#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
PIGG	54872	genome.wustl.edu	37	4	515720	515720	+	Missense_Mutation	SNP	C	C	A			TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr4:515720C>A	ENST00000453061.2	+	8	1710	c.1604C>A	c.(1603-1605)aCc>aAc	p.T535N	PIGG_ENST00000509768.1_Missense_Mutation_p.T446N|PIGG_ENST00000504346.1_Missense_Mutation_p.T446N|PIGG_ENST00000296306.7_3'UTR|PIGG_ENST00000383028.4_Missense_Mutation_p.T402N|PIGG_ENST00000310340.5_Missense_Mutation_p.T527N|PIGG_ENST00000536264.1_3'UTR|PIGG_ENST00000503111.1_3'UTR	NM_001127178.1	NP_001120650.1	Q5H8A4	PIGG_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class G	535					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|GPI anchor biosynthetic process (GO:0006506)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	CP2 mannose-ethanolamine phosphotransferase activity (GO:0051267)|phosphotransferase activity, for other substituted phosphate groups (GO:0016780)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(5)|lung(16)|ovary(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	39						GGTGGAAACACCCCAAGGAAG	0.572																																																0			4											91.0	74.0	80.0					4																	515720		2203	4300	6503	505720	SO:0001583	missense	54872				CCDS3336.1, CCDS46992.1, CCDS75080.1, CCDS75081.1, CCDS75082.1, CCDS75083.1	4p16.3	2013-02-26	2006-06-28		ENSG00000174227	ENSG00000174227		"""Phosphatidylinositol glycan anchor biosynthesis"""	25985	protein-coding gene	gene with protein product			"""phosphatidylinositol glycan, class G"""			15632136	Standard	XM_005272287		Approved	FLJ20265, GPI7, LAS21	uc003gak.4	Q5H8A4	OTTHUMG00000112457	ENST00000453061.2:c.1604C>A	4.37:g.515720C>A	ENSP00000415203:p.Thr535Asn		505720	B4DKC7|Q2TAK5|Q6UX31|Q7L5Y4|Q8N866|Q8NCC9|Q96SY9|Q9BVT7|Q9NXG5	Missense_Mutation	SNP	superfamily_Alkaline_phosphatase_core	p.T527N	ENST00000453061.2	37	c.1580	CCDS46992.1	4	.	.	.	.	.	.	.	.	.	.	C	7.898	0.733710	0.15574	.	.	ENSG00000174227	ENST00000310340;ENST00000453061;ENST00000504346;ENST00000383028;ENST00000509768	T;T;T;T;T	0.30714	3.29;3.28;2.95;2.94;1.52	5.07	-2.36	0.06663	.	1.403040	0.04096	N	0.312046	T	0.12475	0.0303	N	0.08118	0	0.09310	N	1	B;B;B;B	0.16396	0.001;0.017;0.0;0.001	B;B;B;B	0.06405	0.002;0.001;0.001;0.002	T	0.13818	-1.0495	10	0.16896	T	0.51	.	1.6787	0.02827	0.1174:0.2527:0.3163:0.3136	.	402;446;535;527	Q5H8A4-3;D6RFE8;Q5H8A4;Q5H8A4-2	.;.;PIGG_HUMAN;.	N	527;535;446;402;446	ENSP00000311750:T527N;ENSP00000415203:T535N;ENSP00000424800:T446N;ENSP00000372494:T402N;ENSP00000421550:T446N	ENSP00000311750:T527N	T	+	2	0	PIGG	505720	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	0.436000	0.21526	-0.270000	0.09285	-0.367000	0.07326	ACC	-	NULL		0.572	PIGG-001	KNOWN	basic|CCDS	protein_coding	PIGG	protein_coding	OTTHUMT00000357494.1	C	NM_017733		505720	+1	no_errors	NM_017733	genbank	human	validated	54_36p	missense	SNP	0.000	A
APC2	10297	genome.wustl.edu	37	19	1467803	1467803	+	Silent	SNP	C	C	T	rs61749994	byFrequency	TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr19:1467803C>T	ENST00000535453.1	+	14	6216	c.4503C>T	c.(4501-4503)ccC>ccT	p.P1501P	APC2_ENST00000233607.2_Silent_p.P1501P|APC2_ENST00000238483.4_Silent_p.P1227P|C19orf25_ENST00000588427.1_Intron			P02655	APOC2_HUMAN	adenomatosis polyposis coli 2	0					cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|chylomicron remnant clearance (GO:0034382)|chylomicron remodeling (GO:0034371)|high-density lipoprotein particle clearance (GO:0034384)|lipid catabolic process (GO:0016042)|lipoprotein metabolic process (GO:0042157)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cholesterol transport (GO:0032375)|negative regulation of lipid metabolic process (GO:0045833)|negative regulation of receptor-mediated endocytosis (GO:0048261)|negative regulation of very-low-density lipoprotein particle clearance (GO:0010916)|phospholipid efflux (GO:0033700)|phototransduction, visible light (GO:0007603)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of phospholipid catabolic process (GO:0060697)|positive regulation of triglyceride catabolic process (GO:0010898)|positive regulation of very-low-density lipoprotein particle remodeling (GO:0010902)|retinoid metabolic process (GO:0001523)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|triglyceride homeostasis (GO:0070328)|triglyceride-rich lipoprotein particle remodeling (GO:0034370)|very-low-density lipoprotein particle remodeling (GO:0034372)	chylomicron (GO:0042627)|early endosome (GO:0005769)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate-density lipoprotein particle (GO:0034363)|low-density lipoprotein particle (GO:0034362)|spherical high-density lipoprotein particle (GO:0034366)|very-low-density lipoprotein particle (GO:0034361)	lipase inhibitor activity (GO:0055102)|lipid binding (GO:0008289)|lipoprotein lipase activator activity (GO:0060230)|phospholipase activator activity (GO:0016004)|phospholipase binding (GO:0043274)|protein homodimerization activity (GO:0042803)			breast(3)|cervix(1)|kidney(4)|large_intestine(2)|lung(5)|pancreas(1)|skin(2)	18		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TCACGACGCCCACTGAGGAGG	0.751													C|||	141	0.028155	0.0303	0.0274	5008	,	,		11248	0.0		0.0437	False		,,,				2504	0.0389															0			19						C		58,3730		0,58,1836	4.0	5.0	4.0		4503	3.0	1.0	19	dbSNP_129	4	295,7489		4,287,3601	no	coding-synonymous	APC2	NM_005883.2		4,345,5437	TT,TC,CC		3.7898,1.5312,3.0505		1501/2304	1467803	353,11219	1894	3892	5786	1418803	SO:0001819	synonymous_variant	10297				CCDS12068.1	19p13.3	2013-02-14			ENSG00000115266	ENSG00000115266		"""Armadillo repeat containing"""	24036	protein-coding gene	gene with protein product	"""adenomatous polyposis coli like"""	612034				9823329, 10021369	Standard	XM_005259475		Approved	APCL	uc002lsr.1	O95996		ENST00000535453.1:c.4503C>T	19.37:g.1467803C>T			1418803	C0JYY4|Q9BS39|Q9UDE3|Q9UNK3	Silent	SNP	superfamily_ARM repeat,HMMSmart_SM00185,HMMPfam_Arm,PatternScan_CYSTEINE_SWITCH,HMMPfam_APC_crr,HMMPfam_SAMP,HMMPfam_APC_basic	p.P1501	ENST00000535453.1	37	c.4503	CCDS12068.1	19																																																																																			-	NULL		0.751	APC2-004	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	APC2	protein_coding	OTTHUMT00000449539.2	C	NM_005883		1418803	+1	no_errors	NM_005883	genbank	human	validated	54_36p	silent	SNP	1.000	T
REXO1	57455	genome.wustl.edu	37	19	1827427	1827427	+	Missense_Mutation	SNP	G	G	C			TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr19:1827427G>C	ENST00000170168.4	-	2	1455	c.1361C>G	c.(1360-1362)cCa>cGa	p.P454R	CTB-31O20.4_ENST00000587741.1_RNA|CTB-31O20.4_ENST00000593201.1_RNA|REXO1_ENST00000587524.1_5'Flank	NM_020695.3	NP_065746.3	Q8N1G1	REXO1_HUMAN	REX1, RNA exonuclease 1 homolog (S. cerevisiae)	454						nucleus (GO:0005634)	exonuclease activity (GO:0004527)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	16		Ovarian(11;1.78e-06)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCGCCGCGCTGGCCGGTCAGG	0.731																																																0			19											8.0	9.0	8.0					19																	1827427		2084	4078	6162	1778427	SO:0001583	missense	57455			AB032964	CCDS32866.1	19p13.3	2014-05-28	2005-08-22	2005-08-22	ENSG00000079313	ENSG00000079313			24616	protein-coding gene	gene with protein product	"""elongin A binding protein 1"""	609614	"""transcription elongation factor B polypeptide 3 binding protein 1"""	TCEB3BP1		10574461	Standard	NM_020695		Approved	EloA-BP1, KIAA1138	uc002lua.4	Q8N1G1	OTTHUMG00000179991	ENST00000170168.4:c.1361C>G	19.37:g.1827427G>C	ENSP00000170168:p.Pro454Arg		1778427	Q9ULT2	Missense_Mutation	SNP	superfamily_Ribonuclease H-like,HMMSmart_SM00479,HMMPfam_Exonuc_X-T	p.P454R	ENST00000170168.4	37	c.1361	CCDS32866.1	19	.	.	.	.	.	.	.	.	.	.	G	1.609	-0.524448	0.04141	.	.	ENSG00000079313	ENST00000170168	T	0.11495	2.77	2.22	-2.06	0.07298	.	1.087840	0.07125	U	0.844508	T	0.06005	0.0156	N	0.19112	0.55	0.09310	N	1	B	0.29432	0.244	B	0.24006	0.05	T	0.44174	-0.9345	10	0.16896	T	0.51	-4.033	8.1559	0.31169	0.3736:0.0:0.6264:0.0	.	454	Q8N1G1	REXO1_HUMAN	R	454	ENSP00000170168:P454R	ENSP00000170168:P454R	P	-	2	0	REXO1	1778427	0.000000	0.05858	0.000000	0.03702	0.069000	0.16628	0.524000	0.22940	-0.235000	0.09767	0.555000	0.69702	CCA	-	NULL		0.731	REXO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	REXO1	protein_coding	OTTHUMT00000449200.1	G	NM_020695		1778427	-1	no_errors	NM_020695	genbank	human	validated	54_36p	missense	SNP	0.003	C
SLC4A11	83959	genome.wustl.edu	37	20	3209863	3209863	+	Silent	SNP	C	C	T			TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr20:3209863C>T	ENST00000380056.3	-	15	1991	c.1944G>A	c.(1942-1944)gcG>gcA	p.A648A	SLC4A11_ENST00000539553.2_Silent_p.A632A|SLC4A11_ENST00000488544.1_5'UTR|SLC4A11_ENST00000380059.3_Silent_p.A675A	NM_032034.3	NP_114423.1	Q8NBS3	S4A11_HUMAN	solute carrier family 4, sodium borate transporter, member 11	648	Membrane (bicarbonate transporter).				bicarbonate transport (GO:0015701)|borate transmembrane transport (GO:0035445)|borate transport (GO:0046713)|cellular cation homeostasis (GO:0030003)|fluid transport (GO:0042044)|proton transport (GO:0015992)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	bicarbonate transmembrane transporter activity (GO:0015106)|borate transmembrane transporter activity (GO:0046715)|hydrogen ion channel activity (GO:0015252)|inorganic anion exchanger activity (GO:0005452)|protein dimerization activity (GO:0046983)|sodium channel activity (GO:0005272)|symporter activity (GO:0015293)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|liver(1)|lung(16)|ovary(2)|prostate(4)|soft_tissue(1)|urinary_tract(1)	40						ACTGGATCTGCGCCATCGCAA	0.632																																					NSCLC(190;922 2139 10266 10292 38692)											0			20											66.0	68.0	67.0					20																	3209863		2203	4300	6503	3157863	SO:0001819	synonymous_variant	83959			AF336127	CCDS13052.1, CCDS54445.1, CCDS54446.1	20p13	2014-02-14	2007-08-03		ENSG00000088836	ENSG00000088836		"""Solute carriers"""	16438	protein-coding gene	gene with protein product		610206	"""corneal endothelial dystrophy 2 (autosomal recessive)"", ""solute carrier family 4, sodium bicarbonate transporter-like, member 11"", ""corneal dystrophy and perceptive deafness 1"""	CHED2, CDPD1		10843999, 11302728, 16767101	Standard	NM_001174089		Approved	dJ794I6.2, BTR1, NaBC1, FECD4	uc010zqe.2	Q8NBS3	OTTHUMG00000031740	ENST00000380056.3:c.1944G>A	20.37:g.3209863C>T			3157863	B4DKC8|B4DKX9|G3V1M3|Q2TB62|Q2TB63|Q9BXF4|Q9NTW9	Silent	SNP	superfamily_Phoshotransferase/anion transport protein,HMMPfam_HCO3_cotransp	p.A648	ENST00000380056.3	37	c.1944	CCDS13052.1	20																																																																																			-	HMMPfam_HCO3_cotransp		0.632	SLC4A11-002	KNOWN	basic|CCDS	protein_coding	SLC4A11	protein_coding	OTTHUMT00000077728.1	C			3157863	-1	no_errors	NM_032034	genbank	human	validated	54_36p	silent	SNP	0.991	T
PLD2	5338	genome.wustl.edu	37	17	4717793	4717793	+	Missense_Mutation	SNP	G	G	T	rs200410286		TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr17:4717793G>T	ENST00000263088.6	+	11	1222	c.1091G>T	c.(1090-1092)tGg>tTg	p.W364L	PLD2_ENST00000572940.1_Missense_Mutation_p.W364L	NM_001243108.1|NM_002663.4	NP_001230037.1|NP_002654.3	O14939	PLD2_HUMAN	phospholipase D2	364					cytoskeleton organization (GO:0007010)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|G-protein coupled receptor internalization (GO:0002031)|glycerophospholipid biosynthetic process (GO:0046474)|innate immune response (GO:0045087)|lipid catabolic process (GO:0016042)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	brush border membrane (GO:0031526)|endoplasmic reticulum membrane (GO:0005789)|plasma membrane (GO:0005886)	N-acylphosphatidylethanolamine-specific phospholipase D activity (GO:0070290)|phosphatidylinositol binding (GO:0035091)|phospholipase D activity (GO:0004630)			autonomic_ganglia(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(3)|large_intestine(3)|lung(10)|ovary(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)	31					Choline(DB00122)	ATCACAGACTGGTGGTGAGTG	0.572													G|||	1	0.000199681	0.0	0.0	5008	,	,		19392	0.0		0.001	False		,,,				2504	0.0															0			17											51.0	45.0	47.0					17																	4717793		2203	4300	6503	4664759	SO:0001583	missense	5338			AF035483	CCDS11057.1, CCDS58507.1	17p13.3	2008-04-14			ENSG00000129219	ENSG00000129219	3.1.4.4		9068	protein-coding gene	gene with protein product	"""choline phosphatase 2"""	602384				9858823, 9582313	Standard	NM_002663		Approved		uc002fzc.3	O14939	OTTHUMG00000090779	ENST00000263088.6:c.1091G>T	17.37:g.4717793G>T	ENSP00000263088:p.Trp364Leu		4664759	I3L2C9|O43540|O43579|O43580|Q6PGR0|Q96BY3	Missense_Mutation	SNP	superfamily_PX domain,HMMPfam_PX,HMMSmart_SM00312,superfamily_PH domain-like,HMMPfam_PH,HMMSmart_SM00233,superfamily_Phospholipase D/nuclease,HMMPfam_PLDc,HMMSmart_SM00155	p.W364L	ENST00000263088.6	37	c.1091	CCDS11057.1	17	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	28.4	4.917801	0.92249	.	.	ENSG00000129219	ENST00000263088	T	0.21031	2.03	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	T	0.59197	0.2176	H	0.94964	3.605	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.97110	0.994;1.0;1.0	T	0.71745	-0.4500	10	0.87932	D	0	-11.3561	16.4671	0.84083	0.0:0.0:1.0:0.0	.	221;364;364	B7Z905;O14939-2;O14939	.;.;PLD2_HUMAN	L	364	ENSP00000263088:W364L	ENSP00000263088:W364L	W	+	2	0	PLD2	4664759	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.106000	0.94253	2.493000	0.84123	0.561000	0.74099	TGG	-	superfamily_Phospholipase D/nuclease		0.572	PLD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLD2	protein_coding	OTTHUMT00000207561.3	G	NM_002663		4664759	+1	no_errors	NM_002663	genbank	human	validated	54_36p	missense	SNP	1.000	T
FAM90A20P	728430	genome.wustl.edu	37	8	7154758	7154758	+	IGR	SNP	C	C	G			TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr8:7154758C>G								AF228730.2 (98648 upstream) : FAM66B (21303 downstream)																							AAAGGAAAGACAGACAGGGGC	0.607																																																0			8											4.0	14.0	12.0					8																	7154758		443	1451	1894	7142168	SO:0001628	intergenic_variant	728430																															8.37:g.7154758C>G			7142168		Missense_Mutation	SNP	NULL	p.Q203E		37	c.607		8																																																																																			-	NULL	0	0.607					FAM90A20			C			7142168	+1	no_errors	XM_001128051	genbank	human	model	54_36p	missense	SNP	0.004	G
ZNF705G	100131980	genome.wustl.edu	37	8	7215797	7215797	+	Missense_Mutation	SNP	A	A	T			TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr8:7215797A>T	ENST00000400156.4	-	7	885	c.604T>A	c.(604-606)Tgt>Agt	p.C202S	ZNF705G_ENST00000400078.2_Missense_Mutation_p.C202S|FAM66B_ENST00000606573.1_lincRNA			A8MUZ8	Z705G_HUMAN	zinc finger protein 705G	202					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			lung(9)	9						CATAGATGACATGCATATGGC	0.413																																																0			8											79.0	96.0	91.0					8																	7215797		671	1590	2261	7203207	SO:0001583	missense	0				CCDS47773.1	8p23.1	2013-01-08			ENSG00000215372	ENSG00000215372		"""Zinc fingers, C2H2-type"", ""-"""	37134	protein-coding gene	gene with protein product							Standard	NM_001164457		Approved		uc022are.1	A8MUZ8	OTTHUMG00000165384	ENST00000400156.4:c.604T>A	8.37:g.7215797A>T	ENSP00000383020:p.Cys202Ser		7203207		Missense_Mutation	SNP	HMMPfam_KRAB,superfamily_KRAB domain (Kruppel-associated box Pfam 01352),HMMSmart_SM00349,superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1	p.C204S	ENST00000400156.4	37	c.610		8	.	.	.	.	.	.	.	.	.	.	A	15.13	2.742653	0.49151	.	.	ENSG00000215372	ENST00000400156;ENST00000400078	D;D	0.85171	-1.95;-1.95	1.05	1.05	0.20165	.	.	.	.	.	D	0.91975	0.7458	H	0.96518	3.835	0.28238	N	0.925799	.	.	.	.	.	.	D	0.84847	0.0811	7	0.87932	D	0	.	6.3029	0.21123	1.0:0.0:0.0:0.0	.	.	.	.	S	202	ENSP00000383020:C202S;ENSP00000445477:C202S	ENSP00000445477:C202S	C	-	1	0	ZNF705G	7203207	1.000000	0.71417	0.074000	0.20217	0.038000	0.13279	6.971000	0.76105	0.760000	0.33108	0.155000	0.16302	TGT	-	superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1		0.413	ZNF705G-001	KNOWN	basic|appris_principal	protein_coding	ENSG00000215372	protein_coding	OTTHUMT00000383776.1	A	XM_001720517		7203207	-1	no_errors	ENST00000400156	ensembl	human	known	54_36p	missense	SNP	0.881	T
TP53	7157	genome.wustl.edu	37	17	7578271	7578271	+	Missense_Mutation	SNP	T	T	C			TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr17:7578271T>C	ENST00000269305.4	-	6	767	c.578A>G	c.(577-579)cAt>cGt	p.H193R	TP53_ENST00000574684.1_Intron|TP53_ENST00000359597.4_Missense_Mutation_p.H193R|TP53_ENST00000455263.2_Missense_Mutation_p.H193R|TP53_ENST00000420246.2_Missense_Mutation_p.H193R|TP53_ENST00000413465.2_Missense_Mutation_p.H193R|TP53_ENST00000445888.2_Missense_Mutation_p.H193R	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	193	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		H -> D (in sporadic cancers; somatic mutation).|H -> L (in sporadic cancers; somatic mutation).|H -> N (in sporadic cancers; somatic mutation).|H -> P (in sporadic cancers; somatic mutation).|H -> Q (in sporadic cancers; somatic mutation).|H -> R (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7887414}.|H -> Y (in sporadic cancers; somatic mutation).|QH -> HN (in a sporadic cancer; somatic mutation).|QH -> HY (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.H193R(80)|p.H193L(42)|p.H193P(18)|p.0?(8)|p.?(6)|p.H61R(4)|p.H100R(4)|p.H100L(4)|p.H61L(4)|p.A189_V197delAPPQHLIRV(4)|p.P191_E198>Q(3)|p.H193fs*16(3)|p.P191fs*53(2)|p.H61P(2)|p.H100P(2)|p.A189fs*53(1)|p.P191fs*6(1)|p.H193_I195delHLI(1)|p.P59_E66>Q(1)|p.P191fs*15(1)|p.P98_E105>Q(1)|p.H193_I195>AP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TCGGATAAGATGCTGAGGAGG	0.562		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	193	Substitution - Missense(160)|Whole gene deletion(8)|Complex - deletion inframe(6)|Unknown(6)|Deletion - In frame(5)|Deletion - Frameshift(4)|Insertion - Frameshift(3)|Complex - frameshift(1)	lung(36)|upper_aerodigestive_tract(26)|ovary(20)|breast(18)|oesophagus(14)|haematopoietic_and_lymphoid_tissue(12)|endometrium(12)|biliary_tract(10)|liver(9)|stomach(7)|central_nervous_system(6)|large_intestine(6)|urinary_tract(5)|skin(5)|bone(4)|pancreas(2)|prostate(1)	17	GRCh37	CM083194|CM951225	TP53	M							97.0	87.0	90.0					17																	7578271		2203	4300	6503	7518996	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.578A>G	17.37:g.7578271T>C	ENSP00000269305:p.His193Arg		7518996	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	HMMPfam_P53_TAD,HMMPfam_P53,superfamily_p53-like transcription factors,PatternScan_P53,HMMPfam_P53_tetramer,superfamily_p53 tetramerization domain	p.H193R	ENST00000269305.4	37	c.578	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	T	14.03	2.413611	0.42817	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99850	-7.16;-7.16;-7.16;-7.16;-7.16;-7.16;-7.16;-7.16	5.41	4.33	0.51752	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99825	0.9922	M	0.92738	3.34	0.58432	D	0.999992	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D	0.97536	1.0083	10	0.72032	D	0.01	-29.0766	9.707	0.40222	0.0:0.0827:0.0:0.9173	.	154;193;193;100;193;193;193	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	R	193;193;193;193;193;193;182;100;61;100;61	ENSP00000410739:H193R;ENSP00000352610:H193R;ENSP00000269305:H193R;ENSP00000398846:H193R;ENSP00000391127:H193R;ENSP00000391478:H193R;ENSP00000425104:H61R;ENSP00000423862:H100R	ENSP00000269305:H193R	H	-	2	0	TP53	7518996	1.000000	0.71417	0.814000	0.32528	0.023000	0.10783	7.996000	0.88334	1.001000	0.39076	-0.256000	0.11100	CAT	-	HMMPfam_P53,superfamily_p53-like transcription factors		0.562	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	T	NM_000546		7518996	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
FBN3	84467	genome.wustl.edu	37	19	8145917	8145917	+	Missense_Mutation	SNP	C	C	T			TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr19:8145917C>T	ENST00000600128.1	-	59	7837	c.7423G>A	c.(7423-7425)Ggc>Agc	p.G2475S	FBN3_ENST00000601739.1_Missense_Mutation_p.G2475S|FBN3_ENST00000270509.2_Missense_Mutation_p.G2475S			Q75N90	FBN3_HUMAN	fibrillin 3	2475	EGF-like 40; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.					proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(9)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(15)|lung(53)|ovary(7)|pancreas(2)|prostate(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	132						TGGGTGAAGCCGGGCGGACAG	0.602																																																0			19											58.0	53.0	55.0					19																	8145917		2203	4300	6503	8051917	SO:0001583	missense	84467				CCDS12196.1	19p13	2008-02-05							18794	protein-coding gene	gene with protein product		608529					Standard	NM_032447		Approved		uc002mjf.3	Q75N90		ENST00000600128.1:c.7423G>A	19.37:g.8145917C>T	ENSP00000470498:p.Gly2475Ser		8051917	Q75N91|Q75N92|Q75N93|Q86SJ5|Q96JP8	Missense_Mutation	SNP	HMMSmart_SM00181,superfamily_EGF/Laminin,PatternScan_EGF_1,PatternScan_EGF_2,superfamily_TB module/8-cys domain,HMMPfam_TB,PatternScan_EGF_CA,HMMPfam_EGF_CA,HMMSmart_SM00179,PatternScan_ASX_HYDROXYL,HMMPfam_EGF,superfamily_Growth factor receptor domain	p.G2475S	ENST00000600128.1	37	c.7423	CCDS12196.1	19	.	.	.	.	.	.	.	.	.	.	C	21.1	4.103082	0.76983	.	.	ENSG00000142449	ENST00000270509;ENST00000341066	D	0.92545	-3.06	3.91	3.91	0.45181	EGF-like region, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.125100	0.53938	U	0.000057	D	0.96978	0.9013	M	0.93594	3.435	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.98370	1.0553	10	0.87932	D	0	.	16.2296	0.82322	0.0:1.0:0.0:0.0	.	2475;581	Q75N90;Q6ZNB8	FBN3_HUMAN;.	S	2475;581	ENSP00000270509:G2475S	ENSP00000270509:G2475S	G	-	1	0	FBN3	8051917	1.000000	0.71417	0.994000	0.49952	0.303000	0.27691	7.431000	0.80335	1.892000	0.54788	0.297000	0.19635	GGC	-	superfamily_Growth factor receptor domain,HMMPfam_EGF_CA,HMMSmart_SM00179,HMMSmart_SM00181,PatternScan_EGF_2		0.602	FBN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN3	protein_coding	OTTHUMT00000461428.2	C	NM_032447		8051917	-1	no_errors	NM_032447	genbank	human	reviewed	54_36p	missense	SNP	0.996	T
GATA3	2625	genome.wustl.edu	37	10	8115877	8115877	+	Missense_Mutation	SNP	C	C	A			TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr10:8115877C>A	ENST00000346208.3	+	6	1678	c.1223C>A	c.(1222-1224)cCc>cAc	p.P408H	GATA3_ENST00000379328.3_Missense_Mutation_p.P409H|GATA3_ENST00000461472.1_3'UTR			P23771	GATA3_HUMAN	GATA binding protein 3	408					anatomical structure formation involved in morphogenesis (GO:0048646)|anatomical structure morphogenesis (GO:0009653)|aortic valve morphogenesis (GO:0003180)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|canonical Wnt signaling pathway involved in metanephric kidney development (GO:0061290)|cardiac right ventricle morphogenesis (GO:0003215)|cell fate determination (GO:0001709)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|cellular response to interferon-alpha (GO:0035457)|cellular response to interleukin-4 (GO:0071353)|cellular response to tumor necrosis factor (GO:0071356)|defense response (GO:0006952)|developmental growth (GO:0048589)|ear development (GO:0043583)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|interferon-gamma secretion (GO:0072643)|interleukin-4 secretion (GO:0072602)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|lymphocyte migration (GO:0072676)|male gonad development (GO:0008584)|mast cell differentiation (GO:0060374)|mesenchymal to epithelial transition (GO:0060231)|mesonephros development (GO:0001823)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell motility (GO:2000146)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell proliferation involved in mesonephros development (GO:2000607)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway involved in ureteric bud formation (GO:2000703)|negative regulation of glial cell-derived neurotrophic factor receptor signaling pathway involved in ureteric bud formation (GO:2000734)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of transcription, DNA-templated (GO:0045892)|nephric duct formation (GO:0072179)|nephric duct morphogenesis (GO:0072178)|neuron migration (GO:0001764)|norepinephrine biosynthetic process (GO:0042421)|otic vesicle development (GO:0071599)|parathyroid gland development (GO:0060017)|parathyroid hormone secretion (GO:0035898)|pharyngeal system development (GO:0060037)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of interleukin-13 production (GO:0032736)|positive regulation of interleukin-13 secretion (GO:2000667)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-5 production (GO:0032754)|positive regulation of interleukin-5 secretion (GO:2000664)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of signal transduction (GO:0009967)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of thyroid hormone generation (GO:2000611)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ureteric bud formation (GO:0072107)|post-embryonic development (GO:0009791)|pro-T cell differentiation (GO:0002572)|regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043370)|regulation of cellular response to X-ray (GO:2000683)|regulation of cytokine biosynthetic process (GO:0042035)|regulation of establishment of cell polarity (GO:2000114)|regulation of histone H3-K27 methylation (GO:0061085)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to gamma radiation (GO:0010332)|response to virus (GO:0009615)|signal transduction (GO:0007165)|sympathetic nervous system development (GO:0048485)|T cell receptor signaling pathway (GO:0050852)|T-helper 2 cell differentiation (GO:0045064)|thymic T cell selection (GO:0045061)|thymus development (GO:0048538)|TOR signaling (GO:0031929)|transcription from RNA polymerase II promoter (GO:0006366)|type IV hypersensitivity (GO:0001806)|ureter maturation (GO:0035799)|ureteric bud formation (GO:0060676)|uterus development (GO:0060065)|ventricular septum development (GO:0003281)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|enhancer sequence-specific DNA binding (GO:0001158)|HMG box domain binding (GO:0071837)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|zinc ion binding (GO:0008270)			NS(1)|breast(44)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(24)|ovary(3)|skin(2)	87						CACATCTCGCCCTTCAGCCAC	0.612			"""F, N, S"""		breast		"""HDR syndrome (HYPOPARATHYROIDISM, SENSORINEURAL DEAFNESS, AND RENAL DISEASE)"""																																Rec	yes		10	10p15	2625	GATA binding protein 3	yes	E	0			10											95.0	87.0	89.0					10																	8115877		2203	4300	6503	8155883	SO:0001583	missense	2625			X55122	CCDS7083.1, CCDS31143.1	10p15	2013-01-25	2001-11-28		ENSG00000107485	ENSG00000107485		"""GATA zinc finger domain containing"""	4172	protein-coding gene	gene with protein product		131320	"""GATA-binding protein 3"""			2050118, 15087456	Standard	NM_002051		Approved	HDR	uc001ijz.3	P23771	OTTHUMG00000017640	ENST00000346208.3:c.1223C>A	10.37:g.8115877C>A	ENSP00000341619:p.Pro408His		8155883	Q5VWG7|Q5VWG8|Q96J16	Missense_Mutation	SNP	superfamily_Glucocorticoid receptor-like (DNA-binding domain),HMMSmart_SM00401,PatternScan_GATA_ZN_FINGER_1,HMMPfam_GATA	p.P409H	ENST00000346208.3	37	c.1226	CCDS7083.1	10	.	.	.	.	.	.	.	.	.	.	C	17.95	3.512662	0.64522	.	.	ENSG00000107485	ENST00000379328;ENST00000346208	D;D	0.96716	-4.1;-4.08	5.26	5.26	0.73747	.	0.000000	0.64402	D	0.000001	D	0.97167	0.9074	L	0.44542	1.39	0.80722	D	1	B;D	0.89917	0.331;1.0	B;D	0.74348	0.159;0.983	D	0.98039	1.0381	10	0.72032	D	0.01	-24.4691	18.8714	0.92317	0.0:1.0:0.0:0.0	.	408;409	P23771;P23771-2	GATA3_HUMAN;.	H	409;408	ENSP00000368632:P409H;ENSP00000341619:P408H	ENSP00000341619:P408H	P	+	2	0	GATA3	8155883	1.000000	0.71417	0.648000	0.29521	0.995000	0.86356	5.920000	0.70017	2.447000	0.82792	0.462000	0.41574	CCC	-	NULL		0.612	GATA3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	GATA3	protein_coding	OTTHUMT00000046719.1	C	NM_001002295		8155883	+1	no_errors	NM_001002295	genbank	human	validated	54_36p	missense	SNP	0.995	A
ZNF653	115950	genome.wustl.edu	37	19	11597973	11597973	+	Splice_Site	SNP	T	T	C			TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr19:11597973T>C	ENST00000293771.5	-	5	1308	c.1172A>G	c.(1171-1173)gAg>gGg	p.E391G	CTC-398G3.6_ENST00000585656.1_Intron	NM_138783.3	NP_620138.2	Q96CK0	ZN653_HUMAN	zinc finger protein 653	391					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(3)|large_intestine(2)|lung(8)|prostate(1)|skin(1)	17						GTCCTCCTTCTCTACAGGGTG	0.652																																					Pancreas(83;980 1446 4542 6441 43352)											0			19											63.0	72.0	69.0					19																	11597973		2203	4300	6503	11458973	SO:0001630	splice_region_variant	115950			AY072704	CCDS12261.1	19p13.2	2013-01-08						"""Zinc fingers, C2H2-type"""	25196	protein-coding gene	gene with protein product		611371				12477932	Standard	NM_138783		Approved	Zip67	uc002mrz.2	Q96CK0		ENST00000293771.5:c.1172-1A>G	19.37:g.11597973T>C			11458973	Q96AS7	Missense_Mutation	SNP	HMMSmart_AT_hook,HMMPfam_zf-C2H2,HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1,superfamily_SSF57667	p.E391G	ENST00000293771.5	37	c.1172	CCDS12261.1	19	.	.	.	.	.	.	.	.	.	.	T	14.26	2.481231	0.44147	.	.	ENSG00000161914	ENST00000293771	T	0.11930	2.73	4.36	4.36	0.52297	.	0.755999	0.12386	N	0.473421	T	0.08891	0.0220	N	0.14661	0.345	0.33552	D	0.596211	B	0.12630	0.006	B	0.11329	0.006	T	0.06734	-1.0810	10	0.72032	D	0.01	.	7.795	0.29141	0.0:0.097:0.0:0.903	.	391	Q96CK0	ZN653_HUMAN	G	391	ENSP00000293771:E391G	ENSP00000293771:E391G	E	-	2	0	ZNF653	11458973	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	2.837000	0.48191	1.753000	0.51906	0.459000	0.35465	GAG	-	NULL		0.652	ZNF653-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF653	protein_coding	OTTHUMT00000458836.2	T	NM_138783	Missense_Mutation	11458973	-1	no_errors	NM_138783	genbank	human	provisional	54_36p	missense	SNP	0.998	C
ZNF442	79973	genome.wustl.edu	37	19	12462103	12462103	+	Missense_Mutation	SNP	C	C	A			TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr19:12462103C>A	ENST00000242804.4	-	6	878	c.296G>T	c.(295-297)aGt>aTt	p.S99I	ZNF442_ENST00000438182.1_Missense_Mutation_p.S30I	NM_030824.2	NP_110451.1	Q9H7R0	ZN442_HUMAN	zinc finger protein 442	99	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|lung(8)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	31						TGGCTGGCGACTTTCACTAAA	0.343																																																0			19											87.0	81.0	83.0					19																	12462103		2203	4300	6503	12323103	SO:0001583	missense	79973			AK024418	CCDS12271.1	19p13.13	2013-01-08			ENSG00000198342	ENSG00000198342		"""Zinc fingers, C2H2-type"", ""-"""	20877	protein-coding gene	gene with protein product							Standard	NM_030824		Approved	FLJ14356	uc002mtr.1	Q9H7R0	OTTHUMG00000156411	ENST00000242804.4:c.296G>T	19.37:g.12462103C>A	ENSP00000242804:p.Ser99Ile		12323103	B4DJ48	Missense_Mutation	SNP	superfamily_Krueppel-associated_box,HMMPfam_KRAB,HMMSmart_KRAB,superfamily_SSF57667,HMMPfam_zf-C2H2,HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1	p.S99I	ENST00000242804.4	37	c.296	CCDS12271.1	19	.	.	.	.	.	.	.	.	.	.	C	5.365	0.252613	0.10185	.	.	ENSG00000198342	ENST00000242804;ENST00000438182;ENST00000424168	T;T;T	0.06449	3.41;3.3;3.98	1.51	-0.953	0.10362	Krueppel-associated box (1);	.	.	.	.	T	0.04679	0.0127	L	0.35854	1.095	0.09310	N	1	B	0.15719	0.014	B	0.15052	0.012	T	0.45366	-0.9266	9	0.21540	T	0.41	.	5.0716	0.14609	0.0:0.5869:0.0:0.4131	.	99	Q9H7R0	ZN442_HUMAN	I	99;30;30	ENSP00000242804:S99I;ENSP00000388634:S30I;ENSP00000404935:S30I	ENSP00000242804:S99I	S	-	2	0	ZNF442	12323103	0.000000	0.05858	0.006000	0.13384	0.021000	0.10359	-0.034000	0.12225	-0.071000	0.12886	0.313000	0.20887	AGT	-	NULL		0.343	ZNF442-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF442	protein_coding	OTTHUMT00000344109.1	C	NM_030824		12323103	-1	no_errors	NM_030824	genbank	human	validated	54_36p	missense	SNP	0.001	A
TYRP1	7306	genome.wustl.edu	37	9	12694227	12694227	+	Silent	SNP	T	T	C			TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr9:12694227T>C	ENST00000388918.5	+	2	360	c.231T>C	c.(229-231)ccT>ccC	p.P77P	TYRP1_ENST00000381136.2_5'Flank|TYRP1_ENST00000381137.2_5'UTR	NM_000550.2	NP_000541.1	P17643	TYRP1_HUMAN	tyrosinase-related protein 1	77					acetoacetic acid metabolic process (GO:0043438)|melanin biosynthetic process (GO:0042438)|melanocyte differentiation (GO:0030318)|melanosome organization (GO:0032438)	clathrin-coated endocytic vesicle membrane (GO:0030669)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|melanosome (GO:0042470)|melanosome membrane (GO:0033162)	copper ion binding (GO:0005507)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, another compound as one donor, and incorporation of one atom of oxygen (GO:0016716)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(10)|stomach(1)	22		all_cancers(3;3.1e-05)|all_lung(3;1.7e-06)|Lung NSC(3;2.09e-06)|all_epithelial(3;0.000695)|all_hematologic(3;0.0033)|Acute lymphoblastic leukemia(23;0.0744)		GBM - Glioblastoma multiforme(50;9.85e-06)		CCCACAGCCCTCAGTATCCCC	0.587									Oculocutaneous Albinism																																							0			9											44.0	39.0	41.0					9																	12694227		2203	4300	6503	12684227	SO:0001819	synonymous_variant	7306	Familial Cancer Database		L33830	CCDS34990.1	9p23	2013-01-08			ENSG00000107165	ENSG00000107165			12450	protein-coding gene	gene with protein product		115501		TYRP, CAS2		9434945	Standard	NM_000550		Approved	GP75, CATB, TRP, b-PROTEIN, OCA3	uc003zkv.4	P17643	OTTHUMG00000021034	ENST00000388918.5:c.231T>C	9.37:g.12694227T>C			12684227	P78468|P78469|Q13721|Q15679	Silent	SNP	superfamily_Di-copper_centre,HMMPfam_Tyrosinase,PatternScan_TYROSINASE_1,PatternScan_TYROSINASE_2	p.P77	ENST00000388918.5	37	c.231	CCDS34990.1	9																																																																																			-	NULL		0.587	TYRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TYRP1	protein_coding	OTTHUMT00000055502.3	T	NM_000550		12684227	+1	no_errors	NM_000550	genbank	human	reviewed	54_36p	silent	SNP	0.994	C
SIRT5	23408	genome.wustl.edu	37	6	13601090	13601090	+	Missense_Mutation	SNP	C	C	G			TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr6:13601090C>G	ENST00000606117.1	+	9	1062	c.766C>G	c.(766-768)Cca>Gca	p.P256A	SIRT5_ENST00000379262.4_Missense_Mutation_p.P256A|SIRT5_ENST00000397350.2_Missense_Mutation_p.P148A|SIRT5_ENST00000359782.3_Missense_Mutation_p.P238A	NM_012241.4	NP_036373.1			sirtuin 5											breast(1)|endometrium(1)|large_intestine(3)|lung(1)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	11	Breast(50;0.00669)|Ovarian(93;0.0634)	all_hematologic(90;0.117)	Epithelial(50;0.176)			TGTGGTGTACCCAGCAGCCAT	0.532																																																0			6											67.0	55.0	59.0					6																	13601090		2203	4300	6503	13709069	SO:0001583	missense	23408			AF083110	CCDS4526.1, CCDS4527.1, CCDS54966.1, CCDS56398.1	6p23	2010-08-05	2010-06-25		ENSG00000124523	ENSG00000124523			14933	protein-coding gene	gene with protein product		604483	"""sirtuin (silent mating type information regulation 2, S.cerevisiae, homolog) 5"", ""sirtuin (silent mating type information regulation 2 homolog) 5 (S. cerevisiae)"""			10381378	Standard	NM_012241		Approved		uc003nay.3	Q9NXA8	OTTHUMG00000014278	ENST00000606117.1:c.766C>G	6.37:g.13601090C>G	ENSP00000476228:p.Pro256Ala		13709069		Missense_Mutation	SNP	superfamily_DHS-like NAD/FAD-binding domain,HMMPfam_SIR2	p.P256A	ENST00000606117.1	37	c.766	CCDS4526.1	6	.	.	.	.	.	.	.	.	.	.	C	28.2	4.895903	0.91962	.	.	ENSG00000124523	ENST00000359782;ENST00000379262;ENST00000397350;ENST00000379250	T;T;T;T	0.56776	0.44;0.44;0.44;0.44	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	T	0.81418	0.4818	H	0.97240	3.965	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.997;0.999;1.0	D	0.88033	0.2776	10	0.87932	D	0	-21.4724	19.1343	0.93420	0.0:1.0:0.0:0.0	.	238;256;256	F5H5Z9;Q9NXA8;Q9NXA8-2	.;SIRT5_HUMAN;.	A	238;256;148;256	ENSP00000352830:P238A;ENSP00000368564:P256A;ENSP00000380509:P148A;ENSP00000368552:P256A	ENSP00000352830:P238A	P	+	1	0	SIRT5	13709069	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	7.290000	0.78711	2.584000	0.87258	0.591000	0.81541	CCA	-	superfamily_DHS-like NAD/FAD-binding domain,HMMPfam_SIR2		0.532	SIRT5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SIRT5	protein_coding	OTTHUMT00000039908.2	C			13709069	+1	no_errors	NM_012241	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
TUBA8	51807	genome.wustl.edu	37	22	18609613	18609613	+	Missense_Mutation	SNP	G	G	A			TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr22:18609613G>A	ENST00000330423.3	+	4	941	c.868G>A	c.(868-870)Gag>Aag	p.E290K	TUBA8_ENST00000316027.6_Missense_Mutation_p.E224K	NM_018943.2	NP_061816.1	Q9NY65	TBA8_HUMAN	tubulin, alpha 8	290					microtubule-based process (GO:0007017)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)	14						CTCTGTGGCCGAGATAACCAG	0.602																																																0			22											112.0	92.0	99.0					22																	18609613		2203	4300	6503	16989613	SO:0001583	missense	51807			AJ245922	CCDS13751.1, CCDS54495.1	22q11	2005-06-11			ENSG00000183785	ENSG00000183785		"""Tubulins"""	12410	protein-coding gene	gene with protein product		605742		TUBAL2		10772959, 10591208	Standard	NM_001193414		Approved		uc002znv.2	Q9NY65	OTTHUMG00000150097	ENST00000330423.3:c.868G>A	22.37:g.18609613G>A	ENSP00000333326:p.Glu290Lys		16989613	B2RCX2|B3KPW9|B4DWG3|Q2M3N4	Missense_Mutation	SNP	superfamily_Tubulin nucleotide-binding domain-like,HMMPfam_Tubulin,PatternScan_TUBULIN,superfamily_Tubulin C-terminal domain-like,HMMPfam_Tubulin_C	p.E290K	ENST00000330423.3	37	c.868	CCDS13751.1	22	.	.	.	.	.	.	.	.	.	.	.	17.02	3.282555	0.59867	.	.	ENSG00000183785	ENST00000316027;ENST00000330423;ENST00000416740	D;D;D	0.83163	-1.69;-1.69;-1.69	5.67	5.67	0.87782	Tubulin/FtsZ, 2-layer sandwich domain (3);Tubulin/FtsZ, C-terminal (1);	0.047710	0.85682	D	0.000000	D	0.93318	0.7870	H	0.95151	3.63	0.80722	D	1	D;D;D	0.76494	0.989;0.999;0.997	P;P;P	0.59948	0.794;0.866;0.765	D	0.94709	0.7890	10	0.87932	D	0	.	19.1191	0.93355	0.0:0.0:1.0:0.0	.	224;314;290	B3KPW9;C9J2C0;Q9NY65	.;.;TBA8_HUMAN	K	224;290;314	ENSP00000318575:E224K;ENSP00000333326:E290K;ENSP00000412646:E314K	ENSP00000318575:E224K	E	+	1	0	TUBA8	16989613	1.000000	0.71417	0.982000	0.44146	0.982000	0.71751	9.813000	0.99286	2.837000	0.97791	0.655000	0.94253	GAG	-	superfamily_Tubulin C-terminal domain-like,HMMPfam_Tubulin_C		0.602	TUBA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBA8	protein_coding	OTTHUMT00000316232.3	G	NM_018943		16989613	+1	no_errors	NM_018943	genbank	human	provisional	54_36p	missense	SNP	1.000	A
MRGPRX3	117195	genome.wustl.edu	37	11	18158934	18158934	+	Missense_Mutation	SNP	C	C	A			TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr11:18158934C>A	ENST00000396275.2	+	3	546	c.185C>A	c.(184-186)tCc>tAc	p.S62Y		NM_054031.3	NP_473372.3	Q96LB0	MRGX3_HUMAN	MAS-related GPR, member X3	62						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	27						AACGCTGTCTCCATCTACATC	0.587																																																0			11											114.0	108.0	110.0					11																	18158934		2200	4293	6493	18115510	SO:0001583	missense	117195				CCDS7830.1	11p15.1	2013-10-10			ENSG00000179826	ENSG00000179826		"""GPCR / Class A : Orphans"""	17980	protein-coding gene	gene with protein product		607229				11551509	Standard	NM_054031		Approved	MRGX3	uc001mnu.3	Q96LB0	OTTHUMG00000166435	ENST00000396275.2:c.185C>A	11.37:g.18158934C>A	ENSP00000379571:p.Ser62Tyr		18115510	B0M0L1|Q8TDE0|Q8TDE1	Missense_Mutation	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.S62Y	ENST00000396275.2	37	c.185	CCDS7830.1	11	.	.	.	.	.	.	.	.	.	.	C	13.82	2.349978	0.41599	.	.	ENSG00000179826	ENST00000396275;ENST00000531264	T;T	0.30448	1.53;1.53	1.46	1.46	0.22682	GPCR, rhodopsin-like superfamily (1);	0.642983	0.14533	N	0.313740	T	0.57036	0.2026	M	0.89414	3.03	0.23016	N	0.998421	D	0.89917	1.0	D	0.87578	0.998	T	0.40813	-0.9543	10	0.87932	D	0	.	8.8001	0.34903	0.0:1.0:0.0:0.0	.	62	Q96LB0	MRGX3_HUMAN	Y	62	ENSP00000379571:S62Y;ENSP00000436242:S62Y	ENSP00000379571:S62Y	S	+	2	0	MRGPRX3	18115510	0.864000	0.29904	0.009000	0.14445	0.005000	0.04900	1.763000	0.38461	1.108000	0.41662	0.430000	0.28490	TCC	-	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1		0.587	MRGPRX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRGPRX3	protein_coding	OTTHUMT00000389767.1	C	NM_054031		18115510	+1	no_errors	NM_054031	genbank	human	provisional	54_36p	missense	SNP	0.945	A
NRSN1	140767	genome.wustl.edu	37	6	24145907	24145907	+	Silent	SNP	G	G	A			TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr6:24145907G>A	ENST00000378491.4	+	4	622	c.321G>A	c.(319-321)caG>caA	p.Q107Q		NM_080723.4	NP_542454.3			neurensin 1											breast(1)|endometrium(2)|large_intestine(2)|lung(15)|skin(1)|upper_aerodigestive_tract(1)	22						ATGCTGTCCAGTTTAACAGTG	0.527																																																0			6											104.0	92.0	96.0					6																	24145907		2203	4300	6503	24253886	SO:0001819	synonymous_variant	140767			AF418980	CCDS4549.1	6p22.1	2008-02-05	2006-07-04	2006-07-04	ENSG00000152954	ENSG00000152954			17881	protein-coding gene	gene with protein product			"""vesicular membrane protein p24"""	VMP		12463420	Standard	NM_080723		Approved	p24	uc010jpq.1	Q8IZ57	OTTHUMG00000016406	ENST00000378491.4:c.321G>A	6.37:g.24145907G>A			24253886		Silent	SNP	NULL	p.Q107	ENST00000378491.4	37	c.321	CCDS4549.1	6																																																																																			-	NULL		0.527	NRSN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NRSN1	protein_coding	OTTHUMT00000043866.1	G	NM_080723		24253886	+1	no_errors	NM_080723	genbank	human	validated	54_36p	silent	SNP	1.000	A
RAB10	10890	genome.wustl.edu	37	2	26332666	26332666	+	Missense_Mutation	SNP	C	C	G			TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr2:26332666C>G	ENST00000264710.4	+	3	717	c.218C>G	c.(217-219)aCc>aGc	p.T73S	RAB10_ENST00000462003.1_3'UTR	NM_016131.4	NP_057215.3	P61026	RAB10_HUMAN	RAB10, member RAS oncogene family	73					antigen processing and presentation (GO:0019882)|axonogenesis (GO:0007409)|basolateral protein localization (GO:0061467)|cellular response to insulin stimulus (GO:0032869)|endoplasmic reticulum tubular network organization (GO:0071786)|endosomal transport (GO:0016197)|establishment of neuroblast polarity (GO:0045200)|establishment of protein localization to endoplasmic reticulum membrane (GO:0097051)|establishment of protein localization to membrane (GO:0090150)|Golgi to plasma membrane protein transport (GO:0043001)|Golgi to plasma membrane transport (GO:0006893)|GTP catabolic process (GO:0006184)|membrane organization (GO:0061024)|polarized epithelial cell differentiation (GO:0030859)|protein localization to plasma membrane (GO:0072659)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	cytoplasmic vesicle membrane (GO:0030659)|endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum tubular network (GO:0071782)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|insulin-responsive compartment (GO:0032593)|primary cilium (GO:0072372)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin V binding (GO:0031489)			lung(2)|ovary(1)	3	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CGATTTCACACCATCACAACC	0.373																																																0			2											98.0	90.0	93.0					2																	26332666		2203	4300	6503	26186170	SO:0001583	missense	10890			AF106681	CCDS1720.1	2p23.3	2008-05-21			ENSG00000084733	ENSG00000084733		"""RAB, member RAS oncogene"""	9759	protein-coding gene	gene with protein product	"""ras-related GTP-binding protein"""	612672				7688123	Standard	NM_016131		Approved		uc002rgv.3	P61026	OTTHUMG00000094796	ENST00000264710.4:c.218C>G	2.37:g.26332666C>G	ENSP00000264710:p.Thr73Ser		26186170	D6W538|O88386|Q6IA52|Q9D7X6|Q9H0T3	Missense_Mutation	SNP	HMMSmart_SM00177,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00173,HMMSmart_SM00175,HMMPfam_Ras,PatternScan_SIGMA54_INTERACT_1,HMMSmart_SM00174,HMMSmart_SM00176	p.T73S	ENST00000264710.4	37	c.218	CCDS1720.1	2	.	.	.	.	.	.	.	.	.	.	C	29.9	5.041973	0.93685	.	.	ENSG00000084733	ENST00000264710	T	0.75704	-0.96	5.51	5.51	0.81932	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	T	0.72366	0.3451	N	0.02697	-0.525	0.80722	D	1	D	0.69078	0.997	D	0.91635	0.999	T	0.81792	-0.0770	10	0.87932	D	0	.	17.9567	0.89072	0.0:1.0:0.0:0.0	.	73	P61026	RAB10_HUMAN	S	73	ENSP00000264710:T73S	ENSP00000264710:T73S	T	+	2	0	RAB10	26186170	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.792000	0.85828	2.588000	0.87417	0.585000	0.79938	ACC	-	HMMSmart_SM00177,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00173,HMMSmart_SM00175,HMMPfam_Ras,HMMSmart_SM00174,HMMSmart_SM00176		0.373	RAB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB10	protein_coding	OTTHUMT00000211610.1	C	NM_016131		26186170	+1	no_errors	NM_016131	genbank	human	provisional	54_36p	missense	SNP	1.000	G
HIST1H2BI	8346	genome.wustl.edu	37	6	26273441	26273441	+	Missense_Mutation	SNP	C	C	T			TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr6:26273441C>T	ENST00000377733.2	+	1	298	c.238C>T	c.(238-240)Cgc>Tgc	p.R80C	HIST1H3G_ENST00000305910.3_5'Flank	NM_003525.2	NP_003516.1	P62807	H2B1C_HUMAN	histone cluster 1, H2bi	80					antibacterial humoral response (GO:0019731)|chromatin organization (GO:0006325)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)|nucleosome assembly (GO:0006334)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			central_nervous_system(1)|cervix(2)|endometrium(3)|large_intestine(1)|lung(8)|urinary_tract(1)	16						CGAGGCTTCCCGCCTGGCGCA	0.597																																																0			6											114.0	113.0	113.0					6																	26273441		2203	4300	6503	26381420	SO:0001583	missense	8346			Z80782	CCDS4603.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000168242	ENSG00000278588		"""Histones / Replication-dependent"""	4756	protein-coding gene	gene with protein product		602807	"""H2B histone family, member K"", ""histone 1, H2bi"""	H2BFK		9119399, 12408966	Standard	NM_003525		Approved	H2B/k	uc003nhk.3	P62807	OTTHUMG00000014448	ENST00000377733.2:c.238C>T	6.37:g.26273441C>T	ENSP00000366962:p.Arg80Cys		26381420	P02278|Q3B872|Q4VB69|Q93078|Q93080	Missense_Mutation	SNP	superfamily_Histone-fold,HMMSmart_SM00427,HMMPfam_Histone,PatternScan_HISTONE_H2B	p.R80C	ENST00000377733.2	37	c.238	CCDS4603.1	6	.	.	.	.	.	.	.	.	.	.	.	12.58	1.981105	0.34942	.	.	ENSG00000168242	ENST00000377733	T	0.32753	1.44	4.5	4.5	0.54988	.	0.000000	0.42821	U	0.000645	T	0.55000	0.1893	M	0.92367	3.3	0.48040	D	0.999579	.	.	.	.	.	.	T	0.66666	-0.5866	8	0.49607	T	0.09	.	15.8093	0.78543	0.0:1.0:0.0:0.0	.	.	.	.	C	80	ENSP00000366962:R80C	ENSP00000366962:R80C	R	+	1	0	HIST1H2BI	26381420	1.000000	0.71417	0.999000	0.59377	0.070000	0.16714	5.756000	0.68757	2.058000	0.61347	0.563000	0.77884	CGC	-	superfamily_Histone-fold,HMMSmart_SM00427,HMMPfam_Histone		0.597	HIST1H2BI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H2BI	protein_coding	OTTHUMT00000040111.1	C	NM_003525		26381420	+1	no_errors	NM_003525	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
GCKR	2646	genome.wustl.edu	37	2	27729423	27729423	+	Silent	SNP	C	C	G			TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr2:27729423C>G	ENST00000264717.2	+	11	1008	c.945C>G	c.(943-945)acC>acG	p.T315T	GCKR_ENST00000424318.2_Silent_p.T125T	NM_001486.3	NP_001477.2	Q14397	GCKR_HUMAN	glucokinase (hexokinase 4) regulator	315					carbohydrate metabolic process (GO:0005975)|cellular glucose homeostasis (GO:0001678)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|negative regulation of glucokinase activity (GO:0033132)|positive regulation of glucokinase activity (GO:0033133)|protein import into nucleus, translocation (GO:0000060)|regulation of glucose transport (GO:0010827)|response to fructose (GO:0009750)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|triglyceride homeostasis (GO:0070328)|urate metabolic process (GO:0046415)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)	carbohydrate binding (GO:0030246)|enzyme inhibitor activity (GO:0004857)|fructose-6-phosphate binding (GO:0070095)			breast(2)|endometrium(4)|kidney(2)|large_intestine(4)|liver(2)|lung(13)|ovary(2)	29	Acute lymphoblastic leukemia(172;0.155)					AGATTGCCACCCTGATGAAGA	0.527																																																0			2											97.0	95.0	95.0					2																	27729423		2203	4300	6503	27582927	SO:0001819	synonymous_variant	2646			Z48475	CCDS1757.1	2p23	2008-05-21	2004-05-20		ENSG00000084734	ENSG00000084734			4196	protein-coding gene	gene with protein product		600842	"""glucokinase (hexokinase 4) regulatory protein"""			9570959, 8662230	Standard	NM_001486		Approved		uc002rky.3	Q14397	OTTHUMG00000128426	ENST00000264717.2:c.945C>G	2.37:g.27729423C>G			27582927	A1L4C2|B4DPQ2|Q53RY6|Q99522	Silent	SNP	superfamily_SIS domain,PatternScan_GCKR	p.T315	ENST00000264717.2	37	c.945	CCDS1757.1	2	.	.	.	.	.	.	.	.	.	.	C	0.257	-1.002227	0.02128	.	.	ENSG00000084734	ENST00000411584	.	.	.	4.66	1.71	0.24356	.	.	.	.	.	T	0.51907	0.1702	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.41233	-0.9520	4	.	.	.	-0.7956	5.2574	0.15553	0.1634:0.6517:0.0:0.1849	.	.	.	.	R	16	.	.	P	+	2	0	GCKR	27582927	0.001000	0.12720	0.939000	0.37840	0.018000	0.09664	-1.290000	0.02777	0.568000	0.29311	0.563000	0.77884	CCC	-	superfamily_SIS domain		0.527	GCKR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCKR	protein_coding	OTTHUMT00000250214.1	C	NM_001486		27582927	+1	no_errors	NM_001486	genbank	human	reviewed	54_36p	silent	SNP	0.134	G
LTN1	26046	genome.wustl.edu	37	21	30316000	30316000	+	Silent	SNP	A	A	G			TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr21:30316000A>G	ENST00000361371.5	-	23	4288	c.4209T>C	c.(4207-4209)caT>caC	p.H1403H	LTN1_ENST00000389194.2_Silent_p.H1449H			O94822	LTN1_HUMAN	listerin E3 ubiquitin protein ligase 1	1403					protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(12)|lung(19)|ovary(5)|pancreas(1)|prostate(2)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)	60						TGTATAGCATATGATAAACAG	0.303																																																0			21											78.0	73.0	75.0					21																	30316000		2203	4300	6503	29237871	SO:0001819	synonymous_variant	26046			AK001915	CCDS33527.1, CCDS33527.2	21q21.3	2013-01-09	2010-09-17	2010-09-17	ENSG00000198862	ENSG00000198862		"""RING-type (C3HC4) zinc fingers"""	13082	protein-coding gene	gene with protein product	"""listerin"""	613083	"""chromosome 21 open reading frame 98"", ""zinc finger protein 294"", ""ring finger protein 160"""	C21orf98, C21orf10, ZNF294, RNF160		20835226, 19196968	Standard	NM_015565		Approved	KIAA0714, FLJ11053, LISTERIN	uc002ymr.2	O94822	OTTHUMG00000078803	ENST00000361371.5:c.4209T>C	21.37:g.30316000A>G			29237871	A6NL41|A7E2D0|B2RTS0|C9J7U3|J3KPL4|Q05C47|Q9H8M4|Q9NUY5|Q9P0E9	Silent	SNP	superfamily_ARM repeat,superfamily_RING/U-box,HMMSmart_SM00744,HMMPfam_zf-C3HC4	p.H1403	ENST00000361371.5	37	c.4209		21																																																																																			-	NULL		0.303	LTN1-008	NOVEL	basic|appris_principal	protein_coding	RNF160	protein_coding	OTTHUMT00000472108.1	A	NM_015565		29237871	-1	no_errors	NM_015565	genbank	human	validated	54_36p	silent	SNP	0.998	G
OR10C1	442194	genome.wustl.edu	37	6	29408523	29408523	+	Missense_Mutation	SNP	T	T	A			TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr6:29408523T>A	ENST00000444197.2	+	1	1441	c.731T>A	c.(730-732)cTg>cAg	p.L244Q	OR11A1_ENST00000377149.1_Intron	NM_013941.3	NP_039229.3	Q96KK4	O10C1_HUMAN	olfactory receptor, family 10, subfamily C, member 1 (gene/pseudogene)	244						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|kidney(1)|large_intestine(3)|liver(2)|lung(14)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	27						TCCTCCCACCTGATCATGGTC	0.587																																																0			6											270.0	305.0	293.0					6																	29408523		1511	2708	4219	29516502	SO:0001583	missense	442194				CCDS34364.1	6p22.2-p21.31	2013-10-10	2013-10-10		ENSG00000206474	ENSG00000206474		"""GPCR / Class A : Olfactory receptors"""	8165	protein-coding gene	gene with protein product			"""olfactory receptor, family 10, subfamily C, member 2"", ""olfactory receptor, family 10, subfamily C, member 1"""	OR10C2			Standard	NM_013941		Approved	hs6M1-17, OR10C1P	uc011dlp.2	Q96KK4	OTTHUMG00000031207	ENST00000444197.2:c.731T>A	6.37:g.29408523T>A	ENSP00000419119:p.Leu244Gln		29516502	Q5SUN7|Q96R18	Missense_Mutation	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.L244Q	ENST00000444197.2	37	c.731	CCDS34364.1	6	.	.	.	.	.	.	.	.	.	.	T	18.69	3.678720	0.68042	.	.	ENSG00000206474	ENST00000444197	T	0.51325	0.71	3.49	3.49	0.39957	GPCR, rhodopsin-like superfamily (1);	0.000000	0.31092	N	0.008277	T	0.72078	0.3416	H	0.97131	3.945	0.39846	D	0.973173	D	0.89917	1.0	D	0.97110	1.0	T	0.81508	-0.0901	10	0.87932	D	0	.	11.8793	0.52564	0.0:0.0:0.0:1.0	.	244	Q96KK4	O10C1_HUMAN	Q	244	ENSP00000419119:L244Q	ENSP00000419119:L244Q	L	+	2	0	OR10C1	29516502	0.995000	0.38212	0.872000	0.34217	0.768000	0.43524	6.524000	0.73791	1.465000	0.48006	0.491000	0.48974	CTG	-	superfamily_SSF81321,HMMPfam_7tm_1		0.587	OR10C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10C1	protein_coding	OTTHUMT00000076415.2	T			29516502	+1	no_errors	NM_013941	genbank	human	provisional	54_36p	missense	SNP	0.963	A
BPIFB3	359710	genome.wustl.edu	37	20	31656717	31656717	+	Missense_Mutation	SNP	A	A	G			TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr20:31656717A>G	ENST00000375494.3	+	10	1087	c.1087A>G	c.(1087-1089)Aac>Gac	p.N363D		NM_182658.1	NP_872599.1	P59826	BPIB3_HUMAN	BPI fold containing family B, member 3	363					innate immune response (GO:0045087)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	lipid binding (GO:0008289)										CCTCCCAGCCAACATCCATGT	0.602																																																0			20											129.0	94.0	106.0					20																	31656717		2203	4300	6503	31120378	SO:0001583	missense	359710			AF549189	CCDS13212.1	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000186190	ENSG00000186190		"""BPI fold containing"""	16178	protein-coding gene	gene with protein product		615717	"""chromosome 20 open reading frame 185"""	C20orf185		11971875, 21787333	Standard	NM_182658		Approved	dJ726C3.4, LPLUNC3, RYA3	uc002wym.1	P59826	OTTHUMG00000032234	ENST00000375494.3:c.1087A>G	20.37:g.31656717A>G	ENSP00000364643:p.Asn363Asp		31120378	Q5TDX7	Missense_Mutation	SNP	PatternScan_LBP_BPI_CETP,superfamily_Bactericidal_perm-incr_a/b_dom,HMMSmart_BPI1,HMMPfam_LBP_BPI_CETP,HMMSmart_BPI2,HMMPfam_LBP_BPI_CETP_C	p.N363D	ENST00000375494.3	37	c.1087	CCDS13212.1	20	.	.	.	.	.	.	.	.	.	.	A	5.785	0.329253	0.10956	.	.	ENSG00000186190	ENST00000375494	T	0.07327	3.2	4.25	-1.77	0.07982	.	1.618690	0.03662	N	0.242690	T	0.05090	0.0136	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.41106	-0.9527	10	0.11794	T	0.64	0.1349	8.4224	0.32710	0.5147:0.0:0.4853:0.0	.	363	P59826	BPIB3_HUMAN	D	363	ENSP00000364643:N363D	ENSP00000364643:N363D	N	+	1	0	BPIFB3	31120378	0.000000	0.05858	0.395000	0.26283	0.026000	0.11368	-0.124000	0.10595	-0.320000	0.08640	0.482000	0.46254	AAC	-	superfamily_Bactericidal_perm-incr_a/b_dom,HMMSmart_BPI2,HMMPfam_LBP_BPI_CETP_C		0.602	BPIFB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C20orf185	protein_coding	OTTHUMT00000078654.2	A	NM_182658		31120378	+1	no_errors	NM_182658	genbank	human	provisional	54_36p	missense	SNP	0.373	G
CYP21A1P	1590	genome.wustl.edu	37	6	31979012	31979012	+	RNA	SNP	C	C	T			TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr6:31979012C>T	ENST00000342991.6	+	0	1971					NR_040090.1				cytochrome P450, family 21, subfamily A, polypeptide 1 pseudogene																		CTGAGGTCTCCCTGATTTCAC	0.612																																																0			6											24.0	26.0	25.0					6																	31979012		687	1544	2231	32086990			0			M13935		6p21.33	2011-12-01	2003-01-14		ENSG00000204338	ENSG00000204338		"""Cytochrome P450s"""	2599	pseudogene	pseudogene			"""cytochrome P450, subfamily XXIA (steroid 21-hydroxylase), polypeptide 1 pseudogene"""	CYP21P, CYP21A		3487786, 3038528	Standard	NR_040090		Approved	P450c21A	uc021yve.1		OTTHUMG00000031026		6.37:g.31979012C>T			32086990		Silent	SNP	superfamily_FN_III-like,HMMSmart_FN3,HMMPfam_fn3	p.R256	ENST00000342991.6	37	c.768		6																																																																																			-	superfamily_FN_III-like,HMMPfam_fn3,HMMSmart_FN3		0.612	CYP21A1P-002	KNOWN	basic	retained_intron	ENSG00000198493	pseudogene	OTTHUMT00000268795.1	C			32086990	-1	no_errors	ENST00000359300	ensembl	human	known	54_36p	silent	SNP	0.682	T
BBS9	27241	genome.wustl.edu	37	7	33427746	33427746	+	Missense_Mutation	SNP	C	C	A	rs149362446		TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr7:33427746C>A	ENST00000242067.6	+	19	2626	c.2105C>A	c.(2104-2106)aCc>aAc	p.T702N	BBS9_ENST00000350941.3_Missense_Mutation_p.T662N|BBS9_ENST00000355070.2_Missense_Mutation_p.T697N|BBS9_ENST00000354265.4_Missense_Mutation_p.T667N|BBS9_ENST00000396127.2_Missense_Mutation_p.T667N	NM_198428.2	NP_940820.1	Q3SYG4	PTHB1_HUMAN	Bardet-Biedl syndrome 9	702	Interaction with LZTL1.				cilium assembly (GO:0042384)|fat cell differentiation (GO:0045444)|protein transport (GO:0015031)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	BBSome (GO:0034464)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)			BBS9/PKD1L1(2)	NS(1)|autonomic_ganglia(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(27)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	50			GBM - Glioblastoma multiforme(11;0.0894)			TTAGATGGAACCTACAAGCAG	0.413									Bardet-Biedl syndrome				C|||	1	0.000199681	0.0008	0.0	5008	,	,		17430	0.0		0.0	False		,,,				2504	0.0															0			7						C	ASN/THR,ASN/THR,ASN/THR,ASN/THR	13,4393	20.2+/-43.8	0,13,2190	104.0	105.0	104.0		2000,2090,1985,2105	5.3	1.0	7	dbSNP_134	104	0,8600		0,0,4300	yes	missense,missense,missense,missense	BBS9	NM_001033604.1,NM_001033605.1,NM_014451.3,NM_198428.2	65,65,65,65	0,13,6490	AA,AC,CC		0.0,0.2951,0.1	probably-damaging,probably-damaging,probably-damaging,probably-damaging	667/853,697/883,662/848,702/888	33427746	13,12993	2203	4300	6503	33394271	SO:0001583	missense	27241	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome		CCDS5441.1, CCDS34618.1, CCDS43566.1, CCDS47572.1	7p14	2014-06-17			ENSG00000122507	ENSG00000122507			30000	protein-coding gene	gene with protein product	"""parathyroid hormone responsive B1 gene"""	607968				16380913, 10221542	Standard	XM_005249701		Approved	B1, PTHB1	uc003tdn.1	Q3SYG4	OTTHUMG00000128659	ENST00000242067.6:c.2105C>A	7.37:g.33427746C>A	ENSP00000242067:p.Thr702Asn		33394271	E9PDC9|P78514|Q7KYS6|Q7KYS7|Q8N570|Q99844|Q99854|Q9Y699|Q9Y6A0	Missense_Mutation	SNP	NULL	p.T702N	ENST00000242067.6	37	c.2105	CCDS43566.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	24.4|24.4	4.525216|4.525216	0.85600|0.85600	0.002951|0.002951	0.0|0.0	ENSG00000122507|ENSG00000122507	ENST00000434373|ENST00000242067;ENST00000350941;ENST00000396127;ENST00000355070;ENST00000354265;ENST00000396132	.|T;T;T;T;T	.|0.12147	.|2.71;2.71;2.71;2.71;2.71	5.35|5.35	5.35|5.35	0.76521|0.76521	.|.	.|0.114874	.|0.56097	.|D	.|0.000021	T|T	0.36138|0.36138	0.0956|0.0956	M|M	0.63843|0.63843	1.955|1.955	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0;1.0	.|D;D;D;D;D	.|0.79108	.|0.992;0.992;0.992;0.992;0.992	T|T	0.03423|0.03423	-1.1038|-1.1038	5|10	.|0.59425	.|D	.|0.04	-16.9649|-16.9649	17.2483|17.2483	0.87034|0.87034	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|702;662;697;667;702	.|Q3SYG4-3;Q3SYG4-2;E9PDC9;Q3SYG4-4;Q3SYG4	.|.;.;.;.;PTHB1_HUMAN	K|N	268|702;662;667;697;667;702	.|ENSP00000242067:T702N;ENSP00000313122:T662N;ENSP00000379433:T667N;ENSP00000347182:T697N;ENSP00000346214:T667N	.|ENSP00000242067:T702N	N|T	+|+	3|2	2|0	BBS9|BBS9	33394271|33394271	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.971000|0.971000	0.66376|0.66376	7.272000|7.272000	0.78516|0.78516	2.496000|2.496000	0.84212|0.84212	0.555000|0.555000	0.69702|0.69702	AAC|ACC	-	NULL		0.413	BBS9-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BBS9	protein_coding	OTTHUMT00000329064.1	C			33394271	+1	no_errors	NM_198428	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
UBAP2	55833	genome.wustl.edu	37	9	33998843	33998843	+	Missense_Mutation	SNP	C	C	G			TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr9:33998843C>G	ENST00000379238.1	-	3	236	c.119G>C	c.(118-120)cGt>cCt	p.R40P	UBAP2_ENST00000449054.1_Missense_Mutation_p.R40P|UBAP2_ENST00000418786.2_Missense_Mutation_p.R40P|UBAP2_ENST00000360802.1_Missense_Mutation_p.R40P|UBAP2_ENST00000539807.1_Missense_Mutation_p.R2P|UBAP2_ENST00000480885.1_5'UTR|UBAP2_ENST00000379239.4_5'UTR					ubiquitin associated protein 2											endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(13)|ovary(3)|stomach(1)	32			LUSC - Lung squamous cell carcinoma(29;0.00575)	GBM - Glioblastoma multiforme(74;0.168)		TTGAGCGAGACGCATCTGTTC	0.348																																																0			9											106.0	100.0	102.0					9																	33998843		2203	4300	6503	33988843	SO:0001583	missense	55833			AB040924	CCDS6547.1, CCDS75828.1	9p11.2	2008-02-05			ENSG00000137073	ENSG00000137073			14185	protein-coding gene	gene with protein product						8871400	Standard	NM_018449		Approved	KIAA1491, bA176F3.5, FLJ22435	uc003ztq.1	Q5T6F2	OTTHUMG00000000427	ENST00000379238.1:c.119G>C	9.37:g.33998843C>G	ENSP00000368540:p.Arg40Pro		33988843		Missense_Mutation	SNP	HMMPfam_UBA,HMMSmart_UBA	p.R40P	ENST00000379238.1	37	c.119	CCDS6547.1	9	.	.	.	.	.	.	.	.	.	.	C	22.6	4.316683	0.81469	.	.	ENSG00000137073	ENST00000379238;ENST00000449054;ENST00000360802;ENST00000431417;ENST00000539807;ENST00000351580;ENST00000418786;ENST00000412543	T;T;T;T;T;T	0.32023	1.47;1.47;1.47;2.05;1.47;1.47	6.17	4.35	0.52113	UBA-like (1);	0.046972	0.85682	D	0.000000	T	0.51686	0.1689	M	0.64170	1.965	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;0.999;0.999;1.0;0.999	D;D;D;D;D;D	0.91635	0.996;0.999;0.958;0.935;0.998;0.998	T	0.53563	-0.8421	10	0.87932	D	0	-9.6945	12.8758	0.57989	0.0:0.8695:0.0:0.1305	.	40;2;2;2;2;40	E7EWG4;F5H4D5;F5H2U4;F5H2C8;B4DH66;Q5T6F2	.;.;.;.;.;UBAP2_HUMAN	P	40;40;40;2;2;40;40;40	ENSP00000368540:R40P;ENSP00000416932:R40P;ENSP00000354039:R40P;ENSP00000439329:R2P;ENSP00000404436:R40P;ENSP00000414800:R40P	ENSP00000259602:R40P	R	-	2	0	UBAP2	33988843	1.000000	0.71417	0.999000	0.59377	0.962000	0.63368	7.373000	0.79623	0.942000	0.37525	-0.140000	0.14226	CGT	-	NULL		0.348	UBAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBAP2	protein_coding	OTTHUMT00000001071.1	C	NM_018449		33988843	-1	no_errors	NM_018449	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
ZNF536	9745	genome.wustl.edu	37	19	30936337	30936337	+	Missense_Mutation	SNP	C	C	G			TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr19:30936337C>G	ENST00000355537.3	+	2	2015	c.1868C>G	c.(1867-1869)cCt>cGt	p.P623R		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	623					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)			NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					CTGCAGGGTCCTGGGAACATG	0.587																																																0			19											94.0	106.0	102.0					19																	30936337		2203	4300	6503	35628177	SO:0001583	missense	9745				CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.1868C>G	19.37:g.30936337C>G	ENSP00000347730:p.Pro623Arg		35628177	A2RU18	Missense_Mutation	SNP	superfamily_SSF57667,HMMPfam_zf-C2H2,HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1	p.P623R	ENST00000355537.3	37	c.1868	CCDS32984.1	19	.	.	.	.	.	.	.	.	.	.	C	0.001	-2.955114	0.00050	.	.	ENSG00000198597	ENST00000355537	T	0.41065	1.01	5.68	3.51	0.40186	.	0.276346	0.35555	N	0.003136	T	0.18341	0.0440	N	0.08118	0	0.37040	D	0.897093	B;B	0.27559	0.181;0.09	B;B	0.20577	0.03;0.02	T	0.18178	-1.0345	10	0.02654	T	1	-15.8387	12.3032	0.54887	0.6199:0.3801:0.0:0.0	.	623;623	A7E228;O15090	.;ZN536_HUMAN	R	623	ENSP00000347730:P623R	ENSP00000347730:P623R	P	+	2	0	ZNF536	35628177	0.981000	0.34729	0.359000	0.25824	0.405000	0.30901	2.247000	0.43151	1.318000	0.45170	0.655000	0.94253	CCT	-	NULL		0.587	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF536	protein_coding	OTTHUMT00000459667.2	C	NM_014717		35628177	+1	no_errors	NM_014717	genbank	human	provisional	54_36p	missense	SNP	0.994	G
VSTM2L	128434	genome.wustl.edu	37	20	36560151	36560151	+	Missense_Mutation	SNP	G	G	C			TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr20:36560151G>C	ENST00000373461.4	+	2	483	c.236G>C	c.(235-237)tGg>tCg	p.W79S	VSTM2L_ENST00000373458.3_Missense_Mutation_p.W79S|VSTM2L_ENST00000373459.4_Intron	NM_080607.2	NP_542174.1	Q96N03	VTM2L_HUMAN	V-set and transmembrane domain containing 2 like	79	Ig-like.									central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(4)|ovary(1)|skin(1)	8		Myeloproliferative disorder(115;0.00878)				ATCCAGTGGTGGTATGTACGG	0.657																																																0			20											88.0	75.0	80.0					20																	36560151		2203	4300	6503	35993565	SO:0001583	missense	128434			AL109964	CCDS13299.1	20q11.23	2013-01-11	2007-08-10	2007-08-10	ENSG00000132821	ENSG00000132821		"""Immunoglobulin superfamily / V-set domain containing"""	16096	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 102"""	C20orf102			Standard	NM_080607		Approved	dJ1118M15.2	uc002xhk.4	Q96N03	OTTHUMG00000032430	ENST00000373461.4:c.236G>C	20.37:g.36560151G>C	ENSP00000362560:p.Trp79Ser		35993565	E1P5V7|Q5JWZ4|Q5JWZ5|Q8ND45|Q9BR37	Missense_Mutation	SNP	superfamily_Immunoglobulin,HMMPfam_V-set,HMMSmart_SM00409	p.W79S	ENST00000373461.4	37	c.236	CCDS13299.1	20	.	.	.	.	.	.	.	.	.	.	G	17.05	3.289110	0.59976	.	.	ENSG00000132821	ENST00000373458;ENST00000373461;ENST00000448944	T;T;T	0.63096	1.75;-0.02;1.75	4.66	4.66	0.58398	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.058540	0.64402	D	0.000001	T	0.81489	0.4833	M	0.86740	2.835	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	D	0.83533	0.0092	10	0.44086	T	0.13	-22.0236	16.8866	0.86077	0.0:0.0:1.0:0.0	.	79	Q96N03	VTM2L_HUMAN	S	79	ENSP00000362557:W79S;ENSP00000362560:W79S;ENSP00000406537:W79S	ENSP00000362557:W79S	W	+	2	0	VSTM2L	35993565	1.000000	0.71417	1.000000	0.80357	0.887000	0.51463	9.564000	0.98151	2.294000	0.77228	0.484000	0.47621	TGG	-	superfamily_Immunoglobulin,HMMPfam_V-set,HMMSmart_SM00409		0.657	VSTM2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VSTM2L	protein_coding	OTTHUMT00000079133.1	G			35993565	+1	no_errors	NM_080607	genbank	human	validated	54_36p	missense	SNP	1.000	C
AGO1	26523	genome.wustl.edu	37	1	36367577	36367577	+	Missense_Mutation	SNP	C	C	T			TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr1:36367577C>T	ENST00000373204.4	+	10	1382	c.1169C>T	c.(1168-1170)cCc>cTc	p.P390L	AGO1_ENST00000373206.1_Missense_Mutation_p.P315L	NM_012199.2	NP_036331.1	Q9UL18	AGO1_HUMAN	argonaute RISC catalytic component 1	390					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|nuclear-transcribed mRNA catabolic process (GO:0000956)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|micro-ribonucleoprotein complex (GO:0035068)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)										AACTTAGATCCCTACATCCAG	0.542																																																0			1											95.0	90.0	92.0					1																	36367577		2203	4300	6503	36140164	SO:0001583	missense	26523			AF093097	CCDS398.1	1p34.3	2013-02-15	2013-02-15	2013-02-15	ENSG00000092847	ENSG00000092847		"""Argonaute/PIWI family"""	3262	protein-coding gene	gene with protein product	"""argonaute 1"""	606228	"""eukaryotic translation initiation factor 2C, 1"""	EIF2C1		10534406, 12906857	Standard	NM_012199		Approved	hAGO1	uc001bzl.3	Q9UL18	OTTHUMG00000007381	ENST00000373204.4:c.1169C>T	1.37:g.36367577C>T	ENSP00000362300:p.Pro390Leu		36140164	Q5TA57|Q6P4S0	Missense_Mutation	SNP	superfamily_PAZ domain,HMMPfam_DUF1785,HMMPfam_PAZ,superfamily_Ribonuclease H-like,HMMPfam_Piwi	p.P390L	ENST00000373204.4	37	c.1169	CCDS398.1	1	.	.	.	.	.	.	.	.	.	.	C	17.87	3.495181	0.64186	.	.	ENSG00000092847	ENST00000373206;ENST00000373204	T;T	0.05717	3.4;3.4	6.06	6.06	0.98353	.	0.048972	0.85682	D	0.000000	T	0.19525	0.0469	M	0.91663	3.23	0.80722	D	1	P	0.41643	0.758	B	0.39027	0.288	T	0.06552	-1.0820	10	0.87932	D	0	-9.4494	20.6208	0.99490	0.0:1.0:0.0:0.0	.	390	Q9UL18	AGO1_HUMAN	L	315;390	ENSP00000362302:P315L;ENSP00000362300:P390L	ENSP00000362300:P390L	P	+	2	0	EIF2C1	36140164	1.000000	0.71417	1.000000	0.80357	0.365000	0.29674	7.818000	0.86416	2.882000	0.98803	0.655000	0.94253	CCC	-	NULL		0.542	AGO1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF2C1	protein_coding	OTTHUMT00000019337.3	C			36140164	+1	no_errors	NM_012199	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
TGM2	7052	genome.wustl.edu	37	20	36758624	36758624	+	Silent	SNP	G	G	A			TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr20:36758624G>A	ENST00000361475.2	-	13	2234	c.2061C>T	c.(2059-2061)gcC>gcT	p.A687A	TGM2_ENST00000536701.1_Silent_p.A606A|TGM2_ENST00000536724.1_Silent_p.A627A	NM_004613.2|NM_198951.1	NP_004604.2|NP_945189.1	P21980	TGM2_HUMAN	transglutaminase 2	687					apoptotic cell clearance (GO:0043277)|blood vessel remodeling (GO:0001974)|branching involved in salivary gland morphogenesis (GO:0060445)|isopeptide cross-linking via N6-(L-isoglutamyl)-L-lysine (GO:0018153)|negative regulation of endoplasmic reticulum calcium ion concentration (GO:0032471)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)|positive regulation of smooth muscle cell proliferation (GO:0048661)|protein homooligomerization (GO:0051260)|salivary gland cavitation (GO:0060662)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			endometrium(2)|large_intestine(11)|liver(1)|lung(7)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32		Myeloproliferative disorder(115;0.00878)			L-Glutamine(DB00130)	GGGTCCCTTAGGCGGGGCCAA	0.592																																																0			20											40.0	42.0	42.0					20																	36758624		2203	4300	6503	36192038	SO:0001819	synonymous_variant	7052			M98478	CCDS13302.1	20q12	2013-05-02	2013-05-02		ENSG00000198959	ENSG00000198959	2.3.2.13	"""Transglutaminases"""	11778	protein-coding gene	gene with protein product	"""C polypeptide, protein-glutamine-gamma-glutamyltransferase"""	190196	"""transglutaminase 2 (C polypeptide, protein-glutamine-gamma-glutamyltransferase)"""			7912692, 11390390	Standard	NM_004613		Approved	TGC	uc002xhr.3	P21980	OTTHUMG00000032437	ENST00000361475.2:c.2061C>T	20.37:g.36758624G>A			36192038	E1P5V9|Q16436|Q6B838|Q9BTN7|Q9UH35	Silent	SNP	superfamily_E set domains,HMMPfam_Transglut_N,superfamily_Cysteine proteinases,HMMSmart_SM00460,HMMPfam_Transglut_core,PatternScan_TRANSGLUTAMINASES,superfamily_Transglutaminase two C-terminal domains,HMMPfam_Transglut_C	p.A687	ENST00000361475.2	37	c.2061	CCDS13302.1	20																																																																																			-	superfamily_Transglutaminase two C-terminal domains		0.592	TGM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TGM2	protein_coding	OTTHUMT00000079151.2	G	NM_198951		36192038	-1	no_errors	NM_004613	genbank	human	reviewed	54_36p	silent	SNP	0.746	A
APOBEC3G	60489	genome.wustl.edu	37	22	39479798	39479798	+	Missense_Mutation	SNP	G	G	C			TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr22:39479798G>C	ENST00000407997.3	+	5	1001	c.644G>C	c.(643-645)cGg>cCg	p.R215P	APOBEC3G_ENST00000461827.1_3'UTR|APOBEC3G_ENST00000452957.2_Missense_Mutation_p.R215P	NM_021822.3	NP_068594.1	Q9HC16	ABC3G_HUMAN	apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3G	215	Interaction with DNA. {ECO:0000305}.|Necessary for homooligomerization.				base conversion or substitution editing (GO:0016553)|cytidine deamination (GO:0009972)|defense response to virus (GO:0051607)|DNA cytosine deamination (GO:0070383)|innate immune response (GO:0045087)|negative regulation of single stranded viral RNA replication via double stranded DNA intermediate (GO:0045869)|negative regulation of transposition (GO:0010529)|negative regulation of viral genome replication (GO:0045071)|negative regulation of viral process (GO:0048525)|positive regulation of defense response to virus by host (GO:0002230)|viral process (GO:0016032)	apolipoprotein B mRNA editing enzyme complex (GO:0030895)|cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|ribonucleoprotein complex (GO:0030529)	cytidine deaminase activity (GO:0004126)|deoxycytidine deaminase activity (GO:0047844)|protein homodimerization activity (GO:0042803)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			central_nervous_system(1)|large_intestine(4)|lung(5)|skin(1)|stomach(1)	12	Melanoma(58;0.04)					GTCAGAGGACGGCATGAGACT	0.527																																																0			22											127.0	106.0	113.0					22																	39479798		2203	4300	6503	37809744	SO:0001583	missense	60489			AF182420	CCDS13984.1	22q13.1-q13.2	2008-05-15			ENSG00000239713	ENSG00000239713		"""Apolipoprotein B mRNA editing enzymes"""	17357	protein-coding gene	gene with protein product		607113				11863358	Standard	NM_021822		Approved	CEM15, MDS019, dJ494G10.1, FLJ12740, bK150C2.7		Q9HC16	OTTHUMG00000151081	ENST00000407997.3:c.644G>C	22.37:g.39479798G>C	ENSP00000385057:p.Arg215Pro		37809744	B2RDR9|Q45F02|Q5TF77|Q7Z2N1|Q7Z2N4|Q9H9H8	Missense_Mutation	SNP	HMMPfam_APOBEC_N,superfamily_Cytidine deaminase-like,HMMPfam_APOBEC_C,PatternScan_CYT_DCMP_DEAMINASES	p.R215P	ENST00000407997.3	37	c.644	CCDS13984.1	22	.	.	.	.	.	.	.	.	.	.	.	3.104	-0.184028	0.06340	.	.	ENSG00000239713	ENST00000452957;ENST00000407997	T;T	0.74315	-0.83;-0.83	1.7	-3.4	0.04853	APOBEC-like, N-terminal (1);	.	.	.	.	T	0.76898	0.4052	L	0.61387	1.9	0.09310	N	1	D	0.53151	0.958	P	0.60541	0.876	T	0.68985	-0.5265	9	0.72032	D	0.01	.	3.5346	0.07789	0.1977:0.1593:0.5078:0.1352	.	215	Q9HC16	ABC3G_HUMAN	P	215	ENSP00000413376:R215P;ENSP00000385057:R215P	ENSP00000385057:R215P	R	+	2	0	APOBEC3G	37809744	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.018000	0.13422	-2.746000	0.00377	-1.239000	0.01543	CGG	-	HMMPfam_APOBEC_N		0.527	APOBEC3G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOBEC3G	protein_coding	OTTHUMT00000321219.1	G	NM_021822		37809744	+1	no_errors	NM_021822	genbank	human	reviewed	54_36p	missense	SNP	0.000	C
FBXO33	254170	genome.wustl.edu	37	14	39900992	39900992	+	Silent	SNP	C	C	A			TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr14:39900992C>A	ENST00000298097.7	-	1	712	c.375G>T	c.(373-375)ctG>ctT	p.L125L	FBXO33_ENST00000554190.1_5'UTR	NM_203301.3	NP_976046.1	Q7Z6M2	FBX33_HUMAN	F-box protein 33	125					protein ubiquitination (GO:0016567)					endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(4)|urinary_tract(1)	9	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00121)|Epithelial(34;0.169)	GBM - Glioblastoma multiforme(112;0.0425)		TGAGGAATTCCAGCCGAGGCT	0.677																																																0			14											17.0	20.0	19.0					14																	39900992		2157	4234	6391	38970743	SO:0001819	synonymous_variant	254170			BI460761	CCDS9677.1	14q13.3	2004-08-24	2004-06-15		ENSG00000165355	ENSG00000165355		"""F-boxes /  ""other"""""	19833	protein-coding gene	gene with protein product		609103	"""F-box only protein 33"""				Standard	NM_203301		Approved	Fbx33	uc001wvk.3	Q7Z6M2	OTTHUMG00000140257	ENST00000298097.7:c.375G>T	14.37:g.39900992C>A			38970743	Q6PIR2|Q86TR2|Q86YE0	Silent	SNP	superfamily_SSF81383,HMMPfam_F-box,HMMSmart_FBOX	p.L125	ENST00000298097.7	37	c.375	CCDS9677.1	14																																																																																			-	superfamily_SSF81383		0.677	FBXO33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO33	protein_coding	OTTHUMT00000276769.2	C			38970743	-1	no_errors	NM_203301	genbank	human	validated	54_36p	silent	SNP	1.000	A
INO80	54617	genome.wustl.edu	37	15	41279333	41279333	+	Missense_Mutation	SNP	T	T	A			TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr15:41279333T>A	ENST00000361937.3	-	31	4212	c.3788A>T	c.(3787-3789)gAg>gTg	p.E1263V	INO80_ENST00000561244.1_5'UTR|INO80_ENST00000401393.3_Missense_Mutation_p.E1263V			Q9ULG1	INO80_HUMAN	INO80 complex subunit	1263	Assembles INO80 complex module consisting of conserved components INO80B, INO80C, ACTR5, RVBL1, RVBL2.				ATP catabolic process (GO:0006200)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|chromatin remodeling (GO:0006338)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|mitotic sister chromatid segregation (GO:0000070)|positive regulation of cell growth (GO:0030307)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|spindle assembly (GO:0051225)|UV-damage excision repair (GO:0070914)	Ino80 complex (GO:0031011)|microtubule (GO:0005874)|nucleus (GO:0005634)	alpha-tubulin binding (GO:0043014)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			NS(1)|breast(4)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	49						ACTAACCACCTCTTTGGGTTT	0.443																																																0			15											118.0	96.0	103.0					15																	41279333		2203	4300	6503	39066625	SO:0001583	missense	54617			AB033085	CCDS10071.1	15q15.1	2013-08-21	2013-08-21	2008-08-07	ENSG00000128908	ENSG00000128908	3.6.1.3	"""INO80 complex subunits"""	26956	protein-coding gene	gene with protein product	"""INO80 complex subunit A"""	610169	"""INO80 complex homolog 1 (S. cerevisiae)"", ""INO80 homolog (S. cerevisiae)"""	INOC1		16298340, 16230350, 20237820	Standard	NM_017553		Approved	KIAA1259, Ino80, hINO80, INO80A	uc001zni.3	Q9ULG1	OTTHUMG00000130209	ENST00000361937.3:c.3788A>T	15.37:g.41279333T>A	ENSP00000355205:p.Glu1263Val		39066625	A6H8X4|Q9NTG6	Missense_Mutation	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00487,HMMPfam_SNF2_N,HMMSmart_SM00490,HMMPfam_Helicase_C	p.E1263V	ENST00000361937.3	37	c.3788	CCDS10071.1	15	.	.	.	.	.	.	.	.	.	.	T	29.2	4.984748	0.93044	.	.	ENSG00000128908	ENST00000263793;ENST00000361937;ENST00000401393	T;T	0.79033	-1.23;-1.23	4.97	4.97	0.65823	.	0.051190	0.85682	D	0.000000	D	0.89743	0.6803	M	0.90814	3.15	0.80722	D	1	D	0.71674	0.998	D	0.76071	0.987	D	0.91942	0.5564	10	0.87932	D	0	.	15.1122	0.72368	0.0:0.0:0.0:1.0	.	1263	Q9ULG1	INO80_HUMAN	V	57;1263;1263	ENSP00000355205:E1263V;ENSP00000384686:E1263V	ENSP00000263793:E57V	E	-	2	0	INO80	39066625	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.821000	0.86641	2.223000	0.72356	0.455000	0.32223	GAG	-	NULL		0.443	INO80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INO80	protein_coding	OTTHUMT00000252527.2	T	NM_017553		39066625	-1	no_errors	NM_017553	genbank	human	validated	54_36p	missense	SNP	1.000	A
ADAMTS20	80070	genome.wustl.edu	37	12	43770440	43770440	+	Missense_Mutation	SNP	C	C	G			TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr12:43770440C>G	ENST00000389420.3	-	33	5011	c.5012G>C	c.(5011-5013)gGa>gCa	p.G1671A		NM_025003.3	NP_079279.3	P59510	ATS20_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 20	1671	TSP type-1 15. {ECO:0000255|PROSITE- ProRule:PRU00210}.				extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of signal transduction (GO:0009967)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.G1671E(2)		breast(1)|central_nervous_system(6)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(43)|ovary(4)|pancreas(3)|prostate(5)|skin(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	95	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		TATCCCAATTCCACAAGTCAC	0.353																																																2	Substitution - Missense(2)	skin(2)	12											89.0	91.0	90.0					12																	43770440		2203	4300	6503	42056707	SO:0001583	missense	80070			AF488804	CCDS31778.2	12q12	2005-08-19	2005-08-19			ENSG00000173157		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17178	protein-coding gene	gene with protein product		611681	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 20"""			12514189, 12562771	Standard	NM_025003		Approved	GON-1	uc010skx.2	P59510		ENST00000389420.3:c.5012G>C	12.37:g.43770440C>G	ENSP00000374071:p.Gly1671Ala		42056707	A6NNC9|J3QT00	Missense_Mutation	SNP	"HMMPfam_Pep_M12B_propep,superfamily_Metalloproteases (""zincins"") catalytic domain,HMMPfam_Reprolysin,superfamily_TSP-1 type 1 repeat,HMMSmart_SM00209,HMMPfam_TSP_1,HMMPfam_ADAM_spacer1,HMMPfam_GON"	p.G1671A	ENST00000389420.3	37	c.5012	CCDS31778.2	12	.	.	.	.	.	.	.	.	.	.	C	19.52	3.842662	0.71488	.	.	ENSG00000173157	ENST00000389420	T	0.70631	-0.5	4.87	4.87	0.63330	.	0.000000	0.45361	D	0.000364	D	0.87212	0.6121	M	0.90650	3.135	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.88420	0.3028	10	0.48119	T	0.1	.	18.915	0.92501	0.0:1.0:0.0:0.0	.	1671	P59510	ATS20_HUMAN	A	1671	ENSP00000374071:G1671A	ENSP00000374071:G1671A	G	-	2	0	ADAMTS20	42056707	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.956000	0.70315	2.633000	0.89246	0.650000	0.86243	GGA	-	superfamily_TSP-1 type 1 repeat,HMMSmart_SM00209,HMMPfam_TSP_1		0.353	ADAMTS20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS20	protein_coding	OTTHUMT00000403643.1	C	NM_025003		42056707	-1	no_errors	NM_025003	genbank	human	validated	54_36p	missense	SNP	0.995	G
Unknown	0	genome.wustl.edu	37	10	42746580	42746580	+	IGR	SNP	T	T	A			TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr10:42746580T>A								AL031601.1 (16157 upstream) : RP11-313J2.1 (80733 downstream)																							CTGGATTCAATACATGCTTGA	0.393																																																0			10																																								42066586	SO:0001628	intergenic_variant	653097																															10.37:g.42746580T>A			42066586		Missense_Mutation	SNP	NULL	p.N34K		37	c.102		10																																																																																			-	NULL	0	0.393					LOC653097			T			42066586	+1	no_errors	XM_925973	genbank	human	model	54_36p	missense	SNP	1.000	A
YIPF3	25844	genome.wustl.edu	37	6	43483701	43483701	+	Missense_Mutation	SNP	C	C	A			TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr6:43483701C>A	ENST00000372422.2	-	2	396	c.214G>T	c.(214-216)Gct>Tct	p.A72S	YIPF3_ENST00000506469.1_Missense_Mutation_p.A78S|POLR1C_ENST00000372389.3_5'Flank|POLR1C_ENST00000372344.2_5'Flank|POLR1C_ENST00000304004.3_5'Flank	NM_015388.3	NP_056203.2	Q9GZM5	YIPF3_HUMAN	Yip1 domain family, member 3	72					cell differentiation (GO:0030154)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)|transport vesicle (GO:0030133)				large_intestine(2)|lung(4)|pancreas(1)|prostate(1)|skin(1)	9	all_cancers(18;3.79e-05)|Lung NSC(15;0.00217)|all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00736)|OV - Ovarian serous cystadenocarcinoma(102;0.0711)			TCCTCTTCAGCAGCAGCTGCA	0.557																																																0			6											94.0	85.0	88.0					6																	43483701		2203	4300	6503	43591679	SO:0001583	missense	25844			AK000946	CCDS4899.1	6p21.1	2009-10-06	2005-07-04	2005-07-04	ENSG00000137207	ENSG00000137207		"""Yip1 domain family"""	21023	protein-coding gene	gene with protein product		609775	"""chromosome 6 open reading frame 109"""	C6orf109			Standard	NM_015388		Approved	DKFZp566C243, KLIP1, dJ337H4.3, FinGER3	uc003ovl.2	Q9GZM5	OTTHUMG00000014738	ENST00000372422.2:c.214G>T	6.37:g.43483701C>A	ENSP00000361499:p.Ala72Ser		43591679	Q5JTD2|Q6FI85|Q8NI57|Q9NWE3|Q9Y3U9	Missense_Mutation	SNP	HMMPfam_Yip1	p.A72S	ENST00000372422.2	37	c.214	CCDS4899.1	6	.	.	.	.	.	.	.	.	.	.	C	5.633	0.301538	0.10678	.	.	ENSG00000137207	ENST00000372422;ENST00000504851;ENST00000506469;ENST00000503972;ENST00000511831	T;T;T	0.43688	0.94;0.94;0.96	0.418	0.418	0.16429	.	0.218722	0.46758	D	0.000267	T	0.09069	0.0224	N	0.22421	0.69	0.27296	N	0.957709	B;B;B	0.28636	0.091;0.187;0.218	B;B;B	0.25291	0.024;0.059;0.04	T	0.26538	-1.0100	9	0.26408	T	0.33	-0.5091	.	.	.	.	72;78;72	D6RED8;E7EQR8;Q9GZM5	.;.;YIPF3_HUMAN	S	72;72;78;72;37	ENSP00000361499:A72S;ENSP00000425494:A78S;ENSP00000421461:A72S	ENSP00000259737:A72S	A	-	1	0	YIPF3	43591679	1.000000	0.71417	0.900000	0.35374	0.982000	0.71751	3.166000	0.50785	0.452000	0.26830	0.460000	0.39030	GCT	-	NULL		0.557	YIPF3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	YIPF3	protein_coding	OTTHUMT00000040639.2	C	NM_015388		43591679	-1	no_errors	NM_015388	genbank	human	validated	54_36p	missense	SNP	0.997	A
ZBTB7C	201501	genome.wustl.edu	37	18	45696217	45696217	+	Intron	SNP	T	T	C			TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr18:45696217T>C	ENST00000590800.1	-	3	484				RNU6-708P_ENST00000384217.1_RNA			A1YPR0	ZBT7C_HUMAN	zinc finger and BTB domain containing 7C								metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			endometrium(8)|kidney(1)|large_intestine(7)|lung(3)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23						gctaatcttctctgtatcatt	0.393																																																0			18																																								43950215	SO:0001627	intron_variant	0			Y14591	CCDS32830.1	18q21.1	2013-01-08		2005-04-07	ENSG00000184828	ENSG00000184828		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	31700	protein-coding gene	gene with protein product			"""zinc finger and BTB domain containing 36"""	ZBTB36			Standard	NM_001039360		Approved	ZNF857C	uc002ldb.3	A1YPR0		ENST00000590800.1:c.15+16087A>G	18.37:g.45696217T>C			43950215	O73453	RNA	SNP	-	NULL	ENST00000590800.1	37	NULL	CCDS32830.1	18																																																																																			-	-		0.393	ZBTB7C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000206944	protein_coding	OTTHUMT00000450733.1	T	NM_001039360		43950215	-1	no_errors	ENST00000384217	ensembl	human	novel	54_36p	rna	SNP	1.000	C
DUSP21	63904	genome.wustl.edu	37	X	44703898	44703898	+	Missense_Mutation	SNP	G	G	C			TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chrX:44703898G>C	ENST00000339042.4	+	1	650	c.520G>C	c.(520-522)Ggt>Cgt	p.G174R		NM_022076.3	NP_071359.3	Q9H596	DUS21_HUMAN	dual specificity phosphatase 21	174					peptidyl-tyrosine dephosphorylation (GO:0035335)	cytoplasm (GO:0005737)|mitochondrial inner membrane (GO:0005743)|nucleus (GO:0005634)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|skin(3)	19						CTCGCCGGTAGGTAACATCCC	0.493																																																0			X											67.0	58.0	61.0					X																	44703898		2203	4300	6503	44588842	SO:0001583	missense	63904			AF143321	CCDS14264.1	Xp11.4-p11.23	2011-06-09			ENSG00000189037	ENSG00000189037		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	20476	protein-coding gene	gene with protein product		300678				12408986	Standard	NM_022076		Approved		uc004dgd.3	Q9H596	OTTHUMG00000021401	ENST00000339042.4:c.520G>C	X.37:g.44703898G>C	ENSP00000343244:p.Gly174Arg		44588842	Q0VDA6|Q6IAJ6|Q6YDQ8	Missense_Mutation	SNP	superfamily_SSF52799,HMMPfam_DSPc,HMMSmart_DSPc,PatternScan_TYR_PHOSPHATASE_1	p.G174R	ENST00000339042.4	37	c.520	CCDS14264.1	X	.	.	.	.	.	.	.	.	.	.	g	14.58	2.578273	0.45902	.	.	ENSG00000189037	ENST00000339042;ENST00000537377	T	0.03635	3.86	3.95	3.07	0.35406	.	0.000000	0.85682	D	0.000000	T	0.16642	0.0400	M	0.86651	2.83	0.58432	D	0.999998	D	0.89917	1.0	D	0.64237	0.923	T	0.00715	-1.1597	10	0.56958	D	0.05	.	10.1896	0.43019	0.0:0.0:0.8002:0.1998	.	174	Q9H596	DUS21_HUMAN	R	174;173	ENSP00000343244:G174R	ENSP00000343244:G174R	G	+	1	0	DUSP21	44588842	1.000000	0.71417	0.020000	0.16555	0.006000	0.05464	9.492000	0.97957	1.016000	0.39470	-0.227000	0.12334	GGT	-	NULL		0.493	DUSP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUSP21	protein_coding	OTTHUMT00000056323.1	G	NM_022076		44588842	+1	no_errors	NM_022076	genbank	human	reviewed	54_36p	missense	SNP	0.972	C
FCGBP	8857	genome.wustl.edu	37	19	40398460	40398460	+	Missense_Mutation	SNP	G	G	C			TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr19:40398460G>C	ENST00000221347.6	-	14	6514	c.6507C>G	c.(6505-6507)caC>caG	p.H2169Q		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	2169	VWFD 5. {ECO:0000255|PROSITE- ProRule:PRU00580}.					extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			TCAGGTGTGCGTGCAGGAGCG	0.667																																																0			19											13.0	15.0	14.0					19																	40398460		1898	3626	5524	45090300	SO:0001583	missense	8857			D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.6507C>G	19.37:g.40398460G>C	ENSP00000221347:p.His2169Gln		45090300	O95784	Missense_Mutation	SNP	HMMSmart_FOLN,HMMSmart_VWD,HMMPfam_VWD,HMMPfam_C8,superfamily_Cysrich_TIL,HMMPfam_TIL,HMMPfam_TIL_assoc,HMMSmart_VWC	p.H2169Q	ENST00000221347.6	37	c.6507	CCDS12546.1	19	.	.	.	.	.	.	.	.	.	.	G	0.003	-2.452239	0.00175	.	.	ENSG00000090920	ENST00000221347	T	0.58506	0.33	2.17	-1.18	0.09617	von Willebrand factor, type D domain (3);	.	.	.	.	T	0.24699	0.0599	N	0.02368	-0.58	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.14392	-1.0474	9	0.27082	T	0.32	.	3.5502	0.07843	0.267:0.222:0.511:0.0	.	2169	Q9Y6R7	FCGBP_HUMAN	Q	2169	ENSP00000221347:H2169Q	ENSP00000221347:H2169Q	H	-	3	2	FCGBP	45090300	0.286000	0.24305	0.000000	0.03702	0.002000	0.02628	-0.229000	0.09098	-0.199000	0.10317	-0.482000	0.04802	CAC	-	HMMSmart_VWD,HMMPfam_VWD		0.667	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCGBP	protein_coding	OTTHUMT00000462507.1	G	NM_003890		45090300	-1	no_errors	NM_003890	genbank	human	validated	54_36p	missense	SNP	0.000	C
ABCC11	85320	genome.wustl.edu	37	16	48210846	48210846	+	Missense_Mutation	SNP	C	C	T			TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr16:48210846C>T	ENST00000394747.1	-	24	3876	c.3527G>A	c.(3526-3528)aGg>aAg	p.R1176K	ABCC11_ENST00000353782.5_Missense_Mutation_p.R1176K|ABCC11_ENST00000394748.1_Missense_Mutation_p.R1176K|ABCC11_ENST00000565329.1_5'UTR|ABCC11_ENST00000356608.2_Missense_Mutation_p.R1176K	NM_033151.3	NP_149163.2	Q96J66	ABCCB_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 11	1176	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				organic anion transport (GO:0015711)|purine nucleotide transport (GO:0015865)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)|purine nucleotide transmembrane transporter activity (GO:0015216)			breast(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(3)|prostate(2)|skin(5)|urinary_tract(2)	83		all_cancers(37;0.127)|all_lung(18;0.132)|Breast(268;0.166)			Conjugated Estrogens(DB00286)|Folic Acid(DB00158)|Indomethacin(DB00328)|Methotrexate(DB00563)|Probenecid(DB01032)	AGAGCCCGTCCTTCCCACGAT	0.562																																																0			16											122.0	95.0	104.0					16																	48210846		2201	4300	6501	46768347	SO:0001583	missense	85320			AF367202	CCDS10732.1, CCDS10733.1	16q12	2012-03-14			ENSG00000121270	ENSG00000121270		"""ATP binding cassette transporters / subfamily C"""	14639	protein-coding gene	gene with protein product		607040				11483364, 11435397	Standard	NM_033151		Approved	MRP8	uc002efg.1	Q96J66	OTTHUMG00000133146	ENST00000394747.1:c.3527G>A	16.37:g.48210846C>T	ENSP00000378230:p.Arg1176Lys		46768347	Q8TDJ0|Q96JA6|Q9BX80	Missense_Mutation	SNP	superfamily_Multidrug resistance ABC transporter MsbA N-terminal domain,HMMPfam_ABC_membrane,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00382,HMMPfam_ABC_tran,PatternScan_ABC_TRANSPORTER_1	p.R1176K	ENST00000394747.1	37	c.3527	CCDS10732.1	16	.	.	.	.	.	.	.	.	.	.	C	34	5.404791	0.96051	.	.	ENSG00000121270	ENST00000353782;ENST00000356608;ENST00000394748;ENST00000394747	D;D;D;D	0.93659	-3.26;-3.26;-3.26;-3.26	5.1	5.1	0.69264	ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.000000	0.85682	D	0.000000	D	0.95924	0.8673	M	0.64997	1.995	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.83275	0.996;0.978	D	0.96374	0.9276	10	0.87932	D	0	-25.811	16.0137	0.80422	0.0:1.0:0.0:0.0	.	1176;1176	Q96J66-2;Q96J66	.;ABCCB_HUMAN	K	1176	ENSP00000311326:R1176K;ENSP00000349017:R1176K;ENSP00000378231:R1176K;ENSP00000378230:R1176K	ENSP00000311326:R1176K	R	-	2	0	ABCC11	46768347	1.000000	0.71417	0.999000	0.59377	0.985000	0.73830	7.184000	0.77705	2.392000	0.81423	0.561000	0.74099	AGG	-	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00382,HMMPfam_ABC_tran		0.562	ABCC11-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ABCC11	protein_coding	OTTHUMT00000429984.1	C	NM_032583		46768347	-1	no_errors	NM_032583	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
C1QL4	338761	genome.wustl.edu	37	12	49730135	49730135	+	Silent	SNP	G	G	C	rs146137821	byFrequency	TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr12:49730135G>C	ENST00000334221.3	-	1	836	c.126C>G	c.(124-126)ccC>ccG	p.P42P		NM_001008223.1	NP_001008224.1	Q86Z23	C1QL4_HUMAN	complement component 1, q subcomponent-like 4	42						collagen trimer (GO:0005581)|extracellular region (GO:0005576)				large_intestine(2)|lung(1)|ovary(1)|skin(1)	5						GCGCGCCGTCGGGACCAGGGC	0.756													G|||	454	0.090655	0.0991	0.0836	5008	,	,		11826	0.0248		0.1332	False		,,,				2504	0.1084															0			12						G		278,3274		16,246,1514	4.0	4.0	4.0		126	3.4	0.9	12	dbSNP_134	4	773,6267		42,689,2789	no	coding-synonymous	C1QL4	NM_001008223.1		58,935,4303	CC,CG,GG		10.9801,7.8266,9.9226		42/239	49730135	1051,9541	1776	3520	5296	48016402	SO:0001819	synonymous_variant	338761				CCDS31793.1	12q13.12	2012-04-12				ENSG00000186897			31416	protein-coding gene	gene with protein product		615229					Standard	NM_001008223		Approved	C1QTNF11, CTRP11	uc001rtz.1	Q86Z23	OTTHUMG00000169515	ENST00000334221.3:c.126C>G	12.37:g.49730135G>C			48016402		Silent	SNP	HMMPfam_Collagen,HMMSmart_C1Q,superfamily_TNF_like,HMMPfam_C1q	p.P42	ENST00000334221.3	37	c.126	CCDS31793.1	12																																																																																			-	NULL		0.756	C1QL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1QL4	protein_coding	OTTHUMT00000404561.1	G	NM_001008223		48016402	-1	no_errors	NM_001008223	genbank	human	provisional	54_36p	silent	SNP	0.028	C
TRIM51GP	120824	genome.wustl.edu	37	11	49003237	49003237	+	IGR	SNP	C	C	T			TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr11:49003237C>T								OR4A47 (491905 upstream) : TRIM49B (47266 downstream)																							TTGCAAGATTCCAGAATTCAT	0.438																																																0			11																																								48959813	SO:0001628	intergenic_variant	120824																															11.37:g.49003237C>T			48959813		Missense_Mutation	SNP	superfamily_RING/U-box,HMMSmart_SM00184,HMMPfam_zf-C3HC4,HMMPfam_zf-B_box,HMMSmart_SM00336,HMMPfam_SPRY	p.G4E		37	c.11		11																																																																																			-	superfamily_RING/U-box	0	0.438					LOC120824			C			48959813	-1	no_errors	XM_062300	genbank	human	model	54_36p	missense	SNP	0.979	T
DMXL2	23312	genome.wustl.edu	37	15	51799402	51799402	+	Missense_Mutation	SNP	T	T	A			TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr15:51799402T>A	ENST00000251076.5	-	16	2980	c.2693A>T	c.(2692-2694)gAg>gTg	p.E898V	DMXL2_ENST00000449909.3_Missense_Mutation_p.E898V|DMXL2_ENST00000543779.2_Missense_Mutation_p.E898V	NM_001174116.1|NM_015263.3	NP_001167587.1|NP_056078.2	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2	898						cell junction (GO:0030054)|extracellular space (GO:0005615)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	Rab GTPase binding (GO:0017137)			breast(4)|central_nervous_system(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(26)|liver(1)|lung(28)|ovary(7)|prostate(7)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	101				all cancers(107;0.00494)		GCTGTCCTTCTCAATTACTAC	0.318																																																0			15											101.0	96.0	98.0					15																	51799402		2195	4289	6484	49586694	SO:0001583	missense	23312			AB020663	CCDS10141.1, CCDS53945.1, CCDS53946.1	15q21.2	2013-01-10			ENSG00000104093	ENSG00000104093		"""WD repeat domain containing"""	2938	protein-coding gene	gene with protein product	"""rabconnectin 3"""	612186					Standard	NM_001174116		Approved	RC3, KIAA0856	uc010ufy.2	Q8TDJ6	OTTHUMG00000131749	ENST00000251076.5:c.2693A>T	15.37:g.51799402T>A	ENSP00000251076:p.Glu898Val		49586694	B2RTR3|B7ZMH3|F5GWF1|O94938	Missense_Mutation	SNP	superfamily_WD40 repeat-like,HMMSmart_SM00320,HMMPfam_WD40	p.E898V	ENST00000251076.5	37	c.2693	CCDS10141.1	15	.	.	.	.	.	.	.	.	.	.	T	25.0	4.594264	0.86953	.	.	ENSG00000104093	ENST00000251076;ENST00000543779;ENST00000449909	T;T;T	0.43294	0.95;0.95;0.95	4.83	4.83	0.62350	.	0.000000	0.85682	D	0.000000	T	0.66799	0.2826	M	0.82517	2.595	0.36927	D	0.891708	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.91635	0.999;0.997;0.994	T	0.77327	-0.2629	10	0.87932	D	0	.	14.0715	0.64863	0.0:0.0:0.0:1.0	.	898;898;898	F5GWF1;B2RTR3;Q8TDJ6	.;.;DMXL2_HUMAN	V	898	ENSP00000251076:E898V;ENSP00000441858:E898V;ENSP00000400855:E898V	ENSP00000251076:E898V	E	-	2	0	DMXL2	49586694	1.000000	0.71417	1.000000	0.80357	0.912000	0.54170	7.664000	0.83830	1.794000	0.52575	0.397000	0.26171	GAG	-	NULL		0.318	DMXL2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	DMXL2	protein_coding	OTTHUMT00000254671.2	T	NM_015263		49586694	-1	no_errors	NM_015263	genbank	human	validated	54_36p	missense	SNP	1.000	A
DDC	1644	genome.wustl.edu	37	7	50605620	50605620	+	Missense_Mutation	SNP	T	T	A	rs564352252		TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr7:50605620T>A	ENST00000444124.2	-	4	573	c.373A>T	c.(373-375)Atg>Ttg	p.M125L	DDC_ENST00000357936.5_Missense_Mutation_p.M125L|AC018705.5_ENST00000454521.1_RNA|DDC_ENST00000426377.1_Intron|DDC_ENST00000380984.4_Missense_Mutation_p.M125L|DDC_ENST00000431062.1_Missense_Mutation_p.M125L|DDC_ENST00000489162.1_5'UTR	NM_001082971.1	NP_001076440	P20711	DDC_HUMAN	dopa decarboxylase (aromatic L-amino acid decarboxylase)	125	2 X approximate tandem repeats.				catecholamine biosynthetic process (GO:0042423)|cellular amino acid metabolic process (GO:0006520)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to alkaloid (GO:0071312)|cellular response to drug (GO:0035690)|cellular response to growth factor stimulus (GO:0071363)|circadian rhythm (GO:0007623)|dopamine biosynthetic process (GO:0042416)|indolalkylamine biosynthetic process (GO:0046219)|isoquinoline alkaloid metabolic process (GO:0033076)|multicellular organismal aging (GO:0010259)|phytoalexin metabolic process (GO:0052314)|response to pyrethroid (GO:0046684)|serotonin biosynthetic process (GO:0042427)|small molecule metabolic process (GO:0044281)|synaptic vesicle amine transport (GO:0015842)	axon (GO:0030424)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|neuronal cell body (GO:0043025)|synaptic vesicle (GO:0008021)	amino acid binding (GO:0016597)|aromatic-L-amino-acid decarboxylase activity (GO:0004058)|enzyme binding (GO:0019899)|L-dopa decarboxylase activity (GO:0036468)|pyridoxal phosphate binding (GO:0030170)			breast(1)|endometrium(4)|kidney(3)|large_intestine(2)|lung(23)|ovary(4)|skin(2)|stomach(1)	40	Glioma(55;0.08)|all_neural(89;0.245)				Amantadine(DB00915)|Carbidopa(DB00190)|Cycloserine(DB00260)|Droxidopa(DB06262)|Flupentixol(DB00875)|L-DOPA(DB01235)|L-Tryptophan(DB00150)|Methyldopa(DB00968)	AGTTCCAGCATCTTCCCGAGC	0.557													T|||	1	0.000199681	0.0008	0.0	5008	,	,		16408	0.0		0.0	False		,,,				2504	0.0															0			7											92.0	81.0	85.0					7																	50605620		2203	4300	6503	50573114	SO:0001583	missense	1644				CCDS5511.1, CCDS56485.1, CCDS56486.1, CCDS56487.1, CCDS75598.1, CCDS75599.1	7p12.1	2012-08-30			ENSG00000132437	ENSG00000132437	4.1.1.28		2719	protein-coding gene	gene with protein product		107930				1612608	Standard	NM_001082971		Approved	AADC	uc003tpf.4	P20711	OTTHUMG00000023353	ENST00000444124.2:c.373A>T	7.37:g.50605620T>A	ENSP00000403644:p.Met125Leu		50573114	C9IYA0|E7ER62|E7EU95|Q16723|Q5W5T9|Q75MJ6	Missense_Mutation	SNP	superfamily_PLP-dependent transferases,HMMPfam_Pyridoxal_deC,PatternScan_DDC_GAD_HDC_YDC	p.M125L	ENST00000444124.2	37	c.373	CCDS5511.1	7	.	.	.	.	.	.	.	.	.	.	T	17.39	3.377519	0.61735	.	.	ENSG00000132437	ENST00000357936;ENST00000431062;ENST00000444124;ENST00000380984	T;T;T;T	0.34275	1.37;1.63;1.37;1.37	5.62	5.62	0.85841	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.000000	0.85682	D	0.000000	T	0.31979	0.0814	L	0.37630	1.12	0.80722	D	1	B	0.26195	0.144	B	0.19946	0.027	T	0.09952	-1.0651	10	0.87932	D	0	-4.7502	15.8188	0.78624	0.0:0.0:0.0:1.0	.	125	P20711	DDC_HUMAN	L	125	ENSP00000350616:M125L;ENSP00000399184:M125L;ENSP00000403644:M125L;ENSP00000370371:M125L	ENSP00000350616:M125L	M	-	1	0	DDC	50573114	1.000000	0.71417	1.000000	0.80357	0.884000	0.51177	6.230000	0.72301	2.145000	0.66743	0.482000	0.46254	ATG	-	superfamily_PLP-dependent transferases,HMMPfam_Pyridoxal_deC		0.557	DDC-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	DDC	protein_coding	OTTHUMT00000342593.1	T			50573114	-1	no_errors	NM_000790	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
WDR72	256764	genome.wustl.edu	37	15	54025238	54025238	+	Missense_Mutation	SNP	G	G	T			TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr15:54025238G>T	ENST00000396328.1	-	2	348	c.109C>A	c.(109-111)Caa>Aaa	p.Q37K	WDR72_ENST00000559418.1_Missense_Mutation_p.Q37K|WDR72_ENST00000557913.1_Missense_Mutation_p.Q37K|WDR72_ENST00000360509.5_Missense_Mutation_p.Q37K	NM_001277176.1|NM_182758.2	NP_001264105.1|NP_877435.3	Q3MJ13	WDR72_HUMAN	WD repeat domain 72	37										NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(18)|lung(29)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	71				all cancers(107;0.0511)		TGACCCTCTTGACTTCCAGTC	0.493																																																0			15											127.0	107.0	114.0					15																	54025238		2194	4293	6487	51812530	SO:0001583	missense	256764			BX537884	CCDS10151.1, CCDS73730.1	15q21.3	2013-01-09			ENSG00000166415	ENSG00000166415		"""WD repeat domain containing"""	26790	protein-coding gene	gene with protein product		613214					Standard	NM_182758		Approved	FLJ38736	uc002acj.2	Q3MJ13	OTTHUMG00000131939	ENST00000396328.1:c.109C>A	15.37:g.54025238G>T	ENSP00000379619:p.Gln37Lys		51812530	Q7Z3I3|Q8N8X2	Missense_Mutation	SNP	superfamily_WD40 repeat-like,HMMSmart_SM00320,HMMPfam_WD40,PatternScan_WD_REPEATS_1	p.Q37K	ENST00000396328.1	37	c.109	CCDS10151.1	15	.	.	.	.	.	.	.	.	.	.	G	14.21	2.466147	0.43839	.	.	ENSG00000166415	ENST00000396328;ENST00000360509	T;T	0.01258	5.09;5.09	4.66	4.66	0.58398	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.288379	0.29972	N	0.010722	T	0.01454	0.0047	L	0.36672	1.1	0.32145	N	0.585024	B	0.27229	0.172	B	0.22386	0.039	T	0.25847	-1.0120	10	0.31617	T	0.26	.	8.9161	0.35583	0.0999:0.0:0.9:0.0	.	37	Q3MJ13	WDR72_HUMAN	K	37	ENSP00000379619:Q37K;ENSP00000353699:Q37K	ENSP00000353699:Q37K	Q	-	1	0	WDR72	51812530	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	4.414000	0.59802	2.590000	0.87494	0.655000	0.94253	CAA	-	superfamily_WD40 repeat-like,HMMSmart_SM00320		0.493	WDR72-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WDR72	protein_coding	OTTHUMT00000254893.2	G	NM_182758		51812530	-1	no_errors	NM_182758	genbank	human	validated	54_36p	missense	SNP	0.997	T
PHF7	51533	genome.wustl.edu	37	3	52456307	52456307	+	Silent	SNP	C	C	A			TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr3:52456307C>A	ENST00000327906.3	+	9	1410	c.750C>A	c.(748-750)gcC>gcA	p.A250A	PHF7_ENST00000347025.2_Intron	NM_016483.4	NP_057567.3	Q9BWX1	PHF7_HUMAN	PHD finger protein 7	250						Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)			breast(2)|large_intestine(4)|lung(3)	9				BRCA - Breast invasive adenocarcinoma(193;1.71e-05)|Kidney(197;0.00178)|KIRC - Kidney renal clear cell carcinoma(197;0.00201)|OV - Ovarian serous cystadenocarcinoma(275;0.0275)		ACTGTGATGCCCCCATCTGTC	0.493																																																0			3											91.0	87.0	88.0					3																	52456307		2203	4300	6503	52431347	SO:0001819	synonymous_variant	51533			AY014283	CCDS2854.1, CCDS2855.1	3p21.31	2013-01-28			ENSG00000010318	ENSG00000010318		"""Zinc fingers, PHD-type"""	18458	protein-coding gene	gene with protein product						11042152, 11829468	Standard	NM_016483		Approved	NYD-SP6, HSPC226	uc003ddy.3	Q9BWX1	OTTHUMG00000158495	ENST00000327906.3:c.750C>A	3.37:g.52456307C>A			52431347	K4DI82	Silent	SNP	PatternScan_ZF_RING_1,PatternScan_ZF_PHD_1,HMMSmart_PHD,HMMSmart_RING	p.A250	ENST00000327906.3	37	c.750	CCDS2854.1	3	.	.	.	.	.	.	.	.	.	.	C	10.23	1.291707	0.23564	.	.	ENSG00000010318	ENST00000461861	.	.	.	5.75	2.62	0.31277	.	.	.	.	.	T	0.53997	0.1831	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.46679	-0.9174	4	.	.	.	0.0	5.6703	0.17719	0.0:0.6314:0.0:0.3686	.	.	.	.	H	210	.	.	P	+	2	0	PHF7	52431347	0.927000	0.31430	1.000000	0.80357	0.994000	0.84299	0.647000	0.24812	0.790000	0.33803	0.655000	0.94253	CCC	-	HMMSmart_RING		0.493	PHF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHF7	protein_coding	OTTHUMT00000351155.1	C	NM_016483		52431347	+1	no_errors	NM_016483	genbank	human	reviewed	54_36p	silent	SNP	1.000	A
ITGA7	3679	genome.wustl.edu	37	12	56081783	56081783	+	Missense_Mutation	SNP	A	A	T			TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr12:56081783A>T	ENST00000555728.1	-	25	3315	c.3287T>A	c.(3286-3288)cTa>cAa	p.L1096Q	ITGA7_ENST00000452168.2_Missense_Mutation_p.L959Q|ITGA7_ENST00000257880.7_Missense_Mutation_p.L1096Q|ITGA7_ENST00000347027.6_Missense_Mutation_p.L1046Q|ITGA7_ENST00000553804.1_Missense_Mutation_p.L1056Q|ITGA7_ENST00000394230.2_Missense_Mutation_p.L1056Q|ITGA7_ENST00000257879.6_Missense_Mutation_p.L1052Q|ITGA7_ENST00000394229.2_Missense_Mutation_p.L1052Q			Q13683	ITA7_HUMAN	integrin, alpha 7	1096					blood vessel morphogenesis (GO:0048514)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|muscle organ development (GO:0007517)|regulation of cell shape (GO:0008360)|skeletal muscle tissue development (GO:0007519)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|integrin alpha7-beta1 complex (GO:0034677)|muscle tendon junction (GO:0005927)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(16)|ovary(2)|prostate(2)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	50						CAGCAGTGCTAGCACCAGCAG	0.587																																																0			12											106.0	106.0	106.0					12																	56081783		2203	4300	6503	54368050	SO:0001583	missense	3679				CCDS8888.1, CCDS44914.1, CCDS55832.1	12q13	2014-09-17				ENSG00000135424		"""Integrins"""	6143	protein-coding gene	gene with protein product		600536				7607681	Standard	NM_002206		Approved		uc001shh.3	Q13683		ENST00000555728.1:c.3287T>A	12.37:g.56081783A>T	ENSP00000452387:p.Leu1096Gln		54368050	B4E3U0|C9JMD3|C9JMZ6|O43197|Q86W93|Q9NY89|Q9UET0|Q9UEV2	Missense_Mutation	SNP	superfamily_Integrin alpha N-terminal domain,HMMSmart_SM00191,HMMPfam_FG-GAP,HMMPfam_Integrin_alpha2,superfamily_Integrin domains,PatternScan_INTEGRIN_ALPHA,HMMPfam_Integrin_alpha	p.L1052Q	ENST00000555728.1	37	c.3155		12	.	.	.	.	.	.	.	.	.	.	A	22.1	4.246589	0.80024	.	.	ENSG00000135424	ENST00000553804;ENST00000257879;ENST00000347027;ENST00000452168;ENST00000257880;ENST00000394230;ENST00000394229;ENST00000353687;ENST00000555728;ENST00000557555	D;D;D;D;D;D;D;D	0.82803	-1.65;-1.65;-1.65;-1.65;-1.65;-1.65;-1.65;-1.65	4.92	4.92	0.64577	.	0.218004	0.30695	N	0.009061	D	0.92034	0.7476	M	0.90977	3.165	0.51482	D	0.999923	D;D;D;P	0.71674	0.998;0.998;0.998;0.955	D;D;D;P	0.69824	0.966;0.925;0.966;0.646	D	0.93484	0.6830	10	0.87932	D	0	.	12.5563	0.56254	1.0:0.0:0.0:0.0	.	959;1096;1056;1115	Q13683-13;Q13683;Q13683-3;Q4LE35	.;ITA7_HUMAN;.;.	Q	1056;1052;1046;959;1096;1056;1052;925;1096;82	ENSP00000452120:L1056Q;ENSP00000257879:L1052Q;ENSP00000343009:L1046Q;ENSP00000393844:L959Q;ENSP00000257880:L1096Q;ENSP00000377777:L1056Q;ENSP00000377776:L1052Q;ENSP00000452387:L1096Q	ENSP00000257879:L1052Q	L	-	2	0	ITGA7	54368050	1.000000	0.71417	0.999000	0.59377	0.938000	0.57974	8.490000	0.90464	1.854000	0.53819	0.386000	0.25728	CTA	-	NULL		0.587	ITGA7-014	KNOWN	basic	protein_coding	ITGA7	protein_coding	OTTHUMT00000410138.1	A	NM_002206		54368050	-1	no_errors	NM_002206	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
TUBBP6	442308	genome.wustl.edu	37	7	55713694	55713694	+	IGR	SNP	A	A	C			TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr7:55713694A>C								RP11-310H4.3 (50995 upstream) : FKBP9L (35072 downstream)																							GAGAGCTGTGACTGCCTTCAG	0.552																																																0			7																																								55681188	SO:0001628	intergenic_variant	442308																															7.37:g.55713694A>C			55681188		RNA	SNP	-	NULL		37	NULL		7																																																																																			-	-	0	0.552					LOC442308			A			55681188	+1	pseudogene	NR_003598	genbank	human	provisional	54_36p	rna	SNP	1.000	C
OR9G4	283189	genome.wustl.edu	37	11	56510658	56510658	+	Silent	SNP	G	G	A	rs149148369		TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr11:56510658G>A	ENST00000302957.3	-	1	629	c.630C>T	c.(628-630)taC>taT	p.Y210Y		NM_001005284.1	NP_001005284.1	Q8NGQ1	OR9G4_HUMAN	olfactory receptor, family 9, subfamily G, member 4	210						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|autonomic_ganglia(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	34						GGACTTTTTCGTAGACCCTGG	0.438																																																0			11						G		1,4401	2.1+/-5.4	0,1,2200	79.0	73.0	75.0		630	-1.6	0.4	11	dbSNP_134	75	0,8592		0,0,4296	no	coding-synonymous	OR9G4	NM_001005284.1		0,1,6496	AA,AG,GG		0.0,0.0227,0.0077		210/328	56510658	1,12993	2201	4296	6497	56267234	SO:0001819	synonymous_variant	283189			BK004400	CCDS31537.1	11q11	2012-08-09			ENSG00000172457	ENSG00000172457		"""GPCR / Class A : Olfactory receptors"""	15322	protein-coding gene	gene with protein product							Standard	NM_001005284		Approved		uc010rjo.2	Q8NGQ1	OTTHUMG00000166932	ENST00000302957.3:c.630C>T	11.37:g.56510658G>A			56267234	Q6IF62|Q96RA9	Silent	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.Y210	ENST00000302957.3	37	c.630	CCDS31537.1	11																																																																																			-	superfamily_SSF81321,HMMPfam_7tm_1		0.438	OR9G4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR9G4	protein_coding	OTTHUMT00000391945.1	G	NM_001005284		56267234	-1	no_errors	NM_001005284	genbank	human	provisional	54_36p	silent	SNP	0.000	A
MIER3	166968	genome.wustl.edu	37	5	56233470	56233470	+	Missense_Mutation	SNP	G	G	C			TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr5:56233470G>C	ENST00000381199.3	-	5	381	c.371C>G	c.(370-372)gCg>gGg	p.A124G	MIER3_ENST00000381226.3_Missense_Mutation_p.A129G|MIER3_ENST00000409421.1_Missense_Mutation_p.A61G|MIER3_ENST00000381213.3_Missense_Mutation_p.A124G			Q7Z3K6	MIER3_HUMAN	mesoderm induction early response 1, family member 3	124					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|liver(1)|lung(2)|urinary_tract(1)	19		Lung NSC(810;4.65e-05)|Prostate(74;0.0253)|Breast(144;0.0503)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;1.24e-37)		CAGATCATCCGCAGAAGACTG	0.423																																																0			5											123.0	110.0	115.0					5																	56233470		2203	4300	6503	56269227	SO:0001583	missense	166968			BX537798	CCDS3973.2, CCDS75248.1	5q11.2	2009-03-19			ENSG00000155545	ENSG00000155545			26678	protein-coding gene	gene with protein product						12477932	Standard	XM_005248448		Approved	FLJ35954, DKFZp686L09111, DKFZp781I1119	uc003jra.1	Q7Z3K6	OTTHUMG00000059589	ENST00000381199.3:c.371C>G	5.37:g.56233470G>C	ENSP00000370596:p.Ala124Gly		56269227	B4DRI9|B8ZZQ0|Q5CZI0|Q68CS3|Q6MZS7|Q86YG8|Q8NA13	Missense_Mutation	SNP	PatternScan_EF_HAND_1,HMMPfam_ELM2,superfamily_Homeodomain_like,HMMSmart_SANT,HMMPfam_Myb_DNA-binding	p.A124G	ENST00000381199.3	37	c.371		5	.	.	.	.	.	.	.	.	.	.	G	22.7	4.325190	0.81580	.	.	ENSG00000155545	ENST00000381226;ENST00000381213;ENST00000381199;ENST00000409421;ENST00000336942	T;T;T;T;T	0.36340	1.26;1.26;1.26;1.26;1.26	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.57504	0.2058	L	0.58810	1.83	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.995;0.998;0.998	T	0.38520	-0.9657	10	0.16420	T	0.52	-9.9882	20.6593	0.99626	0.0:0.0:1.0:0.0	.	124;129;124	Q7Z3K6;Q7Z3K6-2;Q7Z3K6-3	MIER3_HUMAN;.;.	G	129;124;124;61;97	ENSP00000370624:A129G;ENSP00000370611:A124G;ENSP00000370596:A124G;ENSP00000386584:A61G;ENSP00000337027:A97G	ENSP00000337027:A97G	A	-	2	0	MIER3	56269227	1.000000	0.71417	0.860000	0.33809	0.966000	0.64601	9.837000	0.99465	2.885000	0.99019	0.655000	0.94253	GCG	-	NULL		0.423	MIER3-004	KNOWN	basic|appris_candidate	protein_coding	MIER3	protein_coding	OTTHUMT00000132523.2	G	NM_152622		56269227	-1	no_errors	NM_152622	genbank	human	validated	54_36p	missense	SNP	1.000	C
TBX2	6909	genome.wustl.edu	37	17	59480475	59480475	+	Silent	SNP	C	C	T			TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr17:59480475C>T	ENST00000240328.3	+	3	998	c.717C>T	c.(715-717)gcC>gcT	p.A239A	RP11-332H18.5_ENST00000585765.1_RNA|RP11-332H18.4_ENST00000592009.1_RNA	NM_005994.3	NP_005985.3	Q13207	TBX2_HUMAN	T-box 2	239					aorta morphogenesis (GO:0035909)|atrioventricular canal development (GO:0036302)|cardiac muscle tissue development (GO:0048738)|cell aging (GO:0007569)|cellular senescence (GO:0090398)|developmental growth involved in morphogenesis (GO:0060560)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|endocardial cushion morphogenesis (GO:0003203)|mammary placode formation (GO:0060596)|muscle cell fate determination (GO:0007521)|negative regulation of cardiac chamber formation (GO:1901211)|negative regulation of heart looping (GO:1901208)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|outflow tract septum morphogenesis (GO:0003148)|palate development (GO:0060021)|pharynx development (GO:0060465)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003256)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|lung(7)|ovary(1)	9						TAGTGCGAGCCAACGACATCC	0.627																																					GBM(3;187 253 11467 14965 23079)											0			17											122.0	95.0	104.0					17																	59480475		2203	4300	6503	56835257	SO:0001819	synonymous_variant	6909			AB209378	CCDS11627.2	17q23.2	2012-01-23			ENSG00000121068	ENSG00000121068		"""T-boxes"""	11597	protein-coding gene	gene with protein product		600747				8530034	Standard	NM_005994		Approved		uc010wox.2	Q13207	OTTHUMG00000156986	ENST00000240328.3:c.717C>T	17.37:g.59480475C>T			56835257	Q16424|Q7Z647	Silent	SNP	superfamily_P53_like_DNA_bnd,HMMSmart_TBOX,HMMPfam_T-box,PatternScan_TBOX_1,PatternScan_TBOX_2	p.A229	ENST00000240328.3	37	c.687	CCDS11627.2	17																																																																																			-	superfamily_P53_like_DNA_bnd,HMMSmart_TBOX,HMMPfam_T-box		0.627	TBX2-001	NOVEL	basic|appris_principal|CCDS	protein_coding	TBX2	protein_coding	OTTHUMT00000346977.2	C	NM_005994		56835257	+1	no_errors	NM_005994	genbank	human	validated	54_36p	silent	SNP	1.000	T
OR1S1	219959	genome.wustl.edu	37	11	57983179	57983179	+	Missense_Mutation	SNP	A	A	T			TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr11:57983179A>T	ENST00000309433.6	+	1	963	c.963A>T	c.(961-963)aaA>aaT	p.K321N		NM_001004458.1	NP_001004458.1	Q8NH92	OR1S1_HUMAN	olfactory receptor, family 1, subfamily S, member 1	321						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(24)|kidney(1)|large_intestine(1)|liver(1)|lung(10)|prostate(1)|skin(2)|stomach(3)|urinary_tract(3)	48		Breast(21;0.0589)				TCAATAGAAAAATTTCTTCCC	0.423																																																0			11											137.0	137.0	137.0					11																	57983179		2201	4295	6496	57739755	SO:0001583	missense	219959			BK004299	CCDS31546.1	11q12.1	2012-08-09			ENSG00000172774	ENSG00000172774		"""GPCR / Class A : Olfactory receptors"""	8227	protein-coding gene	gene with protein product							Standard	NM_001004458		Approved	OST034	uc010rkc.2	Q8NH92	OTTHUMG00000167463	ENST00000309433.6:c.963A>T	11.37:g.57983179A>T	ENSP00000311688:p.Lys321Asn		57739755	Q6IFG3	Missense_Mutation	SNP	PatternScan_G_PROTEIN_RECEP_F1_1,superfamily_SSF81321,HMMPfam_7tm_1	p.K321N	ENST00000309433.6	37	c.963	CCDS31546.1	11	.	.	.	.	.	.	.	.	.	.	A	9.107	1.005495	0.19199	.	.	ENSG00000172774	ENST00000309433	T	0.39406	1.08	3.23	0.348	0.16026	.	0.374005	0.22513	N	0.059071	T	0.24275	0.0588	N	0.25825	0.765	0.09310	N	1	B	0.18863	0.031	B	0.15052	0.012	T	0.12502	-1.0545	10	0.33940	T	0.23	.	6.521	0.22275	0.6019:0.0:0.0:0.3981	.	321	Q8NH92	OR1S1_HUMAN	N	321	ENSP00000311688:K321N	ENSP00000311688:K321N	K	+	3	2	OR1S1	57739755	0.000000	0.05858	0.005000	0.12908	0.109000	0.19521	0.127000	0.15790	0.295000	0.22570	0.392000	0.25879	AAA	-	superfamily_SSF81321		0.423	OR1S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR1S1	protein_coding	OTTHUMT00000394705.1	A	NM_001004458		57739755	+1	no_errors	NM_001004458	genbank	human	provisional	54_36p	missense	SNP	0.000	T
OR10Q1	219960	genome.wustl.edu	37	11	57995525	57995525	+	Missense_Mutation	SNP	C	C	T			TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr11:57995525C>T	ENST00000316770.2	-	1	865	c.823G>A	c.(823-825)Gag>Aag	p.E275K		NM_001004471.2	NP_001004471.1	Q8NGQ4	O10Q1_HUMAN	olfactory receptor, family 10, subfamily Q, member 1	275						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(26)|ovary(2)	35		Breast(21;0.0589)				TGGCTGTCCTCATCCTCTGAG	0.567																																																0			11											108.0	96.0	100.0					11																	57995525		2201	4295	6496	57752101	SO:0001583	missense	219960			AB065735	CCDS31547.1	11q12.1	2012-08-09			ENSG00000180475	ENSG00000180475		"""GPCR / Class A : Olfactory receptors"""	15134	protein-coding gene	gene with protein product							Standard	NM_001004471		Approved		uc010rkd.2	Q8NGQ4	OTTHUMG00000167542	ENST00000316770.2:c.823G>A	11.37:g.57995525C>T	ENSP00000314324:p.Glu275Lys		57752101	Q6IFG4	Missense_Mutation	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.E275K	ENST00000316770.2	37	c.823	CCDS31547.1	11	.	.	.	.	.	.	.	.	.	.	C	3.896	-0.023010	0.07634	.	.	ENSG00000180475	ENST00000316770	T	0.00084	8.75	5.07	4.14	0.48551	GPCR, rhodopsin-like superfamily (1);	0.000000	0.43110	D	0.000619	T	0.00144	0.0004	N	0.04335	-0.225	0.20196	N	0.999922	D	0.59357	0.985	D	0.66979	0.948	T	0.56703	-0.7935	10	0.06757	T	0.87	.	7.2936	0.26380	0.0:0.5817:0.3317:0.0866	.	275	Q8NGQ4	O10Q1_HUMAN	K	275	ENSP00000314324:E275K	ENSP00000314324:E275K	E	-	1	0	OR10Q1	57752101	0.000000	0.05858	0.841000	0.33234	0.088000	0.18126	-0.054000	0.11826	1.329000	0.45376	0.650000	0.86243	GAG	-	superfamily_SSF81321,HMMPfam_7tm_1		0.567	OR10Q1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10Q1	protein_coding	OTTHUMT00000394706.1	C	NM_001004471		57752101	-1	no_errors	NM_001004471	genbank	human	provisional	54_36p	missense	SNP	0.013	T
MS4A3	932	genome.wustl.edu	37	11	59828789	59828789	+	Splice_Site	SNP	G	G	T			TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr11:59828789G>T	ENST00000278865.3	+	2	229	c.156G>T	c.(154-156)ggG>ggT	p.G52G	MS4A3_ENST00000395032.2_Intron|MS4A3_ENST00000534744.1_Splice_Site_p.G52G|MS4A3_ENST00000526199.1_3'UTR|MS4A3_ENST00000358152.2_Splice_Site_p.G52G	NM_006138.4	NP_006129.4	Q96HJ5	MS4A3_HUMAN	membrane-spanning 4-domains, subfamily A, member 3 (hematopoietic cell-specific)	52						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				endometrium(4)|kidney(2)|lung(9)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	21		all_epithelial(135;0.245)				AAGTTCTTGGGGTAAGTCAGC	0.428																																																0			11											100.0	96.0	98.0					11																	59828789		2201	4295	6496	59585365	SO:0001630	splice_region_variant	932			L35848	CCDS31567.1, CCDS31568.1, CCDS41651.1	11q12-q13.1	2008-03-25				ENSG00000149516			7317	protein-coding gene	gene with protein product		606498		CD20L		7524084	Standard	NM_006138		Approved	HTM4	uc001nom.3	Q96HJ5		ENST00000278865.3:c.156+1G>T	11.37:g.59828789G>T			59585365	A8MTP8|Q8NHW2	Silent	SNP	HMMPfam_CD20	p.G52	ENST00000278865.3	37	c.156	CCDS31567.1	11																																																																																			-	NULL		0.428	MS4A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MS4A3	protein_coding	OTTHUMT00000394417.1	G		Silent	59585365	+1	no_errors	NM_006138	genbank	human	reviewed	54_36p	silent	SNP	0.974	T
STMN3	50861	genome.wustl.edu	37	20	62273470	62273470	+	Silent	SNP	C	C	T			TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr20:62273470C>T	ENST00000370053.1	-	4	555	c.474G>A	c.(472-474)ctG>ctA	p.L158L	STMN3_ENST00000540534.1_Silent_p.L147L	NM_001276310.1|NM_015894.2	NP_001263239.1|NP_056978.2	Q9NZ72	STMN3_HUMAN	stathmin-like 3	158	SLD. {ECO:0000255|PROSITE- ProRule:PRU00998}.				cytoplasmic microtubule organization (GO:0031122)|negative regulation of Rac protein signal transduction (GO:0035021)|nervous system development (GO:0007399)|neuron projection development (GO:0031175)|regulation of cytoskeleton organization (GO:0051493)|regulation of microtubule polymerization or depolymerization (GO:0031110)|regulation of Rac GTPase activity (GO:0032314)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)	protein domain specific binding (GO:0019904)			kidney(1)|large_intestine(1)|lung(5)|prostate(1)	8	all_cancers(38;2.31e-11)|all_epithelial(29;7.76e-13)		Epithelial(9;1.9e-09)|all cancers(9;1.22e-08)|BRCA - Breast invasive adenocarcinoma(10;8.86e-06)|OV - Ovarian serous cystadenocarcinoma(5;0.00559)			CCTTCTCGCGCAGCCGCTCGC	0.741																																																0			20											14.0	14.0	14.0					20																	62273470		2184	4285	6469	61743914	SO:0001819	synonymous_variant	50861			AF069709	CCDS13529.1, CCDS63330.1	20q13.3	2007-01-22			ENSG00000197457	ENSG00000197457			15926	protein-coding gene	gene with protein product		608362				9603203, 10655513	Standard	NM_001276310		Approved	SCLIP	uc002yfr.2	Q9NZ72	OTTHUMG00000032985	ENST00000370053.1:c.474G>A	20.37:g.62273470C>T			61743914	B3KSQ5|B7WP52|B7Z5G4|O75527|Q969Y4	Silent	SNP	superfamily_Stathmin,HMMPfam_Stathmin,PatternScan_STATHMIN_1,PatternScan_STATHMIN_2	p.L158	ENST00000370053.1	37	c.474	CCDS13529.1	20																																																																																			-	superfamily_Stathmin,HMMPfam_Stathmin		0.741	STMN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STMN3	protein_coding	OTTHUMT00000080163.1	C	NM_015894		61743914	-1	no_errors	NM_015894	genbank	human	reviewed	54_36p	silent	SNP	1.000	T
RTEL1	51750	genome.wustl.edu	37	20	62319070	62319070	+	Missense_Mutation	SNP	C	C	G			TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr20:62319070C>G	ENST00000360203.5	+	17	1753	c.1428C>G	c.(1426-1428)atC>atG	p.I476M	RTEL1_ENST00000318100.4_Missense_Mutation_p.I476M|RTEL1_ENST00000370018.3_Missense_Mutation_p.I476M|RTEL1_ENST00000508582.2_Missense_Mutation_p.I500M|RTEL1_ENST00000370003.1_5'Flank|RTEL1-TNFRSF6B_ENST00000482936.1_Missense_Mutation_p.I476M					regulator of telomere elongation helicase 1											NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	all_cancers(38;6.47e-12)|all_epithelial(29;3.75e-13)		Epithelial(9;1.25e-09)|all cancers(9;5.13e-09)|BRCA - Breast invasive adenocarcinoma(10;7.26e-05)|OV - Ovarian serous cystadenocarcinoma(5;0.00223)|Colorectal(105;0.107)			GCTCCCTCATCCTTACCAGCG	0.682																																																0			20											31.0	26.0	27.0					20																	62319070		2187	4287	6474	61789514	SO:0001583	missense	51750			AB029011	CCDS13530.2, CCDS13531.1, CCDS13530.3, CCDS63331.1, CCDS74751.1	20q13.3	2012-06-27	2004-10-29	2004-10-29	ENSG00000258366	ENSG00000258366			15888	protein-coding gene	gene with protein product		608833	"""chromosome 20 open reading frame 41"""	C20orf41		10655513, 15210109	Standard	NM_016434		Approved	bK3184A7.3, NHL, DKFZP434C013, KIAA1088, RTEL	uc011abd.2	Q9NZ71	OTTHUMG00000032992	ENST00000360203.5:c.1428C>G	20.37:g.62319070C>G	ENSP00000353332:p.Ile476Met		61789514		Missense_Mutation	SNP	superfamily_SSF52540,HMMSmart_DEXDc2,HMMPfam_ResIII,HMMPfam_DEAD_2,HMMSmart_HELICc2,superfamily_SSF57850	p.I476M	ENST00000360203.5	37	c.1428		20	.	.	.	.	.	.	.	.	.	.	C	18.91	3.723400	0.68959	.	.	ENSG00000258366	ENST00000370018;ENST00000318100;ENST00000508582;ENST00000360203	T;T;T;T	0.73789	-0.78;-0.78;-0.78;-0.78	5.31	5.31	0.75309	.	0.053641	0.64402	D	0.000001	D	0.89241	0.6659	H	0.95402	3.665	0.44871	D	0.997886	D;D;P	0.71674	0.997;0.998;0.904	D;D;P	0.68765	0.96;0.914;0.769	D	0.91814	0.5462	10	0.87932	D	0	-21.5108	12.9731	0.58524	0.0:0.9209:0.0:0.0791	.	500;476;476	Q9NZ71-7;Q9NZ71;Q9NZ71-6	.;RTEL1_HUMAN;.	M	476;476;500;476	ENSP00000359035:I476M;ENSP00000322287:I476M;ENSP00000424307:I500M;ENSP00000353332:I476M	ENSP00000353332:I476M	I	+	3	3	AL353715.1	61789514	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	1.276000	0.33156	2.505000	0.84491	0.561000	0.74099	ATC	-	NULL		0.682	RTEL1-011	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	RTEL1	protein_coding	OTTHUMT00000289781.1	C	NM_032957		61789514	+1	no_errors	NM_032957	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
FAM96A	84191	genome.wustl.edu	37	15	64380780	64380780	+	Intron	SNP	C	C	T	rs147993063	byFrequency	TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr15:64380780C>T	ENST00000300030.3	-	2	539				FAM96A_ENST00000557835.1_Intron|FAM96A_ENST00000559950.1_Intron|FAM96A_ENST00000380290.3_Intron	NM_032231.4	NP_115607.1	Q9H5X1	FA96A_HUMAN	family with sequence similarity 96, member A						chromosome segregation (GO:0007059)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			kidney(1)|large_intestine(1)|lung(4)|prostate(1)|skin(1)|urinary_tract(1)	9						gtaatacaTACACTGTATGGT	0.269													C|||	6	0.00119808	0.0045	0.0	5008	,	,		21231	0.0		0.0	False		,,,				2504	0.0															0			15																																								62167833	SO:0001627	intron_variant	84191				CCDS10189.1, CCDS45278.1	15q22.31	2014-01-16			ENSG00000166797	ENSG00000166797			26235	protein-coding gene	gene with protein product						23891004	Standard	NM_032231		Approved	FLJ22875	uc002amt.1	Q9H5X1	OTTHUMG00000132961	ENST00000300030.3:c.289+105G>A	15.37:g.64380780C>T			62167833	A6NKS1|B2R5F8|B7Z8Z5	Silent	SNP	HMMPfam_DUF59	p.V97	ENST00000300030.3	37	c.291	CCDS10189.1	15																																																																																			-	HMMPfam_DUF59		0.269	FAM96A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM96A	protein_coding	OTTHUMT00000256520.1	C	NM_032231		62167833	-1	no_stop_codon	ENST00000380290	ensembl	human	known	54_36p	silent	SNP	0.015	T
ROR1	4919	genome.wustl.edu	37	1	64624824	64624824	+	Silent	SNP	C	C	T			TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr1:64624824C>T	ENST00000371079.1	+	8	1710	c.1335C>T	c.(1333-1335)caC>caT	p.H445H	ROR1_ENST00000545203.1_5'UTR|RP11-24J23.2_ENST00000424995.1_RNA	NM_005012.3	NP_005003.2	Q01973	ROR1_HUMAN	receptor tyrosine kinase-like orphan receptor 1	445					peptidyl-tyrosine phosphorylation (GO:0018108)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|Wnt-protein binding (GO:0017147)			breast(7)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(14)|lung(10)|ovary(6)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	51						AACCAAAACACGTCAGAGGTC	0.453																																																0			1											187.0	165.0	172.0					1																	64624824		2203	4300	6503	64397412	SO:0001819	synonymous_variant	4919			M97675	CCDS626.1, CCDS41344.1	1p32-p31	2013-01-11			ENSG00000185483	ENSG00000185483		"""Immunoglobulin superfamily / I-set domain containing"""	10256	protein-coding gene	gene with protein product		602336		NTRKR1		1334494, 8875995	Standard	NM_001083592		Approved		uc001dbj.3	Q01973	OTTHUMG00000009022	ENST00000371079.1:c.1335C>T	1.37:g.64624824C>T			64397412	Q5VVX6|Q66K77|Q92776	Silent	SNP	superfamily_Immunoglobulin,HMMPfam_I-set,HMMSmart_SM00409,HMMSmart_SM00408,HMMPfam_Fz,superfamily_Kringle-like,HMMSmart_SM00130,HMMPfam_Kringle,PatternScan_KRINGLE_1,superfamily_Protein kinase-like (PK-like),HMMPfam_Pkinase_Tyr,HMMSmart_SM00219,HMMSmart_SM00220,PatternScan_PROTEIN_KINASE_TYR	p.H445	ENST00000371079.1	37	c.1335	CCDS626.1	1																																																																																			-	NULL		0.453	ROR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ROR1	protein_coding	OTTHUMT00000025002.1	C	NM_005012		64397412	+1	no_errors	NM_005012	genbank	human	validated	54_36p	silent	SNP	0.300	T
STARD8	9754	genome.wustl.edu	37	X	67937450	67937450	+	Missense_Mutation	SNP	A	A	T			TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chrX:67937450A>T	ENST00000252336.6	+	5	826	c.454A>T	c.(454-456)Agt>Tgt	p.S152C	STARD8_ENST00000374597.3_Missense_Mutation_p.S152C|STARD8_ENST00000374599.3_Missense_Mutation_p.S232C	NM_014725.4	NP_055540.2	Q92502	STAR8_HUMAN	StAR-related lipid transfer (START) domain containing 8	152					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)	GTPase activator activity (GO:0005096)|lipid binding (GO:0008289)			NS(2)|breast(5)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(25)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(2)	50						GCCCAAGCATAGTCCAGCCAC	0.552																																																0			X											67.0	52.0	57.0					X																	67937450		2203	4300	6503	67854175	SO:0001583	missense	9754			D80011	CCDS14390.1, CCDS48134.1	Xq13.1	2011-09-13	2007-08-16		ENSG00000130052	ENSG00000130052		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	19161	protein-coding gene	gene with protein product		300689	"""START domain containing 8"""			8724849	Standard	NM_001142504		Approved	KIAA0189, ARHGAP38	uc004dxb.3	Q92502	OTTHUMG00000021748	ENST00000252336.6:c.454A>T	X.37:g.67937450A>T	ENSP00000252336:p.Ser152Cys		67854175	A8K6T2|D3DVT9|Q5JST0|Q68DG7	Missense_Mutation	SNP	superfamily_GTPase activation domain GAP,HMMSmart_SM00324,HMMPfam_RhoGAP,superfamily_Bet v1-like,HMMPfam_START,HMMSmart_SM00234	p.S152C	ENST00000252336.6	37	c.454	CCDS14390.1	X	.	.	.	.	.	.	.	.	.	.	a	1.805	-0.476097	0.04414	.	.	ENSG00000130052	ENST00000252336;ENST00000374599;ENST00000374597	T;T;T	0.08546	3.08;3.09;3.08	4.18	-4.01	0.04045	.	1.250240	0.05170	N	0.499440	T	0.04588	0.0125	N	0.19112	0.55	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.06405	0.002;0.001	T	0.42632	-0.9440	10	0.52906	T	0.07	.	0.6753	0.00865	0.235:0.142:0.3101:0.313	.	232;152	Q92502-2;Q92502	.;STAR8_HUMAN	C	152;232;152	ENSP00000252336:S152C;ENSP00000363727:S232C;ENSP00000363725:S152C	ENSP00000252336:S152C	S	+	1	0	STARD8	67854175	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.220000	0.17660	-0.596000	0.05821	-0.365000	0.07479	AGT	-	NULL		0.552	STARD8-201	KNOWN	basic|CCDS	protein_coding	STARD8	protein_coding	OTTHUMT00000057026.2	A	NM_014725		67854175	+1	no_errors	NM_014725	genbank	human	validated	54_36p	missense	SNP	0.000	T
MYO9A	4649	genome.wustl.edu	37	15	72170562	72170562	+	Missense_Mutation	SNP	C	C	T			TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr15:72170562C>T	ENST00000356056.5	-	31	6222	c.5750G>A	c.(5749-5751)gGg>gAg	p.G1917E	MYO9A_ENST00000564571.1_Missense_Mutation_p.G1917E|MYO9A_ENST00000424560.1_Missense_Mutation_p.G1988E|MYO9A_ENST00000444904.1_Missense_Mutation_p.G1898E	NM_006901.3	NP_008832.2	B2RTY4	MYO9A_HUMAN	myosin IXA	1917	Tail.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|visual perception (GO:0007601)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|motor activity (GO:0003774)			NS(4)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(29)|lung(27)|ovary(1)|pancreas(1)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						TATGCTTTTCCCATCATCCAT	0.363																																																0			15											55.0	54.0	54.0					15																	72170562		2199	4297	6496	69957616	SO:0001583	missense	4649			AF117888	CCDS10239.1	15q22-q23	2011-09-27			ENSG00000066933	ENSG00000066933		"""Myosins / Myosin superfamily : Class IX"""	7608	protein-coding gene	gene with protein product		604875				10409426	Standard	NM_006901		Approved	FLJ11061, FLJ13244, MGC71859	uc002atl.5	B2RTY4	OTTHUMG00000133440	ENST00000356056.5:c.5750G>A	15.37:g.72170562C>T	ENSP00000348349:p.Gly1917Glu		69957616	B0I1T5|C9IYB3|C9JA86|Q14787|Q3YLD7|Q3YLD8|Q6P986|Q9H8T5|Q9NTG2|Q9NUY2|Q9UEP3|Q9UNJ2	Missense_Mutation	SNP	HMMPfam_RA,HMMSmart_SM00314,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00242,HMMPfam_Myosin_head,HMMSmart_SM00015,HMMPfam_IQ,superfamily_Cysteine-rich domain,HMMSmart_SM00109,PatternScan_ZF_DAG_PE_1,HMMPfam_C1_1,superfamily_GTPase activation domain GAP,HMMSmart_SM00324,HMMPfam_RhoGAP	p.G1917E	ENST00000356056.5	37	c.5750	CCDS10239.1	15	.	.	.	.	.	.	.	.	.	.	C	25.7	4.660337	0.88154	.	.	ENSG00000066933	ENST00000356056;ENST00000424560;ENST00000444904	T;T;T	0.13420	2.59;2.59;2.59	5.21	5.21	0.72293	.	.	.	.	.	T	0.34600	0.0903	M	0.64997	1.995	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	T	0.02950	-1.1090	9	0.16896	T	0.51	.	19.1165	0.93343	0.0:1.0:0.0:0.0	.	1988;1917	B2RTY4-4;B2RTY4	.;MYO9A_HUMAN	E	1917;1988;1898	ENSP00000348349:G1917E;ENSP00000399162:G1988E;ENSP00000398250:G1898E	ENSP00000348349:G1917E	G	-	2	0	MYO9A	69957616	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.419000	0.80179	2.567000	0.86603	0.591000	0.81541	GGG	-	NULL		0.363	MYO9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO9A	protein_coding	OTTHUMT00000257308.1	C	NM_006901		69957616	-1	no_errors	NM_006901	genbank	human	validated	54_36p	missense	SNP	1.000	T
Unknown	0	genome.wustl.edu	37	11	71962040	71962040	+	IGR	SNP	G	G	T			TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr11:71962040G>T								PHOX2A (5332 upstream) : CLPB (41428 downstream)																							CAGCCAGCAGGTGCTAGTGCT	0.612																																																0			11																																								71639688	SO:0001628	intergenic_variant	220077																															11.37:g.71962040G>T			71639688		RNA	SNP	-	NULL		37	NULL		11																																																																																			-	-	0	0.612					LOC220077			G			71639688	-1	no_errors	XR_017002	genbank	human	model	54_36p	rna	SNP	0.000	T
GOLGA6A	342096	genome.wustl.edu	37	15	74363968	74363968	+	Silent	SNP	C	C	T			TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr15:74363968C>T	ENST00000290438.3	-	15	1663	c.1623G>A	c.(1621-1623)aaG>aaA	p.K541K	RN7SL429P_ENST00000479090.2_RNA	NM_001038640.2	NP_001033729.2	Q9NYA3	GOG6A_HUMAN	golgin A6 family, member A	541						Golgi apparatus (GO:0005794)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|liver(1)|lung(6)|prostate(1)|urinary_tract(1)	16						TCCCGTCCGCCTTCTCCTTCG	0.612																																																0			15											1.0	1.0	1.0					15																	74363968		244	907	1151	72151021	SO:0001819	synonymous_variant	342096			AF263742	CCDS32290.1	15q24.1	2013-05-10	2010-02-12	2009-09-28	ENSG00000159289	ENSG00000159289			13567	protein-coding gene	gene with protein product		610288	"""golgi autoantigen, golgin subfamily a, member 6"", ""golgi autoantigen, golgin subfamily a, 6"", ""golgi autoantigen, golgin subfamily a, 6A"""	GOLGA6		11161787	Standard	NM_001038640		Approved	GLP	uc002axa.1	Q9NYA3	OTTHUMG00000173035	ENST00000290438.3:c.1623G>A	15.37:g.74363968C>T			72151021	A8K959|Q9NYA7	Silent	SNP	NULL	p.K541	ENST00000290438.3	37	c.1623	CCDS32290.1	15																																																																																			-	NULL		0.612	GOLGA6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GOLGA6	protein_coding	OTTHUMT00000421835.1	C	XM_292357		72151021	-1	no_errors	NM_001038640	genbank	human	validated	54_36p	silent	SNP	0.994	T
COMMD4	54939	genome.wustl.edu	37	15	75631422	75631422	+	Missense_Mutation	SNP	T	T	A			TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr15:75631422T>A	ENST00000267935.8	+	5	477	c.278T>A	c.(277-279)cTg>cAg	p.L93Q	COMMD4_ENST00000338995.6_Missense_Mutation_p.L93Q|COMMD4_ENST00000564815.1_Missense_Mutation_p.L71Q|COMMD4_ENST00000562789.1_Missense_Mutation_p.L99Q|COMMD4_ENST00000567195.1_Missense_Mutation_p.L93Q	NM_017828.3	NP_060298.2	Q9H0A8	COMD4_HUMAN	COMM domain containing 4	93						cytoplasm (GO:0005737)				breast(3)|endometrium(2)|kidney(2)|large_intestine(1)|lung(1)|prostate(1)	10						TCCAGTGAACTGCAGCAGCTG	0.617																																																0			15											82.0	77.0	79.0					15																	75631422		2197	4294	6491	73418475	SO:0001583	missense	54939			AY542160	CCDS10277.1, CCDS66834.1, CCDS66835.1, CCDS73764.1	15q24.2	2012-09-20			ENSG00000140365	ENSG00000140365			26027	protein-coding gene	gene with protein product						15799966	Standard	XM_005254511		Approved	FLJ20452	uc002azy.3	Q9H0A8	OTTHUMG00000142823	ENST00000267935.8:c.278T>A	15.37:g.75631422T>A	ENSP00000267935:p.Leu93Gln		73418475	B2RBN4|H3BUL2|Q7L637|Q9NX43	Missense_Mutation	SNP	HMMPfam_HCaRG	p.L93Q	ENST00000267935.8	37	c.278	CCDS10277.1	15	.	.	.	.	.	.	.	.	.	.	T	23.3	4.401561	0.83120	.	.	ENSG00000140365	ENST00000267935;ENST00000338995	T;T	0.34472	1.36;1.36	5.03	5.03	0.67393	.	0.000000	0.64402	D	0.000001	T	0.66470	0.2792	M	0.90650	3.135	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.74771	-0.3552	10	0.87932	D	0	.	13.9761	0.64275	0.0:0.0:0.0:1.0	.	93;93	Q9H0A8-2;Q9H0A8	.;COMD4_HUMAN	Q	93	ENSP00000267935:L93Q;ENSP00000340867:L93Q	ENSP00000267935:L93Q	L	+	2	0	COMMD4	73418475	1.000000	0.71417	1.000000	0.80357	0.724000	0.41520	7.544000	0.82117	1.908000	0.55244	0.487000	0.48397	CTG	-	HMMPfam_HCaRG		0.617	COMMD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COMMD4	protein_coding	OTTHUMT00000286414.1	T	NM_017828		73418475	+1	no_errors	NM_017828	genbank	human	validated	54_36p	missense	SNP	1.000	A
DCTN1	1639	genome.wustl.edu	37	2	74590286	74590286	+	Missense_Mutation	SNP	A	A	T			TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr2:74590286A>T	ENST00000361874.3	-	29	3681	c.3364T>A	c.(3364-3366)Tcc>Acc	p.S1122T	DCTN1_ENST00000409567.3_Missense_Mutation_p.S1097T|DCTN1_ENST00000394003.3_Missense_Mutation_p.S1115T|DCTN1_ENST00000409868.1_Missense_Mutation_p.S1100T|DCTN1_ENST00000495643.1_5'Flank|DCTN1_ENST00000409240.1_Missense_Mutation_p.S1080T|DCTN1_ENST00000407639.2_Missense_Mutation_p.S988T|RP11-287D1.3_ENST00000451608.2_Missense_Mutation_p.S35T|DCTN1_ENST00000409438.1_Missense_Mutation_p.S983T	NM_004082.4	NP_004073.2	Q14203	DCTN1_HUMAN	dynactin 1	1122					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|G2/M transition of mitotic cell cycle (GO:0000086)|melanosome transport (GO:0032402)|microtubule-based transport (GO:0010970)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|nervous system development (GO:0007399)	cell leading edge (GO:0031252)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dynactin complex (GO:0005869)|dynein complex (GO:0030286)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|spindle pole (GO:0000922)	motor activity (GO:0003774)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(20)|ovary(4)|prostate(1)|skin(3)	45						GATGCCAAGGATGCCTTCATC	0.537																																																0			2											67.0	63.0	64.0					2																	74590286		2203	4300	6503	74443794	SO:0001583	missense	1639				CCDS1939.1, CCDS46341.1, CCDS46342.1, CCDS54368.1, CCDS54369.1	2p13	2014-09-17	2010-06-24		ENSG00000204843	ENSG00000204843			2711	protein-coding gene	gene with protein product	"""p150 glued homolog (Drosophila)"""	601143	"""dynactin 1 (p150, Glued (Drosophila) homolog)"""			1828535	Standard	NM_001190836		Approved		uc002skx.3	Q14203	OTTHUMG00000129963	ENST00000361874.3:c.3364T>A	2.37:g.74590286A>T	ENSP00000354791:p.Ser1122Thr		74443794	A8MY36|B4DM45|E9PFS5|E9PGE1|G5E9H4|O95296|Q6IQ37|Q9BRM9|Q9UIU1|Q9UIU2	Missense_Mutation	SNP	superfamily_Cap-Gly domain,HMMPfam_CAP_GLY,PatternScan_CAP_GLY_1,superfamily_Spectrin repeat	p.S1122T	ENST00000361874.3	37	c.3364	CCDS1939.1	2	.	.	.	.	.	.	.	.	.	.	A	12.95	2.092884	0.36952	.	.	ENSG00000204843	ENST00000361874;ENST00000394003;ENST00000393999;ENST00000407639;ENST00000409438;ENST00000409240;ENST00000409868;ENST00000409567	T;T;T;T;T;T;T	0.77229	-0.68;-0.87;-0.68;-0.67;-1.08;-0.86;-0.86	4.96	2.47	0.30058	.	0.175329	0.27673	N	0.018327	T	0.59742	0.2216	N	0.19112	0.55	0.28004	N	0.935186	B;B;B;B;B;B;B	0.21381	0.001;0.001;0.002;0.0;0.055;0.003;0.014	B;B;B;B;B;B;B	0.17722	0.0;0.001;0.003;0.001;0.019;0.006;0.013	T	0.43893	-0.9363	10	0.14656	T	0.56	-1.3303	11.3475	0.49569	0.4495:0.5505:0.0:0.0	.	1097;1080;1122;1115;988;983;1105	E9PGE1;E9PFS5;Q14203;A8MY36;Q14203-2;G5E9H4;A8MWX9	.;.;DCTN1_HUMAN;.;.;.;.	T	1122;1115;1105;988;983;1080;1100;1097	ENSP00000354791:S1122T;ENSP00000377571:S1115T;ENSP00000384844:S988T;ENSP00000387270:S983T;ENSP00000386406:S1080T;ENSP00000387327:S1100T;ENSP00000386843:S1097T	ENSP00000354791:S1122T	S	-	1	0	DCTN1	74443794	0.997000	0.39634	0.998000	0.56505	0.996000	0.88848	3.217000	0.51184	0.864000	0.35578	0.460000	0.39030	TCC	-	NULL		0.537	DCTN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DCTN1	protein_coding	OTTHUMT00000252227.3	A	NM_004082		74443794	-1	no_errors	NM_004082	genbank	human	reviewed	54_36p	missense	SNP	0.995	T
AK5	26289	genome.wustl.edu	37	1	77763529	77763529	+	Missense_Mutation	SNP	T	T	C			TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr1:77763529T>C	ENST00000354567.2	+	5	859	c.596T>C	c.(595-597)aTt>aCt	p.I199T	AK5_ENST00000344720.5_Missense_Mutation_p.I173T|AK5_ENST00000317704.4_3'UTR	NM_174858.2	NP_777283.1	Q9Y6K8	KAD5_HUMAN	adenylate kinase 5	199	Adenylate kinase 1.				ADP biosynthetic process (GO:0006172)|ATP metabolic process (GO:0046034)|dADP biosynthetic process (GO:0006173)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleoside diphosphate phosphorylation (GO:0006165)|nucleoside triphosphate biosynthetic process (GO:0009142)|pyrimidine ribonucleotide biosynthetic process (GO:0009220)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule organizing center (GO:0005815)	adenylate kinase activity (GO:0004017)|ATP binding (GO:0005524)|nucleoside diphosphate kinase activity (GO:0004550)|nucleoside kinase activity (GO:0019206)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(27)|prostate(1)|skin(2)|stomach(1)	40						GAAACAACAATTACAGAGATA	0.338																																																0			1											81.0	82.0	82.0					1																	77763529		2203	4300	6503	77536117	SO:0001583	missense	26289			AF062595	CCDS675.1, CCDS676.1	1p31	2008-02-05			ENSG00000154027	ENSG00000154027		"""Adenylate kinases"""	365	protein-coding gene	gene with protein product		608009				10215863	Standard	NM_012093		Approved		uc001dhn.3	Q9Y6K8	OTTHUMG00000009796	ENST00000354567.2:c.596T>C	1.37:g.77763529T>C	ENSP00000346577:p.Ile199Thr		77536117	Q5U622|Q6FH66|Q7Z4T5|Q86YS0|Q8N464|Q96EC9	Missense_Mutation	SNP	HMMPfam_Dpy-30,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMPfam_ADK,PatternScan_ADENYLATE_KINASE	p.I199T	ENST00000354567.2	37	c.596	CCDS675.1	1	.	.	.	.	.	.	.	.	.	.	T	23.4	4.412294	0.83340	.	.	ENSG00000154027	ENST00000354567;ENST00000344720;ENST00000478407	T;T;T	0.77358	-1.09;-1.09;-1.09	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	D	0.82893	0.5136	L	0.60455	1.87	0.80722	D	1	D;D	0.71674	0.998;0.98	D;P	0.70016	0.967;0.721	D	0.85349	0.1100	10	0.87932	D	0	-0.0276	15.9245	0.79606	0.0:0.0:0.0:1.0	.	199;175	Q9Y6K8;Q8N291	KAD5_HUMAN;.	T	199;173;173	ENSP00000346577:I199T;ENSP00000341430:I173T;ENSP00000434409:I173T	ENSP00000341430:I173T	I	+	2	0	AK5	77536117	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.445000	0.80570	2.236000	0.73375	0.528000	0.53228	ATT	-	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMPfam_ADK		0.338	AK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AK5	protein_coding	OTTHUMT00000026993.4	T	NM_174858		77536117	+1	no_errors	NM_174858	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
ALPK3	57538	genome.wustl.edu	37	15	85384029	85384029	+	Missense_Mutation	SNP	G	G	A	rs180863308		TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr15:85384029G>A	ENST00000258888.5	+	5	2292	c.2125G>A	c.(2125-2127)Gaa>Aaa	p.E709K		NM_020778.4	NP_065829.3	Q96L96	ALPK3_HUMAN	alpha-kinase 3	709					heart development (GO:0007507)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(3)|breast(2)|central_nervous_system(2)|endometrium(12)|kidney(4)|large_intestine(9)|lung(27)|ovary(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	81			BRCA - Breast invasive adenocarcinoma(143;0.0587)			TCAAGCTCCAGAATGCGGGGC	0.612																																																0			15											42.0	43.0	43.0					15																	85384029		2203	4299	6502	83185033	SO:0001583	missense	57538			AY044449	CCDS10333.1	15q25.2	2013-01-29			ENSG00000136383	ENSG00000136383		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17574	protein-coding gene	gene with protein product	"""myocyte induction differentiation originator"", ""muscle alpha-kinase"""					10021370	Standard	NM_020778		Approved	MAK, KIAA1330, Midori	uc002ble.3	Q96L96	OTTHUMG00000148667	ENST00000258888.5:c.2125G>A	15.37:g.85384029G>A	ENSP00000258888:p.Glu709Lys		83185033	Q9P2L6	Missense_Mutation	SNP	superfamily_Immunoglobulin,HMMPfam_I-set,HMMSmart_SM00409,HMMSmart_SM00408,superfamily_Protein kinase-like (PK-like),HMMPfam_Alpha_kinase,HMMSmart_SM00811	p.E709K	ENST00000258888.5	37	c.2125	CCDS10333.1	15	.	.	.	.	.	.	.	.	.	.	G	16.17	3.046135	0.55110	.	.	ENSG00000136383	ENST00000258888	T	0.60672	0.17	5.23	4.26	0.50523	.	3.063420	0.00508	N	0.000168	T	0.52419	0.1733	L	0.32530	0.975	0.09310	N	1	B	0.34103	0.437	B	0.30401	0.115	T	0.50783	-0.8787	10	0.62326	D	0.03	-6.7721	12.6307	0.56655	0.0:0.182:0.818:0.0	.	709	Q96L96	ALPK3_HUMAN	K	709	ENSP00000258888:E709K	ENSP00000258888:E709K	E	+	1	0	ALPK3	83185033	0.196000	0.23350	0.042000	0.18584	0.136000	0.21042	2.421000	0.44688	2.444000	0.82710	0.557000	0.71058	GAA	-	NULL		0.612	ALPK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALPK3	protein_coding	OTTHUMT00000308997.1	G	NM_020778		83185033	+1	no_errors	NM_020778	genbank	human	validated	54_36p	missense	SNP	0.003	A
TCF7L1	83439	genome.wustl.edu	37	2	85360992	85360992	+	Missense_Mutation	SNP	T	T	A			TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr2:85360992T>A	ENST00000282111.3	+	1	460	c.185T>A	c.(184-186)cTa>cAa	p.L62Q		NM_031283.2	NP_112573.1	Q9HCS4	TF7L1_HUMAN	transcription factor 7-like 1 (T-cell specific, HMG-box)	62	CTNNB1-binding. {ECO:0000250}.				anterior/posterior axis specification, embryo (GO:0008595)|axial mesoderm morphogenesis (GO:0048319)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|chromatin organization (GO:0006325)|generation of neurons (GO:0048699)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter during mitosis (GO:0046022)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|skin development (GO:0043588)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|skin(4)|upper_aerodigestive_tract(1)	18						CAGCGGGACCTAGACGAGGTC	0.692																																																0			2											20.0	19.0	19.0					2																	85360992		2173	4248	6421	85214503	SO:0001583	missense	83439			X62870	CCDS1971.1	2p11.2	2008-02-05			ENSG00000152284	ENSG00000152284			11640	protein-coding gene	gene with protein product		604652		TCF3		1741298, 11085512	Standard	NM_031283		Approved		uc002soy.3	Q9HCS4	OTTHUMG00000130026	ENST00000282111.3:c.185T>A	2.37:g.85360992T>A	ENSP00000282111:p.Leu62Gln		85214503	Q53R97|Q6PD70|Q9NP00	Missense_Mutation	SNP	HMMPfam_CTNNB1_binding,superfamily_HMG-box,HMMSmart_HMG,HMMPfam_HMG_box	p.L62Q	ENST00000282111.3	37	c.185	CCDS1971.1	2	.	.	.	.	.	.	.	.	.	.	T	23.1	4.372799	0.82573	.	.	ENSG00000152284	ENST00000282111	D	0.99769	-6.7	3.92	3.92	0.45320	CTNNB1 binding, N-teminal (1);	0.113912	0.37669	N	0.001994	D	0.99718	0.9891	M	0.86864	2.845	0.44652	D	0.997634	D	0.89917	1.0	D	0.91635	0.999	D	0.97603	1.0124	10	0.87932	D	0	.	10.9891	0.47539	0.0:0.0:0.0:1.0	.	62	Q9HCS4	TF7L1_HUMAN	Q	62	ENSP00000282111:L62Q	ENSP00000282111:L62Q	L	+	2	0	TCF7L1	85214503	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	6.888000	0.75622	1.532000	0.49169	0.460000	0.39030	CTA	-	HMMPfam_CTNNB1_binding		0.692	TCF7L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCF7L1	protein_coding	OTTHUMT00000252301.2	T	NM_031283		85214503	+1	no_errors	NM_031283	genbank	human	provisional	54_36p	missense	SNP	1.000	A
PRDM7	11105	genome.wustl.edu	37	16	90127875	90127875	+	Missense_Mutation	SNP	G	G	A			TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr16:90127875G>A	ENST00000449207.2	-	8	954	c.935C>T	c.(934-936)tCg>tTg	p.S312L	PRDM7_ENST00000407825.1_Missense_Mutation_p.S106L|PRDM7_ENST00000325921.6_Missense_Mutation_p.S106L	NM_001098173.1	NP_001091643.1	Q9NQW5	PRDM7_HUMAN	PR domain containing 7	312	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				regulation of transcription, DNA-templated (GO:0006355)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)|nucleic acid binding (GO:0003676)			lung(2)|ovary(2)|stomach(1)	5		all_cancers(9;4.44e-13)|Lung NSC(15;1.56e-06)|all_lung(18;2.18e-06)|all_neural(9;0.00118)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0278)		CCAGTTGGCCGAGGATTTATC	0.438																																																0			16											143.0	127.0	132.0					16																	90127875		2198	4300	6498	88655376	SO:0001583	missense	11105			AF274347	CCDS45557.1	16q24.3	2013-01-09			ENSG00000126856	ENSG00000126856		"""Zinc fingers, C2H2-type"", ""-"""	9351	protein-coding gene	gene with protein product		609759				17916234	Standard	NM_001098173		Approved	ZNF910	uc010cje.3	Q9NQW5	OTTHUMG00000138990	ENST00000449207.2:c.935C>T	16.37:g.90127875G>A	ENSP00000396732:p.Ser312Leu		88655376	A4Q9G8|Q08EM4|Q9NQW4	Missense_Mutation	SNP	superfamily_KRAB domain (Kruppel-associated box Pfam 01352),HMMSmart_SM00349,HMMPfam_KRAB,HMMPfam_SSXRD	p.S312L	ENST00000449207.2	37	c.935	CCDS45557.1	16	.	.	.	.	.	.	.	.	.	.	.	2.809	-0.247356	0.05867	.	.	ENSG00000126856	ENST00000325921;ENST00000449207;ENST00000407825	T;T;T	0.64260	1.08;-0.09;1.08	2.45	-2.98	0.05513	SET domain (2);	.	.	.	.	T	0.25382	0.0617	N	0.02539	-0.55	0.09310	N	1	B;B;B	0.16802	0.019;0.0;0.0	B;B;B	0.12156	0.007;0.0;0.001	T	0.13845	-1.0494	8	.	.	.	0.443	0.5691	0.00692	0.1791:0.2517:0.1776:0.3917	.	106;312;106	Q9NQW5-1;Q9NQW5;Q9NQW5-2	.;PRDM7_HUMAN;.	L	106;312;106	ENSP00000315512:S106L;ENSP00000396732:S312L;ENSP00000385121:S106L	.	S	-	2	0	PRDM7	88655376	0.006000	0.16342	0.017000	0.16124	0.111000	0.19643	-0.245000	0.08890	-0.829000	0.04268	-1.145000	0.01858	TCG	-	NULL		0.438	PRDM7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PRDM7	protein_coding	OTTHUMT00000420560.1	G			88655376	-1	no_errors	NM_001098173	genbank	human	reviewed	54_36p	missense	SNP	0.060	A
MDN1	23195	genome.wustl.edu	37	6	90383967	90383967	+	Missense_Mutation	SNP	G	G	C			TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr6:90383967G>C	ENST00000369393.3	-	79	13218	c.13103C>G	c.(13102-13104)cCc>cGc	p.P4368R	MDN1_ENST00000468568.1_5'Flank|MDN1_ENST00000428876.1_Missense_Mutation_p.P4368R|RP1-122O8.7_ENST00000438877.1_RNA			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	4368					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)			NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		GCAACCAGAGGGCAGCTGACT	0.473																																																0			6											112.0	100.0	104.0					6																	90383967		2203	4300	6503	90440688	SO:0001583	missense	23195			AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.13103C>G	6.37:g.90383967G>C	ENSP00000358400:p.Pro4368Arg		90440688	O15019|Q5T794	Missense_Mutation	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00382,HMMPfam_AAA_5,superfamily_vWA-like,HMMSmart_SM00327	p.P4368R	ENST00000369393.3	37	c.13103	CCDS5024.1	6	.	.	.	.	.	.	.	.	.	.	G	17.38	3.375382	0.61735	.	.	ENSG00000112159	ENST00000369393;ENST00000428876	T;T	0.03745	3.82;3.82	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	T	0.14570	0.0352	M	0.75447	2.3	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.00388	-1.1771	10	0.72032	D	0.01	.	20.422	0.99049	0.0:0.0:1.0:0.0	.	4368	Q9NU22	MDN1_HUMAN	R	4368	ENSP00000358400:P4368R;ENSP00000413970:P4368R	ENSP00000358400:P4368R	P	-	2	0	MDN1	90440688	1.000000	0.71417	0.990000	0.47175	0.760000	0.43138	8.270000	0.89880	2.832000	0.97577	0.655000	0.94253	CCC	-	NULL		0.473	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	MDN1	protein_coding	OTTHUMT00000041514.2	G			90440688	-1	no_errors	NM_014611	genbank	human	provisional	54_36p	missense	SNP	0.998	C
DECR1	1666	genome.wustl.edu	37	8	91013759	91013759	+	Silent	SNP	C	C	T			TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr8:91013759C>T	ENST00000220764.2	+	1	127	c.39C>T	c.(37-39)tcC>tcT	p.S13S	DECR1_ENST00000522161.1_5'UTR|DECR1_ENST00000519007.1_3'UTR	NM_001359.1	NP_001350.1	Q16698	DECR_HUMAN	2,4-dienoyl CoA reductase 1, mitochondrial	13					cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|protein homotetramerization (GO:0051289)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	2,4-dienoyl-CoA reductase (NADPH) activity (GO:0008670)|NADPH binding (GO:0070402)|oxidoreductase activity, acting on NAD(P)H (GO:0016651)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	15			BRCA - Breast invasive adenocarcinoma(11;0.00953)			CTCTGGGGTCCCGGCTGCCCT	0.697											OREG0018857	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				0			8											23.0	25.0	24.0					8																	91013759		2203	4300	6503	91082935	SO:0001819	synonymous_variant	1666			L26050	CCDS6250.1	8q21.3	2011-09-14			ENSG00000104325	ENSG00000104325		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	2753	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 18C, member 1"""	222745		DECR		7818482, 19027726	Standard	NM_001359		Approved	SDR18C1	uc003yek.1	Q16698	OTTHUMG00000163829	ENST00000220764.2:c.39C>T	8.37:g.91013759C>T		1279	91082935	B7Z6B8|Q2M304|Q93085	Silent	SNP	PatternScan_ADH_SHORT,superfamily_NAD(P)-bd,HMMPfam_adh_short	p.S13	ENST00000220764.2	37	c.39	CCDS6250.1	8																																																																																			-	NULL		0.697	DECR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DECR1	protein_coding	OTTHUMT00000375822.1	C			91082935	+1	no_errors	NM_001359	genbank	human	reviewed	54_36p	silent	SNP	0.010	T
SLIT1	6585	genome.wustl.edu	37	10	98823972	98823972	+	Silent	SNP	G	G	A			TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr10:98823972G>A	ENST00000266058.4	-	7	827	c.582C>T	c.(580-582)acC>acT	p.T194T	SLIT1_ENST00000371041.3_Silent_p.T194T|SLIT1_ENST00000371070.4_Silent_p.T194T|ARHGAP19-SLIT1_ENST00000453547.2_3'UTR	NM_003061.2	NP_003052.2	O75093	SLIT1_HUMAN	slit homolog 1 (Drosophila)	194					axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|dorsal/ventral axon guidance (GO:0033563)|establishment of nucleus localization (GO:0040023)|forebrain morphogenesis (GO:0048853)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of synapse assembly (GO:0051964)|retinal ganglion cell axon guidance (GO:0031290)|spinal cord development (GO:0021510)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	extracellular space (GO:0005615)	calcium ion binding (GO:0005509)|Roundabout binding (GO:0048495)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(37)|ovary(5)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	78		Colorectal(252;0.162)		Epithelial(162;2.02e-08)|all cancers(201;1.5e-06)		CGGGGATGGTGGTGATATTGT	0.577																																																0			10											197.0	148.0	165.0					10																	98823972		2203	4300	6503	98813962	SO:0001819	synonymous_variant	6585			AB011537	CCDS7453.1	10q23.3-q24	2008-08-01	2001-11-28		ENSG00000187122	ENSG00000187122			11085	protein-coding gene	gene with protein product		603742	"""slit (Drosophila) homolog 1"""	SLIL1		9693030, 9813312	Standard	NM_003061		Approved	slit1, MEGF4, Slit-1, SLIT3	uc001kmw.2	O75093	OTTHUMG00000018843	ENST00000266058.4:c.582C>T	10.37:g.98823972G>A			98813962	Q5T0V1|Q8WWZ2|Q9UIL7	Silent	SNP	HMMPfam_LRRNT,HMMSmart_SM00013,superfamily_L domain-like,HMMSmart_SM00369,HMMPfam_LRR_1,HMMSmart_SM00365,HMMSmart_SM00082,HMMPfam_LRRCT,superfamily_EGF/Laminin,HMMSmart_SM00179,HMMSmart_SM00181,HMMPfam_EGF,PatternScan_EGF_1,PatternScan_EGF_2,PatternScan_EGF_CA,HMMSmart_SM00274,PatternScan_ASX_HYDROXYL,superfamily_Concanavalin A-like lectins/glucanases,HMMSmart_SM00282,HMMPfam_Laminin_G_2,HMMSmart_SM00041,PatternScan_CTCK_1	p.T194	ENST00000266058.4	37	c.582	CCDS7453.1	10																																																																																			-	superfamily_L domain-like,HMMSmart_SM00369,HMMPfam_LRR_1		0.577	SLIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLIT1	protein_coding	OTTHUMT00000049636.1	G	NM_003061		98813962	-1	no_errors	NM_003061	genbank	human	validated	54_36p	silent	SNP	1.000	A
RP11-66B24.5	0	genome.wustl.edu	37	15	101324510	101324510	+	lincRNA	SNP	C	C	T	rs76654135	byFrequency	TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr15:101324510C>T	ENST00000559755.1	+	0	123																											AGAAAGCCTGCGCCCTGGAGA	0.662													T|||	44	0.00878594	0.0	0.0144	5008	,	,		17870	0.0		0.0328	False		,,,				2504	0.001															0			15																																								99142033			440313																															15.37:g.101324510C>T			99142033		RNA	SNP	-	NULL	ENST00000559755.1	37	NULL		15																																																																																			-	-		0.662	RP11-66B24.5-001	KNOWN	basic	lincRNA	LOC440313	lincRNA	OTTHUMT00000418215.1	C			99142033	-1	no_errors	XR_041905	genbank	human	model	54_36p	rna	SNP	0.000	T
POU3F2	5454	genome.wustl.edu	37	6	99283537	99283537	+	Missense_Mutation	SNP	A	A	G			TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr6:99283537A>G	ENST00000328345.5	+	1	958	c.788A>G	c.(787-789)gAc>gGc	p.D263G		NM_005604.3	NP_005595.2	P20265	PO3F2_HUMAN	POU class 3 homeobox 2	263	POU-specific. {ECO:0000255|PROSITE- ProRule:PRU00530}.				astrocyte development (GO:0014002)|cellular response to organic substance (GO:0071310)|cerebral cortex radially oriented cell migration (GO:0021799)|epidermis development (GO:0008544)|forebrain ventricular zone progenitor cell division (GO:0021869)|hypothalamus cell differentiation (GO:0021979)|myelination in peripheral nervous system (GO:0022011)|neurohypophysis development (GO:0021985)|neuron differentiation (GO:0030182)|positive regulation of cell proliferation (GO:0008284)|positive regulation of multicellular organism growth (GO:0040018)|regulation of axonogenesis (GO:0050770)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	identical protein binding (GO:0042802)|RNA polymerase II transcription coactivator activity (GO:0001105)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|large_intestine(3)|lung(5)	10		all_cancers(76;1.56e-06)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00893)|Colorectal(196;0.069)|Lung NSC(302;0.197)		BRCA - Breast invasive adenocarcinoma(108;0.0355)		TCGGACGAGGACACGCCGACC	0.716																																																0			6											68.0	73.0	71.0					6																	99283537		2203	4300	6503	99390258	SO:0001583	missense	5454			Z11933	CCDS5040.1	6q16.2	2011-06-20	2007-07-13		ENSG00000184486	ENSG00000184486		"""Homeoboxes / POU class"""	9215	protein-coding gene	gene with protein product		600494	"""POU domain class 3, transcription factor 2"""	OTF7		8441633	Standard	NM_005604		Approved	POUF3, BRN2, OCT7	uc003ppe.3	P20265	OTTHUMG00000015258	ENST00000328345.5:c.788A>G	6.37:g.99283537A>G	ENSP00000329170:p.Asp263Gly		99390258	Q14960|Q86V54|Q9UJL0	Missense_Mutation	SNP	HMMPfam_Pou,HMMSmart_SM00352,superfamily_lambda repressor-like DNA-binding domains,PatternScan_POU_1,PatternScan_POU_2,superfamily_Homeodomain-like,HMMSmart_SM00389,HMMPfam_Homeobox,PatternScan_HOMEOBOX_1	p.D263G	ENST00000328345.5	37	c.788	CCDS5040.1	6	.	.	.	.	.	.	.	.	.	.	A	19.47	3.833160	0.71258	.	.	ENSG00000184486	ENST00000328345;ENST00000425116	D	0.84070	-1.8	3.82	3.82	0.43975	POU-specific (3);	0.000000	0.64402	U	0.000002	D	0.85548	0.5722	L	0.58810	1.83	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	D	0.87366	0.2347	10	0.87932	D	0	.	11.7175	0.51661	1.0:0.0:0.0:0.0	.	263	P20265	PO3F2_HUMAN	G	263;196	ENSP00000329170:D263G	ENSP00000329170:D263G	D	+	2	0	POU3F2	99390258	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	8.948000	0.93006	1.594000	0.50039	0.254000	0.18369	GAC	-	HMMPfam_Pou,HMMSmart_SM00352		0.716	POU3F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POU3F2	protein_coding	OTTHUMT00000041586.2	A			99390258	+1	no_errors	NM_005604	genbank	human	validated	54_36p	missense	SNP	1.000	G
PVRIG	79037	genome.wustl.edu	37	7	99817608	99817608	+	Silent	SNP	C	C	A			TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr7:99817608C>A	ENST00000317271.2	+	2	438	c.75C>A	c.(73-75)acC>acA	p.T25T	GATS_ENST00000436886.2_Intron|GATS_ENST00000543273.1_RNA|AC005071.1_ENST00000410550.1_RNA	NM_024070.3	NP_076975.2	Q6DKI7	PVRIG_HUMAN	poliovirus receptor related immunoglobulin domain containing	25						integral component of membrane (GO:0016021)				breast(1)|endometrium(3)|kidney(1)|lung(3)|prostate(1)|skin(2)	11	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GGCACCGGACCCTGGTCCTGC	0.647																																																0			7											26.0	25.0	25.0					7																	99817608		2201	4298	6499	99655544	SO:0001819	synonymous_variant	79037			BC001129	CCDS5690.1	7q22.1	2013-06-26			ENSG00000213413	ENSG00000213413			32190	protein-coding gene	gene with protein product						16926269	Standard	NM_024070		Approved	MGC2463, C7orf15	uc003uuf.1	Q6DKI7	OTTHUMG00000156798	ENST00000317271.2:c.75C>A	7.37:g.99817608C>A			99655544	D6W5U9|Q9BVK3	Silent	SNP	NULL	p.T25	ENST00000317271.2	37	c.75	CCDS5690.1	7																																																																																			-	NULL		0.647	PVRIG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PVRIG	protein_coding	OTTHUMT00000345870.2	C	NM_024070		99655544	+1	no_errors	NM_024070	genbank	human	validated	54_36p	silent	SNP	0.031	A
COL11A1	1301	genome.wustl.edu	37	1	103491156	103491156	+	Missense_Mutation	SNP	T	T	A			TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr1:103491156T>A	ENST00000370096.3	-	7	1223	c.911A>T	c.(910-912)gAt>gTt	p.D304V	COL11A1_ENST00000353414.4_Missense_Mutation_p.D265V|COL11A1_ENST00000512756.1_Intron|COL11A1_ENST00000358392.2_Missense_Mutation_p.D316V	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	304	Nonhelical region.				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		TTGAAAATCATCAACGATGTT	0.338																																																0			1											117.0	109.0	112.0					1																	103491156		2203	4299	6502	103263744	SO:0001583	missense	1301			J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.911A>T	1.37:g.103491156T>A	ENSP00000359114:p.Asp304Val		103263744	B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Missense_Mutation	SNP	HMMSmart_TSPN,superfamily_ConA_like_lec_gl,HMMSmart_LamG,HMMPfam_Laminin_G_2,HMMPfam_Collagen,HMMSmart_COLFI,HMMPfam_COLFI	p.D316V	ENST00000370096.3	37	c.947	CCDS778.1	1	.	.	.	.	.	.	.	.	.	.	T	12.59	1.985059	0.35036	.	.	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000427239	D;T;D;T	0.88431	-2.38;-0.56;-2.32;-0.53	5.39	5.39	0.77823	.	0.187380	0.47852	D	0.000211	D	0.87815	0.6272	M	0.73962	2.25	0.80722	D	1	P;P;P	0.44429	0.835;0.835;0.745	P;P;B	0.46850	0.529;0.529;0.329	D	0.87253	0.2274	10	0.33940	T	0.23	.	15.4008	0.74841	0.0:0.0:0.0:1.0	.	265;316;304	P12107-3;P12107-2;P12107	.;.;COBA1_HUMAN	V	304;316;265;316	ENSP00000359114:D304V;ENSP00000351163:D316V;ENSP00000302551:D265V;ENSP00000408640:D316V	ENSP00000302551:D265V	D	-	2	0	COL11A1	103263744	1.000000	0.71417	0.998000	0.56505	0.887000	0.51463	5.758000	0.68776	2.036000	0.60181	0.519000	0.50382	GAT	-	NULL		0.338	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	COL11A1	protein_coding	OTTHUMT00000029997.1	T	NM_080630		103263744	-1	no_errors	NM_080629	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
COL4A5	1287	genome.wustl.edu	37	X	107930859	107930859	+	Missense_Mutation	SNP	A	A	C			TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chrX:107930859A>C	ENST00000361603.2	+	47	4689	c.4445A>C	c.(4444-4446)cAg>cCg	p.Q1482P	COL4A5_ENST00000328300.6_Missense_Mutation_p.Q1488P	NM_000495.4	NP_000486.1	P29400	CO4A5_HUMAN	collagen, type IV, alpha 5	1482	Collagen IV NC1. {ECO:0000255|PROSITE- ProRule:PRU00736}.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|neuromuscular junction (GO:0031594)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(32)|ovary(4)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	99						GGAACACTTCAGGTCTATGAA	0.483									Alport syndrome with Diffuse Leiomyomatosis																																							0			X											128.0	120.0	123.0					X																	107930859		2203	4300	6503	107817515	SO:0001583	missense	1287	Familial Cancer Database		M90464	CCDS14543.1, CCDS35366.1	Xq22	2014-09-17	2008-07-28		ENSG00000188153	ENSG00000188153		"""Collagens"""	2207	protein-coding gene	gene with protein product		303630	"""Alport syndrome"""	ASLN, ATS			Standard	NM_000495		Approved		uc004enz.2	P29400	OTTHUMG00000022182	ENST00000361603.2:c.4445A>C	X.37:g.107930859A>C	ENSP00000354505:p.Gln1482Pro		107817515	Q16006|Q16126|Q6LD84|Q7Z700|Q9NUB7	Missense_Mutation	SNP	HMMPfam_Collagen,superfamily_C-type_lectin_fold,HMMPfam_C4,HMMSmart_C4	p.Q1488P	ENST00000361603.2	37	c.4463	CCDS14543.1	X	.	.	.	.	.	.	.	.	.	.	A	8.598	0.886269	0.17540	.	.	ENSG00000188153	ENST00000328300;ENST00000361603;ENST00000508186	D;D	0.94497	-3.44;-3.44	5.58	3.04	0.35103	C-type lectin fold (1);	0.588749	0.17479	N	0.172819	D	0.85234	0.5650	N	0.02403	-0.565	0.09310	N	1	B;B	0.15141	0.012;0.012	B;B	0.36464	0.225;0.225	T	0.75918	-0.3148	10	0.36615	T	0.2	.	4.2965	0.10904	0.574:0.1657:0.2603:0.0	.	1485;1482	E7EVY4;P29400	.;CO4A5_HUMAN	P	1488;1482;1488	ENSP00000331902:Q1488P;ENSP00000354505:Q1482P	ENSP00000331902:Q1488P	Q	+	2	0	COL4A5	107817515	0.191000	0.23288	0.230000	0.23976	0.704000	0.40688	1.304000	0.33482	0.754000	0.32968	0.486000	0.48141	CAG	-	superfamily_C-type_lectin_fold,HMMPfam_C4,HMMSmart_C4		0.483	COL4A5-001	KNOWN	basic|CCDS	protein_coding	COL4A5	protein_coding	OTTHUMT00000057880.2	A			107817515	+1	no_errors	NM_033380	genbank	human	reviewed	54_36p	missense	SNP	0.011	C
F7	2155	genome.wustl.edu	37	13	113770013	113770013	+	Missense_Mutation	SNP	G	G	T			TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr13:113770013G>T	ENST00000375581.3	+	6	505	c.470G>T	c.(469-471)gGc>gTc	p.G157V	F7_ENST00000346342.3_Missense_Mutation_p.G135V|F7_ENST00000541084.1_Missense_Mutation_p.G88V	NM_000131.4	NP_000122.1	P08709	FA7_HUMAN	coagulation factor VII (serum prothrombin conversion accelerator)	157	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.		G -> C (in FA7D).|G -> S (in FA7D). {ECO:0000269|PubMed:10862079, ECO:0000269|PubMed:18976247}.|G -> V (in FA7D). {ECO:0000269|PubMed:11129332}.		blood coagulation (GO:0007596)|blood coagulation, extrinsic pathway (GO:0007598)|cellular protein metabolic process (GO:0044267)|circadian rhythm (GO:0007623)|organ regeneration (GO:0031100)|peptidyl-glutamic acid carboxylation (GO:0017187)|positive regulation of blood coagulation (GO:0030194)|positive regulation of cell migration (GO:0030335)|positive regulation of leukocyte chemotaxis (GO:0002690)|positive regulation of platelet-derived growth factor receptor signaling pathway (GO:0010641)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of protein kinase B signaling (GO:0051897)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)|response to estrogen (GO:0043627)|response to growth hormone (GO:0060416)|response to vitamin K (GO:0032571)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|glycoprotein binding (GO:0001948)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			large_intestine(4)|lung(9)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	16	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_cancers(25;0.118)|all_lung(25;0.0364)|all_epithelial(44;0.0393)|Lung NSC(25;0.128)|Breast(118;0.188)	all cancers(43;0.0737)|Epithelial(84;0.213)|BRCA - Breast invasive adenocarcinoma(86;0.218)		Coagulation Factor IX(DB00100)|Coagulation factor VIIa(DB00036)|Menadione(DB00170)	GAGAACGGCGGCTGTGAGCAG	0.642																																																0			13	GRCh37	CM002763	F7	M							55.0	44.0	48.0					13																	113770013		2203	4300	6503	112818014	SO:0001583	missense	2155				CCDS9528.1, CCDS9529.1, CCDS73602.1	13q34	2014-02-03			ENSG00000057593	ENSG00000057593	3.4.21.21		3544	protein-coding gene	gene with protein product	"""eptacog alfa"", ""FVII coagulation protein"", ""factor VII"""	613878				3264725, 2511201	Standard	NM_000131		Approved		uc001vsv.4	P08709	OTTHUMG00000017373	ENST00000375581.3:c.470G>T	13.37:g.113770013G>T	ENSP00000364731:p.Gly157Val		112818014	B0YJC8|Q14339|Q5JVF1|Q5JVF2|Q9UD52|Q9UD53|Q9UD54	Missense_Mutation	SNP	HMMSmart_SM00069,superfamily_GLA-domain,HMMPfam_Gla,PatternScan_GLA_1,PatternScan_EGF_CA,HMMSmart_SM00179,HMMSmart_SM00181,HMMPfam_EGF,PatternScan_ASX_HYDROXYL,PatternScan_EGF_1,superfamily_EGF/Laminin,PatternScan_EGF_2,superfamily_Trypsin-like serine proteases,HMMSmart_SM00020,HMMPfam_Trypsin,PatternScan_TRYPSIN_HIS,PatternScan_TRYPSIN_SER	p.G157V	ENST00000375581.3	37	c.470	CCDS9528.1	13	.	.	.	.	.	.	.	.	.	.	G	13.50	2.254557	0.39896	.	.	ENSG00000057593	ENST00000346342;ENST00000541084;ENST00000375581	D;D;D	0.99766	-6.69;-2.81;-6.69	4.3	2.54	0.30619	Epidermal growth factor-like (1);	0.379201	0.26262	N	0.025394	D	0.99743	0.9898	M	0.94142	3.5	0.80722	D	1	D;D;D;D	0.69078	0.995;0.992;0.997;0.994	D;D;D;D	0.69479	0.964;0.941;0.959;0.911	D	0.98991	1.0808	10	0.87932	D	0	.	6.9395	0.24484	0.2933:0.0:0.7067:0.0	.	88;88;135;157	F5H8B0;B4DPM2;P08709-2;P08709	.;.;.;FA7_HUMAN	V	135;88;157	ENSP00000329546:G135V;ENSP00000442051:G88V;ENSP00000364731:G157V	ENSP00000329546:G135V	G	+	2	0	F7	112818014	1.000000	0.71417	0.934000	0.37439	0.208000	0.24298	2.668000	0.46816	0.431000	0.26258	0.563000	0.77884	GGC	-	superfamily_EGF/Laminin,HMMSmart_SM00181		0.642	F7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	F7	protein_coding	OTTHUMT00000045838.4	G	NM_000131		112818014	+1	no_errors	NM_000131	genbank	human	reviewed	54_36p	missense	SNP	0.994	T
GTPBP8	29083	genome.wustl.edu	37	3	112710060	112710060	+	Missense_Mutation	SNP	G	G	C	rs549530387		TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr3:112710060G>C	ENST00000383678.2	+	1	296	c.214G>C	c.(214-216)Gac>Cac	p.D72H	GTPBP8_ENST00000467752.1_5'Flank|GTPBP8_ENST00000383677.3_Missense_Mutation_p.D72H|RP11-484K9.4_ENST00000609673.1_RNA|GTPBP8_ENST00000473129.1_5'Flank	NM_014170.2	NP_054889.2	Q8N3Z3	GTPB8_HUMAN	GTP-binding protein 8 (putative)	72					barrier septum assembly (GO:0000917)	mitochondrion (GO:0005739)	GTP binding (GO:0005525)|metal ion binding (GO:0046872)			kidney(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	6						GCGTATCTTTGACCCAAGCCC	0.622																																																0			3											50.0	49.0	49.0					3																	112710060		2203	4300	6503	114192750	SO:0001583	missense	29083			BC037163	CCDS33820.1, CCDS33821.1	3q13.2	2008-02-05			ENSG00000163607	ENSG00000163607			25007	protein-coding gene	gene with protein product							Standard	NM_014170		Approved	HSPC135	uc003dzn.3	Q8N3Z3	OTTHUMG00000159268	ENST00000383678.2:c.214G>C	3.37:g.112710060G>C	ENSP00000373176:p.Asp72His		114192750	A6NE99|A6NN11|A8K0P6|Q5I0Y4	Missense_Mutation	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMPfam_MMR_HSR1	p.D72H	ENST00000383678.2	37	c.214	CCDS33820.1	3	.	.	.	.	.	.	.	.	.	.	G	11.97	1.798108	0.31777	.	.	ENSG00000163607	ENST00000383678;ENST00000383677;ENST00000305485	T;T	0.48836	0.88;0.8	5.65	1.89	0.25635	.	0.432637	0.28448	N	0.015302	T	0.30727	0.0774	L	0.29908	0.895	0.80722	D	1	B;B	0.06786	0.001;0.001	B;B	0.13407	0.009;0.002	T	0.05338	-1.0891	10	0.34782	T	0.22	-12.3601	6.3947	0.21605	0.2072:0.2473:0.5455:0.0	.	72;72	Q8N3Z3-2;Q8N3Z3	.;GTPB8_HUMAN	H	72	ENSP00000373176:D72H;ENSP00000373175:D72H	ENSP00000295864:D72H	D	+	1	0	GTPBP8	114192750	0.856000	0.29760	0.983000	0.44433	0.014000	0.08584	0.478000	0.22212	0.172000	0.19760	-0.137000	0.14449	GAC	-	NULL		0.622	GTPBP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTPBP8	protein_coding	OTTHUMT00000354260.2	G	NM_014170		114192750	+1	no_errors	NM_014170	genbank	human	validated	54_36p	missense	SNP	0.999	C
CD2	914	genome.wustl.edu	37	1	117297439	117297439	+	Missense_Mutation	SNP	C	C	A			TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr1:117297439C>A	ENST00000369478.3	+	2	356	c.248C>A	c.(247-249)aCa>aAa	p.T83K	CD2_ENST00000369477.1_Missense_Mutation_p.T83K	NM_001767.3	NP_001758.2	P06729	CD2_HUMAN	CD2 molecule	83	Ig-like V-type.				apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cell surface receptor signaling pathway (GO:0007166)|heterotypic cell-cell adhesion (GO:0034113)|leukocyte migration (GO:0050900)|membrane raft polarization (GO:0001766)|natural killer cell activation (GO:0030101)|positive regulation of interferon-gamma secretion (GO:1902715)|positive regulation of interleukin-8 secretion (GO:2000484)|positive regulation of myeloid dendritic cell activation (GO:0030887)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of T cell differentiation (GO:0045580)|single organismal cell-cell adhesion (GO:0016337)|T cell activation (GO:0042110)	anchored component of plasma membrane (GO:0046658)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|cytoplasmic side of plasma membrane (GO:0009898)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|receptor binding (GO:0005102)			NS(1)|breast(2)|large_intestine(3)|liver(1)|lung(8)|skin(2)|stomach(1)	18	Lung SC(450;0.225)	all_cancers(81;3.15e-06)|Acute lymphoblastic leukemia(138;1.7e-08)|all_epithelial(167;8.38e-07)|all_lung(203;3.37e-06)|Lung NSC(69;2.31e-05)		Epithelial(280;6.71e-26)|OV - Ovarian serous cystadenocarcinoma(397;4.74e-24)|all cancers(265;1.93e-22)|Lung(183;0.0543)|Kidney(133;0.0813)|Colorectal(144;0.174)|KIRC - Kidney renal clear cell carcinoma(1967;0.176)|LUSC - Lung squamous cell carcinoma(189;0.189)|BRCA - Breast invasive adenocarcinoma(282;0.201)	Alefacept(DB00092)	GAAAAAGATACATATAAGCTA	0.294																																					NSCLC(14;263 555 26380 43512 51332)											0			1											38.0	40.0	39.0					1																	117297439		2201	4295	6496	117098962	SO:0001583	missense	914			BC033583	CCDS889.1	1p13	2013-01-11	2006-03-28		ENSG00000116824	ENSG00000116824		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"""	1639	protein-coding gene	gene with protein product		186990	"""CD2 antigen (p50), sheep red blood cell receptor"""	SRBC		2437578	Standard	NM_001767		Approved		uc001egu.4	P06729	OTTHUMG00000022750	ENST00000369478.3:c.248C>A	1.37:g.117297439C>A	ENSP00000358490:p.Thr83Lys		117098962	Q96TE5	Missense_Mutation	SNP	HMMPfam_V-set,superfamily_Immunoglobulin,HMMPfam_C2-set	p.T83K	ENST00000369478.3	37	c.248	CCDS889.1	1	.	.	.	.	.	.	.	.	.	.	C	0.235	-1.018216	0.02078	.	.	ENSG00000116824	ENST00000369478;ENST00000369477	T;T	0.65178	-0.14;-0.14	4.27	-3.48	0.04739	Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	0.889113	0.09476	N	0.797051	T	0.15003	0.0362	N	0.16903	0.455	0.09310	N	1	B;B;B	0.24651	0.108;0.051;0.018	B;B;B	0.24974	0.057;0.042;0.021	T	0.29912	-0.9996	10	0.07030	T	0.85	0.0034	8.267	0.31819	0.5367:0.2173:0.2459:0.0	.	83;83;83	B4E0G3;B4DVN2;P06729	.;.;CD2_HUMAN	K	83	ENSP00000358490:T83K;ENSP00000358489:T83K	ENSP00000358489:T83K	T	+	2	0	CD2	117098962	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.857000	0.01660	-0.827000	0.04278	0.563000	0.77884	ACA	-	HMMPfam_V-set,superfamily_Immunoglobulin		0.294	CD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD2	protein_coding	OTTHUMT00000059039.2	C	NM_001767		117098962	+1	no_errors	NM_001767	genbank	human	validated	54_36p	missense	SNP	0.000	A
CD2	914	genome.wustl.edu	37	1	117311264	117311264	+	Missense_Mutation	SNP	G	G	C			TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr1:117311264G>C	ENST00000369478.3	+	5	1023	c.915G>C	c.(913-915)caG>caC	p.Q305H		NM_001767.3	NP_001758.2	P06729	CD2_HUMAN	CD2 molecule	305	Pro-rich.				apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cell surface receptor signaling pathway (GO:0007166)|heterotypic cell-cell adhesion (GO:0034113)|leukocyte migration (GO:0050900)|membrane raft polarization (GO:0001766)|natural killer cell activation (GO:0030101)|positive regulation of interferon-gamma secretion (GO:1902715)|positive regulation of interleukin-8 secretion (GO:2000484)|positive regulation of myeloid dendritic cell activation (GO:0030887)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of T cell differentiation (GO:0045580)|single organismal cell-cell adhesion (GO:0016337)|T cell activation (GO:0042110)	anchored component of plasma membrane (GO:0046658)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|cytoplasmic side of plasma membrane (GO:0009898)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|receptor binding (GO:0005102)			NS(1)|breast(2)|large_intestine(3)|liver(1)|lung(8)|skin(2)|stomach(1)	18	Lung SC(450;0.225)	all_cancers(81;3.15e-06)|Acute lymphoblastic leukemia(138;1.7e-08)|all_epithelial(167;8.38e-07)|all_lung(203;3.37e-06)|Lung NSC(69;2.31e-05)		Epithelial(280;6.71e-26)|OV - Ovarian serous cystadenocarcinoma(397;4.74e-24)|all cancers(265;1.93e-22)|Lung(183;0.0543)|Kidney(133;0.0813)|Colorectal(144;0.174)|KIRC - Kidney renal clear cell carcinoma(1967;0.176)|LUSC - Lung squamous cell carcinoma(189;0.189)|BRCA - Breast invasive adenocarcinoma(282;0.201)	Alefacept(DB00092)	ACCGTGTTCAGCACCAGCCTC	0.622																																					NSCLC(14;263 555 26380 43512 51332)											0			1											90.0	78.0	82.0					1																	117311264		2203	4300	6503	117112787	SO:0001583	missense	914			BC033583	CCDS889.1	1p13	2013-01-11	2006-03-28		ENSG00000116824	ENSG00000116824		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"""	1639	protein-coding gene	gene with protein product		186990	"""CD2 antigen (p50), sheep red blood cell receptor"""	SRBC		2437578	Standard	NM_001767		Approved		uc001egu.4	P06729	OTTHUMG00000022750	ENST00000369478.3:c.915G>C	1.37:g.117311264G>C	ENSP00000358490:p.Gln305His		117112787	Q96TE5	Missense_Mutation	SNP	HMMPfam_C2-set,HMMPfam_V-set,superfamily_Immunoglobulin	p.Q305H	ENST00000369478.3	37	c.915	CCDS889.1	1	.	.	.	.	.	.	.	.	.	.	G	14.89	2.670177	0.47677	.	.	ENSG00000116824	ENST00000369478	T	0.49139	0.79	5.25	3.36	0.38483	.	0.281535	0.29631	N	0.011618	T	0.46328	0.1387	M	0.64997	1.995	0.80722	D	1	D	0.89917	1.0	D	0.71184	0.972	T	0.43393	-0.9394	10	0.31617	T	0.26	-9.247	6.7794	0.23638	0.0887:0.0:0.7373:0.174	.	305	P06729	CD2_HUMAN	H	305	ENSP00000358490:Q305H	ENSP00000358490:Q305H	Q	+	3	2	CD2	117112787	1.000000	0.71417	0.929000	0.37066	0.373000	0.29922	1.281000	0.33214	0.887000	0.36136	0.655000	0.94253	CAG	-	NULL		0.622	CD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD2	protein_coding	OTTHUMT00000059039.2	G	NM_001767		117112787	+1	no_errors	NM_001767	genbank	human	validated	54_36p	missense	SNP	0.984	C
HPD	3242	genome.wustl.edu	37	12	122287595	122287595	+	Missense_Mutation	SNP	T	T	A			TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr12:122287595T>A	ENST00000289004.4	-	8	551	c.516A>T	c.(514-516)aaA>aaT	p.K172N	HPD_ENST00000543163.1_Missense_Mutation_p.K133N|HPD_ENST00000543869.2_5'UTR	NM_002150.2	NP_002141	P32754	HPPD_HUMAN	4-hydroxyphenylpyruvate dioxygenase	172					cellular nitrogen compound metabolic process (GO:0034641)|L-phenylalanine catabolic process (GO:0006559)|small molecule metabolic process (GO:0044281)|tyrosine catabolic process (GO:0006572)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	4-hydroxyphenylpyruvate dioxygenase activity (GO:0003868)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|kidney(1)|large_intestine(6)|lung(8)|urinary_tract(1)	18	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000105)|Epithelial(86;0.000352)|BRCA - Breast invasive adenocarcinoma(302;0.225)	Nitisinone(DB00348)	ACACTCACAGTTTAGGAAGTA	0.557																																																0			12											96.0	84.0	88.0					12																	122287595		2203	4300	6503	120771978	SO:0001583	missense	3242			BC014790	CCDS9224.1, CCDS53839.1	12q24.31	2013-09-19			ENSG00000158104	ENSG00000158104	1.13.11.27		5147	protein-coding gene	gene with protein product	"""glyoxalase domain containing 3"""	609695		PPD			Standard	NM_001171993		Approved	4-HPPD, 4HPPD, GLOD3	uc001ubj.3	P32754	OTTHUMG00000169081	ENST00000289004.4:c.516A>T	12.37:g.122287595T>A	ENSP00000289004:p.Lys172Asn		120771978	A8K461|B3KQ63|Q13234	Missense_Mutation	SNP	superfamily_Glyoxalase/Bleomycin resistance protein/Dihydroxybiphenyl dioxygenase,HMMPfam_Glyoxalase	p.K172N	ENST00000289004.4	37	c.516	CCDS9224.1	12	.	.	.	.	.	.	.	.	.	.	T	4.993	0.184376	0.09495	.	.	ENSG00000158104	ENST00000289004;ENST00000545969;ENST00000543163	T;T	0.62788	-0.0;-0.0	5.41	1.47	0.22746	.	0.045725	0.85682	D	0.000000	T	0.46210	0.1381	L	0.45228	1.405	0.58432	D	0.999996	B	0.02656	0.0	B	0.01281	0.0	T	0.19877	-1.0292	10	0.12766	T	0.61	-21.4775	8.083	0.30756	0.0:0.5953:0.0:0.4047	.	172	P32754	HPPD_HUMAN	N	172;169;133	ENSP00000289004:K172N;ENSP00000441677:K133N	ENSP00000289004:K172N	K	-	3	2	HPD	120771978	0.976000	0.34144	0.982000	0.44146	0.017000	0.09413	0.167000	0.16602	0.233000	0.21120	-0.912000	0.02778	AAA	-	superfamily_Glyoxalase/Bleomycin resistance protein/Dihydroxybiphenyl dioxygenase		0.557	HPD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HPD	protein_coding	OTTHUMT00000402184.1	T	NM_002150		120771978	-1	no_errors	NM_002150	genbank	human	validated	54_36p	missense	SNP	1.000	A
ITGB5	3693	genome.wustl.edu	37	3	124578105	124578105	+	Silent	SNP	G	G	C	rs547511798		TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr3:124578105G>C	ENST00000296181.4	-	3	641	c.345C>G	c.(343-345)gcC>gcG	p.A115A		NM_002213.3	NP_002204.2	P18084	ITB5_HUMAN	integrin, beta 5	115					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|epithelial cell-cell adhesion (GO:0090136)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|muscle contraction (GO:0006936)|stress fiber assembly (GO:0043149)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cell leading edge (GO:0031252)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alphav-beta5 complex (GO:0034684)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	30				GBM - Glioblastoma multiforme(114;0.163)		GGAGGTTCACGGCAATCTCCT	0.597																																																0			3											67.0	70.0	69.0					3																	124578105		2203	4300	6503	126060795	SO:0001819	synonymous_variant	3693			J05633	CCDS3030.1	3q21.2	2010-03-23			ENSG00000082781	ENSG00000082781		"""Integrins"""	6160	protein-coding gene	gene with protein product		147561				2211615	Standard	NM_002213		Approved		uc003eho.3	P18084	OTTHUMG00000159432	ENST00000296181.4:c.345C>G	3.37:g.124578105G>C			126060795	B0LPF8|B2RD70	Silent	SNP	HMMSmart_PSI,HMMPfam_Integrin_beta,HMMSmart_INB,superfamily_SSF53300,HMMSmart_VWA,superfamily_SSF69179,HMMPfam_EGF_2,PatternScan_EGF_1,PatternScan_EGF_2,PatternScan_INTEGRIN_BETA,superfamily_SSF57196,HMMSmart_EGF,superfamily_Integrin_bsu_tail,HMMPfam_Integrin_B_tail,HMMPfam_Integrin_b_cyt	p.A115	ENST00000296181.4	37	c.345	CCDS3030.1	3																																																																																			-	HMMPfam_Integrin_beta,HMMSmart_INB		0.597	ITGB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGB5	protein_coding	OTTHUMT00000355286.3	G	NM_002213		126060795	-1	no_errors	NM_002213	genbank	human	provisional	54_36p	silent	SNP	0.000	C
LAMC3	10319	genome.wustl.edu	37	9	133963009	133963009	+	Splice_Site	SNP	G	G	T			TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr9:133963009G>T	ENST00000361069.4	+	26	4510	c.4377G>T	c.(4375-4377)cgG>cgT	p.R1459R	LAMC3_ENST00000480883.1_Intron	NM_006059.3	NP_006050.3	Q9Y6N6	LAMC3_HUMAN	laminin, gamma 3	1459	Domain II and I.				astrocyte development (GO:0014002)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|extracellular matrix organization (GO:0030198)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	structural molecule activity (GO:0005198)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(31)|ovary(3)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	69	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.06e-05)|Epithelial(140;0.000551)		AAGCTGAGCGGGTACGTTTGC	0.657																																																0			9											66.0	72.0	70.0					9																	133963009		2203	4300	6503	132952830	SO:0001630	splice_region_variant	10319			AF041835	CCDS6938.1	9q31-q34	2013-03-01			ENSG00000050555	ENSG00000050555		"""Laminins"""	6494	protein-coding gene	gene with protein product		604349				10225960	Standard	NM_006059		Approved	DKFZp434E202	uc004caa.1	Q9Y6N6	OTTHUMG00000020819	ENST00000361069.4:c.4377+1G>T	9.37:g.133963009G>T			132952830	B1APX9|B1APY0|Q59H72	Silent	SNP	HMMSmart_LamNT,HMMPfam_Laminin_N,HMMPfam_Laminin_EGF,HMMSmart_EGF_Lam,superfamily_SSF57196,PatternScan_EGF_1,PatternScan_EGF_LAM_1,HMMPfam_Laminin_B,PatternScan_EGF_2	p.R1459	ENST00000361069.4	37	c.4377	CCDS6938.1	9	.	.	.	.	.	.	.	.	.	.	G	7.107	0.575247	0.13623	.	.	ENSG00000050555	ENST00000355452	.	.	.	4.62	4.62	0.57501	.	.	.	.	.	T	0.64305	0.2586	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.62676	-0.6804	4	.	.	.	.	12.8178	0.57675	0.0:0.0:1.0:0.0	.	.	.	.	V	141	.	.	G	+	2	0	LAMC3	132952830	1.000000	0.71417	0.260000	0.24451	0.134000	0.20937	5.266000	0.65525	2.394000	0.81467	0.467000	0.42956	GGG	-	NULL		0.657	LAMC3-004	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMC3	protein_coding	OTTHUMT00000054717.3	G	NM_006059	Silent	132952830	+1	no_errors	NM_006059	genbank	human	reviewed	54_36p	silent	SNP	0.041	T
TRAPPC9	83696	genome.wustl.edu	37	8	141461133	141461133	+	Silent	SNP	G	G	T	rs146609080		TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr8:141461133G>T	ENST00000438773.2	-	2	473	c.340C>A	c.(340-342)Cgg>Agg	p.R114R	TRAPPC9_ENST00000389328.4_Silent_p.R212R|TRAPPC9_ENST00000389327.3_Silent_p.R114R	NM_001160372.1	NP_001153844.1	Q96Q05	TPPC9_HUMAN	trafficking protein particle complex 9	114					cell differentiation (GO:0030154)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)				breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(16)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	47						ACAAAGAGCCGGGAGTCATAC	0.587																																																0			8											70.0	64.0	66.0					8																	141461133		2203	4300	6503	141530315	SO:0001819	synonymous_variant	83696			BC006206	CCDS34946.1, CCDS55278.1	8q24.3	2010-10-22			ENSG00000167632	ENSG00000167632		"""Trafficking protein particle complex"""	30832	protein-coding gene	gene with protein product	"""TRAPP 120 kDa subunit"", ""tularik gene 1"""	611966				11572484	Standard	NM_031466		Approved	IKBKBBP, NIBP, KIAA1882, T1, TRS120, MRT13	uc003yvh.2	Q96Q05	OTTHUMG00000164187	ENST00000438773.2:c.340C>A	8.37:g.141461133G>T			141530315	Q4VTT3|Q658K7|Q6P149|Q6ZQT3|Q7L5C4|Q86Y21|Q96SL2|Q9BQA2	Silent	SNP	HMMPfam_Trs120	p.R212	ENST00000438773.2	37	c.634	CCDS55278.1	8																																																																																			-	NULL		0.587	TRAPPC9-002	PUTATIVE	basic|CCDS	protein_coding	TRAPPC9	protein_coding	OTTHUMT00000377749.1	G	NM_031466		141530315	-1	no_errors	NM_031466	genbank	human	provisional	54_36p	silent	SNP	1.000	T
LRRC61	65999	genome.wustl.edu	37	7	150034650	150034650	+	Missense_Mutation	SNP	G	G	A			TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr7:150034650G>A	ENST00000359623.4	+	3	1288	c.700G>A	c.(700-702)Gac>Aac	p.D234N	LRRC61_ENST00000323078.7_Missense_Mutation_p.D234N|LRRC61_ENST00000493307.1_Missense_Mutation_p.D234N	NM_001142928.1	NP_001136400.1	Q9BV99	LRC61_HUMAN	leucine rich repeat containing 61	234										endometrium(2)|large_intestine(1)|skin(1)|upper_aerodigestive_tract(1)	5			OV - Ovarian serous cystadenocarcinoma(82;0.011)			CTGGGACCTGGACCGCCAGGC	0.677																																																0			7											14.0	16.0	15.0					7																	150034650		2196	4280	6476	149665583	SO:0001583	missense	65999			BC001354	CCDS5901.1	7q31-q35	2006-02-07			ENSG00000127399	ENSG00000127399			21704	protein-coding gene	gene with protein product							Standard	NM_023942		Approved	MGC3036, FLJ31392, HSPC295	uc003wgv.4	Q9BV99	OTTHUMG00000158326	ENST00000359623.4:c.700G>A	7.37:g.150034650G>A	ENSP00000352642:p.Asp234Asn		149665583	B3KUW0|D3DWY8	Missense_Mutation	SNP	superfamily_SSF52058,HMMPfam_LRR_1	p.D234N	ENST00000359623.4	37	c.700	CCDS5901.1	7	.	.	.	.	.	.	.	.	.	.	G	9.306	1.054337	0.19907	.	.	ENSG00000127399	ENST00000323078;ENST00000359623;ENST00000493307	T;T;T	0.30448	1.53;1.53;1.53	3.97	2.98	0.34508	.	0.397022	0.24823	U	0.035303	T	0.11367	0.0277	N	0.11560	0.145	0.25325	N	0.989085	B	0.29037	0.231	B	0.19666	0.026	T	0.16928	-1.0386	10	0.13853	T	0.58	-22.3203	4.6528	0.12603	0.2581:0.0:0.7419:0.0	.	234	Q9BV99	LRC61_HUMAN	N	234	ENSP00000339047:D234N;ENSP00000352642:D234N;ENSP00000420560:D234N	ENSP00000339047:D234N	D	+	1	0	LRRC61	149665583	0.997000	0.39634	0.999000	0.59377	0.624000	0.37722	0.806000	0.27126	2.074000	0.62210	0.306000	0.20318	GAC	-	NULL		0.677	LRRC61-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC61	protein_coding	OTTHUMT00000350696.1	G	NM_023942		149665583	+1	no_errors	NM_023942	genbank	human	validated	54_36p	missense	SNP	0.935	A
SYNE1	23345	genome.wustl.edu	37	6	152671404	152671404	+	Missense_Mutation	SNP	C	C	A			TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr6:152671404C>A	ENST00000367255.5	-	72	12401	c.11800G>T	c.(11800-11802)Gtc>Ttc	p.V3934F	SYNE1_ENST00000423061.1_Intron|SYNE1_ENST00000448038.1_Intron|SYNE1_ENST00000341594.5_Missense_Mutation_p.V3858F|SYNE1_ENST00000265368.4_Missense_Mutation_p.V3934F	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	3934					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CACTTTTCGACCTCTTGGAGC	0.527										HNSCC(10;0.0054)																																						0			6											108.0	99.0	102.0					6																	152671404		2203	4300	6503	152713097	SO:0001583	missense	23345			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.11800G>T	6.37:g.152671404C>A	ENSP00000356224:p.Val3934Phe		152713097	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	superfamily_Calponin-homology domain CH-domain,HMMPfam_CH,PatternScan_ACTININ_1,HMMSmart_SM00033,PatternScan_ACTININ_2,superfamily_Spectrin repeat,HMMSmart_SM00150,HMMPfam_Spectrin,HMMPfam_KASH	p.V3934F	ENST00000367255.5	37	c.11800	CCDS5236.2	6	.	.	.	.	.	.	.	.	.	.	C	22.3	4.265567	0.80358	.	.	ENSG00000131018	ENST00000367255;ENST00000265368;ENST00000341594	T;T;T	0.34667	1.35;1.35;1.35	5.75	5.75	0.90469	.	0.253441	0.27567	N	0.018800	T	0.40546	0.1121	L	0.56769	1.78	0.80722	D	1	D;D;D	0.55800	0.973;0.973;0.973	P;P;P	0.53689	0.732;0.732;0.732	T	0.03193	-1.1062	10	0.27082	T	0.32	.	19.9522	0.97203	0.0:1.0:0.0:0.0	.	3934;3934;3934	B7ZBC3;Q8NF91;E7EQI5	.;SYNE1_HUMAN;.	F	3934;3934;3858	ENSP00000356224:V3934F;ENSP00000265368:V3934F;ENSP00000341887:V3858F	ENSP00000265368:V3934F	V	-	1	0	SYNE1	152713097	1.000000	0.71417	0.952000	0.39060	0.925000	0.55904	7.466000	0.80914	2.725000	0.93324	0.655000	0.94253	GTC	-	superfamily_Spectrin repeat,HMMPfam_Spectrin,HMMSmart_SM00150		0.527	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	protein_coding	OTTHUMT00000334755.2	C	NM_182961		152713097	-1	no_errors	NM_182961	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
IGSF9	57549	genome.wustl.edu	37	1	159902334	159902334	+	Missense_Mutation	SNP	C	C	T			TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr1:159902334C>T	ENST00000368094.1	-	10	1410	c.1213G>A	c.(1213-1215)Ggg>Agg	p.G405R	IGSF9_ENST00000493195.1_5'UTR|IGSF9_ENST00000361509.3_Missense_Mutation_p.G389R	NM_001135050.1	NP_001128522.1	Q9P2J2	TUTLA_HUMAN	immunoglobulin superfamily, member 9	405	Ig-like 4.				dendrite development (GO:0016358)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synapse (GO:0045202)				central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(13)|lung(17)|ovary(3)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	all_hematologic(112;0.0597)	Breast(1374;0.000126)	BRCA - Breast invasive adenocarcinoma(70;0.111)			GGAGAGGGCCCGGCGGTACCA	0.647																																																0			1											59.0	58.0	59.0					1																	159902334		2203	4300	6503	158168958	SO:0001583	missense	57549			AB037776	CCDS1190.1, CCDS44254.1	1q22-q23	2013-02-11			ENSG00000085552	ENSG00000085552		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	18132	protein-coding gene	gene with protein product		609738				11991715	Standard	NM_020789		Approved	KIAA1355, Nrt1, IGSF9A	uc001fur.2	Q9P2J2	OTTHUMG00000022794	ENST00000368094.1:c.1213G>A	1.37:g.159902334C>T	ENSP00000357073:p.Gly405Arg		158168958		Missense_Mutation	SNP	HMMPfam_V-set,HMMSmart_SM00409,superfamily_Immunoglobulin,HMMSmart_SM00408,HMMPfam_I-set,HMMPfam_ig,HMMSmart_SM00060,HMMPfam_fn3,superfamily_Fibronectin type III	p.G389R	ENST00000368094.1	37	c.1165	CCDS44254.1	1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.231363	0.79688	.	.	ENSG00000085552	ENST00000361509;ENST00000368094;ENST00000198587	T;T	0.66099	-0.19;-0.06	4.7	4.7	0.59300	Immunoglobulin-like (1);	0.000000	0.36482	N	0.002573	T	0.74959	0.3785	M	0.80508	2.5	0.52501	D	0.999951	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.77830	-0.2442	9	.	.	.	-15.2083	15.1302	0.72517	0.0:1.0:0.0:0.0	.	405;405	Q9P2J2;C9JI81	TUTLA_HUMAN;.	R	389;405;405	ENSP00000355049:G389R;ENSP00000357073:G405R	.	G	-	1	0	IGSF9	158168958	1.000000	0.71417	0.936000	0.37596	0.708000	0.40852	6.710000	0.74670	2.154000	0.67381	0.561000	0.74099	GGG	-	superfamily_Immunoglobulin		0.647	IGSF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGSF9	protein_coding	OTTHUMT00000059115.1	C	NM_020789		158168958	-1	no_errors	NM_020789	genbank	human	validated	54_36p	missense	SNP	0.997	T
ATP1A2	477	genome.wustl.edu	37	1	160100344	160100344	+	Missense_Mutation	SNP	C	C	A			TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr1:160100344C>A	ENST00000361216.3	+	13	1873	c.1784C>A	c.(1783-1785)gCt>gAt	p.A595D	ATP1A2_ENST00000392233.3_Missense_Mutation_p.A595D	NM_000702.3	NP_000693.1	P50993	AT1A2_HUMAN	ATPase, Na+/K+ transporting, alpha 2 polypeptide	595					adult locomotory behavior (GO:0008344)|ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to mechanical stimulus (GO:0071260)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|locomotion (GO:0040011)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of heart contraction (GO:0045822)|negative regulation of striated muscle contraction (GO:0045988)|neurotransmitter uptake (GO:0001504)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of smooth muscle contraction (GO:0006940)|regulation of striated muscle contraction (GO:0006942)|regulation of the force of heart contraction (GO:0002026)|regulation of vasoconstriction (GO:0019229)|relaxation of cardiac muscle (GO:0055119)|response to nicotine (GO:0035094)|sodium ion export from cell (GO:0036376)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|visual learning (GO:0008542)	caveola (GO:0005901)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|endosome (GO:0005768)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)|synapse (GO:0045202)|T-tubule (GO:0030315)|vesicle (GO:0031982)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(30)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	69	all_cancers(52;1.11e-16)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)|LUSC - Lung squamous cell carcinoma(543;0.246)			CCCCGGGCTGCTGTGCCAGAT	0.572																																																0			1											68.0	68.0	68.0					1																	160100344		2203	4300	6503	158366968	SO:0001583	missense	477			AB018321	CCDS1196.1	1q23.2	2014-09-17	2010-04-20		ENSG00000018625	ENSG00000018625	3.6.3.9	"""ATPases / P-type"""	800	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-2"", ""sodium pump subunit alpha-2"", ""sodium-potassium ATPase catalytic subunit alpha-2"""	182340	"""migraine, hemiplegic 2"", ""ATPase, Na+/K+ transporting, alpha 2 (+) polypeptide"""	MHP2		9403481	Standard	NM_000702		Approved	FHM2	uc001fvc.3	P50993	OTTHUMG00000024080	ENST00000361216.3:c.1784C>A	1.37:g.160100344C>A	ENSP00000354490:p.Ala595Asp		158366968	D3DVE4|Q07059|Q5JW74|Q86UZ5|Q9UQ25	Missense_Mutation	SNP	HMMPfam_Cation_ATPase_N,superfamily_SSF81665,HMMPfam_E1-E2_ATPase,superfamily_SSF81653,superfamily_SSF56784,HMMPfam_Hydrolase,PatternScan_ATPASE_E1_E2,superfamily_SSF81660,HMMPfam_Cation_ATPase_C	p.A595D	ENST00000361216.3	37	c.1784	CCDS1196.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.3|20.3	3.966913|3.966913	0.74131|0.74131	.|.	.|.	ENSG00000018625|ENSG00000018625	ENST00000361216;ENST00000392233;ENST00000435866|ENST00000447527	D;D|.	0.95518|.	-3.73;-3.73|.	4.6|4.6	4.6|4.6	0.57074|0.57074	Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);ATPase, P-type,  transmembrane domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.35364|0.35364	0.0929|0.0929	N|N	0.13299|0.13299	0.325|0.325	0.80722|0.80722	D|D	1|1	D;D;D|.	0.58268|.	0.964;0.982;0.964|.	D;D;D|.	0.63488|.	0.915;0.911;0.915|.	T|T	0.29822|0.29822	-0.9999|-0.9999	10|5	0.87932|.	D|.	0|.	.|.	16.5445|16.5445	0.84426|0.84426	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	595;495;595|.	B1AKY9;F5GXJ7;P50993|.	.;.;AT1A2_HUMAN|.	D|M	595;595;298|306	ENSP00000354490:A595D;ENSP00000376066:A595D|.	ENSP00000354490:A595D|.	A|L	+|+	2|1	0|2	ATP1A2|ATP1A2	158366968|158366968	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.998000|0.998000	0.95712|0.95712	7.755000|7.755000	0.85180|0.85180	2.279000|2.279000	0.76181|0.76181	0.505000|0.505000	0.49811|0.49811	GCT|CTG	-	superfamily_SSF81665,superfamily_SSF56784,HMMPfam_Hydrolase		0.572	ATP1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP1A2	protein_coding	OTTHUMT00000060642.2	C	NM_000702		158366968	+1	no_errors	NM_000702	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
DOCK2	1794	genome.wustl.edu	37	5	169129351	169129351	+	Missense_Mutation	SNP	T	T	G			TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr5:169129351T>G	ENST00000256935.8	+	14	1383	c.1303T>G	c.(1303-1305)Ttt>Gtt	p.F435V	DOCK2_ENST00000520908.1_5'Flank|DOCK2_ENST00000540750.1_5'Flank	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	435	DHR-1.				actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)			NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			ACAAGGTGACTTTGACAAGTA	0.502											OREG0017017	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				0			5											181.0	148.0	159.0					5																	169129351		2203	4300	6503	169061929	SO:0001583	missense	1794			BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.1303T>G	5.37:g.169129351T>G	ENSP00000256935:p.Phe435Val	1875	169061929	Q2M3I0|Q96AK7	Missense_Mutation	SNP	superfamily_SH3-domain,HMMSmart_SM00326,HMMPfam_SH3_2,superfamily_Cytochrome c	p.F435V	ENST00000256935.8	37	c.1303	CCDS4371.1	5	.	.	.	.	.	.	.	.	.	.	T	26.0	4.696385	0.88830	.	.	ENSG00000134516	ENST00000256935	T	0.16457	2.34	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	T	0.34629	0.0904	M	0.90019	3.08	0.80722	D	1	P	0.39576	0.679	P	0.45538	0.484	T	0.24621	-1.0155	10	0.46703	T	0.11	.	10.8147	0.46569	0.0:0.0732:0.0:0.9268	.	435	Q92608	DOCK2_HUMAN	V	435	ENSP00000256935:F435V	ENSP00000256935:F435V	F	+	1	0	DOCK2	169061929	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.243000	0.72384	2.099000	0.63709	0.533000	0.62120	TTT	-	NULL		0.502	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK2	protein_coding	OTTHUMT00000252828.2	T	NM_004946		169061929	+1	no_errors	NM_004946	genbank	human	validated	54_36p	missense	SNP	1.000	G
G6PC2	57818	genome.wustl.edu	37	2	169763226	169763226	+	Missense_Mutation	SNP	T	T	C			TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr2:169763226T>C	ENST00000375363.3	+	4	585	c.493T>C	c.(493-495)Tgc>Cgc	p.C165R	G6PC2_ENST00000461586.1_Intron|G6PC2_ENST00000429379.2_Intron|SPC25_ENST00000472216.2_Intron|G6PC2_ENST00000421979.1_Intron	NM_021176.2	NP_066999.1	Q9NQR9	G6PC2_HUMAN	glucose-6-phosphatase, catalytic, 2	165					carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose homeostasis (GO:0042593)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	glucose-6-phosphatase activity (GO:0004346)			breast(1)|endometrium(1)|large_intestine(1)|lung(5)|pancreas(1)|prostate(1)|skin(1)|stomach(2)	13						AATCAGTGTCTGCATCTCCAG	0.368																																																0			2											221.0	203.0	209.0					2																	169763226		2203	4300	6503	169471472	SO:0001583	missense	57818			AF283575	CCDS2230.1, CCDS46443.1	2q24-q31	2008-02-05			ENSG00000152254	ENSG00000152254			28906	protein-coding gene	gene with protein product	"""islet specific glucose 6 phosphatase catalytic subunit related protein"""	608058				10078553, 10078554	Standard	NM_021176		Approved	IGRP	uc002uem.3	Q9NQR9	OTTHUMG00000132182	ENST00000375363.3:c.493T>C	2.37:g.169763226T>C	ENSP00000364512:p.Cys165Arg		169471472	E9PAX2|Q6AHZ0	Missense_Mutation	SNP	superfamily_Acid phosphatase/Vanadium-dependent haloperoxidase,HMMSmart_SM00014,HMMPfam_PAP2	p.C165R	ENST00000375363.3	37	c.493	CCDS2230.1	2	.	.	.	.	.	.	.	.	.	.	T	18.59	3.657325	0.67586	.	.	ENSG00000152254	ENST00000375363	T	0.75154	-0.91	5.9	5.9	0.94986	Phosphatidic acid phosphatase/chloroperoxidase, N-terminal (1);	0.064020	0.64402	D	0.000006	D	0.86443	0.5934	M	0.80746	2.51	0.80722	D	1	D	0.76494	0.999	D	0.71184	0.972	D	0.87452	0.2402	10	0.54805	T	0.06	-0.1757	16.3538	0.83227	0.0:0.0:0.0:1.0	.	165	Q9NQR9	G6PC2_HUMAN	R	165	ENSP00000364512:C165R	ENSP00000364512:C165R	C	+	1	0	G6PC2	169471472	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.724000	0.61972	2.254000	0.74563	0.524000	0.50904	TGC	-	superfamily_Acid phosphatase/Vanadium-dependent haloperoxidase,HMMSmart_SM00014,HMMPfam_PAP2		0.368	G6PC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	G6PC2	protein_coding	OTTHUMT00000255234.2	T	NM_021176		169471472	+1	no_errors	NM_021176	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
TNFSF10	8743	genome.wustl.edu	37	3	172224521	172224521	+	Missense_Mutation	SNP	C	C	T			TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr3:172224521C>T	ENST00000241261.2	-	5	729	c.607G>A	c.(607-609)Gac>Aac	p.D203N	TNFSF10_ENST00000420541.2_3'UTR	NM_003810.3	NP_003801.1	P50591	TNF10_HUMAN	tumor necrosis factor (ligand) superfamily, member 10	203					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell-cell signaling (GO:0007267)|immune response (GO:0006955)|male gonad development (GO:0008584)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|response to insulin (GO:0032868)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	metal ion binding (GO:0046872)|receptor binding (GO:0005102)			breast(2)|cervix(1)|large_intestine(1)|lung(6)|ovary(1)|skin(4)	15	Ovarian(172;0.00197)|Breast(254;0.158)		Lung(28;1.67e-15)|LUSC - Lung squamous cell carcinoma(14;1.48e-14)|STAD - Stomach adenocarcinoma(35;0.235)			ATTTGTTTGTCGTTCTTTGTG	0.343																																																0			3											259.0	248.0	252.0					3																	172224521		2203	4300	6503	173707215	SO:0001583	missense	8743			U37518	CCDS3219.1, CCDS54680.1	3q26	2006-09-20			ENSG00000121858	ENSG00000121858		"""Tumor necrosis factor (ligand) superfamily"", ""CD molecules"""	11925	protein-coding gene	gene with protein product		603598				8777713, 8663110	Standard	NM_003810		Approved	TRAIL, Apo-2L, TL2, CD253	uc003fid.3	P50591	OTTHUMG00000156917	ENST00000241261.2:c.607G>A	3.37:g.172224521C>T	ENSP00000241261:p.Asp203Asn		173707215	A1Y9B3	Missense_Mutation	SNP	superfamily_TNF-like,HMMSmart_SM00207,HMMPfam_TNF,PatternScan_TNF_1	p.D203N	ENST00000241261.2	37	c.607	CCDS3219.1	3	.	.	.	.	.	.	.	.	.	.	C	0.010	-1.764157	0.00651	.	.	ENSG00000121858	ENST00000241261	D	0.94330	-3.4	5.64	1.78	0.24846	Tumour necrosis factor (3);Tumour necrosis factor-like (2);	0.954014	0.08852	N	0.884361	T	0.74291	0.3697	N	0.01134	-0.995	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.67369	-0.5688	10	0.07325	T	0.83	-5.0114	1.7822	0.03034	0.1117:0.2417:0.1645:0.4822	.	203	P50591	TNF10_HUMAN	N	203	ENSP00000241261:D203N	ENSP00000241261:D203N	D	-	1	0	TNFSF10	173707215	0.063000	0.20901	0.011000	0.14972	0.131000	0.20780	0.698000	0.25571	0.509000	0.28195	-0.469000	0.05056	GAC	-	superfamily_TNF-like,HMMSmart_SM00207,HMMPfam_TNF		0.343	TNFSF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFSF10	protein_coding	OTTHUMT00000346601.1	C			173707215	-1	no_errors	NM_003810	genbank	human	reviewed	54_36p	missense	SNP	0.000	T
B4GALT7	11285	genome.wustl.edu	37	5	177031200	177031200	+	Missense_Mutation	SNP	G	G	C	rs565183548		TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr5:177031200G>C	ENST00000029410.5	+	2	182	c.71G>C	c.(70-72)gGc>gCc	p.G24A		NM_007255.2	NP_009186.1	Q9UBV7	B4GT7_HUMAN	xylosylprotein beta 1,4-galactosyltransferase, polypeptide 7	24					carbohydrate metabolic process (GO:0005975)|cellular protein modification process (GO:0006464)|chondroitin sulfate metabolic process (GO:0030204)|extracellular fibril organization (GO:0043206)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|negative regulation of fibroblast proliferation (GO:0048147)|protein N-linked glycosylation (GO:0006487)|proteoglycan metabolic process (GO:0006029)|small molecule metabolic process (GO:0044281)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|galactosyltransferase activity (GO:0008378)|manganese ion binding (GO:0030145)|xylosylprotein 4-beta-galactosyltransferase activity (GO:0046525)			endometrium(2)|large_intestine(1)|lung(1)|pancreas(1)|skin(1)|urinary_tract(1)	7	all_cancers(89;0.00033)|Renal(175;0.000269)|Lung NSC(126;0.00161)|all_lung(126;0.00286)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CTCTCCGGCGGCCTCCCTCGG	0.677																																																0			5											33.0	29.0	30.0					5																	177031200		2201	4295	6496	176963806	SO:0001583	missense	11285			AB028600	CCDS4429.1	5q35.1-q35.3	2013-02-19	2012-07-18		ENSG00000027847	ENSG00000027847		"""Beta 4-glycosyltransferases"""	930	protein-coding gene	gene with protein product	"""galactosyltransferase I"""	604327				10438455, 10473568	Standard	NM_007255		Approved	XGALT-1, beta4Gal-T7	uc003mhy.3	Q9UBV7	OTTHUMG00000130851	ENST00000029410.5:c.71G>C	5.37:g.177031200G>C	ENSP00000029410:p.Gly24Ala		176963806	B3KN39|Q9UHN2	Missense_Mutation	SNP	superfamily_Nucleotide-diphospho-sugar transferases,HMMPfam_Galactosyl_T_2	p.G24A	ENST00000029410.5	37	c.71	CCDS4429.1	5	.	.	.	.	.	.	.	.	.	.	G	2.367	-0.345203	0.05208	.	.	ENSG00000027847	ENST00000029410	T	0.68903	-0.36	4.23	3.26	0.37387	.	0.591461	0.17698	N	0.165030	T	0.45895	0.1365	N	0.22421	0.69	0.23798	N	0.996813	B	0.16603	0.018	B	0.09377	0.004	T	0.15492	-1.0435	10	0.12103	T	0.63	-16.8285	8.7791	0.34781	0.0:0.0:0.654:0.346	.	24	Q9UBV7	B4GT7_HUMAN	A	24	ENSP00000029410:G24A	ENSP00000029410:G24A	G	+	2	0	B4GALT7	176963806	0.991000	0.36638	0.916000	0.36221	0.071000	0.16799	2.418000	0.44662	2.285000	0.76669	0.549000	0.68633	GGC	-	NULL		0.677	B4GALT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	B4GALT7	protein_coding	OTTHUMT00000253421.1	G	NM_007255		176963806	+1	no_errors	NM_007255	genbank	human	reviewed	54_36p	missense	SNP	0.758	C
NRROS	375387	genome.wustl.edu	37	3	196388482	196388482	+	Missense_Mutation	SNP	C	C	G			TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr3:196388482C>G	ENST00000328557.4	+	3	2171	c.1968C>G	c.(1966-1968)atC>atG	p.I656M		NM_198565.1	NP_940967.1	Q86YC3	NRROS_HUMAN	negative regulator of reactive oxygen species	656					immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|superoxide metabolic process (GO:0006801)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)											TCGTGCTCATCCTCCCCAGCT	0.622																																																0			3											92.0	97.0	95.0					3																	196388482		2203	4300	6503	197872879	SO:0001583	missense	375387			AY358322	CCDS3319.1	3q29	2013-07-02	2013-07-02	2013-07-02	ENSG00000174004	ENSG00000174004			24613	protein-coding gene	gene with protein product		615322	"""leucine rich repeat containing 33"""	LRRC33		12975309	Standard	NM_198565		Approved	UNQ3030, ELLP3030, MGC50789, GARPL1	uc003fwv.3	Q86YC3	OTTHUMG00000155569	ENST00000328557.4:c.1968C>G	3.37:g.196388482C>G	ENSP00000328625:p.Ile656Met		197872879		Missense_Mutation	SNP	superfamily_SSF52058,HMMPfam_LRR_1,HMMSmart_LRR_TYP	p.I656M	ENST00000328557.4	37	c.1968	CCDS3319.1	3	.	.	.	.	.	.	.	.	.	.	C	11.70	1.715892	0.30413	.	.	ENSG00000174004	ENST00000328557	T	0.50277	0.75	5.67	-9.2	0.00682	.	0.246100	0.41500	D	0.000869	T	0.33527	0.0866	L	0.51422	1.61	0.49130	D	0.999758	P	0.37864	0.61	B	0.34180	0.177	T	0.44498	-0.9324	10	0.36615	T	0.2	.	16.9257	0.86175	0.0876:0.6444:0.0:0.268	.	656	Q86YC3	LRC33_HUMAN	M	656	ENSP00000328625:I656M	ENSP00000328625:I656M	I	+	3	3	LRRC33	197872879	0.001000	0.12720	0.165000	0.22776	0.946000	0.59487	-1.668000	0.01959	-1.884000	0.01119	-0.302000	0.09304	ATC	-	NULL		0.622	NRROS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC33	protein_coding	OTTHUMT00000340676.1	C	NM_198565		197872879	+1	no_errors	NM_198565	genbank	human	provisional	54_36p	missense	SNP	0.013	G
CASP8	841	genome.wustl.edu	37	2	202131492	202131492	+	Missense_Mutation	SNP	A	A	T			TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr2:202131492A>T	ENST00000432109.2	+	3	472	c.283A>T	c.(283-285)Agg>Tgg	p.R95W	CASP8_ENST00000358485.4_Missense_Mutation_p.R154W|CASP8_ENST00000323492.7_Missense_Mutation_p.R95W|CASP8_ENST00000264274.9_Missense_Mutation_p.R95W|CASP8_ENST00000392259.2_Missense_Mutation_p.R95W|CASP8_ENST00000392266.3_Missense_Mutation_p.R95W|CASP8_ENST00000392258.3_Missense_Mutation_p.R95W|CASP8_ENST00000264275.5_Missense_Mutation_p.R95W	NM_033355.3	NP_203519.1	Q14790	CASP8_HUMAN	caspase 8, apoptosis-related cysteine peptidase	95					activation of cysteine-type endopeptidase activity (GO:0097202)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|B cell activation (GO:0042113)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to mechanical stimulus (GO:0071260)|cellular response to organic cyclic compound (GO:0071407)|execution phase of apoptosis (GO:0097194)|extrinsic apoptotic signaling pathway (GO:0097191)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|heart development (GO:0007507)|hepatocyte apoptotic process (GO:0097284)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|macrophage differentiation (GO:0030225)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|natural killer cell activation (GO:0030101)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of necroptotic process (GO:0060546)|neural tube formation (GO:0001841)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of proteolysis (GO:0045862)|protein heterooligomerization (GO:0051291)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|regulation of thymocyte apoptotic process (GO:0070243)|response to antibiotic (GO:0046677)|response to cobalt ion (GO:0032025)|response to cold (GO:0009409)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to tumor necrosis factor (GO:0034612)|syncytiotrophoblast cell differentiation involved in labyrinthine layer development (GO:0060715)|T cell activation (GO:0042110)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRAIL-activated apoptotic signaling pathway (GO:0036462)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral process (GO:0016032)	CD95 death-inducing signaling complex (GO:0031265)|cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|death-inducing signaling complex (GO:0031264)|membrane raft (GO:0045121)|microtubule organizing center (GO:0005815)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|Noc1p-Noc2p complex (GO:0030690)|nucleus (GO:0005634)|ripoptosome (GO:0097342)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type endopeptidase activity involved in apoptotic process (GO:0097153)|cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:0097199)|cysteine-type peptidase activity (GO:0008234)|death effector domain binding (GO:0035877)|peptidase activity (GO:0008233)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)			breast(5)|cervix(2)|endometrium(6)|large_intestine(11)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(9)|urinary_tract(3)	52						GACACCAGGCAGGGCTCAAAT	0.488										HNSCC(4;0.00038)																											Melanoma(82;831 1348 20716 36952 40159)											0			2											47.0	45.0	46.0					2																	202131492		2203	4300	6503	201839737	SO:0001583	missense	841			U60520	CCDS2342.1, CCDS2343.1, CCDS2345.1, CCDS42798.1, CCDS42799.1	2q33-q34	2014-09-17	2005-08-17		ENSG00000064012	ENSG00000064012		"""Caspases"""	1509	protein-coding gene	gene with protein product		601763	"""caspase 8, apoptosis-related cysteine protease"""			8681376, 8681377	Standard	NM_033355		Approved	MCH5, MACH, FLICE, Casp-8	uc002uxt.1	Q14790	OTTHUMG00000132821	ENST00000432109.2:c.283A>T	2.37:g.202131492A>T	ENSP00000412523:p.Arg95Trp		201839737	O14676|Q14791|Q14792|Q14793|Q14794|Q14795|Q14796|Q15780|Q15806|Q53TT5|Q8TDI1|Q8TDI2|Q8TDI3|Q8TDI4|Q8TDI5|Q96T22|Q9C0K4|Q9UQ81	Missense_Mutation	SNP	superfamily_DEATH domain,HMMSmart_SM00031,HMMPfam_DED,superfamily_Caspase-like,HMMSmart_SM00115,HMMPfam_Peptidase_C14,PatternScan_CASPASE_HIS,PatternScan_CASPASE_CYS	p.R154W	ENST00000432109.2	37	c.460	CCDS2342.1	2	.	.	.	.	.	.	.	.	.	.	A	16.42	3.118592	0.56505	.	.	ENSG00000064012	ENST00000392263;ENST00000264274;ENST00000392259;ENST00000392266;ENST00000432109;ENST00000264275;ENST00000440732;ENST00000392258;ENST00000447616;ENST00000358485;ENST00000392261;ENST00000413726;ENST00000323492;ENST00000429881	D;D;D;D;D;D;D;D;D;D;D;D;D	0.83419	-1.72;-1.72;-1.72;-1.72;-1.72;-1.72;-1.72;-1.72;-1.72;-1.72;-1.72;-1.72;-1.72	5.58	5.58	0.84498	DEATH-like (2);	1.151220	0.06204	N	0.683833	D	0.91566	0.7336	M	0.79258	2.445	0.25754	N	0.985022	D;D;D;D;D;P;D;D;D	0.76494	0.975;0.97;0.998;0.992;0.996;0.946;0.983;0.992;0.999	P;P;D;P;D;P;P;D;D	0.66979	0.688;0.685;0.925;0.888;0.925;0.741;0.908;0.925;0.948	T	0.79257	-0.1878	10	0.66056	D	0.02	.	13.4804	0.61332	1.0:0.0:0.0:0.0	.	95;95;95;95;154;95;95;95;95	Q14790-3;E7ETB7;Q14790-7;A8MU92;Q14790-9;Q14790;Q14790-2;Q14790-4;Q14790-5	.;.;.;.;.;CASP8_HUMAN;.;.;.	W	95;95;95;95;95;95;95;95;95;154;95;95;95;95	ENSP00000376091:R95W;ENSP00000264274:R95W;ENSP00000376088:R95W;ENSP00000376094:R95W;ENSP00000412523:R95W;ENSP00000264275:R95W;ENSP00000396869:R95W;ENSP00000376087:R95W;ENSP00000388306:R95W;ENSP00000351273:R154W;ENSP00000397528:R95W;ENSP00000325722:R95W;ENSP00000390641:R95W	ENSP00000264274:R95W	R	+	1	2	CASP8	201839737	0.572000	0.26668	0.919000	0.36401	0.064000	0.16182	2.763000	0.47605	2.111000	0.64477	0.459000	0.35465	AGG	-	superfamily_DEATH domain		0.488	CASP8-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	CASP8	protein_coding	OTTHUMT00000336853.2	A	NM_001228		201839737	+1	no_errors	NM_001080125	genbank	human	reviewed	54_36p	missense	SNP	0.823	T
SERTAD4	56256	genome.wustl.edu	37	1	210415499	210415499	+	Silent	SNP	C	C	G			TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr1:210415499C>G	ENST00000367012.3	+	4	1118	c.888C>G	c.(886-888)ccC>ccG	p.P296P	SERTAD4_ENST00000490620.1_3'UTR	NM_019605.3	NP_062551.1	Q9NUC0	SRTD4_HUMAN	SERTA domain containing 4	296						nucleus (GO:0005634)				endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(1)	14				OV - Ovarian serous cystadenocarcinoma(81;0.0237)|all cancers(67;0.127)		ATGGTGGCCCCCTCAGCCACG	0.393																																																0			1											68.0	65.0	66.0					1																	210415499		2203	4300	6503	208482122	SO:0001819	synonymous_variant	56256			BC012083	CCDS1494.1	1q32.1-q41	2008-02-05			ENSG00000082497	ENSG00000082497			25236	protein-coding gene	gene with protein product						12477932	Standard	NM_019605		Approved	DJ667H12.2	uc001hhy.3	Q9NUC0	OTTHUMG00000036391	ENST00000367012.3:c.888C>G	1.37:g.210415499C>G			208482122	B2RD32	Silent	SNP	HMMPfam_SERTA	p.P296	ENST00000367012.3	37	c.888	CCDS1494.1	1																																																																																			-	NULL		0.393	SERTAD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERTAD4	protein_coding	OTTHUMT00000088577.1	C	NM_019605		208482122	+1	no_errors	NM_019605	genbank	human	validated	54_36p	silent	SNP	0.003	G
CPS1	1373	genome.wustl.edu	37	2	211464238	211464238	+	Missense_Mutation	SNP	C	C	T			TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr2:211464238C>T	ENST00000233072.5	+	14	1698	c.1502C>T	c.(1501-1503)cCa>cTa	p.P501L	CPS1_ENST00000451903.2_Missense_Mutation_p.P50L|CPS1_ENST00000430249.2_Missense_Mutation_p.P507L	NM_001875.4	NP_001866.2	P31327	CPSM_HUMAN	carbamoyl-phosphate synthase 1, mitochondrial	501					anion homeostasis (GO:0055081)|carbamoyl phosphate biosynthetic process (GO:0070409)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to glucagon stimulus (GO:0071377)|cellular response to oleic acid (GO:0071400)|citrulline biosynthetic process (GO:0019240)|glutamine catabolic process (GO:0006543)|glycogen catabolic process (GO:0005980)|hepatocyte differentiation (GO:0070365)|homocysteine metabolic process (GO:0050667)|midgut development (GO:0007494)|nitric oxide metabolic process (GO:0046209)|positive regulation of vasodilation (GO:0045909)|response to amine (GO:0014075)|response to amino acid (GO:0043200)|response to dexamethasone (GO:0071548)|response to drug (GO:0042493)|response to food (GO:0032094)|response to growth hormone (GO:0060416)|response to lipopolysaccharide (GO:0032496)|response to starvation (GO:0042594)|response to toxic substance (GO:0009636)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)|urea cycle (GO:0000050)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|carbamoyl-phosphate synthase (ammonia) activity (GO:0004087)|endopeptidase activity (GO:0004175)|glutamate binding (GO:0016595)|modified amino acid binding (GO:0072341)|phospholipid binding (GO:0005543)			breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(85)|ovary(8)|pancreas(1)|prostate(6)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	142				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)	Carglumic Acid(DB06775)	GCAGAACAGCCAGATGGGTTA	0.473																																																0			2											132.0	131.0	131.0					2																	211464238		2203	4300	6503	211172483	SO:0001583	missense	1373			AF154830	CCDS2393.1, CCDS46505.1, CCDS46506.1	2p	2014-09-17	2010-05-11		ENSG00000021826	ENSG00000021826	6.3.4.16		2323	protein-coding gene	gene with protein product		608307	"""carbamoyl-phosphate synthetase 1, mitochondrial"""				Standard	NM_001122633		Approved		uc002vee.4	P31327	OTTHUMG00000132994	ENST00000233072.5:c.1502C>T	2.37:g.211464238C>T	ENSP00000233072:p.Pro501Leu		211172483	B7Z818|J3KQL0|O43774|Q53TL5|Q59HF8|Q7Z5I5	Missense_Mutation	SNP	superfamily_Carbamoyl phosphate synthetase small subunit N-terminal domain,HMMPfam_CPSase_sm_chain,superfamily_Class I glutamine amidotransferase-like,HMMPfam_GATase,superfamily_PreATP-grasp domain,HMMPfam_CPSase_L_chain,HMMPfam_CPSase_L_D2,superfamily_Glutathione synthetase ATP-binding domain-like,PatternScan_CPSASE_1,PatternScan_CPSASE_2,superfamily_Carbamoyl phosphate synthetase large subunit connection domain,HMMPfam_CPSase_L_D3,superfamily_Methylglyoxal synthase-like,HMMPfam_MGS	p.P501L	ENST00000233072.5	37	c.1502	CCDS2393.1	2	.	.	.	.	.	.	.	.	.	.	C	24.3	4.519253	0.85495	.	.	ENSG00000021826	ENST00000430249;ENST00000539150;ENST00000233072;ENST00000536125;ENST00000451903	D;D;D	0.95821	-3.82;-3.82;-3.82	5.17	5.17	0.71159	Pre-ATP-grasp fold (1);PreATP-grasp-like fold (1);Carbamoyl-phosphate synthase, large subunit, N-terminal (1);	0.050207	0.85682	D	0.000000	D	0.98516	0.9505	H	0.96208	3.785	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.69654	0.965;0.965	D	0.99605	1.0979	10	0.87932	D	0	-7.135	19.03	0.92952	0.0:1.0:0.0:0.0	.	511;501	Q59HF8;P31327	.;CPSM_HUMAN	L	507;509;501;501;50	ENSP00000402608:P507L;ENSP00000233072:P501L;ENSP00000406136:P50L	ENSP00000233072:P501L	P	+	2	0	CPS1	211172483	1.000000	0.71417	0.999000	0.59377	0.816000	0.46133	7.358000	0.79466	2.579000	0.87056	0.455000	0.32223	CCA	-	superfamily_PreATP-grasp domain,HMMPfam_CPSase_L_chain		0.473	CPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPS1	protein_coding	OTTHUMT00000256569.5	C			211172483	+1	no_errors	NM_001875	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
EPRS	2058	genome.wustl.edu	37	1	220198487	220198487	+	Missense_Mutation	SNP	T	T	C			TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr1:220198487T>C	ENST00000366923.3	-	7	1006	c.737A>G	c.(736-738)gAa>gGa	p.E246G		NM_004446.2	NP_004437.2	P07814	SYEP_HUMAN	glutamyl-prolyl-tRNA synthetase	246	Glutamate--tRNA ligase.				cellular response to interferon-gamma (GO:0071346)|gene expression (GO:0010467)|glutamyl-tRNA aminoacylation (GO:0006424)|negative regulation of translation (GO:0017148)|prolyl-tRNA aminoacylation (GO:0006433)|protein complex assembly (GO:0006461)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|GAIT complex (GO:0097452)|membrane (GO:0016020)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|glutamate-tRNA ligase activity (GO:0004818)|proline-tRNA ligase activity (GO:0004827)|RNA stem-loop binding (GO:0035613)			breast(2)|endometrium(11)|kidney(2)|large_intestine(13)|lung(24)|ovary(1)|prostate(3)|skin(2)|stomach(2)|urinary_tract(3)	63				GBM - Glioblastoma multiforme(131;0.0735)	L-Proline(DB00172)	CTCAAAATCTTCCTTTTCTTT	0.358																																																0			1											127.0	116.0	120.0					1																	220198487		2203	4300	6503	218265110	SO:0001583	missense	2058			X54326	CCDS31027.1	1q41	2011-07-01			ENSG00000136628	ENSG00000136628	6.1.1.15, 6.1.1.17	"""Aminoacyl tRNA synthetases / Class I"", ""Aminoacyl tRNA synthetases / Class II"""	3418	protein-coding gene	gene with protein product	"""glutamate tRNA ligase"", ""proline tRNA ligase"""	138295		QPRS, QARS		1988429	Standard	NM_004446		Approved	EARS, PARS, GLUPRORS	uc001hly.1	P07814	OTTHUMG00000037433	ENST00000366923.3:c.737A>G	1.37:g.220198487T>C	ENSP00000355890:p.Glu246Gly		218265110	A0AVA9|B9EGH3|Q05BP6|Q05DF8|Q5DSM1|Q5H9S5|Q6PD57|Q86X73	Missense_Mutation	SNP	superfamily_GST_C_like,superfamily_SSF52374,HMMPfam_tRNA-synt_1c,PatternScan_AA_TRNA_LIGASE_I,HMMPfam_tRNA-synt_1c_C,superfamily_Ribosomal_L25rel,superfamily_S15/NS1_bind,HMMPfam_WHEP-TRS,PatternScan_WHEP_TRS_1,superfamily_SSF55681,HMMPfam_tRNA-synt_2b,superfamily_Anticodon_bd,HMMPfam_HGTP_anticodon,superfamily_Pro-tRNA_synth_II_C,HMMPfam_ProRS-C_1	p.E246G	ENST00000366923.3	37	c.737	CCDS31027.1	1	.	.	.	.	.	.	.	.	.	.	T	20.9	4.071989	0.76415	.	.	ENSG00000136628	ENST00000366923;ENST00000536921;ENST00000435048	T	0.23754	1.89	5.63	5.63	0.86233	Glutamyl/glutaminyl-tRNA synthetase, class Ib, catalytic domain (1);Rossmann-like alpha/beta/alpha sandwich fold (1);	0.000000	0.85682	D	0.000000	T	0.30070	0.0753	M	0.65320	2	0.80722	D	1	B;B;P	0.36837	0.123;0.197;0.571	B;B;B	0.37198	0.139;0.119;0.243	T	0.03852	-1.0998	10	0.30854	T	0.27	-37.4632	16.1413	0.81528	0.0:0.0:0.0:1.0	.	246;246;246	F5H7I7;Q3KQZ8;P07814	.;.;SYEP_HUMAN	G	246	ENSP00000355890:E246G	ENSP00000355890:E246G	E	-	2	0	EPRS	218265110	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.782000	0.85680	2.270000	0.75569	0.482000	0.46254	GAA	-	superfamily_SSF52374,HMMPfam_tRNA-synt_1c		0.358	EPRS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPRS	protein_coding	OTTHUMT00000091133.2	T	NM_004446		218265110	-1	no_errors	NM_004446	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
UGT1A4	54657	genome.wustl.edu	37	2	234627911	234627911	+	Missense_Mutation	SNP	G	G	A			TCGA-13-2061-01A-01D-1526-09	TCGA-13-2061-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	0b9de923-d534-4822-bf1a-56ea599bf007	b8882c3b-a721-4993-ac63-d57990255883	g.chr2:234627911G>A	ENST00000373409.3	+	1	488	c.445G>A	c.(445-447)Gtt>Att	p.V149I	UGT1A1_ENST00000609637.1_Intron|UGT1A1_ENST00000373450.4_Intron|UGT1A10_ENST00000344644.5_Intron|UGT1A1_ENST00000608381.1_Intron|UGT1A6_ENST00000373424.1_Intron|UGT1A10_ENST00000373445.1_Intron|UGT1A9_ENST00000354728.4_Intron|UGT1A5_ENST00000373414.3_Intron|UGT1A6_ENST00000406651.1_Intron|UGT1A7_ENST00000373426.3_Intron|UGT1A6_ENST00000305139.6_Intron|UGT1A6_ENST00000480628.1_Intron	NM_007120.2	NP_009051.1	P22310	UD14_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A4	149					cellular glucuronidation (GO:0052695)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	enzyme binding (GO:0019899)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			autonomic_ganglia(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|skin(2)|urinary_tract(1)	26		Breast(86;0.000765)|all_lung(227;0.00266)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0327)|Lung NSC(271;0.0456)|Lung SC(224;0.128)		Epithelial(121;3.49e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000504)|Lung(119;0.0026)|LUSC - Lung squamous cell carcinoma(224;0.00624)	Asenapine(DB06216)|Clozapine(DB00363)|Ezogabine(DB04953)|Lamotrigine(DB00555)|Midazolam(DB00683)|Paricalcitol(DB00910)|Tamoxifen(DB00675)|Trifluoperazine(DB00831)|Valproic Acid(DB00313)	CTTTGATGTGGTTTTAACAGA	0.458																																					Melanoma(99;1011 1962 13201 26492)											0			2											201.0	200.0	200.0					2																	234627911		2203	4300	6503	234292650	SO:0001583	missense	54657			M84128	CCDS33405.1	2q37.1	2014-01-10	2005-07-20		ENSG00000244474	ENSG00000244474		"""UDP glucuronosyltransferases"""	12536	other	complex locus constituent		606429	"""UDP glycosyltransferase 1 family, polypeptide A4"""			9295054, 1339448	Standard	NM_007120		Approved	HUG-BR2, UGT1D	uc002vux.3	P22310	OTTHUMG00000059119	ENST00000373409.3:c.445G>A	2.37:g.234627911G>A	ENSP00000362508:p.Val149Ile		234292650	B2R937|B8K288|Q5DT00	Missense_Mutation	SNP	superfamily_UDP-Glycosyltransferase/glycogen phosphorylase,HMMPfam_UDPGT,PatternScan_UDPGT	p.V149I	ENST00000373409.3	37	c.445	CCDS33405.1	2	.	.	.	.	.	.	.	.	.	.	G	4.268	0.048892	0.08243	.	.	ENSG00000244474	ENST00000373409	T	0.62232	0.04	4.31	-0.0339	0.13898	.	.	.	.	.	T	0.66096	0.2755	L	0.59912	1.85	0.09310	N	1	P;B	0.49090	0.919;0.039	P;B	0.56514	0.8;0.173	T	0.56637	-0.7946	9	0.25751	T	0.34	.	8.7855	0.34818	0.143:0.4753:0.3816:0.0	.	149;149	B8K288;P22310	.;UD14_HUMAN	I	149	ENSP00000362508:V149I	ENSP00000362508:V149I	V	+	1	0	UGT1A4	234292650	0.000000	0.05858	0.023000	0.16930	0.002000	0.02628	-0.635000	0.05471	-0.397000	0.07691	0.491000	0.48974	GTT	-	superfamily_UDP-Glycosyltransferase/glycogen phosphorylase,HMMPfam_UDPGT		0.458	UGT1A4-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	UGT1A4	protein_coding	OTTHUMT00000130984.1	G	NM_007120		234292650	+1	no_errors	NM_007120	genbank	human	reviewed	54_36p	missense	SNP	0.175	A
