#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
ANKRD35	148741	genome.wustl.edu	37	1	145562276	145562276	+	Missense_Mutation	SNP	A	A	T			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr1:145562276A>T	ENST00000355594.4	+	10	2051	c.1964A>T	c.(1963-1965)gAg>gTg	p.E655V		NM_144698.3	NP_653299.4	Q8N283	ANR35_HUMAN	ankyrin repeat domain 35	655								p.E655V(1)		NS(1)|biliary_tract(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(9)|lung(16)|ovary(4)|prostate(3)|skin(2)|urinary_tract(1)	47	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					CTGCAGCGGGAGTTTGTGCCC	0.612																																					Melanoma(9;127 754 22988 51047)											1	Substitution - Missense(1)	ovary(1)	1											42.0	45.0	44.0					1																	145562276		2203	4299	6502	144273633	SO:0001583	missense	148741			AK091120	CCDS72867.1, CCDS72868.1	1q21.1	2013-01-10			ENSG00000198483	ENSG00000198483		"""Ankyrin repeat domain containing"""	26323	protein-coding gene	gene with protein product							Standard	NM_144698		Approved	FLJ25124	uc001eob.1	Q8N283	OTTHUMG00000013743	ENST00000355594.4:c.1964A>T	1.37:g.145562276A>T	ENSP00000347802:p.Glu655Val		144273633	A6NEU0|B4DL62|Q3MJ10|Q96LS3	Missense_Mutation	SNP	-	p.E655V	ENST00000355594.4	37	c.1964	CCDS919.1	1	.	.	.	.	.	.	.	.	.	.	A	14.20	2.463552	0.43736	.	.	ENSG00000198483	ENST00000453670;ENST00000355594	T	0.70282	-0.47	4.82	4.82	0.62117	.	0.133509	0.33792	N	0.004560	T	0.68888	0.3050	M	0.65975	2.015	0.80722	D	1	D	0.54601	0.967	P	0.55260	0.772	T	0.70226	-0.4930	10	0.37606	T	0.19	-18.1667	10.6914	0.45872	1.0:0.0:0.0:0.0	.	655	Q8N283	ANR35_HUMAN	V	564;655	ENSP00000347802:E655V	ENSP00000347802:E655V	E	+	2	0	ANKRD35	144273633	1.000000	0.71417	0.834000	0.33040	0.370000	0.29829	3.238000	0.51352	2.025000	0.59659	0.460000	0.39030	GAG	-	NULL		0.612	ANKRD35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD35	protein_coding	OTTHUMT00000038515.1	A	NM_144698		144273633	1	no_errors	NM_144698	genbank	human	validated	54_36p	missense	SNP	0.51	T
PGLYRP4	57115	genome.wustl.edu	37	1	153317777	153317777	+	Missense_Mutation	SNP	G	G	A	rs201083169		TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr1:153317777G>A	ENST00000359650.5	-	4	285	c.221C>T	c.(220-222)aCg>aTg	p.T74M	PGLYRP4_ENST00000368739.3_Missense_Mutation_p.T70M|PGLYRP4_ENST00000490266.1_5'UTR	NM_020393.2	NP_065126.2	Q96LB8	PGRP4_HUMAN	peptidoglycan recognition protein 4	74					defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|growth of symbiont in host (GO:0044117)|innate immune response (GO:0045087)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of natural killer cell differentiation involved in immune response (GO:0032827)|pattern recognition receptor signaling pathway (GO:0002221)|peptidoglycan catabolic process (GO:0009253)	extracellular region (GO:0005576)|intracellular (GO:0005622)|membrane (GO:0016020)	N-acetylmuramoyl-L-alanine amidase activity (GO:0008745)|peptidoglycan binding (GO:0042834)|peptidoglycan receptor activity (GO:0016019)|zinc ion binding (GO:0008270)	p.T74M(1)		breast(2)|endometrium(1)|large_intestine(4)|lung(10)|ovary(3)|prostate(1)|skin(1)|stomach(1)	23	all_lung(78;2.81e-33)|Lung NSC(65;9.54e-32)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.171)			ATTCACTGGCGTGGTCAGCTG	0.582													G|||	1	0.000199681	0.0008	0.0	5008	,	,		20568	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	1						G	MET/THR	0,4406		0,0,2203	151.0	118.0	129.0		221	-5.8	0.0	1		129	2,8598	2.2+/-6.3	0,2,4298	yes	missense	PGLYRP4	NM_020393.2	81	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	possibly-damaging	74/374	153317777	2,13004	2203	4300	6503	151584401	SO:0001583	missense	57115			AF242518	CCDS30871.1	1q21	2008-02-05			ENSG00000163218	ENSG00000163218			30015	protein-coding gene	gene with protein product	"""peptidoglycan recognition protein I beta precursor"""	608198				11461926	Standard	XR_241090		Approved	SBBI67, PGRPIB, PGLYRPIbeta, PGRP-Ibeta	uc001fbo.3	Q96LB8	OTTHUMG00000037057	ENST00000359650.5:c.221C>T	1.37:g.153317777G>A	ENSP00000352672:p.Thr74Met		151584401	A8K838|Q3B822|Q3B823|Q5SY63|Q5SY64|Q9HD75	Missense_Mutation	SNP	-	p.T74M	ENST00000359650.5	37	c.221	CCDS30871.1	1	.	.	.	.	.	.	.	.	.	.	G	6.895	0.534566	0.13188	0.0	2.33E-4	ENSG00000163218	ENST00000368739;ENST00000359650	T;T	0.22743	1.94;1.94	3.2	-5.79	0.02354	Peptidoglycan recognition protein family domain, metazoa/bacteria (1);N-acetylmuramoyl-L-alanine amidase domain (4);	.	.	.	.	T	0.02649	0.0080	L	0.31207	0.915	0.09310	N	1	P;P	0.40431	0.669;0.717	B;B	0.24269	0.031;0.052	T	0.24728	-1.0152	9	0.46703	T	0.11	-18.6165	5.0277	0.14393	0.3656:0.3929:0.2415:0.0	.	70;74	Q96LB8-2;Q96LB8	.;PGRP4_HUMAN	M	70;74	ENSP00000357728:T70M;ENSP00000352672:T74M	ENSP00000352672:T74M	T	-	2	0	PGLYRP4	151584401	0.000000	0.05858	0.000000	0.03702	0.554000	0.35429	-3.323000	0.00512	-1.272000	0.02427	0.313000	0.20887	ACG	-	NULL		0.582	PGLYRP4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PGLYRP4	protein_coding	OTTHUMT00000089978.1	G	NM_020393		151584401	-1	no_errors	NM_020393	genbank	human	validated	54_36p	missense	SNP		A
IQGAP3	128239	genome.wustl.edu	37	1	156533015	156533015	+	Silent	SNP	G	G	A			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr1:156533015G>A	ENST00000361170.2	-	8	719	c.709C>T	c.(709-711)Ctg>Ttg	p.L237L		NM_178229.4	NP_839943.2	Q86VI3	IQGA3_HUMAN	IQ motif containing GTPase activating protein 3	237					activation of MAPK activity (GO:0000187)|cellular response to organic substance (GO:0071310)|ERK1 and ERK2 cascade (GO:0070371)|G1/S transition of mitotic cell cycle (GO:0000082)|negative regulation of gene expression (GO:0010629)|positive regulation of gene expression (GO:0010628)|positive regulation of mammary gland epithelial cell proliferation (GO:0033601)|Ras protein signal transduction (GO:0007265)|regulation of cell size (GO:0008361)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)	Ras GTPase activator activity (GO:0005099)	p.L237L(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(14)|lung(29)|ovary(5)|prostate(5)|skin(5)|urinary_tract(3)	75	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					AGATTCTCCAGAAGAGCACTG	0.582																																																1	Substitution - coding silent(1)	ovary(1)	1											81.0	81.0	81.0					1																	156533015		2203	4300	6503	154799639	SO:0001819	synonymous_variant	128239			AY253300	CCDS1144.1	1q21.3	2008-02-05			ENSG00000183856	ENSG00000183856			20669	protein-coding gene	gene with protein product							Standard	NM_178229		Approved		uc001fpf.3	Q86VI3	OTTHUMG00000033114	ENST00000361170.2:c.709C>T	1.37:g.156533015G>A			154799639	Q5T3H8	Silent	SNP	-	p.L237	ENST00000361170.2	37	c.709	CCDS1144.1	1																																																																																			-	NULL		0.582	IQGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IQGAP3	protein_coding	OTTHUMT00000080657.1	G	NM_178229		154799639	-1	no_errors	NM_178229	genbank	human	validated	54_36p	silent	SNP	1	A
SELE	6401	genome.wustl.edu	37	1	169697297	169697297	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr1:169697297C>A	ENST00000333360.7	-	8	1320	c.1181G>T	c.(1180-1182)tGt>tTt	p.C394F	SELE_ENST00000367781.4_Intron|SELE_ENST00000367779.4_Intron|SELE_ENST00000367777.1_Missense_Mutation_p.C394F|C1orf112_ENST00000498289.1_Intron|SELE_ENST00000367776.1_Intron|SELE_ENST00000367782.4_Missense_Mutation_p.C394F|SELE_ENST00000367780.4_Intron|SELE_ENST00000367774.1_Intron|SELE_ENST00000367775.1_Intron	NM_000450.2	NP_000441.2	P16581	LYAM2_HUMAN	selectin E	394	Sushi 4. {ECO:0000255|PROSITE- ProRule:PRU00302}.				actin filament-based process (GO:0030029)|activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|heterophilic cell-cell adhesion (GO:0007157)|inflammatory response (GO:0006954)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte migration involved in inflammatory response (GO:0002523)|leukocyte tethering or rolling (GO:0050901)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of receptor internalization (GO:0002092)|regulation of inflammatory response (GO:0050727)|response to interleukin-1 (GO:0070555)|response to lipopolysaccharide (GO:0032496)|response to tumor necrosis factor (GO:0034612)	caveola (GO:0005901)|coated pit (GO:0005905)|cortical cytoskeleton (GO:0030863)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	oligosaccharide binding (GO:0070492)|phospholipase binding (GO:0043274)|sialic acid binding (GO:0033691)|transmembrane signaling receptor activity (GO:0004888)	p.C394F(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(12)|ovary(3)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	32	all_hematologic(923;0.208)				Carvedilol(DB01136)	GGAGAACTCACAGCTGGACCC	0.537																																																1	Substitution - Missense(1)	ovary(1)	1											116.0	117.0	117.0					1																	169697297		2203	4300	6503	167963921	SO:0001583	missense	6401			M30640	CCDS1283.1	1q22-q25	2008-07-31	2008-07-31		ENSG00000007908	ENSG00000007908		"""CD molecules"""	10718	protein-coding gene	gene with protein product		131210	"""endothelial adhesion molecule 1"""	ELAM1, ELAM		1375831	Standard	NM_000450		Approved	ESEL, CD62E	uc001ggm.4	P16581	OTTHUMG00000034851	ENST00000333360.7:c.1181G>T	1.37:g.169697297C>A	ENSP00000331736:p.Cys394Phe		167963921	A2RRD6|P16111	Missense_Mutation	SNP	HMMPfam_Sushi;HMMPfam_Lectin_C;HMMPfam_EGF	p.C394F	ENST00000333360.7	37	c.1181	CCDS1283.1	1	.	.	.	.	.	.	.	.	.	.	C	17.38	3.375188	0.61735	.	.	ENSG00000007908	ENST00000367782;ENST00000333360;ENST00000367777	T;T;T	0.64618	-0.11;-0.11;-0.11	5.7	4.78	0.61160	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.45126	D	0.000400	D	0.83166	0.5195	H	0.97806	4.08	0.80722	D	1	D	0.76494	0.999	D	0.69824	0.966	D	0.89396	0.3692	10	0.87932	D	0	-2.8713	13.7062	0.62641	0.0:0.9247:0.0:0.0753	.	394	P16581	LYAM2_HUMAN	F	394	ENSP00000356756:C394F;ENSP00000331736:C394F;ENSP00000356751:C394F	ENSP00000331736:C394F	C	-	2	0	SELE	167963921	0.999000	0.42202	0.304000	0.25085	0.393000	0.30537	4.986000	0.63851	1.382000	0.46385	0.655000	0.94253	TGT	-	HMMPfam_Sushi		0.537	SELE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SELE	protein_coding	OTTHUMT00000084333.1	C	NM_000450		167963921	-1	no_errors	NM_000450	genbank	human	reviewed	54_36p	missense	SNP	1	A
ATP2B4	493	genome.wustl.edu	37	1	203672847	203672847	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr1:203672847G>C	ENST00000357681.5	+	8	2128	c.1005G>C	c.(1003-1005)gaG>gaC	p.E335D	ATP2B4_ENST00000341360.2_Missense_Mutation_p.E335D|ATP2B4_ENST00000367219.3_Missense_Mutation_p.E323D|ATP2B4_ENST00000391954.2_Missense_Mutation_p.E335D|ATP2B4_ENST00000367218.3_Missense_Mutation_p.E335D	NM_001684.4	NP_001675.3	P23634	AT2B4_HUMAN	ATPase, Ca++ transporting, plasma membrane 4	335					blood coagulation (GO:0007596)|calcium ion homeostasis (GO:0055074)|calcium ion import across plasma membrane (GO:0098703)|calcium ion transmembrane transport (GO:0070588)|cellular calcium ion homeostasis (GO:0006874)|cellular response to epinephrine stimulus (GO:0071872)|ion transmembrane transport (GO:0034220)|negative regulation of adrenergic receptor signaling pathway involved in heart process (GO:1901205)|negative regulation of arginine catabolic process (GO:1900082)|negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of cardiac muscle hypertrophy in response to stress (GO:1903243)|negative regulation of citrulline biosynthetic process (GO:1903249)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of nitric oxide mediated signal transduction (GO:0010751)|negative regulation of nitric-oxide synthase activity (GO:0051001)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of the force of heart contraction (GO:0098736)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to hydrostatic pressure (GO:0051599)|transmembrane transport (GO:0055085)	caveola (GO:0005901)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|nitric-oxide synthase binding (GO:0050998)|protein phosphatase 2B binding (GO:0030346)|scaffold protein binding (GO:0097110)	p.E335D(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(10)|lung(20)|ovary(2)|prostate(6)|skin(1)|stomach(1)|urinary_tract(3)	56	all_cancers(21;0.071)|all_epithelial(62;0.228)		BRCA - Breast invasive adenocarcinoma(75;0.109)			TCGACAATGAGGAAAAGGACA	0.532																																																1	Substitution - Missense(1)	ovary(1)	1											104.0	93.0	97.0					1																	203672847		2203	4300	6503	201939470	SO:0001583	missense	493			M25874	CCDS1440.1, CCDS30977.1	1q32.1	2010-04-20	2005-05-26		ENSG00000058668	ENSG00000058668	3.6.3.8	"""ATPases / P-type"""	817	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 4"""	108732	"""matrix-remodelling associated 1"""	ATP2B2, MXRA1		1674727	Standard	NM_001001396		Approved	PMCA4	uc001gzw.3	P23634	OTTHUMG00000035906	ENST00000357681.5:c.1005G>C	1.37:g.203672847G>C	ENSP00000350310:p.Glu335Asp		201939470	B1APW5|B1APW6|Q13450|Q13452|Q13455|Q16817|Q7Z3S1	Missense_Mutation	SNP	HMMPfam_Cation_ATPase_N;HMMPfam_Hydrolase;HMMPfam_Cation_ATPase_C;HMMPfam_E1-E2_ATPase;superfamily_HAD-like;superfamily_Calcium ATPase transduction domain A;superfamily_Metal cation-transporting ATPase ATP-binding domain N;superfamily_Calcium ATPase transmembrane domain M	p.E335D	ENST00000357681.5	37	c.1005	CCDS1440.1	1	.	.	.	.	.	.	.	.	.	.	G	10.47	1.359224	0.24598	.	.	ENSG00000058668	ENST00000357681;ENST00000367218;ENST00000367219;ENST00000391954;ENST00000341360	D;D;D;D;D	0.93133	-3.16;-3.16;-3.17;-3.15;-3.16	6.07	3.11	0.35812	ATPase, P-type, ATPase-associated domain (1);	0.242147	0.29653	N	0.011556	D	0.90587	0.7049	N	0.16790	0.44	0.50632	D	0.999884	D;B;D	0.69078	0.997;0.008;0.992	D;B;D	0.79108	0.992;0.015;0.987	D	0.85246	0.1041	10	0.12430	T	0.62	-38.0672	6.4188	0.21732	0.2143:0.1327:0.6529:0.0	.	335;335;335	P23634;P23634-6;B1APW5	AT2B4_HUMAN;.;.	D	335;335;323;335;335	ENSP00000350310:E335D;ENSP00000356187:E335D;ENSP00000356188:E323D;ENSP00000375816:E335D;ENSP00000340930:E335D	ENSP00000340930:E335D	E	+	3	2	ATP2B4	201939470	1.000000	0.71417	0.990000	0.47175	0.355000	0.29361	1.218000	0.32467	0.856000	0.35383	0.655000	0.94253	GAG	-	HMMPfam_E1-E2_ATPase		0.532	ATP2B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP2B4	protein_coding	OTTHUMT00000087462.1	G	NM_001001396		201939470	1	no_errors	NM_001684	genbank	human	reviewed	54_36p	missense	SNP	1	C
KCNH1	3756	genome.wustl.edu	37	1	210977424	210977424	+	Missense_Mutation	SNP	A	A	G			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr1:210977424A>G	ENST00000271751.4	-	8	1574	c.1547T>C	c.(1546-1548)cTc>cCc	p.L516P	KCNH1_ENST00000367007.4_Missense_Mutation_p.L489P			O95259	KCNH1_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 1	516					myoblast fusion (GO:0007520)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|phosphorelay sensor kinase activity (GO:0000155)	p.L516P(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(13)|lung(35)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	68				OV - Ovarian serous cystadenocarcinoma(81;0.0109)|all cancers(67;0.141)|Epithelial(68;0.185)		AACACTGTTGAGCATCTCATG	0.478																																																1	Substitution - Missense(1)	ovary(1)	1											161.0	147.0	152.0					1																	210977424		2203	4300	6503	209044047	SO:0001583	missense	3756			AJ001366	CCDS1496.1, CCDS31015.1	1q32.2	2012-07-05			ENSG00000143473	ENSG00000143473		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6250	protein-coding gene	gene with protein product		603305				9738473, 16382104	Standard	NM_172362		Approved	Kv10.1, eag, h-eag, eag1	uc001hib.2	O95259	OTTHUMG00000036309	ENST00000271751.4:c.1547T>C	1.37:g.210977424A>G	ENSP00000271751:p.Leu516Pro		209044047	B1AQ26|O76035|Q14CL3	Missense_Mutation	SNP	-	p.L516P	ENST00000271751.4	37	c.1547	CCDS1496.1	1	.	.	.	.	.	.	.	.	.	.	A	23.4	4.414958	0.83449	.	.	ENSG00000143473	ENST00000271751;ENST00000367007	D;D	0.97256	-4.31;-4.31	5.6	5.6	0.85130	Cyclic nucleotide-binding-like (1);	0.060386	0.64402	D	0.000003	D	0.98226	0.9413	M	0.78801	2.425	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.69824	0.966;0.954	D	0.99323	1.0907	10	0.87932	D	0	.	15.7772	0.78232	1.0:0.0:0.0:0.0	.	489;516	Q14CL3;O95259	.;KCNH1_HUMAN	P	516;489	ENSP00000271751:L516P;ENSP00000355974:L489P	ENSP00000271751:L516P	L	-	2	0	KCNH1	209044047	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	8.982000	0.93471	2.137000	0.66172	0.418000	0.28097	CTC	-	NULL		0.478	KCNH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNH1	protein_coding	OTTHUMT00000088332.1	A	NM_002238		209044047	-1	no_errors	NM_172362	genbank	human	reviewed	54_36p	missense	SNP	1	G
GNPAT	8443	genome.wustl.edu	37	1	231408063	231408063	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr1:231408063G>T	ENST00000366647.4	+	11	1697	c.1528G>T	c.(1528-1530)Gtc>Ttc	p.V510F	GNPAT_ENST00000366646.3_Missense_Mutation_p.V449F	NM_014236.3	NP_055051.1	O15228	GNPAT_HUMAN	glyceronephosphate O-acyltransferase	510					cellular lipid metabolic process (GO:0044255)|cerebellum morphogenesis (GO:0021587)|ether lipid biosynthetic process (GO:0008611)|glycerophospholipid biosynthetic process (GO:0046474)|membrane organization (GO:0061024)|paranodal junction assembly (GO:0030913)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|response to drug (GO:0042493)|response to fatty acid (GO:0070542)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)|synapse assembly (GO:0007416)	membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	glycerone-phosphate O-acyltransferase activity (GO:0016287)|palmitoyl-CoA hydrolase activity (GO:0016290)|receptor binding (GO:0005102)	p.V510F(1)		breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(3)|prostate(1)|skin(1)	23	Breast(184;0.0871)	all_cancers(173;0.2)|Prostate(94;0.183)				TCCAGAGGATGTCTACAGTTG	0.373																																																1	Substitution - Missense(1)	ovary(1)	1											304.0	290.0	294.0					1																	231408063		2203	4300	6503	229474686	SO:0001583	missense	8443			AF043937	CCDS1592.1	1q42	2008-02-05			ENSG00000116906	ENSG00000116906	2.3.1.42		4416	protein-coding gene	gene with protein product		602744				9459311, 9536089	Standard	NM_014236		Approved	DHAPAT, DAPAT, DAP-AT	uc001hup.4	O15228	OTTHUMG00000038024	ENST00000366647.4:c.1528G>T	1.37:g.231408063G>T	ENSP00000355607:p.Val510Phe		229474686	B4DNM9|Q5TBH7|Q9BWC2	Missense_Mutation	SNP	HMMPfam_Acyltransferase,superfamily_Glycerol-3-phosphate (1)-acyltransferase	p.V510F	ENST00000366647.4	37	c.1528	CCDS1592.1	1	.	.	.	.	.	.	.	.	.	.	G	17.82	3.482918	0.63962	.	.	ENSG00000116906	ENST00000366647;ENST00000366646;ENST00000416000	T;T;T	0.67698	-0.19;-0.19;-0.28	4.71	2.83	0.33086	.	0.205916	0.42964	D	0.000640	T	0.61085	0.2319	L	0.50333	1.59	0.53688	D	0.999979	P;P	0.48503	0.911;0.823	P;B	0.45829	0.494;0.359	T	0.64175	-0.6469	10	0.87932	D	0	.	7.9026	0.29744	0.3087:0.0:0.6913:0.0	.	449;510	B4DNM9;O15228	.;GNPAT_HUMAN	F	510;449;500	ENSP00000355607:V510F;ENSP00000355606:V449F;ENSP00000411640:V500F	ENSP00000355606:V449F	V	+	1	0	GNPAT	229474686	0.999000	0.42202	1.000000	0.80357	0.969000	0.65631	1.325000	0.33724	1.339000	0.45563	0.563000	0.77884	GTC	-	NULL		0.373	GNPAT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GNPAT	protein_coding	OTTHUMT00000092871.1	G			229474686	1	no_errors	NM_014236	genbank	human	reviewed	54_36p	missense	SNP	0.998	T
MDS2	259283	genome.wustl.edu	37	1	23965740	23965740	+	Splice_Site	SNP	A	A	G			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr1:23965740A>G	ENST00000374555.3	+	5	732	c.145A>G	c.(145-147)Agc>Ggc	p.S49G	MDS2_ENST00000477916.1_Intron			Q8NDY4	MDS2_HUMAN	myelodysplastic syndrome 2 translocation associated	49						extracellular space (GO:0005615)		p.S49G(1)		breast(1)|ovary(2)	3						GCAAAGGCTGAGGTGACTGCC	0.433			T	ETV6	MDS																																		Dom	yes		1	1p36	259283	myelodysplastic syndrome 2		L	1	Substitution - Missense(1)	ovary(1)	1											38.0	32.0	34.0					1																	23965740		876	1991	2867	23838327	SO:0001630	splice_region_variant	259283			AJ310434		1p36	2008-02-05			ENSG00000197880	ENSG00000197880			29633	protein-coding gene	gene with protein product		607305				12203785	Standard	NR_027042		Approved		uc001bhi.3	Q8NDY4	OTTHUMG00000002927	ENST00000374555.3:c.146+1A>G	1.37:g.23965740A>G			23838327		Missense_Mutation	SNP	-	p.S49G	ENST00000374555.3	37	c.145		1	.	.	.	.	.	.	.	.	.	.	A	4.497	0.092237	0.08632	.	.	ENSG00000197880	ENST00000374555	.	.	.	1.99	-0.586	0.11694	.	.	.	.	.	T	0.29093	0.0723	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.35871	-0.9771	5	0.87932	D	0	.	1.5152	0.02504	0.4757:0.0:0.219:0.3053	.	.	.	.	G	49	.	ENSP00000363683:S49G	S	+	1	0	MDS2	23838327	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-0.153000	0.10144	-0.162000	0.10964	0.379000	0.24179	AGC	-	NULL		0.433	MDS2-001	KNOWN	basic|appris_principal	protein_coding	MDS2	protein_coding	OTTHUMT00000008172.1	A	NM_148895	Missense_Mutation	23838327	1	no_errors	ENST00000374555	ensembl	human	known	54_36p	missense	SNP		G
ACTN2	88	genome.wustl.edu	37	1	236906308	236906308	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr1:236906308G>T	ENST00000366578.4	+	11	1386	c.1220G>T	c.(1219-1221)aGg>aTg	p.R407M	ACTN2_ENST00000542672.1_Missense_Mutation_p.R407M|ACTN2_ENST00000492634.1_3'UTR|ACTN2_ENST00000546208.1_5'UTR	NM_001103.2|NM_001278343.1	NP_001094.1|NP_001265272.1	P35609	ACTN2_HUMAN	actinin, alpha 2	407					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|focal adhesion assembly (GO:0048041)|microspike assembly (GO:0030035)|muscle filament sliding (GO:0030049)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of protein localization to cell surface (GO:2000009)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein homotetramerization (GO:0051289)|regulation of apoptotic process (GO:0042981)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	actin filament (GO:0005884)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|platelet alpha granule lumen (GO:0031093)|pseudopodium (GO:0031143)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|cytoskeletal protein binding (GO:0008092)|FATZ binding (GO:0051373)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|ion channel binding (GO:0044325)|protein dimerization activity (GO:0046983)|structural constituent of muscle (GO:0008307)|thyroid hormone receptor coactivator activity (GO:0030375)|titin binding (GO:0031432)|titin Z domain binding (GO:0070080)	p.R407M(1)		endometrium(4)|kidney(2)|large_intestine(15)|lung(55)|ovary(4)|prostate(3)|skin(3)	86	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.00661)|Acute lymphoblastic leukemia(190;0.109)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00168)			GAGAAGTTCAGGCAGAAGGCC	0.532																																																1	Substitution - Missense(1)	ovary(1)	1											105.0	97.0	100.0					1																	236906308		2203	4300	6503	234972931	SO:0001583	missense	88			BC047901	CCDS1613.1, CCDS60455.1, CCDS73053.1	1q42-q43	2014-09-17			ENSG00000077522	ENSG00000077522		"""EF-hand domain containing"""	164	protein-coding gene	gene with protein product		102573				1339456	Standard	NM_001103		Approved		uc001hyf.2	P35609	OTTHUMG00000040059	ENST00000366578.4:c.1220G>T	1.37:g.236906308G>T	ENSP00000355537:p.Arg407Met		234972931	B1ANE4|B2RCS5|Q86TF4|Q86TI8	Missense_Mutation	SNP	-	p.R407M	ENST00000366578.4	37	c.1220	CCDS1613.1	1	.	.	.	.	.	.	.	.	.	.	G	16.71	3.197663	0.58126	.	.	ENSG00000077522	ENST00000542672;ENST00000366578;ENST00000545611	T;T	0.51071	0.72;0.72	5.47	2.55	0.30701	.	0.618137	0.16636	N	0.205861	T	0.57695	0.2071	M	0.73217	2.22	0.80722	D	1	B;P;P;P	0.39424	0.179;0.673;0.596;0.522	P;P;P;B	0.49953	0.46;0.627;0.623;0.302	T	0.60611	-0.7229	10	0.87932	D	0	.	10.5258	0.44948	0.2111:0.0:0.7889:0.0	.	192;407;177;407	B7Z4K1;B2RCS5;Q59FD9;P35609	.;.;.;ACTN2_HUMAN	M	407;407;176	ENSP00000443495:R407M;ENSP00000355537:R407M	ENSP00000355537:R407M	R	+	2	0	ACTN2	234972931	0.732000	0.28121	0.829000	0.32907	0.416000	0.31233	1.216000	0.32443	0.778000	0.33520	0.655000	0.94253	AGG	-	NULL		0.532	ACTN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ACTN2	protein_coding	OTTHUMT00000096628.1	G	NM_001103		234972931	1	no_errors	NM_001103	genbank	human	reviewed	54_36p	missense	SNP	0.78	T
SPOCD1	90853	genome.wustl.edu	37	1	32256846	32256846	+	Silent	SNP	C	C	T			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr1:32256846C>T	ENST00000360482.2	-	16	3138	c.3009G>A	c.(3007-3009)gaG>gaA	p.E1003E	RP11-84A19.3_ENST00000527035.1_RNA|SPOCD1_ENST00000373648.2_3'UTR|SPOCD1_ENST00000257100.3_Silent_p.E483E|SPOCD1_ENST00000533231.1_Silent_p.E990E	NM_144569.4	NP_653170.3	Q6ZMY3	SPOC1_HUMAN	SPOC domain containing 1	1003					negative regulation of phosphatase activity (GO:0010923)|transcription, DNA-templated (GO:0006351)			p.E1003E(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|liver(1)|lung(7)|ovary(6)|prostate(1)|skin(3)|stomach(1)|urinary_tract(2)	37		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)|Ovarian(437;0.199)		STAD - Stomach adenocarcinoma(196;0.18)		AGTGAGTGACCTCCAGACCTG	0.582																																																1	Substitution - coding silent(1)	ovary(1)	1											27.0	31.0	30.0					1																	32256846		2203	4300	6503	32029433	SO:0001819	synonymous_variant	90853			AK058077	CCDS347.1, CCDS60066.1, CCDS72748.1	1p35.1	2014-06-13			ENSG00000134668	ENSG00000134668			26338	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 146"""					12477932	Standard	NM_144569		Approved	FLJ25348, PPP1R146	uc001bts.1	Q6ZMY3	OTTHUMG00000003879	ENST00000360482.2:c.3009G>A	1.37:g.32256846C>T			32029433	Q24JU3|Q6PI90|Q8N869|Q8N8U0|Q8NBC6|Q96LN6	Missense_Mutation	SNP	-	p.R288K	ENST00000360482.2	37	c.863	CCDS347.1	1	.	.	.	.	.	.	.	.	.	.	C	4.496	0.092028	0.08632	.	.	ENSG00000134668	ENST00000294514	.	.	.	4.88	-0.615	0.11587	.	.	.	.	.	T	0.31482	0.0798	.	.	.	0.44254	D	0.997108	.	.	.	.	.	.	T	0.08310	-1.0728	5	0.11794	T	0.64	-10.9109	3.6313	0.08133	0.1584:0.279:0.0:0.5626	.	.	.	.	K	288	.	ENSP00000294514:R288K	R	-	2	0	SPOCD1	32029433	0.269000	0.24143	0.085000	0.20634	0.424000	0.31475	0.217000	0.17603	-0.154000	0.11118	-0.290000	0.09829	AGG	-	NULL		0.582	SPOCD1-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPOCD1	protein_coding	OTTHUMT00000381912.1	C	NM_144569		32029433	-1	no_start_codon	ENST00000294514	ensembl	human	known	54_36p	missense	SNP	0.86	T
WDR78	79819	genome.wustl.edu	37	1	67359088	67359088	+	Missense_Mutation	SNP	G	G	T	rs201621125		TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr1:67359088G>T	ENST00000371026.3	-	3	409	c.354C>A	c.(352-354)gaC>gaA	p.D118E	WDR78_ENST00000431318.1_5'UTR|WDR78_ENST00000371023.3_Missense_Mutation_p.D118E|WDR78_ENST00000371022.3_Missense_Mutation_p.D118E	NM_024763.4	NP_079039.4	Q5VTH9	WDR78_HUMAN	WD repeat domain 78	118					hematopoietic progenitor cell differentiation (GO:0002244)			p.D118E(1)		NS(1)|endometrium(3)|kidney(6)|large_intestine(6)|lung(10)|ovary(3)|skin(3)	32						TTCCATTTATGTCAAATACCT	0.343																																																1	Substitution - Missense(1)	ovary(1)	1											115.0	111.0	113.0					1																	67359088		2203	4300	6503	67131676	SO:0001583	missense	79819			BX648840	CCDS635.1, CCDS44157.1	1p31.2	2014-02-21	2013-02-19	2013-02-19	ENSG00000152763	ENSG00000152763		"""WD repeat domain containing"""	26252	protein-coding gene	gene with protein product						21953912	Standard	NM_207014		Approved	DIC4, FLJ23129	uc001dcx.3	Q5VTH9	OTTHUMG00000009165	ENST00000371026.3:c.354C>A	1.37:g.67359088G>T	ENSP00000360065:p.Asp118Glu		67131676	A8K9W5|B5MDT3|H7BY80|Q5VTI0|Q8N5G5|Q9H5R9|Q9UF44	Missense_Mutation	SNP	-	p.D118E	ENST00000371026.3	37	c.354	CCDS635.1	1	.	.	.	.	.	.	.	.	.	.	G	15.85	2.954038	0.53293	.	.	ENSG00000152763	ENST00000371026;ENST00000371023;ENST00000371022	T;T;T	0.81078	-1.45;-0.02;-0.56	5.17	2.84	0.33178	.	0.047632	0.85682	D	0.000000	T	0.74711	0.3752	M	0.69823	2.125	0.24548	N	0.994039	D;D;D	0.63880	0.971;0.993;0.993	P;P;P	0.53809	0.721;0.735;0.735	T	0.67825	-0.5570	10	0.72032	D	0.01	-28.5313	6.7204	0.23327	0.7935:0.0:0.2065:0.0	.	118;118;118	Q5TAD8;A0AVI9;Q5VTH9	.;.;WDR78_HUMAN	E	118	ENSP00000360065:D118E;ENSP00000360062:D118E;ENSP00000360061:D118E	ENSP00000360061:D118E	D	-	3	2	WDR78	67131676	0.826000	0.29277	0.057000	0.19452	0.001000	0.01503	1.470000	0.35354	0.924000	0.37069	-0.312000	0.09012	GAC	-	NULL		0.343	WDR78-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR78	protein_coding	OTTHUMT00000025404.1	G	NM_024763		67131676	-1	no_errors	NM_024763	genbank	human	validated	54_36p	missense	SNP	0.008	T
LRRC7	57554	genome.wustl.edu	37	1	70144129	70144129	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr1:70144129G>T	ENST00000370958.1	+	2	258	c.68G>T	c.(67-69)cGt>cTt	p.R23L	LRRC7_ENST00000310961.5_5'UTR			Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	0						cell junction (GO:0030054)|cytoplasm (GO:0005737)|postsynaptic membrane (GO:0045211)		p.R23L(1)		breast(11)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(3)|lung(81)|ovary(9)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	162						AAAGAGGTTCGTGCAGCACTT	0.403																																																1	Substitution - Missense(1)	ovary(1)	1											25.0	23.0	23.0					1																	70144129		876	1991	2867	69916717	SO:0001583	missense	57554				CCDS645.1	1p31.1	2008-02-05			ENSG00000033122	ENSG00000033122			18531	protein-coding gene	gene with protein product		614453				12525888	Standard	NM_020794		Approved	KIAA1365, densin-180	uc001dep.3	Q96NW7	OTTHUMG00000059194	ENST00000370958.1:c.68G>T	1.37:g.70144129G>T	ENSP00000359997:p.Arg23Leu		69916717	Q5VXC2|Q5VXC3|Q68D07|Q86VE8|Q8WX20|Q9P2I2	Missense_Mutation	SNP	-	p.R23L	ENST00000370958.1	37	c.68		1	.	.	.	.	.	.	.	.	.	.	G	14.84	2.656861	0.47467	.	.	ENSG00000033122	ENST00000370958	T	0.38722	1.12	5.92	5.92	0.95590	.	.	.	.	.	T	0.10723	0.0262	.	.	.	0.80722	D	1	B	0.24823	0.112	B	0.22880	0.042	T	0.07809	-1.0753	8	0.02654	T	1	.	15.8069	0.78520	0.0:0.0:1.0:0.0	.	23	B1AKT2	.	L	23	ENSP00000359997:R23L	ENSP00000359997:R23L	R	+	2	0	LRRC7	69916717	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	4.489000	0.60309	2.803000	0.96430	0.591000	0.81541	CGT	-	NULL		0.403	LRRC7-003	KNOWN	basic	protein_coding	LRRC7	protein_coding	OTTHUMT00000131263.1	G	NM_020794		69916717	1	no_errors	ENST00000370958	ensembl	human	known	54_36p	missense	SNP	0.99	T
OR2G6	391211	genome.wustl.edu	37	1	248685525	248685525	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr1:248685525C>T	ENST00000343414.4	+	1	610	c.578C>T	c.(577-579)aCt>aTt	p.T193I		NM_001013355.1	NP_001013373.1	Q5TZ20	OR2G6_HUMAN	olfactory receptor, family 2, subfamily G, member 6	193						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T193I(1)		NS(1)|cervix(1)|endometrium(2)|large_intestine(7)|lung(40)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	61	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0156)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GTGGATACGACTTTCAACGAG	0.488																																																1	Substitution - Missense(1)	ovary(1)	1											123.0	125.0	124.0					1																	248685525		2203	4300	6503	246752148	SO:0001583	missense	391211				CCDS31119.1	1q44	2012-08-09			ENSG00000188558	ENSG00000188558		"""GPCR / Class A : Olfactory receptors"""	27019	protein-coding gene	gene with protein product							Standard	NM_001013355		Approved		uc001ien.1	Q5TZ20	OTTHUMG00000040462	ENST00000343414.4:c.578C>T	1.37:g.248685525C>T	ENSP00000341291:p.Thr193Ile		246752148	B2RP33	Missense_Mutation	SNP	-	p.T193I	ENST00000343414.4	37	c.578	CCDS31119.1	1	.	.	.	.	.	.	.	.	.	.	N	4.487	0.090235	0.08632	.	.	ENSG00000188558	ENST00000343414	T	0.00091	8.74	3.35	2.42	0.29668	GPCR, rhodopsin-like superfamily (1);	0.307943	0.23139	U	0.051494	T	0.00178	0.0005	L	0.60904	1.88	0.09310	N	1	B	0.27625	0.183	B	0.35727	0.209	T	0.17868	-1.0355	10	0.52906	T	0.07	.	6.1231	0.20164	0.2165:0.5729:0.2105:0.0	.	193	Q5TZ20	OR2G6_HUMAN	I	193	ENSP00000341291:T193I	ENSP00000341291:T193I	T	+	2	0	OR2G6	246752148	0.000000	0.05858	0.011000	0.14972	0.185000	0.23345	-2.044000	0.01411	0.723000	0.32274	0.400000	0.26472	ACT	-	NULL		0.488	OR2G6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2G6	protein_coding	OTTHUMT00000097358.1	C	XM_372842		246752148	1	no_errors	NM_001013355	genbank	human	validated	54_36p	missense	SNP		T
XPNPEP1	7511	genome.wustl.edu	37	10	111630639	111630639	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	G	G	C	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr10:111630639G>C	ENST00000502935.1	-	18	1665	c.1546C>G	c.(1546-1548)Cgt>Ggt	p.R516G	XPNPEP1_ENST00000369683.1_Missense_Mutation_p.R402G|XPNPEP1_ENST00000369680.4_Missense_Mutation_p.R473G|U4_ENST00000607255.1_RNA|XPNPEP1_ENST00000322238.8_Missense_Mutation_p.R492G					X-prolyl aminopeptidase (aminopeptidase P) 1, soluble									p.R516S(1)|p.R473S(1)|p.R473G(1)		endometrium(2)|kidney(9)|large_intestine(4)|lung(9)|ovary(3)|pancreas(2)|skin(1)|urinary_tract(1)	31		Breast(234;0.174)		Epithelial(162;1.64e-05)|all cancers(201;0.000564)|BRCA - Breast invasive adenocarcinoma(275;0.0721)		AAAGCTGAACGGGCAAAGGAG	0.433																																																3	Substitution - Missense(3)	lung(2)|ovary(1)	10											88.0	84.0	85.0					10																	111630639		2203	4300	6503	111620629	SO:0001583	missense	7511				CCDS7560.1, CCDS7560.2, CCDS53576.1	10q25.3	2006-01-16	2002-07-17		ENSG00000108039	ENSG00000108039	3.4.11.9		12822	protein-coding gene	gene with protein product		602443	"""X-prolyl aminopeptidase (aminopeptidase P)-like"""	XPNPEP, XPNPEPL1, XPNPEPL			Standard	NM_020383		Approved		uc001kyp.2	Q9NQW7	OTTHUMG00000019029	ENST00000502935.1:c.1546C>G	10.37:g.111630639G>C	ENSP00000421566:p.Arg516Gly		111620629		Missense_Mutation	SNP	-	p.R473G	ENST00000502935.1	37	c.1417	CCDS7560.2	10	.	.	.	.	.	.	.	.	.	.	G	27.3	4.819565	0.90873	.	.	ENSG00000108039	ENST00000502935;ENST00000369683;ENST00000322238;ENST00000369680	T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19	5.65	5.65	0.86999	Peptidase M24, structural domain (3);	0.000000	0.85682	D	0.000000	D	0.94673	0.8282	H	0.99966	5.095	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97317	0.9941	10	0.87932	D	0	-12.8813	17.9059	0.88918	0.0:0.0:1.0:0.0	.	516;473	G5E9Y2;Q9NQW7	.;XPP1_HUMAN	G	516;402;492;473	ENSP00000421566:R516G;ENSP00000358697:R402G;ENSP00000324011:R492G;ENSP00000358694:R473G	ENSP00000324011:R492G	R	-	1	0	XPNPEP1	111620629	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	9.270000	0.95690	2.673000	0.90976	0.585000	0.79938	CGT	-	NULL		0.433	XPNPEP1-015	KNOWN	basic|CCDS	protein_coding	XPNPEP1	protein_coding	OTTHUMT00000050264.2	G			111620629	-1	no_errors	NM_020383	genbank	human	provisional	54_36p	missense	SNP	1	C
ATRNL1	26033	genome.wustl.edu	37	10	116889146	116889146	+	Silent	SNP	T	T	C			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr10:116889146T>C	ENST00000355044.3	+	5	804	c.678T>C	c.(676-678)tcT>tcC	p.S226S	ATRNL1_ENST00000527407.1_Silent_p.S226S|ATRNL1_ENST00000529665.1_3'UTR	NM_207303.2	NP_997186.1	Q5VV63	ATRN1_HUMAN	attractin-like 1	226	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.				G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)	p.S226S(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(11)|liver(2)|lung(44)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)		CTAGTGTCTCTGTTCCAAGTC	0.363																																																1	Substitution - coding silent(1)	ovary(1)	10											155.0	144.0	148.0					10																	116889146		2203	4300	6503	116879136	SO:0001819	synonymous_variant	26033			AB011106	CCDS7592.1, CCDS73204.1	10q26	2004-03-04			ENSG00000107518	ENSG00000107518			29063	protein-coding gene	gene with protein product		612869				9628581	Standard	NM_001276282		Approved	KIAA0534, FLJ45344, ALP	uc001lcg.3	Q5VV63	OTTHUMG00000019096	ENST00000355044.3:c.678T>C	10.37:g.116889146T>C			116879136	O60283|Q5JSE8|Q5T5Y9|Q6T256|Q6ZSN4|Q86WX2	Silent	SNP	HMMPfam_CUB;superfamily_Spermadhesin CUB domain;HMMPfam_Lectin_C;HMMPfam_Laminin_EGF;HMMPfam_PSI;HMMPfam_EGF;HMMPfam_Kelch_1;superfamily_Galactose oxidase central domain;HMMPfam_Kelch_2;HMMPfam_EGF_2;superfamily_Plexin repeat;superfamily_C-type lectin-like;superfamily_EGF/Laminin	p.S226	ENST00000355044.3	37	c.678	CCDS7592.1	10																																																																																			-	NULL		0.363	ATRNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATRNL1	protein_coding	OTTHUMT00000050507.3	T	XM_049349		116879136	1	no_errors	NM_207303	genbank	human	validated	54_36p	silent	SNP	0.1	C
PALD1	27143	genome.wustl.edu	37	10	72298071	72298071	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr10:72298071G>T	ENST00000263563.6	+	12	1627	c.1359G>T	c.(1357-1359)tgG>tgT	p.W453C		NM_014431.2	NP_055246.2	Q9ULE6	PALD_HUMAN	phosphatase domain containing, paladin 1	453						cytosol (GO:0005829)		p.W453C(1)									TCAGCCGCTGGCTGTGTGCCC	0.662																																																1	Substitution - Missense(1)	ovary(1)	10											56.0	46.0	49.0					10																	72298071		2203	4300	6503	71968077	SO:0001583	missense	27143			AB033100	CCDS31215.1	10q22.2	2012-07-17	2012-07-17	2012-07-17	ENSG00000107719	ENSG00000107719			23530	protein-coding gene	gene with protein product		614656	"""paladin"", ""KIAA1274"""	PALD, KIAA1274			Standard	NM_014431		Approved		uc001jrd.4	Q9ULE6	OTTHUMG00000018411	ENST00000263563.6:c.1359G>T	10.37:g.72298071G>T	ENSP00000263563:p.Trp453Cys		71968077	B2RMS1|B9EGC6|Q5JTK7|Q5JTK8	Missense_Mutation	SNP	superfamily_(Phosphotyrosine protein) phosphatases II	p.W453C	ENST00000263563.6	37	c.1359	CCDS31215.1	10	.	.	.	.	.	.	.	.	.	.	g	20.9	4.071585	0.76301	.	.	ENSG00000107719	ENST00000263563;ENST00000373214	T	0.31510	1.49	4.31	4.31	0.51392	.	0.000000	0.85682	D	0.000000	T	0.61451	0.2348	M	0.86953	2.85	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.70956	-0.4731	10	0.87932	D	0	-19.0291	16.5809	0.84714	0.0:0.0:1.0:0.0	.	453	Q9ULE6	PALD_HUMAN	C	453	ENSP00000263563:W453C	ENSP00000263563:W453C	W	+	3	0	KIAA1274	71968077	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.658000	0.74407	2.221000	0.72209	0.561000	0.74099	TGG	-	NULL		0.662	PALD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1274	protein_coding	OTTHUMT00000048515.2	G	NM_014431		71968077	1	no_errors	NM_014431	genbank	human	validated	54_36p	missense	SNP	1	T
TACC2	10579	genome.wustl.edu	37	10	123842315	123842315	+	Silent	SNP	G	G	A	rs373182521		TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr10:123842315G>A	ENST00000369005.1	+	4	640	c.300G>A	c.(298-300)ccG>ccA	p.P100P	TACC2_ENST00000515603.1_Silent_p.P100P|TACC2_ENST00000453444.2_Silent_p.P100P|TACC2_ENST00000358010.1_Intron|TACC2_ENST00000513429.1_Intron|TACC2_ENST00000515273.1_Silent_p.P100P|TACC2_ENST00000334433.3_Silent_p.P100P	NM_206862.2	NP_996744.2	O95359	TACC2_HUMAN	transforming, acidic coiled-coil containing protein 2	100					astral microtubule organization (GO:0030953)|cerebral cortex development (GO:0021987)|interkinetic nuclear migration (GO:0022027)|neurogenesis (GO:0022008)|regulation of microtubule-based process (GO:0032886)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	nuclear hormone receptor binding (GO:0035257)	p.P100P(1)		NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(15)|lung(27)|ovary(6)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	83		all_neural(114;0.0656)|Lung NSC(174;0.136)|all_lung(145;0.17)|Breast(234;0.197)				GCCCACCACCGTCCCAGGAGC	0.642																																																1	Substitution - coding silent(1)	ovary(1)	10						G	,	1,4405	2.1+/-5.4	0,1,2202	71.0	72.0	72.0		,300	-4.6	0.0	10		72	0,8600		0,0,4300	no	intron,coding-synonymous	TACC2	NM_206861.1,NM_206862.2	,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,	,100/2949	123842315	1,13005	2203	4300	6503	123832305	SO:0001819	synonymous_variant	10579			AF095791	CCDS7625.1, CCDS7626.1, CCDS7627.1, CCDS7628.1	10q26	2008-07-29			ENSG00000138162	ENSG00000138162			11523	protein-coding gene	gene with protein product		605302				14767476	Standard	XM_005269388		Approved	AZU-1	uc001lfv.3	O95359	OTTHUMG00000019181	ENST00000369005.1:c.300G>A	10.37:g.123842315G>A			123832305	Q4VXL0|Q4VXL3|Q4VXL6|Q4VXL7|Q5U5T7|Q86WG6|Q86WG7|Q8TCK9|Q9BVQ1|Q9NZ41|Q9NZR5	Silent	SNP	HMMPfam_TACC	p.P100	ENST00000369005.1	37	c.300	CCDS7626.1	10	.	.	.	.	.	.	.	.	.	.	G	4.262	0.047626	0.08243	2.27E-4	0.0	ENSG00000138162	ENST00000491540	.	.	.	5.23	-4.62	0.03370	.	.	.	.	.	T	0.27524	0.0676	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.27331	-1.0077	4	.	.	.	3.322	7.2034	0.25893	0.2863:0.2916:0.4221:0.0	.	.	.	.	I	114	.	.	V	+	1	0	TACC2	123832305	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.136000	0.10405	-1.759000	0.01313	-2.802000	0.00113	GTC	-	NULL		0.642	TACC2-001	KNOWN	basic|CCDS	protein_coding	TACC2	protein_coding	OTTHUMT00000090004.1	G			123832305	1	no_errors	NM_206862	genbank	human	reviewed	54_36p	silent	SNP		A
KBTBD3	143879	genome.wustl.edu	37	11	105929663	105929663	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr11:105929663G>T	ENST00000531482.2	-	1	175	c.162C>A	c.(160-162)ttC>ttA	p.F54L	KBTBD3_ENST00000526793.1_Missense_Mutation_p.F54L|KBTBD3_ENST00000534815.1_Intron|KBTBD3_ENST00000531837.1_Missense_Mutation_p.F54L			Q8NAB2	KBTB3_HUMAN	kelch repeat and BTB (POZ) domain containing 3	50	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.							p.F54L(2)		NS(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(9)|lung(6)|ovary(1)|prostate(1)	25		Melanoma(852;0.000878)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Breast(348;0.0321)		BRCA - Breast invasive adenocarcinoma(274;5.43e-05)|Epithelial(105;0.00418)|all cancers(92;0.0299)		TAATTATTTTGAAATCATAAA	0.328																																																2	Substitution - Missense(2)	ovary(1)|large_intestine(1)	11											81.0	81.0	81.0					11																	105929663		2201	4298	6499	105434873	SO:0001583	missense	143879			AK055247	CCDS8334.1	11q22.3	2013-01-08	2003-12-12	2003-12-17		ENSG00000182359		"""BTB/POZ domain containing"""	22934	protein-coding gene	gene with protein product			"""BTB and kelch domain containing 3"""	BKLHD3			Standard	NM_198439		Approved		uc001pjb.3	Q8NAB2		ENST00000531482.2:c.162C>A	11.37:g.105929663G>T	ENSP00000475836:p.Phe54Leu		105434873	Q6N066|Q86X38|Q96NK5	Missense_Mutation	SNP	-	p.F54L	ENST00000531482.2	37	c.162		11	.	.	.	.	.	.	.	.	.	.	G	16.34	3.096026	0.56075	.	.	ENSG00000182359	ENST00000526793;ENST00000531837	T;T	0.68765	-0.35;-0.35	5.7	2.4	0.29515	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	T	0.65626	0.2709	N	0.25890	0.77	0.46654	D	0.999144	P;D	0.60160	0.704;0.987	P;P	0.62089	0.581;0.898	T	0.65512	-0.6150	10	0.59425	D	0.04	.	9.1383	0.36888	0.3776:0.0:0.6224:0.0	.	54;50	A8K1K0;Q8NAB2	.;KBTB3_HUMAN	L	54	ENSP00000436262:F54L;ENSP00000432163:F54L	ENSP00000436262:F54L	F	-	3	2	KBTBD3	105434873	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.805000	0.38883	0.773000	0.33404	-0.137000	0.14449	TTC	-	NULL		0.328	KBTBD3-006	PUTATIVE	basic|exp_conf	protein_coding	KBTBD3	protein_coding	OTTHUMT00000388708.2	G	NM_152433		105434873	-1	no_errors	NM_152433	genbank	human	validated	54_36p	missense	SNP	1	T
OR6A2	8590	genome.wustl.edu	37	11	6816296	6816296	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr11:6816296G>T	ENST00000332601.3	-	1	832	c.644C>A	c.(643-645)cCa>cAa	p.P215Q		NM_003696.2	NP_003687.2	O95222	OR6A2_HUMAN	olfactory receptor, family 6, subfamily A, member 2	215					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.P215Q(1)		breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(4)|pancreas(1)|skin(1)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)	29		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.78e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		GACAGAGAGTGGCCCTAGAAG	0.493																																																1	Substitution - Missense(1)	ovary(1)	11											100.0	107.0	104.0					11																	6816296		2201	4296	6497	6772872	SO:0001583	missense	8590			AB065822	CCDS7772.1	11p15.4	2012-08-09		2004-03-10	ENSG00000184933	ENSG00000184933		"""GPCR / Class A : Olfactory receptors"""	15301	protein-coding gene	gene with protein product		608495		OR6A2P, OR6A1			Standard	NM_003696		Approved	OR11-55	uc001mes.1	O95222	OTTHUMG00000165736	ENST00000332601.3:c.644C>A	11.37:g.6816296G>T	ENSP00000330384:p.Pro215Gln		6772872	Q3MJC7|Q6IF35|Q9H206	Missense_Mutation	SNP	-	p.P215Q	ENST00000332601.3	37	c.644	CCDS7772.1	11	.	.	.	.	.	.	.	.	.	.	G	13.80	2.346480	0.41599	.	.	ENSG00000184933	ENST00000332601	T	0.57107	0.42	5.07	5.07	0.68467	GPCR, rhodopsin-like superfamily (1);	0.000000	0.56097	D	0.000035	T	0.79592	0.4472	M	0.93462	3.42	0.26143	N	0.980249	D	0.89917	1.0	D	0.97110	1.0	T	0.75428	-0.3321	10	0.87932	D	0	.	16.3566	0.83237	0.0:0.0:1.0:0.0	.	215	O95222	OR6A2_HUMAN	Q	215	ENSP00000330384:P215Q	ENSP00000330384:P215Q	P	-	2	0	OR6A2	6772872	0.969000	0.33509	0.634000	0.29324	0.156000	0.22039	5.021000	0.64072	2.809000	0.96659	0.655000	0.94253	CCA	-	NULL		0.493	OR6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6A2	protein_coding	OTTHUMT00000385981.1	G	NM_003696		6772872	-1	no_errors	NM_003696	genbank	human	provisional	54_36p	missense	SNP	0.27	T
IGSF22	283284	genome.wustl.edu	37	11	18737088	18737088	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr11:18737088C>G	ENST00000513874.1	-	11	1561	c.1422G>C	c.(1420-1422)gaG>gaC	p.E474D	RP11-1081L13.4_ENST00000527285.1_RNA	NM_173588.3	NP_775859	Q8N9C0	IGS22_HUMAN	immunoglobulin superfamily, member 22	474	Ig-like 3.							p.E474D(1)		NS(2)|autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(20)|ovary(4)|prostate(4)|skin(3)	56						CAATGATCAGCTCTGCTCGCT	0.532																																																1	Substitution - Missense(1)	ovary(1)	11											132.0	130.0	131.0					11																	18737088		2197	4289	6486	18693664	SO:0001583	missense	283284			AK095113	CCDS41625.1, CCDS41625.2	11p15.1	2014-06-06			ENSG00000179057	ENSG00000179057		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	26750	protein-coding gene	gene with protein product							Standard	NM_173588		Approved	FLJ37794	uc009yht.2	Q8N9C0	OTTHUMG00000160502	ENST00000513874.1:c.1422G>C	11.37:g.18737088C>G	ENSP00000421191:p.Glu474Asp		18693664	A6NNA0|D6RGV7	Missense_Mutation	SNP	HMMPfam_fn3;superfamily_Fibronectin type III;HMMPfam_I-set;superfamily_Immunoglobulin	p.E474D	ENST00000513874.1	37	c.1422	CCDS41625.2	11	.	.	.	.	.	.	.	.	.	.	C	11.37	1.618447	0.28801	.	.	ENSG00000179057	ENST00000513874	T	0.67865	-0.29	4.79	1.85	0.25348	.	0.184738	0.25954	N	0.027240	T	0.74053	0.3666	M	0.68952	2.095	0.22940	N	0.998536	D	0.63046	0.992	D	0.76071	0.987	T	0.61700	-0.7009	10	0.34782	T	0.22	.	5.9951	0.19489	0.0:0.6292:0.1358:0.2351	.	474	D6RGV7	.	D	474	ENSP00000421191:E474D	ENSP00000322422:E474D	E	-	3	2	IGSF22	18693664	0.999000	0.42202	0.427000	0.26684	0.405000	0.30901	0.717000	0.25851	0.098000	0.17522	-0.463000	0.05309	GAG	-	HMMPfam_I-set		0.532	IGSF22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGSF22	protein_coding	OTTHUMT00000360850.2	C	NM_173588		18693664	-1	no_errors	NM_173588	genbank	human	validated	54_36p	missense	SNP	0.99	G
SLC5A12	159963	genome.wustl.edu	37	11	26695067	26695067	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr11:26695067C>T	ENST00000396005.3	-	14	1898	c.1589G>A	c.(1588-1590)aGa>aAa	p.R530K		NM_178498.3	NP_848593.2	Q1EHB4	SC5AC_HUMAN	solute carrier family 5 (sodium/monocarboxylate cotransporter), member 12	530					sodium ion transport (GO:0006814)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)	p.R530K(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(1)	35						ATCCTCACCTCTTTGGCGACC	0.363																																																1	Substitution - Missense(1)	ovary(1)	11											107.0	104.0	105.0					11																	26695067		1917	4132	6049	26651643	SO:0001583	missense	159963			BC049207	CCDS7860.2	11p14.2	2013-07-19	2013-07-19		ENSG00000148942	ENSG00000148942		"""Solute carriers"""	28750	protein-coding gene	gene with protein product		612455	"""solute carrier family 5 (sodium/glucose cotransporter), member 12"""			12477932	Standard	NM_178498		Approved	MGC52019, SMCT2	uc001mra.2	Q1EHB4	OTTHUMG00000150706	ENST00000396005.3:c.1589G>A	11.37:g.26695067C>T	ENSP00000379326:p.Arg530Lys		26651643	Q86UC7	Missense_Mutation	SNP	-	p.R530K	ENST00000396005.3	37	c.1589	CCDS7860.2	11	.	.	.	.	.	.	.	.	.	.	C	5.796	0.331208	0.10956	.	.	ENSG00000148942	ENST00000396005	T	0.63744	-0.06	5.62	-2.27	0.06846	.	0.739382	0.11716	U	0.536366	T	0.28995	0.0720	N	0.02192	-0.645	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.31833	-0.9929	10	0.02654	T	1	.	12.5049	0.55975	0.0:0.1728:0.0:0.8272	.	530	Q1EHB4	SC5AC_HUMAN	K	530	ENSP00000379326:R530K	ENSP00000379326:R530K	R	-	2	0	SLC5A12	26651643	0.000000	0.05858	0.000000	0.03702	0.465000	0.32709	-0.042000	0.12063	-0.514000	0.06488	0.585000	0.79938	AGA	-	NULL		0.363	SLC5A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC5A12	protein_coding	OTTHUMT00000319681.1	C	NM_178498		26651643	-1	no_errors	NM_178498	genbank	human	validated	54_36p	missense	SNP	0	T
OR4C12	283093	genome.wustl.edu	37	11	50003838	50003838	+	Missense_Mutation	SNP	A	A	G			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr11:50003838A>G	ENST00000335238.4	-	1	233	c.200T>C	c.(199-201)aTa>aCa	p.I67T		NM_001005270.2	NP_001005270.2	Q96R67	OR4CC_HUMAN	olfactory receptor, family 4, subfamily C, member 12	67						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.I67T(1)		NS(1)|kidney(4)|large_intestine(3)|liver(1)|lung(19)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	36						AACTGTGTCTATCAAAGAAAG	0.433																																																1	Substitution - Missense(1)	ovary(1)	11											64.0	67.0	66.0					11																	50003838		2201	4296	6497	49960414	SO:0001583	missense	283093			BK004413	CCDS31496.1	11p11.12	2012-08-09			ENSG00000221954	ENSG00000221954		"""GPCR / Class A : Olfactory receptors"""	15168	protein-coding gene	gene with protein product							Standard	NM_001005270		Approved		uc010ria.2	Q96R67	OTTHUMG00000166687	ENST00000335238.4:c.200T>C	11.37:g.50003838A>G	ENSP00000334418:p.Ile67Thr		49960414	B2RNF0|Q6IF49	Missense_Mutation	SNP	-	p.I67T	ENST00000335238.4	37	c.200	CCDS31496.1	11	.	.	.	.	.	.	.	.	.	.	.	11.17	1.560295	0.27827	.	.	ENSG00000221954	ENST00000335238	T	0.03181	4.02	3.31	3.31	0.37934	GPCR, rhodopsin-like superfamily (1);	0.000000	0.47455	U	0.000240	T	0.04815	0.0130	L	0.35414	1.06	0.28076	N	0.932378	B	0.30439	0.279	B	0.38921	0.285	T	0.18429	-1.0337	10	0.56958	D	0.05	.	10.0552	0.42241	1.0:0.0:0.0:0.0	.	67	Q96R67	OR4CC_HUMAN	T	67	ENSP00000334418:I67T	ENSP00000334418:I67T	I	-	2	0	OR4C12	49960414	0.001000	0.12720	0.429000	0.26710	0.982000	0.71751	1.646000	0.37249	1.528000	0.49103	0.325000	0.21440	ATA	-	NULL		0.433	OR4C12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4C12	protein_coding	OTTHUMT00000391104.1	A	NM_001005270		49960414	-1	no_errors	NM_001005270	genbank	human	provisional	54_36p	missense	SNP	1	G
P2RY6	5031	genome.wustl.edu	37	11	73008401	73008401	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr11:73008401G>T	ENST00000393590.2	+	2	1137	c.838G>T	c.(838-840)Gca>Tca	p.A280S	P2RY6_ENST00000542092.1_Missense_Mutation_p.A280S|P2RY6_ENST00000538328.1_Missense_Mutation_p.A280S|P2RY6_ENST00000540342.1_Missense_Mutation_p.A280S|P2RY6_ENST00000393591.1_Missense_Mutation_p.A280S|P2RY6_ENST00000540124.1_Missense_Mutation_p.A280S|P2RY6_ENST00000349767.2_Missense_Mutation_p.A280S|P2RY6_ENST00000393592.2_Missense_Mutation_p.A280S	NM_001277207.1|NM_001277208.1	NP_001264136.1|NP_001264137.1	Q15077	P2RY6_HUMAN	pyrimidinergic receptor P2Y, G-protein coupled, 6	280					phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled purinergic nucleotide receptor activity (GO:0045028)|G-protein coupled receptor activity (GO:0004930)	p.A280S(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(2)|skin(2)	14						GGAGGCCTTTGCAGCGGCCTA	0.607																																																1	Substitution - Missense(1)	ovary(1)	11											57.0	57.0	57.0					11																	73008401		2200	4292	6492	72686049	SO:0001583	missense	5031				CCDS8220.1	11q13.5	2012-08-08				ENSG00000171631		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	8543	protein-coding gene	gene with protein product		602451				8670200	Standard	NM_176797		Approved	P2Y6	uc001otr.4	Q15077		ENST00000393590.2:c.838G>T	11.37:g.73008401G>T	ENSP00000377215:p.Ala280Ser		72686049	Q15754	Missense_Mutation	SNP	-	p.A280S	ENST00000393590.2	37	c.838	CCDS8220.1	11	.	.	.	.	.	.	.	.	.	.	G	10.53	1.377424	0.24944	.	.	ENSG00000171631	ENST00000540342;ENST00000542092;ENST00000349767;ENST00000393592;ENST00000393591;ENST00000540124;ENST00000393590;ENST00000538328	T;T;T;T;T;T;T;T	0.20598	2.06;2.06;2.06;2.06;2.06;2.06;2.06;2.06	4.81	3.9	0.45041	GPCR, rhodopsin-like superfamily (1);	0.063909	0.64402	D	0.000006	T	0.08313	0.0207	N	0.03253	-0.375	0.37884	D	0.930493	P	0.35192	0.489	B	0.30179	0.112	T	0.33292	-0.9874	10	0.18276	T	0.48	.	12.5841	0.56408	0.0801:0.0:0.9199:0.0	.	280	Q15077	P2RY6_HUMAN	S	280	ENSP00000443427:A280S;ENSP00000445652:A280S;ENSP00000309771:A280S;ENSP00000377217:A280S;ENSP00000377216:A280S;ENSP00000442551:A280S;ENSP00000377215:A280S;ENSP00000442990:A280S	ENSP00000309771:A280S	A	+	1	0	P2RY6	72686049	1.000000	0.71417	0.321000	0.25320	0.552000	0.35366	3.772000	0.55325	1.383000	0.46405	0.655000	0.94253	GCA	-	NULL		0.607	P2RY6-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	P2RY6	protein_coding	OTTHUMT00000397349.1	G			72686049	1	no_errors	NM_004154	genbank	human	reviewed	54_36p	missense	SNP	0.881	T
NCAM1	4684	genome.wustl.edu	37	11	113078569	113078569	+	Missense_Mutation	SNP	T	T	C			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr11:113078569T>C	ENST00000533760.1	+	7	1006	c.407T>C	c.(406-408)aTa>aCa	p.I136T	NCAM1_ENST00000316851.7_Missense_Mutation_p.I244T|NCAM1_ENST00000397957.4_3'UTR|NCAM1_ENST00000401611.2_Missense_Mutation_p.I253T	NM_001242608.1	NP_001229537.1	P13591	NCAM1_HUMAN	neural cell adhesion molecule 1	254	Ig-like C2-type 2.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cytokine-mediated signaling pathway (GO:0019221)|extracellular matrix organization (GO:0030198)|interferon-gamma-mediated signaling pathway (GO:0060333)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)	p.I253T(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(27)|ovary(3)|prostate(2)|upper_aerodigestive_tract(1)	49		all_cancers(61;5.82e-19)|all_epithelial(67;6.87e-12)|Melanoma(852;1.99e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;0.00119)|Breast(348;0.0109)|all_neural(223;0.0299)|Medulloblastoma(222;0.0458)|Renal(330;0.198)|Prostate(24;0.207)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.000114)|all cancers(92;0.000467)|OV - Ovarian serous cystadenocarcinoma(223;0.212)		GGGGAACAGATAGAGCAAGAG	0.428																																																1	Substitution - Missense(1)	ovary(1)	11											69.0	67.0	67.0					11																	113078569		1979	4163	6142	112583779	SO:0001583	missense	4684				CCDS73384.1, CCDS73385.1, CCDS73386.1, CCDS73387.1, CCDS73388.1	11q23.2	2013-02-11			ENSG00000149294	ENSG00000149294		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7656	protein-coding gene	gene with protein product		116930					Standard	NM_000615		Approved	NCAM, CD56	uc021qqp.1	P13591	OTTHUMG00000167196	ENST00000533760.1:c.407T>C	11.37:g.113078569T>C	ENSP00000473281:p.Ile136Thr		112583779	A8K8T8|P13592|P13593|Q05C58|Q15829|Q16180|Q16209|Q59FL7|Q86X47|Q96CJ3	Missense_Mutation	SNP	-	p.I136T	ENST00000533760.1	37	c.407		11	.	.	.	.	.	.	.	.	.	.	T	18.88	3.716724	0.68844	.	.	ENSG00000149294	ENST00000531044;ENST00000401611;ENST00000316851	T;T	0.68903	-0.36;-0.36	5.71	5.71	0.89125	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000001	T	0.75817	0.3901	.	.	.	0.80722	D	1	P;P;P;P;P	0.47762	0.878;0.878;0.9;0.797;0.797	P;B;P;P;P	0.51918	0.684;0.404;0.539;0.668;0.656	T	0.79247	-0.1882	9	0.87932	D	0	-25.6106	15.988	0.80176	0.0:0.0:0.0:1.0	.	254;254;254;254;254	P13591-5;P13591-1;P13591;P13591-3;P13591-6	.;.;NCAM1_HUMAN;.;.	T	136;253;244	ENSP00000384055:I253T;ENSP00000318472:I244T	ENSP00000318472:I244T	I	+	2	0	NCAM1	112583779	1.000000	0.71417	1.000000	0.80357	0.637000	0.38172	6.205000	0.72148	2.188000	0.69820	0.533000	0.62120	ATA	-	NULL		0.428	NCAM1-003	NOVEL	basic|appris_principal	protein_coding	NCAM1	protein_coding	OTTHUMT00000394068.2	T	NM_000615		112583779	1	no_errors	ENST00000404693	ensembl	human	known	54_36p	missense	SNP	0.97	C
NUAK1	9891	genome.wustl.edu	37	12	106460898	106460898	+	Silent	SNP	G	G	C			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr12:106460898G>C	ENST00000261402.2	-	7	3047	c.1668C>G	c.(1666-1668)gtC>gtG	p.V556V		NM_014840.2	NP_055655.1	O60285	NUAK1_HUMAN	NUAK family, SNF1-like kinase, 1	556					cell adhesion (GO:0007155)|cellular response to DNA damage stimulus (GO:0006974)|regulation of cell adhesion (GO:0030155)|regulation of cell proliferation (GO:0042127)|regulation of cellular senescence (GO:2000772)|regulation of myosin-light-chain-phosphatase activity (GO:0035507)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)	p.V556V(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(13)|ovary(1)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	37						CCTCGGCAGGGACACCAGGCT	0.592																																																1	Substitution - coding silent(1)	ovary(1)	12											43.0	50.0	47.0					12																	106460898		2203	4300	6503	104985028	SO:0001819	synonymous_variant	9891			AB011109	CCDS31892.1	12q23.3	2005-08-09				ENSG00000074590			14311	protein-coding gene	gene with protein product	"""AMP-activated protein kinase family member 5"""	608130				12409306, 13679856	Standard	NM_014840		Approved	ARK5, KIAA0537, NuaK1	uc001tlj.1	O60285	OTTHUMG00000169763	ENST00000261402.2:c.1668C>G	12.37:g.106460898G>C			104985028	A7MD39|Q96KA8	Silent	SNP	HMMPfam_Pkinase;superfamily_Protein kinase-like (PK-like)	p.V556	ENST00000261402.2	37	c.1668	CCDS31892.1	12																																																																																			-	NULL		0.592	NUAK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUAK1	protein_coding	OTTHUMT00000405767.2	G	NM_014840		104985028	-1	no_errors	NM_014840	genbank	human	validated	54_36p	silent	SNP	0.05	C
KDM2B	84678	genome.wustl.edu	37	12	121877819	121877819	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr12:121877819C>A	ENST00000377071.4	-	22	3742	c.3670G>T	c.(3670-3672)Gac>Tac	p.D1224Y	KDM2B_ENST00000542973.1_Missense_Mutation_p.D592Y|KDM2B_ENST00000377069.4_Missense_Mutation_p.D1155Y|KDM2B_ENST00000536437.1_Intron	NM_032590.4	NP_115979.3	Q8NHM5	KDM2B_HUMAN	lysine (K)-specific demethylase 2B	1224					embryonic camera-type eye morphogenesis (GO:0048596)|forebrain development (GO:0030900)|fourth ventricle development (GO:0021592)|hindbrain development (GO:0030902)|histone demethylation (GO:0016577)|histone H2A monoubiquitination (GO:0035518)|initiation of neural tube closure (GO:0021993)|lateral ventricle development (GO:0021670)|midbrain development (GO:0030901)|midbrain-hindbrain boundary morphogenesis (GO:0021555)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|spermatogenesis (GO:0007283)|third ventricle development (GO:0021678)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (GO:0032452)|histone demethylase activity (H3-K36 specific) (GO:0051864)|rRNA binding (GO:0019843)|zinc ion binding (GO:0008270)	p.D863Y(1)		breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	19						TCTGTGATGTCCAGGCCTGCC	0.602																																																1	Substitution - Missense(1)	ovary(1)	12											84.0	100.0	94.0					12																	121877819		2169	4254	6423	120362202	SO:0001583	missense	84678			AJ459424	CCDS41849.1, CCDS41850.1	12q24.31	2014-02-18	2009-04-06	2009-04-06	ENSG00000089094	ENSG00000089094		"""F-boxes / Leucine-rich repeats"", ""Chromatin-modifying enzymes / K-demethylases"""	13610	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1B"""	609078	"""F-box and leucine-rich repeat protein 10"""	FBXL10		10799292	Standard	NM_032590		Approved	PCCX2, CXXC2, Fbl10, JHDM1B	uc001uat.3	Q8NHM5	OTTHUMG00000169071	ENST00000377071.4:c.3670G>T	12.37:g.121877819C>A	ENSP00000366271:p.Asp1224Tyr		120362202	A8MRS1|Q8NCI2|Q96HC7|Q96SL0|Q96T03|Q9NS96|Q9UF75	Missense_Mutation	SNP	-	p.D1224Y	ENST00000377071.4	37	c.3670	CCDS41850.1	12	.	.	.	.	.	.	.	.	.	.	C	32	5.123817	0.94429	.	.	ENSG00000089094	ENST00000397480;ENST00000542973;ENST00000377069;ENST00000377071;ENST00000540043;ENST00000261824	T;T;T	0.36520	1.25;1.25;1.25	5.82	5.82	0.92795	.	0.000000	0.56097	D	0.000035	T	0.66548	0.2800	M	0.82323	2.585	0.80722	D	1	P;D;D;P	0.89917	0.936;1.0;1.0;0.911	P;D;D;P	0.87578	0.727;0.998;0.998;0.643	T	0.69591	-0.5104	10	0.87932	D	0	-36.9044	20.1054	0.97890	0.0:1.0:0.0:0.0	.	664;1224;1155;667	B7ZB05;Q8NHM5;A8MRS1;B4DSN4	.;KDM2B_HUMAN;.;.	Y	1214;592;1155;1224;667;1227	ENSP00000437821:D592Y;ENSP00000366269:D1155Y;ENSP00000366271:D1224Y	ENSP00000261824:D1227Y	D	-	1	0	KDM2B	120362202	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	7.818000	0.86416	2.757000	0.94681	0.655000	0.94253	GAC	-	NULL		0.602	KDM2B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FBXL10	protein_coding	OTTHUMT00000402132.2	C	NM_032590		120362202	-1	no_errors	NM_032590	genbank	human	reviewed	54_36p	missense	SNP	1	A
TSPAN9	10867	genome.wustl.edu	37	12	3387608	3387608	+	Nonsense_Mutation	SNP	G	G	T			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr12:3387608G>T	ENST00000011898.5	+	4	246	c.85G>T	c.(85-87)Gga>Tga	p.G29*	TSPAN9_ENST00000537971.1_Nonsense_Mutation_p.G29*|TSPAN9_ENST00000407263.1_Nonsense_Mutation_p.G29*|TSPAN9_ENST00000492305.1_3'UTR	NM_006675.4	NP_006666.1	O75954	TSN9_HUMAN	tetraspanin 9	29						focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tetraspanin-enriched microdomain (GO:0097197)		p.G29*(1)		endometrium(1)|kidney(2)|large_intestine(3)|lung(1)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	11			OV - Ovarian serous cystadenocarcinoma(31;0.00153)|COAD - Colon adenocarcinoma(12;0.0831)			TGGGCTGCTGGGAGTGGGCAT	0.597																																																1	Substitution - Nonsense(1)	ovary(1)	12											192.0	162.0	172.0					12																	3387608		2203	4300	6503	3257869	SO:0001587	stop_gained	10867			AF089749	CCDS8520.1	12p13.33-p13.32	2013-02-14			ENSG00000011105	ENSG00000011105		"""Tetraspanins"""	21640	protein-coding gene	gene with protein product		613137				10719184, 11739647	Standard	NM_006675		Approved	NET-5	uc021qtd.1	O75954	OTTHUMG00000150333	ENST00000011898.5:c.85G>T	12.37:g.3387608G>T	ENSP00000011898:p.Gly29*		3257869	D3DUQ7|Q53FV2|Q6FGJ8	Nonsense_Mutation	SNP	HMMPfam_Tetraspannin;superfamily_Tetraspanin	p.G29*	ENST00000011898.5	37	c.85	CCDS8520.1	12	.	.	.	.	.	.	.	.	.	.	G	33	5.225342	0.95173	.	.	ENSG00000011105	ENST00000537971;ENST00000011898;ENST00000407263	.	.	.	4.8	4.8	0.61643	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	15.3675	0.74535	0.0:0.0:1.0:0.0	.	.	.	.	X	29	.	ENSP00000011898:G29X	G	+	1	0	TSPAN9	3257869	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	9.869000	0.99810	2.228000	0.72767	0.561000	0.74099	GGA	-	HMMPfam_Tetraspannin		0.597	TSPAN9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSPAN9	protein_coding	OTTHUMT00000317606.2	G	NM_006675		3257869	1	no_errors	NM_006675	genbank	human	reviewed	54_36p	nonsense	SNP	1	T
LPCAT3	10162	genome.wustl.edu	37	12	7087511	7087511	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr12:7087511C>G	ENST00000261407.4	-	9	1117	c.1032G>C	c.(1030-1032)tgG>tgC	p.W344C	U47924.30_ENST00000606112.1_lincRNA|LPCAT3_ENST00000535021.1_Intron	NM_005768.5	NP_005759.4	Q6P1A2	MBOA5_HUMAN	lysophosphatidylcholine acyltransferase 3	344					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|regulation of plasma lipoprotein particle levels (GO:0097006)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	1-acylglycerophosphocholine O-acyltransferase activity (GO:0047184)	p.W344C(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(2)|lung(4)|ovary(1)|skin(2)	17						ACCGGGCCACCCAGGCGTTGG	0.577																																																1	Substitution - Missense(1)	ovary(1)	12											121.0	130.0	127.0					12																	7087511		2203	4300	6503	6957772	SO:0001583	missense	10162			U72515	CCDS8572.1	12p13.31	2010-05-12	2008-06-24	2008-06-24	ENSG00000111684	ENSG00000111684			30244	protein-coding gene	gene with protein product		611950	"""O-acyltransferase (membrane bound) domain containing 5"", ""membrane bound O-acyltransferase domain containing 5"""	OACT5, MBOAT5		8723724, 9074930, 18195019	Standard	NM_005768		Approved	C3F, nessy	uc001qsi.3	Q6P1A2	OTTHUMG00000168970	ENST00000261407.4:c.1032G>C	12.37:g.7087511C>G	ENSP00000261407:p.Trp344Cys		6957772	B2RDH0|B7Z3N3|Q7KZS1|Q92980|Q9BW40	Missense_Mutation	SNP	HMMPfam_MBOAT	p.W344C	ENST00000261407.4	37	c.1032	CCDS8572.1	12	.	.	.	.	.	.	.	.	.	.	C	24.5	4.540748	0.85917	.	.	ENSG00000111684	ENST00000261407	D	0.86297	-2.1	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	D	0.94351	0.8184	M	0.82923	2.615	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94342	0.7571	10	0.87932	D	0	-11.8996	20.1865	0.98220	0.0:1.0:0.0:0.0	.	344	Q6P1A2	MBOA5_HUMAN	C	344	ENSP00000261407:W344C	ENSP00000261407:W344C	W	-	3	0	LPCAT3	6957772	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	6.981000	0.76166	2.775000	0.95449	0.655000	0.94253	TGG	-	NULL		0.577	LPCAT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPCAT3	protein_coding	OTTHUMT00000401812.1	C	NM_005768		6957772	-1	no_errors	NM_005768	genbank	human	validated	54_36p	missense	SNP	1	G
EPS8	2059	genome.wustl.edu	37	12	15835860	15835860	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr12:15835860G>T	ENST00000281172.5	-	2	462	c.26C>A	c.(25-27)cCc>cAc	p.P9H	EPS8_ENST00000543523.1_Missense_Mutation_p.P9H|EPS8_ENST00000543612.1_Missense_Mutation_p.P9H	NM_004447.5	NP_004438.3	Q12929	EPS8_HUMAN	epidermal growth factor receptor pathway substrate 8	9					actin crosslink formation (GO:0051764)|actin cytoskeleton reorganization (GO:0031532)|actin filament bundle assembly (GO:0051017)|actin polymerization-dependent cell motility (GO:0070358)|adult locomotory behavior (GO:0008344)|barbed-end actin filament capping (GO:0051016)|behavioral response to ethanol (GO:0048149)|cell proliferation (GO:0008283)|dendritic cell migration (GO:0036336)|epidermal growth factor receptor signaling pathway (GO:0007173)|exit from mitosis (GO:0010458)|positive regulation of signal transduction (GO:0009967)|Rac protein signal transduction (GO:0016601)|regulation of actin filament length (GO:0030832)|regulation of cell shape (GO:0008360)|signal transduction (GO:0007165)	cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|postsynaptic density (GO:0014069)|ruffle membrane (GO:0032587)|stereocilium (GO:0032420)|vesicle (GO:0031982)	actin binding (GO:0003779)|Rac GTPase binding (GO:0048365)|SH3/SH2 adaptor activity (GO:0005070)	p.P9H(1)		NS(1)|breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	33		all_epithelial(100;1.87e-05)|Breast(259;0.000286)|Hepatocellular(102;0.244)		BRCA - Breast invasive adenocarcinoma(232;4.29e-05)|GBM - Glioblastoma multiforme(207;0.0264)		AAAACTACTGGGATGATTAGA	0.299																																																1	Substitution - Missense(1)	ovary(1)	12											84.0	85.0	84.0					12																	15835860		2203	4299	6502	15727127	SO:0001583	missense	2059			U12535	CCDS31753.1	12p12.3	2008-05-02				ENSG00000151491			3420	protein-coding gene	gene with protein product		600206				8084614	Standard	NM_004447		Approved		uc001rdb.3	Q12929		ENST00000281172.5:c.26C>A	12.37:g.15835860G>T	ENSP00000281172:p.Pro9His		15727127	A6NMC3|A8K6W2|A8KA66|B4DX66|Q8N6J0	Missense_Mutation	SNP	HMMPfam_SH3_1;superfamily_SH3-domain;superfamily_SAM/Pointed domain;HMMPfam_PTB;superfamily_PH domain-like	p.P9H	ENST00000281172.5	37	c.26	CCDS31753.1	12	.	.	.	.	.	.	.	.	.	.	G	10.70	1.423185	0.25639	.	.	ENSG00000151491	ENST00000543523;ENST00000281172;ENST00000543612;ENST00000543223;ENST00000546311;ENST00000535752;ENST00000543363;ENST00000536793;ENST00000544064	T;T;T;T;T	0.47528	3.34;3.34;3.34;0.84;0.84	5.24	4.34	0.51931	.	0.200282	0.35646	N	0.003061	T	0.37348	0.1000	L	0.47716	1.5	0.80722	D	1	B	0.13145	0.007	B	0.10450	0.005	T	0.14727	-1.0462	10	0.12430	T	0.62	-1.1013	10.9777	0.47475	0.0:0.0:0.8137:0.1863	.	9	Q12929	EPS8_HUMAN	H	9	ENSP00000441867:P9H;ENSP00000281172:P9H;ENSP00000442388:P9H;ENSP00000445235:P9H;ENSP00000440591:P9H	ENSP00000281172:P9H	P	-	2	0	EPS8	15727127	1.000000	0.71417	1.000000	0.80357	0.801000	0.45260	3.230000	0.51286	1.418000	0.47098	0.655000	0.94253	CCC	-	NULL		0.299	EPS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPS8	protein_coding	OTTHUMT00000401093.1	G			15727127	-1	no_errors	NM_004447	genbank	human	reviewed	54_36p	missense	SNP	1	T
KRT4	3851	genome.wustl.edu	37	12	53200959	53200959	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr12:53200959C>A	ENST00000551956.1	-	9	1949	c.1457G>T	c.(1456-1458)aGt>aTt	p.S486I	KRT4_ENST00000293774.4_Missense_Mutation_p.S560I|KRT4_ENST00000458244.2_Missense_Mutation_p.S466I			P19013	K2C4_HUMAN	keratin 4	500	Ser-rich.|Tail.				cytoskeleton organization (GO:0007010)|epithelial cell differentiation (GO:0030855)|negative regulation of epithelial cell proliferation (GO:0050680)	cell surface (GO:0009986)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)	p.S560I(1)		endometrium(3)|kidney(4)|large_intestine(6)|lung(8)|ovary(4)|prostate(2)|skin(2)	29						GCCAAAGCCACTACTCAGGCC	0.552																																					Pancreas(190;284 2995 41444 45903)											1	Substitution - Missense(1)	ovary(1)	12											90.0	103.0	99.0					12																	53200959		2123	4238	6361	51487226	SO:0001583	missense	3851				CCDS41787.1, CCDS41787.2	12q13.13	2013-01-16			ENSG00000170477	ENSG00000170477		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6441	protein-coding gene	gene with protein product	"""cytokeratin 4"", ""keratin, type II cytoskeletal 4"""	123940		CYK4		16831889	Standard	NM_002272		Approved	CK4, K4	uc031qhk.1	P19013		ENST00000551956.1:c.1457G>T	12.37:g.53200959C>A	ENSP00000448220:p.Ser486Ile		51487226	F8VS64|Q6GTR8|Q96LA7|Q9BTL1	Missense_Mutation	SNP	-	p.S560I	ENST00000551956.1	37	c.1679	CCDS41787.2	12	.	.	.	.	.	.	.	.	.	.	C	9.193	1.026510	0.19512	.	.	ENSG00000170477	ENST00000551956;ENST00000293774;ENST00000458244	T;T;T	0.74106	-0.81;-0.81;-0.81	4.33	4.33	0.51752	.	0.591953	0.15329	N	0.268135	T	0.64148	0.2572	L	0.38175	1.15	0.31860	N	0.621055	B	0.30406	0.278	B	0.24701	0.055	T	0.69007	-0.5259	10	0.42905	T	0.14	.	13.1271	0.59363	0.1602:0.8398:0.0:0.0	.	500	P19013	K2C4_HUMAN	I	486;560;466	ENSP00000448220:S486I;ENSP00000293774:S560I;ENSP00000387904:S466I	ENSP00000293774:S560I	S	-	2	0	KRT4	51487226	0.012000	0.17670	0.948000	0.38648	0.171000	0.22731	0.828000	0.27435	2.427000	0.82271	0.561000	0.74099	AGT	-	NULL		0.552	KRT4-001	KNOWN	upstream_ATG|basic|appris_candidate|CCDS	protein_coding	KRT4	protein_coding	OTTHUMT00000405931.1	C	NM_002272		51487226	-1	no_errors	NM_002272	genbank	human	reviewed	54_36p	missense	SNP	0.95	A
ERBB3	2065	genome.wustl.edu	37	12	56495392	56495392	+	Missense_Mutation	SNP	T	T	A			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr12:56495392T>A	ENST00000267101.3	+	28	4022	c.3582T>A	c.(3580-3582)gaT>gaA	p.D1194E	ERBB3_ENST00000549832.1_Missense_Mutation_p.D314E|PA2G4_ENST00000552766.1_5'Flank|ERBB3_ENST00000553131.1_Missense_Mutation_p.D435E|ERBB3_ENST00000415288.2_Missense_Mutation_p.D1135E|ERBB3_ENST00000450146.2_Missense_Mutation_p.D551E|RP11-603J24.9_ENST00000548861.1_Intron|PA2G4_ENST00000303305.6_5'Flank	NM_001982.3	NP_001973.2	P21860	ERBB3_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 3	1194					cranial nerve development (GO:0021545)|endocardial cushion development (GO:0003197)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|negative regulation of cell adhesion (GO:0007162)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of secretion (GO:0051048)|negative regulation of signal transduction (GO:0009968)|neuron apoptotic process (GO:0051402)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein tyrosine kinase activity (GO:0061098)|regulation of cell proliferation (GO:0042127)|Schwann cell differentiation (GO:0014037)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein tyrosine kinase activator activity (GO:0030296)|transmembrane signaling receptor activity (GO:0004888)	p.D1194E(1)		central_nervous_system(2)|lung(3)|ovary(1)|skin(1)|stomach(1)	8			OV - Ovarian serous cystadenocarcinoma(18;0.112)			AAGATGAAGATGAGGAGTATG	0.532																																																1	Substitution - Missense(1)	ovary(1)	12											90.0	86.0	87.0					12																	56495392		2203	4300	6503	54781659	SO:0001583	missense	2065			M34309	CCDS31833.1, CCDS44918.1	12q13	2013-07-09	2013-07-09			ENSG00000065361			3431	protein-coding gene	gene with protein product		190151	"""lethal congenital contracture syndrome 2"""	LCCS2			Standard	NM_001982		Approved	HER3	uc001sjh.3	P21860	OTTHUMG00000170140	ENST00000267101.3:c.3582T>A	12.37:g.56495392T>A	ENSP00000267101:p.Asp1194Glu		54781659	A8K6L6|B4DIK7|B4DV32|E9PDT8|Q9BUD7	Missense_Mutation	SNP	superfamily_Growth factor receptor domain;superfamily_Protein kinase-like (PK-like);superfamily_L domain-like;Recep_L_domain;HMMPfam_Recep_L_domain;Pkinase_Tyr;HMMPfam_Pkinase_Tyr;Furin-like;HMMPfam_Furin-like	p.D1194E	ENST00000267101.3	37	c.3582	CCDS31833.1	12	.	.	.	.	.	.	.	.	.	.	T	11.64	1.699352	0.30142	.	.	ENSG00000065361	ENST00000267101;ENST00000450146;ENST00000415288;ENST00000550070;ENST00000553131;ENST00000549832	T;T;T;T;T	0.78924	-1.11;-1.01;-1.1;-1.22;-0.94	5.63	-3.65	0.04502	.	0.165850	0.41194	N	0.000927	T	0.49287	0.1548	N	0.17082	0.46	0.39124	D	0.961722	B;B;B	0.15141	0.012;0.007;0.007	B;B;B	0.16722	0.016;0.007;0.008	T	0.07966	-1.0745	10	0.16896	T	0.51	.	1.6999	0.02870	0.1104:0.2207:0.2772:0.3917	.	1135;314;1194	P21860-4;B3KWG5;P21860	.;.;ERBB3_HUMAN	E	1194;551;1135;317;435;314	ENSP00000267101:D1194E;ENSP00000399178:D551E;ENSP00000408340:D1135E;ENSP00000449129:D435E;ENSP00000448729:D314E	ENSP00000267101:D1194E	D	+	3	2	ERBB3	54781659	0.015000	0.18098	0.997000	0.53966	0.998000	0.95712	-1.853000	0.01666	-0.202000	0.10268	0.533000	0.62120	GAT	-	NULL		0.532	ERBB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERBB3	protein_coding	OTTHUMT00000407619.3	T			54781659	1	no_errors	NM_001982	genbank	human	reviewed	54_36p	missense	SNP	1	A
NAP1L1	4673	genome.wustl.edu	37	12	76447075	76447075	+	Missense_Mutation	SNP	T	T	G			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	T	T	T	G	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr12:76447075T>G	ENST00000261182.8	-	10	1312	c.826A>C	c.(826-828)Aag>Cag	p.K276Q	NAP1L1_ENST00000552342.1_Missense_Mutation_p.K287Q|NAP1L1_ENST00000547773.1_Missense_Mutation_p.K213Q|NAP1L1_ENST00000547993.1_Missense_Mutation_p.K93Q|NAP1L1_ENST00000548044.1_Missense_Mutation_p.K235Q|NAP1L1_ENST00000542344.1_Missense_Mutation_p.K234Q|NAP1L1_ENST00000431879.3_Missense_Mutation_p.K208Q|NAP1L1_ENST00000393263.3_Missense_Mutation_p.K276Q|NAP1L1_ENST00000549596.1_Missense_Mutation_p.K276Q|NAP1L1_ENST00000535020.2_Missense_Mutation_p.K276Q|NAP1L1_ENST00000544816.1_Missense_Mutation_p.K93Q	NM_004537.4|NM_139207.2	NP_004528.1|NP_631946.1	P55209	NP1L1_HUMAN	nucleosome assembly protein 1-like 1	276					DNA replication (GO:0006260)|nucleosome assembly (GO:0006334)|positive regulation of cell proliferation (GO:0008284)	membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.K276Q(1)		kidney(1)|large_intestine(1)|lung(3)|ovary(2)|prostate(1)|skin(1)	9		Colorectal(145;0.09)				TGTTTCTGCTTCTTCTTAATA	0.353																																																1	Substitution - Missense(1)	ovary(1)	12											135.0	137.0	136.0					12																	76447075		2203	4300	6503	74733342	SO:0001583	missense	4673				CCDS9013.1	12q21.1	2010-03-17			ENSG00000187109	ENSG00000187109			7637	protein-coding gene	gene with protein product		164060				8297347	Standard	NM_004537		Approved	NRP, NAP1, NAP1L, MGC8688, MGC23410	uc001sxx.2	P55209		ENST00000261182.8:c.826A>C	12.37:g.76447075T>G	ENSP00000261182:p.Lys276Gln		74733342	B3KNT8	Missense_Mutation	SNP	HMMPfam_NAP	p.K276Q	ENST00000261182.8	37	c.826	CCDS9013.1	12	.	.	.	.	.	.	.	.	.	.	T	20.1	3.940831	0.73557	.	.	ENSG00000187109	ENST00000261182;ENST00000552056;ENST00000393263;ENST00000431879;ENST00000547773;ENST00000544816;ENST00000542344;ENST00000535020;ENST00000549596;ENST00000547993;ENST00000552342;ENST00000548044	T;T;T;T;T;T;T;T;T;T;T;T	0.55588	0.51;0.51;0.51;0.51;0.51;0.51;0.51;0.51;0.51;0.51;0.51;0.51	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	T	0.63224	0.2493	M	0.66939	2.045	0.80722	D	1	P;P;P;P;B;B;P	0.44260	0.454;0.455;0.454;0.704;0.18;0.061;0.83	P;P;P;P;B;B;P	0.49477	0.495;0.461;0.495;0.612;0.248;0.152;0.612	T	0.65821	-0.6075	10	0.59425	D	0.04	.	16.4323	0.83853	0.0:0.0:0.0:1.0	.	276;234;287;276;208;213;276	F5H4R6;B7Z9C2;F8W0J6;B3KNT8;B3KV44;F8W543;P55209	.;.;.;.;.;.;NP1L1_HUMAN	Q	276;270;276;208;213;93;234;276;276;93;287;235	ENSP00000261182:K276Q;ENSP00000450236:K270Q;ENSP00000376947:K276Q;ENSP00000409795:K208Q;ENSP00000448167:K213Q;ENSP00000437507:K93Q;ENSP00000444759:K234Q;ENSP00000445008:K276Q;ENSP00000447793:K276Q;ENSP00000448007:K93Q;ENSP00000447196:K287Q;ENSP00000449649:K235Q	ENSP00000261182:K276Q	K	-	1	0	NAP1L1	74733342	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.037000	0.88933	2.282000	0.76494	0.529000	0.55759	AAG	-	HMMPfam_NAP		0.353	NAP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAP1L1	protein_coding	OTTHUMT00000405850.3	T	NM_139207		74733342	-1	no_errors	NM_004537	genbank	human	reviewed	54_36p	missense	SNP	1	G
GOLGA3	2802	genome.wustl.edu	37	12	133373164	133373164	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr12:133373164C>G	ENST00000450791.2	-	9	2244	c.2061G>C	c.(2059-2061)atG>atC	p.M687I	GOLGA3_ENST00000204726.3_Missense_Mutation_p.M687I|GOLGA3_ENST00000537452.1_Missense_Mutation_p.M687I|GOLGA3_ENST00000456883.2_Missense_Mutation_p.M687I|GOLGA3_ENST00000545875.1_Missense_Mutation_p.M687I			Q08378	GOGA3_HUMAN	golgin A3	687	Gln-rich.				intra-Golgi vesicle-mediated transport (GO:0006891)	cytosol (GO:0005829)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extrinsic component of Golgi membrane (GO:0090498)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	transporter activity (GO:0005215)	p.M687I(1)		breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.27e-08)|Epithelial(86;3.34e-07)|all cancers(50;9.4e-06)		CCGAGTCCGCCATCCTCTGCA	0.627																																																1	Substitution - Missense(1)	ovary(1)	12											154.0	150.0	151.0					12																	133373164		2203	4300	6503	131883237	SO:0001583	missense	2802			AF485338	CCDS9281.1, CCDS53846.1	12q24.33	2010-02-12	2010-02-12		ENSG00000090615	ENSG00000090615			4426	protein-coding gene	gene with protein product	"""SY2/SY10 protein"", ""Golgi complex-associated protein of 170 kD"""	602581	"""golgi autoantigen, golgin subfamily a, 3"""			8315394, 15829563	Standard	NM_001172557		Approved	golgin-160, GCP170, MEA-2	uc001ukz.1	Q08378	OTTHUMG00000168023	ENST00000450791.2:c.2061G>C	12.37:g.133373164C>G	ENSP00000410378:p.Met687Ile		131883237	A5PKX6|O43241|Q6P9C7|Q86XW3|Q8TDA9|Q8WZA3	Missense_Mutation	SNP	superfamily_Prefoldin;superfamily_HLH helix-loop-helix DNA-binding domain;superfamily_Spectrin repeat	p.M687I	ENST00000450791.2	37	c.2061	CCDS9281.1	12	.	.	.	.	.	.	.	.	.	.	C	9.100	1.003992	0.19199	.	.	ENSG00000090615	ENST00000204726;ENST00000450791;ENST00000456883;ENST00000537452;ENST00000545875	T;T;T;T;T	0.29917	1.98;1.98;1.98;1.55;1.55	5.48	2.58	0.30949	.	0.392164	0.31290	N	0.007916	T	0.22975	0.0555	L	0.52364	1.645	0.80722	D	1	P;B;B	0.34615	0.459;0.136;0.255	B;B;B	0.29353	0.101;0.071;0.068	T	0.02991	-1.1085	10	0.34782	T	0.22	.	8.1754	0.31278	0.0:0.6795:0.0:0.3205	.	687;687;687	Q08378-4;Q08378-2;Q08378	.;.;GOGA3_HUMAN	I	687	ENSP00000204726:M687I;ENSP00000410378:M687I;ENSP00000409303:M687I;ENSP00000442143:M687I;ENSP00000442603:M687I	ENSP00000204726:M687I	M	-	3	0	GOLGA3	131883237	1.000000	0.71417	0.202000	0.23494	0.044000	0.14063	0.992000	0.29667	0.241000	0.21283	-0.140000	0.14226	ATG	-	NULL		0.627	GOLGA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GOLGA3	protein_coding	OTTHUMT00000397569.2	C	NM_005895		131883237	-1	no_errors	NM_005895	genbank	human	reviewed	54_36p	missense	SNP	1	G
TUBA3C	7278	genome.wustl.edu	37	13	19752417	19752417	+	Missense_Mutation	SNP	A	A	G			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr13:19752417A>G	ENST00000400113.3	-	3	448	c.344T>C	c.(343-345)gTc>gCc	p.V115A		NM_006001.2	NP_005992.1	Q13748	TBA3C_HUMAN	tubulin, alpha 3c	115					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)	p.V115A(1)		NS(1)|biliary_tract(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(4)|prostate(7)|skin(7)|urinary_tract(1)	72		all_cancers(29;1.31e-20)|all_epithelial(30;1.59e-20)|all_lung(29;6.91e-20)|Lung NSC(5;9.25e-17)|Hepatocellular(1;0.0207)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;6.78e-06)|Epithelial(112;3.79e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00172)|Lung(94;0.0186)|LUSC - Lung squamous cell carcinoma(192;0.108)		GACCAGGTCGACGATCTCCTT	0.537																																																1	Substitution - Missense(1)	ovary(1)	13											214.0	185.0	195.0					13																	19752417		2203	4300	6503	18650417	SO:0001583	missense	7278			AF005392	CCDS9284.1	13q12.11	2007-06-20	2007-02-12	2007-02-12	ENSG00000198033	ENSG00000198033		"""Tubulins"""	12408	protein-coding gene	gene with protein product		602528	"""tubulin, alpha 2"""	TUBA2		9465305	Standard	NM_006001		Approved	bA408E5.3	uc009zzj.3	Q13748	OTTHUMG00000016481	ENST00000400113.3:c.344T>C	13.37:g.19752417A>G	ENSP00000382982:p.Val115Ala		18650417	A6NJQ0|Q5W099|Q6PEY3|Q96F18	Missense_Mutation	SNP	HMMPfam_Tubulin;HMMPfam_Tubulin_C;superfamily_Tubulin nucleotide-binding domain-like;superfamily_Tubulin C-terminal domain-like	p.V115A	ENST00000400113.3	37	c.344	CCDS9284.1	13	.	.	.	.	.	.	.	.	.	.	a	10.19	1.280908	0.23392	.	.	ENSG00000198033	ENST00000400113;ENST00000360801	T	0.66638	-0.22	1.53	1.53	0.23141	.	0.000000	0.42294	U	0.000732	T	0.68550	0.3013	.	.	.	0.36898	D	0.890278	.	.	.	.	.	.	T	0.73056	-0.4103	7	0.87932	D	0	.	7.129	0.25488	1.0:0.0:0.0:0.0	.	.	.	.	A	115	ENSP00000382982:V115A	ENSP00000354037:V115A	V	-	2	0	TUBA3C	18650417	1.000000	0.71417	0.991000	0.47740	0.925000	0.55904	7.512000	0.81728	0.958000	0.37956	0.347000	0.21830	GTC	-	HMMPfam_Tubulin		0.537	TUBA3C-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	TUBA3C	protein_coding	OTTHUMT00000044007.2	A	NM_006001		18650417	-1	no_errors	NM_006001	genbank	human	reviewed	54_36p	missense	SNP	1	G
ALG11	440138	genome.wustl.edu	37	13	52593272	52593272	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	C	C	G	C	C	C	Unknown	Valid	Somatic	Phase_III	Capture	454_PCR_WGA		dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr13:52593272C>G	ENST00000521508.1	+	2	273	c.268C>G	c.(268-270)Cag>Gag	p.Q90E	ALG11_ENST00000523764.1_Intron	NM_001004127.2	NP_001004127.2	Q2TAA5	ALG11_HUMAN	ALG11, alpha-1,2-mannosyltransferase	90					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	GDP-Man:Man3GlcNAc2-PP-Dol alpha-1,2-mannosyltransferase activity (GO:0004377)	p.Q90E(1)		endometrium(1)|large_intestine(6)|lung(4)|ovary(2)	13		Breast(56;0.00173)|Lung NSC(96;0.0108)|Prostate(109;0.0412)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;2.44e-08)		AAGAGCCCTGCAGAAAAAGTA	0.308																																																1	Substitution - Missense(1)	ovary(1)	13											51.0	48.0	49.0					13																	52593272		2203	4300	6503	51491273	SO:0001583	missense	440138			AK025456	CCDS31977.1	13q14.3	2013-02-22	2013-02-22		ENSG00000253710	ENSG00000253710	2.4.1.131	"""Glycosyltransferase group 1 domain containing"""	32456	protein-coding gene	gene with protein product	"""GDP-Man:Man(3)GlcNAc(2)-PP-dolichol alpha-1,2-mannosyltransferase"""	613666	"""asparagine-linked glycosylation 11 homolog (S. cerevisiae, alpha-1,2-mannosyltransferase)"", ""asparagine-linked glycosylation 11, alpha-1,2-mannosyltransferase homolog (yeast)"""			20080937	Standard	NM_001004127		Approved	KIAA0266		Q2TAA5	OTTHUMG00000016959	ENST00000521508.1:c.268C>G	13.37:g.52593272C>G	ENSP00000430236:p.Gln90Glu		51491273	A5PLP3|B4DKW9|Q5TAN9|Q6DKI6|Q96FI7	Missense_Mutation	SNP	HMMPfam_Glycos_transf_1;superfamily_UDP-Glycosyltransferase/glycogen phosphorylase	p.Q90E	ENST00000521508.1	37	c.268	CCDS31977.1	13	.	.	.	.	.	.	.	.	.	.	C	17.33	3.361710	0.61403	.	.	ENSG00000253710	ENST00000521508	T	0.63744	-0.06	5.65	5.65	0.86999	.	0.140334	0.48286	U	0.000183	T	0.81763	0.4891	M	0.90309	3.105	0.80722	D	1	D	0.69078	0.997	P	0.59288	0.855	D	0.85242	0.1039	10	0.72032	D	0.01	.	19.7121	0.96100	0.0:1.0:0.0:0.0	.	90	Q2TAA5	ALG11_HUMAN	E	90	ENSP00000430236:Q90E	ENSP00000430236:Q90E	Q	+	1	0	ALG11	51491273	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.461000	0.60115	2.664000	0.90586	0.579000	0.79373	CAG	-	NULL		0.308	ALG11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALG11	protein_coding	OTTHUMT00000045050.1	C	NM_001004127		51491273	1	no_errors	NM_001004127	genbank	human	provisional	54_36p	missense	SNP	1	G
NALCN	259232	genome.wustl.edu	37	13	101714348	101714348	+	Missense_Mutation	SNP	A	A	G			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr13:101714348A>G	ENST00000251127.6	-	41	4808	c.4727T>C	c.(4726-4728)cTc>cCc	p.L1576P	NALCN-AS1_ENST00000457843.1_RNA	NM_052867.2	NP_443099.1	Q8IZF0	NALCN_HUMAN	sodium leak channel, non-selective	1576					calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium channel activity (GO:0005272)|voltage-gated calcium channel activity (GO:0005245)	p.L1576P(1)		NS(1)|autonomic_ganglia(2)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(33)|liver(2)|lung(81)|ovary(8)|pancreas(3)|prostate(5)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	177	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					GCACTTCTTGAGCCACATGCG	0.612																																																1	Substitution - Missense(1)	ovary(1)	13											124.0	89.0	101.0					13																	101714348		2203	4300	6503	100512349	SO:0001583	missense	259232			AY141972	CCDS9498.1	13q32.3	2012-02-21	2007-04-26	2007-04-26	ENSG00000102452	ENSG00000102452		"""Ion channels / Sodium leak channels, non-selective"""	19082	protein-coding gene	gene with protein product		611549	"""voltage gated channel like 1"""	VGCNL1		17448995	Standard	XM_006719943		Approved	bA430M15.1, CanIon	uc001vox.1	Q8IZF0	OTTHUMG00000017295	ENST00000251127.6:c.4727T>C	13.37:g.101714348A>G	ENSP00000251127:p.Leu1576Pro		100512349	Q6P2S6|Q6ZMI7|Q8IZZ1|Q8TAH1	Missense_Mutation	SNP	HMMPfam_Ion_trans;superfamily_Voltage-gated potassium channels	p.L1576P	ENST00000251127.6	37	c.4727	CCDS9498.1	13	.	.	.	.	.	.	.	.	.	.	A	25.4	4.632084	0.87660	.	.	ENSG00000102452	ENST00000251127	D	0.98684	-5.07	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	D	0.98582	0.9526	L	0.43923	1.385	0.80722	D	1	D	0.89917	1.0	D	0.76071	0.987	D	0.99919	1.1240	10	0.87932	D	0	.	16.1755	0.81847	1.0:0.0:0.0:0.0	.	1576	Q8IZF0	NALCN_HUMAN	P	1576	ENSP00000251127:L1576P	ENSP00000251127:L1576P	L	-	2	0	NALCN	100512349	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.700000	0.91322	2.226000	0.72624	0.528000	0.53228	CTC	-	NULL		0.612	NALCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NALCN	protein_coding	OTTHUMT00000045663.2	A	NM_052867		100512349	-1	no_errors	NM_052867	genbank	human	validated	54_36p	missense	SNP	1	G
TM9SF1	10548	genome.wustl.edu	37	14	24662160	24662160	+	Missense_Mutation	SNP	G	G	A	rs148227366		TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr14:24662160G>A	ENST00000261789.4	-	3	1019	c.661C>T	c.(661-663)Cgt>Tgt	p.R221C	TM9SF1_ENST00000396854.4_Missense_Mutation_p.R221C|TM9SF1_ENST00000556387.1_Missense_Mutation_p.R430C|TM9SF1_ENST00000528669.1_Missense_Mutation_p.R221C|TM9SF1_ENST00000530611.1_Missense_Mutation_p.R430C|RP11-468E2.2_ENST00000561419.1_5'Flank|TM9SF1_ENST00000524835.1_Missense_Mutation_p.R134C	NM_006405.5	NP_006396.2	O15321	TM9S1_HUMAN	transmembrane 9 superfamily member 1	221					autophagy (GO:0006914)	cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)		p.R221C(1)		NS(1)|breast(4)|endometrium(3)|large_intestine(11)|lung(4)|ovary(1)	24				GBM - Glioblastoma multiforme(265;0.0183)		TCGTCACCACGGCGCCTGTCA	0.527													G|||	1	0.000199681	0.0	0.0	5008	,	,		20436	0.001		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	14						G	CYS/ARG,CYS/ARG	0,4406		0,0,2203	101.0	89.0	93.0		661,661	4.2	1.0	14	dbSNP_134	93	4,8596	3.7+/-12.6	0,4,4296	yes	missense,missense	TM9SF1	NM_001014842.1,NM_006405.5	180,180	0,4,6499	AA,AG,GG		0.0465,0.0,0.0308	probably-damaging,probably-damaging	221/490,221/607	24662160	4,13002	2203	4300	6503	23732000	SO:0001583	missense	10548			U94831	CCDS9617.1, CCDS41934.1, CCDS73623.1	14q11.2	2005-10-11			ENSG00000100926	ENSG00000100926			11864	protein-coding gene	gene with protein product						9332367	Standard	NM_006405		Approved	MP70, HMP70	uc010tob.1	O15321	OTTHUMG00000029322	ENST00000261789.4:c.661C>T	14.37:g.24662160G>A	ENSP00000261789:p.Arg221Cys		23732000	D3DS65|Q86SZ6|Q96FI8	Missense_Mutation	SNP	-	p.R221C	ENST00000261789.4	37	c.661	CCDS9617.1	14	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	22.1	4.238247	0.79800	0.0	4.65E-4	ENSG00000100926;ENSG00000100926;ENSG00000100926;ENSG00000100926;ENSG00000100926;ENSG00000100926;ENSG00000100926;ENSG00000100926;ENSG00000100926;ENSG00000254692	ENST00000261789;ENST00000528669;ENST00000556387;ENST00000524835;ENST00000396854;ENST00000528895;ENST00000530563;ENST00000530468;ENST00000525592;ENST00000530611	T;T;T;T;T;T;T;T;T;T	0.70631	-0.5;-0.5;-0.5;-0.5;-0.5;-0.5;-0.5;-0.5;-0.5;-0.5	5.1	4.21	0.49690	.	0.193921	0.44097	N	0.000497	T	0.80949	0.4722	M	0.75085	2.285	0.80722	D	1	D;D;D	0.76494	0.999;0.984;0.98	D;P;P	0.65140	0.932;0.773;0.72	T	0.82684	-0.0335	10	0.72032	D	0.01	-7.15	11.1158	0.48259	0.0886:0.0:0.9114:0.0	.	221;221;221	E9PJM1;Q86SZ6;O15321	.;.;TM9S1_HUMAN	C	221;221;430;134;221;221;134;221;221;430	ENSP00000261789:R221C;ENSP00000432997:R221C;ENSP00000451949:R430C;ENSP00000434387:R134C;ENSP00000380063:R221C;ENSP00000431447:R221C;ENSP00000437127:R134C;ENSP00000435857:R221C;ENSP00000432435:R221C;ENSP00000433967:R430C	ENSP00000433967:R430C	R	-	1	0	TM9SF1;RP11-468E2.1	23732000	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	8.463000	0.90377	1.377000	0.46286	0.655000	0.94253	CGT	-	NULL		0.527	TM9SF1-002	KNOWN	basic|CCDS	protein_coding	TM9SF1	protein_coding	OTTHUMT00000073136.2	G	NM_006405		23732000	-1	no_errors	NM_006405	genbank	human	validated	54_36p	missense	SNP	1	A
CLEC14A	161198	genome.wustl.edu	37	14	38724467	38724467	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr14:38724467C>A	ENST00000342213.2	-	1	1107	c.761G>T	c.(760-762)gGc>gTc	p.G254V		NM_175060.2	NP_778230.1	Q86T13	CLC14_HUMAN	C-type lectin domain family 14, member A	254	EGF-like.					extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)	p.G254V(1)		breast(1)|cervix(2)|endometrium(2)|large_intestine(7)|lung(9)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	33	Hepatocellular(127;0.213)|Esophageal squamous(585;0.22)		Lung(238;3.93e-06)|LUAD - Lung adenocarcinoma(48;2.62e-05)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.00439)		TGCGCATTTGCCAGCACGGAG	0.612																																																1	Substitution - Missense(1)	ovary(1)	14											107.0	117.0	114.0					14																	38724467		2203	4300	6503	37794218	SO:0001583	missense	161198				CCDS9667.1	14q21.1	2010-04-27	2005-02-11	2005-02-11	ENSG00000176435	ENSG00000176435		"""C-type lectin domain containing"""	19832	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 27"""	C14orf27			Standard	NM_175060		Approved		uc001wum.2	Q86T13	OTTHUMG00000140248	ENST00000342213.2:c.761G>T	14.37:g.38724467C>A	ENSP00000353013:p.Gly254Val		37794218	Q695G9|Q6PWT6|Q8N5V5	Missense_Mutation	SNP	-	p.G254V	ENST00000342213.2	37	c.761	CCDS9667.1	14	.	.	.	.	.	.	.	.	.	.	C	15.38	2.817706	0.50633	.	.	ENSG00000176435	ENST00000342213;ENST00000546356	T	0.79454	-1.27	3.81	3.81	0.43845	Epidermal growth factor-like (1);	0.093019	0.39544	N	0.001322	T	0.80742	0.4681	L	0.34521	1.04	0.50039	D	0.999844	D	0.89917	1.0	D	0.91635	0.999	T	0.82010	-0.0669	10	0.87932	D	0	-16.8606	11.4733	0.50282	0.0:1.0:0.0:0.0	.	254	Q86T13	CLC14_HUMAN	V	254;19	ENSP00000353013:G254V	ENSP00000353013:G254V	G	-	2	0	CLEC14A	37794218	0.384000	0.25164	0.567000	0.28434	0.508000	0.34012	1.151000	0.31651	2.439000	0.82584	0.591000	0.81541	GGC	-	NULL		0.612	CLEC14A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLEC14A	protein_coding	OTTHUMT00000276729.1	C	NM_175060		37794218	-1	no_errors	NM_175060	genbank	human	provisional	54_36p	missense	SNP	0.01	A
SPATA7	55812	genome.wustl.edu	37	14	88883125	88883125	+	Silent	SNP	T	T	G			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	T	T	T	G	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr14:88883125T>G	ENST00000393545.4	+	5	598	c.309T>G	c.(307-309)acT>acG	p.T103T	SPATA7_ENST00000556553.1_Silent_p.T71T|SPATA7_ENST00000045347.7_Silent_p.T103T|SPATA7_ENST00000356583.5_Silent_p.T71T	NM_018418.4	NP_060888.2	Q9P0W8	SPAT7_HUMAN	spermatogenesis associated 7	103					response to stimulus (GO:0050896)|visual perception (GO:0007601)			p.T103T(1)		cervix(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)	18						TCAAATTAACTAAAACTGCAA	0.274																																																1	Substitution - coding silent(1)	ovary(1)	14											55.0	60.0	59.0					14																	88883125		2203	4296	6499	87952878	SO:0001819	synonymous_variant	55812			AF144487	CCDS9883.1, CCDS32132.1	14q31.3	2011-02-17				ENSG00000042317			20423	protein-coding gene	gene with protein product		609868	"""Leber congenital amaurosis 3"""	LCA3		9799089, 19268277	Standard	NM_018418		Approved	HSD3	uc001xwq.3	Q9P0W8		ENST00000393545.4:c.309T>G	14.37:g.88883125T>G			87952878	Q5BKY5|Q8WX30|Q96HF3|Q9H0X0|Q9P0W7	Silent	SNP	-	p.T103	ENST00000393545.4	37	c.309	CCDS9883.1	14																																																																																			-	NULL		0.274	SPATA7-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPATA7	protein_coding	OTTHUMT00000410172.1	T			87952878	1	no_errors	NM_018418	genbank	human	validated	54_36p	silent	SNP	0.15	G
TJP1	7082	genome.wustl.edu	37	15	30012114	30012114	+	Missense_Mutation	SNP	T	T	A			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr15:30012114T>A	ENST00000346128.6	-	20	3344	c.2870A>T	c.(2869-2871)gAg>gTg	p.E957V	TJP1_ENST00000356107.6_Missense_Mutation_p.E957V|TJP1_ENST00000400011.2_Intron|TJP1_ENST00000545208.2_Intron	NM_003257.3|NM_175610.2	NP_003248.3|NP_783297.2	Q07157	ZO1_HUMAN	tight junction protein 1	957					apoptotic process (GO:0006915)|blastocyst formation (GO:0001825)|cell-cell junction assembly (GO:0007043)|cell-cell signaling involved in cell-cell junction organization (GO:1901350)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to glucose stimulus (GO:0071333)|hippo signaling (GO:0035329)|membrane organization (GO:0061024)|negative regulation of vascular permeability (GO:0043116)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to magnetism (GO:0071000)|sensory perception of sound (GO:0007605)	apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|basolateral plasma membrane (GO:0016323)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|gap junction (GO:0005921)|intercalated disc (GO:0014704)|intercellular canaliculus (GO:0046581)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)		p.E957V(1)		breast(4)|central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(12)|liver(1)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|urinary_tract(1)	68		all_lung(180;7.48e-11)|Breast(32;0.000153)		all cancers(64;3.29e-10)|Epithelial(43;5.34e-09)|BRCA - Breast invasive adenocarcinoma(123;0.0034)|GBM - Glioblastoma multiforme(186;0.0139)|Lung(196;0.186)		GGTGGGCTCCTCCAGTCTGAC	0.443																																					Melanoma(77;681 1843 6309 6570)											1	Substitution - Missense(1)	ovary(1)	15											139.0	133.0	135.0					15																	30012114		1908	4117	6025	27799406	SO:0001583	missense	7082				CCDS42007.1, CCDS45199.1, CCDS73702.1	15q13	2012-07-12	2012-07-12		ENSG00000104067	ENSG00000104067			11827	protein-coding gene	gene with protein product	"""zona occludens 1"", ""tight junction protein ZO-1"""	601009				8825647	Standard	XM_005254616		Approved	ZO-1, MGC133289, DKFZp686M05161	uc001zcr.3	Q07157	OTTHUMG00000137397	ENST00000346128.6:c.2870A>T	15.37:g.30012114T>A	ENSP00000281537:p.Glu957Val		27799406	B4E3K1|Q2NKP3|Q4ZGJ6	Missense_Mutation	SNP	HMMPfam_ZU5;superfamily_SH3-domain;HMMPfam_PDZ;superfamily_PDZ domain-like;HMMPfam_Guanylate_kin;HMMPfam_SH3_2;superfamily_P-loop containing nucleoside triphosphate hydrolases	p.E957V	ENST00000346128.6	37	c.2870	CCDS42007.1	15	.	.	.	.	.	.	.	.	.	.	T	16.56	3.156564	0.57259	.	.	ENSG00000104067	ENST00000346128;ENST00000545208	T	0.08807	3.05	6.17	5.05	0.67936	.	0.051117	0.85682	D	0.000000	T	0.18173	0.0436	L	0.53249	1.67	0.80722	D	1	D;P	0.71674	0.998;0.919	P;B	0.56343	0.796;0.371	T	0.00512	-1.1696	10	0.44086	T	0.13	.	12.3964	0.55386	0.0:0.0652:0.0:0.9348	.	950;957	A9CQZ8;Q07157	.;ZO1_HUMAN	V	957	ENSP00000281537:E957V	ENSP00000281537:E957V	E	-	2	0	TJP1	27799406	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.293000	0.65680	1.148000	0.42385	0.533000	0.62120	GAG	-	NULL		0.443	TJP1-001	KNOWN	basic|CCDS	protein_coding	TJP1	protein_coding	OTTHUMT00000268237.3	T	NM_003257		27799406	-1	no_errors	NM_003257	genbank	human	validated	54_36p	missense	SNP	1	A
TYRO3	7301	genome.wustl.edu	37	15	41870120	41870120	+	Silent	SNP	C	C	G			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr15:41870120C>G	ENST00000263798.3	+	19	2543	c.2319C>G	c.(2317-2319)ccC>ccG	p.P773P	TYRO3_ENST00000559066.1_Silent_p.P728P	NM_006293.3	NP_006284.2	Q06418	TYRO3_HUMAN	TYRO3 protein tyrosine kinase	773	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic cell clearance (GO:0043277)|cell adhesion (GO:0007155)|forebrain cell migration (GO:0021885)|natural killer cell differentiation (GO:0001779)|negative regulation of inflammatory response (GO:0050728)|negative regulation of innate immune response (GO:0045824)|negative regulation of lymphocyte activation (GO:0051250)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|neuron cellular homeostasis (GO:0070050)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol 3-kinase signaling (GO:0014065)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|protein autophosphorylation (GO:0046777)|protein kinase B signaling (GO:0043491)|secretion by cell (GO:0032940)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|spermatogenesis (GO:0007283)|substrate adhesion-dependent cell spreading (GO:0034446)|vagina development (GO:0060068)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.P765P(1)		central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(26)|ovary(3)|prostate(1)	43		all_cancers(109;7.33e-15)|all_epithelial(112;2.8e-12)|Lung NSC(122;3.48e-08)|all_lung(180;1.71e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.31e-18)|GBM - Glioblastoma multiforme(113;9.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.117)		GTGCTGACCCCAAGCAGCGCC	0.552																																																1	Substitution - coding silent(1)	ovary(1)	15											48.0	55.0	53.0					15																	41870120		2203	4299	6502	39657412	SO:0001819	synonymous_variant	7301			D50479	CCDS10080.1	15q15.1-q21.1	2013-02-11			ENSG00000092445	ENSG00000092445	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12446	protein-coding gene	gene with protein product		600341		RSE		7851890	Standard	NM_006293		Approved	Dtk, Brt, Tif, Sky	uc001zof.2	Q06418	OTTHUMG00000130341	ENST00000263798.3:c.2319C>G	15.37:g.41870120C>G			39657412	O14953|Q86VR3	Silent	SNP	HMMPfam_Pkinase_Tyr;HMMPfam_fn3;superfamily_Fibronectin type III;superfamily_Protein kinase-like (PK-like);HMMPfam_ig;superfamily_Immunoglobulin	p.P773	ENST00000263798.3	37	c.2319	CCDS10080.1	15																																																																																			-	HMMPfam_Pkinase_Tyr		0.552	TYRO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TYRO3	protein_coding	OTTHUMT00000252693.2	C			39657412	1	no_errors	NM_006293	genbank	human	provisional	54_36p	silent	SNP	1	G
MIR7162	102466227	genome.wustl.edu	37	15	62544104	62544104	+	IGR	SNP	A	A	C			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	A	A	A	C	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr15:62544104A>C								hsa-mir-7162 (3110 upstream) : RP11-299H22.5 (11338 downstream)																							AACTCTTACCAATGACTCGAT	0.522																																																0			15																																								60331396	SO:0001628	intergenic_variant	255180																															15.37:g.62544104A>C			60331396		RNA	SNP	-	NULL		37	NULL		15																																																																																			-	-	0	0.522					FLJ38723			A			60331396	-1	no_errors	XR_041381	genbank	human	model	54_36p	rna	SNP	1	C
XYLT1	64131	genome.wustl.edu	37	16	17211515	17211515	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr16:17211515G>C	ENST00000261381.6	-	11	2629	c.2545C>G	c.(2545-2547)Ccc>Gcc	p.P849A		NM_022166.3	NP_071449.1	Q86Y38	XYLT1_HUMAN	xylosyltransferase I	849					cellular response to heat (GO:0034605)|chondroitin sulfate biosynthetic process (GO:0030206)|glycosaminoglycan biosynthetic process (GO:0006024)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|protein xylosyltransferase activity (GO:0030158)	p.P849A(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						GGTTTGATGGGCTGCCTGTTC	0.547																																																1	Substitution - Missense(1)	ovary(1)	16											53.0	49.0	51.0					16																	17211515		2197	4300	6497	17119016	SO:0001583	missense	64131			AJ277441	CCDS10569.1	16p12	2013-02-25			ENSG00000103489	ENSG00000103489	2.4.2.26	"""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	15516	protein-coding gene	gene with protein product	"""protein xylosyltransferase 1"""	608124				11099377	Standard	NM_022166		Approved	XT-I, PXYLT1	uc002dfa.3	Q86Y38	OTTHUMG00000129975	ENST00000261381.6:c.2545C>G	16.37:g.17211515G>C	ENSP00000261381:p.Pro849Ala		17119016	Q9H1B6	Missense_Mutation	SNP	HMMPfam_Branch	p.P849A	ENST00000261381.6	37	c.2545	CCDS10569.1	16	.	.	.	.	.	.	.	.	.	.	G	23.6	4.436463	0.83885	.	.	ENSG00000103489	ENST00000261381	T	0.04758	3.56	5.11	5.11	0.69529	.	0.000000	0.85682	D	0.000000	T	0.17323	0.0416	M	0.85197	2.74	0.80722	D	1	D	0.54207	0.965	P	0.50136	0.632	T	0.01298	-1.1392	10	0.59425	D	0.04	-33.5183	17.8959	0.88888	0.0:0.0:1.0:0.0	.	849	Q86Y38	XYLT1_HUMAN	A	849	ENSP00000261381:P849A	ENSP00000261381:P849A	P	-	1	0	XYLT1	17119016	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	7.929000	0.87595	2.515000	0.84797	0.563000	0.77884	CCC	-	NULL		0.547	XYLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XYLT1	protein_coding	OTTHUMT00000252241.2	G	NM_022166		17119016	-1	no_errors	NM_022166	genbank	human	validated	54_36p	missense	SNP	1	C
NPIPB11	728888	genome.wustl.edu	37	16	29395338	29395338	+	Silent	SNP	G	G	A	rs200145503	byFrequency	TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr16:29395338G>A	ENST00000524087.1	-	8	989	c.915C>T	c.(913-915)ccC>ccT	p.P305P	SNX29P2_ENST00000398878.3_lincRNA			E5RHQ5	NPB11_HUMAN	nuclear pore complex interacting protein family, member B11	305	Pro-rich.					integral component of membrane (GO:0016021)											GCAGACACTCGGGAGGTGTCT	0.582													G|||	1947	0.388778	0.4803	0.3199	5008	,	,		24357	0.253		0.4821	False		,,,				2504	0.3579															0			16																																								29302839	SO:0001819	synonymous_variant	728888					16p11.2	2013-06-11			ENSG00000254206	ENSG00000254206			37453	protein-coding gene	gene with protein product							Standard	XM_006721110		Approved			E5RHQ5	OTTHUMG00000170467	ENST00000524087.1:c.915C>T	16.37:g.29395338G>A			29302839		RNA	SNP	-	NULL	ENST00000524087.1	37	NULL		16																																																																																			-	-		0.582	NPIPB11-001	PUTATIVE	not_best_in_genome_evidence|basic|appris_principal	protein_coding	LOC728888	protein_coding	OTTHUMT00000374094.1	G	XM_002343430		29302839	-1	no_errors	XR_015889	genbank	human	model	54_36p	rna	SNP	0	A
SRCAP	10847	genome.wustl.edu	37	16	30731532	30731532	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	C	C	T	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr16:30731532C>T	ENST00000262518.4	+	19	3252	c.2867C>T	c.(2866-2868)tCt>tTt	p.S956F	SRCAP_ENST00000395059.2_Missense_Mutation_p.S956F|SRCAP_ENST00000344771.4_Missense_Mutation_p.S956F	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	956					histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)	p.S956F(1)		NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			GGTCGTGTCTCTCGATATGAG	0.537																																																1	Substitution - Missense(1)	ovary(1)	16											191.0	191.0	191.0					16																	30731532		2197	4300	6497	30639033	SO:0001583	missense	10847			AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.2867C>T	16.37:g.30731532C>T	ENSP00000262518:p.Ser956Phe		30639033	B0JZA6|O15026|Q7Z744|Q9Y5L9	Missense_Mutation	SNP	-	p.S956F	ENST00000262518.4	37	c.2867	CCDS10689.2	16	.	.	.	.	.	.	.	.	.	.	C	17.50	3.404059	0.62288	.	.	ENSG00000080603	ENST00000262518;ENST00000395059;ENST00000344771	D;D;D	0.92805	-3.11;-3.02;-2.98	5.45	5.45	0.79879	.	0.000000	0.51477	D	0.000084	D	0.94338	0.8180	L	0.54323	1.7	0.40786	D	0.983217	D;D;D	0.76494	0.994;0.999;0.998	D;D;D	0.69654	0.965;0.961;0.915	D	0.94849	0.8012	10	0.87932	D	0	-15.367	13.7646	0.62988	0.0:0.8457:0.1543:0.0	.	956;956;956	Q6ZRS2-3;Q6ZRS2-2;Q6ZRS2	.;.;SRCAP_HUMAN	F	956	ENSP00000262518:S956F;ENSP00000378499:S956F;ENSP00000343042:S956F	ENSP00000262518:S956F	S	+	2	0	SRCAP	30639033	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	5.427000	0.66483	2.569000	0.86673	0.484000	0.47621	TCT	-	NULL		0.537	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRCAP	protein_coding	OTTHUMT00000255523.1	C	NM_006662		30639033	1	no_errors	NM_006662	genbank	human	validated	54_36p	missense	SNP	1	T
BBS2	583	genome.wustl.edu	37	16	56519549	56519549	+	Missense_Mutation	SNP	T	T	C			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr16:56519549T>C	ENST00000245157.5	-	16	2432	c.2012A>G	c.(2011-2013)aAc>aGc	p.N671S	BBS2_ENST00000568104.1_Missense_Mutation_p.N625S	NM_031885.3	NP_114091	Q9BXC9	BBS2_HUMAN	Bardet-Biedl syndrome 2	671					adult behavior (GO:0030534)|artery smooth muscle contraction (GO:0014824)|brain morphogenesis (GO:0048854)|cartilage development (GO:0051216)|cerebral cortex development (GO:0021987)|cilium morphogenesis (GO:0060271)|fat cell differentiation (GO:0045444)|Golgi to plasma membrane protein transport (GO:0043001)|hippocampus development (GO:0021766)|melanosome transport (GO:0032402)|negative regulation of appetite by leptin-mediated signaling pathway (GO:0038108)|negative regulation of gene expression (GO:0010629)|negative regulation of multicellular organism growth (GO:0040015)|nonmotile primary cilium assembly (GO:0035058)|photoreceptor cell maintenance (GO:0045494)|positive regulation of multicellular organism growth (GO:0040018)|protein localization (GO:0008104)|protein localization to organelle (GO:0033365)|regulation of cilium beat frequency involved in ciliary motility (GO:0060296)|sperm axoneme assembly (GO:0007288)|striatum development (GO:0021756)|vasodilation (GO:0042311)|visual perception (GO:0007601)	BBSome (GO:0034464)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	RNA polymerase II repressing transcription factor binding (GO:0001103)	p.N671S(1)		breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)|skin(3)	26						TGCTTTGAGGTTTCCCAACAG	0.383									Bardet-Biedl syndrome																																							1	Substitution - Missense(1)	ovary(1)	16											232.0	226.0	228.0					16																	56519549		2198	4300	6498	55077050	SO:0001583	missense	583	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	AF342736	CCDS32451.1	16q21	2013-01-08				ENSG00000125124			967	protein-coding gene	gene with protein product		606151		BBS		11285252	Standard	NM_031885		Approved		uc002ejd.2	Q9BXC9		ENST00000245157.5:c.2012A>G	16.37:g.56519549T>C	ENSP00000245157:p.Asn671Ser		55077050	Q96CM0|Q96SN9	Missense_Mutation	SNP	superfamily_WD40 repeat-like;HMMPfam_FG-GAP	p.N671S	ENST00000245157.5	37	c.2012	CCDS32451.1	16	.	.	.	.	.	.	.	.	.	.	T	4.983	0.182557	0.09495	.	.	ENSG00000125124	ENST00000245157	D	0.90563	-2.69	5.64	3.41	0.39046	.	0.180588	0.64402	N	0.000014	T	0.79106	0.4390	N	0.16656	0.425	0.37726	D	0.925103	B	0.06786	0.001	B	0.06405	0.002	T	0.67122	-0.5750	10	0.07990	T	0.79	-11.9261	9.0976	0.36649	0.0:0.1525:0.0:0.8475	.	671	Q9BXC9	BBS2_HUMAN	S	671	ENSP00000245157:N671S	ENSP00000245157:N671S	N	-	2	0	BBS2	55077050	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.399000	0.52586	0.440000	0.26502	-0.361000	0.07541	AAC	-	NULL		0.383	BBS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BBS2	protein_coding	OTTHUMT00000434386.2	T	NM_031885		55077050	-1	no_errors	NM_031885	genbank	human	reviewed	54_36p	missense	SNP	1	C
CTCF	10664	genome.wustl.edu	37	16	67645945	67645945	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	G	G	C	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr16:67645945G>C	ENST00000264010.4	+	4	1317	c.873G>C	c.(871-873)gaG>gaC	p.E291D	AC009095.4_ENST00000388909.4_RNA|CTCF_ENST00000401394.1_Intron	NM_006565.3	NP_006556.1	P49711	CTCF_HUMAN	CCCTC-binding factor (zinc finger protein)	291					chromatin modification (GO:0016568)|chromosome segregation (GO:0007059)|DNA methylation (GO:0006306)|maintenance of DNA methylation (GO:0010216)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome positioning (GO:0016584)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of gene expression, epigenetic (GO:0040029)|regulation of histone acetylation (GO:0035065)|regulation of histone methylation (GO:0031060)|regulation of molecular function, epigenetic (GO:0040030)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin insulator sequence binding (GO:0043035)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.E291D(1)		breast(6)|central_nervous_system(2)|cervix(1)|endometrium(34)|haematopoietic_and_lymphoid_tissue(7)|kidney(3)|large_intestine(9)|liver(1)|lung(11)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	79		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0166)|Epithelial(162;0.0577)		ACACTGATGAGAGACCACACA	0.483																																					Colon(175;1200 1966 6945 23069 27405)											1	Substitution - Missense(1)	ovary(1)	16											144.0	116.0	126.0					16																	67645945		2198	4300	6498	66203446	SO:0001583	missense	10664			U25435	CCDS10841.1, CCDS54029.1	16q21-q22.3	2013-01-08			ENSG00000102974	ENSG00000102974		"""Zinc fingers, C2H2-type"""	13723	protein-coding gene	gene with protein product	"""11 zinc finger transcriptional repressor"""	604167				8649389, 18550811	Standard	NM_006565		Approved		uc002etl.3	P49711	OTTHUMG00000137539	ENST00000264010.4:c.873G>C	16.37:g.67645945G>C	ENSP00000264010:p.Glu291Asp		66203446	B5MC38|Q53XI7|Q59EL8	Missense_Mutation	SNP	HMMPfam_zf-C2H2;superfamily_C2H2 and C2HC zinc fingers	p.E291D	ENST00000264010.4	37	c.873	CCDS10841.1	16	.	.	.	.	.	.	.	.	.	.	G	17.51	3.406721	0.62399	.	.	ENSG00000102974	ENST00000264010	T	0.26810	1.71	5.08	3.0	0.34707	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.64402	D	0.000003	T	0.43942	0.1270	M	0.71581	2.175	0.80722	D	1	D	0.63046	0.992	D	0.74348	0.983	T	0.38564	-0.9655	10	0.87932	D	0	.	6.8498	0.24008	0.3331:0.0:0.6669:0.0	.	291	P49711	CTCF_HUMAN	D	291	ENSP00000264010:E291D	ENSP00000264010:E291D	E	+	3	2	CTCF	66203446	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.679000	0.46909	1.369000	0.46134	0.655000	0.94253	GAG	-	NULL		0.483	CTCF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTCF	protein_coding	OTTHUMT00000268870.2	G	NM_006565		66203446	1	no_errors	NM_006565	genbank	human	reviewed	54_36p	missense	SNP	1	C
MYH4	4622	genome.wustl.edu	37	17	10357115	10357115	+	Missense_Mutation	SNP	T	T	G			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	T	T	G	G	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr17:10357115T>G	ENST00000255381.2	-	23	2889	c.2779A>C	c.(2779-2781)Act>Cct	p.T927P	CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|RP11-799N11.1_ENST00000399342.2_RNA	NM_017533.2	NP_060003.2	Q9Y623	MYH4_HUMAN	myosin, heavy chain 4, skeletal muscle	927					actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to activity (GO:0014823)	muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|microfilament motor activity (GO:0000146)	p.T927P(1)		NS(4)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(72)|ovary(10)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	149						GCTCTTTCAGTTACCTCTTTG	0.428																																																1	Substitution - Missense(1)	ovary(1)	17											356.0	327.0	337.0					17																	10357115		2203	4300	6503	10297840	SO:0001583	missense	4622				CCDS11154.1	17p13.1	2013-09-19	2006-09-29		ENSG00000264424	ENSG00000264424		"""Myosins / Myosin superfamily : Class II"""	7574	protein-coding gene	gene with protein product		160742	"""myosin, heavy polypeptide 4, skeletal muscle"""			8518795	Standard	NM_017533		Approved	MYH2B, MyHC-2B, MyHC-IIb	uc002gmn.3	Q9Y623	OTTHUMG00000130365	ENST00000255381.2:c.2779A>C	17.37:g.10357115T>G	ENSP00000255381:p.Thr927Pro		10297840		Missense_Mutation	SNP	HMMPfam_IQ;HMMPfam_Myosin_head;HMMPfam_Myosin_tail_1;HMMPfam_Myosin_N;superfamily_Prefoldin;superfamily_Spectrin repeat;superfamily_P-loop containing nucleoside triphosphate hydrolases	p.T927P	ENST00000255381.2	37	c.2779	CCDS11154.1	17	.	.	.	.	.	.	.	.	.	.	T	10.42	1.344087	0.24339	.	.	ENSG00000141048	ENST00000255381	D	0.83419	-1.72	5.43	5.43	0.79202	.	0.000000	0.38492	U	0.001679	D	0.86535	0.5956	M	0.89214	3.015	0.41106	D	0.985708	P	0.41080	0.737	B	0.40228	0.323	D	0.89265	0.3600	10	0.66056	D	0.02	.	15.7669	0.78135	0.0:0.0:0.0:1.0	.	927	Q9Y623	MYH4_HUMAN	P	927	ENSP00000255381:T927P	ENSP00000255381:T927P	T	-	1	0	MYH4	10297840	0.975000	0.34042	0.623000	0.29173	0.192000	0.23643	1.977000	0.40589	2.180000	0.69256	0.533000	0.62120	ACT	-	NULL		0.428	MYH4-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	MYH4	protein_coding	OTTHUMT00000252731.1	T	NM_017533		10297840	-1	no_errors	NM_017533	genbank	human	validated	54_36p	missense	SNP	0.96	G
MYH2	4620	genome.wustl.edu	37	17	10441068	10441068	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr17:10441068G>T	ENST00000245503.5	-	15	1885	c.1501C>A	c.(1501-1503)Cag>Aag	p.Q501K	CTC-297N7.11_ENST00000587182.2_RNA|MYH2_ENST00000397183.2_Missense_Mutation_p.Q501K|RP11-799N11.1_ENST00000581304.1_RNA|RP11-799N11.1_ENST00000399342.2_RNA|MYH2_ENST00000532183.2_Missense_Mutation_p.Q501K	NM_017534.5	NP_060004.3	Q9UKX2	MYH2_HUMAN	myosin, heavy chain 2, skeletal muscle, adult	501	Myosin motor.				Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|plasma membrane repair (GO:0001778)|response to activity (GO:0014823)	A band (GO:0031672)|actomyosin contractile ring (GO:0005826)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|protein complex (GO:0043234)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)	p.Q501K(1)		NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(99)|ovary(6)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(4)	176						TACTCCTCCTGCTCCAGCACG	0.478																																																1	Substitution - Missense(1)	ovary(1)	17											175.0	148.0	157.0					17																	10441068		2203	4300	6503	10381793	SO:0001583	missense	4620				CCDS11156.1	17p13.1	2014-02-04	2006-09-29		ENSG00000125414	ENSG00000125414		"""Myosins / Myosin superfamily : Class II"""	7572	protein-coding gene	gene with protein product		160740	"""myosin, heavy polypeptide 2, skeletal muscle, adult"", ""inclusion body myopathy 3, autosomal dominant"""	IBM3		7545970, 11889243	Standard	NM_001100112		Approved	MYH2A, MYHSA2, MyHC-IIa, MYHas8, MyHC-2A	uc010coi.3	Q9UKX2	OTTHUMG00000130363	ENST00000245503.5:c.1501C>A	17.37:g.10441068G>T	ENSP00000245503:p.Gln501Lys		10381793	A0AVL4|Q14322|Q16229|Q567P6|Q86T56	Missense_Mutation	SNP	-	p.Q501K	ENST00000245503.5	37	c.1501	CCDS11156.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	34|34	5.386866|5.386866	0.95967|0.95967	.|.	.|.	ENSG00000214970|ENSG00000125414	ENST00000399342|ENST00000532183;ENST00000245503;ENST00000397183	.|T;T;T	.|0.75477	.|-0.94;-0.94;-0.94	5.51|5.51	5.51|5.51	0.81932|0.81932	.|Myosin head, motor domain (2);	.|0.000000	.|0.37483	.|U	.|0.002063	D|D	0.91005|0.91005	0.7171|0.7171	H|H	0.96142|0.96142	3.775|3.775	0.58432|0.58432	D|D	0.999999|0.999999	.|P;B	.|0.46064	.|0.872;0.445	.|D;P	.|0.67103	.|0.949;0.538	D|D	0.93184|0.93184	0.6577|0.6577	6|10	0.87932|0.87932	D|D	0|0	.|.	18.4152|18.4152	0.90567|0.90567	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|501;501	.|Q567P6;Q9UKX2	.|.;MYH2_HUMAN	F|K	47|501	.|ENSP00000433944:Q501K;ENSP00000245503:Q501K;ENSP00000380367:Q501K	ENSP00000382280:C47F|ENSP00000245503:Q501K	C|Q	+|-	2|1	0|0	AC005323.1|MYH2	10381793|10381793	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	9.823000|9.823000	0.99369|0.99369	2.603000|2.603000	0.88011|0.88011	0.655000|0.655000	0.94253|0.94253	TGC|CAG	-	NULL		0.478	MYH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH2	protein_coding	OTTHUMT00000252726.3	G	NM_017534		10381793	-1	no_errors	NM_001100112	genbank	human	validated	54_36p	missense	SNP	1	T
ALDH3A2	224	genome.wustl.edu	37	17	19568264	19568264	+	Missense_Mutation	SNP	A	A	G			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr17:19568264A>G	ENST00000176643.6	+	8	1557	c.1111A>G	c.(1111-1113)Atc>Gtc	p.I371V	SNORA31_ENST00000516540.1_RNA|ALDH3A2_ENST00000339618.4_Missense_Mutation_p.I371V|ALDH3A2_ENST00000395575.2_Missense_Mutation_p.I371V|ALDH3A2_ENST00000581518.1_Missense_Mutation_p.I371V|ALDH3A2_ENST00000579855.1_Missense_Mutation_p.I371V|ALDH3A2_ENST00000571163.1_Missense_Mutation_p.I44V			P51648	AL3A2_HUMAN	aldehyde dehydrogenase 3 family, member A2	371					cellular aldehyde metabolic process (GO:0006081)|central nervous system development (GO:0007417)|epidermis development (GO:0008544)|oxidation-reduction process (GO:0055114)|peripheral nervous system development (GO:0007422)|phytol metabolic process (GO:0033306)|sesquiterpenoid metabolic process (GO:0006714)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrial inner membrane (GO:0005743)|peroxisome (GO:0005777)	aldehyde dehydrogenase (NAD) activity (GO:0004029)|aldehyde dehydrogenase [NAD(P)+] activity (GO:0004030)|long-chain-alcohol oxidase activity (GO:0046577)|long-chain-aldehyde dehydrogenase activity (GO:0050061)|medium-chain-aldehyde dehydrogenase activity (GO:0052814)	p.I371V(1)		endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(2)|ovary(2)|prostate(1)	13	all_cancers(12;1.39e-05)|all_epithelial(12;0.00158)|Breast(13;0.245)					TCCTCAGCTCATCAAACGGAT	0.517																																																1	Substitution - Missense(1)	ovary(1)	17											135.0	97.0	110.0					17																	19568264		2203	4300	6503	19508856	SO:0001583	missense	224			L47162	CCDS11210.1, CCDS32589.1	17p11.2	2010-05-07			ENSG00000072210	ENSG00000072210	1.2.1.3	"""Aldehyde dehydrogenases"""	403	protein-coding gene	gene with protein product	"""fatty aldehyde dehydrogenase"""	609523		SLS, ALDH10		7894487	Standard	NM_000382		Approved	FALDH	uc002gwa.1	P51648	OTTHUMG00000059471	ENST00000176643.6:c.1111A>G	17.37:g.19568264A>G	ENSP00000176643:p.Ile371Val		19508856	Q6I9T3|Q93011|Q96J37	Missense_Mutation	SNP	HMMPfam_Aldedh;superfamily_ALDH-like	p.I371V	ENST00000176643.6	37	c.1111	CCDS11210.1	17	.	.	.	.	.	.	.	.	.	.	A	8.934	0.964232	0.18583	.	.	ENSG00000072210	ENST00000176643;ENST00000395575;ENST00000339618	T;T;T	0.76839	-1.05;-1.05;-1.05	5.41	2.89	0.33648	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, C-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.235594	0.48767	N	0.000161	T	0.60521	0.2275	L	0.28115	0.83	0.52099	D	0.999945	B;B	0.14012	0.008;0.009	B;B	0.21546	0.035;0.01	T	0.49725	-0.8909	10	0.02654	T	1	-11.3227	10.855	0.46794	0.9108:0.0:0.0892:0.0	.	371;371	P51648;P51648-2	AL3A2_HUMAN;.	V	371	ENSP00000176643:I371V;ENSP00000378942:I371V;ENSP00000345774:I371V	ENSP00000176643:I371V	I	+	1	0	ALDH3A2	19508856	0.988000	0.35896	0.997000	0.53966	0.988000	0.76386	2.681000	0.46926	0.238000	0.21222	0.533000	0.62120	ATC	-	HMMPfam_Aldedh		0.517	ALDH3A2-001	KNOWN	basic|CCDS	protein_coding	ALDH3A2	protein_coding	OTTHUMT00000132268.1	A			19508856	1	no_errors	NM_001031806	genbank	human	reviewed	54_36p	missense	SNP	1	G
NSRP1	84081	genome.wustl.edu	37	17	28512336	28512336	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr17:28512336G>A	ENST00000247026.5	+	7	1384	c.1321G>A	c.(1321-1323)Gag>Aag	p.E441K	NSRP1_ENST00000540900.3_3'UTR	NM_001261467.1|NM_032141.3	NP_001248396.1|NP_115517.1	Q9H0G5	NSRP1_HUMAN	nuclear speckle splicing regulatory protein 1	441					developmental process (GO:0032502)|mRNA processing (GO:0006397)|nucleocytoplasmic transport (GO:0006913)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)	p.E441K(1)		autonomic_ganglia(1)|endometrium(2)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)	14						agaaaaaCGAGAGGTAGGTGT	0.363																																																1	Substitution - Missense(1)	ovary(1)	17											59.0	59.0	59.0					17																	28512336		2203	4300	6503	25536462	SO:0001583	missense	84081			AL136806	CCDS11255.1, CCDS74025.1	17q11.2	2011-05-24	2011-05-24	2011-05-24	ENSG00000126653	ENSG00000126653			25305	protein-coding gene	gene with protein product			"""coiled-coil domain containing 55"""	CCDC55		11230166	Standard	NM_032141		Approved	DKFZP434K1421, NSrp70	uc002heu.4	Q9H0G5	OTTHUMG00000132754	ENST00000247026.5:c.1321G>A	17.37:g.28512336G>A	ENSP00000247026:p.Glu441Lys		25536462	Q6FI71	Missense_Mutation	SNP	-	p.E441K	ENST00000247026.5	37	c.1321	CCDS11255.1	17	.	.	.	.	.	.	.	.	.	.	G	14.47	2.545468	0.45280	.	.	ENSG00000126653	ENST00000247026;ENST00000540900	T	0.50548	0.74	5.58	5.58	0.84498	.	0.228496	0.35708	N	0.003038	T	0.42449	0.1203	L	0.51422	1.61	0.80722	D	1	B	0.30482	0.281	B	0.27796	0.083	T	0.19811	-1.0294	10	0.25751	T	0.34	-10.1916	15.5125	0.75795	0.0:0.0:1.0:0.0	.	441	Q9H0G5	NSRP1_HUMAN	K	441;372	ENSP00000247026:E441K	ENSP00000247026:E441K	E	+	1	0	NSRP1	25536462	0.738000	0.28186	0.073000	0.20177	0.738000	0.42128	3.087000	0.50167	2.816000	0.96949	0.644000	0.83932	GAG	-	NULL		0.363	NSRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC55	protein_coding	OTTHUMT00000256121.2	G	NM_032141		25536462	1	no_errors	NM_032141	genbank	human	validated	54_36p	missense	SNP	0.02	A
ATAD5	79915	genome.wustl.edu	37	17	29204471	29204471	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr17:29204471G>C	ENST00000321990.4	+	16	4200	c.3822G>C	c.(3820-3822)caG>caC	p.Q1274H		NM_024857.3	NP_079133.3	Q96QE3	ATAD5_HUMAN	ATPase family, AAA domain containing 5	1274					cellular response to DNA damage stimulus (GO:0006974)	nucleus (GO:0005634)	ATP binding (GO:0005524)	p.Q1274H(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(18)|lung(13)|ovary(3)|pancreas(1)	51		all_hematologic(16;0.0202)|Acute lymphoblastic leukemia(14;0.0238)|Myeloproliferative disorder(56;0.0393)				AAATTACTCAGACTAAATCTA	0.303																																																1	Substitution - Missense(1)	ovary(1)	17											53.0	57.0	56.0					17																	29204471		2203	4298	6501	26228597	SO:0001583	missense	79915				CCDS11260.1	17q11.2	2010-04-21	2007-02-08	2007-02-08	ENSG00000176208	ENSG00000176208		"""ATPases / AAA-type"""	25752	protein-coding gene	gene with protein product	"""enhanced level of genomic instability 1 homolog (S. cerevisiae)"""	609534	"""chromosome 17 open reading frame 41"""	C17orf41		15983387, 11468690, 19755857	Standard	NM_024857		Approved	FLJ12735, FRAG1, ELG1	uc002hfs.1	Q96QE3	OTTHUMG00000132794	ENST00000321990.4:c.3822G>C	17.37:g.29204471G>C	ENSP00000313171:p.Gln1274His		26228597	Q05DH0|Q69YR6|Q9H9I1	Missense_Mutation	SNP	HMMPfam_AAA;superfamily_P-loop containing nucleoside triphosphate hydrolases	p.Q1274H	ENST00000321990.4	37	c.3822	CCDS11260.1	17	.	.	.	.	.	.	.	.	.	.	G	10.28	1.307934	0.23821	.	.	ENSG00000176208	ENST00000321990	T	0.06849	3.25	5.09	-0.0231	0.13945	ATPase, AAA+ type, core (1);	2.948060	0.00890	N	0.002224	T	0.09686	0.0238	L	0.51422	1.61	0.09310	N	1	B	0.19706	0.038	B	0.14578	0.011	T	0.34850	-0.9812	10	0.51188	T	0.08	.	3.9543	0.09383	0.2207:0.0:0.4675:0.3118	.	1274	Q96QE3	ATAD5_HUMAN	H	1274	ENSP00000313171:Q1274H	ENSP00000313171:Q1274H	Q	+	3	2	ATAD5	26228597	0.140000	0.22579	0.040000	0.18447	0.942000	0.58702	0.155000	0.16362	0.215000	0.20761	0.485000	0.47835	CAG	-	NULL		0.303	ATAD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATAD5	protein_coding	OTTHUMT00000256206.2	G	NM_024857		26228597	1	no_errors	NM_024857	genbank	human	provisional	54_36p	missense	SNP	0.16	C
ASIC2	40	genome.wustl.edu	37	17	31348302	31348312	+	Frame_Shift_Del	DEL	AATATATCCAG	AATATATCCAG	-			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	AATATATCCAG	AATATATCCAG	AATATATCCAG	-	AATATATCCAG	AATATATCCAG	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr17:31348302_31348312delAATATATCCAG	ENST00000359872.6	-	7	1974_1984	c.1213_1223delCTGGATATATT	c.(1213-1224)ctggatatatttfs	p.LDIF405fs	ASIC2_ENST00000448983.1_5'Flank|ASIC2_ENST00000225823.2_Frame_Shift_Del_p.LDIF456fs	NM_001094.4	NP_001085.2	Q16515	ASIC2_HUMAN	acid-sensing (proton-gated) ion channel 2	405					central nervous system development (GO:0007417)|detection of mechanical stimulus involved in sensory perception (GO:0050974)|ion transmembrane transport (GO:0034220)|monovalent inorganic cation transport (GO:0015672)|negative regulation of apoptotic process (GO:0043066)|peripheral nervous system development (GO:0007422)|phototransduction (GO:0007602)|positive regulation of synapse assembly (GO:0051965)|protein localization to synapse (GO:0035418)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)|regulation of membrane potential (GO:0042391)|regulation of systemic arterial blood pressure by aortic arch baroreceptor feedback (GO:0003026)|regulation of vasoconstriction (GO:0019229)|response to acid chemical (GO:0001101)|response to acidic pH (GO:0010447)|sensory perception of sound (GO:0007605)|sensory perception of sour taste (GO:0050915)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ion gated channel activity (GO:0022839)|ligand-gated sodium channel activity (GO:0015280)|voltage-gated sodium channel activity (GO:0005248)	p.L456fs*2(1)								Amiloride(DB00594)	AGCTTCAAAAAATATATCCAGAACAAGGATG	0.398																																																1	Deletion - Frameshift(1)	ovary(1)	17																																								28372425	SO:0001589	frameshift_variant	40			AL834182	CCDS11276.1, CCDS42296.1	17q11.2-q12	2012-02-23	2012-02-22	2012-02-22	ENSG00000108684	ENSG00000108684		"""Ion channels / Acid-sensing (proton-gated) ion channels"""	99	protein-coding gene	gene with protein product	"""degenerin"""	601784	"""amiloride-sensitive cation channel 1, neuronal"""	ACCN, ACCN1		8921408	Standard	NM_183377		Approved	ASIC2a, BNC1, BNaC1, hBNaC1, MDEG	uc002hhu.3	Q16515	OTTHUMG00000132885	ENST00000359872.6:c.1213_1223delCTGGATATATT	17.37:g.31348302_31348312delAATATATCCAG	ENSP00000352934:p.Leu405fs		28372415	E9PBX2|Q13553|Q6DJU1|Q8N3E2	Frame_Shift_Del	DEL	-	p.L456fs	ENST00000359872.6	37	c.1376_1366	CCDS42296.1	17																																																																																			(deletion:cds_exon[28372350;28372441])	NULL		0.398	ASIC2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ACCN1	protein_coding	OTTHUMT00000447552.1	AATATATCCAG	NM_183377, NM_001094		28372425	-1	no_errors	NM_183377	genbank	human	reviewed	54_36p	frame_shift_del	DEL	1.000:1.000:1.000:1.000:0.998:0.998:1.000:1.000:1.000:1.000:0.998	-
ACLY	47	genome.wustl.edu	37	17	40069998	40069998	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr17:40069998C>G	ENST00000352035.2	-	2	259	c.129G>C	c.(127-129)ttG>ttC	p.L43F	ACLY_ENST00000393896.2_Missense_Mutation_p.L43F|ACLY_ENST00000537919.1_Missense_Mutation_p.L43F|ACLY_ENST00000353196.1_Missense_Mutation_p.L43F|ACLY_ENST00000590151.1_Missense_Mutation_p.L43F	NM_001096.2	NP_001087.2	P53396	ACLY_HUMAN	ATP citrate lyase	43	ATP-grasp.				ATP catabolic process (GO:0006200)|cellular carbohydrate metabolic process (GO:0044262)|cellular lipid metabolic process (GO:0044255)|citrate metabolic process (GO:0006101)|coenzyme A metabolic process (GO:0015936)|energy reserve metabolic process (GO:0006112)|lipid biosynthetic process (GO:0008610)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	citrate lyase complex (GO:0009346)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATP citrate synthase activity (GO:0003878)|cofactor binding (GO:0048037)|metal ion binding (GO:0046872)|succinate-CoA ligase (ADP-forming) activity (GO:0004775)	p.L43F(1)	NTN1/ACLY(2)	breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(4)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	28		Breast(137;0.000143)				GGTCCTGCAGCAAGCGGGCCC	0.577																																					Colon(64;807 1396 15971 30971)											1	Substitution - Missense(1)	ovary(1)	17											109.0	92.0	98.0					17																	40069998		2203	4300	6503	37323524	SO:0001583	missense	47			X64330	CCDS11412.1, CCDS11413.1	17q21.2	2010-04-27			ENSG00000131473	ENSG00000131473	2.3.3.8		115	protein-coding gene	gene with protein product	"""ATP citrate synthase"""	108728				1371749, 8088842	Standard	NM_001096		Approved	ATPCL, CLATP, ACL	uc002hyg.3	P53396	OTTHUMG00000133507	ENST00000352035.2:c.129G>C	17.37:g.40069998C>G	ENSP00000253792:p.Leu43Phe		37323524	B4DIM0|B4E3P0|Q13037|Q9BRL0	Missense_Mutation	SNP	HMMPfam_CoA_binding;HMMPfam_Ligase_CoA;superfamily_Citrate synthase;superfamily_NAD(P)-binding Rossmann-fold domains;superfamily_Succinyl-CoA synthetase domains;superfamily_Glutathione synthetase ATP-binding domain-like	p.L43F	ENST00000352035.2	37	c.129	CCDS11412.1	17	.	.	.	.	.	.	.	.	.	.	C	15.14	2.745937	0.49151	.	.	ENSG00000131473	ENST00000352035;ENST00000401700;ENST00000353196;ENST00000537919;ENST00000393896	T;T;T;T	0.71698	-0.59;-0.59;-0.59;-0.59	5.49	3.48	0.39840	.	0.000000	0.85682	D	0.000000	T	0.80347	0.4606	M	0.67569	2.06	0.58432	D	0.999999	D;D;D;D;D	0.65815	0.995;0.989;0.994;0.958;0.989	D;P;P;P;P	0.72982	0.979;0.835;0.835;0.855;0.835	T	0.79852	-0.1628	10	0.56958	D	0.05	.	10.855	0.46794	0.0:0.6254:0.3019:0.0727	.	43;97;97;43;43	B4E3P0;B4DIM0;E7ENH9;G3XAI4;P53396	.;.;.;.;ACLY_HUMAN	F	43;97;43;43;43	ENSP00000253792:L43F;ENSP00000345398:L43F;ENSP00000445349:L43F;ENSP00000377474:L43F	ENSP00000253792:L43F	L	-	3	2	ACLY	37323524	1.000000	0.71417	0.985000	0.45067	0.997000	0.91878	2.005000	0.40864	0.771000	0.33359	0.563000	0.77884	TTG	-	NULL		0.577	ACLY-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ACLY	protein_coding	OTTHUMT00000257465.1	C	NM_001096		37323524	-1	no_errors	NM_001096	genbank	human	reviewed	54_36p	missense	SNP	0.99	G
KCNJ16	3773	genome.wustl.edu	37	17	68128366	68128366	+	Silent	SNP	C	C	T			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr17:68128366C>T	ENST00000589377.1	+	2	301	c.138C>T	c.(136-138)taC>taT	p.Y46Y	KCNJ16_ENST00000392670.1_Silent_p.Y46Y|KCNJ16_ENST00000283936.1_Silent_p.Y46Y|KCNJ16_ENST00000585558.1_Silent_p.Y81Y|KCNJ16_ENST00000586462.1_Silent_p.Y85Y|KCNJ16_ENST00000392671.1_Silent_p.Y46Y	NM_001270422.1	NP_001257351.1	Q9NPI9	KCJ16_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 16	46					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	inward rectifier potassium channel activity (GO:0005242)	p.Y46Y(1)		breast(3)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	32	Breast(10;2.96e-09)					GTAATGTCTACTTCAAGCACA	0.443																																																1	Substitution - coding silent(1)	ovary(1)	17											237.0	214.0	222.0					17																	68128366		2203	4300	6503	65639961	SO:0001819	synonymous_variant	3773			AF153815	CCDS11687.1, CCDS74141.1	17q24.3	2011-07-05				ENSG00000153822		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6262	protein-coding gene	gene with protein product		605722				11240146, 16382105	Standard	NM_018658		Approved	Kir5.1, BIR9	uc002jio.4	Q9NPI9		ENST00000589377.1:c.138C>T	17.37:g.68128366C>T			65639961		Silent	SNP	HMMPfam_IRK;superfamily_E set domains;superfamily_Voltage-gated potassium channels	p.Y46	ENST00000589377.1	37	c.138	CCDS11687.1	17																																																																																			-	HMMPfam_IRK		0.443	KCNJ16-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNJ16	protein_coding	OTTHUMT00000450880.1	C	NM_018658		65639961	1	no_errors	NM_018658	genbank	human	reviewed	54_36p	silent	SNP	1	T
OTOP3	347741	genome.wustl.edu	37	17	72943550	72943550	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	C	C	T	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr17:72943550C>T	ENST00000328801.4	+	6	1600	c.1600C>T	c.(1600-1602)Ctc>Ttc	p.L534F		NM_178233.1	NP_839947.1	Q7RTS5	OTOP3_HUMAN	otopetrin 3	534						integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)	p.L534F(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23	all_lung(278;0.151)|Lung NSC(278;0.185)					CTCACTCTTCCTCATCCTCTG	0.602																																																1	Substitution - Missense(1)	ovary(1)	17											23.0	25.0	24.0					17																	72943550		2189	4261	6450	70455145	SO:0001583	missense	347741			BK000568	CCDS11709.1	17q25	2004-01-19				ENSG00000182938			19658	protein-coding gene	gene with protein product		607828				12651873	Standard	NM_178233		Approved		uc010wrr.3	Q7RTS5		ENST00000328801.4:c.1600C>T	17.37:g.72943550C>T	ENSP00000328090:p.Leu534Phe		70455145		Missense_Mutation	SNP	-	p.L534F	ENST00000328801.4	37	c.1600	CCDS11709.1	17	.	.	.	.	.	.	.	.	.	.	C	16.19	3.054074	0.55218	.	.	ENSG00000182938	ENST00000328801	T	0.53640	0.61	4.44	4.44	0.53790	.	0.000000	0.56097	D	0.000032	T	0.52306	0.1726	M	0.84082	2.675	0.51767	D	0.99993	P	0.36110	0.537	B	0.39935	0.314	T	0.60667	-0.7218	10	0.87932	D	0	-31.0058	8.5845	0.33649	0.0:0.8564:0.0:0.1436	.	534	Q7RTS5	OTOP3_HUMAN	F	534	ENSP00000328090:L534F	ENSP00000328090:L534F	L	+	1	0	OTOP3	70455145	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	2.442000	0.44873	2.320000	0.78422	0.456000	0.33151	CTC	-	NULL		0.602	OTOP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OTOP3	protein_coding	OTTHUMT00000445308.1	C	NM_178233		70455145	1	no_errors	NM_178233	genbank	human	provisional	54_36p	missense	SNP	1	T
TP53	7157	genome.wustl.edu	37	17	7574030	7574030	+	Frame_Shift_Del	DEL	G	G	-			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	G	G	G	-	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr17:7574030delG	ENST00000269305.4	-	10	1186	c.997delC	c.(997-999)cgtfs	p.R333fs	TP53_ENST00000445888.2_Frame_Shift_Del_p.R333fs|TP53_ENST00000359597.4_Intron|TP53_ENST00000455263.2_3'UTR|TP53_ENST00000413465.2_Intron|TP53_ENST00000420246.2_3'UTR	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	333	Interaction with CARM1.|Interaction with HIPK1. {ECO:0000250}.|Interaction with HIPK2.|Oligomerization.				apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.R333fs*12(3)|p.I332fs*5(1)|p.?(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TCACGCCCACGGATCTGCAGC	0.512		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	13	Whole gene deletion(8)|Deletion - Frameshift(4)|Unknown(1)	bone(4)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|breast(2)|large_intestine(1)|stomach(1)|ovary(1)	17											45.0	37.0	40.0					17																	7574030		2203	4300	6503	7514755	SO:0001589	frameshift_variant	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.997delC	17.37:g.7574030delG	ENSP00000269305:p.Arg333fs		7514755	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	superfamily_p53-like transcription factors;superfamily_p53 tetramerization domain;P53_tetramer;HMMPfam_P53_tetramer;P53;HMMPfam_P53;P53_TAD;HMMPfam_P53_TAD	p.R333fs	ENST00000269305.4	37	c.997	CCDS11118.1	17																																																																																			(deletion:cds_exon[7514652;7514758])	HMMPfam_P53_tetramer		0.512	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	G	NM_000546		7514755	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	frame_shift_del	DEL	0.03	-
DNAH17	8632	genome.wustl.edu	37	17	76497305	76497305	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr17:76497305C>A	ENST00000585328.1	-	35	5553	c.5429G>T	c.(5428-5430)gGc>gTc	p.G1810V	DNAH17_ENST00000389840.5_Missense_Mutation_p.G1801V|DNAH17-AS1_ENST00000598378.1_3'UTR|RP11-559N14.5_ENST00000591373.1_RNA	NM_173628.3	NP_775899.3	Q9UFH2	DYH17_HUMAN	dynein, axonemal, heavy chain 17	1801	AAA 1. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.G1810V(1)		NS(2)|breast(7)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(8)|lung(37)|ovary(8)|prostate(7)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	116			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			CGGCGTGTTGCCCAGATACTC	0.577																																																1	Substitution - Missense(1)	ovary(1)	17											101.0	113.0	109.0					17																	76497305		2176	4288	6464	74008900	SO:0001583	missense	8632			AJ000522		17q25.3	2012-04-19	2006-09-04		ENSG00000187775	ENSG00000187775		"""Axonemal dyneins"""	2946	protein-coding gene	gene with protein product		610063	"""dynein, axonemal, heavy polypeptide 17"", ""dynein, axonemal, heavy chain like 1"", ""dynein, axonemal, heavy like 1"""	DNAHL1		9545504	Standard	NM_173628		Approved	DNEL2, FLJ40457	uc010dhp.2	Q9UFH2		ENST00000585328.1:c.5429G>T	17.37:g.76497305C>A	ENSP00000465516:p.Gly1810Val		74008900	O00431|O15206|Q2M2Y1|Q6ZRQ2|Q8N7Q7	Missense_Mutation	SNP	-	p.G1810V	ENST00000585328.1	37	c.5429		17	.	.	.	.	.	.	.	.	.	.	C	24.0	4.481682	0.84747	.	.	ENSG00000187775	ENST00000300671;ENST00000389840	T	0.17528	2.27	4.24	4.24	0.50183	.	.	.	.	.	T	0.62282	0.2415	H	0.99074	4.42	0.80722	D	1	.	.	.	.	.	.	T	0.81583	-0.0866	7	0.87932	D	0	.	16.995	0.86365	0.0:1.0:0.0:0.0	.	.	.	.	V	1810;1801	ENSP00000374490:G1801V	ENSP00000300671:G1810V	G	-	2	0	DNAH17	74008900	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.567000	0.82357	2.067000	0.61834	0.448000	0.29417	GGC	-	NULL		0.577	DNAH17-001	PUTATIVE	not_organism_supported|basic|appris_principal	protein_coding	DNAH17	protein_coding	OTTHUMT00000318962.2	C	NM_173628		74008900	-1	no_errors	ENST00000300671	ensembl	human	known	54_36p	missense	SNP	1	A
CCDC57	284001	genome.wustl.edu	37	17	80146286	80146286	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	C	C	G	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr17:80146286C>G	ENST00000389641.4	-	7	897	c.861G>C	c.(859-861)gaG>gaC	p.E287D	CCDC57_ENST00000392347.1_Missense_Mutation_p.E287D|CCDC57_ENST00000392343.3_Missense_Mutation_p.E287D			Q2TAC2	CCD57_HUMAN	coiled-coil domain containing 57	287								p.E287D(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(2)|prostate(1)|urinary_tract(1)	16	Breast(20;0.00285)|all_neural(118;0.0878)|all_lung(278;0.0949)|Lung NSC(278;0.128)|Ovarian(332;0.227)		BRCA - Breast invasive adenocarcinoma(99;0.0232)|OV - Ovarian serous cystadenocarcinoma(97;0.0253)			GACGGTCGAGCTCCTCATGCC	0.637																																																1	Substitution - Missense(1)	ovary(1)	17											41.0	45.0	44.0					17																	80146286		2168	4256	6424	77739575	SO:0001583	missense	284001			BC040264		17q25.3	2006-03-08			ENSG00000176155	ENSG00000176155			27564	protein-coding gene	gene with protein product						12477932	Standard	XM_006722279		Approved	FLJ00130, FLJ23754	uc002kdx.1	Q2TAC2	OTTHUMG00000140396	ENST00000389641.4:c.861G>C	17.37:g.80146286C>G	ENSP00000374292:p.Glu287Asp		77739575	A6NP51|A8MQC7|Q8IWG2|Q8TER3	Missense_Mutation	SNP	-	p.E287D	ENST00000389641.4	37	c.861		17	.	.	.	.	.	.	.	.	.	.	C	12.96	2.094828	0.36952	.	.	ENSG00000176155	ENST00000389641;ENST00000392347;ENST00000392343	T;T;T	0.35973	2.51;2.51;1.28	5.54	4.58	0.56647	.	0.493655	0.21582	N	0.072224	T	0.48624	0.1510	L	0.59436	1.845	0.80722	D	1	D;D	0.67145	0.965;0.996	P;P	0.62089	0.724;0.898	T	0.36841	-0.9731	10	0.22109	T	0.4	-15.1752	10.4521	0.44528	0.0:0.91:0.0:0.09	.	287;287	Q2TAC2-2;Q2TAC2	.;CCD57_HUMAN	D	287	ENSP00000374292:E287D;ENSP00000376158:E287D;ENSP00000376154:E287D	ENSP00000374292:E287D	E	-	3	2	CCDC57	77739575	0.991000	0.36638	0.994000	0.49952	0.911000	0.54048	0.721000	0.25911	1.343000	0.45638	0.650000	0.86243	GAG	-	NULL		0.637	CCDC57-001	KNOWN	basic|appris_candidate_longest	protein_coding	CCDC57	protein_coding	OTTHUMT00000277182.3	C	NM_198082		77739575	-1	no_errors	NM_198082	genbank	human	validated	54_36p	missense	SNP	1	G
NPC1	4864	genome.wustl.edu	37	18	21121351	21121351	+	Silent	SNP	C	C	A			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr18:21121351C>A	ENST00000269228.5	-	15	2846	c.2292G>T	c.(2290-2292)gcG>gcT	p.A764A	NPC1_ENST00000540608.1_5'UTR|NPC1_ENST00000412552.2_Silent_p.A446A	NM_000271.4	NP_000262.2	O15118	NPC1_HUMAN	Niemann-Pick disease, type C1	764	SSD. {ECO:0000255|PROSITE- ProRule:PRU00199}.				adult walking behavior (GO:0007628)|autophagy (GO:0006914)|bile acid metabolic process (GO:0008206)|cellular response to low-density lipoprotein particle stimulus (GO:0071404)|cellular response to steroid hormone stimulus (GO:0071383)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|endocytosis (GO:0006897)|establishment of protein localization to membrane (GO:0090150)|lysosomal transport (GO:0007041)|membrane raft organization (GO:0031579)|negative regulation of cell death (GO:0060548)|negative regulation of macroautophagy (GO:0016242)|protein glycosylation (GO:0006486)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|signal transduction (GO:0007165)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|membrane raft (GO:0045121)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)	cholesterol binding (GO:0015485)|hedgehog receptor activity (GO:0008158)|receptor activity (GO:0004872)|sterol transporter activity (GO:0015248)|transmembrane signaling receptor activity (GO:0004888)	p.A764A(1)		breast(1)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(10)|lung(13)|ovary(2)|stomach(1)	38	all_cancers(21;0.000106)|all_epithelial(16;6.57e-07)|Lung NSC(20;0.00166)|all_lung(20;0.00536)|Colorectal(14;0.0202)|Ovarian(20;0.127)					CTGCCAATCCCGCAAAGAGAG	0.517																																																1	Substitution - coding silent(1)	ovary(1)	18	GRCh37	CS032703	NPC1	S							93.0	85.0	88.0					18																	21121351		2203	4300	6503	19375349	SO:0001819	synonymous_variant	257641			AF002020	CCDS11878.1	18q11.2	2014-06-17			ENSG00000141458	ENSG00000141458			7897	protein-coding gene	gene with protein product		607623				8446622	Standard	NM_000271		Approved		uc002kum.4	O15118	OTTHUMG00000131873	ENST00000269228.5:c.2292G>T	18.37:g.21121351C>A			19375349	B4DET3|Q9P130	Silent	SNP	HMMPfam_Patched;superfamily_Multidrug efflux transporter AcrB transmembrane domain	p.A764	ENST00000269228.5	37	c.2292	CCDS11878.1	18																																																																																			-	HMMPfam_Patched		0.517	NPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPC1	protein_coding	OTTHUMT00000254823.2	C	NM_000271		19375349	-1	no_errors	NM_000271	genbank	human	validated	54_36p	silent	SNP	1	A
MYOM1	8736	genome.wustl.edu	37	18	3102608	3102608	+	Missense_Mutation	SNP	T	T	G			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	T	T	T	G	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr18:3102608T>G	ENST00000356443.4	-	23	3772	c.3439A>C	c.(3439-3441)Aat>Cat	p.N1147H	MYOM1_ENST00000261606.7_Missense_Mutation_p.N1051H|MYOM1_ENST00000400569.3_Missense_Mutation_p.N1147H	NM_003803.3|NM_019856.1	NP_003794.3|NP_062830.1	P52179	MYOM1_HUMAN	myomesin 1	1147	Ig-like C2-type 3.				muscle contraction (GO:0006936)	M band (GO:0031430)|striated muscle myosin thick filament (GO:0005863)	identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|structural constituent of muscle (GO:0008307)	p.N1147H(1)		NS(2)|autonomic_ganglia(1)|central_nervous_system(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(20)|ovary(4)|pancreas(1)|prostate(4)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	77						TCATCCACATTTACAACAACC	0.398																																																1	Substitution - Missense(1)	ovary(1)	18											133.0	128.0	130.0					18																	3102608		1891	4123	6014	3092608	SO:0001583	missense	8736			AF185573	CCDS45823.1, CCDS45824.1	18p11.31	2014-09-17	2012-10-17		ENSG00000101605	ENSG00000101605		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7613	protein-coding gene	gene with protein product	"""skelemin"""	603508	"""myomesin 1 (skelemin) (185kD)"", ""myomesin 1 (skelemin) 185kDa"", ""myomesin 1, 185kDa"""			9806852	Standard	NM_019856		Approved		uc002klp.3	P52179	OTTHUMG00000178209	ENST00000356443.4:c.3439A>C	18.37:g.3102608T>G	ENSP00000348821:p.Asn1147His		3092608	Q14BD6|Q6H969|Q6ZUU0	Missense_Mutation	SNP	HMMPfam_fn3,superfamily_Fibronectin type III,HMMPfam_I-set,superfamily_Immunoglobulin	p.N1147H	ENST00000356443.4	37	c.3439	CCDS45824.1	18	.	.	.	.	.	.	.	.	.	.	T	13.54	2.269031	0.40095	.	.	ENSG00000101605	ENST00000356443;ENST00000400569;ENST00000261606	T;T;T	0.50001	0.9;0.91;0.76	5.56	0.0991	0.14501	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.542047	0.22253	N	0.062537	T	0.47078	0.1426	L	0.44542	1.39	0.09310	N	1	B;P	0.39116	0.002;0.66	B;P	0.52710	0.002;0.707	T	0.37709	-0.9694	10	0.27082	T	0.32	.	7.2027	0.25889	0.0:0.142:0.3074:0.5506	.	1051;1147	P52179-2;P52179	.;MYOM1_HUMAN	H	1147;1147;1051	ENSP00000348821:N1147H;ENSP00000383413:N1147H;ENSP00000261606:N1051H	ENSP00000261606:N1051H	N	-	1	0	MYOM1	3092608	0.000000	0.05858	0.043000	0.18650	0.935000	0.57460	0.730000	0.26043	0.047000	0.15862	-1.580000	0.00857	AAT	-	NULL		0.398	MYOM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MYOM1	protein_coding	OTTHUMT00000441037.2	T	NM_003803		3092608	-1	no_errors	NM_003803	genbank	human	reviewed	54_36p	missense	SNP	0.6	G
LRRC30	339291	genome.wustl.edu	37	18	7231563	7231563	+	Nonsense_Mutation	SNP	G	G	T			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr18:7231563G>T	ENST00000383467.2	+	1	441	c.427G>T	c.(427-429)Gag>Tag	p.E143*		NM_001105581.1	NP_001099051.1	A6NM36	LRC30_HUMAN	leucine rich repeat containing 30	143								p.E143*(1)		central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|liver(1)|lung(13)|ovary(1)|prostate(1)|skin(3)	31						CCGAAAGCTGGAGGTCCTGAG	0.572																																																1	Substitution - Nonsense(1)	ovary(1)	18											46.0	53.0	51.0					18																	7231563		2092	4222	6314	7221563	SO:0001587	stop_gained	339291				CCDS42409.1	18p11.23	2005-01-06				ENSG00000206422			30219	protein-coding gene	gene with protein product							Standard	NM_001105581		Approved		uc010wzk.2	A6NM36		ENST00000383467.2:c.427G>T	18.37:g.7231563G>T	ENSP00000372959:p.Glu143*		7221563		Nonsense_Mutation	SNP	-	p.E143*	ENST00000383467.2	37	c.427	CCDS42409.1	18	.	.	.	.	.	.	.	.	.	.	G	34	5.386415	0.95967	.	.	ENSG00000206422	ENST00000383467	.	.	.	5.65	4.78	0.61160	.	0.044268	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.26408	T	0.33	.	16.7632	0.85517	0.0:0.1366:0.8634:0.0	.	.	.	.	X	143	.	ENSP00000372959:E143X	E	+	1	0	LRRC30	7221563	1.000000	0.71417	0.992000	0.48379	0.967000	0.64934	6.285000	0.72658	1.515000	0.48885	0.650000	0.86243	GAG	-	NULL		0.572	LRRC30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC30	protein_coding	OTTHUMT00000442140.1	G	XM_292678		7221563	1	no_errors	NM_001105581	genbank	human	provisional	54_36p	nonsense	SNP	1	T
LAMA3	3909	genome.wustl.edu	37	18	21447850	21447850	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr18:21447850G>A	ENST00000313654.9	+	37	4977	c.4736G>A	c.(4735-4737)cGg>cAg	p.R1579Q	LAMA3_ENST00000399516.3_Missense_Mutation_p.R1579Q	NM_198129.1	NP_937762.1	Q16787	LAMA3_HUMAN	laminin, alpha 3	1579	Laminin IV type A. {ECO:0000255|PROSITE- ProRule:PRU00458}.				cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)	p.R1579Q(1)		NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(24)|lung(54)|ovary(8)|prostate(6)|skin(7)|urinary_tract(4)	128	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)					CGGCCAGACCGGCTGCATCAT	0.448																																																1	Substitution - Missense(1)	ovary(1)	18											143.0	149.0	147.0					18																	21447850		2001	4175	6176	19701848	SO:0001583	missense	3909			L34155	CCDS11880.1, CCDS42419.1, CCDS45838.1, CCDS59307.1	18q11.2	2013-03-01	2002-08-29		ENSG00000053747	ENSG00000053747		"""Laminins"""	6483	protein-coding gene	gene with protein product		600805	"""laminin, alpha 3 (nicein (150kD), kalinin (165kD), BM600 (150kD), epilegrin)"""	LAMNA		8077230	Standard	NM_000227		Approved	nicein-150kDa, kalinin-165kDa, BM600-150kDa, epiligrin	uc002kuq.3	Q16787	OTTHUMG00000131874	ENST00000313654.9:c.4736G>A	18.37:g.21447850G>A	ENSP00000324532:p.Arg1579Gln		19701848	B0YJ33|Q13679|Q13680|Q6VU67|Q6VU68|Q6VU69|Q76E14|Q96TG0	Missense_Mutation	SNP	HMMPfam_Laminin_B;HMMPfam_Laminin_EGF;HMMPfam_Laminin_N;superfamily_Galactose-binding domain-like;superfamily_Concanavalin A-like lectins/glucanases;HMMPfam_Laminin_I;HMMPfam_Laminin_II;HMMPfam_Laminin_G_2;superfamily_Spectrin repeat;superfamily_EGF/Laminin	p.R1579Q	ENST00000313654.9	37	c.4736	CCDS42419.1	18	.	.	.	.	.	.	.	.	.	.	G	14.32	2.499225	0.44455	.	.	ENSG00000053747	ENST00000313654;ENST00000399516	T;T	0.35789	1.29;1.29	5.45	3.67	0.42095	Laminin B type IV (2);Laminin B, subgroup (1);Growth factor, receptor (1);	.	.	.	.	T	0.31857	0.0810	L	0.52126	1.63	0.39080	D	0.960886	P;P	0.46912	0.886;0.6	P;B	0.44477	0.451;0.195	T	0.11641	-1.0579	9	0.12103	T	0.63	.	10.1932	0.43039	0.213:0.0:0.787:0.0	.	1579;1579	Q6VU67;Q16787	.;LAMA3_HUMAN	Q	1579	ENSP00000324532:R1579Q;ENSP00000382432:R1579Q	ENSP00000324532:R1579Q	R	+	2	0	LAMA3	19701848	1.000000	0.71417	0.463000	0.27130	0.777000	0.43975	2.757000	0.47557	0.795000	0.33922	0.655000	0.94253	CGG	-	HMMPfam_Laminin_B		0.448	LAMA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA3	protein_coding	OTTHUMT00000254824.3	G	NM_000227, NM_198129		19701848	1	no_errors	NM_198129	genbank	human	reviewed	54_36p	missense	SNP	0.9	A
CACNA1A	773	genome.wustl.edu	37	19	13419060	13419060	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr19:13419060C>A	ENST00000360228.5	-	14	1786	c.1787G>T	c.(1786-1788)tGg>tTg	p.W596L	CACNA1A_ENST00000573710.2_Missense_Mutation_p.W597L	NM_000068.3|NM_001127222.1|NM_001174080.1|NM_023035.2	NP_000059.3|NP_001120694.1|NP_001167551.1|NP_075461.2	O00555	CAC1A_HUMAN	calcium channel, voltage-dependent, P/Q type, alpha 1A subunit	597					adult walking behavior (GO:0007628)|behavioral response to pain (GO:0048266)|calcium ion import (GO:0070509)|calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cell death (GO:0008219)|cell growth (GO:0016049)|cellular chloride ion homeostasis (GO:0030644)|cerebellar molecular layer development (GO:0021679)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellum maturation (GO:0021590)|dendrite morphogenesis (GO:0048813)|energy reserve metabolic process (GO:0006112)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glucose metabolic process (GO:0006006)|hormone metabolic process (GO:0042445)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of hormone biosynthetic process (GO:0032353)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular process controlling balance (GO:0050885)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter metabolic process (GO:0042133)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|receptor clustering (GO:0043113)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion-dependent exocytosis (GO:0017158)|regulation of insulin secretion (GO:0050796)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|spinal cord motor neuron differentiation (GO:0021522)|sulfur amino acid metabolic process (GO:0000096)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmission of nerve impulse (GO:0019226)|vestibular nucleus development (GO:0021750)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|syntaxin binding (GO:0019905)|voltage-gated calcium channel activity (GO:0005245)	p.W597L(1)		breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(25)|prostate(2)|urinary_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Loperamide(DB00836)|Pregabalin(DB00230)|Spironolactone(DB00421)|Verapamil(DB00661)	GAGAGATGCCCAGTACCTGCC	0.577																																																1	Substitution - Missense(1)	ovary(1)	19											58.0	62.0	61.0					19																	13419060		2115	4251	6366	13280060	SO:0001583	missense	773			U79666	CCDS45998.1, CCDS45999.1	19p13	2014-09-17			ENSG00000141837	ENSG00000141837		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1388	protein-coding gene	gene with protein product		601011		CACNL1A4, SCA6, MHP1, MHP		8825650, 16382099, 23827678	Standard	NM_000068		Approved	Cav2.1, EA2, APCA, HPCA, FHM	uc010xne.2	O00555	OTTHUMG00000044590	ENST00000360228.5:c.1787G>T	19.37:g.13419060C>A	ENSP00000353362:p.Trp596Leu		13280060	J3KP41|P78510|P78511|Q16290|Q92690|Q99790|Q99791|Q99792|Q99793|Q9NS88|Q9UDC4	Missense_Mutation	SNP	HMMPfam_Ion_trans;HMMPfam_Ca_chan_IQ;superfamily_Voltage-gated potassium channels	p.W597L	ENST00000360228.5	37	c.1790	CCDS45998.1	19	.	.	.	.	.	.	.	.	.	.	C	19.83	3.900497	0.72754	.	.	ENSG00000141837	ENST00000360228;ENST00000418012;ENST00000357018;ENST00000325084	D	0.98264	-4.83	5.12	5.12	0.69794	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.98741	0.9577	M	0.74389	2.26	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.994	D;D;D	0.87578	0.998;0.997;0.988	D	0.99191	1.0870	10	0.37606	T	0.19	.	17.3375	0.87286	0.0:1.0:0.0:0.0	.	597;597;596	O00555;E9PD31;Q9NS88	CAC1A_HUMAN;.;.	L	596;597;597;597	ENSP00000353362:W596L	ENSP00000317661:W597L	W	-	2	0	CACNA1A	13280060	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	7.818000	0.86416	2.374000	0.81015	0.655000	0.94253	TGG	-	HMMPfam_Ion_trans		0.577	CACNA1A-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	CACNA1A	protein_coding	OTTHUMT00000104062.2	C	NM_000068		13280060	-1	no_errors	ENST00000325084	ensembl	human	known	54_36p	missense	SNP	1	A
CCDC105	126402	genome.wustl.edu	37	19	15133816	15133816	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr19:15133816G>A	ENST00000292574.3	+	7	1467	c.1385G>A	c.(1384-1386)cGc>cAc	p.R462H		NM_173482.2	NP_775753.2	Q8IYK2	CC105_HUMAN	coiled-coil domain containing 105	462						extracellular vesicular exosome (GO:0070062)		p.R462H(1)		NS(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(4)|skin(2)	23						AACGTGGTGCGCCTGCGCCTG	0.672																																																1	Substitution - Missense(1)	ovary(1)	19											38.0	29.0	32.0					19																	15133816		2201	4300	6501	14994816	SO:0001583	missense	126402			AK097684	CCDS12322.1	19p13.12	2008-02-05				ENSG00000160994			26866	protein-coding gene	gene with protein product						12477932	Standard	NM_173482		Approved	FLJ40365	uc002nae.2	Q8IYK2		ENST00000292574.3:c.1385G>A	19.37:g.15133816G>A	ENSP00000292574:p.Arg462His		14994816	Q8N7T5|Q8NDL5	Missense_Mutation	SNP	-	p.R462H	ENST00000292574.3	37	c.1385	CCDS12322.1	19	.	.	.	.	.	.	.	.	.	.	g	22.1	4.245127	0.79912	.	.	ENSG00000160994	ENST00000292574	T	0.02498	4.27	4.12	4.12	0.48240	.	0.000000	0.56097	D	0.000025	T	0.12050	0.0293	M	0.67953	2.075	0.35608	D	0.808459	D	0.89917	1.0	D	0.87578	0.998	T	0.03296	-1.1051	10	0.54805	T	0.06	-23.6425	12.1024	0.53792	0.0:0.0:1.0:0.0	.	462	Q8IYK2	CC105_HUMAN	H	462	ENSP00000292574:R462H	ENSP00000292574:R462H	R	+	2	0	CCDC105	14994816	1.000000	0.71417	1.000000	0.80357	0.879000	0.50718	3.774000	0.55341	2.295000	0.77249	0.479000	0.44913	CGC	-	NULL		0.672	CCDC105-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC105	protein_coding	OTTHUMT00000466293.1	G	NM_173482		14994816	1	no_errors	NM_173482	genbank	human	provisional	54_36p	missense	SNP	1	A
CYP4F3	4051	genome.wustl.edu	37	19	15760867	15760867	+	Silent	SNP	C	C	T	rs142562355		TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr19:15760867C>T	ENST00000221307.8	+	7	839	c.792C>T	c.(790-792)caC>caT	p.H264H	CYP4F3_ENST00000585846.1_Silent_p.H264H|CYP4F3_ENST00000591058.1_Silent_p.H264H|CYP4F3_ENST00000586182.2_Silent_p.H264H	NM_000896.2	NP_000887.2	Q08477	CP4F3_HUMAN	cytochrome P450, family 4, subfamily F, polypeptide 3	264					arachidonic acid metabolic process (GO:0019369)|icosanoid metabolic process (GO:0006690)|leukotriene metabolic process (GO:0006691)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	alpha-tocopherol omega-hydroxylase activity (GO:0052871)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|leukotriene-B4 20-monooxygenase activity (GO:0050051)|monooxygenase activity (GO:0004497)	p.H264H(1)		endometrium(3)|large_intestine(4)|lung(21)|ovary(3)|prostate(2)|stomach(1)	34						GCCTGGTGCACGACTTCACAG	0.562																																																1	Substitution - coding silent(1)	ovary(1)	19						C	,,	2,4404		0,2,2201	114.0	106.0	109.0		792,792,792	-5.2	0.0	19	dbSNP_134	109	0,8596		0,0,4298	no	coding-synonymous,coding-synonymous,coding-synonymous	CYP4F3	NM_000896.2,NM_001199208.1,NM_001199209.1	,,	0,2,6499	TT,TC,CC		0.0,0.0454,0.0154	,,	264/521,264/521,264/521	15760867	2,13000	2203	4298	6501	15621867	SO:0001819	synonymous_variant	4051			AB002454	CCDS12332.1, CCDS59362.1	19p13.12	2013-02-21	2003-01-14		ENSG00000186529	ENSG00000186529		"""Cytochrome P450s"""	2646	protein-coding gene	gene with protein product		601270	"""cytochrome P450, subfamily IVF, polypeptide 3 (leukotriene B4 omega hydroxylase)"""	LTB4H		8486631, 9539102	Standard	NM_000896		Approved	CYP4F	uc010xol.2	Q08477	OTTHUMG00000182374	ENST00000221307.8:c.792C>T	19.37:g.15760867C>T			15621867	B7Z8Z3|O60634|Q5U740	Silent	SNP	HMMPfam_p450;superfamily_Cytochrome P450	p.H264	ENST00000221307.8	37	c.792	CCDS12332.1	19																																																																																			-	HMMPfam_p450		0.562	CYP4F3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CYP4F3	protein_coding	OTTHUMT00000460819.3	C	NM_000896		15621867	1	no_errors	NM_000896	genbank	human	reviewed	54_36p	silent	SNP	1	T
SUPT5H	6829	genome.wustl.edu	37	19	39959910	39959910	+	Missense_Mutation	SNP	C	C	T	rs370618161		TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr19:39959910C>T	ENST00000599117.1	+	17	1613	c.1246C>T	c.(1246-1248)Cgg>Tgg	p.R416W	SUPT5H_ENST00000359191.6_Missense_Mutation_p.R412W|SUPT5H_ENST00000402194.2_Missense_Mutation_p.R412W|SUPT5H_ENST00000432763.2_Missense_Mutation_p.R416W|SUPT5H_ENST00000598725.1_Missense_Mutation_p.R416W			O00267	SPT5H_HUMAN	suppressor of Ty 5 homolog (S. cerevisiae)	416	Interaction with RNA polymerase II.				7-methylguanosine mRNA capping (GO:0006370)|cell cycle (GO:0007049)|chromatin remodeling (GO:0006338)|DNA-templated transcription, elongation (GO:0006354)|gene expression (GO:0010467)|negative regulation of DNA-templated transcription, elongation (GO:0032785)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of macroautophagy (GO:0016239)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|response to organic substance (GO:0010033)|single stranded viral RNA replication via double stranded DNA intermediate (GO:0039692)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	DSIF complex (GO:0032044)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)	p.R416W(1)		breast(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(13)|lung(12)|ovary(3)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	51	all_cancers(60;6.69e-07)|all_lung(34;2.66e-08)|Lung NSC(34;3e-08)|all_epithelial(25;1.57e-06)|Ovarian(47;0.159)		Epithelial(26;3.9e-26)|all cancers(26;1.35e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)			AGGGAAGGAGCGGGAGCACAA	0.607																																																1	Substitution - Missense(1)	ovary(1)	19						C	TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG	0,4406		0,0,2203	70.0	62.0	65.0		1246,1246,1234,1246	4.8	1.0	19		65	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense	SUPT5H	NM_001111020.2,NM_001130824.1,NM_001130825.1,NM_003169.3	101,101,101,101	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging	416/1088,416/1088,412/1084,416/1088	39959910	1,13005	2203	4300	6503	44651750	SO:0001583	missense	6829			U56402	CCDS12536.1, CCDS46072.1	19q13	2008-07-22	2001-11-28			ENSG00000196235			11469	protein-coding gene	gene with protein product		602102	"""suppressor of Ty (S.cerevisiae) 5 homolog"""			8975720	Standard	NM_003169		Approved	SPT5H, SPT5, FLJ34157	uc002olp.4	O00267		ENST00000599117.1:c.1246C>T	19.37:g.39959910C>T	ENSP00000470252:p.Arg416Trp		44651750	O43279|Q59G52|Q99639	Missense_Mutation	SNP	HMMPfam_Supt5,HMMPfam_KOW,superfamily_Translation proteins SH3-like domain,superfamily_N-utilization substance G protein NusG N-terminal domain	p.R416W	ENST00000599117.1	37	c.1246	CCDS12536.1	19	.	.	.	.	.	.	.	.	.	.	C	24.0	4.487950	0.84854	0.0	1.16E-4	ENSG00000196235	ENST00000432763;ENST00000402194;ENST00000378524;ENST00000359191	.	.	.	5.82	4.77	0.60923	.	0.000000	0.85682	D	0.000000	T	0.66086	0.2754	L	0.42245	1.32	0.58432	D	0.999999	D;D;D	0.76494	0.989;0.999;0.998	P;D;P	0.67103	0.776;0.949;0.889	T	0.64647	-0.6358	8	.	.	.	-5.3195	12.9725	0.58520	0.2941:0.7059:0.0:0.0	.	208;412;416	B4DJK4;O00267-2;O00267	.;.;SPT5H_HUMAN	W	416;412;394;416	.	.	R	+	1	2	SUPT5H	44651750	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	2.943000	0.49026	1.444000	0.47605	0.650000	0.86243	CGG	-	NULL		0.607	SUPT5H-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SUPT5H	protein_coding	OTTHUMT00000464918.1	C	NM_003169		44651750	1	no_errors	NM_003169	genbank	human	validated	54_36p	missense	SNP	1	T
ODC1	4953	genome.wustl.edu	37	2	10585130	10585130	+	Missense_Mutation	SNP	T	T	C			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr2:10585130T>C	ENST00000234111.4	-	3	539	c.29A>G	c.(28-30)gAc>gGc	p.D10G	ODC1_ENST00000446285.1_5'UTR|ODC1_ENST00000405333.1_Missense_Mutation_p.D10G|SNORA80B_ENST00000383906.1_RNA	NM_002539.1	NP_002530.1	P11926	DCOR_HUMAN	ornithine decarboxylase 1	10					cellular nitrogen compound metabolic process (GO:0034641)|kidney development (GO:0001822)|polyamine metabolic process (GO:0006595)|positive regulation of cell proliferation (GO:0008284)|putrescine biosynthetic process from ornithine (GO:0033387)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of protein catabolic process (GO:0042176)|response to virus (GO:0009615)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ornithine decarboxylase activity (GO:0004586)|protein homodimerization activity (GO:0042803)	p.D10G(1)		NS(1)|central_nervous_system(1)|large_intestine(7)|lung(5)|ovary(1)|prostate(1)|skin(3)	19	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.11)|OV - Ovarian serous cystadenocarcinoma(76;0.161)	Spermine(DB00127)	GAAGTGGCAGTCAAACTCTTC	0.393																																																1	Substitution - Missense(1)	ovary(1)	2											114.0	109.0	111.0					2																	10585130		2203	4300	6503	10502581	SO:0001583	missense	89874				CCDS1672.1	2p25	2012-10-02			ENSG00000115758	ENSG00000115758	4.1.1.17		8109	protein-coding gene	gene with protein product		165640					Standard	NM_002539		Approved	ODC	uc002rao.1	P11926	OTTHUMG00000090450	ENST00000234111.4:c.29A>G	2.37:g.10585130T>C	ENSP00000234111:p.Asp10Gly		10502581	Q53TU3|Q6LDS9	Missense_Mutation	SNP	HMMPfam_Orn_DAP_Arg_deC;HMMPfam_Orn_Arg_deC_N;superfamily_Alanine racemase C-terminal domain-like;superfamily_PLP-binding barrel	p.D10G	ENST00000234111.4	37	c.29	CCDS1672.1	2	.	.	.	.	.	.	.	.	.	.	T	16.43	3.121133	0.56613	.	.	ENSG00000115758	ENST00000234111;ENST00000405333;ENST00000443218	T;T	0.47869	0.83;0.83	5.47	5.47	0.80525	.	0.141330	0.64402	D	0.000006	T	0.43166	0.1235	L	0.54323	1.7	0.47276	D	0.999371	B	0.02656	0.0	B	0.06405	0.002	T	0.37776	-0.9691	10	0.54805	T	0.06	.	10.7178	0.46023	0.0:0.0739:0.0:0.9261	.	10	P11926	DCOR_HUMAN	G	10	ENSP00000234111:D10G;ENSP00000385333:D10G	ENSP00000234111:D10G	D	-	2	0	ODC1	10502581	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.750000	0.68712	2.080000	0.62538	0.533000	0.62120	GAC	-	NULL		0.393	ODC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ODC1	protein_coding	OTTHUMT00000206896.2	T			10502581	-1	no_errors	NM_002539	genbank	human	reviewed	54_36p	missense	SNP	1	C
FAP	2191	genome.wustl.edu	37	2	163059656	163059656	+	Splice_Site	SNP	C	C	G			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr2:163059656C>G	ENST00000188790.4	-	13	1255		c.e13-1		FAP_ENST00000443424.1_Splice_Site	NM_004460.2	NP_004451.2			fibroblast activation protein, alpha									p.?(1)		NS(2)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(5)|lung(34)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(4)	63						AAACAAAGAACTGAAAAAAAT	0.308																																																1	Unknown(1)	ovary(1)	2											50.0	50.0	50.0					2																	163059656		2202	4299	6501	162767902	SO:0001630	splice_region_variant	2191			U09278	CCDS33311.1	2q23	2008-02-05			ENSG00000078098	ENSG00000078098			3590	protein-coding gene	gene with protein product	"""seprase"""	600403				9247085, 14707457	Standard	NM_004460		Approved	DPPIV	uc002ucd.3	Q12884	OTTHUMG00000153890	ENST00000188790.4:c.1048-1G>C	2.37:g.163059656C>G			162767902		Splice_Site	SNP	-	e13-1	ENST00000188790.4	37	c.1048-1	CCDS33311.1	2	.	.	.	.	.	.	.	.	.	.	C	16.86	3.239160	0.58995	.	.	ENSG00000078098	ENST00000188790;ENST00000443424	.	.	.	5.91	5.91	0.95273	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.3011	0.98612	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	FAP	162767902	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.557000	0.67313	2.804000	0.96469	0.650000	0.86243	.	-	-		0.308	FAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAP	protein_coding	OTTHUMT00000332852.2	C		Intron	162767902	-1	no_errors	NM_004460	genbank	human	reviewed	54_36p	splice_site	SNP	1	G
SDC1	6382	genome.wustl.edu	37	2	20405179	20405179	+	Missense_Mutation	SNP	C	C	G	rs146940431	byFrequency	TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr2:20405179C>G	ENST00000254351.4	-	2	317	c.73G>C	c.(73-75)Gtg>Ctg	p.V25L	SDC1_ENST00000403076.1_Missense_Mutation_p.V25L|SDC1_ENST00000482879.1_5'UTR|SDC1_ENST00000381150.1_Missense_Mutation_p.V25L	NM_002997.4	NP_002988	P18827	SDC1_HUMAN	syndecan 1	25					canonical Wnt signaling pathway (GO:0060070)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|inflammatory response (GO:0006954)|lipoprotein metabolic process (GO:0042157)|myoblast development (GO:0048627)|odontogenesis (GO:0042476)|phototransduction, visible light (GO:0007603)|response to calcium ion (GO:0051592)|response to cAMP (GO:0051591)|response to glucocorticoid (GO:0051384)|response to hydrogen peroxide (GO:0042542)|response to toxic substance (GO:0009636)|retinoid metabolic process (GO:0001523)|Sertoli cell development (GO:0060009)|small molecule metabolic process (GO:0044281)|striated muscle cell development (GO:0055002)|ureteric bud development (GO:0001657)|wound healing (GO:0042060)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	protein C-terminus binding (GO:0008022)	p.V25L(1)		NS(1)|breast(1)|kidney(2)|large_intestine(2)|lung(9)|ovary(4)|skin(2)	21	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)			OV - Ovarian serous cystadenocarcinoma(76;0.221)		TTAGTAGCCACAATTTGCTGG	0.547																																																1	Substitution - Missense(1)	ovary(1)	2											66.0	68.0	67.0					2																	20405179		2203	4300	6503	20268660	SO:0001583	missense	6382			AJ551176	CCDS1697.1	2p24.1	2008-02-05			ENSG00000115884	ENSG00000115884		"""CD molecules"", ""Proteoglycans / Cell Surface : Syndecans"""	10658	protein-coding gene	gene with protein product	"""syndecan proteoglycan 1"""	186355		SDC			Standard	XM_005262621		Approved	CD138, syndecan, SYND1	uc002rdo.1	P18827	OTTHUMG00000090751	ENST00000254351.4:c.73G>C	2.37:g.20405179C>G	ENSP00000254351:p.Val25Leu		20268660	D6W523|Q53QV0|Q546D3|Q96HB7	Missense_Mutation	SNP	HMMPfam_Syndecan	p.V25L	ENST00000254351.4	37	c.73	CCDS1697.1	2	.	.	.	.	.	.	.	.	.	.	C	15.25	2.778133	0.49786	.	.	ENSG00000115884	ENST00000254351;ENST00000381150;ENST00000403076;ENST00000429035	T;T;T;T	0.34859	2.27;2.27;1.45;1.34	4.52	1.71	0.24356	.	0.418350	0.19945	N	0.102560	T	0.31670	0.0804	M	0.70595	2.14	0.09310	N	1	B;B	0.30870	0.298;0.114	B;B	0.27887	0.084;0.084	T	0.32107	-0.9919	10	0.87932	D	0	-12.1122	4.5787	0.12248	0.1752:0.635:0.0:0.1898	.	25;25	E9PHH3;P18827	.;SDC1_HUMAN	L	25;25;25;33	ENSP00000254351:V25L;ENSP00000370542:V25L;ENSP00000384613:V25L;ENSP00000400773:V33L	ENSP00000254351:V25L	V	-	1	0	SDC1	20268660	0.001000	0.12720	0.005000	0.12908	0.627000	0.37826	0.043000	0.13971	0.232000	0.21100	-0.379000	0.06801	GTG	-	HMMPfam_Syndecan		0.547	SDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SDC1	protein_coding	OTTHUMT00000207495.1	C	NM_001006946		20268660	-1	no_errors	NM_001006946	genbank	human	reviewed	54_36p	missense	SNP	0.01	G
APOB	338	genome.wustl.edu	37	2	21260914	21260914	+	Silent	SNP	A	A	G			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr2:21260914A>G	ENST00000233242.1	-	5	580	c.453T>C	c.(451-453)acT>acC	p.T151T	APOB_ENST00000399256.4_Silent_p.T151T	NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	151	Vitellogenin. {ECO:0000255|PROSITE- ProRule:PRU00557}.				artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)	p.T151T(1)		NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TCAGGATGTAAGTAGGTTCAT	0.493																																																1	Substitution - coding silent(1)	ovary(1)	2											118.0	114.0	115.0					2																	21260914		2203	4300	6503	21114419	SO:0001819	synonymous_variant	338			M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.453T>C	2.37:g.21260914A>G			21114419	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Silent	SNP	HMMPfam_Vitellogenin_N,HMMPfam_DUF1081,HMMPfam_DUF1943	p.T151	ENST00000233242.1	37	c.453	CCDS1703.1	2																																																																																			-	HMMPfam_Vitellogenin_N		0.493	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOB	protein_coding	OTTHUMT00000207571.1	A			21114419	-1	no_errors	NM_000384	genbank	human	reviewed	54_36p	silent	SNP	0	G
TTN	7273	genome.wustl.edu	37	2	179600767	179600767	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	C	C	A	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr2:179600767C>A	ENST00000591111.1	-	48	13679	c.13455G>T	c.(13453-13455)aaG>aaT	p.K4485N	TTN-AS1_ENST00000590773.1_RNA|TTN_ENST00000342175.6_Intron|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000582847.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.K4802N|TTN_ENST00000342992.6_Missense_Mutation_p.K3558N|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000359218.5_Intron			Q8WZ42	TITIN_HUMAN	titin	12240	Ig-like 25.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.K3558N(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTGTAAGGGACTTAGGTCTGG	0.433																																																1	Substitution - Missense(1)	ovary(1)	2											64.0	61.0	62.0					2																	179600767		1907	4128	6035	179309012	SO:0001583	missense	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.13455G>T	2.37:g.179600767C>A	ENSP00000465570:p.Lys4485Asn		179309012	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	-	p.K3558N	ENST00000591111.1	37	c.10674		2	.	.	.	.	.	.	.	.	.	.	C	6.805	0.517562	0.13005	.	.	ENSG00000155657	ENST00000342992	T	0.69685	-0.42	5.93	3.21	0.36854	Immunoglobulin I-set (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.55721	0.1938	L	0.41961	1.31	0.80722	D	1	B	0.33777	0.425	B	0.31812	0.136	T	0.54050	-0.8351	9	0.87932	D	0	.	8.891	0.35434	0.0:0.6535:0.0:0.3465	.	4485	Q8WZ42	TITIN_HUMAN	N	3558	ENSP00000343764:K3558N	ENSP00000343764:K3558N	K	-	3	2	TTN	179309012	0.930000	0.31532	0.913000	0.36048	0.618000	0.37518	0.047000	0.14056	0.427000	0.26145	-0.140000	0.14226	AAG	-	NULL		0.433	TTN-019	PUTATIVE	basic	protein_coding	TTN	protein_coding	OTTHUMT00000460310.1	C	NM_133378		179309012	-1	pseudogene:no_stop_codon:bad_bp_length_for_coding_region	NM_133378	genbank	human	reviewed	54_36p	missense	SNP	0.99	A
CCDC108	255101	genome.wustl.edu	37	2	219900185	219900185	+	Intron	SNP	A	A	T			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr2:219900185A>T	ENST00000341552.5	-	5	626				CCDC108_ENST00000324264.6_Missense_Mutation_p.S122T|CCDC108_ENST00000295729.2_Missense_Mutation_p.S122T|CCDC108_ENST00000410037.1_Intron|CCDC108_ENST00000453220.1_Intron|CCDC108_ENST00000441968.1_Intron|CCDC108_ENST00000409865.3_Intron	NM_194302.2	NP_919278.2	Q6ZU64	CC108_HUMAN	coiled-coil domain containing 108							integral component of membrane (GO:0016021)	poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(18)|liver(1)|lung(34)|ovary(2)|pancreas(1)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	80		Renal(207;0.0915)		Epithelial(149;1.12e-06)|all cancers(144;0.000196)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TGGGTCCTTGATCCCTTATAC	0.438																																																0			2											127.0	122.0	124.0					2																	219900185		2203	4300	6503	219608429	SO:0001627	intron_variant	255101			NM_194302, AL833882, AK127189	CCDS2430.2, CCDS2431.2, CCDS63125.1, CCDS63126.1	2q35	2008-02-05			ENSG00000181378	ENSG00000181378			25325	protein-coding gene	gene with protein product		614270				12477932	Standard	NM_194302		Approved	DKFZp434O0527, MGC35338	uc002vjl.2	Q6ZU64	OTTHUMG00000133013	ENST00000341552.5:c.542+16T>A	2.37:g.219900185A>T			219608429	A2BDD8|E9PCR1|E9PG25|E9PG72|Q6ZSR8|Q8N0T4|Q8NDJ3	Missense_Mutation	SNP	-	p.S122T	ENST00000341552.5	37	c.364	CCDS2430.2	2	.	.	.	.	.	.	.	.	.	.	A	12.19	1.863430	0.32884	.	.	ENSG00000181378	ENST00000295729;ENST00000324264	T;T	0.28895	1.59;1.59	3.37	-5.01	0.02991	.	.	.	.	.	T	0.09423	0.0232	N	0.08118	0	0.09310	N	1	P	0.35612	0.512	B	0.29785	0.107	T	0.30937	-0.9961	9	0.09084	T	0.74	.	5.3632	0.16099	0.2164:0.3085:0.4751:0.0	.	122	E9PCR1	.	T	122	ENSP00000295729:S122T;ENSP00000313807:S122T	ENSP00000295729:S122T	S	-	1	0	CCDC108	219608429	0.006000	0.16342	0.000000	0.03702	0.093000	0.18481	0.236000	0.17967	-0.851000	0.04147	-0.464000	0.05259	TCA	-	NULL		0.438	CCDC108-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCDC108	protein_coding	OTTHUMT00000256598.4	A	NM_194302		219608429	-1	no_errors	NM_152389	genbank	human	provisional	54_36p	missense	SNP		T
SLC16A14	151473	genome.wustl.edu	37	2	230911221	230911221	+	Silent	SNP	C	C	A			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr2:230911221C>A	ENST00000295190.4	-	4	1079	c.621G>T	c.(619-621)gcG>gcT	p.A207A		NM_152527.4	NP_689740.2	Q7RTX9	MOT14_HUMAN	solute carrier family 16, member 14	207						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)	p.A207A(2)		NS(1)|cervix(1)|endometrium(7)|large_intestine(7)|lung(3)|ovary(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.149)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;7.31e-13)|all cancers(144;5.1e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00948)		GCCTCATGAGCGCCCCACAAA	0.542																																																2	Substitution - coding silent(2)	ovary(1)|large_intestine(1)	2											65.0	69.0	68.0					2																	230911221		2203	4300	6503	230619465	SO:0001819	synonymous_variant	151473			BN000146	CCDS2473.1	2q37.1	2013-07-18	2013-07-18		ENSG00000163053	ENSG00000163053		"""Solute carriers"""	26417	protein-coding gene	gene with protein product	"""monocarboxylic acid transporter 14"""		"""solute carrier family 16 (monocarboxylic acid transporters), member 14"""				Standard	NM_152527		Approved	FLJ30794, MCT14	uc002vqd.2	Q7RTX9	OTTHUMG00000133205	ENST00000295190.4:c.621G>T	2.37:g.230911221C>A			230619465	A8KA08|Q53R92|Q96NI7	Silent	SNP	-	p.A207	ENST00000295190.4	37	c.621	CCDS2473.1	2																																																																																			-	NULL		0.542	SLC16A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC16A14	protein_coding	OTTHUMT00000256918.2	C	NM_152527		230619465	-1	no_errors	NM_152527	genbank	human	provisional	54_36p	silent	SNP	0.98	A
DNMT3A	1788	genome.wustl.edu	37	2	25463284	25463284	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr2:25463284G>A	ENST00000264709.3	-	19	2546	c.2209C>T	c.(2209-2211)Ctc>Ttc	p.L737F	DNMT3A_ENST00000402667.1_Missense_Mutation_p.L514F|DNMT3A_ENST00000321117.5_Missense_Mutation_p.L737F|DNMT3A_ENST00000380746.4_Missense_Mutation_p.L548F|DNMT3A_ENST00000474887.1_5'UTR	NM_175629.2	NP_783328.1	Q9Y6K1	DNM3A_HUMAN	DNA (cytosine-5-)-methyltransferase 3 alpha	737	SAM-dependent MTase C5-type. {ECO:0000255|PROSITE-ProRule:PRU01016}.				C-5 methylation of cytosine (GO:0090116)|cellular response to amino acid stimulus (GO:0071230)|DNA methylation (GO:0006306)|DNA methylation involved in embryo development (GO:0043045)|DNA methylation involved in gamete generation (GO:0043046)|DNA methylation on cytosine within a CG sequence (GO:0010424)|hypermethylation of CpG island (GO:0044027)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of gene expression by genetic imprinting (GO:0006349)|S-adenosylhomocysteine metabolic process (GO:0046498)|S-adenosylmethioninamine metabolic process (GO:0046499)|spermatogenesis (GO:0007283)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|euchromatin (GO:0000791)|nuclear heterochromatin (GO:0005720)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA (cytosine-5-)-methyltransferase activity, acting on CpG substrates (GO:0051718)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|unmethylated CpG binding (GO:0045322)	p.L737F(1)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(964)|kidney(3)|large_intestine(10)|lung(29)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	1021	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TCATGCAGGAGGCGGTAGAAC	0.587			"""Mis, F, N, S"""		AML																																		Rec	yes		2	2p23	1788	DNA (cytosine-5-)-methyltransferase 3 alpha		L	1	Substitution - Missense(1)	ovary(1)	2											74.0	71.0	72.0					2																	25463284		2203	4300	6503	25316788	SO:0001583	missense	1788				CCDS1718.2, CCDS33157.1, CCDS46232.1	2p23	2014-09-17			ENSG00000119772	ENSG00000119772			2978	protein-coding gene	gene with protein product		602769				9662389, 10433969	Standard	NM_175630		Approved		uc002rgc.4	Q9Y6K1	OTTHUMG00000094777	ENST00000264709.3:c.2209C>T	2.37:g.25463284G>A	ENSP00000264709:p.Leu737Phe		25316788	E9PEB8|Q86TE8|Q86XF5|Q8IZV0|Q8WXU9	Missense_Mutation	SNP	HMMPfam_PWWP;HMMPfam_DNA_methylase;superfamily_FYVE/PHD zinc finger;superfamily_S-adenosyl-L-methionine-dependent methyltransferases;superfamily_Tudor/PWWP/MBT	p.L737F	ENST00000264709.3	37	c.2209	CCDS33157.1	2	.	.	.	.	.	.	.	.	.	.	G	24.4	4.525316	0.85600	.	.	ENSG00000119772	ENST00000380746;ENST00000321117;ENST00000264709;ENST00000402667	D;D;D;D	0.85556	-2.0;-2.0;-2.0;-2.0	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	D	0.89553	0.6748	L	0.55103	1.725	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.89797	0.3972	10	0.72032	D	0.01	-10.3231	11.2072	0.48775	0.0849:0.0:0.9151:0.0	.	737;548	Q9Y6K1;E9PEB8	DNM3A_HUMAN;.	F	548;737;737;514	ENSP00000370122:L548F;ENSP00000324375:L737F;ENSP00000264709:L737F;ENSP00000384237:L514F	ENSP00000264709:L737F	L	-	1	0	DNMT3A	25316788	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.794000	0.69067	2.540000	0.85666	0.561000	0.74099	CTC	-	HMMPfam_DNA_methylase		0.587	DNMT3A-001	KNOWN	basic|CCDS	protein_coding	DNMT3A	protein_coding	OTTHUMT00000211587.1	G	NM_022552		25316788	-1	no_errors	NM_022552	genbank	human	reviewed	54_36p	missense	SNP	1	A
OTOF	9381	genome.wustl.edu	37	2	26689715	26689715	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr2:26689715G>A	ENST00000272371.2	-	36	4493	c.4367C>T	c.(4366-4368)tCc>tTc	p.S1456F	OTOF_ENST00000338581.6_Missense_Mutation_p.S689F|OTOF_ENST00000402415.3_Missense_Mutation_p.S766F|OTOF_ENST00000339598.3_Missense_Mutation_p.S689F|OTOF_ENST00000403946.3_Missense_Mutation_p.S1456F	NM_194248.2	NP_919224.1	Q9HC10	OTOF_HUMAN	otoferlin	1456					membrane fusion (GO:0061025)|sensory perception of sound (GO:0007605)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	calcium ion binding (GO:0005509)	p.S1456F(1)|p.S689F(1)		NS(1)|autonomic_ganglia(1)|breast(9)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(35)|ovary(8)|pancreas(1)|prostate(5)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	106	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CACGCAGAGGGAGCCCTGGGC	0.597																																					GBM(102;732 1451 20652 24062 31372)											2	Substitution - Missense(2)	ovary(2)	2											67.0	63.0	65.0					2																	26689715		2203	4300	6503	26543219	SO:0001583	missense	9381			AF107403	CCDS1724.1, CCDS1725.1, CCDS1726.1, CCDS46241.1, CCDS74497.1	2p23.1	2014-06-27			ENSG00000115155	ENSG00000115155			8515	protein-coding gene	gene with protein product	"""fer-1-like family member 2"""	603681		DFNB9		10192385, 18381613	Standard	NM_194248		Approved	FER1L2, DFNB6	uc002rhk.3	Q9HC10	OTTHUMG00000096977	ENST00000272371.2:c.4367C>T	2.37:g.26689715G>A	ENSP00000272371:p.Ser1456Phe		26543219	B4DJX0|B5MCC1|B9A0H6|Q53R90|Q9HC08|Q9HC09|Q9Y650	Missense_Mutation	SNP	HMMPfam_C2;superfamily_C2 domain (Calcium/lipid-binding domain CaLB);HMMPfam_FerB;HMMPfam_FerI	p.S1456F	ENST00000272371.2	37	c.4367	CCDS1725.1	2	.	.	.	.	.	.	.	.	.	.	G	26.7	4.761629	0.89932	.	.	ENSG00000115155	ENST00000338581;ENST00000339598;ENST00000402415;ENST00000272371;ENST00000403946	T;T;T;D;D	0.81821	-1.27;-1.27;-1.26;-1.54;-1.54	4.92	4.92	0.64577	.	0.000000	0.85682	D	0.000000	D	0.90631	0.7062	M	0.88105	2.93	0.80722	D	1	D;D;D;D	0.71674	0.997;0.997;0.998;0.998	D;D;D;D	0.76071	0.931;0.976;0.953;0.987	D	0.89270	0.3604	10	0.23302	T	0.38	-34.8326	18.0702	0.89404	0.0:0.0:1.0:0.0	.	1456;689;766;689	Q9HC10;Q9HC10-2;Q9HC10-3;Q9HC10-4	OTOF_HUMAN;.;.;.	F	689;689;766;1456;1456	ENSP00000345137:S689F;ENSP00000344521:S689F;ENSP00000383906:S766F;ENSP00000272371:S1456F;ENSP00000385255:S1456F	ENSP00000272371:S1456F	S	-	2	0	OTOF	26543219	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	9.785000	0.99042	2.450000	0.82876	0.561000	0.74099	TCC	-	NULL		0.597	OTOF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OTOF	protein_coding	OTTHUMT00000214047.3	G			26543219	-1	no_errors	NM_194248	genbank	human	reviewed	54_36p	missense	SNP	1	A
FOSL2	2355	genome.wustl.edu	37	2	28635199	28635199	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr2:28635199G>C	ENST00000264716.4	+	4	1728	c.865G>C	c.(865-867)Gag>Cag	p.E289Q	FOSL2_ENST00000545753.1_Missense_Mutation_p.E250Q|FOSL2_ENST00000379619.1_Missense_Mutation_p.E281Q	NM_005253.3	NP_005244.1	P15408	FOSL2_HUMAN	FOS-like antigen 2	289					cell death (GO:0008219)|cellular response to hormone stimulus (GO:0032870)|female pregnancy (GO:0007565)|positive regulation of fibroblast proliferation (GO:0048146)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cAMP (GO:0051591)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to mechanical stimulus (GO:0009612)|response to morphine (GO:0043278)|response to progesterone (GO:0032570)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E289Q(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(1)|large_intestine(3)|lung(1)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	14	Acute lymphoblastic leukemia(172;0.155)					TAGCGTCCTGGAGCAGGAGTC	0.617																																																1	Substitution - Missense(1)	ovary(1)	2											80.0	63.0	69.0					2																	28635199		2203	4300	6503	28488703	SO:0001583	missense	2355				CCDS1766.1	2p23.3	2013-01-10			ENSG00000075426	ENSG00000075426		"""basic leucine zipper proteins"""	3798	protein-coding gene	gene with protein product		601575					Standard	NM_005253		Approved	FRA2, FLJ23306	uc002rma.3	P15408	OTTHUMG00000097832	ENST00000264716.4:c.865G>C	2.37:g.28635199G>C	ENSP00000264716:p.Glu289Gln		28488703	B2RD58|B3KP27|B4DYV4|Q6FG46	Missense_Mutation	SNP	-	p.E289Q	ENST00000264716.4	37	c.865	CCDS1766.1	2	.	.	.	.	.	.	.	.	.	.	G	17.69	3.451114	0.63290	.	.	ENSG00000075426	ENST00000379619;ENST00000264716;ENST00000545753	T;T;T	0.78707	-1.2;-0.2;-1.19	5.71	5.71	0.89125	.	.	.	.	.	T	0.72170	0.3427	L	0.39898	1.24	0.51233	D	0.999919	B	0.29909	0.261	B	0.24155	0.051	T	0.69165	-0.5217	9	0.45353	T	0.12	-0.7802	19.8481	0.96728	0.0:0.0:1.0:0.0	.	289	P15408	FOSL2_HUMAN	Q	281;289;250	ENSP00000368939:E281Q;ENSP00000264716:E289Q;ENSP00000439303:E250Q	ENSP00000264716:E289Q	E	+	1	0	FOSL2	28488703	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	5.489000	0.66875	2.693000	0.91896	0.655000	0.94253	GAG	-	NULL		0.617	FOSL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOSL2	protein_coding	OTTHUMT00000215116.2	G	NM_005253		28488703	1	no_errors	NM_005253	genbank	human	reviewed	54_36p	missense	SNP	1	C
HEATR5B	54497	genome.wustl.edu	37	2	37215935	37215935	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr2:37215935G>C	ENST00000233099.5	-	35	5860	c.5765C>G	c.(5764-5766)cCt>cGt	p.P1922R	HEATR5B_ENST00000354531.2_Missense_Mutation_p.P1833R	NM_019024.1	NP_061897.1	Q9P2D3	HTR5B_HUMAN	HEAT repeat containing 5B	1922						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)		p.P1922R(1)		breast(3)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(11)|lung(31)|ovary(5)|pancreas(1)|prostate(1)|skin(10)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	77		all_hematologic(82;0.21)				ATGAATATAAGGAGTTGAAAG	0.383																																																1	Substitution - Missense(1)	ovary(1)	2											104.0	107.0	106.0					2																	37215935		2203	4300	6503	37069439	SO:0001583	missense	54497			AB037835	CCDS33181.1	2p22.2	2007-01-02			ENSG00000008869	ENSG00000008869			29273	protein-coding gene	gene with protein product						10718198	Standard	XM_005264379		Approved	KIAA1414, DKFZp686P15184	uc002rpp.1	Q9P2D3	OTTHUMG00000152158	ENST00000233099.5:c.5765C>G	2.37:g.37215935G>C	ENSP00000233099:p.Pro1922Arg		37069439	B5MDU8|Q7Z3B2|Q9NVL7	Missense_Mutation	SNP	-	p.P1922R	ENST00000233099.5	37	c.5765	CCDS33181.1	2	.	.	.	.	.	.	.	.	.	.	G	24.9	4.576924	0.86645	.	.	ENSG00000008869	ENST00000425467;ENST00000233099;ENST00000354531	T;T	0.70045	-0.45;-0.45	5.38	5.38	0.77491	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.82504	0.5051	M	0.79011	2.435	0.42659	D	0.993473	D;D	0.76494	0.999;0.998	D;D	0.75484	0.986;0.971	T	0.81897	-0.0722	10	0.41790	T	0.15	-14.521	19.4943	0.95065	0.0:0.0:1.0:0.0	.	1922;1922	Q9P2D3;B9EK47	HTR5B_HUMAN;.	R	23;1922;1833	ENSP00000233099:P1922R;ENSP00000346531:P1833R	ENSP00000233099:P1922R	P	-	2	0	HEATR5B	37069439	1.000000	0.71417	0.996000	0.52242	0.991000	0.79684	9.495000	0.97964	2.677000	0.91161	0.491000	0.48974	CCT	-	NULL		0.383	HEATR5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEATR5B	protein_coding	OTTHUMT00000325492.1	G	NM_019024		37069439	-1	no_errors	NM_019024	genbank	human	validated	54_36p	missense	SNP	1	C
DCTN1	1639	genome.wustl.edu	37	2	74595160	74595160	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr2:74595160G>C	ENST00000361874.3	-	17	2270	c.1953C>G	c.(1951-1953)agC>agG	p.S651R	DCTN1_ENST00000407639.2_Missense_Mutation_p.S517R|DCTN1_ENST00000409868.1_Missense_Mutation_p.S634R|DCTN1_ENST00000409438.1_Missense_Mutation_p.S517R|DCTN1_ENST00000409567.3_Missense_Mutation_p.S631R|DCTN1_ENST00000394003.3_Missense_Mutation_p.S644R|DCTN1_ENST00000495643.1_5'Flank|DCTN1_ENST00000409240.1_Missense_Mutation_p.S614R	NM_004082.4	NP_004073.2	Q14203	DCTN1_HUMAN	dynactin 1	651					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|G2/M transition of mitotic cell cycle (GO:0000086)|melanosome transport (GO:0032402)|microtubule-based transport (GO:0010970)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|nervous system development (GO:0007399)	cell leading edge (GO:0031252)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dynactin complex (GO:0005869)|dynein complex (GO:0030286)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|spindle pole (GO:0000922)	motor activity (GO:0003774)	p.S651R(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(20)|ovary(4)|prostate(1)|skin(3)	45						CAGCAGCAAAGCTGAGTTGCT	0.602																																																1	Substitution - Missense(1)	ovary(1)	2											47.0	44.0	45.0					2																	74595160		2203	4300	6503	74448668	SO:0001583	missense	1639				CCDS1939.1, CCDS46341.1, CCDS46342.1, CCDS54368.1, CCDS54369.1	2p13	2014-09-17	2010-06-24		ENSG00000204843	ENSG00000204843			2711	protein-coding gene	gene with protein product	"""p150 glued homolog (Drosophila)"""	601143	"""dynactin 1 (p150, Glued (Drosophila) homolog)"""			1828535	Standard	NM_001190836		Approved		uc002skx.3	Q14203	OTTHUMG00000129963	ENST00000361874.3:c.1953C>G	2.37:g.74595160G>C	ENSP00000354791:p.Ser651Arg		74448668	A8MY36|B4DM45|E9PFS5|E9PGE1|G5E9H4|O95296|Q6IQ37|Q9BRM9|Q9UIU1|Q9UIU2	Missense_Mutation	SNP	HMMPfam_CAP_GLY;superfamily_Docking domain B of the erythromycin polyketide synthase (DEBS);superfamily_Spectrin repeat;superfamily_Cap-Gly domain	p.S651R	ENST00000361874.3	37	c.1953	CCDS1939.1	2	.	.	.	.	.	.	.	.	.	.	G	15.99	2.994614	0.54041	.	.	ENSG00000204843	ENST00000361874;ENST00000394003;ENST00000393999;ENST00000407639;ENST00000409438;ENST00000409240;ENST00000409868;ENST00000409567	D;D;D;D;D;D;D	0.83335	-1.71;-1.71;-1.71;-1.71;-1.71;-1.71;-1.71	5.25	2.44	0.29823	.	0.000000	0.51477	D	0.000092	D	0.86535	0.5956	L	0.49350	1.555	0.58432	D	0.999998	D;P;D;P;D;D	0.89917	1.0;0.767;0.997;0.621;0.996;0.997	D;P;D;B;D;D	0.79784	0.993;0.603;0.992;0.348;0.931;0.986	D	0.85565	0.1230	10	0.59425	D	0.04	-6.3144	10.2639	0.43443	0.2268:0.0:0.7732:0.0	.	631;614;651;644;517;517	E9PGE1;E9PFS5;Q14203;A8MY36;Q14203-2;G5E9H4	.;.;DCTN1_HUMAN;.;.;.	R	651;644;634;517;517;614;634;631	ENSP00000354791:S651R;ENSP00000377571:S644R;ENSP00000384844:S517R;ENSP00000387270:S517R;ENSP00000386406:S614R;ENSP00000387327:S634R;ENSP00000386843:S631R	ENSP00000354791:S651R	S	-	3	2	DCTN1	74448668	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.847000	0.55895	0.779000	0.33543	0.655000	0.94253	AGC	-	NULL		0.602	DCTN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DCTN1	protein_coding	OTTHUMT00000252227.3	G	NM_004082		74448668	-1	no_errors	NM_004082	genbank	human	reviewed	54_36p	missense	SNP	1	C
AFF3	3899	genome.wustl.edu	37	2	100175348	100175348	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr2:100175348C>G	ENST00000409236.2	-	20	3386	c.3274G>C	c.(3274-3276)Gac>Cac	p.D1092H	AFF3_ENST00000356421.2_Missense_Mutation_p.D1117H|AFF3_ENST00000317233.4_Missense_Mutation_p.D1092H|AFF3_ENST00000409579.1_Missense_Mutation_p.D1117H			P51826	AFF3_HUMAN	AF4/FMR2 family, member 3	1092					embryonic hindlimb morphogenesis (GO:0035116)|regulation of transcription, DNA-templated (GO:0006355)|response to tumor necrosis factor (GO:0034612)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)	p.D1117H(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(9)|kidney(4)|large_intestine(20)|liver(1)|lung(28)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(3)	86						TTGAAATAGTCGATTAGTGCT	0.443											OREG0014830	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	2											125.0	118.0	121.0					2																	100175348		2203	4300	6503	99541780	SO:0001583	missense	3899			U34360	CCDS33258.1, CCDS42723.1	2q11.2-q12	2008-02-05	2005-06-27	2005-06-27	ENSG00000144218	ENSG00000144218			6473	protein-coding gene	gene with protein product		601464	"""lymphoid nuclear protein related to AF4"""	LAF4		8662235, 8555498	Standard	XM_005263945		Approved	MLLT2-like	uc002taf.3	P51826	OTTHUMG00000153011	ENST00000409236.2:c.3274G>C	2.37:g.100175348C>G	ENSP00000387207:p.Asp1092His	1349	99541780	B7ZM46|B9EGL9|D3DVI6|Q53RD6|Q53S47|Q53SI6|Q53TB9|Q59F27|Q8IWJ5	Missense_Mutation	SNP	HMMPfam_AF-4	p.D1117H	ENST00000409236.2	37	c.3349	CCDS42723.1	2	.	.	.	.	.	.	.	.	.	.	C	19.79	3.893294	0.72524	.	.	ENSG00000144218	ENST00000317233;ENST00000356421;ENST00000409579;ENST00000409236;ENST00000445815	T;T;T;T;T	0.66099	-0.19;-0.19;-0.19;-0.19;-0.19	5.72	5.72	0.89469	.	0.121669	0.53938	D	0.000042	T	0.80276	0.4593	M	0.76574	2.34	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.75020	0.985;0.928	T	0.81512	-0.0899	10	0.87932	D	0	.	19.8968	0.96969	0.0:1.0:0.0:0.0	.	1092;1117	P51826;P51826-2	AFF3_HUMAN;.	H	1092;1117;1117;1092;134	ENSP00000317421:D1092H;ENSP00000348793:D1117H;ENSP00000386834:D1117H;ENSP00000387207:D1092H;ENSP00000416685:D134H	ENSP00000317421:D1092H	D	-	1	0	AFF3	99541780	1.000000	0.71417	0.998000	0.56505	0.687000	0.40016	6.044000	0.71012	2.691000	0.91804	0.655000	0.94253	GAC	-	HMMPfam_AF-4		0.443	AFF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AFF3	protein_coding	OTTHUMT00000328982.3	C	NM_002285		99541780	-1	no_errors	NM_001025108	genbank	human	reviewed	54_36p	missense	SNP	1	G
SH3BP4	23677	genome.wustl.edu	37	2	235950811	235950811	+	Silent	SNP	G	G	A			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr2:235950811G>A	ENST00000409212.1	+	4	1905	c.1398G>A	c.(1396-1398)gtG>gtA	p.V466V	SH3BP4_ENST00000392011.2_Silent_p.V466V|SH3BP4_ENST00000344528.4_Silent_p.V466V			Q9P0V3	SH3B4_HUMAN	SH3-domain binding protein 4	466					cellular response to amino acid stimulus (GO:0071230)|endocytosis (GO:0006897)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of GTPase activity (GO:0034260)|negative regulation of TOR signaling (GO:0032007)|positive regulation of autophagy (GO:0010508)|protein localization to lysosome (GO:0061462)|regulation of catalytic activity (GO:0050790)	coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	GDP-dissociation inhibitor activity (GO:0005092)|identical protein binding (GO:0042802)|Ras GTPase binding (GO:0017016)	p.V466V(1)		central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(6)|lung(13)|ovary(4)|prostate(2)|skin(6)|stomach(3)|urinary_tract(2)	44		Breast(86;0.000332)|Renal(207;0.00339)|all_lung(227;0.00458)|all_hematologic(139;0.0296)|Lung NSC(271;0.0419)		Epithelial(121;7.66e-20)|BRCA - Breast invasive adenocarcinoma(100;0.000402)|Lung(119;0.00299)|LUSC - Lung squamous cell carcinoma(224;0.00645)|GBM - Glioblastoma multiforme(43;0.237)		CTTCCACCGTGTGGGACTTCA	0.552																																																1	Substitution - coding silent(1)	ovary(1)	2											58.0	60.0	59.0					2																	235950811		2203	4300	6503	235615550	SO:0001819	synonymous_variant	23677			AF147747	CCDS2513.1	2q37.1-q37.2	2008-05-15			ENSG00000130147	ENSG00000130147			10826	protein-coding gene	gene with protein product		605611				10644451	Standard	NM_014521		Approved		uc002vvp.3	Q9P0V3	OTTHUMG00000133292	ENST00000409212.1:c.1398G>A	2.37:g.235950811G>A			235615550	O95082|Q309A3|Q53QD0|Q53TD1	Silent	SNP	-	p.V466	ENST00000409212.1	37	c.1398	CCDS2513.1	2																																																																																			-	NULL		0.552	SH3BP4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SH3BP4	protein_coding	OTTHUMT00000329763.1	G			235615550	1	no_errors	NM_014521	genbank	human	reviewed	54_36p	silent	SNP	0.8	A
NCOA6	23054	genome.wustl.edu	37	20	33330093	33330093	+	Missense_Mutation	SNP	G	G	A	rs181662709		TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr20:33330093G>A	ENST00000374796.2	-	12	6537	c.3967C>T	c.(3967-3969)Cgg>Tgg	p.R1323W	NCOA6_ENST00000359003.2_Missense_Mutation_p.R1323W			Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	1323					brain development (GO:0007420)|cellular lipid metabolic process (GO:0044255)|cellular response to DNA damage stimulus (GO:0006974)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-templated transcription, initiation (GO:0006352)|glucocorticoid receptor signaling pathway (GO:0042921)|heart development (GO:0007507)|intracellular estrogen receptor signaling pathway (GO:0030520)|labyrinthine layer blood vessel development (GO:0060716)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)	histone methyltransferase complex (GO:0035097)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)	p.R1323W(2)		NS(2)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(8)|large_intestine(16)|lung(37)|ovary(4)|prostate(5)|skin(13)|upper_aerodigestive_tract(2)|urinary_tract(1)	107						GGACTTGCCCGTTTTGTTGCT	0.453																																																2	Substitution - Missense(2)	ovary(2)	20											139.0	138.0	138.0					20																	33330093		2203	4300	6503	32793754	SO:0001583	missense	23054			AF128458	CCDS13241.1, CCDS74720.1	20q11	2008-08-01			ENSG00000198646	ENSG00000198646			15936	protein-coding gene	gene with protein product	"""nuclear receptor coactivator RAP250"", ""activating signal cointegrator-2"", ""peroxisome proliferator-activated receptor interacting protein"""	605299				8724849, 8263591	Standard	NM_014071		Approved	KIAA0181, RAP250, ASC2, AIB3, PRIP, TRBP, NRC	uc002xaw.3	Q14686	OTTHUMG00000032311	ENST00000374796.2:c.3967C>T	20.37:g.33330093G>A	ENSP00000363929:p.Arg1323Trp		32793754	A6NLF1|B2RMN5|E1P5P7|Q9NTZ9|Q9UH74|Q9UK86	Missense_Mutation	SNP	-	p.R1323W	ENST00000374796.2	37	c.3967	CCDS13241.1	20	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	G	16.30	3.084708	0.55861	.	.	ENSG00000198646	ENST00000374796;ENST00000359003	T;T	0.31510	1.49;1.49	5.98	5.02	0.67125	.	0.000000	0.64402	D	0.000007	T	0.45438	0.1342	L	0.32530	0.975	0.58432	D	0.999997	D	0.89917	1.0	D	0.91635	0.999	T	0.46775	-0.9167	10	0.87932	D	0	-14.3735	14.9392	0.70980	0.0:0.0:0.7266:0.2734	.	1323	Q14686	NCOA6_HUMAN	W	1323	ENSP00000363929:R1323W;ENSP00000351894:R1323W	ENSP00000351894:R1323W	R	-	1	2	NCOA6	32793754	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	2.918000	0.48829	1.503000	0.48686	0.591000	0.81541	CGG	-	NULL		0.453	NCOA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCOA6	protein_coding	OTTHUMT00000078811.2	G	NM_014071		32793754	-1	no_errors	NM_014071	genbank	human	reviewed	54_36p	missense	SNP	1	A
IFT52	51098	genome.wustl.edu	37	20	42264597	42264597	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr20:42264597C>G	ENST00000373030.3	+	11	1085	c.955C>G	c.(955-957)Cca>Gca	p.P319A	IFT52_ENST00000373039.4_Missense_Mutation_p.P319A	NM_016004.2	NP_057088.2	Q9Y366	IFT52_HUMAN	intraflagellar transport 52	319					cilium morphogenesis (GO:0060271)|dorsal/ventral pattern formation (GO:0009953)|embryonic digit morphogenesis (GO:0042733)|heart looping (GO:0001947)|intraciliary transport (GO:0042073)|negative regulation of epithelial cell proliferation (GO:0050680)|neural tube formation (GO:0001841)|regulation of protein processing (GO:0070613)|smoothened signaling pathway (GO:0007224)	centriole (GO:0005814)|ciliary base (GO:0097546)|ciliary tip (GO:0097542)|cilium (GO:0005929)|dendrite terminus (GO:0044292)|intraciliary transport particle B (GO:0030992)|motile cilium (GO:0031514)|photoreceptor connecting cilium (GO:0032391)	protein C-terminus binding (GO:0008022)	p.P319A(1)		endometrium(5)|kidney(1)|large_intestine(2)|lung(10)|ovary(2)|urinary_tract(1)	21		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)			GAAACATGAACCACTCCAGCT	0.522																																																1	Substitution - Missense(1)	ovary(1)	20											118.0	105.0	109.0					20																	42264597		2203	4300	6503	41698011	SO:0001583	missense	51098			AF151811	CCDS33470.1	20q12-q13.1	2014-07-03	2014-07-03	2005-11-02	ENSG00000101052	ENSG00000101052		"""Intraflagellar transport homologs"""	15901	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 9"", ""intraflagellar transport 52 homolog (Chlamydomonas)"""	C20orf9		10810093	Standard	NM_016004		Approved	CGI-53, NGD5, dJ1028D15.1, NGD2	uc002xkw.3	Q9Y366	OTTHUMG00000032513	ENST00000373030.3:c.955C>G	20.37:g.42264597C>G	ENSP00000362121:p.Pro319Ala		41698011	B3KMA1|E1P5W9|Q5H8Z0|Q9H1G3|Q9H1G4|Q9H1H2	Missense_Mutation	SNP	-	p.P319A	ENST00000373030.3	37	c.955	CCDS33470.1	20	.	.	.	.	.	.	.	.	.	.	C	13.96	2.392376	0.42410	.	.	ENSG00000101052	ENST00000373030;ENST00000373039	.	.	.	5.53	5.53	0.82687	.	0.155526	0.64402	N	0.000015	T	0.62307	0.2417	M	0.75264	2.295	0.51482	D	0.999929	B	0.20052	0.041	B	0.17979	0.02	T	0.58994	-0.7537	9	0.38643	T	0.18	-12.6457	13.5649	0.61813	0.1559:0.8441:0.0:0.0	.	319	Q9Y366	IFT52_HUMAN	A	319	.	ENSP00000362121:P319A	P	+	1	0	IFT52	41698011	1.000000	0.71417	1.000000	0.80357	0.925000	0.55904	3.697000	0.54764	2.770000	0.95276	0.650000	0.86243	CCA	-	NULL		0.522	IFT52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFT52	protein_coding	OTTHUMT00000079317.1	C	NM_016004		41698011	1	no_errors	NM_016004	genbank	human	validated	54_36p	missense	SNP	1	G
RIMS4	140730	genome.wustl.edu	37	20	43400046	43400046	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr20:43400046G>A	ENST00000372851.3	-	2	172	c.106C>T	c.(106-108)Cgg>Tgg	p.R36W	RIMS4_ENST00000541604.2_Missense_Mutation_p.R37W	NM_001205317.1|NM_182970.3	NP_001192246.1|NP_892015.1	Q9H426	RIMS4_HUMAN	regulating synaptic membrane exocytosis 4	36					exocytosis (GO:0006887)|neurotransmitter transport (GO:0006836)|regulation of membrane potential (GO:0042391)	cell junction (GO:0030054)|presynaptic active zone (GO:0048786)|synaptic membrane (GO:0097060)		p.R36W(1)		central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(11)|ovary(5)|urinary_tract(1)	29		Myeloproliferative disorder(115;0.0122)				TTCAGCCTCCGGCTGTCCCCT	0.622																																																1	Substitution - Missense(1)	ovary(1)	20											55.0	55.0	55.0					20																	43400046		2203	4300	6503	42833460	SO:0001583	missense	140730				CCDS13338.1, CCDS56191.1	20q13.12	2005-02-03	2003-06-18	2003-06-20	ENSG00000101098	ENSG00000101098			16183	protein-coding gene	gene with protein product		611601	"""chromosome 20 open reading frame 190"""	C20orf190		12620390	Standard	NM_182970		Approved	dJ781B1.3	uc010ggu.3	Q9H426	OTTHUMG00000032546	ENST00000372851.3:c.106C>T	20.37:g.43400046G>A	ENSP00000361942:p.Arg36Trp		42833460	A4FU94|E1P613|Q3MI44|Q5JWT7	Missense_Mutation	SNP	-	p.R36W	ENST00000372851.3	37	c.106	CCDS13338.1	20	.	.	.	.	.	.	.	.	.	.	G	20.2	3.948065	0.73787	.	.	ENSG00000101098	ENST00000372851;ENST00000541604	T;T	0.25912	1.83;1.77	4.37	4.37	0.52481	.	0.000000	0.85682	D	0.000000	T	0.41673	0.1169	L	0.50333	1.59	0.58432	D	0.999998	D;D	0.76494	0.998;0.999	P;D	0.63793	0.881;0.918	T	0.33929	-0.9849	10	0.87932	D	0	.	13.1683	0.59583	0.0:0.0:0.8396:0.1604	.	37;36	E1P613;Q9H426	.;RIMS4_HUMAN	W	36;37	ENSP00000361942:R36W;ENSP00000439287:R37W	ENSP00000361942:R36W	R	-	1	2	RIMS4	42833460	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	3.390000	0.52523	2.148000	0.66965	0.551000	0.68910	CGG	-	NULL		0.622	RIMS4-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	RIMS4	protein_coding	OTTHUMT00000101027.2	G	NM_182970		42833460	-1	no_errors	NM_182970	genbank	human	validated	54_36p	missense	SNP	1	A
ANGPT4	51378	genome.wustl.edu	37	20	858888	858888	+	Missense_Mutation	SNP	C	C	T	rs201791557		TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr20:858888C>T	ENST00000381922.3	-	7	1238	c.1136G>A	c.(1135-1137)cGt>cAt	p.R379H	ANGPT4_ENST00000546022.1_Missense_Mutation_p.R379H	NM_015985.2	NP_057069.1	Q9Y264	ANGP4_HUMAN	angiopoietin 4	379	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cellular response to hypoxia (GO:0071456)|leukocyte migration (GO:0050900)|negative regulation of angiogenesis (GO:0016525)|negative regulation of apoptotic process (GO:0043066)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	receptor tyrosine kinase binding (GO:0030971)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)	p.R379H(1)		breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(12)|ovary(2)|prostate(1)	27						CAGCTCCACACGCAGAGAGTA	0.612																																					Pancreas(181;481 2077 3259 31286 49856)											1	Substitution - Missense(1)	ovary(1)	20						C	HIS/ARG	0,4406		0,0,2203	63.0	52.0	55.0		1136	5.5	1.0	20		55	1,8599	1.2+/-3.3	0,1,4299	no	missense	ANGPT4	NM_015985.2	29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	379/504	858888	1,13005	2203	4300	6503	806888	SO:0001583	missense	51378			AF074332	CCDS13009.1	20p13	2013-02-06			ENSG00000101280	ENSG00000101280		"""Fibrinogen C domain containing"""	487	protein-coding gene	gene with protein product		603705				10051567, 10218486	Standard	NM_015985		Approved		uc002wei.3	Q9Y264	OTTHUMG00000031652	ENST00000381922.3:c.1136G>A	20.37:g.858888C>T	ENSP00000371347:p.Arg379His		806888	B4E3J9|Q5TFF4|Q9H4Z4	Missense_Mutation	SNP	HMMPfam_Fibrinogen_C;superfamily_DnaK suppressor protein DksA alpha-hairpin domain;superfamily_Fibrinogen C-terminal domain-like	p.R379H	ENST00000381922.3	37	c.1136	CCDS13009.1	20	.	.	.	.	.	.	.	.	.	.	C	31	5.078938	0.94050	0.0	1.16E-4	ENSG00000101280	ENST00000381922;ENST00000546022	T;T	0.80909	-1.43;-1.43	5.5	5.5	0.81552	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 1 (1);	0.000000	0.85682	D	0.000000	D	0.86188	0.5873	M	0.72894	2.215	0.58432	D	0.999999	D;D	0.61697	0.99;0.99	P;P	0.54060	0.741;0.659	D	0.86003	0.1496	10	0.48119	T	0.1	.	18.1469	0.89661	0.0:1.0:0.0:0.0	.	379;379	B4E3J9;Q9Y264	.;ANGP4_HUMAN	H	379	ENSP00000371347:R379H;ENSP00000439605:R379H	ENSP00000371347:R379H	R	-	2	0	ANGPT4	806888	0.998000	0.40836	0.972000	0.41901	0.979000	0.70002	4.740000	0.62087	2.861000	0.98227	0.655000	0.94253	CGT	-	HMMPfam_Fibrinogen_C		0.612	ANGPT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANGPT4	protein_coding	OTTHUMT00000077493.1	C	NM_015985		806888	-1	no_errors	NM_015985	genbank	human	reviewed	54_36p	missense	SNP	0.97	T
WFDC10B	280664	genome.wustl.edu	37	20	44313569	44313569	+	Missense_Mutation	SNP	A	A	G			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr20:44313569A>G	ENST00000330523.5	-	4	352	c.122T>C	c.(121-123)aTa>aCa	p.I41T	WFDC10B_ENST00000335769.2_Missense_Mutation_p.I57T	NM_172006.2	NP_742003.1	Q8IUB3	WF10B_HUMAN	WAP four-disulfide core domain 10B	41	WAP. {ECO:0000255|PROSITE- ProRule:PRU00722}.					extracellular region (GO:0005576)	peptidase inhibitor activity (GO:0030414)	p.I41T(1)		lung(2)|ovary(1)|stomach(1)	4		Myeloproliferative disorder(115;0.0122)				GCATAGATCTATGCTGGGTCG	0.438																																																1	Substitution - Missense(1)	ovary(1)	20											135.0	114.0	121.0					20																	44313569		2203	4300	6503	43746983	SO:0001583	missense	280664			AF454506	CCDS13365.1, CCDS13366.1	20q13.12	2013-01-21			ENSG00000182931	ENSG00000182931		"""WAP four-disulfide core domain containing"""	20479	protein-coding gene	gene with protein product						12206714	Standard	NM_172006		Approved	WAP12	uc002xpb.3	Q8IUB3	OTTHUMG00000130227	ENST00000330523.5:c.122T>C	20.37:g.44313569A>G	ENSP00000327628:p.Ile41Thr		43746983	A6PVD7|Q0VAG0|Q0VAG1|Q5TGZ5|Q8IUB4	Missense_Mutation	SNP	-	p.I57T	ENST00000330523.5	37	c.170	CCDS13366.1	20	.	.	.	.	.	.	.	.	.	.	A	11.96	1.793194	0.31685	.	.	ENSG00000182931	ENST00000330523;ENST00000335769	T;T	0.21734	1.99;1.99	3.75	-1.87	0.07737	Whey acidic protein, 4-disulphide core (1);	.	.	.	.	T	0.10465	0.0256	.	.	.	0.09310	N	1	B;B	0.14012	0.009;0.009	B;B	0.11329	0.006;0.006	T	0.34129	-0.9841	8	0.26408	T	0.33	.	4.4326	0.11535	0.3979:0.1936:0.4084:0.0	.	57;41	Q8IUB3-2;Q8IUB3	.;WF10B_HUMAN	T	41;57	ENSP00000327628:I41T;ENSP00000337466:I57T	ENSP00000327628:I41T	I	-	2	0	WFDC10B	43746983	0.000000	0.05858	0.000000	0.03702	0.320000	0.28249	-0.208000	0.09371	-0.373000	0.07979	0.379000	0.24179	ATA	-	NULL		0.438	WFDC10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WFDC10B	protein_coding	OTTHUMT00000252547.1	A			43746983	-1	no_errors	NM_172131	genbank	human	reviewed	54_36p	missense	SNP		G
SAMSN1	64092	genome.wustl.edu	37	21	15870796	15870796	+	Silent	SNP	G	G	A			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr21:15870796G>A	ENST00000400566.1	-	7	967	c.886C>T	c.(886-888)Cta>Tta	p.L296L	SAMSN1_ENST00000463807.1_5'UTR|SAMSN1_ENST00000400564.1_Silent_p.L128L|SAMSN1_ENST00000285670.2_Silent_p.L364L	NM_022136.4	NP_071419.3	Q9NSI8	SAMN1_HUMAN	SAM domain, SH3 domain and nuclear localization signals 1	296	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.				negative regulation of adaptive immune response (GO:0002820)|negative regulation of B cell activation (GO:0050869)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)	cell projection (GO:0042995)|cytosol (GO:0005829)|nucleus (GO:0005634)	phosphotyrosine binding (GO:0001784)|poly(A) RNA binding (GO:0044822)	p.L296L(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(9)|ovary(3)|pancreas(1)|prostate(3)|urinary_tract(1)	24				Epithelial(23;0.000155)|COAD - Colon adenocarcinoma(22;0.00118)|Colorectal(24;0.00961)|Lung(58;0.164)		GCAGCTGATAGTAACCTTCTT	0.333																																																1	Substitution - coding silent(1)	ovary(1)	21											110.0	99.0	103.0					21																	15870796		1815	4074	5889	14792667	SO:0001819	synonymous_variant	64092			AF222927	CCDS42906.1, CCDS58786.1, CCDS74774.1	21q11	2013-01-10	2006-12-13		ENSG00000155307	ENSG00000155307		"""SAM and SH3 domain containing"", ""Sterile alpha motif (SAM) domain containing"""	10528	protein-coding gene	gene with protein product	"""nuclear localization signals, SAM and SH3 domain containing 1"", ""SAM and SH3 domain containing 2"", ""hematopoietic adapter-containing SH3 and sterile &#945;-motif (SAM) domains 1"", ""Src homology domain 3 (SH3)-containing adapter protein SH3 lymphocyte protein 2"""	607978				11536050, 11594764	Standard	NM_022136		Approved	NASH1, SASH2, SH3D6B, HACS1, SLy2	uc002yjv.1	Q9NSI8	OTTHUMG00000074317	ENST00000400566.1:c.886C>T	21.37:g.15870796G>A			14792667	B3KWJ3|F8WAA1|Q8NFF7|Q9C041	Silent	SNP	superfamily_SH3-domain;superfamily_SAM/Pointed domain;HMMPfam_SAM_2;HMMPfam_SH3_2	p.L296	ENST00000400566.1	37	c.886	CCDS42906.1	21																																																																																			-	HMMPfam_SAM_2		0.333	SAMSN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SAMSN1	protein_coding	OTTHUMT00000157914.1	G			14792667	-1	no_errors	NM_022136	genbank	human	validated	54_36p	silent	SNP	1	A
LTN1	26046	genome.wustl.edu	37	21	30358518	30358518	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr21:30358518G>A	ENST00000361371.5	-	3	366	c.287C>T	c.(286-288)aCa>aTa	p.T96I	LTN1_ENST00000389195.2_Missense_Mutation_p.T142I|LTN1_ENST00000389194.2_Missense_Mutation_p.T142I			O94822	LTN1_HUMAN	listerin E3 ubiquitin protein ligase 1	96					protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.T96I(1)		NS(1)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(12)|lung(19)|ovary(5)|pancreas(1)|prostate(2)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)	60						CACAGTTTCTGTGTCTCTCTC	0.308																																																1	Substitution - Missense(1)	ovary(1)	21											62.0	63.0	62.0					21																	30358518		2202	4298	6500	29280389	SO:0001583	missense	26046			AK001915	CCDS33527.1, CCDS33527.2	21q21.3	2013-01-09	2010-09-17	2010-09-17	ENSG00000198862	ENSG00000198862		"""RING-type (C3HC4) zinc fingers"""	13082	protein-coding gene	gene with protein product	"""listerin"""	613083	"""chromosome 21 open reading frame 98"", ""zinc finger protein 294"", ""ring finger protein 160"""	C21orf98, C21orf10, ZNF294, RNF160		20835226, 19196968	Standard	NM_015565		Approved	KIAA0714, FLJ11053, LISTERIN	uc002ymr.2	O94822	OTTHUMG00000078803	ENST00000361371.5:c.287C>T	21.37:g.30358518G>A	ENSP00000354977:p.Thr96Ile		29280389	A6NL41|A7E2D0|B2RTS0|C9J7U3|J3KPL4|Q05C47|Q9H8M4|Q9NUY5|Q9P0E9	Missense_Mutation	SNP	HMMPfam_zf-C3HC4;superfamily_ARM repeat;superfamily_RING/U-box	p.T96I	ENST00000361371.5	37	c.287		21	.	.	.	.	.	.	.	.	.	.	G	14.99	2.699741	0.48307	.	.	ENSG00000198862	ENST00000389194;ENST00000361371;ENST00000446611;ENST00000389195	T;T;T	0.66460	3.56;3.56;-0.21	4.2	4.2	0.49525	Armadillo-like helical (1);Armadillo-type fold (1);	0.154150	0.41396	D	0.000889	T	0.52386	0.1731	L	0.29908	0.895	0.39876	D	0.973573	B	0.24823	0.112	B	0.25140	0.058	T	0.53479	-0.8433	10	0.37606	T	0.19	.	10.403	0.44241	0.0896:0.0:0.9104:0.0	.	96	O94822	LTN1_HUMAN	I	142;96;98;142	ENSP00000373846:T142I;ENSP00000354977:T96I;ENSP00000373847:T142I	ENSP00000354977:T96I	T	-	2	0	LTN1	29280389	0.632000	0.27172	1.000000	0.80357	0.989000	0.77384	3.491000	0.53252	2.190000	0.69967	0.467000	0.42956	ACA	-	NULL		0.308	LTN1-008	NOVEL	basic|appris_principal	protein_coding	RNF160	protein_coding	OTTHUMT00000472108.1	G	NM_015565		29280389	-1	no_errors	NM_015565	genbank	human	validated	54_36p	missense	SNP	1	A
SYNJ1	8867	genome.wustl.edu	37	21	34058111	34058111	+	Silent	SNP	G	G	C			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr21:34058111G>C	ENST00000322229.7	-	8	1064	c.1065C>G	c.(1063-1065)gtC>gtG	p.V355V	SYNJ1_ENST00000382491.3_Silent_p.V355V|SYNJ1_ENST00000382499.2_Silent_p.V394V|SYNJ1_ENST00000357345.3_Silent_p.V355V|SYNJ1_ENST00000433931.2_Silent_p.V394V			O43426	SYNJ1_HUMAN	synaptojanin 1	355	SAC. {ECO:0000255|PROSITE- ProRule:PRU00183}.				cell death (GO:0008219)|inositol phosphate metabolic process (GO:0043647)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of synaptic vesicle uncoating (GO:1903390)|regulation of synaptic vesicle membrane organization (GO:1901632)|small molecule metabolic process (GO:0044281)|synaptic vesicle endocytosis (GO:0048488)	cytosol (GO:0005829)	inositol-polyphosphate 5-phosphatase activity (GO:0004445)|nucleotide binding (GO:0000166)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|RNA binding (GO:0003723)	p.V355V(1)		breast(1)|cervix(1)|endometrium(13)|kidney(5)|large_intestine(13)|lung(11)|ovary(4)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	57						GAAACTTCTGGACTTGAGGTT	0.333																																																1	Substitution - coding silent(1)	ovary(1)	21											111.0	106.0	107.0					21																	34058111		2202	4300	6502	32979982	SO:0001819	synonymous_variant	8867			AF009040	CCDS33539.1, CCDS33540.1, CCDS33539.2, CCDS33540.2, CCDS54483.1	21q22.2	2008-06-23			ENSG00000159082	ENSG00000159082			11503	protein-coding gene	gene with protein product		604297				9428629, 10773674	Standard	NM_203446		Approved	INPP5G	uc002yqh.2	O43426	OTTHUMG00000064926	ENST00000322229.7:c.1065C>G	21.37:g.34058111G>C			32979982	O43425|O94984|Q4KMR1	Silent	SNP	HMMPfam_Syja_N;HMMPfam_Exo_endo_phos;HMMPfam_DUF1866;superfamily_RNA-binding domain RBD;superfamily_DNase I-like	p.V355	ENST00000322229.7	37	c.1065	CCDS54484.1	21																																																																																			-	NULL		0.333	SYNJ1-201	KNOWN	basic|CCDS	protein_coding	SYNJ1	protein_coding		G			32979982	-1	no_errors	NM_003895	genbank	human	validated	54_36p	silent	SNP	1	C
TRAV1-1	28693	genome.wustl.edu	37	14	22090639	22090639	+	RNA	SNP	G	G	A			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr14:22090639G>A	ENST00000542354.1	+	0	311									T cell receptor alpha variable 1-1																		TCATTCCTTAGTCGCTCTGAT	0.483																																																0			14											222.0	197.0	205.0					14																	22090639		1917	4130	6047	21160479			0			AE000658		14q11.2	2012-02-07			ENSG00000255569	ENSG00000255569		"""T cell receptors / TRA locus"""	12101	other	T cell receptor gene						8188290	Standard	NG_001332		Approved	TRAV11, TCRAV1S1, TCRAV7S1			OTTHUMG00000168977		14.37:g.22090639G>A			21160479		Missense_Mutation	SNP	-	p.S82N	ENST00000542354.1	37	c.245		14																																																																																			-	NULL		0.483	TRAV1-1-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	TR_V_gene	uc001wbi.2	TR_V_gene	OTTHUMT00000401872.1	G	NG_001332		21160479	1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000390422	ensembl	human	known	54_36p	missense	SNP		A
SEZ6L	23544	genome.wustl.edu	37	22	26706763	26706763	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	C	C	A	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr22:26706763C>A	ENST00000248933.6	+	7	1737	c.1642C>A	c.(1642-1644)Cag>Aag	p.Q548K	SEZ6L_ENST00000403121.1_Missense_Mutation_p.Q321K|SEZ6L_ENST00000360929.3_Missense_Mutation_p.Q548K|SEZ6L_ENST00000343706.4_Missense_Mutation_p.Q548K|SEZ6L_ENST00000404234.3_Missense_Mutation_p.Q548K|SEZ6L_ENST00000529632.2_Missense_Mutation_p.Q548K|SEZ6L_ENST00000402979.1_Missense_Mutation_p.Q321K			Q9BYH1	SE6L1_HUMAN	seizure related 6 homolog (mouse)-like	548	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.				adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)		p.Q548K(1)		breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(35)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	80						CACGTCCGACCAGGCCCGGGC	0.602																																																1	Substitution - Missense(1)	ovary(1)	22											103.0	90.0	94.0					22																	26706763		2203	4300	6503	25036763	SO:0001583	missense	23544			AL050253	CCDS13833.1, CCDS54508.1, CCDS54510.1, CCDS54511.1, CCDS74837.1	22q12.1	2008-05-14	2001-11-28		ENSG00000100095	ENSG00000100095			10763	protein-coding gene	gene with protein product		607021	"""seizure related gene 6 (mouse)-like"""				Standard	NM_021115		Approved		uc003acb.3	Q9BYH1	OTTHUMG00000150870	ENST00000248933.6:c.1642C>A	22.37:g.26706763C>A	ENSP00000248933:p.Gln548Lys		25036763	A0AUW7|B0QYG4|B0QYG5|B7ZLJ6|G8JLP3|O95917|Q5THY5|Q6IBZ4|Q6UXD4|Q9NUI3|Q9NUI4|Q9NUI5|Q9Y2E1|Q9Y3J6	Missense_Mutation	SNP	HMMPfam_Sushi;HMMPfam_CUB;superfamily_Spermadhesin CUB domain;superfamily_Complement control module/SCR domain	p.Q548K	ENST00000248933.6	37	c.1642	CCDS13833.1	22	.	.	.	.	.	.	.	.	.	.	C	7.035	0.561341	0.13498	.	.	ENSG00000100095	ENST00000404234;ENST00000529632;ENST00000360929;ENST00000248933;ENST00000343706;ENST00000403121;ENST00000402979	T;T;T;T;T;T;T	0.16897	2.31;2.31;2.31;2.31;2.31;2.31;2.31	5.04	2.79	0.32731	CUB (5);	0.228496	0.28624	N	0.014681	T	0.11281	0.0275	N	0.10972	0.075	0.58432	D	0.999998	P;B;P;P;P;B;B	0.36789	0.515;0.367;0.507;0.57;0.57;0.367;0.367	B;B;B;B;B;B;B	0.40825	0.248;0.338;0.257;0.341;0.341;0.338;0.338	T	0.24941	-1.0146	10	0.23302	T	0.38	.	14.7557	0.69564	0.0:0.5663:0.4337:0.0	.	548;548;321;548;548;548;548	B7ZLJ8;B7ZLJ6;B0QYH4;Q9BYH1-5;Q9BYH1-4;B0QYG3;Q9BYH1	.;.;.;.;.;.;SE6L1_HUMAN	K	548;548;548;548;548;321;321	ENSP00000384772:Q548K;ENSP00000437037:Q548K;ENSP00000354185:Q548K;ENSP00000248933:Q548K;ENSP00000342661:Q548K;ENSP00000384838:Q321K;ENSP00000384733:Q321K	ENSP00000248933:Q548K	Q	+	1	0	SEZ6L	25036763	1.000000	0.71417	0.009000	0.14445	0.031000	0.12232	1.431000	0.34925	1.248000	0.43934	-0.304000	0.09214	CAG	-	NULL		0.602	SEZ6L-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SEZ6L	protein_coding	OTTHUMT00000320359.3	C			25036763	1	no_errors	NM_021115	genbank	human	validated	54_36p	missense	SNP	0.88	A
DMC1	11144	genome.wustl.edu	37	22	38964241	38964241	+	Silent	SNP	C	C	T			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr22:38964241C>T	ENST00000216024.2	-	2	297	c.21G>A	c.(19-21)gtG>gtA	p.V7V	DMC1_ENST00000428462.2_Silent_p.V7V|DMC1_ENST00000464842.1_5'Flank	NM_007068.2	NP_008999.2	Q14565	DMC1_HUMAN	DNA meiotic recombinase 1	7					female gamete generation (GO:0007292)|male meiosis I (GO:0007141)|meiotic nuclear division (GO:0007126)|oocyte maturation (GO:0001556)|ovarian follicle development (GO:0001541)|reciprocal meiotic recombination (GO:0007131)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|synapsis (GO:0007129)	chromosome (GO:0005694)|chromosome, telomeric region (GO:0000781)|condensed nuclear chromosome (GO:0000794)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)	p.V7V(1)		large_intestine(5)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	11	Melanoma(58;0.0286)					GTTCTTCCGCCACAACTTGAT	0.368								Homologous recombination																																								1	Substitution - coding silent(1)	ovary(1)	22											98.0	96.0	96.0					22																	38964241		2203	4300	6503	37294187	SO:0001819	synonymous_variant	11144			D63882	CCDS13973.1, CCDS63477.1	22q13.1	2013-05-02	2013-05-02		ENSG00000100206	ENSG00000100206			2927	protein-coding gene	gene with protein product		602721	"""DMC1 (dosage suppressor of mck1, yeast homolog) meiosis-specific homologous recombination"", ""DMC1 dosage suppressor of mck1 homolog, meiosis-specific homologous recombination (yeast)"""			8602360, 8590282, 17541404	Standard	NM_007068		Approved	LIM15	uc003avz.2	Q14565	OTTHUMG00000151088	ENST00000216024.2:c.21G>A	22.37:g.38964241C>T			37294187	A8K9A2|B4DMW6|Q08AI1|Q99498|Q9UH11	Silent	SNP	HMMPfam_HHH;superfamily_Rad51 N-terminal domain-like;HMMPfam_Rad51;superfamily_P-loop containing nucleoside triphosphate hydrolases	p.V7	ENST00000216024.2	37	c.21	CCDS13973.1	22																																																																																			-	NULL		0.368	DMC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMC1	protein_coding	OTTHUMT00000321246.2	C	NM_007068		37294187	-1	no_errors	NM_007068	genbank	human	reviewed	54_36p	silent	SNP	0.53	T
ABI3BP	25890	genome.wustl.edu	37	3	100566471	100566471	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr3:100566471G>T	ENST00000284322.5	-	17	1606	c.1497C>A	c.(1495-1497)agC>agA	p.S499R	ABI3BP_ENST00000383691.4_5'Flank|ABI3BP_ENST00000495063.1_Missense_Mutation_p.S548R|ABI3BP_ENST00000471714.1_Missense_Mutation_p.S548R	NM_015429.3	NP_056244.2	Q7Z7G0	TARSH_HUMAN	ABI family, member 3 (NESH) binding protein	499	Pro-rich.				extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	extracellular space (GO:0005615)|interstitial matrix (GO:0005614)	heparin binding (GO:0008201)	p.S500R(1)		central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(18)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	50						TAGGTTCAGGGCTTTTAGAAA	0.368																																																1	Substitution - Missense(1)	ovary(1)	3											307.0	292.0	297.0					3																	100566471		1839	4082	5921	102049161	SO:0001583	missense	25890			AB056106	CCDS46880.1	3q12.2	2013-02-11	2008-09-12		ENSG00000154175	ENSG00000154175		"""Fibronectin type III domain containing"""	17265	protein-coding gene	gene with protein product	"""target of Nesh-SH3"""	606279				11501947	Standard	NM_015429		Approved	NESHBP, DKFZP586L2024, TARSH	uc003dun.3	Q7Z7G0	OTTHUMG00000159094	ENST00000284322.5:c.1497C>A	3.37:g.100566471G>T	ENSP00000284322:p.Ser499Arg		102049161	B3KSL4|Q6ZW20|Q6ZW22|Q9C082|Q9UFI6	Missense_Mutation	SNP	HMMPfam_fn3;superfamily_Fibronectin type III	p.S499R	ENST00000284322.5	37	c.1497	CCDS46880.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.23|11.23	1.578409|1.578409	0.28180|0.28180	.|.	.|.	ENSG00000154175|ENSG00000154175	ENST00000528490;ENST00000533855|ENST00000471714;ENST00000284322;ENST00000495063	.|T;T;T	.|0.56444	.|0.46;0.46;0.46	4.64|4.64	-2.6|-2.6	0.06190|0.06190	.|.	.|2.627910	.|0.01152	.|N	.|0.006449	T|T	0.17152|0.17152	0.0412|0.0412	N|N	0.00321|0.00321	-1.65|-1.65	0.09310|0.09310	N|N	1|1	.|B;B	.|0.06786	.|0.001;0.0	.|B;B	.|0.06405	.|0.002;0.0	T|T	0.12041|0.12041	-1.0563|-1.0563	5|10	.|0.45353	.|T	.|0.12	-0.1002|-0.1002	1.5323|1.5323	0.02538|0.02538	0.3897:0.1318:0.3441:0.1344|0.3897:0.1318:0.3441:0.1344	.|.	.|548;499	.|Q5JPC9;Q7Z7G0	.|.;TARSH_HUMAN	D|R	16;177|548;499;548	.|ENSP00000420524:S548R;ENSP00000284322:S499R;ENSP00000433993:S548R	.|ENSP00000284322:S499R	A|S	-|-	2|3	0|2	ABI3BP|ABI3BP	102049161|102049161	0.000000|0.000000	0.05858|0.05858	0.115000|0.115000	0.21578|0.21578	0.998000|0.998000	0.95712|0.95712	-1.238000|-1.238000	0.02919|0.02919	-0.687000|-0.687000	0.05162|0.05162	0.591000|0.591000	0.81541|0.81541	GCC|AGC	-	NULL		0.368	ABI3BP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ABI3BP	protein_coding	OTTHUMT00000353260.1	G			102049161	-1	no_errors	NM_015429	genbank	human	validated	54_36p	missense	SNP	0.1	T
DPPA2	151871	genome.wustl.edu	37	3	109026937	109026937	+	Silent	SNP	C	C	T			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr3:109026937C>T	ENST00000478945.1	-	6	846	c.600G>A	c.(598-600)aaG>aaA	p.K200K		NM_138815.3	NP_620170.3	Q7Z7J5	DPPA2_HUMAN	developmental pluripotency associated 2	200					lung-associated mesenchyme development (GO:0060484)|positive regulation of stem cell proliferation (GO:2000648)|regulation of histone methylation (GO:0031060)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|nucleic acid binding (GO:0003676)	p.K200K(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(19)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						AATTCAAAGCCTTAGGCTGAA	0.463																																																1	Substitution - coding silent(1)	ovary(1)	3											112.0	102.0	105.0					3																	109026937		2203	4300	6503	110509627	SO:0001819	synonymous_variant	151871			AY283672	CCDS2956.1	3q13.13	2010-05-04			ENSG00000163530	ENSG00000163530			19197	protein-coding gene	gene with protein product	"""cancer/testis antigen 100"""	614445				15583978	Standard	NM_138815		Approved	PESCRG1, CT100	uc003dxo.3	Q7Z7J5	OTTHUMG00000159227	ENST00000478945.1:c.600G>A	3.37:g.109026937C>T			110509627	Q8WVF0	Silent	SNP	-	p.K200	ENST00000478945.1	37	c.600	CCDS2956.1	3																																																																																			-	NULL		0.463	DPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPPA2	protein_coding	OTTHUMT00000353938.1	C	NM_138815		110509627	-1	no_errors	NM_138815	genbank	human	provisional	54_36p	silent	SNP	0.01	T
CASR	846	genome.wustl.edu	37	3	121975939	121975939	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr3:121975939G>A	ENST00000490131.1	+	3	569	c.197G>A	c.(196-198)cGt>cAt	p.R66H	CASR_ENST00000498619.1_Missense_Mutation_p.R66H|CASR_ENST00000296154.5_Missense_Mutation_p.R66H	NM_000388.3	NP_000379	P41180	CASR_HUMAN	calcium-sensing receptor	66			R -> C (in HHC1). {ECO:0000269|PubMed:7726161}.		anatomical structure morphogenesis (GO:0009653)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|chemosensory behavior (GO:0007635)|detection of calcium ion (GO:0005513)|G-protein coupled receptor signaling pathway (GO:0007186)|metabolic process (GO:0008152)|ossification (GO:0001503)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|phosphatidylinositol phospholipase C activity (GO:0004435)	p.R66H(1)		NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(45)|ovary(4)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	84				GBM - Glioblastoma multiforme(114;0.226)	Cinacalcet(DB01012)	TATAATTTCCGTGGGTTTCGC	0.443																																																1	Substitution - Missense(1)	ovary(1)	3											79.0	82.0	81.0					3																	121975939		2203	4300	6503	123458629	SO:0001583	missense	846			U20760	CCDS3010.1, CCDS54632.1	3q21.1	2012-08-29	2008-08-01		ENSG00000036828	ENSG00000036828		"""GPCR / Class C : Calcium-sensing receptors"""	1514	protein-coding gene	gene with protein product	"""severe neonatal hyperparathyroidism"""	601199	"""hypocalciuric hypercalcemia 1"""	HHC, HHC1		7677761	Standard	NM_000388		Approved	FHH, NSHPT, GPRC2A	uc003eew.4	P41180	OTTHUMG00000159491	ENST00000490131.1:c.197G>A	3.37:g.121975939G>A	ENSP00000418685:p.Arg66His		123458629	Q13912|Q16108|Q16109|Q16110|Q16379|Q2M1T0|Q4PJ19	Missense_Mutation	SNP	-	p.R66H	ENST00000490131.1	37	c.197	CCDS3010.1	3	.	.	.	.	.	.	.	.	.	.	G	16.24	3.066105	0.55539	.	.	ENSG00000036828	ENST00000490131;ENST00000498619;ENST00000296154	D;D;D	0.86497	-2.13;-2.13;-2.13	5.84	4.97	0.65823	.	0.000000	0.85682	D	0.000000	D	0.92227	0.7535	M	0.68952	2.095	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.78314	0.991;0.965	D	0.92952	0.6381	10	0.87932	D	0	.	14.2176	0.65805	0.0714:0.0:0.9286:0.0	.	66;66	E7ENE0;P41180	.;CASR_HUMAN	H	66	ENSP00000418685:R66H;ENSP00000420194:R66H;ENSP00000296154:R66H	ENSP00000296154:R66H	R	+	2	0	CASR	123458629	1.000000	0.71417	0.930000	0.37139	0.005000	0.04900	9.869000	0.99810	1.473000	0.48159	-0.150000	0.13652	CGT	-	NULL		0.443	CASR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CASR	protein_coding	OTTHUMT00000355761.1	G	NM_000388		123458629	1	no_errors	NM_000388	genbank	human	reviewed	54_36p	missense	SNP	1	A
GYG1	2992	genome.wustl.edu	37	3	148714548	148714548	+	Missense_Mutation	SNP	A	A	T			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr3:148714548A>T	ENST00000345003.4	+	4	638	c.338A>T	c.(337-339)gAt>gTt	p.D113V	GYG1_ENST00000484197.1_Missense_Mutation_p.D113V|GYG1_ENST00000483267.1_Missense_Mutation_p.D113V|GYG1_ENST00000296048.6_Missense_Mutation_p.D113V	NM_004130.3	NP_004121.2	P46976	GLYG_HUMAN	glycogenin 1	113					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen catabolic process (GO:0005980)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	glucose binding (GO:0005536)|glycogenin glucosyltransferase activity (GO:0008466)|metal ion binding (GO:0046872)	p.D113V(1)		breast(1)|central_nervous_system(1)|endometrium(2)|lung(3)|ovary(1)	8			LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)			AATATTGATGATCTTTTTGAC	0.433																																																1	Substitution - Missense(1)	ovary(1)	3											86.0	85.0	86.0					3																	148714548		2203	4300	6503	150197238	SO:0001583	missense	2992			AF087942	CCDS3139.1, CCDS54654.1, CCDS54655.1	3q24-q25.1	2013-02-22	2005-11-04	2005-11-04	ENSG00000163754	ENSG00000163754	2.4.1.186	"""Glycosyltransferase family 8 domain containing"""	4699	protein-coding gene	gene with protein product	"""glycogenin glucosyltransferase"""	603942	"""glycogenin"""	GYG		8602861	Standard	NM_004130		Approved		uc003ewn.3	P46976	OTTHUMG00000159533	ENST00000345003.4:c.338A>T	3.37:g.148714548A>T	ENSP00000340736:p.Asp113Val		150197238	D3DNH0|D3DNH1|D3DNH2|Q6FHZ1|Q9UNV0	Missense_Mutation	SNP	-	p.D113V	ENST00000345003.4	37	c.338	CCDS3139.1	3	.	.	.	.	.	.	.	.	.	.	A	28.8	4.949287	0.92660	.	.	ENSG00000163754	ENST00000345003;ENST00000296048;ENST00000483267;ENST00000484197;ENST00000492285;ENST00000461191	T;T;T;T;T;T	0.45668	0.89;0.89;0.89;0.89;0.89;0.89	6.07	6.07	0.98685	.	0.044047	0.85682	D	0.000000	T	0.64091	0.2567	M	0.73372	2.23	0.80722	D	1	P;P;P;P	0.48998	0.918;0.888;0.774;0.808	P;D;P;P	0.63597	0.544;0.916;0.755;0.604	T	0.66337	-0.5949	10	0.87932	D	0	-30.6372	16.686	0.85306	1.0:0.0:0.0:0.0	.	113;113;113;113	G5E9W8;D3DNH0;P46976-2;P46976	.;.;.;GLYG_HUMAN	V	113;113;113;113;67;113	ENSP00000340736:D113V;ENSP00000296048:D113V;ENSP00000419499:D113V;ENSP00000420683:D113V;ENSP00000418297:D67V;ENSP00000420247:D113V	ENSP00000296048:D113V	D	+	2	0	GYG1	150197238	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	8.923000	0.92808	2.340000	0.79590	0.529000	0.55759	GAT	-	NULL		0.433	GYG1-001	KNOWN	basic|CCDS	protein_coding	GYG1	protein_coding	OTTHUMT00000356046.1	A	NM_004130		150197238	1	no_errors	NM_004130	genbank	human	provisional	54_36p	missense	SNP	1	T
GPR149	344758	genome.wustl.edu	37	3	154146463	154146463	+	Silent	SNP	G	G	T			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr3:154146463G>T	ENST00000389740.2	-	1	1041	c.942C>A	c.(940-942)atC>atA	p.I314I		NM_001038705.1	NP_001033794.1	Q86SP6	GP149_HUMAN	G protein-coupled receptor 149	314					antral ovarian follicle growth (GO:0001547)|estrous cycle phase (GO:0060206)|negative regulation of ovulation (GO:0060280)|preantral ovarian follicle growth (GO:0001546)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.I314I(1)		autonomic_ganglia(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(22)|ovary(7)|prostate(1)|skin(1)|urinary_tract(2)	47			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)			TAAGCGCTAGGATCAAAGCGA	0.562																																																1	Substitution - coding silent(1)	ovary(1)	3											103.0	102.0	102.0					3																	154146463		1975	4149	6124	155629157	SO:0001819	synonymous_variant	344758			AY255534	CCDS43162.1	3q25.2	2012-08-21			ENSG00000174948	ENSG00000174948		"""GPCR / Class A : Orphans"""	23627	protein-coding gene	gene with protein product						12679517	Standard	NM_001038705		Approved	PGR10, IEDA	uc003faa.3	Q86SP6	OTTHUMG00000159131	ENST00000389740.2:c.942C>A	3.37:g.154146463G>T			155629157		Silent	SNP	-	p.I314	ENST00000389740.2	37	c.942	CCDS43162.1	3																																																																																			-	NULL		0.562	GPR149-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR149	protein_coding	OTTHUMT00000353430.1	G	XM_293580		155629157	-1	no_errors	NM_001038705	genbank	human	provisional	54_36p	silent	SNP	1	T
ITPR1	3708	genome.wustl.edu	37	3	4808381	4808381	+	Silent	SNP	A	A	G			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr3:4808381A>G	ENST00000443694.2	+	42	5667	c.5667A>G	c.(5665-5667)ccA>ccG	p.P1889P	ITPR1_ENST00000302640.8_Silent_p.P1889P|ITPR1_ENST00000357086.4_Silent_p.P1856P|ITPR1_ENST00000354582.6_Silent_p.P1889P|ITPR1_ENST00000423119.2_Silent_p.P1856P|ITPR1_ENST00000456211.2_Silent_p.P1841P|ITPR1_ENST00000544951.1_Intron			Q14643	ITPR1_HUMAN	inositol 1,4,5-trisphosphate receptor, type 1	1904					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of calcium-mediated signaling (GO:0050849)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|post-embryonic development (GO:0009791)|regulation of insulin secretion (GO:0050796)|release of sequestered calcium ion into cytosol (GO:0051209)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|voluntary musculoskeletal movement (GO:0050882)	calcineurin complex (GO:0005955)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear inner membrane (GO:0005637)|nucleolus (GO:0005730)|platelet dense granule membrane (GO:0031088)|platelet dense tubular network (GO:0031094)|platelet dense tubular network membrane (GO:0031095)|postsynaptic density (GO:0014069)|sarcoplasmic reticulum (GO:0016529)	calcium channel inhibitor activity (GO:0019855)|calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)	p.P1841P(1)		NS(1)|autonomic_ganglia(1)|breast(10)|endometrium(15)|kidney(6)|large_intestine(27)|liver(1)|lung(27)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(2)	106				Epithelial(13;0.0199)|OV - Ovarian serous cystadenocarcinoma(96;0.0361)|all cancers(10;0.0982)	Caffeine(DB00201)	GGGATGCCCCATCACGGAAAA	0.438																																																1	Substitution - coding silent(1)	ovary(1)	3											70.0	67.0	68.0					3																	4808381		1928	4127	6055	4783381	SO:0001819	synonymous_variant	3708			D26070	CCDS46740.1, CCDS46740.2, CCDS54550.1, CCDS54551.1	3p26.1	2014-06-12	2011-04-28			ENSG00000150995		"""Ion channels / Inositol triphosphate receptors"""	6180	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 94"""	147265	"""spinocerebellar ataxia 15"", ""spinocerebellar ataxia 16"", ""spinocerebellar ataxia 29"""	SCA15, SCA16, SCA29		7945203, 7500840, 17590087, 17932120, 22986007	Standard	NM_001099952		Approved	Insp3r1, IP3R1, ACV, PPP1R94	uc003bqc.3	Q14643		ENST00000443694.2:c.5667A>G	3.37:g.4808381A>G			4783381	E7EPX7|E9PDE9|Q14660|Q99897	Silent	SNP	-	p.P1856	ENST00000443694.2	37	c.5568	CCDS54551.1	3																																																																																			-	NULL		0.438	ITPR1-004	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	ITPR1	protein_coding	OTTHUMT00000337982.3	A	NM_002222		4783381	1	no_errors	NM_001099952	genbank	human	validated	54_36p	silent	SNP		G
NEK10	152110	genome.wustl.edu	37	3	27216207	27216207	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr3:27216207C>A	ENST00000429845.2	-	28	2985	c.2623G>T	c.(2623-2625)Gac>Tac	p.D875Y	NEK10_ENST00000383771.4_Missense_Mutation_p.D187Y|NEK10_ENST00000295720.6_Missense_Mutation_p.D187Y|NEK10_ENST00000357467.2_Missense_Mutation_p.D272Y|NEK10_ENST00000383770.3_Missense_Mutation_p.D187Y|NEK10_ENST00000498182.1_5'UTR			Q6ZWH5	NEK10_HUMAN	NIMA-related kinase 10	875					positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein autophosphorylation (GO:0031954)|protein phosphorylation (GO:0006468)|regulation of cell cycle G2/M phase transition (GO:1902749)|regulation of ERK1 and ERK2 cascade (GO:0070372)	protein kinase complex (GO:1902911)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.D875Y(1)		NS(2)|breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(5)|pancreas(1)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	41						CTGTCTTCGTCTTTACCATAG	0.502																																																1	Substitution - Missense(1)	ovary(1)	3											138.0	135.0	136.0					3																	27216207		2203	4300	6503	27191211	SO:0001583	missense	152110			AK123061, AK057247	CCDS46781.1	3p24.1	2012-11-15	2012-11-15		ENSG00000163491	ENSG00000163491			18592	protein-coding gene	gene with protein product			"""NIMA (never in mitosis gene a)- related kinase 10"""			15289607	Standard	NM_199347		Approved	FLJ32685	uc003cdt.2	Q6ZWH5	OTTHUMG00000130571	ENST00000429845.2:c.2623G>T	3.37:g.27216207C>A	ENSP00000395849:p.Asp875Tyr		27191211	A8MWG1|B9ZVR0|Q45VJ4|Q6ZR11|Q7Z671|Q86XB1|Q96MB3	Missense_Mutation	SNP	-	p.D272Y	ENST00000429845.2	37	c.814		3	.	.	.	.	.	.	.	.	.	.	C	15.81	2.942631	0.53079	.	.	ENSG00000163491	ENST00000295720;ENST00000383771;ENST00000383770;ENST00000357467	T;T;T;T	0.75154	2.64;2.68;2.96;-0.91	5.91	5.91	0.95273	.	.	.	.	.	D	0.85318	0.5669	.	.	.	0.32548	N	0.532769	D;D;P	0.58620	0.957;0.983;0.911	P;P;P	0.61201	0.854;0.885;0.522	D	0.87757	0.2596	8	0.66056	D	0.02	.	18.485	0.90825	0.0:1.0:0.0:0.0	.	187;187;272	Q6ZWH5-5;Q6ZWH5-7;Q8N774	.;.;.	Y	187;187;187;272	ENSP00000295720:D187Y;ENSP00000373281:D187Y;ENSP00000373280:D187Y;ENSP00000350059:D272Y	ENSP00000295720:D187Y	D	-	1	0	NEK10	27191211	1.000000	0.71417	0.403000	0.26384	0.177000	0.22998	3.110000	0.50352	2.807000	0.96579	0.557000	0.71058	GAC	-	NULL		0.502	NEK10-016	NOVEL	basic|appris_principal	protein_coding	NEK10	protein_coding	OTTHUMT00000438156.1	C	NM_152534		27191211	-1	no_errors	ENST00000396636	ensembl	human	known	54_36p	missense	SNP	1	A
USP19	10869	genome.wustl.edu	37	3	49154036	49154036	+	Silent	SNP	G	G	A			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr3:49154036G>A	ENST00000398888.2	-	7	1146	c.828C>T	c.(826-828)ccC>ccT	p.P276P	USP19_ENST00000398898.2_Silent_p.P314P|USP19_ENST00000398896.1_Silent_p.P82P|USP19_ENST00000417901.1_Silent_p.P377P|USP19_ENST00000398892.3_Silent_p.P314P|USP19_ENST00000434032.2_Silent_p.P377P|USP19_ENST00000453664.1_Silent_p.P367P|USP19_ENST00000488993.1_5'Flank	NM_006677.2	NP_006668.1	O94966	UBP19_HUMAN	ubiquitin specific peptidase 19	276					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|negative regulation of skeletal muscle tissue development (GO:0048642)|positive regulation of cell cycle process (GO:0090068)|protein deubiquitination (GO:0016579)|regulation of cellular response to hypoxia (GO:1900037)|regulation of protein stability (GO:0031647)|response to endoplasmic reticulum stress (GO:0034976)|skeletal muscle atrophy (GO:0014732)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|ubiquitin-specific protease activity (GO:0004843)	p.P362P(1)		NS(1)|breast(3)|endometrium(5)|kidney(2)|large_intestine(10)|lung(5)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	38				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		CCATCGACTCGGGCTCTATAT	0.532																																																1	Substitution - coding silent(1)	ovary(1)	3											79.0	79.0	79.0					3																	49154036		2060	4199	6259	49129040	SO:0001819	synonymous_variant	10869			AB020698	CCDS43090.1, CCDS56254.1, CCDS56255.1, CCDS56256.1	3p21.31	2005-10-13	2005-08-08		ENSG00000172046	ENSG00000172046		"""Zinc fingers, MYND-type"", ""Ubiquitin-specific peptidases"""	12617	protein-coding gene	gene with protein product		614471	"""ubiquitin specific protease 19"""			12838346	Standard	NM_001199160		Approved	KIAA0891, ZMYND9	uc011bch.2	O94966	OTTHUMG00000133611	ENST00000398888.2:c.828C>T	3.37:g.49154036G>A			49129040	A5PKX8|A6H8U2|B4DGT3|B4DTZ0|E7EN22|E7ETS0|E9PEG8|Q3KQW4|Q641Q9|Q6NZY8|Q86XV9	Silent	SNP	-	p.P276	ENST00000398888.2	37	c.828	CCDS43090.1	3																																																																																			-	NULL		0.532	USP19-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	USP19	protein_coding	OTTHUMT00000257721.1	G	NM_006677		49129040	-1	no_errors	NM_006677	genbank	human	provisional	54_36p	silent	SNP	0.78	A
OR5H15	403274	genome.wustl.edu	37	3	97888306	97888306	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr3:97888306C>A	ENST00000356526.2	+	1	763	c.763C>A	c.(763-765)Ctt>Att	p.L255I		NM_001005515.1	NP_001005515.1	A6NDH6	O5H15_HUMAN	olfactory receptor, family 5, subfamily H, member 15	255						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L255I(1)		NS(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(20)|ovary(1)|prostate(1)|skin(2)|stomach(1)	35						CTATGGCCCCCTTCTCTTAAT	0.433																																																1	Substitution - Missense(1)	ovary(1)	3											95.0	98.0	97.0					3																	97888306		2203	4300	6503	99370996	SO:0001583	missense	403274				CCDS33799.1	3q11.2	2013-09-23			ENSG00000233412	ENSG00000233412		"""GPCR / Class A : Olfactory receptors"""	31287	protein-coding gene	gene with protein product							Standard	NM_001005515		Approved		uc011bgu.2	A6NDH6	OTTHUMG00000160076	ENST00000356526.2:c.763C>A	3.37:g.97888306C>A	ENSP00000373195:p.Leu255Ile		99370996		Missense_Mutation	SNP	-	p.L255I	ENST00000356526.2	37	c.763	CCDS33799.1	3	.	.	.	.	.	.	.	.	.	.	-	8.869	0.948702	0.18356	.	.	ENSG00000233412	ENST00000356526;ENST00000454529	T	0.00069	8.77	2.48	2.48	0.30137	GPCR, rhodopsin-like superfamily (1);	0.000000	0.42548	D	0.000696	T	0.00210	0.0006	L	0.31926	0.97	0.09310	N	1	D	0.89917	1.0	D	0.91635	0.999	T	0.56202	-0.8018	10	0.11485	T	0.65	.	7.3073	0.26455	0.0:0.7234:0.2766:0.0	.	255	A6NDH6	O5H15_HUMAN	I	255	ENSP00000373195:L255I	ENSP00000373195:L255I	L	+	1	0	OR5H15	99370996	0.000000	0.05858	0.006000	0.13384	0.013000	0.08279	-0.674000	0.05233	1.386000	0.46466	0.184000	0.17185	CTT	-	NULL		0.433	OR5H15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5H15	protein_coding	OTTHUMT00000359109.1	C			99370996	1	no_errors	NM_001005515	genbank	human	provisional	54_36p	missense	SNP		A
ZDHHC19	131540	genome.wustl.edu	37	3	195938140	195938140	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_III	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr3:195938140G>A	ENST00000296326.3	-	1	126	c.47C>T	c.(46-48)cCc>cTc	p.P16L	ZDHHC19_ENST00000488508.1_5'UTR	NM_001039617.1	NP_001034706.1	Q8WVZ1	ZDH19_HUMAN	zinc finger, DHHC-type containing 19	16						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)	p.P16L(1)		breast(1)|endometrium(1)|large_intestine(1)|liver(1)|lung(7)|ovary(3)	14	all_cancers(143;1.68e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;1.89e-25)|all cancers(36;1.46e-23)|OV - Ovarian serous cystadenocarcinoma(49;2.1e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.0022)		CAGAGGCAGGGGATGGGGCTC	0.622																																																1	Substitution - Missense(1)	ovary(1)	3											113.0	147.0	136.0					3																	195938140		2106	4219	6325	197422537	SO:0001583	missense	131540			BC022078	CCDS43190.1	3q29	2008-05-02			ENSG00000163958	ENSG00000163958		"""Zinc fingers, DHHC-type"""	20713	protein-coding gene	gene with protein product							Standard	XR_246038		Approved	MGC33345	uc003fwc.3	Q8WVZ1	OTTHUMG00000133642	ENST00000296326.3:c.47C>T	3.37:g.195938140G>A	ENSP00000296326:p.Pro16Leu		197422537	A8MSY6|B3KVI1	Missense_Mutation	SNP	-	p.P16L	ENST00000296326.3	37	c.47	CCDS43190.1	3	.	.	.	.	.	.	.	.	.	.	G	11.79	1.743897	0.30865	.	.	ENSG00000163958	ENST00000296326	T	0.29655	1.56	4.96	-2.01	0.07410	.	1.382910	0.04795	N	0.432358	T	0.20333	0.0489	L	0.31294	0.92	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.28459	-1.0043	10	0.48119	T	0.1	-3.1891	3.7871	0.08704	0.0803:0.3709:0.2817:0.2671	.	16	Q8WVZ1	ZDH19_HUMAN	L	16	ENSP00000296326:P16L	ENSP00000296326:P16L	P	-	2	0	ZDHHC19	197422537	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	0.192000	0.17096	-0.245000	0.09625	0.555000	0.69702	CCC	-	NULL		0.622	ZDHHC19-007	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	ZDHHC19	protein_coding	OTTHUMT00000341533.1	G	NM_144637		197422537	-1	no_errors	NM_001039617	genbank	human	validated	54_36p	missense	SNP	0	A
AVL9	23080	genome.wustl.edu	37	7	32878045	32878045	+	Intron	SNP	G	G	A			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr7:32878045G>A	ENST00000404479.1	+	11	1215							Q8NBF6	AVL9_HUMAN	AVL9 homolog (S. cerevisiase)						cell migration (GO:0016477)	integral component of membrane (GO:0016021)|recycling endosome (GO:0055037)				endometrium(3)|kidney(1)|large_intestine(3)|lung(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	18						CAGTATGCCTGAAATTTGGGA	0.408																																																0			7																																								32844570	SO:0001627	intron_variant	100133317			D87682	CCDS34613.1	7p14.3	2013-05-01	2008-10-03	2008-10-03	ENSG00000105778	ENSG00000105778			28994	protein-coding gene	gene with protein product		612927	"""KIAA0241"""	KIAA0241		17229886, 22595670	Standard	XM_005249668		Approved		uc003tcv.1	Q8NBF6	OTTHUMG00000152929	ENST00000404479.1:c.1216-191177G>A	7.37:g.32878045G>A			32844570	Q92573	RNA	SNP	-	NULL	ENST00000404479.1	37	NULL		7																																																																																			-	-		0.408	AVL9-201	KNOWN	basic	protein_coding	LOC100133317	protein_coding		G	NM_015060		32844570	1	pseudogene	XR_039293	genbank	human	model	54_36p	rna	SNP	1	A
TUBB8P12	260334	genome.wustl.edu	37	18	47469	47469	+	Missense_Mutation	SNP	A	A	C			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	A	A	A	C	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr18:47469A>C	ENST00000573909.1	-	3	1686	c.1154T>G	c.(1153-1155)gTg>gGg	p.V385G	RP11-683L23.1_ENST00000308911.6_Missense_Mutation_p.V419G|RP11-683L23.1_ENST00000594555.1_5'Flank														p.V419G(1)									ATATTCAGACACCAGGTCGTT	0.547																																																1	Substitution - Missense(1)	ovary(1)	18																																								37469	SO:0001583	missense	0																														ENST00000573909.1:c.1154T>G	18.37:g.47469A>C	ENSP00000459638:p.Val385Gly		37469		Missense_Mutation	SNP	HMMPfam_Tubulin;HMMPfam_Tubulin_C;superfamily_SSF52490;superfamily_SSF55307	p.V419G	ENST00000573909.1	37	c.1256		18	.	.	.	.	.	.	.	.	.	.	.	9.524	1.108965	0.20714	.	.	ENSG00000173213	ENST00000308911	T	0.72394	-0.65	0.149	0.149	0.14863	.	0.103535	0.37095	U	0.002246	T	0.67277	0.2876	.	.	.	0.27567	N	0.950012	.	.	.	.	.	.	T	0.69453	-0.5141	6	0.87932	D	0	.	4.6416	0.12552	0.9996:0.0:4.0E-4:0.0	.	.	.	.	G	419	ENSP00000309431:V419G	ENSP00000309431:V419G	V	-	2	0	RP11-683L23.1	37469	1.000000	0.71417	0.005000	0.12908	0.005000	0.04900	6.233000	0.72320	0.166000	0.19597	0.164000	0.16699	GTG	-	NULL		0.547	RP11-683L23.1-002	PUTATIVE	not_best_in_genome_evidence|basic	protein_coding	uc010djz.1	protein_coding	OTTHUMT00000439819.1	A			37469	-1	no_errors	ENST00000308911	ensembl	human	known	54_36p	missense	SNP	1	C
HTRA3	94031	genome.wustl.edu	37	4	8305998	8305998	+	Silent	SNP	T	T	G			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	T	T	T	G	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr4:8305998T>G	ENST00000307358.2	+	8	1392	c.1188T>G	c.(1186-1188)ccT>ccG	p.P396P		NM_053044.3	NP_444272.1	P83110	HTRA3_HUMAN	HtrA serine peptidase 3	396	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)	endopeptidase activity (GO:0004175)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.P396P(1)		central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)|liver(1)|lung(6)|ovary(2)|prostate(1)|urinary_tract(1)	18						CGAATTCACCTTCTCAGAGGT	0.587																																																1	Substitution - coding silent(1)	ovary(1)	4											62.0	62.0	62.0					4																	8305998		2203	4300	6503	8356898	SO:0001819	synonymous_variant	94031			AY040094	CCDS3400.1, CCDS75105.1	4p16.1	2008-02-05			ENSG00000170801	ENSG00000170801			30406	protein-coding gene	gene with protein product	"""pregnancy-related serine protease"""	608785				12513693, 14500695	Standard	XM_005248040		Approved	Tasp, Prsp	uc003gla.3	P83110	OTTHUMG00000090561	ENST00000307358.2:c.1188T>G	4.37:g.8305998T>G			8356898	Q7Z7A2	Silent	SNP	-	p.P396	ENST00000307358.2	37	c.1188	CCDS3400.1	4																																																																																			-	NULL		0.587	HTRA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTRA3	protein_coding	OTTHUMT00000092669.1	T	NM_053044		8356898	1	no_errors	NM_053044	genbank	human	provisional	54_36p	silent	SNP	1	G
FRAS1	80144	genome.wustl.edu	37	4	79351519	79351519	+	Silent	SNP	G	G	A			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr4:79351519G>A	ENST00000325942.6	+	37	5357	c.4917G>A	c.(4915-4917)caG>caA	p.Q1639Q	FRAS1_ENST00000264895.6_Silent_p.Q1639Q	NM_001166133.1	NP_001159605.1	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1	1639					cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)	p.Q1639Q(1)		breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						GACCTCCACAGCATGGTGTGC	0.522																																																1	Substitution - coding silent(1)	ovary(1)	4											63.0	65.0	64.0					4																	79351519		1961	4173	6134	79570543	SO:0001819	synonymous_variant	80144			AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000325942.6:c.4917G>A	4.37:g.79351519G>A			79570543	A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Silent	SNP	-	p.Q1639	ENST00000325942.6	37	c.4917	CCDS54772.1	4	.	.	.	.	.	.	.	.	.	.	G	0.284	-0.984419	0.02180	.	.	ENSG00000138759	ENST00000510944	.	.	.	5.68	3.85	0.44370	.	.	.	.	.	T	0.55513	0.1925	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.52888	-0.8515	4	.	.	.	.	6.2983	0.21099	0.075:0.1109:0.6522:0.1619	.	.	.	.	T	89	.	.	A	+	1	0	FRAS1	79570543	0.266000	0.24112	0.901000	0.35422	0.053000	0.15095	0.468000	0.22051	1.536000	0.49237	0.591000	0.81541	GCA	-	NULL		0.522	FRAS1-001	NOVEL	basic|CCDS	protein_coding	FRAS1	protein_coding	OTTHUMT00000362706.2	G			79570543	1	no_errors	ENST00000380674	ensembl	human	known	54_36p	silent	SNP	0.35	A
SLC9B1	150159	genome.wustl.edu	37	4	103827787	103827787	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr4:103827787C>G	ENST00000296422.7	-	10	1242	c.1101G>C	c.(1099-1101)aaG>aaC	p.K367N	SLC9B1_ENST00000512651.2_Intron|SLC9B1_ENST00000394789.3_Missense_Mutation_p.K367N	NM_139173.3	NP_631912	Q4ZJI4	SL9B1_HUMAN	solute carrier family 9, subfamily B (NHA1, cation proton antiporter 1), member 1	367					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	solute:proton antiporter activity (GO:0015299)	p.K367N(1)									TCGTAATAATCTTTTGGACTT	0.303																																																1	Substitution - Missense(1)	ovary(1)	4											25.0	33.0	30.0					4																	103827787		1310	2254	3564	104047236	SO:0001583	missense	150159			AF447585	CCDS34041.1, CCDS47119.1	4q24	2013-05-22	2012-03-22	2011-07-26	ENSG00000164037	ENSG00000164037		"""Solute carriers"""	24244	protein-coding gene	gene with protein product		611527	"""Na+/H+ exchanger domain containing 1"", ""solute carrier family 9, subfamily B (cation proton antiporter 2), member 1"""	NHEDC1		16850186	Standard	NM_139173		Approved	NHA1	uc003hww.3	Q4ZJI4	OTTHUMG00000161114	ENST00000296422.7:c.1101G>C	4.37:g.103827787C>G	ENSP00000296422:p.Lys367Asn		104047236	A1KXV1|B9EH04|C9JBP7|Q49A30|Q8NCV2|Q8WVZ0	Missense_Mutation	SNP	-	p.K367N	ENST00000296422.7	37	c.1101	CCDS34041.1	4	.	.	.	.	.	.	.	.	.	.	C	11.75	1.732296	0.30684	.	.	ENSG00000164037	ENST00000394789;ENST00000296422;ENST00000511253	T;T;T	0.48522	2.19;2.2;0.81	3.25	-0.657	0.11432	.	0.800333	0.11877	N	0.520894	T	0.52108	0.1714	M	0.78637	2.42	0.09310	N	0.999998	P;D;P	0.53151	0.868;0.958;0.948	P;P;P	0.52598	0.674;0.703;0.66	T	0.44128	-0.9348	10	0.52906	T	0.07	-26.2824	2.6838	0.05102	0.3296:0.2123:0.0:0.458	.	135;367;367	Q4ZJI4-2;Q4ZJI4;Q4ZJI4-3	.;SL9B1_HUMAN;.	N	367;367;92	ENSP00000378269:K367N;ENSP00000296422:K367N;ENSP00000425544:K92N	ENSP00000296422:K367N	K	-	3	2	SLC9B1	104047236	0.881000	0.30235	0.032000	0.17829	0.140000	0.21249	0.019000	0.13444	-0.113000	0.11958	-0.482000	0.04802	AAG	-	NULL		0.303	SLC9B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NHEDC1	protein_coding	OTTHUMT00000363841.1	C	NM_139173		104047236	-1	no_errors	NM_139173	genbank	human	reviewed	54_36p	missense	SNP	0.38	G
FBXL7	23194	genome.wustl.edu	37	5	15928325	15928325	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr5:15928325C>T	ENST00000504595.1	+	3	935	c.454C>T	c.(454-456)Cgg>Tgg	p.R152W	FBXL7_ENST00000329673.7_Missense_Mutation_p.R140W|FBXL7_ENST00000510662.1_Missense_Mutation_p.R105W	NM_001278317.1|NM_012304.3	NP_001265246.1|NP_036436.1	Q9UJT9	FBXL7_HUMAN	F-box and leucine-rich repeat protein 7	152	F-box. {ECO:0000255|PROSITE- ProRule:PRU00080}.				cell proliferation (GO:0008283)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic nuclear division (GO:0007067)|protein ubiquitination (GO:0016567)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|ubiquitin-dependent protein catabolic process (GO:0006511)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)	p.R152W(1)		cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(13)|lung(33)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	60						CTGGGACCCGCGGCTCTGGAG	0.667																																																1	Substitution - Missense(1)	ovary(1)	5											16.0	20.0	18.0					5																	15928325		2059	4212	6271	15981325	SO:0001583	missense	23194			AB020647	CCDS54833.1, CCDS64129.1	5p15.1	2011-06-09				ENSG00000183580		"""F-boxes / Leucine-rich repeats"""	13604	protein-coding gene	gene with protein product		605656				10048485, 10531035	Standard	NM_012304		Approved	KIAA0840, FBL7, FBL6	uc003jfn.1	Q9UJT9		ENST00000504595.1:c.454C>T	5.37:g.15928325C>T	ENSP00000423630:p.Arg152Trp		15981325	B9EGF1|D6RDY7|O94926	Missense_Mutation	SNP	HMMPfam_F-box;superfamily_RNI-like	p.R152W	ENST00000504595.1	37	c.454	CCDS54833.1	5	.	.	.	.	.	.	.	.	.	.	C	21.3	4.135302	0.77662	.	.	ENSG00000183580	ENST00000504595;ENST00000510662;ENST00000329673	T;T;T	0.44482	0.92;0.92;0.92	5.46	5.46	0.80206	F-box domain, cyclin-like (3);F-box domain, Skp2-like (1);	0.000000	0.85682	D	0.000000	T	0.61887	0.2383	L	0.55213	1.73	0.58432	D	0.999998	D	0.89917	1.0	D	0.70016	0.967	T	0.63655	-0.6588	10	0.87932	D	0	.	19.3032	0.94151	0.0:1.0:0.0:0.0	.	152	Q9UJT9	FBXL7_HUMAN	W	152;105;140	ENSP00000423630:R152W;ENSP00000425184:R105W;ENSP00000329632:R140W	ENSP00000329632:R140W	R	+	1	2	FBXL7	15981325	0.995000	0.38212	1.000000	0.80357	0.879000	0.50718	3.058000	0.49939	2.576000	0.86940	0.561000	0.74099	CGG	-	HMMPfam_F-box		0.667	FBXL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXL7	protein_coding	OTTHUMT00000366117.1	C	NM_012304		15981325	1	no_errors	NM_012304	genbank	human	reviewed	54_36p	missense	SNP	1	T
CMYA5	202333	genome.wustl.edu	37	5	79032363	79032363	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr5:79032363C>T	ENST00000446378.2	+	2	7806	c.7775C>T	c.(7774-7776)aCa>aTa	p.T2592I		NM_153610.3	NP_705838.3	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	2592					negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|regulation of skeletal muscle adaptation (GO:0014733)	costamere (GO:0043034)		p.T2592I(1)		NS(2)|breast(4)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(37)|lung(34)|ovary(6)|pancreas(2)|prostate(5)|skin(5)|stomach(11)|upper_aerodigestive_tract(3)|urinary_tract(1)	128		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		GTTAAAGCTACATCAGTTACT	0.403																																																1	Substitution - Missense(1)	ovary(1)	5											67.0	65.0	66.0					5																	79032363		1861	4105	5966	79068119	SO:0001583	missense	202333			AW755254, AL831986	CCDS47238.1	5q14.1	2013-02-11			ENSG00000164309	ENSG00000164309		"""Tripartite motif containing / Tripartite motif containing"", ""A-kinase anchor proteins"", ""Fibronectin type III domain containing"""	14305	protein-coding gene	gene with protein product	"""genethonin-3"", ""tripartite motif-containing 76"""	612193	"""chromosome 5 open reading frame 10"""	C5orf10		14688250	Standard	NM_153610		Approved	myospryn, SPRYD2, DKFZp451G223, TRIM76	uc003kgc.3	Q8N3K9	OTTHUMG00000162548	ENST00000446378.2:c.7775C>T	5.37:g.79032363C>T	ENSP00000394770:p.Thr2592Ile		79068119	A0PJB7|Q05CT4|Q2NKX1|Q2T9G9|Q69YQ8|Q69YQ9|Q6P517|Q6P5U3|Q7Z4I1|Q86T34|Q86T49|Q8N3S4|Q8N3S7|Q8NAG8|Q9UK88	Missense_Mutation	SNP	HMMPfam_SPRY;HMMPfam_fn3;superfamily_Fibronectin type III	p.T2592I	ENST00000446378.2	37	c.7775	CCDS47238.1	5	.	.	.	.	.	.	.	.	.	.	C	6.004	0.369178	0.11352	.	.	ENSG00000164309	ENST00000446378	T	0.20332	2.08	5.05	1.96	0.26148	.	1.152960	0.06326	N	0.705300	T	0.15176	0.0366	L	0.33485	1.01	0.09310	N	1	B	0.21381	0.055	B	0.15052	0.012	T	0.30416	-0.9979	10	0.40728	T	0.16	.	3.4019	0.07327	0.2142:0.5624:0.0:0.2234	.	2592	Q8N3K9	CMYA5_HUMAN	I	2592	ENSP00000394770:T2592I	ENSP00000394770:T2592I	T	+	2	0	CMYA5	79068119	0.000000	0.05858	0.002000	0.10522	0.567000	0.35839	0.035000	0.13797	0.683000	0.31428	0.561000	0.74099	ACA	-	NULL		0.403	CMYA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CMYA5	protein_coding	OTTHUMT00000369497.1	C	NM_153610		79068119	1	no_errors	NM_153610	genbank	human	validated	54_36p	missense	SNP		T
ARSI	340075	genome.wustl.edu	37	5	149676887	149676887	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	C	C	A	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr5:149676887C>A	ENST00000328668.7	-	2	2179	c.1600G>T	c.(1600-1602)Ggg>Tgg	p.G534W		NM_001012301.2	NP_001012301.1	Q5FYB1	ARSI_HUMAN	arylsulfatase family, member I	534					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)	p.G534W(1)		central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(11)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	23			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CGAGCCCTCCCTTCCTCTTCC	0.562																																																1	Substitution - Missense(1)	ovary(1)	5											103.0	115.0	111.0					5																	149676887		2203	4300	6503	149657080	SO:0001583	missense	340075			AY875937	CCDS34275.1	5q32	2014-03-03	2006-03-07			ENSG00000183876		"""Arylsulfatase family"""	32521	protein-coding gene	gene with protein product		610009	"""arylsulfatase I"""			16174644, 24482476	Standard	NM_001012301		Approved	FLJ16069, SPG66	uc003lrv.2	Q5FYB1		ENST00000328668.7:c.1600G>T	5.37:g.149676887C>A	ENSP00000333395:p.Gly534Trp		149657080	A1L3B0|B3KV22|B7XD03	Missense_Mutation	SNP	-	p.G534W	ENST00000328668.7	37	c.1600	CCDS34275.1	5	.	.	.	.	.	.	.	.	.	.	C	4.499	0.092492	0.08632	.	.	ENSG00000183876	ENST00000328668;ENST00000515301	D;D	0.97209	-4.29;-3.4	4.56	4.56	0.56223	.	0.474564	0.23300	N	0.049685	D	0.95582	0.8564	L	0.51422	1.61	0.18873	N	0.999989	P	0.50066	0.931	P	0.48488	0.579	D	0.91242	0.5022	10	0.72032	D	0.01	.	8.46	0.32923	0.0:0.8961:0.0:0.1039	.	534	Q5FYB1	ARSI_HUMAN	W	534;391	ENSP00000333395:G534W;ENSP00000426879:G391W	ENSP00000333395:G534W	G	-	1	0	ARSI	149657080	0.006000	0.16342	0.266000	0.24541	0.034000	0.12701	1.012000	0.29924	2.356000	0.79943	0.643000	0.83706	GGG	-	NULL		0.562	ARSI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARSI	protein_coding	OTTHUMT00000373681.1	C	NM_001012301		149657080	-1	no_errors	NM_001012301	genbank	human	validated	54_36p	missense	SNP	0.04	A
ROS1	6098	genome.wustl.edu	37	6	117715380	117715380	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr6:117715380G>T	ENST00000368508.3	-	10	1307	c.1109C>A	c.(1108-1110)tCt>tAt	p.S370Y	GOPC_ENST00000467125.1_Intron|ROS1_ENST00000368507.3_Missense_Mutation_p.S379Y	NM_002944.2	NP_002935.2	P08922	ROS1_HUMAN	ROS proto-oncogene 1 , receptor tyrosine kinase	370			S -> P (in dbSNP:rs56274823). {ECO:0000269|PubMed:17344846}.		cell differentiation (GO:0030154)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|columnar/cuboidal epithelial cell development (GO:0002066)|negative regulation of gene expression (GO:0010629)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of phosphate transport (GO:0010966)|regulation of TOR signaling (GO:0032006)|spermatogenesis (GO:0007283)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.S370Y(1)	TPM3_ENST00000368530/ROS1(4)|LRIG3/ROS1(2)|CD74_ENST00000009530/ROS1(32)|SLC34A2/ROS1(14)|EZR/ROS1(4)|GOPC/ROS1(14)|SDC4/ROS1(7)	NS(2)|breast(7)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(28)|lung(56)|ovary(8)|prostate(5)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	162		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		GGAGATAGAAGAAATTAATCC	0.373			T	"""GOPC, SDC4, SLC34A2, EZR, LRIG3"""	"""glioblastoma, NSCLC"""																																		Dom	yes		6	6q22	6098	v-ros UR2 sarcoma virus oncogene homolog 1 (avian)		"""O, E"""	1	Substitution - Missense(1)	ovary(1)	6											52.0	55.0	54.0					6																	117715380		2202	4300	6502	117822073	SO:0001583	missense	6098			M13599	CCDS5116.1	6q21-q22	2014-06-26	2014-06-26		ENSG00000047936	ENSG00000047936		"""Fibronectin type III domain containing"""	10261	protein-coding gene	gene with protein product		165020	"""v-ros avian UR2 sarcoma virus oncogene homolog 1"", ""v-ros UR2 sarcoma virus oncogene homolog 1 (avian)"", ""c-ros oncogene 1 , receptor tyrosine kinase"""			1611909	Standard	NM_002944		Approved	MCF3, ROS, c-ros-1	uc003pxp.1	P08922	OTTHUMG00000016188	ENST00000368508.3:c.1109C>A	6.37:g.117715380G>T	ENSP00000357494:p.Ser370Tyr		117822073	Q15368|Q5TDB5	Missense_Mutation	SNP	Pkinase_Tyr;HMMPfam_Pkinase_Tyr;fn3;HMMPfam_fn3;Fibronectin type III;superfamily_Fibronectin type III;Protein kinase-like (PK-like);superfamily_Protein kinase-like (PK-like);YWTD domain;superfamily_YWTD domain	p.S370Y	ENST00000368508.3	37	c.1109	CCDS5116.1	6	.	.	.	.	.	.	.	.	.	.	G	14.38	2.518395	0.44763	.	.	ENSG00000047936	ENST00000368508;ENST00000368507	D;D	0.91351	-2.83;-2.83	5.12	5.12	0.69794	.	0.300661	0.29152	N	0.012996	D	0.87358	0.6157	L	0.56769	1.78	0.80722	D	1	D	0.55385	0.971	P	0.50440	0.641	D	0.85647	0.1280	10	0.34782	T	0.22	.	9.4876	0.38940	0.0795:0.1454:0.775:0.0	.	370	P08922	ROS1_HUMAN	Y	370;379	ENSP00000357494:S370Y;ENSP00000357493:S379Y	ENSP00000357493:S379Y	S	-	2	0	ROS1	117822073	1.000000	0.71417	1.000000	0.80357	0.798000	0.45092	3.843000	0.55865	2.773000	0.95371	0.650000	0.86243	TCT	-	NULL		0.373	ROS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ROS1	protein_coding	OTTHUMT00000043464.1	G			117822073	-1	no_errors	NM_002944	genbank	human	reviewed	54_36p	missense	SNP	1	T
MTHFD1L	25902	genome.wustl.edu	37	6	151358145	151358178	+	Frame_Shift_Del	DEL	TCTATCTCACCAACCTGACAAAAAAGGTGTGCCA	TCTATCTCACCAACCTGACAAAAAAGGTGTGCCA	-	rs202243690		TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	TCTATCTCACCAACCTGACAAAAAAGGTGTGCCA	TCTATCTCACCAACCTGACAAAAAAGGTGTGCCA	TCTATCTCACCAACCTGACAAAAAAGGTGTGCCA	-	TCTATCTCACCAACCTGACAAAAAAGGTGTGCCA	TCTATCTCACCAACCTGACAAAAAAGGTGTGCCA	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr6:151358145_151358178delTCTATCTCACCAACCTGACAAAAAAGGTGTGCCA	ENST00000367321.3	+	26	3013_3046	c.2739_2772delTCTATCTCACCAACCTGACAAAAAAGGTGTGCCA	c.(2737-2772)tctctatctcaccaacctgacaaaaaaggtgtgccafs	p.SLSHQPDKKGVP913fs	AL133260.1_ENST00000408542.1_RNA	NM_001242767.1|NM_001242768.1|NM_015440.4	NP_001229696.1|NP_001229697.1|NP_056255.2	Q6UB35	C1TM_HUMAN	methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like	913	Formyltetrahydrofolate synthetase.				folic acid-containing compound biosynthetic process (GO:0009396)|folic acid-containing compound metabolic process (GO:0006760)|formate metabolic process (GO:0015942)|one-carbon metabolic process (GO:0006730)|oxidation-reduction process (GO:0055114)|tetrahydrofolate interconversion (GO:0035999)|tetrahydrofolate metabolic process (GO:0046653)	membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|formate-tetrahydrofolate ligase activity (GO:0004329)|protein homodimerization activity (GO:0042803)	p.L914fs*14(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(12)|lung(8)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)	29		Ovarian(120;0.128)		OV - Ovarian serous cystadenocarcinoma(155;8.7e-12)		CCCACCTTTCTCTATCTCACCAACCTGACAAAAAAGGTGTGCCAAGGGACTTCA	0.462																																																1	Deletion - Frameshift(1)	ovary(1)	6																																								151399871	SO:0001589	frameshift_variant	25902			BC017477	CCDS5228.1, CCDS56457.1, CCDS75535.1, CCDS75536.1	6q25.1	2010-07-19	2004-12-13	2004-12-14	ENSG00000120254	ENSG00000120254	6.3.4.3		21055	protein-coding gene	gene with protein product	"""10-formyl-THF synthetase"", ""mitochondrial C1-tetrahydrofolate synthase"", ""monofunctional C1-tetrahydrofolate synthase, mitochondrial"""	611427	"""formyltetrahydrofolate synthetase domain containing 1"""	FTHFSDC1		18804703	Standard	NM_015440		Approved	DKFZP586G1517, FLJ21145	uc021zgs.1	Q6UB35	OTTHUMG00000015828	ENST00000367321.3:c.2739_2772delTCTATCTCACCAACCTGACAAAAAAGGTGTGCCA	6.37:g.151358145_151358178delTCTATCTCACCAACCTGACAAAAAAGGTGTGCCA	ENSP00000356290:p.Ser913fs		151399838	Q2TBF3|Q8WVW0|Q96HG8|Q9H789|Q9UFU8	Frame_Shift_Del	DEL	HMMPfam_FTHFS;HMMPfam_THF_DHG_CYH;HMMPfam_THF_DHG_CYH_C;superfamily_NAD(P)-binding Rossmann-fold domains;superfamily_P-loop containing nucleoside triphosphate hydrolases;superfamily_Aminoacid dehydrogenase-like N-terminal domain	p.L914fs	ENST00000367321.3	37	c.2739_2772	CCDS5228.1	6																																																																																			(deletion:cds_exon[151399794;151399946])	HMMPfam_FTHFS		0.462	MTHFD1L-003	KNOWN	basic|appris_principal|CCDS	protein_coding	MTHFD1L	protein_coding	OTTHUMT00000042699.1	TCTATCTCACCAACCTGACAAAAAAGGTGTGCCA	NM_015440		151399871	1	no_errors	NM_015440	genbank	human	validated	54_36p	frame_shift_del	DEL	0.999:1.000:0.999:0.954:1.000:1.000:1.000:1.000:0.993:0.029:0.003:0.008:0.034:0.797:0.979:0.975:1.000:1.000:0.997:1.000:1.000:1.000:1.000:1.000:1.000:1.000:0.998:0.153:0.895:0.886:0.582:0.997:1.000:0.989	-
TMEM181	57583	genome.wustl.edu	37	6	159002020	159002020	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr6:159002020G>T	ENST00000367090.3	+	3	583	c.572G>T	c.(571-573)aGc>aTc	p.S191I		NM_020823.1	NP_065874.1	Q9P2C4	TM181_HUMAN	transmembrane protein 181	191					pathogenesis (GO:0009405)	integral component of membrane (GO:0016021)	toxic substance binding (GO:0015643)	p.S191I(1)		central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)|skin(1)	22		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;8.15e-18)|BRCA - Breast invasive adenocarcinoma(81;1.38e-05)		CTAAATAATAGCAAAAAGGTA	0.403																																																1	Substitution - Missense(1)	ovary(1)	6											88.0	84.0	85.0					6																	159002020		1849	4098	5947	158922008	SO:0001583	missense	57583			AB037844	CCDS43520.1	6q25.3	2012-08-10	2006-10-19	2006-10-19	ENSG00000146433	ENSG00000146433			20958	protein-coding gene	gene with protein product		613209	"""G protein-coupled receptor 178"", ""KIAA1423"""	KIAA1423, GPR178		16452613	Standard	NM_020823		Approved		uc003qrm.4	Q9P2C4	OTTHUMG00000015913	ENST00000367090.3:c.572G>T	6.37:g.159002020G>T	ENSP00000356057:p.Ser191Ile		158922008	Q5VTU1	Missense_Mutation	SNP	-	p.S191I	ENST00000367090.3	37	c.572	CCDS43520.1	6	.	.	.	.	.	.	.	.	.	.	G	16.64	3.178153	0.57692	.	.	ENSG00000146433	ENST00000314630;ENST00000367090	.	.	.	4.41	3.52	0.40303	.	0.296750	0.37530	N	0.002049	T	0.40815	0.1132	L	0.36672	1.1	0.42452	D	0.992755	D;D	0.58620	0.983;0.974	P;P	0.53861	0.736;0.736	T	0.42999	-0.9418	9	0.66056	D	0.02	.	10.5886	0.45296	0.0:0.1959:0.804:0.0	.	191;102	Q9P2C4;Q8N4V6	TM181_HUMAN;.	I	98;191	.	ENSP00000323755:S98I	S	+	2	0	TMEM181	158922008	1.000000	0.71417	0.999000	0.59377	0.964000	0.63967	4.621000	0.61233	0.969000	0.38237	0.467000	0.42956	AGC	-	NULL		0.403	TMEM181-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM181	protein_coding	OTTHUMT00000042873.1	G	NM_020823		158922008	1	no_errors	NM_020823	genbank	human	validated	54_36p	missense	SNP	0.93	T
GPLD1	2822	genome.wustl.edu	37	6	24462987	24462987	+	Silent	SNP	T	T	A			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr6:24462987T>A	ENST00000230036.1	-	11	968	c.858A>T	c.(856-858)gcA>gcT	p.A286A		NM_001503.3	NP_001494.2	P80108	PHLD_HUMAN	glycosylphosphatidylinositol specific phospholipase D1	286					cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to calcium ion (GO:0071277)|cellular response to cholesterol (GO:0071397)|cellular response to drug (GO:0035690)|cellular response to insulin stimulus (GO:0032869)|cellular response to pH (GO:0071467)|cellular response to triglyceride (GO:0071401)|chondrocyte differentiation (GO:0002062)|complement receptor mediated signaling pathway (GO:0002430)|GPI anchor release (GO:0006507)|hematopoietic stem cell migration (GO:0035701)|hematopoietic stem cell migration to bone marrow (GO:0097241)|insulin receptor signaling pathway (GO:0008286)|negative regulation of cell proliferation (GO:0008285)|negative regulation of triglyceride catabolic process (GO:0010897)|ossification (GO:0001503)|phosphatidylcholine metabolic process (GO:0046470)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytolysis (GO:0045919)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of high-density lipoprotein particle clearance (GO:0010983)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of secretion (GO:0051047)|positive regulation of triglyceride biosynthetic process (GO:0010867)|regulation of cellular response to insulin stimulus (GO:1900076)|response to glucose (GO:0009749)|transepithelial transport (GO:0070633)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|proteinaceous extracellular matrix (GO:0005578)	glycosylphosphatidylinositol phospholipase D activity (GO:0004621)|phospholipase D activity (GO:0004630)|sodium channel regulator activity (GO:0017080)	p.A286A(2)		breast(3)|endometrium(5)|kidney(1)|large_intestine(11)|lung(8)|ovary(2)|prostate(1)|urinary_tract(1)	32						GGCCGCCACATGCAATGAACA	0.453																																																2	Substitution - coding silent(2)	ovary(1)|lung(1)	6											140.0	139.0	140.0					6																	24462987		2203	4300	6503	24570966	SO:0001819	synonymous_variant	2822			L11701	CCDS4553.1	6p22.1	2008-02-05			ENSG00000112293	ENSG00000112293			4459	protein-coding gene	gene with protein product		602515				11072085	Standard	NM_001503		Approved		uc003ned.2	P80108	OTTHUMG00000016104	ENST00000230036.1:c.858A>T	6.37:g.24462987T>A			24570966	Q15127|Q15128|Q2M2F2|Q5T3Y0|Q7Z6T8|Q8TCV0|Q8WW82|Q96ID6|Q9H167|Q9H4M1|Q9UJC9	Silent	SNP	HMMPfam_FG-GAP;superfamily_Integrin alpha N-terminal domain	p.A286	ENST00000230036.1	37	c.858	CCDS4553.1	6																																																																																			-	NULL		0.453	GPLD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPLD1	protein_coding	OTTHUMT00000043315.1	T	NM_001503		24570966	-1	no_errors	NM_001503	genbank	human	reviewed	54_36p	silent	SNP		A
HIST1H2AM	8336	genome.wustl.edu	37	6	27860927	27860927	+	Start_Codon_SNP	SNP	T	T	C			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr6:27860927T>C	ENST00000359611.2	-	1	36	c.1A>G	c.(1-3)Atg>Gtg	p.M1V	HIST1H3J_ENST00000479986.1_5'Flank|HIST1H2BO_ENST00000303806.4_5'Flank|HIST1H3J_ENST00000359303.2_5'Flank	NM_003514.2	NP_003505.1	P0C0S8	H2A1_HUMAN	histone cluster 1, H2am	1						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)	p.M1V(1)		endometrium(3)|kidney(2)|large_intestine(1)|lung(6)|ovary(2)	14						CGTCCAGACATGGTAAAACGA	0.572																																																1	Substitution - Missense(1)	ovary(1)	6											37.0	38.0	38.0					6																	27860927		2203	4300	6503	27968906	SO:0001582	initiator_codon_variant	8336			X57138	CCDS4639.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000233224	ENSG00000278677		"""Histones / Replication-dependent"""	4735	protein-coding gene	gene with protein product		602796	"""H2A histone family, member N"", ""histone 1, H2am"""	H2AFN		1768865, 9439656, 12408966	Standard	NM_003514		Approved	H2A/n, H2A.1	uc003nkb.1	P0C0S8	OTTHUMG00000014494	ENST00000359611.2:c.1A>G	6.37:g.27860927T>C	ENSP00000352627:p.Met1Val		27968906	P02261|Q2M1R2|Q76PA6	Missense_Mutation	SNP	-	p.M1V	ENST00000359611.2	37	c.1	CCDS4639.1	6	.	.	.	.	.	.	.	.	.	.	T	11.54	1.669695	0.29693	.	.	ENSG00000233224	ENST00000359611	D	0.92699	-3.09	3.92	3.92	0.45320	.	0.000000	0.35870	U	0.002928	D	0.93074	0.7795	.	.	.	0.80722	D	1	.	.	.	.	.	.	D	0.93987	0.7263	7	0.87932	D	0	.	12.5707	0.56334	0.0:0.0:0.0:1.0	.	.	.	.	V	1	ENSP00000352627:M1V	ENSP00000352627:M1V	M	-	1	0	HIST1H2AM	27968906	1.000000	0.71417	0.991000	0.47740	0.650000	0.38633	7.476000	0.81055	2.003000	0.58678	0.459000	0.35465	ATG	-	NULL		0.572	HIST1H2AM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H2AM	protein_coding	OTTHUMT00000040162.1	T	NM_003514	Missense_Mutation	27968906	-1	no_errors	NM_003514	genbank	human	reviewed	54_36p	missense	SNP	0.99	C
TRIM26	7726	genome.wustl.edu	37	6	30164453	30164453	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr6:30164453C>T	ENST00000454678.2	-	6	1041	c.605G>A	c.(604-606)cGg>cAg	p.R202Q	TRIM26_ENST00000487829.1_5'Flank|TRIM26_ENST00000437089.1_Missense_Mutation_p.R202Q|TRIM26_ENST00000453195.1_Missense_Mutation_p.R202Q	NM_003449.4	NP_003440.1	Q12899	TRI26_HUMAN	tripartite motif containing 26	202					innate immune response (GO:0045087)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)	cytoplasm (GO:0005737)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|zinc ion binding (GO:0008270)	p.R202Q(2)		lung(1)|ovary(2)	3						GTGTTCCTCCCGCTCCCTCAG	0.632																																																2	Substitution - Missense(2)	ovary(1)|endometrium(1)	6											55.0	47.0	50.0					6																	30164453		2203	4300	6503	30272432	SO:0001583	missense	7726			AB088090	CCDS4678.1	6p21.3	2013-01-09	2011-01-25	2001-11-23	ENSG00000234127	ENSG00000234127		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	12962	protein-coding gene	gene with protein product		600830	"""tripartite motif-containing 26"""	ZNF173		8530076	Standard	NM_003449		Approved	RNF95	uc003npt.3	Q12899	OTTHUMG00000031041	ENST00000454678.2:c.605G>A	6.37:g.30164453C>T	ENSP00000410446:p.Arg202Gln		30272432	A6NG96|Q5SRL2	Missense_Mutation	SNP	-	p.R202Q	ENST00000454678.2	37	c.605	CCDS4678.1	6	.	.	.	.	.	.	.	.	.	.	C	13.37	2.217521	0.39201	.	.	ENSG00000234127	ENST00000453195;ENST00000454678;ENST00000437089;ENST00000416596;ENST00000420345	T;T;T;T	0.70045	3.59;3.59;3.59;-0.45	5.71	4.84	0.62591	.	0.187799	0.26170	N	0.025927	T	0.39091	0.1065	L	0.32530	0.975	0.24814	N	0.992629	D	0.56035	0.974	P	0.45639	0.488	T	0.28839	-1.0031	10	0.14252	T	0.57	.	12.7067	0.57063	0.0:0.9201:0.0:0.0799	.	202	Q12899	TRI26_HUMAN	Q	202;202;202;202;127	ENSP00000391879:R202Q;ENSP00000410446:R202Q;ENSP00000395491:R202Q;ENSP00000413673:R202Q	ENSP00000413673:R202Q	R	-	2	0	TRIM26	30272432	0.959000	0.32827	1.000000	0.80357	0.936000	0.57629	3.926000	0.56491	1.439000	0.47511	-0.169000	0.13324	CGG	-	NULL		0.632	TRIM26-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM26	protein_coding	OTTHUMT00000253442.1	C	NM_003449		30272432	-1	no_errors	NM_003449	genbank	human	validated	54_36p	missense	SNP	0.92	T
TTK	7272	genome.wustl.edu	37	6	80721178	80721178	+	Nonsense_Mutation	SNP	C	C	G			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr6:80721178C>G	ENST00000369798.2	+	6	752	c.641C>G	c.(640-642)tCa>tGa	p.S214*	TTK_ENST00000230510.3_Nonsense_Mutation_p.S214*|TTK_ENST00000509894.1_Nonsense_Mutation_p.S214*	NM_001166691.1|NM_003318.4	NP_001160163.1|NP_003309.2	P33981	TTK_HUMAN	TTK protein kinase	214					chromosome separation (GO:0051304)|mitotic spindle assembly checkpoint (GO:0007094)|mitotic spindle organization (GO:0007052)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|spindle organization (GO:0007051)	membrane (GO:0016020)|spindle (GO:0005819)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)	p.S198*(1)		endometrium(4)|kidney(2)|large_intestine(12)|lung(22)|ovary(7)|pancreas(1)|prostate(1)|stomach(3)|urinary_tract(1)	53		all_cancers(76;0.00177)|Acute lymphoblastic leukemia(125;1.24e-05)|all_hematologic(105;0.00223)|all_epithelial(107;0.2)		BRCA - Breast invasive adenocarcinoma(397;0.0321)		GCCCAAGAATCATTTTCCGGT	0.333																																																1	Substitution - Nonsense(1)	ovary(1)	6											58.0	59.0	59.0					6																	80721178		2201	4299	6500	80777897	SO:0001587	stop_gained	7272				CCDS4993.1, CCDS55040.1	6q14.1	2014-04-07			ENSG00000112742	ENSG00000112742			12401	protein-coding gene	gene with protein product	"""cancer/testis antigen 96"", ""monopolar spindle 1 kinase"""	604092				1639825	Standard	NM_003318		Approved	MPS1, MPS1L1, CT96, MPH1	uc003pjc.3	P33981	OTTHUMG00000015088	ENST00000369798.2:c.641C>G	6.37:g.80721178C>G	ENSP00000358813:p.Ser214*		80777897	A8K8U5|B2RDW2|E1P543|Q15272|Q5TCS0|Q9BW51|Q9NTM0	Nonsense_Mutation	SNP	HMMPfam_Pkinase;superfamily_Protein kinase-like (PK-like);superfamily_TPR-like	p.S214*	ENST00000369798.2	37	c.641	CCDS4993.1	6	.	.	.	.	.	.	.	.	.	.	C	43	10.063690	0.99329	.	.	ENSG00000112742	ENST00000509894;ENST00000230510;ENST00000369798	.	.	.	5.23	4.36	0.52297	.	0.911955	0.09518	N	0.791288	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.31617	T	0.26	.	9.7522	0.40483	0.0:0.9046:0.0:0.0954	.	.	.	.	X	214	.	ENSP00000230510:S214X	S	+	2	0	TTK	80777897	0.976000	0.34144	0.814000	0.32528	0.915000	0.54546	2.469000	0.45110	1.327000	0.45338	0.561000	0.74099	TCA	-	NULL		0.333	TTK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TTK	protein_coding	OTTHUMT00000041316.2	C			80777897	1	no_errors	NM_003318	genbank	human	provisional	54_36p	nonsense	SNP	0.9	G
FNDC1	84624	genome.wustl.edu	37	6	159670087	159670087	+	Silent	SNP	G	G	A			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	G	G	A	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr6:159670087G>A	ENST00000297267.9	+	16	4907	c.4707G>A	c.(4705-4707)acG>acA	p.T1569T	FNDC1_ENST00000340366.6_Silent_p.T1506T	NM_032532.2	NP_115921.2	Q4ZHG4	FNDC1_HUMAN	fibronectin type III domain containing 1	1569					cellular response to hypoxia (GO:0071456)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of protein phosphorylation (GO:0001934)|regulation of protein transport (GO:0051223)	cell-cell junction (GO:0005911)|extracellular region (GO:0005576)|mitochondrial membrane (GO:0031966)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.T1569T(1)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(29)|liver(2)|lung(23)|ovary(3)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)	93		Breast(66;0.000781)|Ovarian(120;0.0308)|Prostate(117;0.195)		OV - Ovarian serous cystadenocarcinoma(65;2.6e-16)|BRCA - Breast invasive adenocarcinoma(81;1.06e-05)		AATTTGAGACGTCAAGGCCAC	0.463																																																1	Substitution - coding silent(1)	ovary(1)	6											48.0	52.0	50.0					6																	159670087		2002	4162	6164	159590077	SO:0001819	synonymous_variant	84624			AB058769	CCDS47512.1	6q25	2013-02-11			ENSG00000164694	ENSG00000164694		"""Fibronectin type III domain containing"""	21184	protein-coding gene	gene with protein product		609991	"""fibronectin type III domain containing 2"""	FNDC2		11347906	Standard	NM_032532		Approved	bA243O10.1, KIAA1866, dJ322A24.1	uc010kjv.3	Q4ZHG4	OTTHUMG00000015927	ENST00000297267.9:c.4707G>A	6.37:g.159670087G>A			159590077	A6H8X2|B7ZBR4|B7ZBR5|B9EK49|Q5JPI0|Q5VU31|Q5VU32|Q5VXX4|Q70CQ6|Q96JG1	Silent	SNP	-	p.T1569	ENST00000297267.9	37	c.4707	CCDS47512.1	6	.	.	.	.	.	.	.	.	.	.	g	6.471	0.455132	0.12283	.	.	ENSG00000164694	ENST00000329629	.	.	.	5.04	-0.0444	0.13855	.	.	.	.	.	T	0.26412	0.0645	.	.	.	0.58432	D	0.999998	.	.	.	.	.	.	T	0.17198	-1.0377	4	.	.	.	-11.5266	3.1767	0.06571	0.1264:0.3399:0.3728:0.1608	.	.	.	.	I	1465	.	.	V	+	1	0	FNDC1	159590077	0.235000	0.23794	0.420000	0.26596	0.732000	0.41865	0.286000	0.18902	-0.208000	0.10171	-0.738000	0.03535	GTC	-	NULL		0.463	FNDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FNDC1	protein_coding	OTTHUMT00000042897.3	G	NM_032532		159590077	1	no_errors	NM_032532	genbank	human	validated	54_36p	silent	SNP	0.17	A
EIF3IP1	442720	genome.wustl.edu	37	7	109600160	109600160	+	IGR	SNP	C	C	T			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr7:109600160C>T								AC073071.1 (362937 upstream) : AC003088.1 (472135 downstream)																							TCCTTGGCCACGGTGAAGAGG	0.512																																																0			7																																								109387396	SO:0001628	intergenic_variant	442720																															7.37:g.109600160C>T			109387396		RNA	SNP	-	NULL		37	NULL		7																																																																																			-	-	0	0.512					EIF3IP1			C			109387396	-1	pseudogene	NR_003024	genbank	human	provisional	54_36p	rna	SNP	0.993	T
DOCK4	9732	genome.wustl.edu	37	7	111430594	111430594	+	Silent	SNP	C	C	T			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr7:111430594C>T	ENST00000437633.1	-	31	3490	c.3234G>A	c.(3232-3234)caG>caA	p.Q1078Q	DOCK4_ENST00000428084.1_Silent_p.Q1078Q	NM_014705.3	NP_055520.3	Q8N1I0	DOCK4_HUMAN	dedicator of cytokinesis 4	1078					cell chemotaxis (GO:0060326)|positive regulation of Rac GTPase activity (GO:0032855)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)|stereocilium (GO:0032420)|stereocilium bundle (GO:0032421)	guanyl-nucleotide exchange factor activity (GO:0005085)|PDZ domain binding (GO:0030165)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)|receptor tyrosine kinase binding (GO:0030971)	p.Q1066Q(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(13)|lung(31)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(4)	72		Acute lymphoblastic leukemia(1;0.0441)				GAAGATCTGGCTGGGGTATCA	0.443																																																1	Substitution - coding silent(1)	ovary(1)	7											65.0	64.0	64.0					7																	111430594		1877	4103	5980	111217830	SO:0001819	synonymous_variant	9732				CCDS47688.1	7q31.1	2007-08-07			ENSG00000128512	ENSG00000128512			19192	protein-coding gene	gene with protein product		607679				12432077, 12628187	Standard	XM_006716188		Approved	FLJ34238, KIAA0716	uc003vfx.3	Q8N1I0	OTTHUMG00000155077	ENST00000437633.1:c.3234G>A	7.37:g.111430594C>T			111217830	O14584|O94824|Q8NB45	Silent	SNP	superfamily_SH3-domain;superfamily_GTPase activation domain GAP;superfamily_C2 domain (Calcium/lipid-binding domain CaLB);HMMPfam_SH3_2;superfamily_ARM repeat	p.Q1078	ENST00000437633.1	37	c.3234	CCDS47688.1	7	.	.	.	.	.	.	.	.	.	.	C	9.929	1.214394	0.22289	.	.	ENSG00000128512	ENST00000423057;ENST00000445943	.	.	.	5.28	3.42	0.39159	.	.	.	.	.	T	0.61751	0.2372	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.58487	-0.7628	4	.	.	.	.	11.2864	0.49224	0.0:0.8472:0.0:0.1528	.	.	.	.	N	530;1102	.	.	S	-	2	0	DOCK4	111217830	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.125000	0.50469	0.859000	0.35456	0.655000	0.94253	AGC	-	NULL		0.443	DOCK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK4	protein_coding	OTTHUMT00000338369.4	C	NM_014705		111217830	-1	no_errors	NM_014705	genbank	human	reviewed	54_36p	silent	SNP	1	T
EPHA1	2041	genome.wustl.edu	37	7	143088585	143088585	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr7:143088585G>A	ENST00000275815.3	-	18	2982	c.2896C>T	c.(2896-2898)Cgc>Tgc	p.R966C	EPHA1_ENST00000458129.1_5'Flank	NM_005232.4	NP_005223.4	P21709	EPHA1_HUMAN	EPH receptor A1	966	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.				activation of Rho GTPase activity (GO:0032862)|angiogenesis (GO:0001525)|cell surface receptor signaling pathway (GO:0007166)|negative regulation of cell migration (GO:0030336)|negative regulation of protein kinase activity (GO:0006469)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of stress fiber assembly (GO:0051496)|protein autophosphorylation (GO:0046777)|regulation of Rac GTPase activity (GO:0032314)|substrate adhesion-dependent cell spreading (GO:0034446)	integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|transmembrane-ephrin receptor activity (GO:0005005)	p.R966C(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(11)|lung(21)|ovary(4)|skin(1)|stomach(1)|urinary_tract(3)	51	Melanoma(164;0.205)	Myeloproliferative disorder(862;0.0255)				CAAAGAATGCGCTTCTGGTGC	0.622																																																1	Substitution - Missense(1)	ovary(1)	7											94.0	61.0	72.0					7																	143088585		2203	4300	6503	142798707	SO:0001583	missense	2041			M18391	CCDS5884.1	7q32-q36	2013-02-11	2004-10-28		ENSG00000146904	ENSG00000146904	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3385	protein-coding gene	gene with protein product		179610	"""EphA1"""	EPHT, EPHT1		9267020	Standard	NM_005232		Approved	EPH	uc003wcz.3	P21709	OTTHUMG00000155894	ENST00000275815.3:c.2896C>T	7.37:g.143088585G>A	ENSP00000275815:p.Arg966Cys		142798707	A1L3V3|B5A966|B5A967|Q15405	Missense_Mutation	SNP	Ephrin_lbd,HMMPfam_Ephrin_lbd,Pkinase_Tyr,HMMPfam_Pkinase_Tyr,SAM_1,HMMPfam_SAM_1,fn3,HMMPfam_fn3	p.R966C	ENST00000275815.3	37	c.2896	CCDS5884.1	7	.	.	.	.	.	.	.	.	.	.	G	21.4	4.139165	0.77775	.	.	ENSG00000146904	ENST00000275815	T	0.55234	0.53	5.24	5.24	0.73138	Sterile alpha motif domain (2);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 1 (1);	0.000000	0.56097	D	0.000029	T	0.77837	0.4190	M	0.92555	3.32	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.82563	-0.0395	10	0.87932	D	0	.	13.1812	0.59655	0.0:0.0:0.7447:0.2553	.	966	P21709	EPHA1_HUMAN	C	966	ENSP00000275815:R966C	ENSP00000275815:R966C	R	-	1	0	EPHA1	142798707	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	3.777000	0.55364	2.724000	0.93272	0.561000	0.74099	CGC	-	HMMPfam_SAM_1		0.622	EPHA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHA1	protein_coding	OTTHUMT00000342154.1	G			142798707	-1	no_errors	NM_005232	genbank	human	reviewed	54_36p	missense	SNP	1	A
KMT2C	58508	genome.wustl.edu	37	7	151860167	151860167	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr7:151860167G>C	ENST00000262189.6	-	43	10713	c.10495C>G	c.(10495-10497)Caa>Gaa	p.Q3499E	KMT2C_ENST00000355193.2_Missense_Mutation_p.Q3499E	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	3499	Gln-rich.				histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.Q3499E(1)									ATGAAAGTTTGGGTGGAGGGT	0.458																																																1	Substitution - Missense(1)	ovary(1)	7											144.0	146.0	146.0					7																	151860167		2203	4300	6503	151491100	SO:0001583	missense	58508			AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.10495C>G	7.37:g.151860167G>C	ENSP00000262189:p.Gln3499Glu		151491100	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	AT_hook;HMMPfam_AT_hook;HMG_box;HMMPfam_HMG_box;SET;HMMPfam_SET;PHD;HMMPfam_PHD;FYRN;HMMPfam_FYRN;FYRC;HMMPfam_FYRC	p.Q3499E	ENST00000262189.6	37	c.10495	CCDS5931.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	4.885|4.885	0.164516|0.164516	0.09287|0.09287	.|.	.|.	ENSG00000055609|ENSG00000055609	ENST00000360104|ENST00000262189;ENST00000355193;ENST00000424877	.|D;D;D	.|0.88277	.|-1.81;-1.82;-2.36	5.27|5.27	4.38|4.38	0.52667|0.52667	.|.	.|0.524747	.|0.15729	.|N	.|0.247504	D|D	0.83737|0.83737	0.5319|0.5319	L|L	0.50333|0.50333	1.59|1.59	0.09310|0.09310	N|N	1|1	.|B;B;B	.|0.33777	.|0.19;0.425;0.034	.|B;B;B	.|0.29663	.|0.05;0.105;0.023	T|T	0.75442|0.75442	-0.3316|-0.3316	5|10	.|0.49607	.|T	.|0.09	.|.	8.4696|8.4696	0.32977|0.32977	0.0:0.2419:0.4686:0.2894|0.0:0.2419:0.4686:0.2894	.|.	.|3499;2560;3499	.|Q8NEZ4;Q8NEZ4-2;Q8NEZ4-3	.|MLL3_HUMAN;.;.	R|E	1004|3499;3499;85	.|ENSP00000262189:Q3499E;ENSP00000347325:Q3499E;ENSP00000410411:Q85E	.|ENSP00000262189:Q3499E	P|Q	-|-	2|1	0|0	MLL3|MLL3	151491100|151491100	0.364000|0.364000	0.24997|0.24997	0.111000|0.111000	0.21465|0.21465	0.766000|0.766000	0.43426|0.43426	1.484000|1.484000	0.35508|0.35508	1.197000|1.197000	0.43143|0.43143	0.655000|0.655000	0.94253|0.94253	CCA|CAA	-	NULL		0.458	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MLL3	protein_coding	OTTHUMT00000318887.3	G			151491100	-1	no_errors	NM_170606	genbank	human	reviewed	54_36p	missense	SNP	0.02	C
NUPL2	11097	genome.wustl.edu	37	7	23240128	23240128	+	Missense_Mutation	SNP	G	G	A	rs76834116		TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr7:23240128G>A	ENST00000258742.5	+	7	1295	c.1036G>A	c.(1036-1038)Ggt>Agt	p.G346S		NM_007342.2	NP_031368.1	O15504	NUPL2_HUMAN	nucleoporin like 2	346	Ser-rich.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein export from nucleus (GO:0006611)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nuclear export signal receptor activity (GO:0005049)|poly(A) RNA binding (GO:0044822)	p.G346S(1)		breast(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(4)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						GGCTGGTTTTGGTAGTCCGGG	0.512																																																1	Substitution - Missense(1)	ovary(1)	7											98.0	96.0	97.0					7																	23240128		2203	4300	6503	23206653	SO:0001583	missense	11097			U97198	CCDS5379.1	7p15	2003-08-07			ENSG00000136243	ENSG00000136243			17010	protein-coding gene	gene with protein product	"""nucleoporin-like protein 1"""					10358091, 9450185	Standard	NM_007342		Approved	NLP_1, CG1, hCG1, H_RG271G13.9	uc003svu.3	O15504	OTTHUMG00000096955	ENST00000258742.5:c.1036G>A	7.37:g.23240128G>A	ENSP00000258742:p.Gly346Ser		23206653	A4D143|B4DP42|Q49AE7|Q9BS49	Missense_Mutation	SNP	HMMPfam_zf-CCCH	p.G346S	ENST00000258742.5	37	c.1036	CCDS5379.1	7	.	.	.	.	.	.	.	.	.	.	G	17.60	3.429576	0.62844	.	.	ENSG00000136243	ENST00000258742;ENST00000413919	T;T	0.46451	1.02;0.87	6.17	5.26	0.73747	.	0.186317	0.56097	D	0.000024	T	0.53465	0.1798	L	0.41710	1.295	0.80722	D	1	D	0.69078	0.997	D	0.65443	0.935	T	0.44651	-0.9314	10	0.42905	T	0.14	-18.2504	15.4643	0.75387	0.0:0.1383:0.8617:0.0	.	346	O15504	NUPL2_HUMAN	S	346;371	ENSP00000258742:G346S;ENSP00000401475:G371S	ENSP00000258742:G346S	G	+	1	0	NUPL2	23206653	0.998000	0.40836	0.998000	0.56505	0.633000	0.38033	2.423000	0.44705	2.941000	0.99782	0.655000	0.94253	GGT	-	NULL		0.512	NUPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUPL2	protein_coding	OTTHUMT00000214017.2	G	NM_007342		23206653	1	no_errors	NM_007342	genbank	human	validated	54_36p	missense	SNP	0.5	A
HOXA6	3203	genome.wustl.edu	37	7	27187351	27187351	+	Silent	SNP	C	C	T			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr7:27187351C>T	ENST00000222728.3	-	1	42	c.18G>A	c.(16-18)gtG>gtA	p.V6V	HOXA6_ENST00000521478.1_Intron|HOXA-AS3_ENST00000524304.1_RNA|RP1-170O19.22_ENST00000467897.2_RNA|HOXA-AS3_ENST00000518947.2_RNA|HOXA-AS3_ENST00000521231.1_RNA|RP1-170O19.23_ENST00000498652.1_RNA|HOXA-AS3_ENST00000518848.1_RNA|HOXA-AS3_ENST00000521197.1_RNA	NM_024014.3	NP_076919.1	P31267	HXA6_HUMAN	homeobox A6	6					anterior/posterior pattern specification (GO:0009952)|embryonic skeletal system morphogenesis (GO:0048704)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.V6V(1)		central_nervous_system(1)|large_intestine(5)|lung(3)|ovary(1)	10						AAGTGGGATTCACAAAATAGG	0.542											OREG0003757	type=REGULATORY REGION|Gene=HOXA6|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																																				1	Substitution - coding silent(1)	ovary(1)	7											29.0	33.0	32.0					7																	27187351		2203	4298	6501	27153876	SO:0001819	synonymous_variant	3203				CCDS5407.1	7p15.2	2011-06-20	2005-12-22		ENSG00000106006	ENSG00000106006		"""Homeoboxes / ANTP class : HOXL subclass"""	5107	protein-coding gene	gene with protein product		142951	"""homeo box A6"""	HOX1B, HOX1		1973146, 1358459	Standard	NM_024014		Approved		uc003syo.2	P31267	OTTHUMG00000023216	ENST00000222728.3:c.18G>A	7.37:g.27187351C>T		792	27153876	A4D192|Q2M3G3|Q9UPM0	Silent	SNP	-	p.V6	ENST00000222728.3	37	c.18	CCDS5407.1	7																																																																																			-	NULL		0.542	HOXA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOXA6	protein_coding	OTTHUMT00000358697.1	C			27153876	-1	no_errors	NM_024014	genbank	human	reviewed	54_36p	silent	SNP	1	T
DPP6	1804	genome.wustl.edu	37	7	154379449	154379449	+	Intron	SNP	T	T	A			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr7:154379449T>A	ENST00000377770.3	+	6	768				DPP6_ENST00000404039.1_Intron|DPP6_ENST00000332007.3_Intron|DPP6_ENST00000406326.1_Nonsense_Mutation_p.C239*|DPP6_ENST00000427557.1_Intron			P42658	DPP6_HUMAN	dipeptidyl-peptidase 6						cell death (GO:0008219)|neuronal action potential (GO:0019228)|positive regulation of potassium ion transmembrane transport (GO:1901381)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	dipeptidyl-peptidase activity (GO:0008239)|serine-type peptidase activity (GO:0008236)			NS(3)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(35)|pancreas(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	71	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			gcccagcttgtcaccagggct	0.463																																					NSCLC(125;1384 1783 2490 7422 34254)											0			7											9.0	8.0	8.0					7																	154379449		863	1976	2839	154010382	SO:0001627	intron_variant	1804			M96859	CCDS75682.1, CCDS75683.1, CCDS75684.1	7q36.2	2006-08-07	2006-01-12		ENSG00000130226	ENSG00000130226			3010	protein-coding gene	gene with protein product		126141	"""dipeptidylpeptidase VI"", ""dipeptidylpeptidase 6"""			1729689	Standard	XM_006715871		Approved	DPPX	uc003wlk.3	P42658	OTTHUMG00000151511	ENST00000377770.3:c.628-50082T>A	7.37:g.154379449T>A			154010382		Nonsense_Mutation	SNP	-	p.C239*	ENST00000377770.3	37	c.717		7	.	.	.	.	.	.	.	.	.	.	T	32	5.186197	0.94885	.	.	ENSG00000130226	ENST00000406326	.	.	.	2.87	-5.73	0.02398	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	.	.	.	.	0.18276	T	0.48	.	5.4195	0.16392	0.1565:0.5517:0.0:0.2918	.	.	.	.	X	239	.	ENSP00000384393:C239X	C	+	3	2	DPP6	154010382	0.000000	0.05858	0.000000	0.03702	0.608000	0.37181	-2.243000	0.01194	-1.498000	0.01824	0.255000	0.18592	TGT	-	NULL		0.463	DPP6-003	KNOWN	basic|appris_principal	protein_coding	DPP6	protein_coding	OTTHUMT00000322932.1	T	NM_130797		154010382	1	no_errors	ENST00000406326	ensembl	human	known	54_36p	nonsense	SNP	0	A
ANGPT1	284	genome.wustl.edu	37	8	108334357	108334357	+	Splice_Site	SNP	C	C	T			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr8:108334357C>T	ENST00000520734.1	-	3	261		c.e3-1		ANGPT1_ENST00000520052.1_Splice_Site|ANGPT1_ENST00000518386.1_5'Flank			Q15389	ANGP1_HUMAN	angiopoietin 1						activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cell-substrate adhesion (GO:0031589)|glomerulus vasculature development (GO:0072012)|hemopoiesis (GO:0030097)|heparin biosynthetic process (GO:0030210)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell adhesion (GO:0007162)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of vascular permeability (GO:0043116)|positive chemotaxis (GO:0050918)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell adhesion (GO:0045785)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of receptor internalization (GO:0002092)|protein localization to cell surface (GO:0034394)|regulation of satellite cell proliferation (GO:0014842)|sprouting angiogenesis (GO:0002040)|Tie signaling pathway (GO:0048014)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	receptor tyrosine kinase binding (GO:0030971)	p.?(2)		NS(1)|breast(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(13)|ovary(4)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)	43	Breast(1;5.06e-08)		OV - Ovarian serous cystadenocarcinoma(57;5.53e-09)			TTCTAATAAACTACAAGGAAG	0.294																																																2	Unknown(2)	ovary(1)|kidney(1)	8											77.0	73.0	74.0					8																	108334357		2203	4300	6503	108403533	SO:0001630	splice_region_variant	284			D13628	CCDS6306.1, CCDS56551.1	8q23.1	2013-02-06			ENSG00000154188	ENSG00000154188		"""Fibrinogen C domain containing"""	484	protein-coding gene	gene with protein product		601667				9545648	Standard	NM_001146		Approved	KIAA0003, Ang1	uc003ymn.3	Q15389	OTTHUMG00000164812	ENST00000520734.1:c.25-1G>A	8.37:g.108334357C>T			108403533	Q5HYA0	Splice_Site	SNP	-	e4-1	ENST00000520734.1	37	c.576-1		8	.	.	.	.	.	.	.	.	.	.	C	17.07	3.294573	0.60086	.	.	ENSG00000154188	ENST00000517746;ENST00000297450;ENST00000395820	.	.	.	5.77	4.89	0.63831	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.5463	0.68032	0.0:0.93:0.0:0.07	.	.	.	.	.	-1	.	.	.	-	.	.	ANGPT1	108403533	1.000000	0.71417	0.997000	0.53966	0.884000	0.51177	7.174000	0.77620	1.443000	0.47586	0.655000	0.94253	.	-	-		0.294	ANGPT1-002	PUTATIVE	alternative_5_UTR|basic	protein_coding	ANGPT1	protein_coding	OTTHUMT00000380428.2	C	NM_001146, NM_139290	Intron	108403533	-1	no_errors	NM_001146	genbank	human	reviewed	54_36p	splice_site	SNP	1	T
CSMD1	64478	genome.wustl.edu	37	8	2815251	2815251	+	Missense_Mutation	SNP	A	A	T			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr8:2815251A>T	ENST00000520002.1	-	64	10339	c.9784T>A	c.(9784-9786)Tta>Ata	p.L3262I	CSMD1_ENST00000602723.1_Missense_Mutation_p.L3085I|CSMD1_ENST00000400186.3_Missense_Mutation_p.L3085I|CSMD1_ENST00000537824.1_Missense_Mutation_p.L3261I|CSMD1_ENST00000542608.1_Missense_Mutation_p.L3084I|CSMD1_ENST00000602557.1_Missense_Mutation_p.L3262I			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	3262	Sushi 27. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)		p.L2990I(1)		breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		CTCCATGTTAAATTGGCAAGG	0.433																																																1	Substitution - Missense(1)	ovary(1)	8											96.0	91.0	93.0					8																	2815251		1964	4148	6112	2802658	SO:0001583	missense	64478					8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.9784T>A	8.37:g.2815251A>T	ENSP00000430733:p.Leu3262Ile		2802658	Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	-	p.F3262Y	ENST00000520002.1	37	c.9785		8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	15.24|15.24	2.774640|2.774640	0.49786|0.49786	.|.	.|.	ENSG00000183117|ENSG00000183117	ENST00000335551|ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608	.|T;T;T;T	.|0.65178	.|-0.14;-0.14;-0.14;-0.14	5.48|5.48	-1.05|-1.05	0.10036|0.10036	.|Complement control module (2);Sushi/SCR/CCP (3);	.|0.000000	.|0.53938	.|D	.|0.000049	T|T	0.78097|0.78097	0.4230|0.4230	M|M	0.89601|0.89601	3.045|3.045	0.35442|0.35442	D|D	0.794941|0.794941	.|D;D;D	.|0.71674	.|0.992;0.998;0.998	.|D;D;D	.|0.85130	.|0.987;0.996;0.997	T|T	0.79438|0.79438	-0.1803|-0.1803	5|10	.|0.28530	.|T	.|0.3	.|.	11.5439|11.5439	0.50681|0.50681	0.6177:0.0:0.3823:0.0|0.6177:0.0:0.3823:0.0	.|.	.|3262;3262;3084	.|E5RIG2;Q96PZ7;F5H2I8	.|.;CSMD1_HUMAN;.	Y|I	2678|3085;3262;3123;3261;3084	.|ENSP00000383047:L3085I;ENSP00000430733:L3262I;ENSP00000441462:L3261I;ENSP00000446243:L3084I	.|ENSP00000320445:L3123I	F|L	-|-	2|1	0|2	CSMD1|CSMD1	2802658|2802658	1.000000|1.000000	0.71417|0.71417	0.001000|0.001000	0.08648|0.08648	0.384000|0.384000	0.30261|0.30261	1.809000|1.809000	0.38922|0.38922	-0.327000|-0.327000	0.08551|0.08551	-0.304000|-0.304000	0.09214|0.09214	TTT|TTA	-	NULL		0.433	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	CSMD1	protein_coding	OTTHUMT00000374500.2	A	NM_033225		2802658	-1	pseudogene:no_stop_codon:bad_bp_length_for_coding_region	NM_033225	genbank	human	validated	54_36p	missense	SNP	0.99	T
TPD52	7163	genome.wustl.edu	37	8	80976725	80976727	+	In_Frame_Del	DEL	TCT	TCT	-			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	TCT	TCT	TCT	-	TCT	TCT	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr8:80976725_80976727delTCT	ENST00000379097.3	-	2	603_605	c.241_243delAGA	c.(241-243)agadel	p.R81del	TPD52_ENST00000379096.5_In_Frame_Del_p.R41del|TPD52_ENST00000448733.2_In_Frame_Del_p.R81del|TPD52_ENST00000519303.2_5'UTR|TPD52_ENST00000520527.1_In_Frame_Del_p.R81del|TPD52_ENST00000518937.1_In_Frame_Del_p.R41del|TPD52_ENST00000517427.1_In_Frame_Del_p.R81del|TPD52_ENST00000537855.1_In_Frame_Del_p.R81del	NM_001025252.1	NP_001020423.1	P55327	TPD52_HUMAN	tumor protein D52	81					anatomical structure morphogenesis (GO:0009653)|B cell differentiation (GO:0030183)|positive regulation of cell proliferation (GO:0008284)|secretion (GO:0046903)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.R81del(1)		endometrium(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)	8	all_epithelial(4;1.13e-09)|Lung NSC(7;9.71e-07)|all_lung(9;3.75e-06)	Lung NSC(129;3.55e-06)|all_lung(136;1.53e-05)|Acute lymphoblastic leukemia(644;0.158)	BRCA - Breast invasive adenocarcinoma(6;0.00181)|Epithelial(68;0.0149)|all cancers(69;0.0612)			TTGCAAGTTCTCTTCTTAGCTCT	0.424																																																1	Deletion - In frame(1)	ovary(1)	8																																								81139282	SO:0001651	inframe_deletion	7163			U18914	CCDS34912.1, CCDS47879.1, CCDS55249.1, CCDS75757.1, CCDS75758.1, CCDS75759.1	8q21.13	2014-06-24			ENSG00000076554	ENSG00000076554			12005	protein-coding gene	gene with protein product		604068				7796418	Standard	NM_001287144		Approved	D52, hD52, N8L	uc003ybr.1	P55327	OTTHUMG00000164565	ENST00000379097.3:c.241_243delAGA	8.37:g.80976728_80976730delTCT	ENSP00000368391:p.Arg81del		81139280	B7Z414|C9J502|D0UFD1|D0UFD2|D0UFD3|D0UFD4|D0UFD5|E5RKB4|Q13056|Q53EK8|Q6FGP3|Q6FGS3|Q86YZ2|Q9UCX8	In_Frame_Del	DEL	-	p.R81in_frame_del	ENST00000379097.3	37	c.243_241	CCDS34912.1	8																																																																																			(deletion:cds_exon[81139268;81139383])	NULL		0.424	TPD52-006	KNOWN	basic|CCDS	protein_coding	TPD52	protein_coding	OTTHUMT00000379539.2	TCT	NM_005079		81139282	-1	no_errors	NM_001025252	genbank	human	validated	54_36p	in_frame_del	DEL	0.863:0.862:0.851	-
SLC30A8	169026	genome.wustl.edu	37	8	118184798	118184798	+	Missense_Mutation	SNP	G	G	C	rs374485094		TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr8:118184798G>C	ENST00000456015.2	+	8	988	c.988G>C	c.(988-990)Gtt>Ctt	p.V330L	SLC30A8_ENST00000519688.1_Missense_Mutation_p.V281L|SLC30A8_ENST00000427715.2_Missense_Mutation_p.V281L|SLC30A8_ENST00000521243.1_Missense_Mutation_p.V281L	NM_173851.2	NP_776250.2	Q8IWU4	ZNT8_HUMAN	solute carrier family 30 (zinc transporter), member 8	330					cellular zinc ion homeostasis (GO:0006882)|insulin secretion (GO:0030073)|positive regulation of insulin secretion (GO:0032024)|regulation of sequestering of zinc ion (GO:0061088)|regulation of vesicle-mediated transport (GO:0060627)|response to glucose (GO:0009749)|response to interferon-gamma (GO:0034341)|response to interleukin-1 (GO:0070555)|sequestering of zinc ion (GO:0032119)|transmembrane transport (GO:0055085)|zinc ion transmembrane transport (GO:0071577)|zinc ion transport (GO:0006829)	cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|secretory granule membrane (GO:0030667)	protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)|zinc ion transmembrane transporter activity (GO:0005385)	p.V330L(1)		breast(1)|endometrium(2)|large_intestine(9)|liver(2)|lung(18)|ovary(2)|pancreas(2)|skin(5)	41	all_cancers(13;2.11e-22)|Lung NSC(37;6.08e-05)|Ovarian(258;0.0173)		STAD - Stomach adenocarcinoma(47;0.203)			CAGCCAAGTGGTTCGGAGAGA	0.502																																					Ovarian(162;1202 1922 6011 16223 52092)											1	Substitution - Missense(1)	ovary(1)	8											101.0	95.0	97.0					8																	118184798		2203	4300	6503	118253979	SO:0001583	missense	169026				CCDS6322.1, CCDS55272.1	8q24.11	2014-08-12			ENSG00000164756			"""Solute carriers"""	20303	protein-coding gene	gene with protein product		611145					Standard	NM_001172811		Approved		uc003yoh.3	Q8IWU4	OTTHUMG00000164962	ENST00000456015.2:c.988G>C	8.37:g.118184798G>C	ENSP00000415011:p.Val330Leu		118253979	A0AVP9|A5YM39|B4DPE0|Q8TCL3	Missense_Mutation	SNP	HMMPfam_Cation_efflux	p.V330L	ENST00000456015.2	37	c.988	CCDS6322.1	8	.	.	.	.	.	.	.	.	.	.	G	14.47	2.545990	0.45383	.	.	ENSG00000164756	ENST00000521243;ENST00000427715;ENST00000519688;ENST00000456015	T;T;T;T	0.65732	-0.17;-0.17;-0.17;-0.17	5.15	2.92	0.33932	.	0.214058	0.42821	D	0.000646	T	0.49677	0.1571	N	0.25957	0.775	0.40253	D	0.978096	B	0.32467	0.372	B	0.40782	0.34	T	0.52442	-0.8575	10	0.62326	D	0.03	-13.302	5.3964	0.16271	0.3492:0.0:0.6508:0.0	.	330	Q8IWU4	ZNT8_HUMAN	L	281;281;281;330	ENSP00000428545:V281L;ENSP00000407505:V281L;ENSP00000431069:V281L;ENSP00000415011:V330L	ENSP00000407505:V281L	V	+	1	0	SLC30A8	118253979	0.979000	0.34478	0.789000	0.31954	0.081000	0.17604	1.972000	0.40540	1.290000	0.44636	0.650000	0.86243	GTT	-	HMMPfam_Cation_efflux		0.502	SLC30A8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC30A8	protein_coding	OTTHUMT00000381205.1	G	NM_173851		118253979	1	no_errors	NM_173851	genbank	human	validated	54_36p	missense	SNP	0.073	C
ALG2	85365	genome.wustl.edu	37	9	101980889	101980889	+	Missense_Mutation	SNP	T	T	G			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	T	T	T	G	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr9:101980889T>G	ENST00000476832.1	-	2	639	c.578A>C	c.(577-579)cAc>cCc	p.H193P	ALG2_ENST00000319033.6_Missense_Mutation_p.H100P	NM_033087.3	NP_149078.1	O75340	PDCD6_HUMAN	ALG2, alpha-1,3/1,6-mannosyltransferase	0					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|cellular response to heat (GO:0034605)|intracellular protein transport (GO:0006886)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of TOR signaling (GO:0032007)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|proteolysis (GO:0006508)|response to calcium ion (GO:0051592)|vascular endothelial growth factor receptor-2 signaling pathway (GO:0036324)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	binding, bridging (GO:0060090)|calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|calcium-dependent protein binding (GO:0048306)|protein dimerization activity (GO:0046983)	p.H193P(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(11)|ovary(2)|prostate(2)	22		Acute lymphoblastic leukemia(62;0.0559)				AGGGTCTATGTGAGACAGGGA	0.458																																																1	Substitution - Missense(1)	ovary(1)	9											118.0	118.0	118.0					9																	101980889		2203	4300	6503	101020710	SO:0001583	missense	85365			AK027417	CCDS6739.1	9q31.1	2013-02-22	2013-02-22		ENSG00000119523	ENSG00000119523	2.4.1.132, 2.4.1.257	"""Glycosyltransferase group 1 domain containing"""	23159	protein-coding gene	gene with protein product		607905	"""asparagine-linked glycosylation 2 homolog (yeast, alpha-1,3-mannosyltransferase)"", ""asparagine-linked glycosylation 2, alpha-1,3-mannosyltransferase homolog (S. cerevisiae)"""			12684507	Standard	NR_024532		Approved	CDGIi, FLJ14511, hALPG2, NET38	uc004azf.3	Q9H553	OTTHUMG00000020355	ENST00000476832.1:c.578A>C	9.37:g.101980889T>G	ENSP00000417764:p.His193Pro		101020710	B2RD16|E7ESR3|Q2YDC2|Q5TZS0	Missense_Mutation	SNP	HMMPfam_Glycos_transf_1;superfamily_UDP-Glycosyltransferase/glycogen phosphorylase	p.H193P	ENST00000476832.1	37	c.578	CCDS6739.1	9	.	.	.	.	.	.	.	.	.	.	T	10.89	1.478686	0.26511	.	.	ENSG00000119523	ENST00000476832;ENST00000319033	T;T	0.77098	-1.07;-1.07	5.38	5.38	0.77491	.	0.352304	0.36740	N	0.002423	T	0.81842	0.4908	M	0.79926	2.475	0.45087	D	0.998101	P;P	0.46912	0.886;0.818	P;B	0.46975	0.533;0.411	T	0.81459	-0.0923	10	0.28530	T	0.3	-14.4437	15.6924	0.77464	0.0:0.0:0.0:1.0	.	100;193	Q9H553-2;Q9H553	.;ALG2_HUMAN	P	193;100	ENSP00000417764:H193P;ENSP00000326609:H100P	ENSP00000432675:H100P	H	-	2	0	ALG2	101020710	1.000000	0.71417	0.998000	0.56505	0.915000	0.54546	2.976000	0.49289	2.167000	0.68274	0.528000	0.53228	CAC	-	NULL		0.458	ALG2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ALG2	protein_coding	OTTHUMT00000215080.1	T	NM_033087		101020710	-1	no_errors	NM_033087	genbank	human	reviewed	54_36p	missense	SNP	0.99	G
C9orf84	158401	genome.wustl.edu	37	9	114490176	114490176	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr9:114490176G>A	ENST00000318737.4	-	11	1507	c.1379C>T	c.(1378-1380)gCa>gTa	p.A460V	C9orf84_ENST00000394777.4_Missense_Mutation_p.A421V|C9orf84_ENST00000394779.3_Missense_Mutation_p.A421V|C9orf84_ENST00000374287.3_Missense_Mutation_p.A460V	NM_173521.3	NP_775792.3	Q5VXU9	CI084_HUMAN	chromosome 9 open reading frame 84	460								p.A421V(1)		breast(1)|cervix(1)|endometrium(3)|kidney(7)|large_intestine(10)|liver(1)|lung(7)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35						TTCTTTTGCTGCTCCTTTATC	0.358																																																1	Substitution - Missense(1)	ovary(1)	9											94.0	95.0	95.0					9																	114490176		2203	4300	6503	113529997	SO:0001583	missense	158401			AL833535	CCDS6781.3, CCDS43863.1	9q32	2012-03-16			ENSG00000165181	ENSG00000165181			26535	protein-coding gene	gene with protein product							Standard	XM_005251738		Approved	FLJ32779	uc004bfr.3	Q5VXU9	OTTHUMG00000020495	ENST00000318737.4:c.1379C>T	9.37:g.114490176G>A	ENSP00000322108:p.Ala460Val		113529997	A2A2V3|Q2M1H8|Q96M73	Missense_Mutation	SNP	-	p.A460V	ENST00000318737.4	37	c.1379	CCDS6781.3	9	.	.	.	.	.	.	.	.	.	.	G	6.212	0.407305	0.11754	.	.	ENSG00000165181	ENST00000394779;ENST00000394777;ENST00000394778;ENST00000374287;ENST00000318737	T;T;T;T	0.04917	3.53;3.53;3.54;3.54	5.04	2.16	0.27623	.	0.717261	0.12681	N	0.447949	T	0.03011	0.0089	N	0.08118	0	0.09310	N	1	B;B;B	0.19200	0.034;0.013;0.034	B;B;B	0.21917	0.025;0.037;0.025	T	0.46414	-0.9193	10	0.23302	T	0.38	-0.0177	4.0165	0.09646	0.1909:0.0:0.621:0.1881	.	421;460;421	A6PVK7;Q5VXU9;A2A2V3	.;CI084_HUMAN;.	V	421;421;74;460;460	ENSP00000378259:A421V;ENSP00000378257:A421V;ENSP00000363405:A460V;ENSP00000322108:A460V	ENSP00000322108:A460V	A	-	2	0	C9orf84	113529997	0.017000	0.18338	0.003000	0.11579	0.249000	0.25844	1.619000	0.36965	0.808000	0.34231	0.585000	0.79938	GCA	-	NULL		0.358	C9orf84-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C9orf84	protein_coding	OTTHUMT00000053656.2	G	NM_173521		113529997	-1	no_errors	NM_173521	genbank	human	validated	54_36p	missense	SNP		A
FKBP15	23307	genome.wustl.edu	37	9	115969541	115969541	+	Missense_Mutation	SNP	T	T	C			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr9:115969541T>C	ENST00000238256.3	-	3	322	c.205A>G	c.(205-207)Atg>Gtg	p.M69V	FKBP15_ENST00000493847.1_5'UTR	NM_015258.1	NP_056073.1	Q5T1M5	FKB15_HUMAN	FK506 binding protein 15, 133kDa	69					endocytosis (GO:0006897)|negative regulation of phosphatase activity (GO:0010923)|protein folding (GO:0006457)	actin filament (GO:0005884)|axon (GO:0030424)|endosome (GO:0005768)|growth cone (GO:0030426)|membrane (GO:0016020)		p.M94V(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(9)|ovary(3)|urinary_tract(1)	26						GGAGTGCTCATGGTGGCTGGT	0.433																																																1	Substitution - Missense(1)	ovary(1)	9											364.0	381.0	375.0					9																	115969541		2108	4240	6348	115009362	SO:0001583	missense	23307			AB014574	CCDS48007.1	9q33.1	2014-05-09	2006-10-31	2006-10-31	ENSG00000119321	ENSG00000119321		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	23397	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 76"", ""WASP and FKBP-like protein"""		"""KIAA0674"""	KIAA0674		16756961, 20376207	Standard	NM_015258		Approved	PPP1R76, FKBP133, WAFL	uc004bgs.2	Q5T1M5	OTTHUMG00000020518	ENST00000238256.3:c.205A>G	9.37:g.115969541T>C	ENSP00000238256:p.Met69Val		115009362	Q05DK8|Q5T1M2|Q6DD85|Q9Y4D0	Missense_Mutation	SNP	-	p.M69V	ENST00000238256.3	37	c.205	CCDS48007.1	9	.	.	.	.	.	.	.	.	.	.	T	4.998	0.185392	0.09495	.	.	ENSG00000119321	ENST00000446284;ENST00000238256;ENST00000414250	T;T;T	0.28666	2.02;2.02;1.6	6.04	-5.78	0.02362	.	.	.	.	.	T	0.08846	0.0219	N	0.02011	-0.69	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.25710	-1.0124	9	0.36615	T	0.2	0.9122	3.7985	0.08749	0.2003:0.4594:0.1151:0.2251	.	69;69;69	Q5T1M5-2;Q5T1M5-3;Q5T1M5	.;.;FKB15_HUMAN	V	94;69;94	ENSP00000416158:M94V;ENSP00000238256:M69V;ENSP00000415733:M94V	ENSP00000238256:M69V	M	-	1	0	FKBP15	115009362	0.000000	0.05858	0.000000	0.03702	0.076000	0.17211	-0.711000	0.05019	-0.601000	0.05783	-0.376000	0.06991	ATG	-	NULL		0.433	FKBP15-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FKBP15	protein_coding		T	NM_015258		115009362	-1	no_errors	NM_015258	genbank	human	validated	54_36p	missense	SNP		C
ASS1	445	genome.wustl.edu	37	9	133376404	133376404	+	Missense_Mutation	SNP	A	A	C			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	A	A	A	C	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr9:133376404A>C	ENST00000372394.1	+	16	1716	c.1235A>C	c.(1234-1236)aAa>aCa	p.K412T	ASS1_ENST00000352480.5_Missense_Mutation_p.K412T|ASS1_ENST00000372393.3_Missense_Mutation_p.K412T			P00966	ASSY_HUMAN	argininosuccinate synthase 1	412					acute-phase response (GO:0006953)|aging (GO:0007568)|arginine biosynthetic process (GO:0006526)|argininosuccinate metabolic process (GO:0000053)|aspartate metabolic process (GO:0006531)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to amine stimulus (GO:0071418)|cellular response to amino acid stimulus (GO:0071230)|cellular response to ammonium ion (GO:0071242)|cellular response to cAMP (GO:0071320)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to glucagon stimulus (GO:0071377)|cellular response to interferon-gamma (GO:0071346)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to oleic acid (GO:0071400)|cellular response to tumor necrosis factor (GO:0071356)|citrulline metabolic process (GO:0000052)|diaphragm development (GO:0060539)|kidney development (GO:0001822)|liver development (GO:0001889)|midgut development (GO:0007494)|negative regulation of leukocyte cell-cell adhesion (GO:1903038)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to growth hormone (GO:0060416)|response to mycotoxin (GO:0010046)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)|urea cycle (GO:0000050)	cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)|perikaryon (GO:0043204)	amino acid binding (GO:0016597)|argininosuccinate synthase activity (GO:0004055)|ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|toxic substance binding (GO:0015643)	p.K412T(1)		breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(4)|ovary(1)|skin(1)|urinary_tract(1)	17				OV - Ovarian serous cystadenocarcinoma(145;0.000514)	Adenosine triphosphate(DB00171)|L-Arginine(DB00125)|L-Aspartic Acid(DB00128)|L-Citrulline(DB00155)	GTCACTGCCAAATAGACCCGT	0.418																																																1	Substitution - Missense(1)	ovary(1)	9											125.0	124.0	125.0					9																	133376404		2203	4299	6502	132366225	SO:0001583	missense	445			X01630	CCDS6933.1	9q34.1	2012-10-02	2010-04-20	2006-08-24	ENSG00000130707	ENSG00000130707	6.3.4.5		758	protein-coding gene	gene with protein product		603470	"""argininosuccinate synthetase"""	ASS		3513483, 852520	Standard	NM_054012		Approved	CTLN1	uc004bzm.3	P00966	OTTHUMG00000020806	ENST00000372394.1:c.1235A>C	9.37:g.133376404A>C	ENSP00000361471:p.Lys412Thr		132366225	Q6LDL2|Q86UZ0|Q96GT4	Missense_Mutation	SNP	HMMPfam_Arginosuc_synth;superfamily_Adenine nucleotide alpha hydrolases-like;superfamily_Argininosuccinate synthetase C-terminal domain	p.K412T	ENST00000372394.1	37	c.1235	CCDS6933.1	9	.	.	.	.	.	.	.	.	.	.	A	14.21	2.465964	0.43839	.	.	ENSG00000130707	ENST00000334909;ENST00000352480;ENST00000372394;ENST00000372393;ENST00000372386	D;D;D;D	0.98835	-5.14;-5.14;-5.14;-5.17	4.6	3.46	0.39613	.	0.000000	0.64402	U	0.000001	D	0.97278	0.9110	N	0.22421	0.69	0.39429	D	0.967057	P;D;D;P;P	0.69078	0.89;0.997;0.997;0.89;0.89	B;P;P;B;B	0.60068	0.441;0.868;0.868;0.441;0.441	D	0.96522	0.9386	10	0.87932	D	0	.	7.9344	0.29920	0.9032:0.0:0.0968:0.0	.	412;295;295;412;412	A8KAP9;B4E395;E9PDT0;Q5T6L4;P00966	.;.;.;.;ASSY_HUMAN	T	412;412;412;412;169	ENSP00000253004:K412T;ENSP00000361471:K412T;ENSP00000361469:K412T;ENSP00000361461:K169T	ENSP00000361470:K412T	K	+	2	0	ASS1	132366225	1.000000	0.71417	0.996000	0.52242	0.717000	0.41224	5.780000	0.68956	0.723000	0.32274	-0.353000	0.07706	AAA	-	NULL		0.418	ASS1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ASS1	protein_coding	OTTHUMT00000054652.1	A	NM_000050		132366225	1	no_errors	NM_000050	genbank	human	reviewed	54_36p	missense	SNP	1	C
SLC25A51	92014	genome.wustl.edu	37	9	37887988	37887988	+	Missense_Mutation	SNP	T	T	A			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr9:37887988T>A	ENST00000377716.2	-	3	1303	c.560A>T	c.(559-561)aAt>aTt	p.N187I	SLC25A51_ENST00000380590.3_Missense_Mutation_p.N187I|SLC25A51_ENST00000242275.6_Missense_Mutation_p.N187I|RP11-613M10.9_ENST00000540557.1_Intron|SLC25A51_ENST00000496760.1_Intron			Q9H1U9	S2551_HUMAN	solute carrier family 25, member 51	187					transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)		p.N187I(1)									AAACAAGACATTGCTGAGTCC	0.463																																																1	Substitution - Missense(1)	ovary(1)	9											76.0	73.0	74.0					9																	37887988		2203	4296	6499	37877988	SO:0001583	missense	92014			BC008500	CCDS6614.1	9p13.3-p12	2013-05-22	2012-03-29	2012-03-29	ENSG00000122696	ENSG00000122696		"""Solute carriers"""	23323	protein-coding gene	gene with protein product			"""mitochondrial carrier triple repeat 1"""	MCART1		12477932	Standard	NM_033412		Approved	MGC14836, CG7943	uc004aav.2	Q9H1U9	OTTHUMG00000019935	ENST00000377716.2:c.560A>T	9.37:g.37887988T>A	ENSP00000366945:p.Asn187Ile		37877988		Missense_Mutation	SNP	-	p.N187I	ENST00000377716.2	37	c.560	CCDS6614.1	9	.	.	.	.	.	.	.	.	.	.	.	21.3	4.122474	0.77436	.	.	ENSG00000122696	ENST00000380590;ENST00000377716;ENST00000242275	T;T;T	0.78481	-1.18;-1.18;-1.18	4.64	4.64	0.57946	Mitochondrial carrier domain (2);	0.058414	0.64402	D	0.000004	D	0.87430	0.6175	M	0.81802	2.56	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.88996	0.3418	10	0.87932	D	0	.	12.3163	0.54958	0.0:0.0:0.0:1.0	.	187	Q9H1U9	MCAR1_HUMAN	I	187	ENSP00000369964:N187I;ENSP00000366945:N187I;ENSP00000242275:N187I	ENSP00000242275:N187I	N	-	2	0	MCART1	37877988	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.568000	0.82369	1.868000	0.54150	0.477000	0.44152	AAT	-	NULL		0.463	SLC25A51-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MCART1	protein_coding	OTTHUMT00000313746.1	T	NM_033412		37877988	-1	no_errors	NM_033412	genbank	human	validated	54_36p	missense	SNP	1	A
TTF1	7270	genome.wustl.edu	37	9	135277490	135277490	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chr9:135277490G>C	ENST00000334270.2	-	2	758	c.719C>G	c.(718-720)tCg>tGg	p.S240W		NM_001205296.1|NM_007344.3	NP_001192225.1|NP_031370.2	Q15361	TTF1_HUMAN	transcription termination factor, RNA polymerase I	240					chromatin remodeling (GO:0006338)|DNA-templated transcription, termination (GO:0006353)|gene expression (GO:0010467)|negative regulation of DNA replication (GO:0008156)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase I transcription (GO:0006363)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.S240W(1)		endometrium(3)|kidney(1)|large_intestine(5)|lung(13)|ovary(2)|pancreas(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	30		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;4.25e-06)|Epithelial(140;9.09e-05)		GCCTGCTTGCGATCCTTCAGG	0.453																																																1	Substitution - Missense(1)	ovary(1)	9											42.0	43.0	43.0					9																	135277490		2203	4300	6503	134267311	SO:0001583	missense	7270			BC050734	CCDS6948.1, CCDS75925.1	9q34.3	2008-02-05			ENSG00000125482	ENSG00000125482			12397	protein-coding gene	gene with protein product		600777				7597036	Standard	NM_007344		Approved		uc004cbl.3	Q15361	OTTHUMG00000020836	ENST00000334270.2:c.719C>G	9.37:g.135277490G>C	ENSP00000333920:p.Ser240Trp		134267311	A1L160|Q4VXF3|Q58EY2|Q6P5T5	Missense_Mutation	SNP	superfamily_Homeodomain-like;HMMPfam_Myb_DNA-binding	p.S240W	ENST00000334270.2	37	c.719	CCDS6948.1	9	.	.	.	.	.	.	.	.	.	.	G	9.523	1.108704	0.20714	.	.	ENSG00000125482	ENST00000334270;ENST00000245588	T	0.12147	2.71	1.86	-0.359	0.12571	.	.	.	.	.	T	0.07638	0.0192	L	0.29908	0.895	0.09310	N	1	D	0.56035	0.974	B	0.39562	0.303	T	0.27606	-1.0069	9	0.87932	D	0	.	1.962	0.03388	0.2168:0.0:0.4634:0.3199	.	240	Q15361	TTF1_HUMAN	W	240	ENSP00000333920:S240W	ENSP00000245588:S240W	S	-	2	0	TTF1	134267311	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.018000	0.13422	0.070000	0.16634	-0.518000	0.04402	TCG	-	NULL		0.453	TTF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTF1	protein_coding	OTTHUMT00000054784.2	G	NM_007344		134267311	-1	no_errors	NM_007344	genbank	human	validated	54_36p	missense	SNP		C
FRMPD3	84443	genome.wustl.edu	37	X	106841012	106841012	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chrX:106841012C>G	ENST00000276185.4	+	15	2002	c.2002C>G	c.(2002-2004)Cgt>Ggt	p.R668G				Q5JV73	FRPD3_HUMAN	FERM and PDZ domain containing 3	668						cytoskeleton (GO:0005856)		p.R717G(1)		breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(16)|ovary(2)|urinary_tract(1)	28						TGGCTCCTCTCGTGACAATAT	0.542																																																1	Substitution - Missense(1)	ovary(1)	X											9.0	9.0	9.0					X																	106841012		869	1968	2837	106727668	SO:0001583	missense	84443			AB058720	CCDS76006.1	Xq22	2008-02-05			ENSG00000147234	ENSG00000147234			29382	protein-coding gene	gene with protein product						11347906	Standard	NM_032428		Approved	RP5-1070B1.1, KIAA1817		Q5JV73	OTTHUMG00000022165	ENST00000276185.4:c.2002C>G	X.37:g.106841012C>G	ENSP00000276185:p.Arg668Gly		106727668	Q96JK8	Missense_Mutation	SNP	-	p.R668G	ENST00000276185.4	37	c.2002		X	.	.	.	.	.	.	.	.	.	.	C	11.26	1.584813	0.28268	.	.	ENSG00000147234	ENST00000276185;ENST00000439554	T;T	0.21031	2.03;2.03	5.06	3.12	0.35913	.	0.428519	0.25854	N	0.027862	T	0.14313	0.0346	L	0.29908	0.895	0.24063	N	0.996007	.	.	.	.	.	.	T	0.19160	-1.0314	8	0.19147	T	0.46	.	6.4723	0.22015	0.3181:0.5859:0.0:0.096	.	.	.	.	G	668;616	ENSP00000276185:R668G;ENSP00000398668:R616G	ENSP00000276185:R668G	R	+	1	0	FRMPD3	106727668	0.993000	0.37304	0.999000	0.59377	0.862000	0.49288	0.856000	0.27818	1.109000	0.41680	0.429000	0.28392	CGT	-	NULL		0.542	FRMPD3-201	KNOWN	basic|appris_principal	protein_coding	FRMPD3	protein_coding		C	XM_042978		106727668	1	no_errors	XM_042978	genbank	human	model	54_36p	missense	SNP	1	G
COL4A6	1288	genome.wustl.edu	37	X	107404858	107404858	+	Nonsense_Mutation	SNP	C	C	A			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chrX:107404858C>A	ENST00000372216.4	-	42	4427	c.4327G>T	c.(4327-4329)Gga>Tga	p.G1443*	COL4A6_ENST00000545689.1_Nonsense_Mutation_p.G1418*|COL4A6_ENST00000334504.7_Nonsense_Mutation_p.G1442*|COL4A6_ENST00000538570.1_Nonsense_Mutation_p.G1385*|COL4A6_ENST00000418180.1_5'Flank|COL4A6_ENST00000394872.2_Nonsense_Mutation_p.G1443*	NM_001847.2	NP_001838.2	Q14031	CO4A6_HUMAN	collagen, type IV, alpha 6	1443	Triple-helical region.				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)	p.G1442*(1)		breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(41)|ovary(7)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	92						CCTTCAAATCCTGGAGGGCCT	0.602									Alport syndrome with Diffuse Leiomyomatosis																												Melanoma(87;1895 1945 2589 7165)											1	Substitution - Nonsense(1)	ovary(1)	X											31.0	35.0	34.0					X																	107404858		2202	4296	6498	107291514	SO:0001587	stop_gained	1288	Familial Cancer Database		U04845	CCDS14541.1, CCDS14542.1, CCDS76008.1, CCDS76009.1, CCDS76010.1	Xq22	2014-09-17			ENSG00000197565	ENSG00000197565		"""Collagens"""	2208	protein-coding gene	gene with protein product		303631				8356449	Standard	NM_033641		Approved		uc004env.4	Q14031	OTTHUMG00000022179	ENST00000372216.4:c.4327G>T	X.37:g.107404858C>A	ENSP00000361290:p.Gly1443*		107291514	Q12823|Q14053|Q5JYH6|Q5JYH8|Q9NQM5|Q9NTX3|Q9UJ76|Q9UMG6|Q9Y4L4	Nonsense_Mutation	SNP	HMMPfam_C4;HMMPfam_Collagen;superfamily_C-type lectin-like	p.G1443*	ENST00000372216.4	37	c.4327	CCDS14541.1	X	.	.	.	.	.	.	.	.	.	.	C	45	11.619214	0.99583	.	.	ENSG00000197565	ENST00000372216;ENST00000334504;ENST00000394872;ENST00000541389;ENST00000545689;ENST00000538570	.	.	.	5.13	5.13	0.70059	.	0.000000	0.38217	N	0.001776	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	18.2684	0.90060	0.0:1.0:0.0:0.0	.	.	.	.	X	1443;1442;1443;1430;1418;1385	.	ENSP00000334733:G1442X	G	-	1	0	COL4A6	107291514	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.049000	0.76613	2.447000	0.82792	0.600000	0.82982	GGA	-	HMMPfam_Collagen		0.602	COL4A6-001	KNOWN	basic|CCDS	protein_coding	COL4A6	protein_coding	OTTHUMT00000057875.2	C			107291514	-1	no_errors	NM_001847	genbank	human	reviewed	54_36p	nonsense	SNP	1	A
CAPN6	827	genome.wustl.edu	37	X	110495619	110495619	+	Silent	SNP	A	A	T			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chrX:110495619A>T	ENST00000324068.1	-	5	782	c.615T>A	c.(613-615)acT>acA	p.T205T	CAPN6_ENST00000541758.1_Intron	NM_014289.3	NP_055104.2	Q9Y6Q1	CAN6_HUMAN	calpain 6	205	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				microtubule bundle formation (GO:0001578)|proteolysis (GO:0006508)|regulation of cytoskeleton organization (GO:0051493)	perinuclear region of cytoplasm (GO:0048471)|spindle microtubule (GO:0005876)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|microtubule binding (GO:0008017)	p.T205T(1)		cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(25)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)	47						CAACAAGCTCAGTGTATCTTC	0.433																																																1	Substitution - coding silent(1)	ovary(1)	X											173.0	123.0	140.0					X																	110495619		2203	4300	6503	110382275	SO:0001819	synonymous_variant	827			AF029232	CCDS14555.1	Xq23	2008-07-29			ENSG00000077274	ENSG00000077274			1483	protein-coding gene	gene with protein product		300146				9503024, 9339374	Standard	NM_014289		Approved	CAPNX, CalpM, CANPX	uc004epc.2	Q9Y6Q1	OTTHUMG00000022203	ENST00000324068.1:c.615T>A	X.37:g.110495619A>T			110382275	D3DUY7|Q9UEQ1|Q9UJA8	Silent	SNP	HMMPfam_C2;HMMPfam_Peptidase_C2;HMMPfam_Calpain_III;superfamily_Calpain large subunit middle domain (domain III);superfamily_C2 domain (Calcium/lipid-binding domain CaLB);superfamily_Cysteine proteinases	p.T205	ENST00000324068.1	37	c.615	CCDS14555.1	X																																																																																			-	HMMPfam_Peptidase_C2		0.433	CAPN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAPN6	protein_coding	OTTHUMT00000057922.1	A			110382275	-1	no_errors	NM_014289	genbank	human	reviewed	54_36p	silent	SNP	0.68	T
GABRA3	2556	genome.wustl.edu	37	X	151336921	151336921	+	Missense_Mutation	SNP	C	C	T	rs202150301		TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chrX:151336921C>T	ENST00000370314.4	-	10	1496	c.1258G>A	c.(1258-1260)Gct>Act	p.A420T	RP11-329E24.6_ENST00000453915.1_RNA|GABRA3_ENST00000535043.1_Missense_Mutation_p.A420T	NM_000808.3	NP_000799.1	P34903	GBRA3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 3	420					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)	p.A420T(2)		breast(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(16)|ovary(1)|prostate(2)|skin(6)	37	Acute lymphoblastic leukemia(192;6.56e-05)				Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zolpidem(DB00425)|Zopiclone(DB01198)	CTGGGAGCAGCGCCCTTGGAG	0.552																																					NSCLC(142;2578 2613 10251 16743)											2	Substitution - Missense(2)	ovary(1)|lung(1)	X											301.0	243.0	263.0					X																	151336921		2203	4300	6503	151087577	SO:0001583	missense	2556				CCDS14706.1	Xq28	2012-06-22			ENSG00000011677	ENSG00000011677		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4077	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 3"""	305660					Standard	NM_000808		Approved		uc010ntk.1	P34903	OTTHUMG00000024183	ENST00000370314.4:c.1258G>A	X.37:g.151336921C>T	ENSP00000359337:p.Ala420Thr		151087577	Q8TAF9	Missense_Mutation	SNP	HMMPfam_Neur_chan_memb;HMMPfam_Neur_chan_LBD;superfamily_Nicotinic receptor ligand binding domain-like;superfamily_Neurotransmitter-gated ion-channel transmembrane pore	p.A420T	ENST00000370314.4	37	c.1258	CCDS14706.1	X	.	.	.	.	.	.	.	.	.	.	C	14.05	2.420034	0.42918	.	.	ENSG00000011677	ENST00000370314;ENST00000370311;ENST00000535043	D;D;D	0.82081	-1.57;-1.57;-1.57	4.71	3.85	0.44370	Neurotransmitter-gated ion-channel transmembrane domain (1);	0.518559	0.21905	N	0.067399	T	0.73156	0.3551	N	0.13098	0.295	0.52501	D	0.999952	D	0.58268	0.982	P	0.50109	0.631	T	0.66795	-0.5833	10	0.15952	T	0.53	.	10.2929	0.43608	0.0:0.8981:0.0:0.1019	.	420	P34903	GBRA3_HUMAN	T	420	ENSP00000359337:A420T;ENSP00000359334:A420T;ENSP00000443527:A420T	ENSP00000359334:A420T	A	-	1	0	GABRA3	151087577	1.000000	0.71417	0.311000	0.25182	0.876000	0.50452	5.844000	0.69430	0.903000	0.36546	-0.195000	0.12781	GCT	-	HMMPfam_Neur_chan_memb		0.552	GABRA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABRA3	protein_coding	OTTHUMT00000060921.1	C	NM_000808		151087577	-1	no_errors	NM_000808	genbank	human	reviewed	54_36p	missense	SNP	1	T
SHROOM2	357	genome.wustl.edu	37	X	9900271	9900271	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chrX:9900271G>C	ENST00000380913.3	+	6	3038	c.2948G>C	c.(2947-2949)aGt>aCt	p.S983T	SHROOM2_ENST00000493668.1_3'UTR|SHROOM2_ENST00000418909.2_5'UTR	NM_001649.2	NP_001640.1	Q13796	SHRM2_HUMAN	shroom family member 2	983					apical protein localization (GO:0045176)|brain development (GO:0007420)|camera-type eye development (GO:0043010)|camera-type eye morphogenesis (GO:0048593)|cell migration (GO:0016477)|cell-cell junction maintenance (GO:0045217)|cellular pigment accumulation (GO:0043482)|ear development (GO:0043583)|establishment of melanosome localization (GO:0032401)|eye pigment granule organization (GO:0008057)|lens morphogenesis in camera-type eye (GO:0002089)|melanosome organization (GO:0032438)|negative regulation of actin filament depolymerization (GO:0030835)|sodium ion transmembrane transport (GO:0035725)	apical plasma membrane (GO:0016324)|cell cortex (GO:0005938)|cell-cell adherens junction (GO:0005913)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|beta-catenin binding (GO:0008013)|ligand-gated sodium channel activity (GO:0015280)	p.S983T(1)		breast(4)|central_nervous_system(2)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(13)|ovary(3)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)	57		Hepatocellular(5;0.000888)				CACCCACCGAGTCAGAAGGCA	0.577																																																1	Substitution - Missense(1)	ovary(1)	X											112.0	95.0	101.0					X																	9900271		2203	4300	6503	9860271	SO:0001583	missense	357			X83543	CCDS14135.1	Xp22.3	2008-02-05	2006-07-20	2006-07-20	ENSG00000146950	ENSG00000146950			630	protein-coding gene	gene with protein product		300103	"""apical protein, Xenopus laevis-like"", ""apical protein-like (Xenopus laevis)"""	APXL		7795590, 16615870	Standard	NM_001649		Approved		uc004csu.1	Q13796	OTTHUMG00000021121	ENST00000380913.3:c.2948G>C	X.37:g.9900271G>C	ENSP00000370299:p.Ser983Thr		9860271	B9EIQ7	Missense_Mutation	SNP	HMMPfam_PDZ;superfamily_PDZ domain-like;HMMPfam_ASD2;HMMPfam_ASD1	p.S983T	ENST00000380913.3	37	c.2948	CCDS14135.1	X	.	.	.	.	.	.	.	.	.	.	g	1.744	-0.490895	0.04322	.	.	ENSG00000146950	ENST00000380913	T	0.14391	2.51	3.11	-3.05	0.05396	.	7739.210000	0.00166	N	0.000000	T	0.11367	0.0277	L	0.36672	1.1	0.09310	N	0.999999	B	0.25105	0.118	B	0.21151	0.033	T	0.29458	-1.0011	10	0.14656	T	0.56	.	10.1791	0.42957	0.8578:0.0:0.1422:0.0	.	983	Q13796	SHRM2_HUMAN	T	983	ENSP00000370299:S983T	ENSP00000370299:S983T	S	+	2	0	SHROOM2	9860271	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.132000	0.15891	-0.684000	0.05183	-0.203000	0.12734	AGT	-	NULL		0.577	SHROOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHROOM2	protein_coding	OTTHUMT00000055721.1	G	NM_001649		9860271	1	no_errors	NM_001649	genbank	human	reviewed	54_36p	missense	SNP		C
GRPR	2925	genome.wustl.edu	37	X	16168719	16168719	+	Silent	SNP	A	A	G			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chrX:16168719A>G	ENST00000380289.2	+	2	1103	c.705A>G	c.(703-705)aaA>aaG	p.K235K	RP11-431J24.2_ENST00000435789.1_RNA|RP11-431J24.2_ENST00000422438.1_RNA|RP11-431J24.2_ENST00000454712.2_RNA	NM_005314.2	NP_005305.1	P30550	GRPR_HUMAN	gastrin-releasing peptide receptor	235					cell proliferation (GO:0008283)|G-protein coupled receptor signaling pathway (GO:0007186)|regulation of cell proliferation (GO:0042127)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	bombesin receptor activity (GO:0004946)|G-protein coupled peptide receptor activity (GO:0008528)	p.K235K(1)		central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(12)|ovary(3)|stomach(1)|upper_aerodigestive_tract(3)	25	Hepatocellular(33;0.183)					TCATTGCTAAAAATCTGATCC	0.423																																																1	Substitution - coding silent(1)	ovary(1)	X											120.0	102.0	108.0					X																	16168719		2203	4300	6503	16078640	SO:0001819	synonymous_variant	2925				CCDS14174.1	Xp22.2	2014-02-21			ENSG00000126010	ENSG00000126010		"""GPCR / Class A : Bombesin receptors"""	4609	protein-coding gene	gene with protein product	"""bombesin receptor 2"""	305670					Standard	NM_005314		Approved	BB2	uc004cxj.3	P30550	OTTHUMG00000021189	ENST00000380289.2:c.705A>G	X.37:g.16168719A>G			16078640	B2R910	Silent	SNP	HMMPfam_7tm_1;superfamily_Family A G protein-coupled receptor-like	p.K235	ENST00000380289.2	37	c.705	CCDS14174.1	X																																																																																			-	HMMPfam_7tm_1		0.423	GRPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRPR	protein_coding	OTTHUMT00000055901.1	A	NM_005314		16078640	1	no_errors	NM_005314	genbank	human	reviewed	54_36p	silent	SNP	0.38	G
DMD	1756	genome.wustl.edu	37	X	32382762	32382762	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chrX:32382762C>G	ENST00000357033.4	-	36	5297	c.5091G>C	c.(5089-5091)caG>caC	p.Q1697H	DMD_ENST00000378677.2_Missense_Mutation_p.Q1693H	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	1697	Interaction with SYNM. {ECO:0000250}.				cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)	p.Q1692H(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				GTGTGTCAGCCTGAATGATCC	0.373																																																1	Substitution - Missense(1)	ovary(1)	X											245.0	197.0	213.0					X																	32382762		2202	4300	6502	32292683	SO:0001583	missense	1756			AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.5091G>C	X.37:g.32382762C>G	ENSP00000354923:p.Gln1697His		32292683	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	HMMPfam_ZZ;HMMPfam_WW;superfamily_WW domain;HMMPfam_CH;HMMPfam_Spectrin;superfamily_Prefoldin;superfamily_t-snare proteins;HMMPfam_efhand_1;HMMPfam_efhand_2;superfamily_Spectrin repeat;superfamily_EF-hand;superfamily_Calponin-homology domain CH-domain	p.Q1697H	ENST00000357033.4	37	c.5091	CCDS14233.1	X	.	.	.	.	.	.	.	.	.	.	C	12.83	2.054698	0.36277	.	.	ENSG00000198947	ENST00000534884;ENST00000378682;ENST00000378684;ENST00000378677;ENST00000357033;ENST00000542849;ENST00000535280	T;T	0.35421	1.31;1.31	5.38	-3.93	0.04143	.	0.608291	0.12498	N	0.463628	T	0.15305	0.0369	N	0.14661	0.345	0.46203	D	0.998927	B;B;B;B;B	0.06786	0.0;0.001;0.0;0.0;0.0	B;B;B;B;B	0.10450	0.0;0.005;0.001;0.001;0.001	T	0.07597	-1.0764	10	0.51188	T	0.08	.	1.5183	0.02510	0.3832:0.2499:0.081:0.2859	.	1689;1697;1693;356;353	P11532-4;P11532;E9PDN5;E7EQS7;E7EQS6	.;DMD_HUMAN;.;.;.	H	1689;356;353;1693;1697;1697;1574	ENSP00000367948:Q1693H;ENSP00000354923:Q1697H	ENSP00000354923:Q1697H	Q	-	3	2	DMD	32292683	0.701000	0.27806	0.941000	0.38009	0.993000	0.82548	-0.105000	0.10907	-0.665000	0.05317	0.538000	0.68166	CAG	-	HMMPfam_Spectrin		0.373	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMD	protein_coding	OTTHUMT00000056182.2	C	NM_004006		32292683	-1	no_errors	NM_004006	genbank	human	reviewed	54_36p	missense	SNP	0.6	G
ZNF182	7569	genome.wustl.edu	37	X	47836155	47836155	+	Missense_Mutation	SNP	T	T	C			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chrX:47836155T>C	ENST00000396965.1	-	7	1681	c.1331A>G	c.(1330-1332)aAc>aGc	p.N444S	ZNF182_ENST00000376943.3_Missense_Mutation_p.N425S|ZNF182_ENST00000305127.6_Missense_Mutation_p.N444S	NM_001178099.1	NP_001171570.1	P17025	ZN182_HUMAN	zinc finger protein 182	444					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.N444S(1)		endometrium(5)|kidney(1)|large_intestine(8)|lung(5)|ovary(2)|prostate(1)	22						TACACCAAGGTTTGACTTTTG	0.418																																																1	Substitution - Missense(1)	ovary(1)	X											68.0	61.0	64.0					X																	47836155		2203	4300	6503	47721099	SO:0001583	missense	7569			AK122874, R98366	CCDS35235.1, CCDS35236.1	Xp11.23	2013-01-08	2006-05-10	2006-05-10	ENSG00000147118	ENSG00000147118		"""Zinc fingers, C2H2-type"", ""-"""	13001	protein-coding gene	gene with protein product		314993	"""zinc finger protein 182 (HHZ150)"", ""zinc finger protein 21 (KOX 14)"""	ZNF21		8088786, 2014798, 8914609	Standard	NM_001178099		Approved	KOX14, HHZ150, Zfp182	uc004dit.3	P17025	OTTHUMG00000021460	ENST00000396965.1:c.1331A>G	X.37:g.47836155T>C	ENSP00000380165:p.Asn444Ser		47721099	A2IDD7|Q3KP67|Q96QH7	Missense_Mutation	SNP	HMMPfam_zf-C2H2;superfamily_KRAB domain (Kruppel-associated box Pfam 01352);superfamily_C2H2 and C2HC zinc fingers;HMMPfam_KRAB	p.N444S	ENST00000396965.1	37	c.1331	CCDS35236.1	X	.	.	.	.	.	.	.	.	.	.	T	5.261	0.233592	0.09969	.	.	ENSG00000147118	ENST00000376943;ENST00000396965;ENST00000305127	T;T;T	0.03272	3.99;3.99;3.99	4.47	4.47	0.54385	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.02342	0.0072	N	0.25060	0.705	0.09310	N	1	B;B;P	0.39181	0.013;0.038;0.663	B;B;B	0.33339	0.011;0.011;0.162	T	0.20075	-1.0286	9	0.05351	T	0.99	.	10.8788	0.46927	0.0:0.0:0.0:1.0	.	424;425;444	B4DRM0;Q96QH7;P17025	.;.;ZN182_HUMAN	S	425;444;444	ENSP00000366142:N425S;ENSP00000380165:N444S;ENSP00000306351:N444S	ENSP00000306351:N444S	N	-	2	0	ZNF182	47721099	0.000000	0.05858	0.999000	0.59377	0.992000	0.81027	0.088000	0.14979	1.768000	0.52137	0.441000	0.28932	AAC	-	HMMPfam_zf-C2H2		0.418	ZNF182-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF182	protein_coding	OTTHUMT00000277055.1	T	NM_006962		47721099	-1	no_errors	NM_006962	genbank	human	validated	54_36p	missense	SNP	0.01	C
PAGE2	203569	genome.wustl.edu	37	X	55117043	55117043	+	Splice_Site	SNP	G	G	T			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chrX:55117043G>T	ENST00000374968.4	+	3	297	c.193G>T	c.(193-195)Ggg>Tgg	p.G65W	PAGE2_ENST00000374965.1_Intron	NM_207339.2	NP_997222.1	Q7Z2X7	PAGE2_HUMAN	P antigen family, member 2 (prostate associated)	65								p.G65W(1)		endometrium(1)|large_intestine(2)|lung(1)|ovary(2)	6						TGCTTTTCAAGGTGAAGGGAG	0.433																																																1	Substitution - Missense(1)	ovary(1)	X											69.0	58.0	62.0					X																	55117043		2169	4288	6457	55133768	SO:0001630	splice_region_variant	203569			BC054022	CCDS14367.1	Xp11.22	2009-06-17			ENSG00000234068	ENSG00000234068			31804	protein-coding gene	gene with protein product		300738	"""G antigen, family C, 2"""	GAGEC2		9724777	Standard	NM_207339		Approved	MGC62094, PAGE-2, CT16.4		Q7Z2X7	OTTHUMG00000021648	ENST00000374968.4:c.193+1G>T	X.37:g.55117043G>T			55133768	Q5JRK7|Q5JRK8	Missense_Mutation	SNP	-	p.G65W	ENST00000374968.4	37	c.193	CCDS14367.1	X	.	.	.	.	.	.	.	.	.	.	g	10.14	1.268260	0.23136	.	.	ENSG00000234068	ENST00000374968	T	0.13307	2.6	0.921	0.921	0.19403	.	.	.	.	.	T	0.32556	0.0833	M	0.81802	2.56	0.09310	N	1	D	0.76494	0.999	D	0.79784	0.993	T	0.06006	-1.0851	9	0.66056	D	0.02	.	4.885	0.13699	0.0:0.0:1.0:0.0	.	65	Q7Z2X7	GGEE2_HUMAN	W	65	ENSP00000364107:G65W	ENSP00000364107:G65W	G	+	1	0	PAGE2	55133768	0.277000	0.24220	0.006000	0.13384	0.017000	0.09413	1.469000	0.35343	0.736000	0.32559	0.181000	0.17075	GGG	-	NULL		0.433	PAGE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAGE2	protein_coding	OTTHUMT00000056857.1	G	NM_207339	Missense_Mutation	55133768	1	no_errors	NM_207339	genbank	human	provisional	54_36p	missense	SNP		T
HEPH	9843	genome.wustl.edu	37	X	65417598	65417598	+	Silent	SNP	C	C	T	rs374611265		TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chrX:65417598C>T	ENST00000343002.2	+	9	2239	c.1575C>T	c.(1573-1575)gcC>gcT	p.A525A	HEPH_ENST00000374727.3_Silent_p.A528A|HEPH_ENST00000336279.5_Silent_p.A258A|HEPH_ENST00000519389.1_Silent_p.A579A|HEPH_ENST00000441993.2_Silent_p.A528A|HEPH_ENST00000419594.1_Intron			Q9BQS7	HEPH_HUMAN	hephaestin	525	Plastocyanin-like 3.				cellular iron ion homeostasis (GO:0006879)|copper ion transport (GO:0006825)|iron ion transport (GO:0006826)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	copper ion binding (GO:0005507)|ferrous iron binding (GO:0008198)|ferroxidase activity (GO:0004322)	p.A525A(1)		endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(56)|ovary(5)|prostate(1)|skin(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	89						CCCCTCATGCCGGTCCCACTG	0.532																																																1	Substitution - coding silent(1)	ovary(1)	X						C	,,	0,3835		0,0,1632,571	75.0	62.0	67.0		1584,774,1737	-2.3	0.5	X		67	2,6726		0,2,2426,1872	no	coding-synonymous,coding-synonymous,coding-synonymous	HEPH	NM_001130860.2,NM_014799.2,NM_138737.3	,,	0,2,4058,2443	TT,TC,CC,C		0.0297,0.0,0.0189	,,	528/1161,258/892,579/1213	65417598	2,10561	2203	4300	6503	65334323	SO:0001819	synonymous_variant	9843			AB014598	CCDS14384.2, CCDS14385.1, CCDS48133.1, CCDS14384.3, CCDS65277.1	Xq11-q12	2008-02-05			ENSG00000089472	ENSG00000089472			4866	protein-coding gene	gene with protein product		300167				9988272, 9734811	Standard	NM_014799		Approved	KIAA0698, CPL	uc011moz.2	Q9BQS7	OTTHUMG00000021732	ENST00000343002.2:c.1575C>T	X.37:g.65417598C>T			65334323	B1AJX8|D3DVT7|E9PHN8|O75180|Q6UW45|Q9C058	Silent	SNP	-	p.A258	ENST00000343002.2	37	c.774		X																																																																																			-	NULL		0.532	HEPH-002	KNOWN	alternative_5_UTR|basic|appris_candidate	protein_coding	HEPH	protein_coding	OTTHUMT00000056995.1	C	NM_138737		65334323	1	no_errors	NM_014799	genbank	human	reviewed	54_36p	silent	SNP	0.9	T
DACH2	117154	genome.wustl.edu	37	X	86071103	86071103	+	Splice_Site	SNP	G	G	T			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chrX:86071103G>T	ENST00000373125.4	+	11	1750		c.e11+1		DACH2_ENST00000373131.1_Splice_Site|DACH2_ENST00000508860.1_Splice_Site|DACH2_ENST00000510272.1_Splice_Site	NM_053281.3	NP_444511.1	Q96NX9	DACH2_HUMAN	dachshund family transcription factor 2						development of primary female sexual characteristics (GO:0046545)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.?(2)		breast(2)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(14)|lung(28)|ovary(5)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)	71						GCTATGCAAGGTACAGTCAAC	0.398																																																2	Unknown(2)	ovary(2)	X											78.0	71.0	73.0					X																	86071103		2203	4300	6503	85957759	SO:0001630	splice_region_variant	117154			AF428101	CCDS14455.1, CCDS48140.1, CCDS55457.1	Xq21.3	2014-02-03	2014-02-03		ENSG00000126733	ENSG00000126733			16814	protein-coding gene	gene with protein product		300608	"""dachshund homolog 2 (Drosophila)"""				Standard	NM_053281		Approved		uc004eew.2	Q96NX9	OTTHUMG00000021944	ENST00000373125.4:c.1750+1G>T	X.37:g.86071103G>T			85957759	B1AJV3|B4DQG3|Q8NAY3|Q8ND17|Q96N55	Splice_Site	SNP	-	e11+1	ENST00000373125.4	37	c.1750+1	CCDS14455.1	X	.	.	.	.	.	.	.	.	.	.	G	13.08	2.129430	0.37630	.	.	ENSG00000126733	ENST00000344497;ENST00000373131;ENST00000373125;ENST00000508860;ENST00000510272;ENST00000400297;ENST00000484479	.	.	.	4.81	4.81	0.61882	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.1479	0.86771	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	DACH2	85957759	1.000000	0.71417	0.996000	0.52242	0.257000	0.26127	5.205000	0.65186	1.970000	0.57323	0.513000	0.50165	.	-	-		0.398	DACH2-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DACH2	protein_coding	OTTHUMT00000359266.1	G	NM_053281	Intron	85957759	1	no_errors	NM_053281	genbank	human	reviewed	54_36p	splice_site	SNP	1	T
F8	2157	genome.wustl.edu	37	X	154090037	154090037	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1497-01A-01W-0549-09	TCGA-13-1497-10A-01W-0549-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	04e814c6-ea28-4ade-bc8f-a618552943da	a85e2881-3685-486b-8c14-2b540dd5b1ee	g.chrX:154090037C>G	ENST00000360256.4	-	24	6879	c.6679G>C	c.(6679-6681)Gct>Cct	p.A2227P	F8_ENST00000330287.6_Missense_Mutation_p.A92P	NM_000132.3	NP_000123.1	P00451	FA8_HUMAN	coagulation factor VIII, procoagulant component	2227	F5/8 type C 2. {ECO:0000255|PROSITE- ProRule:PRU00081}.				acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	copper ion binding (GO:0005507)|oxidoreductase activity (GO:0016491)|serine-type endopeptidase activity (GO:0004252)	p.A2227P(2)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(27)|liver(1)|lung(47)|ovary(5)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(5)|urinary_tract(2)	120	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)	TGAAGTCGAGCTTTTGAAGGA	0.453																																																2	Substitution - Missense(2)	ovary(2)	X											222.0	204.0	210.0					X																	154090037		2203	4300	6503	153743231	SO:0001583	missense	2157			M90707	CCDS35457.1, CCDS44026.1	Xq28	2014-09-17	2008-07-29		ENSG00000185010	ENSG00000185010			3546	protein-coding gene	gene with protein product	"""Factor VIIIF8B"", ""hemophilia A"""	300841		F8C		6438528, 3935400	Standard	NM_000132		Approved	FVIII, DXS1253E, HEMA	uc004fmt.3	P00451	OTTHUMG00000022688	ENST00000360256.4:c.6679G>C	X.37:g.154090037C>G	ENSP00000353393:p.Ala2227Pro		153743231	Q14286|Q5HY69	Missense_Mutation	SNP	-	p.A2227P	ENST00000360256.4	37	c.6679	CCDS35457.1	X	.	.	.	.	.	.	.	.	.	.	c	23.1	4.372531	0.82573	.	.	ENSG00000185010	ENST00000330287;ENST00000360256	D;D	0.98585	-5.01;-5.01	5.6	5.6	0.85130	Coagulation factor 5/8 C-terminal type domain (3);Galactose-binding domain-like (1);	0.000000	0.85682	D	0.000000	D	0.99208	0.9725	M	0.93241	3.395	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99215	1.0877	10	0.87932	D	0	-15.2089	15.8026	0.78468	0.0:1.0:0.0:0.0	.	2227;92	P00451;Q14286	FA8_HUMAN;.	P	92;2227	ENSP00000327895:A92P;ENSP00000353393:A2227P	ENSP00000327895:A92P	A	-	1	0	F8	153743231	1.000000	0.71417	1.000000	0.80357	0.862000	0.49288	4.047000	0.57383	2.329000	0.79093	0.600000	0.82982	GCT	-	NULL		0.453	F8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	F8	protein_coding	OTTHUMT00000058869.4	C			153743231	-1	no_errors	NM_000132	genbank	human	reviewed	54_36p	missense	SNP	1	G
