07-14	2011-07-14		ENSG00000172349	ENSG00000172349		"""Interleukins and interleukin receptors"""	5980	protein-coding gene	gene with protein product	"""prointerleukin 16"", ""lymphocyte chemoattractant factor"""	603035	"""interleukin 16 (lymphocyte chemoattractant factor)"""			9144227	Standard	NM_004513		Approved	LCF, IL-16, prIL-16, HsT19289, FLJ42735, FLJ16806	uc021ssh.1	Q14005	OTTHUMG00000144186	ENST00000302987.4:c.1734G>A	15.37:g.81585210G>A			79372265	A6NM20|A8MU65|B5TY35|B9EGR6|H3BVH5|Q16435|Q6VVE6|Q6ZMQ7|Q9UP18	Silent	SNP	-	p.P578	ENST00000302987.4	37	c.1734	CCDS42069.1	15																																																																																			-	NULL		0.567	IL16-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	IL16	protein_coding	OTTHUMT00000303952.1	G	NM_172217		79372265	1	no_errors	NM_172217	genbank	human	reviewed	54_36p	silent	SNP		A
ERN2	10595	genome.wustl.edu	37	16	23716380	23716380	+	Silent	SNP	G	G	A			TCGA-13-1491-01A-01W-0549-09	TCGA-13-1491-10A-01W-0549-09	G	G	A	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fb7d1c2b-3e87-4d05-a58b-92d0e1016986	95848a3e-2292-4a0a-ace2-683e70709a56	g.chr16:23716380G>A	ENST00000457008.2	-	8	716	c.678C>T	c.(676-678)ggC>ggT	p.G226G	ERN2_ENST00000256797.4_Silent_p.G274G					endoplasmic reticulum to nucleus signaling 2											large_intestine(2)|lung(2)|ovary(2)	6				GBM - Glioblastoma multiforme(48;0.0156)		TCACAGGCACGCCCAGGTCCT	0.662																																																0			16											55.0	50.0	52.0					16																	23716380		2197	4300	6497	23623881	SO:0001819	synonymous_variant	10595			AA527544	CCDS32407.1	16p12.2	2008-02-05	2007-08-14			ENSG00000134398			16942	protein-coding gene	gene with protein product		604034	"""ER to nucleus signalling 2"""			9755171, 11175748	Standard	NM_033266		Approved	IRE1b	uc002dma.4	Q76MJ5		ENST00000457008.2:c.678C>T	16.37:g.23716380G>A			23623881		Silent	SNP	HMMPfam_Pkinase,HMMPfam_PQQ,HMMPfam_Ribonuc_2-5A,superfamily_Protein kinase-like (PK-like),superfamily_Quinoprotein alcohol dehydrogenase-like	p.G274	ENST00000457008.2	37	c.822		16																																																																																			-	NULL		0.662	ERN2-002	NOVEL	basic|exp_conf	protein_coding	ERN2	protein_coding	OTTHUMT00000434886.1	G			23623881	-1	no_errors	NM_033266	genbank	human	validated	54_36p	silent	SNP	1	A
TP53	7157	genome.wustl.edu	37	17	7577114	7577114	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1491-01A-01W-0549-09	TCGA-13-1491-10A-01W-0549-09	C	C	T	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fb7d1c2b-3e87-4d05-a58b-92d0e1016986	95848a3e-2292-4a0a-ace2-683e70709a56	g.chr17:7577114C>T	ENST00000269305.4	-	8	1013	c.824G>A	c.(823-825)tGt>tAt	p.C275Y	TP53_ENST00000455263.2_Missense_Mutation_p.C275Y|TP53_ENST00000359597.4_Missense_Mutation_p.C275Y|TP53_ENST00000445888.2_Missense_Mutation_p.C275Y|TP53_ENST00000420246.2_Missense_Mutation_p.C275Y|TP53_ENST00000413465.2_Intron|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	275	Interaction with AXIN1. {ECO:0000250}.|Interaction with DNA.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		C -> F (in sporadic cancers; somatic mutation).|C -> G (in sporadic cancers; somatic mutation).|C -> R (in sporadic cancers; somatic mutation).|C -> S (in sporadic cancers; somatic mutation).|C -> W (in sporadic cancers; somatic mutation).|C -> Y (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:7887414}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.C275Y(53)|p.C275F(37)|p.0?(8)|p.C275fs*70(3)|p.?(2)|p.C275S(2)|p.C275fs*20(1)|p.L265_K305del41(1)|p.R273_C275delRVC(1)|p.F270_D281del12(1)|p.V274_P278del(1)|p.A276fs*29(1)|p.S269fs*21(1)|p.C275fs*67(1)|p.V272_K292del21(1)|p.C275_R283delCACPGRDRR(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AGGACAGGCACAAACACGCAC	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	115	Substitution - Missense(92)|Whole gene deletion(8)|Deletion - Frameshift(7)|Deletion - In frame(6)|Unknown(2)	lung(14)|large_intestine(13)|breast(13)|upper_aerodigestive_tract(12)|central_nervous_system(10)|haematopoietic_and_lymphoid_tissue(10)|ovary(7)|urinary_tract(6)|stomach(5)|oesophagus(5)|bone(5)|liver(5)|skin(3)|pancreas(2)|NS(2)|prostate(2)|biliary_tract(1)	17	GRCh37	CM076568|CM951234	TP53	M							71.0	61.0	64.0					17																	7577114		2203	4300	6503	7517839	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.824G>A	17.37:g.7577114C>T	ENSP00000269305:p.Cys275Tyr		7517839	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	superfamily_p53-like transcription factors;superfamily_p53 tetramerization domain;P53_tetramer;HMMPfam_P53_tetramer;P53;HMMPfam_P53;P53_TAD;HMMPfam_P53_TAD	p.C275Y	ENST00000269305.4	37	c.824	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	25.1	4.605675	0.87157	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99874	-7.39;-7.39;-7.39;-7.39;-7.39;-7.39	4.92	4.92	0.64577	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99883	0.9944	M	0.92738	3.34	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.997;1.0;0.997;0.997	D	0.96317	0.9233	10	0.87932	D	0	-17.2181	15.662	0.77193	0.0:1.0:0.0:0.0	.	275;275;275;275	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	Y	275;275;275;275;275;264;143	ENSP00000352610:C275Y;ENSP00000269305:C275Y;ENSP00000398846:C275Y;ENSP00000391127:C275Y;ENSP00000391478:C275Y;ENSP00000425104:C143Y	ENSP00000269305:C275Y	C	-	2	0	TP53	7517839	1.000000	0.71417	0.999000	0.59377	0.904000	0.53231	7.587000	0.82613	2.556000	0.86216	0.462000	0.41574	TGT	-	HMMPfam_P53		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	C	NM_000546		7517839	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	missense	SNP	1	T
RNF213	57674	genome.wustl.edu	37	17	78350233	78350233	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1491-01A-01W-0549-09	TCGA-13-1491-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fb7d1c2b-3e87-4d05-a58b-92d0e1016986	95848a3e-2292-4a0a-ace2-683e70709a56	g.chr17:78350233G>A	ENST00000582970.1	+	52	13461	c.13318G>A	c.(13318-13320)Gat>Aat	p.D4440N	CTD-2047H16.4_ENST00000572151.1_RNA|RNF213_ENST00000508628.2_Missense_Mutation_p.D4489N|CTD-2047H16.4_ENST00000575034.1_RNA|RNF213_ENST00000336301.6_Missense_Mutation_p.D2513N	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	4440					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.D2513N(1)		NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			CAGCAACCTTGATGGAACGGT	0.522																																																1	Substitution - Missense(1)	ovary(1)	17											148.0	129.0	135.0					17																	78350233		2203	4300	6503	75964828	SO:0001583	missense	57674			AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.13318G>A	17.37:g.78350233G>A	ENSP00000464087:p.Asp4440Asn		75964828	C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Missense_Mutation	SNP	HMMPfam_zf-C3HC4;superfamily_P-loop containing nucleoside triphosphate hydrolases;superfamily_Nickel-iron hydrogenase small subunit;superfamily_RING/U-box	p.D2513N	ENST00000582970.1	37	c.7537	CCDS58606.1	17	.	.	.	.	.	.	.	.	.	.	G	10.78	1.446136	0.25987	.	.	ENSG00000173821	ENST00000508628;ENST00000411702;ENST00000336301	T	0.22539	1.95	5.47	-3.83	0.04269	.	1.185250	0.05914	N	0.632297	T	0.09113	0.0225	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.08055	0.003;0.0	T	0.37619	-0.9698	10	0.17832	T	0.49	.	7.4823	0.27413	0.1539:0.5515:0.2035:0.0912	.	4489;2513	C9JCP4;Q63HN8	.;RN213_HUMAN	N	4440;4489;2513	ENSP00000338218:D2513N	ENSP00000338218:D2513N	D	+	1	0	RNF213	75964828	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.062000	0.11674	-0.498000	0.06632	-1.268000	0.01426	GAT	-	NULL		0.522	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	RNF213	protein_coding	OTTHUMT00000443298.1	G	NM_020914		75964828	1	no_errors	NM_020914	genbank	human	validated	54_36p	missense	SNP		A
DSG1	1828	genome.wustl.edu	37	18	28913635	28913635	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1491-01A-01W-0549-09	TCGA-13-1491-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fb7d1c2b-3e87-4d05-a58b-92d0e1016986	95848a3e-2292-4a0a-ace2-683e70709a56	g.chr18:28913635C>A	ENST00000257192.4	+	7	980	c.768C>A	c.(766-768)aaC>aaA	p.N256K		NM_001942.2	NP_001933.2	Q02413	DSG1_HUMAN	desmoglein 1	256	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell-cell junction assembly (GO:0007043)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|homophilic cell adhesion (GO:0007156)|maternal process involved in female pregnancy (GO:0060135)|protein stabilization (GO:0050821)|response to progesterone (GO:0032570)|single organismal cell-cell adhesion (GO:0016337)	apical plasma membrane (GO:0016324)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|gamma-catenin binding (GO:0045295)|toxic substance binding (GO:0015643)	p.N256K(1)		NS(2)|central_nervous_system(2)|endometrium(5)|kidney(7)|large_intestine(11)|lung(36)|ovary(3)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)	76			OV - Ovarian serous cystadenocarcinoma(10;0.00559)			GTGAGTGCAACATTAAAATCC	0.388																																																1	Substitution - Missense(1)	ovary(1)	18											163.0	145.0	151.0					18																	28913635		2203	4300	6503	27167633	SO:0001583	missense	1828			X56654	CCDS11896.1	18q12.1	2014-05-13			ENSG00000134760	ENSG00000134760		"""Cadherins / Major cadherins"""	3048	protein-coding gene	gene with protein product		125670		DSG		1889810	Standard	NM_001942		Approved	CDHF4	uc002kwp.3	Q02413	OTTHUMG00000131983	ENST00000257192.4:c.768C>A	18.37:g.28913635C>A	ENSP00000257192:p.Asn256Lys		27167633	B7Z845	Missense_Mutation	SNP	HMMPfam_Cadherin_C;HMMPfam_Cadherin;superfamily_Cadherin-like	p.N256K	ENST00000257192.4	37	c.768	CCDS11896.1	18	.	.	.	.	.	.	.	.	.	.	c	8.250	0.808844	0.16467	.	.	ENSG00000134760	ENST00000257192	T	0.52526	0.66	5.96	0.846	0.18955	Cadherin (5);Cadherin-like (1);	0.821629	0.11290	N	0.579325	T	0.16557	0.0398	N	0.03268	-0.37	0.35569	D	0.805343	B	0.06786	0.001	B	0.11329	0.006	T	0.40887	-0.9539	10	0.02654	T	1	.	2.8042	0.05423	0.1917:0.4648:0.1517:0.1918	.	256	Q02413	DSG1_HUMAN	K	256	ENSP00000257192:N256K	ENSP00000257192:N256K	N	+	3	2	DSG1	27167633	0.000000	0.05858	0.868000	0.34077	0.826000	0.46750	-0.517000	0.06275	0.435000	0.26365	-0.121000	0.15023	AAC	-	HMMPfam_Cadherin		0.388	DSG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSG1	protein_coding	OTTHUMT00000254947.1	C	NM_001942		27167633	1	no_errors	NM_001942	genbank	human	reviewed	54_36p	missense	SNP	0.15	A
ZNF407	55628	genome.wustl.edu	37	18	72589219	72589219	+	Missense_Mutation	SNP	A	A	T			TCGA-13-1491-01A-01W-0549-09	TCGA-13-1491-10A-01W-0549-09	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	fb7d1c2b-3e87-4d05-a58b-92d0e1016986	95848a3e-2292-4a0a-ace2-683e70709a56	g.chr18:72589219A>T	ENST00000299687.5	+	4	4944	c.4944A>T	c.(4942-4944)aaA>aaT	p.K1648N	ZNF407_ENST00000577538.1_Missense_Mutation_p.K1648N|ZNF407_ENST00000584235.1_3'UTR	NM_017757.2	NP_060227.2	Q9C0G0	ZN407_HUMAN	zinc finger protein 407	1648					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.K1648N(1)		central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(21)|lung(23)|ovary(4)|prostate(3)|upper_aerodigestive_tract(2)	67		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.184)		ACCACATGAAACTCCACACGG	0.453																																																1	Substitution - Missense(1)	ovary(1)	18											92.0	94.0	93.0					18																	72589219		1936	4135	6071	70718207	SO:0001583	missense	55628			AB051490	CCDS45885.1, CCDS54191.1, CCDS58634.1	18q23	2013-01-08			ENSG00000215421	ENSG00000215421		"""Zinc fingers, C2H2-type"""	19904	protein-coding gene	gene with protein product		615894				11214970	Standard	NM_017757		Approved	FLJ20307, FLJ13839, KIAA1703	uc002llw.2	Q9C0G0		ENST00000299687.5:c.4944A>T	18.37:g.72589219A>T	ENSP00000299687:p.Lys1648Asn		70718207	B5MD54|Q96MY0|Q9H8A1|Q9NXD4|Q9NXD7	Missense_Mutation	SNP	-	p.K1648N	ENST00000299687.5	37	c.4944	CCDS45885.1	18	.	.	.	.	.	.	.	.	.	.	A	22.3	4.271071	0.80469	.	.	ENSG00000215421	ENST00000299687	T	0.24723	1.84	5.93	-3.86	0.04230	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.166700	0.35936	N	0.002895	T	0.32436	0.0829	L	0.31526	0.94	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.62941	-0.6747	10	0.66056	D	0.02	.	15.2367	0.73436	0.3668:0.0:0.6332:0.0	.	1648;1648	Q9C0G0-2;Q9C0G0	.;ZN407_HUMAN	N	1648	ENSP00000299687:K1648N	ENSP00000299687:K1648N	K	+	3	2	ZNF407	70718207	0.828000	0.29307	0.846000	0.33378	0.996000	0.88848	0.053000	0.14184	2.818000	0.97014	0.591000	0.81541	AAA	-	NULL		0.453	ZNF407-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF407	protein_coding	OTTHUMT00000444903.1	A	NM_017757		70718207	1	no_errors	NM_017757	genbank	human	provisional	54_36p	missense	SNP	1	T
CLPP	8192	genome.wustl.edu	37	19	6368570	6368570	+	Missense_Mutation	SNP	G	G	A	rs142079552		TCGA-13-1491-01A-01W-0549-09	TCGA-13-1491-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fb7d1c2b-3e87-4d05-a58b-92d0e1016986	95848a3e-2292-4a0a-ace2-683e70709a56	g.chr19:6368570G>A	ENST00000245816.4	+	6	806	c.683G>A	c.(682-684)cGc>cAc	p.R228H	CLPP_ENST00000596149.1_Missense_Mutation_p.R141H|CLPP_ENST00000596605.1_3'UTR	NM_006012.2	NP_006003.1	Q16740	CLPP_HUMAN	caseinolytic mitochondrial matrix peptidase proteolytic subunit	228					protein homooligomerization (GO:0051260)|proteolysis involved in cellular protein catabolic process (GO:0051603)	endopeptidase Clp complex (GO:0009368)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)	p.R228H(1)		endometrium(2)|large_intestine(2)|ovary(2)	6						GAGAGGGACCGCTACATGAGC	0.607																																																1	Substitution - Missense(1)	ovary(1)	19						G	HIS/ARG	2,4404	4.2+/-10.8	0,2,2201	54.0	41.0	45.0		683	3.1	1.0	19	dbSNP_134	45	0,8600		0,0,4300	no	missense	CLPP	NM_006012.2	29	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	benign	228/278	6368570	2,13004	2203	4300	6503	6319570	SO:0001583	missense	8192			Z50853	CCDS12162.1	19p13.3	2013-09-12	2013-09-12		ENSG00000125656	ENSG00000125656		"""ATPases / AAA-type"""	2084	protein-coding gene	gene with protein product	"""ATP-dependent protease ClpAP (E. coli), proteolytic subunit, human"""	601119	"""ClpP (caseinolytic protease, ATP-dependent, proteolytic subunit, E. coli) homolog"", ""ClpP caseinolytic protease, ATP-dependent, proteolytic subunit homolog (E. coli)"", ""ClpP caseinolytic peptidase, ATP-dependent, proteolytic subunit homolog (E. coli)"""			8543061, 23360988	Standard	NM_006012		Approved		uc002mem.1	Q16740	OTTHUMG00000180779	ENST00000245816.4:c.683G>A	19.37:g.6368570G>A	ENSP00000245816:p.Arg228His		6319570	B2R4W5	Missense_Mutation	SNP	-	p.R228H	ENST00000245816.4	37	c.683	CCDS12162.1	19	.	.	.	.	.	.	.	.	.	.	G	14.53	2.563475	0.45694	4.54E-4	0.0	ENSG00000125656	ENST00000245816	.	.	.	5.2	3.09	0.35607	.	0.000000	0.85682	D	0.000000	T	0.34308	0.0893	N	0.24115	0.695	0.80722	D	1	B	0.31153	0.31	B	0.26416	0.069	T	0.08351	-1.0726	9	0.29301	T	0.29	-24.4795	10.8629	0.46837	0.156:0.0:0.844:0.0	.	228	Q16740	CLPP_HUMAN	H	228	.	ENSP00000245816:R228H	R	+	2	0	CLPP	6319570	1.000000	0.71417	0.989000	0.46669	0.998000	0.95712	8.719000	0.91436	0.704000	0.31869	0.563000	0.77884	CGC	-	NULL		0.607	CLPP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLPP	protein_coding	OTTHUMT00000452984.1	G	NM_006012		6319570	1	no_errors	NM_006012	genbank	human	reviewed	54_36p	missense	SNP	1	A
BABAM1	29086	genome.wustl.edu	37	19	17382464	17382464	+	Splice_Site	SNP	G	G	T			TCGA-13-1491-01A-01W-0549-09	TCGA-13-1491-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fb7d1c2b-3e87-4d05-a58b-92d0e1016986	95848a3e-2292-4a0a-ace2-683e70709a56	g.chr19:17382464G>T	ENST00000359435.4	+	3	537	c.344G>T	c.(343-345)gGc>gTc	p.G115V	CTD-2278I10.6_ENST00000596542.1_Intron|BABAM1_ENST00000448635.2_3'UTR|BABAM1_ENST00000598188.1_Splice_Site_p.G115V|BABAM1_ENST00000601043.1_Splice_Site_p.G115V|BABAM1_ENST00000595632.1_Splice_Site_p.G115V|BABAM1_ENST00000447614.2_Splice_Site_p.G115V	NM_001033549.1	NP_001028721.1	Q9NWV8	BABA1_HUMAN	BRISC and BRCA1 A complex member 1	115	VWFA-like.				chromatin modification (GO:0016568)|double-strand break repair (GO:0006302)|G2 DNA damage checkpoint (GO:0031572)|positive regulation of DNA repair (GO:0045739)|protein K63-linked deubiquitination (GO:0070536)|response to ionizing radiation (GO:0010212)	BRCA1-A complex (GO:0070531)|BRISC complex (GO:0070552)|cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.G115V(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)	5						TCGTTCAACGGGTAAGAGGGA	0.532																																																1	Substitution - Missense(1)	ovary(1)	19											82.0	81.0	81.0					19																	17382464		2054	4186	6240	17243464	SO:0001630	splice_region_variant	29086			AK000578	CCDS46012.1, CCDS74310.1	19p13.11	2011-02-21	2011-02-21	2011-01-31	ENSG00000105393	ENSG00000105393			25008	protein-coding gene	gene with protein product	"""Mediator of Rap80 Interactions and Targeting 40 kD"", ""new component of the BRCA1 A complex"""	612766	"""chromosome 19 open reading frame 62"""	C19orf62		11042152	Standard	NM_001288756		Approved	FLJ20571, HSPC142, NBA1, MERIT40	uc002nfv.3	Q9NWV8		ENST00000359435.4:c.344+1G>T	19.37:g.17382464G>T			17243464	A8MQT0|B4DRY9|B4DVR1|Q6FIA0|Q9P018	Missense_Mutation	SNP	superfamily_vWA-like	p.G115V	ENST00000359435.4	37	c.344	CCDS46012.1	19	.	.	.	.	.	.	.	.	.	.	G	17.76	3.468598	0.63625	.	.	ENSG00000105393	ENST00000359435;ENST00000447614;ENST00000448635	.	.	.	3.97	3.97	0.46021	.	0.000000	0.85682	D	0.000000	T	0.76040	0.3932	M	0.68952	2.095	0.80722	D	1	D;D	0.89917	1.0;0.994	D;P	0.91635	0.999;0.905	T	0.79429	-0.1807	9	0.87932	D	0	-28.5384	13.6129	0.62091	0.0:0.0:1.0:0.0	.	115;115	Q9NWV8-3;Q9NWV8	.;BABA1_HUMAN	V	115	.	ENSP00000352408:G115V	G	+	2	0	BABAM1	17243464	1.000000	0.71417	0.852000	0.33557	0.577000	0.36160	8.545000	0.90657	2.065000	0.61736	0.561000	0.74099	GGC	-	NULL		0.532	BABAM1-005	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	C19orf62	protein_coding	OTTHUMT00000463471.1	G	NM_014173	Missense_Mutation	17243464	1	no_errors	NM_001033549	genbank	human	validated	54_36p	missense	SNP	1	T
EHBP1	23301	genome.wustl.edu	37	2	63101664	63101664	+	Silent	SNP	T	T	C			TCGA-13-1491-01A-01W-0549-09	TCGA-13-1491-10A-01W-0549-09	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fb7d1c2b-3e87-4d05-a58b-92d0e1016986	95848a3e-2292-4a0a-ace2-683e70709a56	g.chr2:63101664T>C	ENST00000263991.5	+	11	1769	c.1287T>C	c.(1285-1287)ccT>ccC	p.P429P	EHBP1_ENST00000431489.1_Silent_p.P394P|EHBP1_ENST00000405015.3_Silent_p.P394P|EHBP1_ENST00000354487.3_Silent_p.P394P|EHBP1_ENST00000405289.1_Silent_p.P394P	NM_015252.3	NP_056067.2	Q8NDI1	EHBP1_HUMAN	EH domain binding protein 1	429						cytoplasm (GO:0005737)|membrane (GO:0016020)		p.P429P(1)		biliary_tract(1)|breast(3)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(8)|lung(22)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	47	Lung NSC(7;0.0951)|all_lung(7;0.169)		LUSC - Lung squamous cell carcinoma(7;7.74e-05)|Epithelial(17;0.189)			CTACTTCTCCTAAGGTAGGAT	0.348																																																1	Substitution - coding silent(1)	ovary(1)	2											76.0	87.0	83.0					2																	63101664		2203	4300	6503	62955168	SO:0001819	synonymous_variant	23301			AL833968	CCDS1872.1, CCDS46299.1, CCDS46300.1	2p15	2008-02-05			ENSG00000115504	ENSG00000115504			29144	protein-coding gene	gene with protein product		609922				10048485	Standard	NM_015252		Approved	KIAA0903, NACSIN	uc002sby.3	Q8NDI1	OTTHUMG00000129453	ENST00000263991.5:c.1287T>C	2.37:g.63101664T>C			62955168	O94977|Q53TG7|Q53TV6|Q580X2|Q6NX72|Q6PIT3|Q6QNV2|Q9NWI9	Silent	SNP	-	p.P429	ENST00000263991.5	37	c.1287	CCDS1872.1	2																																																																																			-	NULL		0.348	EHBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EHBP1	protein_coding	OTTHUMT00000251616.1	T	NM_015252		62955168	1	no_errors	NM_015252	genbank	human	validated	54_36p	silent	SNP	0.98	C
TPTE	7179	genome.wustl.edu	37	21	10934052	10934052	+	Missense_Mutation	SNP	C	C	T	rs373623566		TCGA-13-1491-01A-01W-0549-09	TCGA-13-1491-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fb7d1c2b-3e87-4d05-a58b-92d0e1016986	95848a3e-2292-4a0a-ace2-683e70709a56	g.chr21:10934052C>T	ENST00000361285.4	-	16	1254	c.925G>A	c.(925-927)Gtc>Atc	p.V309I	TPTE_ENST00000342420.5_Missense_Mutation_p.V271I|TPTE_ENST00000298232.7_Missense_Mutation_p.V291I|TPTE_ENST00000415664.2_5'UTR	NM_199261.2	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	309	Phosphatase tensin-type. {ECO:0000255|PROSITE-ProRule:PRU00590}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.V291I(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(19)|lung(76)|ovary(2)|prostate(2)|skin(8)|urinary_tract(1)	130			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		AGAGTGGGGACATTATGATCA	0.299																																																1	Substitution - Missense(1)	ovary(1)	21											158.0	166.0	163.0					21																	10934052		2203	4300	6503	9955923	SO:0001583	missense	7179			AF007118	CCDS74771.1, CCDS74772.1, CCDS74773.1	21p11	2011-06-09			ENSG00000166157	ENSG00000274391		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	12023	protein-coding gene	gene with protein product	"""PTEN-related tyrosine phosphatase"", ""cancer/testis antigen 44"""	604336				10830953, 14659893	Standard	NM_001290224		Approved	PTEN2, CT44	uc002yip.1	P56180	OTTHUMG00000074127	ENST00000361285.4:c.925G>A	21.37:g.10934052C>T	ENSP00000355208:p.Val309Ile		9955923	B2RAP7|C9J6D6|C9JKK8|Q6XPS4|Q6XPS5|Q71JA8|Q8NCS8	Missense_Mutation	SNP	-	p.V309I	ENST00000361285.4	37	c.925	CCDS13560.2	21	.	.	.	.	.	.	.	.	.	.	.	13.57	2.276361	0.40294	.	.	ENSG00000166157	ENST00000298232;ENST00000361285;ENST00000342420	T;T;T	0.31247	1.5;1.5;1.5	2.07	2.07	0.26955	Phosphatase tensin type (1);Dual specificity phosphatase, catalytic domain (1);	0.000000	0.85682	U	0.000000	T	0.53077	0.1774	M	0.83223	2.63	0.52501	D	0.999955	D;D;P	0.76494	0.999;0.999;0.87	D;D;P	0.74674	0.984;0.984;0.754	T	0.58346	-0.7652	10	0.54805	T	0.06	-22.3245	10.2257	0.43225	0.0:1.0:0.0:0.0	.	271;291;309	P56180-3;P56180-2;P56180	.;.;TPTE_HUMAN	I	291;309;271	ENSP00000298232:V291I;ENSP00000355208:V309I;ENSP00000344441:V271I	ENSP00000298232:V291I	V	-	1	0	TPTE	9955923	1.000000	0.71417	0.746000	0.31095	0.447000	0.32167	5.904000	0.69886	1.470000	0.48102	0.194000	0.17425	GTC	-	NULL		0.299	TPTE-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TPTE	protein_coding	OTTHUMT00000157413.1	C			9955923	-1	no_errors	NM_199261	genbank	human	validated	54_36p	missense	SNP	1	T
SCUBE1	80274	genome.wustl.edu	37	22	43614426	43614426	+	Nonsense_Mutation	SNP	G	G	A			TCGA-13-1491-01A-01W-0549-09	TCGA-13-1491-10A-01W-0549-09	G	G	A	A	G	G	Unknown	Valid	Somatic	4	Capture	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	fb7d1c2b-3e87-4d05-a58b-92d0e1016986	95848a3e-2292-4a0a-ace2-683e70709a56	g.chr22:43614426G>A	ENST00000360835.4	-	15	1852	c.1726C>T	c.(1726-1728)Cag>Tag	p.Q576*		NM_173050.3	NP_766638.2	Q8IWY4	SCUB1_HUMAN	signal peptide, CUB domain, EGF-like 1	576					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|endothelial cell differentiation (GO:0045446)|inflammatory response (GO:0006954)|post-embryonic development (GO:0009791)|protein homooligomerization (GO:0051260)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extrinsic component of plasma membrane (GO:0019897)	calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|protein heterodimerization activity (GO:0046982)	p.Q576*(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(4)|large_intestine(4)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31		all_neural(38;0.0414)|Ovarian(80;0.07)				TGCAGGCTCTGTTCTGCTCGC	0.602																																																1	Substitution - Nonsense(1)	ovary(1)	22											80.0	84.0	83.0					22																	43614426		2203	4300	6503	41944370	SO:0001587	stop_gained	80274				CCDS14048.1	22q13	2008-07-01			ENSG00000159307	ENSG00000159307			13441	protein-coding gene	gene with protein product		611746				11087664	Standard	NM_173050		Approved		uc003bdt.2	Q8IWY4	OTTHUMG00000150679	ENST00000360835.4:c.1726C>T	22.37:g.43614426G>A	ENSP00000354080:p.Gln576*		41944370	Q5R336	Nonsense_Mutation	SNP	HMMPfam_CUB;superfamily_Spermadhesin CUB domain;HMMPfam_EGF;superfamily_Growth factor receptor domain;HMMPfam_GCC2_GCC3;HMMPfam_EGF_CA;superfamily_EGF/Laminin	p.Q576*	ENST00000360835.4	37	c.1726	CCDS14048.1	22	.	.	.	.	.	.	.	.	.	.	G	31	5.097292	0.94197	.	.	ENSG00000159307	ENST00000360835;ENST00000381243	.	.	.	4.4	4.4	0.53042	.	0.387612	0.30556	N	0.009362	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05620	T	0.96	.	17.2191	0.86952	0.0:0.0:1.0:0.0	.	.	.	.	X	576;206	.	ENSP00000354080:Q576X	Q	-	1	0	SCUBE1	41944370	1.000000	0.71417	1.000000	0.80357	0.114000	0.19823	1.967000	0.40491	2.287000	0.76781	0.558000	0.71614	CAG	-	NULL		0.602	SCUBE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCUBE1	protein_coding	OTTHUMT00000319582.3	G	NM_173050		41944370	-1	no_errors	NM_173050	genbank	human	validated	54_36p	nonsense	SNP	1	A
Unknown	0	genome.wustl.edu	37	22	31552241	31552241	+	IGR	SNP	C	C	T	rs532710457		TCGA-13-1491-01A-01W-0549-09	TCGA-13-1491-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	fb7d1c2b-3e87-4d05-a58b-92d0e1016986	95848a3e-2292-4a0a-ace2-683e70709a56	g.chr22:31552241C>T								PLA2G3 (15648 upstream) : MIR3928 (3806 downstream)																							ACTCCTGGGACGGGGCCTGCT	0.607													C|||	1	0.000199681	0.0	0.0	5008	,	,		18092	0.0		0.0	False		,,,				2504	0.001															0			22																																								29882241	SO:0001628	intergenic_variant	100133224																															22.37:g.31552241C>T			29882241		Missense_Mutation	SNP	-	p.V276I		37	c.826		22																																																																																			-	NULL	0	0.607					LOC100133224			C			29882241	-1	no_errors	XM_001716151	genbank	human	model	54_36p	missense	SNP	0.99	T
GRAMD4	23151	genome.wustl.edu	37	22	47022815	47022815	+	Missense_Mutation	SNP	T	T	A			TCGA-13-1491-01A-01W-0549-09	TCGA-13-1491-10A-01W-0549-09	T	T	A	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fb7d1c2b-3e87-4d05-a58b-92d0e1016986	95848a3e-2292-4a0a-ace2-683e70709a56	g.chr22:47022815T>A	ENST00000406902.1	+	2	332	c.119T>A	c.(118-120)gTa>gAa	p.V40E	GRAMD4_ENST00000361034.3_Missense_Mutation_p.V40E|GRAMD4_ENST00000490378.1_Splice_Site			Q6IC98	GRAM4_HUMAN	GRAM domain containing 4	40					apoptotic process (GO:0006915)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)		p.V40E(1)		breast(1)|endometrium(1)|large_intestine(1)|lung(7)|ovary(1)|skin(1)	12		Breast(42;0.00571)|Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)|BRCA - Breast invasive adenocarcinoma(115;0.166)		CCCCTGAAGGTACCGCGGACC	0.612																																																1	Substitution - Missense(1)	ovary(1)	22											113.0	94.0	100.0					22																	47022815		2203	4300	6503	45401479	SO:0001583	missense	23151				CCDS33672.1	22q13.31	2008-03-03			ENSG00000075240	ENSG00000075240			29113	protein-coding gene	gene with protein product	"""death-inducing-protein"""	613691				15565177	Standard	NM_015124		Approved	KIAA0767, DIP	uc003bhx.3	Q6IC98	OTTHUMG00000150402	ENST00000406902.1:c.119T>A	22.37:g.47022815T>A	ENSP00000385689:p.Val40Glu		45401479	A9IN51|A9IN57|Q68EN0|Q9UGE6|Q9Y4B9	Missense_Mutation	SNP	HMMPfam_GRAM	p.V40E	ENST00000406902.1	37	c.119	CCDS33672.1	22	.	.	.	.	.	.	.	.	.	.	T	3.280	-0.147320	0.06627	.	.	ENSG00000075240	ENST00000447351;ENST00000406902;ENST00000361034	T;T	0.44482	0.92;0.92	4.44	-0.173	0.13322	.	1.343290	0.05666	N	0.587756	T	0.24392	0.0591	N	0.08118	0	0.09310	N	1	B	0.18166	0.026	B	0.12837	0.008	T	0.28299	-1.0048	10	0.56958	D	0.05	-0.0977	8.0562	0.30606	0.0:0.3696:0.0:0.6304	.	40	Q6IC98	GRAM4_HUMAN	E	40	ENSP00000385689:V40E;ENSP00000354313:V40E	ENSP00000354313:V40E	V	+	2	0	GRAMD4	45401479	0.010000	0.17322	0.000000	0.03702	0.105000	0.19272	0.154000	0.16343	-0.290000	0.09025	0.378000	0.23410	GTA	-	NULL		0.612	GRAMD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRAMD4	protein_coding	OTTHUMT00000317969.1	T	NM_015124		45401479	1	no_errors	NM_015124	genbank	human	validated	54_36p	missense	SNP	0.26	A
CTNNB1	1499	genome.wustl.edu	37	3	41266887	41266887	+	Silent	SNP	C	C	T	rs373990577		TCGA-13-1491-01A-01W-0549-09	TCGA-13-1491-10A-01W-0549-09	C	C	T	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fb7d1c2b-3e87-4d05-a58b-92d0e1016986	95848a3e-2292-4a0a-ace2-683e70709a56	g.chr3:41266887C>T	ENST00000349496.5	+	5	838	c.558C>T	c.(556-558)caC>caT	p.H186H	CTNNB1_ENST00000453024.1_Silent_p.H179H|CTNNB1_ENST00000396185.3_Silent_p.H186H|CTNNB1_ENST00000405570.1_Silent_p.H186H|CTNNB1_ENST00000396183.3_Silent_p.H186H	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	186					adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.H186H(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		CTTCCAGACACGCTATCATGC	0.428		15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												Colon(6;3 56 14213 18255)		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	1	Substitution - coding silent(1)	ovary(1)	3											76.0	75.0	75.0					3																	41266887		2203	4300	6503	41241891	SO:0001819	synonymous_variant	1499	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.558C>T	3.37:g.41266887C>T			41241891	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Silent	SNP	-	p.H186	ENST00000349496.5	37	c.558	CCDS2694.1	3																																																																																			-	NULL		0.428	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTNNB1	protein_coding	OTTHUMT00000254182.2	C	NM_001098210		41241891	1	no_errors	NM_001098209	genbank	human	validated	54_36p	silent	SNP	0.99	T
RASSF1	11186	genome.wustl.edu	37	3	50368842	50368842	+	Missense_Mutation	SNP	G	G	A	rs140805123		TCGA-13-1491-01A-01W-0549-09	TCGA-13-1491-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fb7d1c2b-3e87-4d05-a58b-92d0e1016986	95848a3e-2292-4a0a-ace2-683e70709a56	g.chr3:50368842G>A	ENST00000357043.2	-	5	846	c.811C>T	c.(811-813)Cgg>Tgg	p.R271W	RASSF1_ENST00000359365.4_Missense_Mutation_p.R267W|RASSF1_ENST00000395126.3_Missense_Mutation_p.R116W|RASSF1_ENST00000327761.3_Missense_Mutation_p.R197W					Ras association (RalGDS/AF-6) domain family member 1									p.R271W(1)		lung(2)|ovary(1)|skin(1)|urinary_tract(1)	5				BRCA - Breast invasive adenocarcinoma(193;0.000278)|OV - Ovarian serous cystadenocarcinoma(275;0.0015)|KIRC - Kidney renal clear cell carcinoma(197;0.00551)|Kidney(197;0.00621)		AGCCGCAGCCGCAGGGGCTGC	0.562																																																1	Substitution - Missense(1)	ovary(1)	3						G	TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG	2,4404	4.2+/-10.8	0,2,2201	33.0	36.0	35.0		346,799,346,589,811	3.6	0.4	3	dbSNP_134	35	2,8598	2.2+/-6.3	0,2,4298	yes	missense,missense,missense,missense,missense	RASSF1	NM_001206957.1,NM_007182.4,NM_170712.2,NM_170713.2,NM_170714.1	101,101,101,101,101	0,4,6499	AA,AG,GG		0.0233,0.0454,0.0308	possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging	116/190,267/341,116/190,197/271,271/345	50368842	4,13002	2203	4300	6503	50343846	SO:0001583	missense	11186			AF132675	CCDS2820.1, CCDS2821.1, CCDS2822.1, CCDS43096.1	3p21.3	2008-02-22	2008-02-22		ENSG00000068028	ENSG00000068028			9882	protein-coding gene	gene with protein product		605082					Standard	NM_170713		Approved	NORE2A, REH3P21, RDA32, 123F2	uc003dad.1	Q9NS23	OTTHUMG00000149958	ENST00000357043.2:c.811C>T	3.37:g.50368842G>A	ENSP00000349547:p.Arg271Trp		50343846		Missense_Mutation	SNP	HMMPfam_RA,HMMPfam_C1_1,superfamily_Cysteine-rich domain	p.R271W	ENST00000357043.2	37	c.811	CCDS2820.1	3	.	.	.	.	.	.	.	.	.	.	G	15.51	2.855563	0.51376	4.54E-4	2.33E-4	ENSG00000068028	ENST00000327761;ENST00000395126;ENST00000357043;ENST00000359365	T;T;T;T	0.18016	2.24;2.24;2.24;2.24	5.55	3.56	0.40772	Ras-association (3);	0.438837	0.24774	N	0.035702	T	0.20577	0.0495	N	0.19112	0.55	0.33979	D	0.647709	B;D;B	0.64830	0.015;0.994;0.002	B;P;B	0.56788	0.014;0.806;0.014	T	0.20075	-1.0286	10	0.41790	T	0.15	-9.4422	12.8277	0.57728	0.0:0.0:0.4859:0.5141	.	267;271;197	Q9NS23-2;Q9NS23;Q5TZT2	.;RASF1_HUMAN;.	W	197;116;271;267	ENSP00000333327:R197W;ENSP00000378558:R116W;ENSP00000349547:R271W;ENSP00000352323:R267W	ENSP00000333327:R197W	R	-	1	2	RASSF1	50343846	0.827000	0.29292	0.370000	0.25965	0.940000	0.58332	1.347000	0.33975	0.519000	0.28406	0.563000	0.77884	CGG	-	HMMPfam_RA		0.562	RASSF1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RASSF1	protein_coding	OTTHUMT00000314304.1	G			50343846	-1	no_errors	NM_170714	genbank	human	reviewed	54_36p	missense	SNP	0.177	A
ROBO1	6091	genome.wustl.edu	37	3	78685111	78685111	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1491-01A-01W-0549-09	TCGA-13-1491-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fb7d1c2b-3e87-4d05-a58b-92d0e1016986	95848a3e-2292-4a0a-ace2-683e70709a56	g.chr3:78685111C>T	ENST00000464233.1	-	23	3298	c.3185G>A	c.(3184-3186)cGt>cAt	p.R1062H	ROBO1_ENST00000436010.2_Missense_Mutation_p.R1023H|ROBO1_ENST00000467549.1_Intron|ROBO1_ENST00000495273.1_Missense_Mutation_p.R1017H	NM_002941.3	NP_002932.1	Q9Y6N7	ROBO1_HUMAN	roundabout, axon guidance receptor, homolog 1 (Drosophila)	1062					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|homophilic cell adhesion (GO:0007156)|mammary duct terminal end bud growth (GO:0060763)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of negative chemotaxis (GO:0050925)|nervous system development (GO:0007399)|positive regulation of axonogenesis (GO:0050772)|Roundabout signaling pathway (GO:0035385)	axolemma (GO:0030673)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)|LRR domain binding (GO:0030275)	p.R1039H(1)		breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(25)|urinary_tract(1)	44		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		ATTGACAAAACGCCCATCCTT	0.473																																																1	Substitution - Missense(1)	ovary(1)	3											155.0	159.0	157.0					3																	78685111		2107	4225	6332	78767801	SO:0001583	missense	6091			AF040990	CCDS46872.1, CCDS46872.2, CCDS54610.1, CCDS54611.1	3p12.3	2013-02-11	2001-11-28		ENSG00000169855	ENSG00000169855		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10249	protein-coding gene	gene with protein product		602430	"""roundabout (axon guidance receptor, Drosophila) homolog 1"""			9458045, 9608531	Standard	NM_002941		Approved	DUTT1, FLJ21882, SAX3	uc003dqe.2	Q9Y6N7	OTTHUMG00000158843	ENST00000464233.1:c.3185G>A	3.37:g.78685111C>T	ENSP00000420321:p.Arg1062His		78767801	B2RXI1|D3DU36|E9PD49|Q1RMC7|Q7Z300|Q9BUS7	Missense_Mutation	SNP	fn3;HMMPfam_fn3;I-set;HMMPfam_I-set	p.R1062H	ENST00000464233.1	37	c.3185	CCDS54611.1	3	.	.	.	.	.	.	.	.	.	.	C	23.6	4.437230	0.83885	.	.	ENSG00000169855	ENST00000436010;ENST00000398412;ENST00000464233;ENST00000495273;ENST00000398414	T;T;T	0.62105	0.08;0.05;0.12	6.05	6.05	0.98169	.	0.000000	0.85682	D	0.000000	T	0.74680	0.3748	L	0.44542	1.39	0.80722	D	1	D;D;D;D	0.76494	0.999;0.996;0.999;0.999	D;P;D;D	0.80764	0.994;0.731;0.926;0.921	T	0.69720	-0.5069	9	.	.	.	.	20.6087	0.99469	0.0:1.0:0.0:0.0	.	1026;1062;1017;1023	Q9Y6N7-3;Q9Y6N7;B2RXI1;Q9Y6N7-4	.;ROBO1_HUMAN;.;.	H	1023;1017;1062;1017;1066	ENSP00000406043:R1023H;ENSP00000420321:R1062H;ENSP00000420637:R1017H	.	R	-	2	0	ROBO1	78767801	1.000000	0.71417	1.000000	0.80357	0.835000	0.47333	7.291000	0.78721	2.866000	0.98385	0.650000	0.86243	CGT	-	NULL		0.473	ROBO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ROBO1	protein_coding	OTTHUMT00000352610.1	C	NM_002941		78767801	-1	no_errors	NM_002941	genbank	human	reviewed	54_36p	missense	SNP	1	T
Unknown	0	genome.wustl.edu	37	3	180041208	180041208	+	IGR	SNP	G	G	T			TCGA-13-1491-01A-01W-0549-09	TCGA-13-1491-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fb7d1c2b-3e87-4d05-a58b-92d0e1016986	95848a3e-2292-4a0a-ace2-683e70709a56	g.chr3:180041208G>T								RNA5SP149 (161443 upstream) : RP11-420J11.2 (90753 downstream)																							AAATGAAGAGGCTCAAGGGAA	0.373																																																0			3																																								181523902	SO:0001628	intergenic_variant	131054																															3.37:g.180041208G>T			181523902		RNA	SNP	-	NULL		37	NULL		3																																																																																			-	-	0	0.373					LOC131054			G			181523902	1	pseudogene	XR_017452	genbank	human	model	54_36p	rna	SNP	1	T
ADD1	118	genome.wustl.edu	37	4	2916637	2916637	+	Silent	SNP	C	C	T			TCGA-13-1491-01A-01W-0549-09	TCGA-13-1491-10A-01W-0549-09	C	C	T	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fb7d1c2b-3e87-4d05-a58b-92d0e1016986	95848a3e-2292-4a0a-ace2-683e70709a56	g.chr4:2916637C>T	ENST00000398129.1	+	12	1652	c.1632C>T	c.(1630-1632)gcC>gcT	p.A544A	ADD1_ENST00000503455.2_Silent_p.A575A|ADD1_ENST00000398125.1_Silent_p.A575A|ADD1_ENST00000355842.3_Silent_p.A575A|ADD1_ENST00000446856.1_Silent_p.A544A|ADD1_ENST00000513328.2_Silent_p.A544A|ADD1_ENST00000264758.7_Silent_p.A575A|ADD1_ENST00000398123.2_Silent_p.A575A			P35611	ADDA_HUMAN	adducin 1 (alpha)	544					actin cytoskeleton organization (GO:0030036)|actin filament bundle assembly (GO:0051017)|activation of signaling protein activity involved in unfolded protein response (GO:0006987)|apoptotic process (GO:0006915)|barbed-end actin filament capping (GO:0051016)|cell morphogenesis (GO:0000902)|cell volume homeostasis (GO:0006884)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular protein metabolic process (GO:0044267)|cellular response to retinoic acid (GO:0071300)|endoplasmic reticulum unfolded protein response (GO:0030968)|erythrocyte differentiation (GO:0030218)|hemoglobin metabolic process (GO:0020027)|homeostasis of number of cells within a tissue (GO:0048873)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endocytosis (GO:0045807)|positive regulation of protein binding (GO:0032092)	cytosol (GO:0005829)|dendritic spine (GO:0043197)|F-actin capping protein complex (GO:0008290)|focal adhesion (GO:0005925)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|spectrin binding (GO:0030507)|structural molecule activity (GO:0005198)|transcription factor binding (GO:0008134)	p.A575A(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)	22				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		CCTCCAAGGCCATCATTGAAA	0.632																																					Esophageal Squamous(71;505 1201 20414 34538 37449)											1	Substitution - coding silent(1)	ovary(1)	4											94.0	92.0	93.0					4																	2916637		2203	4300	6503	2886435	SO:0001819	synonymous_variant	118			L07261	CCDS3363.1, CCDS3364.1, CCDS43205.1, CCDS75094.1	4p16.3	2009-04-22			ENSG00000087274	ENSG00000087274			243	protein-coding gene	gene with protein product		102680				1840603	Standard	NM_001119		Approved		uc003gfq.3	P35611	OTTHUMG00000122080	ENST00000398129.1:c.1632C>T	4.37:g.2916637C>T			2886435	A2A3N8|A2A3P0|B4DI79|D3DVR3|D3DVR4|D3DVR5|Q13734|Q14729|Q16156|Q86XM2|Q9UJB6	Silent	SNP	-	p.A575	ENST00000398129.1	37	c.1725	CCDS43205.1	4	.	.	.	.	.	.	.	.	.	.	C	10.93	1.490290	0.26686	.	.	ENSG00000087274	ENST00000514940	.	.	.	5.56	1.36	0.22044	.	.	.	.	.	T	0.51500	0.1678	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.37753	-0.9692	4	.	.	.	-26.2112	5.2618	0.15578	0.3476:0.4261:0.0:0.2264	.	.	.	.	L	281	.	.	P	+	2	0	ADD1	2886435	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	1.015000	0.29963	0.304000	0.22809	-1.357000	0.01221	CCA	-	NULL		0.632	ADD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADD1	protein_coding	OTTHUMT00000242840.1	C	NM_014189		2886435	1	no_errors	NM_014189	genbank	human	reviewed	54_36p	silent	SNP	1	T
ANKRD17	26057	genome.wustl.edu	37	4	73956406	73956406	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1491-01A-01W-0549-09	TCGA-13-1491-10A-01W-0549-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fb7d1c2b-3e87-4d05-a58b-92d0e1016986	95848a3e-2292-4a0a-ace2-683e70709a56	g.chr4:73956406C>G	ENST00000358602.4	-	29	7055	c.6939G>C	c.(6937-6939)caG>caC	p.Q2313H	ANKRD17_ENST00000330838.6_Missense_Mutation_p.Q2062H|ANKRD17_ENST00000509867.2_Missense_Mutation_p.Q2200H	NM_032217.3	NP_115593.3	O75179	ANR17_HUMAN	ankyrin repeat domain 17	2313					blood vessel maturation (GO:0001955)|negative regulation of smooth muscle cell differentiation (GO:0051151)|viral process (GO:0016032)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.Q2313H(1)		NS(3)|breast(2)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(39)|ovary(6)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)	96	Breast(15;0.000295)		Epithelial(6;8.86e-07)|OV - Ovarian serous cystadenocarcinoma(6;6.22e-06)|all cancers(17;1.51e-05)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			GAGCAGGTCTCTGTAATGGTG	0.383																																																1	Substitution - Missense(1)	ovary(1)	4											90.0	95.0	93.0					4																	73956406		2203	4300	6503	74175270	SO:0001583	missense	26057			AB014597	CCDS34003.1, CCDS34004.1, CCDS68721.1	4q21.1-q21.21	2013-01-10			ENSG00000132466	ENSG00000132466		"""Ankyrin repeat domain containing"""	23575	protein-coding gene	gene with protein product		615929				11165478	Standard	NM_032217		Approved	GTAR, KIAA0697, FLJ22206, NY-BR-16	uc003hgp.3	O75179	OTTHUMG00000160826	ENST00000358602.4:c.6939G>C	4.37:g.73956406C>G	ENSP00000351416:p.Gln2313His		74175270	E7EUV3|G5E964|Q6PJ85|Q6PK85|Q6PKA2|Q86XI3|Q8NDR5|Q96I86|Q9H288|Q9H6J9	Missense_Mutation	SNP	HMMPfam_MutS_V,HMMPfam_Ank,superfamily_Ankyrin repeat,HMMPfam_KH_1,superfamily_Eukaryotic type KH-domain (KH-domain type I)	p.Q2313H	ENST00000358602.4	37	c.6939	CCDS34004.1	4	.	.	.	.	.	.	.	.	.	.	C	9.856	1.194886	0.22037	.	.	ENSG00000132466	ENST00000358602;ENST00000426990;ENST00000330838;ENST00000509867;ENST00000426917	T;T;T	0.80909	-1.43;-1.43;-0.78	5.98	1.89	0.25635	.	0.000000	0.64402	D	0.000014	D	0.85906	0.5806	L	0.57536	1.79	0.31264	N	0.692522	D;D;D;D	0.64830	0.994;0.994;0.99;0.99	D;D;D;D	0.78314	0.991;0.991;0.979;0.979	D	0.85278	0.1060	10	0.87932	D	0	.	11.872	0.52525	0.0:0.7271:0.0:0.2729	.	2312;2062;2313;2200	O75179-2;G5E964;O75179;E7EUV3	.;.;ANR17_HUMAN;.	H	2313;1720;2062;2200;697	ENSP00000351416:Q2313H;ENSP00000332265:Q2062H;ENSP00000427151:Q2200H	ENSP00000332265:Q2062H	Q	-	3	2	ANKRD17	74175270	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	0.718000	0.25866	0.444000	0.26612	-0.768000	0.03414	CAG	-	NULL		0.383	ANKRD17-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANKRD17	protein_coding	OTTHUMT00000362475.1	C	NM_032217		74175270	-1	no_errors	NM_032217	genbank	human	reviewed	54_36p	missense	SNP	1	G
ADCY2	108	genome.wustl.edu	37	5	7712987	7712987	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1491-01A-01W-0549-09	TCGA-13-1491-10A-01W-0549-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fb7d1c2b-3e87-4d05-a58b-92d0e1016986	95848a3e-2292-4a0a-ace2-683e70709a56	g.chr5:7712987C>G	ENST00000338316.4	+	11	1686	c.1597C>G	c.(1597-1599)Cat>Gat	p.H533D	ADCY2_ENST00000537121.1_Missense_Mutation_p.H353D|RP11-711G10.1_ENST00000514105.2_RNA	NM_020546.2	NP_065433.2	Q08462	ADCY2_HUMAN	adenylate cyclase 2 (brain)	533					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)	p.H533D(1)		NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(56)|ovary(8)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	119						CATGGGTCAGCATAATTTTCA	0.294																																																1	Substitution - Missense(1)	ovary(1)	5											127.0	123.0	124.0					5																	7712987		2203	4300	6503	7765987	SO:0001583	missense	108			AB028983	CCDS3872.2	5p15.3	2013-02-04			ENSG00000078295	ENSG00000078295	4.6.1.1	"""Adenylate cyclases"""	233	protein-coding gene	gene with protein product		103071				1427768	Standard	NM_020546		Approved	HBAC2, KIAA1060, AC2	uc003jdz.1	Q08462	OTTHUMG00000090476	ENST00000338316.4:c.1597C>G	5.37:g.7712987C>G	ENSP00000342952:p.His533Asp		7765987	B7Z2C1|Q2NKL8|Q9UDB2|Q9UPU2	Missense_Mutation	SNP	-	p.H533D	ENST00000338316.4	37	c.1597	CCDS3872.2	5	.	.	.	.	.	.	.	.	.	.	C	12.69	2.014743	0.35511	.	.	ENSG00000078295	ENST00000338316;ENST00000541993;ENST00000537121	T;T	0.75260	-0.92;-0.92	5.88	5.88	0.94601	.	0.349867	0.30940	N	0.008574	T	0.58892	0.2154	N	0.22421	0.69	0.36741	D	0.88223	B;B	0.02656	0.0;0.0	B;B	0.09377	0.004;0.0	T	0.58896	-0.7555	10	0.33940	T	0.23	.	9.1464	0.36935	0.0:0.8787:0.0:0.1213	.	353;533	B7Z2C1;Q08462	.;ADCY2_HUMAN	D	533;366;353	ENSP00000342952:H533D;ENSP00000444803:H353D	ENSP00000342952:H533D	H	+	1	0	ADCY2	7765987	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.057000	0.49931	2.777000	0.95525	0.551000	0.68910	CAT	-	NULL		0.294	ADCY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY2	protein_coding	OTTHUMT00000206930.2	C	NM_020546		7765987	1	no_errors	NM_020546	genbank	human	reviewed	54_36p	missense	SNP	1	G
DNAH5	1767	genome.wustl.edu	37	5	13850804	13850804	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1491-01A-01W-0549-09	TCGA-13-1491-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fb7d1c2b-3e87-4d05-a58b-92d0e1016986	95848a3e-2292-4a0a-ace2-683e70709a56	g.chr5:13850804G>T	ENST00000265104.4	-	31	5175	c.5071C>A	c.(5071-5073)Cac>Aac	p.H1691N		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	1691	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.H1691N(1)		NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					TCCAGCAAGTGTGGTAACAGC	0.488									Kartagener syndrome																																							1	Substitution - Missense(1)	ovary(1)	5											79.0	75.0	77.0					5																	13850804		2203	4300	6503	13903804	SO:0001583	missense	1767	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.5071C>A	5.37:g.13850804G>T	ENSP00000265104:p.His1691Asn		13903804	Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	-	p.H1691N	ENST00000265104.4	37	c.5071	CCDS3882.1	5	.	.	.	.	.	.	.	.	.	.	G	26.0	4.697923	0.88830	.	.	ENSG00000039139	ENST00000265104	T	0.60171	0.21	5.49	5.49	0.81192	Dynein heavy chain, domain-2 (1);	0.000000	0.85682	D	0.000000	T	0.70176	0.3194	M	0.73598	2.24	0.80722	D	1	P	0.47677	0.899	P	0.51297	0.665	T	0.70303	-0.4909	10	0.41790	T	0.15	.	19.3649	0.94458	0.0:0.0:1.0:0.0	.	1691	Q8TE73	DYH5_HUMAN	N	1691	ENSP00000265104:H1691N	ENSP00000265104:H1691N	H	-	1	0	DNAH5	13903804	1.000000	0.71417	0.974000	0.42286	0.862000	0.49288	6.535000	0.73838	2.571000	0.86741	0.591000	0.81541	CAC	-	NULL		0.488	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH5	protein_coding	OTTHUMT00000207057.2	G	NM_001369		13903804	-1	no_errors	NM_001369	genbank	human	validated	54_36p	missense	SNP	1	T
CDH18	1016	genome.wustl.edu	37	5	19571821	19571821	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1491-01A-01W-0549-09	TCGA-13-1491-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fb7d1c2b-3e87-4d05-a58b-92d0e1016986	95848a3e-2292-4a0a-ace2-683e70709a56	g.chr5:19571821C>A	ENST00000507958.1	-	10	2110	c.1120G>T	c.(1120-1122)Gtt>Ttt	p.V374F	CDH18_ENST00000506372.1_Missense_Mutation_p.V374F|CDH18_ENST00000274170.4_Missense_Mutation_p.V374F|CDH18_ENST00000502796.1_Missense_Mutation_p.V374F|CDH18_ENST00000382275.1_Missense_Mutation_p.V374F|CDH18_ENST00000511273.1_Missense_Mutation_p.V374F			Q13634	CAD18_HUMAN	cadherin 18, type 2	374	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.V374F(1)		breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(24)|lung(76)|ovary(5)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)	138	Lung NSC(1;0.00734)|all_lung(1;0.0197)					ACATCCCCAACAATGATCTTC	0.423																																																1	Substitution - Missense(1)	ovary(1)	5											154.0	128.0	137.0					5																	19571821		2203	4300	6503	19607578	SO:0001583	missense	1016			U59325	CCDS3889.1, CCDS54835.1, CCDS75229.1	5p14.3	2010-01-26			ENSG00000145526	ENSG00000145526		"""Cadherins / Major cadherins"""	1757	protein-coding gene	gene with protein product		603019				9030594, 10191097	Standard	NM_004934		Approved	CDH14, EY-CADHERIN	uc003jgd.3	Q13634	OTTHUMG00000090578	ENST00000507958.1:c.1120G>T	5.37:g.19571821C>A	ENSP00000425093:p.Val374Phe		19607578	A8K0I2|B4DHG6|Q8N5Z2	Missense_Mutation	SNP	HMMPfam_Cadherin_C;HMMPfam_Cadherin;superfamily_Cadherin-like	p.V374F	ENST00000507958.1	37	c.1120	CCDS3889.1	5	.	.	.	.	.	.	.	.	.	.	C	22.2	4.253088	0.80135	.	.	ENSG00000145526	ENST00000382275;ENST00000507958;ENST00000542864;ENST00000274170;ENST00000506372;ENST00000502796;ENST00000515257;ENST00000511273	T;T;T;T;T;T;T	0.72835	-0.69;-0.69;-0.69;-0.69;-0.69;0.07;-0.69	5.17	5.17	0.71159	Cadherin (2);Cadherin-like (1);	0.000000	0.85682	D	0.000000	D	0.90553	0.7039	H	0.98594	4.275	0.53688	D	0.999979	D;D	0.76494	0.999;0.999	D;D	0.81914	0.995;0.987	D	0.94099	0.7360	9	.	.	.	.	17.5963	0.88013	0.0:1.0:0.0:0.0	.	374;374	B4DHG6;Q13634	.;CAD18_HUMAN	F	374;374;374;374;374;374;320;374	ENSP00000371710:V374F;ENSP00000425093:V374F;ENSP00000274170:V374F;ENSP00000424931:V374F;ENSP00000422138:V374F;ENSP00000427383:V320F;ENSP00000425854:V374F	.	V	-	1	0	CDH18	19607578	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.494000	0.60347	2.591000	0.87537	0.655000	0.94253	GTT	-	NULL		0.423	CDH18-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CDH18	protein_coding	OTTHUMT00000366747.1	C	NM_004934		19607578	-1	no_errors	NM_004934	genbank	human	reviewed	54_36p	missense	SNP	1	A
CDH6	1004	genome.wustl.edu	37	5	31323263	31323263	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1491-01A-01W-0549-09	TCGA-13-1491-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fb7d1c2b-3e87-4d05-a58b-92d0e1016986	95848a3e-2292-4a0a-ace2-683e70709a56	g.chr5:31323263G>A	ENST00000265071.2	+	12	2486	c.2221G>A	c.(2221-2223)Gaa>Aaa	p.E741K		NM_004932.3	NP_004923.1	P55285	CADH6_HUMAN	cadherin 6, type 2, K-cadherin (fetal kidney)	741					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.E741K(2)		NS(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(42)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	77						TTACGCCTATGAAGGCACTGG	0.527																																																2	Substitution - Missense(2)	ovary(1)|skin(1)	5											45.0	44.0	45.0					5																	31323263		2203	4300	6503	31359020	SO:0001583	missense	1004			D31784	CCDS3894.1	5p13.3	2010-01-26			ENSG00000113361	ENSG00000113361		"""Cadherins / Major cadherins"""	1765	protein-coding gene	gene with protein product	"""K-Cadherin"""	603007				7743525, 10191097	Standard	NM_004932		Approved		uc003jhe.2	P55285	OTTHUMG00000090673	ENST00000265071.2:c.2221G>A	5.37:g.31323263G>A	ENSP00000265071:p.Glu741Lys		31359020	A8K5H5|Q9BWS0	Missense_Mutation	SNP	HMMPfam_Cadherin_C;HMMPfam_Cadherin;superfamily_Cadherin-like	p.E741K	ENST00000265071.2	37	c.2221	CCDS3894.1	5	.	.	.	.	.	.	.	.	.	.	G	36	5.747362	0.96882	.	.	ENSG00000113361	ENST00000265071	D	0.87887	-2.31	5.66	5.66	0.87406	Cadherin, cytoplasmic domain (1);	0.000000	0.85682	D	0.000000	D	0.96488	0.8854	H	0.97783	4.075	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97411	1.0002	10	0.87932	D	0	.	20.1253	0.97977	0.0:0.0:1.0:0.0	.	741	P55285	CADH6_HUMAN	K	741	ENSP00000265071:E741K	ENSP00000265071:E741K	E	+	1	0	CDH6	31359020	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	9.813000	0.99286	2.832000	0.97577	0.655000	0.94253	GAA	-	HMMPfam_Cadherin_C		0.527	CDH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH6	protein_coding	OTTHUMT00000207355.2	G	NM_004932		31359020	1	no_errors	NM_004932	genbank	human	reviewed	54_36p	missense	SNP	1	A
ARHGEF28	64283	genome.wustl.edu	37	5	73069741	73069741	+	Silent	SNP	C	C	T			TCGA-13-1491-01A-01W-0549-09	TCGA-13-1491-10A-01W-0549-09	C	C	T	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fb7d1c2b-3e87-4d05-a58b-92d0e1016986	95848a3e-2292-4a0a-ace2-683e70709a56	g.chr5:73069741C>T	ENST00000426542.2	+	4	557	c.537C>T	c.(535-537)tcC>tcT	p.S179S	ARHGEF28_ENST00000513042.2_Silent_p.S179S|ARHGEF28_ENST00000287898.5_Silent_p.S179S|ARHGEF28_ENST00000296794.6_Silent_p.S179S|ARHGEF28_ENST00000437974.1_Silent_p.S179S|ARHGEF28_ENST00000545377.1_Silent_p.S179S			Q8N1W1	ARG28_HUMAN	Rho guanine nucleotide exchange factor (GEF) 28	179					central nervous system neuron axonogenesis (GO:0021955)|intracellular signal transduction (GO:0035556)|neurofilament cytoskeleton organization (GO:0060052)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|RNA binding (GO:0003723)	p.S179S(1)									CTAAACTTTCCCAGTTCTTCT	0.483																																																1	Substitution - coding silent(1)	ovary(1)	5											63.0	57.0	59.0					5																	73069741		1853	4087	5940	73105497	SO:0001819	synonymous_variant	64283				CCDS47231.1, CCDS47231.2, CCDS54870.1, CCDS58957.1	5q13.2	2012-08-08			ENSG00000214944	ENSG00000214944			30322	protein-coding gene	gene with protein product		612790				9199174, 11058585	Standard	NM_001177693		Approved	RGNEF, p190RhoGEF, RIP2	uc010izf.3	Q8N1W1	OTTHUMG00000162454	ENST00000426542.2:c.537C>T	5.37:g.73069741C>T			73105497	B2RXG7|B4E3K4|B5MDA3|B7ZW32|E9PC75|Q8NCM7|Q96E37|Q9H6L3|Q9H6W0	Silent	SNP	-	p.S179	ENST00000426542.2	37	c.537	CCDS54870.1	5																																																																																			-	NULL		0.483	ARHGEF28-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RGNEF	protein_coding	OTTHUMT00000368975.1	C			73105497	1	no_errors	NM_001080479	genbank	human	provisional	54_36p	silent	SNP	0.99	T
SLC12A2	6558	genome.wustl.edu	37	5	127486967	127486967	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1491-01A-01W-0549-09	TCGA-13-1491-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fb7d1c2b-3e87-4d05-a58b-92d0e1016986	95848a3e-2292-4a0a-ace2-683e70709a56	g.chr5:127486967G>T	ENST00000262461.2	+	14	2331	c.2142G>T	c.(2140-2142)tgG>tgT	p.W714C	SLC12A2_ENST00000343225.4_Missense_Mutation_p.W714C	NM_001046.2	NP_001037.1	P55011	S12A2_HUMAN	solute carrier family 12 (sodium/potassium/chloride transporter), member 2	714					ammonium transmembrane transport (GO:0072488)|ammonium transport (GO:0015696)|branching involved in mammary gland duct morphogenesis (GO:0060444)|chloride transmembrane transport (GO:1902476)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|gamma-aminobutyric acid signaling pathway (GO:0007214)|hyperosmotic response (GO:0006972)|ion transport (GO:0006811)|mammary duct terminal end bud growth (GO:0060763)|multicellular organism growth (GO:0035264)|positive regulation of cell volume (GO:0045795)|potassium ion transport (GO:0006813)|sodium ion transport (GO:0006814)|transepithelial ammonium transport (GO:0070634)|transepithelial chloride transport (GO:0030321)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	ammonium transmembrane transporter activity (GO:0008519)|sodium:potassium:chloride symporter activity (GO:0008511)	p.W714C(1)		breast(3)|endometrium(5)|kidney(5)|large_intestine(12)|lung(16)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48		all_cancers(142;0.0972)|Prostate(80;0.151)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	Epithelial(69;0.0433)|OV - Ovarian serous cystadenocarcinoma(64;0.0978)	Bumetanide(DB00887)|Potassium Chloride(DB00761)|Quinethazone(DB01325)	ACAACATGTGGATATCACTTC	0.363																																																1	Substitution - Missense(1)	ovary(1)	5											249.0	236.0	240.0					5																	127486967		2203	4300	6503	127514866	SO:0001583	missense	6558				CCDS4144.1, CCDS58965.1	5q23.3	2014-06-13	2013-07-18		ENSG00000064651	ENSG00000064651		"""Solute carriers"""	10911	protein-coding gene	gene with protein product	"""bumetanide-sensitive sodium-(potassium)-chloride cotransporter 1"", ""basolateral Na-K-Cl symporter"", ""protein phosphatase 1, regulatory subunit 141"""	600840				7629105	Standard	NM_001256461		Approved	NKCC1, BSC, BSC2, PPP1R141	uc003kus.3	P55011	OTTHUMG00000128983	ENST00000262461.2:c.2142G>T	5.37:g.127486967G>T	ENSP00000262461:p.Trp714Cys		127514866	Q8N713|Q8WWH7	Missense_Mutation	SNP	-	p.W714C	ENST00000262461.2	37	c.2142	CCDS4144.1	5	.	.	.	.	.	.	.	.	.	.	G	16.84	3.234449	0.58886	.	.	ENSG00000064651	ENST00000262461;ENST00000343225	D;D	0.98835	-5.17;-5.17	4.75	4.75	0.60458	Amino acid permease domain (1);	0.127811	0.56097	D	0.000023	D	0.98960	0.9646	H	0.96604	3.85	0.80722	D	1	B;P	0.34800	0.414;0.469	B;B	0.38954	0.188;0.286	D	0.99943	1.1439	10	0.87932	D	0	.	18.3079	0.90189	0.0:0.0:1.0:0.0	.	714;714	P55011-3;P55011	.;S12A2_HUMAN	C	714	ENSP00000262461:W714C;ENSP00000340878:W714C	ENSP00000262461:W714C	W	+	3	0	SLC12A2	127514866	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.657000	0.98554	2.655000	0.90218	0.655000	0.94253	TGG	-	NULL		0.363	SLC12A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC12A2	protein_coding	OTTHUMT00000250972.1	G	NM_001046		127514866	1	no_errors	NM_001046	genbank	human	validated	54_36p	missense	SNP	1	T
HLA-G	3135	genome.wustl.edu	37	6	29797366	29797366	+	Missense_Mutation	SNP	C	C	T	rs202126599		TCGA-13-1491-01A-01W-0549-09	TCGA-13-1491-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fb7d1c2b-3e87-4d05-a58b-92d0e1016986	95848a3e-2292-4a0a-ace2-683e70709a56	g.chr6:29797366C>T	ENST00000360323.6	+	4	815	c.791C>T	c.(790-792)aCc>aTc	p.T264I	HLA-G_ENST00000376818.3_Missense_Mutation_p.T172I|HLA-G_ENST00000376815.3_Intron|HLA-G_ENST00000376828.2_Missense_Mutation_p.T269I|HLA-G_ENST00000428701.1_Missense_Mutation_p.T264I			P17693	HLAG_HUMAN	major histocompatibility complex, class I, G	264	Alpha-3.|Ig-like C1-type.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular defense response (GO:0006968)|cytokine-mediated signaling pathway (GO:0019221)|immune response-inhibiting cell surface receptor signaling pathway (GO:0002767)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of dendritic cell differentiation (GO:2001199)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of regulatory T cell differentiation (GO:0045591)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|positive regulation of T cell tolerance induction (GO:0002666)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)	early endosome membrane (GO:0031901)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|membrane (GO:0016020)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	peptide antigen binding (GO:0042605)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)	p.T264I(1)		central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(4)|ovary(3)|pancreas(1)|prostate(5)|skin(1)	21						GGGGATGGAACCTTCCAGAAG	0.627																																																1	Substitution - Missense(1)	ovary(1)	6											66.0	59.0	61.0					6																	29797366		2203	4299	6502	29905345	SO:0001583	missense	3135				CCDS4668.1	6p21.3	2013-01-11	2007-12-12		ENSG00000204632	ENSG00000204632		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4964	protein-coding gene	gene with protein product	"""b2 microglobulin"""	142871	"""HLA-G histocompatibility antigen, class I, G"""				Standard	NM_002127		Approved		uc003nnw.2	P17693	OTTHUMG00000031157	ENST00000360323.6:c.791C>T	6.37:g.29797366C>T	ENSP00000353472:p.Thr264Ile		29905345		Missense_Mutation	SNP	-	p.T264I	ENST00000360323.6	37	c.791	CCDS4668.1	6	.	.	.	.	.	.	.	.	.	.	.	9.067	0.995979	0.19043	.	.	ENSG00000204632	ENST00000376828;ENST00000428701;ENST00000360323;ENST00000376818	T;T;T;T	0.03635	3.86;3.86;3.86;3.86	1.7	-0.678	0.11353	Immunoglobulin-like (1);Immunoglobulin C1-set (2);Immunoglobulin-like fold (1);	0.369118	0.18934	U	0.127122	T	0.15955	0.0384	H	0.99960	5.065	0.20563	N	0.999887	D;B;D	0.89917	0.999;0.033;1.0	D;B;D	0.97110	0.987;0.013;1.0	T	0.08086	-1.0739	10	0.87932	D	0	.	0.7453	0.00981	0.2351:0.361:0.2329:0.171	.	269;172;264	Q5RJ85;Q31611;P17693	.;.;HLAG_HUMAN	I	269;264;264;172	ENSP00000366024:T269I;ENSP00000412927:T264I;ENSP00000353472:T264I;ENSP00000366014:T172I	ENSP00000353472:T264I	T	+	2	0	HLA-G	29905345	0.986000	0.35501	0.270000	0.24601	0.280000	0.26924	0.194000	0.17135	-0.401000	0.07644	0.291000	0.19559	ACC	-	NULL		0.627	HLA-G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLA-G	protein_coding	OTTHUMT00000076286.2	C	NM_002127		29905345	1	no_errors	NM_002127	genbank	human	reviewed	54_36p	missense	SNP	1	T
SRRT	51593	genome.wustl.edu	37	7	100485713	100485713	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1491-01A-01W-0549-09	TCGA-13-1491-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fb7d1c2b-3e87-4d05-a58b-92d0e1016986	95848a3e-2292-4a0a-ace2-683e70709a56	g.chr7:100485713C>A	ENST00000347433.4	+	18	2535	c.2377C>A	c.(2377-2379)Cag>Aag	p.Q793K	SRRT_ENST00000388793.4_Missense_Mutation_p.Q792K|SRRT_ENST00000457580.2_Missense_Mutation_p.Q789K|SRRT_ENST00000432932.1_Missense_Mutation_p.Q788K			Q9BXP5	SRRT_HUMAN	serrate, RNA effector molecule	793	Pro-rich.				cell proliferation (GO:0008283)|neuronal stem cell maintenance (GO:0097150)|primary miRNA processing (GO:0031053)|regulation of transcription, DNA-templated (GO:0006355)|response to arsenic-containing substance (GO:0046685)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)	p.Q793K(1)		breast(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(5)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	40						CCAGACTCCCCAGGGCCTGAT	0.627																																																1	Substitution - Missense(1)	ovary(1)	7											51.0	55.0	54.0					7																	100485713		2203	4300	6503	100323649	SO:0001583	missense	51593				CCDS34709.1, CCDS47665.1, CCDS47666.1, CCDS47667.1	7q21	2014-04-14	2014-04-14		ENSG00000087087	ENSG00000087087			24101	protein-coding gene	gene with protein product	"""arsenite resistance protein"""	614469	"""serrate RNA effector molecule homolog (Arabidopsis)"""			11239002, 11230166	Standard	NM_015908		Approved	Asr2, serrate, ARS2	uc003uwy.2	Q9BXP5	OTTHUMG00000157031	ENST00000347433.4:c.2377C>A	7.37:g.100485713C>A	ENSP00000314491:p.Gln793Lys		100323649	A4D2E5|A4D2E6|A6NK22|B4DJL4|B4DZA6|O95808|Q32MI4|Q6NT74|Q8TDQ5|Q9BWP6|Q9BXP4|Q9Y4S4	Missense_Mutation	SNP	-	p.Q793K	ENST00000347433.4	37	c.2377	CCDS34709.1	7	.	.	.	.	.	.	.	.	.	.	C	12.91	2.080174	0.36662	.	.	ENSG00000087087	ENST00000457580;ENST00000388793;ENST00000342198;ENST00000432932;ENST00000347433;ENST00000448764;ENST00000445337	.	.	.	4.91	4.91	0.64330	Arsenite-resistance protein 2 (1);	0.000000	0.85682	D	0.000000	T	0.67429	0.2892	L	0.49350	1.555	0.58432	D	0.999999	P;P;P;P	0.52577	0.954;0.859;0.859;0.884	D;P;P;P	0.65140	0.932;0.554;0.554;0.682	T	0.60682	-0.7215	9	0.18710	T	0.47	.	15.6172	0.76775	0.0:1.0:0.0:0.0	.	792;788;789;793	Q9BXP5-3;Q9BXP5-4;Q9BXP5-2;Q9BXP5	.;.;.;SRRT_HUMAN	K	789;792;158;788;793;423;70	.	ENSP00000344670:Q158K	Q	+	1	0	SRRT	100323649	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	6.652000	0.74377	2.545000	0.85829	0.484000	0.47621	CAG	-	NULL		0.627	SRRT-004	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	SRRT	protein_coding	OTTHUMT00000347168.1	C	NM_015908		100323649	1	no_errors	NM_015908	genbank	human	validated	54_36p	missense	SNP	1	A
C7orf60	154743	genome.wustl.edu	37	7	112535741	112535741	+	Missense_Mutation	SNP	T	T	A			TCGA-13-1491-01A-01W-0549-09	TCGA-13-1491-10A-01W-0549-09	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fb7d1c2b-3e87-4d05-a58b-92d0e1016986	95848a3e-2292-4a0a-ace2-683e70709a56	g.chr7:112535741T>A	ENST00000297145.4	-	3	521	c.356A>T	c.(355-357)gAt>gTt	p.D119V	C7orf60_ENST00000485446.1_5'UTR	NM_152556.2	NP_689769.2	Q1RMZ1	BMT2_HUMAN	chromosome 7 open reading frame 60	119							rRNA (adenine) methyltransferase activity (GO:0016433)	p.D119V(1)		breast(1)|endometrium(2)|lung(7)|ovary(3)|prostate(2)|skin(1)|urinary_tract(1)	17						TCTTTTTTCATCTTTCTCAAG	0.363																																																1	Substitution - Missense(1)	ovary(1)	7											152.0	139.0	143.0					7																	112535741		1843	4091	5934	112322977	SO:0001583	missense	154743				CCDS43634.1	7q31.1	2011-01-11	2008-06-19		ENSG00000164603	ENSG00000164603			26475	protein-coding gene	gene with protein product	"""hypothetical protein FLJ31818"""						Standard	NM_152556		Approved	DKFZp762M126, FLJ31818	uc003vgo.1	Q1RMZ1	OTTHUMG00000155233	ENST00000297145.4:c.356A>T	7.37:g.112535741T>A	ENSP00000297145:p.Asp119Val		112322977	Q8N3D0|Q96MV7	Missense_Mutation	SNP	-	p.D119V	ENST00000297145.4	37	c.356	CCDS43634.1	7	.	.	.	.	.	.	.	.	.	.	T	21.5	4.155896	0.78114	.	.	ENSG00000164603	ENST00000297145;ENST00000432572;ENST00000358032	.	.	.	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.78685	0.4322	M	0.70275	2.135	0.80722	D	1	D;D	0.76494	0.999;0.998	D;P	0.83275	0.996;0.852	T	0.80910	-0.1171	9	0.72032	D	0.01	-14.4182	16.087	0.81065	0.0:0.0:0.0:1.0	.	66;119	B4DST1;Q1RMZ1	.;CG060_HUMAN	V	119;101;66	.	ENSP00000297145:D119V	D	-	2	0	C7orf60	112322977	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.212000	0.65225	2.202000	0.70862	0.533000	0.62120	GAT	-	NULL		0.363	C7orf60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C7orf60	protein_coding	OTTHUMT00000338923.1	T	NM_152556		112322977	-1	no_errors	NM_152556	genbank	human	validated	54_36p	missense	SNP	1	A
GPR85	54329	genome.wustl.edu	37	7	112723805	112723805	+	Silent	SNP	A	A	G			TCGA-13-1491-01A-01W-0549-09	TCGA-13-1491-10A-01W-0549-09	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fb7d1c2b-3e87-4d05-a58b-92d0e1016986	95848a3e-2292-4a0a-ace2-683e70709a56	g.chr7:112723805A>G	ENST00000297146.3	-	3	1575	c.972T>C	c.(970-972)gcT>gcC	p.A324A	GPR85_ENST00000424100.1_Silent_p.A324A|GPR85_ENST00000487573.1_5'Flank|GPR85_ENST00000501255.2_Silent_p.A324A|GPR85_ENST00000449591.1_Silent_p.A324A	NM_001146266.1	NP_001139738.1	P60893	GPR85_HUMAN	G protein-coupled receptor 85	324					signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.A324A(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	17						TCATCCAGACAGCAGCTGTTA	0.488																																																1	Substitution - coding silent(1)	ovary(1)	7											53.0	56.0	55.0					7																	112723805		2203	4300	6503	112511041	SO:0001819	synonymous_variant	54329			AF250237	CCDS5758.1	7q31	2012-08-21			ENSG00000164604	ENSG00000164604		"""GPCR / Class A : Orphans"""	4536	protein-coding gene	gene with protein product		605188				10978537, 10833454	Standard	NM_018970		Approved	SREB2	uc003vgp.1	P60893	OTTHUMG00000156933	ENST00000297146.3:c.972T>C	7.37:g.112723805A>G			112511041	Q9JHI6|Q9NPD1	Silent	SNP	-	p.A324	ENST00000297146.3	37	c.972	CCDS5758.1	7																																																																																			-	NULL		0.488	GPR85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR85	protein_coding	OTTHUMT00000346650.2	A			112511041	-1	no_errors	NM_018970	genbank	human	validated	54_36p	silent	SNP	1	G
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	SNP	C	C	A			TCGA-13-1491-01A-01W-0549-09	TCGA-13-1491-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Invalid:failed_liftOver	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fb7d1c2b-3e87-4d05-a58b-92d0e1016986	95848a3e-2292-4a0a-ace2-683e70709a56	g.chrUnknown:0C>A								None (None upstream) : None (None downstream)																								0.0																																																0			7																																								141819621	SO:0001628	intergenic_variant	0																															Unknown.37:g.0C>A			141819621		Missense_Mutation	SNP	-	p.P18T		37	c.52		7																																																																																			-	NULL	0	0					uc003vym.2			C			141819621	1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000390368	ensembl	human	known	54_36p	missense	SNP		A
DNAH11	8701	genome.wustl.edu	37	7	21906229	21906229	+	Missense_Mutation	SNP	A	A	C			TCGA-13-1491-01A-01W-0549-09	TCGA-13-1491-10A-01W-0549-09	A	A	A	C	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fb7d1c2b-3e87-4d05-a58b-92d0e1016986	95848a3e-2292-4a0a-ace2-683e70709a56	g.chr7:21906229A>C	ENST00000409508.3	+	71	11669	c.11638A>C	c.(11638-11640)Aag>Cag	p.K3880Q	DNAH11_ENST00000328843.6_Missense_Mutation_p.K3887Q	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	3887					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.K3887Q(1)		NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						TTTAATACAGAAGCTGATTCT	0.428									Kartagener syndrome																																							1	Substitution - Missense(1)	ovary(1)	7											79.0	79.0	79.0					7																	21906229		1853	4094	5947	21872754	SO:0001583	missense	8701	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.11638A>C	7.37:g.21906229A>C	ENSP00000475939:p.Lys3880Gln		21872754	Q9UJ82	Missense_Mutation	SNP	HMMPfam_Dynein_heavy;superfamily_HR1 repeat;HMMPfam_AAA_5;HMMPfam_DHC_N1;HMMPfam_DHC_N2;superfamily_Spectrin repeat;superfamily_P-loop containing nucleoside triphosphate hydrolases	p.K3887Q	ENST00000409508.3	37	c.11659		7	.	.	.	.	.	.	.	.	.	.	A	22.3	4.269777	0.80469	.	.	ENSG00000105877	ENST00000328843	T	0.11495	2.77	5.81	5.81	0.92471	Dynein heavy chain (1);	0.086087	0.85682	D	0.000000	T	0.33614	0.0869	.	.	.	0.54753	D	0.999988	D	0.76494	0.999	D	0.71870	0.975	T	0.03576	-1.1023	9	0.59425	D	0.04	.	15.8235	0.78678	1.0:0.0:0.0:0.0	.	3887	Q96DT5	DYH11_HUMAN	Q	3887	ENSP00000330671:K3887Q	ENSP00000330671:K3887Q	K	+	1	0	DNAH11	21872754	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.307000	0.96226	2.224000	0.72417	0.533000	0.62120	AAG	-	HMMPfam_Dynein_heavy		0.428	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	DNAH11	protein_coding	OTTHUMT00000326582.6	A	NM_003777		21872754	1	no_errors	ENST00000328843	ensembl	human	known	54_36p	missense	SNP	1	C
DYNC1I1	1780	genome.wustl.edu	37	7	95442612	95442612	+	Nonsense_Mutation	SNP	G	G	T			TCGA-13-1491-01A-01W-0549-09	TCGA-13-1491-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fb7d1c2b-3e87-4d05-a58b-92d0e1016986	95848a3e-2292-4a0a-ace2-683e70709a56	g.chr7:95442612G>T	ENST00000324972.6	+	4	521	c.328G>T	c.(328-330)Gga>Tga	p.G110*	DYNC1I1_ENST00000413338.1_Nonsense_Mutation_p.G93*|DYNC1I1_ENST00000537881.1_Nonsense_Mutation_p.G93*|DYNC1I1_ENST00000359388.4_Nonsense_Mutation_p.G93*|DYNC1I1_ENST00000457059.1_Nonsense_Mutation_p.G93*|DYNC1I1_ENST00000447467.2_Nonsense_Mutation_p.G93*|DYNC1I1_ENST00000437599.1_Nonsense_Mutation_p.G110*	NM_004411.4	NP_004402.1	O14576	DC1I1_HUMAN	dynein, cytoplasmic 1, intermediate chain 1	110	Interaction with DCTN1. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|metabolic process (GO:0008152)|vesicle transport along microtubule (GO:0047496)	cytoplasmic dynein complex (GO:0005868)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|kinetochore (GO:0000776)|microtubule (GO:0005874)|perinuclear region of cytoplasm (GO:0048471)|spindle pole (GO:0000922)|vesicle (GO:0031982)	microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)|spectrin binding (GO:0030507)	p.G110*(1)		NS(2)|autonomic_ganglia(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(27)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	54	all_cancers(62;9.39e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.165)|all_lung(186;0.191)		STAD - Stomach adenocarcinoma(171;0.0957)			CAGTGAAGCTGGAAGCCAAGA	0.428																																																1	Substitution - Nonsense(1)	ovary(1)	7											80.0	78.0	78.0					7																	95442612		2203	4300	6503	95280548	SO:0001587	stop_gained	1780			AF063228	CCDS5644.1, CCDS47645.1, CCDS47646.1, CCDS64718.1	7q21.3-q22.1	2013-01-18	2005-11-24	2005-11-24	ENSG00000158560	ENSG00000158560		"""Cytoplasmic dyneins"", ""WD repeat domain containing"""	2963	protein-coding gene	gene with protein product		603772	"""dynein, cytoplasmic, intermediate polypeptide 1"""	DNCI1		10049579, 16260502	Standard	NM_004411		Approved	DNCIC1	uc003uoc.4	O14576	OTTHUMG00000153983	ENST00000324972.6:c.328G>T	7.37:g.95442612G>T	ENSP00000320130:p.Gly110*		95280548	B4DME3|F5H050|G5E9K1|Q8TBF7|Q9Y2X1	Nonsense_Mutation	SNP	HMMPfam_WD40;superfamily_WD40 repeat-like	p.G110*	ENST00000324972.6	37	c.328	CCDS5644.1	7	.	.	.	.	.	.	.	.	.	.	G	35	5.559091	0.96514	.	.	ENSG00000158560	ENST00000447467;ENST00000324972;ENST00000537881;ENST00000437599;ENST00000359388;ENST00000413338;ENST00000518089;ENST00000457059	.	.	.	4.64	4.64	0.57946	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-4.2279	18.8307	0.92137	0.0:0.0:1.0:0.0	.	.	.	.	X	93;110;93;110;93;93;93;93	.	ENSP00000320130:G110X	G	+	1	0	DYNC1I1	95280548	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.577000	0.98196	2.861000	0.98227	0.655000	0.94253	GGA	-	NULL		0.428	DYNC1I1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DYNC1I1	protein_coding	OTTHUMT00000333432.1	G	NM_004411		95280548	1	no_errors	NM_004411	genbank	human	validated	54_36p	nonsense	SNP	1	T
GLOD5	392465	genome.wustl.edu	37	X	48634232	48634232	+	IGR	SNP	G	G	A			TCGA-13-1491-01A-01W-0549-09	TCGA-13-1491-10A-01W-0549-09	G	G	A	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fb7d1c2b-3e87-4d05-a58b-92d0e1016986	95848a3e-2292-4a0a-ace2-683e70709a56	g.chrX:48634232G>A	ENST00000303227.6	+	0	735				RNU6-29P_ENST00000384637.1_RNA	NM_001080489.2	NP_001073958.2	A6NK44	GLOD5_HUMAN	glyoxalase domain containing 5											endometrium(1)|lung(2)	3						CGTACTTCTAGCATGGGCTCC	0.383																																																0			X																																								48519176	SO:0001628	intergenic_variant	648603				CCDS55410.1	Xp11.23	2008-02-05			ENSG00000171433	ENSG00000171433			33358	protein-coding gene	gene with protein product							Standard	NM_001080489		Approved		uc011mmh.2	A6NK44	OTTHUMG00000024125		X.37:g.48634232G>A			48519176		RNA	SNP	-	NULL	ENST00000303227.6	37	NULL	CCDS55410.1	X																																																																																			-	-		0.383	GLOD5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC648603	protein_coding		G	NM_001080489		48519176	-1	pseudogene	XR_038238	genbank	human	model	54_36p	rna	SNP		A
TGIF2LX	90316	genome.wustl.edu	37	X	89177102	89177102	+	Silent	SNP	C	C	T	rs372625687		TCGA-13-1491-01A-01W-0549-09	TCGA-13-1491-10A-01W-0549-09	C	C	T	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fb7d1c2b-3e87-4d05-a58b-92d0e1016986	95848a3e-2292-4a0a-ace2-683e70709a56	g.chrX:89177102C>T	ENST00000561129.2	+	1	148	c.18C>T	c.(16-18)gaC>gaT	p.D6D	TGIF2LX_ENST00000283891.5_Silent_p.D6D			Q8IUE1	TF2LX_HUMAN	TGFB-induced factor homeobox 2-like, X-linked	6					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.D6D(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(29)|ovary(1)|skin(3)|urinary_tract(1)	40						CCGCTGCGGACGGCCCGGCTG	0.517																																																1	Substitution - coding silent(1)	ovary(1)	X						C		0,3832		0,0,1631,570	45.0	53.0	51.0		18	-2.4	0.0	X		51	1,6727		0,1,2427,1872	no	coding-synonymous	TGIF2LX	NM_138960.3		0,1,4058,2442	TT,TC,CC,C		0.0149,0.0,0.0095		6/242	89177102	1,10559	2201	4300	6501	89063758	SO:0001819	synonymous_variant	90316			AF497480	CCDS14459.1	Xq21.31	2014-05-14	2007-02-07		ENSG00000153779	ENSG00000153779		"""Homeoboxes / TALE class"""	18570	protein-coding gene	gene with protein product		300411	"""TGFB-induced factor 2-like, X-linked"""				Standard	NM_138960		Approved		uc004efe.3	Q8IUE1	OTTHUMG00000021954	ENST00000561129.2:c.18C>T	X.37:g.89177102C>T			89063758	Q5JRM9|Q8TD48	Silent	SNP	-	p.D6	ENST00000561129.2	37	c.18	CCDS14459.1	X																																																																																			-	NULL		0.517	TGIF2LX-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TGIF2LX	protein_coding	OTTHUMT00000417911.2	C	NM_138960		89063758	1	no_errors	NM_138960	genbank	human	reviewed	54_36p	silent	SNP		T
