#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
PPAPDC2	403313	genome.wustl.edu	37	9	4663149	4663149	+	Silent	SNP	C	C	G			TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chr9:4663149C>G	ENST00000381883.2	+	1	852	c.774C>G	c.(772-774)gtC>gtG	p.V258V	SPATA6L_ENST00000475086.1_Intron|SPATA6L_ENST00000381890.5_Intron|SPATA6L_ENST00000454239.2_Intron|SPATA6L_ENST00000381895.5_Intron|SPATA6L_ENST00000223517.5_Intron	NM_203453.3	NP_982278.3	Q8IY26	PPAC2_HUMAN	phosphatidic acid phosphatase type 2 domain containing 2	258						integral component of membrane (GO:0016021)	hydrolase activity (GO:0016787)			endometrium(1)|large_intestine(2)|lung(1)	4	all_hematologic(13;0.137)	Breast(48;0.238)		GBM - Glioblastoma multiforme(50;0.026)		GGCACAATGTCACCGACGTAG	0.552																																					Melanoma(187;1057 3809 8526)											0			9											156.0	125.0	135.0					9																	4663149		2203	4300	6503	4653149	SO:0001819	synonymous_variant	403313			AK128369	CCDS34981.1	9p24	2010-04-23			ENSG00000205808	ENSG00000205808			23682	protein-coding gene	gene with protein product	"""polyisoprenoid diphosphate phosphatase type 1"""	611666				16464866	Standard	NM_203453		Approved	FLJ90191, FLJ46512, PDP1	uc003zin.4	Q8IY26	OTTHUMG00000019466	ENST00000381883.2:c.774C>G	9.37:g.4663149C>G			4653149	B3KY05|Q5JVJ6|Q8NCK9	Silent	SNP	superfamily_AcPase_VanPerase,HMMSmart_acidPPc,HMMPfam_PAP2	p.V258	ENST00000381883.2	37	c.774	CCDS34981.1	9																																																																																			-	superfamily_AcPase_VanPerase,HMMSmart_acidPPc,HMMPfam_PAP2		0.552	PPAPDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPAPDC2	protein_coding	OTTHUMT00000051567.1	C	NM_203453		4653149	+1	no_errors	NM_203453	genbank	human	validated	54_36p	silent	SNP	1.000	G
VWF	7450	genome.wustl.edu	37	12	6062762	6062762	+	Splice_Site	SNP	T	T	G	rs111381150		TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chr12:6062762T>G	ENST00000261405.5	-	48	8142		c.e48-2			NM_000552.3	NP_000543	P04275	VWF_HUMAN	von Willebrand factor						blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|extracellular matrix organization (GO:0030198)|hemostasis (GO:0007599)|liver development (GO:0001889)|placenta development (GO:0001890)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein homooligomerization (GO:0051260)|response to wounding (GO:0009611)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)|Weibel-Palade body (GO:0033093)	chaperone binding (GO:0051087)|collagen binding (GO:0005518)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|immunoglobulin binding (GO:0019865)|integrin binding (GO:0005178)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(41)|ovary(7)|pancreas(2)|prostate(6)|skin(15)|stomach(1)|upper_aerodigestive_tract(5)	129					Antihemophilic Factor(DB00025)	CTTGTAACCCTGCATCCAGAG	0.458																																																0			12											118.0	96.0	103.0					12																	6062762		2203	4300	6503	5933023	SO:0001630	splice_region_variant	7450				CCDS8539.1	12p13.3	2014-09-17			ENSG00000110799	ENSG00000110799		"""Endogenous ligands"""	12726	protein-coding gene	gene with protein product		613160		F8VWF		2251280	Standard	NM_000552		Approved		uc001qnn.1	P04275	OTTHUMG00000168265	ENST00000261405.5:c.7888-2A>C	12.37:g.6062762T>G			5933023	Q8TCE8|Q99806	Splice_Site	SNP	-	e47-2	ENST00000261405.5	37	c.7888-2	CCDS8539.1	12	.	.	.	.	.	.	.	.	.	.	T	9.299	1.052533	0.19907	.	.	ENSG00000110799	ENST00000261405	.	.	.	4.67	4.67	0.58626	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.668	0.45741	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	VWF	5933023	0.997000	0.39634	0.926000	0.36857	0.036000	0.12997	4.158000	0.58150	2.083000	0.62718	0.533000	0.62120	.	-	-		0.458	VWF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	VWF	protein_coding	OTTHUMT00000399020.1	T	NM_000552	Intron	5933023	-1	no_errors	NM_000552	genbank	human	reviewed	54_36p	splice_site	SNP	0.967	G
SLC25A23	79085	genome.wustl.edu	37	19	6456044	6456044	+	Intron	SNP	T	T	A			TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chr19:6456044T>A	ENST00000301454.4	-	4	590				SLC25A23_ENST00000334510.5_Intron|SLC25A23_ENST00000414491.2_5'Flank	NM_024103.2	NP_077008.2	Q9BV35	SCMC3_HUMAN	solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 23						adenine nucleotide transport (GO:0051503)|cellular response to calcium ion (GO:0071277)|regulation of cellular respiration (GO:0043457)|regulation of oxidative phosphorylation (GO:0002082)|regulation of sequestering of calcium ion (GO:0051282)|transmembrane transport (GO:0055085)|urea homeostasis (GO:0097274)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	calcium ion binding (GO:0005509)			endometrium(3)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|pancreas(1)|skin(1)	17						CCGTGGTTTTTGAACGATTCT	0.562																																																0			19																																								6407044	SO:0001627	intron_variant	79085			AJ619962	CCDS32882.1	19p13.1	2014-02-06			ENSG00000125648	ENSG00000125648		"""Solute carriers"", ""EF-hand domain containing"""	19375	protein-coding gene	gene with protein product		608746				15123600	Standard	NM_024103		Approved	FLJ30339, MGC2615, APC2	uc002mex.1	Q9BV35	OTTHUMG00000180852	ENST00000301454.4:c.483+386A>T	19.37:g.6456044T>A			6407044	B4DGB6|Q4LBC2|Q705K3|Q86Y43|Q8N2N4|Q96NQ4	Silent	SNP	superfamily_SSF47473,HMMSmart_EFh,HMMPfam_efhand,PatternScan_EF_HAND_1,superfamily_Mitoch_carrier,HMMPfam_Mito_carr	p.S181	ENST00000301454.4	37	c.543	CCDS32882.1	19																																																																																			-	NULL		0.562	SLC25A23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A23	protein_coding	OTTHUMT00000453325.1	T	NM_024103		6407044	-1	no_errors	ENST00000264088	ensembl	human	known	54_36p	silent	SNP	0.000	A
TP53	7157	genome.wustl.edu	37	17	7577105	7577105	+	Missense_Mutation	SNP	G	G	A			TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chr17:7577105G>A	ENST00000269305.4	-	8	1022	c.833C>T	c.(832-834)cCt>cTt	p.P278L	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Missense_Mutation_p.P278L|TP53_ENST00000420246.2_Missense_Mutation_p.P278L|TP53_ENST00000445888.2_Missense_Mutation_p.P278L|TP53_ENST00000455263.2_Missense_Mutation_p.P278L|TP53_ENST00000413465.2_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	278	Interaction with AXIN1. {ECO:0000250}.|Interaction with DNA.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		P -> A (in sporadic cancers; somatic mutation; dbSNP:rs17849781). {ECO:0000269|PubMed:15489334}.|P -> F (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|P -> H (in sporadic cancers; somatic mutation).|P -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:2263646}.|P -> R (in sporadic cancers; somatic mutation).|P -> S (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:2263646, ECO:0000269|PubMed:9450901}.|P -> T (in LFS; germline mutation and in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.P278L(61)|p.P278R(30)|p.P278H(13)|p.0?(8)|p.P278F(3)|p.?(2)|p.P278fs*67(2)|p.A276_R283delACPGRDRR(1)|p.C275fs*20(1)|p.A276fs*64(1)|p.L265_K305del41(1)|p.F270_D281del12(1)|p.V274_P278del(1)|p.S269fs*21(1)|p.V272_K292del21(1)|p.C275_R283delCACPGRDRR(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GTCTCTCCCAGGACAGGCACA	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	128	Substitution - Missense(107)|Whole gene deletion(8)|Deletion - In frame(6)|Deletion - Frameshift(5)|Unknown(2)	large_intestine(18)|lung(17)|skin(15)|upper_aerodigestive_tract(12)|haematopoietic_and_lymphoid_tissue(11)|breast(9)|kidney(8)|central_nervous_system(7)|oesophagus(7)|ovary(7)|stomach(4)|bone(4)|liver(3)|soft_tissue(2)|thyroid(1)|prostate(1)|urinary_tract(1)|autonomic_ganglia(1)	17	GRCh37	CM961376	TP53	M							72.0	63.0	66.0					17																	7577105		2203	4300	6503	7517830	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.833C>T	17.37:g.7577105G>A	ENSP00000269305:p.Pro278Leu		7517830	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	HMMPfam_P53_TAD,HMMPfam_P53,superfamily_p53-like transcription factors,PatternScan_P53,HMMPfam_P53_tetramer,superfamily_p53 tetramerization domain	p.P278L	ENST00000269305.4	37	c.833	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	G	27.3	4.814432	0.90790	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99885	-7.5;-7.5;-7.5;-7.5;-7.5;-7.5	5.13	4.16	0.48862	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.050655	0.85682	N	0.000000	D	0.99891	0.9948	M	0.92459	3.31	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.96442	0.9327	10	0.87932	D	0	-13.7877	11.4227	0.49991	0.0873:0.0:0.9127:0.0	.	278;278;278;278	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	L	278;278;278;278;278;267;146	ENSP00000352610:P278L;ENSP00000269305:P278L;ENSP00000398846:P278L;ENSP00000391127:P278L;ENSP00000391478:P278L;ENSP00000425104:P146L	ENSP00000269305:P278L	P	-	2	0	TP53	7517830	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.573000	0.98181	1.392000	0.46585	0.462000	0.41574	CCT	-	HMMPfam_P53,superfamily_p53-like transcription factors		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	G	NM_000546		7517830	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
NLRP10	338322	genome.wustl.edu	37	11	7982397	7982397	+	Silent	SNP	C	C	T			TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chr11:7982397C>T	ENST00000328600.2	-	2	923	c.762G>A	c.(760-762)ctG>ctA	p.L254L		NM_176821.3	NP_789791.1	Q86W26	NAL10_HUMAN	NLR family, pyrin domain containing 10	254	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				defense response to fungus (GO:0050832)|defense response to Gram-negative bacterium (GO:0050829)|dendritic cell migration (GO:0036336)|helper T cell enhancement of adaptive immune response (GO:0035397)|innate immune response (GO:0045087)|positive regulation of interleukin-6 secretion (GO:2000778)|positive regulation of interleukin-8 secretion (GO:2000484)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of T-helper 17 type immune response (GO:2000318)	cytoplasm (GO:0005737)|extrinsic component of plasma membrane (GO:0019897)	ATP binding (GO:0005524)			breast(1)|endometrium(2)|kidney(2)|large_intestine(8)|liver(1)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	58				Epithelial(150;1.47e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)		AGGGCCTCTGCAGCTCATCAA	0.542																																																0			11											55.0	55.0	55.0					11																	7982397		2201	4296	6497	7938973	SO:0001819	synonymous_variant	338322			AY154465	CCDS7784.1	11p15.4	2006-12-08	2006-12-08	2006-12-08		ENSG00000182261		"""Nucleotide-binding domain and leucine rich repeat containing"""	21464	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 10"""	609662	"""NACHT, leucine rich repeat and PYD containing 10"""	NALP10		12563287	Standard	NM_176821		Approved	NOD8, PAN5, Pynod, CLR11.1	uc001mfv.1	Q86W26		ENST00000328600.2:c.762G>A	11.37:g.7982397C>T			7938973	Q2M3C4|Q6JGT0	Silent	SNP	superfamily_DEATH_like,HMMPfam_PAAD_DAPIN,superfamily_SSF52540,HMMPfam_NACHT	p.L254	ENST00000328600.2	37	c.762	CCDS7784.1	11																																																																																			-	superfamily_SSF52540,HMMPfam_NACHT		0.542	NLRP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP10	protein_coding	OTTHUMT00000385705.1	C	NM_176821		7938973	-1	no_errors	NM_176821	genbank	human	reviewed	54_36p	silent	SNP	0.265	T
SLC2A3	6515	genome.wustl.edu	37	12	8083913	8083913	+	Silent	SNP	C	C	T			TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chr12:8083913C>T	ENST00000075120.7	-	4	678	c.438G>A	c.(436-438)tcG>tcA	p.S146S		NM_006931.2	NP_008862.1	P11169	GTR3_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 3	146					carbohydrate metabolic process (GO:0005975)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|L-ascorbic acid metabolic process (GO:0019852)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glucose transmembrane transporter activity (GO:0005355)			central_nervous_system(1)|cervix(2)|endometrium(1)|kidney(3)|large_intestine(2)|lung(14)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30				Kidney(36;0.0866)		GGGCAGTAGGCGAGATCTCTC	0.517																																					Colon(96;424 1461 14416 20933 23688)											0			12											90.0	84.0	86.0					12																	8083913		2203	4300	6503	7975180	SO:0001819	synonymous_variant	6515			M20681	CCDS8586.1	12p13.3	2013-05-22			ENSG00000059804	ENSG00000059804		"""Solute carriers"""	11007	protein-coding gene	gene with protein product		138170		GLUT3			Standard	NM_006931		Approved		uc001qtr.3	P11169	OTTHUMG00000133685	ENST00000075120.7:c.438G>A	12.37:g.8083913C>T			7975180	B2R606|D3DUU6|Q6I9U2|Q9UG15	Silent	SNP	superfamily_MFS general substrate transporter,HMMPfam_Sugar_tr,PatternScan_SUGAR_TRANSPORT_2,PatternScan_SUGAR_TRANSPORT_1	p.S146	ENST00000075120.7	37	c.438	CCDS8586.1	12																																																																																			-	superfamily_MFS general substrate transporter,HMMPfam_Sugar_tr,PatternScan_SUGAR_TRANSPORT_2		0.517	SLC2A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC2A3	protein_coding	OTTHUMT00000257914.1	C	NM_006931		7975180	-1	no_errors	NM_006931	genbank	human	validated	54_36p	silent	SNP	0.910	T
MRVI1	10335	genome.wustl.edu	37	11	10648029	10648029	+	Missense_Mutation	SNP	C	C	G	rs78826049	byFrequency	TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chr11:10648029C>G	ENST00000436272.1	-	8	849	c.771G>C	c.(769-771)gaG>gaC	p.E257D	MRVI1_ENST00000552103.1_Missense_Mutation_p.E193D|MRVI1_ENST00000545852.1_5'UTR|MRVI1_ENST00000421747.1_Missense_Mutation_p.E275D|MRVI1_ENST00000531107.1_Missense_Mutation_p.E276D|MRVI1_ENST00000423302.2_Missense_Mutation_p.E284D|MRVI1_ENST00000558540.1_5'UTR|MRVI1_ENST00000534266.2_5'UTR|MRVI1_ENST00000541483.1_Intron|MRVI1_ENST00000527509.2_Missense_Mutation_p.E193D|MRVI1_ENST00000547195.1_Missense_Mutation_p.E193D|MRVI1_ENST00000424001.1_5'UTR			Q9Y6F6	MRVI1_HUMAN	murine retrovirus integration site 1 homolog	257					blood coagulation (GO:0007596)|cGMP-mediated signaling (GO:0019934)|relaxation of vascular smooth muscle (GO:0060087)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)				central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|prostate(2)	22				all cancers(16;2.68e-07)|Epithelial(150;3.04e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0723)		CTATTGCAATCTCTTTGGACT	0.532																																																0			11											98.0	102.0	101.0					11																	10648029		1952	4135	6087	10604605	SO:0001583	missense	10335			AF081249	CCDS44538.1, CCDS44539.1, CCDS44540.1, CCDS44538.2, CCDS55745.1, CCDS55746.1	11p15.4	2014-09-11			ENSG00000072952	ENSG00000072952			7237	protein-coding gene	gene with protein product	"""inositol 1,4,5-triphosphate-associated cGMP kinase substrate"", ""IP3R-associated cGMP kinase substrate"""	604673				10321731	Standard	NM_001098579		Approved	JAW1L, IRAG	uc010rcb.1	Q9Y6F6	OTTHUMG00000165773	ENST00000436272.1:c.771G>C	11.37:g.10648029C>G	ENSP00000412229:p.Glu257Asp		10604605	B7Z3T4|B7Z6I2|B7Z9A3|E9PQY6|F5H6A1|J3KQZ7|Q17S00|Q9UNY1	Missense_Mutation	SNP	HMMPfam_MRVI1	p.E275D	ENST00000436272.1	37	c.825		11	.	.	.	.	.	.	.	.	.	.	C	12.41	1.930694	0.34096	.	.	ENSG00000072952	ENST00000421747;ENST00000308763;ENST00000436272;ENST00000547195;ENST00000552103;ENST00000423302;ENST00000531107;ENST00000527509	T;T;T;T;T;T;T	0.17854	2.8;2.73;2.25;2.25;2.62;2.79;2.25	5.56	-1.16	0.09678	.	0.107593	0.40728	N	0.001032	T	0.12860	0.0312	L	0.54323	1.7	0.80722	D	1	B;B;B	0.32693	0.262;0.262;0.38	B;B;B	0.30316	0.053;0.053;0.114	T	0.05419	-1.0886	10	0.45353	T	0.12	-12.0484	6.3876	0.21569	0.0:0.3606:0.247:0.3924	.	257;276;275	Q9Y6F6;E9PQY6;Q9Y6F6-4	MRVI1_HUMAN;.;.	D	275;258;257;193;193;284;276;193	ENSP00000414598:E275D;ENSP00000412229:E257D;ENSP00000448278:E193D;ENSP00000446764:E193D;ENSP00000412130:E284D;ENSP00000432436:E276D;ENSP00000432067:E193D	ENSP00000307885:E258D	E	-	3	2	MRVI1	10604605	0.455000	0.25736	0.513000	0.27749	0.942000	0.58702	-0.252000	0.08806	-0.535000	0.06307	-0.253000	0.11424	GAG	-	NULL		0.532	MRVI1-203	KNOWN	basic	protein_coding	MRVI1	protein_coding		C	NM_001098579		10604605	-1	no_errors	NM_001098579	genbank	human	reviewed	54_36p	missense	SNP	0.116	G
ZNF564	163050	genome.wustl.edu	37	19	12638047	12638047	+	Missense_Mutation	SNP	G	G	C			TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chr19:12638047G>C	ENST00000339282.7	-	4	1071	c.875C>G	c.(874-876)tCt>tGt	p.S292C	ZNF709_ENST00000428311.1_Intron|CTD-2192J16.20_ENST00000593682.1_3'UTR|CTD-2192J16.21_ENST00000601420.1_RNA	NM_144976.3	NP_659413.1	Q8TBZ8	ZN564_HUMAN	zinc finger protein 564	292					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	18						ATTTGTGAAAGAAATGAAGGC	0.398																																																0			19											52.0	57.0	55.0					19																	12638047		2129	4258	6387	12499047	SO:0001583	missense	163050			BC028367	CCDS42505.1	19p13.2	2013-09-19			ENSG00000249709	ENSG00000249709		"""Zinc fingers, C2H2-type"", ""-"""	31106	protein-coding gene	gene with protein product							Standard	NM_144976		Approved	MGC26914		Q8TBZ8	OTTHUMG00000156418	ENST00000339282.7:c.875C>G	19.37:g.12638047G>C	ENSP00000340004:p.Ser292Cys		12499047	B9EGT4|Q6P1K6	Missense_Mutation	SNP	superfamily_KRAB domain (Kruppel-associated box Pfam 01352),HMMPfam_KRAB,HMMSmart_SM00349,superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,PatternScan_ZINC_FINGER_C2H2_1,HMMSmart_SM00355	p.S292C	ENST00000339282.7	37	c.875	CCDS42505.1	19	.	.	.	.	.	.	.	.	.	.	G	10.11	1.259436	0.23051	.	.	ENSG00000249709	ENST00000339282	T	0.08282	3.11	1.96	-3.93	0.04143	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.06735	0.0172	L	0.46947	1.48	0.09310	N	1	B	0.18310	0.027	B	0.27715	0.082	T	0.41360	-0.9513	9	0.36615	T	0.2	.	1.8934	0.03252	0.1056:0.2968:0.2401:0.3575	.	292	Q8TBZ8	ZN564_HUMAN	C	292	ENSP00000340004:S292C	ENSP00000340004:S292C	S	-	2	0	ZNF564	12499047	0.000000	0.05858	0.000000	0.03702	0.977000	0.68977	-2.757000	0.00788	-1.555000	0.01697	0.643000	0.83706	TCT	-	superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1		0.398	ZNF564-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF564	protein_coding	OTTHUMT00000344120.2	G	NM_144976		12499047	-1	no_errors	NM_144976	genbank	human	validated	54_36p	missense	SNP	0.000	C
GUCY2C	2984	genome.wustl.edu	37	12	14827688	14827688	+	Nonsense_Mutation	SNP	G	G	A			TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chr12:14827688G>A	ENST00000261170.3	-	8	1091	c.955C>T	c.(955-957)Cga>Tga	p.R319*	RP11-174G6.1_ENST00000501178.2_RNA	NM_004963.3	NP_004954.2	P25092	GUC2C_HUMAN	guanylate cyclase 2C (heat stable enterotoxin receptor)	319					intracellular signal transduction (GO:0035556)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of cell proliferation (GO:0042127)|response to toxic substance (GO:0009636)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|toxic substance binding (GO:0015643)			breast(3)|endometrium(7)|kidney(3)|large_intestine(9)|lung(17)|ovary(4)|skin(7)|urinary_tract(1)	51					Linaclotide(DB08890)	GCAAAGTCTCGTTTTGTCTAA	0.363																																																0			12											60.0	64.0	63.0					12																	14827688		2202	4300	6502	14718955	SO:0001587	stop_gained	2984				CCDS8664.1	12p12	2008-08-18			ENSG00000070019	ENSG00000070019			4688	protein-coding gene	gene with protein product		601330		GUC2C		8661067	Standard	NM_004963		Approved	STAR	uc001rcd.3	P25092	OTTHUMG00000168732	ENST00000261170.3:c.955C>T	12.37:g.14827688G>A	ENSP00000261170:p.Arg319*		14718955	B2RMY6	Nonsense_Mutation	SNP	superfamily_Periplasmic binding protein-like I,HMMPfam_ANF_receptor,superfamily_Protein kinase-like (PK-like),HMMSmart_SM00219,HMMSmart_SM00220,HMMPfam_Pkinase,HMMSmart_SM00044,superfamily_Adenylyl and guanylyl cyclase catalytic domain,HMMPfam_Guanylate_cyc,PatternScan_GUANYLATE_CYCLASE_1	p.R319*	ENST00000261170.3	37	c.955	CCDS8664.1	12	.	.	.	.	.	.	.	.	.	.	G	20.9	4.074066	0.76415	.	.	ENSG00000070019	ENST00000261170	.	.	.	5.68	1.97	0.26223	.	0.413363	0.30538	N	0.009408	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	.	0.7086	0.00920	0.1957:0.1269:0.2283:0.4492	.	.	.	.	X	319	.	ENSP00000261170:R319X	R	-	1	2	GUCY2C	14718955	0.039000	0.19947	0.001000	0.08648	0.005000	0.04900	0.517000	0.22832	0.411000	0.25702	-0.262000	0.10625	CGA	-	superfamily_Periplasmic binding protein-like I,HMMPfam_ANF_receptor		0.363	GUCY2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GUCY2C	protein_coding	OTTHUMT00000400835.1	G			14718955	-1	no_errors	NM_004963	genbank	human	validated	54_36p	nonsense	SNP	0.000	A
EMR2	30817	genome.wustl.edu	37	19	14862249	14862249	+	Splice_Site	SNP	G	G	A			TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chr19:14862249G>A	ENST00000315576.3	-	16	2474	c.2023C>T	c.(2023-2025)Cgc>Tgc	p.R675C	EMR2_ENST00000601345.1_Splice_Site_p.R664C|EMR2_ENST00000353876.1_Splice_Site_p.R582C|EMR2_ENST00000392964.3_3'UTR|EMR2_ENST00000346057.1_Splice_Site_p.R626C|EMR2_ENST00000594294.1_Splice_Site_p.R626C|EMR2_ENST00000595839.1_Splice_Site_p.R533C|EMR2_ENST00000392967.2_Splice_Site_p.R664C|EMR2_ENST00000392965.3_Splice_Site_p.R617C|EMR2_ENST00000353005.1_Splice_Site_p.R533C|EMR2_ENST00000594076.1_Splice_Site_p.R582C|EMR2_ENST00000596991.2_Splice_Site_p.R664C	NM_013447.3	NP_038475.2	Q9UHX3	EMR2_HUMAN	egf-like module containing, mucin-like, hormone receptor-like 2	675					cell adhesion (GO:0007155)|cell migration (GO:0016477)|G-protein coupled receptor signaling pathway (GO:0007186)|granulocyte chemotaxis (GO:0071621)|inflammatory response (GO:0006954)|neuropeptide signaling pathway (GO:0007218)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|leading edge membrane (GO:0031256)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chondroitin sulfate binding (GO:0035374)|G-protein coupled receptor activity (GO:0004930)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(8)|lung(19)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	48						TGCACTAACCGGGAAGGTGTT	0.468																																																0			19											83.0	80.0	81.0					19																	14862249		2203	4300	6503	14723249	SO:0001630	splice_region_variant	30817			AF114491	CCDS32935.1, CCDS59361.1	19p13.1	2014-08-08	2003-11-26			ENSG00000127507		"""CD molecules"", ""-"", ""GPCR / Class B : Orphans"""	3337	protein-coding gene	gene with protein product		606100	"""egf-like module containing, mucin-like, hormone receptor-like sequence 2"""				Standard	NM_013447		Approved	CD312	uc002mzp.2	Q9UHX3		ENST00000315576.3:c.2024+1C>T	19.37:g.14862249G>A			14723249	B4DQ96|E7ESD7|E9PBR1|E9PEL6|E9PFQ5|E9PG91|Q8NG96|Q9Y4B1	Missense_Mutation	SNP	HMMSmart_SM00181,PatternScan_EGF_CA,HMMPfam_EGF_CA,HMMSmart_SM00179,superfamily_EGF/Laminin,PatternScan_ASX_HYDROXYL,HMMPfam_GPS,HMMSmart_SM00303,HMMPfam_7tm_2,PatternScan_G_PROTEIN_RECEP_F2_2	p.R675C	ENST00000315576.3	37	c.2023	CCDS32935.1	19	.	.	.	.	.	.	.	.	.	.	G	13.83	2.353200	0.41700	.	.	ENSG00000127507	ENST00000315576;ENST00000392967;ENST00000346057;ENST00000353876;ENST00000353005;ENST00000392965	T;T;T;T;T;T	0.37235	1.21;1.21;1.21;1.21;1.21;1.21	4.25	0.317	0.15861	GPCR, family 2-like (1);	.	.	.	.	T	0.57975	0.2090	M	0.83603	2.65	0.19775	N	0.99995	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.998;1.0;1.0;0.998	D;P;D;D;D;D;D;P	0.76575	0.978;0.886;0.988;0.931;0.921;0.969;0.953;0.886	T	0.47195	-0.9136	9	0.40728	T	0.16	.	10.0239	0.42059	0.0:0.0:0.4906:0.5094	.	617;582;675;533;626;675;675;664	E7ESD7;Q9UHX3-4;A0JNV7;Q9UHX3-5;Q9UHX3-3;A8K6W1;Q9UHX3;Q9UHX3-2	.;.;.;.;.;.;EMR2_HUMAN;.	C	675;664;626;582;533;617	ENSP00000319883:R675C;ENSP00000376694:R664C;ENSP00000263380:R626C;ENSP00000319454:R582C;ENSP00000319838:R533C;ENSP00000376692:R617C	ENSP00000319883:R675C	R	-	1	0	EMR2	14723249	0.048000	0.20356	0.001000	0.08648	0.002000	0.02628	0.221000	0.17680	0.311000	0.23014	0.514000	0.50259	CGC	-	HMMPfam_7tm_2		0.468	EMR2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	EMR2	protein_coding	OTTHUMT00000466502.2	G		Missense_Mutation	14723249	-1	no_errors	NM_013447	genbank	human	reviewed	54_36p	missense	SNP	0.020	A
CUBN	8029	genome.wustl.edu	37	10	16877175	16877175	+	Missense_Mutation	SNP	G	G	C			TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chr10:16877175G>C	ENST00000377833.4	-	64	10265	c.10200C>G	c.(10198-10200)caC>caG	p.H3400Q		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	3400	CUB 26. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	CAAATGCCTTGTGATAGTCTC	0.423																																																0			10											124.0	112.0	116.0					10																	16877175		2203	4300	6503	16917181	SO:0001583	missense	8029			AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.10200C>G	10.37:g.16877175G>C	ENSP00000367064:p.His3400Gln		16917181	B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	superfamily_EGF/Laminin,HMMSmart_SM00179,HMMSmart_SM00181,HMMPfam_EGF,PatternScan_ASX_HYDROXYL,PatternScan_EGF_1,PatternScan_EGF_CA,HMMPfam_EGF_CA,PatternScan_EGF_2,superfamily_Spermadhesin CUB domain,HMMPfam_CUB,HMMSmart_SM00042	p.H3400Q	ENST00000377833.4	37	c.10200	CCDS7113.1	10	.	.	.	.	.	.	.	.	.	.	G	0.185	-1.058408	0.01950	.	.	ENSG00000107611	ENST00000377833;ENST00000545090	T	0.16743	2.32	4.84	-6.93	0.01638	CUB (5);	0.540328	0.15424	N	0.263082	T	0.07548	0.0190	N	0.20328	0.56	0.22213	N	0.999282	B	0.06786	0.001	B	0.04013	0.001	T	0.16305	-1.0407	10	0.34782	T	0.22	.	7.5495	0.27788	0.4403:0.3018:0.2579:0.0	.	3400	O60494	CUBN_HUMAN	Q	3400;241	ENSP00000367064:H3400Q	ENSP00000367064:H3400Q	H	-	3	2	CUBN	16917181	0.095000	0.21747	0.000000	0.03702	0.019000	0.09904	-0.539000	0.06113	-1.442000	0.01955	-0.291000	0.09656	CAC	-	superfamily_Spermadhesin CUB domain,HMMPfam_CUB,HMMSmart_SM00042		0.423	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUBN	protein_coding	OTTHUMT00000047009.1	G	NM_001081		16917181	-1	no_errors	NM_001081	genbank	human	reviewed	54_36p	missense	SNP	0.788	C
PEX26	55670	genome.wustl.edu	37	22	18567998	18567998	+	Missense_Mutation	SNP	G	G	T			TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chr22:18567998G>T	ENST00000329627.7	+	5	994	c.788G>T	c.(787-789)tGt>tTt	p.C263F	PEX26_ENST00000428061.2_Intron|PEX26_ENST00000399744.3_Missense_Mutation_p.C263F	NM_017929.5	NP_060399.1	Q7Z412	PEX26_HUMAN	peroxisomal biogenesis factor 26	263					protein import into peroxisome matrix (GO:0016558)|protein import into peroxisome membrane (GO:0045046)	integral component of peroxisomal membrane (GO:0005779)|peroxisome (GO:0005777)	ATPase binding (GO:0051117)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)			breast(1)|kidney(2)|large_intestine(3)|lung(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13						TTGATCCTCTGTCTCCTGGTG	0.567																																																0			22											100.0	93.0	95.0					22																	18567998		2203	4300	6503	16947998	SO:0001583	missense	55670			AB089678	CCDS13750.1, CCDS56221.1	22q11.21	2008-08-26	2008-08-26		ENSG00000215193	ENSG00000215193			22965	protein-coding gene	gene with protein product		608666	"""peroxisome biogenesis factor 26"""			12717447, 12851857	Standard	NM_017929		Approved	FLJ20695	uc002znp.4	Q7Z412	OTTHUMG00000149970	ENST00000329627.7:c.788G>T	22.37:g.18567998G>T	ENSP00000331106:p.Cys263Phe		16947998	F6UBB5|Q7Z413|Q7Z414|Q7Z415|Q7Z416|Q96B12|Q9NWQ0|Q9NXU0	Missense_Mutation	SNP	HMMPfam_Pex26	p.C263F	ENST00000329627.7	37	c.788	CCDS13750.1	22	.	.	.	.	.	.	.	.	.	.	G	16.29	3.080599	0.55753	.	.	ENSG00000215193	ENST00000329627;ENST00000399744;ENST00000399746	D;D	0.93811	-3.29;-3.29	5.77	5.77	0.91146	.	0.175224	0.39020	U	0.001500	D	0.93979	0.8072	M	0.68317	2.08	0.80722	D	1	D	0.56746	0.977	P	0.54544	0.755	D	0.92253	0.5810	10	0.34782	T	0.22	-10.2298	10.2635	0.43441	0.0934:0.0:0.9066:0.0	.	263	Q7Z412	PEX26_HUMAN	F	263	ENSP00000331106:C263F;ENSP00000382648:C263F	ENSP00000331106:C263F	C	+	2	0	PEX26	16947998	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	3.119000	0.50422	2.732000	0.93576	0.655000	0.94253	TGT	-	HMMPfam_Pex26		0.567	PEX26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PEX26	protein_coding	OTTHUMT00000314644.3	G	NM_017929		16947998	+1	no_errors	NM_017929	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
CUBN	8029	genome.wustl.edu	37	10	17151705	17151705	+	Missense_Mutation	SNP	G	G	T			TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chr10:17151705G>T	ENST00000377833.4	-	10	1110	c.1045C>A	c.(1045-1047)Ctc>Atc	p.L349I		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	349	EGF-like 5. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	ATGTCTGTGAGTGTGCACACT	0.488																																																0			10											184.0	128.0	147.0					10																	17151705		2203	4300	6503	17191711	SO:0001583	missense	8029			AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.1045C>A	10.37:g.17151705G>T	ENSP00000367064:p.Leu349Ile		17191711	B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	PatternScan_ASX_HYDROXYL,HMMPfam_CUB,HMMSmart_SM00042,superfamily_Spermadhesin CUB domain,HMMSmart_SM00179,HMMPfam_EGF,HMMSmart_SM00181,PatternScan_EGF_1,PatternScan_EGF_2,HMMPfam_EGF_CA,PatternScan_EGF_CA,superfamily_EGF/Laminin	p.L349I	ENST00000377833.4	37	c.1045	CCDS7113.1	10	.	.	.	.	.	.	.	.	.	.	G	8.139	0.784720	0.16189	.	.	ENSG00000107611	ENST00000377833	D	0.95554	-3.74	5.64	2.72	0.32119	Growth factor, receptor (1);Epidermal growth factor-like, type 3 (1);	0.603639	0.13676	N	0.370520	D	0.90417	0.7000	L	0.29908	0.895	0.31534	N	0.660823	B	0.13145	0.007	B	0.11329	0.006	D	0.83744	0.0205	10	0.22706	T	0.39	.	10.0111	0.41986	0.0691:0.2588:0.672:0.0	.	349	O60494	CUBN_HUMAN	I	349	ENSP00000367064:L349I	ENSP00000367064:L349I	L	-	1	0	CUBN	17191711	0.174000	0.23070	0.001000	0.08648	0.737000	0.42083	2.656000	0.46716	0.391000	0.25143	-0.252000	0.11476	CTC	-	superfamily_EGF/Laminin		0.488	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUBN	protein_coding	OTTHUMT00000047009.1	G	NM_001081		17191711	-1	no_errors	NM_001081	genbank	human	reviewed	54_36p	missense	SNP	0.036	T
LLGL1	3996	genome.wustl.edu	37	17	18141444	18141444	+	Silent	SNP	C	C	T			TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chr17:18141444C>T	ENST00000316843.4	+	15	2064	c.1968C>T	c.(1966-1968)ctC>ctT	p.L656L		NM_004140.3	NP_004131	Q15334	L2GL1_HUMAN	lethal giant larvae homolog 1 (Drosophila)	656					axonogenesis (GO:0007409)|cortical actin cytoskeleton organization (GO:0030866)|exocytosis (GO:0006887)|Golgi to plasma membrane transport (GO:0006893)|maintenance of apical/basal cell polarity (GO:0035090)|positive regulation of Rab GTPase activity (GO:0032851)|protein complex assembly (GO:0006461)	cell projection (GO:0042995)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|early endosome membrane (GO:0031901)|Golgi cis cisterna (GO:0000137)|myelin sheath abaxonal region (GO:0035748)|trans-Golgi network membrane (GO:0032588)	protein kinase binding (GO:0019901)|Rab GTPase activator activity (GO:0005097)|structural molecule activity (GO:0005198)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(6)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	21	all_neural(463;0.228)					TGAAGTCTCTCAAGAAGTCAC	0.607																																																0			17											48.0	45.0	46.0					17																	18141444		2203	4300	6503	18082169	SO:0001819	synonymous_variant	3996				CCDS32586.1	17p11.2	2013-01-10	2001-11-28		ENSG00000131899	ENSG00000131899		"""WD repeat domain containing"""	6628	protein-coding gene	gene with protein product		600966	"""lethal giant larvae (Drosophila) homolog 1"""	DLG4, LLGL, HUGL, HUGL-1		7542763, 8565641	Standard	XM_005256643		Approved		uc002gsp.3	Q15334	OTTHUMG00000059396	ENST00000316843.4:c.1968C>T	17.37:g.18141444C>T			18082169	A7MBM7|O00188|Q58F11|Q86UK6	Silent	SNP	HMMSmart_SM00320,superfamily_WD40 repeat-like,PatternScan_WD_REPEATS_1,HMMPfam_LLGL,HMMPfam_WD40	p.L656	ENST00000316843.4	37	c.1968	CCDS32586.1	17																																																																																			-	NULL		0.607	LLGL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LLGL1	protein_coding	OTTHUMT00000132067.3	C			18082169	+1	no_errors	NM_004140	genbank	human	reviewed	54_36p	silent	SNP	1.000	T
TUBA3C	7278	genome.wustl.edu	37	13	19751365	19751365	+	Missense_Mutation	SNP	G	G	C	rs139914455	byFrequency	TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chr13:19751365G>C	ENST00000400113.3	-	4	862	c.758C>G	c.(757-759)aCg>aGg	p.T253R		NM_006001.2	NP_005992.1	Q13748	TBA3C_HUMAN	tubulin, alpha 3c	253					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(4)|prostate(7)|skin(7)|urinary_tract(1)	72		all_cancers(29;1.31e-20)|all_epithelial(30;1.59e-20)|all_lung(29;6.91e-20)|Lung NSC(5;9.25e-17)|Hepatocellular(1;0.0207)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;6.78e-06)|Epithelial(112;3.79e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00172)|Lung(94;0.0186)|LUSC - Lung squamous cell carcinoma(192;0.108)		CTGGAATTCCGTCAAGTCCAC	0.617																																																0			13											150.0	132.0	138.0					13																	19751365		2203	4300	6503	18649365	SO:0001583	missense	7278			AF005392	CCDS9284.1	13q12.11	2007-06-20	2007-02-12	2007-02-12	ENSG00000198033	ENSG00000198033		"""Tubulins"""	12408	protein-coding gene	gene with protein product		602528	"""tubulin, alpha 2"""	TUBA2		9465305	Standard	NM_006001		Approved	bA408E5.3	uc009zzj.3	Q13748	OTTHUMG00000016481	ENST00000400113.3:c.758C>G	13.37:g.19751365G>C	ENSP00000382982:p.Thr253Arg		18649365	A6NJQ0|Q5W099|Q6PEY3|Q96F18	Missense_Mutation	SNP	superfamily_Tubulin nucleotide-binding domain-like,HMMPfam_Tubulin,PatternScan_TUBULIN,superfamily_Tubulin C-terminal domain-like,HMMPfam_Tubulin_C	p.T253R	ENST00000400113.3	37	c.758	CCDS9284.1	13	.	.	.	.	.	.	.	.	.	.	g	9.597	1.127743	0.20959	.	.	ENSG00000198033	ENST00000400113;ENST00000360801	D	0.83075	-1.68	1.19	1.19	0.21007	.	0.000000	0.48286	U	0.000189	D	0.84575	0.5502	.	.	.	0.44937	D	0.997957	.	.	.	.	.	.	D	0.83999	0.0342	7	0.72032	D	0.01	.	8.3297	0.32178	0.0:0.0:1.0:0.0	.	.	.	.	R	253	ENSP00000382982:T253R	ENSP00000354037:T253R	T	-	2	0	TUBA3C	18649365	1.000000	0.71417	0.954000	0.39281	0.213000	0.24496	4.987000	0.63857	0.972000	0.38314	0.175000	0.17021	ACG	-	superfamily_Tubulin C-terminal domain-like,HMMPfam_Tubulin_C		0.617	TUBA3C-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	TUBA3C	protein_coding	OTTHUMT00000044007.2	G	NM_006001		18649365	-1	no_errors	NM_006001	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
PLCZ1	89869	genome.wustl.edu	37	12	18846611	18846611	+	Intron	SNP	G	G	C			TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chr12:18846611G>C	ENST00000538330.1	-	8	1189				PLCZ1_ENST00000541695.1_Intron|PLCZ1_ENST00000447925.2_Intron|PLCZ1_ENST00000542762.1_5'Flank|PLCZ1_ENST00000534932.1_Intron|PLCZ1_ENST00000435379.1_Intron|PLCZ1_ENST00000539875.1_Intron|PLCZ1_ENST00000266505.7_Intron					phospholipase C, zeta 1											NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	31	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.0241)					CAATTCTGGTGGTGAGAGAGA	0.428																																																0			12																																								18737878	SO:0001627	intron_variant	643668			AY035866	CCDS8680.1	12p13.31	2013-01-10			ENSG00000139151	ENSG00000139151	3.1.4.11	"""EF-hand domain containing"""	19218	protein-coding gene	gene with protein product		608075				12117804	Standard	NM_033123		Approved	NYD-SP27, PLCzeta	uc021qvx.2	Q86YW0	OTTHUMG00000168937	ENST00000538330.1:c.807+1232C>G	12.37:g.18846611G>C			18737878		RNA	SNP	-	NULL	ENST00000538330.1	37	NULL		12																																																																																			-	-		0.428	PLCZ1-002	PUTATIVE	basic|exp_conf	protein_coding	LOC643668	protein_coding	OTTHUMT00000401666.3	G	NM_033123		18737878	+1	pseudogene	XR_016986	genbank	human	model	54_36p	rna	SNP	1.000	C
SYT17	51760	genome.wustl.edu	37	16	19236110	19236110	+	Missense_Mutation	SNP	G	G	C			TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chr16:19236110G>C	ENST00000355377.2	+	7	1576	c.1178G>C	c.(1177-1179)aGc>aCc	p.S393T	SYT17_ENST00000568433.1_Missense_Mutation_p.S87T|SYT17_ENST00000562034.1_Missense_Mutation_p.S332T|SYT17_ENST00000568115.1_Missense_Mutation_p.S332T|SYT17_ENST00000562711.2_Missense_Mutation_p.S389T	NM_016524.2	NP_057608.2	Q9BSW7	SYT17_HUMAN	synaptotagmin XVII	393	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				exocytosis (GO:0006887)	membrane (GO:0016020)|synaptic vesicle (GO:0008021)|trans-Golgi network (GO:0005802)	transporter activity (GO:0005215)			NS(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|skin(1)	17						GAATCCTTCAGCTTCAAAGTT	0.443																																																0			16											116.0	115.0	115.0					16																	19236110		2197	4300	6497	19143611	SO:0001583	missense	51760				CCDS10575.1	16p12.3	2013-01-21			ENSG00000103528	ENSG00000103528		"""Synaptotagmins"""	24119	protein-coding gene	gene with protein product	"""B/K protein"""					10493829	Standard	NM_016524		Approved		uc002dfw.3	Q9BSW7	OTTHUMG00000131461	ENST00000355377.2:c.1178G>C	16.37:g.19236110G>C	ENSP00000347538:p.Ser393Thr		19143611	O43330|Q9NZ18	Missense_Mutation	SNP	superfamily_C2_CaLB,HMMSmart_C2,HMMPfam_C2	p.S393T	ENST00000355377.2	37	c.1178	CCDS10575.1	16	.	.	.	.	.	.	.	.	.	.	G	21.2	4.112205	0.77210	.	.	ENSG00000103528	ENST00000355377	T	0.68479	-0.33	5.05	5.05	0.67936	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	T	0.67683	0.2919	N	0.25789	0.76	0.80722	D	1	D;D	0.56521	0.976;0.976	D;P	0.65140	0.932;0.908	T	0.61073	-0.7136	10	0.02654	T	1	.	18.405	0.90532	0.0:0.0:1.0:0.0	.	393;332	Q9BSW7;B4DJB2	SYT17_HUMAN;.	T	393	ENSP00000347538:S393T	ENSP00000347538:S393T	S	+	2	0	SYT17	19143611	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.378000	0.90144	2.355000	0.79922	0.561000	0.74099	AGC	-	superfamily_C2_CaLB,HMMSmart_C2,HMMPfam_C2		0.443	SYT17-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYT17	protein_coding	OTTHUMT00000254286.2	G	NM_016524		19143611	+1	no_errors	NM_016524	genbank	human	validated	54_36p	missense	SNP	1.000	C
SLC47A1	55244	genome.wustl.edu	37	17	19480786	19480786	+	Silent	SNP	C	C	A			TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chr17:19480786C>A	ENST00000270570.4	+	17	1719	c.1633C>A	c.(1633-1635)Cgg>Agg	p.R545R	AC025627.7_ENST00000420951.1_RNA|SLC47A1_ENST00000571335.1_Silent_p.R291R|RP11-1113L8.1_ENST00000574267.1_RNA|SLC47A1_ENST00000395585.1_Silent_p.R545R|SLC47A1_ENST00000575023.1_Silent_p.R243R|SLC47A1_ENST00000457293.1_Silent_p.R545R|SLC47A1_ENST00000436810.2_3'UTR	NM_018242.2	NP_060712.2	Q96FL8	S47A1_HUMAN	solute carrier family 47 (multidrug and toxin extrusion), member 1	545					organic cation transport (GO:0015695)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|membrane-bounded vesicle (GO:0031988)|plasma membrane (GO:0005886)	drug transmembrane transporter activity (GO:0015238)|monovalent cation:proton antiporter activity (GO:0005451)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(4)|lung(5)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	23	all_cancers(12;2.49e-05)|all_epithelial(12;0.00263)|Hepatocellular(7;0.00345)				Aciclovir(DB00787)|Bromodiphenhydramine(DB01237)|Cephalexin(DB00567)|Cimetidine(DB00501)|Metformin(DB00331)|Sirolimus(DB00877)	GCTGGTGCTGCGGCGAGGGCT	0.522																																																0			17											140.0	147.0	145.0					17																	19480786		2203	4300	6503	19421378	SO:0001819	synonymous_variant	55244				CCDS11209.1	17p11.2	2013-07-17	2013-07-17		ENSG00000142494	ENSG00000142494		"""Solute carriers"""	25588	protein-coding gene	gene with protein product	"""multidrug and toxin extrusion 1"""	609832				16330770, 16996621, 16928787	Standard	NM_018242		Approved	FLJ10847, MATE1	uc002gvy.1	Q96FL8	OTTHUMG00000059466	ENST00000270570.4:c.1633C>A	17.37:g.19480786C>A			19421378	Q53HF5|Q6PD77|Q86VL4|Q9NVA3	Silent	SNP	HMMPfam_MatE	p.R545	ENST00000270570.4	37	c.1633	CCDS11209.1	17																																																																																			-	NULL		0.522	SLC47A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC47A1	protein_coding	OTTHUMT00000132250.1	C	NM_018242		19421378	+1	no_errors	NM_018242	genbank	human	validated	54_36p	silent	SNP	0.003	A
PDILT	204474	genome.wustl.edu	37	16	20371968	20371968	+	Nonsense_Mutation	SNP	A	A	T			TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chr16:20371968A>T	ENST00000302451.4	-	11	1676	c.1428T>A	c.(1426-1428)taT>taA	p.Y476*		NM_174924.1	NP_777584.1	Q8N807	PDILT_HUMAN	protein disulfide isomerase-like, testis expressed	476					cell migration (GO:0016477)|cell redox homeostasis (GO:0045454)|multicellular organismal development (GO:0007275)|protein folding (GO:0006457)|spermatid development (GO:0007286)	endoplasmic reticulum (GO:0005783)	protein disulfide isomerase activity (GO:0003756)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(13)|liver(1)|lung(33)|prostate(3)|skin(1)|urinary_tract(1)	61						GTTCTCCCTTATACAGGACAG	0.488																																																0			16											152.0	139.0	143.0					16																	20371968		2203	4300	6503	20279469	SO:0001587	stop_gained	204474				CCDS10584.1	16p12.3	2011-11-10	2009-02-23		ENSG00000169340	ENSG00000169340		"""Protein disulfide isomerases"""	27338	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 7"", ""protein disulfide isomerase-like protein of the testis"""					15475357	Standard	NM_174924		Approved	PDIA7	uc002dhc.1	Q8N807	OTTHUMG00000131487	ENST00000302451.4:c.1428T>A	16.37:g.20371968A>T	ENSP00000305465:p.Tyr476*		20279469	Q8IVQ5	Nonsense_Mutation	SNP	PatternScan_THIOREDOXIN_1,superfamily_Thiordxn-like_fd,HMMPfam_Thioredoxin,PatternScan_ER_TARGET	p.Y476*	ENST00000302451.4	37	c.1428	CCDS10584.1	16	.	.	.	.	.	.	.	.	.	.	A	28.0	4.879794	0.91740	.	.	ENSG00000169340	ENST00000302451	.	.	.	4.58	-1.4	0.08968	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.6459	0.34005	0.563:0.0:0.437:0.0	.	.	.	.	X	476	.	ENSP00000305465:Y476X	Y	-	3	2	PDILT	20279469	0.096000	0.21769	0.003000	0.11579	0.037000	0.13140	-0.186000	0.09670	-0.288000	0.09051	-0.297000	0.09499	TAT	-	superfamily_Thiordxn-like_fd		0.488	PDILT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDILT	protein_coding	OTTHUMT00000254332.1	A	NM_174924		20279469	-1	no_errors	NM_174924	genbank	human	provisional	54_36p	nonsense	SNP	0.368	T
NOP9	161424	genome.wustl.edu	37	14	24770921	24770921	+	Missense_Mutation	SNP	C	C	G			TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chr14:24770921C>G	ENST00000267425.3	+	3	894	c.801C>G	c.(799-801)gaC>gaG	p.D267E	NOP9_ENST00000396802.3_Missense_Mutation_p.D267E|DHRS1_ENST00000288111.7_5'Flank|DHRS1_ENST00000396813.1_5'Flank	NM_174913.1	NP_777573.1	Q86U38	NOP9_HUMAN	NOP9 nucleolar protein	267							poly(A) RNA binding (GO:0044822)										TTCTGAAGGACATTGCAGGTA	0.493																																																0			14											96.0	83.0	87.0					14																	24770921		2203	4300	6503	23840761	SO:0001583	missense	161424				CCDS9624.1, CCDS66616.1	14q12	2012-12-10	2012-12-10	2012-06-06	ENSG00000196943	ENSG00000196943			19826	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 21"", ""NOP9 nucleolar protein homolog (yeast)"""	C14orf21		21653694	Standard	XM_005267385		Approved		uc001wol.1	Q86U38	OTTHUMG00000029342	ENST00000267425.3:c.801C>G	14.37:g.24770921C>G	ENSP00000267425:p.Asp267Glu		23840761	A8MY76|Q8IVF0|Q8TBS6	Missense_Mutation	SNP	superfamily_ARM-type_fold,HMMPfam_PUF,HMMSmart_Pumilio	p.D267E	ENST00000267425.3	37	c.801	CCDS9624.1	14	.	.	.	.	.	.	.	.	.	.	C	18.36	3.606003	0.66445	.	.	ENSG00000196943	ENST00000267425;ENST00000396802	T;T	0.13778	2.56;2.56	5.46	3.51	0.40186	Armadillo-type fold (1);	0.105290	0.64402	D	0.000005	T	0.22781	0.0550	L	0.56769	1.78	0.31888	N	0.617535	D	0.64830	0.994	P	0.61397	0.888	T	0.05419	-1.0886	10	0.09084	T	0.74	-5.8723	9.3343	0.38040	0.0:0.8145:0.0:0.1855	.	267	Q86U38	CN021_HUMAN	E	267	ENSP00000267425:D267E;ENSP00000380020:D267E	ENSP00000267425:D267E	D	+	3	2	C14orf21	23840761	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	0.517000	0.22832	1.538000	0.49270	0.655000	0.94253	GAC	-	superfamily_ARM-type_fold,HMMSmart_Pumilio		0.493	NOP9-004	KNOWN	basic|appris_principal|CCDS	protein_coding	C14orf21	protein_coding	OTTHUMT00000073186.2	C			23840761	+1	no_errors	NM_174913	genbank	human	predicted	54_36p	missense	SNP	1.000	G
SUZ12	23512	genome.wustl.edu	37	17	30322729	30322729	+	Missense_Mutation	SNP	T	T	A			TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chr17:30322729T>A	ENST00000322652.5	+	14	1971	c.1742T>A	c.(1741-1743)gTa>gAa	p.V581E	SUZ12_ENST00000580398.1_Missense_Mutation_p.V558E	NM_015355.2	NP_056170.2	Q15022	SUZ12_HUMAN	SUZ12 polycomb repressive complex 2 subunit	581	VEFS-box.				histone ubiquitination (GO:0016574)|negative regulation of cell differentiation (GO:0045596)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell proliferation (GO:0008284)|transcription, DNA-templated (GO:0006351)	ESC/E(Z) complex (GO:0035098)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|sex chromatin (GO:0001739)	chromatin binding (GO:0003682)|histone methyltransferase activity (GO:0042054)|metal ion binding (GO:0046872)|methylated histone binding (GO:0035064)|RNA binding (GO:0003723)|sequence-specific DNA binding (GO:0043565)		SSH2/SUZ12(2)|JAZF1/SUZ12(133)	breast(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(4)|lung(5)|skin(1)	21		Myeloproliferative disorder(56;0.0255)|all_hematologic(16;0.041)|Ovarian(249;0.182)|Breast(31;0.231)				GAAATGGAAGTAGATAGTGAA	0.353			T	JAZF1	endometrial stromal tumours																																		Dom	yes		17	17q11.2	23512	suppressor of zeste 12 homolog (Drosophila)		M	0			17											79.0	74.0	76.0					17																	30322729		2203	4300	6503	27346842	SO:0001583	missense	23512			D63881	CCDS11270.1	17q21	2013-06-05	2013-06-05		ENSG00000178691	ENSG00000178691		"""Zinc fingers, C2H2-type"""	17101	protein-coding gene	gene with protein product		606245	"""suppressor of zeste 12 homolog (Drosophila)"""			8590280, 11371647, 18784248	Standard	NM_015355		Approved	JJAZ1, KIAA0160, CHET9	uc002hgs.2	Q15022	OTTHUMG00000132813	ENST00000322652.5:c.1742T>A	17.37:g.30322729T>A	ENSP00000316578:p.Val581Glu		27346842	Q96BD9	Missense_Mutation	SNP	HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1,HMMPfam_VEFS-Box	p.V581E	ENST00000322652.5	37	c.1742	CCDS11270.1	17	.	.	.	.	.	.	.	.	.	.	t	12.20	1.867833	0.32977	.	.	ENSG00000178691	ENST00000322652	T	0.41758	0.99	4.96	4.96	0.65561	Polycomb protein, VEFS-Box (1);	0.118831	0.56097	D	0.000033	T	0.35885	0.0947	L	0.49350	1.555	0.58432	D	0.999992	B;B	0.15141	0.012;0.01	B;B	0.19666	0.011;0.026	T	0.18304	-1.0341	10	0.07644	T	0.81	-8.1993	14.6107	0.68514	0.0:0.0:0.0:1.0	.	581;581	A8K1U9;Q15022	.;SUZ12_HUMAN	E	581	ENSP00000316578:V581E	ENSP00000316578:V581E	V	+	2	0	SUZ12	27346842	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.005000	0.57075	1.835000	0.53391	0.379000	0.24179	GTA	-	HMMPfam_VEFS-Box		0.353	SUZ12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUZ12	protein_coding	OTTHUMT00000256260.2	T	NM_015355		27346842	+1	no_errors	NM_015355	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
CHN2	1124	genome.wustl.edu	37	7	29438004	29438004	+	Silent	SNP	C	C	T			TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chr7:29438004C>T	ENST00000222792.6	+	5	722	c.192C>T	c.(190-192)atC>atT	p.I64I	CHN2_ENST00000495789.2_Silent_p.I77I|CHN2_ENST00000539406.1_Silent_p.I139I|CHN2_ENST00000435288.2_Silent_p.I64I|CHN2_ENST00000546235.1_Silent_p.I49I|CHN2_ENST00000539389.1_Intron	NM_004067.2	NP_004058.1	P52757	CHIO_HUMAN	chimerin 2	64	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				positive regulation of GTPase activity (GO:0043547)|positive regulation of signal transduction (GO:0009967)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|SH3/SH2 adaptor activity (GO:0005070)			breast(2)|endometrium(3)|large_intestine(2)|lung(12)|ovary(2)|urinary_tract(2)	23						ATGGGATCATCTCTCGGGAGC	0.522																																					Ovarian(1;44 48 13232 18918 31480)											0			7											153.0	128.0	136.0					7																	29438004		2203	4300	6503	29404529	SO:0001819	synonymous_variant	1124			L29126	CCDS5420.1	7p15.3	2013-02-14	2012-10-17		ENSG00000106069	ENSG00000106069		"""Rho GTPase activating proteins"", ""SH2 domain containing"""	1944	protein-coding gene	gene with protein product	"""beta chimerin"", ""chimaerin 2"""	602857	"""chimerin (chimaerin) 2"""			8175705	Standard	XM_005249602		Approved	ARHGAP3, RhoGAP3	uc003szz.3	P52757	OTTHUMG00000023063	ENST00000222792.6:c.192C>T	7.37:g.29438004C>T			29404529	A4D1A2|B3VCF1|B3VCF2|B3VCF3|B3VCF7|B3VCG1|C9J7B0|E9PGE0|F8QPL9|Q2M203|Q75MM2	Missense_Mutation	SNP	NULL	p.S48F	ENST00000222792.6	37	c.143	CCDS5420.1	7																																																																																			-	NULL		0.522	CHN2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CHN2	protein_coding	OTTHUMT00000214228.2	C	NM_004067		29404529	+1	no_errors	ENST00000409350	ensembl	human	known	54_36p	missense	SNP	1.000	T
IL1RAPL1	11141	genome.wustl.edu	37	X	29938193	29938193	+	Missense_Mutation	SNP	G	G	A	rs200419221		TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chrX:29938193G>A	ENST00000378993.1	+	8	1712	c.1039G>A	c.(1039-1041)Gtt>Att	p.V347I	IL1RAPL1_ENST00000302196.4_Missense_Mutation_p.V347I	NM_014271.3	NP_055086.1	Q9NZN1	IRPL1_HUMAN	interleukin 1 receptor accessory protein-like 1	347	Ig-like C2-type 3.				calcium ion transmembrane transport (GO:0070588)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of exocytosis (GO:0045920)|neuron differentiation (GO:0030182)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|regulation of neuron projection development (GO:0010975)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	receptor binding (GO:0005102)|voltage-gated calcium channel activity (GO:0005245)			biliary_tract(1)|breast(1)|endometrium(5)|large_intestine(9)|lung(38)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	62						ACACGCCAGCGTTCTCCTTCA	0.413																																																0			X											121.0	97.0	105.0					X																	29938193		2202	4300	6502	29848114	SO:0001583	missense	11141			AJ243874	CCDS14218.1	Xp22.1-p21.3	2013-01-29	2004-02-13		ENSG00000169306	ENSG00000169306		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5996	protein-coding gene	gene with protein product		300206	"""mental retardation, X-linked 34"", ""mental retardation, X-linked 21"", ""mental retardation, X-linked 10"""	IL1RAPL, MRX34, MRX21, MRX10		10471494, 10757639	Standard	NM_014271		Approved	OPHN4, TIGIRR-2, IL1R8	uc004dby.2	Q9NZN1	OTTHUMG00000021317	ENST00000378993.1:c.1039G>A	X.37:g.29938193G>A	ENSP00000368278:p.Val347Ile		29848114	A0AVG4|Q9UJ53	Missense_Mutation	SNP	superfamily_Immunoglobulin,HMMSmart_SM00409,HMMPfam_ig,HMMSmart_SM00408,superfamily_Toll/Interleukin receptor TIR domain,HMMSmart_SM00255,HMMPfam_TIR	p.V347I	ENST00000378993.1	37	c.1039	CCDS14218.1	X	.	.	.	.	.	.	.	.	.	.	G	8.206	0.799275	0.16397	.	.	ENSG00000169306	ENST00000378993;ENST00000302196	T;T	0.67865	-0.29;-0.29	6.03	4.17	0.49024	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.256486	0.39544	N	0.001326	T	0.45994	0.1370	N	0.16266	0.395	0.30919	N	0.728182	B	0.10296	0.003	B	0.15484	0.013	T	0.40136	-0.9579	9	.	.	.	.	8.2191	0.31530	0.3543:0.0:0.6457:0.0	.	347	Q9NZN1	IRPL1_HUMAN	I	347	ENSP00000368278:V347I;ENSP00000305200:V347I	.	V	+	1	0	IL1RAPL1	29848114	0.959000	0.32827	0.972000	0.41901	0.954000	0.61252	1.646000	0.37249	0.594000	0.29761	0.523000	0.50628	GTT	-	superfamily_Immunoglobulin,HMMSmart_SM00409		0.413	IL1RAPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL1RAPL1	protein_coding	OTTHUMT00000056155.1	G	NM_014271		29848114	+1	no_errors	NM_014271	genbank	human	reviewed	54_36p	missense	SNP	0.999	A
EPB41L1	2036	genome.wustl.edu	37	20	34782204	34782204	+	Silent	SNP	G	G	A			TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chr20:34782204G>A	ENST00000338074.2	+	12	1532	c.1371G>A	c.(1369-1371)gaG>gaA	p.E457E	EPB41L1_ENST00000373950.2_Silent_p.E360E|EPB41L1_ENST00000441639.1_Silent_p.E395E|EPB41L1_ENST00000373946.3_Silent_p.E426E|EPB41L1_ENST00000373941.1_Silent_p.E457E|EPB41L1_ENST00000202028.5_Silent_p.E395E	NM_001258329.1|NM_012156.2	NP_001245258.1|NP_036288.2	Q9H4G0	E41L1_HUMAN	erythrocyte membrane protein band 4.1-like 1	457					cortical actin cytoskeleton organization (GO:0030866)|synaptic transmission (GO:0007268)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)	structural molecule activity (GO:0005198)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(10)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	37	Breast(12;0.0239)					AGCGGGATGAGGATGGCGAGT	0.592																																																0			20											71.0	53.0	59.0					20																	34782204		2203	4300	6503	34245618	SO:0001819	synonymous_variant	2036			AB002336	CCDS13271.1, CCDS13272.1, CCDS58771.1	20q11.2-q12	2003-03-17			ENSG00000088367	ENSG00000088367			3378	protein-coding gene	gene with protein product		602879				9570967, 9828140	Standard	NM_012156		Approved	KIAA0338	uc002xfb.3	Q9H4G0	OTTHUMG00000032378	ENST00000338074.2:c.1371G>A	20.37:g.34782204G>A			34245618	O15046|Q4VXM6|Q4VXM7|Q4VXM8|Q4VXN4|Q6ZT61|Q8IUU7|Q96CV5|Q96L65	Silent	SNP	HMMSmart_SM00295,superfamily_Ubiquitin-like,HMMPfam_FERM_N,PatternScan_FERM_1,superfamily_Second domain of FERM,HMMPfam_FERM_M,PatternScan_FERM_2,superfamily_PH domain-like,HMMPfam_FERM_C,HMMPfam_FA,HMMPfam_SAB,HMMPfam_4_1_CTD	p.E457	ENST00000338074.2	37	c.1371	CCDS13271.1	20	.	.	.	.	.	.	.	.	.	.	G	9.856	1.194963	0.22037	.	.	ENSG00000088367	ENST00000451082	.	.	.	5.49	0.685	0.18009	.	.	.	.	.	T	0.43322	0.1242	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.22626	-1.0211	4	.	.	.	.	2.8581	0.05578	0.2396:0.1208:0.5094:0.1302	.	.	.	.	K	35	.	.	R	+	2	0	EPB41L1	34245618	0.998000	0.40836	0.995000	0.50966	0.962000	0.63368	0.356000	0.20181	0.254000	0.21573	0.655000	0.94253	AGG	-	NULL		0.592	EPB41L1-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EPB41L1	protein_coding	OTTHUMT00000078978.3	G	NM_012156		34245618	+1	no_errors	NM_012156	genbank	human	reviewed	54_36p	silent	SNP	0.990	A
ZNF76	7629	genome.wustl.edu	37	6	35259447	35259447	+	Silent	SNP	G	G	A	rs377634955		TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chr6:35259447G>A	ENST00000373953.3	+	9	1130	c.864G>A	c.(862-864)ccG>ccA	p.P288P	ZNF76_ENST00000339411.5_Silent_p.P288P|ZNF76_ENST00000440666.2_Silent_p.P262P	NM_003427.3	NP_003418.2	P36508	ZNF76_HUMAN	zinc finger protein 76	288					regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(1)	16						ACACCTGCCCGGAGCCCCACT	0.617																																					Esophageal Squamous(52;92 1039 20612 23956 34676)											0			6						G		0,4406		0,0,2203	58.0	52.0	54.0		864	-7.3	0.6	6		54	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	ZNF76	NM_003427.3		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		288/571	35259447	1,13005	2203	4300	6503	35367425	SO:0001819	synonymous_variant	7629			M91592	CCDS4801.1, CCDS75435.1	6p21.31	2013-01-08	2011-02-25		ENSG00000065029	ENSG00000065029		"""Zinc fingers, C2H2-type"""	13149	protein-coding gene	gene with protein product		194549	"""zinc finger protein 76 (expressed in testis)"""	D6S229E		1427894	Standard	XM_005249364		Approved	Zfp523, ZNF523	uc003oki.1	P36508	OTTHUMG00000014564	ENST00000373953.3:c.864G>A	6.37:g.35259447G>A			35367425	Q9BQB2	Silent	SNP	superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1	p.P288	ENST00000373953.3	37	c.864	CCDS4801.1	6																																																																																			-	superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1		0.617	ZNF76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF76	protein_coding	OTTHUMT00000040279.2	G	NM_003427		35367425	+1	no_errors	NM_003427	genbank	human	provisional	54_36p	silent	SNP	0.685	A
C1orf216	127703	genome.wustl.edu	37	1	36181412	36181412	+	Missense_Mutation	SNP	G	G	A			TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chr1:36181412G>A	ENST00000270815.4	-	2	1281	c.511C>T	c.(511-513)Cac>Tac	p.H171Y	C1orf216_ENST00000503824.1_5'Flank	NM_152374.1	NP_689587.1	Q8TAB5	CA216_HUMAN	chromosome 1 open reading frame 216	171										kidney(2)|lung(3)|skin(2)|urinary_tract(1)	8		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.196)				ATCACCAAGTGCACGTGGTGC	0.607											OREG0013357	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				0			1											181.0	171.0	174.0					1																	36181412		2203	4300	6503	35953999	SO:0001583	missense	127703			AK096303	CCDS395.1	1p34.3	2007-08-10			ENSG00000142686	ENSG00000142686			26800	protein-coding gene	gene with protein product						12477932	Standard	NM_152374		Approved	FLJ38984	uc001bzh.1	Q8TAB5	OTTHUMG00000004167	ENST00000270815.4:c.511C>T	1.37:g.36181412G>A	ENSP00000425166:p.His171Tyr	861	35953999	D3DPS1|Q8N8N6	Missense_Mutation	SNP	NULL	p.H171Y	ENST00000270815.4	37	c.511	CCDS395.1	1	.	.	.	.	.	.	.	.	.	.	G	32	5.182135	0.94885	.	.	ENSG00000142686	ENST00000270815;ENST00000422623	.	.	.	4.79	4.79	0.61399	.	0.063678	0.64402	D	0.000006	T	0.73009	0.3532	L	0.50333	1.59	0.46874	D	0.999237	D	0.62365	0.991	P	0.61477	0.889	T	0.76091	-0.3086	9	0.72032	D	0.01	-20.4184	18.0332	0.89291	0.0:0.0:1.0:0.0	.	171	Q8TAB5	CA216_HUMAN	Y	171;141	.	ENSP00000425166:H171Y	H	-	1	0	C1orf216	35953999	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.713000	0.91408	2.486000	0.83907	0.561000	0.74099	CAC	-	NULL		0.607	C1orf216-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf216	protein_coding	OTTHUMT00000012013.3	G	NM_152374		35953999	-1	no_errors	NM_152374	genbank	human	predicted	54_36p	missense	SNP	1.000	A
NIPBL	25836	genome.wustl.edu	37	5	37003377	37003377	+	Missense_Mutation	SNP	A	A	C			TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chr5:37003377A>C	ENST00000282516.8	+	16	4282	c.3783A>C	c.(3781-3783)aaA>aaC	p.K1261N	NIPBL_ENST00000448238.2_Missense_Mutation_p.K1261N	NM_015384.4|NM_133433.3	NP_056199.2|NP_597677.2	Q6KC79	NIPBL_HUMAN	Nipped-B homolog (Drosophila)	1261					brain development (GO:0007420)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to X-ray (GO:0071481)|cognition (GO:0050890)|developmental growth (GO:0048589)|ear morphogenesis (GO:0042471)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic forelimb morphogenesis (GO:0035115)|embryonic viscerocranium morphogenesis (GO:0048703)|external genitalia morphogenesis (GO:0035261)|eye morphogenesis (GO:0048592)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|forelimb morphogenesis (GO:0035136)|gall bladder development (GO:0061010)|heart morphogenesis (GO:0003007)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|metanephros development (GO:0001656)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of ossification (GO:0045778)|regulation of developmental growth (GO:0048638)|regulation of embryonic development (GO:0045995)|regulation of hair cycle (GO:0042634)|sensory perception of sound (GO:0007605)|stem cell maintenance (GO:0019827)|uterus morphogenesis (GO:0061038)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMC loading complex (GO:0032116)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|histone deacetylase binding (GO:0042826)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)			autonomic_ganglia(1)|breast(4)|endometrium(9)|kidney(22)|large_intestine(21)|liver(1)|lung(47)|ovary(7)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	128	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			CAACTGACAAAACTGTGAAAG	0.279																																																0			5											81.0	93.0	89.0					5																	37003377		2201	4288	6489	37039134	SO:0001583	missense	25836			AB019494	CCDS3920.1, CCDS47198.1	5p13.2	2009-08-28			ENSG00000164190	ENSG00000164190			28862	protein-coding gene	gene with protein product	"""sister chromatid cohesion 2 homolog (yeast)"""	608667				15146186, 15146185	Standard	NM_133433		Approved	IDN3, DKFZp434L1319, FLJ11203, FLJ12597, FLJ13354, FLJ13648, Scc2	uc003jkl.4	Q6KC79	OTTHUMG00000090795	ENST00000282516.8:c.3783A>C	5.37:g.37003377A>C	ENSP00000282516:p.Lys1261Asn		37039134	Q6KCD6|Q6N080|Q6ZT92|Q7Z2E6|Q8N4M5|Q9Y6Y3|Q9Y6Y4	Missense_Mutation	SNP	superfamily_ARM repeat	p.K1261N	ENST00000282516.8	37	c.3783	CCDS3920.1	5	.	.	.	.	.	.	.	.	.	.	A	22.5	4.300269	0.81136	.	.	ENSG00000164190	ENST00000282516;ENST00000448238	T;T	0.56611	0.45;0.45	5.98	5.98	0.97165	.	0.000000	0.85682	D	0.000000	T	0.69405	0.3107	M	0.63843	1.955	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.72338	0.93;0.977	T	0.67098	-0.5756	10	0.34782	T	0.22	.	16.4696	0.84102	1.0:0.0:0.0:0.0	.	1261;1261	Q6KC79;Q6KC79-2	NIPBL_HUMAN;.	N	1261	ENSP00000282516:K1261N;ENSP00000406266:K1261N	ENSP00000282516:K1261N	K	+	3	2	NIPBL	37039134	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.723000	0.54955	2.289000	0.77006	0.482000	0.46254	AAA	-	superfamily_ARM repeat		0.279	NIPBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NIPBL	protein_coding	OTTHUMT00000207582.1	A	NM_015384		37039134	+1	no_errors	NM_133433	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
RHPN2	85415	genome.wustl.edu	37	19	33512482	33512482	+	Missense_Mutation	SNP	G	G	A			TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chr19:33512482G>A	ENST00000254260.3	-	4	420	c.385C>T	c.(385-387)Ctc>Ttc	p.L129F	RHPN2_ENST00000400226.4_Intron	NM_033103.4	NP_149094.3	Q8IUC4	RHPN2_HUMAN	rhophilin, Rho GTPase binding protein 2	129	BRO1. {ECO:0000255|PROSITE- ProRule:PRU00526}.				signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)				NS(1)|breast(3)|central_nervous_system(5)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(3)|skin(3)|urinary_tract(1)	44	Esophageal squamous(110;0.137)					TTTACCTTGAGGACGACTGCA	0.478																																																0			19											115.0	85.0	95.0					19																	33512482		2203	4300	6503	38204322	SO:0001583	missense	85415			AF268032	CCDS12427.1	19q13.12	2008-02-05				ENSG00000131941			19974	protein-coding gene	gene with protein product						12221077	Standard	NM_033103		Approved		uc002nuf.3	Q8IUC4		ENST00000254260.3:c.385C>T	19.37:g.33512482G>A	ENSP00000254260:p.Leu129Phe		38204322	B2RCG8|B3KUY8|B4DUS7|Q8N3T7|Q8N9D6|Q8NE33|Q96RU1	Missense_Mutation	SNP	superfamily_PKN_effector,HMMSmart_Hr1,HMMPfam_HR1,HMMPfam_BRO1,superfamily_PDZ,HMMSmart_PDZ	p.L129F	ENST00000254260.3	37	c.385	CCDS12427.1	19	.	.	.	.	.	.	.	.	.	.	G	7.455	0.643457	0.14451	.	.	ENSG00000131941	ENST00000254260	T	0.34072	1.38	4.02	2.98	0.34508	BRO1 domain (3);	0.186958	0.47093	N	0.000260	T	0.24774	0.0601	L	0.38838	1.175	0.80722	D	1	B	0.19817	0.039	B	0.25140	0.058	T	0.04607	-1.0939	10	0.17369	T	0.5	-0.0062	7.4011	0.26965	0.2055:0.0:0.7945:0.0	.	129	Q8IUC4	RHPN2_HUMAN	F	129	ENSP00000254260:L129F	ENSP00000254260:L129F	L	-	1	0	RHPN2	38204322	1.000000	0.71417	0.914000	0.36105	0.824000	0.46624	3.797000	0.55514	0.878000	0.35920	0.557000	0.71058	CTC	-	HMMPfam_BRO1		0.478	RHPN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RHPN2	protein_coding	OTTHUMT00000450828.2	G	NM_033103		38204322	-1	no_errors	NM_033103	genbank	human	provisional	54_36p	missense	SNP	0.630	A
CD300LG	146894	genome.wustl.edu	37	17	41926033	41926033	+	Missense_Mutation	SNP	T	T	C			TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chr17:41926033T>C	ENST00000317310.4	+	2	192	c.151T>C	c.(151-153)Tgc>Cgc	p.C51R	CD300LG_ENST00000539718.1_Missense_Mutation_p.C51R|CD300LG_ENST00000586233.1_Missense_Mutation_p.C51R|CD300LG_ENST00000293396.8_Missense_Mutation_p.C51R|CD300LG_ENST00000377203.4_Missense_Mutation_p.C51R|CD300LG_ENST00000588884.1_Missense_Mutation_p.C51R	NM_145273.3	NP_660316.2	Q6UXG3	CLM9_HUMAN	CD300 molecule-like family member g	51	Ig-like V-type.				immune system process (GO:0002376)|immunoglobulin transcytosis in epithelial cells (GO:0002414)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(2)|lung(5)|skin(4)	19		Breast(137;0.0199)		BRCA - Breast invasive adenocarcinoma(366;0.115)		GAAGTACTGGTGCAGGAAGGG	0.592																																																0			17											89.0	74.0	79.0					17																	41926033		2203	4300	6503	39281559	SO:0001583	missense	146894			BC025395	CCDS11470.1, CCDS54131.1, CCDS54132.1, CCDS54133.1	17q21.31	2013-01-11	2006-03-29					"""Immunoglobulin superfamily / V-set domain containing"""	30455	protein-coding gene	gene with protein product	"""nepmucin"""	610520	"""CD300 antigen like family member G"""			16876123, 16754720	Standard	NM_001168322		Approved	Trem4, CLM9	uc002iem.3	Q6UXG3		ENST00000317310.4:c.151T>C	17.37:g.41926033T>C	ENSP00000321005:p.Cys51Arg		39281559	B4DNY5|F5H7P9|F8W9M3|Q8IX38|Q8IX39|Q8TA95	Missense_Mutation	SNP	superfamily_Immunoglobulin,HMMPfam_V-set,HMMSmart_SM00409	p.C51R	ENST00000317310.4	37	c.151	CCDS11470.1	17	.	.	.	.	.	.	.	.	.	.	T	11.49	1.655226	0.29425	.	.	ENSG00000161649	ENST00000317310;ENST00000539718;ENST00000377203;ENST00000293396	T;T;T;T	0.65916	-0.18;-0.18;-0.18;-0.18	4.89	3.79	0.43588	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.47852	D	0.000209	D	0.82563	0.5064	H	0.95260	3.645	0.58432	D	0.999999	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;0.999;1.0;1.0;1.0	D	0.83416	0.0030	10	0.87932	D	0	.	8.0548	0.30598	0.1808:0.0:0.0:0.8192	.	51;51;51;51;51;51	F8W9M3;Q6UXG3-3;F5H7P9;Q6UXG3;Q6UXG3-2;B4DNY5	.;.;.;CLM9_HUMAN;.;.	R	51	ENSP00000321005:C51R;ENSP00000442368:C51R;ENSP00000366408:C51R;ENSP00000293396:C51R	ENSP00000293396:C51R	C	+	1	0	CD300LG	39281559	1.000000	0.71417	0.996000	0.52242	0.005000	0.04900	4.250000	0.58772	0.793000	0.33875	-0.333000	0.08304	TGC	-	superfamily_Immunoglobulin,HMMPfam_V-set,HMMSmart_SM00409		0.592	CD300LG-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD300LG	protein_coding	OTTHUMT00000457646.1	T	NM_145273		39281559	+1	no_errors	NM_145273	genbank	human	provisional	54_36p	missense	SNP	1.000	C
SLC25A38	54977	genome.wustl.edu	37	3	39425255	39425255	+	Missense_Mutation	SNP	G	G	A			TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chr3:39425255G>A	ENST00000273158.4	+	1	417	c.40G>A	c.(40-42)Gat>Aat	p.D14N		NM_017875.2	NP_060345.2			solute carrier family 25, member 38											breast(1)|endometrium(1)|large_intestine(1)|lung(6)|skin(1)|stomach(1)	11				KIRC - Kidney renal clear cell carcinoma(284;0.0525)|Kidney(284;0.0661)		GCAACCCCAAGATGTCGGAGA	0.662																																																0			3											52.0	48.0	49.0					3																	39425255		2203	4300	6503	39400259	SO:0001583	missense	54977			BC013194	CCDS2685.1	3p22.1	2013-05-22			ENSG00000144659	ENSG00000144659		"""Solute carriers"""	26054	protein-coding gene	gene with protein product		610819				16949250	Standard	NM_017875		Approved	FLJ20551	uc003cjo.2	Q96DW6	OTTHUMG00000131289	ENST00000273158.4:c.40G>A	3.37:g.39425255G>A	ENSP00000273158:p.Asp14Asn		39400259		Missense_Mutation	SNP	superfamily_Mitoch_carrier,HMMPfam_Mito_carr	p.D14N	ENST00000273158.4	37	c.40	CCDS2685.1	3	.	.	.	.	.	.	.	.	.	.	g	22.7	4.321960	0.81580	.	.	ENSG00000144659	ENST00000273158	T	0.80123	-1.34	4.25	4.25	0.50352	.	0.536026	0.19092	N	0.122922	T	0.67618	0.2912	N	0.22421	0.69	0.29934	N	0.821688	P	0.39665	0.682	B	0.35550	0.205	T	0.71006	-0.4717	10	0.66056	D	0.02	-10.9975	12.0051	0.53255	0.0:0.0:1.0:0.0	.	14	Q96DW6	S2538_HUMAN	N	14	ENSP00000273158:D14N	ENSP00000273158:D14N	D	+	1	0	SLC25A38	39400259	0.999000	0.42202	0.986000	0.45419	0.978000	0.69477	4.326000	0.59241	2.189000	0.69895	0.655000	0.94253	GAT	-	NULL		0.662	SLC25A38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A38	protein_coding	OTTHUMT00000254057.3	G	NM_017875		39400259	+1	no_errors	NM_017875	genbank	human	validated	54_36p	missense	SNP	0.991	A
ELF1	1997	genome.wustl.edu	37	13	41508159	41508159	+	Missense_Mutation	SNP	A	A	T			TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chr13:41508159A>T	ENST00000239882.3	-	9	1576	c.1262T>A	c.(1261-1263)aTa>aAa	p.I421K	ELF1_ENST00000498824.1_5'UTR|ELF1_ENST00000442101.1_Missense_Mutation_p.I397K	NM_172373.3	NP_758961.1	P32519	ELF1_HUMAN	E74-like factor 1 (ets domain transcription factor)	421					cell differentiation (GO:0030154)|negative regulation of T cell receptor signaling pathway (GO:0050860)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokine production (GO:0001817)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(12)|ovary(1)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	37		Lung NSC(96;8.3e-05)|Prostate(109;0.0233)|Breast(139;0.0296)|Lung SC(185;0.0367)		all cancers(112;1.87e-08)|Epithelial(112;8.45e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000202)|GBM - Glioblastoma multiforme(144;0.00266)|BRCA - Breast invasive adenocarcinoma(63;0.072)		TGGAGCCTGTATAGTCCTATT	0.378																																																0			13											88.0	80.0	83.0					13																	41508159		2203	4300	6503	40406159	SO:0001583	missense	1997			M82882	CCDS9374.1	13q13	2008-07-18			ENSG00000120690	ENSG00000120690			3316	protein-coding gene	gene with protein product		189973				1545787	Standard	NM_001145353		Approved		uc001uxs.3	P32519	OTTHUMG00000016783	ENST00000239882.3:c.1262T>A	13.37:g.41508159A>T	ENSP00000239882:p.Ile421Lys		40406159	B4E2I5|E9PDQ9|Q8N6F6|Q9UDE1	Missense_Mutation	SNP	superfamily_SSF46785,HMMPfam_Ets,HMMSmart_ETS,PatternScan_ETS_DOMAIN_1,PatternScan_ETS_DOMAIN_2	p.I421K	ENST00000239882.3	37	c.1262	CCDS9374.1	13	.	.	.	.	.	.	.	.	.	.	A	16.60	3.169423	0.57584	.	.	ENSG00000120690	ENST00000442101;ENST00000379498;ENST00000239882	T;T	0.52526	0.66;0.66	5.44	4.27	0.50696	.	0.299802	0.33253	N	0.005120	T	0.44222	0.1283	L	0.29908	0.895	0.48571	D	0.999676	P;D	0.53462	0.811;0.96	B;P	0.50192	0.427;0.634	T	0.41395	-0.9511	10	0.72032	D	0.01	.	10.9893	0.47541	0.9269:0.0:0.0731:0.0	.	397;421	E9PDQ9;P32519	.;ELF1_HUMAN	K	397;163;421	ENSP00000405580:I397K;ENSP00000239882:I421K	ENSP00000239882:I421K	I	-	2	0	ELF1	40406159	0.996000	0.38824	0.979000	0.43373	0.988000	0.76386	6.865000	0.75500	0.904000	0.36572	0.533000	0.62120	ATA	-	NULL		0.378	ELF1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ELF1	protein_coding	OTTHUMT00000044654.3	A	NM_172373		40406159	-1	no_errors	NM_172373	genbank	human	reviewed	54_36p	missense	SNP	0.996	T
TTC33	23548	genome.wustl.edu	37	5	40716469	40716469	+	Silent	SNP	T	T	C			TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chr5:40716469T>C	ENST00000337702.4	-	5	719	c.567A>G	c.(565-567)gcA>gcG	p.A189A	TTC33_ENST00000503936.2_5'UTR	NM_012382.2	NP_036514.1	Q6PID6	TTC33_HUMAN	tetratricopeptide repeat domain 33	189										NS(1)|large_intestine(1)|lung(6)|ovary(1)|pancreas(1)|urinary_tract(1)	11						CTTCAGCTGGTGCTTCACTTT	0.423																																																0			5											151.0	137.0	142.0					5																	40716469		2203	4300	6503	40752226	SO:0001819	synonymous_variant	23548			BC015701	CCDS3931.1	5p13.1	2013-01-11			ENSG00000113638	ENSG00000113638		"""Tetratricopeptide (TTC) repeat domain containing"""	29959	protein-coding gene	gene with protein product	"""osmosis responsive factor"""					12477932	Standard	NM_012382		Approved	OSRF	uc003jma.3	Q6PID6	OTTHUMG00000131142	ENST00000337702.4:c.567A>G	5.37:g.40716469T>C			40752226	B2R6G0|O95105	Silent	SNP	HMMPfam_TPR_2,HMMSmart_SM00028,superfamily_TPR-like	p.A189	ENST00000337702.4	37	c.567	CCDS3931.1	5																																																																																			-	NULL		0.423	TTC33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC33	protein_coding	OTTHUMT00000253831.1	T	NM_012382		40752226	-1	no_errors	NM_012382	genbank	human	validated	54_36p	silent	SNP	0.000	C
PPHLN1	51535	genome.wustl.edu	37	12	42835124	42835124	+	Missense_Mutation	SNP	G	G	T			TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chr12:42835124G>T	ENST00000395568.2	+	10	1001	c.917G>T	c.(916-918)cGa>cTa	p.R306L	PPHLN1_ENST00000449194.2_Missense_Mutation_p.R287L|PPHLN1_ENST00000432191.2_Missense_Mutation_p.R251L|PPHLN1_ENST00000395580.3_Missense_Mutation_p.R313L|PPHLN1_ENST00000337898.6_Missense_Mutation_p.R251L|PPHLN1_ENST00000552761.1_Missense_Mutation_p.R258L|PPHLN1_ENST00000549190.1_Missense_Mutation_p.R324L|PPHLN1_ENST00000358314.7_Missense_Mutation_p.R306L|PPHLN1_ENST00000317560.9_Missense_Mutation_p.R239L|PPHLN1_ENST00000256678.8_Missense_Mutation_p.R186L	NM_016488.6	NP_057572.5	Q8NEY8	PPHLN_HUMAN	periphilin 1	306					keratinization (GO:0031424)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(5)|kidney(1)|large_intestine(4)|lung(2)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)	16	all_cancers(12;0.00049)|Breast(8;0.165)	Lung NSC(34;0.123)		GBM - Glioblastoma multiforme(48;0.0875)		TAGGTTTACCGACAAGACTGT	0.363																																																0			12											143.0	137.0	139.0					12																	42835124		2203	4300	6503	41121391	SO:0001583	missense	51535			AY157850	CCDS8741.1, CCDS31777.1, CCDS41773.1, CCDS44860.1, CCDS44861.1, CCDS55817.1	12q12	2006-10-24				ENSG00000134283			19369	protein-coding gene	gene with protein product		608150					Standard	NM_016488		Approved		uc001rng.1	Q8NEY8		ENST00000395568.2:c.917G>T	12.37:g.42835124G>T	ENSP00000378935:p.Arg306Leu		41121391	E9PAX8|Q86YT2|Q8IXN3|Q8TB09|Q96NB9|Q9NXL4|Q9P0P6|Q9P0R9	Missense_Mutation	SNP	NULL	p.R306L	ENST00000395568.2	37	c.917	CCDS31777.1	12	.	.	.	.	.	.	.	.	.	.	G	17.70	3.453913	0.63290	.	.	ENSG00000134283	ENST00000549190;ENST00000395580;ENST00000337898;ENST00000358314;ENST00000395568;ENST00000256678;ENST00000449194;ENST00000552761;ENST00000317560;ENST00000432191	.	.	.	6.06	5.15	0.70609	.	0.107759	0.64402	N	0.000009	T	0.68723	0.3032	L	0.49455	1.56	0.48571	D	0.999672	P;P;D;D;D;D;D;P;P;B;P;P	0.89917	0.502;0.679;1.0;0.998;1.0;0.997;1.0;0.876;0.702;0.355;0.702;0.57	B;B;D;D;D;D;D;P;B;B;B;B	0.97110	0.224;0.353;0.999;0.964;1.0;0.939;0.999;0.618;0.334;0.276;0.334;0.261	T	0.69840	-0.5036	9	0.54805	T	0.06	-1.1389	10.8086	0.46533	0.0671:0.0:0.8005:0.1323	.	239;186;232;251;239;251;306;287;306;258;313;324	F8WF16;F8W6A0;B7Z695;B7Z8L1;B7Z615;Q8NEY8-3;Q8NEY8;E9PAX8;Q8NEY8-8;Q8NEY8-6;Q8NEY8-2;F8W0Q9	.;.;.;.;.;.;PPHLN_HUMAN;.;.;.;.;.	L	324;313;251;306;306;186;287;258;239;251	.	ENSP00000256678:R186L	R	+	2	0	PPHLN1	41121391	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	5.407000	0.66363	1.524000	0.49035	0.655000	0.94253	CGA	-	NULL		0.363	PPHLN1-010	KNOWN	basic|CCDS	protein_coding	PPHLN1	protein_coding	OTTHUMT00000404047.1	G	NM_201515		41121391	+1	no_errors	NM_016488	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
BACE2	25825	genome.wustl.edu	37	21	42647522	42647522	+	Missense_Mutation	SNP	T	T	C			TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chr21:42647522T>C	ENST00000330333.6	+	9	1991	c.1528T>C	c.(1528-1530)Tcc>Ccc	p.S510P	BACE2_ENST00000328735.6_3'UTR|BACE2_ENST00000347667.5_Missense_Mutation_p.S460P|BACE2_ENST00000466122.1_3'UTR	NM_012105.3	NP_036237.2	Q9Y5Z0	BACE2_HUMAN	beta-site APP-cleaving enzyme 2	510					membrane protein ectodomain proteolysis (GO:0006509)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|peptide hormone processing (GO:0016486)|proteolysis (GO:0006508)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	aspartic-type endopeptidase activity (GO:0004190)			endometrium(2)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14		Prostate(19;1.57e-07)|all_epithelial(19;0.0251)				CAATGATGAGTCCTCTCTGGT	0.552																																																0			21											127.0	106.0	113.0					21																	42647522		2203	4300	6503	41569392	SO:0001583	missense	25825			AF117892	CCDS13668.1, CCDS13669.1, CCDS13670.1	21q22.3	2011-08-11			ENSG00000182240	ENSG00000182240			934	protein-coding gene	gene with protein product		605668		AEPLC		10965118, 10830953	Standard	NM_138991		Approved	CEAP1, DRAP, ALP56	uc002yyw.3	Q9Y5Z0	OTTHUMG00000086742	ENST00000330333.6:c.1528T>C	21.37:g.42647522T>C	ENSP00000332979:p.Ser510Pro		41569392	A8K7P1|Q5DIH8|Q8N2D4|Q9H2V8|Q9NZL1|Q9NZL2|Q9UJT6	Missense_Mutation	SNP	superfamily_Acid proteases,HMMPfam_Asp,PatternScan_ASP_PROTEASE	p.S510P	ENST00000330333.6	37	c.1528	CCDS13668.1	21	.	.	.	.	.	.	.	.	.	.	T	27.6	4.845153	0.91197	.	.	ENSG00000182240	ENST00000330333;ENST00000347667;ENST00000544566	T;T	0.60797	0.21;0.16	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	T	0.66713	0.2817	L	0.32530	0.975	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.85130	0.997;0.996	T	0.68754	-0.5325	10	0.54805	T	0.06	.	14.8212	0.70074	0.0:0.0:0.0:1.0	.	460;510	Q9Y5Z0-2;Q9Y5Z0	.;BACE2_HUMAN	P	510;460;415	ENSP00000332979:S510P;ENSP00000327528:S460P	ENSP00000332979:S510P	S	+	1	0	BACE2	41569392	1.000000	0.71417	1.000000	0.80357	0.905000	0.53344	6.344000	0.72991	2.097000	0.63578	0.529000	0.55759	TCC	-	NULL		0.552	BACE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BACE2	protein_coding	OTTHUMT00000195056.1	T			41569392	+1	no_errors	NM_012105	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
NR1H3	10062	genome.wustl.edu	37	11	47290222	47290222	+	Missense_Mutation	SNP	C	C	G	rs149895806	byFrequency	TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chr11:47290222C>G	ENST00000467728.1	+	9	2557	c.1319C>G	c.(1318-1320)tCt>tGt	p.S440C	NR1H3_ENST00000441012.2_Missense_Mutation_p.S440C|MADD_ENST00000349238.3_5'Flank|NR1H3_ENST00000481889.2_Missense_Mutation_p.S459C|NR1H3_ENST00000395397.3_Missense_Mutation_p.S395C|MADD_ENST00000395344.3_5'Flank|MADD_ENST00000402799.1_5'Flank|MADD_ENST00000406482.1_5'Flank|NR1H3_ENST00000405853.3_Missense_Mutation_p.S380C|MADD_ENST00000342922.4_5'Flank|NR1H3_ENST00000529540.1_3'UTR|NR1H3_ENST00000405576.1_Missense_Mutation_p.S335C|MADD_ENST00000395336.3_5'Flank|MADD_ENST00000402192.2_5'Flank|MADD_ENST00000407859.3_5'Flank|NR1H3_ENST00000407404.1_Missense_Mutation_p.S380C|RP11-17G12.3_ENST00000543925.1_RNA|RP11-17G12.3_ENST00000545474.1_RNA|NR1H3_ENST00000527949.1_Missense_Mutation_p.S289C|MADD_ENST00000311027.5_5'Flank			Q13133	NR1H3_HUMAN	nuclear receptor subfamily 1, group H, member 3	440					apoptotic cell clearance (GO:0043277)|cellular lipid metabolic process (GO:0044255)|cellular response to lipopolysaccharide (GO:0071222)|cholesterol homeostasis (GO:0042632)|gene expression (GO:0010467)|lipid homeostasis (GO:0055088)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interferon-gamma-mediated signaling pathway (GO:0060336)|negative regulation of lipid transport (GO:0032369)|negative regulation of macrophage activation (GO:0043031)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|negative regulation of pancreatic juice secretion (GO:0090188)|negative regulation of pinocytosis (GO:0048550)|negative regulation of proteolysis (GO:0045861)|negative regulation of secretion of lysosomal enzymes (GO:0090341)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of cholesterol homeostasis (GO:2000189)|positive regulation of cholesterol transport (GO:0032376)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of toll-like receptor 4 signaling pathway (GO:0034145)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of triglyceride biosynthetic process (GO:0010867)|regulation of cholesterol homeostasis (GO:2000188)|regulation of circadian rhythm (GO:0042752)|response to progesterone (GO:0032570)|sterol homeostasis (GO:0055092)|transcription initiation from RNA polymerase II promoter (GO:0006367)|triglyceride homeostasis (GO:0070328)	nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	cholesterol binding (GO:0015485)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|steroid hormone receptor activity (GO:0003707)|sterol response element binding (GO:0032810)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(6)|lung(6)|ovary(5)	20						CCGCTGCTCTCTGAGATCTGG	0.542													C|||	2	0.000399361	0.0	0.0029	5008	,	,		21683	0.0		0.0	False		,,,				2504	0.0															0			11						C	CYS/SER,CYS/SER,CYS/SER	0,4402		0,0,2201	114.0	104.0	107.0		1139,1184,1319	5.8	1.0	11	dbSNP_134	107	3,8593	2.2+/-6.3	0,3,4295	yes	missense,missense,missense	NR1H3	NM_001130101.1,NM_001130102.1,NM_005693.2	112,112,112	0,3,6496	GG,GC,CC		0.0349,0.0,0.0231	probably-damaging,probably-damaging,probably-damaging	380/388,395/403,440/448	47290222	3,12995	2201	4298	6499	47246798	SO:0001583	missense	10062			U22662	CCDS7929.1, CCDS44584.1, CCDS44585.1, CCDS73285.1	11p11.2	2013-01-16			ENSG00000025434	ENSG00000025434		"""Nuclear hormone receptors"""	7966	protein-coding gene	gene with protein product	"""liver X receptor-alpha"""	602423				8621574, 7744246	Standard	NM_005693		Approved	LXR-a, RLD-1	uc009ylm.3	Q13133	OTTHUMG00000150628	ENST00000467728.1:c.1319C>G	11.37:g.47290222C>G	ENSP00000420656:p.Ser440Cys		47246798	A8K3J9|D3DQR1|Q8IW13|Q96H87	Missense_Mutation	SNP	HMMSmart_SM00399,HMMPfam_zf-C4,superfamily_Glucocorticoid receptor-like (DNA-binding domain),PatternScan_NUCLEAR_REC_DBD_1,PatternScan_ZINC_FINGER_C2H2_1,PatternScan_COPPER_BLUE,superfamily_Nuclear receptor ligand-binding domain,HMMSmart_SM00430,HMMPfam_Hormone_recep	p.S440C	ENST00000467728.1	37	c.1319	CCDS7929.1	11	2	9.157509157509158E-4	0	0.0	2	0.0055248618784530384	0	0.0	0	0.0	C	21.9	4.218475	0.79464	0.0	3.49E-4	ENSG00000025434	ENST00000395397;ENST00000405576;ENST00000481889;ENST00000407404;ENST00000441012;ENST00000467728;ENST00000405853;ENST00000527949	D;D;D;D;D;D;D;D	0.95103	-3.61;-3.61;-3.61;-3.61;-3.61;-3.61;-3.61;-3.61	5.8	5.8	0.92144	Nuclear hormone receptor, ligand-binding (2);	0.000000	0.85682	D	0.000000	D	0.92348	0.7572	N	0.11064	0.09	0.80722	D	1	B;D;D;P;D	0.89917	0.149;1.0;1.0;0.752;1.0	B;D;D;B;D	0.85130	0.022;0.986;0.981;0.233;0.997	D	0.93462	0.6811	10	0.44086	T	0.13	.	20.0545	0.97645	0.0:1.0:0.0:0.0	.	446;335;440;459;380	B4DXU5;B5MBY7;Q13133;E9PLL4;Q13133-2	.;.;NR1H3_HUMAN;.;.	C	395;335;459;380;440;440;380;289	ENSP00000378793:S395C;ENSP00000385073:S335C;ENSP00000433271:S459C;ENSP00000385801:S380C;ENSP00000387946:S440C;ENSP00000420656:S440C;ENSP00000384745:S380C;ENSP00000432073:S289C	ENSP00000378793:S395C	S	+	2	0	NR1H3	47246798	1.000000	0.71417	0.997000	0.53966	0.997000	0.91878	7.487000	0.81328	2.748000	0.94277	0.655000	0.94253	TCT	-	superfamily_Nuclear receptor ligand-binding domain,HMMPfam_Hormone_recep		0.542	NR1H3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NR1H3	protein_coding	OTTHUMT00000319214.3	C			47246798	+1	no_errors	NM_005693	genbank	human	validated	54_36p	missense	SNP	0.999	G
ADNP	23394	genome.wustl.edu	37	20	49510649	49510649	+	Missense_Mutation	SNP	C	C	G			TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chr20:49510649C>G	ENST00000396029.3	-	5	1169	c.602G>C	c.(601-603)gGa>gCa	p.G201A	ADNP_ENST00000396032.3_Missense_Mutation_p.G201A|ADNP_ENST00000349014.3_Missense_Mutation_p.G201A|ADNP_ENST00000371602.4_Missense_Mutation_p.G201A	NM_001282531.1|NM_015339.2	NP_001269460.1|NP_056154.1	Q9H2P0	ADNP_HUMAN	activity-dependent neuroprotector homeobox	201					negative regulation of neuron apoptotic process (GO:0043524)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular space (GO:0005615)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(4)|endometrium(7)|kidney(1)|large_intestine(13)|lung(7)|ovary(2)|prostate(2)|skin(2)	39						TGATTTTTCTCCTGCCTTTGC	0.448																																																0			20											125.0	122.0	123.0					20																	49510649		2203	4300	6503	48944056	SO:0001583	missense	23394			AF250860	CCDS13433.1	20q13.13	2011-06-20	2007-07-17		ENSG00000101126	ENSG00000101126		"""Homeoboxes / ZF class"""	15766	protein-coding gene	gene with protein product	"""ADNP homeobox 1"""	611386	"""activity-dependent neuroprotector"""			9872452, 11013255	Standard	NM_015339		Approved	KIAA0784, ADNP1	uc002xvu.1	Q9H2P0	OTTHUMG00000032737	ENST00000396029.3:c.602G>C	20.37:g.49510649C>G	ENSP00000379346:p.Gly201Ala		48944056	E1P5Y2|O94881|Q5BKU2|Q9UG34	Missense_Mutation	SNP	PatternScan_HOMEOBOX_1,HMMSmart_ZnF_C2H2,HMMPfam_zf-C2H2,PatternScan_ZINC_FINGER_C2H2_1,superfamily_Homeodomain_like,HMMSmart_HOX,HMMPfam_Homeobox	p.G201A	ENST00000396029.3	37	c.602	CCDS13433.1	20	.	.	.	.	.	.	.	.	.	.	C	15.19	2.759230	0.49468	.	.	ENSG00000101126	ENST00000371602;ENST00000349014;ENST00000396029;ENST00000396032	T;T;T;T	0.70986	-0.53;-0.53;-0.53;-0.53	6.08	6.08	0.98989	.	0.095560	0.64402	D	0.000001	T	0.63663	0.2530	L	0.40543	1.245	0.58432	D	0.999999	P	0.48503	0.911	B	0.39185	0.293	T	0.60541	-0.7243	10	0.21014	T	0.42	-8.0783	20.6634	0.99662	0.0:1.0:0.0:0.0	.	201	Q9H2P0	ADNP_HUMAN	A	201	ENSP00000360662:G201A;ENSP00000342905:G201A;ENSP00000379346:G201A;ENSP00000379349:G201A	ENSP00000342905:G201A	G	-	2	0	ADNP	48944056	1.000000	0.71417	0.997000	0.53966	0.997000	0.91878	5.707000	0.68370	2.894000	0.99253	0.655000	0.94253	GGA	-	NULL		0.448	ADNP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ADNP	protein_coding	OTTHUMT00000079705.2	C	NM_181442		48944056	-1	no_errors	NM_015339	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
TRIM53CP	340970	genome.wustl.edu	37	11	49007537	49007537	+	IGR	SNP	A	A	G			TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chr11:49007537A>G								OR4A47 (496205 upstream) : TRIM49B (42966 downstream)																							TAGCTTCACAATCCAGGAATA	0.453																																																0			11																																								48964113	SO:0001628	intergenic_variant	340970																															11.37:g.49007537A>G			48964113		RNA	SNP	-	NULL		37	NULL		11																																																																																			-	-	0	0.453					LOC340970			A			48964113	-1	pseudogene	XR_042351	genbank	human	model	54_36p	rna	SNP	1.000	G
EEF1A1P22	645693	genome.wustl.edu	37	15	53230573	53230573	+	IGR	SNP	C	C	G			TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chr15:53230573C>G								RP11-209K10.2 (133434 upstream) : RP11-209E8.1 (177988 downstream)																							CCTTTCCCATCTCAGCAGCCT	0.463																																																0			15											117.0	111.0	113.0					15																	53230573		876	1991	2867	51017865	SO:0001628	intergenic_variant	0																															15.37:g.53230573C>G			51017865		RNA	SNP	-	NULL		37	NULL		15																																																																																			-	-	0	0.463					MIRN1300			C			51017865	-1	no_errors	ENST00000408347	ensembl	human	known	54_36p	rna	SNP	1.000	G
KRT4	3851	genome.wustl.edu	37	12	53207718	53207718	+	Missense_Mutation	SNP	C	C	A			TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chr12:53207718C>A	ENST00000551956.1	-	1	617	c.125G>T	c.(124-126)tGc>tTc	p.C42F	KRT4_ENST00000293774.4_Missense_Mutation_p.C116F|KRT4_ENST00000458244.2_Missense_Mutation_p.C42F			P19013	K2C4_HUMAN	keratin 4	42	Gly-rich.|Head.				cytoskeleton organization (GO:0007010)|epithelial cell differentiation (GO:0030855)|negative regulation of epithelial cell proliferation (GO:0050680)	cell surface (GO:0009986)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			endometrium(3)|kidney(4)|large_intestine(6)|lung(8)|ovary(4)|prostate(2)|skin(2)	29						CCCAGAAGAGCATCGGCCAGC	0.612																																					Pancreas(190;284 2995 41444 45903)											0			12											96.0	108.0	104.0					12																	53207718		2071	4215	6286	51493985	SO:0001583	missense	3851				CCDS41787.1, CCDS41787.2	12q13.13	2013-01-16			ENSG00000170477	ENSG00000170477		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6441	protein-coding gene	gene with protein product	"""cytokeratin 4"", ""keratin, type II cytoskeletal 4"""	123940		CYK4		16831889	Standard	NM_002272		Approved	CK4, K4	uc031qhk.1	P19013		ENST00000551956.1:c.125G>T	12.37:g.53207718C>A	ENSP00000448220:p.Cys42Phe		51493985	F8VS64|Q6GTR8|Q96LA7|Q9BTL1	Missense_Mutation	SNP	HMMPfam_Filament,superfamily_Prefoldin,PatternScan_IF	p.C116F	ENST00000551956.1	37	c.347	CCDS41787.2	12	.	.	.	.	.	.	.	.	.	.	C	16.20	3.056358	0.55325	.	.	ENSG00000170477	ENST00000551956;ENST00000293774;ENST00000458244	T;T;D	0.86097	-0.91;-0.91;-2.07	5.0	5.0	0.66597	.	0.000000	0.52532	D	0.000074	D	0.83381	0.5242	L	0.33624	1.015	0.43846	D	0.996437	.	.	.	.	.	.	T	0.82499	-0.0427	8	0.42905	T	0.14	.	12.8017	0.57591	0.0:0.9196:0.0:0.0804	.	.	.	.	F	42;116;42	ENSP00000448220:C42F;ENSP00000293774:C116F;ENSP00000387904:C42F	ENSP00000293774:C116F	C	-	2	0	KRT4	51493985	1.000000	0.71417	1.000000	0.80357	0.559000	0.35586	6.032000	0.70918	2.705000	0.92388	0.585000	0.79938	TGC	-	NULL		0.612	KRT4-001	KNOWN	upstream_ATG|basic|appris_candidate|CCDS	protein_coding	KRT4	protein_coding	OTTHUMT00000405931.1	C	NM_002272		51493985	-1	no_errors	NM_002272	genbank	human	reviewed	54_36p	missense	SNP	0.976	A
POM121L12	285877	genome.wustl.edu	37	7	53104248	53104248	+	Missense_Mutation	SNP	G	G	T			TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chr7:53104248G>T	ENST00000408890.4	+	1	900	c.884G>T	c.(883-885)gGc>gTc	p.G295V		NM_182595.3	NP_872401.3	Q8N7R1	P1L12_HUMAN	POM121 transmembrane nucleoporin-like 12	295										endometrium(5)|kidney(1)|large_intestine(5)|lung(44)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	61						GGCCCCTTTGGCTCCTAAGAA	0.602																																																0			7											40.0	44.0	43.0					7																	53104248		2008	4170	6178	53071742	SO:0001583	missense	285877				CCDS43584.1	7p12.1	2012-03-13	2012-03-13		ENSG00000221900	ENSG00000221900			25369	protein-coding gene	gene with protein product			"""POM121 membrane glycoprotein-like 12"""				Standard	NM_182595		Approved	DKFZp564N2472	uc003tpz.3	Q8N7R1	OTTHUMG00000155995	ENST00000408890.4:c.884G>T	7.37:g.53104248G>T	ENSP00000386133:p.Gly295Val		53071742	Q8NDI9	Missense_Mutation	SNP	NULL	p.G295V	ENST00000408890.4	37	c.884	CCDS43584.1	7	.	.	.	.	.	.	.	.	.	.	G	11.21	1.572171	0.28092	.	.	ENSG00000221900	ENST00000408890	T	0.30448	1.53	1.78	-1.71	0.08133	.	.	.	.	.	T	0.26340	0.0643	N	0.08118	0	0.09310	N	1	D	0.65815	0.995	D	0.66979	0.948	T	0.16689	-1.0394	9	0.87932	D	0	.	4.103	0.10023	0.1745:0.4832:0.3423:0.0	.	295	Q8N7R1	P1L12_HUMAN	V	295	ENSP00000386133:G295V	ENSP00000386133:G295V	G	+	2	0	POM121L12	53071742	0.001000	0.12720	0.000000	0.03702	0.040000	0.13550	-0.248000	0.08854	-0.493000	0.06678	0.561000	0.74099	GGC	-	NULL		0.602	POM121L12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DKFZp564N2472	protein_coding	OTTHUMT00000342656.1	G	NM_182595		53071742	+1	no_errors	NM_182595	genbank	human	validated	54_36p	missense	SNP	0.009	T
CCDC155	147872	genome.wustl.edu	37	19	49910167	49910167	+	Missense_Mutation	SNP	G	G	A			TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chr19:49910167G>A	ENST00000447857.3	+	10	1028	c.823G>A	c.(823-825)Gat>Aat	p.D275N		NM_144688.4	NP_653289.3	Q8N6L0	KASH5_HUMAN	coiled-coil domain containing 155	275						chromosome, telomeric region (GO:0000781)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(2)|lung(10)|ovary(1)|stomach(1)	22						TGCCGAGCGGGATGGAGTGAA	0.507																																																0			19											51.0	55.0	53.0					19																	49910167		1964	4153	6117	54601979	SO:0001583	missense	147872				CCDS46140.1	19q13.33	2014-01-21			ENSG00000161609	ENSG00000161609			26520	protein-coding gene	gene with protein product							Standard	NM_144688		Approved	FLJ32658, KASH5	uc002pnm.2	Q8N6L0	OTTHUMG00000183170	ENST00000447857.3:c.823G>A	19.37:g.49910167G>A	ENSP00000404220:p.Asp275Asn		54601979	Q96MC3	Missense_Mutation	SNP	NULL	p.D275N	ENST00000447857.3	37	c.823	CCDS46140.1	19	.	.	.	.	.	.	.	.	.	.	G	22.3	4.278214	0.80692	.	.	ENSG00000161609	ENST00000447857	T	0.37915	1.17	5.29	5.29	0.74685	.	0.464615	0.23782	N	0.044617	T	0.52933	0.1765	M	0.70595	2.14	0.29177	N	0.876757	P;D	0.57257	0.944;0.979	P;P	0.56563	0.602;0.801	T	0.52997	-0.8500	10	0.45353	T	0.12	-28.6382	14.8608	0.70379	0.0:0.0:1.0:0.0	.	275;275	C9JGW3;Q8N6L0	.;CC155_HUMAN	N	275	ENSP00000404220:D275N	ENSP00000404220:D275N	D	+	1	0	CCDC155	54601979	0.985000	0.35326	0.974000	0.42286	0.719000	0.41307	3.166000	0.50785	2.675000	0.91044	0.650000	0.86243	GAT	-	NULL		0.507	CCDC155-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC155	protein_coding	OTTHUMT00000465436.2	G	NM_144688		54601979	+1	no_errors	NM_144688	genbank	human	provisional	54_36p	missense	SNP	0.499	A
GPR32	2854	genome.wustl.edu	37	19	51274863	51274863	+	Missense_Mutation	SNP	G	G	T			TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chr19:51274863G>T	ENST00000270590.4	+	1	1143	c.1006G>T	c.(1006-1008)Gcg>Tcg	p.A336S		NM_001506.1	NP_001497.1	O75388	GPR32_HUMAN	G protein-coupled receptor 32	336					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			breast(4)|endometrium(4)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	29		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00641)|GBM - Glioblastoma multiforme(134;0.028)		TTCTGCCCTGGCGAGGGCGTT	0.552																																					Esophageal Squamous(113;152 1581 5732 15840 44398)											0			19											65.0	70.0	68.0					19																	51274863		2203	4300	6503	55966675	SO:0001583	missense	2854			AF045764	CCDS12801.1	19q13.33	2012-08-20			ENSG00000142511	ENSG00000142511		"""GPCR / Class A : Resolvin receptors"""	4487	protein-coding gene	gene with protein product	"""resolvin D1 receptor"""	603195				9653656	Standard	NM_001506		Approved	RVDR1	uc010ycf.3	O75388		ENST00000270590.4:c.1006G>T	19.37:g.51274863G>T	ENSP00000270590:p.Ala336Ser		55966675	Q502U7|Q6NWS5	Missense_Mutation	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.A336S	ENST00000270590.4	37	c.1006	CCDS12801.1	19	.	.	.	.	.	.	.	.	.	.	G	12.98	2.101039	0.37048	.	.	ENSG00000142511	ENST00000270590	T	0.29142	1.58	2.71	1.64	0.23874	.	.	.	.	.	T	0.15825	0.0381	N	0.08118	0	0.22996	N	0.998455	P	0.34757	0.467	B	0.35312	0.2	T	0.16988	-1.0384	9	0.54805	T	0.06	.	7.7068	0.28655	0.1427:0.0:0.8573:0.0	.	336	O75388	GPR32_HUMAN	S	336	ENSP00000270590:A336S	ENSP00000270590:A336S	A	+	1	0	GPR32	55966675	1.000000	0.71417	0.237000	0.24090	0.739000	0.42172	5.575000	0.67430	0.411000	0.25702	0.313000	0.20887	GCG	-	superfamily_SSF81321		0.552	GPR32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR32	protein_coding	OTTHUMT00000465016.1	G			55966675	+1	no_errors	NM_001506	genbank	human	provisional	54_36p	missense	SNP	0.804	T
GLI1	2735	genome.wustl.edu	37	12	57860054	57860054	+	Missense_Mutation	SNP	G	G	A	rs201621277		TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chr12:57860054G>A	ENST00000228682.2	+	8	885	c.794G>A	c.(793-795)cGg>cAg	p.R265Q	GLI1_ENST00000543426.1_Missense_Mutation_p.R137Q|GLI1_ENST00000546141.1_Missense_Mutation_p.R224Q	NM_005269.2	NP_005260.1	P08151	GLI1_HUMAN	GLI family zinc finger 1	265					cerebellar cortex morphogenesis (GO:0021696)|digestive tract morphogenesis (GO:0048546)|dorsal/ventral pattern formation (GO:0009953)|epidermal cell differentiation (GO:0009913)|lung development (GO:0030324)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|notochord regression (GO:0060032)|osteoblast differentiation (GO:0001649)|pituitary gland development (GO:0021983)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA replication (GO:0045740)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proximal/distal pattern formation (GO:0009954)|regulation of smoothened signaling pathway (GO:0008589)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in regulation of cerebellar granule cell precursor cell proliferation (GO:0021938)|spermatogenesis (GO:0007283)|ventral midline development (GO:0007418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|primary cilium (GO:0072372)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(8)|lung(22)|ovary(6)|pancreas(2)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69			GBM - Glioblastoma multiforme(3;3.99e-32)			CACGGGGAGCGGAAGGAGTTC	0.597													G|||	1	0.000199681	0.0	0.0	5008	,	,		18788	0.0		0.001	False		,,,				2504	0.0				Pancreas(157;841 1936 10503 41495 50368)											0			12											157.0	153.0	154.0					12																	57860054		2203	4300	6503	56146321	SO:0001583	missense	2735				CCDS8940.1, CCDS53806.1, CCDS53807.1	12q13.2-q13.3	2013-01-25	2009-03-05	2005-01-14		ENSG00000111087		"""Zinc fingers, C2H2-type"""	4317	protein-coding gene	gene with protein product		165220	"""glioma-associated oncogene homolog 1 (zinc finger protein)"", ""glioma-associated oncogene family zinc finger 1"""	GLI		2850480	Standard	NM_005269		Approved		uc001snx.3	P08151		ENST00000228682.2:c.794G>A	12.37:g.57860054G>A	ENSP00000228682:p.Arg265Gln		56146321	D0EUY3|E9PQQ9|F5H6H8|Q8TDN9	Missense_Mutation	SNP	superfamily_SSF57667,HMMPfam_zf-C2H2,HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1	p.R265Q	ENST00000228682.2	37	c.794	CCDS8940.1	12	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	13.56	2.272870	0.40194	.	.	ENSG00000111087	ENST00000532291;ENST00000543426;ENST00000228682;ENST00000546141;ENST00000528467;ENST00000443131	D;D;D;D;D	0.91180	-2.8;-2.8;-2.8;-2.8;-2.8	4.03	4.03	0.46877	Zinc finger, C2H2 (1);	0.185246	0.25971	N	0.027135	T	0.70833	0.3269	N	0.02539	-0.55	0.34817	D	0.738262	P	0.49185	0.92	B	0.34242	0.178	T	0.79453	-0.1797	10	0.87932	D	0	.	6.2844	0.21025	0.2068:0.0:0.7932:0.0	.	265	P08151	GLI1_HUMAN	Q	137;137;265;224;224;137	ENSP00000436671:R137Q;ENSP00000437607:R137Q;ENSP00000228682:R265Q;ENSP00000441006:R224Q;ENSP00000434408:R224Q	ENSP00000228682:R265Q	R	+	2	0	GLI1	56146321	1.000000	0.71417	1.000000	0.80357	0.276000	0.26787	5.238000	0.65366	2.247000	0.74100	0.591000	0.81541	CGG	-	superfamily_SSF57667		0.597	GLI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLI1	protein_coding	OTTHUMT00000394197.1	G	NM_005269		56146321	+1	no_errors	NM_005269	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
VPS4B	9525	genome.wustl.edu	37	18	61078732	61078732	+	Missense_Mutation	SNP	T	T	C			TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chr18:61078732T>C	ENST00000238497.5	-	2	310	c.107A>G	c.(106-108)cAt>cGt	p.H36R	VPS4B_ENST00000591519.1_Missense_Mutation_p.H36R	NM_004869.3	NP_004860.2	O75351	VPS4B_HUMAN	vacuolar protein sorting 4 homolog B (S. cerevisiae)	36	MIT.				ATP catabolic process (GO:0006200)|cell cycle (GO:0007049)|cell division (GO:0051301)|endosomal transport (GO:0016197)|endosome organization (GO:0007032)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|intracellular cholesterol transport (GO:0032367)|membrane organization (GO:0061024)|positive regulation of viral release from host cell (GO:1902188)|potassium ion transport (GO:0006813)|protein transport (GO:0015031)|regulation of viral process (GO:0050792)|response to lipid (GO:0033993)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|lysosome (GO:0005764)|nucleus (GO:0005634)|vacuolar membrane (GO:0005774)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled (GO:0042623)|protein C-terminus binding (GO:0008022)			breast(1)|large_intestine(3)|lung(6)|ovary(1)|upper_aerodigestive_tract(2)	13						CTGCACAGCATGCTGATAGAG	0.383																																																0			18											111.0	104.0	106.0					18																	61078732		2203	4300	6503	59229712	SO:0001583	missense	9525			AF038960	CCDS11983.1	18q21.33	2010-04-21	2006-04-04	2002-06-14	ENSG00000119541	ENSG00000119541		"""ATPases / AAA-type"""	10895	protein-coding gene	gene with protein product		609983	"""suppressor of K+ transport defect 1"", ""vacuolar protein sorting 4B (yeast)"""	SKD1		11563910	Standard	XM_006722582		Approved	VPS4-2, SKD1B	uc002lix.3	O75351	OTTHUMG00000132790	ENST00000238497.5:c.107A>G	18.37:g.61078732T>C	ENSP00000238497:p.His36Arg		59229712	Q69HW4|Q9GZS7	Missense_Mutation	SNP	HMMSmart_SM00745,HMMPfam_MIT,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00382,HMMPfam_AAA,PatternScan_AAA,HMMPfam_Vps4_C	p.H36R	ENST00000238497.5	37	c.107	CCDS11983.1	18	.	.	.	.	.	.	.	.	.	.	T	16.12	3.033732	0.54896	.	.	ENSG00000119541	ENST00000238497	T	0.69561	-0.41	6.06	6.06	0.98353	MIT (2);	0.423315	0.28398	N	0.015492	T	0.69433	0.3110	M	0.63428	1.95	0.58432	D	0.999993	B;B	0.20164	0.042;0.012	B;B	0.32980	0.156;0.156	T	0.65467	-0.6161	10	0.41790	T	0.15	-19.6888	16.286	0.82722	0.0:0.0:0.0:1.0	.	36;36	A8K4G7;O75351	.;VPS4B_HUMAN	R	36	ENSP00000238497:H36R	ENSP00000238497:H36R	H	-	2	0	VPS4B	59229712	1.000000	0.71417	0.981000	0.43875	0.906000	0.53458	4.884000	0.63135	2.323000	0.78572	0.528000	0.53228	CAT	-	HMMSmart_SM00745,HMMPfam_MIT		0.383	VPS4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS4B	protein_coding	OTTHUMT00000256198.2	T	NM_004869		59229712	-1	no_errors	NM_004869	genbank	human	reviewed	54_36p	missense	SNP	0.998	C
TAT	6898	genome.wustl.edu	37	16	71605982	71605982	+	Intron	SNP	C	C	T			TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chr16:71605982C>T	ENST00000355962.4	-	6	840				RP11-432I5.1_ENST00000561529.1_RNA	NM_000353.2	NP_000344.1	P17735	ATTY_HUMAN	tyrosine aminotransferase						2-oxoglutarate metabolic process (GO:0006103)|biosynthetic process (GO:0009058)|cellular nitrogen compound metabolic process (GO:0034641)|glutamate metabolic process (GO:0006536)|L-phenylalanine catabolic process (GO:0006559)|response to glucocorticoid (GO:0051384)|response to mercury ion (GO:0046689)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|tyrosine catabolic process (GO:0006572)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	amino acid binding (GO:0016597)|L-phenylalanine:2-oxoglutarate aminotransferase activity (GO:0080130)|L-tyrosine:2-oxoglutarate aminotransferase activity (GO:0004838)|pyridoxal phosphate binding (GO:0030170)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(9)|ovary(2)|prostate(1)|skin(3)	29		Ovarian(137;0.125)		Kidney(780;0.0157)	L-Phenylalanine(DB00120)|L-Tyrosine(DB00135)	AGCTCCCCACCTCCACCCCAG	0.483																																					Melanoma(198;542 2142 10292 21661 50033)|Esophageal Squamous(48;487 1013 5572 44395 52594)											0			16																																								70163483	SO:0001627	intron_variant	0				CCDS10903.1	16q22.1	2012-10-02			ENSG00000198650	ENSG00000198650	2.6.1.5		11573	protein-coding gene	gene with protein product		613018					Standard	NM_000353		Approved		uc002fap.2	P17735	OTTHUMG00000137590	ENST00000355962.4:c.706+106G>A	16.37:g.71605982C>T			70163483	B2R8I1|D3DWS2	Missense_Mutation	SNP	NULL	p.P97L	ENST00000355962.4	37	c.290	CCDS10903.1	16																																																																																			-	NULL		0.483	TAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC100132529	protein_coding	OTTHUMT00000268989.1	C			70163483	+1	no_errors	XM_001719539	genbank	human	model	54_36p	missense	SNP	0.003	T
CHRDL2	25884	genome.wustl.edu	37	11	74408313	74408313	+	Missense_Mutation	SNP	C	C	G			TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chr11:74408313C>G	ENST00000376332.3	-	10	1646	c.1150G>C	c.(1150-1152)Gtc>Ctc	p.V384L	CHRDL2_ENST00000263671.5_Missense_Mutation_p.S402T	NM_001278473.1	NP_001265402.1	Q6WN34	CRDL2_HUMAN	chordin-like 2	384					cartilage development (GO:0051216)|cell differentiation (GO:0030154)|ossification (GO:0001503)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)				endometrium(1)|kidney(1)|large_intestine(6)|lung(4)|prostate(1)|skin(2)	15	Hepatocellular(1;0.098)					TGCTTCCTGACTTTCTTGATC	0.547																																																0			11											119.0	108.0	112.0					11																	74408313		2200	4293	6493	74085961	SO:0001583	missense	25884			AL110168	CCDS8234.1, CCDS60893.1	11q13.4	2013-09-20			ENSG00000054938	ENSG00000054938			24168	protein-coding gene	gene with protein product		613127				12853144, 12975309	Standard	NM_015424		Approved	BNF1	uc001ovh.3	Q6WN34	OTTHUMG00000165623	ENST00000376332.3:c.1150G>C	11.37:g.74408313C>G	ENSP00000365510:p.Val384Leu		74085961	A5PKU9|Q6WN30|Q6WN31|Q6WN32|Q7Z5J3	Missense_Mutation	SNP	HMMPfam_VWC,HMMSmart_VWC,PatternScan_VWFC_1	p.S402T	ENST00000376332.3	37	c.1205		11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.02|16.02	3.002876|3.002876	0.54254|0.54254	.|.	.|.	ENSG00000054938|ENSG00000054938	ENST00000263671|ENST00000529912;ENST00000376332	T|T	0.50001|0.47869	0.76|0.83	5.28|5.28	5.28|5.28	0.74379|0.74379	.|.	0.985432|.	0.08309|.	N|.	0.965701|.	T|T	0.27241|0.27241	0.0668|0.0668	N|N	0.08118|0.08118	0|0	0.33531|0.33531	D|D	0.593634|0.593634	D|B	0.56968|0.12013	0.978|0.005	P|B	0.47402|0.09377	0.546|0.004	T|T	0.28808|0.28808	-1.0032|-1.0032	10|9	0.12103|0.34782	T|T	0.63|0.22	-1.191|-1.191	9.9309|9.9309	0.41521|0.41521	0.0:0.9069:0.0:0.0931|0.0:0.9069:0.0:0.0931	.|.	402|384	Q6WN34-2|Q6WN34	.|CRDL2_HUMAN	T|L	402|42;384	ENSP00000263671:S402T|ENSP00000365510:V384L	ENSP00000263671:S402T|ENSP00000365510:V384L	S|V	-|-	2|1	0|0	CHRDL2|CHRDL2	74085961|74085961	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	3.798000|3.798000	0.55522|0.55522	2.449000|2.449000	0.82847|0.82847	0.591000|0.591000	0.81541|0.81541	AGT|GTC	-	NULL		0.547	CHRDL2-002	KNOWN	basic	protein_coding	CHRDL2	protein_coding	OTTHUMT00000385391.1	C			74085961	-1	no_errors	NM_015424	genbank	human	validated	54_36p	missense	SNP	1.000	G
ANKRD17	26057	genome.wustl.edu	37	4	73968168	73968168	+	Missense_Mutation	SNP	C	C	G			TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chr4:73968168C>G	ENST00000358602.4	-	25	4614	c.4498G>C	c.(4498-4500)Gaa>Caa	p.E1500Q	ANKRD17_ENST00000509867.2_Missense_Mutation_p.E1387Q|ANKRD17_ENST00000330838.6_Missense_Mutation_p.E1249Q	NM_032217.3	NP_115593.3	O75179	ANR17_HUMAN	ankyrin repeat domain 17	1500					blood vessel maturation (GO:0001955)|negative regulation of smooth muscle cell differentiation (GO:0051151)|viral process (GO:0016032)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(3)|breast(2)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(39)|ovary(6)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)	96	Breast(15;0.000295)		Epithelial(6;8.86e-07)|OV - Ovarian serous cystadenocarcinoma(6;6.22e-06)|all cancers(17;1.51e-05)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			TCAATTTCTTCTAGTTTCctt	0.368																																																0			4											183.0	180.0	181.0					4																	73968168		2203	4300	6503	74187032	SO:0001583	missense	26057			AB014597	CCDS34003.1, CCDS34004.1, CCDS68721.1	4q21.1-q21.21	2013-01-10			ENSG00000132466	ENSG00000132466		"""Ankyrin repeat domain containing"""	23575	protein-coding gene	gene with protein product		615929				11165478	Standard	NM_032217		Approved	GTAR, KIAA0697, FLJ22206, NY-BR-16	uc003hgp.3	O75179	OTTHUMG00000160826	ENST00000358602.4:c.4498G>C	4.37:g.73968168C>G	ENSP00000351416:p.Glu1500Gln		74187032	E7EUV3|G5E964|Q6PJ85|Q6PK85|Q6PKA2|Q86XI3|Q8NDR5|Q96I86|Q9H288|Q9H6J9	Missense_Mutation	SNP	superfamily_Ankyrin repeat,HMMSmart_SM00248,HMMPfam_Ank,HMMPfam_MutS_V,superfamily_Eukaryotic type KH-domain (KH-domain type I),HMMSmart_SM00322,HMMPfam_KH_1	p.E1500Q	ENST00000358602.4	37	c.4498	CCDS34004.1	4	.	.	.	.	.	.	.	.	.	.	C	28.6	4.930455	0.92389	.	.	ENSG00000132466	ENST00000358602;ENST00000330838;ENST00000509867	T;T;T	0.67523	1.5;-0.26;-0.27	5.69	5.69	0.88448	.	0.168935	0.39759	N	0.001279	T	0.73179	0.3554	N	0.24115	0.695	0.47819	D	0.99952	D;D;D;D	0.67145	0.996;0.996;0.993;0.993	D;D;D;D	0.78314	0.991;0.991;0.979;0.968	T	0.76321	-0.3002	10	0.72032	D	0.01	.	18.3883	0.90473	0.0:1.0:0.0:0.0	.	1499;1249;1500;1387	O75179-2;G5E964;O75179;E7EUV3	.;.;ANR17_HUMAN;.	Q	1500;1249;1387	ENSP00000351416:E1500Q;ENSP00000332265:E1249Q;ENSP00000427151:E1387Q	ENSP00000332265:E1249Q	E	-	1	0	ANKRD17	74187032	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.999000	0.70665	2.682000	0.91365	0.585000	0.79938	GAA	-	NULL		0.368	ANKRD17-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANKRD17	protein_coding	OTTHUMT00000362475.1	C	NM_032217		74187032	-1	no_errors	NM_032217	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
LOC646127	646127	genome.wustl.edu	37	X	74547351	74547351	+	IGR	SNP	T	T	G			TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chrX:74547351T>G								UPRT (22916 upstream) : ZDHHC15 (40910 downstream)																							TTAAATTCTATATTTCTTCAT	0.323																																																0			X																																								74464076	SO:0001628	intergenic_variant	0																															X.37:g.74547351T>G			74464076		RNA	SNP	-	NULL		37	NULL		X																																																																																			-	-	0	0.323					LOC646127			T			74464076	-1	pseudogene	XR_037591	genbank	human	model	54_36p	rna	SNP	0.799	G
OR2AT4	341152	genome.wustl.edu	37	11	74800043	74800043	+	Missense_Mutation	SNP	C	C	T			TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chr11:74800043C>T	ENST00000305159.3	-	1	756	c.716G>A	c.(715-717)cGg>cAg	p.R239Q		NM_001005285.1	NP_001005285.1	A6NND4	O2AT4_HUMAN	olfactory receptor, family 2, subfamily AT, member 4	239						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|large_intestine(3)|lung(3)|ovary(1)|upper_aerodigestive_tract(2)	12						GGCTTTTGCCCGTCCTTCTAG	0.582																																																0			11											54.0	52.0	53.0					11																	74800043		2200	4293	6493	74477691	SO:0001583	missense	341152			BK004820	CCDS31639.1	11q13.4	2012-08-09			ENSG00000171561	ENSG00000171561		"""GPCR / Class A : Olfactory receptors"""	19620	protein-coding gene	gene with protein product							Standard	NM_001005285		Approved		uc010rro.2	A6NND4	OTTHUMG00000165370	ENST00000305159.3:c.716G>A	11.37:g.74800043C>T	ENSP00000304846:p.Arg239Gln		74477691	B9EGZ8	Missense_Mutation	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.R239Q	ENST00000305159.3	37	c.716	CCDS31639.1	11	.	.	.	.	.	.	.	.	.	.	C	13.08	2.130710	0.37630	.	.	ENSG00000171561	ENST00000305159	T	0.43294	0.95	5.12	3.25	0.37280	GPCR, rhodopsin-like superfamily (1);	0.250633	0.20813	N	0.085207	T	0.57431	0.2053	M	0.70275	2.135	0.09310	N	1	D	0.67145	0.996	P	0.62885	0.908	T	0.49762	-0.8905	10	0.62326	D	0.03	.	9.9918	0.41877	0.0:0.832:0.0:0.168	.	239	A6NND4	O2AT4_HUMAN	Q	239	ENSP00000304846:R239Q	ENSP00000304846:R239Q	R	-	2	0	OR2AT4	74477691	0.000000	0.05858	0.074000	0.20217	0.413000	0.31143	-0.636000	0.05465	0.661000	0.30985	-0.133000	0.14855	CGG	-	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1		0.582	OR2AT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2AT4	protein_coding	OTTHUMT00000383734.1	C	NM_001005285		74477691	-1	no_errors	NM_001005285	genbank	human	provisional	54_36p	missense	SNP	0.002	T
LY96	23643	genome.wustl.edu	37	8	74939060	74939060	+	Missense_Mutation	SNP	G	G	C			TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chr8:74939060G>C	ENST00000284818.2	+	4	459	c.368G>C	c.(367-369)gGa>gCa	p.G123A	LY96_ENST00000518893.1_Missense_Mutation_p.G93A	NM_015364.4	NP_056179	Q9Y6Y9	LY96_HUMAN	lymphocyte antigen 96	123	Interaction with lipopolysaccharide.				cell surface receptor signaling pathway (GO:0007166)|cellular defense response (GO:0006968)|detection of lipopolysaccharide (GO:0032497)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)|response to lipopolysaccharide (GO:0032496)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	endosome membrane (GO:0010008)|extracellular region (GO:0005576)|lipopolysaccharide receptor complex (GO:0046696)|plasma membrane (GO:0005886)	coreceptor activity (GO:0015026)|lipopolysaccharide receptor activity (GO:0001875)			endometrium(1)|large_intestine(2)|lung(1)|upper_aerodigestive_tract(1)	5	Breast(64;0.0311)		Epithelial(68;0.0208)|BRCA - Breast invasive adenocarcinoma(89;0.0499)|all cancers(69;0.0619)			TCCTTCAAGGGAATAAAATTT	0.299																																					GBM(131;1357 1748 34893 50149 52212)											0			8											83.0	81.0	82.0					8																	74939060		2203	4297	6500	75101614	SO:0001583	missense	23643			AB018549	CCDS6216.1, CCDS56540.1	8q13.3	2004-01-22			ENSG00000154589	ENSG00000154589			17156	protein-coding gene	gene with protein product		605243				10359581, 11466383	Standard	NM_015364		Approved	MD-2	uc003yad.3	Q9Y6Y9	OTTHUMG00000164504	ENST00000284818.2:c.368G>C	8.37:g.74939060G>C	ENSP00000284818:p.Gly123Ala		75101614	B3Y6A5|E5RJJ7	Missense_Mutation	SNP	HMMPfam_E1_DerP2_DerF2,HMMSmart_SM00737	p.G123A	ENST00000284818.2	37	c.368	CCDS6216.1	8	.	.	.	.	.	.	.	.	.	.	G	1.385	-0.582422	0.03827	.	.	ENSG00000154589	ENST00000284818;ENST00000518893	T;T	0.39406	1.08;1.08	3.64	1.77	0.24775	MD-2-related lipid-recognition (2);Immunoglobulin E-set (1);	0.527930	0.17140	N	0.185493	T	0.36799	0.0980	M	0.76838	2.35	0.09310	N	1	B	0.30114	0.269	B	0.21917	0.037	T	0.26643	-1.0097	10	0.39692	T	0.17	-3.4039	5.1346	0.14928	0.1166:0.2108:0.6727:0.0	.	123	Q9Y6Y9	LY96_HUMAN	A	123;93	ENSP00000284818:G123A;ENSP00000430533:G93A	ENSP00000284818:G123A	G	+	2	0	LY96	75101614	0.002000	0.14202	0.004000	0.12327	0.006000	0.05464	0.229000	0.17833	0.500000	0.27991	0.655000	0.94253	GGA	-	HMMPfam_E1_DerP2_DerF2,HMMSmart_SM00737		0.299	LY96-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LY96	protein_coding	OTTHUMT00000379032.2	G	NM_015364		75101614	+1	no_errors	NM_015364	genbank	human	validated	54_36p	missense	SNP	0.748	C
POU3F4	5456	genome.wustl.edu	37	X	82763382	82763382	+	Missense_Mutation	SNP	T	T	A			TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chrX:82763382T>A	ENST00000373200.2	+	1	114	c.50T>A	c.(49-51)cTa>cAa	p.L17Q	RP3-326L13.3_ENST00000607789.1_lincRNA|RP3-326L13.2_ENST00000607095.1_RNA	NM_000307.3	NP_000298	P49335	PO3F4_HUMAN	POU class 3 homeobox 4	17					cochlea morphogenesis (GO:0090103)|forebrain neuron differentiation (GO:0021879)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|sensory perception of sound (GO:0007605)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	AT DNA binding (GO:0003680)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	37						TCCACCTCCCTAGTCCATGCG	0.547																																																0			X											63.0	46.0	52.0					X																	82763382		2203	4300	6503	82650038	SO:0001583	missense	5456			X82324	CCDS14450.1	Xq21.1	2011-06-20	2007-07-13		ENSG00000196767	ENSG00000196767		"""Homeoboxes / POU class"""	9217	protein-coding gene	gene with protein product	"""brain-4"""	300039	"""POU domain class 3, transcription factor 4"""	DFN3		7911044, 7581392	Standard	NM_000307		Approved	BRN4, OTF9, DFNX2	uc004eeg.2	P49335	OTTHUMG00000021919	ENST00000373200.2:c.50T>A	X.37:g.82763382T>A	ENSP00000362296:p.Leu17Gln		82650038	B2RC71|Q5H9G9|Q99410	Missense_Mutation	SNP	HMMPfam_Pou,HMMSmart_POU,superfamily_Lambda_like_DNA,PatternScan_POU_1,PatternScan_POU_2,superfamily_Homeodomain_like,HMMSmart_HOX,HMMPfam_Homeobox,PatternScan_HOMEOBOX_1	p.L17Q	ENST00000373200.2	37	c.50	CCDS14450.1	X	.	.	.	.	.	.	.	.	.	.	T	12.03	1.815334	0.32053	.	.	ENSG00000196767	ENST00000373200	D	0.86097	-2.07	4.46	4.46	0.54185	.	0.206066	0.39687	N	0.001288	T	0.76047	0.3933	L	0.39898	1.24	0.37819	D	0.928306	P	0.44006	0.824	B	0.36719	0.231	T	0.79127	-0.1931	10	0.51188	T	0.08	.	8.8238	0.35043	0.0:0.0:0.1869:0.8131	.	17	P49335	PO3F4_HUMAN	Q	17	ENSP00000362296:L17Q	ENSP00000362296:L17Q	L	+	2	0	POU3F4	82650038	1.000000	0.71417	0.778000	0.31720	0.962000	0.63368	4.927000	0.63440	1.753000	0.51906	0.483000	0.47432	CTA	-	NULL		0.547	POU3F4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POU3F4	protein_coding	OTTHUMT00000057368.2	T	NM_000307		82650038	+1	no_errors	NM_000307	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
ME3	10873	genome.wustl.edu	37	11	86157520	86157520	+	Missense_Mutation	SNP	T	T	C			TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chr11:86157520T>C	ENST00000393324.3	-	12	1643	c.1390A>G	c.(1390-1392)Att>Gtt	p.I464V	RP11-317J19.1_ENST00000524610.1_RNA|ME3_ENST00000543262.1_Missense_Mutation_p.I464V|ME3_ENST00000359636.2_Missense_Mutation_p.I464V	NM_001014811.1	NP_001014811.1	Q16798	MAON_HUMAN	malic enzyme 3, NADP(+)-dependent, mitochondrial	464					aerobic respiration (GO:0009060)|malate metabolic process (GO:0006108)|oxidation-reduction process (GO:0055114)|oxygen metabolic process (GO:0072592)|pyruvate metabolic process (GO:0006090)	mitochondrion (GO:0005739)	cofactor binding (GO:0048037)|malate dehydrogenase (decarboxylating) (NAD+) activity (GO:0004471)|malate dehydrogenase (decarboxylating) (NADP+) activity (GO:0004473)|malic enzyme activity (GO:0004470)|metal ion binding (GO:0046872)|NAD binding (GO:0051287)|oxaloacetate decarboxylase activity (GO:0008948)			endometrium(4)|kidney(1)|large_intestine(7)|lung(7)|ovary(2)|skin(3)|stomach(2)|urinary_tract(1)	27		Acute lymphoblastic leukemia(157;4.34e-06)|all_hematologic(158;0.00252)				CTGGCAAAAATCCCTCGGCCC	0.488																																																0			11											53.0	46.0	48.0					11																	86157520		2202	4299	6501	85835168	SO:0001583	missense	10873			X79440	CCDS8277.1	11q14.2	2012-09-20			ENSG00000151376	ENSG00000151376	1.1.1.40		6985	protein-coding gene	gene with protein product		604626				7818469	Standard	NM_001161586		Approved		uc001pbz.3	Q16798	OTTHUMG00000167217	ENST00000393324.3:c.1390A>G	11.37:g.86157520T>C	ENSP00000376998:p.Ile464Val		85835168	B7Z6V0|Q8TBJ0	Missense_Mutation	SNP	superfamily_SSF53223,HMMPfam_malic,PatternScan_MALIC_ENZYMES,HMMPfam_Malic_M,superfamily_NAD(P)-bd	p.I464V	ENST00000393324.3	37	c.1390	CCDS8277.1	11	.	.	.	.	.	.	.	.	.	.	T	15.40	2.822923	0.50739	.	.	ENSG00000151376	ENST00000359636;ENST00000543262;ENST00000393324;ENST00000524826	T;T;T;T	0.50548	0.74;0.74;0.74;0.74	5.34	5.34	0.76211	Malic enzyme, NAD-binding (2);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.40297	0.1111	L	0.28740	0.885	0.80722	D	1	B	0.19200	0.034	B	0.31686	0.134	T	0.20605	-1.0270	9	.	.	.	-4.4893	15.3077	0.74004	0.0:0.0:0.0:1.0	.	464	Q16798	MAON_HUMAN	V	464	ENSP00000352657:I464V;ENSP00000440246:I464V;ENSP00000376998:I464V;ENSP00000431182:I464V	.	I	-	1	0	ME3	85835168	1.000000	0.71417	0.997000	0.53966	0.966000	0.64601	6.095000	0.71439	2.005000	0.58758	0.528000	0.53228	ATT	-	HMMPfam_Malic_M,superfamily_NAD(P)-bd		0.488	ME3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ME3	protein_coding	OTTHUMT00000393767.2	T			85835168	-1	no_errors	NM_001014811	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
GRID1	2894	genome.wustl.edu	37	10	87484429	87484429	+	Missense_Mutation	SNP	G	G	T			TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chr10:87484429G>T	ENST00000327946.7	-	11	1623	c.1538C>A	c.(1537-1539)gCa>gAa	p.A513E	GRID1_ENST00000536331.1_Missense_Mutation_p.A84E	NM_017551.2	NP_060021.1	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1	513					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|social behavior (GO:0035176)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|ionotropic glutamate receptor complex (GO:0008328)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(46)|ovary(5)|prostate(4)|skin(5)|stomach(4)|upper_aerodigestive_tract(5)	106						GGCCAAGTCTGCTCTCTGAAA	0.527										Multiple Myeloma(13;0.14)																																						0			10											53.0	48.0	50.0					10																	87484429		2203	4300	6503	87474409	SO:0001583	missense	2894			AB033046	CCDS31236.1	10q22	2012-08-29			ENSG00000182771	ENSG00000182771		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4575	protein-coding gene	gene with protein product		610659					Standard	NM_017551		Approved	GluD1, KIAA1220	uc001kdl.1	Q9ULK0	OTTHUMG00000018650	ENST00000327946.7:c.1538C>A	10.37:g.87484429G>T	ENSP00000330148:p.Ala513Glu		87474409	B3KXD5|B7Z7L0|Q8IXT3	Missense_Mutation	SNP	superfamily_Periplasmic binding protein-like I,HMMPfam_ANF_receptor,HMMSmart_SM00079,superfamily_Periplasmic binding protein-like II,HMMPfam_Lig_chan-Glu_bd,HMMPfam_Lig_chan,PatternScan_ALDEHYDE_DEHYDR_GLU	p.A513E	ENST00000327946.7	37	c.1538	CCDS31236.1	10	.	.	.	.	.	.	.	.	.	.	G	32	5.171720	0.94807	.	.	ENSG00000182771	ENST00000327946;ENST00000536331	T;T	0.29917	1.55;1.55	5.83	5.83	0.93111	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (1);	0.000000	0.85682	D	0.000000	T	0.69744	0.3145	H	0.95437	3.67	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	T	0.78841	-0.2045	10	0.87932	D	0	.	19.0851	0.93200	0.0:0.0:1.0:0.0	.	513	Q9ULK0	GRID1_HUMAN	E	513;84	ENSP00000330148:A513E;ENSP00000444455:A84E	ENSP00000330148:A513E	A	-	2	0	GRID1	87474409	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.869000	0.99810	2.741000	0.93983	0.650000	0.86243	GCA	-	HMMSmart_SM00079,superfamily_Periplasmic binding protein-like II		0.527	GRID1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GRID1	protein_coding	OTTHUMT00000049148.3	G	XM_043613		87474409	-1	no_errors	NM_017551	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
TCF25	22980	genome.wustl.edu	37	16	89965209	89965209	+	Missense_Mutation	SNP	C	C	G			TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chr16:89965209C>G	ENST00000263346.8	+	11	1206	c.1150C>G	c.(1150-1152)Ctg>Gtg	p.L384V	TCF25_ENST00000263347.7_Missense_Mutation_p.L149V	NM_014972.2	NP_055787.1	Q9BQ70	TCF25_HUMAN	transcription factor 25 (basic helix-loop-helix)	384					heart development (GO:0007507)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|large_intestine(1)|lung(8)|ovary(3)|skin(1)|urinary_tract(2)	18		all_cancers(9;4.71e-08)|Lung NSC(15;0.000192)|all_lung(18;0.000319)|all_neural(9;0.0122)|all_hematologic(23;0.027)		BRCA - Breast invasive adenocarcinoma(80;0.0288)		CTGCATGCTGCTGCTCATCGA	0.657																																																0			16											68.0	64.0	65.0					16																	89965209		2198	4300	6498	88492710	SO:0001583	missense	22980			AF322111	CCDS10987.1	16q24.3	2008-02-05			ENSG00000141002	ENSG00000141002			29181	protein-coding gene	gene with protein product		612326				12107429, 16574069	Standard	NM_014972		Approved	Nulp1, KIAA1049	uc002fpb.2	Q9BQ70	OTTHUMG00000138986	ENST00000263346.8:c.1150C>G	16.37:g.89965209C>G	ENSP00000263346:p.Leu384Val		88492710	Q2MK75|Q9UPV3	Missense_Mutation	SNP	HMMPfam_DUF654	p.L384V	ENST00000263346.8	37	c.1150	CCDS10987.1	16	.	.	.	.	.	.	.	.	.	.	C	20.6	4.019761	0.75275	.	.	ENSG00000141002	ENST00000263346;ENST00000263347	T;T	0.80653	-1.4;-1.4	5.63	4.68	0.58851	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	D	0.91499	0.7316	M	0.92122	3.275	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.93166	0.6562	10	0.87932	D	0	.	13.5124	0.61519	0.0:0.925:0.0:0.075	.	149;384	Q9H384;Q9BQ70	.;TCF25_HUMAN	V	384;149	ENSP00000263346:L384V;ENSP00000263347:L149V	ENSP00000263346:L384V	L	+	1	2	TCF25	88492710	1.000000	0.71417	1.000000	0.80357	0.618000	0.37518	2.236000	0.43052	1.371000	0.46172	0.561000	0.74099	CTG	-	HMMPfam_DUF654		0.657	TCF25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCF25	protein_coding	OTTHUMT00000272875.2	C	NM_014972		88492710	+1	no_errors	NM_014972	genbank	human	validated	54_36p	missense	SNP	1.000	G
SAMD9L	219285	genome.wustl.edu	37	7	92762082	92762082	+	Missense_Mutation	SNP	T	T	C			TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chr7:92762082T>C	ENST00000318238.4	-	5	4419	c.3203A>G	c.(3202-3204)gAa>gGa	p.E1068G	SAMD9L_ENST00000437805.1_Missense_Mutation_p.E1068G|SAMD9L_ENST00000411955.1_Missense_Mutation_p.E1068G	NM_152703.2	NP_689916.2	Q8IVG5	SAM9L_HUMAN	sterile alpha motif domain containing 9-like	1068					common myeloid progenitor cell proliferation (GO:0035726)|endosomal vesicle fusion (GO:0034058)|hematopoietic progenitor cell differentiation (GO:0002244)|regulation of protein catabolic process (GO:0042176)|spleen development (GO:0048536)|stem cell division (GO:0017145)	early endosome (GO:0005769)				central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(23)|liver(2)|lung(31)|ovary(5)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	88	all_cancers(62;4.15e-11)|all_epithelial(64;2.29e-10)|Breast(17;0.000675)|Lung NSC(181;0.0755)|all_lung(186;0.0989)		STAD - Stomach adenocarcinoma(171;0.000302)			CAAGACCTTTTCAATGTCTTT	0.388																																																0			7											120.0	116.0	117.0					7																	92762082		2203	4299	6502	92600018	SO:0001583	missense	219285			AB095926	CCDS34681.1	7q21.2	2013-01-10		2005-04-26	ENSG00000177409	ENSG00000177409		"""Sterile alpha motif (SAM) domain containing"""	1349	protein-coding gene	gene with protein product		611170	"""chromosome 7 open reading frame 6"""	C7orf6			Standard	NM_152703		Approved	KIAA2005, FLJ39885	uc003umh.1	Q8IVG5	OTTHUMG00000155807	ENST00000318238.4:c.3203A>G	7.37:g.92762082T>C	ENSP00000326247:p.Glu1068Gly		92600018	A0JP23|A0JP24|A0PJG8|A4D1G8|D6W5Q6|Q2TV71|Q2TV75|Q2UZV8|Q8IWI4|Q8N3L9|Q8N875	Missense_Mutation	SNP	superfamily_SAM/Pointed domain	p.E1068G	ENST00000318238.4	37	c.3203	CCDS34681.1	7	.	.	.	.	.	.	.	.	.	.	T	12.62	1.993715	0.35131	.	.	ENSG00000177409	ENST00000318238;ENST00000411955;ENST00000437805	T;T;T	0.25912	1.77;1.77;1.77	4.74	4.74	0.60224	.	0.139357	0.47455	D	0.000235	T	0.37046	0.0989	M	0.63843	1.955	0.19575	N	0.999969	D	0.56746	0.977	P	0.50537	0.643	T	0.30268	-0.9984	10	0.87932	D	0	-8.7485	14.0352	0.64640	0.0:0.0:0.0:1.0	.	1068	Q8IVG5	SAM9L_HUMAN	G	1068	ENSP00000326247:E1068G;ENSP00000405760:E1068G;ENSP00000408796:E1068G	ENSP00000326247:E1068G	E	-	2	0	SAMD9L	92600018	0.984000	0.35163	0.074000	0.20217	0.537000	0.34900	2.970000	0.49240	1.983000	0.57843	0.383000	0.25322	GAA	-	NULL		0.388	SAMD9L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAMD9L	protein_coding	OTTHUMT00000341730.1	T	NM_152703		92600018	-1	no_errors	NM_152703	genbank	human	validated	54_36p	missense	SNP	0.313	C
Unknown	0	genome.wustl.edu	37	14	94833076	94833076	+	IGR	SNP	G	G	A			TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chr14:94833076G>A								SERPINA6 (43345 upstream) : SERPINA1 (10007 downstream)																							CCCCAAGTCAGGGCACATGAT	0.552																																																0			14																																								93902829	SO:0001628	intergenic_variant	390502																															14.37:g.94833076G>A			93902829		RNA	SNP	-	NULL		37	NULL		14																																																																																			-	-	0	0.552					SERPINA2			G			93902829	-1	no_errors	XR_041183	genbank	human	model	54_36p	rna	SNP	0.000	A
JRKL	8690	genome.wustl.edu	37	11	96125359	96125359	+	Missense_Mutation	SNP	A	A	C			TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chr11:96125359A>C	ENST00000332349.4	+	2	1793	c.1546A>C	c.(1546-1548)Aaa>Caa	p.K516Q	CCDC82_ENST00000525786.1_5'Flank|CCDC82_ENST00000542662.1_5'Flank|JRKL_ENST00000546177.1_Intron|JRKL_ENST00000458427.1_Missense_Mutation_p.K516Q	NM_001261833.1	NP_001248762.1	Q9Y4A0	JERKL_HUMAN	JRK-like	516					central nervous system development (GO:0007417)	nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|upper_aerodigestive_tract(1)	11		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)		BRCA - Breast invasive adenocarcinoma(274;0.148)		CATCAGAAATAAACAGAAGAT	0.333																																																0			11											36.0	33.0	34.0					11																	96125359		2197	4284	6481	95765007	SO:0001583	missense	8690			AF004715	CCDS8308.1	11q21	2014-03-28	2014-03-28		ENSG00000183340	ENSG00000183340			6200	protein-coding gene	gene with protein product		603211	"""erky (mouse) homolog-like"", ""jerky homolog-like (mouse)"""			9240447	Standard	NM_003772		Approved	HHMJG	uc009ywu.4	Q9Y4A0	OTTHUMG00000154950	ENST00000332349.4:c.1546A>C	11.37:g.96125359A>C	ENSP00000333350:p.Lys516Gln		95765007	A8K3G4|B2RAJ3|Q32MC2	Missense_Mutation	SNP	HMMPfam_CENP-B_N,superfamily_Homeodomain_like,HMMPfam_CenpB-DNA-bind,HMMSmart_CENPB,HMMPfam_DDE	p.K516Q	ENST00000332349.4	37	c.1546	CCDS8308.1	11	.	.	.	.	.	.	.	.	.	.	A	16.21	3.059524	0.55325	.	.	ENSG00000183340	ENST00000332349;ENST00000458427	T;T	0.26067	1.76;1.76	4.5	4.5	0.54988	.	0.000000	0.41001	D	0.000978	T	0.42131	0.1189	L	0.58101	1.795	0.32260	N	0.570296	D	0.76494	0.999	D	0.80764	0.994	T	0.48399	-0.9039	10	0.24483	T	0.36	-18.6906	10.4672	0.44616	1.0:0.0:0.0:0.0	.	516	Q9Y4A0	JERKL_HUMAN	Q	516	ENSP00000333350:K516Q;ENSP00000389989:K516Q	ENSP00000333350:K516Q	K	+	1	0	JRKL	95765007	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.460000	0.60108	1.789000	0.52484	0.379000	0.24179	AAA	-	NULL		0.333	JRKL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JRKL	protein_coding	OTTHUMT00000337775.2	A	NM_003772		95765007	+1	no_errors	NM_003772	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
MUC17	140453	genome.wustl.edu	37	7	100686037	100686037	+	Silent	SNP	C	C	T	rs138649661	byFrequency	TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chr7:100686037C>T	ENST00000306151.4	+	3	11404	c.11340C>T	c.(11338-11340)taC>taT	p.Y3780Y		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	3780	Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					CATCTGTTTACACCAGCATGT	0.488																																																0			7								1,4405	2.1+/-5.4	0,1,2202	152.0	145.0	147.0		11340	0.8	0.0	7	dbSNP_134	147	12,8588	9.1+/-34.3	0,12,4288	no	coding-synonymous	MUC17	NM_001040105.1		0,13,6490	TT,TC,CC		0.1395,0.0227,0.1		3780/4494	100686037	13,12993	2203	4300	6503	100472757	SO:0001819	synonymous_variant	140453			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.11340C>T	7.37:g.100686037C>T			100472757	O14761|Q685J2|Q8TDH7	Silent	SNP	superfamily_EGF/Laminin,PatternScan_EGF_1,superfamily_SEA domain,HMMSmart_SM00200,HMMPfam_SEA	p.Y3780	ENST00000306151.4	37	c.11340	CCDS34711.1	7																																																																																			-	NULL		0.488	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC17	protein_coding	OTTHUMT00000347161.1	C	NM_001040105		100472757	+1	no_errors	NM_001040105	genbank	human	provisional	54_36p	silent	SNP	0.153	T
RIMS2	9699	genome.wustl.edu	37	8	104709490	104709490	+	Missense_Mutation	SNP	G	G	A	rs377666095		TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chr8:104709490G>A	ENST00000406091.3	+	2	353	c.353G>A	c.(352-354)cGt>cAt	p.R118H		NM_001100117.2	NP_001093587.1	Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	149	RabBD. {ECO:0000255|PROSITE- ProRule:PRU00234}.				calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			TTCTGTGCTCGTTGTGGAGGT	0.413										HNSCC(12;0.0054)																																						0			8						G	HIS/ARG	1,3917		0,1,1958	202.0	194.0	197.0		353	5.5	1.0	8		197	0,8322		0,0,4161	no	missense	RIMS2	NM_001100117.2	29	0,1,6119	AA,AG,GG		0.0,0.0255,0.0082	probably-damaging	118/1350	104709490	1,12239	1959	4161	6120	104778666	SO:0001583	missense	9699			AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000406091.3:c.353G>A	8.37:g.104709490G>A	ENSP00000384892:p.Arg118His		104778666	B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Missense_Mutation	SNP	HMMPfam_RPH3A_effector,superfamily_FYVE/PHD zinc finger,superfamily_PDZ domain-like,HMMSmart_SM00228,superfamily_C2 domain (Calcium/lipid-binding domain CaLB),HMMSmart_SM00239,HMMPfam_C2	p.R118H	ENST00000406091.3	37	c.353	CCDS55269.1	8	.	.	.	.	.	.	.	.	.	.	G	33	5.260075	0.95368	2.55E-4	0.0	ENSG00000176406	ENST00000504942;ENST00000329869;ENST00000406091;ENST00000402998	T;T	0.77620	-1.11;-1.11	5.49	5.49	0.81192	.	.	.	.	.	D	0.90428	0.7003	M	0.88906	2.99	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.91861	0.5499	9	0.87932	D	0	.	19.3601	0.94434	0.0:0.0:1.0:0.0	.	118	F8WD47	.	H	118;149;118;149	ENSP00000427018:R118H;ENSP00000384892:R118H	ENSP00000332184:R149H	R	+	2	0	RIMS2	104778666	1.000000	0.71417	0.984000	0.44739	0.996000	0.88848	9.869000	0.99810	2.559000	0.86315	0.462000	0.41574	CGT	-	HMMPfam_RPH3A_effector,superfamily_FYVE/PHD zinc finger		0.413	RIMS2-202	KNOWN	basic|appris_principal|CCDS	protein_coding	RIMS2	protein_coding		G	NM_001100117		104778666	+1	no_errors	NM_001100117	genbank	human	validated	54_36p	missense	SNP	0.999	A
COG5	10466	genome.wustl.edu	37	7	106938658	106938658	+	Missense_Mutation	SNP	G	G	T			TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chr7:106938658G>T	ENST00000347053.3	-	12	1385	c.1335C>A	c.(1333-1335)gaC>gaA	p.D445E	COG5_ENST00000297135.3_Missense_Mutation_p.D445E|COG5_ENST00000393603.2_Missense_Mutation_p.D445E	NM_181733.2	NP_859422.2	Q9UP83	COG5_HUMAN	component of oligomeric golgi complex 5	445					intra-Golgi vesicle-mediated transport (GO:0006891)|protein transport (GO:0015031)	Golgi apparatus (GO:0005794)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)				breast(3)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(17)|ovary(2)|skin(4)|stomach(1)	40						CAACATAGAGGTCTGTAGTTC	0.338																																																0			7											145.0	136.0	139.0					7																	106938658		2203	4300	6503	106725894	SO:0001583	missense	10466			AF058718	CCDS5742.1, CCDS5743.1, CCDS55152.1	7q31	2010-06-24	2001-12-07	2002-05-10	ENSG00000164597	ENSG00000164597		"""Components of oligomeric golgi complex"""	14857	protein-coding gene	gene with protein product		606821	"""golgi transport complex 1 (90 kDa subunit)"""	GOLTC1		9792665, 11980916	Standard	NM_006348		Approved	GTC90	uc003vec.2	Q9UP83	OTTHUMG00000023895	ENST00000347053.3:c.1335C>A	7.37:g.106938658G>T	ENSP00000334703:p.Asp445Glu		106725894	A4D0R6|A4D0R7|O14555|O95008|Q6NUL5	Missense_Mutation	SNP	HMMPfam_COG5	p.D445E	ENST00000347053.3	37	c.1335	CCDS5743.1	7	.	.	.	.	.	.	.	.	.	.	G	13.53	2.265020	0.40095	.	.	ENSG00000164597	ENST00000347053;ENST00000297135;ENST00000393603	T;T;T	0.59364	0.27;0.27;0.27	5.68	1.24	0.21308	.	0.103143	0.64402	N	0.000003	T	0.35856	0.0946	L	0.38838	1.175	0.33754	D	0.621033	B;B	0.10296	0.002;0.003	B;B	0.08055	0.001;0.003	T	0.21861	-1.0233	10	0.10111	T	0.7	-7.5822	3.324	0.07061	0.451:0.0:0.2392:0.3098	.	445;445	Q9UP83;Q9UP83-2	COG5_HUMAN;.	E	445	ENSP00000334703:D445E;ENSP00000297135:D445E;ENSP00000377228:D445E	ENSP00000297135:D445E	D	-	3	2	COG5	106725894	0.990000	0.36364	0.981000	0.43875	0.851000	0.48451	0.164000	0.16542	0.156000	0.19299	0.650000	0.86243	GAC	-	NULL		0.338	COG5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	COG5	protein_coding	OTTHUMT00000060216.4	G			106725894	-1	no_errors	NM_006348	genbank	human	validated	54_36p	missense	SNP	0.960	T
WNT2B	7482	genome.wustl.edu	37	1	113059953	113059953	+	Missense_Mutation	SNP	G	G	A			TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chr1:113059953G>A	ENST00000369684.4	+	4	1377	c.892G>A	c.(892-894)Gat>Aat	p.D298N	WNT2B_ENST00000369686.5_Missense_Mutation_p.D279N|RP4-671G15.2_ENST00000608357.1_RNA|WNT2B_ENST00000256640.5_Missense_Mutation_p.D206N	NM_024494.2	NP_078613.1	Q93097	WNT2B_HUMAN	wingless-type MMTV integration site family, member 2B	298					canonical Wnt signaling pathway (GO:0060070)|cell fate commitment (GO:0045165)|cellular response to starvation (GO:0009267)|chondrocyte differentiation (GO:0002062)|cornea development in camera-type eye (GO:0061303)|forebrain regionalization (GO:0021871)|hematopoietic stem cell proliferation (GO:0071425)|iris morphogenesis (GO:0061072)|lens development in camera-type eye (GO:0002088)|lung induction (GO:0060492)|male gonad development (GO:0008584)|mesenchymal-epithelial cell signaling (GO:0060638)|neuron differentiation (GO:0030182)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)			breast(2)|central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(4)|ovary(2)|skin(1)|stomach(1)	18	Lung SC(450;0.246)	all_cancers(81;7.31e-07)|all_epithelial(167;4.59e-06)|all_lung(203;2.56e-05)|Lung NSC(69;4.38e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CACCCGGACTGATCTTGTCTA	0.577																																																0			1											55.0	52.0	53.0					1																	113059953		2203	4300	6503	112861476	SO:0001583	missense	7482			AB045116	CCDS847.1, CCDS846.1	1p13	2008-07-18			ENSG00000134245	ENSG00000134245		"""Wingless-type MMTV integration sites"""	12781	protein-coding gene	gene with protein product	"""XWNT2, Xenopus, homolog of"", ""wingless-type MMTV integration site family, member 13"""	601968		WNT13		8761309, 10944466	Standard	NM_024494		Approved	XWNT2	uc001ecb.3	Q93097	OTTHUMG00000011157	ENST00000369684.4:c.892G>A	1.37:g.113059953G>A	ENSP00000358698:p.Asp298Asn		112861476	O14903|Q5TEH9|Q5TEI2|Q9HDC1|Q9HDC2	Missense_Mutation	SNP	HMMPfam_wnt,HMMSmart_SM00097,PatternScan_WNT1	p.D298N	ENST00000369684.4	37	c.892	CCDS847.1	1	.	.	.	.	.	.	.	.	.	.	G	35	5.565223	0.96527	.	.	ENSG00000134245	ENST00000256640;ENST00000369686;ENST00000369684	T;T;T	0.78126	-1.15;-1.15;-1.15	5.53	5.53	0.82687	.	0.086238	0.85682	D	0.000000	D	0.89462	0.6722	M	0.90977	3.165	0.80722	D	1	D;D	0.67145	0.996;0.986	D;D	0.66979	0.948;0.913	D	0.91317	0.5079	10	0.87932	D	0	.	19.0601	0.93090	0.0:0.0:1.0:0.0	.	298;279	Q93097;Q93097-2	WNT2B_HUMAN;.	N	206;279;298	ENSP00000256640:D206N;ENSP00000358700:D279N;ENSP00000358698:D298N	ENSP00000256640:D206N	D	+	1	0	WNT2B	112861476	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.869000	0.99810	2.599000	0.87857	0.555000	0.69702	GAT	-	HMMPfam_wnt,HMMSmart_SM00097		0.577	WNT2B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	WNT2B	protein_coding	OTTHUMT00000030692.1	G	NM_004185		112861476	+1	no_errors	NM_024494	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
MAGI3	260425	genome.wustl.edu	37	1	114223893	114223893	+	Missense_Mutation	SNP	T	T	C			TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chr1:114223893T>C	ENST00000307546.9	+	20	3338	c.3263T>C	c.(3262-3264)aTt>aCt	p.I1088T	MAGI3_ENST00000369617.4_Missense_Mutation_p.I1113T|MAGI3_ENST00000369615.1_Missense_Mutation_p.I1088T|MAGI3_ENST00000369611.4_Missense_Mutation_p.I1088T	NM_001142782.1	NP_001136254.1	Q5TCQ9	MAGI3_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 3	1113	PDZ 6. {ECO:0000255|PROSITE- ProRule:PRU00143}.				apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|nucleotide phosphorylation (GO:0046939)|positive regulation of JUN kinase activity (GO:0043507)|viral process (GO:0016032)	membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	ATP binding (GO:0005524)|guanylate kinase activity (GO:0004385)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(9)|ovary(3)|prostate(7)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	41	Lung SC(450;0.184)	all_cancers(81;2.34e-09)|all_epithelial(167;7.41e-09)|all_lung(203;7.13e-06)|Lung NSC(69;1.2e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		ATTGAGCTCATTCAGGCTGGT	0.433																																																0			1											171.0	156.0	161.0					1																	114223893		2203	4300	6503	114025416	SO:0001583	missense	260425			AF213259	CCDS860.1, CCDS44196.1	1p12-p11.2	2008-02-05			ENSG00000081026	ENSG00000081026			29647	protein-coding gene	gene with protein product		615943				10997877, 10748157	Standard	NM_152900		Approved	MAGI-3	uc001edk.3	Q5TCQ9	OTTHUMG00000011737	ENST00000307546.9:c.3263T>C	1.37:g.114223893T>C	ENSP00000304604:p.Ile1088Thr		114025416	Q5TCQ8|Q5TCR0|Q9H2V6|Q9H5Y8|Q9HBC4|Q9HCD8	Missense_Mutation	SNP	superfamily_PDZ,HMMSmart_PDZ,HMMSmart_GuKc,superfamily_SSF52540,PatternScan_GUANYLATE_KINASE_1,HMMPfam_Guanylate_kin,superfamily_WW_Rsp5_WWP,HMMSmart_WW,HMMPfam_WW,PatternScan_WW_DOMAIN_1,HMMPfam_PDZ	p.I1088T	ENST00000307546.9	37	c.3263	CCDS44196.1	1	.	.	.	.	.	.	.	.	.	.	T	26.6	4.756946	0.89843	.	.	ENSG00000081026	ENST00000369617;ENST00000307546;ENST00000369615;ENST00000369611;ENST00000546156	T;T;T;T	0.51071	0.72;0.72;0.72;0.72	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	T	0.71082	0.3298	M	0.91140	3.18	0.80722	D	1	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.97110	1.0;0.999;1.0	T	0.79167	-0.1915	10	0.87932	D	0	-8.8806	16.1806	0.81895	0.0:0.0:0.0:1.0	.	1088;1088;1113	Q5TCQ9-4;Q5TCQ9-3;Q5TCQ9-2	.;.;.	T	1113;1088;1088;1088;128	ENSP00000358630:I1113T;ENSP00000304604:I1088T;ENSP00000358628:I1088T;ENSP00000358624:I1088T	ENSP00000304604:I1088T	I	+	2	0	MAGI3	114025416	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	8.040000	0.89188	2.221000	0.72209	0.528000	0.53228	ATT	-	superfamily_PDZ,HMMPfam_PDZ,HMMSmart_PDZ		0.433	MAGI3-004	NOVEL	basic|exp_conf|CCDS	protein_coding	MAGI3	protein_coding	OTTHUMT00000032429.1	T	NM_152900		114025416	+1	no_errors	NM_152900	genbank	human	validated	54_36p	missense	SNP	1.000	C
KSR2	283455	genome.wustl.edu	37	12	117907528	117907528	+	Missense_Mutation	SNP	C	C	G			TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chr12:117907528C>G	ENST00000339824.5	-	19	3512	c.2785G>C	c.(2785-2787)Gag>Cag	p.E929Q	KSR2_ENST00000302438.5_3'UTR|KSR2_ENST00000425217.1_Missense_Mutation_p.E900Q			Q6VAB6	KSR2_HUMAN	kinase suppressor of ras 2	929	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(25)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	67	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GGCAGTTTCTCCAGCATGTCC	0.483																																																0			12											124.0	124.0	124.0					12																	117907528		1984	4176	6160	116391911	SO:0001583	missense	283455			AY345972	CCDS61250.1	12q24.22-q24.23	2014-08-12			ENSG00000171435	ENSG00000171435			18610	protein-coding gene	gene with protein product		610737				12471243	Standard	NM_173598		Approved	FLJ25965	uc001two.2	Q6VAB6	OTTHUMG00000169020	ENST00000339824.5:c.2785G>C	12.37:g.117907528C>G	ENSP00000339952:p.Glu929Gln		116391911	A0PJT2|Q3B828|Q8N775	Missense_Mutation	SNP	superfamily_Cysteine-rich domain,HMMSmart_SM00109,HMMPfam_C1_1,PatternScan_ZF_DAG_PE_1,superfamily_Protein kinase-like (PK-like),HMMSmart_SM00219,HMMSmart_SM00220,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ST	p.E808Q	ENST00000339824.5	37	c.2422		12	.	.	.	.	.	.	.	.	.	.	C	21.3	4.121939	0.77436	.	.	ENSG00000171435	ENST00000425217;ENST00000339824	T;T	0.80304	-1.36;-1.36	4.55	4.55	0.56014	Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.87390	0.6165	L	0.59967	1.855	0.80722	D	1	D	0.76494	0.999	D	0.67103	0.949	D	0.89190	0.3550	10	0.87932	D	0	.	17.296	0.87171	0.0:1.0:0.0:0.0	.	929	Q6VAB6	KSR2_HUMAN	Q	900;929	ENSP00000389715:E900Q;ENSP00000339952:E929Q	ENSP00000339952:E929Q	E	-	1	0	KSR2	116391911	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	7.787000	0.85759	2.069000	0.61940	0.462000	0.41574	GAG	-	superfamily_Protein kinase-like (PK-like)		0.483	KSR2-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	KSR2	protein_coding	OTTHUMT00000401987.2	C	NM_173598		116391911	-1	no_errors	NM_173598	genbank	human	validated	54_36p	missense	SNP	1.000	G
TAOK3	51347	genome.wustl.edu	37	12	118590131	118590131	+	Silent	SNP	G	G	A			TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chr12:118590131G>A	ENST00000392533.3	-	20	2926	c.2436C>T	c.(2434-2436)taC>taT	p.Y812Y	TAOK3_ENST00000537952.1_Silent_p.Y352Y|TAOK3_ENST00000419821.2_Silent_p.Y812Y|TAOK3_ENST00000543709.1_5'UTR|TAOK3_ENST00000536979.1_Silent_p.Y7Y	NM_016281.3	NP_057365.3	Q9H2K8	TAOK3_HUMAN	TAO kinase 3	812					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|MAPK cascade (GO:0000165)|mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of JNK cascade (GO:0046329)|negative regulation of protein kinase activity (GO:0006469)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase inhibitor activity (GO:0004860)|protein serine/threonine kinase activity (GO:0004674)|transferase activity (GO:0016740)			central_nervous_system(1)|lung(5)|skin(1)	7	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					TTTTGCTCTGGTAGGCGTTGA	0.532																																																0			12											183.0	136.0	151.0					12																	118590131		2203	4300	6503	117074514	SO:0001819	synonymous_variant	51347			AF135158	CCDS9188.1	12q	2007-08-03				ENSG00000135090			18133	protein-coding gene	gene with protein product						10559204, 10924369	Standard	NM_016281		Approved	JIK, DPK, MAP3K18	uc001twy.4	Q9H2K8		ENST00000392533.3:c.2436C>T	12.37:g.118590131G>A			117074514	Q658N1|Q8IUM4|Q9HC79|Q9NZM9|Q9UHG7	Silent	SNP	superfamily_Kinase_like,HMMSmart_S_TKc,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_ST	p.Y812	ENST00000392533.3	37	c.2436	CCDS9188.1	12																																																																																			-	NULL		0.532	TAOK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAOK3	protein_coding	OTTHUMT00000401456.2	G	NM_016281		117074514	-1	no_errors	NM_016281	genbank	human	validated	54_36p	silent	SNP	1.000	A
NKRF	55922	genome.wustl.edu	37	X	118724128	118724128	+	Missense_Mutation	SNP	T	T	A			TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chrX:118724128T>A	ENST00000371527.1	-	2	1912	c.1260A>T	c.(1258-1260)aaA>aaT	p.K420N	NKRF_ENST00000542113.1_Missense_Mutation_p.K435N|NKRF_ENST00000304449.5_Missense_Mutation_p.K420N|NKRF_ENST00000487600.1_Intron	NM_001173488.1	NP_001166959.1	O15226	NKRF_HUMAN	NFKB repressing factor	420					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(2)|lung(9)|ovary(1)|prostate(3)|skin(1)|urinary_tract(1)	30						ATTGTGAACTTTTGACAGATG	0.403																																																0			X											144.0	133.0	136.0					X																	118724128		2203	4300	6503	118608156	SO:0001583	missense	55922			AJ011812	CCDS35375.1, CCDS55486.1	Xq24	2013-01-28	2008-03-26		ENSG00000186416	ENSG00000186416		"""G patch domain containing"""	19374	protein-coding gene	gene with protein product		300440	"""NF-kappaB repressing factor"""			10562553	Standard	NM_017544		Approved	ITBA4, NRF	uc022cdk.1	O15226	OTTHUMG00000022277	ENST00000371527.1:c.1260A>T	X.37:g.118724128T>A	ENSP00000360582:p.Lys420Asn		118608156	G3V1N1|Q4VC41|Q9UJ91	Missense_Mutation	SNP	superfamily_dsRNA-binding domain-like,HMMPfam_dsrm,HMMSmart_SM00358,HMMSmart_SM00443,HMMPfam_G-patch,HMMSmart_SM00393,superfamily_R3H domain,HMMPfam_R3H	p.K420N	ENST00000371527.1	37	c.1260	CCDS35375.1	X	.	.	.	.	.	.	.	.	.	.	T	6.984	0.551690	0.13374	.	.	ENSG00000186416	ENST00000371527;ENST00000304449;ENST00000542113	T;T;T	0.48201	0.82;0.82;0.82	5.49	0.623	0.17654	.	0.346876	0.34025	N	0.004337	T	0.29126	0.0724	L	0.36672	1.1	0.32813	D	0.501728	P	0.34462	0.454	B	0.21360	0.034	T	0.32798	-0.9893	10	0.45353	T	0.12	-19.4285	8.6839	0.34225	0.0:0.3134:0.0:0.6866	.	420	O15226	NKRF_HUMAN	N	420;420;435	ENSP00000360582:K420N;ENSP00000304803:K420N;ENSP00000442308:K435N	ENSP00000304803:K420N	K	-	3	2	NKRF	118608156	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.515000	0.35845	0.249000	0.21456	0.486000	0.48141	AAA	-	NULL		0.403	NKRF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NKRF	protein_coding	OTTHUMT00000058044.1	T	NM_017544		118608156	-1	no_errors	NM_017544	genbank	human	validated	54_36p	missense	SNP	0.783	A
SH2D1A	4068	genome.wustl.edu	37	X	123504070	123504070	+	Silent	SNP	T	T	C			TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chrX:123504070T>C	ENST00000371139.4	+	3	545	c.246T>C	c.(244-246)aaT>aaC	p.N82N	SH2D1A_ENST00000491950.1_3'UTR|STAG2_ENST00000469481.1_Intron|SH2D1A_ENST00000360027.4_Silent_p.N82N|SH2D1A_ENST00000477673.2_Intron	NM_001114937.2|NM_002351.4	NP_001108409.1|NP_002342.1	O60880	SH21A_HUMAN	SH2 domain containing 1A	82	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				cell-cell signaling (GO:0007267)|cellular defense response (GO:0006968)|humoral immune response (GO:0006959)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|positive regulation of signal transduction (GO:0009967)	cytoplasm (GO:0005737)	SH3/SH2 adaptor activity (GO:0005070)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	10						AAATAAAAAATCTCATTTCAG	0.368																																																0			X											113.0	110.0	111.0					X																	123504070		2203	4300	6503	123331751	SO:0001819	synonymous_variant	4068			AL023657	CCDS14608.1, CCDS48162.1	Xq25	2014-09-17	2010-04-21		ENSG00000183918	ENSG00000183918		"""SH2 domain containing"""	10820	protein-coding gene	gene with protein product	"""Duncan's disease"""	300490	"""lymphoproliferative syndrome"", ""SH2 domain protein 1A"""	IMD5, LYP		9771704, 9774102	Standard	NM_001114937		Approved	XLP, MTCP1, DSHP, XLPD, EBVS, SAP	uc004euf.4	O60880	OTTHUMG00000022344	ENST00000371139.4:c.246T>C	X.37:g.123504070T>C			123331751	A8MSW0|O95383|O95384|O95385|O95386|Q6FGS6|Q9UNR0	Silent	SNP	superfamily_SH2 domain,HMMSmart_SM00252,HMMPfam_SH2	p.N82	ENST00000371139.4	37	c.246	CCDS14608.1	X																																																																																			-	superfamily_SH2 domain,HMMSmart_SM00252,HMMPfam_SH2		0.368	SH2D1A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SH2D1A	protein_coding	OTTHUMT00000058174.1	T	NM_002351		123331751	+1	no_errors	NM_002351	genbank	human	reviewed	54_36p	silent	SNP	1.000	C
FAT4	79633	genome.wustl.edu	37	4	126372377	126372377	+	Silent	SNP	C	C	T	rs267600014		TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chr4:126372377C>T	ENST00000394329.3	+	9	10219	c.10206C>T	c.(10204-10206)ccC>ccT	p.P3402P	FAT4_ENST00000335110.5_Silent_p.P1700P	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	3402	Cadherin 32. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						ATGACCCACCCATTTTTACTC	0.453																																																0			4											182.0	174.0	177.0					4																	126372377		2203	4300	6503	126591827	SO:0001819	synonymous_variant	79633			AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.10206C>T	4.37:g.126372377C>T			126591827	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Silent	SNP	superfamily_Cadherin,HMMPfam_Cadherin,HMMSmart_CA,PatternScan_CADHERIN_1,superfamily_SSF57196,HMMSmart_EGF,PatternScan_EGF_1,PatternScan_EGF_2,PatternScan_EGF_CA,HMMPfam_EGF_CA,HMMSmart_EGF_CA,PatternScan_ASX_HYDROXYL,superfamily_ConA_like_lec_gl,HMMSmart_LamG,HMMPfam_Laminin_G_2,HMMPfam_EGF	p.P3402	ENST00000394329.3	37	c.10206	CCDS3732.3	4																																																																																			-	HMMSmart_CA,superfamily_Cadherin		0.453	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT4	protein_coding	OTTHUMT00000256765.2	C	NM_024582		126591827	+1	no_errors	NM_024582	genbank	human	validated	54_36p	silent	SNP	0.540	T
HTATSF1	27336	genome.wustl.edu	37	X	135593245	135593245	+	Missense_Mutation	SNP	C	C	A			TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chrX:135593245C>A	ENST00000218364.4	+	9	1515	c.1341C>A	c.(1339-1341)aaC>aaA	p.N447K	HTATSF1_ENST00000535601.1_Missense_Mutation_p.N447K	NM_014500.4	NP_055315.2	O43719	HTSF1_HUMAN	HIV-1 Tat specific factor 1	447	Asp/Glu-rich (acidic).|Mediates interaction with the P-TEFb complex.				regulation of DNA-templated transcription, elongation (GO:0032784)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral genome replication (GO:0019079)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(5)|lung(14)|ovary(3)|prostate(1)	30	Acute lymphoblastic leukemia(192;0.000127)					CTTCTGAAAACAATGCTAAGG	0.448																																																0			X											81.0	90.0	87.0					X																	135593245		2202	4298	6500	135420911	SO:0001583	missense	27336			U76992	CCDS14657.1	Xq26.3	2013-02-12	2006-01-09		ENSG00000102241	ENSG00000102241		"""RNA binding motif (RRM) containing"""	5276	protein-coding gene	gene with protein product		300346	"""HIV TAT specific factor 1"""			8849451	Standard	NM_014500		Approved	TAT-SF1	uc004ezx.3	O43719	OTTHUMG00000022510	ENST00000218364.4:c.1341C>A	X.37:g.135593245C>A	ENSP00000218364:p.Asn447Lys		135420911	D3DWG9|Q59G06|Q99730	Missense_Mutation	SNP	superfamily_SSF54928,HMMSmart_RRM,HMMPfam_RRM_1	p.N447K	ENST00000218364.4	37	c.1341	CCDS14657.1	X	.	.	.	.	.	.	.	.	.	.	C	0	-2.634384	0.00114	.	.	ENSG00000102241	ENST00000535601;ENST00000218364;ENST00000415377	T;T	0.19806	2.12;2.12	5.59	-0.147	0.13428	.	0.602445	0.18811	N	0.130506	T	0.04407	0.0121	N	0.01874	-0.695	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.33879	-0.9851	10	0.02654	T	1	-14.2566	1.321	0.02116	0.388:0.2559:0.0847:0.2715	.	447	O43719	HTSF1_HUMAN	K	447	ENSP00000442699:N447K;ENSP00000218364:N447K	ENSP00000218364:N447K	N	+	3	2	HTATSF1	135420911	0.000000	0.05858	0.003000	0.11579	0.167000	0.22549	-0.106000	0.10890	0.015000	0.14971	-0.480000	0.04831	AAC	-	NULL		0.448	HTATSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTATSF1	protein_coding	OTTHUMT00000058497.1	C	NM_014500		135420911	+1	no_errors	NM_014500	genbank	human	provisional	54_36p	missense	SNP	0.844	A
ZFAT	57623	genome.wustl.edu	37	8	135524759	135524759	+	Missense_Mutation	SNP	G	G	A			TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chr8:135524759G>A	ENST00000377838.3	-	14	3494	c.3320C>T	c.(3319-3321)gCg>gTg	p.A1107V	ZFAT_ENST00000520214.1_Missense_Mutation_p.A1095V|ZFAT_ENST00000520727.1_Missense_Mutation_p.A1095V|ZFAT_ENST00000429442.2_Missense_Mutation_p.A1095V|ZFAT_ENST00000523399.1_Missense_Mutation_p.A1045V|ZFAT_ENST00000517307.1_5'Flank|ZFAT_ENST00000520356.1_Intron	NM_001174157.1|NM_020863.3	NP_001167628.1|NP_065914.2	Q9P243	ZFAT_HUMAN	zinc finger and AT hook domain containing	1107					hematopoietic progenitor cell differentiation (GO:0002244)|spongiotrophoblast layer development (GO:0060712)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(10)|kidney(9)|large_intestine(8)|lung(16)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	54	all_epithelial(106;8.26e-19)|Lung NSC(106;3.47e-07)|all_lung(105;1.39e-06)|Ovarian(258;0.0102)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0432)			CGCGGCCACCGCTGCCTGTGT	0.527																																																0			8											161.0	171.0	168.0					8																	135524759		2025	4187	6212	135593941	SO:0001583	missense	57623			BC025423	CCDS43768.1, CCDS47924.1, CCDS43768.2, CCDS55275.1, CCDS55276.1	8q24.23	2008-06-05	2008-01-25	2008-01-25	ENSG00000066827	ENSG00000066827		"""Zinc fingers, C2H2-type"""	19899	protein-coding gene	gene with protein product		610931	"""zinc finger protein 406"""	ZNF406, ZFAT1		10819331, 18329245	Standard	NM_020863		Approved	KIAA1485	uc003yup.3	Q9P243	OTTHUMG00000164321	ENST00000377838.3:c.3320C>T	8.37:g.135524759G>A	ENSP00000367069:p.Ala1107Val		135593941	B7ZL15|E9PER3|Q3MIM5|Q6PJ01|Q75PJ6|Q75PJ7|Q75PJ9|Q86X64	Missense_Mutation	SNP	HMMSmart_SM00355,superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,PatternScan_ZINC_FINGER_C2H2_1,PatternScan_SUGAR_TRANSPORT_1	p.A1107V	ENST00000377838.3	37	c.3320	CCDS47924.1	8	.	.	.	.	.	.	.	.	.	.	G	17.78	3.472723	0.63737	.	.	ENSG00000066827	ENST00000520727;ENST00000429442;ENST00000377838;ENST00000520214;ENST00000318135;ENST00000523399	T;T;T;T;T	0.11385	2.9;2.78;2.9;2.9;2.92	4.8	4.8	0.61643	.	0.228413	0.45126	D	0.000381	T	0.22044	0.0531	L	0.27053	0.805	0.53005	D	0.999967	D;D;D	0.89917	0.999;0.996;1.0	P;P;D	0.80764	0.692;0.713;0.994	T	0.01516	-1.1335	10	0.52906	T	0.07	-22.9777	17.3851	0.87413	0.0:0.0:1.0:0.0	.	226;1045;1107	B7Z741;E9PER3;Q9P243	.;.;ZFAT_HUMAN	V	1095;1095;1107;1095;994;1045	ENSP00000427831:A1095V;ENSP00000394501:A1095V;ENSP00000367069:A1107V;ENSP00000428483:A1095V;ENSP00000429091:A1045V	ENSP00000326997:A994V	A	-	2	0	ZFAT	135593941	1.000000	0.71417	0.160000	0.22671	0.182000	0.23217	7.316000	0.79007	2.648000	0.89879	0.563000	0.77884	GCG	-	NULL		0.527	ZFAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFAT	protein_coding	OTTHUMT00000378272.1	G	NM_001029939		135593941	-1	no_errors	NM_020863	genbank	human	validated	54_36p	missense	SNP	0.998	A
CAMSAP1	157922	genome.wustl.edu	37	9	138709844	138709844	+	Missense_Mutation	SNP	G	G	A			TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chr9:138709844G>A	ENST00000389532.4	-	14	4314	c.4250C>T	c.(4249-4251)tCc>tTc	p.S1417F	CAMSAP1_ENST00000312405.6_Missense_Mutation_p.S1139F|CAMSAP1_ENST00000483991.1_5'UTR|CAMSAP1_ENST00000409386.3_Missense_Mutation_p.S1428F	NM_015447.3	NP_056262.3	Q5T5Y3	CAMP1_HUMAN	calmodulin regulated spectrin-associated protein 1	1417					cytoskeleton organization (GO:0007010)|neuron projection development (GO:0031175)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)|microtubule (GO:0005874)	calmodulin binding (GO:0005516)|microtubule binding (GO:0008017)|spectrin binding (GO:0030507)			breast(3)|central_nervous_system(2)|endometrium(6)|kidney(4)|large_intestine(11)|lung(16)|ovary(3)|pancreas(1)|skin(1)	47				OV - Ovarian serous cystadenocarcinoma(145;1.4e-06)|Epithelial(140;1.11e-05)		TGTGCCCCCGGAATGAACGCT	0.637																																																0			9											43.0	45.0	45.0					9																	138709844		2203	4300	6503	137849665	SO:0001583	missense	157922			AJ519841	CCDS35176.2	9q34.3	2008-02-05			ENSG00000130559	ENSG00000130559			19946	protein-coding gene	gene with protein product		613774				12477932	Standard	NM_015447		Approved	FLJ31228, DKFZp434F195	uc004cgr.4	Q5T5Y3	OTTHUMG00000020918	ENST00000389532.4:c.4250C>T	9.37:g.138709844G>A	ENSP00000374183:p.Ser1417Phe		137849665	A1L4L2|B2REB2|B2REB3|Q70W33|Q8NCY0|Q96E80|Q96FM3|Q9UFJ5	Missense_Mutation	SNP	superfamily_PRC-barrel domain,HMMPfam_DUF1781	p.S1139F	ENST00000389532.4	37	c.3416	CCDS35176.2	9	.	.	.	.	.	.	.	.	.	.	G	16.00	2.998433	0.54147	.	.	ENSG00000130559	ENST00000389532;ENST00000312405;ENST00000409386	T;T;T	0.18502	2.21;2.21;2.21	5.28	4.39	0.52855	.	0.000000	0.85682	D	0.000000	T	0.41994	0.1183	M	0.73962	2.25	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.87578	0.998;0.991	T	0.41324	-0.9515	10	0.87932	D	0	-2.7359	13.9019	0.63809	0.0739:0.0:0.9261:0.0	.	1417;1428	Q5T5Y3;Q5T5Y3-3	CAMP1_HUMAN;.	F	1417;1139;1428	ENSP00000374183:S1417F;ENSP00000312463:S1139F;ENSP00000386420:S1428F	ENSP00000312463:S1139F	S	-	2	0	CAMSAP1	137849665	1.000000	0.71417	0.023000	0.16930	0.001000	0.01503	9.466000	0.97665	1.230000	0.43646	-0.258000	0.10820	TCC	-	NULL		0.637	CAMSAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAMSAP1	protein_coding	OTTHUMT00000055024.2	G	XM_351857		137849665	-1	no_errors	NM_015447	genbank	human	validated	54_36p	missense	SNP	0.990	A
PCDHGA8	9708	genome.wustl.edu	37	5	140774533	140774533	+	Missense_Mutation	SNP	G	G	A			TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chr5:140774533G>A	ENST00000398604.2	+	1	2153	c.2153G>A	c.(2152-2154)cGc>cAc	p.R718H	PCDHGB2_ENST00000522605.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA3_ENST00000253812.6_Intron	NM_032088.1	NP_114477.1	Q9Y5G5	PCDG8_HUMAN	protocadherin gamma subfamily A, 8	718					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(6)|kidney(6)|large_intestine(6)|lung(30)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	51			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGGCTGAGGCGCTGGCACAAG	0.582																																																0			5											43.0	48.0	46.0					5																	140774533		2191	4295	6486	140754717	SO:0001583	missense	9708			AF152515	CCDS47291.1, CCDS75338.1	5q31	2010-01-26			ENSG00000253767	ENSG00000253767		"""Cadherins / Protocadherins : Clustered"""	8706	other	protocadherin		606295				10380929	Standard	NM_014004		Approved	KIAA0327, PCDH-GAMMA-A8		Q9Y5G5	OTTHUMG00000164053	ENST00000398604.2:c.2153G>A	5.37:g.140774533G>A	ENSP00000381605:p.Arg718His		140754717	A7MCZ4|O15039	Missense_Mutation	SNP	HMMSmart_SM00112,superfamily_Cadherin-like,HMMPfam_Cadherin_2,PatternScan_CADHERIN_1,HMMPfam_Cadherin	p.R718H	ENST00000398604.2	37	c.2153	CCDS47291.1	5	.	.	.	.	.	.	.	.	.	.	.	12.77	2.036893	0.35893	.	.	ENSG00000253767	ENST00000398604	T	0.21734	1.99	4.5	2.55	0.30701	.	0.639648	0.09089	U	0.850182	T	0.19685	0.0473	L	0.58669	1.825	0.09310	N	0.999997	B;B	0.31040	0.107;0.305	B;B	0.25614	0.028;0.062	T	0.18745	-1.0327	10	0.40728	T	0.16	.	6.6776	0.23103	0.3522:0.0:0.6478:0.0	.	718;718	Q9Y5G5;Q9Y5G5-2	PCDG8_HUMAN;.	H	718	ENSP00000381605:R718H	ENSP00000381605:R718H	R	+	2	0	PCDHGA8	140754717	0.004000	0.15560	0.883000	0.34634	0.701000	0.40568	1.440000	0.35024	1.133000	0.42147	0.655000	0.94253	CGC	-	NULL		0.582	PCDHGA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA8	protein_coding	OTTHUMT00000376972.1	G	NM_032088		140754717	+1	no_errors	NM_032088	genbank	human	reviewed	54_36p	missense	SNP	0.445	A
CLCN1	1180	genome.wustl.edu	37	7	143013308	143013308	+	Start_Codon_SNP	SNP	G	G	C			TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chr7:143013308G>C	ENST00000343257.2	+	1	90	c.3G>C	c.(1-3)atG>atC	p.M1I		NM_000083.2	NP_000074	P35523	CLCN1_HUMAN	chloride channel, voltage-sensitive 1	1					chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|neuronal action potential propagation (GO:0019227)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	adenyl nucleotide binding (GO:0030554)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)			breast(4)|central_nervous_system(1)|endometrium(1)|large_intestine(11)|lung(26)|ovary(3)|prostate(2)|skin(7)|stomach(1)|upper_aerodigestive_tract(2)	58	Melanoma(164;0.205)					GAGGGAATATGGAGCAATCCC	0.617																																																0			7											54.0	48.0	50.0					7																	143013308		2203	4300	6503	142723430	SO:0001582	initiator_codon_variant	1180			Z25884	CCDS5881.1	7q12	2012-09-26	2012-02-23		ENSG00000188037	ENSG00000188037		"""Ion channels / Chloride channels : Voltage-sensitive"""	2019	protein-coding gene	gene with protein product	"""Thomsen disease, autosomal dominant"""	118425	"""chloride channel 1, skeletal muscle"""			1379744	Standard	NM_000083		Approved	CLC1, ClC-1	uc003wcr.1	P35523	OTTHUMG00000152695	ENST00000343257.2:c.3G>C	7.37:g.143013308G>C	ENSP00000339867:p.Met1Ile		142723430	A4D2H5|Q2M202	Missense_Mutation	SNP	superfamily_Clc chloride channel,HMMPfam_Voltage_CLC,superfamily_CBS-domain,HMMPfam_CBS	p.M1I	ENST00000343257.2	37	c.3	CCDS5881.1	7	.	.	.	.	.	.	.	.	.	.	.	15.36	2.809255	0.50421	.	.	ENSG00000188037	ENST00000343257	D	0.84873	-1.91	5.19	5.19	0.71726	.	2.538100	0.01619	N	0.022909	D	0.92941	0.7754	.	.	.	0.40389	D	0.979526	P	0.45126	0.851	P	0.58391	0.838	T	0.80437	-0.1383	9	0.87932	D	0	.	16.9742	0.86309	0.0:0.0:1.0:0.0	.	1	P35523	CLCN1_HUMAN	I	1	ENSP00000339867:M1I	ENSP00000339867:M1I	M	+	3	0	CLCN1	142723430	1.000000	0.71417	1.000000	0.80357	0.641000	0.38312	2.177000	0.42509	2.427000	0.82271	0.650000	0.86243	ATG	-	NULL		0.617	CLCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLCN1	protein_coding	OTTHUMT00000327420.1	G	NM_000083	Missense_Mutation	142723430	+1	no_errors	NM_000083	genbank	human	reviewed	54_36p	missense	SNP	0.994	C
ARHGAP39	80728	genome.wustl.edu	37	8	145763156	145763156	+	Intron	SNP	T	T	A			TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chr8:145763156T>A	ENST00000276826.5	-	6	2723				ARHGAP39_ENST00000540274.1_Intron|ARHGAP39_ENST00000528810.1_5'UTR|ARHGAP39_ENST00000377307.2_Nonsense_Mutation_p.K855*			Q9C0H5	RHG39_HUMAN	Rho GTPase activating protein 39						axon guidance (GO:0007411)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nucleus (GO:0005634)				NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(11)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	22						TTGGACTTCTTCTTAGTGTTT	0.552																																																0			8											184.0	188.0	187.0					8																	145763156		2203	4300	6503	145733964	SO:0001627	intron_variant	80728				CCDS34971.1	8q24.3	2011-06-29			ENSG00000147799	ENSG00000147799		"""Rho GTPase activating proteins"""	29351	protein-coding gene	gene with protein product	"""RhoGAP93B homolog (Drosophila)"", ""crossGAP homolog (Drosophila)"""	615880				15755809	Standard	XM_005272344		Approved	KIAA1688, Vilse, CrGAP	uc003zds.1	Q9C0H5	OTTHUMG00000165182	ENST00000276826.5:c.2522-3570A>T	8.37:g.145763156T>A			145733964	B4E1I1	Nonsense_Mutation	SNP	HMMSmart_SM00456,HMMPfam_WW,superfamily_WW domain,HMMSmart_SM00139,HMMPfam_MyTH4,superfamily_GTPase activation domain GAP,HMMSmart_SM00324,HMMPfam_RhoGAP	p.K855*	ENST00000276826.5	37	c.2563		8	.	.	.	.	.	.	.	.	.	.	T	38	7.090472	0.98055	.	.	ENSG00000147799	ENST00000377307	.	.	.	4.95	4.95	0.65309	.	0.258992	0.36519	N	0.002556	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-46.899	12.5727	0.56347	0.0:0.0:0.0:1.0	.	.	.	.	X	855	.	ENSP00000366522:K855X	K	-	1	0	ARHGAP39	145733964	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.820000	0.75267	1.863000	0.54032	0.459000	0.35465	AAG	-	HMMPfam_MyTH4		0.552	ARHGAP39-001	KNOWN	basic|appris_principal	protein_coding	KIAA1688	protein_coding	OTTHUMT00000382509.1	T			145733964	-1	no_errors	NM_025251	genbank	human	validated	54_36p	nonsense	SNP	1.000	A
FMR1NB	158521	genome.wustl.edu	37	X	147063126	147063126	+	Silent	SNP	C	C	A			TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chrX:147063126C>A	ENST00000370467.3	+	1	278	c.204C>A	c.(202-204)ccC>ccA	p.P68P		NM_152578.2	NP_689791.1	Q8N0W7	FMR1N_HUMAN	fragile X mental retardation 1 neighbor	68						integral component of membrane (GO:0016021)|nucleolus (GO:0005730)				breast(2)|cervix(1)|endometrium(3)|large_intestine(7)|lung(10)|ovary(1)|skin(1)	25	Acute lymphoblastic leukemia(192;6.56e-05)					TCAGCAAACCCTTTGGGATGC	0.587																																																0			X											132.0	122.0	126.0					X																	147063126		2203	4300	6503	146870818	SO:0001819	synonymous_variant	158521				CCDS14683.1	Xq28	2009-03-25			ENSG00000176988	ENSG00000176988			26372	protein-coding gene	gene with protein product	"""cancer/testis antigen 37"""					12601173	Standard	NM_152578		Approved	FLJ25736, NY-SAR-35, CT37	uc004fcm.3	Q8N0W7	OTTHUMG00000022608	ENST00000370467.3:c.204C>A	X.37:g.147063126C>A			146870818	D3DWT3	Silent	SNP	NULL	p.P68	ENST00000370467.3	37	c.204	CCDS14683.1	X																																																																																			-	NULL		0.587	FMR1NB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMR1NB	protein_coding	OTTHUMT00000058667.1	C	NM_152578		146870818	+1	no_errors	NM_152578	genbank	human	provisional	54_36p	silent	SNP	0.001	A
HIST2H2AC	8338	genome.wustl.edu	37	1	149858790	149858790	+	Missense_Mutation	SNP	G	G	C			TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chr1:149858790G>C	ENST00000331380.2	+	1	266	c.266G>C	c.(265-267)cGc>cCc	p.R89P	HIST2H2BE_ENST00000369155.2_5'Flank|BOLA1_ENST00000369153.2_5'Flank	NM_003517.2	NP_003508.1	Q16777	H2A2C_HUMAN	histone cluster 2, H2ac	89						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(11)|ovary(1)|skin(1)	20	Breast(34;0.0124)|all_hematologic(923;0.127)		STAD - Stomach adenocarcinoma(528;0.133)|LUSC - Lung squamous cell carcinoma(543;0.221)			CTGGCCATCCGCAACGACGAG	0.597																																																0			1											64.0	65.0	65.0					1																	149858790		2203	4296	6499	148125414	SO:0001583	missense	8338			AY131973	CCDS937.1	1q21.2	2011-01-27	2006-10-11	2003-02-21	ENSG00000184260	ENSG00000184260		"""Histones / Replication-dependent"""	4738	protein-coding gene	gene with protein product		602797	"""H2A histone family, member Q"", ""histone 2, H2ac"""	H2A, H2AFQ		1469070, 9439656, 12408966	Standard	NM_003517		Approved	H2A/q	uc001etd.3	Q16777	OTTHUMG00000035825	ENST00000331380.2:c.266G>C	1.37:g.149858790G>C	ENSP00000332194:p.Arg89Pro		148125414	Q6DRA7|Q8IUE5	Missense_Mutation	SNP	superfamily_Histone-fold,HMMSmart_SM00414,HMMPfam_Histone,PatternScan_HISTONE_H2A	p.R89P	ENST00000331380.2	37	c.266	CCDS937.1	1	.	.	.	.	.	.	.	.	.	.	G	10.78	1.445509	0.25987	.	.	ENSG00000184260	ENST00000331380	T	0.75589	-0.95	5.56	2.62	0.31277	Histone-fold (2);Histone core (1);Histone H2A (1);	0.000000	0.45361	D	0.000374	D	0.87819	0.6273	H	0.99169	4.455	0.44221	D	0.997056	D	0.89917	1.0	D	0.83275	0.996	D	0.86056	0.1529	10	0.87932	D	0	.	6.3766	0.21511	0.0727:0.1322:0.6579:0.1372	.	89	Q16777	H2A2C_HUMAN	P	89	ENSP00000332194:R89P	ENSP00000332194:R89P	R	+	2	0	HIST2H2AC	148125414	1.000000	0.71417	1.000000	0.80357	0.218000	0.24690	7.829000	0.86735	0.291000	0.22468	-0.175000	0.13238	CGC	-	superfamily_Histone-fold,HMMSmart_SM00414,HMMPfam_Histone		0.597	HIST2H2AC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST2H2AC	protein_coding	OTTHUMT00000087128.1	G	NM_003517		148125414	+1	no_errors	NM_003517	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
ACVR2A	92	genome.wustl.edu	37	2	148677893	148677893	+	Missense_Mutation	SNP	G	G	A			TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chr2:148677893G>A	ENST00000241416.7	+	8	1693	c.1057G>A	c.(1057-1059)Gca>Aca	p.A353T	ACVR2A_ENST00000535787.1_Missense_Mutation_p.A245T|ACVR2A_ENST00000404590.1_Missense_Mutation_p.A353T	NM_001278579.1|NM_001278580.1|NM_001616.3	NP_001265508.1|NP_001265509.1|NP_001607.1	P27037	AVR2A_HUMAN	activin A receptor, type IIA	353	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|BMP signaling pathway (GO:0030509)|cellular response to BMP stimulus (GO:0071773)|determination of left/right symmetry (GO:0007368)|embryonic skeletal system development (GO:0048706)|gastrulation with mouth forming second (GO:0001702)|mesoderm development (GO:0007498)|penile erection (GO:0043084)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of bone mineralization (GO:0030501)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein phosphorylation (GO:0001934)|regulation of BMP signaling pathway (GO:0030510)|regulation of nitric-oxide synthase activity (GO:0050999)|Sertoli cell proliferation (GO:0060011)|sperm ejaculation (GO:0042713)|spermatogenesis (GO:0007283)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|inhibin-betaglycan-ActRII complex (GO:0034673)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|coreceptor activity (GO:0015026)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(5)|large_intestine(14)|liver(1)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(8)	45				BRCA - Breast invasive adenocarcinoma(221;0.0969)		TGGCAAGTCTGCAGGCGATAC	0.383																																																0			2											87.0	89.0	89.0					2																	148677893		2203	4300	6503	148394363	SO:0001583	missense	92				CCDS33301.1, CCDS63030.1	2q22.2-q23.3	2008-02-05	2005-05-10	2005-05-10	ENSG00000121989	ENSG00000121989			173	protein-coding gene	gene with protein product		102581	"""activin A receptor, type II"""	ACVR2		1314589, 10702675	Standard	NM_001278579		Approved	ACTRII	uc002twh.3	P27037	OTTHUMG00000150603	ENST00000241416.7:c.1057G>A	2.37:g.148677893G>A	ENSP00000241416:p.Ala353Thr		148394363	B2RAB8|B4DWQ2|D3DP85|Q53TH4|Q6NWV2|Q92474	Missense_Mutation	SNP	superfamily_Snake toxin-like,HMMPfam_Activin_recp,superfamily_Protein kinase-like (PK-like),HMMSmart_SM00219,HMMPfam_Pkinase,HMMSmart_SM00220,PatternScan_PROTEIN_KINASE_ST	p.A353T	ENST00000241416.7	37	c.1057	CCDS33301.1	2	.	.	.	.	.	.	.	.	.	.	G	16.14	3.039512	0.55003	.	.	ENSG00000121989	ENST00000241416;ENST00000535787;ENST00000404590	T;T;T	0.65732	-0.17;-0.17;-0.17	5.42	5.42	0.78866	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.38188	0.1031	N	0.02345	-0.59	0.80722	D	1	B	0.11235	0.004	B	0.13407	0.009	T	0.26849	-1.0091	10	0.34782	T	0.22	.	15.113	0.72375	0.0:0.1411:0.8589:0.0	.	353	P27037	AVR2A_HUMAN	T	353;245;353	ENSP00000241416:A353T;ENSP00000439988:A245T;ENSP00000384338:A353T	ENSP00000241416:A353T	A	+	1	0	ACVR2A	148394363	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.587000	0.67510	2.699000	0.92147	0.655000	0.94253	GCA	-	superfamily_Protein kinase-like (PK-like),HMMSmart_SM00219,HMMPfam_Pkinase,HMMSmart_SM00220		0.383	ACVR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACVR2A	protein_coding	OTTHUMT00000319051.1	G	NM_001616		148394363	+1	no_errors	NM_001616	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
GPR50	9248	genome.wustl.edu	37	X	150349106	150349106	+	Missense_Mutation	SNP	C	C	T	rs374706343		TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chrX:150349106C>T	ENST00000218316.3	+	2	1120	c.1051C>T	c.(1051-1053)Cgt>Tgt	p.R351C	GPR50-AS1_ENST00000454196.1_RNA|AF003625.3_ENST00000602313.1_lincRNA	NM_004224.3	NP_004215.2	Q13585	MTR1L_HUMAN	G protein-coupled receptor 50	351	Pro-rich.				cell-cell signaling (GO:0007267)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)|identical protein binding (GO:0042802)|melatonin receptor activity (GO:0008502)			breast(4)|central_nervous_system(1)|endometrium(8)|kidney(1)|large_intestine(6)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|stomach(1)	38	Acute lymphoblastic leukemia(192;6.56e-05)					TGAACAAGACCGTGCCCATGC	0.607																																																0			X						C	CYS/ARG	7,3745		0,5,2,1586,568	101.0	106.0	104.0		1051	-2.0	0.0	X		104	0,6636		0,0,0,2405,1826	no	missense	GPR50	NM_004224.3	180	0,5,2,3991,2394	TT,TC,T,CC,C		0.0,0.1866,0.0674	possibly-damaging	351/618	150349106	7,10381	2161	4231	6392	150099764	SO:0001583	missense	9248			U52219	CCDS44012.1	Xq28	2012-08-21			ENSG00000102195	ENSG00000102195		"""GPCR / Class A : Orphans"""	4506	protein-coding gene	gene with protein product		300207				9933574, 18400093	Standard	NM_004224		Approved	H9, Mel1c	uc010ntg.2	Q13585	OTTHUMG00000024166	ENST00000218316.3:c.1051C>T	X.37:g.150349106C>T	ENSP00000218316:p.Arg351Cys		150099764	Q0VGG3|Q3ZAR0	Missense_Mutation	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1,PatternScan_TRYPSIN_HIS	p.R351C	ENST00000218316.3	37	c.1051	CCDS44012.1	X	.	.	.	.	.	.	.	.	.	.	C	7.248	0.602558	0.13939	0.001866	0.0	ENSG00000102195	ENST00000218316	T	0.60424	0.19	3.32	-1.96	0.07525	.	1.144850	0.06719	N	0.774538	T	0.34687	0.0906	N	0.14661	0.345	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.16041	-1.0416	10	0.45353	T	0.12	1.2454	3.2061	0.06666	0.313:0.3718:0.0:0.3153	.	351	Q13585	MTR1L_HUMAN	C	351	ENSP00000218316:R351C	ENSP00000218316:R351C	R	+	1	0	GPR50	150099764	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.502000	0.06390	-0.546000	0.06216	-1.254000	0.01491	CGT	-	NULL		0.607	GPR50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR50	protein_coding	OTTHUMT00000060874.1	C	NM_004224		150099764	+1	no_errors	NM_004224	genbank	human	validated	54_36p	missense	SNP	0.137	T
CEP350	9857	genome.wustl.edu	37	1	180047655	180047655	+	Missense_Mutation	SNP	G	G	C			TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chr1:180047655G>C	ENST00000367607.3	+	29	6243	c.5825G>C	c.(5824-5826)aGc>aCc	p.S1942T		NM_014810.4	NP_055625.4	Q5VT06	CE350_HUMAN	centrosomal protein 350kDa	1942					microtubule anchoring (GO:0034453)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	66						AACAGTGAAAGCTCCATTCCA	0.418																																																0			1											64.0	61.0	62.0					1																	180047655		2203	4300	6503	178314278	SO:0001583	missense	9857			AF287356	CCDS1336.1	1q25.2	2014-02-20			ENSG00000135837	ENSG00000135837			24238	protein-coding gene	gene with protein product	"""centrosome associated protein 350"""					16314388, 15615782	Standard	NM_014810		Approved	KIAA0480, CAP350	uc001gnt.3	Q5VT06	OTTHUMG00000035269	ENST00000367607.3:c.5825G>C	1.37:g.180047655G>C	ENSP00000356579:p.Ser1942Thr		178314278	O75068|Q8TDK3|Q8WY20	Missense_Mutation	SNP	superfamily_Cap-Gly domain,HMMPfam_CAP_GLY,PatternScan_CAP_GLY_1	p.S1941T	ENST00000367607.3	37	c.5822	CCDS1336.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.64|18.64	3.667376|3.667376	0.67814|0.67814	.|.	.|.	ENSG00000135837|ENSG00000135837	ENST00000429851|ENST00000367607	.|T	.|0.55234	.|0.53	5.31|5.31	4.4|4.4	0.53042|0.53042	.|.	.|0.000000	.|0.53938	.|D	.|0.000045	T|T	0.45577|0.45577	0.1349|0.1349	M|M	0.65975|0.65975	2.015|2.015	0.35699|0.35699	D|D	0.815439|0.815439	.|P;P	.|0.39665	.|0.682;0.561	.|B;B	.|0.28991	.|0.097;0.086	T|T	0.59134|0.59134	-0.7511|-0.7511	5|9	.|.	.|.	.|.	.|.	12.5868|12.5868	0.56423|0.56423	0.0776:0.0:0.9224:0.0|0.0776:0.0:0.9224:0.0	.|.	.|1942;1942	.|E7EU22;Q5VT06	.|.;CE350_HUMAN	N|T	116|1942	.|ENSP00000356579:S1942T	.|.	K|S	+|+	3|2	2|0	CEP350|CEP350	178314278|178314278	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.975000|0.975000	0.68041|0.68041	4.509000|4.509000	0.60448|0.60448	1.377000|1.377000	0.46286|0.46286	0.591000|0.591000	0.81541|0.81541	AAG|AGC	-	NULL		0.418	CEP350-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP350	protein_coding	OTTHUMT00000085315.2	G	NM_014810		178314278	+1	no_errors	NM_014810	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
ST6GAL1	6480	genome.wustl.edu	37	3	186760530	186760530	+	Silent	SNP	C	C	T	rs368957799		TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chr3:186760530C>T	ENST00000169298.3	+	4	713	c.39C>T	c.(37-39)tgC>tgT	p.C13C	ST6GAL1_ENST00000457772.2_Intron|ST6GAL1_ENST00000448044.1_Silent_p.C13C	NM_173216.2	NP_775323.1	P15907	SIAT1_HUMAN	ST6 beta-galactosamide alpha-2,6-sialyltranferase 1	13					cellular protein metabolic process (GO:0044267)|humoral immune response (GO:0006959)|N-acetylneuraminate metabolic process (GO:0006054)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|sialylation (GO:0097503)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	beta-galactoside alpha-2,6-sialyltransferase activity (GO:0003835)|sialyltransferase activity (GO:0008373)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	7	all_cancers(143;2.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;8.53e-19)	GBM - Glioblastoma multiforme(93;0.0939)		TCAGCTGCTGCGTCCTGGTCT	0.408																																																0			3						C	,,	0,4406		0,0,2203	164.0	160.0	162.0		39,39,	-8.4	0.0	3		162	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,intron	ST6GAL1	NM_003032.2,NM_173216.2,NM_173217.2	,,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,,	13/407,13/407,	186760530	1,13005	2203	4300	6503	188243224	SO:0001819	synonymous_variant	6480			X62822	CCDS3285.1, CCDS46973.1	3q27-q28	2013-02-26	2003-01-14	2005-02-07	ENSG00000073849	ENSG00000073849	2.4.99.1		10860	protein-coding gene	gene with protein product	"""ST6Gal I"""	109675	"""sialyltransferase 1 (beta-galactoside alpha-2,6-sialytransferase)"""	SIAT1		2408023	Standard	NM_003032		Approved		uc003frd.3	P15907	OTTHUMG00000156500	ENST00000169298.3:c.39C>T	3.37:g.186760530C>T			188243224	A8KA14|B2R513|D3DNV3	Silent	SNP	HMMPfam_Glyco_transf_29	p.C13	ENST00000169298.3	37	c.39	CCDS3285.1	3																																																																																			-	NULL		0.408	ST6GAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ST6GAL1	protein_coding	OTTHUMT00000344399.1	C	NM_173216		188243224	+1	no_errors	NM_003032	genbank	human	reviewed	54_36p	silent	SNP	0.006	T
RNPEP	6051	genome.wustl.edu	37	1	201970792	201970792	+	Nonsense_Mutation	SNP	T	T	A	rs544887005		TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chr1:201970792T>A	ENST00000295640.4	+	8	1366	c.1323T>A	c.(1321-1323)taT>taA	p.Y441*	RNPEP_ENST00000471105.1_3'UTR|RP11-465N4.4_ENST00000419190.1_RNA|RP11-465N4.4_ENST00000415582.1_RNA|RNPEP_ENST00000367286.3_Nonsense_Mutation_p.Y402*	NM_020216.3	NP_064601.3	Q9H4A4	AMPB_HUMAN	arginyl aminopeptidase (aminopeptidase B)	441					leukotriene biosynthetic process (GO:0019370)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|epoxide hydrolase activity (GO:0004301)|metalloexopeptidase activity (GO:0008235)|zinc ion binding (GO:0008270)			breast(1)|endometrium(4)|large_intestine(4)|lung(6)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21				KIRC - Kidney renal clear cell carcinoma(1967;3.23e-08)|Colorectal(1306;0.005)		CACAGGCCTATGTGCATGAAT	0.488																																					GBM(19;39 479 7473 13131 19462)											0			1											130.0	127.0	128.0					1																	201970792		2203	4300	6503	200237415	SO:0001587	stop_gained	6051			BC001064	CCDS1418.1	1q32	2008-02-05			ENSG00000176393	ENSG00000176393	3.4.11.6		10078	protein-coding gene	gene with protein product		602675				9533033, 10467730	Standard	NM_020216		Approved		uc001gxd.3	Q9H4A4	OTTHUMG00000035866	ENST00000295640.4:c.1323T>A	1.37:g.201970792T>A	ENSP00000295640:p.Tyr441*		200237415	Q9BVM9|Q9H1D4|Q9NPT7	Nonsense_Mutation	SNP	superfamily_SSF63737,HMMPfam_Peptidase_M1,superfamily_SSF55486,PatternScan_ZINC_PROTEASE,superfamily_ARM-type_fold,HMMPfam_Leuk-A4-hydro_C	p.Y441*	ENST00000295640.4	37	c.1323	CCDS1418.1	1	.	.	.	.	.	.	.	.	.	.	T	14.06	2.421821	0.43020	.	.	ENSG00000176393	ENST00000295640;ENST00000367286;ENST00000447312;ENST00000449524	.	.	.	5.71	-0.6	0.11642	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-4.6598	9.7115	0.40247	0.0:0.4105:0.0:0.5895	.	.	.	.	X	441;402;310;149	.	ENSP00000295640:Y441X	Y	+	3	2	RNPEP	200237415	0.989000	0.36119	0.749000	0.31150	0.289000	0.27227	0.064000	0.14437	-0.351000	0.08249	0.459000	0.35465	TAT	-	superfamily_SSF55486		0.488	RNPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNPEP	protein_coding	OTTHUMT00000087345.1	T	NM_020216		200237415	+1	no_errors	NM_020216	genbank	human	validated	54_36p	nonsense	SNP	0.996	A
RAPH1	65059	genome.wustl.edu	37	2	204354715	204354715	+	Missense_Mutation	SNP	A	A	C	rs371363652		TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chr2:204354715A>C	ENST00000319170.5	-	4	623	c.324T>G	c.(322-324)agT>agG	p.S108R	RAPH1_ENST00000457812.1_Missense_Mutation_p.S108R|RAPH1_ENST00000423104.1_Missense_Mutation_p.S108R|RAPH1_ENST00000308091.4_Missense_Mutation_p.S108R|RAPH1_ENST00000374493.3_Missense_Mutation_p.S108R|RAPH1_ENST00000374488.2_Missense_Mutation_p.S108R|RAPH1_ENST00000418114.1_Missense_Mutation_p.S108R|RAPH1_ENST00000439222.1_Missense_Mutation_p.S108R|RAPH1_ENST00000374489.2_Missense_Mutation_p.S108R|RAPH1_ENST00000419464.1_Missense_Mutation_p.S108R|RAPH1_ENST00000453034.1_Missense_Mutation_p.S108R	NM_213589.1	NP_998754.1	Q70E73	RAPH1_HUMAN	Ras association (RalGDS/AF-6) and pleckstrin homology domains 1	108					axon extension (GO:0048675)|cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)				breast(5)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(7)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						TTTGACGCTTACTGTTTCCTG	0.438																																																0			2						A	ARG/SER,ARG/SER	0,4406		0,0,2203	201.0	196.0	198.0		324,324	4.6	1.0	2		198	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	RAPH1	NM_203365.2,NM_213589.1	110,110	0,1,6502	CC,CA,AA		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging	108/645,108/1251	204354715	1,13005	2203	4300	6503	204062960	SO:0001583	missense	65059			AJ584699	CCDS2359.1, CCDS2360.1	2q33	2013-01-10	2003-11-25	2003-11-26	ENSG00000173166	ENSG00000173166		"""Pleckstrin homology (PH) domain containing"""	14436	protein-coding gene	gene with protein product	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 18"""	609035	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 9"""	ALS2CR9, ALS2CR18			Standard	NM_203365		Approved	KIAA1681	uc002vad.3	Q70E73	OTTHUMG00000132876	ENST00000319170.5:c.324T>G	2.37:g.204354715A>C	ENSP00000316543:p.Ser108Arg		204062960	Q96Q37|Q9C0I2	Missense_Mutation	SNP	HMMSmart_SM00314,HMMPfam_RA,superfamily_PH domain-like,HMMPfam_PH,HMMSmart_SM00233	p.S108R	ENST00000319170.5	37	c.324	CCDS2359.1	2	.	.	.	.	.	.	.	.	.	.	A	18.56	3.650387	0.67472	0.0	1.16E-4	ENSG00000173166	ENST00000457812;ENST00000319170;ENST00000374493;ENST00000374489;ENST00000374488;ENST00000308091;ENST00000439222;ENST00000419464;ENST00000423104;ENST00000453034;ENST00000432342;ENST00000418114;ENST00000413201;ENST00000428637	T;T;T;T;T;T;T;T;T;T;T	0.55052	0.7;0.7;0.54;0.7;0.73;0.57;0.73;0.7;0.7;0.56;0.7	5.78	4.62	0.57501	.	0.105490	0.42821	D	0.000649	T	0.47507	0.1449	L	0.38175	1.15	0.35843	D	0.826212	P;B;P	0.46987	0.888;0.079;0.779	P;B;B	0.50270	0.636;0.029;0.235	T	0.51164	-0.8740	10	0.15952	T	0.53	-7.8891	8.8704	0.35311	0.8563:0.0:0.1437:0.0	.	108;108;108	Q70E73-6;C9K0J5;Q70E73	.;.;RAPH1_HUMAN	R	108	ENSP00000392854:S108R;ENSP00000316543:S108R;ENSP00000363617:S108R;ENSP00000363613:S108R;ENSP00000363612:S108R;ENSP00000311293:S108R;ENSP00000411138:S108R;ENSP00000390578:S108R;ENSP00000397751:S108R;ENSP00000406662:S108R;ENSP00000396711:S108R	ENSP00000311293:S108R	S	-	3	2	RAPH1	204062960	1.000000	0.71417	1.000000	0.80357	0.850000	0.48378	3.978000	0.56881	1.002000	0.39104	0.528000	0.53228	AGT	-	NULL		0.438	RAPH1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RAPH1	protein_coding	OTTHUMT00000256363.2	A	NM_025252		204062960	-1	no_errors	NM_213589	genbank	human	validated	54_36p	missense	SNP	1.000	C
ZDBF2	57683	genome.wustl.edu	37	2	207173340	207173340	+	Missense_Mutation	SNP	G	G	T			TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chr2:207173340G>T	ENST00000374423.3	+	5	4474	c.4088G>T	c.(4087-4089)aGt>aTt	p.S1363I		NM_020923.1	NP_065974.1	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	1363							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(5)|large_intestine(28)|lung(50)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	95						AATTCTTATAGTCCTGAAGAA	0.373																																																0			2											56.0	55.0	55.0					2																	207173340		1856	4108	5964	206881585	SO:0001583	missense	57683			AB046791	CCDS46501.1, CCDS74637.1	2q33.3	2013-01-10			ENSG00000204186	ENSG00000204186		"""Zinc fingers, DBF-type"""	29313	protein-coding gene	gene with protein product						10997877	Standard	XM_005246711		Approved	FLJ45338, KIAA1571	uc002vbp.2	Q9HCK1	OTTHUMG00000154648	ENST00000374423.3:c.4088G>T	2.37:g.207173340G>T	ENSP00000363545:p.Ser1363Ile		206881585	Q6ZNP7|Q6ZSN8	Missense_Mutation	SNP	HMMPfam_zf-DBF	p.S1363I	ENST00000374423.3	37	c.4088	CCDS46501.1	2	.	.	.	.	.	.	.	.	.	.	G	11.65	1.700625	0.30142	.	.	ENSG00000204186	ENST00000374423	T	0.46819	0.86	3.68	-1.23	0.09465	.	.	.	.	.	T	0.23249	0.0562	N	0.22421	0.69	0.09310	N	1	P	0.45126	0.851	B	0.35182	0.197	T	0.18587	-1.0332	9	0.72032	D	0.01	.	0.645	0.00816	0.1973:0.1599:0.315:0.3278	.	1363	Q9HCK1	ZDBF2_HUMAN	I	1363	ENSP00000363545:S1363I	ENSP00000363545:S1363I	S	+	2	0	ZDBF2	206881585	0.000000	0.05858	0.017000	0.16124	0.001000	0.01503	-0.720000	0.04969	-0.272000	0.09259	-1.877000	0.00547	AGT	-	NULL		0.373	ZDBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDBF2	protein_coding	OTTHUMT00000336458.1	G	NM_020923		206881585	+1	no_errors	NM_020923	genbank	human	validated	54_36p	missense	SNP	0.011	T
CPO	130749	genome.wustl.edu	37	2	207827210	207827210	+	Missense_Mutation	SNP	G	G	C			TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chr2:207827210G>C	ENST00000272852.3	+	7	695	c.649G>C	c.(649-651)Gct>Cct	p.A217P		NM_173077.2	NP_775100.1	Q8IVL8	CBPO_HUMAN	carboxypeptidase O	217						extracellular region (GO:0005576)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|skin(1)	14				LUSC - Lung squamous cell carcinoma(261;0.0744)|Epithelial(149;0.0807)|Lung(261;0.142)		AGAGACTAAAGCTGTTGCCAG	0.448																																																0			2											202.0	193.0	196.0					2																	207827210		2203	4300	6503	207535455	SO:0001583	missense	130749				CCDS2372.1	2q34	2012-02-10			ENSG00000144410	ENSG00000144410			21011	protein-coding gene	gene with protein product	"""metallocarboxypeptidase O"", ""metallocarboxypeptidase C"""	609563				11836249	Standard	NM_173077		Approved		uc002vby.2	Q8IVL8	OTTHUMG00000088987	ENST00000272852.3:c.649G>C	2.37:g.207827210G>C	ENSP00000272852:p.Ala217Pro		207535455	Q2M277|Q7RTW7	Missense_Mutation	SNP	PatternScan_CARBOXYPEPT_ZN_2,superfamily_SSF53187,HMMSmart_Zn_pept,HMMPfam_Peptidase_M14,PatternScan_CARBOXYPEPT_ZN_1	p.A217P	ENST00000272852.3	37	c.649	CCDS2372.1	2	.	.	.	.	.	.	.	.	.	.	G	17.47	3.397088	0.62177	.	.	ENSG00000144410	ENST00000272852	T	0.17528	2.27	5.5	3.66	0.41972	Peptidase M14, carboxypeptidase A (2);	0.000000	0.85682	D	0.000000	T	0.52948	0.1766	H	0.97214	3.96	0.39431	D	0.967071	D	0.89917	1.0	D	0.97110	1.0	T	0.63056	-0.6722	10	0.72032	D	0.01	.	8.4376	0.32797	0.0812:0.0:0.7605:0.1583	.	217	Q8IVL8	CBPO_HUMAN	P	217	ENSP00000272852:A217P	ENSP00000272852:A217P	A	+	1	0	CPO	207535455	0.858000	0.29795	0.051000	0.19133	0.651000	0.38670	3.346000	0.52190	0.838000	0.34948	0.555000	0.69702	GCT	-	superfamily_SSF53187,HMMSmart_Zn_pept,HMMPfam_Peptidase_M14		0.448	CPO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPO	protein_coding	OTTHUMT00000202040.2	G	NM_173077		207535455	+1	no_errors	NM_173077	genbank	human	validated	54_36p	missense	SNP	0.982	C
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	DEL	AAGATCCTGCTGTGA	AAGATCCTGCTGTGA	-			TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	AAGATCCTGCTGTGA	AAGATCCTGCTGTGA					Unknown	Invalid:failed_liftOver	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chrUnknown:0delAAGATCCTGCTGTGA								None (None upstream) : None (None downstream)																								0.0																																																0			NT_113961																																								135740	SO:0001628	intergenic_variant	0																															Unknown.37:g.0delAAGATCCTGCTGTGA			135726		In_Frame_Del	DEL	superfamily_Ankyrin repeat,HMMSmart_SM00248,HMMPfam_Ank	p.DPAVK341in_frame_del		37	c.1019_1033		NT_113961																																																																																			(deletion:cds_exon[135710,135782])	NULL	0	0					ENSG00000217945			AAGATCCTGCTGTGA			135740	+1	no_start_codon	ENST00000402318	ensembl	human	novel	54_36p	in_frame_del	DEL	NULL	-
ATP7B	540	genome.wustl.edu	37	13	52542721	52542732	+	In_Frame_Del	DEL	GGCAACCAACAC	GGCAACCAACAC	-	rs192957846		TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	GGCAACCAACAC	GGCAACCAACAC					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chr13:52542721_52542732delGGCAACCAACAC	ENST00000242839.4	-	4	1711_1722	c.1555_1566delGTGTTGGTTGCC	c.(1555-1566)gtgttggttgccdel	p.VLVA519del	ATP7B_ENST00000482841.1_5'UTR|ATP7B_ENST00000344297.5_In_Frame_Del_p.VLVA519del|ATP7B_ENST00000542656.1_Intron|ATP7B_ENST00000448424.2_In_Frame_Del_p.VLVA519del|ATP7B_ENST00000418097.2_In_Frame_Del_p.VLVA519del|ATP7B_ENST00000400370.3_Intron|ATP7B_ENST00000400366.3_In_Frame_Del_p.VLVA408del	NM_000053.3	NP_000044.2	P35670	ATP7B_HUMAN	ATPase, Cu++ transporting, beta polypeptide	519	HMA 5. {ECO:0000255|PROSITE- ProRule:PRU00280}.				cellular copper ion homeostasis (GO:0006878)|cellular zinc ion homeostasis (GO:0006882)|copper ion import (GO:0015677)|copper ion transport (GO:0006825)|intracellular copper ion transport (GO:0015680)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|response to copper ion (GO:0046688)|sequestering of calcium ion (GO:0051208)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|membrane (GO:0016020)|mitochondrion (GO:0005739)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|copper ion binding (GO:0005507)|copper-exporting ATPase activity (GO:0004008)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(7)|lung(23)|ovary(1)|prostate(3)|skin(4)|stomach(2)	55		Breast(56;0.000207)|Lung NSC(96;0.000845)|Prostate(109;0.0235)|Hepatocellular(98;0.065)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;5.25e-08)	Carboplatin(DB00958)|Cisplatin(DB00515)|Oxaliplatin(DB00526)	CTGCCATCAAGGCAACCAACACGGAGAGAACA	0.519									Wilson disease																																							0			13																																								51440733	SO:0001651	inframe_deletion	540	Familial Cancer Database		U11700	CCDS41892.1, CCDS45049.1, CCDS58293.1	13q14.3	2012-10-22	2005-11-29		ENSG00000123191	ENSG00000123191	3.6.3.4	"""ATPases / P-type"""	870	protein-coding gene	gene with protein product	"""Wilson disease"", ""copper pump 2"", ""copper-transporting ATPase 2"""	606882	"""ATPase, Cu++ transporting, beta polypeptide (Wilson disease)"""	WND		8298641, 8298639	Standard	NM_000053		Approved		uc001vfw.2	P35670	OTTHUMG00000017406	ENST00000242839.4:c.1555_1566delGTGTTGGTTGCC	13.37:g.52542721_52542732delGGCAACCAACAC	ENSP00000242839:p.Val519_Ala522del		51440722	Q16318|Q16319|Q4U3V3|Q59FJ9|Q5T7X7	In_Frame_Del	DEL	superfamily_HMA heavy metal-associated domain,HMMPfam_HMA,PatternScan_HMA_1,HMMPfam_E1-E2_ATPase,superfamily_Calcium ATPase transmembrane domain M,superfamily_Calcium ATPase transduction domain A,superfamily_HAD-like,HMMPfam_Hydrolase,PatternScan_ATPASE_E1_E2,superfamily_Metal cation-transporting ATPase ATP-binding domain N	p.VLVA519in_frame_del	ENST00000242839.4	37	c.1566_1555	CCDS41892.1	13																																																																																			(deletion:cds_exon[51440581,51440744])	superfamily_HMA heavy metal-associated domain,HMMPfam_HMA,PatternScan_HMA_1		0.519	ATP7B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP7B	protein_coding	OTTHUMT00000045981.1	GGCAACCAACAC	NM_000053		51440733	-1	no_errors	NM_000053	genbank	human	reviewed	54_36p	in_frame_del	DEL	0.993:0.993:1.000:0.994:0.607:0.998:1.000:1.000:1.000:0.998:0.997:1.000	-
PC	5091	genome.wustl.edu	37	11	66617253	66617255	+	In_Frame_Del	DEL	CTT	CTT	-	rs368895283		TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	CTT	CTT					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chr11:66617253_66617255delCTT	ENST00000393958.2	-	20	3067_3069	c.2974_2976delAAG	c.(2974-2976)aagdel	p.K992del	PC_ENST00000529047.1_In_Frame_Del_p.K112del|PC_ENST00000528224.1_5'UTR|PC_ENST00000393955.2_In_Frame_Del_p.K992del|PC_ENST00000393960.1_In_Frame_Del_p.K992del	NM_000920.3	NP_000911.2	P11498	PYC_HUMAN	pyruvate carboxylase	992					biotin metabolic process (GO:0006768)|carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|lipid metabolic process (GO:0006629)|oxaloacetate metabolic process (GO:0006107)|pyruvate metabolic process (GO:0006090)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|pyruvate carboxylase activity (GO:0004736)			cervix(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(12)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32		Melanoma(852;0.0525)		Lung(977;0.153)|LUSC - Lung squamous cell carcinoma(976;0.227)	Biotin(DB00121)|Pyruvic acid(DB00119)	CTACCAGCTCCTTCTCCAGTGCC	0.611																																																0			11																																								66373831	SO:0001651	inframe_deletion	5091			U04641	CCDS8152.1	11q13.4-q13.5	2012-07-11			ENSG00000173599	ENSG00000173599	6.4.1.1		8636	protein-coding gene	gene with protein product		608786				6548474	Standard	NM_022172		Approved	PCB	uc001ojn.1	P11498	OTTHUMG00000167099	ENST00000393958.2:c.2974_2976delAAG	11.37:g.66617253_66617255delCTT	ENSP00000377530:p.Lys992del		66373829	B4DN00|Q16705	In_Frame_Del	DEL	HMMPfam_CPSase_L_chain,superfamily_PreATP-grasp-like,HMMPfam_CPSase_L_D2,superfamily_SSF56059,superfamily_Rudmnt_hyb_motif,HMMPfam_Biotin_carb_C,superfamily_SSF51569,HMMPfam_HMGL-like,HMMPfam_PYC_OADA,superfamily_SSF89000,superfamily_Hybrid_motif,HMMPfam_Biotin_lipoyl,PatternScan_BIOTIN	p.K992in_frame_del	ENST00000393958.2	37	c.2976_2974	CCDS8152.1	11																																																																																			(deletion:cds_exon[66373658,66373906])	HMMPfam_PYC_OADA,superfamily_SSF89000		0.611	PC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PC	protein_coding	OTTHUMT00000393115.1	CTT	NM_001040716		66373831	-1	no_errors	NM_000920	genbank	human	reviewed	54_36p	in_frame_del	DEL	1.000:1.000:1.000	-
PLXNA3	55558	genome.wustl.edu	37	X	153697233	153697245	+	Frame_Shift_Del	DEL	TTGATGCCATCAC	TTGATGCCATCAC	-			TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	TTGATGCCATCAC	TTGATGCCATCAC					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chrX:153697233_153697245delTTGATGCCATCAC	ENST00000369682.3	+	25	4530_4542	c.4355_4367delTTGATGCCATCAC	c.(4354-4368)attgatgccatcacgfs	p.IDAIT1452fs		NM_017514.3	NP_059984.3	P51805	PLXA3_HUMAN	plexin A3	1452					axon guidance (GO:0007411)|branchiomotor neuron axon guidance (GO:0021785)|facial nerve structural organization (GO:0021612)|hippocampus development (GO:0021766)|multicellular organismal development (GO:0007275)|negative chemotaxis (GO:0050919)|negative regulation of axon extension involved in axon guidance (GO:0048843)|positive regulation of cytoskeleton organization (GO:0051495)|pyramidal neuron development (GO:0021860)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|trigeminal nerve structural organization (GO:0021637)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(26)|ovary(2)|prostate(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	48	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					AAGGGCCCCATTGATGCCATCACGGGCGAGGCA	0.62																																																0			X																																								153350439	SO:0001589	frameshift_variant	55558			X74609	CCDS14752.1	Xq28	2008-02-05			ENSG00000130827	ENSG00000130827		"""Plexins"""	9101	protein-coding gene	gene with protein product		300022		PLXN4		8248200, 8733135	Standard	NM_017514		Approved	SEX, XAP-6, 6.3, Plxn3	uc004flm.3	P51805	OTTHUMG00000033290	ENST00000369682.3:c.4355_4367delTTGATGCCATCAC	X.37:g.153697233_153697245delTTGATGCCATCAC	ENSP00000358696:p.Ile1452fs		153350427	Q5HY36	Frame_Shift_Del	DEL	superfamily_Sema,HMMPfam_Sema,HMMSmart_Sema,HMMPfam_PSI,HMMSmart_PSI,superfamily_Plexin-like_fold,HMMSmart_IPT,superfamily_Ig_E-set,HMMPfam_TIG,HMMPfam_Plexin_cytopl,superfamily_Rho_GAP	p.I1452fs	ENST00000369682.3	37	c.4355_4367	CCDS14752.1	X																																																																																			(deletion:cds_exon[153350360,153350506])	HMMPfam_Plexin_cytopl,superfamily_Rho_GAP		0.620	PLXNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNA3	protein_coding	OTTHUMT00000081634.1	TTGATGCCATCAC	NM_017514		153350439	+1	no_errors	NM_017514	genbank	human	validated	54_36p	frame_shift_del	DEL	0.997:0.741:0.996:0.995:0.802:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000	-
PLXNA3	55558	genome.wustl.edu	37	X	153699662	153699676	+	Splice_Site	DEL	TGGGCTCCGCCCTGC	TGGGCTCCGCCCTGC	-			TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	TGGGCTCCGCCCTGC	TGGGCTCCGCCCTGC					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chrX:153699662_153699676delTGGGCTCCGCCCTGC	ENST00000369682.3	+	31	5544		c.e31+2			NM_017514.3	NP_059984.3	P51805	PLXA3_HUMAN	plexin A3						axon guidance (GO:0007411)|branchiomotor neuron axon guidance (GO:0021785)|facial nerve structural organization (GO:0021612)|hippocampus development (GO:0021766)|multicellular organismal development (GO:0007275)|negative chemotaxis (GO:0050919)|negative regulation of axon extension involved in axon guidance (GO:0048843)|positive regulation of cytoskeleton organization (GO:0051495)|pyramidal neuron development (GO:0021860)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|trigeminal nerve structural organization (GO:0021637)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(26)|ovary(2)|prostate(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	48	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GGTGGAGAGGTGGGCTCCGCCCTGCTGTGGGTGGC	0.674																																																0			X																																								153352870	SO:0001630	splice_region_variant	55558			X74609	CCDS14752.1	Xq28	2008-02-05			ENSG00000130827	ENSG00000130827		"""Plexins"""	9101	protein-coding gene	gene with protein product		300022		PLXN4		8248200, 8733135	Standard	NM_017514		Approved	SEX, XAP-6, 6.3, Plxn3	uc004flm.3	P51805	OTTHUMG00000033290	ENST00000369682.3:c.5369+2TGGGCTCCGCCCTGC>-	X.37:g.153699662_153699676delTGGGCTCCGCCCTGC			153352856	Q5HY36	Splice_Site	DEL	-	e30+2	ENST00000369682.3	37	c.5369+2_5369+1	CCDS14752.1	X																																																																																			(deletion:intron[153352855,153353024])	-		0.674	PLXNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNA3	protein_coding	OTTHUMT00000081634.1	TGGGCTCCGCCCTGC	NM_017514	Intron	153352870	+1	no_errors	NM_017514	genbank	human	validated	54_36p	splice_site_del	DEL	1.000:0.981:0.888:0.866:0.189:0.031:0.029:0.000:0.000:0.000:0.000:0.000:0.000:0.001:0.000	-
AXDND1	126859	genome.wustl.edu	37	1	179364254	179364261	+	Frame_Shift_Del	DEL	ACATGATG	ACATGATG	-	rs147693539	byFrequency	TCGA-20-1682-01A-01W-0633-09	TCGA-20-1682-10A-01W-0633-09	ACATGATG	ACATGATG					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	1a77c0cf-43c2-409b-81db-a8091e3ebfe0	86334b20-a70a-4a78-8fef-3f98c25e3197	g.chr1:179364254_179364261delACATGATG	ENST00000367618.3	+	11	1413_1420	c.1026_1033delACATGATG	c.(1024-1035)gcacatgatgtgfs	p.HDV343fs	AXDND1_ENST00000457238.2_Frame_Shift_Del_p.HDV343fs|AXDND1_ENST00000461179.2_3'UTR	NM_144696.4	NP_653297.3	Q5T1B0	AXDN1_HUMAN	axonemal dynein light chain domain containing 1	343										NS(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(27)|ovary(1)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	59						TAGTTCGGGCACATGATGTGAAATTAAC	0.332																																																0			1																																								177630884	SO:0001589	frameshift_variant	126859			BX647935	CCDS30948.1	1q25.2	2011-02-18	2011-02-18	2011-02-18	ENSG00000162779	ENSG00000162779			26564	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 125"""	C1orf125		14702039	Standard	NM_144696		Approved	FLJ32940	uc001gmo.3	Q5T1B0	OTTHUMG00000035266	ENST00000367618.3:c.1026_1033delACATGATG	1.37:g.179364254_179364261delACATGATG	ENSP00000356590:p.His343fs		177630877	Q6AWB2|Q96LJ3|Q96M01	Frame_Shift_Del	DEL	HMMPfam_Ax_dynein_light	p.H343fs	ENST00000367618.3	37	c.1026_1033	CCDS30948.1	1																																																																																			(deletion:cds_exon[177630856,177630960])	NULL		0.332	AXDND1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf125	protein_coding	OTTHUMT00000085312.1	ACATGATG	NM_144696		177630884	+1	no_errors	NM_144696	genbank	human	validated	54_36p	frame_shift_del	DEL	0.980:0.996:0.998:0.997:0.997:0.971:0.331:0.255	-
