#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
HSD3B1	3283	broad.mit.edu	37	1	120056873	120056873	+	Missense_Mutation	SNP	C	C	A			TCGA-23-2081-01A-01W-0722-08	TCGA-23-2081-10A-01W-0722-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	05cd5b89-dd8b-49fa-afec-787b644f7854	c53ea000-9f6d-44ea-b41b-a2a10fb1deb0	g.chr1:120056873C>A	ENST00000369413.3	+	4	872	c.727C>A	c.(727-729)Ccc>Acc	p.P243T	HSD3B1_ENST00000235547.6_Missense_Mutation_p.P245T|HSD3B1_ENST00000528909.1_Missense_Mutation_p.P243T			P14060	3BHS1_HUMAN	hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1	243					androgen biosynthetic process (GO:0006702)|estrogen biosynthetic process (GO:0006703)|glucocorticoid biosynthetic process (GO:0006704)|mineralocorticoid biosynthetic process (GO:0006705)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)|steroid metabolic process (GO:0008202)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|smooth endoplasmic reticulum membrane (GO:0030868)	3-beta-hydroxy-delta5-steroid dehydrogenase activity (GO:0003854)|steroid delta-isomerase activity (GO:0004769)	p.P243T(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(18)|ovary(2)|prostate(1)|skin(1)	32	all_neural(166;0.219)	all_lung(203;3.16e-06)|Lung NSC(69;2.19e-05)|all_epithelial(167;0.000624)		Lung(183;0.0106)|LUSC - Lung squamous cell carcinoma(189;0.0554)	Trilostane(DB01108)	CCTGCAGGACCCCAAGAAGGC	0.507																																																1	Substitution - Missense(1)	ovary(1)	1											60.0	65.0	63.0					1																	120056873		2203	4300	6503	119858396	SO:0001583	missense	3283			S45679	CCDS903.1	1p12	2014-06-03			ENSG00000203857	ENSG00000203857	1.1.1.145, 5.3.3.1	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	5217	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 11E, member 1"""	109715		HSDB3, HSD3B		2779585, 19027726	Standard	NM_000862		Approved	SDR11E1	uc001ehv.1	P14060	OTTHUMG00000012525	ENST00000369413.3:c.727C>A	1.37:g.120056873C>A	ENSP00000358421:p.Pro243Thr		119858396	A8K691|Q14545|Q8IV65	Missense_Mutation	SNP	ENST00000369413.3	37	CCDS903.1	.	.	.	.	.	.	.	.	.	.	C	13.06	2.123875	0.37436	.	.	ENSG00000203857	ENST00000369413;ENST00000235547;ENST00000528909	D;D;D	0.85088	-1.94;-1.94;-1.94	3.26	1.33	0.21861	3-beta hydroxysteroid dehydrogenase/isomerase (1);NAD(P)-binding domain (1);	0.173944	0.51477	D	0.000099	D	0.84266	0.5434	M	0.74258	2.255	0.39922	D	0.974179	P;D	0.53151	0.74;0.958	P;P	0.57846	0.491;0.828	D	0.83820	0.0246	10	0.72032	D	0.01	4.5762	6.8322	0.23917	0.0:0.7444:0.0:0.2556	.	245;243	Q5TDG2;P14060	.;3BHS1_HUMAN	T	243;245;243	ENSP00000358421:P243T;ENSP00000235547:P245T;ENSP00000432268:P243T	ENSP00000235547:P245T	P	+	1	0	HSD3B1	119858396	1.000000	0.71417	0.957000	0.39632	0.228000	0.25075	3.541000	0.53618	0.685000	0.31468	0.313000	0.20887	CCC		0.507	HSD3B1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000034993.3	NM_000862	
ETV3L	440695	broad.mit.edu	37	1	157069286	157069286	+	Missense_Mutation	SNP	G	G	C			TCGA-23-2081-01A-01W-0722-08	TCGA-23-2081-10A-01W-0722-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	05cd5b89-dd8b-49fa-afec-787b644f7854	c53ea000-9f6d-44ea-b41b-a2a10fb1deb0	g.chr1:157069286G>C	ENST00000454449.2	-	1	314	c.30C>G	c.(28-30)atC>atG	p.I10M		NM_001004341.2	NP_001004341.1	Q6ZN32	ETV3L_HUMAN	ets variant 3-like	10					cell differentiation (GO:0030154)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.I10M(1)		breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(9)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	24	Hepatocellular(266;0.158)	Prostate(1639;0.184)				GGTTGGCTGGGATGCCCTCAG	0.637																																																1	Substitution - Missense(1)	ovary(1)	1											33.0	30.0	31.0					1																	157069286		2203	4300	6503	155335910	SO:0001583	missense	440695			AK131392	CCDS30893.1	1q23.1	2013-09-24	2008-09-12		ENSG00000253831	ENSG00000253831			33834	protein-coding gene	gene with protein product			"""ets variant gene 3-like"""				Standard	NM_001004341		Approved	FLJ16478	uc001fqq.2	Q6ZN32	OTTHUMG00000041325	ENST00000454449.2:c.30C>G	1.37:g.157069286G>C	ENSP00000430271:p.Ile10Met		155335910		Missense_Mutation	SNP	ENST00000454449.2	37	CCDS30893.1	.	.	.	.	.	.	.	.	.	.	G	11.00	1.510542	0.27036	.	.	ENSG00000253831	ENST00000454449	T	0.09073	3.02	5.16	0.926	0.19430	.	1.858080	0.03241	N	0.180424	T	0.01454	0.0047	N	0.19112	0.55	0.09310	N	1	B	0.17465	0.022	B	0.09377	0.004	T	0.44483	-0.9325	10	0.30078	T	0.28	.	1.0729	0.01625	0.1762:0.1508:0.3617:0.3113	.	10	Q6ZN32	ETV3L_HUMAN	M	10	ENSP00000430271:I10M	ENSP00000430271:I10M	I	-	3	3	ETV3L	155335910	0.009000	0.17119	0.015000	0.15790	0.036000	0.12997	0.212000	0.17497	0.666000	0.31087	0.655000	0.94253	ATC		0.637	ETV3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000099024.2	NM_001004341	
OR10J5	127385	broad.mit.edu	37	1	159505434	159505434	+	Missense_Mutation	SNP	G	G	A	rs373445383		TCGA-23-2081-01A-01W-0722-08	TCGA-23-2081-10A-01W-0722-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	05cd5b89-dd8b-49fa-afec-787b644f7854	c53ea000-9f6d-44ea-b41b-a2a10fb1deb0	g.chr1:159505434G>A	ENST00000334857.2	-	1	408	c.364C>T	c.(364-366)Cgc>Tgc	p.R122C		NM_001004469.1	NP_001004469.1	Q8NHC4	O10J5_HUMAN	olfactory receptor, family 10, subfamily J, member 5	122						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R122C(2)		kidney(1)|large_intestine(4)|lung(9)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	22	all_hematologic(112;0.0429)					GCCACATAGCGGTCATACCCC	0.478																																																2	Substitution - Missense(2)	ovary(1)|prostate(1)	1											121.0	102.0	108.0					1																	159505434		2203	4300	6503	157772058	SO:0001583	missense	127385				CCDS30910.1	1q23.2	2012-08-09			ENSG00000184155	ENSG00000184155		"""GPCR / Class A : Olfactory receptors"""	14993	protein-coding gene	gene with protein product							Standard	NM_001004469		Approved		uc010piw.2	Q8NHC4	OTTHUMG00000022738	ENST00000334857.2:c.364C>T	1.37:g.159505434G>A	ENSP00000334441:p.Arg122Cys		157772058	B9EH35|Q6IFH2	Missense_Mutation	SNP	ENST00000334857.2	37	CCDS30910.1	.	.	.	.	.	.	.	.	.	.	G	4.834	0.154959	0.09236	.	.	ENSG00000184155	ENST00000334857	T	0.77358	-1.09	4.13	-6.71	0.01760	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.58323	0.2114	M	0.89968	3.075	0.41428	D	0.987848	P	0.35684	0.515	B	0.27715	0.082	T	0.53989	-0.8360	9	0.72032	D	0.01	.	4.5851	0.12279	0.3824:0.0:0.3066:0.311	.	122	Q8NHC4	O10J5_HUMAN	C	122	ENSP00000334441:R122C	ENSP00000334441:R122C	R	-	1	0	OR10J5	157772058	0.932000	0.31603	0.076000	0.20297	0.002000	0.02628	0.437000	0.21543	-1.738000	0.01348	-1.314000	0.01303	CGC		0.478	OR10J5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059021.1	NM_001004469	
FCGR3A	2214	broad.mit.edu	37	1	161514546	161514546	+	Silent	SNP	C	C	T			TCGA-23-2081-01A-01W-0722-08	TCGA-23-2081-10A-01W-0722-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	05cd5b89-dd8b-49fa-afec-787b644f7854	c53ea000-9f6d-44ea-b41b-a2a10fb1deb0	g.chr1:161514546C>T	ENST00000436743.1	-	5	676	c.522G>A	c.(520-522)ggG>ggA	p.G174G	FCGR3A_ENST00000540048.1_Silent_p.G174G|RP11-25K21.6_ENST00000537821.2_RNA|FCGR3A_ENST00000476031.1_5'Flank|FCGR3A_ENST00000443193.1_Silent_p.G209G|FCGR3A_ENST00000367969.3_Silent_p.G210G	NM_001127593.1|NM_001127595.1|NM_001127596.1	NP_001121065.1|NP_001121067.1|NP_001121068.1	P08637	FCG3A_HUMAN	Fc fragment of IgG, low affinity IIIa, receptor (CD16a)	174	Ig-like C2-type 2.				Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of immune response (GO:0050776)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.G210G(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(14)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	24	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Intravenous Immunoglobulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	TCCCAAAAAGCCCCCTGCAGA	0.468																																																1	Substitution - coding silent(1)	ovary(1)	1											78.0	79.0	79.0					1																	161514546		2203	4300	6503	159781170	SO:0001819	synonymous_variant	2214			BC036723	CCDS1232.1, CCDS44266.1	1q23	2014-09-17	2005-02-02		ENSG00000203747	ENSG00000203747		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3619	protein-coding gene	gene with protein product		146740	"""Fc fragment of IgG, low affinity IIIa, receptor for (CD16)"""	FCGR3, FCG3		2139735	Standard	NM_001127592		Approved	CD16, CD16a	uc001gar.3	P08637	OTTHUMG00000034466	ENST00000436743.1:c.522G>A	1.37:g.161514546C>T			159781170	A2N6W9|Q53FJ0|Q53FL6|Q5EBR4|Q65ZM6|Q6PIJ0	Silent	SNP	ENST00000436743.1	37	CCDS44266.1	.	.	.	.	.	.	.	.	.	.	C	2.989	-0.208527	0.06140	.	.	ENSG00000203747	ENST00000426740	T	0.13778	2.56	4.71	-8.43	0.00953	.	0.286200	0.24620	N	0.036978	T	0.04048	0.0113	.	.	.	0.21386	N	0.999708	.	.	.	.	.	.	T	0.09574	-1.0668	7	0.87932	D	0	.	4.6627	0.12650	0.1773:0.248:0.4412:0.1335	.	.	.	.	D	191	ENSP00000410180:G191D	ENSP00000410180:G191D	G	-	2	0	FCGR3A	159781170	0.000000	0.05858	0.000000	0.03702	0.030000	0.12068	-2.894000	0.00707	-2.008000	0.00955	-2.689000	0.00140	GGC		0.468	FCGR3A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102169.2	NM_000569	
CDH23	64072	broad.mit.edu	37	10	73562832	73562832	+	Splice_Site	SNP	G	G	T			TCGA-23-2081-01A-01W-0722-08	TCGA-23-2081-10A-01W-0722-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	05cd5b89-dd8b-49fa-afec-787b644f7854	c53ea000-9f6d-44ea-b41b-a2a10fb1deb0	g.chr10:73562832G>T	ENST00000224721.6	+	53	7680	c.7675G>T	c.(7675-7677)Gag>Tag	p.E2559*	CDH23_ENST00000475158.1_3'UTR|CDH23_ENST00000398788.3_Splice_Site_p.E314*	NM_022124.5	NP_071407.4	Q9H251	CAD23_HUMAN	cadherin-related 23	2554	Cadherin 24. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium ion transport (GO:0006816)|calcium-dependent cell-cell adhesion (GO:0016339)|cytosolic calcium ion homeostasis (GO:0051480)|equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)	calcium ion binding (GO:0005509)	p.E2559*(1)		NS(1)|breast(2)|central_nervous_system(6)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(27)|lung(49)|ovary(3)|pancreas(1)|prostate(7)|stomach(7)|upper_aerodigestive_tract(3)	133						CCCTGGCGTGGGTATGTGGCC	0.617																																																1	Substitution - Nonsense(1)	ovary(1)	10	GRCh37	CM063888	CDH23	M							70.0	74.0	73.0					10																	73562832		1984	4155	6139	73232838	SO:0001630	splice_region_variant	64072			AY010111	CCDS53540.1, CCDS73146.1	10q22.1	2014-08-08	2010-01-25		ENSG00000107736	ENSG00000107736		"""Cadherins / Cadherin-related"""	13733	protein-coding gene	gene with protein product	"""cadherin-related family member 23"""	605516	"""cadherin related 23"", ""cadherin-like 23"""	DFNB12, USH1D		11090341	Standard	NM_022124		Approved	CDHR23	uc001jrx.4	Q9H251	OTTHUMG00000019347	ENST00000224721.6:c.7675+1G>T	10.37:g.73562832G>T			73232838	C4IXS9|F6U049|Q5QGS1|Q5QGS2|Q5QGS5|Q5QGS6|Q5XKN2|Q6UWW1|Q96JL3|Q9H4K9	Nonsense_Mutation	SNP	ENST00000224721.6	37		.	.	.	.	.	.	.	.	.	.	G	39	7.507638	0.98325	.	.	ENSG00000107736	ENST00000398860;ENST00000398855;ENST00000224721;ENST00000398788	.	.	.	5.02	4.12	0.48240	.	0.124573	0.53938	D	0.000060	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.42905	T	0.14	.	13.6301	0.62189	0.0755:0.0:0.9244:0.0	.	.	.	.	X	2559;2554;2557;314	.	ENSP00000224721:E2559X	E	+	1	0	CDH23	73232838	1.000000	0.71417	0.642000	0.29436	0.701000	0.40568	9.265000	0.95647	1.250000	0.43966	0.551000	0.68910	GAG		0.617	CDH23-001	PUTATIVE	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051227.4	NM_052836	Nonsense_Mutation
TTC17	55761	broad.mit.edu	37	11	43427399	43427399	+	Silent	SNP	C	C	T			TCGA-23-2081-01A-01W-0722-08	TCGA-23-2081-10A-01W-0722-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	05cd5b89-dd8b-49fa-afec-787b644f7854	c53ea000-9f6d-44ea-b41b-a2a10fb1deb0	g.chr11:43427399C>T	ENST00000039989.4	+	13	1673	c.1659C>T	c.(1657-1659)tcC>tcT	p.S553S	TTC17_ENST00000526774.1_3'UTR|TTC17_ENST00000299240.6_Silent_p.S553S	NM_018259.5	NP_060729.2	Q96AE7	TTC17_HUMAN	tetratricopeptide repeat domain 17	553					actin filament polymerization (GO:0030041)|cilium organization (GO:0044782)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)		p.S553S(1)		breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(27)|ovary(5)|prostate(3)|skin(3)	53						CTGACTGTTCCATAACTGACT	0.423																																																1	Substitution - coding silent(1)	ovary(1)	11											119.0	112.0	115.0					11																	43427399		2203	4300	6503	43383975	SO:0001819	synonymous_variant	55761			AK001540	CCDS31466.1	11p11.2	2013-01-10			ENSG00000052841	ENSG00000052841		"""Tetratricopeptide (TTC) repeat domain containing"""	25596	protein-coding gene	gene with protein product						12477932	Standard	NM_018259		Approved	FLJ10890	uc001mxi.3	Q96AE7	OTTHUMG00000166398	ENST00000039989.4:c.1659C>T	11.37:g.43427399C>T			43383975	G3XAB3|Q8NEC0	Silent	SNP	ENST00000039989.4	37	CCDS31466.1																																																																																				0.423	TTC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389577.2	NM_018259	
Unknown	0	broad.mit.edu	37	11	124095490	124095490	+	IGR	SNP	A	A	G			TCGA-23-2081-01A-01W-0722-08	TCGA-23-2081-10A-01W-0722-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	05cd5b89-dd8b-49fa-afec-787b644f7854	c53ea000-9f6d-44ea-b41b-a2a10fb1deb0	g.chr11:124095490A>G								OR10D3 (38538 upstream) : OR8G1 (24932 downstream)																							CTGGGCTCTCAGAACAGCCAG	0.493																																																0			11											86.0	89.0	88.0					11																	124095490		2077	4235	6312	123600700	SO:0001628	intergenic_variant	26492																															11.37:g.124095490A>G			123600700		Silent	SNP		37																																																																																				0	0.493								
KRT6C	286887	broad.mit.edu	37	12	52865203	52865203	+	Splice_Site	SNP	A	A	G			TCGA-23-2081-01A-01W-0722-08	TCGA-23-2081-10A-01W-0722-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	05cd5b89-dd8b-49fa-afec-787b644f7854	c53ea000-9f6d-44ea-b41b-a2a10fb1deb0	g.chr12:52865203A>G	ENST00000252250.6	-	4	960		c.e4+1			NM_173086.4	NP_775109.2	P48668	K2C6C_HUMAN	keratin 6C						intermediate filament cytoskeleton organization (GO:0045104)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)	p.?(1)		cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(6)|ovary(3)|prostate(2)|skin(2)	23				BRCA - Breast invasive adenocarcinoma(357;0.0828)		GGAGATGCTTACTGCATCATA	0.463																																																1	Unknown(1)	ovary(1)	12											115.0	104.0	108.0					12																	52865203		2203	4300	6503	51151470	SO:0001630	splice_region_variant	286887			L42611	CCDS8829.1	12q13.13	2013-01-16	2006-07-17	2006-07-17	ENSG00000170465	ENSG00000170465		"""-"", ""Intermediate filaments type II, keratins (basic)"""	20406	protein-coding gene	gene with protein product		612315	"""keratin 6E"""	KRT6E		7543104, 16831889	Standard	NM_173086		Approved		uc001sal.4	P48668	OTTHUMG00000169596	ENST00000252250.6:c.912+1T>C	12.37:g.52865203A>G			51151470	A1L4L5|P48666|Q2TAZ9|Q7RTN9	Splice_Site	SNP	ENST00000252250.6	37	CCDS8829.1	.	.	.	.	.	.	.	.	.	.	A	13.71	2.319164	0.41096	.	.	ENSG00000170465	ENST00000252250;ENST00000411979	.	.	.	3.33	3.33	0.38152	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.7221	0.46046	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	KRT6C	51151470	1.000000	0.71417	0.653000	0.29593	0.217000	0.24651	6.964000	0.76061	1.507000	0.48752	0.368000	0.22195	.		0.463	KRT6C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404976.1	NM_173086	Intron
TMCC3	57458	broad.mit.edu	37	12	94975623	94975623	+	Missense_Mutation	SNP	C	C	T			TCGA-23-2081-01A-01W-0722-08	TCGA-23-2081-10A-01W-0722-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	05cd5b89-dd8b-49fa-afec-787b644f7854	c53ea000-9f6d-44ea-b41b-a2a10fb1deb0	g.chr12:94975623C>T	ENST00000261226.4	-	2	901	c.770G>A	c.(769-771)tGt>tAt	p.C257Y	TMCC3_ENST00000551457.1_Missense_Mutation_p.C226Y	NM_020698.2	NP_065749	Q9ULS5	TMCC3_HUMAN	transmembrane and coiled-coil domain family 3	257						integral component of membrane (GO:0016021)		p.C257Y(1)		NS(1)|breast(3)|endometrium(2)|kidney(2)|large_intestine(8)|lung(10)|ovary(1)|skin(1)|urinary_tract(1)	29						GCCACTCGAACATTCATCATC	0.577																																																1	Substitution - Missense(1)	ovary(1)	12											102.0	92.0	96.0					12																	94975623		2203	4300	6503	93499754	SO:0001583	missense	57458			AB032971	CCDS31877.1, CCDS73506.1	12q22	2005-01-21	2005-07-13			ENSG00000057704		"""Transmembrane and coiled-coil domain containing"""	29199	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 3"""			10574461	Standard	XM_005269039		Approved	KIAA1145	uc001tdj.2	Q9ULS5	OTTHUMG00000170225	ENST00000261226.4:c.770G>A	12.37:g.94975623C>T	ENSP00000261226:p.Cys257Tyr		93499754	Q8IWB2	Missense_Mutation	SNP	ENST00000261226.4	37	CCDS31877.1	.	.	.	.	.	.	.	.	.	.	C	19.58	3.854532	0.71719	.	.	ENSG00000057704	ENST00000261226;ENST00000551457	T;T	0.52057	0.68;0.68	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	T	0.73814	0.3635	M	0.83774	2.66	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	T	0.76008	-0.3116	10	0.87932	D	0	-23.3798	20.3242	0.98691	0.0:1.0:0.0:0.0	.	257	Q9ULS5	TMCC3_HUMAN	Y	257;226	ENSP00000261226:C257Y;ENSP00000449888:C226Y	ENSP00000261226:C257Y	C	-	2	0	TMCC3	93499754	1.000000	0.71417	0.967000	0.41034	0.433000	0.31745	7.487000	0.81328	2.811000	0.96726	0.555000	0.69702	TGT		0.577	TMCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408113.1	NM_020698	
TMEM132D	121256	broad.mit.edu	37	12	130185159	130185159	+	Missense_Mutation	SNP	T	T	G			TCGA-23-2081-01A-01W-0722-08	TCGA-23-2081-10A-01W-0722-08	T	T	G	G	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	05cd5b89-dd8b-49fa-afec-787b644f7854	c53ea000-9f6d-44ea-b41b-a2a10fb1deb0	g.chr12:130185159T>G	ENST00000422113.2	-	2	490	c.164A>C	c.(163-165)aAc>aCc	p.N55T	RP11-174M13.2_ENST00000544036.1_lincRNA	NM_133448.2	NP_597705.2	Q14C87	T132D_HUMAN	transmembrane protein 132D	55					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)		p.N55T(1)		NS(1)|breast(6)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(33)|liver(1)|lung(69)|ovary(10)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(2)	152	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		GACGTCCGCGTTGTTGATGTG	0.552																																																1	Substitution - Missense(1)	ovary(1)	12											96.0	71.0	80.0					12																	130185159		2203	4300	6503	128751112	SO:0001583	missense	121256			AB061814	CCDS9266.1	12q24.32-q24.33	2014-06-13			ENSG00000151952	ENSG00000151952			29411	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 153"""	611257				11853319, 12966072	Standard	NM_133448		Approved	KIAA1944, MOLT, PPP1R153	uc009zyl.1	Q14C87	OTTHUMG00000168400	ENST00000422113.2:c.164A>C	12.37:g.130185159T>G	ENSP00000408581:p.Asn55Thr		128751112	Q14C96|Q76M59|Q8N1W9|Q8N3Q5|Q8TF57	Missense_Mutation	SNP	ENST00000422113.2	37	CCDS9266.1	.	.	.	.	.	.	.	.	.	.	T	15.53	2.860620	0.51482	.	.	ENSG00000151952	ENST00000422113	T	0.13089	2.62	5.33	1.66	0.24008	.	0.735385	0.12590	N	0.455644	T	0.14184	0.0343	M	0.65975	2.015	0.09310	N	1	P	0.38504	0.634	B	0.34242	0.178	T	0.11179	-1.0598	9	.	.	.	-9.6166	8.3218	0.32134	0.0:0.295:0.0:0.705	.	55	Q14C87	T132D_HUMAN	T	55	ENSP00000408581:N55T	.	N	-	2	0	TMEM132D	128751112	0.998000	0.40836	0.001000	0.08648	0.901000	0.52897	4.115000	0.57865	0.036000	0.15547	0.454000	0.30748	AAC		0.552	TMEM132D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399592.1	NM_133448	
TJP1	7082	broad.mit.edu	37	15	30025330	30025330	+	Silent	SNP	C	C	T			TCGA-23-2081-01A-01W-0722-08	TCGA-23-2081-10A-01W-0722-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	05cd5b89-dd8b-49fa-afec-787b644f7854	c53ea000-9f6d-44ea-b41b-a2a10fb1deb0	g.chr15:30025330C>T	ENST00000346128.6	-	13	2178	c.1704G>A	c.(1702-1704)gaG>gaA	p.E568E	TJP1_ENST00000356107.6_Silent_p.E568E|TJP1_ENST00000545208.2_Silent_p.E568E|TJP1_ENST00000400011.2_Silent_p.E572E	NM_003257.3|NM_175610.2	NP_003248.3|NP_783297.2	Q07157	ZO1_HUMAN	tight junction protein 1	568	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				apoptotic process (GO:0006915)|blastocyst formation (GO:0001825)|cell-cell junction assembly (GO:0007043)|cell-cell signaling involved in cell-cell junction organization (GO:1901350)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to glucose stimulus (GO:0071333)|hippo signaling (GO:0035329)|membrane organization (GO:0061024)|negative regulation of vascular permeability (GO:0043116)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to magnetism (GO:0071000)|sensory perception of sound (GO:0007605)	apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|basolateral plasma membrane (GO:0016323)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|gap junction (GO:0005921)|intercalated disc (GO:0014704)|intercellular canaliculus (GO:0046581)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)		p.E568E(1)		breast(4)|central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(12)|liver(1)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|urinary_tract(1)	68		all_lung(180;7.48e-11)|Breast(32;0.000153)		all cancers(64;3.29e-10)|Epithelial(43;5.34e-09)|BRCA - Breast invasive adenocarcinoma(123;0.0034)|GBM - Glioblastoma multiforme(186;0.0139)|Lung(196;0.186)		CTCGTTCTACCTCCTTATGAT	0.383																																					Melanoma(77;681 1843 6309 6570)											1	Substitution - coding silent(1)	ovary(1)	15											152.0	134.0	139.0					15																	30025330		1867	4103	5970	27812622	SO:0001819	synonymous_variant	7082				CCDS42007.1, CCDS45199.1, CCDS73702.1	15q13	2012-07-12	2012-07-12		ENSG00000104067	ENSG00000104067			11827	protein-coding gene	gene with protein product	"""zona occludens 1"", ""tight junction protein ZO-1"""	601009				8825647	Standard	XM_005254616		Approved	ZO-1, MGC133289, DKFZp686M05161	uc001zcr.3	Q07157	OTTHUMG00000137397	ENST00000346128.6:c.1704G>A	15.37:g.30025330C>T			27812622	B4E3K1|Q2NKP3|Q4ZGJ6	Silent	SNP	ENST00000346128.6	37	CCDS42007.1																																																																																				0.383	TJP1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000268237.3	NM_003257	
RTF1	23168	broad.mit.edu	37	15	41767963	41767963	+	Silent	SNP	A	A	G			TCGA-23-2081-01A-01W-0722-08	TCGA-23-2081-10A-01W-0722-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	05cd5b89-dd8b-49fa-afec-787b644f7854	c53ea000-9f6d-44ea-b41b-a2a10fb1deb0	g.chr15:41767963A>G	ENST00000389629.4	+	11	1440	c.1428A>G	c.(1426-1428)gaA>gaG	p.E476E		NM_015138.4	NP_055953.3	Q92541	RTF1_HUMAN	Rtf1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)	476	Plus3. {ECO:0000255|PROSITE- ProRule:PRU00693}.				DNA-templated transcription, initiation (GO:0006352)|endodermal cell fate commitment (GO:0001711)|histone H3-K4 trimethylation (GO:0080182)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell maintenance (GO:0019827)|Wnt signaling pathway (GO:0016055)	Cdc73/Paf1 complex (GO:0016593)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|single-stranded DNA binding (GO:0003697)	p.E351E(1)		central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(2)|prostate(1)|skin(1)	18		all_cancers(109;1.79e-19)|all_epithelial(112;8.18e-17)|Lung NSC(122;3.16e-11)|all_lung(180;8.14e-10)|Melanoma(134;0.0179)|Colorectal(260;0.0946)|Ovarian(310;0.143)		OV - Ovarian serous cystadenocarcinoma(18;1.15e-16)|GBM - Glioblastoma multiforme(113;1.81e-06)|BRCA - Breast invasive adenocarcinoma(123;0.119)		ATAAAAAGGAATTATCTATTA	0.378																																																1	Substitution - coding silent(1)	ovary(1)	15											51.0	55.0	53.0					15																	41767963		2201	4299	6500	39555255	SO:0001819	synonymous_variant	23168			D87440	CCDS32200.2	15q14	2004-03-03	2005-07-20	2005-07-20	ENSG00000137815	ENSG00000137815			28996	protein-coding gene	gene with protein product		611633	"""KIAA0252"""	KIAA0252		15632063	Standard	NM_015138		Approved		uc001zny.3	Q92541	OTTHUMG00000133744	ENST00000389629.4:c.1428A>G	15.37:g.41767963A>G			39555255	Q96BX6	Silent	SNP	ENST00000389629.4	37	CCDS32200.2																																																																																				0.378	RTF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258111.1	NM_015138	
HYDIN	54768	broad.mit.edu	37	16	70908489	70908489	+	Missense_Mutation	SNP	T	T	C			TCGA-23-2081-01A-01W-0722-08	TCGA-23-2081-10A-01W-0722-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	05cd5b89-dd8b-49fa-afec-787b644f7854	c53ea000-9f6d-44ea-b41b-a2a10fb1deb0	g.chr16:70908489T>C	ENST00000393567.2	-	64	10817	c.10667A>G	c.(10666-10668)aAa>aGa	p.K3556R	AC027281.1_ENST00000411384.1_RNA	NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	3556					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)		p.K3507R(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				TGTGTGAGCTTTCTTTGCTGC	0.423																																																1	Substitution - Missense(1)	ovary(1)	16											3.0	3.0	3.0					16																	70908489		1559	3511	5070	69465990	SO:0001583	missense	54768			AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.10667A>G	16.37:g.70908489T>C	ENSP00000377197:p.Lys3556Arg		69465990	A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	ENST00000393567.2	37	CCDS59269.1	.	.	.	.	.	.	.	.	.	.	T	11.63	1.696619	0.30142	.	.	ENSG00000157423	ENST00000393567;ENST00000316490	T	0.00922	5.54	4.71	4.71	0.59529	.	0.000000	0.34411	U	0.003993	T	0.00998	0.0033	L	0.41027	1.25	0.80722	D	1	B	0.23854	0.092	B	0.23018	0.043	T	0.60546	-0.7242	10	0.15499	T	0.54	.	8.6059	0.33773	0.0:0.0877:0.0:0.9123	.	3555	F8WD23	.	R	3556;3555	ENSP00000377197:K3556R	ENSP00000313052:K3555R	K	-	2	0	HYDIN	69465990	1.000000	0.71417	0.981000	0.43875	0.832000	0.47134	2.065000	0.41442	1.728000	0.51552	0.418000	0.28097	AAA		0.423	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000398624.3		
TP53	7157	broad.mit.edu	37	17	7577153	7577153	+	Missense_Mutation	SNP	C	C	A			TCGA-23-2081-01A-01W-0722-08	TCGA-23-2081-10A-01W-0722-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture			Illumina GAIIx	05cd5b89-dd8b-49fa-afec-787b644f7854	c53ea000-9f6d-44ea-b41b-a2a10fb1deb0	g.chr17:7577153C>A	ENST00000269305.4	-	8	974	c.785G>T	c.(784-786)gGt>gTt	p.G262V	TP53_ENST00000445888.2_Missense_Mutation_p.G262V|TP53_ENST00000420246.2_Missense_Mutation_p.G262V|TP53_ENST00000413465.2_Intron|TP53_ENST00000455263.2_Missense_Mutation_p.G262V|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Missense_Mutation_p.G262V	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	262	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		G -> C (in a sporadic cancer; somatic mutation).|G -> D (in sporadic cancers; somatic mutation).|G -> H (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|G -> S (in sporadic cancers; somatic mutation).|G -> V (in sporadic cancers; somatic mutation). {ECO:0000269|Ref.23}.|GN -> PD (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.G262V(19)|p.0?(8)|p.G262D(4)|p.?(3)|p.G262_F270delGNLLGRNSF(2)|p.G262fs*83(2)|p.G262_S269delGNLLGRNS(2)|p.G262del(2)|p.G262H(1)|p.E258fs*71(1)|p.S261_L264>R(1)|p.G262fs*2(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CAGTAGATTACCACTACTCAG	0.517		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	46	Substitution - Missense(24)|Whole gene deletion(8)|Deletion - In frame(6)|Deletion - Frameshift(4)|Unknown(3)|Complex - deletion inframe(1)	lung(8)|large_intestine(5)|central_nervous_system(5)|haematopoietic_and_lymphoid_tissue(5)|ovary(5)|upper_aerodigestive_tract(4)|bone(4)|endometrium(2)|urinary_tract(2)|pancreas(2)|eye(1)|liver(1)|breast(1)|stomach(1)	17											40.0	37.0	38.0					17																	7577153		2203	4299	6502	7517878	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.785G>T	17.37:g.7577153C>A	ENSP00000269305:p.Gly262Val		7517878	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	24.7	4.565296	0.86439	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99957	-9.0;-9.0;-9.0;-9.0;-9.0;-9.0	5.03	5.03	0.67393	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99955	0.9981	M	0.90977	3.165	0.80722	D	1	D;P;D;D	0.89917	1.0;0.819;0.999;1.0	D;P;D;D	0.83275	0.996;0.537;0.996;0.992	D	0.95599	0.8661	10	0.87932	D	0	-15.6281	15.9038	0.79403	0.0:1.0:0.0:0.0	.	262;262;262;262	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	V	262;262;262;262;262;251;130	ENSP00000352610:G262V;ENSP00000269305:G262V;ENSP00000398846:G262V;ENSP00000391127:G262V;ENSP00000391478:G262V;ENSP00000425104:G130V	ENSP00000269305:G262V	G	-	2	0	TP53	7517878	1.000000	0.71417	0.951000	0.38953	0.085000	0.17905	7.572000	0.82409	2.619000	0.88677	0.462000	0.41574	GGT		0.517	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
ADORA2B	136	broad.mit.edu	37	17	15878601	15878601	+	Missense_Mutation	SNP	T	T	G			TCGA-23-2081-01A-01W-0722-08	TCGA-23-2081-10A-01W-0722-08	T	T	G	G	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	05cd5b89-dd8b-49fa-afec-787b644f7854	c53ea000-9f6d-44ea-b41b-a2a10fb1deb0	g.chr17:15878601T>G	ENST00000304222.2	+	2	1276	c.944T>G	c.(943-945)gTc>gGc	p.V315G	ZSWIM7_ENST00000399280.2_5'Flank	NM_000676.2	NP_000667.1	P29275	AA2BR_HUMAN	adenosine A2b receptor	315					activation of adenylate cyclase activity (GO:0007190)|activation of MAPK activity (GO:0000187)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|cellular defense response (GO:0006968)|cellular response to extracellular stimulus (GO:0031668)|excretion (GO:0007588)|G-protein coupled receptor signaling pathway (GO:0007186)|JNK cascade (GO:0007254)|positive regulation of cGMP biosynthetic process (GO:0030828)|positive regulation of chemokine production (GO:0032722)|positive regulation of chronic inflammatory response to non-antigenic stimulus (GO:0002882)|positive regulation of guanylate cyclase activity (GO:0031284)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of mast cell degranulation (GO:0043306)|positive regulation vascular endothelial growth factor production (GO:0010575)|relaxation of vascular smooth muscle (GO:0060087)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled adenosine receptor activity (GO:0001609)	p.V315G(1)		breast(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(2)	9				UCEC - Uterine corpus endometrioid carcinoma (92;0.0855)	Adenosine(DB00640)|Defibrotide(DB04932)|Enprofylline(DB00824)|Theophylline(DB00277)	CAAGCAGATGTCAAGAGTGGG	0.483																																																1	Substitution - Missense(1)	ovary(1)	17											99.0	107.0	104.0					17																	15878601		2203	4300	6503	15819326	SO:0001583	missense	136			M97759	CCDS11173.1	17p12	2012-08-08			ENSG00000170425	ENSG00000170425		"""GPCR / Class A : Adenosine receptors"""	264	protein-coding gene	gene with protein product		600446				7558011	Standard	NM_000676		Approved		uc002gpd.1	P29275	OTTHUMG00000059140	ENST00000304222.2:c.944T>G	17.37:g.15878601T>G	ENSP00000304501:p.Val315Gly		15819326		Missense_Mutation	SNP	ENST00000304222.2	37	CCDS11173.1	.	.	.	.	.	.	.	.	.	.	T	10.91	1.485130	0.26598	.	.	ENSG00000170425	ENST00000304222	T	0.55760	0.5	5.79	-0.808	0.10868	.	0.687214	0.14043	N	0.345311	T	0.21307	0.0513	N	0.03608	-0.345	0.18873	N	0.999981	B	0.06786	0.001	B	0.01281	0.0	T	0.12915	-1.0529	10	0.25106	T	0.35	-3.4751	3.3213	0.07052	0.368:0.2854:0.0:0.3466	.	315	P29275	AA2BR_HUMAN	G	315	ENSP00000304501:V315G	ENSP00000304501:V315G	V	+	2	0	ADORA2B	15819326	0.000000	0.05858	0.078000	0.20375	0.741000	0.42261	-0.066000	0.11598	-0.090000	0.12462	0.460000	0.39030	GTC		0.483	ADORA2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131032.1		
OTOP2	92736	broad.mit.edu	37	17	72927062	72927062	+	Missense_Mutation	SNP	A	A	T			TCGA-23-2081-01A-01W-0722-08	TCGA-23-2081-10A-01W-0722-08	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	05cd5b89-dd8b-49fa-afec-787b644f7854	c53ea000-9f6d-44ea-b41b-a2a10fb1deb0	g.chr17:72927062A>T	ENST00000580223.1	+	5	1362	c.1332A>T	c.(1330-1332)caA>caT	p.Q444H	OTOP2_ENST00000331427.4_Missense_Mutation_p.Q444H			Q7RTS6	OTOP2_HUMAN	otopetrin 2	444						integral component of membrane (GO:0016021)		p.Q444H(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(13)|ovary(3)|prostate(4)|skin(1)|urinary_tract(2)	39	all_lung(278;0.172)|Lung NSC(278;0.207)					AGCCCTGCCAAGACCTCACCT	0.637																																																1	Substitution - Missense(1)	ovary(1)	17											103.0	84.0	90.0					17																	72927062		2203	4300	6503	70438657	SO:0001583	missense	92736			BK000567	CCDS11708.1	17q25.3	2006-09-20				ENSG00000183034			19657	protein-coding gene	gene with protein product		607827				12651873	Standard	NM_178160		Approved		uc010wrp.2	Q7RTS6		ENST00000580223.1:c.1332A>T	17.37:g.72927062A>T	ENSP00000463837:p.Gln444His		70438657		Missense_Mutation	SNP	ENST00000580223.1	37	CCDS11708.1	.	.	.	.	.	.	.	.	.	.	A	0.238	-1.015850	0.02078	.	.	ENSG00000183034	ENST00000331427	T	0.09817	2.94	5.0	-1.89	0.07689	.	0.677498	0.12692	N	0.447126	T	0.02455	0.0075	N	0.02142	-0.665	0.27568	N	0.949965	B	0.02656	0.0	B	0.04013	0.001	T	0.43458	-0.9390	10	0.14656	T	0.56	-6.822	0.4306	0.00471	0.2061:0.1913:0.1958:0.4068	.	444	Q7RTS6	OTOP2_HUMAN	H	444	ENSP00000332528:Q444H	ENSP00000332528:Q444H	Q	+	3	2	OTOP2	70438657	0.000000	0.05858	0.671000	0.29857	0.007000	0.05969	-1.927000	0.01561	0.009000	0.14813	0.379000	0.24179	CAA		0.637	OTOP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445306.1	NM_178160	
B3GNTL1	146712	broad.mit.edu	37	17	81006596	81006596	+	Silent	SNP	T	T	C	rs200476683		TCGA-23-2081-01A-01W-0722-08	TCGA-23-2081-10A-01W-0722-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	05cd5b89-dd8b-49fa-afec-787b644f7854	c53ea000-9f6d-44ea-b41b-a2a10fb1deb0	g.chr17:81006596T>C	ENST00000320865.3	-	2	139	c.126A>G	c.(124-126)caA>caG	p.Q42Q	B3GNTL1_ENST00000576599.1_5'UTR|B3GNTL1_ENST00000571954.1_5'UTR	NM_001009905.1	NP_001009905.1	Q67FW5	B3GNL_HUMAN	UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase-like 1	42							transferase activity, transferring glycosyl groups (GO:0016757)	p.Q42Q(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	8	Breast(20;0.000443)|all_neural(118;0.0779)	all_cancers(8;0.0396)|all_epithelial(8;0.0556)	BRCA - Breast invasive adenocarcinoma(99;0.0517)|OV - Ovarian serous cystadenocarcinoma(97;0.0868)			CAAAGTCCTGTTGCAAAACAG	0.468																																																1	Substitution - coding silent(1)	ovary(1)	17						T		0,4406		0,0,2203	99.0	97.0	98.0		126	-5.8	0.8	17		98	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	B3GNTL1	NM_001009905.1		0,1,6502	CC,CT,TT		0.0116,0.0,0.0077		42/362	81006596	1,13005	2203	4300	6503	78599885	SO:0001819	synonymous_variant	146712			AY634364	CCDS32778.1	17q25.3	2013-02-22	2004-01-13	2004-01-14	ENSG00000175711	ENSG00000175711		"""Glycosyltransferase family 2 domain containing"""	21727	protein-coding gene	gene with protein product		615337					Standard	NM_001009905		Approved	B3GNT8	uc002kgg.1	Q67FW5	OTTHUMG00000177788	ENST00000320865.3:c.126A>G	17.37:g.81006596T>C			78599885	Q6GV30|Q8WUT3	Silent	SNP	ENST00000320865.3	37	CCDS32778.1																																																																																				0.468	B3GNTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438949.1	NM_001009905	
MUC16	94025	broad.mit.edu	37	19	9085170	9085170	+	Silent	SNP	T	T	C			TCGA-23-2081-01A-01W-0722-08	TCGA-23-2081-10A-01W-0722-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	05cd5b89-dd8b-49fa-afec-787b644f7854	c53ea000-9f6d-44ea-b41b-a2a10fb1deb0	g.chr19:9085170T>C	ENST00000397910.4	-	1	6848	c.6645A>G	c.(6643-6645)acA>acG	p.T2215T		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	2215	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.T2215T(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TGCTTGTTTCTGTATTAGTAG	0.473																																																1	Substitution - coding silent(1)	ovary(1)	19											112.0	107.0	108.0					19																	9085170		1968	4159	6127	8946170	SO:0001819	synonymous_variant	94025			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.6645A>G	19.37:g.9085170T>C			8946170	Q6ZQW5|Q96RK2	Silent	SNP	ENST00000397910.4	37	CCDS54212.1																																																																																				0.473	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
ZNF665	79788	broad.mit.edu	37	19	53669371	53669371	+	Missense_Mutation	SNP	T	T	A			TCGA-23-2081-01A-01W-0722-08	TCGA-23-2081-10A-01W-0722-08	T	T	A	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	05cd5b89-dd8b-49fa-afec-787b644f7854	c53ea000-9f6d-44ea-b41b-a2a10fb1deb0	g.chr19:53669371T>A	ENST00000600412.1	-	2	292	c.177A>T	c.(175-177)agA>agT	p.R59S	ZNF665_ENST00000396424.3_Missense_Mutation_p.R124S|CTD-2245F17.2_ENST00000600257.1_RNA			Q9H7R5	ZN665_HUMAN	zinc finger protein 665	59					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R59S(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(10)|lung(16)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	35				GBM - Glioblastoma multiforme(134;0.0196)		CACGTTGAGCTCTTCTACCAG	0.388																																																1	Substitution - Missense(1)	ovary(1)	19											118.0	124.0	122.0					19																	53669371		2068	4226	6294	58361183	SO:0001583	missense	79788				CCDS46169.1	19q13.42	2013-01-08				ENSG00000197497		"""Zinc fingers, C2H2-type"", ""-"""	25885	protein-coding gene	gene with protein product							Standard	NM_024733		Approved	FLJ14345	uc010eqm.1	Q9H7R5		ENST00000600412.1:c.177A>T	19.37:g.53669371T>A	ENSP00000469154:p.Arg59Ser		58361183	A8K5T8	Missense_Mutation	SNP	ENST00000600412.1	37		.	.	.	.	.	.	.	.	.	.	T	9.811	1.183109	0.21870	.	.	ENSG00000197497	ENST00000396424	T	0.08546	3.08	2.4	2.4	0.29515	.	.	.	.	.	T	0.05823	0.0152	N	0.25485	0.75	0.09310	N	1	P	0.46142	0.873	B	0.42361	0.385	T	0.31530	-0.9940	9	0.20046	T	0.44	.	5.1865	0.15187	0.0:0.1483:0.0:0.8517	.	124	Q9H7R5-2	.	S	124	ENSP00000379702:R124S	ENSP00000379702:R124S	R	-	3	2	ZNF665	58361183	0.001000	0.12720	0.004000	0.12327	0.041000	0.13682	0.968000	0.29357	1.098000	0.41479	0.443000	0.29094	AGA		0.388	ZNF665-002	PUTATIVE	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000464179.1	NM_024733	
SULT6B1	391365	broad.mit.edu	37	2	37415665	37415665	+	Missense_Mutation	SNP	C	C	T			TCGA-23-2081-01A-01W-0722-08	TCGA-23-2081-10A-01W-0722-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	05cd5b89-dd8b-49fa-afec-787b644f7854	c53ea000-9f6d-44ea-b41b-a2a10fb1deb0	g.chr2:37415665C>T	ENST00000535679.1	-	1	118	c.119G>A	c.(118-120)tGc>tAc	p.C40Y	SULT6B1_ENST00000260637.3_Missense_Mutation_p.C2Y|SULT6B1_ENST00000407963.1_Missense_Mutation_p.C2Y|SULT6B1_ENST00000379149.2_Missense_Mutation_p.C40Y			Q6IMI4	ST6B1_HUMAN	sulfotransferase family, cytosolic, 6B, member 1	40						cytoplasm (GO:0005737)	sulfotransferase activity (GO:0008146)	p.C2Y(1)		NS(1)|breast(1)|central_nervous_system(1)|large_intestine(3)|lung(5)|ovary(1)	12		all_hematologic(82;0.248)				TTCTGAGGTGCACATGGTGAT	0.418																																																1	Substitution - Missense(1)	ovary(1)	2											175.0	154.0	161.0					2																	37415665		2203	4300	6503	37269169	SO:0001583	missense	391365			AY289770, AY289774	CCDS33182.1	2p22.2	2007-07-26			ENSG00000138068	ENSG00000138068		"""Sulfotransferases, cytosolic"""	33433	protein-coding gene	gene with protein product						14676822	Standard	XM_005264307		Approved		uc002rpu.3	Q6IMI4	OTTHUMG00000152160	ENST00000535679.1:c.119G>A	2.37:g.37415665C>T	ENSP00000444081:p.Cys40Tyr		37269169	B2RTS7	Missense_Mutation	SNP	ENST00000535679.1	37		.	.	.	.	.	.	.	.	.	.	C	14.13	2.442421	0.43326	.	.	ENSG00000138068	ENST00000535679;ENST00000379149;ENST00000260637;ENST00000407963;ENST00000433192;ENST00000416345;ENST00000420611	T;T;T;T	0.02606	4.98;4.23;4.79;4.79	4.39	4.39	0.52855	.	0.111661	0.64402	D	0.000007	T	0.05731	0.0150	N	0.08118	0	0.51482	D	0.999923	D	0.89917	1.0	D	0.77557	0.99	T	0.56456	-0.7976	10	0.87932	D	0	.	14.4965	0.67691	0.0:1.0:0.0:0.0	.	40	Q6IMI4	ST6B1_HUMAN	Y	40;40;2;2;2;2;2	ENSP00000444081:C40Y;ENSP00000368444:C40Y;ENSP00000260637:C2Y;ENSP00000384950:C2Y	ENSP00000260637:C2Y	C	-	2	0	SULT6B1	37269169	1.000000	0.71417	0.993000	0.49108	0.980000	0.70556	4.776000	0.62354	2.277000	0.76020	0.655000	0.94253	TGC		0.418	SULT6B1-203	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001032377	
RMDN2	151393	broad.mit.edu	37	2	38179075	38179075	+	Intron	SNP	C	C	A			TCGA-23-2081-01A-01W-0722-08	TCGA-23-2081-10A-01W-0722-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	05cd5b89-dd8b-49fa-afec-787b644f7854	c53ea000-9f6d-44ea-b41b-a2a10fb1deb0	g.chr2:38179075C>A	ENST00000406384.1	+	3	646				RMDN2-AS1_ENST00000414365.2_RNA|RMDN2_ENST00000354545.2_Intron|RMDN2_ENST00000417700.2_Intron|RMDN2_ENST00000402091.3_Silent_p.G239G|RMDN2_ENST00000234195.3_Silent_p.G239G|RMDN2_ENST00000407257.1_Silent_p.G239G	NM_001170792.1	NP_001164263.1	Q96LZ7	RMD2_HUMAN	regulator of microtubule dynamics 2							cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|microtubule (GO:0005874)|mitochondrion (GO:0005739)		p.G239G(1)									AACAAAGGGGCCAATTATGTA	0.398																																																1	Substitution - coding silent(1)	ovary(1)	2											120.0	120.0	120.0					2																	38179075		2203	4299	6502	38032579	SO:0001627	intron_variant	151393			AK057516	CCDS1792.1, CCDS54351.1, CCDS54352.1	2p22.2	2013-01-11	2013-01-11	2013-01-11	ENSG00000115841	ENSG00000115841			26567	protein-coding gene	gene with protein product		611872	"""family with sequence similarity 82, member A1"""	FAM82A, FAM82A1		12477932	Standard	XM_005264161		Approved	FLJ32954, RMD2	uc002rqn.2	Q96LZ7	OTTHUMG00000128487	ENST00000406384.1:c.453-22108C>A	2.37:g.38179075C>A			38032579	A9UMZ7|A9UN00|Q4ZG33|Q6UXN4|Q8N657|Q8N9A2|Q8NCV6|Q8NHM0	Silent	SNP	ENST00000406384.1	37	CCDS54351.1																																																																																				0.398	RMDN2-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325577.1	NM_144713	
CNOT11	55571	broad.mit.edu	37	2	101869724	101869724	+	Missense_Mutation	SNP	G	G	C			TCGA-23-2081-01A-01W-0722-08	TCGA-23-2081-10A-01W-0722-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	05cd5b89-dd8b-49fa-afec-787b644f7854	c53ea000-9f6d-44ea-b41b-a2a10fb1deb0	g.chr2:101869724G>C	ENST00000289382.3	+	1	461	c.298G>C	c.(298-300)Gac>Cac	p.D100H	TBC1D8_ENST00000462819.1_5'Flank	NM_017546.4	NP_060016.3	Q9UKZ1	CNO11_HUMAN	CCR4-NOT transcription complex, subunit 11	100					cell proliferation (GO:0008283)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|transcription, DNA-templated (GO:0006351)	CCR4-NOT complex (GO:0030014)|cytosol (GO:0005829)|nucleus (GO:0005634)		p.D100H(1)									CAGCAAGGCCGACCACTTCCG	0.682																																																1	Substitution - Missense(1)	ovary(1)	2											19.0	19.0	19.0					2																	101869724		2193	4294	6487	101236156	SO:0001583	missense	55571			AF103798	CCDS2050.1	2q12.1	2013-01-24	2013-01-24	2013-01-24	ENSG00000158435	ENSG00000158435			25217	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 29"""	C2orf29		10497265, 23232451, 23303381	Standard	NM_017546		Approved	C40	uc002taw.4	Q9UKZ1	OTTHUMG00000130686	ENST00000289382.3:c.298G>C	2.37:g.101869724G>C	ENSP00000289382:p.Asp100His		101236156	Q6P2M9|Q8N681	Missense_Mutation	SNP	ENST00000289382.3	37	CCDS2050.1	.	.	.	.	.	.	.	.	.	.	G	24.1	4.493929	0.84962	.	.	ENSG00000158435	ENST00000289382	.	.	.	4.68	3.8	0.43715	.	0.112601	0.64402	D	0.000011	T	0.55401	0.1918	M	0.61703	1.905	0.54753	D	0.999985	P	0.47350	0.894	B	0.42062	0.374	T	0.60058	-0.7337	9	0.56958	D	0.05	-9.4268	12.7871	0.57512	0.0801:0.0:0.9199:0.0	.	100	Q9UKZ1	CB029_HUMAN	H	100	.	ENSP00000289382:D100H	D	+	1	0	C2orf29	101236156	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	6.973000	0.76116	0.976000	0.38417	0.585000	0.79938	GAC		0.682	CNOT11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253181.1	NM_017546	
GTF3C3	9330	broad.mit.edu	37	2	197639861	197639861	+	Missense_Mutation	SNP	A	A	G			TCGA-23-2081-01A-01W-0722-08	TCGA-23-2081-10A-01W-0722-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	05cd5b89-dd8b-49fa-afec-787b644f7854	c53ea000-9f6d-44ea-b41b-a2a10fb1deb0	g.chr2:197639861A>G	ENST00000263956.3	-	13	1899	c.1810T>C	c.(1810-1812)Tca>Cca	p.S604P		NM_012086.4	NP_036218.1	Q9Y5Q9	TF3C3_HUMAN	general transcription factor IIIC, polypeptide 3, 102kDa	604					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	nucleoplasm (GO:0005654)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)	p.S604P(1)		breast(4)|endometrium(3)|kidney(1)|large_intestine(9)|lung(5)|ovary(3)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	33						CAATTTGCTGACTCTTGGTCA	0.348																																																1	Substitution - Missense(1)	ovary(1)	2											122.0	112.0	116.0					2																	197639861		2203	4300	6503	197348106	SO:0001583	missense	9330			AF133123	CCDS2316.1, CCDS56153.1	2q33.1	2013-01-10	2002-08-29		ENSG00000119041	ENSG00000119041		"""General transcription factors"", ""Tetratricopeptide (TTC) repeat domain containing"""	4666	protein-coding gene	gene with protein product		604888	"""general transcription factor IIIC, polypeptide 3 (102kD)"""			10373544	Standard	NM_001206774		Approved	TFiiiC2-102, TFIIIC102	uc002uts.3	Q9Y5Q9	OTTHUMG00000154633	ENST00000263956.3:c.1810T>C	2.37:g.197639861A>G	ENSP00000263956:p.Ser604Pro		197348106	Q4ZG48|Q86XJ8|Q8WX84|Q96B44|Q9H5I8|Q9NT97	Missense_Mutation	SNP	ENST00000263956.3	37	CCDS2316.1	.	.	.	.	.	.	.	.	.	.	A	13.32	2.201250	0.38905	.	.	ENSG00000119041	ENST00000263956;ENST00000435252	T	0.46063	0.88	5.2	-0.157	0.13387	.	0.603581	0.17834	N	0.160419	T	0.17577	0.0422	N	0.08118	0	0.80722	D	1	B	0.15141	0.012	B	0.12837	0.008	T	0.04781	-1.0927	10	0.31617	T	0.26	-9.1329	3.8957	0.09138	0.3848:0.202:0.0:0.4132	.	604	Q9Y5Q9	TF3C3_HUMAN	P	604;127	ENSP00000263956:S604P	ENSP00000263956:S604P	S	-	1	0	GTF3C3	197348106	0.957000	0.32711	0.996000	0.52242	0.993000	0.82548	-0.049000	0.11924	-0.165000	0.10908	-0.339000	0.08088	TCA		0.348	GTF3C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256104.1		
CDH22	64405	broad.mit.edu	37	20	44841655	44841655	+	Silent	SNP	C	C	T			TCGA-23-2081-01A-01W-0722-08	TCGA-23-2081-10A-01W-0722-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	05cd5b89-dd8b-49fa-afec-787b644f7854	c53ea000-9f6d-44ea-b41b-a2a10fb1deb0	g.chr20:44841655C>T	ENST00000372262.3	-	5	1411	c.1011G>A	c.(1009-1011)gaG>gaA	p.E337E	CDH22_ENST00000474438.1_5'UTR|CDH22_ENST00000537909.1_Silent_p.E337E	NM_021248.1	NP_067071.1	Q9UJ99	CAD22_HUMAN	cadherin 22, type 2	337	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				brain development (GO:0007420)|calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.E337E(1)		endometrium(3)|kidney(1)|large_intestine(9)|lung(16)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|urinary_tract(3)	44		Myeloproliferative disorder(115;0.0122)				CGATGATGGCCTCCTGAGTGT	0.602																																																1	Substitution - coding silent(1)	ovary(1)	20											151.0	95.0	114.0					20																	44841655		2203	4300	6503	44275062	SO:0001819	synonymous_variant	64405			AF035300	CCDS13395.1	20q13.1	2010-01-26	2009-11-20		ENSG00000149654	ENSG00000149654		"""Cadherins / Major cadherins"""	13251	protein-coding gene	gene with protein product		609920	"""cadherin-like 22"""	C20orf25		8626716	Standard	NM_021248		Approved	dJ998H6.1	uc010ghk.2	Q9UJ99	OTTHUMG00000033073	ENST00000372262.3:c.1011G>A	20.37:g.44841655C>T			44275062	B9EGK7|O43205	Silent	SNP	ENST00000372262.3	37	CCDS13395.1																																																																																				0.602	CDH22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080491.1	NM_021248	
SALL4	57167	broad.mit.edu	37	20	50407414	50407414	+	Missense_Mutation	SNP	G	G	C			TCGA-23-2081-01A-01W-0722-08	TCGA-23-2081-10A-01W-0722-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	05cd5b89-dd8b-49fa-afec-787b644f7854	c53ea000-9f6d-44ea-b41b-a2a10fb1deb0	g.chr20:50407414G>C	ENST00000217086.4	-	2	1719	c.1608C>G	c.(1606-1608)ttC>ttG	p.F536L	SALL4_ENST00000371539.3_Intron|SALL4_ENST00000483130.1_5'Flank|SALL4_ENST00000395997.3_Intron	NM_020436.3	NP_065169.1	Q9UJQ4	SALL4_HUMAN	spalt-like transcription factor 4	536					embryonic limb morphogenesis (GO:0030326)|inner cell mass cell proliferation (GO:0001833)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|ventricular septum development (GO:0003281)	cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.F536L(1)		endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(27)|ovary(5)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						CACTCCCTTGGAAGCCACCAG	0.582																																																1	Substitution - Missense(1)	ovary(1)	20											110.0	108.0	108.0					20																	50407414		2203	4300	6503	49840821	SO:0001583	missense	57167			AK001666	CCDS13438.1	20q13.2	2014-09-17	2013-10-17		ENSG00000101115	ENSG00000101115		"""Zinc fingers, C2H2-type"""	15924	protein-coding gene	gene with protein product		607343	"""sal (Drosophila)-like 4"", ""sal-like 4 (Drosophila)"""				Standard	NM_020436		Approved	dJ1112F19.1, ZNF797	uc002xwh.4	Q9UJQ4	OTTHUMG00000032752	ENST00000217086.4:c.1608C>G	20.37:g.50407414G>C	ENSP00000217086:p.Phe536Leu		49840821	A2A2D8|Q540H3|Q6Y8G6	Missense_Mutation	SNP	ENST00000217086.4	37	CCDS13438.1	.	.	.	.	.	.	.	.	.	.	G	7.129	0.579538	0.13686	.	.	ENSG00000101115	ENST00000217086	T	0.08984	3.03	5.4	5.4	0.78164	.	0.000000	0.46442	D	0.000286	T	0.16342	0.0393	M	0.86028	2.79	0.80722	D	1	B	0.25441	0.126	B	0.16289	0.015	T	0.07121	-1.0789	10	0.22706	T	0.39	-31.8673	19.1686	0.93567	0.0:0.0:1.0:0.0	.	536	Q9UJQ4	SALL4_HUMAN	L	536	ENSP00000217086:F536L	ENSP00000217086:F536L	F	-	3	2	SALL4	49840821	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	3.151000	0.50670	2.517000	0.84864	0.650000	0.86243	TTC		0.582	SALL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079738.3		
CACNA1D	776	broad.mit.edu	37	3	53835308	53835308	+	Missense_Mutation	SNP	A	A	C			TCGA-23-2081-01A-01W-0722-08	TCGA-23-2081-10A-01W-0722-08	A	A	C	C	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	05cd5b89-dd8b-49fa-afec-787b644f7854	c53ea000-9f6d-44ea-b41b-a2a10fb1deb0	g.chr3:53835308A>C	ENST00000350061.5	+	42	5775	c.5264A>C	c.(5263-5265)aAt>aCt	p.N1755T	CACNA1D_ENST00000288139.4_Missense_Mutation_p.N1775T|CACNA1D_ENST00000544977.1_Missense_Mutation_p.N134T|CACNA1D_ENST00000422281.2_Missense_Mutation_p.N1740T	NM_001128840.1	NP_001122312.1	Q01668	CAC1D_HUMAN	calcium channel, voltage-dependent, L type, alpha 1D subunit	1755					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|energy reserve metabolic process (GO:0006112)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane repolarization during SA node cell action potential (GO:0086052)|positive regulation of calcium ion transport (GO:0051928)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|ankyrin binding (GO:0030506)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)|voltage-gated calcium channel activity involved in cardiac muscle cell action potential (GO:0086007)|voltage-gated calcium channel activity involved SA node cell action potential (GO:0086059)	p.N1775T(1)		breast(3)|central_nervous_system(9)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(13)|liver(1)|lung(29)|ovary(6)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	90				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	ACCTCAACAAATGCCAATCTC	0.453																																																1	Substitution - Missense(1)	ovary(1)	3											86.0	76.0	79.0					3																	53835308		2203	4300	6503	53810348	SO:0001583	missense	776			AB209171	CCDS2872.1, CCDS46848.1, CCDS46849.1	3p14.3	2012-03-07			ENSG00000157388	ENSG00000157388		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1391	protein-coding gene	gene with protein product		114206		CCHL1A2, CACNL1A2		1664412	Standard	NM_000720		Approved	Cav1.3, CACH3, CACN4	uc003dgu.5	Q01668	OTTHUMG00000158278	ENST00000350061.5:c.5264A>C	3.37:g.53835308A>C	ENSP00000288133:p.Asn1755Thr		53810348	B0FYA3|Q13916|Q13931|Q71UT1|Q9UDC3	Missense_Mutation	SNP	ENST00000350061.5	37	CCDS46848.1	.	.	.	.	.	.	.	.	.	.	A	18.37	3.609812	0.66558	.	.	ENSG00000157388	ENST00000350061;ENST00000288139;ENST00000422281;ENST00000481478;ENST00000544977	D;D;D;D	0.96967	-4.14;-4.19;-4.16;-4.18	4.3	4.3	0.51218	.	2.053350	0.02459	N	0.086371	D	0.96097	0.8728	M	0.71206	2.165	0.53688	D	0.999979	B;B;B;B	0.21520	0.006;0.009;0.005;0.057	B;B;B;B	0.26310	0.014;0.027;0.017;0.068	T	0.77341	-0.2624	10	0.19590	T	0.45	.	14.1545	0.65407	1.0:0.0:0.0:0.0	.	1740;1448;1755;1775	B0FYA3;Q59GD8;Q01668;Q01668-2	.;.;CAC1D_HUMAN;.	T	1755;1775;1740;1448;134	ENSP00000288133:N1755T;ENSP00000288139:N1775T;ENSP00000409174:N1740T;ENSP00000418014:N1448T	ENSP00000288139:N1775T	N	+	2	0	CACNA1D	53810348	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.567000	0.90737	1.892000	0.54788	0.379000	0.24179	AAT		0.453	CACNA1D-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350557.1	NM_000720	
CNTN3	5067	broad.mit.edu	37	3	74347174	74347174	+	Missense_Mutation	SNP	C	C	G			TCGA-23-2081-01A-01W-0722-08	TCGA-23-2081-10A-01W-0722-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	05cd5b89-dd8b-49fa-afec-787b644f7854	c53ea000-9f6d-44ea-b41b-a2a10fb1deb0	g.chr3:74347174C>G	ENST00000263665.6	-	17	2362	c.2335G>C	c.(2335-2337)Ggt>Cgt	p.G779R		NM_020872.1	NP_065923.1	Q9P232	CNTN3_HUMAN	contactin 3 (plasmacytoma associated)	779	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|nervous system development (GO:0007399)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)		p.G779R(1)		NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(39)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	83		Lung NSC(201;0.138)|Lung SC(41;0.21)		Epithelial(33;0.00212)|BRCA - Breast invasive adenocarcinoma(55;0.00258)|LUSC - Lung squamous cell carcinoma(21;0.00461)|Lung(16;0.01)		TTATAAACACCCACTTTAACT	0.433																																																1	Substitution - Missense(1)	ovary(1)	3											146.0	143.0	144.0					3																	74347174		2203	4300	6503	74429864	SO:0001583	missense	5067			AB040929	CCDS33790.1	3p12.3	2013-02-11			ENSG00000113805	ENSG00000113805		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2173	protein-coding gene	gene with protein product		601325		PANG		8661054, 8586965	Standard	XM_005264757		Approved	BIG-1	uc003dpm.1	Q9P232	OTTHUMG00000158813	ENST00000263665.6:c.2335G>C	3.37:g.74347174C>G	ENSP00000263665:p.Gly779Arg		74429864	B9EK50|Q9H039	Missense_Mutation	SNP	ENST00000263665.6	37	CCDS33790.1	.	.	.	.	.	.	.	.	.	.	C	22.7	4.318722	0.81469	.	.	ENSG00000113805	ENST00000263665	T	0.54479	0.57	5.91	5.91	0.95273	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.65709	0.2717	L	0.60067	1.865	0.80722	D	1	D	0.56287	0.975	P	0.62014	0.897	T	0.56619	-0.7949	10	0.07644	T	0.81	.	20.2985	0.98592	0.0:1.0:0.0:0.0	.	779	Q9P232	CNTN3_HUMAN	R	779	ENSP00000263665:G779R	ENSP00000263665:G779R	G	-	1	0	CNTN3	74429864	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.207000	0.77899	2.793000	0.96121	0.655000	0.94253	GGT		0.433	CNTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352306.1	NM_020872	
NOP16	51491	broad.mit.edu	37	5	175811237	175811237	+	Nonsense_Mutation	SNP	C	C	A			TCGA-23-2081-01A-01W-0722-08	TCGA-23-2081-10A-01W-0722-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	05cd5b89-dd8b-49fa-afec-787b644f7854	c53ea000-9f6d-44ea-b41b-a2a10fb1deb0	g.chr5:175811237C>A	ENST00000389158.5	-	5	967	c.532G>T	c.(532-534)Gag>Tag	p.E178*	NOP16_ENST00000507413.1_Missense_Mutation_p.G53V|NOP16_ENST00000510123.1_Missense_Mutation_p.W147C			Q9Y3C1	NOP16_HUMAN	NOP16 nucleolar protein	178				E -> D (in Ref. 5; CAG33450). {ECO:0000305}.		intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.E178*(1)		central_nervous_system(1)|endometrium(2)|lung(4)|ovary(1)	8						ACCAGTCACTCCACCTCCATC	0.542																																																1	Substitution - Nonsense(1)	ovary(1)	5											125.0	125.0	125.0					5																	175811237		2005	4170	6175	175743843	SO:0001587	stop_gained	51491				CCDS43403.1, CCDS58991.1	5q35.2	2012-12-10	2012-12-10		ENSG00000048162	ENSG00000048162			26934	protein-coding gene	gene with protein product	"""hypothetical protein HSPC111"", ""HBV pre-S2 trans-regulated protein 3"""	612861	"""nucleolar protein 16 homolog (yeast)"", ""NOP16 nucleolar protein homolog (yeast)"""			10810093, 11042152	Standard	NM_001291308		Approved	HSPC111, HSPC185, LOC51491	uc003mee.4	Q9Y3C1	OTTHUMG00000163186	ENST00000389158.5:c.532G>T	5.37:g.175811237C>A	ENSP00000373810:p.Glu178*		175743843	B4DV13|D6RGD3|Q05D05|Q6IAI6|Q8IXL5	Nonsense_Mutation	SNP	ENST00000389158.5	37	CCDS43403.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	23.9|23.9|23.9	4.468459|4.468459|4.468459	0.84533|0.84533|0.84533	.|.|.	.|.|.	ENSG00000048162|ENSG00000048162|ENSG00000048162	ENST00000389158|ENST00000507413|ENST00000510123;ENST00000341213;ENST00000451293	.|.|.	.|.|.	.|.|.	5.35|5.35|5.35	5.35|5.35|5.35	0.76521|0.76521|0.76521	.|.|.	.|.|1.372080	.|.|0.04917	.|.|N	.|.|0.454227	.|T|T	.|0.61160|0.61160	.|0.2325|0.2325	.|.|.	.|.|.	.|.|.	0.80722|0.80722|0.80722	D|D|D	1|1|1	.|.|B;B	.|.|0.02656	.|.|0.0;0.0	.|.|B;B	.|.|0.04013	.|.|0.001;0.001	.|T|T	.|0.32851|0.32851	.|-0.9891|-0.9891	.|5|8	0.59425|0.87932|0.87932	D|D|D	0.04|0|0	-0.2478|-0.2478|-0.2478	15.3537|15.3537|15.3537	0.74412|0.74412|0.74412	0.0:0.8233:0.1767:0.0|0.0:0.8233:0.1767:0.0|0.0:0.8233:0.1767:0.0	.|.|.	.|.|148;147	.|.|Q6PIM0;D6RGD3	.|.|.;.	X|V|C	178|53|147;152;148	.|.|.	ENSP00000373810:E178X|ENSP00000426392:G53V|ENSP00000340662:W152C	E|G|W	-|-|-	1|2|3	0|0|0	NOP16|NOP16|NOP16	175743843|175743843|175743843	0.943000|0.943000|0.943000	0.32029|0.32029|0.32029	0.542000|0.542000|0.542000	0.28115|0.28115|0.28115	0.048000|0.048000|0.048000	0.14542|0.14542|0.14542	2.019000|2.019000|2.019000	0.41001|0.41001|0.41001	2.941000|2.941000|2.941000	0.99782|0.99782|0.99782	0.655000|0.655000|0.655000	0.94253|0.94253|0.94253	GAG|GGA|TGG		0.542	NOP16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371963.1	NM_016391	
DDX43	55510	broad.mit.edu	37	6	74125223	74125223	+	Missense_Mutation	SNP	G	G	C			TCGA-23-2081-01A-01W-0722-08	TCGA-23-2081-10A-01W-0722-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	05cd5b89-dd8b-49fa-afec-787b644f7854	c53ea000-9f6d-44ea-b41b-a2a10fb1deb0	g.chr6:74125223G>C	ENST00000370336.4	+	15	1907	c.1749G>C	c.(1747-1749)agG>agC	p.R583S	MB21D1_ENST00000370318.1_Intron	NM_018665.2	NP_061135.2	Q9NXZ2	DDX43_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 43	583	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)	intracellular (GO:0005622)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|RNA binding (GO:0003723)	p.R583S(1)		NS(1)|breast(2)|central_nervous_system(1)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	24						ACTAAAGGAGGACTGGTGTTT	0.343																																																1	Substitution - Missense(1)	ovary(1)	6											121.0	120.0	121.0					6																	74125223		2203	4300	6503	74181944	SO:0001583	missense	55510				CCDS4977.1	6q13	2014-01-21			ENSG00000080007	ENSG00000080007		"""DEAD-boxes"""	18677	protein-coding gene	gene with protein product	"""cancer/testis antigen 13"""	606286				10919659	Standard	NM_018665		Approved	HAGE, DKFZp434H2114, CT13	uc003pgw.3	Q9NXZ2	OTTHUMG00000015033	ENST00000370336.4:c.1749G>C	6.37:g.74125223G>C	ENSP00000359361:p.Arg583Ser		74181944	B4E0C8|Q6NXR1	Missense_Mutation	SNP	ENST00000370336.4	37	CCDS4977.1	.	.	.	.	.	.	.	.	.	.	G	13.06	2.125295	0.37533	.	.	ENSG00000080007	ENST00000370336	T	0.05199	3.48	4.66	-9.31	0.00646	Helicase, C-terminal (1);	0.214449	0.42682	D	0.000661	T	0.01523	0.0049	L	0.59436	1.845	0.19945	N	0.999945	P	0.36753	0.568	B	0.39840	0.311	T	0.12319	-1.0552	10	0.41790	T	0.15	-12.3005	1.2294	0.01940	0.3439:0.3147:0.1054:0.236	.	583	Q9NXZ2	DDX43_HUMAN	S	583	ENSP00000359361:R583S	ENSP00000359361:R583S	R	+	3	2	DDX43	74181944	0.034000	0.19679	0.009000	0.14445	0.218000	0.24690	-1.185000	0.03073	-1.611000	0.01581	-0.367000	0.07326	AGG		0.343	DDX43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041219.3	NM_018665	
COL12A1	1303	broad.mit.edu	37	6	75838022	75838022	+	Silent	SNP	A	A	G			TCGA-23-2081-01A-01W-0722-08	TCGA-23-2081-10A-01W-0722-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	05cd5b89-dd8b-49fa-afec-787b644f7854	c53ea000-9f6d-44ea-b41b-a2a10fb1deb0	g.chr6:75838022A>G	ENST00000322507.8	-	38	6639	c.6330T>C	c.(6328-6330)aaT>aaC	p.N2110N	COL12A1_ENST00000483888.2_Silent_p.N2110N|COL12A1_ENST00000345356.6_Silent_p.N946N|COL12A1_ENST00000416123.2_Silent_p.N2110N	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	2110	Fibronectin type-III 16. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)	p.N2110N(1)		breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						CAGTTCTTCCATTTCCTGTTA	0.338																																																1	Substitution - coding silent(1)	ovary(1)	6											141.0	139.0	140.0					6																	75838022		1864	4096	5960	75894742	SO:0001819	synonymous_variant	1303			U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.6330T>C	6.37:g.75838022A>G			75894742	O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Silent	SNP	ENST00000322507.8	37	CCDS43482.1																																																																																				0.338	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041249.3	NM_004370	
LTV1	84946	broad.mit.edu	37	6	144171287	144171287	+	Missense_Mutation	SNP	C	C	A			TCGA-23-2081-01A-01W-0722-08	TCGA-23-2081-10A-01W-0722-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	05cd5b89-dd8b-49fa-afec-787b644f7854	c53ea000-9f6d-44ea-b41b-a2a10fb1deb0	g.chr6:144171287C>A	ENST00000367576.5	+	4	463	c.329C>A	c.(328-330)cCt>cAt	p.P110H		NM_032860.3	NP_116249.2	Q96GA3	LTV1_HUMAN	LTV1 ribosome biogenesis factor	110						cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.P110H(1)		breast(2)|endometrium(1)|large_intestine(2)|lung(5)|ovary(2)|prostate(1)	13				OV - Ovarian serous cystadenocarcinoma(155;2.72e-06)|GBM - Glioblastoma multiforme(68;0.0372)		ATTAAGTTGCCTTCATCAGTG	0.363																																																1	Substitution - Missense(1)	ovary(1)	6											174.0	172.0	173.0					6																	144171287		2203	4300	6503	144212980	SO:0001583	missense	84946			BC009855	CCDS5201.1	6q24.2	2014-02-03	2014-02-03	2006-02-06	ENSG00000135521	ENSG00000135521			21173	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 93"", ""LTV1 homolog (S. cerevisiae)"""	C6orf93			Standard	NM_032860		Approved	FLJ14909, dJ468K18.4	uc003qjs.3	Q96GA3	OTTHUMG00000015733	ENST00000367576.5:c.329C>A	6.37:g.144171287C>A	ENSP00000356548:p.Pro110His		144212980	Q96JX8	Missense_Mutation	SNP	ENST00000367576.5	37	CCDS5201.1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.609924	0.87258	.	.	ENSG00000135521	ENST00000367576	.	.	.	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	D	0.84651	0.5519	M	0.91196	3.185	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.85683	0.1302	9	0.52906	T	0.07	.	20.0246	0.97519	0.0:1.0:0.0:0.0	.	110	Q96GA3	LTV1_HUMAN	H	110	.	ENSP00000356548:P110H	P	+	2	0	LTV1	144212980	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.146000	0.77373	2.810000	0.96702	0.650000	0.86243	CCT		0.363	LTV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042532.1	NM_032860	
ZNF479	90827	broad.mit.edu	37	7	57188623	57188623	+	Missense_Mutation	SNP	C	C	G			TCGA-23-2081-01A-01W-0722-08	TCGA-23-2081-10A-01W-0722-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	05cd5b89-dd8b-49fa-afec-787b644f7854	c53ea000-9f6d-44ea-b41b-a2a10fb1deb0	g.chr7:57188623C>G	ENST00000331162.4	-	5	769	c.499G>C	c.(499-501)Ggt>Cgt	p.G167R		NM_033273.1	NP_150376.1	Q96JC4	ZN479_HUMAN	zinc finger protein 479	167					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G167R(1)		NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(53)|ovary(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	84			GBM - Glioblastoma multiforme(1;9.18e-12)			GAAAATTTACCAAAGACTTTG	0.303																																																1	Substitution - Missense(1)	ovary(1)	7											31.0	30.0	30.0					7																	57188623		1817	4072	5889	57192565	SO:0001583	missense	90827			AF277624	CCDS43590.1	7p11.2	2013-01-08			ENSG00000185177	ENSG00000185177		"""Zinc fingers, C2H2-type"", ""-"""	23258	protein-coding gene	gene with protein product						11410164	Standard	NM_033273		Approved	KR19	uc010kzo.3	Q96JC4	OTTHUMG00000156682	ENST00000331162.4:c.499G>C	7.37:g.57188623C>G	ENSP00000333776:p.Gly167Arg		57192565		Missense_Mutation	SNP	ENST00000331162.4	37	CCDS43590.1	.	.	.	.	.	.	.	.	.	.	c	7.910	0.736204	0.15574	.	.	ENSG00000185177	ENST00000331162	T	0.35605	1.3	0.946	-1.53	0.08611	.	.	.	.	.	T	0.24586	0.0596	N	0.13299	0.325	0.09310	N	1	D	0.53619	0.961	P	0.52758	0.708	T	0.12502	-1.0545	9	0.25106	T	0.35	.	3.2658	0.06864	0.0:0.3727:0.0:0.6273	.	167	Q96JC4	ZN479_HUMAN	R	167	ENSP00000333776:G167R	ENSP00000333776:G167R	G	-	1	0	ZNF479	57192565	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-2.022000	0.01439	-0.503000	0.06586	-0.498000	0.04607	GGT		0.303	ZNF479-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345302.1	XM_291202	
MUC17	140453	broad.mit.edu	37	7	100675089	100675089	+	Missense_Mutation	SNP	G	G	C			TCGA-23-2081-01A-01W-0722-08	TCGA-23-2081-10A-01W-0722-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture			Illumina GAIIx	05cd5b89-dd8b-49fa-afec-787b644f7854	c53ea000-9f6d-44ea-b41b-a2a10fb1deb0	g.chr7:100675089G>C	ENST00000306151.4	+	3	456	c.392G>C	c.(391-393)aGt>aCt	p.S131T		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	131	Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)	p.S131T(1)		NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					CTTTTCCCCAGTTCTACTGAA	0.473																																																1	Substitution - Missense(1)	ovary(1)	7											170.0	157.0	161.0					7																	100675089		2203	4300	6503	100461809	SO:0001583	missense	140453			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.392G>C	7.37:g.100675089G>C	ENSP00000302716:p.Ser131Thr		100461809	O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	37	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	G	0.372	-0.933520	0.02359	.	.	ENSG00000169876	ENST00000306151	T	0.02498	4.27	0.801	-1.6	0.08426	.	.	.	.	.	T	0.01320	0.0043	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.47209	-0.9135	9	0.02654	T	1	.	2.3631	0.04312	0.0:0.3651:0.3416:0.2933	.	131	Q685J3	MUC17_HUMAN	T	131	ENSP00000302716:S131T	ENSP00000302716:S131T	S	+	2	0	MUC17	100461809	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-1.526000	0.02229	-0.811000	0.04369	0.196000	0.17591	AGT		0.473	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105	
FAM180A	389558	broad.mit.edu	37	7	135418866	135418866	+	Missense_Mutation	SNP	C	C	T			TCGA-23-2081-01A-01W-0722-08	TCGA-23-2081-10A-01W-0722-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture			Illumina GAIIx	05cd5b89-dd8b-49fa-afec-787b644f7854	c53ea000-9f6d-44ea-b41b-a2a10fb1deb0	g.chr7:135418866C>T	ENST00000338588.3	-	3	644	c.379G>A	c.(379-381)Gtg>Atg	p.V127M	FAM180A_ENST00000415751.1_Missense_Mutation_p.V127M|FAM180A_ENST00000435869.1_Intron	NM_205855.3	NP_995327.1	Q6UWF9	F180A_HUMAN	family with sequence similarity 180, member A	127						extracellular region (GO:0005576)		p.V127M(1)		endometrium(1)|kidney(2)|large_intestine(2)|lung(6)|ovary(2)|pancreas(1)	14						AGGGTCAGCACTGTCCTTTCA	0.607																																																1	Substitution - Missense(1)	ovary(1)	7											146.0	121.0	129.0					7																	135418866		2203	4300	6503	135069406	SO:0001583	missense	389558			AC091736, AK290250, AK310180, AY358803	CCDS5841.1	7q33	2008-07-25			ENSG00000189320	ENSG00000189320			33773	protein-coding gene	gene with protein product						12975309, 12690205	Standard	NM_205855		Approved	HWKM1940, UNQ1940	uc003vtd.3	Q6UWF9	OTTHUMG00000155537	ENST00000338588.3:c.379G>A	7.37:g.135418866C>T	ENSP00000342336:p.Val127Met		135069406	B2RP85	Missense_Mutation	SNP	ENST00000338588.3	37	CCDS5841.1	.	.	.	.	.	.	.	.	.	.	C	15.19	2.760365	0.49468	.	.	ENSG00000189320	ENST00000338588;ENST00000415751	T;T	0.37235	1.21;1.21	5.65	4.76	0.60689	.	0.403185	0.27340	N	0.019801	T	0.33876	0.0878	L	0.46157	1.445	0.23978	N	0.996286	P	0.46220	0.874	B	0.44224	0.444	T	0.27872	-1.0061	10	0.66056	D	0.02	-10.2304	8.5212	0.33277	0.0:0.7647:0.1529:0.0824	.	127	Q6UWF9	F180A_HUMAN	M	127	ENSP00000342336:V127M;ENSP00000395467:V127M	ENSP00000342336:V127M	V	-	1	0	FAM180A	135069406	0.132000	0.22450	0.990000	0.47175	0.861000	0.49209	1.821000	0.39041	1.371000	0.46172	0.561000	0.74099	GTG		0.607	FAM180A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340554.2	NM_205855	
NPBWR1	2831	broad.mit.edu	37	8	53853430	53853430	+	Silent	SNP	G	G	A			TCGA-23-2081-01A-01W-0722-08	TCGA-23-2081-10A-01W-0722-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	05cd5b89-dd8b-49fa-afec-787b644f7854	c53ea000-9f6d-44ea-b41b-a2a10fb1deb0	g.chr8:53853430G>A	ENST00000331251.3	+	1	2440	c.963G>A	c.(961-963)ctG>ctA	p.L321L		NM_005285.3	NP_005276.2	P48145	NPBW1_HUMAN	neuropeptides B/W receptor 1	321					G-protein coupled receptor signaling pathway (GO:0007186)|opioid receptor signaling pathway (GO:0038003)|regulation of metabolic process (GO:0019222)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide receptor activity (GO:0008188)|opioid receptor activity (GO:0004985)	p.L321L(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)	17		Lung NSC(129;0.0222)|all_epithelial(80;0.0301)|all_lung(136;0.0431)				TCCGCCAGCTGATAACTTGCC	0.672																																																1	Substitution - coding silent(1)	ovary(1)	8											18.0	19.0	19.0					8																	53853430		2181	4262	6443	54015983	SO:0001819	synonymous_variant	2831			BC033145	CCDS6151.1	8p22-q21.13	2012-08-08	2006-02-15	2006-02-15		ENSG00000183729		"""GPCR / Class A : Neuropeptide receptors : W/B"""	4522	protein-coding gene	gene with protein product		600730	"""G protein-coupled receptor 7"""	GPR7		7590751, 12401809	Standard	NM_005285		Approved		uc011ldu.2	P48145		ENST00000331251.3:c.963G>A	8.37:g.53853430G>A			54015983	Q6NTC7	Silent	SNP	ENST00000331251.3	37	CCDS6151.1																																																																																				0.672	NPBWR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378047.1	NM_005285	
WDYHV1	55093	broad.mit.edu	37	8	124448697	124448697	+	Missense_Mutation	SNP	A	A	T			TCGA-23-2081-01A-01W-0722-08	TCGA-23-2081-10A-01W-0722-08	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	05cd5b89-dd8b-49fa-afec-787b644f7854	c53ea000-9f6d-44ea-b41b-a2a10fb1deb0	g.chr8:124448697A>T	ENST00000287387.2	+	4	364	c.239A>T	c.(238-240)tAc>tTc	p.Y80F	WDYHV1_ENST00000523984.1_Missense_Mutation_p.Y20F|WDYHV1_ENST00000517609.1_3'UTR|WDYHV1_ENST00000523356.1_Missense_Mutation_p.Y80F|WDYHV1_ENST00000518125.1_Intron	NM_018024.1	NP_060494.1	Q96HA8	NTAQ1_HUMAN	WDYHV motif containing 1	80					cellular protein modification process (GO:0006464)	cytosol (GO:0005829)|nucleus (GO:0005634)	protein-N-terminal glutamine amidohydrolase activity (GO:0070773)	p.Y80F(1)		endometrium(2)|kidney(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)|skin(1)|stomach(3)	17						TTTTAGGATTACCATGTTGTT	0.358																																																1	Substitution - Missense(1)	ovary(1)	8											163.0	135.0	145.0					8																	124448697		2203	4300	6503	124517878	SO:0001583	missense	55093			AK001066	CCDS6344.1, CCDS64965.1	8q24.13	2008-10-01	2008-10-01	2008-10-01		ENSG00000156795			25490	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 32"""	C8orf32		12477932	Standard	NM_018024		Approved	FLJ10204	uc003yqn.1	Q96HA8		ENST00000287387.2:c.239A>T	8.37:g.124448697A>T	ENSP00000287387:p.Tyr80Phe		124517878	B4DE68|Q9NW95	Missense_Mutation	SNP	ENST00000287387.2	37	CCDS6344.1	.	.	.	.	.	.	.	.	.	.	A	19.63	3.863598	0.71949	.	.	ENSG00000156795	ENST00000287387;ENST00000523984;ENST00000523356	T;T;T	0.38401	1.14;1.14;1.14	5.63	4.44	0.53790	Protein N-terminal glutamine amidohydrolase, alpha beta roll (1);Protein N-terminal glutamine amidohydrolase (1);	0.060978	0.64402	D	0.000002	T	0.66528	0.2798	M	0.92412	3.305	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	T	0.72811	-0.4180	10	0.62326	D	0.03	-22.0576	11.7866	0.52045	0.8525:0.1474:0.0:0.0	.	80	Q96HA8	NTAQ1_HUMAN	F	80;20;80	ENSP00000287387:Y80F;ENSP00000430427:Y20F;ENSP00000428615:Y80F	ENSP00000287387:Y80F	Y	+	2	0	WDYHV1	124517878	1.000000	0.71417	1.000000	0.80357	0.739000	0.42172	7.119000	0.77145	0.925000	0.37094	0.533000	0.62120	TAC		0.358	WDYHV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381772.1	NM_018024	
ANXA13	312	broad.mit.edu	37	8	124696890	124696890	+	Missense_Mutation	SNP	T	T	C			TCGA-23-2081-01A-01W-0722-08	TCGA-23-2081-10A-01W-0722-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	05cd5b89-dd8b-49fa-afec-787b644f7854	c53ea000-9f6d-44ea-b41b-a2a10fb1deb0	g.chr8:124696890T>C	ENST00000419625.1	-	10	863	c.791A>G	c.(790-792)gAt>gGt	p.D264G	ANXA13_ENST00000262219.6_Missense_Mutation_p.D305G	NM_004306.2	NP_004297.2	P27216	ANX13_HUMAN	annexin A13	264					cell differentiation (GO:0030154)|negative regulation of Golgi to plasma membrane protein transport (GO:0042997)|positive regulation of Golgi to plasma membrane protein transport (GO:0042998)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|exocytic vesicle (GO:0070382)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phosphatidylglycerol binding (GO:1901611)|phosphatidylserine binding (GO:0001786)	p.D305G(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|liver(1)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(2)	25	Lung NSC(37;2.06e-11)|Ovarian(258;0.00579)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00288)			CGTCTCCTCATCGGTCCCCGC	0.517																																																1	Substitution - Missense(1)	ovary(1)	8											190.0	148.0	162.0					8																	124696890		2203	4300	6503	124766071	SO:0001583	missense	312			Z11502	CCDS34939.1, CCDS47917.1	8q24.13	2005-11-09			ENSG00000104537	ENSG00000104537		"""Annexins"""	536	protein-coding gene	gene with protein product		602573		ANX13		9503022	Standard	NM_004306		Approved		uc003yqt.3	P27216	OTTHUMG00000164987	ENST00000419625.1:c.791A>G	8.37:g.124696890T>C	ENSP00000390809:p.Asp264Gly		124766071	Q9BQR5	Missense_Mutation	SNP	ENST00000419625.1	37	CCDS47917.1	.	.	.	.	.	.	.	.	.	.	T	21.9	4.212626	0.79240	.	.	ENSG00000104537	ENST00000262219;ENST00000419625	T;T	0.05447	3.44;3.44	5.62	5.62	0.85841	Annexin repeat, conserved site (1);	0.043123	0.85682	D	0.000000	T	0.31136	0.0787	H	0.95004	3.61	0.47183	D	0.999347	D;D	0.64830	0.994;0.992	P;P	0.58210	0.779;0.835	T	0.42899	-0.9424	10	0.66056	D	0.02	.	15.1018	0.72284	0.0:0.0:0.0:1.0	.	264;305	P27216;P27216-2	ANX13_HUMAN;.	G	305;264	ENSP00000262219:D305G;ENSP00000390809:D264G	ENSP00000262219:D305G	D	-	2	0	ANXA13	124766071	1.000000	0.71417	0.551000	0.28230	0.751000	0.42716	6.638000	0.74309	2.268000	0.75426	0.454000	0.30748	GAT		0.517	ANXA13-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381308.1	NM_004306	
SLC38A5	92745	broad.mit.edu	37	X	48318131	48318131	+	Missense_Mutation	SNP	G	G	C			TCGA-23-2081-01A-01W-0722-08	TCGA-23-2081-10A-01W-0722-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	05cd5b89-dd8b-49fa-afec-787b644f7854	c53ea000-9f6d-44ea-b41b-a2a10fb1deb0	g.chrX:48318131G>C	ENST00000376876.3	-	14	2043	c.1200C>G	c.(1198-1200)atC>atG	p.I400M	SLC38A5_ENST00000480105.1_5'UTR|SLC38A5_ENST00000376875.1_Missense_Mutation_p.I349M|SLC38A5_ENST00000317669.5_Missense_Mutation_p.I400M			Q8WUX1	S38A5_HUMAN	solute carrier family 38, member 5	400					amino acid transport (GO:0006865)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glycine transmembrane transporter activity (GO:0015187)	p.I400M(1)		breast(1)|cervix(1)|endometrium(6)|large_intestine(2)|lung(5)|ovary(3)|skin(1)	19						TAACTCCAAAGATATCCCGGA	0.517																																																1	Substitution - Missense(1)	ovary(1)	X											123.0	100.0	108.0					X																	48318131		2203	4300	6503	48203075	SO:0001583	missense	92745			AF276889	CCDS14293.1	Xp11.23	2013-05-22			ENSG00000017483	ENSG00000017483		"""Solute carriers"""	18070	protein-coding gene	gene with protein product		300649				11243884	Standard	NM_033518		Approved	SN2, JM24	uc010nid.3	Q8WUX1	OTTHUMG00000024117	ENST00000376876.3:c.1200C>G	X.37:g.48318131G>C	ENSP00000366073:p.Ile400Met		48203075	B3KT20|B5MDE6|B7WPJ9|Q6PIW9|Q8WYU2|Q96PQ4	Missense_Mutation	SNP	ENST00000376876.3	37	CCDS14293.1	.	.	.	.	.	.	.	.	.	.	g	13.53	2.263433	0.39995	.	.	ENSG00000017483	ENST00000376876;ENST00000376875;ENST00000317669	T;T;T	0.02812	4.15;4.15;4.15	5.31	4.45	0.53987	.	0.000000	0.85682	D	0.000000	T	0.18593	0.0446	M	0.91663	3.23	0.50467	D	0.99987	D	0.89917	1.0	D	0.87578	0.998	T	0.00686	-1.1610	10	0.87932	D	0	.	10.8207	0.46604	0.0945:0.0:0.9055:0.0	.	400	Q8WUX1	S38A5_HUMAN	M	400;349;400	ENSP00000366073:I400M;ENSP00000366071:I349M;ENSP00000313740:I400M	ENSP00000313740:I400M	I	-	3	3	SLC38A5	48203075	1.000000	0.71417	1.000000	0.80357	0.422000	0.31414	1.796000	0.38794	1.035000	0.39972	0.529000	0.55759	ATC		0.517	SLC38A5-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060724.1	NM_033518	
CYSLTR1	10800	broad.mit.edu	37	X	77528369	77528369	+	Missense_Mutation	SNP	G	G	C			TCGA-23-2081-01A-01W-0722-08	TCGA-23-2081-10A-01W-0722-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	05cd5b89-dd8b-49fa-afec-787b644f7854	c53ea000-9f6d-44ea-b41b-a2a10fb1deb0	g.chrX:77528369G>C	ENST00000373304.3	-	3	1167	c.875C>G	c.(874-876)cCt>cGt	p.P292R		NM_001282187.1|NM_001282188.1|NM_006639.3	NP_001269116.1|NP_001269117.1|NP_006630.1	Q9Y271	CLTR1_HUMAN	cysteinyl leukotriene receptor 1	292					defense response (GO:0006952)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|respiratory gaseous exchange (GO:0007585)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	leukotriene receptor activity (GO:0004974)	p.P292R(1)		endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|skin(1)	14					Cinalukast(DB00587)|Montelukast(DB00471)|Nedocromil(DB00716)|Pranlukast(DB01411)|Zafirlukast(DB00549)	ATATAGGAGAGGGTCAAAGCA	0.423																																																1	Substitution - Missense(1)	ovary(1)	X											59.0	58.0	58.0					X																	77528369		2202	4300	6502	77415025	SO:0001583	missense	10800			AF119711	CCDS14439.1	Xq13-q21	2012-08-10			ENSG00000173198	ENSG00000173198		"""GPCR / Class A : Leukotriene receptors"""	17451	protein-coding gene	gene with protein product		300201				10391245, 10462554	Standard	NM_006639		Approved	CysLT1, CysLT(1), CYSLT1R	uc004edb.3	Q9Y271	OTTHUMG00000021889	ENST00000373304.3:c.875C>G	X.37:g.77528369G>C	ENSP00000362401:p.Pro292Arg		77415025	B2R954|D3DTE4|Q5JS94|Q8IV19	Missense_Mutation	SNP	ENST00000373304.3	37	CCDS14439.1	.	.	.	.	.	.	.	.	.	.	G	17.61	3.433368	0.62844	.	.	ENSG00000173198	ENST00000373304	D	0.98807	-5.15	3.89	3.89	0.44902	GPCR, rhodopsin-like superfamily (1);	0.120594	0.56097	D	0.000025	D	0.99217	0.9728	M	0.92970	3.365	0.53688	D	0.999974	D	0.89917	1.0	D	0.91635	0.999	D	0.99060	1.0830	10	0.87932	D	0	.	12.4121	0.55473	0.0:0.0:1.0:0.0	.	292	Q9Y271	CLTR1_HUMAN	R	292	ENSP00000362401:P292R	ENSP00000362401:P292R	P	-	2	0	CYSLTR1	77415025	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	9.342000	0.97044	1.770000	0.52166	0.468000	0.43344	CCT		0.423	CYSLTR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057315.1		
TCEAL1	9338	broad.mit.edu	37	X	102884961	102884961	+	Silent	SNP	G	G	A	rs201420287		TCGA-23-2081-01A-01W-0722-08	TCGA-23-2081-10A-01W-0722-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	05cd5b89-dd8b-49fa-afec-787b644f7854	c53ea000-9f6d-44ea-b41b-a2a10fb1deb0	g.chrX:102884961G>A	ENST00000372625.3	+	3	281	c.117G>A	c.(115-117)tcG>tcA	p.S39S	TCEAL1_ENST00000469820.1_3'UTR|TCEAL1_ENST00000372624.3_Silent_p.S39S|TCEAL1_ENST00000372626.3_Silent_p.S39S	NM_001006639.1|NM_004780.2	NP_001006640.1|NP_004771.2	Q15170	TCAL1_HUMAN	transcription elongation factor A (SII)-like 1	37	Arg/Ser-rich.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S39S(1)		ovary(1)	1						AGCAGTCTTCGGAGGAGCAGT	0.622																																																1	Substitution - coding silent(1)	ovary(1)	X											21.0	20.0	20.0					X																	102884961		2195	4287	6482	102771617	SO:0001819	synonymous_variant	9338			M99701	CCDS35358.1	Xq22.1	2014-03-21			ENSG00000172465	ENSG00000172465			11616	protein-coding gene	gene with protein product		300237				8206389, 7971997, 16221301	Standard	NM_004780		Approved	p21, pp21, SIIR, P21, WEX9	uc004eku.3	Q15170	OTTHUMG00000022699	ENST00000372625.3:c.117G>A	X.37:g.102884961G>A			102771617	Q9UJQ9	Silent	SNP	ENST00000372625.3	37	CCDS35358.1	.	.	.	.	.	.	.	.	.	.	G	10.09	1.254234	0.22965	.	.	ENSG00000172465	ENST00000537029	.	.	.	4.52	-9.04	0.00734	.	.	.	.	.	T	0.32071	0.0817	.	.	.	0.44515	D	0.997469	.	.	.	.	.	.	T	0.41142	-0.9525	4	.	.	.	-7.0888	0.4102	0.00440	0.3486:0.2597:0.1432:0.2486	.	.	.	.	Q	38	.	.	R	+	2	0	TCEAL1	102771617	0.033000	0.19621	0.008000	0.14137	0.313000	0.28021	-2.496000	0.00970	-2.910000	0.00308	-0.192000	0.12808	CGG		0.622	TCEAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058903.1	NM_004780	
IRS4	8471	broad.mit.edu	37	X	107979367	107979367	+	Nonsense_Mutation	SNP	C	C	A			TCGA-23-2081-01A-01W-0722-08	TCGA-23-2081-10A-01W-0722-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	05cd5b89-dd8b-49fa-afec-787b644f7854	c53ea000-9f6d-44ea-b41b-a2a10fb1deb0	g.chrX:107979367C>A	ENST00000372129.2	-	1	284	c.208G>T	c.(208-210)Gag>Tag	p.E70*	RP6-24A23.3_ENST00000436013.1_RNA|RP6-24A23.3_ENST00000608811.1_RNA	NM_003604.2	NP_003595.1	O14654	IRS4_HUMAN	insulin receptor substrate 4	70					positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)|signal transducer activity (GO:0004871)	p.E70*(1)		NS(1)|breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(1)	78						AGGTCCTCCTCTTCGGACTCG	0.642																																																1	Substitution - Nonsense(1)	ovary(1)	X											33.0	29.0	30.0					X																	107979367		2192	4274	6466	107866023	SO:0001587	stop_gained	8471			AF007567	CCDS14544.1	Xq22.3	2008-08-01			ENSG00000133124	ENSG00000133124			6128	protein-coding gene	gene with protein product		300904				9261155, 9553137	Standard	NM_003604		Approved	PY160, IRS-4	uc004eoc.2	O14654	OTTHUMG00000022181	ENST00000372129.2:c.208G>T	X.37:g.107979367C>A	ENSP00000361202:p.Glu70*		107866023		Nonsense_Mutation	SNP	ENST00000372129.2	37	CCDS14544.1	.	.	.	.	.	.	.	.	.	.	C	14.00	2.404221	0.42613	.	.	ENSG00000133124	ENST00000372129	.	.	.	3.14	2.28	0.28536	.	0.675885	0.12603	N	0.454513	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	-4.0156	4.008	0.09610	0.0:0.6144:0.2429:0.1427	.	.	.	.	X	70	.	ENSP00000361202:E70X	E	-	1	0	IRS4	107866023	0.626000	0.27120	0.454000	0.27019	0.080000	0.17528	2.173000	0.42472	0.738000	0.32606	0.529000	0.55759	GAG		0.642	IRS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057879.1	NM_003604	
HCFC1	3054	broad.mit.edu	37	X	153222426	153222426	+	Missense_Mutation	SNP	T	T	A			TCGA-23-2081-01A-01W-0722-08	TCGA-23-2081-10A-01W-0722-08	T	T	A	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	05cd5b89-dd8b-49fa-afec-787b644f7854	c53ea000-9f6d-44ea-b41b-a2a10fb1deb0	g.chrX:153222426T>A	ENST00000310441.7	-	14	3405	c.2439A>T	c.(2437-2439)aaA>aaT	p.K813N	HCFC1_ENST00000354233.3_Missense_Mutation_p.K744N|HCFC1_ENST00000369984.4_Missense_Mutation_p.K813N	NM_005334.2	NP_005325.2	P51610	HCFC1_HUMAN	host cell factor C1	813	Interaction with GABP2.|Interaction with ZBTB17.				cell cycle (GO:0007049)|chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell cycle (GO:0045787)|positive regulation of gene expression (GO:0010628)|protein stabilization (GO:0050821)|regulation of protein complex assembly (GO:0043254)|regulation of transcription, DNA-templated (GO:0006355)|release from viral latency (GO:0019046)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|membrane (GO:0016020)|mitochondrion (GO:0005739)|MLL1 complex (GO:0071339)|MLL5-L complex (GO:0070688)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	chromatin binding (GO:0003682)|identical protein binding (GO:0042802)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)	p.K716N(1)		NS(1)|breast(2)|central_nervous_system(2)|endometrium(12)|kidney(3)|large_intestine(3)|lung(18)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	all_cancers(53;6.23e-16)|all_epithelial(53;5.61e-10)|all_lung(58;3.99e-07)|Lung NSC(58;5.02e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CAGTGATGATTTTCGCAGGTG	0.582																																																1	Substitution - Missense(1)	ovary(1)	X											117.0	111.0	113.0					X																	153222426		2068	4176	6244	152875620	SO:0001583	missense	3054				CCDS44020.1	Xq28	2014-06-12	2014-06-09		ENSG00000172534	ENSG00000172534			4839	protein-coding gene	gene with protein product	"""VP16-accessory protein"", ""protein phosphatase 1, regulatory subunit 89"""	300019	"""mental retardation, X-linked 3"", ""host cell factor C1 (VP16-accessory protein)"""	HFC1, MRX3		8392914, 23000143	Standard	XM_005274664		Approved	HCF-1, HCF1, CFF, VCAF, MGC70925, PPP1R89	uc004fjp.3	P51610	OTTHUMG00000024222	ENST00000310441.7:c.2439A>T	X.37:g.153222426T>A	ENSP00000309555:p.Lys813Asn		152875620	Q6P4G5	Missense_Mutation	SNP	ENST00000310441.7	37	CCDS44020.1	.	.	.	.	.	.	.	.	.	.	T	20.6	4.020463	0.75275	.	.	ENSG00000172534	ENST00000310441;ENST00000369984;ENST00000354233	T;T;T	0.04083	3.77;3.83;3.71	5.76	-0.677	0.11357	.	0.000000	0.85682	D	0.000000	T	0.09862	0.0242	L	0.29908	0.895	0.45342	D	0.998334	D	0.76494	0.999	D	0.80764	0.994	T	0.00383	-1.1774	10	0.51188	T	0.08	.	11.1472	0.48436	0.0:0.5162:0.0:0.4838	.	813	P51610	HCFC1_HUMAN	N	813;813;744	ENSP00000309555:K813N;ENSP00000359001:K813N;ENSP00000346174:K744N	ENSP00000309555:K813N	K	-	3	2	HCFC1	152875620	0.998000	0.40836	0.958000	0.39756	0.983000	0.72400	0.420000	0.21263	-0.523000	0.06409	-0.330000	0.08379	AAA		0.582	HCFC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061099.4	NM_005334	
C1orf146	388649	broad.mit.edu	37	1	92711188	92711218	+	Frame_Shift_Del	DEL	TTCAGAAGATAAAACTGAATAGTGATTCAGT	TTCAGAAGATAAAACTGAATAGTGATTCAGT	-	rs113770627		TCGA-23-2081-01A-01W-0722-08	TCGA-23-2081-10A-01W-0722-08	TTCAGAAGATAAAACTGAATAGTGATTCAGT	TTCAGAAGATAAAACTGAATAGTGATTCAGT	-	-	TTCAGAAGATAAAACTGAATAGTGATTCAGT	TTCAGAAGATAAAACTGAATAGTGATTCAGT	Unknown	Valid	Somatic	Phase_I	Capture	Illumina_Capture			Illumina GAIIx	05cd5b89-dd8b-49fa-afec-787b644f7854	c53ea000-9f6d-44ea-b41b-a2a10fb1deb0	g.chr1:92711188_92711218delTTCAGAAGATAAAACTGAATAGTGATTCAGT	ENST00000370375.3	+	6	648_678	c.500_530delTTCAGAAGATAAAACTGAATAGTGATTCAGT	c.(499-531)cttcagaagataaaactgaatagtgattcagttfs	p.LQKIKLNSDSV167fs	C1orf146_ENST00000370373.2_Frame_Shift_Del_p.LQKIKLNSDSV108fs	NM_001012425.1	NP_001012425.1	Q5VVC0	CA146_HUMAN	chromosome 1 open reading frame 146	167								p.Q168fs>3(1)|p.K169R(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)|urinary_tract(1)	8		all_lung(203;0.00528)|Lung NSC(277;0.0193)		all cancers(265;0.00846)|Epithelial(280;0.0952)		TGGAAAACACTTCAGAAGATAAAACTGAATAGTGATTCAGTTAACCCAAAT	0.303																																																2	Substitution - Missense(1)|Deletion - Frameshift(1)	ovary(1)|kidney(1)	1																																								92483806	SO:0001589	frameshift_variant	388649				CCDS30772.1	1p22.1	2008-02-05			ENSG00000203910	ENSG00000203910			24032	protein-coding gene	gene with protein product						15496913	Standard	NM_001012425		Approved		uc001doq.3	Q5VVC0	OTTHUMG00000010285	ENST00000370375.3:c.500_530delTTCAGAAGATAAAACTGAATAGTGATTCAGT	1.37:g.92711188_92711218delTTCAGAAGATAAAACTGAATAGTGATTCAGT	ENSP00000359401:p.Leu167fs		92483776	Q5VVC4	Frame_Shift_Del	DEL	ENST00000370375.3	37	CCDS30772.1																																																																																				0.303	C1orf146-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028364.1	NM_001012425	
HKDC1	80201	broad.mit.edu	37	10	71008231	71008241	+	Frame_Shift_Del	DEL	TGTCCGCTTCC	TGTCCGCTTCC	-	rs202161330		TCGA-23-2081-01A-01W-0722-08	TCGA-23-2081-10A-01W-0722-08	TGTCCGCTTCC	TGTCCGCTTCC	-	-	TGTCCGCTTCC	TGTCCGCTTCC	Unknown	Valid	Somatic	Phase_I	Capture	Illumina_Capture			Illumina GAIIx	05cd5b89-dd8b-49fa-afec-787b644f7854	c53ea000-9f6d-44ea-b41b-a2a10fb1deb0	g.chr10:71008231_71008241delTGTCCGCTTCC	ENST00000354624.5	+	10	1450_1460	c.1317_1327delTGTCCGCTTCC	c.(1315-1329)gatgtccgcttcctcfs	p.VRFL440fs	HKDC1_ENST00000395086.2_Frame_Shift_Del_p.VRFL440fs|HKDC1_ENST00000488706.1_3'UTR	NM_025130.3	NP_079406	Q2TB90	HKDC1_HUMAN	hexokinase domain containing 1	440	Hexokinase type-2 1.				carbohydrate phosphorylation (GO:0046835)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glycolytic process (GO:0006096)|hexose metabolic process (GO:0019318)	cytosol (GO:0005829)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|mannokinase activity (GO:0019158)	p.V440fs*51(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(11)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34						CAAGCTGTGATGTCCGCTTCCTCCTGTCAGA	0.592																																																1	Deletion - Frameshift(1)	ovary(1)	10																																								70678247	SO:0001589	frameshift_variant	80201				CCDS7288.1	10q22.1	2006-10-24			ENSG00000156510	ENSG00000156510			23302	protein-coding gene	gene with protein product						12477932	Standard	NM_025130		Approved	FLJ37767, FLJ22761	uc001jpf.4	Q2TB90	OTTHUMG00000018371	ENST00000354624.5:c.1317_1327delTGTCCGCTTCC	10.37:g.71008231_71008241delTGTCCGCTTCC	ENSP00000346643:p.Val440fs		70678237	B5MDN9|Q2TB91|Q5VTC7|Q7Z373|Q8WU37|Q96EH2|Q9H5Y9	Frame_Shift_Del	DEL	ENST00000354624.5	37	CCDS7288.1																																																																																				0.592	HKDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048389.1	NM_025130	
