#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
PLOD1	5351	genome.wustl.edu	37	1	12024280	12024280	+	Silent	SNP	C	C	T			TCGA-24-1426-01A-01W-0549-09	TCGA-24-1426-10A-01W-0549-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	063f8696-2c9d-4af4-a863-df10c42a5ea8	a3986ae3-7431-4383-b8fc-976e58f7725c	g.chr1:12024280C>T	ENST00000196061.4	+	12	1278	c.1251C>T	c.(1249-1251)aaC>aaT	p.N417N	PLOD1_ENST00000376369.3_Silent_p.N464N	NM_000302.3	NP_000293.2	Q02809	PLOD1_HUMAN	procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1	417					cellular protein modification process (GO:0006464)|epidermis development (GO:0008544)|extracellular matrix organization (GO:0030198)|hydroxylysine biosynthetic process (GO:0046947)|oxidation-reduction process (GO:0055114)|response to hypoxia (GO:0001666)	endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen-lysine 5-dioxygenase activity (GO:0008475)|protein homodimerization activity (GO:0042803)	p.N417N(1)		breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(15)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	29	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.06e-06)|COAD - Colon adenocarcinoma(227;0.000273)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.000809)|KIRC - Kidney renal clear cell carcinoma(229;0.00267)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0649)	Succinic acid(DB00139)|Vitamin C(DB00126)	TGTGGTCGAACTTCTGGGGGG	0.627																																																1	Substitution - coding silent(1)	ovary(1)	1											152.0	150.0	151.0					1																	12024280		2203	4300	6503	11946867	SO:0001819	synonymous_variant	5351			BC016657	CCDS142.1	1p36.22	2011-08-25	2011-08-24	2004-12-14	ENSG00000083444	ENSG00000083444	1.14.11.4		9081	protein-coding gene	gene with protein product	"""lysyl hydroxlase 1"""	153454	"""procollagen-lysine 1, 2-oxoglutarate 5-dioxygenase (lysine hydroxylase, Ehlers-Danlos syndrome type VI)"""	LLH, PLOD		1577494	Standard	NM_000302		Approved	LH1	uc001atm.3	Q02809	OTTHUMG00000002393	ENST00000196061.4:c.1251C>T	1.37:g.12024280C>T			11946867	B4DR87|Q96AV9|Q9H132	Silent	SNP	HMMPfam_2OG-FeII_Oxy	p.N417	ENST00000196061.4	37	c.1251	CCDS142.1	1																																																																																			-	NULL		0.627	PLOD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLOD1	protein_coding	OTTHUMT00000006865.1	C	NM_000302		11946867	1	no_errors	NM_000302	genbank	human	reviewed	54_36p	silent	SNP	1	T
POLR3C	10623	genome.wustl.edu	37	1	145608205	145608205	+	Silent	SNP	A	A	G			TCGA-24-1426-01A-01W-0549-09	TCGA-24-1426-10A-01W-0549-09	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	063f8696-2c9d-4af4-a863-df10c42a5ea8	a3986ae3-7431-4383-b8fc-976e58f7725c	g.chr1:145608205A>G	ENST00000334163.3	-	4	652	c.492T>C	c.(490-492)ccT>ccC	p.P164P	POLR3C_ENST00000369294.1_Silent_p.P164P|POLR3C_ENST00000471254.1_5'UTR|RNF115_ENST00000369291.5_5'Flank	NM_006468.6	NP_006459.3	Q9BUI4	RPC3_HUMAN	polymerase (RNA) III (DNA directed) polypeptide C (62kD)	164					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of innate immune response (GO:0045089)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of type I interferon production (GO:0032481)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)	cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)	p.P164P(1)		breast(2)|endometrium(4)|kidney(1)|large_intestine(3)|liver(1)|lung(8)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)		Epithelial(2;7.55e-13)			TCTCAGTGGTAGGTACCGAAG	0.483																																																1	Substitution - coding silent(1)	ovary(1)	1											205.0	188.0	194.0					1																	145608205		2203	4300	6503	144319562	SO:0001819	synonymous_variant	10623			AJ238234	CCDS72864.1	1q21	2013-01-21			ENSG00000186141	ENSG00000186141		"""RNA polymerase subunits"""	30076	protein-coding gene	gene with protein product						9171375, 12391170	Standard	NM_006468		Approved	RPC62, RPC3	uc001eoh.3	Q9BUI4	OTTHUMG00000013753	ENST00000334163.3:c.492T>C	1.37:g.145608205A>G			144319562	O15317|Q9Y3R6	Silent	SNP	HMMPfam_RNA_pol_Rpc82;HMMPfam_HTH_9	p.P164	ENST00000334163.3	37	c.492	CCDS921.1	1																																																																																			-	HMMPfam_RNA_pol_Rpc82		0.483	POLR3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR3C	protein_coding	OTTHUMT00000038542.1	A	NM_006468		144319562	-1	no_errors	NM_006468	genbank	human	provisional	54_36p	silent	SNP	0.09	G
TSPAN1	10103	genome.wustl.edu	37	1	46650757	46650757	+	Silent	SNP	C	C	T			TCGA-24-1426-01A-01W-0549-09	TCGA-24-1426-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	063f8696-2c9d-4af4-a863-df10c42a5ea8	a3986ae3-7431-4383-b8fc-976e58f7725c	g.chr1:46650757C>T	ENST00000372003.1	+	7	1028	c.564C>T	c.(562-564)acC>acT	p.T188T	TSPAN1_ENST00000498443.1_3'UTR	NM_005727.3	NP_005718.2	O60635	TSN1_HUMAN	tetraspanin 1	188					cell migration (GO:0016477)|cell proliferation (GO:0008283)|positive regulation of endocytosis (GO:0045807)|protein stabilization (GO:0050821)|thiamine transmembrane transport (GO:0071934)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	thiamine uptake transmembrane transporter activity (GO:0015403)	p.T188T(1)		kidney(1)|large_intestine(1)|lung(5)|ovary(1)	8	Acute lymphoblastic leukemia(166;0.155)	Medulloblastoma(700;0.00498)|all_neural(321;0.0212)				AAACCTGCACCAAGCAAAAGG	0.512																																																1	Substitution - coding silent(1)	ovary(1)	1											122.0	128.0	126.0					1																	46650757		2203	4300	6503	46423344	SO:0001819	synonymous_variant	10103			BC013404	CCDS530.1	1p33	2013-02-14			ENSG00000117472	ENSG00000117472		"""Tetraspanins"""	20657	protein-coding gene	gene with protein product		613170				9714763, 10719184	Standard	NM_005727		Approved	TSPAN-1, NET-1	uc001cpd.3	O60635	OTTHUMG00000007602	ENST00000372003.1:c.564C>T	1.37:g.46650757C>T			46423344	D3DQ14|O60745|Q5VST0	Silent	SNP	-	p.T188	ENST00000372003.1	37	c.564	CCDS530.1	1																																																																																			-	NULL		0.512	TSPAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSPAN1	protein_coding	OTTHUMT00000020135.1	C	NM_005727		46423344	1	no_errors	NM_005727	genbank	human	reviewed	54_36p	silent	SNP		T
PPFIA4	8497	genome.wustl.edu	37	1	203015021	203015021	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1426-01A-01W-0549-09	TCGA-24-1426-10A-01W-0549-09	G	G	C	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	063f8696-2c9d-4af4-a863-df10c42a5ea8	a3986ae3-7431-4383-b8fc-976e58f7725c	g.chr1:203015021G>C	ENST00000447715.2	+	12	1352	c.911G>C	c.(910-912)cGc>cCc	p.R304P	PPFIA4_ENST00000414050.2_Missense_Mutation_p.R11P|PPFIA4_ENST00000367240.2_Missense_Mutation_p.R304P|PPFIA4_ENST00000295706.4_5'UTR			O75335	LIPA4_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 4	304					cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|presynaptic active zone (GO:0048786)		p.R451P(1)		NS(1)|autonomic_ganglia(1)|breast(3)|endometrium(6)|kidney(2)|large_intestine(8)|lung(20)|ovary(4)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	50						CTGGAGAAGCGCTACCTGGCT	0.572																																																1	Substitution - Missense(1)	ovary(1)	1											190.0	173.0	179.0					1																	203015021		876	1991	2867	201281644	SO:0001583	missense	8497			AF034801	CCDS44296.1	1q32.1	2013-01-10			ENSG00000143847	ENSG00000143847		"""Sterile alpha motif (SAM) domain containing"""	9248	protein-coding gene	gene with protein product	"""Liprin-alpha4"""	603145				9624153	Standard	XM_005245553		Approved		uc009xaj.3	O75335	OTTHUMG00000042123	ENST00000447715.2:c.911G>C	1.37:g.203015021G>C	ENSP00000402576:p.Arg304Pro		201281644	A2RUJ5|B1APN8|B1N949|B7ZM43|O94971	Missense_Mutation	SNP	-	p.R304P	ENST00000447715.2	37	c.911		1	.	.	.	.	.	.	.	.	.	.	G	23.7	4.451582	0.84209	.	.	ENSG00000143847	ENST00000367240;ENST00000447715;ENST00000414050	T;T;T	0.79940	-1.32;-1.32;1.08	4.72	4.72	0.59763	.	0.000000	0.46442	D	0.000296	D	0.90116	0.6912	.	.	.	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.974	D	0.91597	0.5292	9	0.87932	D	0	-9.6034	17.8719	0.88813	0.0:0.0:1.0:0.0	.	11;304	B4DIS5;B1N949	.;.	P	304;304;11	ENSP00000356209:R304P;ENSP00000402576:R304P;ENSP00000400379:R11P	ENSP00000356209:R304P	R	+	2	0	PPFIA4	201281644	1.000000	0.71417	1.000000	0.80357	0.739000	0.42172	9.544000	0.98092	2.456000	0.83038	0.557000	0.71058	CGC	-	NULL		0.572	PPFIA4-005	NOVEL	basic|appris_candidate	protein_coding	PPFIA4	protein_coding	OTTHUMT00000462949.1	G	NM_015053		201281644	1	no_errors	ENST00000367238	ensembl	human	known	54_36p	missense	SNP	1	C
EDRF1	26098	genome.wustl.edu	37	10	127409845	127409845	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1426-01A-01W-0549-09	TCGA-24-1426-10A-01W-0549-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	063f8696-2c9d-4af4-a863-df10c42a5ea8	a3986ae3-7431-4383-b8fc-976e58f7725c	g.chr10:127409845C>G	ENST00000356792.4	+	2	413	c.181C>G	c.(181-183)Cga>Gga	p.R61G	C10orf137_ENST00000337623.3_Missense_Mutation_p.R61G|RP11-383C5.4_ENST00000423178.2_lincRNA|RP11-383C5.5_ENST00000430970.1_RNA	NM_001202438.1	NP_001189367.1	Q3B7T1	EDRF1_HUMAN		61					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)		p.R61G(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(12)|lung(20)|ovary(8)|pancreas(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	61		all_lung(145;0.0096)|Lung NSC(174;0.0145)|Colorectal(57;0.0846)|all_neural(114;0.0936)				TGCCCCTCCTCGAACAGCATT	0.468																																																1	Substitution - Missense(1)	ovary(1)	10											98.0	99.0	99.0					10																	127409845		2203	4300	6503	127399835	SO:0001583	missense	26098																														ENST00000356792.4:c.181C>G	10.37:g.127409845C>G	ENSP00000349244:p.Arg61Gly		127399835	B2RC65|Q3KR40|Q4G190|Q5VZQ4|Q8IZ74|Q9Y3W4	Missense_Mutation	SNP	superfamily_TPR-like	p.R61G	ENST00000356792.4	37	c.181	CCDS55733.1	10	.	.	.	.	.	.	.	.	.	.	C	16.71	3.199203	0.58126	.	.	ENSG00000107938	ENST00000356792;ENST00000392732;ENST00000337623	.	.	.	5.18	5.18	0.71444	.	0.308213	0.31834	N	0.006984	T	0.48660	0.1512	L	0.29908	0.895	0.43579	D	0.995914	B;B;B	0.31193	0.312;0.15;0.312	B;B;B	0.35182	0.197;0.142;0.091	T	0.40590	-0.9555	9	0.19590	T	0.45	.	16.8995	0.86109	0.0:1.0:0.0:0.0	.	61;61;61	Q3B7T1;Q3B7T1-5;Q3B7T1-3	EDRF1_HUMAN;.;.	G	61	.	ENSP00000336727:R61G	R	+	1	2	C10orf137	127399835	1.000000	0.71417	0.999000	0.59377	0.999000	0.98932	5.741000	0.68638	2.404000	0.81709	0.655000	0.94253	CGA	-	NULL		0.468	C10orf137-007	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	C10orf137	protein_coding	OTTHUMT00000388539.1	C			127399835	1	no_errors	NM_015608	genbank	human	validated	54_36p	missense	SNP	0.99	G
FXYD2	486	genome.wustl.edu	37	11	117691574	117691574	+	Splice_Site	SNP	C	C	T	rs139816783		TCGA-24-1426-01A-01W-0549-09	TCGA-24-1426-10A-01W-0549-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	063f8696-2c9d-4af4-a863-df10c42a5ea8	a3986ae3-7431-4383-b8fc-976e58f7725c	g.chr11:117691574C>T	ENST00000292079.2	-	4	241	c.176G>A	c.(175-177)aGg>aAg	p.R59K	FXYD2_ENST00000532119.1_Splice_Site_p.R57K|FXYD2_ENST00000514385.1_5'Flank|FXYD2_ENST00000260287.2_Splice_Site_p.R57K|FXYD2_ENST00000528014.1_Splice_Site_p.R57K|RP11-728F11.3_ENST00000596805.1_RNA|FXYD6-FXYD2_ENST00000532984.1_3'UTR|RP11-728F11.3_ENST00000531850.2_RNA	NM_001680.4	NP_001671.2	P54710	ATNG_HUMAN	FXYD domain containing ion transport regulator 2	59					ion transmembrane transport (GO:0034220)|regulation of cell growth (GO:0001558)|regulation of cell proliferation (GO:0042127)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)	ion channel activity (GO:0005216)|sodium:potassium-exchanging ATPase activity (GO:0005391)|transporter activity (GO:0005215)	p.R57K(1)		breast(1)|kidney(2)|lung(1)|ovary(1)|upper_aerodigestive_tract(1)	6	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0425)|Breast(348;0.111)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;2.83e-05)|Epithelial(105;0.00114)	Cyclothiazide(DB00606)	CAGCGCTCACCTGCGCTTCTT	0.552													C|||	1	0.000199681	0.0008	0.0	5008	,	,		10233	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	11						C	LYS/ARG,LYS/ARG,LYS/ARG	5,4397	9.9+/-24.2	0,5,2196	100.0	119.0	113.0		410,176,170	4.2	0.9	11	dbSNP_134	113	0,8592		0,0,4296	yes	missense-near-splice,missense-near-splice,missense-near-splice	FXYD2,FXYD6-FXYD2	NM_001204268.1,NM_001680.4,NM_021603.3	26,26,26	0,5,6492	TT,TC,CC		0.0,0.1136,0.0385	,,	137/145,59/67,57/65	117691574	5,12989	2201	4296	6497	117196784	SO:0001630	splice_region_variant	100287298			AF241236	CCDS8385.1, CCDS8386.1	11q23	2008-02-05	2003-02-28						4026	protein-coding gene	gene with protein product		601814	"""hypomagnesemia 2, renal"""	ATP1G1, HOMG2		9048881, 9915957	Standard	NM_021603		Approved	MGC12372		P54710		ENST00000292079.2:c.176+1G>A	11.37:g.117691574C>T			117196784	Q15332|Q53YC1|Q9GZP3|Q9GZQ7	Missense_Mutation	SNP	-	p.R59K	ENST00000292079.2	37	c.176	CCDS8386.1	11	.	.	.	.	.	.	.	.	.	.	C	22.2	4.252889	0.80135	0.001136	0.0	ENSG00000137731	ENST00000532119;ENST00000528014;ENST00000292079;ENST00000260287	T;T;T;T	0.66995	-0.24;-0.24;-0.24;-0.24	4.18	4.18	0.49190	.	.	.	.	.	T	0.79323	0.4426	.	.	.	0.80722	D	1	D;D	0.69078	0.99;0.997	D;D	0.79108	0.979;0.992	T	0.79822	-0.1641	7	.	.	.	.	12.1901	0.54266	0.0:1.0:0.0:0.0	.	57;59	P54710-2;P54710	.;ATNG_HUMAN	K	57;57;59;57	ENSP00000436414:R57K;ENSP00000432430:R57K;ENSP00000292079:R59K;ENSP00000260287:R57K	.	R	-	2	0	FXYD2	117196784	0.990000	0.36364	0.875000	0.34327	0.120000	0.20174	3.775000	0.55349	2.321000	0.78463	0.655000	0.94253	AGG	-	NULL		0.552	FXYD2-002	KNOWN	basic|CCDS	protein_coding	FXYD2	protein_coding	OTTHUMT00000390050.1	C	NM_021603	Missense_Mutation	117196784	-1	no_errors	NM_001680	genbank	human	reviewed	54_36p	missense	SNP	0.24	T
ARID4A	5926	genome.wustl.edu	37	14	58831429	58831429	+	Silent	SNP	A	A	T			TCGA-24-1426-01A-01W-0549-09	TCGA-24-1426-10A-01W-0549-09	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	063f8696-2c9d-4af4-a863-df10c42a5ea8	a3986ae3-7431-4383-b8fc-976e58f7725c	g.chr14:58831429A>T	ENST00000355431.3	+	20	2995	c.2622A>T	c.(2620-2622)ggA>ggT	p.G874G	ARID4A_ENST00000348476.3_Silent_p.G874G|ARID4A_ENST00000431317.2_Silent_p.G874G|ARID4A_ENST00000395168.3_Silent_p.G874G	NM_002892.3	NP_002883.3	P29374	ARI4A_HUMAN	AT rich interactive domain 4A (RBP1-like)	874					erythrocyte development (GO:0048821)|histone H3-K4 trimethylation (GO:0080182)|histone H3-K9 trimethylation (GO:0036124)|histone H4-K20 trimethylation (GO:0034773)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of gene expression by genetic imprinting (GO:0006349)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G874G(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(4)|endometrium(8)|kidney(2)|large_intestine(14)|lung(19)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	60						TTGAGAATGGAATGGAAATGA	0.333																																																1	Substitution - coding silent(1)	ovary(1)	14											69.0	64.0	66.0					14																	58831429		2203	4298	6501	57901182	SO:0001819	synonymous_variant	5926			S57153	CCDS9732.1, CCDS9733.1, CCDS45114.1	14q22.3	2013-02-07	2004-01-28	2004-01-28	ENSG00000032219	ENSG00000032219		"""-"""	9885	protein-coding gene	gene with protein product		180201	"""retinoblastoma-binding protein 1"""	RBBP1		1857421, 8455946	Standard	NM_023000		Approved	RBP1, RBP-1	uc001xdp.3	P29374	OTTHUMG00000140320	ENST00000355431.3:c.2622A>T	14.37:g.58831429A>T			57901182	Q15991|Q15992|Q15993	Silent	SNP	HMMPfam_ARID;HMMPfam_RBB1NT;superfamily_ARID-like;superfamily_Tudor/PWWP/MBT	p.G874	ENST00000355431.3	37	c.2622	CCDS9732.1	14																																																																																			-	NULL		0.333	ARID4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARID4A	protein_coding	OTTHUMT00000276927.2	A	NM_023001		57901182	1	no_errors	NM_002892	genbank	human	reviewed	54_36p	silent	SNP	0.95	T
TSHR	7253	genome.wustl.edu	37	14	81609337	81609337	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1426-01A-01W-0549-09	TCGA-24-1426-10A-01W-0549-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	063f8696-2c9d-4af4-a863-df10c42a5ea8	a3986ae3-7431-4383-b8fc-976e58f7725c	g.chr14:81609337G>C	ENST00000541158.2	+	11	1257	c.935G>C	c.(934-936)aGa>aCa	p.R312T	TSHR_ENST00000298171.2_Missense_Mutation_p.R312T|RP11-114N19.3_ENST00000557775.1_RNA			P16473	TSHR_HUMAN	thyroid stimulating hormone receptor	312					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adult locomotory behavior (GO:0008344)|B cell differentiation (GO:0030183)|cell-cell signaling (GO:0007267)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|positive regulation of cell proliferation (GO:0008284)|positive regulation of multicellular organism growth (GO:0040018)|regulation of locomotion (GO:0040012)|thyroid-stimulating hormone signaling pathway (GO:0038194)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	thyroid-stimulating hormone receptor activity (GO:0004996)	p.R312T(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(10)|lung(18)|ovary(6)|prostate(3)|skin(2)|stomach(1)|thyroid(291)|upper_aerodigestive_tract(1)	337				BRCA - Breast invasive adenocarcinoma(234;0.0402)	Thyrotropin Alfa(DB00024)	TTGCGCCAGAGAAAATCTGTG	0.493			Mis		toxic thyroid adenoma	thyroid  adenoma	Hereditary nonautoimmune hyperthyroidism; subclinical hypothyroidism																															yes	Dom	yes		14	14q31	7253	thyroid stimulating hormone receptor	yes	E	1	Substitution - Missense(1)	ovary(1)	14											128.0	124.0	125.0					14																	81609337		2203	4300	6503	80679090	SO:0001583	missense	7253			AY429111	CCDS9872.1, CCDS32131.1, CCDS55935.1	14q24-q31	2014-09-17			ENSG00000165409	ENSG00000165409		"""GPCR / Class A : Gonadotropin and TSH receptors"""	12373	protein-coding gene	gene with protein product		603372				2558651, 2610690	Standard	NM_001018036		Approved	LGR3	uc001xvd.1	P16473		ENST00000541158.2:c.935G>C	14.37:g.81609337G>C	ENSP00000441235:p.Arg312Thr		80679090	A0PJU7|F5GYU5|G3V2A9|Q16503|Q8TB90|Q96GT6|Q9P1V4|Q9ULA3|Q9UPH3	Missense_Mutation	SNP	superfamily_L domain-like;superfamily_Family A G protein-coupled receptor-like;7tm_1;HMMPfam_7tm_1;LRR_1;HMMPfam_LRR_1	p.R312T	ENST00000541158.2	37	c.935	CCDS9872.1	14	.	.	.	.	.	.	.	.	.	.	G	11.85	1.762549	0.31228	.	.	ENSG00000165409	ENST00000541158;ENST00000298171	T;T	0.75704	-0.96;-0.96	6.08	-0.712	0.11226	.	0.382162	0.35262	N	0.003338	T	0.55481	0.1923	N	0.19112	0.55	0.50813	D	0.999897	B	0.24186	0.099	B	0.29440	0.102	T	0.40997	-0.9533	10	0.59425	D	0.04	.	6.9233	0.24401	0.48:0.0:0.4065:0.1135	.	312	F5GYU5	.	T	312	ENSP00000441235:R312T;ENSP00000298171:R312T	ENSP00000298171:R312T	R	+	2	0	TSHR	80679090	1.000000	0.71417	0.984000	0.44739	0.995000	0.86356	0.920000	0.28705	-0.044000	0.13491	0.655000	0.94253	AGA	-	NULL		0.493	TSHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSHR	protein_coding	OTTHUMT00000413364.1	G	NM_000369		80679090	1	no_errors	NM_000369	genbank	human	reviewed	54_36p	missense	SNP	0.96	C
KCNK10	54207	genome.wustl.edu	37	14	88729714	88729714	+	Silent	SNP	A	A	C			TCGA-24-1426-01A-01W-0549-09	TCGA-24-1426-10A-01W-0549-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	063f8696-2c9d-4af4-a863-df10c42a5ea8	a3986ae3-7431-4383-b8fc-976e58f7725c	g.chr14:88729714A>C	ENST00000340700.5	-	2	670	c.219T>G	c.(217-219)gtT>gtG	p.V73V	KCNK10_ENST00000312350.5_Silent_p.V78V|KCNK10_ENST00000319231.5_Silent_p.V78V	NM_021161.4	NP_066984.1	P57789	KCNKA_HUMAN	potassium channel, subfamily K, member 10	73					signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transport (GO:0006810)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)	p.V73V(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(3)|pancreas(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	47						CAAAGATGGCAACCACCGTCT	0.582																																																1	Substitution - coding silent(1)	ovary(1)	14											117.0	99.0	105.0					14																	88729714		2203	4300	6503	87799467	SO:0001819	synonymous_variant	54207			AF279890	CCDS9880.1, CCDS9881.1, CCDS9882.1	14q31	2014-06-12						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6273	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 97"""	605873				10880510, 16382106	Standard	NM_021161		Approved	K2p10.1, TREK-2, TREK2, PPP1R97	uc001xwn.3	P57789		ENST00000340700.5:c.219T>G	14.37:g.88729714A>C			87799467	B2R8T4|B2RCT3|B5TJL4|Q6B014|Q8TDK7|Q8TDK8|Q9HB59	Silent	SNP	HMMPfam_Ion_trans_2;superfamily_Voltage-gated potassium channels	p.V78	ENST00000340700.5	37	c.234	CCDS9880.1	14																																																																																			-	NULL		0.582	KCNK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNK10	protein_coding	OTTHUMT00000410167.1	A	NM_021161		87799467	-1	no_errors	NM_138317	genbank	human	reviewed	54_36p	silent	SNP	1	C
OTUB2	78990	genome.wustl.edu	37	14	94511024	94511024	+	Silent	SNP	G	G	T	rs370284565		TCGA-24-1426-01A-01W-0549-09	TCGA-24-1426-10A-01W-0549-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	063f8696-2c9d-4af4-a863-df10c42a5ea8	a3986ae3-7431-4383-b8fc-976e58f7725c	g.chr14:94511024G>T	ENST00000203664.5	+	5	605	c.396G>T	c.(394-396)gtG>gtT	p.V132V		NM_023112.3	NP_075601.1	Q96DC9	OTUB2_HUMAN	OTU deubiquitinase, ubiquitin aldehyde binding 2	132	OTU. {ECO:0000255|PROSITE- ProRule:PRU00139}.				cellular amino acid metabolic process (GO:0006520)|protein deubiquitination (GO:0016579)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)	nucleus (GO:0005634)	omega peptidase activity (GO:0008242)|ubiquitin-specific protease activity (GO:0004843)	p.V132V(1)		kidney(1)|large_intestine(1)|lung(2)|ovary(1)	5		all_cancers(154;0.12)		Epithelial(152;0.124)|all cancers(159;0.21)|COAD - Colon adenocarcinoma(157;0.215)		ACCACATCGTGCAGTTCCTGC	0.552																																																1	Substitution - coding silent(1)	ovary(1)	14											121.0	95.0	104.0					14																	94511024		2203	4300	6503	93580777	SO:0001819	synonymous_variant	78990			AF318378	CCDS9917.1	14q32.13-q32.2	2014-02-24	2014-02-24	2004-05-28		ENSG00000089723		"""OTU domain containing"""	20351	protein-coding gene	gene with protein product		608338	"""chromosome 14 open reading frame 137"", ""OTU domain, ubiquitin aldehyde binding 2"""	C14orf137		12704427, 19996094	Standard	NM_023112		Approved	FLJ21916, MGC3102	uc001ych.4	Q96DC9		ENST00000203664.5:c.396G>T	14.37:g.94511024G>T			93580777	Q6IA10|Q9H6T1	Silent	SNP	superfamily_Cysteine proteinases	p.V132	ENST00000203664.5	37	c.396	CCDS9917.1	14																																																																																			-	NULL		0.552	OTUB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OTUB2	protein_coding	OTTHUMT00000412855.1	G			93580777	1	no_errors	NM_023112	genbank	human	validated	54_36p	silent	SNP	1	T
FHOD1	29109	genome.wustl.edu	37	16	67271277	67271277	+	Silent	SNP	C	C	A			TCGA-24-1426-01A-01W-0549-09	TCGA-24-1426-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	063f8696-2c9d-4af4-a863-df10c42a5ea8	a3986ae3-7431-4383-b8fc-976e58f7725c	g.chr16:67271277C>A	ENST00000258201.4	-	9	1105	c.858G>T	c.(856-858)gcG>gcT	p.A286A		NM_013241.2	NP_037373.2	Q9Y613	FHOD1_HUMAN	formin homology 2 domain containing 1	286	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|nucleus (GO:0005634)	identical protein binding (GO:0042802)	p.A286A(1)		breast(4)|endometrium(3)|kidney(3)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	34		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.000691)|Epithelial(162;0.00462)|all cancers(182;0.0434)		CCGGGAGCGCCGCCAGCGTCT	0.662																																																1	Substitution - coding silent(1)	ovary(1)	16											50.0	52.0	52.0					16																	67271277		2198	4300	6498	65828778	SO:0001819	synonymous_variant	29109			AF113615	CCDS10834.1	16q22	2008-02-22			ENSG00000135723	ENSG00000135723			17905	protein-coding gene	gene with protein product		606881				10352228, 16112087	Standard	NM_013241		Approved	FHOS	uc002esl.3	Q9Y613	OTTHUMG00000137521	ENST00000258201.4:c.858G>T	16.37:g.67271277C>A			65828778	Q59F76|Q6Y1F2|Q76MS8|Q8N521	Silent	SNP	HMMPfam_FH2;superfamily_Formin homology 2 domain (FH2 domain);superfamily_ARM repeat	p.A286	ENST00000258201.4	37	c.858	CCDS10834.1	16																																																																																			-	NULL		0.662	FHOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FHOD1	protein_coding	OTTHUMT00000268844.2	C			65828778	-1	no_errors	NM_013241	genbank	human	reviewed	54_36p	silent	SNP	0.19	A
TP53	7157	genome.wustl.edu	37	17	7577121	7577121	+	Missense_Mutation	SNP	G	G	A	rs121913343		TCGA-24-1426-01A-01W-0549-09	TCGA-24-1426-10A-01W-0549-09	G	G	A	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	063f8696-2c9d-4af4-a863-df10c42a5ea8	a3986ae3-7431-4383-b8fc-976e58f7725c	g.chr17:7577121G>A	ENST00000269305.4	-	8	1006	c.817C>T	c.(817-819)Cgt>Tgt	p.R273C	TP53_ENST00000413465.2_Intron|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.R273C|TP53_ENST00000420246.2_Missense_Mutation_p.R273C|TP53_ENST00000445888.2_Missense_Mutation_p.R273C|TP53_ENST00000359597.4_Missense_Mutation_p.R273C	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	273	Interaction with AXIN1. {ECO:0000250}.|Interaction with DNA.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		R -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:17224074, ECO:0000269|PubMed:7887414, ECO:0000269|PubMed:9450901}.|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation; abolishes sequence-specific DNA binding; does not induce SNAI1 degradation; dbSNP:rs28934576). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:1565144, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1699228, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:7682763, ECO:0000269|Ref.14}.|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|R -> N (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).|R -> S (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R273C(481)|p.R273S(16)|p.R273G(9)|p.0?(8)|p.?(2)|p.R273fs*72(2)|p.R273fs*33(2)|p.R273fs*32(2)|p.V272>?(2)|p.F270fs*72(1)|p.R273_C275delRVC(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.E258fs*71(1)|p.R273fs*71(1)|p.F270_D281del12(1)|p.E271_R273delEVR(1)|p.V272_K292del21(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCACAAACACGCACCTCAAAG	0.542	R273C(8MGBA_CENTRAL_NERVOUS_SYSTEM)|R273C(BL70_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(EFO27_OVARY)|R273C(KARPAS299_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(MFE319_ENDOMETRIUM)|R273C(NCIH1048_LUNG)|R273C(PANC0213_PANCREAS)|R273C(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(RDES_BONE)|R273C(RH30_SOFT_TISSUE)|R273C(RPMI8402_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(SH10TC_STOMACH)|R273C(SJRH30_SOFT_TISSUE)|R273C(SUDHL4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(SW1710_URINARY_TRACT)|R273C(SW1783_CENTRAL_NERVOUS_SYSTEM)|R273C(TT2609C02_THYROID)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	533	Substitution - Missense(506)|Whole gene deletion(8)|Deletion - Frameshift(8)|Deletion - In frame(5)|Insertion - Frameshift(2)|Unknown(2)|Complex(2)	central_nervous_system(117)|large_intestine(108)|ovary(32)|haematopoietic_and_lymphoid_tissue(31)|upper_aerodigestive_tract(30)|stomach(25)|urinary_tract(23)|lung(21)|breast(21)|liver(20)|endometrium(17)|oesophagus(17)|bone(16)|pancreas(15)|prostate(8)|skin(7)|cervix(6)|biliary_tract(6)|kidney(3)|thyroid(3)|vulva(2)|genital_tract(1)|penis(1)|adrenal_gland(1)|salivary_gland(1)|small_intestine(1)	17	GRCh37	CM010471|CM010473|CM951233	TP53	M	rs121913343						65.0	56.0	59.0					17																	7577121		2203	4300	6503	7517846	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.817C>T	17.37:g.7577121G>A	ENSP00000269305:p.Arg273Cys		7517846	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	superfamily_p53-like transcription factors;superfamily_p53 tetramerization domain;P53_tetramer;HMMPfam_P53_tetramer;P53;HMMPfam_P53;P53_TAD;HMMPfam_P53_TAD	p.R273C	ENST00000269305.4	37	c.817	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	G	17.48	3.400216	0.62177	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99869	-7.34;-7.34;-7.34;-7.34;-7.34;-7.34	4.92	3.95	0.45737	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99851	0.9931	M	0.90759	3.145	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.998;0.998;0.999;0.996	D	0.96877	0.9643	10	0.87932	D	0	-11.9995	11.2235	0.48869	0.0895:0.0:0.9105:0.0	.	273;273;273;273	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	C	273;273;273;273;273;262;141	ENSP00000352610:R273C;ENSP00000269305:R273C;ENSP00000398846:R273C;ENSP00000391127:R273C;ENSP00000391478:R273C;ENSP00000425104:R141C	ENSP00000269305:R273C	R	-	1	0	TP53	7517846	1.000000	0.71417	0.066000	0.19879	0.723000	0.41478	4.540000	0.60664	1.299000	0.44798	0.462000	0.41574	CGT	-	HMMPfam_P53		0.542	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	G	NM_000546		7517846	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	missense	SNP	0.8	A
SRP68	6730	genome.wustl.edu	37	17	74039922	74039922	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1426-01A-01W-0549-09	TCGA-24-1426-10A-01W-0549-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	063f8696-2c9d-4af4-a863-df10c42a5ea8	a3986ae3-7431-4383-b8fc-976e58f7725c	g.chr17:74039922C>A	ENST00000307877.2	-	13	1673	c.1512G>T	c.(1510-1512)aaG>aaT	p.K504N	SRP68_ENST00000355113.5_Missense_Mutation_p.K403N|SRP68_ENST00000542536.2_5'UTR|SRP68_ENST00000602720.1_Missense_Mutation_p.K165N|SRP68_ENST00000539137.1_Missense_Mutation_p.K466N	NM_014230.3	NP_055045.2	Q9UHB9	SRP68_HUMAN	signal recognition particle 68kDa	504					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|response to drug (GO:0042493)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|nucleolus (GO:0005730)|ribosome (GO:0005840)|signal recognition particle, endoplasmic reticulum targeting (GO:0005786)	7S RNA binding (GO:0008312)|endoplasmic reticulum signal peptide binding (GO:0030942)|poly(A) RNA binding (GO:0044822)|signal recognition particle binding (GO:0005047)	p.K504N(1)		NS(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(5)|lung(4)|ovary(2)|prostate(3)	23						TTAGGCTGTTCTTGAAGGCGC	0.517																																																1	Substitution - Missense(1)	ovary(1)	17											110.0	97.0	102.0					17																	74039922		2203	4300	6503	71551517	SO:0001583	missense	6730			AF195951	CCDS11738.1, CCDS58600.1, CCDS58601.1	17q25.1	2010-04-30	2002-08-29		ENSG00000167881	ENSG00000167881			11302	protein-coding gene	gene with protein product		604858	"""signal recognition particle 68kD"""			10618370	Standard	NM_014230		Approved		uc002jqk.2	Q9UHB9		ENST00000307877.2:c.1512G>T	17.37:g.74039922C>A	ENSP00000312066:p.Lys504Asn		71551517	B3KUU5|B3KWY7|G3V1U4|Q8NCJ4|Q8WUK2	Missense_Mutation	SNP	superfamily_TPR-like	p.K504N	ENST00000307877.2	37	c.1512	CCDS11738.1	17	.	.	.	.	.	.	.	.	.	.	C	11.74	1.727535	0.30593	.	.	ENSG00000167881	ENST00000411758;ENST00000539137;ENST00000542536;ENST00000307877;ENST00000304220;ENST00000355113	.	.	.	6.06	3.86	0.44501	.	0.542764	0.23093	N	0.052013	T	0.27098	0.0664	N	0.05230	-0.09	0.41590	D	0.988791	B;B	0.06786	0.001;0.001	B;B	0.06405	0.002;0.002	T	0.10753	-1.0616	9	0.21540	T	0.41	-8.9799	8.7242	0.34458	0.0:0.7197:0.1559:0.1244	.	466;504	G3V1U4;Q9UHB9	.;SRP68_HUMAN	N	244;466;165;504;473;403	.	ENSP00000307756:K473N	K	-	3	2	SRP68	71551517	0.400000	0.25295	0.998000	0.56505	0.989000	0.77384	0.342000	0.19926	2.882000	0.98803	0.655000	0.94253	AAG	-	NULL		0.517	SRP68-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRP68	protein_coding	OTTHUMT00000449487.1	C	NM_014230		71551517	-1	no_errors	NM_014230	genbank	human	reviewed	54_36p	missense	SNP	0.82	A
TMX3	54495	genome.wustl.edu	37	18	66381130	66381130	+	Silent	SNP	T	T	A			TCGA-24-1426-01A-01W-0549-09	TCGA-24-1426-10A-01W-0549-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	063f8696-2c9d-4af4-a863-df10c42a5ea8	a3986ae3-7431-4383-b8fc-976e58f7725c	g.chr18:66381130T>A	ENST00000299608.2	-	2	370	c.54A>T	c.(52-54)gtA>gtT	p.V18V	TMX3_ENST00000443099.2_Silent_p.V18V|TMX3_ENST00000562706.1_Silent_p.V18V	NM_019022.3	NP_061895.3	Q96JJ7	TMX3_HUMAN	thioredoxin-related transmembrane protein 3	18					cell redox homeostasis (GO:0045454)|protein folding (GO:0006457)|response to endoplasmic reticulum stress (GO:0034976)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	protein disulfide isomerase activity (GO:0003756)	p.V18V(1)		cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)|skin(1)|urinary_tract(1)	17						CCATATCAAGTACAACAACTG	0.294																																																1	Substitution - coding silent(1)	ovary(1)	18											32.0	30.0	31.0					18																	66381130		2193	4294	6487	64532110	SO:0001819	synonymous_variant	54495			BX647846	CCDS32840.1	18q22	2011-10-19	2009-02-23	2009-02-23		ENSG00000166479		"""Protein disulfide isomerases"""	24718	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 13"""		"""thioredoxin domain containing 10"""	TXNDC10		15623505	Standard	NM_019022		Approved	FLJ20793, KIAA1830, PDIA13	uc002lkf.3	Q96JJ7		ENST00000299608.2:c.54A>T	18.37:g.66381130T>A			64532110	B3KV75|Q52LT7|Q8N5J0|Q9NWJ9	Silent	SNP	-	p.V18	ENST00000299608.2	37	c.54	CCDS32840.1	18																																																																																			-	NULL		0.294	TMX3-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	TMX3	protein_coding	OTTHUMT00000420155.1	T	NM_019022		64532110	-1	no_errors	NM_019022	genbank	human	validated	54_36p	silent	SNP	0.14	A
PTBP1	5725	genome.wustl.edu	37	19	805531	805531	+	Intron	SNP	C	C	T			TCGA-24-1426-01A-01W-0549-09	TCGA-24-1426-10A-01W-0549-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	063f8696-2c9d-4af4-a863-df10c42a5ea8	a3986ae3-7431-4383-b8fc-976e58f7725c	g.chr19:805531C>T	ENST00000349038.4	+	8	965				PTBP1_ENST00000350092.4_Intron|PTBP1_ENST00000356948.6_Missense_Mutation_p.A311V|MIR4745_ENST00000577608.1_RNA|PTBP1_ENST00000394601.4_Missense_Mutation_p.A304V	NM_031991.3	NP_114368.1	P26599	PTBP1_HUMAN	polypyrimidine tract binding protein 1						alternative mRNA splicing, via spliceosome (GO:0000380)|gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|negative regulation of muscle cell differentiation (GO:0051148)|negative regulation of RNA splicing (GO:0033119)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|poly-pyrimidine tract binding (GO:0008187)|pre-mRNA binding (GO:0036002)|RNA binding (GO:0003723)	p.A311V(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|skin(2)|upper_aerodigestive_tract(4)	19		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;6.59e-06)|all_lung(49;9.97e-06)|Breast(49;0.000172)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TATGCAGGAGCTGGTTTCCCT	0.557																																																1	Substitution - Missense(1)	ovary(1)	19											257.0	281.0	273.0					19																	805531		2098	4201	6299	756531	SO:0001627	intron_variant	5725			X60648	CCDS32859.1, CCDS42456.1, CCDS45892.1	19p13.3	2013-07-16	2002-01-25	2002-01-25	ENSG00000011304	ENSG00000011304		"""RNA binding motif (RRM) containing"""	9583	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein I"""	600693	"""polypyrimidine tract binding protein (heterogeneous nuclear ribonucleoprotein I)"""	PTB		1906036, 11024286	Standard	NM_002819		Approved	HNRPI, HNRNP-I, PTB2, PTB3, PTB-1, PTB4, pPTB	uc002lpp.2	P26599		ENST00000349038.4:c.892+344C>T	19.37:g.805531C>T			756531	Q9BUQ0	Missense_Mutation	SNP	HMMPfam_RRM_1;superfamily_RNA-binding domain RBD	p.A311V	ENST00000349038.4	37	c.932	CCDS32859.1	19	.	.	.	.	.	.	.	.	.	.	C	23.7	4.448857	0.84101	.	.	ENSG00000011304	ENST00000356948;ENST00000394601	T;T	0.51071	0.81;0.72	5.11	5.11	0.69529	.	0.256644	0.37669	N	0.001991	T	0.41488	0.1161	.	.	.	0.80722	D	1	B;B	0.16396	0.008;0.017	B;B	0.17722	0.019;0.017	T	0.19224	-1.0312	9	0.35671	T	0.21	-15.3367	17.5549	0.87887	0.0:1.0:0.0:0.0	.	304;311	P26599-2;Q9BUQ0	.;.	V	311;304	ENSP00000349428:A311V;ENSP00000408096:A304V	ENSP00000349428:A311V	A	+	2	0	PTBP1	756531	1.000000	0.71417	1.000000	0.80357	0.911000	0.54048	7.045000	0.76585	2.376000	0.81061	0.650000	0.86243	GCT	-	NULL		0.557	PTBP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PTBP1	protein_coding	OTTHUMT00000457605.1	C			756531	1	no_errors	NM_002819	genbank	human	reviewed	54_36p	missense	SNP	1	T
MYO1F	4542	genome.wustl.edu	37	19	8587323	8587323	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1426-01A-01W-0549-09	TCGA-24-1426-10A-01W-0549-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	063f8696-2c9d-4af4-a863-df10c42a5ea8	a3986ae3-7431-4383-b8fc-976e58f7725c	g.chr19:8587323A>G	ENST00000338257.8	-	27	3425	c.3158T>C	c.(3157-3159)gTg>gCg	p.V1053A		NM_012335.3	NP_036467.2	O00160	MYO1F_HUMAN	myosin IF	1053	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				defense response to Gram-positive bacterium (GO:0050830)|negative regulation of cell adhesion (GO:0007162)|neutrophil degranulation (GO:0043312)|positive regulation of cell migration (GO:0030335)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of innate immune response (GO:0045088)	cortical actin cytoskeleton (GO:0030864)|filamentous actin (GO:0031941)|unconventional myosin complex (GO:0016461)	actin binding (GO:0003779)|ATP binding (GO:0005524)|motor activity (GO:0003774)	p.V1053A(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(7)|lung(13)|ovary(3)|prostate(3)|skin(3)|urinary_tract(1)	42						ATCTTGGCCCACGTACTGGTA	0.627																																																1	Substitution - Missense(1)	ovary(1)	19											61.0	64.0	63.0					19																	8587323		2085	4203	6288	8493323	SO:0001583	missense	4542			X98411	CCDS42494.1	19p13.3-p13.2	2011-09-27			ENSG00000142347	ENSG00000142347		"""Myosins / Myosin superfamily : Class I"""	7600	protein-coding gene	gene with protein product		601480				9119401, 8884266	Standard	NM_012335		Approved		uc002mkg.3	O00160	OTTHUMG00000156005	ENST00000338257.8:c.3158T>C	19.37:g.8587323A>G	ENSP00000344871:p.Val1053Ala		8493323	Q8WWN7	Missense_Mutation	SNP	HMMPfam_IQ;HMMPfam_SH3_1;superfamily_SH3-domain;HMMPfam_Myosin_head;HMMPfam_Myosin_TH1;superfamily_P-loop containing nucleoside triphosphate hydrolases	p.V1053A	ENST00000338257.8	37	c.3158	CCDS42494.1	19	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	5.908|5.908	0.351691|0.351691	0.11182|0.11182	.|.	.|.	ENSG00000142347|ENSG00000142347	ENST00000338257|ENST00000305795	T|.	0.48201|.	0.82|.	5.5|5.5	5.5|5.5	0.81552|0.81552	Src homology-3 domain (5);|.	.|0.194416	.|0.39615	.|U	.|0.001313	T|T	0.36744|0.36744	0.0978|0.0978	N|N	0.16602|0.16602	0.42|0.42	0.09310|0.09310	N|N	1|1	B|.	0.16802|.	0.019|.	B|.	0.22601|.	0.04|.	T|T	0.40850|0.40850	-0.9541|-0.9541	9|7	0.19590|0.87932	T|D	0.45|0	.|.	14.7786|14.7786	0.69749|0.69749	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	1053|.	O00160|.	MYO1F_HUMAN|.	A|R	1053|1097	ENSP00000344871:V1053A|.	ENSP00000344871:V1053A|ENSP00000304899:W1097R	V|W	-|-	2|1	0|0	MYO1F|MYO1F	8493323|8493323	0.005000|0.005000	0.15991|0.15991	0.014000|0.014000	0.15608|0.15608	0.638000|0.638000	0.38207|0.38207	2.359000|2.359000	0.44142|0.44142	2.078000|2.078000	0.62432|0.62432	0.528000|0.528000	0.53228|0.53228	GTG|TGG	-	HMMPfam_SH3_1		0.627	MYO1F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO1F	protein_coding	OTTHUMT00000342716.2	A			8493323	-1	no_errors	NM_012335	genbank	human	provisional	54_36p	missense	SNP	0.12	G
COMP	1311	genome.wustl.edu	37	19	18901377	18901377	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1426-01A-01W-0549-09	TCGA-24-1426-10A-01W-0549-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	063f8696-2c9d-4af4-a863-df10c42a5ea8	a3986ae3-7431-4383-b8fc-976e58f7725c	g.chr19:18901377C>T	ENST00000222271.2	-	3	255	c.211G>A	c.(211-213)Gcg>Acg	p.A71T	COMP_ENST00000542601.2_Missense_Mutation_p.A38T|COMP_ENST00000425807.1_Missense_Mutation_p.A71T	NM_000095.2	NP_000086.2	P49747	COMP_HUMAN	cartilage oligomeric matrix protein	71	COMP N-terminal.				apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|limb development (GO:0060173)|negative regulation of apoptotic process (GO:0043066)|organ morphogenesis (GO:0009887)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)|heparan sulfate proteoglycan binding (GO:0043395)|heparin binding (GO:0008201)|protease binding (GO:0002020)	p.A71T(1)		breast(6)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	32						TCACCGCACGCGTCACACTCC	0.612																																																1	Substitution - Missense(1)	ovary(1)	19											198.0	210.0	206.0					19																	18901377		2203	4300	6503	18762377	SO:0001583	missense	1311			L32137	CCDS12385.1	19p13.1	2008-02-05				ENSG00000105664			2227	protein-coding gene	gene with protein product	"""thrombospondin-5"""	600310	"""cartilage oligomeric matrix protein (pseudoachondroplasia, epiphyseal dysplasia 1, multiple)"""	PSACH, EDM1, EPD1		7713493, 8307576	Standard	NM_000095		Approved	MED, THBS5	uc002nke.3	P49747	OTTHUMG00000169318	ENST00000222271.2:c.211G>A	19.37:g.18901377C>T	ENSP00000222271:p.Ala71Thr		18762377	B4DKJ3|O14592|Q16388|Q16389|Q2NL86|Q8N4T2	Missense_Mutation	SNP	HMMPfam_TSP_3;HMMPfam_EGF;HMMPfam_TSP_C;superfamily_Concanavalin A-like lectins/glucanases;HMMPfam_EGF_CA;superfamily_TSP type-3 repeat;superfamily_EGF/Laminin	p.A71T	ENST00000222271.2	37	c.211	CCDS12385.1	19	.	.	.	.	.	.	.	.	.	.	C	25.5	4.640421	0.87859	.	.	ENSG00000105664	ENST00000542601;ENST00000222271;ENST00000425807;ENST00000454701	T;T;T	0.39787	1.06;1.06;1.06	3.96	3.96	0.45880	Thrombospondin/cartilage oligomeric matrix protein, coiled-coil domain (1);	0.162831	0.40222	U	0.001154	T	0.59321	0.2185	M	0.62723	1.935	0.58432	D	0.999995	D;D	0.71674	0.991;0.998	P;D	0.66602	0.85;0.945	T	0.64041	-0.6500	10	0.59425	D	0.04	-21.272	15.196	0.73088	0.0:1.0:0.0:0.0	.	71;71	B4DKJ3;P49747	.;COMP_HUMAN	T	38;71;71;71	ENSP00000439156:A38T;ENSP00000222271:A71T;ENSP00000403792:A71T	ENSP00000222271:A71T	A	-	1	0	COMP	18762377	1.000000	0.71417	1.000000	0.80357	0.637000	0.38172	6.818000	0.75257	2.070000	0.61991	0.306000	0.20318	GCG	-	NULL		0.612	COMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COMP	protein_coding	OTTHUMT00000403457.1	C	NM_000095		18762377	-1	no_errors	NM_000095	genbank	human	reviewed	54_36p	missense	SNP	1	T
Unknown	0	genome.wustl.edu	37	3	195664998	195664998	+	IGR	SNP	C	C	T			TCGA-24-1426-01A-01W-0549-09	TCGA-24-1426-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	063f8696-2c9d-4af4-a863-df10c42a5ea8	a3986ae3-7431-4383-b8fc-976e58f7725c	g.chr3:195664998C>T								RNU2-11P (9352 upstream) : RP11-480A16.1 (11060 downstream)																							GCAGCGTGTTCagaagaggat	0.423																																																0			3																																								197149395	SO:0001628	intergenic_variant	100133326																															3.37:g.195664998C>T			197149395		RNA	SNP	-	NULL		37	NULL		3																																																																																			-	-	0	0.423					LOC100133326			C			197149395	1	pseudogene	XR_037589	genbank	human	model	54_36p	rna	SNP	0.18	T
CRIM1	51232	genome.wustl.edu	37	2	36744582	36744582	+	Silent	SNP	C	C	T			TCGA-24-1426-01A-01W-0549-09	TCGA-24-1426-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	063f8696-2c9d-4af4-a863-df10c42a5ea8	a3986ae3-7431-4383-b8fc-976e58f7725c	g.chr2:36744582C>T	ENST00000280527.2	+	12	2470	c.2103C>T	c.(2101-2103)tgC>tgT	p.C701C		NM_016441.2	NP_057525.1	Q9NZV1	CRIM1_HUMAN	cysteine rich transmembrane BMP regulator 1 (chordin-like)	701	VWFC 4. {ECO:0000255|PROSITE- ProRule:PRU00220}.				insulin-like growth factor receptor signaling pathway (GO:0048009)|nervous system development (GO:0007399)|regulation of cell growth (GO:0001558)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	insulin-like growth factor-activated receptor activity (GO:0005010)|PDZ domain binding (GO:0030165)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.C701C(1)		autonomic_ganglia(1)|breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(15)|liver(2)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	45		all_hematologic(82;0.131)|Acute lymphoblastic leukemia(82;0.154)				GTACTCAGTGCACCTGCCACA	0.582																																																1	Substitution - coding silent(1)	ovary(1)	2											91.0	81.0	85.0					2																	36744582		2203	4300	6503	36598086	SO:0001819	synonymous_variant	51232			AF168681	CCDS1783.1	2p21	2010-06-29	2005-07-25		ENSG00000150938	ENSG00000150938			2359	protein-coding gene	gene with protein product		606189	"""cysteine-rich motor neuron 1"""	S52		10642437	Standard	NM_016441		Approved		uc002rpd.3	Q9NZV1	OTTHUMG00000099419	ENST00000280527.2:c.2103C>T	2.37:g.36744582C>T			36598086	Q2M2G4|Q59GH0|Q7LCQ5|Q9H318	Silent	SNP	HMMPfam_VWC;HMMPfam_Antistasin;superfamily_Leech antihemostatic proteins	p.C701	ENST00000280527.2	37	c.2103	CCDS1783.1	2																																																																																			-	HMMPfam_VWC		0.582	CRIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRIM1	protein_coding	OTTHUMT00000216878.2	C	NM_016441		36598086	1	no_errors	NM_016441	genbank	human	provisional	54_36p	silent	SNP	1	T
Unknown	0	genome.wustl.edu	37	2	162137781	162137781	+	IGR	SNP	C	C	A	rs75392614	byFrequency	TCGA-24-1426-01A-01W-0549-09	TCGA-24-1426-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	063f8696-2c9d-4af4-a863-df10c42a5ea8	a3986ae3-7431-4383-b8fc-976e58f7725c	g.chr2:162137781C>A								AC009299.2 (26602 upstream) : PSMD14 (26767 downstream)																							GAGCGTTTGGCGGACTCTGCG	0.592																																																0			2																																								161846027	SO:0001628	intergenic_variant	643194																															2.37:g.162137781C>A			161846027		Missense_Mutation	SNP	-	p.A60S		37	c.178		2																																																																																			-	NULL	0	0.592					LOC643194			C			161846027	-1	no_errors	XM_931396	genbank	human	model	54_36p	missense	SNP	0	A
KALRN	8997	genome.wustl.edu	37	3	123988076	123988076	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1426-01A-01W-0549-09	TCGA-24-1426-10A-01W-0549-09	C	C	T	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	063f8696-2c9d-4af4-a863-df10c42a5ea8	a3986ae3-7431-4383-b8fc-976e58f7725c	g.chr3:123988076C>T	ENST00000240874.3	+	5	1094	c.937C>T	c.(937-939)Cgg>Tgg	p.R313W	KALRN_ENST00000460856.1_Missense_Mutation_p.R313W|KALRN_ENST00000360013.3_Missense_Mutation_p.R313W	NM_003947.4	NP_003938.1	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase	313					apoptotic signaling pathway (GO:0097190)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|protein phosphorylation (GO:0006468)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.R313W(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(21)|lung(28)|ovary(4)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	83						CTTTCAGCTGCGGCTCTTCGA	0.582																																																1	Substitution - Missense(1)	ovary(1)	3											38.0	41.0	40.0					3																	123988076		2202	4299	6501	125470766	SO:0001583	missense	8997			U94190	CCDS3027.1, CCDS3028.1	3q21.2	2013-02-11	2005-03-11	2005-03-12	ENSG00000160145	ENSG00000160145		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	4814	protein-coding gene	gene with protein product	"""serine/threonine kinase with Dbl and pleckstrin homology domains"""	604605	"""huntingtin-associated protein interacting protein (duo)"""	HAPIP		9285789, 10023074	Standard	NM_001024660		Approved	duo, Hs.8004, TRAD, DUET, Kalirin, ARHGEF24	uc003ehd.3	O60229	OTTHUMG00000125545	ENST00000240874.3:c.937C>T	3.37:g.123988076C>T	ENSP00000240874:p.Arg313Trp		125470766	A8MSI4|C9JQ37|Q6ZN45|Q8TBQ5|Q9NSZ4|Q9Y2A5	Missense_Mutation	SNP	-	p.R313W	ENST00000240874.3	37	c.937	CCDS3027.1	3	.	.	.	.	.	.	.	.	.	.	C	22.2	4.261163	0.80246	.	.	ENSG00000160145	ENST00000460856;ENST00000240874;ENST00000360013	T;T;T	0.56941	0.43;0.43;0.43	5.16	4.28	0.50868	.	0.000000	0.64402	D	0.000001	T	0.73009	0.3532	M	0.79926	2.475	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.992;0.998;0.99	T	0.76214	-0.3041	10	0.48119	T	0.1	.	15.1548	0.72733	0.1422:0.8578:0.0:0.0	.	313;313;313	C9IZQ6;O60229;O60229-2	.;KALRN_HUMAN;.	W	313	ENSP00000418611:R313W;ENSP00000240874:R313W;ENSP00000353109:R313W	ENSP00000240874:R313W	R	+	1	2	KALRN	125470766	0.999000	0.42202	1.000000	0.80357	0.997000	0.91878	1.949000	0.40313	1.375000	0.46248	0.655000	0.94253	CGG	-	NULL		0.582	KALRN-005	KNOWN	basic|CCDS	protein_coding	KALRN	protein_coding	OTTHUMT00000258843.4	C	NM_003947		125470766	1	no_errors	NM_001024660	genbank	human	reviewed	54_36p	missense	SNP	1	T
ECE2	9718	genome.wustl.edu	37	3	183975499	183975499	+	Silent	SNP	C	C	T	rs372175263		TCGA-24-1426-01A-01W-0549-09	TCGA-24-1426-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	063f8696-2c9d-4af4-a863-df10c42a5ea8	a3986ae3-7431-4383-b8fc-976e58f7725c	g.chr3:183975499C>T	ENST00000402825.3	+	2	435	c.435C>T	c.(433-435)acC>acT	p.T145T	EIF2B5_ENST00000444495.1_Intron|ECE2_ENST00000324557.4_Silent_p.T145T	NM_014693.3	NP_055508.3	O60344	ECE2_HUMAN	endothelin converting enzyme 2	145	Methyltransferase-like region.				brain development (GO:0007420)|cardioblast differentiation (GO:0010002)|cell-cell signaling (GO:0007267)|heart development (GO:0007507)|peptide hormone processing (GO:0016486)	cytoplasmic vesicle membrane (GO:0030659)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|methyltransferase activity (GO:0008168)	p.T145T(1)		breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|lung(13)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(4)	49	all_cancers(143;1.39e-10)|Ovarian(172;0.0339)		Epithelial(37;8.28e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			ATCCCTGGACCGTGTCCTCTG	0.582																																																1	Substitution - coding silent(1)	ovary(1)	3						C	,	1,4405	2.1+/-5.4	0,1,2202	53.0	54.0	54.0		435,435	-12.0	0.0	3		54	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	ECE2	NM_014693.3,NM_032331.3	,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,	145/884,145/256	183975499	1,13005	2203	4300	6503	185458193	SO:0001819	synonymous_variant	9718			AF428263	CCDS3255.1, CCDS33899.1, CCDS3256.2, CCDS43179.1, CCDS46969.1	3q27.1	2007-07-26			ENSG00000145194	ENSG00000145194			13275	protein-coding gene	gene with protein product		610145				11718899	Standard	NM_032331		Approved	KIAA0604, MGC2408	uc003fni.4	O60344	OTTHUMG00000150551	ENST00000402825.3:c.435C>T	3.37:g.183975499C>T			185458193	A5PLK8|Q6NTG7|Q6UW36|Q8NFD7|Q96NX3|Q96NX4|Q9BRZ8	Silent	SNP	-	p.T145	ENST00000402825.3	37	c.435	CCDS3256.2	3																																																																																			-	NULL		0.582	ECE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ECE2	protein_coding	OTTHUMT00000318874.3	C	NM_014693		185458193	1	no_errors	NM_014693	genbank	human	validated	54_36p	silent	SNP	0.27	T
ARSJ	79642	genome.wustl.edu	37	4	114824078	114824078	+	Silent	SNP	G	G	A			TCGA-24-1426-01A-01W-0549-09	TCGA-24-1426-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	063f8696-2c9d-4af4-a863-df10c42a5ea8	a3986ae3-7431-4383-b8fc-976e58f7725c	g.chr4:114824078G>A	ENST00000315366.7	-	2	2018	c.1152C>T	c.(1150-1152)ctC>ctT	p.L384L	ARSJ_ENST00000541197.1_Silent_p.L384L	NM_024590.3	NP_078866.3	Q5FYB0	ARSJ_HUMAN	arylsulfatase family, member J	384					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)	p.L384L(1)		endometrium(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(3)|skin(2)|urinary_tract(1)	21		Ovarian(17;0.0035)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00194)		CCAGTGAAATGAGAGTGGGGT	0.488																																																1	Substitution - coding silent(1)	ovary(1)	4											164.0	158.0	160.0					4																	114824078		1973	4170	6143	115043527	SO:0001819	synonymous_variant	79642				CCDS43264.1	4q26	2013-02-14	2006-03-07		ENSG00000180801	ENSG00000180801		"""Arylsulfatase family"""	26286	protein-coding gene	gene with protein product		610010	"""arylsulfatase J"""			12975309, 16174644	Standard	NM_024590		Approved	FLJ23548	uc003ibq.1	Q5FYB0	OTTHUMG00000161067	ENST00000315366.7:c.1152C>T	4.37:g.114824078G>A			115043527	A2RUG0|B7ZM45|Q1HA39|Q5FWE4|Q6UWT9	Silent	SNP	-	p.L384	ENST00000315366.7	37	c.1152	CCDS43264.1	4																																																																																			-	NULL		0.488	ARSJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARSJ	protein_coding	OTTHUMT00000363650.1	G	NM_024590		115043527	-1	no_errors	NM_024590	genbank	human	validated	54_36p	silent	SNP	1	A
DCHS2	54798	genome.wustl.edu	37	4	155242049	155242049	+	Missense_Mutation	SNP	T	T	A			TCGA-24-1426-01A-01W-0549-09	TCGA-24-1426-10A-01W-0549-09	T	T	A	A	T	T	Unknown	Valid	Somatic	4	Capture	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	063f8696-2c9d-4af4-a863-df10c42a5ea8	a3986ae3-7431-4383-b8fc-976e58f7725c	g.chr4:155242049T>A	ENST00000357232.4	-	14	3136	c.3137A>T	c.(3136-3138)gAa>gTa	p.E1046V		NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	1046	Cadherin 8. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.E1046V(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		ATTCTGATCTTCCACATCGAT	0.428																																																1	Substitution - Missense(1)	ovary(1)	4											137.0	131.0	133.0					4																	155242049		2203	4300	6503	155461499	SO:0001583	missense	54798			BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.3137A>T	4.37:g.155242049T>A	ENSP00000349768:p.Glu1046Val		155461499	B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Missense_Mutation	SNP	-	p.E1046V	ENST00000357232.4	37	c.3137	CCDS3785.1	4	.	.	.	.	.	.	.	.	.	.	T	23.9	4.469706	0.84533	.	.	ENSG00000197410	ENST00000357232	T	0.60672	0.17	5.69	5.69	0.88448	Cadherin (3);Cadherin conserved site (1);Cadherin-like (1);	0.000000	0.64402	D	0.000002	T	0.75547	0.3864	M	0.73598	2.24	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.75693	-0.3229	10	0.40728	T	0.16	.	15.9502	0.79827	0.0:0.0:0.0:1.0	.	1046	Q6V1P9	PCD23_HUMAN	V	1046	ENSP00000349768:E1046V	ENSP00000349768:E1046V	E	-	2	0	DCHS2	155461499	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.698000	0.84413	2.167000	0.68274	0.460000	0.39030	GAA	-	NULL		0.428	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCHS2	protein_coding	OTTHUMT00000365281.2	T	NM_001142552		155461499	-1	no_errors	NM_017639	genbank	human	validated	54_36p	missense	SNP	1	A
SEPT8	23176	genome.wustl.edu	37	5	132098188	132098188	+	Silent	SNP	G	G	A	rs376667090	byFrequency	TCGA-24-1426-01A-01W-0549-09	TCGA-24-1426-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	063f8696-2c9d-4af4-a863-df10c42a5ea8	a3986ae3-7431-4383-b8fc-976e58f7725c	g.chr5:132098188G>A	ENST00000378719.2	-	5	921	c.684C>T	c.(682-684)aaC>aaT	p.N228N	SEPT8_ENST00000458488.2_Silent_p.N228N|SEPT8_ENST00000378706.1_Silent_p.N228N|SEPT8_ENST00000448933.1_Silent_p.N168N|SEPT8_ENST00000481030.1_5'Flank|SEPT8_ENST00000378699.2_Silent_p.N168N|SEPT8_ENST00000378701.1_Silent_p.N226N|SEPT8_ENST00000378721.4_Silent_p.N226N|SEPT8_ENST00000296873.7_Silent_p.N228N	NM_001098811.1	NP_001092281.1	Q92599	SEPT8_HUMAN	septin 8	228	Septin-type G.				cell cycle (GO:0007049)	septin complex (GO:0031105)	GTP binding (GO:0005525)	p.N228N(1)	SEPT8/AFF4(2)	kidney(2)|lung(5)|ovary(2)|skin(1)|urinary_tract(1)	11		all_cancers(142;0.0751)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TCATGACTGCGTTAATCTCTG	0.572													G|||	2	0.000399361	0.0008	0.0	5008	,	,		19691	0.001		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	5						G	,,,	1,4123		0,1,2061	116.0	113.0	114.0		684,684,504,684	-8.4	0.5	5		114	1,8485		0,1,4242	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	SEPT8	NM_001098811.1,NM_001098812.1,NM_001098813.1,NM_015146.1	,,,	0,2,6303	AA,AG,GG		0.0118,0.0242,0.0159	,,,	228/484,228/443,168/370,228/430	132098188	2,12608	2062	4243	6305	132126087	SO:0001819	synonymous_variant	23176			AF179995	CCDS43358.1, CCDS43359.1, CCDS43360.1, CCDS47262.1, CCDS75298.1	5q31	2013-01-21			ENSG00000164402	ENSG00000164402		"""Septins"""	16511	protein-coding gene	gene with protein product		608418				9039502, 9149945	Standard	NM_001098812		Approved	KIAA0202, SEP2	uc003kxr.2	Q92599	OTTHUMG00000059735	ENST00000378719.2:c.684C>T	5.37:g.132098188G>A			132126087	A6NC65|A6NKP6|F6W7K9|Q8IX36|Q8IX37|Q9BVB3	Silent	SNP	-	p.N228	ENST00000378719.2	37	c.684	CCDS43358.1	5																																																																																			-	NULL		0.572	SEPT8-002	KNOWN	basic|CCDS	protein_coding	SEPT8	protein_coding	OTTHUMT00000132827.2	G	XM_034872		132126087	-1	no_errors	NM_001098811	genbank	human	validated	54_36p	silent	SNP	0.98	A
CDH9	1007	genome.wustl.edu	37	5	26915969	26915969	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1426-01A-01W-0549-09	TCGA-24-1426-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	063f8696-2c9d-4af4-a863-df10c42a5ea8	a3986ae3-7431-4383-b8fc-976e58f7725c	g.chr5:26915969C>A	ENST00000231021.4	-	3	464	c.292G>T	c.(292-294)Ggc>Tgc	p.G98C		NM_016279.3	NP_057363.3	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 (T1-cadherin)	98	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G98R(1)|p.G98C(1)|p.G98L(1)		breast(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(25)|lung(80)|ovary(5)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	137						AATAGACTGCCAGCCCCATCT	0.363																																					Melanoma(8;187 585 15745 40864 52829)											3	Substitution - Missense(3)	lung(2)|ovary(1)	5											109.0	112.0	111.0					5																	26915969		2203	4299	6502	26951726	SO:0001583	missense	1007			AB035302	CCDS3893.1	5p14	2010-01-26			ENSG00000113100	ENSG00000113100		"""Cadherins / Major cadherins"""	1768	protein-coding gene	gene with protein product		609974				2059658	Standard	NM_016279		Approved		uc003jgs.1	Q9ULB4	OTTHUMG00000090671	ENST00000231021.4:c.292G>T	5.37:g.26915969C>A	ENSP00000231021:p.Gly98Cys		26951726	Q3B7I5	Missense_Mutation	SNP	HMMPfam_Cadherin_C;HMMPfam_Cadherin;superfamily_Cadherin-like	p.G98C	ENST00000231021.4	37	c.292	CCDS3893.1	5	.	.	.	.	.	.	.	.	.	.	C	23.1	4.373402	0.82573	.	.	ENSG00000113100	ENST00000231021;ENST00000513289	T;T	0.55052	0.54;0.54	4.62	4.62	0.57501	Cadherin (4);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.82245	0.4995	H	0.97516	4.02	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.89154	0.3525	9	.	.	.	.	16.4099	0.83704	0.0:1.0:0.0:0.0	.	98;98	E7EPN0;Q9ULB4	.;CADH9_HUMAN	C	98	ENSP00000231021:G98C;ENSP00000426239:G98C	.	G	-	1	0	CDH9	26951726	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.361000	0.79497	2.275000	0.75901	0.585000	0.79938	GGC	-	HMMPfam_Cadherin		0.363	CDH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH9	protein_coding	OTTHUMT00000207352.1	C	NM_016279		26951726	-1	no_errors	NM_016279	genbank	human	reviewed	54_36p	missense	SNP	1	A
ANKHD1	54882	genome.wustl.edu	37	5	139815788	139815788	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1426-01A-01W-0549-09	TCGA-24-1426-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	063f8696-2c9d-4af4-a863-df10c42a5ea8	a3986ae3-7431-4383-b8fc-976e58f7725c	g.chr5:139815788C>T	ENST00000360839.2	+	2	560	c.406C>T	c.(406-408)Cgc>Tgc	p.R136C	ANKHD1_ENST00000394723.3_Missense_Mutation_p.R136C|ANKHD1_ENST00000394722.3_Missense_Mutation_p.R136C|ANKHD1_ENST00000297183.6_Missense_Mutation_p.R136C|ANKHD1-EIF4EBP3_ENST00000532219.1_Missense_Mutation_p.R136C	NM_017747.2	NP_060217.1	Q8IWZ3	ANKH1_HUMAN	ankyrin repeat and KH domain containing 1	136						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)	p.R136C(2)		breast(2)|endometrium(8)|kidney(6)|large_intestine(14)|lung(18)|ovary(5)|prostate(2)|skin(3)|urinary_tract(2)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGCAGACTTACGCACTGTGGA	0.378																																																2	Substitution - Missense(2)	ovary(2)	5											91.0	92.0	92.0					5																	139815788		2203	4300	6503	139795972	SO:0001583	missense	404734			AF521882	CCDS4225.1, CCDS43371.1, CCDS43372.1, CCDS75319.1	5q31.3	2013-01-10			ENSG00000131503	ENSG00000131503		"""Ankyrin repeat domain containing"""	24714	protein-coding gene	gene with protein product		610500				10470851, 11230166, 16098192	Standard	NM_017747		Approved	MASK, FLJ20288, FLJ11979, FLJ10042, FLJ14127, KIAA1085		Q8IWZ3	OTTHUMG00000161610	ENST00000360839.2:c.406C>T	5.37:g.139815788C>T	ENSP00000354085:p.Arg136Cys		139795972	A6NH85|Q149P2|Q8IWZ2|Q8WY90|Q96G77|Q96GK0|Q9H2U0|Q9HA95|Q9NWG4|Q9UPR7	Missense_Mutation	SNP	-	p.R136C	ENST00000360839.2	37	c.406	CCDS4225.1	5	.	.	.	.	.	.	.	.	.	.	C	15.95	2.983567	0.53827	.	.	ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000254996	ENST00000360839;ENST00000422011;ENST00000297183;ENST00000253810;ENST00000421134;ENST00000394723;ENST00000511151;ENST00000394722;ENST00000532219	T;T;T;T;T;T;T	0.70869	-0.33;-0.36;-0.24;-0.1;-0.52;-0.4;-0.36	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	T	0.74007	0.3660	L	0.27053	0.805	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.998;0.998;1.0;1.0	D;P;P;D;D	0.67900	0.931;0.72;0.609;0.954;0.931	T	0.76974	-0.2760	10	0.87932	D	0	.	13.3877	0.60805	0.2635:0.7365:0.0:0.0	.	136;136;136;136;136	Q8IWZ3-5;Q8IWZ2;Q8IWZ3;Q8IWZ3-3;Q8IWZ3-2	.;.;ANKH1_HUMAN;.;.	C	136;150;136;136;136;136;136;136;136	ENSP00000354085:R136C;ENSP00000297183:R136C;ENSP00000394489:R136C;ENSP00000378212:R136C;ENSP00000421069:R136C;ENSP00000378211:R136C;ENSP00000432016:R136C	ENSP00000432016:R136C	R	+	1	0	ANKHD1-EIF4EBP3;ANKHD1	139795972	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.419000	0.52728	2.534000	0.85438	0.655000	0.94253	CGC	-	NULL		0.378	ANKHD1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	ANKHD1-EIF4EBP3	protein_coding	OTTHUMT00000251672.1	C	NM_017747		139795972	1	no_errors	NM_020690	genbank	human	reviewed	54_36p	missense	SNP	1	T
C7orf66	154907	genome.wustl.edu	37	7	108524558	108524558	+	Missense_Mutation	SNP	A	A	T	rs367868708		TCGA-24-1426-01A-01W-0549-09	TCGA-24-1426-10A-01W-0549-09	A	A	T	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	063f8696-2c9d-4af4-a863-df10c42a5ea8	a3986ae3-7431-4383-b8fc-976e58f7725c	g.chr7:108524558A>T	ENST00000379007.2	-	1	86	c.32T>A	c.(31-33)cTt>cAt	p.L11H		NM_001024607.1	NP_001019778.1	A4D0T2	CG066_HUMAN	chromosome 7 open reading frame 66	11						integral component of membrane (GO:0016021)		p.L11H(1)		breast(1)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)	15						GAGTTGAGAAAGACCATCACT	0.413																																																1	Substitution - Missense(1)	ovary(1)	7											157.0	127.0	137.0					7																	108524558		2203	4300	6503	108311794	SO:0001583	missense	154907			AF103078	CCDS34735.1	7q31.1	2009-03-06			ENSG00000205174	ENSG00000205174			33712	protein-coding gene	gene with protein product							Standard	NM_001024607		Approved		uc003vfo.3	A4D0T2	OTTHUMG00000154867	ENST00000379007.2:c.32T>A	7.37:g.108524558A>T	ENSP00000368292:p.Leu11His		108311794		Missense_Mutation	SNP	-	p.L11H	ENST00000379007.2	37	c.32	CCDS34735.1	7	.	.	.	.	.	.	.	.	.	.	A	10.63	1.405271	0.25378	.	.	ENSG00000205174	ENST00000379007	.	.	.	2.28	-0.775	0.10988	.	.	.	.	.	T	0.20577	0.0495	N	0.08118	0	0.09310	N	1	D	0.61697	0.99	P	0.54460	0.753	T	0.15665	-1.0429	7	.	.	.	.	5.2342	0.15437	0.4835:0.0:0.5165:0.0	.	11	A4D0T2	CG066_HUMAN	H	11	.	.	L	-	2	0	C7orf66	108311794	0.001000	0.12720	0.000000	0.03702	0.535000	0.34838	0.538000	0.23160	-0.213000	0.10094	0.254000	0.18369	CTT	-	NULL		0.413	C7orf66-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	C7orf66	protein_coding	OTTHUMT00000337420.1	A	NM_001024607		108311794	-1	no_errors	NM_001024607	genbank	human	predicted	54_36p	missense	SNP		T
GRHL2	79977	genome.wustl.edu	37	8	102631900	102631900	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1426-01A-01W-0549-09	TCGA-24-1426-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	063f8696-2c9d-4af4-a863-df10c42a5ea8	a3986ae3-7431-4383-b8fc-976e58f7725c	g.chr8:102631900G>T	ENST00000251808.3	+	9	1570	c.1232G>T	c.(1231-1233)tGc>tTc	p.C411F	GRHL2_ENST00000395927.1_Missense_Mutation_p.C395F	NM_024915.3	NP_079191.2	Q6ISB3	GRHL2_HUMAN	grainyhead-like 2 (Drosophila)	411					brain development (GO:0007420)|camera-type eye development (GO:0043010)|cardiac ventricle morphogenesis (GO:0003208)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digit morphogenesis (GO:0042733)|face development (GO:0060324)|in utero embryonic development (GO:0001701)|lung lobe morphogenesis (GO:0060463)|multicellular organism growth (GO:0035264)|neural tube closure (GO:0001843)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.C411F(1)		breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|liver(2)|lung(6)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28	all_cancers(14;4.39e-08)|all_epithelial(15;4.09e-10)|Lung NSC(17;7.11e-06)|all_lung(17;1.44e-05)		Epithelial(11;5.81e-09)|all cancers(13;3.81e-07)|OV - Ovarian serous cystadenocarcinoma(57;0.000213)			AGAGCTTATTGCCAGATCAAG	0.338																																																1	Substitution - Missense(1)	ovary(1)	8											99.0	98.0	98.0					8																	102631900		2203	4300	6503	102701076	SO:0001583	missense	79977			AK023844	CCDS34931.1	8q22.3	2008-02-05	2005-07-11	2005-07-11	ENSG00000083307	ENSG00000083307			2799	protein-coding gene	gene with protein product		608576	"""deafness, autosomal dominant 28"", ""transcription factor CP2-like 3"""	DFNA28, TFCP2L3		12393799	Standard	NM_024915		Approved	FLJ13782, BOM	uc010mbu.3	Q6ISB3	OTTHUMG00000149915	ENST00000251808.3:c.1232G>T	8.37:g.102631900G>T	ENSP00000251808:p.Cys411Phe		102701076	A1L303|Q6NT03|Q9H8B8	Missense_Mutation	SNP	-	p.C411F	ENST00000251808.3	37	c.1232	CCDS34931.1	8	.	.	.	.	.	.	.	.	.	.	G	22.1	4.245910	0.80024	.	.	ENSG00000083307	ENST00000251808;ENST00000395927;ENST00000395928	T;T	0.36878	1.23;1.23	5.85	5.85	0.93711	CP2 transcription factor (1);	0.088124	0.85682	D	0.000000	T	0.69296	0.3095	M	0.89534	3.04	0.80722	D	1	D	0.57257	0.979	D	0.70935	0.971	T	0.74642	-0.3597	10	0.87932	D	0	-29.2946	20.1634	0.98142	0.0:0.0:1.0:0.0	.	411	Q6ISB3	GRHL2_HUMAN	F	411;395;411	ENSP00000251808:C411F;ENSP00000379260:C395F	ENSP00000251808:C411F	C	+	2	0	GRHL2	102701076	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.097000	0.64542	2.773000	0.95371	0.655000	0.94253	TGC	-	NULL		0.338	GRHL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRHL2	protein_coding	OTTHUMT00000313882.1	G	NM_024915		102701076	1	no_errors	NM_024915	genbank	human	validated	54_36p	missense	SNP	1	T
SGCZ	137868	genome.wustl.edu	37	8	14095116	14095116	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1426-01A-01W-0549-09	TCGA-24-1426-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	063f8696-2c9d-4af4-a863-df10c42a5ea8	a3986ae3-7431-4383-b8fc-976e58f7725c	g.chr8:14095116C>T	ENST00000382080.1	-	4	1124	c.409G>A	c.(409-411)Gga>Aga	p.G137R	SGCZ_ENST00000421524.2_Missense_Mutation_p.G90R	NM_139167.2	NP_631906.2	Q96LD1	SGCZ_HUMAN	sarcoglycan, zeta	124					membrane organization (GO:0061024)|muscle cell cellular homeostasis (GO:0046716)|muscle cell development (GO:0055001)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|sarcoglycan complex (GO:0016012)		p.G137R(1)		NS(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(14)|lung(15)|ovary(2)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	47				all cancers(2;0.000643)|Colorectal(111;0.00674)|COAD - Colon adenocarcinoma(73;0.0193)|GBM - Glioblastoma multiforme(2;0.026)		GTCAGCTGTCCGGTTAACTGC	0.403																																																1	Substitution - Missense(1)	ovary(1)	8											363.0	348.0	353.0					8																	14095116		2203	4300	6503	14139487	SO:0001583	missense	137868			AY028700	CCDS5992.2	8p22	2014-09-17	2010-04-21		ENSG00000185053	ENSG00000185053			14075	protein-coding gene	gene with protein product		608113				12189167	Standard	XM_006716287		Approved	ZSG1	uc003wwq.3	Q96LD1	OTTHUMG00000090827	ENST00000382080.1:c.409G>A	8.37:g.14095116C>T	ENSP00000371512:p.Gly137Arg		14139487	Q6REU0	Missense_Mutation	SNP	-	p.G137R	ENST00000382080.1	37	c.409	CCDS5992.2	8	.	.	.	.	.	.	.	.	.	.	c	24.2	4.507534	0.85282	.	.	ENSG00000185053	ENST00000382080;ENST00000421524	D;D	0.94537	-3.45;-3.45	5.39	5.39	0.77823	.	0.107851	0.64402	D	0.000006	D	0.96386	0.8821	M	0.75777	2.31	0.52501	D	0.999959	D;D	0.55800	0.973;0.966	P;P	0.56865	0.808;0.622	D	0.95983	0.8979	10	0.49607	T	0.09	.	18.5837	0.91181	0.0:1.0:0.0:0.0	.	90;137	Q08AT0;Q96LD1-2	.;.	R	137;90	ENSP00000371512:G137R;ENSP00000405224:G90R	ENSP00000371512:G137R	G	-	1	0	SGCZ	14139487	1.000000	0.71417	0.999000	0.59377	0.972000	0.66771	6.935000	0.75886	2.708000	0.92522	0.585000	0.79938	GGA	-	NULL		0.403	SGCZ-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SGCZ	protein_coding	OTTHUMT00000207636.2	C	NM_139167		14139487	-1	no_errors	NM_139167	genbank	human	reviewed	54_36p	missense	SNP	1	T
OC90	729330	genome.wustl.edu	37	8	133036962	133036962	+	Nonsense_Mutation	SNP	G	G	T			TCGA-24-1426-01A-01W-0549-09	TCGA-24-1426-10A-01W-0549-09	G	G	T	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	063f8696-2c9d-4af4-a863-df10c42a5ea8	a3986ae3-7431-4383-b8fc-976e58f7725c	g.chr8:133036962G>T	ENST00000443356.2	-	15	1334	c.1248C>A	c.(1246-1248)tgC>tgA	p.C416*	OC90_ENST00000603859.1_Nonsense_Mutation_p.C400*|OC90_ENST00000262283.5_Nonsense_Mutation_p.C612*|OC90_ENST00000254627.3_Nonsense_Mutation_p.C400*			Q02509	OC90_HUMAN	otoconin 90	416	Phospholipase A2-like 3.				lipid catabolic process (GO:0016042)|phospholipid metabolic process (GO:0006644)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|phospholipase A2 activity (GO:0004623)	p.C612*(1)|p.C374*(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(3)|lung(23)|ovary(2)|prostate(1)|skin(1)	37	Esophageal squamous(12;0.00693)|Ovarian(258;0.00769)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000805)			CAGAGGTCATGCACTCAGCTG	0.587																																																2	Substitution - Nonsense(2)	ovary(2)	8											37.0	41.0	40.0					8																	133036962		2101	4229	6330	133106144	SO:0001587	stop_gained	729330			Z14310	CCDS47919.1	8q24.22	2011-03-01			ENSG00000253117	ENSG00000253117			8100	protein-coding gene	gene with protein product		601658		PLA2L		10329003, 9860971	Standard	NM_001080399		Approved		uc011lix.1	Q02509	OTTHUMG00000164672	ENST00000443356.2:c.1248C>A	8.37:g.133036962G>T	ENSP00000390050:p.Cys416*		133106144	B4DNG8	Nonsense_Mutation	SNP	-	p.C400*	ENST00000443356.2	37	c.1200		8	.	.	.	.	.	.	.	.	.	.	G	30	5.052725	0.93793	.	.	ENSG00000253117;ENSG00000253117;ENSG00000258417	ENST00000254627;ENST00000443356;ENST00000262283	.	.	.	5.65	3.54	0.40534	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-16.5597	10.711	0.45984	0.1793:0.0:0.8207:0.0	.	.	.	.	X	400;416;612	.	ENSP00000254627:C400X	C	-	3	2	RP11-240B13.2;OC90	133106144	1.000000	0.71417	1.000000	0.80357	0.441000	0.31987	1.852000	0.39348	1.393000	0.46605	-0.254000	0.11334	TGC	-	NULL		0.587	OC90-201	KNOWN	basic	protein_coding	OC90	protein_coding		G	NM_001080399		133106144	-1	no_errors	NM_001080399	genbank	human	validated	54_36p	nonsense	SNP	1	T
OR2S2	56656	genome.wustl.edu	37	9	35957870	35957870	+	Missense_Mutation	SNP	T	T	C			TCGA-24-1426-01A-01W-0549-09	TCGA-24-1426-10A-01W-0549-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	063f8696-2c9d-4af4-a863-df10c42a5ea8	a3986ae3-7431-4383-b8fc-976e58f7725c	g.chr9:35957870T>C	ENST00000341959.2	-	1	281	c.226A>G	c.(226-228)Acc>Gcc	p.T76A		NM_019897.2	NP_063950.2	Q9NQN1	OR2S1_HUMAN	olfactory receptor, family 2, subfamily S, member 2	76					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T66A(1)		central_nervous_system(2)|endometrium(2)|large_intestine(2)|lung(8)|ovary(1)|skin(1)|stomach(1)	17			LUSC - Lung squamous cell carcinoma(32;0.00613)|STAD - Stomach adenocarcinoma(86;0.194)			ACTGAGGAGGTAGTGAAGCAG	0.562																																					Pancreas(172;293 2036 17878 24427 30946)											1	Substitution - Missense(1)	ovary(1)	9											90.0	73.0	79.0					9																	35957870		2203	4300	6503	35947870	SO:0001583	missense	56656			AL135841	CCDS6596.2	9p13.3	2012-08-09			ENSG00000122718	ENSG00000122718		"""GPCR / Class A : Olfactory receptors"""	8276	protein-coding gene	gene with protein product							Standard	NM_019897		Approved		uc011lpi.2	Q9NQN1	OTTHUMG00000019891	ENST00000341959.2:c.226A>G	9.37:g.35957870T>C	ENSP00000344040:p.Thr76Ala		35947870	Q2M3L0|Q6IF19|Q96R42	Missense_Mutation	SNP	-	p.T66A	ENST00000341959.2	37	c.196	CCDS6596.2	9	.	.	.	.	.	.	.	.	.	.	T	3.520	-0.097887	0.07010	.	.	ENSG00000122718	ENST00000341959	T	0.00384	7.6	4.32	1.98	0.26296	GPCR, rhodopsin-like superfamily (1);	0.130205	0.34959	N	0.003548	T	0.00300	0.0009	M	0.73372	2.23	0.09310	N	1	B	0.31817	0.341	B	0.27715	0.082	T	0.47947	-0.9077	10	0.87932	D	0	.	3.0641	0.06209	0.1772:0.1938:0.0:0.629	.	76	Q9NQN1	OR2S1_HUMAN	A	76	ENSP00000344040:T76A	ENSP00000344040:T76A	T	-	1	0	OR2S2	35947870	0.110000	0.22057	0.170000	0.22879	0.033000	0.12548	0.409000	0.21082	0.436000	0.26393	-0.290000	0.09829	ACC	-	NULL		0.562	OR2S2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2S2	protein_coding	OTTHUMT00000052400.2	T	NM_019897		35947870	-1	no_errors	NM_019897	genbank	human	provisional	54_36p	missense	SNP	0.15	C
RPA4	29935	genome.wustl.edu	37	X	96139484	96139484	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1426-01A-01W-0549-09	TCGA-24-1426-10A-01W-0549-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	063f8696-2c9d-4af4-a863-df10c42a5ea8	a3986ae3-7431-4383-b8fc-976e58f7725c	g.chrX:96139484G>T	ENST00000373040.3	+	1	578	c.175G>T	c.(175-177)Gtg>Ttg	p.V59L	DIAPH2_ENST00000324765.8_Intron|DIAPH2_ENST00000373054.4_Intron|DIAPH2_ENST00000373049.4_Intron|DIAPH2_ENST00000373061.3_Intron|DIAPH2_ENST00000355827.4_Intron	NM_013347.4	NP_037479.1	Q13156	RFA4_HUMAN	replication protein A4, 30kDa	59					DNA damage checkpoint (GO:0000077)|DNA recombination (GO:0006310)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)	DNA replication factor A complex (GO:0005662)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	single-stranded DNA binding (GO:0003697)	p.V59L(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)	13						CAGCTCTACTGTGTTTGACCC	0.468								Other identified genes with known or suspected DNA repair function																																								1	Substitution - Missense(1)	ovary(1)	X											151.0	128.0	136.0					X																	96139484		2203	4300	6503	96026140	SO:0001583	missense	29935			U24186	CCDS35345.1	Xq21	2010-04-09	2010-04-09		ENSG00000204086	ENSG00000204086			30305	protein-coding gene	gene with protein product		300767	"""replication protein A4, 34kDa"""			7760808	Standard	NM_013347		Approved	HSU24186	uc004efv.4	Q13156	OTTHUMG00000021987	ENST00000373040.3:c.175G>T	X.37:g.96139484G>T	ENSP00000362131:p.Val59Leu		96026140	Q3SY03	Missense_Mutation	SNP	"superfamily_""Winged helix"" DNA-binding domain;superfamily_Nucleic acid-binding proteins;HMMPfam_tRNA_anti;HMMPfam_RPA_C"	p.V59L	ENST00000373040.3	37	c.175	CCDS35345.1	X	.	.	.	.	.	.	.	.	.	.	G	0.013	-1.638311	0.00799	.	.	ENSG00000204086	ENST00000373040	T	0.42131	0.98	3.2	-2.29	0.06805	Nucleic acid-binding, OB-fold-like (1);Nucleic acid-binding, OB-fold (1);	.	.	.	.	T	0.10723	0.0262	N	0.00729	-1.24	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.33904	-0.9850	9	0.02654	T	1	-4.2217	9.4571	0.38760	0.1458:0.2145:0.6397:0.0	.	59	Q13156	RFA4_HUMAN	L	59	ENSP00000362131:V59L	ENSP00000362131:V59L	V	+	1	0	RPA4	96026140	0.001000	0.12720	0.000000	0.03702	0.003000	0.03518	0.059000	0.14322	-0.762000	0.04664	-0.216000	0.12614	GTG	-	NULL		0.468	RPA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPA4	protein_coding	OTTHUMT00000057464.1	G	NM_013347		96026140	1	no_errors	NM_013347	genbank	human	reviewed	54_36p	missense	SNP	0	T
