#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PEAR1	375033	broad.mit.edu	37	1	156874645	156874645	+	Splice_Site	SNP	G	G	A	rs373109940		TCGA-24-1565-01A-01W-0551-08	TCGA-24-1565-10A-01W-0551-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	e411496c-ce15-48c7-bd51-cb4bd6d34d65	65cd679f-5442-4a1b-ad0c-a2bd142fa3e5	g.chr1:156874645G>A	ENST00000338302.3	+	4	431		c.e4+1		PEAR1_ENST00000292357.7_Splice_Site			Q5VY43	PEAR1_HUMAN	platelet endothelial aggregation receptor 1						recognition of apoptotic cell (GO:0043654)	integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)		p.?(1)		breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(6)|lung(22)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)	43	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					CCCAGCCCACGTGAGTGCTCC	0.652																																																1	Unknown(1)	ovary(1)	1											30.0	34.0	33.0					1																	156874645		2203	4300	6503	155141269	SO:0001630	splice_region_variant	375033			AK098809	CCDS30892.1	1q23.1	2008-02-05	2007-10-25	2007-10-25	ENSG00000187800	ENSG00000187800			33631	protein-coding gene	gene with protein product		610278	"""multiple EGF-like-domains 12"""	MEGF12		15851471	Standard	NM_001080471		Approved	JEDI, FLJ00193	uc001fqj.1	Q5VY43	OTTHUMG00000041293	ENST00000338302.3:c.206+1G>A	1.37:g.156874645G>A			155141269	Q8TEK2	Splice_Site	SNP	ENST00000338302.3	37	CCDS30892.1	.	.	.	.	.	.	.	.	.	.	G	19.39	3.818621	0.71028	.	.	ENSG00000187800	ENST00000338302;ENST00000455314;ENST00000292357	.	.	.	3.7	3.7	0.42460	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.1372	0.48381	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PEAR1	155141269	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	4.509000	0.60448	2.065000	0.61736	0.561000	0.74099	.		0.652	PEAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098937.2	NM_001080471	Intron
CHML	1122	broad.mit.edu	37	1	241798262	241798262	+	Silent	SNP	C	C	A			TCGA-24-1565-01A-01W-0551-08	TCGA-24-1565-10A-01W-0551-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	e411496c-ce15-48c7-bd51-cb4bd6d34d65	65cd679f-5442-4a1b-ad0c-a2bd142fa3e5	g.chr1:241798262C>A	ENST00000366553.1	-	1	970	c.807G>T	c.(805-807)cgG>cgT	p.R269R	OPN3_ENST00000469376.1_Intron|OPN3_ENST00000366554.2_Intron|OPN3_ENST00000331838.5_Intron	NM_001821.3	NP_001812.2	P26374	RAE2_HUMAN	choroideremia-like (Rab escort protein 2)	269					intracellular protein transport (GO:0006886)|protein geranylgeranylation (GO:0018344)	Rab-protein geranylgeranyltransferase complex (GO:0005968)	GTPase activator activity (GO:0005096)|Rab geranylgeranyltransferase activity (GO:0004663)|Rab GTPase binding (GO:0017137)	p.R269R(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(6)|lung(7)|ovary(4)|skin(3)|stomach(1)	26	Ovarian(103;0.103)|all_lung(81;0.23)	all_cancers(173;0.0231)	OV - Ovarian serous cystadenocarcinoma(106;0.0125)			CCTTTCCTTCCCGAAATGCAA	0.353																																																1	Substitution - coding silent(1)	ovary(1)	1											50.0	49.0	49.0					1																	241798262		2203	4299	6502	239864885	SO:0001819	synonymous_variant	1122			X64728	CCDS31073.1	1q43	2013-09-19			ENSG00000203668	ENSG00000203668			1941	protein-coding gene	gene with protein product		118825				7981670	Standard	NM_001821		Approved	REP-2	uc001hzd.3	P26374	OTTHUMG00000039690	ENST00000366553.1:c.807G>T	1.37:g.241798262C>A			239864885	B2RAB9|Q17RE0|Q9H1Y4	Silent	SNP	ENST00000366553.1	37	CCDS31073.1																																																																																				0.353	CHML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095712.1	NM_001821	
KIAA1462	57608	broad.mit.edu	37	10	30336644	30336644	+	Missense_Mutation	SNP	G	G	A	rs530709153		TCGA-24-1565-01A-01W-0551-08	TCGA-24-1565-10A-01W-0551-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	e411496c-ce15-48c7-bd51-cb4bd6d34d65	65cd679f-5442-4a1b-ad0c-a2bd142fa3e5	g.chr10:30336644G>A	ENST00000375377.1	-	2	199	c.98C>T	c.(97-99)gCg>gTg	p.A33V		NM_020848.2	NP_065899.1	Q9P266	JCAD_HUMAN	KIAA1462	33					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)		p.A33V(1)		breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|lung(23)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	75						CCCAGTCCTCGCTGCCTGGCG	0.607																																																1	Substitution - Missense(1)	ovary(1)	10											59.0	65.0	63.0					10																	30336644		2043	4192	6235	30376650	SO:0001583	missense	57608			AB040895	CCDS41500.1	10p12.1	2013-04-23			ENSG00000165757	ENSG00000165757			29283	protein-coding gene	gene with protein product	"""junctional protein associated with coronary artery disease"""	614398				10819331, 21884682	Standard	NM_020848		Approved	JCAD	uc001iux.3	Q9P266	OTTHUMG00000017885	ENST00000375377.1:c.98C>T	10.37:g.30336644G>A	ENSP00000364526:p.Ala33Val		30376650	Q5HYA7|Q5T992|Q86WZ9|Q9BYJ2	Missense_Mutation	SNP	ENST00000375377.1	37	CCDS41500.1	.	.	.	.	.	.	.	.	.	.	G	15.59	2.878523	0.51801	.	.	ENSG00000165757	ENST00000375377	T	0.14144	2.53	5.3	-3.52	0.04682	.	0.621181	0.15014	N	0.285382	T	0.08980	0.0222	L	0.57536	1.79	0.09310	N	1	P	0.41546	0.754	B	0.34242	0.178	T	0.17776	-1.0358	10	0.35671	T	0.21	-6.9937	4.4209	0.11479	0.0747:0.3804:0.2544:0.2905	.	33	Q9P266	K1462_HUMAN	V	33	ENSP00000364526:A33V	ENSP00000364526:A33V	A	-	2	0	KIAA1462	30376650	0.000000	0.05858	0.000000	0.03702	0.092000	0.18411	0.214000	0.17541	-0.273000	0.09246	-0.499000	0.04595	GCG		0.607	KIAA1462-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047409.1	NM_020848	
CTR9	9646	broad.mit.edu	37	11	10800398	10800398	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1565-01A-01W-0551-08	TCGA-24-1565-10A-01W-0551-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	e411496c-ce15-48c7-bd51-cb4bd6d34d65	65cd679f-5442-4a1b-ad0c-a2bd142fa3e5	g.chr11:10800398C>T	ENST00000361367.2	+	25	3694	c.3268C>T	c.(3268-3270)Cca>Tca	p.P1090S		NM_014633.3	NP_055448.1	Q6PD62	CTR9_HUMAN	CTR9, Paf1/RNA polymerase II complex component	1090	Ser-rich.				cellular response to lipopolysaccharide (GO:0071222)|endodermal cell fate commitment (GO:0001711)|histone H2B ubiquitination (GO:0033523)|histone H3-K4 trimethylation (GO:0080182)|histone monoubiquitination (GO:0010390)|interleukin-6-mediated signaling pathway (GO:0070102)|JAK-STAT cascade (GO:0007259)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K79 methylation (GO:2001162)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	Cdc73/Paf1 complex (GO:0016593)|transcriptionally active chromatin (GO:0035327)		p.P1090S(1)		breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(7)|lung(12)|ovary(2)|pancreas(1)|stomach(1)	40				all cancers(16;1.64e-07)|Epithelial(150;2.47e-07)|BRCA - Breast invasive adenocarcinoma(625;0.111)		CAGTGACCAGCCATCCAGAAA	0.572																																																1	Substitution - Missense(1)	ovary(1)	11											82.0	84.0	83.0					11																	10800398		2201	4294	6495	10756974	SO:0001583	missense	9646			D63875	CCDS7805.1	11p15.3	2013-07-03	2013-07-03	2006-05-22	ENSG00000198730	ENSG00000198730		"""Tetratricopeptide (TTC) repeat domain containing"""	16850	protein-coding gene	gene with protein product		609366	"""SH2 domain binding protein 1 (tetratricopeptide repeat containing)"", ""Ctr9, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)"""	SH2BP1		8590280, 8636124	Standard	NM_014633		Approved	KIAA0155, TSBP, p150TSP	uc001mja.3	Q6PD62	OTTHUMG00000165789	ENST00000361367.2:c.3268C>T	11.37:g.10800398C>T	ENSP00000355013:p.Pro1090Ser		10756974	D3DQV8|Q15015	Missense_Mutation	SNP	ENST00000361367.2	37	CCDS7805.1	.	.	.	.	.	.	.	.	.	.	C	14.51	2.558371	0.45590	.	.	ENSG00000198730	ENST00000361367	T	0.41758	0.99	5.5	3.37	0.38596	.	0.169923	0.53938	D	0.000043	T	0.18593	0.0446	N	0.12182	0.205	0.39621	D	0.970025	B	0.02656	0.0	B	0.01281	0.0	T	0.07654	-1.0761	10	0.13853	T	0.58	-8.4572	3.8364	0.08896	0.2227:0.5639:0.0:0.2134	.	1090	Q6PD62	CTR9_HUMAN	S	1090	ENSP00000355013:P1090S	ENSP00000355013:P1090S	P	+	1	0	CTR9	10756974	1.000000	0.71417	0.992000	0.48379	0.912000	0.54170	2.072000	0.41510	1.307000	0.44944	-0.182000	0.12963	CCA		0.572	CTR9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386215.1	NM_014633	
GRIA4	2893	broad.mit.edu	37	11	105769126	105769126	+	Silent	SNP	G	G	A			TCGA-24-1565-01A-01W-0551-08	TCGA-24-1565-10A-01W-0551-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture			Illumina GAIIx	e411496c-ce15-48c7-bd51-cb4bd6d34d65	65cd679f-5442-4a1b-ad0c-a2bd142fa3e5	g.chr11:105769126G>A	ENST00000530497.1	+	6	858	c.858G>A	c.(856-858)gaG>gaA	p.E286E	GRIA4_ENST00000282499.5_Silent_p.E286E|GRIA4_ENST00000525187.1_Silent_p.E286E|GRIA4_ENST00000428631.2_Silent_p.E286E|GRIA4_ENST00000393125.2_Silent_p.E286E|GRIA4_ENST00000393127.2_Silent_p.E286E			P48058	GRIA4_HUMAN	glutamate receptor, ionotropic, AMPA 4	286					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|vesicle (GO:0031982)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)	p.E286E(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(24)|liver(2)|lung(25)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(6)	82		Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Breast(348;0.0323)		BRCA - Breast invasive adenocarcinoma(274;0.000147)|Epithelial(105;0.0291)|all cancers(92;0.0899)		ATCAGAGAGAGTATCCAGGAT	0.338																																																1	Substitution - coding silent(1)	ovary(1)	11											59.0	60.0	59.0					11																	105769126		2202	4299	6501	105274336	SO:0001819	synonymous_variant	2893			U16129	CCDS8333.1, CCDS41706.1, CCDS41707.1	11q22	2012-08-29	2012-02-03		ENSG00000152578	ENSG00000152578		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4574	protein-coding gene	gene with protein product		138246	"""glutamate receptor, ionotrophic, AMPA 4"""	GLUR4			Standard	NM_001077244		Approved	GluA4, GLURD	uc001pix.2	P48058	OTTHUMG00000166236	ENST00000530497.1:c.858G>A	11.37:g.105769126G>A			105274336	Q86XE8	Silent	SNP	ENST00000530497.1	37	CCDS8333.1																																																																																				0.338	GRIA4-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000388593.1		
ANPEP	290	broad.mit.edu	37	15	90349532	90349532	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1565-01A-01W-0551-08	TCGA-24-1565-10A-01W-0551-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture			Illumina GAIIx	e411496c-ce15-48c7-bd51-cb4bd6d34d65	65cd679f-5442-4a1b-ad0c-a2bd142fa3e5	g.chr15:90349532G>A	ENST00000300060.6	-	2	596	c.283C>T	c.(283-285)Ccc>Tcc	p.P95S		NM_001150.2	NP_001141.2	P15144	AMPN_HUMAN	alanyl (membrane) aminopeptidase	95	Metalloprotease.				angiogenesis (GO:0001525)|angiotensin maturation (GO:0002003)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|viral process (GO:0016032)	endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|receptor activity (GO:0004872)|virus receptor activity (GO:0001618)|zinc ion binding (GO:0008270)	p.P95S(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	57	Lung NSC(78;0.0221)|all_lung(78;0.0448)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.169)		Ezetimibe(DB00973)|Icatibant(DB06196)	CTGTCATTGGGGGTGAGGTAC	0.567																																					NSCLC(30;827 977 2459 19669 26125)											1	Substitution - Missense(1)	ovary(1)	15											104.0	82.0	90.0					15																	90349532		2200	4299	6499	88150536	SO:0001583	missense	290			M22324	CCDS10356.1	15q25-q26	2008-07-31	2008-07-31		ENSG00000166825	ENSG00000166825	3.4.11.2	"""CD molecules"""	500	protein-coding gene	gene with protein product	"""aminopeptidase N"", ""aminopeptidase M"", ""microsomal aminopeptidase"""	151530		CD13, PEPN		2428842, 1977688	Standard	NM_001150		Approved	LAP1, gp150, p150	uc002bop.4	P15144	OTTHUMG00000149814	ENST00000300060.6:c.283C>T	15.37:g.90349532G>A	ENSP00000300060:p.Pro95Ser		88150536	Q16728|Q6GT90|Q8IUK3|Q8IVH3|Q9UCE0	Missense_Mutation	SNP	ENST00000300060.6	37	CCDS10356.1	.	.	.	.	.	.	.	.	.	.	G	13.33	2.204456	0.38905	.	.	ENSG00000166825	ENST00000300060	T	0.04119	3.7	4.94	3.93	0.45458	Peptidase M1, membrane alanine aminopeptidase, N-terminal (1);	0.803406	0.11695	N	0.538489	T	0.09862	0.0242	L	0.44542	1.39	0.26590	N	0.973228	P	0.38473	0.633	P	0.51974	0.686	T	0.15321	-1.0441	10	0.09843	T	0.71	.	11.3392	0.49523	0.0:0.0:0.7352:0.2648	.	95	P15144	AMPN_HUMAN	S	95	ENSP00000300060:P95S	ENSP00000300060:P95S	P	-	1	0	ANPEP	88150536	1.000000	0.71417	0.956000	0.39512	0.031000	0.12232	4.164000	0.58190	2.288000	0.76882	0.467000	0.42956	CCC		0.567	ANPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313425.1		
OR3A2	4995	broad.mit.edu	37	17	3181524	3181524	+	Nonsense_Mutation	SNP	G	G	A	rs373734930		TCGA-24-1565-01A-01W-0551-08	TCGA-24-1565-10A-01W-0551-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	e411496c-ce15-48c7-bd51-cb4bd6d34d65	65cd679f-5442-4a1b-ad0c-a2bd142fa3e5	g.chr17:3181524G>A	ENST00000408891.2	-	1	744	c.706C>T	c.(706-708)Cga>Tga	p.R236*	RP11-64J4.2_ENST00000573491.1_RNA	NM_002551.3	NP_002542.3	P47893	OR3A2_HUMAN	olfactory receptor, family 3, subfamily A, member 2	236					sensory perception of chemical stimulus (GO:0007606)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)|receptor activity (GO:0004872)	p.R236*(1)		ovary(1)	1						GAACGGATTCGTAGAACTGCA	0.517													G|||	1	0.000199681	0.0	0.0	5008	,	,		21441	0.0		0.001	False		,,,				2504	0.0				GBM(166;478 2018 3875 5042 31983)|Esophageal Squamous(77;407 1232 1405 14297 15272)											1	Substitution - Nonsense(1)	ovary(1)	17						G	stop/ARG	0,4406		0,0,2203	51.0	53.0	52.0		706	1.7	0.0	17		52	1,8599	1.2+/-3.3	0,1,4299	no	stop-gained	OR3A2	NM_002551.3		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		236/322	3181524	1,13005	2203	4300	6503	3128274	SO:0001587	stop_gained	4995			U04713	CCDS42233.1	17p13.3	2012-08-09				ENSG00000221882		"""GPCR / Class A : Olfactory receptors"""	8283	protein-coding gene	gene with protein product						8921386, 10673334	Standard	NM_002551		Approved	OLFRA04, OR228, OR17-228	uc002fvg.3	P47893		ENST00000408891.2:c.706C>T	17.37:g.3181524G>A	ENSP00000386180:p.Arg236*		3128274	Q6IFM3|Q9P1Q3	Nonsense_Mutation	SNP	ENST00000408891.2	37	CCDS42233.1	.	.	.	.	.	.	.	.	.	.	G	11.45	1.642902	0.29246	0.0	1.16E-4	ENSG00000221882	ENST00000408891	.	.	.	4.9	1.72	0.24424	.	0.899233	0.09160	N	0.840281	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	0.1513	7.2807	0.26310	0.0819:0.0:0.3735:0.5446	.	.	.	.	X	236	.	ENSP00000386180:R236X	R	-	1	2	OR3A2	3128274	0.000000	0.05858	0.000000	0.03702	0.041000	0.13682	-0.063000	0.11655	0.330000	0.23485	0.561000	0.74099	CGA		0.517	OR3A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438370.1		
MYH4	4622	broad.mit.edu	37	17	10351711	10351711	+	Splice_Site	SNP	A	A	T			TCGA-24-1565-01A-01W-0551-08	TCGA-24-1565-10A-01W-0551-08	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture			Illumina GAIIx	e411496c-ce15-48c7-bd51-cb4bd6d34d65	65cd679f-5442-4a1b-ad0c-a2bd142fa3e5	g.chr17:10351711A>T	ENST00000255381.2	-	33	4767		c.e33+1		RP11-799N11.1_ENST00000581304.1_RNA|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000399342.2_RNA	NM_017533.2	NP_060003.2	Q9Y623	MYH4_HUMAN	myosin, heavy chain 4, skeletal muscle						actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to activity (GO:0014823)	muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|microfilament motor activity (GO:0000146)	p.?(1)		NS(4)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(72)|ovary(10)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	149						TGAAAAATGTACCTCTGCTTC	0.353																																																1	Unknown(1)	ovary(1)	17											84.0	79.0	81.0					17																	10351711		2203	4300	6503	10292436	SO:0001630	splice_region_variant	4622				CCDS11154.1	17p13.1	2013-09-19	2006-09-29		ENSG00000264424	ENSG00000264424		"""Myosins / Myosin superfamily : Class II"""	7574	protein-coding gene	gene with protein product		160742	"""myosin, heavy polypeptide 4, skeletal muscle"""			8518795	Standard	NM_017533		Approved	MYH2B, MyHC-2B, MyHC-IIb	uc002gmn.3	Q9Y623	OTTHUMG00000130365	ENST00000255381.2:c.4656+1T>A	17.37:g.10351711A>T			10292436		Splice_Site	SNP	ENST00000255381.2	37	CCDS11154.1	.	.	.	.	.	.	.	.	.	.	A	22.4	4.284965	0.80803	.	.	ENSG00000141048	ENST00000255381	.	.	.	5.69	5.69	0.88448	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.2433	0.82426	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	MYH4	10292436	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	6.231000	0.72307	2.296000	0.77279	0.533000	0.62120	.		0.353	MYH4-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252731.1	NM_017533	Intron
KRT12	3859	broad.mit.edu	37	17	39023371	39023371	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1565-01A-01W-0551-08	TCGA-24-1565-10A-01W-0551-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	e411496c-ce15-48c7-bd51-cb4bd6d34d65	65cd679f-5442-4a1b-ad0c-a2bd142fa3e5	g.chr17:39023371G>C	ENST00000251643.4	-	1	91	c.68C>G	c.(67-69)tCg>tGg	p.S23W		NM_000223.3	NP_000214.1	Q99456	K1C12_HUMAN	keratin 12	23	Head.				visual perception (GO:0007601)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)	p.S23W(1)		central_nervous_system(1)|endometrium(1)|large_intestine(3)|liver(1)|lung(5)|ovary(2)|upper_aerodigestive_tract(2)	15		Breast(137;0.000301)			Griseofulvin(DB00400)	CACACTCTGCGAGGAGAGCCG	0.607																																																1	Substitution - Missense(1)	ovary(1)	17											49.0	52.0	51.0					17																	39023371		2203	4300	6503	36276897	SO:0001583	missense	3859				CCDS11378.1	17q21.2	2013-06-20	2008-08-01		ENSG00000187242	ENSG00000187242		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6414	protein-coding gene	gene with protein product	"""Meesmann corneal dystrophy"""	601687				9171831, 16831889	Standard	NM_000223		Approved	K12	uc002hvk.2	Q99456	OTTHUMG00000133369	ENST00000251643.4:c.68C>G	17.37:g.39023371G>C	ENSP00000251643:p.Ser23Trp		36276897	B2R9E0	Missense_Mutation	SNP	ENST00000251643.4	37	CCDS11378.1	.	.	.	.	.	.	.	.	.	.	G	15.38	2.815699	0.50527	.	.	ENSG00000187242	ENST00000251643	D	0.84516	-1.86	5.61	4.64	0.57946	.	0.278761	0.26048	N	0.026652	T	0.81475	0.4830	L	0.29908	0.895	0.48830	D	0.999712	D	0.61697	0.99	P	0.49683	0.619	T	0.82824	-0.0266	10	0.72032	D	0.01	.	10.5268	0.44954	0.154:0.0:0.846:0.0	.	23	Q99456	K1C12_HUMAN	W	23	ENSP00000251643:S23W	ENSP00000251643:S23W	S	-	2	0	KRT12	36276897	0.045000	0.20229	0.056000	0.19401	0.222000	0.24845	1.425000	0.34859	1.500000	0.48636	0.655000	0.94253	TCG		0.607	KRT12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257214.2	NM_000223	
CYP4F3	4051	broad.mit.edu	37	19	15756582	15756582	+	Silent	SNP	C	C	T	rs148575704		TCGA-24-1565-01A-01W-0551-08	TCGA-24-1565-10A-01W-0551-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	e411496c-ce15-48c7-bd51-cb4bd6d34d65	65cd679f-5442-4a1b-ad0c-a2bd142fa3e5	g.chr19:15756582C>T	ENST00000221307.8	+	3	299	c.252C>T	c.(250-252)ttC>ttT	p.F84F	CYP4F3_ENST00000585846.1_Intron|CYP4F3_ENST00000591058.1_Intron|CYP4F3_ENST00000586182.2_Intron	NM_000896.2	NP_000887.2	Q08477	CP4F3_HUMAN	cytochrome P450, family 4, subfamily F, polypeptide 3	84					arachidonic acid metabolic process (GO:0019369)|icosanoid metabolic process (GO:0006690)|leukotriene metabolic process (GO:0006691)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	alpha-tocopherol omega-hydroxylase activity (GO:0052871)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|leukotriene-B4 20-monooxygenase activity (GO:0050051)|monooxygenase activity (GO:0004497)	p.F84F(1)		endometrium(3)|large_intestine(4)|lung(21)|ovary(3)|prostate(2)|stomach(1)	34						CATGCACCTTCGGTGATATGT	0.557													.|||	1	0.000199681	0.0	0.0	5008	,	,		21961	0.0		0.0	False		,,,				2504	0.001															1	Substitution - coding silent(1)	ovary(1)	19											124.0	115.0	118.0					19																	15756582		2203	4300	6503	15617582	SO:0001819	synonymous_variant	4051			AB002454	CCDS12332.1, CCDS59362.1	19p13.12	2013-02-21	2003-01-14		ENSG00000186529	ENSG00000186529		"""Cytochrome P450s"""	2646	protein-coding gene	gene with protein product		601270	"""cytochrome P450, subfamily IVF, polypeptide 3 (leukotriene B4 omega hydroxylase)"""	LTB4H		8486631, 9539102	Standard	NM_000896		Approved	CYP4F	uc010xol.2	Q08477	OTTHUMG00000182374	ENST00000221307.8:c.252C>T	19.37:g.15756582C>T			15617582	B7Z8Z3|O60634|Q5U740	Silent	SNP	ENST00000221307.8	37	CCDS12332.1																																																																																				0.557	CYP4F3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460819.3	NM_000896	
CD207	50489	broad.mit.edu	37	2	71062877	71062877	+	Silent	SNP	C	C	T	rs575060537		TCGA-24-1565-01A-01W-0551-08	TCGA-24-1565-10A-01W-0551-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	e411496c-ce15-48c7-bd51-cb4bd6d34d65	65cd679f-5442-4a1b-ad0c-a2bd142fa3e5	g.chr2:71062877C>T	ENST00000410009.3	-	1	75	c.30G>A	c.(28-30)gcG>gcA	p.A10A		NM_015717.3	NP_056532	Q9UJ71	CLC4K_HUMAN	CD207 molecule, langerin	10					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|defense response to virus (GO:0051607)	clathrin-coated endocytic vesicle membrane (GO:0030669)|early endosome membrane (GO:0031901)|endocytic vesicle (GO:0030139)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|mannose binding (GO:0005537)	p.A10A(1)		endometrium(1)|kidney(2)|large_intestine(2)|lung(13)|ovary(1)|stomach(1)	20						CAGTGAAGTGCGCATCAGGGG	0.567													C|||	1	0.000199681	0.0	0.0	5008	,	,		18673	0.0		0.0	False		,,,				2504	0.001															1	Substitution - coding silent(1)	ovary(1)	2											102.0	109.0	106.0					2																	71062877		2110	4247	6357	70916385	SO:0001819	synonymous_variant	50489			AJ242859	CCDS74520.1	2p13	2011-08-30	2006-03-28		ENSG00000116031	ENSG00000116031		"""C-type lectin domain containing"", ""CD molecules"""	17935	protein-coding gene	gene with protein product		604862	"""CD207 antigen, langerin"""			10661407, 9847074	Standard	NM_015717		Approved	Langerin, CLEC4K	uc002shg.3	Q9UJ71	OTTHUMG00000153176	ENST00000410009.3:c.30G>A	2.37:g.71062877C>T			70916385		Silent	SNP	ENST00000410009.3	37																																																																																					0.567	CD207-001	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000329959.4	NM_015717	
NRP2	8828	broad.mit.edu	37	2	206592644	206592644	+	Silent	SNP	G	G	A			TCGA-24-1565-01A-01W-0551-08	TCGA-24-1565-10A-01W-0551-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture;Sequenom			Illumina GAIIx	e411496c-ce15-48c7-bd51-cb4bd6d34d65	65cd679f-5442-4a1b-ad0c-a2bd142fa3e5	g.chr2:206592644G>A	ENST00000357785.5	+	7	1051	c.1020G>A	c.(1018-1020)acG>acA	p.T340T	NRP2_ENST00000272849.3_Silent_p.T340T|NRP2_ENST00000355117.4_Silent_p.T340T|NRP2_ENST00000540178.1_Silent_p.T340T|NRP2_ENST00000357118.4_Silent_p.T340T|NRP2_ENST00000540841.1_Silent_p.T340T|NRP2_ENST00000360409.3_Silent_p.T340T|NRP2_ENST00000412873.2_Silent_p.T340T|NRP2_ENST00000417189.1_Silent_p.T340T			Q99435	NELL2_HUMAN	neuropilin 2	0						extracellular region (GO:0005576)	calcium ion binding (GO:0005509)	p.T340T(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(14)|lung(19)|ovary(1)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	52						CCATGCTCACGGCCATCGCAA	0.502																																																1	Substitution - coding silent(1)	ovary(1)	2											95.0	79.0	84.0					2																	206592644		2203	4300	6503	206300889	SO:0001819	synonymous_variant	8828			AF016098	CCDS2364.1, CCDS2365.1, CCDS46496.1, CCDS46497.1, CCDS46498.1, CCDS46499.1	2q33.3	2008-05-23			ENSG00000118257	ENSG00000118257			8005	protein-coding gene	gene with protein product		602070				9529250, 9331348	Standard	NM_003872		Approved	VEGF165R2	uc002vaw.3	O60462	OTTHUMG00000132893	ENST00000357785.5:c.1020G>A	2.37:g.206592644G>A			206300889	B7Z2U7|B7Z5Q4|B7Z9J5|B7Z9U3|Q96JS2	Silent	SNP	ENST00000357785.5	37	CCDS46496.1																																																																																				0.502	NRP2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000336467.1		
SIGLEC1	6614	broad.mit.edu	37	20	3674892	3674892	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1565-01A-01W-0551-08	TCGA-24-1565-10A-01W-0551-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture;Sequenom			Illumina GAIIx	e411496c-ce15-48c7-bd51-cb4bd6d34d65	65cd679f-5442-4a1b-ad0c-a2bd142fa3e5	g.chr20:3674892C>T	ENST00000344754.4	-	12	3231	c.3232G>A	c.(3232-3234)Gcc>Acc	p.A1078T	SIGLEC1_ENST00000202578.4_Missense_Mutation_p.A1078T	NM_023068.3	NP_075556.1	Q9BZZ2	SN_HUMAN	sialic acid binding Ig-like lectin 1, sialoadhesin	1078	Ig-like C2-type 10.				cell-matrix adhesion (GO:0007160)|endocytosis (GO:0006897)|inflammatory response (GO:0006954)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of T cell apoptotic process (GO:0070234)|single organismal cell-cell adhesion (GO:0016337)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)	p.A1078T(1)		NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|liver(2)|lung(24)|ovary(3)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)	70						TCAGCTGAGGCCGAGGCCTGG	0.577																																																1	Substitution - Missense(1)	ovary(1)	20											67.0	56.0	60.0					20																	3674892		2183	4254	6437	3622892	SO:0001583	missense	6614			AF230073	CCDS13060.1	20p13	2013-01-29	2006-01-19	2006-01-19	ENSG00000088827	ENSG00000088827		"""CD molecules"", ""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	11127	protein-coding gene	gene with protein product		600751	"""sialoadhesin"""	SN		8530048	Standard	XM_006723610		Approved	SIGLEC-1, CD169, FLJ00051, FLJ00055, FLJ00073, FLJ32150, dJ1009E24.1, sialoadhesin	uc002wja.3	Q9BZZ2	OTTHUMG00000031757	ENST00000344754.4:c.3232G>A	20.37:g.3674892C>T	ENSP00000341141:p.Ala1078Thr		3622892	Q96DL4|Q9GZS5|Q9H1H6|Q9H1H7|Q9H7L7	Missense_Mutation	SNP	ENST00000344754.4	37	CCDS13060.1	.	.	.	.	.	.	.	.	.	.	C	15.20	2.764201	0.49574	.	.	ENSG00000088827	ENST00000344754;ENST00000202578	T;T	0.68624	-0.34;-0.34	5.3	5.3	0.74995	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.41605	D	0.000860	T	0.77239	0.4101	L	0.60845	1.875	0.28636	N	0.907432	P;D	0.76494	0.879;0.999	P;D	0.69479	0.559;0.964	T	0.69771	-0.5055	10	0.23302	T	0.38	.	16.7947	0.85598	0.0:1.0:0.0:0.0	.	1078;1078	Q9BZZ2;Q9BZZ2-3	SN_HUMAN;.	T	1078	ENSP00000341141:A1078T;ENSP00000202578:A1078T	ENSP00000202578:A1078T	A	-	1	0	SIGLEC1	3622892	0.199000	0.23386	0.163000	0.22734	0.120000	0.20174	0.490000	0.22403	2.653000	0.90120	0.561000	0.74099	GCC		0.577	SIGLEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077761.2	NM_023068	
PLCB1	23236	broad.mit.edu	37	20	8769132	8769132	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1565-01A-01W-0551-08	TCGA-24-1565-10A-01W-0551-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture			Illumina GAIIx	e411496c-ce15-48c7-bd51-cb4bd6d34d65	65cd679f-5442-4a1b-ad0c-a2bd142fa3e5	g.chr20:8769132C>A	ENST00000338037.6	+	28	3175	c.3148C>A	c.(3148-3150)Cag>Aag	p.Q1050K	PLCB1_ENST00000378637.2_Missense_Mutation_p.Q1050K|PLCB1_ENST00000494924.1_3'UTR|PLCB1_ENST00000378641.3_Missense_Mutation_p.Q1050K	NM_015192.2	NP_056007.1	Q9NQ66	PLCB1_HUMAN	phospholipase C, beta 1 (phosphoinositide-specific)	1050					activation of meiosis involved in egg activation (GO:0060466)|cerebral cortex development (GO:0021987)|fat cell differentiation (GO:0045444)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G2/M transition of mitotic cell cycle (GO:0000086)|glutamate receptor signaling pathway (GO:0007215)|inositol phosphate metabolic process (GO:0043647)|insulin-like growth factor receptor signaling pathway (GO:0048009)|interleukin-1-mediated signaling pathway (GO:0070498)|interleukin-12-mediated signaling pathway (GO:0035722)|interleukin-15-mediated signaling pathway (GO:0035723)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|memory (GO:0007613)|negative regulation of monocyte extravasation (GO:2000438)|negative regulation of transcription, DNA-templated (GO:0045892)|phosphatidylinositol metabolic process (GO:0046488)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of CD24 biosynthetic process (GO:2000560)|positive regulation of developmental growth (GO:0048639)|positive regulation of embryonic development (GO:0040019)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of GTPase activity (GO:0043547)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of JNK cascade (GO:0046330)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fertilization (GO:0080154)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|phosphatidylinositol phospholipase C activity (GO:0004435)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein homodimerization activity (GO:0042803)|signal transducer activity (GO:0004871)	p.Q1050K(1)		NS(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(11)|liver(2)|lung(41)|ovary(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	95						AGAAGAGTGTCAGAACAATCA	0.378																																																1	Substitution - Missense(1)	ovary(1)	20											70.0	67.0	68.0					20																	8769132		2203	4300	6503	8717132	SO:0001583	missense	23236			AB011153	CCDS13102.1, CCDS13103.1	20p12	2008-03-18			ENSG00000182621	ENSG00000182621	3.1.4.11		15917	protein-coding gene	gene with protein product		607120				10760467, 11118617	Standard	NM_015192		Approved	KIAA0581, PLC-I, PLC154	uc002wnb.4	Q9NQ66	OTTHUMG00000031849	ENST00000338037.6:c.3148C>A	20.37:g.8769132C>A	ENSP00000338185:p.Gln1050Lys		8717132	D3DW12|D3DW13|O60325|Q17RQ6|Q5TFF7|Q5TGC9|Q8IV93|Q9BQW2|Q9H4H2|Q9H8H5|Q9NQ65|Q9NQH9|Q9NTH4|Q9UJP6|Q9UM26	Missense_Mutation	SNP	ENST00000338037.6	37	CCDS13102.1	.	.	.	.	.	.	.	.	.	.	C	33	5.255604	0.95336	.	.	ENSG00000182621	ENST00000378641;ENST00000338037;ENST00000378637;ENST00000441163;ENST00000535719	T;T;T	0.57907	0.37;0.37;0.37	5.28	5.28	0.74379	PLC-beta, C-terminal (1);	0.117014	0.64402	D	0.000013	T	0.66096	0.2755	L	0.61218	1.895	0.80722	D	1	D;P	0.54964	0.969;0.887	P;P	0.55749	0.783;0.669	T	0.65586	-0.6132	10	0.45353	T	0.12	.	19.2861	0.94072	0.0:1.0:0.0:0.0	.	1050;1050	Q9NQ66;Q9NQ66-2	PLCB1_HUMAN;.	K	1050;1050;1050;970;970	ENSP00000367908:Q1050K;ENSP00000338185:Q1050K;ENSP00000367904:Q1050K	ENSP00000338185:Q1050K	Q	+	1	0	PLCB1	8717132	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.445000	0.80570	2.640000	0.89533	0.563000	0.77884	CAG		0.378	PLCB1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077938.3		
STK4	6789	broad.mit.edu	37	20	43703741	43703741	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1565-01A-01W-0551-08	TCGA-24-1565-10A-01W-0551-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture;Sequenom			Illumina GAIIx	e411496c-ce15-48c7-bd51-cb4bd6d34d65	65cd679f-5442-4a1b-ad0c-a2bd142fa3e5	g.chr20:43703741G>A	ENST00000372806.3	+	11	1483	c.1388G>A	c.(1387-1389)cGg>cAg	p.R463Q	STK4_ENST00000372801.1_3'UTR|STK4_ENST00000499879.2_Missense_Mutation_p.R408Q	NM_006282.2	NP_006273.1	Q13043	STK4_HUMAN	serine/threonine kinase 4	463	SARAH. {ECO:0000255|PROSITE- ProRule:PRU00310}.				apoptotic process (GO:0006915)|cell differentiation involved in embryonic placenta development (GO:0060706)|cell morphogenesis (GO:0000902)|central nervous system development (GO:0007417)|endocardium development (GO:0003157)|hepatocyte apoptotic process (GO:0097284)|hippo signaling (GO:0035329)|intracellular signal transduction (GO:0035556)|keratinocyte differentiation (GO:0030216)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of organ growth (GO:0046621)|neural tube formation (GO:0001841)|patterning of blood vessels (GO:0001569)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|primitive hemopoiesis (GO:0060215)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|protein dimerization activity (GO:0046983)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activator activity (GO:0043539)|protein serine/threonine kinase activity (GO:0004674)|transcription factor binding (GO:0008134)	p.R463Q(1)		NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|liver(2)|lung(5)|ovary(1)|prostate(1)|skin(2)	20		Myeloproliferative disorder(115;0.0122)				GAAGAGATCCGGCAGAAGTAC	0.552																																					GBM(187;1039 2137 11798 21916 33213)											1	Substitution - Missense(1)	ovary(1)	20											54.0	52.0	53.0					20																	43703741		2203	4300	6503	43137155	SO:0001583	missense	6789				CCDS13341.1	20q11.2-q13.2	2014-09-17			ENSG00000101109	ENSG00000101109			11408	protein-coding gene	gene with protein product	"""mammalian sterile 20-like 1"", ""yeast Ste20-like"", ""kinase responsive to stress 2"""	604965				8816758, 9545236, 11517310	Standard	NM_006282		Approved	MST1, KRS2, YSK3	uc002xnb.3	Q13043	OTTHUMG00000033059	ENST00000372806.3:c.1388G>A	20.37:g.43703741G>A	ENSP00000361892:p.Arg463Gln		43137155	B2RCR8|Q15802|Q4G156|Q5H982|Q6PD60|Q9BR32|Q9NTZ4	Missense_Mutation	SNP	ENST00000372806.3	37	CCDS13341.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.973318	0.74246	.	.	ENSG00000101109	ENST00000372806;ENST00000499879	T;T	0.75154	-0.91;0.04	5.99	5.99	0.97316	SARAH domain (1);SARAH (1);	0.063318	0.64402	D	0.000005	T	0.68091	0.2963	L	0.46885	1.475	0.80722	D	1	D;P	0.53151	0.958;0.766	B;B	0.42030	0.373;0.354	T	0.68135	-0.5489	10	0.35671	T	0.21	.	13.6476	0.62290	0.0704:0.0:0.9296:0.0	.	408;463	F5H5B4;Q13043	.;STK4_HUMAN	Q	463;408	ENSP00000361892:R463Q;ENSP00000443514:R408Q	ENSP00000361892:R463Q	R	+	2	0	STK4	43137155	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.620000	0.83070	2.847000	0.97988	0.655000	0.94253	CGG		0.552	STK4-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080401.4	NM_006282	
PTPRG	5793	broad.mit.edu	37	3	62189578	62189578	+	Silent	SNP	C	C	T	rs371158794		TCGA-24-1565-01A-01W-0551-08	TCGA-24-1565-10A-01W-0551-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture			Illumina GAIIx	e411496c-ce15-48c7-bd51-cb4bd6d34d65	65cd679f-5442-4a1b-ad0c-a2bd142fa3e5	g.chr3:62189578C>T	ENST00000474889.1	+	12	2486	c.2109C>T	c.(2107-2109)cgC>cgT	p.R703R	PTPRG_ENST00000295874.10_Silent_p.R703R	NM_002841.3	NP_002832.3	P23470	PTPRG_HUMAN	protein tyrosine phosphatase, receptor type, G	703					brain development (GO:0007420)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of neuron projection development (GO:0010977)|peptidyl-tyrosine dephosphorylation (GO:0035335)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.R703R(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(12)|liver(2)|lung(15)|ovary(7)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	62				BRCA - Breast invasive adenocarcinoma(55;0.000376)|KIRC - Kidney renal clear cell carcinoma(10;0.0499)|Kidney(10;0.065)		CTATGTCCCGCGGGGACCGAT	0.542																																																1	Substitution - coding silent(1)	ovary(1)	3																																								62164618	SO:0001819	synonymous_variant	5793			L09247	CCDS2895.1	3p21-p14	2013-02-11			ENSG00000144724	ENSG00000144724		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9671	protein-coding gene	gene with protein product		176886		PTPG		1711217	Standard	NM_002841		Approved	RPTPG	uc003dlb.3	P23470	OTTHUMG00000158660	ENST00000474889.1:c.2109C>T	3.37:g.62189578C>T			62164618	B2RU12|B7ZLX5|Q15623|Q59EE0|Q68DU5	Silent	SNP	ENST00000474889.1	37	CCDS2895.1																																																																																				0.542	PTPRG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351674.1	NM_002841	
CCRN4L	25819	broad.mit.edu	37	4	139964380	139964380	+	Silent	SNP	A	A	C			TCGA-24-1565-01A-01W-0551-08	TCGA-24-1565-10A-01W-0551-08	A	A	C	C	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	e411496c-ce15-48c7-bd51-cb4bd6d34d65	65cd679f-5442-4a1b-ad0c-a2bd142fa3e5	g.chr4:139964380A>C	ENST00000280614.2	+	2	536	c.343A>C	c.(343-345)Agg>Cgg	p.R115R	ELF2_ENST00000515489.1_Intron	NM_012118.2	NP_036250.2	Q9UK39	NOCT_HUMAN	CCR4 carbon catabolite repression 4-like (S. cerevisiae)	115					circadian regulation of gene expression (GO:0032922)|cytoplasmic mRNA processing body assembly (GO:0033962)|deadenylation-dependent decapping of nuclear-transcribed mRNA (GO:0000290)|mRNA processing (GO:0006397)|mRNA stabilization (GO:0048255)|negative regulation of gene expression (GO:0010629)|negative regulation of osteoblast differentiation (GO:0045668)|positive regulation of fat cell differentiation (GO:0045600)|regulation of circadian rhythm (GO:0042752)|regulation of embryonic development (GO:0045995)|regulation of transcription, DNA-templated (GO:0006355)|response to extracellular stimulus (GO:0009991)|response to lipopolysaccharide (GO:0032496)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	metal ion binding (GO:0046872)|mRNA binding (GO:0003729)|poly(A)-specific ribonuclease activity (GO:0004535)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R115R(1)		kidney(2)|large_intestine(3)|lung(3)|ovary(1)	9	all_hematologic(180;0.162)					TGAGGAATGCAGGGCCGTCCT	0.557																																					Ovarian(144;566 1842 19130 21379 22209)											1	Substitution - coding silent(1)	ovary(1)	4											89.0	87.0	88.0					4																	139964380		2203	4300	6503	140183830	SO:0001819	synonymous_variant	25819			AF183961	CCDS3743.1	4q31.1	2014-06-18	2001-11-28		ENSG00000151014	ENSG00000151014			14254	protein-coding gene	gene with protein product		608468	"""CCR4-like (carbon catabolite repression 4, S.cerevisiae)"""			10521507	Standard	NM_012118		Approved	CCR4L, Ccr4c	uc003ihl.3	Q9UK39	OTTHUMG00000161271	ENST00000280614.2:c.343A>C	4.37:g.139964380A>C			140183830	D3DNY5|Q14D51|Q9HD93|Q9HD94|Q9HD95	Silent	SNP	ENST00000280614.2	37	CCDS3743.1																																																																																				0.557	CCRN4L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257231.3	NM_012118	
FBXW7	55294	broad.mit.edu	37	4	153244205	153244205	+	Nonsense_Mutation	SNP	A	A	T			TCGA-24-1565-01A-01W-0551-08	TCGA-24-1565-10A-01W-0551-08	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture;Sequenom			Illumina GAIIx	e411496c-ce15-48c7-bd51-cb4bd6d34d65	65cd679f-5442-4a1b-ad0c-a2bd142fa3e5	g.chr4:153244205A>T	ENST00000281708.4	-	12	3181	c.1952T>A	c.(1951-1953)tTg>tAg	p.L651*	FBXW7_ENST00000296555.5_Nonsense_Mutation_p.L533*|FBXW7_ENST00000263981.5_Nonsense_Mutation_p.L571*|FBXW7_ENST00000603841.1_Nonsense_Mutation_p.L651*|FBXW7_ENST00000393956.3_Nonsense_Mutation_p.L475*|RP11-461L13.3_ENST00000603766.1_lincRNA|FBXW7_ENST00000603548.1_Nonsense_Mutation_p.L651*	NM_033632.3	NP_361014.1	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase	651					cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|lipid homeostasis (GO:0055088)|lung development (GO:0030324)|negative regulation of DNA endoreduplication (GO:0032876)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of SREBP signaling pathway (GO:2000639)|negative regulation of triglyceride biosynthetic process (GO:0010868)|Notch signaling pathway (GO:0007219)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903378)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|regulation of cell cycle G1/S phase transition (GO:1902806)|regulation of lipid storage (GO:0010883)|regulation of protein localization (GO:0032880)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|sister chromatid cohesion (GO:0007062)|vasculature development (GO:0001944)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|protein complex (GO:0043234)|SCF ubiquitin ligase complex (GO:0019005)	cyclin binding (GO:0030332)|identical protein binding (GO:0042802)|protein binding, bridging (GO:0030674)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activator activity (GO:0097027)	p.L571*(1)|p.L651*(1)|p.?(1)		NS(1)|biliary_tract(8)|bone(1)|breast(5)|central_nervous_system(6)|cervix(2)|endometrium(36)|haematopoietic_and_lymphoid_tissue(159)|kidney(6)|large_intestine(155)|lung(31)|ovary(10)|pancreas(3)|prostate(2)|skin(6)|stomach(16)|upper_aerodigestive_tract(9)|urinary_tract(6)	462	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				ACCCGTTTTCAAGTCCCATAG	0.463			"""Mis, N, D, F"""		"""colorectal, endometrial, T-ALL"""																																		Rec	yes		4	4q31.3	55294	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"""		"""E, L"""	3	Substitution - Nonsense(2)|Unknown(1)	ovary(2)|haematopoietic_and_lymphoid_tissue(1)	4											152.0	148.0	149.0					4																	153244205		2203	4300	6503	153463655	SO:0001587	stop_gained	55294			AF411971	CCDS3777.1, CCDS3778.1, CCDS34078.1, CCDS64082.1	4q31.23	2013-01-09	2012-02-23					"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	16712	protein-coding gene	gene with protein product	"""archipelago homolog (Drosophila)"""	606278	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"", ""F-box and WD repeat domain containing 7"""			10531037, 11425854	Standard	NM_018315		Approved	AGO, FLJ11071, SEL-10, SEL10, FBW7, FBX30, CDC4, FBXW6	uc003ims.3	Q969H0		ENST00000281708.4:c.1952T>A	4.37:g.153244205A>T	ENSP00000281708:p.Leu651*		153463655	B7ZLP9|Q68DR0|Q96A16|Q96LE0|Q96RI2|Q9NUX6	Nonsense_Mutation	SNP	ENST00000281708.4	37	CCDS3777.1	.	.	.	.	.	.	.	.	.	.	A	25.2	4.617713	0.87359	.	.	ENSG00000109670	ENST00000281708;ENST00000296555;ENST00000263981;ENST00000393956	.	.	.	5.67	4.47	0.54385	.	0.063358	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.5533	12.8432	0.57815	0.8635:0.1365:0.0:0.0	.	.	.	.	X	651;533;571;475	.	ENSP00000263981:L571X	L	-	2	0	FBXW7	153463655	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.270000	0.95690	0.959000	0.37980	0.533000	0.62120	TTG		0.463	FBXW7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000469956.1		
TENM3	55714	broad.mit.edu	37	4	183714082	183714082	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1565-01A-01W-0551-08	TCGA-24-1565-10A-01W-0551-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	e411496c-ce15-48c7-bd51-cb4bd6d34d65	65cd679f-5442-4a1b-ad0c-a2bd142fa3e5	g.chr4:183714082G>A	ENST00000511685.1	+	26	6380	c.6257G>A	c.(6256-6258)cGt>cAt	p.R2086H	TENM3_ENST00000406950.2_Missense_Mutation_p.R2086H			Q9P273	TEN3_HUMAN	teneurin transmembrane protein 3	2086					camera-type eye morphogenesis (GO:0048593)|homophilic cell adhesion (GO:0007156)|positive regulation of neuron projection development (GO:0010976)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										GCTCATGGCCGTATCAAGGAG	0.368																																																0			4											44.0	43.0	43.0					4																	183714082		1873	4106	5979	183951076	SO:0001583	missense	55714			AF195420	CCDS47165.1	4q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000218336	ENSG00000218336			29944	protein-coding gene	gene with protein product		610083	"""odz, odd Oz/ten-m homolog 3 (Drosophila)"""	ODZ3		10331952, 10625539	Standard	NM_001080477		Approved	Ten-M3, KIAA1455	uc003ivd.1	Q9P273	OTTHUMG00000160682	ENST00000511685.1:c.6257G>A	4.37:g.183714082G>A	ENSP00000424226:p.Arg2086His		183951076	Q5XUL9|Q96SY2|Q9NV77|Q9NVW1|Q9NZJ2	Missense_Mutation	SNP	ENST00000511685.1	37	CCDS47165.1	.	.	.	.	.	.	.	.	.	.	G	20.5	4.000821	0.74818	.	.	ENSG00000218336	ENST00000511685;ENST00000406950	D;D	0.88124	-2.34;-2.34	4.89	4.89	0.63831	.	.	.	.	.	D	0.93602	0.7957	M	0.80028	2.48	0.80722	D	1	D	0.76494	0.999	D	0.73380	0.98	D	0.94380	0.7604	9	0.87932	D	0	.	18.2684	0.90060	0.0:0.0:1.0:0.0	.	2086	Q9P273	TEN3_HUMAN	H	2086	ENSP00000424226:R2086H;ENSP00000385276:R2086H	ENSP00000385276:R2086H	R	+	2	0	ODZ3	183951076	1.000000	0.71417	1.000000	0.80357	0.876000	0.50452	9.623000	0.98386	2.534000	0.85438	0.563000	0.77884	CGT		0.368	TENM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361734.1		
ISL1	3670	broad.mit.edu	37	5	50685761	50685761	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1565-01A-01W-0551-08	TCGA-24-1565-10A-01W-0551-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	e411496c-ce15-48c7-bd51-cb4bd6d34d65	65cd679f-5442-4a1b-ad0c-a2bd142fa3e5	g.chr5:50685761A>G	ENST00000230658.7	+	4	1345	c.760A>G	c.(760-762)Aaa>Gaa	p.K254E	ISL1_ENST00000505475.2_3'UTR|ISL1_ENST00000511384.1_Missense_Mutation_p.K254E	NM_002202.2	NP_002193.2	P61371	ISL1_HUMAN	ISL LIM homeobox 1	254	Gln-rich.				atrial septum morphogenesis (GO:0060413)|axon regeneration (GO:0031103)|cardiac cell fate determination (GO:0060913)|cardiac muscle cell myoblast differentiation (GO:0060379)|cardiac right ventricle morphogenesis (GO:0003215)|cellular response to glucocorticoid stimulus (GO:0071385)|endocardial cushion morphogenesis (GO:0003203)|innervation (GO:0060384)|mesenchymal cell differentiation (GO:0048762)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of inflammatory response (GO:0050728)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of protein homodimerization activity (GO:0090074)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural crest cell migration (GO:0001755)|neuron fate specification (GO:0048665)|outflow tract morphogenesis (GO:0003151)|outflow tract septum morphogenesis (GO:0003148)|pancreas development (GO:0031016)|peripheral nervous system neuron axonogenesis (GO:0048936)|pharyngeal system development (GO:0060037)|pituitary gland development (GO:0021983)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of granulocyte colony-stimulating factor production (GO:0071657)|positive regulation of granulocyte macrophage colony-stimulating factor production (GO:0032725)|positive regulation of insulin secretion (GO:0032024)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 alpha production (GO:0032730)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of macrophage colony-stimulating factor production (GO:1901258)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|retinal ganglion cell axon guidance (GO:0031290)|secondary heart field specification (GO:0003139)|sensory system development (GO:0048880)|spinal cord motor neuron cell fate specification (GO:0021520)|spinal cord motor neuron differentiation (GO:0021522)|trigeminal nerve development (GO:0021559)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visceral motor neuron differentiation (GO:0021524)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	bHLH transcription factor binding (GO:0043425)|chromatin binding (GO:0003682)|enhancer sequence-specific DNA binding (GO:0001158)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor binding (GO:0016922)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription coactivator activity (GO:0001105)|zinc ion binding (GO:0008270)	p.K254E(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(11)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	31		Lung NSC(810;0.000845)|Breast(144;0.0411)				GCCCAATGACAAAACTGTGAG	0.577																																																1	Substitution - Missense(1)	ovary(1)	5											37.0	45.0	42.0					5																	50685761		2177	4287	6464	50721518	SO:0001583	missense	3670			BC031213	CCDS43314.1	5q11.2	2012-03-09	2007-07-13		ENSG00000016082	ENSG00000016082		"""Homeoboxes / LIM class"""	6132	protein-coding gene	gene with protein product		600366	"""ISL1 transcription factor, LIM/homeodomain, (islet-1)"""			7912209	Standard	NM_002202		Approved	Isl-1, ISLET1	uc003jor.3	P61371	OTTHUMG00000162281	ENST00000230658.7:c.760A>G	5.37:g.50685761A>G	ENSP00000230658:p.Lys254Glu		50721518	P20663|P47894	Missense_Mutation	SNP	ENST00000230658.7	37	CCDS43314.1	.	.	.	.	.	.	.	.	.	.	A	13.16	2.155423	0.38021	.	.	ENSG00000016082	ENST00000230658;ENST00000511384	D;D	0.85171	-1.95;-1.85	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	D	0.85344	0.5675	M	0.78801	2.425	0.58432	D	0.999999	B	0.17268	0.021	B	0.17979	0.02	T	0.81573	-0.0871	10	0.29301	T	0.29	.	15.8464	0.78895	1.0:0.0:0.0:0.0	.	254	P61371	ISL1_HUMAN	E	254	ENSP00000230658:K254E;ENSP00000422676:K254E	ENSP00000230658:K254E	K	+	1	0	ISL1	50721518	1.000000	0.71417	1.000000	0.80357	0.107000	0.19398	9.226000	0.95229	2.128000	0.65567	0.528000	0.53228	AAA		0.577	ISL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368413.3	NM_002202	
PITX1	5307	broad.mit.edu	37	5	134364597	134364597	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1565-01A-01W-0551-08	TCGA-24-1565-10A-01W-0551-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	e411496c-ce15-48c7-bd51-cb4bd6d34d65	65cd679f-5442-4a1b-ad0c-a2bd142fa3e5	g.chr5:134364597C>T	ENST00000265340.7	-	3	1233	c.817G>A	c.(817-819)Gtc>Atc	p.V273I	PITX1_ENST00000506438.1_Missense_Mutation_p.V273I	NM_002653.4	NP_002644.4	P78337	PITX1_HUMAN	paired-like homeodomain 1	273	Interacts with PIT-1. {ECO:0000250}.				anatomical structure morphogenesis (GO:0009653)|branchiomeric skeletal muscle development (GO:0014707)|cartilage development (GO:0051216)|embryonic hindlimb morphogenesis (GO:0035116)|myoblast fate commitment (GO:0048625)|pituitary gland development (GO:0021983)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)	p.V273I(1)		central_nervous_system(1)|cervix(3)|endometrium(3)|large_intestine(1)|lung(5)|ovary(1)	14			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)	READ - Rectum adenocarcinoma(2;0.0607)		TCCCGGTAGACGCTGTAGGGC	0.672																																																1	Substitution - Missense(1)	ovary(1)	5											44.0	44.0	44.0					5																	134364597		2203	4300	6503	134392496	SO:0001583	missense	5307			AF009648	CCDS4182.1	5q31.1	2011-06-20	2007-07-12		ENSG00000069011	ENSG00000069011		"""Homeoboxes / PRD class"""	9004	protein-coding gene	gene with protein product		602149	"""paired-like homeodomain transcription factor 1"""	BFT		9337397, 9070926	Standard	NM_002653		Approved	PTX1, POTX	uc010jea.3	P78337	OTTHUMG00000149983	ENST00000265340.7:c.817G>A	5.37:g.134364597C>T	ENSP00000265340:p.Val273Ile		134392496	A8K3M0|D3DQB0|O14677|O60425|Q9BTI5	Missense_Mutation	SNP	ENST00000265340.7	37	CCDS4182.1	.	.	.	.	.	.	.	.	.	.	C	25.8	4.677418	0.88445	.	.	ENSG00000069011	ENST00000265340;ENST00000506438	D;D	0.90788	-2.73;-2.73	4.14	4.14	0.48551	.	0.130098	0.50627	D	0.000117	D	0.92528	0.7627	L	0.48362	1.52	0.80722	D	1	D	0.60160	0.987	P	0.62014	0.897	D	0.93489	0.6834	10	0.72032	D	0.01	.	15.3899	0.74735	0.0:1.0:0.0:0.0	.	273	P78337	PITX1_HUMAN	I	273	ENSP00000265340:V273I;ENSP00000427542:V273I	ENSP00000265340:V273I	V	-	1	0	PITX1	134392496	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	7.296000	0.78790	1.859000	0.53934	0.462000	0.41574	GTC		0.672	PITX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251195.3		
GRIA1	2890	broad.mit.edu	37	5	153190617	153190617	+	Silent	SNP	C	C	T			TCGA-24-1565-01A-01W-0551-08	TCGA-24-1565-10A-01W-0551-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	e411496c-ce15-48c7-bd51-cb4bd6d34d65	65cd679f-5442-4a1b-ad0c-a2bd142fa3e5	g.chr5:153190617C>T	ENST00000285900.5	+	16	2896	c.2553C>T	c.(2551-2553)aaC>aaT	p.N851N	GRIA1_ENST00000340592.5_Silent_p.N851N|GRIA1_ENST00000518142.1_Silent_p.N771N|GRIA1_ENST00000521843.2_Silent_p.N782N|GRIA1_ENST00000518783.1_Silent_p.N861N|GRIA1_ENST00000448073.4_Silent_p.N861N	NM_000827.3|NM_001258019.1	NP_000818.2|NP_001244948.1	P42261	GRIA1_HUMAN	glutamate receptor, ionotropic, AMPA 1	851					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term memory (GO:0007616)|receptor internalization (GO:0031623)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|axonal spine (GO:0044308)|cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|dendrite membrane (GO:0032590)|dendritic spine (GO:0043197)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|neuron spine (GO:0044309)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|PDZ domain binding (GO:0030165)	p.N851N(1)		NS(1)|breast(4)|endometrium(7)|kidney(3)|large_intestine(24)|liver(2)|lung(23)|ovary(4)|pancreas(1)|prostate(5)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	81		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Perampanel(DB08883)|Sevoflurane(DB01236)	AATCCATCAACGAAGCCATAC	0.587																																																1	Substitution - coding silent(1)	ovary(1)	5											68.0	71.0	70.0					5																	153190617		2203	4300	6503	153170810	SO:0001819	synonymous_variant	2890				CCDS4322.1, CCDS47318.1, CCDS58986.1, CCDS58987.1, CCDS58988.1, CCDS58989.1	5q33	2012-08-29			ENSG00000155511	ENSG00000155511		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4571	protein-coding gene	gene with protein product		138248		GLUR1		1652753, 1319477	Standard	NM_000827		Approved	GluA1, GLURA	uc011dcy.2	P42261	OTTHUMG00000130148	ENST00000285900.5:c.2553C>T	5.37:g.153190617C>T			153170810	B7Z2S0|B7Z2W8|B7Z3F6|B7Z9G9|D3DQI4|E7ESV8|Q2NKM6	Silent	SNP	ENST00000285900.5	37	CCDS4322.1																																																																																				0.587	GRIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252456.3		
LANCL2	55915	broad.mit.edu	37	7	55467798	55467798	+	Splice_Site	SNP	G	G	A			TCGA-24-1565-01A-01W-0551-08	TCGA-24-1565-10A-01W-0551-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture;Sequenom			Illumina GAIIx	e411496c-ce15-48c7-bd51-cb4bd6d34d65	65cd679f-5442-4a1b-ad0c-a2bd142fa3e5	g.chr7:55467798G>A	ENST00000254770.2	+	4	1256		c.e4+1		LANCL2_ENST00000486376.1_3'UTR	NM_018697.3	NP_061167.1	Q9NS86	LANC2_HUMAN	LanC lantibiotic synthetase component C-like 2 (bacterial)						negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of abscisic acid-activated signaling pathway (GO:0009789)	cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|catalytic activity (GO:0003824)|GTP binding (GO:0005525)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)	p.?(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|liver(2)|lung(11)|ovary(1)|skin(1)|stomach(1)|urinary_tract(1)	25	Breast(14;0.0379)		Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00128)|Epithelial(13;0.0706)			TATTAAAGAGGTACTATGGGG	0.443																																																1	Unknown(1)	ovary(1)	7											182.0	163.0	170.0					7																	55467798		2203	4300	6503	55435292	SO:0001630	splice_region_variant	55915			AJ278245	CCDS5517.1	7q31.1-q31.33	2008-07-18	2001-12-04		ENSG00000132434	ENSG00000132434			6509	protein-coding gene	gene with protein product	"""testis-specific adriamycin sensitivity protein"", ""G protein-coupled receptor 69B"""	612919	"""LanC (bacterial lantibiotic synthetase component C)-like 2"""	GPR69B		11762191	Standard	NM_018697		Approved	TASP	uc003tqp.3	Q9NS86	OTTHUMG00000023779	ENST00000254770.2:c.678+1G>A	7.37:g.55467798G>A			55435292	B2R8D4|Q6NSL4|Q8TCQ3|Q9BSR1	Splice_Site	SNP	ENST00000254770.2	37	CCDS5517.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.089286	0.76756	.	.	ENSG00000132434	ENST00000254770	.	.	.	5.39	5.39	0.77823	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.071	0.89407	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	LANCL2	55435292	1.000000	0.71417	1.000000	0.80357	0.817000	0.46193	8.842000	0.92136	2.684000	0.91462	0.591000	0.81541	.		0.443	LANCL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251459.1	NM_018697	Intron
BRAF	673	broad.mit.edu	37	7	140453193	140453193	+	Splice_Site	SNP	T	T	C	rs121913370		TCGA-24-1565-01A-01W-0551-08	TCGA-24-1565-10A-01W-0551-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture			Illumina GAIIx	e411496c-ce15-48c7-bd51-cb4bd6d34d65	65cd679f-5442-4a1b-ad0c-a2bd142fa3e5	g.chr7:140453193T>C	ENST00000288602.6	-	15	1802	c.1742A>G	c.(1741-1743)aAt>aGt	p.N581S		NM_004333.4	NP_004324.2	P15056	BRAF_HUMAN	B-Raf proto-oncogene, serine/threonine kinase	581	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		N -> D (in CFC1). {ECO:0000269|PubMed:16439621, ECO:0000269|PubMed:16474404, ECO:0000269|PubMed:18042262}.|N -> S (in a colorectal adenocarcinoma sample; somatic mutation). {ECO:0000269|PubMed:17344846}.		activation of MAPKK activity (GO:0000186)|CD4-positive, alpha-beta T cell differentiation (GO:0043367)|cellular response to calcium ion (GO:0071277)|cellular response to drug (GO:0035690)|fibroblast growth factor receptor signaling pathway (GO:0008543)|long-term synaptic potentiation (GO:0060291)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fibroblast migration (GO:0010764)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic vesicle exocytosis (GO:2000301)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive T cell selection (GO:0043368)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of cell proliferation (GO:0042127)|response to cAMP (GO:0051591)|response to epidermal growth factor (GO:0070849)|response to peptide hormone (GO:0043434)|small GTPase mediated signal transduction (GO:0007264)|somatic stem cell maintenance (GO:0035019)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	cell body (GO:0044297)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.N581S(9)|p.N581I(1)	SLC45A3/BRAF(2)|AGTRAP/BRAF(2)|FAM131B_ENST00000443739/BRAF(7)|AKAP9_ENST00000356239/BRAF(10)|KIAA1549/BRAF(703)|FCHSD1/BRAF(2)	NS(588)|adrenal_gland(3)|autonomic_ganglia(3)|biliary_tract(29)|bone(7)|breast(21)|central_nervous_system(99)|cervix(6)|endometrium(33)|eye(72)|gastrointestinal_tract_(site_indeterminate)(2)|genital_tract(4)|haematopoietic_and_lymphoid_tissue(436)|kidney(3)|large_intestine(6953)|liver(17)|lung(192)|oesophagus(4)|ovary(275)|pancreas(15)|pituitary(1)|prostate(25)|salivary_gland(1)|skin(6285)|small_intestine(12)|soft_tissue(40)|stomach(11)|testis(7)|thyroid(12220)|upper_aerodigestive_tract(13)|urinary_tract(3)	27380	Melanoma(164;0.00956)				Dabrafenib(DB08912)|Regorafenib(DB08896)|Sorafenib(DB00398)|Vemurafenib(DB08881)	AAGAAATATATCTGAGGTGTA	0.358		61	"""Mis, T, O"""	"""AKAP9, KIAA1549"""	"""melanoma, colorectal, papillary thyroid, borderline ov, Non small-cell lung cancer (NSCLC), cholangiocarcinoma, pilocytic astrocytoma"""		Cardio-facio-cutaneous syndrome		Cardiofaciocutaneous syndrome																												Colon(40;35 892 2973 5743 27438)		Dom	yes		7	7q34	673	v-raf murine sarcoma viral oncogene homolog B1	yes	E	10	Substitution - Missense(10)	large_intestine(3)|lung(3)|skin(2)|ovary(1)|soft_tissue(1)	7											86.0	83.0	84.0					7																	140453193		2203	4298	6501	140099662	SO:0001630	splice_region_variant	673	Familial Cancer Database	CFC, CFCS	M95712	CCDS5863.1	7q34	2014-09-17	2014-06-26		ENSG00000157764	ENSG00000157764			1097	protein-coding gene	gene with protein product		164757	"""v-raf murine sarcoma viral oncogene homolog B"""			2284096, 1565476	Standard	NM_004333		Approved	BRAF1	uc003vwc.4	P15056	OTTHUMG00000157457	ENST00000288602.6:c.1742-1A>G	7.37:g.140453193T>C			140099662	A4D1T4|B6HY61|B6HY62|B6HY63|B6HY64|B6HY65|B6HY66|Q13878|Q3MIN6|Q9UDP8|Q9Y6T3	Missense_Mutation	SNP	ENST00000288602.6	37	CCDS5863.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	17.68|17.68	3.450518|3.450518	0.63290|0.63290	.|.	.|.	ENSG00000157764|ENSG00000157764	ENST00000496384|ENST00000288602	.|D	.|0.99803	.|-6.82	5.65|5.65	5.65|5.65	0.86999|0.86999	.|Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.99864|0.99864	0.9936|0.9936	H|H	0.96970|0.96970	3.915|3.915	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.87578	.|0.998	D|D	0.96655|0.96655	0.9484|0.9484	5|10	.|0.59425	.|D	.|0.04	.|.	15.9326|15.9326	0.79675|0.79675	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|581	.|P15056	.|BRAF_HUMAN	V|S	189|581	.|ENSP00000288602:N581S	.|ENSP00000288602:N581S	I|N	-|-	1|2	0|0	BRAF|BRAF	140099662|140099662	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.921000|7.921000	0.87530|0.87530	2.169000|2.169000	0.68431|0.68431	0.529000|0.529000	0.55759|0.55759	ATA|AAT		0.358	BRAF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348886.1	NM_004333	Missense_Mutation
SLC24A2	25769	broad.mit.edu	37	9	19516389	19516389	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1565-01A-01W-0551-08	TCGA-24-1565-10A-01W-0551-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	e411496c-ce15-48c7-bd51-cb4bd6d34d65	65cd679f-5442-4a1b-ad0c-a2bd142fa3e5	g.chr9:19516389G>A	ENST00000341998.2	-	10	1809	c.1748C>T	c.(1747-1749)cCc>cTc	p.P583L	SLC24A2_ENST00000286344.3_Missense_Mutation_p.P566L	NM_001193288.2|NM_020344.3	NP_001180217.1|NP_065077.1	Q9UI40	NCKX2_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 2	583					cellular calcium ion homeostasis (GO:0006874)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|learning (GO:0007612)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)	cadmium ion binding (GO:0046870)|calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium, potassium:sodium antiporter activity (GO:0008273)|manganese ion binding (GO:0030145)|nickel cation binding (GO:0016151)|potassium ion binding (GO:0030955)|sodium ion binding (GO:0031402)|symporter activity (GO:0015293)	p.P583L(1)		endometrium(3)|kidney(1)|large_intestine(9)|lung(13)|ovary(3)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	33				GBM - Glioblastoma multiforme(1;1.67e-55)|Lung(42;0.0443)		CAGGAGCCAGGGCAGTGGGAG	0.517																																																1	Substitution - Missense(1)	ovary(1)	9											40.0	41.0	41.0					9																	19516389		2203	4300	6503	19506389	SO:0001583	missense	25769			AF097366	CCDS6493.1, CCDS55297.1	9p22.1	2013-05-22			ENSG00000155886	ENSG00000155886		"""Solute carriers"""	10976	protein-coding gene	gene with protein product		609838				10662833	Standard	NM_020344		Approved	NCKX2	uc003zoa.2	Q9UI40	OTTHUMG00000019646	ENST00000341998.2:c.1748C>T	9.37:g.19516389G>A	ENSP00000344801:p.Pro583Leu		19506389	B7ZLL8|Q9NTN5|Q9NZQ4	Missense_Mutation	SNP	ENST00000341998.2	37	CCDS6493.1	.	.	.	.	.	.	.	.	.	.	G	25.3	4.624466	0.87560	.	.	ENSG00000155886	ENST00000341998;ENST00000286344	T;T	0.61980	0.06;0.06	5.07	5.07	0.68467	Sodium/calcium exchanger membrane region (1);	0.000000	0.85682	D	0.000000	D	0.87865	0.6285	H	0.98333	4.205	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	D	0.92898	0.6337	9	.	.	.	.	18.4603	0.90736	0.0:0.0:1.0:0.0	.	566;583	Q9UI40-2;Q9UI40	.;NCKX2_HUMAN	L	583;566	ENSP00000344801:P583L;ENSP00000286344:P566L	.	P	-	2	0	SLC24A2	19506389	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.808000	0.99193	2.351000	0.79841	0.655000	0.94253	CCC		0.517	SLC24A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051866.2	NM_020344	
COL15A1	1306	broad.mit.edu	37	9	101763192	101763192	+	Missense_Mutation	SNP	G	G	A	rs137949756	byFrequency	TCGA-24-1565-01A-01W-0551-08	TCGA-24-1565-10A-01W-0551-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	e411496c-ce15-48c7-bd51-cb4bd6d34d65	65cd679f-5442-4a1b-ad0c-a2bd142fa3e5	g.chr9:101763192G>A	ENST00000375001.3	+	7	1447	c.1024G>A	c.(1024-1026)Ggc>Agc	p.G342S		NM_001855.3	NP_001846.3	P39059	COFA1_HUMAN	collagen, type XV, alpha 1	342	Nonhelical region 1 (NC1).				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|signal transduction (GO:0007165)	collagen type XV trimer (GO:0005582)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	extracellular matrix structural constituent (GO:0005201)	p.G342S(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(20)|liver(1)|lung(42)|ovary(6)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	107		Acute lymphoblastic leukemia(62;0.0562)				TACTGACAGCGGCTCAGGGGC	0.468											OREG0019364	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	9						G	SER/GLY	3,4403	8.1+/-20.4	0,3,2200	83.0	76.0	78.0		1024	2.8	0.9	9	dbSNP_134	78	1,8599	1.2+/-3.3	0,1,4299	yes	missense	COL15A1	NM_001855.3	56	0,4,6499	AA,AG,GG		0.0116,0.0681,0.0308	probably-damaging	342/1389	101763192	4,13002	2203	4300	6503	100803013	SO:0001583	missense	1306			L25286	CCDS35081.1	9q21-q22	2013-01-16			ENSG00000204291	ENSG00000204291		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2192	protein-coding gene	gene with protein product	"""collagen type XV proteoglycan"""	120325				1427836	Standard	NM_001855		Approved		uc004azb.2	P39059	OTTHUMG00000020351	ENST00000375001.3:c.1024G>A	9.37:g.101763192G>A	ENSP00000364140:p.Gly342Ser	1361	100803013	Q5T6J4|Q9UDC5|Q9Y4W4	Missense_Mutation	SNP	ENST00000375001.3	37	CCDS35081.1	.	.	.	.	.	.	.	.	.	.	G	14.42	2.528966	0.44969	6.81E-4	1.16E-4	ENSG00000204291	ENST00000375001;ENST00000536083	D	0.91180	-2.8	4.62	2.79	0.32731	.	1.854780	0.02430	N	0.083495	D	0.90403	0.6996	N	0.24115	0.695	0.25593	N	0.986678	D	0.67145	0.996	P	0.62089	0.898	T	0.79708	-0.1690	10	0.23302	T	0.38	-4.6285	7.2781	0.26296	0.1986:0.0:0.8014:0.0	.	342	P39059	COFA1_HUMAN	S	342;312	ENSP00000364140:G342S	ENSP00000364140:G342S	G	+	1	0	COL15A1	100803013	0.994000	0.37717	0.907000	0.35723	0.039000	0.13416	2.717000	0.47227	0.689000	0.31550	-0.768000	0.03414	GGC		0.468	COL15A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053386.3	NM_001855	
EPB41L4B	54566	broad.mit.edu	37	9	111979393	111979393	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1565-01A-01W-0551-08	TCGA-24-1565-10A-01W-0551-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture			Illumina GAIIx	e411496c-ce15-48c7-bd51-cb4bd6d34d65	65cd679f-5442-4a1b-ad0c-a2bd142fa3e5	g.chr9:111979393G>A	ENST00000374566.3	-	16	1959	c.1442C>T	c.(1441-1443)tCg>tTg	p.S481L		NM_019114.3	NP_061987.3	Q9H329	E41LB_HUMAN	erythrocyte membrane protein band 4.1 like 4B	481					actomyosin structure organization (GO:0031032)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)	structural constituent of cytoskeleton (GO:0005200)	p.S481L(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						CAACCGGTCCGAGCTGCTAAG	0.557																																																1	Substitution - Missense(1)	ovary(1)	9											68.0	68.0	68.0					9																	111979393		2120	4246	6366	111019214	SO:0001583	missense	54566			AB032179	CCDS43859.1, CCDS43860.1	9q22.1-q22.3	2008-02-05			ENSG00000095203	ENSG00000095203			19818	protein-coding gene	gene with protein product		610340				10783258	Standard	NM_018424		Approved	EHM2	uc004bdz.1	Q9H329	OTTHUMG00000020470	ENST00000374566.3:c.1442C>T	9.37:g.111979393G>A	ENSP00000363694:p.Ser481Leu		111019214	Q5T4G5|Q5T4G6|Q9H328|Q9P2V3	Missense_Mutation	SNP	ENST00000374566.3	37	CCDS43859.1	.	.	.	.	.	.	.	.	.	.	G	11.65	1.702960	0.30232	.	.	ENSG00000095203	ENST00000262536;ENST00000374566	D	0.83837	-1.77	5.91	5.91	0.95273	.	0.481175	0.15664	N	0.250746	T	0.74520	0.3727	N	0.24115	0.695	0.80722	D	1	B	0.24426	0.103	B	0.14023	0.01	T	0.68754	-0.5325	10	0.44086	T	0.13	.	15.7986	0.78433	0.0:0.0:1.0:0.0	.	481	Q9H329	E41LB_HUMAN	L	166;481	ENSP00000363694:S481L	ENSP00000262536:S166L	S	-	2	0	EPB41L4B	111019214	0.953000	0.32496	0.822000	0.32727	0.078000	0.17371	2.382000	0.44345	2.793000	0.96121	0.655000	0.94253	TCG		0.557	EPB41L4B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053592.1	NM_018424	
KCND1	3750	broad.mit.edu	37	X	48819928	48819928	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1565-01A-01W-0551-08	TCGA-24-1565-10A-01W-0551-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	e411496c-ce15-48c7-bd51-cb4bd6d34d65	65cd679f-5442-4a1b-ad0c-a2bd142fa3e5	g.chrX:48819928C>T	ENST00000218176.3	-	6	3155	c.1858G>A	c.(1858-1860)Ggt>Agt	p.G620S	KCND1_ENST00000376477.1_Missense_Mutation_p.G243S	NM_004979.4	NP_004970.3	Q9NSA2	KCND1_HUMAN	potassium voltage-gated channel, Shal-related subfamily, member 1	620					protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	cell projection (GO:0042995)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|metal ion binding (GO:0046872)	p.G620S(1)		endometrium(3)|large_intestine(7)|lung(7)|ovary(2)|prostate(1)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(2)	24					Dalfampridine(DB06637)	GCCCTGCCACCGCCGCCAGGG	0.637																																																1	Substitution - Missense(1)	ovary(1)	X											32.0	29.0	30.0					X																	48819928		2203	4300	6503	48704872	SO:0001583	missense	3750			AF166003	CCDS14314.1	Xp11.23	2012-07-05			ENSG00000102057	ENSG00000102057		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6237	protein-coding gene	gene with protein product		300281				10729221, 16382104	Standard	NM_004979		Approved	Kv4.1	uc004dlx.1	Q9NSA2	OTTHUMG00000024127	ENST00000218176.3:c.1858G>A	X.37:g.48819928C>T	ENSP00000218176:p.Gly620Ser		48704872	A6NEF1|B2RCG0|O75671	Missense_Mutation	SNP	ENST00000218176.3	37	CCDS14314.1	.	.	.	.	.	.	.	.	.	.	c	0.026	-1.367685	0.01225	.	.	ENSG00000102057	ENST00000376477;ENST00000218176	D;D	0.95788	-3.31;-3.81	5.32	3.5	0.40072	.	0.628911	0.15141	N	0.278288	D	0.88514	0.6457	N	0.22421	0.69	0.18873	N	0.999989	B	0.02656	0.0	B	0.01281	0.0	T	0.71283	-0.4639	10	0.02654	T	1	.	9.7176	0.40284	0.0:0.8178:0.0:0.1822	.	620	Q9NSA2	KCND1_HUMAN	S	243;620	ENSP00000365660:G243S;ENSP00000218176:G620S	ENSP00000218176:G620S	G	-	1	0	KCND1	48704872	0.000000	0.05858	0.011000	0.14972	0.032000	0.12392	0.058000	0.14301	0.424000	0.26061	0.431000	0.28591	GGT		0.637	KCND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060774.1	NM_004979	
BEX1	55859	broad.mit.edu	37	X	102317854	102317854	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1565-01A-01W-0551-08	TCGA-24-1565-10A-01W-0551-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	e411496c-ce15-48c7-bd51-cb4bd6d34d65	65cd679f-5442-4a1b-ad0c-a2bd142fa3e5	g.chrX:102317854G>C	ENST00000372728.3	-	3	588	c.349C>G	c.(349-351)Cat>Gat	p.H117D		NM_018476.3	NP_060946.3	Q9HBH7	BEX1_HUMAN	brain expressed, X-linked 1	117					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II activating transcription factor binding (GO:0001102)	p.H117D(1)		endometrium(1)|large_intestine(1)|lung(7)|ovary(1)|skin(2)	12						TCATCATGATGGTCATGGTGA	0.483																																																1	Substitution - Missense(1)	ovary(1)	X											178.0	142.0	154.0					X																	102317854		2203	4300	6503	102204510	SO:0001583	missense	55859				CCDS35354.1	Xq22.1	2014-03-21			ENSG00000133169	ENSG00000133169			1036	protein-coding gene	gene with protein product		300690				16221301	Standard	NM_018476		Approved		uc004ejt.1	Q9HBH7	OTTHUMG00000022708	ENST00000372728.3:c.349C>G	X.37:g.102317854G>C	ENSP00000361813:p.His117Asp		102204510	A0AVN1|A8K4J3|Q9NZ33	Missense_Mutation	SNP	ENST00000372728.3	37	CCDS35354.1	.	.	.	.	.	.	.	.	.	.	G	14.52	2.559370	0.45590	.	.	ENSG00000133169	ENST00000372728	T	0.10005	2.92	3.21	2.33	0.28932	.	0.144198	0.32372	N	0.006191	T	0.28366	0.0701	M	0.83483	2.645	0.30969	N	0.72281	D	0.76494	0.999	D	0.69824	0.966	T	0.16100	-1.0414	10	0.66056	D	0.02	.	5.4607	0.16615	0.1592:0.0:0.8408:0.0	.	117	Q9HBH7	BEX1_HUMAN	D	117	ENSP00000361813:H117D	ENSP00000361813:H117D	H	-	1	0	BEX1	102204510	1.000000	0.71417	0.982000	0.44146	0.947000	0.59692	1.094000	0.30951	0.740000	0.32651	0.597000	0.82753	CAT		0.483	BEX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058925.1	NM_018476	
GRIA2	2891	broad.mit.edu	37	4	158257676	158257682	+	Frame_Shift_Del	DEL	CCTTTAG	CCTTTAG	-			TCGA-24-1565-01A-01W-0551-08	TCGA-24-1565-10A-01W-0551-08	CCTTTAG	CCTTTAG	-	-	CCTTTAG	CCTTTAG	Unknown	Valid	Somatic	Phase_I	Capture	Illumina_Capture			Illumina GAIIx	e411496c-ce15-48c7-bd51-cb4bd6d34d65	65cd679f-5442-4a1b-ad0c-a2bd142fa3e5	g.chr4:158257676_158257682delCCTTTAG	ENST00000264426.9	+	11	1900_1906	c.1621_1627delCCTTTAG	c.(1621-1629)cctttagccfs	p.PLA541fs	GRIA2_ENST00000393815.2_Frame_Shift_Del_p.PLA494fs|GRIA2_ENST00000296526.7_Frame_Shift_Del_p.PLA541fs|GRIA2_ENST00000507898.1_Frame_Shift_Del_p.PLA494fs|GRIA2_ENST00000449365.1_Frame_Shift_Del_p.PLA494fs	NM_001083619.1	NP_001077088	P42262	GRIA2_HUMAN	glutamate receptor, ionotropic, AMPA 2	541					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)	p.L542fs*16(1)		NS(1)|breast(2)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|liver(2)|lung(32)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	79	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.0294)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Quinidine barbiturate(DB01346)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)	CTTTCTTGATCCTTTAGCCTATGAGAT	0.454																																																1	Deletion - Frameshift(1)	ovary(1)	4																																								158477132	SO:0001589	frameshift_variant	2891				CCDS3797.1, CCDS43274.1, CCDS43275.1	4q32.1	2012-08-29			ENSG00000120251	ENSG00000120251		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4572	protein-coding gene	gene with protein product		138247		GLUR2		1311100	Standard	NM_001083619		Approved	GluA2, GLURB	uc003ipl.4	P42262	OTTHUMG00000133836	ENST00000264426.9:c.1621_1627delCCTTTAG	4.37:g.158257676_158257682delCCTTTAG	ENSP00000264426:p.Pro541fs		158477126	A8MT92|I6L997|Q96FP6	Frame_Shift_Del	DEL	ENST00000264426.9	37	CCDS43274.1																																																																																				0.454	GRIA2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000258367.2		
PRKDC	5591	broad.mit.edu	37	8	48767881	48767881	+	Frame_Shift_Del	DEL	T	T	-			TCGA-24-1565-01A-01W-0551-08	TCGA-24-1565-10A-01W-0551-08	T	T	-	-	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Illumina_Capture			Illumina GAIIx	e411496c-ce15-48c7-bd51-cb4bd6d34d65	65cd679f-5442-4a1b-ad0c-a2bd142fa3e5	g.chr8:48767881delT	ENST00000314191.2	-	51	6716	c.6660delA	c.(6658-6660)aaafs	p.K2220fs	PRKDC_ENST00000523565.1_5'UTR|PRKDC_ENST00000338368.3_Frame_Shift_Del_p.K2220fs	NM_006904.6	NP_008835.5	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic polypeptide	2221					B cell lineage commitment (GO:0002326)|brain development (GO:0007420)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|ectopic germ cell programmed cell death (GO:0035234)|heart development (GO:0007507)|immunoglobulin V(D)J recombination (GO:0033152)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of protein phosphorylation (GO:0001933)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|pro-B cell differentiation (GO:0002328)|protein destabilization (GO:0031648)|regulation of circadian rhythm (GO:0042752)|response to gamma radiation (GO:0010332)|rhythmic process (GO:0048511)|signal transduction involved in mitotic G1 DNA damage checkpoint (GO:0072431)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell receptor V(D)J recombination (GO:0033153)|telomere maintenance (GO:0000723)	cytosol (GO:0005829)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription factor binding (GO:0008134)	p.K2221fs*18(1)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(9)|cervix(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(30)|lung(56)|ovary(6)|pancreas(1)|prostate(8)|skin(7)	147		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)			Caffeine(DB00201)	GAAAGACATGTTTCATTAGGA	0.378								Non-homologous end-joining																													Esophageal Squamous(79;1091 1253 12329 31680 40677)											1	Deletion - Frameshift(1)	ovary(1)	8											72.0	65.0	67.0					8																	48767881		1830	4089	5919	48930434	SO:0001589	frameshift_variant	5591				CCDS75734.1, CCDS75735.1	8q11	2014-09-17				ENSG00000253729	2.7.11.1		9413	protein-coding gene	gene with protein product		600899		HYRC, HYRC1		7638222	Standard	NM_001081640		Approved	DNPK1, p350, DNAPK, XRCC7, DNA-PKcs	uc003xqi.3	P78527		ENST00000314191.2:c.6660delA	8.37:g.48767881delT	ENSP00000313420:p.Lys2220fs		48930434	P78528|Q13327|Q13337|Q14175|Q59H99|Q7Z611|Q96SE6|Q9UME3	Frame_Shift_Del	DEL	ENST00000314191.2	37																																																																																					0.378	PRKDC-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001081640	
