#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
MIIP	60672	genome.wustl.edu	37	1	12089946	12089946	+	Silent	SNP	C	C	T	rs117146839	byFrequency	TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr1:12089946C>T	ENST00000235332.4	+	7	1009	c.840C>T	c.(838-840)caC>caT	p.H280H	MIIP_ENST00000436478.2_Silent_p.H280H|MIIP_ENST00000466860.1_3'UTR	NM_021933.3	NP_068752.2	Q5JXC2	MIIP_HUMAN	migration and invasion inhibitory protein	280	Interaction with IGFBP2.							p.H280H(1)		autonomic_ganglia(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)|skin(1)	15						AGCCAGCGCACGTCAGGTGAG	0.667																																																1	Substitution - coding silent(1)	ovary(1)	1											34.0	33.0	33.0					1																	12089946		2203	4299	6502	12012533	SO:0001819	synonymous_variant	60672			AK022500	CCDS143.1	1p36.22	2009-07-09			ENSG00000116691	ENSG00000116691			25715	protein-coding gene	gene with protein product	"""invasion inhibitory protein 45"""	608772				15867349, 14617774	Standard	NM_021933		Approved	FLJ12438, IIp45	uc001ato.2	Q5JXC2	OTTHUMG00000002439	ENST00000235332.4:c.840C>T	1.37:g.12089946C>T			12012533	C0KL22|Q96HU6|Q9H839|Q9HA00	Silent	SNP	-	p.H280	ENST00000235332.4	37	c.840	CCDS143.1	1																																																																																			-	NULL		0.667	MIIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IIP45	protein_coding	OTTHUMT00000006941.1	C	NM_021933		12012533	1	no_errors	NM_021933	genbank	human	validated	54_36p	silent	SNP	0.32	T
SV2A	9900	genome.wustl.edu	37	1	149881106	149881106	+	Silent	SNP	C	C	A	rs375397567		TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr1:149881106C>A	ENST00000369146.3	-	7	1687	c.1197G>T	c.(1195-1197)acG>acT	p.T399T	SV2A_ENST00000369145.1_Silent_p.T399T	NM_001278719.1|NM_014849.3	NP_001265648.1|NP_055664.3	Q7L0J3	SV2A_HUMAN	synaptic vesicle glycoprotein 2A	399					cellular calcium ion homeostasis (GO:0006874)|neurotransmitter transport (GO:0006836)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|presynaptic active zone (GO:0048786)|synaptic vesicle (GO:0008021)|synaptic vesicle membrane (GO:0030672)	protein kinase binding (GO:0019901)|receptor activity (GO:0004872)|transmembrane transporter activity (GO:0022857)	p.T399T(1)		breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(8)|lung(16)|ovary(6)|pancreas(1)|prostate(8)|skin(2)|urinary_tract(2)	55	Breast(34;0.00769)|all_hematologic(923;0.127)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)		Levetiracetam(DB01202)	CCTGATGAATCGTCTTAATGT	0.577																																																1	Substitution - coding silent(1)	ovary(1)	1						C		0,4406		0,0,2203	67.0	66.0	66.0		1197	-6.0	0.9	1		66	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	SV2A	NM_014849.3		0,1,6502	AA,AC,CC		0.0116,0.0,0.0077		399/743	149881106	1,13005	2203	4300	6503	148147730	SO:0001819	synonymous_variant	9900			AB018279	CCDS940.1	1q21.2	2008-02-05			ENSG00000159164	ENSG00000159164			20566	protein-coding gene	gene with protein product		185860				7681585, 10611374	Standard	NM_014849		Approved	SV2, KIAA0736	uc001etg.3	Q7L0J3	OTTHUMG00000012209	ENST00000369146.3:c.1197G>T	1.37:g.149881106C>A			148147730	D3DUZ7|O94841|Q5QNX8|Q7Z3L6|Q8NBJ6|Q9BVZ9	Silent	SNP	-	p.T399	ENST00000369146.3	37	c.1197	CCDS940.1	1																																																																																			-	NULL		0.577	SV2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SV2A	protein_coding	OTTHUMT00000033754.1	C			148147730	-1	no_errors	NM_014849	genbank	human	validated	54_36p	silent	SNP	0.01	A
SETDB1	9869	genome.wustl.edu	37	1	150921932	150921932	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr1:150921932C>G	ENST00000271640.5	+	12	1701	c.1511C>G	c.(1510-1512)tCc>tGc	p.S504C	SETDB1_ENST00000459773.1_Intron|SETDB1_ENST00000368969.4_Missense_Mutation_p.S504C	NM_001145415.1|NM_012432.3	NP_001138887.1|NP_036564.3	Q15047	SETB1_HUMAN	SET domain, bifurcated 1	504					bone development (GO:0060348)|histone H3-K9 trimethylation (GO:0036124)|inner cell mass cell proliferation (GO:0001833)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)	p.S504C(1)		NS(1)|large_intestine(5)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	12	all_lung(15;9e-35)|Lung NSC(24;3.45e-31)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.108)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|BRCA - Breast invasive adenocarcinoma(12;0.0152)|LUSC - Lung squamous cell carcinoma(543;0.211)			TCTGGTCATTCCTCCCCTACA	0.512																																																1	Substitution - Missense(1)	ovary(1)	1											143.0	141.0	142.0					1																	150921932		2203	4300	6503	149188556	SO:0001583	missense	9869			D31891	CCDS972.1, CCDS44217.1, CCDS58026.1	1q21	2013-01-23			ENSG00000143379	ENSG00000143379		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Tudor domain containing"""	10761	protein-coding gene	gene with protein product	"""tudor domain containing 21"""	604396				10343109	Standard	NM_001145415		Approved	KG1T, KIAA0067, ESET, KMT1E, TDRD21	uc001evu.2	Q15047	OTTHUMG00000035003	ENST00000271640.5:c.1511C>G	1.37:g.150921932C>G	ENSP00000271640:p.Ser504Cys		149188556	A6NEW2|Q5SZD8|Q5SZD9|Q5SZE0|Q5SZE7|Q96GM9	Missense_Mutation	SNP	HMMPfam_SET;HMMPfam_MBD;HMMPfam_Pre-SET;superfamily_DNA-binding domain;superfamily_Tudor/PWWP/MBT;superfamily_SET domain	p.S504C	ENST00000271640.5	37	c.1511	CCDS44217.1	1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.176802	0.78564	.	.	ENSG00000143379	ENST00000271640;ENST00000534805;ENST00000368969;ENST00000498193	D;T;D;T	0.90004	-2.6;1.2;-2.6;0.87	4.86	4.86	0.63082	.	0.102130	0.64402	D	0.000003	D	0.88492	0.6451	N	0.24115	0.695	0.80722	D	1	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.79784	0.97;0.993;0.993;0.984	D	0.88327	0.2966	10	0.38643	T	0.18	.	18.1851	0.89790	0.0:1.0:0.0:0.0	.	504;505;504;504	E9PRF4;E9PQM8;Q15047-3;Q15047	.;.;.;SETB1_HUMAN	C	504;505;504;504	ENSP00000271640:S504C;ENSP00000436148:S505C;ENSP00000357965:S504C;ENSP00000432348:S504C	ENSP00000271640:S504C	S	+	2	0	SETDB1	149188556	0.999000	0.42202	1.000000	0.80357	0.989000	0.77384	5.122000	0.64697	2.528000	0.85240	0.561000	0.74099	TCC	-	NULL		0.512	SETDB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SETDB1	protein_coding	OTTHUMT00000084717.2	C			149188556	1	no_errors	NM_012432	genbank	human	reviewed	54_36p	missense	SNP	1	G
SCNM1	79005	genome.wustl.edu	37	1	151140771	151140771	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr1:151140771C>A	ENST00000368905.4	+	6	661	c.550C>A	c.(550-552)Ccc>Acc	p.P184T	LYSMD1_ENST00000368908.5_5'Flank|LYSMD1_ENST00000440902.2_5'Flank	NM_001204856.1|NM_024041.3	NP_001191785.1|NP_076946.1	Q9BWG6	SCNM1_HUMAN	sodium channel modifier 1	184					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	enzyme binding (GO:0019899)|metal ion binding (GO:0046872)	p.P184T(1)		breast(1)|endometrium(2)|large_intestine(2)|lung(4)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	17	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			ACCCATGAGCCCCACAAGAAG	0.532																																																1	Substitution - Missense(1)	ovary(1)	1											125.0	126.0	126.0					1																	151140771		2203	4300	6503	149407395	SO:0001583	missense	79005			BC000264	CCDS987.1, CCDS55636.1	1q21.3	2012-03-13			ENSG00000163156	ENSG00000163156			23136	protein-coding gene	gene with protein product		608095				12920299	Standard	NM_024041		Approved	MGC3180	uc001ewz.3	Q9BWG6	OTTHUMG00000012258	ENST00000368905.4:c.550C>A	1.37:g.151140771C>A	ENSP00000357901:p.Pro184Thr		149407395	B4DWR1|Q5JR74	Missense_Mutation	SNP	-	p.P184T	ENST00000368905.4	37	c.550	CCDS987.1	1	.	.	.	.	.	.	.	.	.	.	C	17.64	3.439247	0.63067	.	.	ENSG00000163156	ENST00000368905;ENST00000368902	.	.	.	5.5	4.59	0.56863	.	0.250357	0.39475	N	0.001350	T	0.26484	0.0647	L	0.34521	1.04	0.34382	D	0.693227	P	0.36144	0.539	B	0.35353	0.201	T	0.28138	-1.0053	9	0.62326	D	0.03	0.0173	11.5142	0.50511	0.1788:0.8212:0.0:0.0	.	184	Q9BWG6	SCNM1_HUMAN	T	184;149	.	ENSP00000357898:P149T	P	+	1	0	SCNM1	149407395	1.000000	0.71417	1.000000	0.80357	0.743000	0.42351	2.609000	0.46317	1.521000	0.48983	0.655000	0.94253	CCC	-	NULL		0.532	SCNM1-001	KNOWN	mRNA_start_NF|basic|appris_principal|CCDS	protein_coding	SCNM1	protein_coding	OTTHUMT00000034064.2	C	NM_024041		149407395	1	no_errors	NM_024041	genbank	human	validated	54_36p	missense	SNP	0.97	A
FLG2	388698	genome.wustl.edu	37	1	152324686	152324686	+	Missense_Mutation	SNP	T	T	G			TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	T	T	T	G	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr1:152324686T>G	ENST00000388718.5	-	3	5648	c.5576A>C	c.(5575-5577)cAa>cCa	p.Q1859P	FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000445097.1_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	1859					establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.Q1859P(1)		NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			ATGACCAGATTGAGAATGTCC	0.517																																																1	Substitution - Missense(1)	ovary(1)	1											332.0	289.0	304.0					1																	152324686		2203	4300	6503	150591310	SO:0001583	missense	388698			AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.5576A>C	1.37:g.152324686T>G	ENSP00000373370:p.Gln1859Pro		150591310	Q9H4U1	Missense_Mutation	SNP	-	p.Q1859P	ENST00000388718.5	37	c.5576	CCDS30861.1	1	.	.	.	.	.	.	.	.	.	.	T	11.46	1.646474	0.29246	.	.	ENSG00000143520	ENST00000388718	T	0.03801	3.8	3.88	0.21	0.15231	.	.	.	.	.	T	0.02047	0.0064	L	0.39898	1.24	0.09310	N	1	P	0.49185	0.92	P	0.52309	0.695	T	0.41016	-0.9532	9	0.20519	T	0.43	7.1489	3.3985	0.07315	0.0:0.2342:0.2317:0.5341	.	1859	Q5D862	FILA2_HUMAN	P	1859	ENSP00000373370:Q1859P	ENSP00000373370:Q1859P	Q	-	2	0	FLG2	150591310	0.001000	0.12720	0.000000	0.03702	0.005000	0.04900	0.465000	0.22004	0.191000	0.20236	0.449000	0.29647	CAA	-	NULL		0.517	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG2	protein_coding	OTTHUMT00000034018.5	T	NM_001014342		150591310	-1	no_errors	NM_001014342	genbank	human	provisional	54_36p	missense	SNP	0	G
DENND4B	9909	genome.wustl.edu	37	1	153903207	153903207	+	Missense_Mutation	SNP	T	T	A			TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr1:153903207T>A	ENST00000361217.4	-	26	4659	c.4241A>T	c.(4240-4242)gAa>gTa	p.E1414V	DENND4B_ENST00000474386.1_5'Flank	NM_014856.2	NP_055671.2	O75064	DEN4B_HUMAN	DENN/MADD domain containing 4B	1414					positive regulation of Rab GTPase activity (GO:0032851)|regulation of Rab protein signal transduction (GO:0032483)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.E1302V(1)		NS(1)|breast(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	36	all_lung(78;2.89e-32)|Lung NSC(65;2.27e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			CCCTAGAGTTTCCAGCAGGAG	0.597																																																1	Substitution - Missense(1)	ovary(1)	1											24.0	27.0	26.0					1																	153903207		1984	4157	6141	152169831	SO:0001583	missense	9909			AB007945	CCDS44228.1	1q21.3	2012-10-03	2006-01-27	2006-01-27	ENSG00000198837	ENSG00000198837		"""DENN/MADD domain containing"""	29044	protein-coding gene	gene with protein product			"""KIAA0476"""	KIAA0476		9455484, 12906859	Standard	NM_014856		Approved		uc001fdd.1	O75064	OTTHUMG00000037157	ENST00000361217.4:c.4241A>T	1.37:g.153903207T>A	ENSP00000354597:p.Glu1414Val		152169831	Q5T4K0	Missense_Mutation	SNP	-	p.E1414V	ENST00000361217.4	37	c.4241	CCDS44228.1	1	.	.	.	.	.	.	.	.	.	.	T	14.60	2.582652	0.46006	.	.	ENSG00000198837	ENST00000361217	T	0.08546	3.08	5.14	5.14	0.70334	.	0.389449	0.27730	N	0.018085	T	0.02929	0.0087	L	0.27053	0.805	0.51482	D	0.999923	P	0.37864	0.61	B	0.37422	0.249	T	0.39840	-0.9594	10	0.59425	D	0.04	-3.6469	8.6893	0.34256	0.0:0.0855:0.0:0.9145	.	1414	O75064	DEN4B_HUMAN	V	1414	ENSP00000354597:E1414V	ENSP00000354597:E1414V	E	-	2	0	DENND4B	152169831	1.000000	0.71417	0.958000	0.39756	0.966000	0.64601	4.804000	0.62554	2.155000	0.67459	0.460000	0.39030	GAA	-	NULL		0.597	DENND4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DENND4B	protein_coding	OTTHUMT00000090278.2	T	XM_375806		152169831	-1	no_errors	NM_014856	genbank	human	validated	54_36p	missense	SNP	0.998	A
HHAT	55733	genome.wustl.edu	37	1	210686532	210686532	+	Splice_Site	SNP	G	G	A			TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr1:210686532G>A	ENST00000367010.1	+	9	1270	c.1043G>A	c.(1042-1044)aGg>aAg	p.R348K	HHAT_ENST00000391905.3_Splice_Site_p.R348K|HHAT_ENST00000545781.1_Splice_Site_p.R285K|HHAT_ENST00000261458.3_Splice_Site_p.R348K|HHAT_ENST00000413764.2_Splice_Site_p.R348K|HHAT_ENST00000537898.1_Splice_Site_p.R283K|HHAT_ENST00000367009.1_Splice_Site_p.R38K|HHAT_ENST00000545154.1_Splice_Site_p.R349K|HHAT_ENST00000308852.6_Splice_Site_p.R303K|HHAT_ENST00000541565.1_Splice_Site_p.R211K	NM_001170580.1	NP_001164051.1	Q5VTY9	HHAT_HUMAN	hedgehog acyltransferase	348					multicellular organismal development (GO:0007275)|protein palmitoylation (GO:0018345)|smoothened signaling pathway (GO:0007224)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	GTP binding (GO:0005525)|palmitoyltransferase activity (GO:0016409)	p.R348K(1)		breast(3)|central_nervous_system(1)|kidney(1)|large_intestine(6)|lung(8)|ovary(2)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)	27				OV - Ovarian serous cystadenocarcinoma(81;0.0136)|all cancers(67;0.161)|KIRC - Kidney renal clear cell carcinoma(1967;0.215)		TTCTTAATCAGGTAAGCCAAT	0.264																																																1	Substitution - Missense(1)	ovary(1)	1											78.0	81.0	80.0					1																	210686532		2199	4298	6497	208753155	SO:0001630	splice_region_variant	55733			AK001586	CCDS1495.1, CCDS53471.1, CCDS53472.1, CCDS53473.1	1q32	2008-02-05			ENSG00000054392	ENSG00000054392			18270	protein-coding gene	gene with protein product		605743				11160356	Standard	NM_001170587		Approved	FLJ10724, MART-2, MART2, Skn, ski, rasp, sit, GUP2	uc009xcx.3	Q5VTY9	OTTHUMG00000036447	ENST00000367010.1:c.1043+1G>A	1.37:g.210686532G>A			208753155	B7Z4D5|B7Z5I1|B7Z868|B7ZA75|D3DT91|F5H444|Q17RZ7|Q4G0K3|Q5CZ95|Q5TGI2|Q9NVH9|Q9Y3N8	Missense_Mutation	SNP	-	p.R348K	ENST00000367010.1	37	c.1043	CCDS1495.1	1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.389764	0.82902	.	.	ENSG00000054392	ENST00000413764;ENST00000541565;ENST00000545154;ENST00000537898;ENST00000391905;ENST00000545781;ENST00000261458;ENST00000308852;ENST00000367010;ENST00000367009	T;T;T;T;T;T;T;T;T;T	0.76448	-1.02;-1.02;-1.02;-1.02;-1.02;-1.02;-1.02;-1.02;-1.02;-1.02	4.65	4.65	0.58169	.	0.000000	0.85682	D	0.000000	D	0.83110	0.5183	L	0.50919	1.6	0.41956	D	0.990685	D;D;D;D;D	0.76494	0.997;0.996;0.998;0.999;0.999	D;D;D;D;D	0.75020	0.957;0.928;0.968;0.985;0.957	T	0.81357	-0.0969	10	0.34782	T	0.22	-25.1946	13.2422	0.60004	0.0:0.0:1.0:0.0	.	303;349;211;283;348	B7Z2U8;F5H444;B7Z4D5;B7Z5I1;Q5VTY9	.;.;.;.;HHAT_HUMAN	K	348;211;349;283;348;285;348;303;348;38	ENSP00000416845:R348K;ENSP00000444995:R211K;ENSP00000438468:R349K;ENSP00000442625:R283K;ENSP00000375773:R348K;ENSP00000439229:R285K;ENSP00000261458:R348K;ENSP00000308628:R303K;ENSP00000355977:R348K;ENSP00000355976:R38K	ENSP00000261458:R348K	R	+	2	0	HHAT	208753155	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	4.174000	0.58256	2.576000	0.86940	0.655000	0.94253	AGG	-	NULL		0.264	HHAT-004	KNOWN	basic|appris_principal|CCDS	protein_coding	HHAT	protein_coding	OTTHUMT00000088662.1	G	NM_018194	Missense_Mutation	208753155	1	no_errors	NM_018194	genbank	human	validated	54_36p	missense	SNP	1	A
WNT4	54361	genome.wustl.edu	37	1	22448064	22448064	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr1:22448064G>A	ENST00000290167.6	-	3	362	c.319C>T	c.(319-321)Cgg>Tgg	p.R107W	WNT4_ENST00000542383.1_Missense_Mutation_p.R52W	NM_030761.4	NP_110388.2	P56705	WNT4_HUMAN	wingless-type MMTV integration site family, member 4	107					adrenal gland development (GO:0030325)|androgen biosynthetic process (GO:0006702)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|cell fate commitment (GO:0045165)|cellular response to starvation (GO:0009267)|cellular response to transforming growth factor beta stimulus (GO:0071560)|embryonic epithelial tube formation (GO:0001838)|epithelial to mesenchymal transition (GO:0001837)|establishment of protein localization to plasma membrane (GO:0090002)|female gonad development (GO:0008585)|female sex determination (GO:0030237)|immature T cell proliferation in thymus (GO:0033080)|kidney development (GO:0001822)|liver development (GO:0001889)|male gonad development (GO:0008584)|mammary gland epithelium development (GO:0061180)|mesenchymal to epithelial transition (GO:0060231)|metanephric mesenchymal cell differentiation (GO:0072162)|metanephric nephron morphogenesis (GO:0072273)|metanephric tubule formation (GO:0072174)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell differentiation (GO:0045596)|negative regulation of cell migration (GO:0030336)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of gene expression (GO:0010629)|negative regulation of male gonad development (GO:2000019)|negative regulation of steroid biosynthetic process (GO:0010894)|negative regulation of testicular blood vessel morphogenesis (GO:0061369)|negative regulation of testosterone biosynthetic process (GO:2000225)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of wound healing (GO:0061045)|neuron differentiation (GO:0030182)|non-canonical Wnt signaling pathway via MAPK cascade (GO:0038030)|oocyte development (GO:0048599)|paramesonephric duct development (GO:0061205)|positive regulation of aldosterone biosynthetic process (GO:0032349)|positive regulation of bone mineralization (GO:0030501)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of cortisol biosynthetic process (GO:2000066)|positive regulation of dermatome development (GO:0061184)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of meiosis (GO:0045836)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription, DNA-templated (GO:0045893)|protein palmitoylation (GO:0018345)|regulation of cell-cell adhesion (GO:0022407)|renal vesicle formation (GO:0072033)|renal vesicle induction (GO:0072034)|smooth muscle cell differentiation (GO:0051145)|somatotropin secreting cell differentiation (GO:0060126)|tertiary branching involved in mammary gland duct morphogenesis (GO:0060748)|thyroid-stimulating hormone-secreting cell differentiation (GO:0060129)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)|transcription corepressor activity (GO:0003714)	p.R107W(1)		breast(1)|endometrium(1)|large_intestine(2)|lung(1)|ovary(1)|prostate(2)	8		Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;6.55e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;9.02e-26)|Colorectal(126;1.71e-07)|COAD - Colon adenocarcinoma(152;1.17e-05)|GBM - Glioblastoma multiforme(114;2.01e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000568)|KIRC - Kidney renal clear cell carcinoma(1967;0.00277)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.138)		GCCGCCTCCCGAGTCCCTGTG	0.662																																																1	Substitution - Missense(1)	ovary(1)	1											33.0	34.0	34.0					1																	22448064		2203	4300	6503	22320651	SO:0001583	missense	54361			AL031281	CCDS223.1	1p36.23-p35.1	2013-02-28			ENSG00000162552	ENSG00000162552		"""Wingless-type MMTV integration sites"", ""Endogenous ligands"""	12783	protein-coding gene	gene with protein product		603490				8168088	Standard	NM_030761		Approved	WNT-4	uc001bfs.4	P56705	OTTHUMG00000002894	ENST00000290167.6:c.319C>T	1.37:g.22448064G>A	ENSP00000290167:p.Arg107Trp		22320651	B4DJF9|Q5TZQ0|Q96T81|Q9BXF5|Q9H1J8|Q9UJM2	Missense_Mutation	SNP	HMMPfam_wnt	p.R107W	ENST00000290167.6	37	c.319	CCDS223.1	1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.197078	0.79015	.	.	ENSG00000162552	ENST00000290167;ENST00000542383	D;D	0.81739	-1.53;-1.53	4.48	3.49	0.39957	.	0.000000	0.85682	D	0.000000	D	0.92024	0.7473	H	0.96777	3.88	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.93164	0.6560	10	0.87932	D	0	.	10.5852	0.45278	0.0:0.0:0.6755:0.3245	.	107	P56705	WNT4_HUMAN	W	107;52	ENSP00000290167:R107W;ENSP00000441033:R52W	ENSP00000290167:R107W	R	-	1	2	WNT4	22320651	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.305000	0.59110	2.219000	0.72066	0.555000	0.69702	CGG	-	HMMPfam_wnt		0.662	WNT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WNT4	protein_coding	OTTHUMT00000008088.2	G			22320651	-1	no_errors	NM_030761	genbank	human	reviewed	54_36p	missense	SNP	1	A
USH2A	7399	genome.wustl.edu	37	1	215972433	215972433	+	Silent	SNP	C	C	A			TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr1:215972433C>A	ENST00000307340.3	-	50	10160	c.9774G>T	c.(9772-9774)cgG>cgT	p.R3258R	USH2A_ENST00000366943.2_Silent_p.R3258R	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	3258					hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)	p.R3258R(1)		NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		CAACAGAAACCCGATTGTGCT	0.433										HNSCC(13;0.011)																																						1	Substitution - coding silent(1)	ovary(1)	1											75.0	66.0	69.0					1																	215972433		2203	4300	6503	214039056	SO:0001819	synonymous_variant	7399			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.9774G>T	1.37:g.215972433C>A			214039056	Q5VVM9|Q6S362|Q9NS27	Silent	SNP	-	p.R3258	ENST00000307340.3	37	c.9774	CCDS31025.1	1																																																																																			-	NULL		0.433	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USH2A	protein_coding	OTTHUMT00000128138.1	C	NM_007123		214039056	-1	no_errors	NM_206933	genbank	human	reviewed	54_36p	silent	SNP	0.98	A
OBSCN	84033	genome.wustl.edu	37	1	228444596	228444596	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr1:228444596C>G	ENST00000422127.1	+	15	4598	c.4554C>G	c.(4552-4554)agC>agG	p.S1518R	OBSCN_ENST00000284548.11_Missense_Mutation_p.S1518R|OBSCN_ENST00000359599.6_Missense_Mutation_p.S82R|OBSCN_ENST00000366707.4_5'UTR|OBSCN_ENST00000570156.2_Missense_Mutation_p.S1610R|OBSCN_ENST00000366709.4_5'UTR	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	1518	Ig-like 15.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)	p.S1518R(2)		NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				AGGCGGGGAGCCAGCGGCTCT	0.652																																																2	Substitution - Missense(2)	ovary(2)	1											40.0	48.0	45.0					1																	228444596		2060	4191	6251	226511219	SO:0001583	missense	84033			AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.4554C>G	1.37:g.228444596C>G	ENSP00000409493:p.Ser1518Arg		226511219	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	-	p.S1518R	ENST00000422127.1	37	c.4554	CCDS58065.1	1	.	.	.	.	.	.	.	.	.	.	.	7.710	0.694865	0.15039	.	.	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000359599	T;T;T	0.05025	3.51;3.51;3.55	4.6	0.0116	0.14088	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.448691	0.22287	N	0.062054	T	0.03178	0.0093	N	0.25825	0.765	0.80722	D	1	P;P	0.43633	0.784;0.813	B;B	0.37480	0.233;0.251	T	0.56836	-0.7913	10	0.18276	T	0.48	.	4.1996	0.10460	0.2391:0.3355:0.3489:0.0765	.	1518;1518	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	R	1518;1518;82	ENSP00000284548:S1518R;ENSP00000409493:S1518R;ENSP00000352613:S82R	ENSP00000284548:S1518R	S	+	3	2	OBSCN	226511219	0.621000	0.27077	1.000000	0.80357	0.066000	0.16364	-0.263000	0.08670	0.350000	0.24002	0.491000	0.48974	AGC	-	NULL		0.652	OBSCN-204	KNOWN	basic|CCDS	protein_coding	OBSCN	protein_coding		C	NM_052843		226511219	1	no_errors	NM_001098623	genbank	human	reviewed	54_36p	missense	SNP	0.921	G
RYR2	6262	genome.wustl.edu	37	1	237777662	237777662	+	Missense_Mutation	SNP	A	A	C			TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	A	A	A	C	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr1:237777662A>C	ENST00000366574.2	+	37	5551	c.5234A>C	c.(5233-5235)aAa>aCa	p.K1745T	RYR2_ENST00000360064.6_Missense_Mutation_p.K1743T|RYR2_ENST00000542537.1_Missense_Mutation_p.K1729T	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	1745	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)	p.K1743T(1)		NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GAGAACAAAAAACACGGCCTT	0.517																																																1	Substitution - Missense(1)	ovary(1)	1											65.0	65.0	65.0					1																	237777662		2047	4199	6246	235844285	SO:0001583	missense	6262			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.5234A>C	1.37:g.237777662A>C	ENSP00000355533:p.Lys1745Thr		235844285	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	HMMPfam_RYDR_ITPR;HMMPfam_efhand;HMMPfam_RyR;HMMPfam_MIR;HMMPfam_SPRY;HMMPfam_Ion_trans;HMMPfam_RR_TM4-6;HMMPfam_RIH_assoc;HMMPfam_Ins145_P3_rec;superfamily_EF-hand;superfamily_MIR domain (Pfam 02815)	p.K1745T	ENST00000366574.2	37	c.5234	CCDS55691.1	1	.	.	.	.	.	.	.	.	.	.	A	12.15	1.852243	0.32699	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	T;T;T	0.73897	-0.79;-0.79;-0.79	5.43	5.43	0.79202	.	0.000000	0.64402	D	0.000006	T	0.66809	0.2827	L	0.40543	1.245	0.80722	D	1	B	0.27498	0.18	B	0.27796	0.083	T	0.63010	-0.6732	10	0.25751	T	0.34	.	15.4979	0.75669	1.0:0.0:0.0:0.0	.	1745	Q92736	RYR2_HUMAN	T	1745;1743;1729	ENSP00000355533:K1745T;ENSP00000353174:K1743T;ENSP00000443798:K1729T	ENSP00000353174:K1743T	K	+	2	0	RYR2	235844285	1.000000	0.71417	0.967000	0.41034	0.838000	0.47535	4.533000	0.60615	2.073000	0.62155	0.528000	0.53228	AAA	-	NULL		0.517	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	protein_coding	OTTHUMT00000095402.2	A	NM_001035		235844285	1	no_errors	NM_001035	genbank	human	reviewed	54_36p	missense	SNP	1	C
ZMYM6	9204	genome.wustl.edu	37	1	35474438	35474438	+	Missense_Mutation	SNP	T	T	C			TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr1:35474438T>C	ENST00000357182.4	-	11	1807	c.1580A>G	c.(1579-1581)aAt>aGt	p.N527S	ZMYM6_ENST00000487874.1_Missense_Mutation_p.N527S|ZMYM6_ENST00000493328.1_5'UTR|ZMYM6_ENST00000373340.2_Missense_Mutation_p.N527S	NM_007167.3	NP_009098.3	O95789	ZMYM6_HUMAN	zinc finger, MYM-type 6	527					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.N527S(1)		breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(10)|ovary(4)|pancreas(1)|prostate(1)|skin(1)	44		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.13)				TTCTACCAAATTTGGGGATGT	0.398																																																1	Substitution - Missense(1)	ovary(1)	1											110.0	110.0	110.0					1																	35474438		2203	4300	6503	35247025	SO:0001583	missense	9204			AF055470	CCDS387.2	1p34.2	2014-05-12	2005-09-12	2005-09-12	ENSG00000163867	ENSG00000163867		"""Zinc fingers, MYM type"", ""Zinc fingers, BED-type"""	13050	protein-coding gene	gene with protein product	"""zinc finger, BED-type containing 7"""	613567	"""zinc finger protein 258"", ""zinc finger, MYM-type containing 6"""	ZNF258		10486218, 23533661	Standard	NM_007167		Approved	ZNF198L4, MYM, Buster2, ZBED7	uc001byh.3	O95789	OTTHUMG00000004163	ENST00000357182.4:c.1580A>G	1.37:g.35474438T>C	ENSP00000349708:p.Asn527Ser		35247025	B4DRJ6|Q32Q23|Q4G108|Q5SVZ9|Q5SW00|Q69YL4|Q96IY0|Q9NWF1|Q9P2J4	Missense_Mutation	SNP	-	p.N527S	ENST00000357182.4	37	c.1580	CCDS387.2	1	.	.	.	.	.	.	.	.	.	.	T	19.86	3.906430	0.72868	.	.	ENSG00000163867	ENST00000373340;ENST00000357182	T;T	0.21932	1.98;3.16	4.94	4.94	0.65067	TRASH (1);	0.229151	0.43416	D	0.000569	T	0.27169	0.0666	L	0.51422	1.61	0.28471	N	0.915422	B;P;P	0.45715	0.435;0.865;0.532	B;P;B	0.45913	0.078;0.497;0.356	T	0.08973	-1.0696	10	0.48119	T	0.1	-14.8986	15.0721	0.72046	0.0:0.0:0.0:1.0	.	430;527;527	B4DWC0;O95789;O95789-1	.;ZMYM6_HUMAN;.	S	527	ENSP00000362437:N527S;ENSP00000349708:N527S	ENSP00000349708:N527S	N	-	2	0	ZMYM6	35247025	1.000000	0.71417	0.977000	0.42913	0.945000	0.59286	3.075000	0.50073	2.201000	0.70794	0.528000	0.53228	AAT	-	NULL		0.398	ZMYM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZMYM6	protein_coding	OTTHUMT00000011999.1	T	NM_007167		35247025	-1	no_errors	NM_007167	genbank	human	validated	54_36p	missense	SNP	0.99	C
MACF1	23499	genome.wustl.edu	37	1	39905072	39905072	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr1:39905072C>G	ENST00000372915.3	+	71	18131	c.18044C>G	c.(18043-18045)gCt>gGt	p.A6015G	MACF1_ENST00000289893.4_Missense_Mutation_p.A4559G|MACF1_ENST00000361689.2_Missense_Mutation_p.A4057G|MACF1_ENST00000567887.1_Missense_Mutation_p.A6153G|MACF1_ENST00000564288.1_Missense_Mutation_p.A6116G|MACF1_ENST00000539005.1_Missense_Mutation_p.A3927G|MACF1_ENST00000317713.7_Missense_Mutation_p.A4057G|MACF1_ENST00000545844.1_Missense_Mutation_p.A4057G			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	6015					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)	p.A4057G(1)|p.A4559G(1)		breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			GACATGGCAGCTCTCCTGACC	0.458																																																2	Substitution - Missense(2)	ovary(2)	1											86.0	81.0	83.0					1																	39905072		2203	4300	6503	39677659	SO:0001583	missense	23499			AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.18044C>G	1.37:g.39905072C>G	ENSP00000362006:p.Ala6015Gly		39677659	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Missense_Mutation	SNP	-	p.A4559G	ENST00000372915.3	37	c.13676		1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	33|33	5.198371|5.198371	0.94997|0.94997	.|.	.|.	ENSG00000127603|ENSG00000127603	ENST00000545844;ENST00000372915;ENST00000361689;ENST00000317713;ENST00000539005;ENST00000289893|ENST00000372925	T;T;T;T;T;T|.	0.52754|.	0.65;0.65;0.65;0.65;0.65;0.65|.	5.77|5.77	5.77|5.77	0.91146|0.91146	.|.	0.000000|.	0.64402|.	D|.	0.000007|.	T|T	0.71434|0.71434	0.3339|0.3339	L|L	0.52364|0.52364	1.645|1.645	0.80722|0.80722	D|D	1|1	D;B|.	0.76494|.	0.999;0.446|.	D;B|.	0.68039|.	0.955;0.363|.	T|T	0.66555|0.66555	-0.5894|-0.5894	10|5	0.51188|.	T|.	0.08|.	.|.	19.9826|19.9826	0.97334|0.97334	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	6015;4057|.	Q9UPN3;F8W8Q1|.	MACF1_HUMAN;.|.	G|R	4057;6015;4057;4057;3927;4559|3060	ENSP00000439537:A4057G;ENSP00000362006:A6015G;ENSP00000354573:A4057G;ENSP00000313438:A4057G;ENSP00000444364:A3927G;ENSP00000289893:A4559G|.	ENSP00000289893:A4559G|.	A|S	+|+	2|3	0|2	MACF1|MACF1	39677659|39677659	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	7.814000|7.814000	0.86154|0.86154	2.734000|2.734000	0.93682|0.93682	0.650000|0.650000	0.86243|0.86243	GCT|AGC	-	NULL		0.458	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	MACF1	protein_coding	OTTHUMT00000392096.1	C	NM_033044		39677659	1	no_errors	NM_033044	genbank	human	reviewed	54_36p	missense	SNP	1	G
YBX1	4904	genome.wustl.edu	37	1	43162404	43162404	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr1:43162404C>G	ENST00000321358.7	+	5	585	c.446C>G	c.(445-447)cCa>cGa	p.P149R	YBX1_ENST00000467957.1_3'UTR	NM_004559.3	NP_004550.2	P67809	YBOX1_HUMAN	Y box binding protein 1	149					CRD-mediated mRNA stabilization (GO:0070934)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of striated muscle cell differentiation (GO:0051154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell division (GO:0051781)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription from RNA polymerase II promoter (GO:0006366)	CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|extracellular vesicular exosome (GO:0070062)|histone pre-mRNA 3'end processing complex (GO:0071204)|intracellular membrane-bounded organelle (GO:0043231)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|U12-type spliceosomal complex (GO:0005689)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)	p.P149R(1)		large_intestine(2)|lung(4)|ovary(4)|prostate(4)|upper_aerodigestive_tract(2)	16	Ovarian(52;0.00744)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				AGACGCTATCCACGTCGTAGG	0.517																																																1	Substitution - Missense(1)	ovary(1)	1											76.0	78.0	77.0					1																	43162404		2203	4300	6503	42934991	SO:0001583	missense	4904			BC013838	CCDS470.1	1p34	2008-02-05	2005-08-11	2005-08-11	ENSG00000065978	ENSG00000065978			8014	protein-coding gene	gene with protein product		154030	"""nuclease sensitive element binding protein 1"""	NSEP1		1891370, 3174636	Standard	NM_004559		Approved	YB-1, YB1, DBPB, NSEP-1, MDR-NF1, BP-8, CSDB, CSDA2	uc001chs.3	P67809	OTTHUMG00000007523	ENST00000321358.7:c.446C>G	1.37:g.43162404C>G	ENSP00000361626:p.Pro149Arg		42934991	P16990|P16991|Q14972|Q15325|Q5FVF0	Missense_Mutation	SNP	HMMPfam_CSD;superfamily_Nucleic acid-binding proteins	p.P149R	ENST00000321358.7	37	c.446	CCDS470.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.35|18.35	3.605110|3.605110	0.66445|0.66445	.|.	.|.	ENSG00000065978|ENSG00000065978	ENST00000436427|ENST00000321358;ENST00000332220;ENST00000318612	.|T;T	.|0.34472	.|1.36;1.36	5.24|5.24	5.24|5.24	0.73138|0.73138	.|.	.|0.094233	.|0.85682	.|D	.|0.000000	T|T	0.39226|0.39226	0.1070|0.1070	M|M	0.85945|0.85945	2.785|2.785	0.58432|0.58432	D|D	0.999994|0.999994	.|P	.|0.40875	.|0.731	.|B	.|0.35312	.|0.2	T|T	0.34750|0.34750	-0.9816|-0.9816	5|10	.|0.24483	.|T	.|0.36	-1.9726|-1.9726	11.734|11.734	0.51755|0.51755	0.1764:0.8236:0.0:0.0|0.1764:0.8236:0.0:0.0	.|.	.|149	.|P67809	.|YBOX1_HUMAN	D|R	199|149;119;145	.|ENSP00000361626:P149R;ENSP00000405937:P119R	.|ENSP00000361621:P145R	H|P	+|+	1|2	0|0	YBX1|YBX1	42934991|42934991	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	5.403000|5.403000	0.66338|0.66338	2.600000|2.600000	0.87896|0.87896	0.563000|0.563000	0.77884|0.77884	CAC|CCA	-	NULL		0.517	YBX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YBX1	protein_coding	OTTHUMT00000019786.2	C	NM_004559		42934991	1	no_errors	NM_004559	genbank	human	validated	54_36p	missense	SNP	1	G
YBX1	4904	genome.wustl.edu	37	1	43166659	43166659	+	Silent	SNP	C	C	T	rs371842681		TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr1:43166659C>T	ENST00000321358.7	+	7	1087	c.948C>T	c.(946-948)ccC>ccT	p.P316P		NM_004559.3	NP_004550.2	P67809	YBOX1_HUMAN	Y box binding protein 1	316					CRD-mediated mRNA stabilization (GO:0070934)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of striated muscle cell differentiation (GO:0051154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell division (GO:0051781)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription from RNA polymerase II promoter (GO:0006366)	CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|extracellular vesicular exosome (GO:0070062)|histone pre-mRNA 3'end processing complex (GO:0071204)|intracellular membrane-bounded organelle (GO:0043231)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|U12-type spliceosomal complex (GO:0005689)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)	p.P316P(1)		large_intestine(2)|lung(4)|ovary(4)|prostate(4)|upper_aerodigestive_tract(2)	16	Ovarian(52;0.00744)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				CGTCCGCTCCCGAGGCTGAGC	0.542																																																1	Substitution - coding silent(1)	ovary(1)	1						C		0,4406		0,0,2203	47.0	48.0	48.0		948	5.4	1.0	1		48	1,8599		0,1,4299	no	coding-synonymous	YBX1	NM_004559.3		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		316/325	43166659	1,13005	2203	4300	6503	42939246	SO:0001819	synonymous_variant	4904			BC013838	CCDS470.1	1p34	2008-02-05	2005-08-11	2005-08-11	ENSG00000065978	ENSG00000065978			8014	protein-coding gene	gene with protein product		154030	"""nuclease sensitive element binding protein 1"""	NSEP1		1891370, 3174636	Standard	NM_004559		Approved	YB-1, YB1, DBPB, NSEP-1, MDR-NF1, BP-8, CSDB, CSDA2	uc001chs.3	P67809	OTTHUMG00000007523	ENST00000321358.7:c.948C>T	1.37:g.43166659C>T			42939246	P16990|P16991|Q14972|Q15325|Q5FVF0	Silent	SNP	HMMPfam_CSD;superfamily_Nucleic acid-binding proteins	p.P316	ENST00000321358.7	37	c.948	CCDS470.1	1	.	.	.	.	.	.	.	.	.	.	C	9.632	1.136728	0.21123	0.0	1.16E-4	ENSG00000065978	ENST00000436427	T	0.40225	1.04	5.39	5.39	0.77823	.	0.098626	0.64402	N	0.000001	T	0.62073	0.2398	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.66035	-0.6023	7	0.87932	D	0	-3.0175	16.6483	0.85182	0.0:1.0:0.0:0.0	.	.	.	.	L	366	ENSP00000389639:P366L	ENSP00000389639:P366L	P	+	2	0	YBX1	42939246	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.129000	0.77225	2.505000	0.84491	0.557000	0.71058	CCG	-	NULL		0.542	YBX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YBX1	protein_coding	OTTHUMT00000019786.2	C	NM_004559		42939246	1	no_errors	NM_004559	genbank	human	validated	54_36p	silent	SNP	1	T
ABCA4	24	genome.wustl.edu	37	1	94548924	94548924	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr1:94548924G>A	ENST00000370225.3	-	7	928	c.842C>T	c.(841-843)tCa>tTa	p.S281L	ABCA4_ENST00000535735.1_Missense_Mutation_p.S281L	NM_000350.2	NP_000341.2	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 4	281					phospholipid transfer to membrane (GO:0006649)|photoreceptor cell maintenance (GO:0045494)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|phospholipid-translocating ATPase activity (GO:0004012)|transporter activity (GO:0005215)	p.S281L(1)		NS(2)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(10)|large_intestine(25)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(10)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	147		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		AATTCTTGGTGACATATCAGA	0.348																																																1	Substitution - Missense(1)	ovary(1)	1											184.0	202.0	195.0					1																	94548924		2203	4300	6503	94321512	SO:0001583	missense	24			U88667	CCDS747.1	1p22	2013-01-23			ENSG00000198691	ENSG00000198691		"""ATP binding cassette transporters / subfamily A"""	34	protein-coding gene	gene with protein product	"""Stargardt disease"""	601691	"""ATP-binding cassette transporter, retinal-specific"""	STGD1, ABCR, RP19, STGD		9490294	Standard	NM_000350		Approved	FFM, ARMD2, CORD3	uc001dqh.3	P78363	OTTHUMG00000010622	ENST00000370225.3:c.842C>T	1.37:g.94548924G>A	ENSP00000359245:p.Ser281Leu		94321512	O15112|O60438|O60915|Q0QD48|Q4LE31	Missense_Mutation	SNP	HMMPfam_ABC_tran;superfamily_P-loop containing nucleoside triphosphate hydrolases	p.S281L	ENST00000370225.3	37	c.842	CCDS747.1	1	.	.	.	.	.	.	.	.	.	.	G	16.28	3.079285	0.55753	.	.	ENSG00000198691	ENST00000370225;ENST00000535735	D;D	0.91407	-2.72;-2.84	5.59	4.68	0.58851	.	0.672345	0.14279	N	0.329622	T	0.78065	0.4225	L	0.39633	1.23	0.58432	D	0.999999	P;B	0.36974	0.576;0.001	B;B	0.33620	0.167;0.002	T	0.75599	-0.3262	10	0.14252	T	0.57	.	14.9659	0.71193	0.0689:0.0:0.9311:0.0	.	281;281	F5H6E5;P78363	.;ABCA4_HUMAN	L	281	ENSP00000359245:S281L;ENSP00000437682:S281L	ENSP00000359245:S281L	S	-	2	0	ABCA4	94321512	1.000000	0.71417	0.957000	0.39632	0.912000	0.54170	6.677000	0.74503	1.493000	0.48517	-0.150000	0.13652	TCA	-	NULL		0.348	ABCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA4	protein_coding	OTTHUMT00000029320.1	G	NM_000350		94321512	-1	no_errors	NM_000350	genbank	human	reviewed	54_36p	missense	SNP	1	A
DPYD	1806	genome.wustl.edu	37	1	98015114	98015114	+	Splice_Site	SNP	A	A	T			TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr1:98015114A>T	ENST00000370192.3	-	12	1625		c.e12+1			NM_000110.3	NP_000101	Q12882	DPYD_HUMAN	dihydropyrimidine dehydrogenase						beta-alanine biosynthetic process (GO:0019483)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase catabolic process (GO:0006145)|pyrimidine nucleobase catabolic process (GO:0006208)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)|thymidine catabolic process (GO:0006214)|thymine catabolic process (GO:0006210)|UMP biosynthetic process (GO:0006222)|uracil catabolic process (GO:0006212)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	4 iron, 4 sulfur cluster binding (GO:0051539)|dihydroorotate dehydrogenase activity (GO:0004152)|dihydropyrimidine dehydrogenase (NADP+) activity (GO:0017113)|flavin adenine dinucleotide binding (GO:0050660)|metal ion binding (GO:0046872)|NADP binding (GO:0050661)|protein homodimerization activity (GO:0042803)	p.?(1)		NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(18)|lung(30)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(1)	83		all_epithelial(167;0.000185)|all_lung(203;0.00318)|Lung NSC(277;0.00994)		Colorectal(170;0.0165)|Epithelial(280;0.0526)|all cancers(265;0.104)|READ - Rectum adenocarcinoma(84;0.171)|Lung(183;0.216)	Capecitabine(DB01101)|Flavin adenine dinucleotide(DB03147)|Fluorouracil(DB00544)	GCAAATGCCTACCTGTACGTA	0.363																																																1	Unknown(1)	ovary(1)	1											145.0	123.0	131.0					1																	98015114		2203	4300	6503	97787702	SO:0001630	splice_region_variant	1806			U20938	CCDS30777.1, CCDS53346.1	1p22	2014-09-17			ENSG00000188641	ENSG00000188641	1.3.1.2		3012	protein-coding gene	gene with protein product		612779				7713523	Standard	NM_000110		Approved	DPD	uc001drv.3	Q12882	OTTHUMG00000039683	ENST00000370192.3:c.1524+1T>A	1.37:g.98015114A>T			97787702	A2RRQ2|A2RRQ3|A8K5A2|A8MWG9|B1AN21|E9PFN1|Q16694|Q16761|Q32NB0|Q96HL6|Q96TH1	Splice_Site	SNP	-	e12+2	ENST00000370192.3	37	c.1524+2	CCDS30777.1	1	.	.	.	.	.	.	.	.	.	.	A	16.27	3.077134	0.55753	.	.	ENSG00000188641	ENST00000370192	.	.	.	6.16	6.16	0.99307	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.8061	0.85666	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	DPYD	97787702	1.000000	0.71417	1.000000	0.80357	0.278000	0.26855	8.893000	0.92498	2.367000	0.80283	0.528000	0.53228	.	-	-		0.363	DPYD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPYD	protein_coding	OTTHUMT00000095698.3	A	NM_000110	Intron	97787702	-1	no_errors	NM_000110	genbank	human	reviewed	54_36p	splice_site	SNP	1	T
OR2C3	81472	genome.wustl.edu	37	1	247695179	247695179	+	Missense_Mutation	SNP	A	A	C			TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	A	A	A	C	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr1:247695179A>C	ENST00000366487.3	-	2	996	c.635T>G	c.(634-636)cTg>cGg	p.L212R	GCSAML_ENST00000531662.1_Intron|GCSAML_ENST00000527084.1_Intron|GCSAML_ENST00000463359.1_Intron|GCSAML_ENST00000366489.1_Intron|GCSAML_ENST00000366491.2_Intron|GCSAML_ENST00000366490.3_Intron|GCSAML_ENST00000527541.1_Intron	NM_198074.4	NP_932340	Q8N628	OR2C3_HUMAN	olfactory receptor, family 2, subfamily C, member 3	212						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L211R(1)		breast(1)|endometrium(5)|large_intestine(2)|lung(31)|ovary(1)|prostate(1)|skin(2)	43	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0242)	OV - Ovarian serous cystadenocarcinoma(106;0.0241)			GATGAGCCCCAGAGGCAGGAC	0.537																																																1	Substitution - Missense(1)	ovary(1)	1											90.0	87.0	88.0					1																	247695179		2203	4300	6503	245761802	SO:0001583	missense	81472			BC030717	CCDS1634.2	1q44	2014-02-19	2002-02-28		ENSG00000196242	ENSG00000196242		"""GPCR / Class A : Olfactory receptors"""	15005	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily C, member 4"""	OR2C4, OR2C5P			Standard	NM_198074		Approved	OST742	uc009xgy.3	Q8N628	OTTHUMG00000040579	ENST00000366487.3:c.635T>G	1.37:g.247695179A>C	ENSP00000355443:p.Leu212Arg		245761802	Q5JQS4|Q6IEZ1|Q8NGW7	Missense_Mutation	SNP	-	p.L211R	ENST00000366487.3	37	c.632	CCDS1634.2	1	.	.	.	.	.	.	.	.	.	.	A	14.40	2.524413	0.44969	.	.	ENSG00000196242	ENST00000366487	T	0.49432	0.78	3.89	3.89	0.44902	GPCR, rhodopsin-like superfamily (1);	0.308092	0.17578	U	0.169222	T	0.76751	0.4031	H	0.97131	3.945	0.09310	N	1	D	0.76494	0.999	D	0.72338	0.977	T	0.70608	-0.4825	10	0.87932	D	0	.	11.0234	0.47730	1.0:0.0:0.0:0.0	.	212	Q8N628	OR2C3_HUMAN	R	212	ENSP00000355443:L212R	ENSP00000355443:L212R	L	-	2	0	OR2C3	245761802	0.000000	0.05858	0.919000	0.36401	0.773000	0.43773	0.743000	0.26231	1.752000	0.51891	0.528000	0.53228	CTG	-	NULL		0.537	OR2C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2C3	protein_coding	OTTHUMT00000097626.2	A	NM_198074		245761802	-1	no_errors	NM_198074	genbank	human	validated	54_36p	missense	SNP	0.12	C
Unknown	0	genome.wustl.edu	37	10	29188307	29188307	+	IGR	SNP	T	T	C			TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr10:29188307T>C								C10orf126 (17480 upstream) : LYZL1 (389682 downstream)																							AATATCACCTTTCTTATAGAT	0.413																																																0			10																																								29228313	SO:0001628	intergenic_variant	653665																															10.37:g.29188307T>C			29228313		Missense_Mutation	SNP	-	p.K23R		37	c.68		10																																																																																			-	NULL	0	0.413					LOC653665			T			29228313	-1	pseudogene	XM_001723025	genbank	human	model	54_36p	missense	SNP	1	C
CCAR1	55749	genome.wustl.edu	37	10	70506999	70506999	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr10:70506999G>C	ENST00000265872.6	+	7	719	c.600G>C	c.(598-600)tgG>tgC	p.W200C	CCAR1_ENST00000543719.1_Missense_Mutation_p.W185C|CCAR1_ENST00000535016.1_Missense_Mutation_p.W185C	NM_001282959.1|NM_001282960.1|NM_018237.2	NP_001269888.1|NP_001269889.1|NP_060707.2	Q8IX12	CCAR1_HUMAN	cell division cycle and apoptosis regulator 1	200					apoptotic process (GO:0006915)|cell cycle (GO:0007049)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|poly(A) RNA binding (GO:0044822)	p.W200C(1)		NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|lung(13)|ovary(7)|skin(3)	56						CTTTTAAATGGAATGCACAGA	0.338																																																1	Substitution - Missense(1)	ovary(1)	10											88.0	90.0	90.0					10																	70506999		2203	4300	6503	70177005	SO:0001583	missense	55749			AY249140	CCDS7282.1, CCDS60547.1	10q22.1	2004-02-19			ENSG00000060339	ENSG00000060339			24236	protein-coding gene	gene with protein product		612569				12816952	Standard	NM_018237		Approved	FLJ10590, CARP-1, CARP1	uc001joo.3	Q8IX12	OTTHUMG00000018361	ENST00000265872.6:c.600G>C	10.37:g.70506999G>C	ENSP00000265872:p.Trp200Cys		70177005	A0JLT7|A1L4P7|A8K9D4|B4DNP8|B4DRK8|Q32NE3|Q5EBM3|Q5VUP6|Q6PIZ0|Q6X935|Q9H8N4|Q9NVA7|Q9NVQ0|Q9NWM6	Missense_Mutation	SNP	HMMPfam_SAP;superfamily_EF-hand;superfamily_Nucleic acid-binding proteins;superfamily_SAP domain	p.W200C	ENST00000265872.6	37	c.600	CCDS7282.1	10	.	.	.	.	.	.	.	.	.	.	G	18.32	3.598440	0.66332	.	.	ENSG00000060339	ENST00000265872;ENST00000535016;ENST00000543719;ENST00000539539;ENST00000543225;ENST00000536012;ENST00000540807	T;T;T;T;T;T	0.66995	1.59;-0.08;-0.08;-0.0;-0.24;0.17	5.51	5.51	0.81932	Nucleic acid-binding, OB-fold-like (1);	0.000000	0.85682	D	0.000000	T	0.81754	0.4889	M	0.68593	2.085	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.997;0.998;0.998	T	0.82680	-0.0337	10	0.87932	D	0	-5.094	19.7838	0.96428	0.0:0.0:1.0:0.0	.	185;200;174	Q8IX12-2;Q8IX12;F5H2E6	.;CCAR1_HUMAN;.	C	200;185;185;185;174;5;5	ENSP00000265872:W200C;ENSP00000441820:W185C;ENSP00000445254:W185C;ENSP00000439252:W185C;ENSP00000438610:W174C;ENSP00000439642:W5C	ENSP00000265872:W200C	W	+	3	0	CCAR1	70177005	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.723000	0.98772	2.755000	0.94549	0.650000	0.86243	TGG	-	NULL		0.338	CCAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCAR1	protein_coding	OTTHUMT00000048356.2	G	NM_018237		70177005	1	no_errors	NM_018237	genbank	human	validated	54_36p	missense	SNP	1	C
RBM7	10179	genome.wustl.edu	37	11	114278229	114278229	+	Missense_Mutation	SNP	A	A	T	rs528095443		TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr11:114278229A>T	ENST00000540163.1	+	5	1143	c.501A>T	c.(499-501)caA>caT	p.Q167H	RBM7_ENST00000544582.1_Intron|RBM7_ENST00000541475.1_3'UTR|RBM7_ENST00000375490.5_Missense_Mutation_p.Q168H|RBM7_ENST00000545678.1_Missense_Mutation_p.Q47H|RP11-212D19.4_ENST00000544347.1_Intron			Q9Y580	RBM7_HUMAN	RNA binding motif protein 7	167					meiotic nuclear division (GO:0007126)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.Q167H(1)		NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	17		all_cancers(61;5.06e-12)|all_epithelial(67;5.3e-06)|all_hematologic(158;7.68e-05)|Acute lymphoblastic leukemia(157;0.000966)|Melanoma(852;0.00153)|Medulloblastoma(222;0.0523)|all_neural(223;0.0663)|Breast(348;0.0818)|Prostate(24;0.104)		BRCA - Breast invasive adenocarcinoma(274;2.56e-06)|Epithelial(105;4.17e-05)|all cancers(92;0.000348)		CTCTGGATCAATCAGGATTTT	0.408																																																1	Substitution - Missense(1)	ovary(1)	11											103.0	101.0	101.0					11																	114278229		2201	4296	6497	113783439	SO:0001583	missense	10179			AF156098	CCDS8370.1, CCDS66233.1, CCDS73395.1	11q23.1-q23.2	2013-02-12			ENSG00000076053	ENSG00000076053		"""RNA binding motif (RRM) containing"""	9904	protein-coding gene	gene with protein product		612413				12477932	Standard	NM_001286045		Approved		uc001pov.3	Q9Y580		ENST00000540163.1:c.501A>T	11.37:g.114278229A>T	ENSP00000439918:p.Gln167His		113783439	B2R6K8|Q9NUT4	Missense_Mutation	SNP	-	p.Q167H	ENST00000540163.1	37	c.501	CCDS8370.1	11	.	.	.	.	.	.	.	.	.	.	A	6.036	0.374970	0.11409	.	.	ENSG00000076053	ENST00000540163;ENST00000375490;ENST00000545678	T;T	0.28666	1.6;2.62	5.75	-11.5	0.00074	.	0.302389	0.35349	N	0.003268	T	0.17109	0.0411	L	0.29908	0.895	0.25094	N	0.990836	B;B	0.11235	0.004;0.004	B;B	0.11329	0.006;0.005	T	0.05733	-1.0867	10	0.34782	T	0.22	-7.2817	17.0856	0.86611	0.7487:0.0719:0.1793:0.0	.	167;167	Q6IRX3;Q9Y580	.;RBM7_HUMAN	H	167;168;47	ENSP00000439918:Q167H;ENSP00000364639:Q168H	ENSP00000364639:Q168H	Q	+	3	2	RBM7	113783439	0.000000	0.05858	0.018000	0.16275	0.653000	0.38743	-2.039000	0.01418	-3.276000	0.00198	-1.162000	0.01777	CAA	-	NULL		0.408	RBM7-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	RBM7	protein_coding	OTTHUMT00000399010.1	A	NM_016090		113783439	1	no_errors	NM_016090	genbank	human	provisional	54_36p	missense	SNP	0.13	T
LRRC4C	57689	genome.wustl.edu	37	11	40137584	40137584	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr11:40137584G>C	ENST00000278198.2	-	2	2222	c.259C>G	c.(259-261)Caa>Gaa	p.Q87E	LRRC4C_ENST00000530763.1_Missense_Mutation_p.Q87E|LRRC4C_ENST00000527150.1_Missense_Mutation_p.Q87E|LRRC4C_ENST00000528697.1_Missense_Mutation_p.Q87E			Q9HCJ2	LRC4C_HUMAN	leucine rich repeat containing 4C	87					regulation of axonogenesis (GO:0050770)	cell junction (GO:0030054)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|postsynaptic membrane (GO:0045211)		p.Q87E(1)		NS(2)|central_nervous_system(3)|endometrium(1)|large_intestine(14)|lung(43)|ovary(5)|prostate(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	86		all_lung(304;0.0575)|Lung NSC(402;0.138)				ATCTGGATTTGGTTCTCATGG	0.468																																																1	Substitution - Missense(1)	ovary(1)	11											107.0	98.0	101.0					11																	40137584		2203	4300	6503	40094160	SO:0001583	missense	57689			AB046800	CCDS31464.1	11p12	2013-01-14				ENSG00000148948		"""Immunoglobulin superfamily / I-set domain containing"""	29317	protein-coding gene	gene with protein product		608817				14595443	Standard	NM_020929		Approved	KIAA1580, NGL-1	uc031pzu.1	Q9HCJ2		ENST00000278198.2:c.259C>G	11.37:g.40137584G>C	ENSP00000278198:p.Gln87Glu		40094160	A8K0T1|Q7L0N3	Missense_Mutation	SNP	HMMPfam_LRRNT;HMMPfam_LRR_1;HMMPfam_I-set;superfamily_Immunoglobulin;superfamily_L domain-like	p.Q87E	ENST00000278198.2	37	c.259	CCDS31464.1	11	.	.	.	.	.	.	.	.	.	.	G	11.05	1.523692	0.27299	.	.	ENSG00000148948	ENST00000278198;ENST00000527150;ENST00000528697;ENST00000530763	T;T;T;T	0.04454	3.62;3.62;3.62;3.62	5.76	5.76	0.90799	.	0.062753	0.64402	D	0.000003	T	0.04770	0.0129	L	0.28458	0.855	0.46521	D	0.999089	B	0.17038	0.02	B	0.15052	0.012	T	0.24476	-1.0159	10	0.05525	T	0.97	.	18.9442	0.92615	0.0:0.0:1.0:0.0	.	87	Q9HCJ2	LRC4C_HUMAN	E	87	ENSP00000278198:Q87E;ENSP00000436976:Q87E;ENSP00000437132:Q87E;ENSP00000434761:Q87E	ENSP00000278198:Q87E	Q	-	1	0	LRRC4C	40094160	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.855000	0.99526	2.719000	0.93026	0.650000	0.86243	CAA	-	HMMPfam_LRR_1		0.468	LRRC4C-001	NOVEL	basic|appris_principal|CCDS	protein_coding	LRRC4C	protein_coding	OTTHUMT00000389499.1	G	NM_020929		40094160	-1	no_errors	NM_020929	genbank	human	validated	54_36p	missense	SNP	1	C
GLYATL2	219970	genome.wustl.edu	37	11	58604586	58604586	+	Missense_Mutation	SNP	A	A	T	rs201500483		TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr11:58604586A>T	ENST00000287275.1	-	5	768	c.378T>A	c.(376-378)gaT>gaA	p.D126E	GLYATL2_ENST00000532258.1_Missense_Mutation_p.D126E|GLYATL2_ENST00000533636.1_5'UTR	NM_145016.3	NP_659453.3	Q8WU03	GLYL2_HUMAN	glycine-N-acyltransferase-like 2	126						endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)	glycine N-acyltransferase activity (GO:0047961)	p.D126E(1)		breast(1)|kidney(1)|large_intestine(3)|lung(12)|ovary(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	23		Breast(21;0.0044)|all_epithelial(135;0.0216)			Glycine(DB00145)	TTTTCATGTAATCTACCTGCA	0.393																																																1	Substitution - Missense(1)	ovary(1)	11											196.0	174.0	181.0					11																	58604586		1884	4105	5989	58361162	SO:0001583	missense	219970			AF426250	CCDS41649.1	11q12.1	2008-02-05				ENSG00000156689			24178	protein-coding gene	gene with protein product		614762				12477932	Standard	NM_145016		Approved	BXMAS2-10, MGC24009	uc001nnd.4	Q8WU03		ENST00000287275.1:c.378T>A	11.37:g.58604586A>T	ENSP00000287275:p.Asp126Glu		58361162	A5LGC7|Q86WC3|Q96AT2	Missense_Mutation	SNP	-	p.D126E	ENST00000287275.1	37	c.378	CCDS41649.1	11	.	.	.	.	.	.	.	.	.	.	A	10.45	1.352559	0.24512	.	.	ENSG00000156689	ENST00000287275;ENST00000532258	T;T	0.12774	2.65;2.65	3.14	-6.29	0.02013	Acyl-CoA N-acyltransferase (1);Glycine N-acyltransferase, N-terminal (1);	0.816494	0.10469	U	0.670972	T	0.10423	0.0255	N	0.25890	0.77	0.09310	N	1	D	0.65815	0.995	P	0.60068	0.868	T	0.13791	-1.0496	10	0.06365	T	0.9	.	2.2562	0.04056	0.1911:0.4364:0.2284:0.1441	.	126	Q8WU03	GLYL2_HUMAN	E	126	ENSP00000287275:D126E;ENSP00000434277:D126E	ENSP00000287275:D126E	D	-	3	2	GLYATL2	58361162	0.000000	0.05858	0.000000	0.03702	0.457000	0.32468	-2.379000	0.01067	-1.083000	0.03097	0.524000	0.50904	GAT	-	NULL		0.393	GLYATL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLYATL2	protein_coding	OTTHUMT00000394599.1	A	NM_145016		58361162	-1	no_errors	NM_145016	genbank	human	validated	54_36p	missense	SNP		T
PLEKHB1	58473	genome.wustl.edu	37	11	73361656	73361656	+	Silent	SNP	G	G	T			TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr11:73361656G>T	ENST00000354190.5	+	3	584	c.153G>T	c.(151-153)ctG>ctT	p.L51L	PLEKHB1_ENST00000544532.1_3'UTR|PLEKHB1_ENST00000398494.4_Silent_p.L32L|PLEKHB1_ENST00000543085.1_Intron|PLEKHB1_ENST00000227214.6_Silent_p.L32L|PLEKHB1_ENST00000535129.1_Silent_p.L32L|PLEKHB1_ENST00000398492.4_Silent_p.L51L	NM_021200.2	NP_067023.1	Q9UF11	PKHB1_HUMAN	pleckstrin homology domain containing, family B (evectins) member 1	51	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				multicellular organismal development (GO:0007275)|phototransduction (GO:0007602)|regulation of cell differentiation (GO:0045595)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	signal transducer activity (GO:0004871)	p.L51L(1)		endometrium(2)|large_intestine(2)|lung(1)|ovary(1)|prostate(1)	7						ACGGGACCCTGGGATACTACC	0.587																																																1	Substitution - coding silent(1)	ovary(1)	11											42.0	46.0	45.0					11																	73361656		2113	4217	6330	73039304	SO:0001819	synonymous_variant	58473			AF081583	CCDS44672.1, CCDS44673.1, CCDS44674.1, CCDS44675.1	11q13.5-q14.1	2013-01-10	2002-11-04	2002-11-08	ENSG00000021300	ENSG00000021300		"""Pleckstrin homology (PH) domain containing"""	19079	protein-coding gene	gene with protein product		607651	"""PH domain containing, retinal 1"""	PHRET1		10585447	Standard	NM_021200		Approved	PHR1, KPL1	uc001ouc.3	Q9UF11	OTTHUMG00000168030	ENST00000354190.5:c.153G>T	11.37:g.73361656G>T			73039304	A8K0Q5|B2RBP1|B7Z716|Q9UBF5|Q9UI37|Q9UI44	Silent	SNP	HMMPfam_PH;superfamily_PH domain-like	p.L51	ENST00000354190.5	37	c.153	CCDS44672.1	11																																																																																			-	HMMPfam_PH		0.587	PLEKHB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PLEKHB1	protein_coding	OTTHUMT00000397593.1	G			73039304	1	no_errors	NM_021200	genbank	human	validated	54_36p	silent	SNP	1	T
C11orf63	79864	genome.wustl.edu	37	11	122830102	122830102	+	Silent	SNP	C	C	T			TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr11:122830102C>T	ENST00000531316.1	+	8	2378	c.2286C>T	c.(2284-2286)caC>caT	p.H762H	C11orf63_ENST00000227349.2_Silent_p.H762H			Q6NUN7	CK063_HUMAN	chromosome 11 open reading frame 63	762					axoneme assembly (GO:0035082)|brain development (GO:0007420)|cerebrospinal fluid secretion (GO:0033326)|ciliary basal body organization (GO:0032053)			p.H762H(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(13)|lung(14)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)	47		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.018)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.34e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0311)		AGAACAGACACGAAAGGGAAA	0.418																																																1	Substitution - coding silent(1)	ovary(1)	11											96.0	89.0	91.0					11																	122830102		2202	4299	6501	122335312	SO:0001819	synonymous_variant	79864			BC068507	CCDS8438.1, CCDS8439.1	11q24.1	2012-05-25			ENSG00000109944	ENSG00000109944			26288	protein-coding gene	gene with protein product						12477932	Standard	NM_024806		Approved	FLJ23554	uc001pym.4	Q6NUN7	OTTHUMG00000166027	ENST00000531316.1:c.2286C>T	11.37:g.122830102C>T			122335312	A8K6G0|Q96GB5|Q9H5D6	Silent	SNP	-	p.H762	ENST00000531316.1	37	c.2286	CCDS8438.1	11																																																																																			-	NULL		0.418	C11orf63-002	KNOWN	basic|appris_principal|CCDS	protein_coding	C11orf63	protein_coding	OTTHUMT00000387511.1	C	NM_024806		122335312	1	no_errors	NM_024806	genbank	human	validated	54_36p	silent	SNP	1	T
PARP11	57097	genome.wustl.edu	37	12	3921561	3921561	+	Missense_Mutation	SNP	T	T	C			TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr12:3921561T>C	ENST00000228820.4	-	8	889	c.745A>G	c.(745-747)Aaa>Gaa	p.K249E	PARP11_ENST00000476985.1_Intron|PARP11_ENST00000397096.2_Intron|PARP11_ENST00000427057.2_Missense_Mutation_p.K168E|PARP11_ENST00000447133.3_Missense_Mutation_p.K168E	NM_020367.4	NP_065100.2	Q9NR21	PAR11_HUMAN	poly (ADP-ribose) polymerase family, member 11	242	PARP catalytic. {ECO:0000255|PROSITE- ProRule:PRU00397}.						NAD+ ADP-ribosyltransferase activity (GO:0003950)	p.K242E(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)	17			all cancers(3;1.58e-07)|OV - Ovarian serous cystadenocarcinoma(31;0.00287)|GBM - Glioblastoma multiforme(3;0.0141)|COAD - Colon adenocarcinoma(12;0.0264)			ATGTCATCTTTGCAGAAACGA	0.378																																																1	Substitution - Missense(1)	ovary(1)	12											86.0	82.0	84.0					12																	3921561		2203	4300	6503	3791822	SO:0001583	missense	57097			AF263540	CCDS8523.2, CCDS66281.1	12p13.3	2014-01-28	2004-08-25	2004-08-26	ENSG00000111224	ENSG00000111224		"""Poly (ADP-ribose) polymerases"""	1186	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 6"""	C12orf6		15273990	Standard	NM_001286522		Approved		uc001qml.2	Q9NR21	OTTHUMG00000156442	ENST00000228820.4:c.745A>G	12.37:g.3921561T>C	ENSP00000228820:p.Lys249Glu		3791822	B4DRQ0|Q68DS1|Q8N5Y9	Missense_Mutation	SNP	-	p.K242E	ENST00000228820.4	37	c.724	CCDS8523.2	12	.	.	.	.	.	.	.	.	.	.	T	21.2	4.114940	0.77210	.	.	ENSG00000111224	ENST00000427057;ENST00000228820;ENST00000447133	T;T;T	0.14640	2.49;2.49;2.49	5.95	4.75	0.60458	Poly(ADP-ribose) polymerase, catalytic domain (2);	0.092426	0.85682	D	0.000000	T	0.20700	0.0498	L	0.55481	1.735	0.41537	D	0.988497	B;P;P	0.42757	0.203;0.75;0.789	B;P;P	0.49361	0.142;0.473;0.608	T	0.01051	-1.1468	10	0.31617	T	0.26	.	11.0785	0.48047	0.0:0.0:0.155:0.845	.	168;249;242	Q9NR21-2;Q9NR21-4;Q9NR21	.;.;PAR11_HUMAN	E	168;249;168	ENSP00000397058:K168E;ENSP00000228820:K249E;ENSP00000405385:K168E	ENSP00000228820:K249E	K	-	1	0	PARP11	3791822	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.841000	0.62824	2.281000	0.76405	0.528000	0.53228	AAA	-	NULL		0.378	PARP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARP11	protein_coding	OTTHUMT00000344213.1	T			3791822	-1	no_errors	NM_020367	genbank	human	validated	54_36p	missense	SNP	1	C
SLCO1B1	10599	genome.wustl.edu	37	12	21358822	21358822	+	Missense_Mutation	SNP	A	A	T			TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr12:21358822A>T	ENST00000256958.2	+	11	1448	c.1352A>T	c.(1351-1353)cAt>cTt	p.H451L		NM_006446.4	NP_006437.3	Q9Y6L6	SO1B1_HUMAN	solute carrier organic anion transporter family, member 1B1	451					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium-independent organic anion transmembrane transporter activity (GO:0015347)	p.H451L(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(33)|ovary(3)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)	70					Acetylcysteine(DB06151)|Aminohippurate(DB00345)|Atorvastatin(DB01076)|Axitinib(DB06626)|Benzylpenicillin(DB01053)|Bezafibrate(DB01393)|Cabazitaxel(DB06772)|Caspofungin(DB00520)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dabrafenib(DB08912)|Dextrothyroxine(DB00509)|Digoxin(DB00390)|Dinoprostone(DB00917)|Eltrombopag(DB06210)|Estradiol(DB00783)|Estrone(DB00655)|Ezetimibe(DB00973)|Fexofenadine(DB00950)|Fluvastatin(DB01095)|Gadoxetate(DB08884)|Gemfibrozil(DB01241)|Indinavir(DB00224)|Irinotecan(DB00762)|L-Carnitine(DB00583)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Lovastatin(DB00227)|Methotrexate(DB00563)|Mycophenolate mofetil(DB00688)|Nelfinavir(DB00220)|Olmesartan(DB00275)|Ouabain(DB01092)|Pantoprazole(DB00213)|Pazopanib(DB06589)|Penicillamine(DB00859)|Pioglitazone(DB01132)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Quinidine(DB00908)|Repaglinide(DB00912)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Ritonavir(DB00503)|Rosiglitazone(DB00412)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|SIMEPREVIR(DB06290)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sumatriptan(DB00669)|Valsartan(DB00177)|Verapamil(DB00661)	GTGACATCTCATAGAGATGTA	0.373																																																1	Substitution - Missense(1)	ovary(1)	12											97.0	94.0	95.0					12																	21358822		2203	4300	6503	21250089	SO:0001583	missense	10599				CCDS8685.1	12p12	2013-05-22	2003-11-25	2003-11-26	ENSG00000134538	ENSG00000134538		"""Solute carriers"""	10959	protein-coding gene	gene with protein product		604843	"""solute carrier family 21 (organic anion transporter), member 6"""	SLC21A6		10358072	Standard	NM_006446		Approved	OATP-C, LST-1, OATP1B1	uc001req.4	Q9Y6L6	OTTHUMG00000169047	ENST00000256958.2:c.1352A>T	12.37:g.21358822A>T	ENSP00000256958:p.His451Leu		21250089	B2R7G2|Q29R64|Q9NQ37|Q9UBF3|Q9UH89	Missense_Mutation	SNP	-	p.H451L	ENST00000256958.2	37	c.1352	CCDS8685.1	12	.	.	.	.	.	.	.	.	.	.	A	11.42	1.634270	0.29068	.	.	ENSG00000134538	ENST00000256958	T	0.39056	1.1	4.06	-0.432	0.12291	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	1.517240	0.03380	N	0.200267	T	0.31358	0.0794	L	0.41124	1.26	0.09310	N	1	B	0.14805	0.011	B	0.18263	0.021	T	0.11616	-1.0580	10	0.13470	T	0.59	.	5.2215	0.15371	0.3418:0.4868:0.0:0.1714	.	451	Q9Y6L6	SO1B1_HUMAN	L	451	ENSP00000256958:H451L	ENSP00000256958:H451L	H	+	2	0	SLCO1B1	21250089	0.010000	0.17322	0.604000	0.28916	0.434000	0.31775	0.689000	0.25437	0.402000	0.25451	0.397000	0.26171	CAT	-	NULL		0.373	SLCO1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLCO1B1	protein_coding	OTTHUMT00000402070.1	A	NM_006446		21250089	1	no_errors	NM_006446	genbank	human	reviewed	54_36p	missense	SNP	0.01	T
ATF1	466	genome.wustl.edu	37	12	51203255	51203255	+	Missense_Mutation	SNP	T	T	A			TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr12:51203255T>A	ENST00000262053.3	+	4	233	c.211T>A	c.(211-213)Tta>Ata	p.L71I	ATF1_ENST00000539132.1_Intron	NM_005171.4	NP_005162.1	P18846	ATF1_HUMAN	activating transcription factor 1	71	KID. {ECO:0000255|PROSITE- ProRule:PRU00312}.				cellular protein complex assembly (GO:0043623)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of DNA replication (GO:0045740)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to cobalt ion (GO:0032025)|response to organic cyclic compound (GO:0014070)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.L71I(1)	EWSR1/ATF1(347)|FUS/ATF1(4)	breast(1)|large_intestine(1)|ovary(2)	4					Pseudoephedrine(DB00852)	TTTGAAAGACTTATCTTCTGA	0.323			T	"""EWSR1, FUS"""	"""malignant melanoma of soft parts , angiomatoid fibrous histiocytoma """																																		Dom	yes		12	12q13	466	activating transcription factor 1		"""E, M"""	1	Substitution - Missense(1)	ovary(1)	12											56.0	63.0	61.0					12																	51203255		2202	4300	6502	49489522	SO:0001583	missense	466			BC029619	CCDS8803.1	12q13	2014-05-13			ENSG00000123268	ENSG00000123268		"""basic leucine zipper proteins"""	783	protein-coding gene	gene with protein product		123803				8401579	Standard	NM_005171		Approved	TREB36	uc001rww.4	P18846		ENST00000262053.3:c.211T>A	12.37:g.51203255T>A	ENSP00000262053:p.Leu71Ile		49489522	B4DRF9|P25168|Q9H4A8	Missense_Mutation	SNP	HMMPfam_pKID;HMMPfam_bZIP_1	p.L71I	ENST00000262053.3	37	c.211	CCDS8803.1	12	.	.	.	.	.	.	.	.	.	.	T	22.4	4.287192	0.80803	.	.	ENSG00000123268	ENST00000552510;ENST00000262053;ENST00000552487	D;D;D	0.85773	-2.03;-2.03;-2.03	4.5	3.6	0.41247	Coactivator CBP, pKID (2);	0.000000	0.85682	D	0.000000	D	0.89230	0.6656	L	0.50993	1.605	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	D	0.89724	0.3921	10	0.87932	D	0	-7.0004	12.4867	0.55877	0.0:0.9152:0.0:0.0848	.	71	P18846	ATF1_HUMAN	I	71	ENSP00000448592:L71I;ENSP00000262053:L71I;ENSP00000448921:L71I	ENSP00000262053:L71I	L	+	1	2	ATF1	49489522	1.000000	0.71417	0.987000	0.45799	0.816000	0.46133	3.612000	0.54142	1.174000	0.42811	-0.248000	0.11899	TTA	-	HMMPfam_pKID		0.323	ATF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATF1	protein_coding	OTTHUMT00000404285.1	T	NM_005171		49489522	1	no_errors	NM_005171	genbank	human	validated	54_36p	missense	SNP	1	A
FAM19A2	338811	genome.wustl.edu	37	12	62148734	62148734	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr12:62148734C>G	ENST00000416284.3	-	3	1762	c.178G>C	c.(178-180)Gaa>Caa	p.E60Q	FAM19A2_ENST00000551619.1_Missense_Mutation_p.E60Q|FAM19A2_ENST00000551449.1_Intron|FAM19A2_ENST00000550003.1_5'UTR	NM_178539.4	NP_848634.1	Q8N3H0	F19A2_HUMAN	family with sequence similarity 19 (chemokine (C-C motif)-like), member A2	60						cytoplasm (GO:0005737)		p.E60Q(1)		endometrium(1)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|skin(1)|stomach(1)	15			GBM - Glioblastoma multiforme(1;0.00484)	GBM - Glioblastoma multiforme(3;0.02)		TGTGACCGTTCTTCTATCTTG	0.488																																																1	Substitution - Missense(1)	ovary(1)	12											205.0	141.0	163.0					12																	62148734		2203	4300	6503	60435001	SO:0001583	missense	338811			AY325115	CCDS8962.1	12q14.1	2012-10-03			ENSG00000198673	ENSG00000198673			21589	protein-coding gene	gene with protein product						15028294	Standard	NM_178539		Approved	TAFA-2	uc001sqw.3	Q8N3H0	OTTHUMG00000170207	ENST00000416284.3:c.178G>C	12.37:g.62148734C>G	ENSP00000393987:p.Glu60Gln		60435001	B3KVV4|Q4G0R9|Q68DK0|Q6GTX6	Missense_Mutation	SNP	-	p.E60Q	ENST00000416284.3	37	c.178	CCDS8962.1	12	.	.	.	.	.	.	.	.	.	.	C	29.6	5.019455	0.93462	.	.	ENSG00000198673	ENST00000416284;ENST00000551619;ENST00000552075;ENST00000549958;ENST00000548780	.	.	.	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	D	0.83285	0.5221	M	0.81239	2.535	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.83827	0.0250	8	.	.	.	.	19.2833	0.94060	0.0:1.0:0.0:0.0	.	60	Q8N3H0	F19A2_HUMAN	Q	60;60;61;67;61	.	.	E	-	1	0	FAM19A2	60435001	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.749000	0.85096	2.557000	0.86248	0.558000	0.71614	GAA	-	NULL		0.488	FAM19A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM19A2	protein_coding	OTTHUMT00000407967.2	C	NM_178539		60435001	-1	no_errors	NM_178539	genbank	human	reviewed	54_36p	missense	SNP	1	G
HCAR1	27198	genome.wustl.edu	37	12	123214524	123214524	+	Silent	SNP	G	G	A			TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	G	G	A	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr12:123214524G>A	ENST00000436083.2	-	1	866	c.363C>T	c.(361-363)caC>caT	p.H121H	HCAR1_ENST00000432564.1_Silent_p.H121H|HCAR1_ENST00000356987.2_Silent_p.H121H			Q9BXC0	HCAR1_HUMAN	hydroxycarboxylic acid receptor 1	121					response to estradiol (GO:0032355)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.H121H(1)		NS(1)|breast(3)|endometrium(1)|kidney(1)|lung(1)|ovary(1)|pancreas(1)|skin(1)	10						TCACCGCGTGGTGGGGGTGGA	0.612																																																1	Substitution - coding silent(1)	ovary(1)	12											55.0	54.0	54.0					12																	123214524		2203	4300	6503	121780477	SO:0001819	synonymous_variant	27198			AF411110	CCDS9236.1	12q24.31	2012-08-08	2011-05-30	2011-05-30	ENSG00000196917	ENSG00000196917		"""GPCR / Class A : Hydroxy-carboxylic acid receptors"""	4532	protein-coding gene	gene with protein product	"""lactate receptor 1"""	606923	"""G protein-coupled receptor 104"", ""G protein-coupled receptor 81"""	GPR104, GPR81		11574155, 19047060, 18952058, 21454438	Standard	NM_032554		Approved	HCA1, FKSG80, TA-GPCR, LACR1	uc001ucz.3	Q9BXC0		ENST00000436083.2:c.363C>T	12.37:g.123214524G>A			121780477	B2R9X4|Q3Y5J3|Q4VBN1|Q6NXU5	Silent	SNP	-	p.H121	ENST00000436083.2	37	c.363	CCDS9236.1	12																																																																																			-	NULL		0.612	HCAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR81	protein_coding	OTTHUMT00000401415.1	G			121780477	-1	no_errors	NM_032554	genbank	human	validated	54_36p	silent	SNP	1	A
DNAJC3	5611	genome.wustl.edu	37	13	96395151	96395151	+	Intron	SNP	T	T	A			TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr13:96395151T>A	ENST00000602402.1	+	5	510				DNAJC3_ENST00000376795.6_Intron	NM_006260.4	NP_006251.1	Q13217	DNJC3_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 3						activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|defense response to virus (GO:0051607)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of protein kinase activity (GO:0006469)|proteolysis involved in cellular protein catabolic process (GO:0051603)	cytoplasm (GO:0005737)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum Sec complex (GO:0031205)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|vesicle (GO:0031982)	protein kinase inhibitor activity (GO:0004860)			NS(1)|breast(1)|kidney(4)|large_intestine(1)|lung(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15	all_neural(89;0.0878)|Breast(111;0.148)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.126)			cttctaaaagttttatggttt	0.328																																																0			13											12.0	13.0	12.0					13																	96395151		865	1963	2828	95193152	SO:0001627	intron_variant	5611			U28424	CCDS9479.1	13q32	2013-01-10			ENSG00000102580	ENSG00000102580		"""Heat shock proteins / DNAJ (HSP40)"", ""Tetratricopeptide (TTC) repeat domain containing"""	9439	protein-coding gene	gene with protein product		601184		PRKRI		7511204, 8824806	Standard	NM_006260		Approved	P58, P58IPK, HP58	uc001vmq.3	Q13217	OTTHUMG00000017227	ENST00000602402.1:c.394-14747T>A	13.37:g.96395151T>A			95193152	Q86WT9|Q8N4N2	Missense_Mutation	SNP	-	p.S219R	ENST00000602402.1	37	c.657	CCDS9479.1	13																																																																																			-	NULL		0.328	DNAJC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC3	protein_coding	OTTHUMT00000045504.3	T			95193152	1	no_errors	ENST00000360638	ensembl	human	known	54_36p	missense	SNP		A
TPP2	7174	genome.wustl.edu	37	13	103280241	103280241	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr13:103280241G>C	ENST00000376065.4	+	8	1019	c.983G>C	c.(982-984)aGt>aCt	p.S328T	TPP2_ENST00000376052.3_Missense_Mutation_p.S328T	NM_003291.2	NP_003282.2	P29144	TPP2_HUMAN	tripeptidyl peptidase II	328	Peptidase S8.				antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|endopeptidase activity (GO:0004175)|serine-type endopeptidase activity (GO:0004252)|tripeptidyl-peptidase activity (GO:0008240)	p.S328T(1)		breast(2)|endometrium(5)|kidney(2)|large_intestine(12)|lung(21)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	52	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					GTCAACTACAGTTACGGAGAA	0.373																																																1	Substitution - Missense(1)	ovary(1)	13											112.0	102.0	106.0					13																	103280241		2203	4300	6503	102078242	SO:0001583	missense	7174			M55169	CCDS9502.1	13q32-q33	2008-02-05			ENSG00000134900	ENSG00000134900	3.4.14.10		12016	protein-coding gene	gene with protein product		190470				1670990	Standard	NM_003291		Approved		uc001vpi.4	P29144	OTTHUMG00000017305	ENST00000376065.4:c.983G>C	13.37:g.103280241G>C	ENSP00000365233:p.Ser328Thr		102078242	Q5VZU8	Missense_Mutation	SNP	HMMPfam_Peptidase_S8;superfamily_Subtilisin-like	p.S328T	ENST00000376065.4	37	c.983	CCDS9502.1	13	.	.	.	.	.	.	.	.	.	.	G	33	5.203791	0.95033	.	.	ENSG00000134900	ENST00000376065;ENST00000376052	T;T	0.72615	-0.67;-0.67	5.15	5.15	0.70609	Peptidase S8/S53, subtilisin/kexin/sedolisin (3);	0.086103	0.85682	D	0.000000	D	0.87132	0.6101	H	0.96398	3.815	0.80722	D	1	D	0.53151	0.958	P	0.54431	0.752	D	0.91385	0.5130	10	0.87932	D	0	.	19.0466	0.93022	0.0:0.0:1.0:0.0	.	328	P29144	TPP2_HUMAN	T	328	ENSP00000365233:S328T;ENSP00000365220:S328T	ENSP00000365220:S328T	S	+	2	0	TPP2	102078242	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	9.371000	0.97162	2.580000	0.87095	0.558000	0.71614	AGT	-	HMMPfam_Peptidase_S8		0.373	TPP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPP2	protein_coding	OTTHUMT00000045683.2	G			102078242	1	no_errors	NM_003291	genbank	human	reviewed	54_36p	missense	SNP	1	C
PPP2R5C	5527	genome.wustl.edu	37	14	102384182	102384182	+	Missense_Mutation	SNP	T	T	G			TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	T	T	T	G	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr14:102384182T>G	ENST00000334743.5	+	13	1389	c.1341T>G	c.(1339-1341)agT>agG	p.S447R	PPP2R5C_ENST00000328724.5_Intron|PPP2R5C_ENST00000422945.2_Missense_Mutation_p.S478R|PPP2R5C_ENST00000350249.3_Intron	NM_002719.3	NP_002710.2	Q13362	2A5G_HUMAN	protein phosphatase 2, regulatory subunit B', gamma	447					DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|negative regulation of cell proliferation (GO:0008285)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	chromosome, centromeric region (GO:0000775)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)	p.S447R(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	20						CAGTGTATAGTCAAGCCAGCA	0.517																																																1	Substitution - Missense(1)	ovary(1)	14											179.0	149.0	159.0					14																	102384182		2203	4300	6503	101453935	SO:0001583	missense	5527			L42375	CCDS9964.1, CCDS9965.1, CCDS45163.1, CCDS53911.1, CCDS53912.1	14q32.31	2010-06-18	2010-04-14		ENSG00000078304	ENSG00000078304		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9311	protein-coding gene	gene with protein product		601645	"""protein phosphatase 2, regulatory subunit B (B56), gamma isoform"", ""protein phosphatase 2, regulatory subunit B', gamma isoform"""			7592815	Standard	NM_002719		Approved	B56G, PR61G	uc001ykk.3	Q13362		ENST00000334743.5:c.1341T>G	14.37:g.102384182T>G	ENSP00000333905:p.Ser447Arg		101453935	B4DYJ8|B5BUA5|F5GWP3|Q14391|Q15060|Q15174|Q6ZN33	Missense_Mutation	SNP	HMMPfam_B56,superfamily_ARM repeat	p.S447R	ENST00000334743.5	37	c.1341	CCDS9964.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	9.603|9.603	1.129235|1.129235	0.21041|0.21041	.|.	.|.	ENSG00000078304|ENSG00000078304	ENST00000422945;ENST00000557268;ENST00000334743|ENST00000555237	T;T;T|.	0.43688|.	0.94;0.94;0.94|.	5.27|5.27	2.89|2.89	0.33648|0.33648	.|.	.|.	.|.	.|.	.|.	T|T	0.43456|0.43456	0.1248|0.1248	L|L	0.34521|0.34521	1.04|1.04	0.40463|0.40463	D|D	0.980263|0.980263	B;B|.	0.06786|.	0.001;0.0|.	B;B|.	0.10450|.	0.005;0.001|.	T|T	0.18147|0.18147	-1.0346|-1.0346	9|5	0.09843|.	T|.	0.71|.	.|.	6.6863|6.6863	0.23146|0.23146	0.1493:0.075:0.0:0.7757|0.1493:0.075:0.0:0.7757	.|.	478;447|.	F5GWP3;Q13362|.	.;2A5G_HUMAN|.	R|G	478;476;447|72	ENSP00000412324:S478R;ENSP00000450931:S476R;ENSP00000333905:S447R|.	ENSP00000333905:S447R|.	S|V	+|+	3|2	2|0	PPP2R5C|PPP2R5C	101453935|101453935	0.982000|0.982000	0.34865|0.34865	0.990000|0.990000	0.47175|0.47175	0.759000|0.759000	0.43091|0.43091	0.120000|0.120000	0.15647|0.15647	0.392000|0.392000	0.25172|0.25172	0.459000|0.459000	0.35465|0.35465	AGT|GTC	-	NULL		0.517	PPP2R5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP2R5C	protein_coding	OTTHUMT00000414373.2	T	NM_002719		101453935	1	no_errors	NM_002719	genbank	human	reviewed	54_36p	missense	SNP	1	G
APEX1	328	genome.wustl.edu	37	14	20925288	20925288	+	Missense_Mutation	SNP	G	G	A	rs367614890		TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr14:20925288G>A	ENST00000216714.3	+	5	846	c.578G>A	c.(577-579)cGc>cAc	p.R193H	APEX1_ENST00000557365.1_3'UTR|APEX1_ENST00000398030.4_Missense_Mutation_p.R193H|OSGEP_ENST00000556252.1_5'Flank|APEX1_ENST00000557054.1_Missense_Mutation_p.A12T|OSGEP_ENST00000206542.4_5'Flank|APEX1_ENST00000555414.1_Missense_Mutation_p.R193H	NM_001244249.1|NM_001641.3	NP_001231178.1|NP_001632.2	P27695	APEX1_HUMAN	APEX nuclease (multifunctional DNA repair enzyme) 1	193					aging (GO:0007568)|base-excision repair (GO:0006284)|cell redox homeostasis (GO:0045454)|cellular response to cAMP (GO:0071320)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to peptide hormone stimulus (GO:0071375)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA catabolic process, exonucleolytic (GO:0000738)|DNA demethylation (GO:0080111)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|negative regulation of smooth muscle cell migration (GO:0014912)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|oxidation-reduction process (GO:0055114)|positive regulation of DNA repair (GO:0045739)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|regulation of mRNA stability (GO:0043488)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|ribosome (GO:0005840)|transcription factor complex (GO:0005667)	3'-5' exonuclease activity (GO:0008408)|chromatin DNA binding (GO:0031490)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|DNA-(apurinic or apyrimidinic site) lyase activity (GO:0003906)|double-stranded DNA 3'-5' exodeoxyribonuclease activity (GO:0008311)|endodeoxyribonuclease activity (GO:0004520)|endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)|oxidoreductase activity (GO:0016491)|phosphodiesterase I activity (GO:0004528)|phosphoric diester hydrolase activity (GO:0008081)|poly(A) RNA binding (GO:0044822)|RNA-DNA hybrid ribonuclease activity (GO:0004523)|site-specific endodeoxyribonuclease activity, specific for altered base (GO:0016890)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|uracil DNA N-glycosylase activity (GO:0004844)	p.R193H(1)		breast(2)|endometrium(1)|large_intestine(4)|ovary(2)	9	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;1.09e-07)|all cancers(55;1.19e-06)	GBM - Glioblastoma multiforme(265;0.0224)|READ - Rectum adenocarcinoma(17;0.193)	Lucanthone(DB04967)	GAAGCCTTTCGCAAGTTCCTG	0.542								Other BER factors																																								1	Substitution - Missense(1)	ovary(1)	14						G	HIS/ARG,HIS/ARG,HIS/ARG	0,4406		0,0,2203	70.0	72.0	71.0		578,578,578	4.9	0.9	14		71	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	APEX1	NM_001641.3,NM_080648.2,NM_080649.2	29,29,29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign,benign,benign	193/319,193/319,193/319	20925288	1,13005	2203	4300	6503	19995128	SO:0001583	missense	328			X59764	CCDS9550.1	14q11.2	2008-02-05	2002-09-11	2002-09-13	ENSG00000100823	ENSG00000100823	4.2.99.18		587	protein-coding gene	gene with protein product		107748	"""APEX nuclease (multifunctional DNA repair enzyme)"""	APEX			Standard	NM_001641		Approved	APE, REF1, HAP1, APX, APEN, REF-1, APE-1	uc021rnr.1	P27695	OTTHUMG00000029544	ENST00000216714.3:c.578G>A	14.37:g.20925288G>A	ENSP00000216714:p.Arg193His		19995128	Q969L5|Q99775	Missense_Mutation	SNP	HMMPfam_Exo_endo_phos;superfamily_DNase I-like	p.R193H	ENST00000216714.3	37	c.578	CCDS9550.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.45|14.45	2.538819|2.538819	0.45176|0.45176	0.0|0.0	1.16E-4|1.16E-4	ENSG00000100823|ENSG00000100823	ENST00000438886|ENST00000555414;ENST00000216714;ENST00000553681;ENST00000398030;ENST00000555839	.|T;T;T;T;T	.|0.80994	.|-1.44;-1.44;-1.44;-1.44;-1.44	5.79|5.79	4.89|4.89	0.63831|0.63831	.|Endonuclease/exonuclease/phosphatase (2);	.|0.107146	.|0.64402	.|D	.|0.000004	T|T	0.78355|0.78355	0.4270|0.4270	L|L	0.57130|0.57130	1.785|1.785	0.80722|0.80722	D|D	1|1	.|B	.|0.19331	.|0.035	.|B	.|0.09377	.|0.004	T|T	0.75736|0.75736	-0.3213|-0.3213	5|10	.|0.72032	.|D	.|0.01	.|.	15.7814|15.7814	0.78264|0.78264	0.0:0.1369:0.8631:0.0|0.0:0.1369:0.8631:0.0	.|.	.|193	.|P27695	.|APEX1_HUMAN	T|H	120|193;193;193;193;164	.|ENSP00000451979:R193H;ENSP00000216714:R193H;ENSP00000451327:R193H;ENSP00000381111:R193H;ENSP00000452460:R164H	.|ENSP00000216714:R193H	A|R	+|+	1|2	0|0	APEX1|APEX1	19995128|19995128	1.000000|1.000000	0.71417|0.71417	0.919000|0.919000	0.36401|0.36401	0.967000|0.967000	0.64934|0.64934	4.380000|4.380000	0.59581|0.59581	1.420000|1.420000	0.47138|0.47138	0.655000|0.655000	0.94253|0.94253	GCA|CGC	-	HMMPfam_Exo_endo_phos		0.542	APEX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APEX1	protein_coding	OTTHUMT00000073641.3	G	NM_001641		19995128	1	no_errors	NM_001641	genbank	human	reviewed	54_36p	missense	SNP	1	A
PTGDR	5729	genome.wustl.edu	37	14	52734924	52734924	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr14:52734924G>T	ENST00000306051.2	+	1	494	c.392G>T	c.(391-393)tGg>tTg	p.W131L	PTGDR_ENST00000553372.1_Missense_Mutation_p.W131L	NM_000953.2	NP_000944.1	Q13258	PD2R_HUMAN	prostaglandin D2 receptor (DP)	131					adenosine metabolic process (GO:0046085)|cellular response to prostaglandin D stimulus (GO:0071799)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|male sex determination (GO:0030238)|sleep (GO:0030431)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	prostaglandin D receptor activity (GO:0004956)|prostaglandin J receptor activity (GO:0001785)	p.W131L(1)		breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(1)|lung(15)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26	Breast(41;0.0639)|all_epithelial(31;0.0887)				Nedocromil(DB00716)	CTGGAGTGCTGGCTCTCCCTA	0.622																																																1	Substitution - Missense(1)	ovary(1)	14											120.0	123.0	122.0					14																	52734924		2203	4300	6503	51804674	SO:0001583	missense	5729			U31332	CCDS9707.1, CCDS61454.1	14q22.1	2012-08-08			ENSG00000168229	ENSG00000168229		"""GPCR / Class A : Prostanoid receptors"""	9591	protein-coding gene	gene with protein product		604687				7642548	Standard	NM_000953		Approved	DP, DP1, PTGDR1	uc001wzq.3	Q13258	OTTHUMG00000140299	ENST00000306051.2:c.392G>T	14.37:g.52734924G>T	ENSP00000303424:p.Trp131Leu		51804674	G3V5L3|Q13250|Q13251|Q1ZZ52	Missense_Mutation	SNP	HMMPfam_7tm_1;superfamily_Family A G protein-coupled receptor-like	p.W131L	ENST00000306051.2	37	c.392	CCDS9707.1	14	.	.	.	.	.	.	.	.	.	.	G	19.83	3.899792	0.72754	.	.	ENSG00000168229	ENST00000306051;ENST00000553372	T;T	0.71934	-0.61;-0.61	4.71	4.71	0.59529	GPCR, rhodopsin-like superfamily (1);	0.000000	0.45361	D	0.000371	T	0.72120	0.3421	L	0.39633	1.23	0.54753	D	0.999983	P	0.50272	0.933	P	0.53988	0.739	T	0.68473	-0.5399	10	0.27082	T	0.32	-21.6448	15.9719	0.80027	0.0:0.0:1.0:0.0	.	131	Q13258	PD2R_HUMAN	L	131	ENSP00000303424:W131L;ENSP00000452408:W131L	ENSP00000303424:W131L	W	+	2	0	PTGDR	51804674	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.714000	0.61902	2.549000	0.85964	0.563000	0.77884	TGG	-	HMMPfam_7tm_1		0.622	PTGDR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTGDR	protein_coding	OTTHUMT00000276889.1	G	NM_000953		51804674	1	no_errors	NM_000953	genbank	human	reviewed	54_36p	missense	SNP	1	T
CDCA4	55038	genome.wustl.edu	37	14	105478068	105478068	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr14:105478068G>A	ENST00000336219.3	-	2	354	c.199C>T	c.(199-201)Cgg>Tgg	p.R67W	CDCA4_ENST00000392590.3_Missense_Mutation_p.R67W	NM_017955.3	NP_060425.2	Q9BXL8	CDCA4_HUMAN	cell division cycle associated 4	67	SERTA. {ECO:0000255|PROSITE- ProRule:PRU00396}.					nucleus (GO:0005634)		p.R67W(1)		endometrium(1)|large_intestine(2)|lung(2)|ovary(1)	6		all_cancers(154;0.0798)|Melanoma(154;0.155)|all_epithelial(191;0.183)	OV - Ovarian serous cystadenocarcinoma(23;0.00778)|all cancers(16;0.00936)|Epithelial(46;0.0227)	Epithelial(152;0.142)		TGGATCTGCCGGACCGTGTTG	0.632																																																1	Substitution - Missense(1)	ovary(1)	14											57.0	45.0	49.0					14																	105478068		2203	4300	6503	104549113	SO:0001583	missense	55038			BG354577	CCDS9996.1	14q32.33	2014-02-14			ENSG00000170779	ENSG00000170779			14625	protein-coding gene	gene with protein product	"""hematopoietic progenitor protein"""	612270				12188893	Standard	NM_145701		Approved	FLJ20764, Hepp	uc001yqb.2	Q9BXL8	OTTHUMG00000170767	ENST00000336219.3:c.199C>T	14.37:g.105478068G>A	ENSP00000337226:p.Arg67Trp		104549113	Q8TB18|Q9NWK7	Missense_Mutation	SNP	HMMPfam_SERTA	p.R67W	ENST00000336219.3	37	c.199	CCDS9996.1	14	.	.	.	.	.	.	.	.	.	.	G	17.70	3.453546	0.63290	.	.	ENSG00000170779	ENST00000336219;ENST00000392590	T;T	0.41758	0.99;0.99	4.56	1.36	0.22044	.	0.125699	0.53938	D	0.000060	T	0.54565	0.1866	L	0.56199	1.76	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.54450	-0.8292	10	0.87932	D	0	0.0	9.7907	0.40704	0.0:0.1337:0.5914:0.2749	.	67	Q9BXL8	CDCA4_HUMAN	W	67	ENSP00000337226:R67W;ENSP00000376369:R67W	ENSP00000337226:R67W	R	-	1	2	CDCA4	104549113	1.000000	0.71417	0.892000	0.35008	0.638000	0.38207	5.784000	0.68990	0.433000	0.26313	-0.165000	0.13383	CGG	-	HMMPfam_SERTA		0.632	CDCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDCA4	protein_coding	OTTHUMT00000410311.1	G	NM_145701		104549113	-1	no_errors	NM_017955	genbank	human	reviewed	54_36p	missense	SNP	0.999	A
TUBGCP4	27229	genome.wustl.edu	37	15	43689444	43689444	+	Missense_Mutation	SNP	A	A	C			TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	A	A	A	C	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr15:43689444A>C	ENST00000260383.7	+	12	1458	c.1204A>C	c.(1204-1206)Aag>Cag	p.K402Q	TUBGCP4_ENST00000399460.3_Missense_Mutation_p.K266Q|TUBGCP4_ENST00000564079.1_Missense_Mutation_p.K402Q			Q9UGJ1	GCP4_HUMAN	tubulin, gamma complex associated protein 4	402					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)|protein complex assembly (GO:0006461)	centrosome (GO:0005813)|cytosol (GO:0005829)|gamma-tubulin ring complex (GO:0008274)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|spindle pole (GO:0000922)	structural constituent of cytoskeleton (GO:0005200)	p.K402Q(1)		breast(1)|cervix(2)|endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(4)|prostate(2)|upper_aerodigestive_tract(2)	21		all_cancers(109;1.27e-10)|all_epithelial(112;4.82e-09)|Lung NSC(122;1.72e-06)|all_lung(180;1.59e-05)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;3.53e-07)		GTCAGCACACAAGGTATTGCT	0.493																																																1	Substitution - Missense(1)	ovary(1)	15											176.0	177.0	177.0					15																	43689444		2134	4244	6378	41476736	SO:0001583	missense	27229			AJ249677	CCDS42030.1, CCDS66745.1	15q15.3	2014-08-12			ENSG00000137822	ENSG00000137822			16691	protein-coding gene	gene with protein product		609610				10562286	Standard	NM_001286414		Approved	76P, FLJ14797	uc001zrn.3	Q9UGJ1	OTTHUMG00000176647	ENST00000260383.7:c.1204A>C	15.37:g.43689444A>C	ENSP00000260383:p.Lys402Gln		41476736	B3KNK6|Q969X3|Q9NVF0	Missense_Mutation	SNP	-	p.K402Q	ENST00000260383.7	37	c.1204		15	.	.	.	.	.	.	.	.	.	.	A	24.4	4.532558	0.85812	.	.	ENSG00000137822	ENST00000260383;ENST00000399460	T;T	0.07567	3.18;3.18	5.64	4.51	0.55191	.	0.041966	0.85682	D	0.000000	T	0.12860	0.0312	M	0.71871	2.18	0.47621	D	0.999473	P;P	0.41848	0.763;0.516	B;B	0.43194	0.411;0.287	T	0.03403	-1.1040	10	0.26408	T	0.33	-20.5908	10.5849	0.45278	0.9246:0.0:0.0754:0.0	.	402;402	Q9UGJ1;Q9UGJ1-2	GCP4_HUMAN;.	Q	402;266	ENSP00000260383:K402Q;ENSP00000382387:K266Q	ENSP00000260383:K402Q	K	+	1	0	TUBGCP4	41476736	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	7.243000	0.78219	2.272000	0.75746	0.460000	0.39030	AAG	-	NULL		0.493	TUBGCP4-001	KNOWN	basic|appris_candidate_longest	protein_coding	TUBGCP4	protein_coding	OTTHUMT00000432970.1	A	NM_014444		41476736	1	no_errors	NM_014444	genbank	human	provisional	54_36p	missense	SNP	1	C
SHC4	399694	genome.wustl.edu	37	15	49127214	49127214	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	G	G	T	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr15:49127214G>T	ENST00000332408.4	-	11	1917	c.1489C>A	c.(1489-1491)Cca>Aca	p.P497T	SHC4_ENST00000537958.1_Missense_Mutation_p.P211T|SHC4_ENST00000396535.3_Missense_Mutation_p.P254T	NM_203349.3	NP_976224.3	Q6S5L8	SHC4_HUMAN	SHC (Src homology 2 domain containing) family, member 4	497	CH1.				apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|positive regulation of cell proliferation (GO:0008284)|regulation of gene expression (GO:0010468)|stem cell differentiation (GO:0048863)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)		p.P497T(1)		breast(1)|endometrium(2)|large_intestine(8)|lung(11)|ovary(3)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)	29		all_lung(180;0.00466)		all cancers(107;9.4e-08)|GBM - Glioblastoma multiforme(94;5.94e-07)		ACAGTTTCTGGTGCCTCTGAA	0.468																																																1	Substitution - Missense(1)	ovary(1)	15											40.0	35.0	37.0					15																	49127214		2197	4295	6492	46914506	SO:0001583	missense	399694			AY358250	CCDS10130.1	15q21.1-q21.2	2013-02-14			ENSG00000185634	ENSG00000185634		"""SH2 domain containing"""	16743	protein-coding gene	gene with protein product	"""rai-like protein"""						Standard	NM_203349		Approved	RaLP	uc001zxb.1	Q6S5L8	OTTHUMG00000131513	ENST00000332408.4:c.1489C>A	15.37:g.49127214G>T	ENSP00000329668:p.Pro497Thr		46914506	Q6UXQ3|Q8IYW3	Missense_Mutation	SNP	HMMPfam_SH2;HMMPfam_PID;superfamily_PH domain-like;superfamily_SH2 domain	p.P497T	ENST00000332408.4	37	c.1489	CCDS10130.1	15	.	.	.	.	.	.	.	.	.	.	G	11.49	1.653506	0.29425	.	.	ENSG00000185634	ENST00000332408;ENST00000396535;ENST00000537958	T;T;T	0.30981	3.51;1.51;1.52	4.76	4.76	0.60689	.	0.170764	0.41605	D	0.000842	T	0.23014	0.0556	L	0.39898	1.24	0.46927	D	0.999257	B;B	0.23249	0.082;0.048	B;B	0.21708	0.036;0.028	T	0.03945	-1.0990	10	0.10377	T	0.69	-23.2345	12.1432	0.54008	0.0:0.0:0.8293:0.1707	.	254;497	Q6S5L8-2;Q6S5L8	.;SHC4_HUMAN	T	497;254;211	ENSP00000329668:P497T;ENSP00000379786:P254T;ENSP00000443300:P211T	ENSP00000329668:P497T	P	-	1	0	SHC4	46914506	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	2.117000	0.41939	2.473000	0.83533	0.467000	0.42956	CCA	-	NULL		0.468	SHC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHC4	protein_coding	OTTHUMT00000254371.1	G	NM_203349		46914506	-1	no_errors	NM_203349	genbank	human	validated	54_36p	missense	SNP	1	T
TLN2	83660	genome.wustl.edu	37	15	63131054	63131054	+	Splice_Site	SNP	G	G	A			TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr15:63131054G>A	ENST00000561311.1	+	57	7604		c.e57-1		RP11-1069G10.1_ENST00000558404.1_RNA|TLN2_ENST00000306829.6_Splice_Site			Q9Y4G6	TLN2_HUMAN	talin 2						cell adhesion (GO:0007155)|cell-cell junction assembly (GO:0007043)|cytoskeletal anchoring at plasma membrane (GO:0007016)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	actin binding (GO:0003779)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.?(1)		NS(3)|breast(6)|central_nervous_system(3)|endometrium(8)|kidney(8)|large_intestine(20)|lung(34)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)	99						TCACTCTCCAGGCGGCAGGAA	0.448																																																1	Unknown(1)	ovary(1)	15											92.0	88.0	90.0					15																	63131054		2203	4300	6503	60918107	SO:0001630	splice_region_variant	83660			AB002318	CCDS32261.1	15q15-q21	2008-07-03			ENSG00000171914	ENSG00000171914			15447	protein-coding gene	gene with protein product		607349				9205841, 11527381	Standard	NM_015059		Approved	KIAA0320, ILWEQ	uc002alb.4	Q9Y4G6	OTTHUMG00000133679	ENST00000561311.1:c.7375-1G>A	15.37:g.63131054G>A			60918107	A6NLB8	Splice_Site	SNP	-	e55-1	ENST00000561311.1	37	c.7375-1	CCDS32261.1	15	.	.	.	.	.	.	.	.	.	.	G	25.2	4.616834	0.87359	.	.	ENSG00000171914	ENST00000306829	.	.	.	5.68	5.68	0.88126	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.786	0.96437	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TLN2	60918107	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.813000	0.99286	2.676000	0.91093	0.563000	0.77884	.	-	-		0.448	TLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLN2	protein_coding	OTTHUMT00000257878.2	G		Intron	60918107	1	no_errors	NM_015059	genbank	human	reviewed	54_36p	splice_site	SNP	1	A
ZNF592	9640	genome.wustl.edu	37	15	85342397	85342397	+	Silent	SNP	C	C	T			TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr15:85342397C>T	ENST00000560079.2	+	9	3381	c.3093C>T	c.(3091-3093)caC>caT	p.H1031H	ZNF592_ENST00000299927.3_Silent_p.H1031H	NM_014630.2	NP_055445.2	Q92610	ZN592_HUMAN	zinc finger protein 592	1031					cell death (GO:0008219)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.H1031H(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(2)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(143;0.0587)			TGCGCAAACACATCCGCAACA	0.537																																																1	Substitution - coding silent(1)	ovary(1)	15											240.0	218.0	226.0					15																	85342397		2203	4299	6502	83143401	SO:0001819	synonymous_variant	9640			D86966	CCDS32317.1	15q25.2	2011-03-15				ENSG00000166716		"""Zinc fingers, C2H2-type"""	28986	protein-coding gene	gene with protein product		613624	"""spinocerebellar ataxia, autosomal recessive 5"""	SCAR5		9039502, 12030328, 20531441	Standard	NM_014630		Approved	KIAA0211, CAMOS	uc002bld.3	Q92610		ENST00000560079.2:c.3093C>T	15.37:g.85342397C>T			83143401	Q2M1T2|Q504Y9	Silent	SNP	superfamily_C2H2 and C2HC zinc fingers;HMMPfam_zf-C2H2;superfamily_Multiheme cytochromes	p.H1031	ENST00000560079.2	37	c.3093	CCDS32317.1	15																																																																																			-	HMMPfam_zf-C2H2		0.537	ZNF592-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF592	protein_coding	OTTHUMT00000418779.2	C	NM_014630		83143401	1	no_errors	NM_014630	genbank	human	validated	54_36p	silent	SNP	1	T
MYH4	4622	genome.wustl.edu	37	17	10362708	10362708	+	Missense_Mutation	SNP	A	A	C			TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	A	A	A	C	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr17:10362708A>C	ENST00000255381.2	-	15	1557	c.1447T>G	c.(1447-1449)Ttc>Gtc	p.F483V	RP11-799N11.1_ENST00000581304.1_RNA|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000399342.2_RNA	NM_017533.2	NP_060003.2	Q9Y623	MYH4_HUMAN	myosin, heavy chain 4, skeletal muscle	483	Myosin motor.				actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to activity (GO:0014823)	muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|microfilament motor activity (GO:0000146)	p.F483V(1)		NS(4)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(72)|ovary(10)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	149						TCGTTGGTGAAGTTGATGCAC	0.408																																																1	Substitution - Missense(1)	ovary(1)	17											155.0	136.0	142.0					17																	10362708		2203	4300	6503	10303433	SO:0001583	missense	4622				CCDS11154.1	17p13.1	2013-09-19	2006-09-29		ENSG00000264424	ENSG00000264424		"""Myosins / Myosin superfamily : Class II"""	7574	protein-coding gene	gene with protein product		160742	"""myosin, heavy polypeptide 4, skeletal muscle"""			8518795	Standard	NM_017533		Approved	MYH2B, MyHC-2B, MyHC-IIb	uc002gmn.3	Q9Y623	OTTHUMG00000130365	ENST00000255381.2:c.1447T>G	17.37:g.10362708A>C	ENSP00000255381:p.Phe483Val		10303433		Missense_Mutation	SNP	HMMPfam_IQ;HMMPfam_Myosin_head;HMMPfam_Myosin_tail_1;HMMPfam_Myosin_N;superfamily_Prefoldin;superfamily_Spectrin repeat;superfamily_P-loop containing nucleoside triphosphate hydrolases	p.F483V	ENST00000255381.2	37	c.1447	CCDS11154.1	17	.	.	.	.	.	.	.	.	.	.	A	28.0	4.878970	0.91740	.	.	ENSG00000141048	ENST00000255381	T	0.72051	-0.62	5.57	5.57	0.84162	Myosin head, motor domain (3);	0.000000	0.39475	U	0.001344	D	0.87985	0.6316	M	0.92219	3.285	0.80722	D	1	B	0.32604	0.377	P	0.55545	0.778	D	0.89083	0.3477	10	0.87932	D	0	.	16.0284	0.80558	1.0:0.0:0.0:0.0	.	483	Q9Y623	MYH4_HUMAN	V	483	ENSP00000255381:F483V	ENSP00000255381:F483V	F	-	1	0	MYH4	10303433	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.199000	0.95003	2.253000	0.74438	0.533000	0.62120	TTC	-	HMMPfam_Myosin_head		0.408	MYH4-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	MYH4	protein_coding	OTTHUMT00000252731.1	A	NM_017533		10303433	-1	no_errors	NM_017533	genbank	human	validated	54_36p	missense	SNP	1	C
PITPNA	5306	genome.wustl.edu	37	17	1442213	1442213	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr17:1442213C>T	ENST00000313486.7	-	7	661	c.406G>A	c.(406-408)Gtg>Atg	p.V136M	PITPNA_ENST00000539476.1_Missense_Mutation_p.V136M	NM_006224.3	NP_006215.1	Q00169	PIPNA_HUMAN	phosphatidylinositol transfer protein, alpha	136					axon guidance (GO:0007411)|lipid metabolic process (GO:0006629)|phospholipid transport (GO:0015914)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	lipid binding (GO:0008289)|phosphatidylcholine transporter activity (GO:0008525)|phosphatidylinositol transporter activity (GO:0008526)	p.V136M(1)		central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)	7				UCEC - Uterine corpus endometrioid carcinoma (25;0.0845)		ACGGCTTCCACGTGTTTCCAC	0.473																																																1	Substitution - Missense(1)	ovary(1)	17											133.0	129.0	130.0					17																	1442213		1929	4137	6066	1388963	SO:0001583	missense	5306			M73704	CCDS45563.1	17p13.3	2012-06-29	2003-05-09	2004-09-03	ENSG00000174238	ENSG00000174238			9001	protein-coding gene	gene with protein product		600174	"""phosphotidylinositol transfer protein"""	PITPN		8255295	Standard	NM_006224		Approved	VIB1A	uc021tnf.1	Q00169	OTTHUMG00000177779	ENST00000313486.7:c.406G>A	17.37:g.1442213C>T	ENSP00000316809:p.Val136Met		1388963		Missense_Mutation	SNP	-	p.V136M	ENST00000313486.7	37	c.406	CCDS45563.1	17	.	.	.	.	.	.	.	.	.	.	C	22.1	4.239042	0.79800	.	.	ENSG00000174238	ENST00000539476;ENST00000313486;ENST00000539870	T;T	0.48201	0.82;0.82	5.98	5.02	0.67125	START-like domain (1);	0.118428	0.56097	D	0.000024	T	0.71710	0.3372	M	0.86805	2.84	0.58432	D	0.999999	D;D	0.89917	0.981;1.0	P;D	0.91635	0.907;0.999	T	0.76263	-0.3023	10	0.52906	T	0.07	.	13.7036	0.62624	0.0:0.9259:0.0:0.0741	.	63;136	B4E1U1;Q00169	.;PIPNA_HUMAN	M	136;136;63	ENSP00000441869:V136M;ENSP00000316809:V136M	ENSP00000316809:V136M	V	-	1	0	PITPNA	1388963	1.000000	0.71417	0.997000	0.53966	0.754000	0.42855	6.017000	0.70805	1.541000	0.49316	0.591000	0.81541	GTG	-	NULL		0.473	PITPNA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PITPNA	protein_coding	OTTHUMT00000438927.3	C			1388963	-1	no_errors	NM_006224	genbank	human	validated	54_36p	missense	SNP	1	T
MYH1	4619	genome.wustl.edu	37	17	10408742	10408742	+	Missense_Mutation	SNP	T	T	A			TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr17:10408742T>A	ENST00000226207.5	-	20	2355	c.2261A>T	c.(2260-2262)gAc>gTc	p.D754V	RP11-799N11.1_ENST00000581304.1_RNA|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000399342.2_RNA	NM_005963.3	NP_005954.3	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	754	Myosin motor.				muscle contraction (GO:0006936)	A band (GO:0031672)|cytoplasmic ribonucleoprotein granule (GO:0036464)|intercalated disc (GO:0014704)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.D754V(1)		NS(7)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(22)|lung(78)|ovary(11)|pancreas(1)|prostate(3)|skin(13)|upper_aerodigestive_tract(4)|urinary_tract(5)	176						GTGGTCAATGTCAATGGACCC	0.403																																																1	Substitution - Missense(1)	ovary(1)	17											118.0	115.0	116.0					17																	10408742		2203	4300	6503	10349467	SO:0001583	missense	4619				CCDS11155.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109061	ENSG00000109061		"""Myosins / Myosin superfamily : Class II"""	7567	protein-coding gene	gene with protein product	"""myosin heavy chain IIx/d"""	160730	"""myosin, heavy polypeptide 1, skeletal muscle, adult"""			6304733	Standard	NM_005963		Approved	MYHSA1, MYHa, MyHC-2X/D, MGC133384	uc002gmo.3	P12882	OTTHUMG00000130362	ENST00000226207.5:c.2261A>T	17.37:g.10408742T>A	ENSP00000226207:p.Asp754Val		10349467	Q14CA4|Q9Y622	Missense_Mutation	SNP	HMMPfam_IQ;HMMPfam_Myosin_head;HMMPfam_Myosin_tail_1;HMMPfam_Myosin_N;superfamily_Prefoldin;superfamily_tRNA-binding arm;superfamily_P-loop containing nucleoside triphosphate hydrolases	p.D754V	ENST00000226207.5	37	c.2261	CCDS11155.1	17	.	.	.	.	.	.	.	.	.	.	T	15.54	2.864434	0.51482	.	.	ENSG00000109061	ENST00000226207	D	0.87650	-2.28	5.47	5.47	0.80525	Myosin head, motor domain (2);	0.000000	0.44902	U	0.000417	D	0.90542	0.7036	M	0.80183	2.485	0.80722	D	1	B	0.22211	0.066	B	0.38296	0.27	D	0.89546	0.3796	10	0.87932	D	0	.	15.8518	0.78937	0.0:0.0:0.0:1.0	.	754	P12882	MYH1_HUMAN	V	754	ENSP00000226207:D754V	ENSP00000226207:D754V	D	-	2	0	MYH1	10349467	1.000000	0.71417	0.115000	0.21578	0.076000	0.17211	7.827000	0.86722	2.216000	0.71823	0.528000	0.53228	GAC	-	HMMPfam_Myosin_head		0.403	MYH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH1	protein_coding	OTTHUMT00000252725.1	T	NM_005963		10349467	-1	no_errors	NM_005963	genbank	human	reviewed	54_36p	missense	SNP	0.98	A
WFIKKN2	124857	genome.wustl.edu	37	17	48917135	48917135	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr17:48917135G>C	ENST00000311378.4	+	2	1014	c.486G>C	c.(484-486)gaG>gaC	p.E162D	WFIKKN2_ENST00000426127.1_Missense_Mutation_p.E69D|RP11-506D12.5_ENST00000572491.2_RNA	NM_175575.5	NP_783165.1	Q8TEU8	WFKN2_HUMAN	WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 2	162	Kazal-like. {ECO:0000255|PROSITE- ProRule:PRU00798}.				muscle fiber development (GO:0048747)|negative regulation of DNA binding (GO:0043392)|negative regulation of protein binding (GO:0032091)|palate development (GO:0060021)|skeletal system development (GO:0001501)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular region (GO:0005576)	metalloendopeptidase inhibitor activity (GO:0008191)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.E162D(1)		cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(13)|ovary(4)|skin(1)	29			BRCA - Breast invasive adenocarcinoma(22;1.09e-08)			TGGATGCCGAGGCCTGCTCCA	0.602																																																1	Substitution - Missense(1)	ovary(1)	17											103.0	94.0	97.0					17																	48917135		2203	4300	6503	46272134	SO:0001583	missense	124857			AY358142	CCDS11575.1	17q21.33	2013-01-21			ENSG00000173714	ENSG00000173714		"""Immunoglobulin superfamily / I-set domain containing"", ""WAP four-disulfide core domain containing"""	30916	protein-coding gene	gene with protein product	"""WAP four-disulfide core domain 20B"""	610895				11928817, 12709070	Standard	NM_175575		Approved	WFIKKNRP, WFDC20B	uc002isv.4	Q8TEU8	OTTHUMG00000162274	ENST00000311378.4:c.486G>C	17.37:g.48917135G>C	ENSP00000311184:p.Glu162Asp		46272134	Q6UXZ9	Missense_Mutation	SNP	HMMPfam_Kunitz_BPTI;superfamily_BPTI-like;HMMPfam_WAP;superfamily_Elafin-like;superfamily_TIMP-like;HMMPfam_Kazal_2;HMMPfam_I-set;superfamily_Kazal-type serine protease inhibitors;superfamily_Immunoglobulin	p.E162D	ENST00000311378.4	37	c.486	CCDS11575.1	17	.	.	.	.	.	.	.	.	.	.	G	17.81	3.481908	0.63849	.	.	ENSG00000173714	ENST00000426127;ENST00000311378	T;T	0.05996	3.36;3.36	5.25	0.825	0.18824	Proteinase inhibitor I1, Kazal (1);Protease inhibitor, Kazal-type (1);	0.000000	0.85682	D	0.000000	T	0.18383	0.0441	M	0.61703	1.905	0.51233	D	0.999918	D	0.76494	0.999	D	0.76575	0.988	T	0.00284	-1.1848	10	0.66056	D	0.02	.	11.2218	0.48860	0.3825:0.0:0.6175:0.0	.	162	Q8TEU8	WFKN2_HUMAN	D	69;162	ENSP00000405889:E69D;ENSP00000311184:E162D	ENSP00000311184:E162D	E	+	3	2	WFIKKN2	46272134	1.000000	0.71417	0.997000	0.53966	0.996000	0.88848	1.106000	0.31098	0.197000	0.20387	0.651000	0.88453	GAG	-	HMMPfam_Kazal_2		0.602	WFIKKN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WFIKKN2	protein_coding	OTTHUMT00000368358.1	G	NM_175575		46272134	1	no_errors	NM_175575	genbank	human	reviewed	54_36p	missense	SNP	1	C
PPM1E	22843	genome.wustl.edu	37	17	57043102	57043103	+	Missense_Mutation	DNP	GA	GA	AG			TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	GA	GA	GA	AG	GA	GA	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr17:57043102_57043103GA>AG	ENST00000308249.2	+	3	760_761	c.631_632GA>AG	c.(631-633)GAg>AGg	p.E211R	RP11-579O24.3_ENST00000582080.1_RNA	NM_014906.4	NP_055721.3	Q96MI6	PPM1M_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1E	0					protein dephosphorylation (GO:0006470)	nucleus (GO:0005634)	CTD phosphatase activity (GO:0008420)|manganese ion binding (GO:0030145)	p.E211K(1)		biliary_tract(1)|breast(3)|endometrium(4)|kidney(2)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(2)	33	Medulloblastoma(34;0.127)|all_neural(34;0.237)		BRCA - Breast invasive adenocarcinoma(1;5.76e-11)			CAAACTACACGAGATTTGCTGC	0.46																																																1	Substitution - Missense(1)	large_intestine(1)	17																																								54397885	SO:0001583	missense	22843			AB028995	CCDS11613.1	17q24.2	2012-04-17	2010-03-05		ENSG00000175175	ENSG00000175175		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	19322	protein-coding gene	gene with protein product	"""partner of PIX 1"", ""nuclear calmodulin-dependent protein kinase phosphatase"""		"""protein phosphatase 1E (PP2C domain containing)"""			11864573, 10470851	Standard	NR_048561		Approved	POPX1, KIAA1072, PP2CH, CaMKP-N	uc002iwx.4	Q8WY54		Exception_encountered	17.37:g.57043102_57043103delinsAG	ENSP00000312411:p.Glu211Arg		54397884	Q8N8J9|Q96DB8	Missense_Mutation	DNP	HMMPfam_PP2C;superfamily_Protein serine/threonine phosphatase 2C catalytic domain	p.E211R	ENST00000308249.2	37	c.631_632	CCDS11613.1	17																																																																																			-	NULL		0.460	PPM1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPM1E	protein_coding	OTTHUMT00000445458.1	GA	NM_014906		54397885	1	no_errors	NM_014906	genbank	human	reviewed	54_36p	missense	DNP	1.000:1.000	AG
TP53	7157	genome.wustl.edu	37	17	7578505	7578511	+	Frame_Shift_Del	DEL	GGGCAGG	GGGCAGG	-	rs587781288		TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	GGGCAGG	GGGCAGG	GGGCAGG	-	GGGCAGG	GGGCAGG	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr17:7578505_7578511delGGGCAGG	ENST00000269305.4	-	5	608_614	c.419_425delCCTGCCC	c.(418-426)acctgccctfs	p.TCP140fs	TP53_ENST00000359597.4_Frame_Shift_Del_p.TCP140fs|TP53_ENST00000445888.2_Frame_Shift_Del_p.TCP140fs|TP53_ENST00000413465.2_Frame_Shift_Del_p.TCP140fs|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Frame_Shift_Del_p.TCP140fs|TP53_ENST00000455263.2_Frame_Shift_Del_p.TCP140fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	140	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		T -> A (in sporadic cancers; somatic mutation).|T -> I (in sporadic cancers; somatic mutation).|T -> N (in a sporadic cancer; somatic mutation).|T -> P (in a sporadic cancer; somatic mutation).|T -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.C141Y(79)|p.C141R(13)|p.C141W(13)|p.T140I(12)|p.C141*(11)|p.P142L(8)|p.0?(8)|p.T140T(6)|p.C9Y(5)|p.C48Y(5)|p.C141S(5)|p.A138_P142delAKTCP(4)|p.C141C(4)|p.C141F(4)|p.K139_T140delKT(3)|p.P142H(3)|p.C141fs*29(3)|p.P142F(2)|p.P142A(2)|p.P142T(2)|p.P142S(2)|p.N131fs*27(2)|p.P142fs*28(2)|p.C141fs*8(2)|p.L137_W146del10(1)|p.P142_Q144delPVQ(1)|p.K139fs*4(1)|p.A45_P49delAKTCP(1)|p.K7_T8delKT(1)|p.T140fs*9(1)|p.K46_T47delKT(1)|p.C141fs*34(1)|p.C141fs*30(1)|p.A6_P10delAKTCP(1)|p.A138_V143delAKTCPV(1)|p.T140N(1)|p.C48S(1)|p.C48R(1)|p.C48W(1)|p.C9S(1)|p.C9R(1)|p.C9W(1)|p.C135_T140delCQLAKT(1)|p.C141A(1)|p.C141G(1)|p.C141_P142insXX(1)|p.K139_C141>N(1)|p.K139fs*29(1)|p.T140fs*28(1)|p.C141fs*5(1)|p.P142del(1)|p.P142fs*7(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CAGCTGCACAGGGCAGGTCTTGGCCAG	0.575		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	228	Substitution - Missense(164)|Deletion - In frame(16)|Substitution - Nonsense(11)|Deletion - Frameshift(10)|Substitution - coding silent(10)|Whole gene deletion(8)|Insertion - Frameshift(6)|Insertion - In frame(1)|Complex - frameshift(1)|Complex - deletion inframe(1)	large_intestine(37)|ovary(24)|breast(23)|lung(17)|oesophagus(14)|haematopoietic_and_lymphoid_tissue(14)|central_nervous_system(11)|upper_aerodigestive_tract(11)|stomach(11)|liver(11)|urinary_tract(9)|prostate(8)|skin(7)|endometrium(6)|NS(5)|bone(5)|biliary_tract(4)|testis(3)|soft_tissue(2)|pancreas(2)|vulva(1)|kidney(1)|eye(1)|genital_tract(1)	17	GRCh37	CM993216	TP53	M																																				7519236	SO:0001589	frameshift_variant	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.419_425delCCTGCCC	17.37:g.7578505_7578511delGGGCAGG	ENSP00000269305:p.Thr140fs		7519230	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	superfamily_p53-like transcription factors;superfamily_p53 tetramerization domain;P53_tetramer;HMMPfam_P53_tetramer;P53;HMMPfam_P53;P53_TAD;HMMPfam_P53_TAD	p.T140fs	ENST00000269305.4	37	c.425_419	CCDS11118.1	17																																																																																			(deletion:cds_exon[7519096;7519279])	HMMPfam_P53		0.575	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	GGGCAGG	NM_000546		7519236	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	frame_shift_del	DEL	0.999:1.000:1.000:1.000:1.000:0.996:1.000	-
DNAH2	146754	genome.wustl.edu	37	17	7660424	7660424	+	Silent	SNP	C	C	G			TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr17:7660424C>G	ENST00000572933.1	+	13	3380	c.1920C>G	c.(1918-1920)ctC>ctG	p.L640L	RPL29P2_ENST00000498671.1_RNA|DNAH2_ENST00000389173.2_Silent_p.L640L			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	640	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.L640L(1)		NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				TTCTGATTCTCTTTGCGGAAA	0.557																																																1	Substitution - coding silent(1)	ovary(1)	17											195.0	191.0	192.0					17																	7660424		2203	4300	6503	7601149	SO:0001819	synonymous_variant	146754			U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.1920C>G	17.37:g.7660424C>G			7601149	A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Silent	SNP	HMMPfam_Dynein_heavy;HMMPfam_AAA_5;HMMPfam_DHC_N1;HMMPfam_DHC_N2;superfamily_Spectrin repeat;superfamily_P-loop containing nucleoside triphosphate hydrolases	p.L640	ENST00000572933.1	37	c.1920	CCDS32551.1	17																																																																																			-	HMMPfam_DHC_N1		0.557	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH2	protein_coding	OTTHUMT00000440241.1	C	NM_020877		7601149	1	no_errors	NM_020877	genbank	human	validated	54_36p	silent	SNP	1	G
GPRC5C	55890	genome.wustl.edu	37	17	72435976	72435976	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr17:72435976G>A	ENST00000481232.1	+	2	707	c.196G>A	c.(196-198)Gcc>Acc	p.A66T	GPRC5C_ENST00000392629.2_Missense_Mutation_p.A33T|GPRC5C_ENST00000342648.5_Intron|GPRC5C_ENST00000392627.1_Missense_Mutation_p.A66T			Q9NQ84	GPC5C_HUMAN	G protein-coupled receptor, class C, group 5, member C	21					G-protein coupled receptor signaling pathway (GO:0007186)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|receptor complex (GO:0043235)|vesicle (GO:0031982)	G-protein coupled receptor activity (GO:0004930)	p.A66T(1)		central_nervous_system(1)|large_intestine(3)|lung(9)|ovary(2)|pancreas(1)|prostate(1)	17						GTTCCCAGGGGCCTGGGCCCA	0.652																																																1	Substitution - Missense(1)	ovary(1)	17											57.0	52.0	53.0					17																	72435976		2203	4300	6503	69947571	SO:0001583	missense	55890			AF207989	CCDS11699.1, CCDS42378.1	17q25	2014-01-30	2014-01-30		ENSG00000170412	ENSG00000170412		"""GPCR / Class C : Orphans"""	13309	protein-coding gene	gene with protein product		605949	"""G protein-coupled receptor, family C, group 5, member C"""			10945465	Standard	NM_022036		Approved	RAIG-3	uc002jkr.3	Q9NQ84	OTTHUMG00000067613	ENST00000481232.1:c.196G>A	17.37:g.72435976G>A	ENSP00000462147:p.Ala66Thr		69947571	B5BUN4|Q2NL85|Q9NZG5	Missense_Mutation	SNP	-	p.A66T	ENST00000481232.1	37	c.196		17	.	.	.	.	.	.	.	.	.	.	G	8.266	0.812290	0.16537	.	.	ENSG00000170412	ENST00000392627;ENST00000342648;ENST00000392629;ENST00000392628	T	0.18502	2.21	5.16	2.96	0.34315	.	1.331490	0.04384	N	0.361356	T	0.20700	0.0498	L	0.53249	1.67	0.09310	N	1	B;B;B;P	0.46142	0.022;0.022;0.037;0.873	B;B;B;B	0.39660	0.006;0.006;0.013;0.306	T	0.30504	-0.9976	10	0.56958	D	0.05	-4.6753	9.4826	0.38911	0.2328:0.0:0.7672:0.0	.	21;21;33;21	A8MXZ4;Q9NQ84;Q9NQ84-2;Q9BSP0	.;GPC5C_HUMAN;.;.	T	21;66;33;21	ENSP00000376405:A33T	ENSP00000340595:A66T	A	+	1	0	GPRC5C	69947571	0.016000	0.18221	0.155000	0.22561	0.772000	0.43724	0.928000	0.28831	1.179000	0.42884	0.561000	0.74099	GCC	-	NULL		0.652	GPRC5C-002	PUTATIVE	basic|exp_conf	protein_coding	GPRC5C	protein_coding	OTTHUMT00000145095.2	G			69947571	1	no_errors	NM_022036	genbank	human	reviewed	54_36p	missense	SNP		A
LOC101929963	101929963	genome.wustl.edu	37	2	177674277	177674277	+	IGR	SNP	G	G	C			TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr2:177674277G>C								AC092162.1 (46933 upstream) : AC073636.1 (36443 downstream)																							GGTGATGCAGGGATGAGCACA	0.532																																																0			2																																								177382523	SO:0001628	intergenic_variant	100131991																															2.37:g.177674277G>C			177382523		Missense_Mutation	SNP	-	p.P67R		37	c.200		2																																																																																			-	NULL	0	0.532					LOC100131991			G			177382523	-1	pseudogene	XM_001722203	genbank	human	model	54_36p	missense	SNP	0.01	C
MC2R	4158	genome.wustl.edu	37	18	13884639	13884639	+	Silent	SNP	G	G	A			TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr18:13884639G>A	ENST00000327606.3	-	2	1059	c.879C>T	c.(877-879)tgC>tgT	p.C293C		NM_000529.2	NP_000520.1	Q01718	ACTHR_HUMAN	melanocortin 2 receptor (adrenocorticotropic hormone)	293					G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|neuropeptide signaling pathway (GO:0007218)|placenta development (GO:0001890)|positive regulation of cAMP biosynthetic process (GO:0030819)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	corticotropin receptor activity (GO:0004978)|melanocortin receptor activity (GO:0004977)	p.C293C(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(10)|lung(8)|ovary(4)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	30					Corticotropin(DB01285)|Cosyntropin(DB01284)	AGTACCTGCTGCAGAAGATCA	0.473																																					Colon(141;1584 1782 35999 48227 48692)											1	Substitution - coding silent(1)	ovary(1)	18											115.0	112.0	113.0					18																	13884639		2203	4300	6503	13874639	SO:0001819	synonymous_variant	4158				CCDS11869.1	18p11.2	2012-08-10			ENSG00000185231	ENSG00000185231		"""GPCR / Class A : Melanocortin receptors"""	6930	protein-coding gene	gene with protein product		607397				8390157	Standard	NM_001291911		Approved	ACTHR	uc002ksp.1	Q01718	OTTHUMG00000131721	ENST00000327606.3:c.879C>T	18.37:g.13884639G>A			13874639	A8K016|Q3MI45|Q504X6	Silent	SNP	-	p.C293	ENST00000327606.3	37	c.879	CCDS11869.1	18																																																																																			-	NULL		0.473	MC2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MC2R	protein_coding	OTTHUMT00000254639.2	G			13874639	-1	no_errors	NM_000529	genbank	human	reviewed	54_36p	silent	SNP	0.07	A
LDLR	3949	genome.wustl.edu	37	19	11240342	11240342	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr19:11240342C>T	ENST00000558518.1	+	17	2730	c.2543C>T	c.(2542-2544)cCc>cTc	p.P848L	LDLR_ENST00000545707.1_Missense_Mutation_p.P670L|LDLR_ENST00000558013.1_Missense_Mutation_p.P848L|LDLR_ENST00000535915.1_Missense_Mutation_p.P807L|LDLR_ENST00000455727.2_Missense_Mutation_p.P680L|LDLR_ENST00000560628.1_Intron|LDLR_ENST00000557933.1_Missense_Mutation_p.P869S	NM_000527.4|NM_001195798.1	NP_000518.1|NP_001182727.1	P01130	LDLR_HUMAN	low density lipoprotein receptor	848	Required for MYLIP-triggered down- regulation of LDLR.				cholesterol homeostasis (GO:0042632)|cholesterol import (GO:0070508)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|endocytosis (GO:0006897)|intestinal cholesterol absorption (GO:0030299)|lipid metabolic process (GO:0006629)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|low-density lipoprotein particle clearance (GO:0034383)|phospholipid transport (GO:0015914)|phototransduction, visible light (GO:0007603)|positive regulation of triglyceride biosynthetic process (GO:0010867)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol homeostasis (GO:2000188)|regulation of phosphatidylcholine catabolic process (GO:0010899)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cell surface (GO:0009986)|clathrin-coated endocytic vesicle membrane (GO:0030669)|coated pit (GO:0005905)|early endosome (GO:0005769)|endosome membrane (GO:0010008)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|low-density lipoprotein particle (GO:0034362)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|glycoprotein binding (GO:0001948)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein receptor activity (GO:0005041)|very-low-density lipoprotein particle receptor activity (GO:0030229)	p.P848L(1)		breast(2)|endometrium(2)|large_intestine(5)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Lung NSC(9;0.000245)|Renal(1328;0.0007)|Hepatocellular(1079;0.0524)		GBM - Glioblastoma multiforme(1328;1.36e-05)|STAD - Stomach adenocarcinoma(1328;0.000766)|Lung(535;0.197)	Porfimer(DB00707)	TACAGCTACCCCTCGGTGAGT	0.572																																					GBM(18;201 575 7820 21545)											1	Substitution - Missense(1)	ovary(1)	19											114.0	88.0	97.0					19																	11240342		2203	4300	6503	11101342	SO:0001583	missense	3949			AY114155	CCDS12254.1, CCDS56083.1, CCDS56084.1, CCDS56085.1, CCDS58651.1	19p13.2	2014-09-17	2008-08-01		ENSG00000130164	ENSG00000130164		"""Low density lipoprotein receptors"""	6547	protein-coding gene	gene with protein product	"""familial hypercholesterolemia"""	606945					Standard	NM_000527		Approved	LDLCQ2	uc002mqk.4	P01130		ENST00000558518.1:c.2543C>T	19.37:g.11240342C>T	ENSP00000454071:p.Pro848Leu		11101342	B4DII3|B4DJZ8|B4DR00|B4DTQ3|C0JYY8|H0YLU8|H0YNT7|Q53ZD9|Q59FQ1|Q9UDH7	Missense_Mutation	SNP	HMMPfam_Ldl_recept_b;HMMPfam_Ldl_recept_a;HMMPfam_EGF;HMMPfam_EGF_CA;superfamily_EGF/Laminin;superfamily_LDL receptor-like module;superfamily_YWTD domain	p.P848L	ENST00000558518.1	37	c.2543	CCDS12254.1	19	.	.	.	.	.	.	.	.	.	.	C	22.4	4.285252	0.80803	.	.	ENSG00000130164	ENST00000252444;ENST00000545707;ENST00000535915;ENST00000455727	D;D;D	0.97906	-4.6;-3.6;-3.69	4.82	4.82	0.62117	Growth factor, receptor (1);	0.000000	0.50627	D	0.000103	D	0.98588	0.9528	M	0.77406	2.37	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0	D	0.99823	1.1048	10	0.87932	D	0	.	17.0233	0.86439	0.0:1.0:0.0:0.0	.	680;670;727;807;860;848	B4DR00;B4DJZ8;B4DII3;B4DTQ3;Q59FQ1;P01130	.;.;.;.;.;LDLR_HUMAN	L	848;670;807;680	ENSP00000437639:P670L;ENSP00000440520:P807L;ENSP00000397829:P680L	ENSP00000252444:P848L	P	+	2	0	LDLR	11101342	1.000000	0.71417	1.000000	0.80357	0.582000	0.36321	7.292000	0.78731	2.389000	0.81357	0.563000	0.77884	CCC	-	NULL		0.572	LDLR-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LDLR	protein_coding	OTTHUMT00000415973.2	C			11101342	1	no_errors	NM_000527	genbank	human	reviewed	54_36p	missense	SNP	1	T
DDX39A	10212	genome.wustl.edu	37	19	14521893	14521893	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr19:14521893C>T	ENST00000242776.4	-	5	622	c.521G>A	c.(520-522)cGc>cAc	p.R174H	DDX39A_ENST00000592927.1_5'UTR|DDX39A_ENST00000454233.2_Missense_Mutation_p.R174H|CTC-548K16.5_ENST00000590626.1_RNA	NM_005804.3	NP_005795.2	O00148	DX39A_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 39A	174	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)	p.R174H(1)		NS(1)|endometrium(5)|kidney(1)|lung(2)|ovary(1)|pancreas(1)	11						CGCCAGGATGCGGCCCGGGGT	0.552																																																1	Substitution - Missense(1)	ovary(1)	19											104.0	103.0	103.0					19																	14521893		2203	4300	6503	14382893	SO:0001583	missense	10212			U90426	CCDS12308.1	19p13.12	2011-02-08	2011-02-08	2011-02-08	ENSG00000123136	ENSG00000123136		"""DEAD-boxes"""	17821	protein-coding gene	gene with protein product	"""UAP56-related helicase, 49 kDa"""		"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 39"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 39"""	DDX39		7601445	Standard	NM_005804		Approved	DDXL, BAT1L, URH49	uc002myo.3	O00148		ENST00000242776.4:c.521G>A	19.37:g.14521893C>T	ENSP00000242776:p.Arg174His		14382893	Q8N5M0|Q9BVP6|Q9H5W0	Missense_Mutation	SNP	HMMPfam_Helicase_C;HMMPfam_DEAD;superfamily_P-loop containing nucleoside triphosphate hydrolases	p.R174H	ENST00000242776.4	37	c.521	CCDS12308.1	19	.	.	.	.	.	.	.	.	.	.	C	28.5	4.924289	0.92319	.	.	ENSG00000123136	ENST00000451994;ENST00000242776;ENST00000324340;ENST00000454233	T;T;T	0.54479	2.11;0.57;0.57	4.73	4.73	0.59995	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.82426	0.5034	H	0.97896	4.1	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.993	D	0.89265	0.3600	10	0.87932	D	0	-27.288	15.2086	0.73198	0.0:1.0:0.0:0.0	.	174;174	B1Q2N1;O00148	.;DX39A_HUMAN	H	217;174;174;174	ENSP00000242776:R174H;ENSP00000322749:R174H;ENSP00000392929:R174H	ENSP00000242776:R174H	R	-	2	0	DDX39A	14382893	1.000000	0.71417	0.992000	0.48379	0.973000	0.67179	7.205000	0.77881	2.172000	0.68678	0.655000	0.94253	CGC	-	HMMPfam_DEAD		0.552	DDX39A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX39	protein_coding	OTTHUMT00000459880.1	C	NM_138998		14382893	-1	no_errors	NM_005804	genbank	human	reviewed	54_36p	missense	SNP	1	T
ZNF224	7767	genome.wustl.edu	37	19	44611668	44611668	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr19:44611668G>T	ENST00000336976.6	+	6	1609	c.1355G>T	c.(1354-1356)gGa>gTa	p.G452V	AC084219.4_ENST00000592946.1_RNA	NM_013398.2	NP_037530.2	Q9NZL3	ZN224_HUMAN	zinc finger protein 224	452					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nuclear membrane (GO:0031965)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G452V(1)		NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(2)|ovary(2)|prostate(1)|stomach(2)|urinary_tract(1)	19		Prostate(69;0.0435)				GTCCATACAGGAGAGAAACTG	0.453																																																1	Substitution - Missense(1)	ovary(1)	19											76.0	80.0	79.0					19																	44611668		2203	4300	6503	49303508	SO:0001583	missense	7767			AF187990	CCDS33046.1	19q13.2	2013-01-08	2004-02-13			ENSG00000267680		"""Zinc fingers, C2H2-type"", ""-"""	13017	protein-coding gene	gene with protein product		194555	"""zinc finger protein 255"", ""zinc finger protein 27"""	ZNF255, ZNF27			Standard	NM_013398		Approved	BMZF-2, KOX22	uc002oyh.2	Q9NZL3		ENST00000336976.6:c.1355G>T	19.37:g.44611668G>T	ENSP00000337368:p.Gly452Val		49303508	A6NFW9|P17033|Q86V10|Q8IZC8|Q9UID9|Q9Y2P6	Missense_Mutation	SNP	HMMPfam_KRAB;HMMPfam_zf-C2H2;superfamily_KRAB domain (Kruppel-associated box Pfam 01352);superfamily_C2H2 and C2HC zinc fingers	p.G452V	ENST00000336976.6	37	c.1355	CCDS33046.1	19	.	.	.	.	.	.	.	.	.	.	g	15.63	2.890444	0.52014	.	.	ENSG00000186019	ENST00000336976	T	0.23552	1.9	2.93	2.93	0.34026	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.53916	0.1826	M	0.86953	2.85	0.49299	D	0.999772	D	0.89917	1.0	D	0.97110	1.0	T	0.63580	-0.6605	9	0.62326	D	0.03	.	13.0472	0.58933	0.0:0.0:1.0:0.0	.	452	Q9NZL3	ZN224_HUMAN	V	452	ENSP00000337368:G452V	ENSP00000337368:G452V	G	+	2	0	ZNF224	49303508	.	.	0.945000	0.38365	0.609000	0.37215	.	.	1.631000	0.50456	0.591000	0.81541	GGA	-	NULL		0.453	ZNF224-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF224	protein_coding	OTTHUMT00000460477.1	G	NM_013398		49303508	1	no_errors	NM_013398	genbank	human	provisional	54_36p	missense	SNP	1	T
RELB	5971	genome.wustl.edu	37	19	45535916	45535916	+	Silent	SNP	C	C	G			TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr19:45535916C>G	ENST00000221452.8	+	9	1266	c.1116C>G	c.(1114-1116)gtC>gtG	p.V372V	RELB_ENST00000505236.1_Silent_p.V369V|RELB_ENST00000540120.1_Silent_p.V372V	NM_006509.3	NP_006500.2	Q01201	RELB_HUMAN	v-rel avian reticuloendotheliosis viral oncogene homolog B	372	RHD. {ECO:0000255|PROSITE- ProRule:PRU00265}.				antigen processing and presentation (GO:0019882)|circadian regulation of gene expression (GO:0032922)|myeloid dendritic cell differentiation (GO:0043011)|NIK/NF-kappaB signaling (GO:0038061)|positive regulation of gene expression (GO:0010628)|T-helper 1 cell differentiation (GO:0045063)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nucleus (GO:0005634)	core promoter binding (GO:0001047)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.V372V(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(3)|ovary(3)|skin(1)	12		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00986)		TGGAGATTGTCGAGCCCGTGA	0.617																																																1	Substitution - coding silent(1)	ovary(1)	19											37.0	39.0	38.0					19																	45535916		2078	4217	6295	50227756	SO:0001819	synonymous_variant	5971			M83221	CCDS46110.1	19q13.32	2013-07-09	2013-07-09		ENSG00000104856	ENSG00000104856			9956	protein-coding gene	gene with protein product		604758	"""v-rel avian reticuloendotheliosis viral oncogene homolog B (nuclear factor of kappa light polypeptide gene enhancer in B-cells 3)"""			1531086	Standard	NM_006509		Approved	REL-B	uc021uvp.1	Q01201	OTTHUMG00000162116	ENST00000221452.8:c.1116C>G	19.37:g.45535916C>G			50227756	Q6GTX7|Q9UEI7	Silent	SNP	HMMPfam_TIG;superfamily_p53-like transcription factors;HMMPfam_RHD;superfamily_E set domains	p.V372	ENST00000221452.8	37	c.1116	CCDS46110.1	19																																																																																			-	HMMPfam_TIG		0.617	RELB-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RELB	protein_coding	OTTHUMT00000367361.2	C			50227756	1	no_errors	NM_006509	genbank	human	validated	54_36p	silent	SNP		G
C5AR2	27202	genome.wustl.edu	37	19	47844955	47844955	+	Missense_Mutation	SNP	G	G	T	rs117238101	byFrequency	TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr19:47844955G>T	ENST00000595464.1	+	2	1117	c.899G>T	c.(898-900)cGc>cTc	p.R300L	C5AR2_ENST00000257267.2_Missense_Mutation_p.R300L|C5AR2_ENST00000600626.1_Missense_Mutation_p.R300L	NM_001271749.1	NP_001258678.1	Q9P296	C5AR2_HUMAN	complement component 5a receptor 2	300					chemotaxis (GO:0006935)|inflammatory response (GO:0006954)|negative regulation of interleukin-6 secretion (GO:1900165)|negative regulation of neutrophil chemotaxis (GO:0090024)|negative regulation of tumor necrosis factor production (GO:0032720)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|regulation of interleukin-8 secretion (GO:2000482)	apical part of cell (GO:0045177)|basal plasma membrane (GO:0009925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	C5a anaphylatoxin receptor activity (GO:0004944)	p.R300L(1)									GCTCAACTCCGCCGGTCACTG	0.632																																																1	Substitution - Missense(1)	ovary(1)	19											49.0	46.0	47.0					19																	47844955		2203	4300	6503	52536795	SO:0001583	missense	27202			AB038237	CCDS12699.1	19q13.33	2013-01-28	2013-01-28	2013-01-28		ENSG00000134830		"""GPCR / Class A : Complement component receptors"""	4527	protein-coding gene	gene with protein product		609949	"""G protein-coupled receptor 77"""	GPR77		11165367	Standard	NM_018485		Approved	C5L2	uc010ela.1	Q9P296		ENST00000595464.1:c.899G>T	19.37:g.47844955G>T	ENSP00000472620:p.Arg300Leu		52536795	B2RA09	Missense_Mutation	SNP	-	p.R300L	ENST00000595464.1	37	c.899	CCDS12699.1	19	.	.	.	.	.	.	.	.	.	.	G	3.493	-0.103361	0.06967	.	.	ENSG00000134830	ENST00000257267	T	0.39406	1.08	3.86	2.81	0.32909	.	0.375017	0.26213	U	0.025665	T	0.26412	0.0645	L	0.27053	0.805	0.09310	N	1	B	0.17852	0.024	B	0.15870	0.014	T	0.13415	-1.0510	10	0.34782	T	0.22	.	7.549	0.27783	0.1204:0.0:0.8796:0.0	.	300	Q9P296	C5ARL_HUMAN	L	300	ENSP00000257267:R300L	ENSP00000257267:R300L	R	+	2	0	GPR77	52536795	0.000000	0.05858	0.001000	0.08648	0.561000	0.35649	-0.013000	0.12678	0.956000	0.37904	0.313000	0.20887	CGC	-	NULL		0.632	C5AR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR77	protein_coding	OTTHUMT00000466926.1	G	NM_018485		52536795	1	no_errors	NM_018485	genbank	human	provisional	54_36p	missense	SNP		T
KLK12	43849	genome.wustl.edu	37	19	51534152	51534152	+	Silent	SNP	G	G	A			TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr19:51534152G>A	ENST00000525263.1	-	4	602	c.483C>T	c.(481-483)tgC>tgT	p.C161C	KLK12_ENST00000250351.4_Silent_p.C161C|KLK11_ENST00000319720.7_5'Flank|CTC-518B2.9_ENST00000594910.1_RNA|KLK12_ENST00000319590.4_Silent_p.C161C|KLK12_ENST00000529888.1_Missense_Mutation_p.P75S|KLK11_ENST00000391804.3_5'Flank|KLK12_ENST00000250352.11_Silent_p.C51C			Q9UKR0	KLK12_HUMAN	kallikrein-related peptidase 12	161	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				proteolysis (GO:0006508)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.C161C(1)		endometrium(1)|large_intestine(4)|lung(3)|ovary(1)|skin(1)|stomach(1)|urinary_tract(1)	12		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00328)|GBM - Glioblastoma multiforme(134;0.00399)		AGAGGTTGAGGCACTGGAGCA	0.607																																																1	Substitution - coding silent(1)	ovary(1)	19											171.0	156.0	161.0					19																	51534152		2203	4300	6503	56225964	SO:0001819	synonymous_variant	43849				CCDS12820.1, CCDS12821.1, CCDS54298.1	19q13.33	2008-02-05	2006-10-27		ENSG00000186474	ENSG00000186474		"""Kallikreins"""	6360	protein-coding gene	gene with protein product		605539	"""kallikrein 12"""			16800724, 16800723	Standard	NM_019598		Approved	KLK-L5	uc002pvh.1	Q9UKR0	OTTHUMG00000165806	ENST00000525263.1:c.483C>T	19.37:g.51534152G>A			56225964	Q9UKR1|Q9UKR2	Missense_Mutation	SNP	-	p.P75S	ENST00000525263.1	37	c.223	CCDS12821.1	19	.	.	.	.	.	.	.	.	.	.	g	6.788	0.514355	0.12944	.	.	ENSG00000186474	ENST00000529888	D	0.81499	-1.5	4.62	1.22	0.21188	.	.	.	.	.	T	0.67144	0.2862	.	.	.	0.80722	D	1	B	0.15930	0.015	B	0.04013	0.001	T	0.56956	-0.7893	8	0.29301	T	0.29	.	8.2259	0.31568	0.2811:0.0:0.7189:0.0	.	75	Q9UKR2	.	S	75	ENSP00000434036:P75S	ENSP00000434036:P75S	P	-	1	0	KLK12	56225964	0.935000	0.31712	0.997000	0.53966	0.058000	0.15608	0.375000	0.20518	0.554000	0.29061	0.555000	0.69702	CCT	-	NULL		0.607	KLK12-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	KLK12	protein_coding	OTTHUMT00000386288.1	G	NM_019598		56225964	-1	no_errors	NM_145895	genbank	human	reviewed	54_36p	missense	SNP	0.97	A
CHST10	9486	genome.wustl.edu	37	2	101014521	101014521	+	Nonsense_Mutation	SNP	G	G	T			TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr2:101014521G>T	ENST00000264249.3	-	5	661	c.276C>A	c.(274-276)tgC>tgA	p.C92*	CHST10_ENST00000409701.1_Nonsense_Mutation_p.C92*|CHST10_ENST00000542617.1_Nonsense_Mutation_p.C140*	NM_004854.4	NP_004845.1	O43529	CHSTA_HUMAN	carbohydrate sulfotransferase 10	92					carbohydrate biosynthetic process (GO:0016051)|cell adhesion (GO:0007155)|learning (GO:0007612)|long-term memory (GO:0007616)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	HNK-1 sulfotransferase activity (GO:0016232)|sulfotransferase activity (GO:0008146)	p.C92*(1)		breast(1)|endometrium(1)|large_intestine(9)|lung(4)|ovary(1)	16						CATCATCCCTGCAGACGTTTC	0.527																																																1	Substitution - Nonsense(1)	ovary(1)	2											138.0	140.0	139.0					2																	101014521		2203	4300	6503	100380953	SO:0001587	stop_gained	9486			BC010441	CCDS2047.1	2q11.2	2008-02-05			ENSG00000115526	ENSG00000115526		"""Sulfotransferases, membrane-bound"""	19650	protein-coding gene	gene with protein product		606376				12080076	Standard	NM_004854		Approved	HNK-1ST	uc002tam.3	O43529	OTTHUMG00000130669	ENST00000264249.3:c.276C>A	2.37:g.101014521G>T	ENSP00000264249:p.Cys92*		100380953	Q53T18	Nonsense_Mutation	SNP	-	p.C92*	ENST00000264249.3	37	c.276	CCDS2047.1	2	.	.	.	.	.	.	.	.	.	.	G	27.8	4.861171	0.91433	.	.	ENSG00000115526	ENST00000264249;ENST00000542617;ENST00000409701;ENST00000409046;ENST00000420858;ENST00000448989	.	.	.	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-34.8109	19.5919	0.95518	0.0:0.0:1.0:0.0	.	.	.	.	X	92;140;92;92;92;140	.	ENSP00000264249:C92X	C	-	3	2	CHST10	100380953	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	6.343000	0.72986	2.628000	0.89032	0.655000	0.94253	TGC	-	NULL		0.527	CHST10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHST10	protein_coding	OTTHUMT00000253162.1	G	NM_004854		100380953	-1	no_errors	NM_004854	genbank	human	validated	54_36p	nonsense	SNP	1	T
ZC3H6	376940	genome.wustl.edu	37	2	113067586	113067586	+	Missense_Mutation	SNP	A	A	G			TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr2:113067586A>G	ENST00000409871.1	+	4	862	c.461A>G	c.(460-462)gAc>gGc	p.D154G	ZC3H6_ENST00000343936.4_Missense_Mutation_p.D154G	NM_198581.2	NP_940983.2	P61129	ZC3H6_HUMAN	zinc finger CCCH-type containing 6	154							metal ion binding (GO:0046872)	p.D154G(1)		central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(9)|lung(12)|ovary(4)|prostate(2)	35						TACAGTGATGACAACTTTGGT	0.363																																																1	Substitution - Missense(1)	ovary(1)	2											77.0	72.0	74.0					2																	113067586		1881	4113	5994	112784057	SO:0001583	missense	376940			AK123404	CCDS46393.1	2q13	2012-07-05	2005-06-02	2005-06-02	ENSG00000188177	ENSG00000188177		"""Zinc fingers, CCCH-type domain containing"""	24762	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 6"""	ZC3HDC6			Standard	NM_198581		Approved	FLJ41410, FLJ45877, KIAA2035	uc002thq.1	P61129	OTTHUMG00000153286	ENST00000409871.1:c.461A>G	2.37:g.113067586A>G	ENSP00000386764:p.Asp154Gly		112784057	A9JR71|Q6ZW96	Missense_Mutation	SNP	-	p.D154G	ENST00000409871.1	37	c.461	CCDS46393.1	2	.	.	.	.	.	.	.	.	.	.	A	14.72	2.618229	0.46736	.	.	ENSG00000188177	ENST00000409871;ENST00000343936;ENST00000542974	T;T	0.15718	2.4;2.4	3.09	3.09	0.35607	.	1.025170	0.07767	N	0.951061	T	0.12817	0.0311	N	0.22421	0.69	0.33846	D	0.632094	P	0.34522	0.455	B	0.34093	0.175	T	0.20806	-1.0264	10	0.66056	D	0.02	-16.8445	7.9401	0.29952	1.0:0.0:0.0:0.0	.	154	P61129	ZC3H6_HUMAN	G	154;154;131	ENSP00000386764:D154G;ENSP00000340298:D154G	ENSP00000340298:D154G	D	+	2	0	ZC3H6	112784057	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.476000	0.60216	1.671000	0.50874	0.459000	0.35465	GAC	-	NULL		0.363	ZC3H6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC3H6	protein_coding	OTTHUMT00000330551.1	A	NM_198581		112784057	1	no_errors	NM_198581	genbank	human	validated	54_36p	missense	SNP	1	G
LINC01090	104355152	genome.wustl.edu	37	2	189092744	189092744	+	lincRNA	SNP	C	C	A			TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr2:189092744C>A	ENST00000415357.1	-	0	683																											GACACAGGAGCTACCTGGAGG	0.512																																																0			2																																								188800989			729141																															2.37:g.189092744C>A			188800989		RNA	SNP	-	NULL	ENST00000415357.1	37	NULL		2																																																																																			-	-		0.512	AC068718.1-002	KNOWN	basic	lincRNA	LOC729141	lincRNA	OTTHUMT00000334696.1	C			188800989	1	pseudogene	XR_015463	genbank	human	model	54_36p	rna	SNP	0.98	A
TMEM131	23505	genome.wustl.edu	37	2	98430603	98430603	+	Splice_Site	SNP	A	A	G			TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr2:98430603A>G	ENST00000186436.5	-	15	1676	c.1448T>C	c.(1447-1449)gTt>gCt	p.V483A		NM_015348.1	NP_056163.1	Q92545	TM131_HUMAN	transmembrane protein 131	483						integral component of membrane (GO:0016021)		p.V370A(1)		NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(4)|prostate(1)|skin(1)|stomach(1)	57						GAAGTTGTGAACCTGAGAAAT	0.373																																																1	Substitution - Missense(1)	ovary(1)	2											87.0	81.0	83.0					2																	98430603		1875	4099	5974	97797035	SO:0001630	splice_region_variant	23505			AK025852	CCDS46368.1	2q11.2	2006-04-12			ENSG00000075568	ENSG00000075568			30366	protein-coding gene	gene with protein product		615659				9039502, 10996388	Standard	NM_015348		Approved	CC28, YR-23, RW1, KIAA0257, PRO1048	uc002syh.4	Q92545	OTTHUMG00000153061	ENST00000186436.5:c.1447-1T>C	2.37:g.98430603A>G			97797035		Missense_Mutation	SNP	-	p.V483A	ENST00000186436.5	37	c.1448	CCDS46368.1	2	.	.	.	.	.	.	.	.	.	.	A	16.66	3.185318	0.57909	.	.	ENSG00000075568	ENST00000186436	T	0.39056	1.1	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	T	0.36663	0.0975	L	0.29908	0.895	0.80722	D	1	P	0.52316	0.952	P	0.44518	0.452	T	0.09079	-1.0691	10	0.32370	T	0.25	-16.7559	16.1667	0.81768	1.0:0.0:0.0:0.0	.	483	Q92545	TM131_HUMAN	A	483	ENSP00000186436:V483A	ENSP00000186436:V483A	V	-	2	0	TMEM131	97797035	1.000000	0.71417	1.000000	0.80357	0.855000	0.48748	8.528000	0.90598	2.210000	0.71456	0.533000	0.62120	GTT	-	NULL		0.373	TMEM131-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM131	protein_coding	OTTHUMT00000329285.2	A	XM_371542	Missense_Mutation	97797035	-1	no_errors	NM_015348	genbank	human	validated	54_36p	missense	SNP	1	G
ANKRD44	91526	genome.wustl.edu	37	2	197870559	197870559	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr2:197870559C>T	ENST00000328737.2	-	21	2207	c.2131G>A	c.(2131-2133)Ggg>Agg	p.G711R	ANKRD44_ENST00000450567.1_Missense_Mutation_p.G711R|ANKRD44_ENST00000282272.8_Missense_Mutation_p.G728R|ANKRD44_ENST00000337207.5_Missense_Mutation_p.G711R			Q8N8A2	ANR44_HUMAN	ankyrin repeat domain 44	736								p.G551W(1)|p.G711R(1)|p.G711W(1)		NS(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(20)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	45			OV - Ovarian serous cystadenocarcinoma(117;0.246)			GGCGTCCTCCCTCTGGAATCT	0.483																																																3	Substitution - Missense(3)	lung(2)|ovary(1)	2											184.0	179.0	180.0					2																	197870559		2203	4300	6503	197578804	SO:0001583	missense	91526			AK097086	CCDS33355.1, CCDS33355.2, CCDS74619.1	2q33.1	2013-01-10			ENSG00000065413	ENSG00000065413		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"", ""Ankyrin repeat domain containing"""	25259	protein-coding gene	gene with protein product	"""protein phosphatase 6 ankyrin repeat subunit B"""						Standard	NM_153697		Approved	PP6-ARS-B	uc021vuj.1	Q8N8A2	OTTHUMG00000154411	ENST00000328737.2:c.2131G>A	2.37:g.197870559C>T	ENSP00000331516:p.Gly711Arg		197578804	Q53SL9|Q6P480|Q86VL5|Q8IZ72|Q9UFA4	Missense_Mutation	SNP	-	p.G711R	ENST00000328737.2	37	c.2131		2	.	.	.	.	.	.	.	.	.	.	C	33	5.196928	0.94960	.	.	ENSG00000065413	ENST00000424317;ENST00000282272;ENST00000328737;ENST00000450567;ENST00000337207	D;D;D;D;D	0.86297	-2.1;-2.1;-2.1;-2.1;-2.1	5.14	5.14	0.70334	.	0.000000	0.85682	D	0.000000	D	0.94268	0.8159	M	0.85859	2.78	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94793	0.7964	10	0.87932	D	0	.	18.8054	0.92035	0.0:1.0:0.0:0.0	.	754	Q8N8A2-2	.	R	551;728;711;711;711	ENSP00000403415:G551R;ENSP00000282272:G728R;ENSP00000331516:G711R;ENSP00000402420:G711R;ENSP00000338794:G711R	ENSP00000282272:G728R	G	-	1	0	ANKRD44	197578804	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.651000	0.83577	2.697000	0.92050	0.655000	0.94253	GGG	-	NULL		0.483	ANKRD44-002	KNOWN	basic|appris_principal	protein_coding	ANKRD44	protein_coding	OTTHUMT00000335113.1	C	NM_153697		197578804	-1	no_errors	NM_153697	genbank	human	provisional	54_36p	missense	SNP	1	T
PTPRT	11122	genome.wustl.edu	37	20	41419875	41419875	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr20:41419875G>A	ENST00000373187.1	-	3	445	c.446C>T	c.(445-447)gCa>gTa	p.A149V	PTPRT_ENST00000373201.1_Missense_Mutation_p.A149V|PTPRT_ENST00000373184.1_Missense_Mutation_p.A149V|PTPRT_ENST00000373190.1_Missense_Mutation_p.A149V|PTPRT_ENST00000356100.2_Missense_Mutation_p.A149V|PTPRT_ENST00000373198.4_Missense_Mutation_p.A149V|PTPRT_ENST00000373193.3_Missense_Mutation_p.A149V			O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	149	MAM. {ECO:0000255|PROSITE- ProRule:PRU00128}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|protein tyrosine phosphatase activity (GO:0004725)	p.A149V(1)		NS(2)|breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(12)|large_intestine(26)|liver(1)|lung(63)|ovary(8)|pancreas(2)|prostate(5)|skin(35)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	176		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				GGCGAGCTCTGCCTTCACCCA	0.493																																																1	Substitution - Missense(1)	ovary(1)	20											91.0	95.0	94.0					20																	41419875		2019	4198	6217	40853289	SO:0001583	missense	11122			AF043644	CCDS42874.1, CCDS68127.1	20q12-q13	2013-02-11			ENSG00000196090	ENSG00000196090		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9682	protein-coding gene	gene with protein product		608712				9486824, 9602027	Standard	NM_133170		Approved	RPTPrho, KIAA0283	uc010ggj.3	O14522	OTTHUMG00000033040	ENST00000373187.1:c.446C>T	20.37:g.41419875G>A	ENSP00000362283:p.Ala149Val		40853289	A8E4R6|O43655|O75664|Q5W0X9|Q5W0Y1|Q9BR24|Q9BR28|Q9H0Y8|Q9NTL1|Q9NU72|Q9UBD2|Q9UJL7	Missense_Mutation	SNP	-	p.A149V	ENST00000373187.1	37	c.446	CCDS42874.1	20	.	.	.	.	.	.	.	.	.	.	G	14.99	2.701288	0.48307	.	.	ENSG00000196090	ENST00000373190;ENST00000373187;ENST00000373193;ENST00000356100;ENST00000373198;ENST00000373184;ENST00000373201	T;T;T;T;T;T;T	0.02421	4.3;4.3;4.3;4.3;4.3;4.3;4.3	5.67	5.67	0.87782	Concanavalin A-like lectin/glucanase (1);MAM domain (3);	0.056253	0.64402	D	0.000001	T	0.03564	0.0102	L	0.35593	1.075	0.47949	D	0.999557	B;B	0.30361	0.234;0.277	B;B	0.25506	0.036;0.061	T	0.58482	-0.7629	10	0.21014	T	0.42	.	19.7626	0.96329	0.0:0.0:1.0:0.0	.	149;149	O14522-1;O14522	.;PTPRT_HUMAN	V	149	ENSP00000362286:A149V;ENSP00000362283:A149V;ENSP00000362289:A149V;ENSP00000348408:A149V;ENSP00000362294:A149V;ENSP00000362280:A149V;ENSP00000362297:A149V	ENSP00000348408:A149V	A	-	2	0	PTPRT	40853289	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.718000	0.74713	2.676000	0.91093	0.561000	0.74099	GCA	-	NULL		0.493	PTPRT-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTPRT	protein_coding	OTTHUMT00000080315.1	G			40853289	-1	no_errors	NM_133170	genbank	human	reviewed	54_36p	missense	SNP	1	A
FAM65C	140876	genome.wustl.edu	37	20	49209686	49209686	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr20:49209686G>A	ENST00000327979.2	-	18	2659	c.2248C>T	c.(2248-2250)Ccc>Tcc	p.P750S	FAM65C_ENST00000535356.1_Missense_Mutation_p.P754S|FAM65C_ENST00000045083.2_Missense_Mutation_p.P750S			Q96MK2	FA65C_HUMAN	family with sequence similarity 65, member C	750								p.P750S(1)		endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|liver(1)|lung(12)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						CCAGCTCCGGGGAGCAGCCCA	0.602																																																1	Substitution - Missense(1)	ovary(1)	20											50.0	54.0	53.0					20																	49209686		1965	4159	6124	48643093	SO:0001583	missense	140876			AL133230	CCDS13431.2	20q13.13	2011-11-24	2008-06-13	2008-06-13	ENSG00000042062	ENSG00000042062			16168	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 175"", ""chromosome 20 open reading frame 176"""	C20orf175, C20orf176			Standard	XM_005260294		Approved	dJ530I15.2, dJ530I15.3	uc002xvm.3	Q96MK2	OTTHUMG00000032724	ENST00000327979.2:c.2248C>T	20.37:g.49209686G>A	ENSP00000332663:p.Pro750Ser		48643093	Q5QPB6|Q9NQQ2	Missense_Mutation	SNP	-	p.P750S	ENST00000327979.2	37	c.2248	CCDS13431.2	20	.	.	.	.	.	.	.	.	.	.	G	8.541	0.873270	0.17322	.	.	ENSG00000042062	ENST00000327979;ENST00000045083;ENST00000535356	T;T;T	0.77229	-1.08;-1.08;-1.08	4.91	1.59	0.23543	.	0.544083	0.15744	U	0.246754	T	0.64136	0.2571	L	0.36672	1.1	0.24554	N	0.994004	B;B	0.23806	0.03;0.091	B;B	0.28849	0.037;0.095	T	0.47446	-0.9117	10	0.07175	T	0.84	-9.5239	10.0312	0.42101	0.0764:0.2704:0.6532:0.0	.	754;750	F5H0X2;Q96MK2	.;FA65C_HUMAN	S	750;750;754	ENSP00000332663:P750S;ENSP00000045083:P750S;ENSP00000439802:P754S	ENSP00000045083:P750S	P	-	1	0	FAM65C	48643093	0.770000	0.28543	0.458000	0.27068	0.272000	0.26649	1.050000	0.30404	1.144000	0.42321	0.561000	0.74099	CCC	-	NULL		0.602	FAM65C-004	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM65C	protein_coding	OTTHUMT00000257962.1	G			48643093	-1	no_errors	NM_080829	genbank	human	predicted	54_36p	missense	SNP	0.05	A
ISX	91464	genome.wustl.edu	37	22	35481509	35481509	+	Silent	SNP	G	G	A	rs202084562		TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr22:35481509G>A	ENST00000308700.6	+	4	1513	c.561G>A	c.(559-561)tcG>tcA	p.S187S	ISX_ENST00000404699.2_Silent_p.S187S	NM_001008494.1	NP_001008494.1	Q2M1V0	ISX_HUMAN	intestine-specific homeobox	187					regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of vitamin A metabolic process (GO:1901738)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.S187S(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(12)|ovary(3)|prostate(1)|skin(4)	26						GTTGTCCATCGGCTCAAGATC	0.617																																																1	Substitution - coding silent(1)	ovary(1)	22											161.0	129.0	140.0					22																	35481509		2203	4300	6503	33811509	SO:0001819	synonymous_variant	91464			AK025181	CCDS33640.1	22q12.3	2011-06-20			ENSG00000175329	ENSG00000175329		"""Homeoboxes / PRD class"""	28084	protein-coding gene	gene with protein product		612019					Standard	NM_001008494		Approved	RAXLX	uc003anj.3	Q2M1V0	OTTHUMG00000150962	ENST00000308700.6:c.561G>A	22.37:g.35481509G>A			33811509	Q68DJ5	Silent	SNP	HMMPfam_Homeobox;superfamily_Homeodomain-like	p.S187	ENST00000308700.6	37	c.561	CCDS33640.1	22																																																																																			-	NULL		0.617	ISX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ISX	protein_coding	OTTHUMT00000320662.1	G	NM_001008494		33811509	1	no_errors	NM_001008494	genbank	human	validated	54_36p	silent	SNP		A
TCF20	6942	genome.wustl.edu	37	22	42608132	42608132	+	Silent	SNP	G	G	C			TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr22:42608132G>C	ENST00000359486.3	-	1	3316	c.3180C>G	c.(3178-3180)gcC>gcG	p.A1060A	TCF20_ENST00000404876.1_5'Flank|TCF20_ENST00000335626.4_Silent_p.A1060A	NM_005650.1	NP_005641.1	Q9UGU0	TCF20_HUMAN	transcription factor 20 (AR1)	1060					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)	p.A1060A(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(13)|lung(22)|ovary(5)|prostate(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(5)	66						GATAAGCAGAGGCCAGGGTTT	0.483																																																1	Substitution - coding silent(1)	ovary(1)	22											70.0	70.0	70.0					22																	42608132		2203	4300	6503	40938076	SO:0001819	synonymous_variant	6942			U19345	CCDS14032.1, CCDS14033.1	22q13.3	2011-02-08			ENSG00000100207	ENSG00000100207			11631	protein-coding gene	gene with protein product	"""stromelysin-1 platelet-derived growth factor-responsive element binding protein"""	603107				9730594, 10995766	Standard	NM_005650		Approved	AR1, SPBP	uc003bcj.1	Q9UGU0	OTTHUMG00000150920	ENST00000359486.3:c.3180C>G	22.37:g.42608132G>C			40938076	A9JX12|O14528|Q13078|Q4V353|Q9H4M0	Silent	SNP	-	p.A1060	ENST00000359486.3	37	c.3180	CCDS14033.1	22																																																																																			-	NULL		0.483	TCF20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCF20	protein_coding	OTTHUMT00000320531.1	G	NM_181492		40938076	-1	no_errors	NM_005650	genbank	human	reviewed	54_36p	silent	SNP	1	C
RPN1	6184	genome.wustl.edu	37	3	128350847	128350848	+	Frame_Shift_Ins	INS	-	-	T			TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	-	-	-	T	-	-	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr3:128350847_128350848insT	ENST00000296255.3	-	4	834_835	c.786_787insA	c.(784-789)tcacgcfs	p.R263fs	RPN1_ENST00000497289.1_Frame_Shift_Ins_p.R91fs	NM_002950.3	NP_002941.1	P04843	RPN1_HUMAN	ribophorin I	263					cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|gene expression (GO:0010467)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|oligosaccharyltransferase complex (GO:0008250)|rough endoplasmic reticulum (GO:0005791)	dolichyl-diphosphooligosaccharide-protein glycotransferase activity (GO:0004579)|poly(A) RNA binding (GO:0044822)	p.R263fs*3(1)|p.R263C(1)		NS(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(2)|ovary(2)|stomach(2)	13				GBM - Glioblastoma multiforme(114;0.189)		TAATCATAGCGTGAGAAAGGCC	0.441			T	EVI1	AML																																		Dom	yes		3	3q21.3-q25.2	6184	ribophorin I		L	2	Substitution - Missense(1)|Insertion - Frameshift(1)	ovary(1)|lung(1)	3																																								129833538	SO:0001589	frameshift_variant	6184				CCDS3051.1	3q21.3	2013-03-06			ENSG00000163902	ENSG00000163902			10381	protein-coding gene	gene with protein product	"""oligosaccharyltransferase 1 homolog (S. cerevisiae)"", ""oligosaccharyltransferase complex subunit (non-catalytic)"""	180470					Standard	NM_002950		Approved	OST1	uc003ekr.1	P04843	OTTHUMG00000159691	ENST00000296255.3:c.787dupA	3.37:g.128350848_128350848dupT	ENSP00000296255:p.Arg263fs		129833537	B2R5Z0|D3DNB6|Q68DT1	Frame_Shift_Ins	INS	Ribophorin_I;HMMPfam_Ribophorin_I;PRTase-like;superfamily_PRTase-like	p.R262fs	ENST00000296255.3	37	c.787_786	CCDS3051.1	3																																																																																			-	HMMPfam_Ribophorin_I		0.441	RPN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPN1	protein_coding	OTTHUMT00000356934.2	-	NM_002950		129833538	-1	no_errors	NM_002950	genbank	human	reviewed	54_36p	frame_shift_ins	INS	0.994:0.921	T
SLC9A9	285195	genome.wustl.edu	37	3	143515741	143515741	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr3:143515741G>A	ENST00000316549.6	-	3	591	c.383C>T	c.(382-384)aCa>aTa	p.T128I		NM_173653.3	NP_775924.1	Q8IVB4	SL9A9_HUMAN	solute carrier family 9, subfamily A (NHE9, cation proton antiporter 9), member 9	128					ion transport (GO:0006811)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|late endosome membrane (GO:0031902)|recycling endosome (GO:0055037)	sodium:proton antiporter activity (GO:0015385)	p.T128I(1)		breast(2)|endometrium(5)|kidney(2)|large_intestine(13)|lung(29)|ovary(2)|skin(3)|stomach(1)	57						TGGATCAAATGTCATCTGCCA	0.313																																																1	Substitution - Missense(1)	ovary(1)	3											56.0	61.0	59.0					3																	143515741		2203	4299	6502	144998431	SO:0001583	missense	285195			AY254100	CCDS33872.1	3q23-q24	2014-01-28	2012-03-22		ENSG00000181804	ENSG00000181804		"""Solute carriers"""	20653	protein-coding gene	gene with protein product		608396	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 9"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 9"""			14569117	Standard	NM_173653		Approved	FLJ35613, NHE9	uc003evn.3	Q8IVB4	OTTHUMG00000159373	ENST00000316549.6:c.383C>T	3.37:g.143515741G>A	ENSP00000320246:p.Thr128Ile		144998431	A6NMQ9|Q3LIC2|Q5JPI6|Q5WA58|Q8NAB9	Missense_Mutation	SNP	-	p.T128I	ENST00000316549.6	37	c.383	CCDS33872.1	3	.	.	.	.	.	.	.	.	.	.	G	22.7	4.318813	0.81469	.	.	ENSG00000181804	ENST00000316549;ENST00000450105	T	0.21734	1.99	5.4	5.4	0.78164	Cation/H+ exchanger (1);	0.170876	0.39909	N	0.001221	T	0.44117	0.1278	L	0.53729	1.69	0.54753	D	0.999981	D	0.76494	0.999	D	0.85130	0.997	T	0.26985	-1.0087	10	0.62326	D	0.03	.	17.9469	0.89042	0.0:0.0:1.0:0.0	.	128	Q8IVB4	SL9A9_HUMAN	I	128;11	ENSP00000320246:T128I	ENSP00000320246:T128I	T	-	2	0	SLC9A9	144998431	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	6.293000	0.72731	2.524000	0.85096	0.637000	0.83480	ACA	-	NULL		0.313	SLC9A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9A9	protein_coding	OTTHUMT00000354994.1	G	NM_173653		144998431	-1	no_errors	NM_173653	genbank	human	validated	54_36p	missense	SNP	1	A
SLC33A1	9197	genome.wustl.edu	37	3	155560290	155560290	+	Silent	SNP	G	G	A			TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr3:155560290G>A	ENST00000392845.3	-	2	1274	c.894C>T	c.(892-894)taC>taT	p.Y298Y	SLC33A1_ENST00000460729.1_5'Flank|SLC33A1_ENST00000359479.3_Silent_p.Y298Y			O00400	ACATN_HUMAN	solute carrier family 33 (acetyl-CoA transporter), member 1	298					acetyl-CoA transport (GO:0015876)|cell death (GO:0008219)|transmembrane transport (GO:0055085)|transport (GO:0006810)	endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	acetyl-CoA transporter activity (GO:0008521)	p.Y298Y(1)		endometrium(1)|kidney(3)|large_intestine(6)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|urinary_tract(1)	22			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			AAAGCAGCTTGTAAGTATCTG	0.313																																																1	Substitution - coding silent(1)	ovary(1)	3											88.0	79.0	82.0					3																	155560290		2203	4297	6500	157042984	SO:0001819	synonymous_variant	9197			D88152	CCDS3173.1	3q25.31	2013-05-22		2002-12-06	ENSG00000169359	ENSG00000169359		"""Solute carriers"""	95	protein-coding gene	gene with protein product		603690	"""acetyl-Coenzyme A transporter"", ""spastic paraplegia 42 (autosomal dominant)"""	ACATN, SPG42		9096318, 19061983	Standard	NM_004733		Approved	AT-1, AT1	uc003fao.2	O00400	OTTHUMG00000158481	ENST00000392845.3:c.894C>T	3.37:g.155560290G>A			157042984	B2R5Q2|D3DNK4	Silent	SNP	superfamily_MFS general substrate transporter	p.Y298	ENST00000392845.3	37	c.894	CCDS3173.1	3																																																																																			-	NULL		0.313	SLC33A1-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	SLC33A1	protein_coding	OTTHUMT00000351130.3	G	NM_004733		157042984	-1	no_errors	NM_004733	genbank	human	reviewed	54_36p	silent	SNP	1	A
LMCD1	29995	genome.wustl.edu	37	3	8609162	8609162	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr3:8609162C>G	ENST00000157600.3	+	6	1208	c.976C>G	c.(976-978)Ctg>Gtg	p.L326V	LMCD1_ENST00000397386.3_Missense_Mutation_p.L214V|LMCD1_ENST00000454244.1_Missense_Mutation_p.L253V|LMCD1-AS1_ENST00000439407.1_RNA	NM_014583.2	NP_055398.1	Q9NZU5	LMCD1_HUMAN	LIM and cysteine-rich domains 1	326	LIM zinc-binding 2. {ECO:0000255|PROSITE- ProRule:PRU00125}.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|regulation of cardiac muscle hypertrophy (GO:0010611)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.L326V(1)		breast(2)|kidney(1)|large_intestine(7)|lung(4)|ovary(1)|prostate(1)	16				OV - Ovarian serous cystadenocarcinoma(96;0.124)		TGTGGAAGATCTGGCCTGGCA	0.547																																																1	Substitution - Missense(1)	ovary(1)	3											259.0	247.0	251.0					3																	8609162		2203	4300	6503	8584162	SO:0001583	missense	29995			AF169284	CCDS33688.1, CCDS63533.1, CCDS63534.1	3p26-p24	2008-07-18			ENSG00000071282	ENSG00000071282			6633	protein-coding gene	gene with protein product	"""dyxin"""	604859				10662546	Standard	NM_001278233		Approved		uc003bqq.4	Q9NZU5	OTTHUMG00000154971	ENST00000157600.3:c.976C>G	3.37:g.8609162C>G	ENSP00000157600:p.Leu326Val		8584162	B4DG80	Missense_Mutation	SNP	-	p.L326V	ENST00000157600.3	37	c.976	CCDS33688.1	3	.	.	.	.	.	.	.	.	.	.	C	15.04	2.714933	0.48622	.	.	ENSG00000071282	ENST00000157600;ENST00000454244;ENST00000397386	D;D;D	0.87491	-2.26;-2.26;-2.26	5.52	3.72	0.42706	Zinc finger, LIM-type (5);	0.394587	0.21403	N	0.075115	T	0.78483	0.4290	N	0.25485	0.75	0.26932	N	0.966448	P;P	0.43578	0.629;0.811	B;B	0.44044	0.439;0.433	T	0.70417	-0.4877	10	0.49607	T	0.09	-20.0772	3.3484	0.07143	0.1372:0.5764:0.1333:0.1532	.	214;326	B4DEY6;Q9NZU5	.;LMCD1_HUMAN	V	326;253;214	ENSP00000157600:L326V;ENSP00000396515:L253V;ENSP00000380542:L214V	ENSP00000157600:L326V	L	+	1	2	LMCD1	8584162	0.211000	0.23529	1.000000	0.80357	0.995000	0.86356	0.740000	0.26188	0.802000	0.34089	0.591000	0.81541	CTG	-	NULL		0.547	LMCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LMCD1	protein_coding	OTTHUMT00000337854.1	C	NM_014583		8584162	1	no_errors	NM_014583	genbank	human	reviewed	54_36p	missense	SNP	1	G
RAD18	56852	genome.wustl.edu	37	3	8923063	8923063	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr3:8923063C>G	ENST00000264926.2	-	13	1582	c.1466G>C	c.(1465-1467)aGa>aCa	p.R489T		NM_020165.3	NP_064550.3	Q9NS91	RAD18_HUMAN	RAD18 E3 ubiquitin protein ligase	489					DNA repair (GO:0006281)|negative regulation of DNA recombination (GO:0045910)|protein ubiquitination (GO:0016567)|response to UV (GO:0009411)|spermatogenesis (GO:0007283)	chromatin (GO:0000785)|nucleus (GO:0005634)|replication fork (GO:0005657)|XY body (GO:0001741)	damaged DNA binding (GO:0003684)|ligase activity (GO:0016874)|polyubiquitin binding (GO:0031593)|ubiquitin protein ligase binding (GO:0031625)|Y-form DNA binding (GO:0000403)|zinc ion binding (GO:0008270)	p.R489T(1)		breast(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|prostate(1)|skin(3)	15				OV - Ovarian serous cystadenocarcinoma(96;0.0552)		ACGCTTGTTTCTTGGTTCAAT	0.383								Rad6 pathway																																								1	Substitution - Missense(1)	ovary(1)	3											175.0	166.0	169.0					3																	8923063		2203	4300	6503	8898063	SO:0001583	missense	56852				CCDS2571.1	3p25-p24	2014-08-04	2014-08-04		ENSG00000070950	ENSG00000070950		"""RING-type (C3HC4) zinc fingers"""	18278	protein-coding gene	gene with protein product		605256	"""RAD18 homolog (S. cerevisiae)"""			10884424, 10908344	Standard	NM_020165		Approved	RNF73	uc003brd.3	Q9NS91	OTTHUMG00000090545	ENST00000264926.2:c.1466G>C	3.37:g.8923063C>G	ENSP00000264926:p.Arg489Thr		8898063	Q58F55|Q9NRT6	Missense_Mutation	SNP	HMMPfam_zf-C3HC4;HMMPfam_SAP;superfamily_RING/U-box;superfamily_SAP domain	p.R489T	ENST00000264926.2	37	c.1466	CCDS2571.1	3	.	.	.	.	.	.	.	.	.	.	C	16.13	3.035668	0.54896	.	.	ENSG00000070950	ENST00000264926	T	0.38401	1.14	4.54	4.54	0.55810	.	0.098347	0.44097	D	0.000486	T	0.26557	0.0649	L	0.27053	0.805	0.37575	D	0.919574	B	0.32573	0.376	B	0.30401	0.115	T	0.31447	-0.9943	10	0.87932	D	0	-17.4904	13.0067	0.58710	0.0:1.0:0.0:0.0	.	489	Q9NS91	RAD18_HUMAN	T	489	ENSP00000264926:R489T	ENSP00000264926:R489T	R	-	2	0	RAD18	8898063	1.000000	0.71417	0.997000	0.53966	0.871000	0.50021	3.167000	0.50793	2.518000	0.84900	0.655000	0.94253	AGA	-	NULL		0.383	RAD18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAD18	protein_coding	OTTHUMT00000207071.2	C	NM_020165		8898063	-1	no_errors	NM_020165	genbank	human	reviewed	54_36p	missense	SNP	0.95	G
MLH1	4292	genome.wustl.edu	37	3	37053324	37053324	+	Missense_Mutation	SNP	A	A	T			TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr3:37053324A>T	ENST00000231790.2	+	7	775	c.559A>T	c.(559-561)Aat>Tat	p.N187Y	MLH1_ENST00000455445.2_5'UTR|MLH1_ENST00000539477.1_5'UTR|MLH1_ENST00000492474.1_3'UTR|MLH1_ENST00000435176.1_Missense_Mutation_p.N89Y|MLH1_ENST00000536378.1_5'UTR|MLH1_ENST00000458205.2_5'UTR	NM_000249.3|NM_001258273.1	NP_000240.1|NP_001245202.1	P40692	MLH1_HUMAN	mutL homolog 1	187					ATP catabolic process (GO:0006200)|double-strand break repair via nonhomologous end joining (GO:0006303)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|isotype switching (GO:0045190)|male meiosis chromosome segregation (GO:0007060)|meiotic metaphase I plate congression (GO:0043060)|mismatch repair (GO:0006298)|negative regulation of mitotic recombination (GO:0045950)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|oogenesis (GO:0048477)|resolution of meiotic recombination intermediates (GO:0000712)|somatic hypermutation of immunoglobulin genes (GO:0016446)|spermatogenesis (GO:0007283)|spindle midzone assembly involved in meiosis (GO:0051257)|synapsis (GO:0007129)	chiasma (GO:0005712)|male germ cell nucleus (GO:0001673)|membrane (GO:0016020)|MutLalpha complex (GO:0032389)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|guanine/thymine mispair binding (GO:0032137)	p.N187Y(1)|p.0?(1)		NS(1)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(12)|kidney(2)|large_intestine(54)|lung(13)|oesophagus(7)|ovary(6)|pancreas(5)|prostate(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	127						TTCAGTACACAATGCAGGCAT	0.328		1	"""D, Mis, N, F, S"""		"""colorectal, endometrial, ovarian, CNS"""	"""colorectal, endometrial, ovarian, CNS"""		Mismatch excision repair (MMR)	Turcot syndrome;Muir-Torre syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																													yes	Rec	yes	"""Hereditary non-polyposis colorectal cancer, Turcot syndrome"""	3	3p21.3	4292	E.coli MutL homolog gene		"""E, O"""	2	Substitution - Missense(1)|Whole gene deletion(1)	ovary(2)	3											183.0	198.0	193.0					3																	37053324		2203	4300	6503	37028328	SO:0001583	missense	4292	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome; ;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III	U07418	CCDS2663.1, CCDS54562.1, CCDS54563.1	3p22.3	2014-09-17	2013-09-12		ENSG00000076242	ENSG00000076242			7127	protein-coding gene	gene with protein product		120436	"""mutL (E. coli) homolog 1 (colon cancer, nonpolyposis type 2)"", ""mutL homolog 1, colon cancer, nonpolyposis type 2 (E. coli)"""	COCA2		7903889	Standard	NM_000249		Approved	HNPCC, FCC2, HNPCC2	uc003cgl.3	P40692	OTTHUMG00000130797	ENST00000231790.2:c.559A>T	3.37:g.37053324A>T	ENSP00000231790:p.Asn187Tyr		37028328	B4DI13|B4DQ11|E9PCU2	Missense_Mutation	SNP	HATPase_c;HMMPfam_HATPase_c;ATPase domain of HSP90 chaperone/DNA topoisomerase II/histidine kinase;superfamily_ATPase domain of HSP90 chaperone/DNA topoisomerase II/histidine kinase;DNA_mis_repair;HMMPfam_DNA_mis_repair;Ribosomal protein S5 domain 2-like;superfamily_Ribosomal protein S5 domain 2-like	p.N187Y	ENST00000231790.2	37	c.559	CCDS2663.1	3	.	.	.	.	.	.	.	.	.	.	A	22.3	4.268271	0.80469	.	.	ENSG00000076242	ENST00000231790;ENST00000436867;ENST00000537937;ENST00000383761;ENST00000435176	D;D	0.90504	-2.68;-2.68	6.08	6.08	0.98989	DNA mismatch repair protein, N-terminal (1);ATPase-like, ATP-binding domain (2);	0.000000	0.85682	D	0.000000	D	0.93413	0.7899	L	0.42487	1.325	0.80722	D	1	D;D;P	0.89917	0.97;1.0;0.931	P;D;P	0.77557	0.77;0.99;0.688	D	0.93972	0.7250	10	0.72032	D	0.01	-28.5752	16.6438	0.85155	1.0:0.0:0.0:0.0	.	89;187;187	E9PCU2;Q53GX1;P40692	.;.;MLH1_HUMAN	Y	187;153;153;51;89	ENSP00000231790:N187Y;ENSP00000402564:N89Y	ENSP00000231790:N187Y	N	+	1	0	MLH1	37028328	0.996000	0.38824	1.000000	0.80357	0.910000	0.53928	2.878000	0.48515	2.333000	0.79357	0.533000	0.62120	AAT	-	NULL		0.328	MLH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MLH1	protein_coding	OTTHUMT00000253337.2	A	NM_000249		37028328	1	no_errors	NM_000249	genbank	human	reviewed	54_36p	missense	SNP	1	T
KCNAB1	7881	genome.wustl.edu	37	3	156009909	156009909	+	Intron	SNP	G	G	A			TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr3:156009909G>A	ENST00000490337.1	+	2	339				KCNAB1_ENST00000389636.5_Intron|KCNAB1_ENST00000471742.1_Intron|KCNAB1_ENST00000389634.5_Missense_Mutation_p.M71I|KCNAB1_ENST00000302490.8_Missense_Mutation_p.M71I	NM_172160.2	NP_751892.1	Q14722	KCAB1_HUMAN	potassium voltage-gated channel, shaker-related subfamily, beta member 1						learning or memory (GO:0007611)|potassium ion transport (GO:0006813)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel regulator activity (GO:0015459)|voltage-gated potassium channel activity (GO:0005249)	p.M71I(1)		breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	28			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)			AGACTGGCATGAAATATAGGT	0.507																																																1	Substitution - Missense(1)	ovary(1)	3											61.0	56.0	58.0					3																	156009909		2203	4300	6503	157492603	SO:0001627	intron_variant	7881			U33428	CCDS3174.1, CCDS3175.1, CCDS33882.1	3q26.1	2006-11-29			ENSG00000169282	ENSG00000169282		"""Potassium channels"", ""Aldo-keto reductases"""	6228	protein-coding gene	gene with protein product		601141				8838324, 7499366	Standard	NM_172160		Approved	AKR6A3, KCNA1B, hKvBeta3, Kvb1.3, hKvb3	uc003far.2	Q14722	OTTHUMG00000158552	ENST00000490337.1:c.276-129496G>A	3.37:g.156009909G>A			157492603	A8K9H8|A8KAD4|B3KPZ4|Q13031|Q13302|Q16547|Q6PI60|Q99869	Missense_Mutation	SNP	-	p.M71I	ENST00000490337.1	37	c.213	CCDS3174.1	3	.	.	.	.	.	.	.	.	.	.	G	29.4	5.001255	0.93227	.	.	ENSG00000169282	ENST00000302490;ENST00000389634	T;T	0.57907	0.37;0.37	5.28	5.28	0.74379	.	0.040000	0.85682	D	0.000000	T	0.55705	0.1937	.	.	.	0.80722	D	1	B;B	0.31413	0.322;0.114	B;B	0.36666	0.23;0.086	T	0.59685	-0.7408	9	0.87932	D	0	.	18.5064	0.90898	0.0:0.0:1.0:0.0	.	71;71	F8W6W4;B3KPZ4	.;.	I	71	ENSP00000305858:M71I;ENSP00000374285:M71I	ENSP00000305858:M71I	M	+	3	0	KCNAB1	157492603	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.675000	0.98638	2.479000	0.83701	0.557000	0.71058	ATG	-	NULL		0.507	KCNAB1-002	KNOWN	basic|CCDS	protein_coding	KCNAB1	protein_coding	OTTHUMT00000351411.1	G	NM_003471		157492603	1	no_errors	NM_172159	genbank	human	reviewed	54_36p	missense	SNP	1	A
SYNPO2	171024	genome.wustl.edu	37	4	119952995	119952995	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr4:119952995C>T	ENST00000429713.2	+	4	3247	c.3065C>T	c.(3064-3066)tCg>tTg	p.S1022L	SYNPO2_ENST00000307142.4_Missense_Mutation_p.S1022L|SYNPO2_ENST00000434046.2_Missense_Mutation_p.S1022L|SYNPO2_ENST00000448416.2_Intron	NM_001128933.1	NP_001122405.1	Q9UMS6	SYNP2_HUMAN	synaptopodin 2	1022						actin cytoskeleton (GO:0015629)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|Z disc (GO:0030018)	14-3-3 protein binding (GO:0071889)|muscle alpha-actinin binding (GO:0051371)	p.S1022L(1)		breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(18)|ovary(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						GTGCAGGCTTCGTCAGTGTAC	0.572																																																1	Substitution - Missense(1)	ovary(1)	4											101.0	85.0	91.0					4																	119952995		2203	4300	6503	120172443	SO:0001583	missense	171024			AJ010482	CCDS34054.1, CCDS47128.1, CCDS47129.1, CCDS75185.1, CCDS75186.1	4q26	2008-08-29			ENSG00000172403	ENSG00000172403			17732	protein-coding gene	gene with protein product						11673475, 17828378	Standard	NM_133477		Approved	MYOPODIN	uc010inb.3	Q9UMS6	OTTHUMG00000161165	ENST00000429713.2:c.3065C>T	4.37:g.119952995C>T	ENSP00000395143:p.Ser1022Leu		120172443	B2RWP6|B2Y8J9|Q9UK89|S5XAM4	Missense_Mutation	SNP	HMMPfam_PDZ;superfamily_PDZ domain-like	p.S1022L	ENST00000429713.2	37	c.3065	CCDS47129.1	4	.	.	.	.	.	.	.	.	.	.	C	15.28	2.786017	0.49997	.	.	ENSG00000172403	ENST00000307142;ENST00000429713;ENST00000434046	T;T;T	0.09630	2.96;2.97;2.97	5.19	5.19	0.71726	.	0.000000	0.64402	D	0.000016	T	0.28699	0.0711	M	0.63428	1.95	0.53688	D	0.999971	D;P;D;P	0.71674	0.996;0.803;0.998;0.806	P;B;P;B	0.60473	0.758;0.095;0.875;0.316	T	0.00655	-1.1624	9	.	.	.	-8.0152	18.706	0.91639	0.0:1.0:0.0:0.0	.	1022;1022;1022;1022	B9EG60;Q9UMS6-2;E9PEM2;Q9UMS6	.;.;.;SYNP2_HUMAN	L	1022	ENSP00000306015:S1022L;ENSP00000395143:S1022L;ENSP00000390965:S1022L	.	S	+	2	0	SYNPO2	120172443	0.006000	0.16342	0.575000	0.28536	0.591000	0.36615	1.848000	0.39309	2.417000	0.82017	0.655000	0.94253	TCG	-	NULL		0.572	SYNPO2-003	KNOWN	basic|CCDS	protein_coding	SYNPO2	protein_coding	OTTHUMT00000364020.1	C			120172443	1	no_errors	NM_133477	genbank	human	validated	54_36p	missense	SNP	0.04	T
FGB	2244	genome.wustl.edu	37	4	155491581	155491581	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr4:155491581G>T	ENST00000302068.4	+	8	1318	c.1255G>T	c.(1255-1257)Gat>Tat	p.D419Y	FGB_ENST00000502545.1_3'UTR|FGB_ENST00000509493.1_Missense_Mutation_p.D200Y	NM_005141.4	NP_005132.2	P02675	FIBB_HUMAN	fibrinogen beta chain	419	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cellular protein complex assembly (GO:0043623)|cellular response to interleukin-1 (GO:0071347)|cellular response to leptin stimulus (GO:0044320)|extracellular matrix organization (GO:0030198)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of exocytosis (GO:0045921)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of peptide hormone secretion (GO:0090277)|positive regulation of protein secretion (GO:0050714)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of vasoconstriction (GO:0045907)|protein polymerization (GO:0051258)|response to calcium ion (GO:0051592)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|cell cortex (GO:0005938)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	chaperone binding (GO:0051087)|structural molecule activity (GO:0005198)	p.D419Y(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|liver(2)|lung(22)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34	all_hematologic(180;0.215)	Renal(120;0.0458)			Sucralfate(DB00364)	GTTAACATCAGATCCCAGAAA	0.423																																					NSCLC(106;1133 1613 21870 46110 52656)											1	Substitution - Missense(1)	ovary(1)	4											91.0	81.0	85.0					4																	155491581		2203	4300	6503	155711031	SO:0001583	missense	2244				CCDS3786.1	4q28	2014-09-17			ENSG00000171564	ENSG00000171564		"""Fibrinogen C domain containing"", ""Endogenous ligands"""	3662	protein-coding gene	gene with protein product		134830	"""fibrinogen, B beta polypeptide"""				Standard	NM_005141		Approved		uc003ioa.4	P02675	OTTHUMG00000150331	ENST00000302068.4:c.1255G>T	4.37:g.155491581G>T	ENSP00000306099:p.Asp419Tyr		155711031	A0JLR9|B2R7G3|Q32Q65|Q3KPF2	Missense_Mutation	SNP	-	p.D419Y	ENST00000302068.4	37	c.1255	CCDS3786.1	4	.	.	.	.	.	.	.	.	.	.	G	16.60	3.167181	0.57476	.	.	ENSG00000171564	ENST00000302068;ENST00000537843;ENST00000509493	T;T	0.81247	-1.47;-1.47	5.62	5.62	0.85841	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 2 (1);	0.043120	0.85682	D	0.000000	D	0.89455	0.6720	M	0.67953	2.075	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.89575	0.3816	10	0.87932	D	0	.	20.0281	0.97530	0.0:0.0:1.0:0.0	.	402;419	B4E1D3;P02675	.;FIBB_HUMAN	Y	419;402;200	ENSP00000306099:D419Y;ENSP00000426757:D200Y	ENSP00000306099:D419Y	D	+	1	0	FGB	155711031	1.000000	0.71417	0.996000	0.52242	0.034000	0.12701	9.310000	0.96267	2.818000	0.97014	0.655000	0.94253	GAT	-	NULL		0.423	FGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGB	protein_coding	OTTHUMT00000317595.1	G	NM_005141		155711031	1	no_errors	NM_005141	genbank	human	reviewed	54_36p	missense	SNP	1	T
ZNF608	57507	genome.wustl.edu	37	5	123983883	123983883	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr5:123983883G>C	ENST00000306315.5	-	4	2629	c.2194C>G	c.(2194-2196)Ctg>Gtg	p.L732V	ZNF608_ENST00000504926.1_Missense_Mutation_p.L305V	NM_020747.2	NP_065798.2	Q9ULD9	ZN608_HUMAN	zinc finger protein 608	732							metal ion binding (GO:0046872)	p.L732V(1)		breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(12)|ovary(3)|skin(6)|urinary_tract(1)	46		all_cancers(142;0.186)|Prostate(80;0.081)	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.00126)|Epithelial(69;0.00238)|all cancers(49;0.00783)		GCACTTTTCAGTTTAGAGAGG	0.473																																																1	Substitution - Missense(1)	ovary(1)	5											26.0	29.0	28.0					5																	123983883		2203	4300	6503	124011782	SO:0001583	missense	57507			AB033107	CCDS34219.1	5q23.2	2008-05-02			ENSG00000168916	ENSG00000168916		"""Zinc fingers, C2H2-type"""	29238	protein-coding gene	gene with protein product						10574462, 10508479	Standard	NM_020747		Approved	KIAA1281, DKFZp434M098, NY-REN-36	uc003ktq.1	Q9ULD9	OTTHUMG00000162999	ENST00000306315.5:c.2194C>G	5.37:g.123983883G>C	ENSP00000307746:p.Leu732Val		124011782	A7E2W9|Q3SYM6|Q68D12|Q8IY05|Q9Y5A1	Missense_Mutation	SNP	superfamily_C2H2 and C2HC zinc fingers	p.L732V	ENST00000306315.5	37	c.2194	CCDS34219.1	5	.	.	.	.	.	.	.	.	.	.	G	14.26	2.482849	0.44147	.	.	ENSG00000168916	ENST00000504926;ENST00000306315	T;T	0.45668	0.89;0.89	6.01	6.01	0.97437	.	0.316636	0.32357	N	0.006212	T	0.47691	0.1459	L	0.49350	1.555	0.40058	D	0.975865	D	0.56035	0.974	P	0.47402	0.546	T	0.24225	-1.0166	10	0.25751	T	0.34	-13.4973	20.5161	0.99213	0.0:0.0:1.0:0.0	.	732	Q9ULD9	ZN608_HUMAN	V	305;732	ENSP00000427657:L305V;ENSP00000307746:L732V	ENSP00000307746:L732V	L	-	1	2	ZNF608	124011782	1.000000	0.71417	0.879000	0.34478	0.895000	0.52256	5.001000	0.63946	2.852000	0.98041	0.643000	0.83706	CTG	-	NULL		0.473	ZNF608-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF608	protein_coding	OTTHUMT00000371300.1	G	XM_114432		124011782	-1	no_errors	NM_020747	genbank	human	validated	54_36p	missense	SNP	0.99	C
KDM3B	51780	genome.wustl.edu	37	5	137727944	137727944	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr5:137727944C>A	ENST00000314358.5	+	8	2823	c.2623C>A	c.(2623-2625)Ctg>Atg	p.L875M	KDM3B_ENST00000394866.1_Missense_Mutation_p.L531M|KDM3B_ENST00000542866.1_Intron	NM_016604.3	NP_057688	Q7LBC6	KDM3B_HUMAN	lysine (K)-specific demethylase 3B	875					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)	p.L875M(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(15)|liver(2)|lung(18)|ovary(4)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	65						GACTGCCCCCCTGAAAGGTGA	0.602																																																1	Substitution - Missense(1)	ovary(1)	5																																								137755843	SO:0001583	missense	51780			AF251039	CCDS34242.1	5q31	2011-07-01	2009-04-06	2009-04-06	ENSG00000120733	ENSG00000120733		"""Chromatin-modifying enzymes / K-demethylases"""	1337	protein-coding gene	gene with protein product		609373	"""chromosome 5 open reading frame 7"", ""jumonji domain containing 1B"""	C5orf7, JMJD1B		15138608	Standard	NM_016604		Approved	KIAA1082, NET22	uc003lcy.1	Q7LBC6	OTTHUMG00000163469	ENST00000314358.5:c.2623C>A	5.37:g.137727944C>A	ENSP00000326563:p.Leu875Met		137755843	A6H8X7|Q9BVH6|Q9BW93|Q9BZ52|Q9NYF4|Q9UPS0	Missense_Mutation	SNP	HMMPfam_JmjC;superfamily_Clavaminate synthase-like;superfamily_Cysteine-rich domain	p.L875M	ENST00000314358.5	37	c.2623	CCDS34242.1	5	.	.	.	.	.	.	.	.	.	.	C	14.61	2.586790	0.46110	.	.	ENSG00000120733	ENST00000314358;ENST00000545151;ENST00000394866	T;T	0.72282	-0.08;-0.64	5.97	2.07	0.26955	.	0.071914	0.56097	D	0.000024	T	0.72095	0.3418	L	0.36672	1.1	0.80722	D	1	D;D	0.71674	0.997;0.998	D;P	0.65010	0.931;0.896	T	0.66236	-0.5974	10	0.33940	T	0.23	-14.1594	10.452	0.44528	0.0:0.733:0.0:0.267	.	531;875	Q7LBC6-2;Q7LBC6	.;KDM3B_HUMAN	M	875;665;531	ENSP00000326563:L875M;ENSP00000378335:L531M	ENSP00000326563:L875M	L	+	1	2	KDM3B	137755843	0.663000	0.27448	0.980000	0.43619	0.992000	0.81027	0.390000	0.20768	0.088000	0.17205	0.655000	0.94253	CTG	-	NULL		0.602	KDM3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JMJD1B	protein_coding	OTTHUMT00000373597.1	C	NM_016604		137755843	1	no_errors	NM_016604	genbank	human	validated	54_36p	missense	SNP	0.99	A
LPCAT1	79888	genome.wustl.edu	37	5	1463851	1463851	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr5:1463851G>A	ENST00000283415.3	-	14	1652	c.1520C>T	c.(1519-1521)gCg>gTg	p.A507V	LPCAT1_ENST00000503252.1_5'UTR	NM_024830.3	NP_079106.3	Q8NF37	PCAT1_HUMAN	lysophosphatidylcholine acyltransferase 1	507					cellular lipid metabolic process (GO:0044255)|glycerophospholipid biosynthetic process (GO:0046474)|negative regulation of phosphatidylcholine biosynthetic process (GO:2001246)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phospholipid biosynthetic process (GO:0008654)|phospholipid metabolic process (GO:0006644)|positive regulation of protein catabolic process (GO:0045732)|retina development in camera-type eye (GO:0060041)|small molecule metabolic process (GO:0044281)|surfactant homeostasis (GO:0043129)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)|membrane (GO:0016020)	1-acylglycerophosphocholine O-acyltransferase activity (GO:0047184)|1-alkenylglycerophosphocholine O-acyltransferase activity (GO:0047159)|1-alkylglycerophosphocholine O-acetyltransferase activity (GO:0047192)|1-alkylglycerophosphocholine O-acyltransferase activity (GO:0047191)|calcium ion binding (GO:0005509)	p.A507V(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(12)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30			OV - Ovarian serous cystadenocarcinoma(19;0.0274)|all cancers(22;0.0534)	GBM - Glioblastoma multiforme(108;0.156)		TGGGATTGGCGCAGGTGAGGT	0.557																																																1	Substitution - Missense(1)	ovary(1)	5											99.0	99.0	99.0					5																	1463851		2203	4300	6503	1516851	SO:0001583	missense	79888			BC020166	CCDS3864.1	5p15.33	2013-01-10	2007-12-17	2007-12-17	ENSG00000153395	ENSG00000153395		"""EF-hand domain containing"""	25718	protein-coding gene	gene with protein product		610472	"""acyltransferase like 2"""	AYTL2		8619474, 16704971	Standard	NM_024830		Approved	FLJ12443	uc003jcm.3	Q8NF37	OTTHUMG00000131017	ENST00000283415.3:c.1520C>T	5.37:g.1463851G>A	ENSP00000283415:p.Ala507Val		1516851	Q1HAQ1|Q7Z4G6|Q8N3U7|Q8WUL8|Q9GZW6	Missense_Mutation	SNP	-	p.A507V	ENST00000283415.3	37	c.1520	CCDS3864.1	5	.	.	.	.	.	.	.	.	.	.	G	12.09	1.833700	0.32421	.	.	ENSG00000153395	ENST00000283415	T	0.70749	-0.51	4.23	1.25	0.21368	.	0.751394	0.12640	N	0.451412	T	0.43897	0.1268	L	0.27053	0.805	0.09310	N	1	P	0.42620	0.785	B	0.25140	0.058	T	0.29336	-1.0015	10	0.33141	T	0.24	-7.4202	3.4963	0.07655	0.0969:0.1676:0.5627:0.1728	.	507	Q8NF37	PCAT1_HUMAN	V	507	ENSP00000283415:A507V	ENSP00000283415:A507V	A	-	2	0	LPCAT1	1516851	0.046000	0.20272	0.000000	0.03702	0.003000	0.03518	2.541000	0.45735	-0.067000	0.12976	0.561000	0.74099	GCG	-	NULL		0.557	LPCAT1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LPCAT1	protein_coding	OTTHUMT00000304032.1	G	NM_024830		1516851	-1	no_errors	NM_024830	genbank	human	validated	54_36p	missense	SNP		A
NIPBL	25836	genome.wustl.edu	37	5	37026373	37026373	+	Missense_Mutation	SNP	A	A	G	rs199639172		TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr5:37026373A>G	ENST00000282516.8	+	31	6251	c.5752A>G	c.(5752-5754)Act>Gct	p.T1918A	NIPBL_ENST00000448238.2_Missense_Mutation_p.T1918A	NM_015384.4|NM_133433.3	NP_056199.2|NP_597677.2	Q6KC79	NIPBL_HUMAN	Nipped-B homolog (Drosophila)	1918					brain development (GO:0007420)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to X-ray (GO:0071481)|cognition (GO:0050890)|developmental growth (GO:0048589)|ear morphogenesis (GO:0042471)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic forelimb morphogenesis (GO:0035115)|embryonic viscerocranium morphogenesis (GO:0048703)|external genitalia morphogenesis (GO:0035261)|eye morphogenesis (GO:0048592)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|forelimb morphogenesis (GO:0035136)|gall bladder development (GO:0061010)|heart morphogenesis (GO:0003007)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|metanephros development (GO:0001656)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of ossification (GO:0045778)|regulation of developmental growth (GO:0048638)|regulation of embryonic development (GO:0045995)|regulation of hair cycle (GO:0042634)|sensory perception of sound (GO:0007605)|stem cell maintenance (GO:0019827)|uterus morphogenesis (GO:0061038)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMC loading complex (GO:0032116)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|histone deacetylase binding (GO:0042826)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)	p.T1918A(1)		autonomic_ganglia(1)|breast(4)|endometrium(9)|kidney(22)|large_intestine(21)|liver(1)|lung(47)|ovary(7)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	128	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			GTTTACTCCAACTCCACACAA	0.348													A|||	1	0.000199681	0.0	0.0	5008	,	,		18217	0.0		0.001	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	5											58.0	55.0	56.0					5																	37026373		2203	4300	6503	37062130	SO:0001583	missense	25836			AB019494	CCDS3920.1, CCDS47198.1	5p13.2	2009-08-28			ENSG00000164190	ENSG00000164190			28862	protein-coding gene	gene with protein product	"""sister chromatid cohesion 2 homolog (yeast)"""	608667				15146186, 15146185	Standard	NM_133433		Approved	IDN3, DKFZp434L1319, FLJ11203, FLJ12597, FLJ13354, FLJ13648, Scc2	uc003jkl.4	Q6KC79	OTTHUMG00000090795	ENST00000282516.8:c.5752A>G	5.37:g.37026373A>G	ENSP00000282516:p.Thr1918Ala		37062130	Q6KCD6|Q6N080|Q6ZT92|Q7Z2E6|Q8N4M5|Q9Y6Y3|Q9Y6Y4	Missense_Mutation	SNP	superfamily_ARM repeat	p.T1918A	ENST00000282516.8	37	c.5752	CCDS3920.1	5	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	A	16.98	3.272027	0.59649	.	.	ENSG00000164190	ENST00000282516;ENST00000448238	D;D	0.93189	-3.18;-3.18	6.07	6.07	0.98685	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.90133	0.6917	L	0.47716	1.5	0.58432	D	0.999999	B;B	0.13145	0.002;0.007	B;B	0.13407	0.003;0.009	D	0.86246	0.1646	10	0.11485	T	0.65	-13.5668	16.6406	0.85098	1.0:0.0:0.0:0.0	.	1918;1918	Q6KC79;Q6KC79-2	NIPBL_HUMAN;.	A	1918	ENSP00000282516:T1918A;ENSP00000406266:T1918A	ENSP00000282516:T1918A	T	+	1	0	NIPBL	37062130	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.932000	0.92897	2.326000	0.78906	0.533000	0.62120	ACT	-	NULL		0.348	NIPBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NIPBL	protein_coding	OTTHUMT00000207582.1	A	NM_015384		37062130	1	no_errors	NM_133433	genbank	human	reviewed	54_36p	missense	SNP	1	G
PCDH1	5097	genome.wustl.edu	37	5	141243662	141243662	+	Missense_Mutation	SNP	T	T	A			TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr5:141243662T>A	ENST00000394536.3	-	3	2373	c.2234A>T	c.(2233-2235)gAc>gTc	p.D745V	PCDH1_ENST00000456271.1_Missense_Mutation_p.D733V|PCDH1_ENST00000511044.1_5'UTR|PCDH1_ENST00000536585.1_Missense_Mutation_p.D723V|PCDH1_ENST00000287008.3_Missense_Mutation_p.D745V|PCDH1_ENST00000503492.1_Intron	NM_001278613.1|NM_001278615.1	NP_001265542.1|NP_001265544.1	Q08174	PCDH1_HUMAN	protocadherin 1	745	Cadherin 7. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell-cell signaling (GO:0007267)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	cell-cell junction (GO:0005911)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.D745V(1)		breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(4)|lung(20)|ovary(5)|skin(3)|upper_aerodigestive_tract(1)	51		Lung NSC(810;0.027)|all_lung(500;0.0321)|all_hematologic(541;0.0433)|Prostate(461;0.0453)|Breast(839;0.128)|Lung SC(612;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;1.06e-05)		GACACCAGAGTCAAAGTCCTC	0.552																																					Ovarian(132;1609 1739 4190 14731 45037)											1	Substitution - Missense(1)	ovary(1)	5											67.0	64.0	65.0					5																	141243662		2203	4300	6503	141223846	SO:0001583	missense	5097			AK075233	CCDS4267.1, CCDS43375.1	5q31.3	2010-01-26	2007-02-12		ENSG00000156453	ENSG00000156453		"""Cadherins / Protocadherins : Non-clustered"""	8655	protein-coding gene	gene with protein product		603626	"""protocadherin 1 (cadherin-like 1)"""			8508762	Standard	NM_032420		Approved	pc42	uc003llp.3	Q08174	OTTHUMG00000129661	ENST00000394536.3:c.2234A>T	5.37:g.141243662T>A	ENSP00000378043:p.Asp745Val		141223846	Q8IUP2	Missense_Mutation	SNP	-	p.D745V	ENST00000394536.3	37	c.2234	CCDS43375.1	5	.	.	.	.	.	.	.	.	.	.	t	16.93	3.257138	0.59321	.	.	ENSG00000156453	ENST00000287008;ENST00000394536;ENST00000456271;ENST00000357517;ENST00000536585	T;T;T;T;T	0.74737	-0.87;-0.87;-0.87;-0.87;-0.87	5.42	5.42	0.78866	Cadherin (4);Cadherin-like (1);	0.000000	0.53938	D	0.000043	D	0.92378	0.7581	H	0.99659	4.685	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.95172	0.8291	10	0.87932	D	0	.	13.3964	0.60856	0.0:0.0:0.0:1.0	.	745;745	Q08174;Q08174-2	PCDH1_HUMAN;.	V	745;745;733;756;723	ENSP00000287008:D745V;ENSP00000378043:D745V;ENSP00000403497:D733V;ENSP00000350122:D756V;ENSP00000438825:D723V	ENSP00000287008:D745V	D	-	2	0	PCDH1	141223846	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.988000	0.88194	2.060000	0.61445	0.375000	0.23000	GAC	-	NULL		0.552	PCDH1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PCDH1	protein_coding	OTTHUMT00000251862.1	T	NM_032420		141223846	-1	no_errors	NM_032420	genbank	human	reviewed	54_36p	missense	SNP	1	A
MICB	4277	genome.wustl.edu	37	6	31465979	31465980	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	GG	GG	GG	TT	GG	GG	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr6:31465979_31465980GG>TT	ENST00000252229.6	+	1	88_89	c.9_10GG>TT	c.(7-12)ctGGgc>ctTTgc	p.G4C	MICB_ENST00000538442.1_Intron|Y_RNA_ENST00000383850.1_RNA|MICB_ENST00000427115.1_Missense_Mutation_p.G4C|MICB_ENST00000399150.3_Missense_Mutation_p.G4C	NM_005931.3	NP_005922.2			MHC class I polypeptide-related sequence B											NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)	13						CCATGGGGCTGGGCCGGGTCCT	0.668																																																0			6																																								31573959	SO:0001583	missense	4277				CCDS43449.1, CCDS75422.1, CCDS75423.1	6p21.3	2013-01-11			ENSG00000204516	ENSG00000204516		"""Immunoglobulin superfamily / C1-set domain containing"""	7091	protein-coding gene	gene with protein product		602436				8022771	Standard	NM_005931		Approved	PERB11.2	uc003ntn.4	Q29980	OTTHUMG00000031074	Exception_encountered	6.37:g.31465979_31465980delinsTT	ENSP00000252229:p.Gly4Cys		31573958		Missense_Mutation	DNP	-	p.G4C	ENST00000252229.6	37	c.9_10	CCDS43449.1	6																																																																																			-	NULL		0.668	MICB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MICB	protein_coding	OTTHUMT00000076102.3	GG	NM_005931		31573959	1	no_errors	NM_005931	genbank	human	reviewed	54_36p	missense	DNP	0.001:0.000	TT
BACH2	60468	genome.wustl.edu	37	6	90642163	90642163	+	Silent	SNP	A	A	G			TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr6:90642163A>G	ENST00000257749.4	-	9	3197	c.2490T>C	c.(2488-2490)tgT>tgC	p.C830C	BACH2_ENST00000343122.3_Silent_p.C830C|BACH2_ENST00000537989.1_Silent_p.C830C	NM_021813.2	NP_068585.1	Q9BYV9	BACH2_HUMAN	BTB and CNC homology 1, basic leucine zipper transcription factor 2	830						cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001206)	p.C830C(1)		central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(18)|ovary(5)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	45		all_cancers(76;7.37e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.0063)		BRCA - Breast invasive adenocarcinoma(108;0.0799)		CGTCAGTTGTACACTTATCAG	0.547																																																1	Substitution - coding silent(1)	ovary(1)	6											249.0	255.0	253.0					6																	90642163		2203	4300	6503	90698884	SO:0001819	synonymous_variant	60468			AL121787	CCDS5026.1	6q15	2013-01-10			ENSG00000112182	ENSG00000112182		"""BTB/POZ domain containing"", ""basic leucine zipper proteins"""	14078	protein-coding gene	gene with protein product		605394				10949928, 12829606	Standard	NM_001170794		Approved	BTBD25	uc003pnw.3	Q9BYV9	OTTHUMG00000015216	ENST00000257749.4:c.2490T>C	6.37:g.90642163A>G			90698884	E1P518|Q59H70|Q5T793|Q9NTS5	Silent	SNP	superfamily_A DNA-binding domain in eukaryotic transcription factors;HMMPfam_bZIP_1;HMMPfam_BTB;superfamily_POZ domain	p.C830	ENST00000257749.4	37	c.2490	CCDS5026.1	6																																																																																			-	NULL		0.547	BACH2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	BACH2	protein_coding	OTTHUMT00000041522.2	A	NM_021813		90698884	-1	no_errors	NM_021813	genbank	human	validated	54_36p	silent	SNP	1	G
SLC22A3	6581	genome.wustl.edu	37	6	160872083	160872083	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr6:160872083C>T	ENST00000275300.2	+	11	1818	c.1666C>T	c.(1666-1668)Ctt>Ttt	p.L556F	SLC22A3_ENST00000392145.1_Missense_Mutation_p.L557F	NM_021977.3	NP_068812.1	O75751	S22A3_HUMAN	solute carrier family 22 (organic cation transporter), member 3	556					dopamine transport (GO:0015872)|drug transmembrane transport (GO:0006855)|histamine uptake (GO:0051615)|organic cation transport (GO:0015695)|quaternary ammonium group transport (GO:0015697)|regulation of appetite (GO:0032098)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	dopamine transmembrane transporter activity (GO:0005329)|organic cation transmembrane transporter activity (GO:0015101)|quaternary ammonium group transmembrane transporter activity (GO:0015651)|toxin transporter activity (GO:0019534)	p.L556F(1)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	27		Breast(66;0.00028)|Ovarian(120;0.0308)|Prostate(117;0.218)		OV - Ovarian serous cystadenocarcinoma(65;9.47e-17)|BRCA - Breast invasive adenocarcinoma(81;9.75e-06)	Adefovir Dipivoxil(DB00718)|Amphetamine(DB00182)|Choline(DB00122)|Cimetidine(DB00501)|Clonidine(DB00575)|Colchicine(DB01394)|Desipramine(DB01151)|Dopamine(DB00988)|Estradiol(DB00783)|Guanidine(DB00536)|Histamine Phosphate(DB00667)|Imipramine(DB00458)|Irinotecan(DB00762)|Lamivudine(DB00709)|Melphalan(DB01042)|Metformin(DB00331)|Methamphetamine(DB01577)|Nicotine(DB00184)|Norepinephrine(DB00368)|Oxaliplatin(DB00526)|Phenoxybenzamine(DB00925)|Prazosin(DB00457)|Procainamide(DB01035)|Progesterone(DB00396)|Testosterone(DB00624)|Vincristine(DB00541)	CCGCTCTCACCTTTGAGGCCC	0.458																																																1	Substitution - Missense(1)	ovary(1)	6											40.0	36.0	37.0					6																	160872083		2202	4300	6502	160792073	SO:0001583	missense	6581			AF078749	CCDS5277.1	6q25.3	2013-07-18	2013-07-18		ENSG00000146477	ENSG00000146477		"""Solute carriers"""	10967	protein-coding gene	gene with protein product		604842	"""solute carrier family 22 (extraneuronal monoamine transporter), member 3"""			9632645, 9933568	Standard	NM_021977		Approved	OCT3, EMT	uc003qti.4	O75751	OTTHUMG00000015953	ENST00000275300.2:c.1666C>T	6.37:g.160872083C>T	ENSP00000275300:p.Leu556Phe		160792073	Q5SYN6|Q9UP02	Missense_Mutation	SNP	HMMPfam_MFS_1;superfamily_MFS general substrate transporter	p.L556F	ENST00000275300.2	37	c.1666	CCDS5277.1	6	.	.	.	.	.	.	.	.	.	.	c	8.891	0.954078	0.18431	.	.	ENSG00000146477	ENST00000275300;ENST00000392145	T;T	0.74421	-0.84;-0.84	4.59	2.54	0.30619	.	0.416519	0.20374	N	0.093600	T	0.32255	0.0823	N	0.08118	0	0.20403	N	0.999905	B	0.34015	0.435	B	0.32533	0.147	T	0.12967	-1.0527	10	0.66056	D	0.02	.	6.7092	0.23268	0.182:0.5279:0.2901:0.0	.	556	O75751	S22A3_HUMAN	F	556;557	ENSP00000275300:L556F;ENSP00000375989:L557F	ENSP00000275300:L556F	L	+	1	0	SLC22A3	160792073	0.946000	0.32159	0.918000	0.36340	0.116000	0.19942	0.238000	0.18004	1.149000	0.42402	0.561000	0.74099	CTT	-	NULL		0.458	SLC22A3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SLC22A3	protein_coding	OTTHUMT00000042953.1	C	NM_021977		160792073	1	no_errors	NM_021977	genbank	human	reviewed	54_36p	missense	SNP	0.22	T
MYL10	93408	genome.wustl.edu	37	7	101267528	101267528	+	Missense_Mutation	SNP	C	C	T	rs143165987		TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr7:101267528C>T	ENST00000223167.4	-	2	272	c.95G>A	c.(94-96)cGg>cAg	p.R32Q		NM_138403.4	NP_612412.2	Q9BUA6	MYL10_HUMAN	myosin, light chain 10, regulatory	32						mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)	p.R32Q(1)		breast(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)	12						TGCTCTTTTCCGAGCTCTTCT	0.612																																					Esophageal Squamous(24;575 709 17516 40384 51639)											1	Substitution - Missense(1)	ovary(1)	7						C	GLN/ARG	0,4406		0,0,2203	113.0	109.0	111.0		95	3.6	1.0	7	dbSNP_134	111	1,8599	1.2+/-3.3	0,1,4299	no	missense	MYL10	NM_138403.4	43	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging	32/227	101267528	1,13005	2203	4300	6503	101054248	SO:0001583	missense	93408			BC002778	CCDS34713.1	7q22.1	2013-01-10			ENSG00000106436	ENSG00000106436		"""Myosins / Light chain"", ""EF-hand domain containing"""	29825	protein-coding gene	gene with protein product						1628631	Standard	NM_138403		Approved	MGC3479, MYLC2PL, PLRLC	uc003uyr.3	Q9BUA6	OTTHUMG00000157137	ENST00000223167.4:c.95G>A	7.37:g.101267528C>T	ENSP00000223167:p.Arg32Gln		101054248		Missense_Mutation	SNP	-	p.R32Q	ENST00000223167.4	37	c.95	CCDS34713.1	7	.	.	.	.	.	.	.	.	.	.	C	18.58	3.653938	0.67472	0.0	1.16E-4	ENSG00000106436	ENST00000223167	T	0.72505	-0.66	4.71	3.56	0.40772	.	0.088290	0.42964	D	0.000638	T	0.57066	0.2028	L	0.46157	1.445	0.29288	N	0.869536	P	0.43169	0.8	B	0.38755	0.281	T	0.61628	-0.7024	10	0.62326	D	0.03	.	4.1434	0.10205	0.0:0.6769:0.0:0.3231	.	32	Q9BUA6	MYL10_HUMAN	Q	32	ENSP00000223167:R32Q	ENSP00000223167:R32Q	R	-	2	0	MYL10	101054248	1.000000	0.71417	0.998000	0.56505	0.797000	0.45037	5.783000	0.68982	2.339000	0.79563	0.561000	0.74099	CGG	-	NULL		0.612	MYL10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYL10	protein_coding	OTTHUMT00000347575.1	C	NM_138403		101054248	-1	no_errors	NM_138403	genbank	human	validated	54_36p	missense	SNP	1	T
EXOC4	60412	genome.wustl.edu	37	7	133602392	133602392	+	Missense_Mutation	SNP	A	A	G			TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr7:133602392A>G	ENST00000253861.4	+	13	1957	c.1928A>G	c.(1927-1929)gAt>gGt	p.D643G	EXOC4_ENST00000545148.1_Missense_Mutation_p.D253G|EXOC4_ENST00000460346.1_3'UTR|EXOC4_ENST00000539845.1_Missense_Mutation_p.D542G	NM_021807.3	NP_068579.3	Q96A65	EXOC4_HUMAN	exocyst complex component 4	643					cellular protein metabolic process (GO:0044267)|membrane organization (GO:0061024)|protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	cytoplasm (GO:0005737)|exocyst (GO:0000145)|growth cone membrane (GO:0032584)|membrane (GO:0016020)|myelin sheath abaxonal region (GO:0035748)|plasma membrane (GO:0005886)	protein N-terminus binding (GO:0047485)	p.D643G(1)		NS(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(16)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	50		Esophageal squamous(399;0.129)				GCAAAAGATGATGATATCAGC	0.428																																																1	Substitution - Missense(1)	ovary(1)	7											160.0	148.0	152.0					7																	133602392		2203	4300	6503	133252932	SO:0001583	missense	60412			AL831989	CCDS5829.1, CCDS43648.1	7q31	2013-01-22	2005-11-01	2005-11-01	ENSG00000131558	ENSG00000131558			30389	protein-coding gene	gene with protein product		608185	"""SEC8-like 1 (S. cerevisiae)"""	SEC8L1		11214970, 12687004	Standard	XM_005250523		Approved	KIAA1699, MGC27170, SEC8, Sec8p	uc003vrk.3	Q96A65	OTTHUMG00000155259	ENST00000253861.4:c.1928A>G	7.37:g.133602392A>G	ENSP00000253861:p.Asp643Gly		133252932	E9PED2|Q541U8|Q9C0G4|Q9H9K0|Q9P102	Missense_Mutation	SNP	HMMPfam_Sec8_exocyst	p.D643G	ENST00000253861.4	37	c.1928	CCDS5829.1	7	.	.	.	.	.	.	.	.	.	.	A	20.1	3.938064	0.73557	.	.	ENSG00000131558	ENST00000253861;ENST00000546185;ENST00000539845;ENST00000545148	.	.	.	4.91	4.91	0.64330	.	0.053291	0.64402	D	0.000001	T	0.53850	0.1822	L	0.38175	1.15	0.80722	D	1	B;B;B	0.28055	0.029;0.199;0.007	B;B;B	0.31101	0.009;0.124;0.006	T	0.52366	-0.8585	9	0.33940	T	0.23	.	14.8347	0.70175	1.0:0.0:0.0:0.0	.	175;253;643	B7Z689;F5GZT1;Q96A65	.;.;EXOC4_HUMAN	G	643;262;542;253	.	ENSP00000253861:D643G	D	+	2	0	EXOC4	133252932	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.545000	0.90657	1.966000	0.57179	0.460000	0.39030	GAT	-	NULL		0.428	EXOC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EXOC4	protein_coding	OTTHUMT00000339182.1	A	NM_021807		133252932	1	no_errors	NM_021807	genbank	human	reviewed	54_36p	missense	SNP	1	G
ZNF479	90827	genome.wustl.edu	37	7	57188077	57188077	+	Missense_Mutation	SNP	T	T	C	rs560371254	byFrequency	TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr7:57188077T>C	ENST00000331162.4	-	5	1315	c.1045A>G	c.(1045-1047)Aga>Gga	p.R349G		NM_033273.1	NP_150376.1	Q96JC4	ZN479_HUMAN	zinc finger protein 479	349					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R349G(1)		NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(53)|ovary(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	84			GBM - Glioblastoma multiforme(1;9.18e-12)			GGTTTCTCTCTAGTATGAATT	0.438													.|||	3	0.000599042	0.0	0.0029	5008	,	,		21578	0.0		0.001	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	7																																								57192019	SO:0001583	missense	90827			AF277624	CCDS43590.1	7p11.2	2013-01-08			ENSG00000185177	ENSG00000185177		"""Zinc fingers, C2H2-type"", ""-"""	23258	protein-coding gene	gene with protein product						11410164	Standard	NM_033273		Approved	KR19	uc010kzo.3	Q96JC4	OTTHUMG00000156682	ENST00000331162.4:c.1045A>G	7.37:g.57188077T>C	ENSP00000333776:p.Arg349Gly		57192019		Missense_Mutation	SNP	-	p.R349G	ENST00000331162.4	37	c.1045	CCDS43590.1	7	.	.	.	.	.	.	.	.	.	.	N	0.009	-1.820834	0.00595	.	.	ENSG00000185177	ENST00000331162	T	0.11495	2.77	0.946	-0.24	0.13047	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.01905	0.0060	N	0.00265	-1.74	0.22745	N	0.998782	B	0.02656	0.0	B	0.01281	0.0	T	0.35992	-0.9766	9	0.02654	T	1	.	6.684	0.23134	0.0:0.7699:0.0:0.2301	.	349	Q96JC4	ZN479_HUMAN	G	349	ENSP00000333776:R349G	ENSP00000333776:R349G	R	-	1	2	ZNF479	57192019	0.003000	0.15002	0.015000	0.15790	0.013000	0.08279	1.442000	0.35046	-2.200000	0.00747	-2.221000	0.00296	AGA	-	NULL		0.438	ZNF479-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF479	protein_coding	OTTHUMT00000345302.1	T	XM_291202		57192019	-1	no_errors	NM_033273	genbank	human	provisional	54_36p	missense	SNP	0.97	C
RBM33	155435	genome.wustl.edu	37	7	155537869	155537869	+	Nonsense_Mutation	SNP	C	C	G			TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr7:155537869C>G	ENST00000401878.3	+	14	2750	c.2552C>G	c.(2551-2553)tCa>tGa	p.S851*	RBM33_ENST00000341148.3_5'Flank	NM_053043.2	NP_444271.2	Q96EV2	RBM33_HUMAN	RNA binding motif protein 33	851							nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.S851*(1)		breast(3)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(4)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	27	all_neural(206;0.101)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.011)	UCEC - Uterine corpus endometrioid carcinoma (81;0.2)		CTGTCACCATCACCCACCAAC	0.542																																																1	Substitution - Nonsense(1)	ovary(1)	7											59.0	44.0	49.0					7																	155537869		2203	4300	6503	155230630	SO:0001587	stop_gained	155435			AL832196	CCDS5941.2	7q36.3	2013-02-12			ENSG00000184863	ENSG00000184863		"""RNA binding motif (RRM) containing"""	27223	protein-coding gene	gene with protein product			"""proline rich 8"""	PRR8			Standard	NM_053043		Approved	DKFZp686F102, MGC20460, DKFZp434D1319	uc010lqk.1	Q96EV2	OTTHUMG00000150260	ENST00000401878.3:c.2552C>G	7.37:g.155537869C>G	ENSP00000384160:p.Ser851*		155230630	A4D244|B5MC24|Q52LF5|Q75LN9|Q75ML5|Q9NSV0	Nonsense_Mutation	SNP	-	p.S851*	ENST00000401878.3	37	c.2552	CCDS5941.2	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	26.4|26.4	4.736030|4.736030	0.89482|0.89482	.|.	.|.	ENSG00000184863|ENSG00000184863	ENST00000392761|ENST00000401878	.|.	.|.	.|.	5.95|5.95	3.21|3.21	0.36854|0.36854	.|.	.|0.696198	.|0.13112	.|N	.|0.412914	T|.	0.17450|.	0.0419|.	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.28964|.	-1.0027|.	4|.	.|0.11182	.|T	.|0.66	.|.	5.3522|5.3522	0.16042|0.16042	0.1265:0.541:0.0:0.3325|0.1265:0.541:0.0:0.3325	.|.	.|.	.|.	.|.	D|X	623|851	.|.	.|ENSP00000384160:S851X	H|S	+|+	1|2	0|0	RBM33|RBM33	155230630|155230630	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.065000|0.065000	0.16274|0.16274	0.217000|0.217000	0.17603|0.17603	0.428000|0.428000	0.26173|0.26173	0.655000|0.655000	0.94253|0.94253	CAC|TCA	-	NULL		0.542	RBM33-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RBM33	protein_coding	OTTHUMT00000317225.3	C	NM_001008408		155230630	1	no_errors	NM_053043	genbank	human	validated	54_36p	nonsense	SNP	0	G
MATN2	4147	genome.wustl.edu	37	8	99039928	99039928	+	Nonsense_Mutation	SNP	G	G	T			TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr8:99039928G>T	ENST00000520016.1	+	13	2351	c.2227G>T	c.(2227-2229)Gag>Tag	p.E743*	MATN2_ENST00000521689.1_Nonsense_Mutation_p.E743*|MATN2_ENST00000524308.1_Nonsense_Mutation_p.E702*|RPL30_ENST00000518164.1_Intron|MATN2_ENST00000522025.2_Nonsense_Mutation_p.E459*|MATN2_ENST00000254898.5_Nonsense_Mutation_p.E743*			O00339	MATN2_HUMAN	matrilin 2	743	VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.					proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)	p.E743*(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(17)|ovary(2)|urinary_tract(1)	31	Breast(36;1.43e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.244)			ACACATGTTTGAGAGAAGTTT	0.532																																																1	Substitution - Nonsense(1)	ovary(1)	8											46.0	46.0	46.0					8																	99039928		1871	4104	5975	99109104	SO:0001587	stop_gained	4147			U69263	CCDS55264.1, CCDS55265.1	8q22.1-q22.2	2008-05-15							6908	protein-coding gene	gene with protein product		602108				9083061, 11852232	Standard	XM_005250920		Approved		uc003yic.3	O00339		ENST00000520016.1:c.2227G>T	8.37:g.99039928G>T	ENSP00000430487:p.Glu743*		99109104	A8K106|E7EW74|E9PD48|E9PGL2|Q6UWA5|Q7Z5X1|Q8NDE6|Q96FT5|Q9NSZ1	Nonsense_Mutation	SNP	HMMPfam_VWA;HMMPfam_EGF;superfamily_vWA-like;superfamily_EGF/Laminin	p.E743*	ENST00000520016.1	37	c.2227	CCDS55264.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	37|37	6.584154|6.584154	0.97684|0.97684	.|.	.|.	ENSG00000132561|ENSG00000132561	ENST00000521689;ENST00000254898;ENST00000378716;ENST00000524308;ENST00000522025;ENST00000520016|ENST00000518154;ENST00000517321	.|.	.|.	.|.	5.24|5.24	5.24|5.24	0.73138|0.73138	.|.	0.000000|.	0.64402|.	D|.	0.000006|.	.|.	.|.	.|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	0.56958|.	D|.	0.05|.	-31.1363|-31.1363	19.1881|19.1881	0.93653|0.93653	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|L	743;743;702;702;459;743|525;176	.|.	ENSP00000254898:E743X|.	E|X	+|+	1|2	0|2	MATN2|MATN2	99109104|99109104	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	3.920000|3.920000	0.56446|0.56446	2.602000|2.602000	0.87976|0.87976	0.555000|0.555000	0.69702|0.69702	GAG|TGA	-	HMMPfam_VWA		0.532	MATN2-004	KNOWN	non_canonical_conserved|basic|appris_candidate|CCDS	protein_coding	MATN2	protein_coding	OTTHUMT00000380332.1	G			99109104	1	no_errors	NM_002380	genbank	human	reviewed	54_36p	nonsense	SNP	1	T
PKHD1L1	93035	genome.wustl.edu	37	8	110457743	110457743	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr8:110457743G>A	ENST00000378402.5	+	38	5749	c.5645G>A	c.(5644-5646)tGc>tAc	p.C1882Y		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	1882	IPT/TIG 11.				immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.C1884Y(1)		NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			GAAGTCTACTGCCGCACTCCC	0.438										HNSCC(38;0.096)																																						1	Substitution - Missense(1)	ovary(1)	8											48.0	48.0	48.0					8																	110457743		1918	4142	6060	110526919	SO:0001583	missense	93035			AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.5645G>A	8.37:g.110457743G>A	ENSP00000367655:p.Cys1882Tyr		110526919	Q567P2|Q9UF27	Missense_Mutation	SNP	HMMPfam_TIG;superfamily_Cupredoxins;superfamily_Pectin lyase-like;superfamily_Composite domain of metallo-dependent hydrolases;superfamily_E set domains;superfamily_Anthrax protective antigen	p.C1882Y	ENST00000378402.5	37	c.5645	CCDS47911.1	8	.	.	.	.	.	.	.	.	.	.	G	15.89	2.967065	0.53507	.	.	ENSG00000205038	ENST00000378402	D	0.83163	-1.69	5.91	5.91	0.95273	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.94476	0.8222	H	0.96633	3.855	0.50632	D	0.999887	D	0.89917	1.0	D	0.97110	1.0	D	0.95736	0.8779	10	0.87932	D	0	.	17.7921	0.88555	0.0:0.0:1.0:0.0	.	1882	Q86WI1	PKHL1_HUMAN	Y	1882	ENSP00000367655:C1882Y	ENSP00000367655:C1882Y	C	+	2	0	PKHD1L1	110526919	1.000000	0.71417	0.523000	0.27875	0.129000	0.20672	7.560000	0.82277	2.802000	0.96397	0.655000	0.94253	TGC	-	HMMPfam_TIG		0.438	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKHD1L1	protein_coding	OTTHUMT00000381017.1	G	NM_177531		110526919	1	no_errors	NM_177531	genbank	human	validated	54_36p	missense	SNP	0.91	A
OR1Q1	158131	genome.wustl.edu	37	9	125377715	125377715	+	Silent	SNP	C	C	T			TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr9:125377715C>T	ENST00000297913.2	+	1	768	c.699C>T	c.(697-699)ggC>ggT	p.G233G	RP11-64P14.7_ENST00000431442.1_RNA	NM_012364.1	NP_036496.1	Q15612	OR1Q1_HUMAN	olfactory receptor, family 1, subfamily Q, member 1	233					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.G233G(1)		NS(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)|skin(2)	17						CAGCCAAGGGCAGGTGGAAAA	0.552																																																1	Substitution - coding silent(1)	ovary(1)	9											103.0	102.0	103.0					9																	125377715		2203	4300	6503	124417536	SO:0001819	synonymous_variant	158131				CCDS35125.1	9q33.2	2013-09-20			ENSG00000165202	ENSG00000165202		"""GPCR / Class A : Olfactory receptors"""	8223	protein-coding gene	gene with protein product				OR1Q2, OR1Q3			Standard	NM_012364		Approved	OST226, OR9-A, HSTPCR106, OST226OR9-A, TPCR106	uc011lyy.2	Q15612	OTTHUMG00000020615	ENST00000297913.2:c.699C>T	9.37:g.125377715C>T			124417536	Q6IFN4|Q8NGR7|Q96R82	Silent	SNP	-	p.G233	ENST00000297913.2	37	c.699	CCDS35125.1	9																																																																																			-	NULL		0.552	OR1Q1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR1Q1	protein_coding	OTTHUMT00000053946.1	C			124417536	1	no_errors	NM_012364	genbank	human	provisional	54_36p	silent	SNP		T
PGM5	5239	genome.wustl.edu	37	9	71080034	71080034	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr9:71080034G>T	ENST00000396396.1	+	7	1298	c.1069G>T	c.(1069-1071)Gta>Tta	p.V357L	PGM5_ENST00000396392.1_Missense_Mutation_p.V357L	NM_021965.3	NP_068800.2	Q15124	PGM5_HUMAN	phosphoglucomutase 5	357					carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)	cell-cell adherens junction (GO:0005913)|costamere (GO:0043034)|cytoplasmic side of plasma membrane (GO:0009898)|dystrophin-associated glycoprotein complex (GO:0016010)|focal adhesion (GO:0005925)|intercalated disc (GO:0014704)|sarcolemma (GO:0042383)|spot adherens junction (GO:0005914)|stress fiber (GO:0001725)|Z disc (GO:0030018)	intramolecular transferase activity, phosphotransferases (GO:0016868)|magnesium ion binding (GO:0000287)|structural molecule activity (GO:0005198)	p.V357L(1)		endometrium(5)|kidney(1)|large_intestine(5)|liver(2)|lung(15)|ovary(1)|pancreas(1)|prostate(3)|skin(1)	34						GAAGGTCCCTGTATATGAGAC	0.408																																																1	Substitution - Missense(1)	ovary(1)	9											147.0	138.0	141.0					9																	71080034		2203	4300	6503	70269854	SO:0001583	missense	5239			L40933	CCDS6622.2	9q13	2008-02-05			ENSG00000154330	ENSG00000154330			8908	protein-coding gene	gene with protein product	"""phosphoglucomutase-related protein"""	600981				8586438, 8631316	Standard	NM_021965		Approved	PGMRP	uc004agr.3	Q15124	OTTHUMG00000019966	ENST00000396396.1:c.1069G>T	9.37:g.71080034G>T	ENSP00000379678:p.Val357Leu		70269854	B1AM46|B4DLQ6|Q5VYV3|Q8N527|Q9UDH4	Missense_Mutation	SNP	-	p.V357L	ENST00000396396.1	37	c.1069	CCDS6622.2	9	.	.	.	.	.	.	.	.	.	.	G	9.543	1.113870	0.20795	.	.	ENSG00000154330	ENST00000396396;ENST00000396392	T;T	0.39787	1.06;1.06	5.87	5.87	0.94306	Alpha-D-phosphohexomutase, alpha/beta/alpha I/II/III (2);Alpha-D-phosphohexomutase, alpha/beta/alpha domain III (1);	0.062805	0.64402	D	0.000005	T	0.26011	0.0634	N	0.05177	-0.1	0.58432	D	0.999996	B	0.06786	0.001	B	0.13407	0.009	T	0.10132	-1.0643	10	0.17832	T	0.49	.	19.3531	0.94398	0.0:0.0:1.0:0.0	.	357	Q15124	PGM5_HUMAN	L	357	ENSP00000379678:V357L;ENSP00000379674:V357L	ENSP00000379674:V357L	V	+	1	0	PGM5	70269854	0.998000	0.40836	0.983000	0.44433	0.897000	0.52465	2.555000	0.45854	2.941000	0.99782	0.655000	0.94253	GTA	-	NULL		0.408	PGM5-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PGM5	protein_coding	OTTHUMT00000052548.2	G	NM_021965		70269854	1	no_errors	NM_021965	genbank	human	validated	54_36p	missense	SNP	1	T
C9orf135	138255	genome.wustl.edu	37	9	72435915	72435915	+	Silent	SNP	G	G	A			TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr9:72435915G>A	ENST00000377197.3	+	1	207	c.120G>A	c.(118-120)aaG>aaA	p.K40K	C9orf135_ENST00000466872.2_3'UTR|C9orf135_ENST00000527647.1_Silent_p.K40K|C9orf135-AS1_ENST00000439418.1_lincRNA	NM_001010940.1	NP_001010940.1	Q5VTT2	CI135_HUMAN	chromosome 9 open reading frame 135	40						integral component of membrane (GO:0016021)		p.K40K(1)		endometrium(2)|large_intestine(2)|lung(1)|ovary(1)|skin(1)	7						CCCATCACAAGAAATACTCGA	0.602																																																1	Substitution - coding silent(1)	ovary(1)	9											50.0	48.0	49.0					9																	72435915		2203	4300	6503	71625735	SO:0001819	synonymous_variant	138255				CCDS35041.1	9q21.11	2013-06-07	2013-06-07	2013-06-07	ENSG00000204711	ENSG00000204711			31422	protein-coding gene	gene with protein product							Standard	XM_005251705		Approved		uc004ahl.3	Q5VTT2	OTTHUMG00000019985	ENST00000377197.3:c.120G>A	9.37:g.72435915G>A			71625735	A7E2U4|B2RN61	Silent	SNP	-	p.K40	ENST00000377197.3	37	c.120	CCDS35041.1	9	.	.	.	.	.	.	.	.	.	.	G	8.896	0.955166	0.18507	.	.	ENSG00000204711	ENST00000480564	.	.	.	4.8	2.97	0.34412	.	.	.	.	.	T	0.55924	0.1951	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.48747	-0.9008	4	.	.	.	-10.1063	7.3843	0.26874	0.1963:0.0:0.8037:0.0	.	.	.	.	K	14	.	.	E	+	1	0	C9orf135	71625735	1.000000	0.71417	0.999000	0.59377	0.671000	0.39405	3.036000	0.49767	0.630000	0.30394	0.655000	0.94253	GAA	-	NULL		0.602	C9orf135-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	C9orf135	protein_coding	OTTHUMT00000052591.1	G	NM_001010940		71625735	1	no_errors	NM_001010940	genbank	human	validated	54_36p	silent	SNP	1	A
STXBP1	6812	genome.wustl.edu	37	9	130453129	130453129	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chr9:130453129G>A	ENST00000373299.1	+	19	1893	c.1778G>A	c.(1777-1779)aGc>aAc	p.S593N	STXBP1_ENST00000481942.1_Intron|STXBP1_ENST00000373302.3_3'UTR|MIR3911_ENST00000577791.1_RNA	NM_001032221.3	NP_001027392.1	P61764	STXB1_HUMAN	syntaxin binding protein 1	593					axon target recognition (GO:0007412)|energy reserve metabolic process (GO:0006112)|glutamate secretion (GO:0014047)|long term synaptic depression (GO:0060292)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter secretion (GO:0007269)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|protein stabilization (GO:0050821)|protein transport (GO:0015031)|regulation of insulin secretion (GO:0050796)|regulation of SNARE complex assembly (GO:0035542)|regulation of synaptic vesicle fusion to presynaptic membrane (GO:0031630)|regulation of synaptic vesicle priming (GO:0010807)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|synaptic vesicle maturation (GO:0016188)|vesicle docking involved in exocytosis (GO:0006904)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|protein complex (GO:0043234)	identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|SNARE binding (GO:0000149)|syntaxin binding (GO:0019905)|syntaxin-1 binding (GO:0017075)	p.S593N(1)		breast(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(7)|skin(2)	23						GAAGAAATAAGCAGTTAAAAA	0.522																																																1	Substitution - Missense(1)	ovary(1)	9											113.0	124.0	120.0					9																	130453129		2203	4300	6503	129492950	SO:0001583	missense	6812			AF004563	CCDS6874.1, CCDS35146.1	9q34.1	2008-07-21			ENSG00000136854	ENSG00000136854			11444	protein-coding gene	gene with protein product	"""syntaxin-binding protein 1"""	602926				9545644	Standard	NM_001032221		Approved	hUNC18, MUNC18-1, UNC18, rbSec1	uc004brk.2	P61764	OTTHUMG00000020713	ENST00000373299.1:c.1778G>A	9.37:g.130453129G>A	ENSP00000362396:p.Ser593Asn		129492950	B1AM97|Q28208|Q62759|Q64320|Q96TG8	Missense_Mutation	SNP	-	p.S593N	ENST00000373299.1	37	c.1778	CCDS35146.1	9	.	.	.	.	.	.	.	.	.	.	G	15.27	2.783246	0.49891	.	.	ENSG00000136854	ENST00000373299	T	0.74947	-0.89	5.18	4.25	0.50352	.	.	.	.	.	T	0.59932	0.2230	N	0.14661	0.345	0.20403	N	0.99991	B	0.25105	0.118	B	0.21151	0.033	T	0.56171	-0.8023	9	0.72032	D	0.01	.	13.555	0.61756	0.0:0.1687:0.8313:0.0	.	593	P61764	STXB1_HUMAN	N	593	ENSP00000362396:S593N	ENSP00000362396:S593N	S	+	2	0	STXBP1	129492950	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.168000	0.58216	2.687000	0.91594	0.655000	0.94253	AGC	-	NULL		0.522	STXBP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	STXBP1	protein_coding	OTTHUMT00000054229.1	G	NM_003165		129492950	1	no_errors	NM_001032221	genbank	human	provisional	54_36p	missense	SNP	1	A
PHEX	5251	genome.wustl.edu	37	X	22129652	22129652	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chrX:22129652C>G	ENST00000379374.4	+	10	1712	c.1147C>G	c.(1147-1149)Cag>Gag	p.Q383E	PHEX_ENST00000537599.1_Missense_Mutation_p.Q383E|PHEX_ENST00000418858.3_Missense_Mutation_p.Q86E|PHEX_ENST00000535894.1_Missense_Mutation_p.Q286E	NM_000444.4	NP_000435.3	P78562	PHEX_HUMAN	phosphate regulating endopeptidase homolog, X-linked	383					bone mineralization (GO:0030282)|cell-cell signaling (GO:0007267)|cellular protein modification process (GO:0006464)|organophosphate metabolic process (GO:0019637)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.Q383E(1)		breast(1)|cervix(2)|endometrium(2)|large_intestine(12)|liver(1)|lung(19)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	42						CAGGCGCTTTCAGTATAGATG	0.388																																																1	Substitution - Missense(1)	ovary(1)	X											146.0	139.0	141.0					X																	22129652		2203	4300	6503	22039573	SO:0001583	missense	5251			U82970	CCDS14204.1	Xp22.2-p22.1	2008-07-31	2008-07-31		ENSG00000102174	ENSG00000102174			8918	protein-coding gene	gene with protein product		300550	"""phosphate regulating gene with homologies to endopeptidases on the X chromosome (hypophosphatemia, vitamin D resistant rickets)"""	HYP, HPDR		7550339, 9070861	Standard	NM_000444		Approved	PEX, HPDR1, HYP1, XLH	uc004dah.3	P78562	OTTHUMG00000021241	ENST00000379374.4:c.1147C>G	X.37:g.22129652C>G	ENSP00000368682:p.Gln383Glu		22039573	O00678|Q13646|Q2M325|Q93032|Q99827	Missense_Mutation	SNP	"HMMPfam_Peptidase_M13;HMMPfam_Peptidase_M13_N;superfamily_Metalloproteases (""zincins"") catalytic domain"	p.Q383E	ENST00000379374.4	37	c.1147	CCDS14204.1	X	.	.	.	.	.	.	.	.	.	.	C	17.19	3.327002	0.60743	.	.	ENSG00000102174	ENST00000379374;ENST00000537599;ENST00000535894;ENST00000418858	T;T;T;T	0.72835	-0.69;-0.69;-0.69;-0.69	5.58	5.58	0.84498	Peptidase M13 (1);	0.056475	0.64402	D	0.000001	T	0.55800	0.1943	N	0.20986	0.625	0.45216	D	0.998226	B;B	0.31153	0.063;0.31	B;B	0.24848	0.022;0.056	T	0.54715	-0.8252	10	0.11794	T	0.64	.	18.2521	0.90007	0.0:1.0:0.0:0.0	.	383;383	F5GXU4;P78562	.;PHEX_HUMAN	E	383;383;286;86	ENSP00000368682:Q383E;ENSP00000440362:Q383E;ENSP00000439418:Q286E;ENSP00000443531:Q86E	ENSP00000368682:Q383E	Q	+	1	0	PHEX	22039573	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.329000	0.72920	2.349000	0.79799	0.600000	0.82982	CAG	-	HMMPfam_Peptidase_M13_N		0.388	PHEX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHEX	protein_coding	OTTHUMT00000056035.1	C	NM_000444		22039573	1	no_errors	NM_000444	genbank	human	reviewed	54_36p	missense	SNP	1	G
SLC38A5	92745	genome.wustl.edu	37	X	48318119	48318119	+	Splice_Site	SNP	G	G	A	rs201040223		TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chrX:48318119G>A	ENST00000376876.3	-	14	2055	c.1212C>T	c.(1210-1212)atC>atT	p.I404I	SLC38A5_ENST00000480105.1_5'UTR|SLC38A5_ENST00000376875.1_Splice_Site_p.I353I|SLC38A5_ENST00000317669.5_Splice_Site_p.I404I			Q8WUX1	S38A5_HUMAN	solute carrier family 38, member 5	404					amino acid transport (GO:0006865)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glycine transmembrane transporter activity (GO:0015187)	p.I404I(1)		breast(1)|cervix(1)|endometrium(6)|large_intestine(2)|lung(5)|ovary(3)|skin(1)	19						TTTACTGACCGATAACTCCAA	0.517																																																1	Substitution - coding silent(1)	ovary(1)	X											123.0	101.0	108.0					X																	48318119		2203	4300	6503	48203063	SO:0001630	splice_region_variant	92745			AF276889	CCDS14293.1	Xp11.23	2013-05-22			ENSG00000017483	ENSG00000017483		"""Solute carriers"""	18070	protein-coding gene	gene with protein product		300649				11243884	Standard	NM_033518		Approved	SN2, JM24	uc010nid.3	Q8WUX1	OTTHUMG00000024117	ENST00000376876.3:c.1213+1C>T	X.37:g.48318119G>A			48203063	B3KT20|B5MDE6|B7WPJ9|Q6PIW9|Q8WYU2|Q96PQ4	Silent	SNP	-	p.I404	ENST00000376876.3	37	c.1212	CCDS14293.1	X																																																																																			-	NULL		0.517	SLC38A5-011	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC38A5	protein_coding	OTTHUMT00000060724.1	G	NM_033518	Silent	48203063	-1	no_errors	NM_033518	genbank	human	validated	54_36p	silent	SNP	1	A
H2BFM	286436	genome.wustl.edu	37	X	103294694	103294694	+	Missense_Mutation	SNP	C	C	T	rs543811117		TCGA-13-1507-01A-01W-0549-09	TCGA-13-1507-10A-01W-0550-09	C	C	T	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5423db1a-5b59-4a5b-a676-00a54570b04a	8ae22ce0-cea0-4bba-9c5e-5b6cc0ae78bd	g.chrX:103294694C>T	ENST00000355016.3	+	1	179	c.151C>T	c.(151-153)Cgc>Tgc	p.R51C	H2BFM_ENST00000243297.5_Missense_Mutation_p.R154C	NM_001164416.1	NP_001157888.1	P0C1H6	H2BFM_HUMAN	H2B histone family, member M	51						nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.R88C(1)		endometrium(1)|lung(1)|ovary(1)	3						CCACGCCAACCGCCGTGGGGA	0.662													.|||	1	0.000264901	0.0	0.0014	3775	,	,		12039	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	X											28.0	34.0	32.0					X																	103294694		692	1591	2283	103181350	SO:0001583	missense	286436			AK093522	CCDS55468.1	Xq22.2	2011-01-27			ENSG00000101812	ENSG00000101812		"""Histones / Replication-independent"""	27867	protein-coding gene	gene with protein product							Standard	NM_001164416		Approved		uc004els.2	P0C1H6	OTTHUMG00000022122	ENST00000355016.3:c.151C>T	X.37:g.103294694C>T	ENSP00000347119:p.Arg51Cys		103181350	A6NP82	Missense_Mutation	SNP	-	p.R154C	ENST00000355016.3	37	c.460	CCDS55468.1	X	.	.	.	.	.	.	.	.	.	.	.	2.118	-0.402097	0.04865	.	.	ENSG00000101812	ENST00000243297;ENST00000355016	T;T	0.23552	1.9;1.9	1.69	-1.46	0.08800	Histone-fold (2);	.	.	.	.	T	0.07413	0.0187	N	0.01874	-0.695	0.09310	N	1	B	0.14805	0.011	B	0.04013	0.001	T	0.29305	-1.0016	9	0.29301	T	0.29	.	2.183	0.03879	0.2481:0.4179:0.0:0.3339	.	154	P0C1H6	H2BFM_HUMAN	C	154;51	ENSP00000243297:R154C;ENSP00000347119:R51C	ENSP00000243297:R154C	R	+	1	0	H2BFM	103181350	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.285000	0.01153	-0.567000	0.06046	-2.312000	0.00255	CGC	-	NULL		0.662	H2BFM-001	NOVEL	basic|appris_candidate|CCDS	protein_coding	H2BFM	protein_coding	OTTHUMT00000057758.2	C	XM_210048		103181350	1	no_errors	XM_001723437	genbank	human	model	54_36p	missense	SNP	0	T
