#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
SYT6	148281	genome.wustl.edu	37	1	114640380	114640380	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1616-01A-01W-0553-09	TCGA-24-1616-10A-01W-0553-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	c464b2f6-9cfe-463a-b5e3-9a76cd4480c5	502d962b-e71b-4b9d-a85f-4513c720ee09	g.chr1:114640380G>C	ENST00000610222.1	-	6	1630	c.1484C>G	c.(1483-1485)tCc>tGc	p.S495C	SYT6_ENST00000369547.1_Missense_Mutation_p.S410C|SYT6_ENST00000393296.1_Missense_Mutation_p.S495C|SYT6_ENST00000609117.1_Missense_Mutation_p.S410C|SYT6_ENST00000607941.1_Missense_Mutation_p.S410C			Q5T7P8	SYT6_HUMAN	synaptotagmin VI	495	Necessary for cell membrane association (isoform 2). {ECO:0000250}.				acrosomal vesicle exocytosis (GO:0060478)	cell junction (GO:0030054)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|integral component of membrane (GO:0016021)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	clathrin binding (GO:0030276)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|syntaxin binding (GO:0019905)|transporter activity (GO:0005215)	p.S410C(1)		central_nervous_system(1)|endometrium(3)|large_intestine(10)|lung(14)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	37	Lung SC(450;0.184)	all_cancers(81;4.41e-08)|all_epithelial(167;5.18e-08)|all_lung(203;1.58e-05)|Lung NSC(69;2.82e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CTCCACCAAGGAGTGCCAGTG	0.582																																																1	Substitution - Missense(1)	ovary(1)	1											138.0	124.0	129.0					1																	114640380		2203	4300	6503	114441903	SO:0001583	missense	148281				CCDS871.1	1p13.1	2013-01-21			ENSG00000134207	ENSG00000134207		"""Synaptotagmins"""	18638	protein-coding gene	gene with protein product		607718				11543631	Standard	NM_205848		Approved		uc021orz.1	Q5T7P8	OTTHUMG00000011755	ENST00000610222.1:c.1484C>G	1.37:g.114640380G>C	ENSP00000476396:p.Ser495Cys		114441903	B1AMB8|B3KPK1	Missense_Mutation	SNP	-	p.S410C	ENST00000610222.1	37	c.1229		1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.932094	0.73442	.	.	ENSG00000134207	ENST00000369547;ENST00000393296;ENST00000369546;ENST00000369545	T;T;T;T	0.72394	-0.65;-0.65;-0.65;-0.65	5.37	4.45	0.53987	C2 calcium/lipid-binding domain, CaLB (1);	0.112214	0.64402	N	0.000009	T	0.68403	0.2997	L	0.46157	1.445	0.38547	D	0.94937	P;P	0.47106	0.89;0.808	P;P	0.54460	0.571;0.753	T	0.73541	-0.3950	10	0.62326	D	0.03	.	16.2874	0.82727	0.0:0.1323:0.8677:0.0	.	495;410	Q5T7P8;Q5T7P8-2	SYT6_HUMAN;.	C	410;495;410;495	ENSP00000358560:S410C;ENSP00000376974:S495C;ENSP00000358559:S410C;ENSP00000358558:S495C	ENSP00000358558:S495C	S	-	2	0	SYT6	114441903	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.669000	0.68081	1.234000	0.43709	0.462000	0.41574	TCC	-	NULL		0.582	SYT6-004	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	SYT6	protein_coding	OTTHUMT00000314819.2	G	NM_205848		114441903	-1	no_errors	NM_205848	genbank	human	validated	54_36p	missense	SNP	1	C
SYT6	148281	genome.wustl.edu	37	1	114641884	114641884	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1616-01A-01W-0553-09	TCGA-24-1616-10A-01W-0553-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	c464b2f6-9cfe-463a-b5e3-9a76cd4480c5	502d962b-e71b-4b9d-a85f-4513c720ee09	g.chr1:114641884G>C	ENST00000610222.1	-	5	1342	c.1196C>G	c.(1195-1197)cCc>cGc	p.P399R	SYT6_ENST00000369547.1_Missense_Mutation_p.P314R|SYT6_ENST00000393296.1_Missense_Mutation_p.P399R|SYT6_ENST00000609117.1_Missense_Mutation_p.P314R|SYT6_ENST00000607941.1_Missense_Mutation_p.P314R			Q5T7P8	SYT6_HUMAN	synaptotagmin VI	399	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				acrosomal vesicle exocytosis (GO:0060478)	cell junction (GO:0030054)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|integral component of membrane (GO:0016021)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	clathrin binding (GO:0030276)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|syntaxin binding (GO:0019905)|transporter activity (GO:0005215)	p.P314R(1)		central_nervous_system(1)|endometrium(3)|large_intestine(10)|lung(14)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	37	Lung SC(450;0.184)	all_cancers(81;4.41e-08)|all_epithelial(167;5.18e-08)|all_lung(203;1.58e-05)|Lung NSC(69;2.82e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TTTCACATAGGGATCTGTGCC	0.458																																																1	Substitution - Missense(1)	ovary(1)	1											145.0	131.0	136.0					1																	114641884		2203	4300	6503	114443407	SO:0001583	missense	148281				CCDS871.1	1p13.1	2013-01-21			ENSG00000134207	ENSG00000134207		"""Synaptotagmins"""	18638	protein-coding gene	gene with protein product		607718				11543631	Standard	NM_205848		Approved		uc021orz.1	Q5T7P8	OTTHUMG00000011755	ENST00000610222.1:c.1196C>G	1.37:g.114641884G>C	ENSP00000476396:p.Pro399Arg		114443407	B1AMB8|B3KPK1	Missense_Mutation	SNP	-	p.P314R	ENST00000610222.1	37	c.941		1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.153510	0.78114	.	.	ENSG00000134207	ENST00000369547;ENST00000393296;ENST00000369546;ENST00000369545	T;T;T;T	0.78003	-1.14;-1.14;-1.14;-1.14	5.77	5.77	0.91146	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	D	0.94335	0.8179	H	0.99800	4.79	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96709	0.9524	10	0.87932	D	0	.	19.9837	0.97340	0.0:0.0:1.0:0.0	.	399	Q5T7P8	SYT6_HUMAN	R	314;399;314;399	ENSP00000358560:P314R;ENSP00000376974:P399R;ENSP00000358559:P314R;ENSP00000358558:P399R	ENSP00000358558:P399R	P	-	2	0	SYT6	114443407	1.000000	0.71417	0.969000	0.41365	0.797000	0.45037	9.869000	0.99810	2.723000	0.93209	0.655000	0.94253	CCC	-	NULL		0.458	SYT6-004	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	SYT6	protein_coding	OTTHUMT00000314819.2	G	NM_205848		114443407	-1	no_errors	NM_205848	genbank	human	validated	54_36p	missense	SNP	1	C
AMPD1	270	genome.wustl.edu	37	1	115231552	115231552	+	Intron	SNP	T	T	C			TCGA-24-1616-01A-01W-0553-09	TCGA-24-1616-10A-01W-0553-09	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	c464b2f6-9cfe-463a-b5e3-9a76cd4480c5	502d962b-e71b-4b9d-a85f-4513c720ee09	g.chr1:115231552T>C	ENST00000520113.2	-	3	149				AMPD1_ENST00000353928.6_Intron|AMPD1_ENST00000369538.3_Intron			P23109	AMPD1_HUMAN	adenosine monophosphate deaminase 1						IMP salvage (GO:0032264)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|response to organic substance (GO:0010033)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	AMP deaminase activity (GO:0003876)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(17)|ovary(3)|pancreas(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	45	all_epithelial(7;7.83e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)	Adenosine monophosphate(DB00131)	ACCTTGAAAATATGCTCTCAG	0.493																																																0			1											213.0	195.0	200.0					1																	115231552		876	1991	2867	115033075	SO:0001627	intron_variant	270			M60092	CCDS876.1, CCDS876.2, CCDS53349.1	1p13	2010-02-10	2010-02-10		ENSG00000116748	ENSG00000116748	3.5.4.6		468	protein-coding gene	gene with protein product	"""AMPD isoform M"", ""skeletal muscle AMPD"""	102770	"""adenosine monophosphate deaminase 1 (isoform M)"""			1400401	Standard	NM_001172626		Approved	MAD, MADA	uc001efe.2	P23109	OTTHUMG00000011892	ENST00000520113.2:c.134-190A>G	1.37:g.115231552T>C			115033075	A8K5N4|B2RAM1|F2Z3B3|Q5TF00|Q5TF02	Missense_Mutation	SNP	-	p.I2V	ENST00000520113.2	37	c.4	CCDS876.2	1																																																																																			-	NULL		0.493	AMPD1-001	KNOWN	basic|CCDS	protein_coding	AMPD1	protein_coding	OTTHUMT00000032860.4	T			115033075	-1	no_start_codon	ENST00000393268	ensembl	human	known	54_36p	missense	SNP	0.05	C
IGSF3	3321	genome.wustl.edu	37	1	117159062	117159062	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1616-01A-01W-0553-09	TCGA-24-1616-10A-01W-0553-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	c464b2f6-9cfe-463a-b5e3-9a76cd4480c5	502d962b-e71b-4b9d-a85f-4513c720ee09	g.chr1:117159062G>A	ENST00000369486.3	-	3	826	c.61C>T	c.(61-63)Cgg>Tgg	p.R21W	IGSF3_ENST00000369483.1_Missense_Mutation_p.R21W|IGSF3_ENST00000318837.6_Missense_Mutation_p.R21W	NM_001007237.1	NP_001007238.1	O75054	IGSF3_HUMAN	immunoglobulin superfamily, member 3	21	Ig-like C2-type 1.				lacrimal gland development (GO:0032808)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)		p.R21W(1)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	62	Lung SC(450;0.225)	all_cancers(81;1.24e-06)|all_epithelial(167;4.85e-07)|all_lung(203;1.66e-06)|Lung NSC(69;1.11e-05)		Lung(183;0.0142)|Colorectal(144;0.0929)|LUSC - Lung squamous cell carcinoma(189;0.108)|COAD - Colon adenocarcinoma(174;0.139)|all cancers(265;0.159)|Epithelial(280;0.166)		GTGACCTGCCGCTGTGCTGAC	0.522																																																1	Substitution - Missense(1)	ovary(1)	1											22.0	23.0	23.0					1																	117159062		2056	4082	6138	116960585	SO:0001583	missense	3321			AF031174	CCDS30813.1, CCDS30814.1	1p13	2013-01-29			ENSG00000143061	ENSG00000143061		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5950	protein-coding gene	gene with protein product		603491				9790749	Standard	NM_001007237		Approved	V8, EWI-3, MGC117164	uc031pnr.1	O75054	OTTHUMG00000022751	ENST00000369486.3:c.61C>T	1.37:g.117159062G>A	ENSP00000358498:p.Arg21Trp		116960585	A6NJZ6|A6NMC7	Missense_Mutation	SNP	-	p.R21W	ENST00000369486.3	37	c.61	CCDS30813.1	1	.	.	.	.	.	.	.	.	.	.	G	13.44	2.236402	0.39498	.	.	ENSG00000143061	ENST00000369486;ENST00000369483;ENST00000318837	T;T;T	0.13307	2.63;2.6;2.6	4.66	1.37	0.22104	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.134875	0.48286	D	0.000189	T	0.09730	0.0239	M	0.89534	3.04	0.54753	D	0.999988	B;B	0.24651	0.019;0.108	B;B	0.14023	0.002;0.01	T	0.02567	-1.1140	10	0.87932	D	0	-30.48	6.8773	0.24153	0.0924:0.0:0.5924:0.3152	.	21;21	O75054;A6NJZ6	IGSF3_HUMAN;.	W	21	ENSP00000358498:R21W;ENSP00000358495:R21W;ENSP00000321184:R21W	ENSP00000321184:R21W	R	-	1	2	IGSF3	116960585	1.000000	0.71417	0.995000	0.50966	0.977000	0.68977	3.114000	0.50383	0.539000	0.28788	0.455000	0.32223	CGG	-	NULL		0.522	IGSF3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	IGSF3	protein_coding	OTTHUMT00000059040.1	G	NM_001542		116960585	-1	no_errors	NM_001542	genbank	human	validated	54_36p	missense	SNP	1	A
NOTCH2NL	388677	genome.wustl.edu	37	1	145273262	145273262	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1616-01A-01W-0553-09	TCGA-24-1616-10A-01W-0553-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	c464b2f6-9cfe-463a-b5e3-9a76cd4480c5	502d962b-e71b-4b9d-a85f-4513c720ee09	g.chr1:145273262C>A	ENST00000369340.3	+	4	560	c.116C>A	c.(115-117)aCt>aAt	p.T39N	RP11-458D21.5_ENST00000468030.1_Missense_Mutation_p.T39N|NOTCH2NL_ENST00000344859.3_Missense_Mutation_p.T39N|NOTCH2NL_ENST00000362074.6_Missense_Mutation_p.T39N			Q7Z3S9	NT2NL_HUMAN	notch 2 N-terminal like	39	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|Notch signaling pathway (GO:0007219)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	calcium ion binding (GO:0005509)	p.T39N(1)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	27						AATGGTGGGACTTGTGTGGCC	0.537																																																1	Substitution - Missense(1)	ovary(1)	1											103.0	102.0	102.0					1																	145273262		2202	4278	6480	143984619	SO:0001583	missense	388677				CCDS72880.1	1q21.2	2010-06-24	2010-06-24		ENSG00000213240	ENSG00000213240			31862	protein-coding gene	gene with protein product			"""Notch homolog 2 (Drosophila) N-terminal like"""			14673143	Standard	NM_203458		Approved	N2N	uc001emn.4	Q7Z3S9	OTTHUMG00000013754	ENST00000369340.3:c.116C>A	1.37:g.145273262C>A	ENSP00000358346:p.Thr39Asn		143984619	Q5BKT8|Q5VTG9|Q5XG84|Q6P192|Q8NC23|Q8WUQ9|Q96FY1	Missense_Mutation	SNP	HMMPfam_EGF;HMMPfam_EGF_CA;superfamily_EGF/Laminin	p.T39N	ENST00000369340.3	37	c.116	CCDS909.1	1	.	.	.	.	.	.	.	.	.	.	C	16.25	3.070713	0.55539	.	.	ENSG00000213240	ENST00000362074;ENST00000344859;ENST00000369340	T;T;T	0.57595	0.39;0.39;0.39	2.75	2.75	0.32379	EGF (1);Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	.	.	.	.	T	0.57829	0.2080	M	0.66439	2.03	0.27575	N	0.949765	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	T	0.45220	-0.9276	9	0.59425	D	0.04	.	11.2552	0.49050	0.0:1.0:0.0:0.0	.	39;39	Q7Z3S9-2;Q7Z3S9	.;NT2NL_HUMAN	N	39	ENSP00000354929:T39N;ENSP00000344557:T39N;ENSP00000358346:T39N	ENSP00000344557:T39N	T	+	2	0	NOTCH2NL	143984619	0.872000	0.30054	0.987000	0.45799	0.908000	0.53690	2.062000	0.41413	1.532000	0.49169	0.394000	0.25966	ACT	-	HMMPfam_EGF		0.537	NOTCH2NL-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NOTCH2NL	protein_coding	OTTHUMT00000038546.1	C	NM_203458		143984619	1	no_errors	NM_203458	genbank	human	validated	54_36p	missense	SNP	1	A
ASTN1	460	genome.wustl.edu	37	1	176838105	176838105	+	Silent	SNP	C	C	T			TCGA-24-1616-01A-01W-0553-09	TCGA-24-1616-10A-01W-0553-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	c464b2f6-9cfe-463a-b5e3-9a76cd4480c5	502d962b-e71b-4b9d-a85f-4513c720ee09	g.chr1:176838105C>T	ENST00000367654.3	-	22	3757	c.3546G>A	c.(3544-3546)caG>caA	p.Q1182Q	ASTN1_ENST00000424564.2_Silent_p.Q1174Q|ASTN1_ENST00000367657.3_Silent_p.Q1174Q|ASTN1_ENST00000361833.2_Silent_p.Q1174Q	NM_004319.1	NP_004310.1	O14525	ASTN1_HUMAN	astrotactin 1	1182					locomotory behavior (GO:0007626)|neuron cell-cell adhesion (GO:0007158)|neuron migration (GO:0001764)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)		p.Q1174Q(1)		NS(4)|breast(5)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(23)|liver(1)|lung(81)|ovary(6)|prostate(5)|skin(10)|urinary_tract(3)	153						TGTAGGCGGTCTGCTGCTCCT	0.463																																																1	Substitution - coding silent(1)	ovary(1)	1											150.0	136.0	141.0					1																	176838105		2203	4300	6503	175104728	SO:0001819	synonymous_variant	460			AB006627	CCDS1319.1, CCDS44280.1, CCDS65732.1	1q25.2	2008-02-05	2006-08-24	2006-08-24	ENSG00000152092	ENSG00000152092			773	protein-coding gene	gene with protein product		600904	"""astrotactin"""	ASTN		9070947	Standard	NM_001286164		Approved		uc001glc.3	O14525	OTTHUMG00000035041	ENST00000367654.3:c.3546G>A	1.37:g.176838105C>T			175104728	A5PL12|B4DHI9|E9PFR8|O60799|Q5W0V7|Q5W0V8	Silent	SNP	superfamily_Fibronectin type III;superfamily_EGF/Laminin	p.Q1174	ENST00000367654.3	37	c.3522		1																																																																																			-	NULL		0.463	ASTN1-201	KNOWN	basic	protein_coding	ASTN1	protein_coding		C	NM_004319		175104728	-1	no_errors	NM_004319	genbank	human	validated	54_36p	silent	SNP	1	T
TEDDM1	127670	genome.wustl.edu	37	1	182368911	182368911	+	Missense_Mutation	SNP	T	T	C			TCGA-24-1616-01A-01W-0553-09	TCGA-24-1616-10A-01W-0553-09	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	c464b2f6-9cfe-463a-b5e3-9a76cd4480c5	502d962b-e71b-4b9d-a85f-4513c720ee09	g.chr1:182368911T>C	ENST00000367565.1	-	1	840	c.710A>G	c.(709-711)aAa>aGa	p.K237R		NM_172000.3	NP_741997.3	Q5T9Z0	TEDM1_HUMAN	transmembrane epididymal protein 1	237						integral component of membrane (GO:0016021)		p.K237R(1)		haematopoietic_and_lymphoid_tissue(1)|lung(4)|ovary(2)	7						TGGAGCTTCTTTGGGCCCAGT	0.488																																																1	Substitution - Missense(1)	ovary(1)	1											76.0	71.0	73.0					1																	182368911		2203	4300	6503	180635534	SO:0001583	missense	127670			AJ515384	CCDS30953.1	1q25.3	2009-09-17		2005-08-09	ENSG00000203730	ENSG00000203730			30233	protein-coding gene	gene with protein product	"""putative membrane protein HE9"", ""transmembrane protein 45C"", ""epididymal protein 9"""						Standard	NM_172000		Approved	HE9, Epdd1, TMEM45C, EDDM9	uc001gpe.3	Q5T9Z0	OTTHUMG00000037398	ENST00000367565.1:c.710A>G	1.37:g.182368911T>C	ENSP00000356536:p.Lys237Arg		180635534	Q8IVJ0	Missense_Mutation	SNP	-	p.K237R	ENST00000367565.1	37	c.710	CCDS30953.1	1	.	.	.	.	.	.	.	.	.	.	T	10.53	1.375150	0.24857	.	.	ENSG00000203730	ENST00000367565	T	0.49720	0.77	4.73	1.05	0.20165	.	1.001230	0.08058	N	0.997728	T	0.26991	0.0661	N	0.19112	0.55	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.24190	-1.0167	10	0.14656	T	0.56	-1.6573	3.5066	0.07693	0.0:0.2182:0.1994:0.5824	.	237	Q5T9Z0	TEDM1_HUMAN	R	237	ENSP00000356536:K237R	ENSP00000356536:K237R	K	-	2	0	TEDDM1	180635534	0.262000	0.24073	0.001000	0.08648	0.010000	0.07245	0.301000	0.19174	0.016000	0.14998	0.460000	0.39030	AAA	-	NULL		0.488	TEDDM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TEDDM1	protein_coding	OTTHUMT00000091029.1	T	NM_172000		180635534	-1	no_errors	NM_172000	genbank	human	validated	54_36p	missense	SNP		C
PTPRC	5788	genome.wustl.edu	37	1	198671561	198671561	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1616-01A-01W-0553-09	TCGA-24-1616-10A-01W-0553-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	c464b2f6-9cfe-463a-b5e3-9a76cd4480c5	502d962b-e71b-4b9d-a85f-4513c720ee09	g.chr1:198671561C>A	ENST00000367376.2	+	6	650	c.479C>A	c.(478-480)cCa>cAa	p.P160Q	PTPRC_ENST00000348564.6_Intron|PTPRC_ENST00000594404.1_Intron|PTPRC_ENST00000352140.3_Intron|PTPRC_ENST00000391970.3_3'UTR|PTPRC_ENST00000442510.2_Missense_Mutation_p.P162Q	NM_002838.4	NP_002829.3	P08575	PTPRC_HUMAN	protein tyrosine phosphatase, receptor type, C	160					axon guidance (GO:0007411)|B cell proliferation (GO:0042100)|B cell receptor signaling pathway (GO:0050853)|bone marrow development (GO:0048539)|cell cycle phase transition (GO:0044770)|cell surface receptor signaling pathway (GO:0007166)|defense response to virus (GO:0051607)|dephosphorylation (GO:0016311)|hematopoietic progenitor cell differentiation (GO:0002244)|immunoglobulin biosynthetic process (GO:0002378)|negative regulation of cell adhesion involved in substrate-bound cell migration (GO:0006933)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of antigen receptor-mediated signaling pathway (GO:0050857)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of hematopoietic stem cell migration (GO:2000473)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of T cell proliferation (GO:0042102)|protein dephosphorylation (GO:0006470)|regulation of cell cycle (GO:0051726)|release of sequestered calcium ion into cytosol (GO:0051209)|stem cell development (GO:0048864)|T cell differentiation (GO:0030217)|T cell receptor signaling pathway (GO:0050852)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.P160Q(1)		breast(7)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(22)|lung(41)|ovary(4)|pancreas(2)|prostate(1)|skin(13)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	111						CCTACAGACCCAGTTTCCCCA	0.557																																																1	Substitution - Missense(1)	ovary(1)	1											408.0	315.0	346.0					1																	198671561		2203	4300	6503	196938184	SO:0001583	missense	5788			Y00062	CCDS1397.1, CCDS1398.1, CCDS44291.1, CCDS1397.2, CCDS1398.2, CCDS44291.2	1q31-q32	2014-09-17			ENSG00000081237	ENSG00000081237		"""CD molecules"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9666	protein-coding gene	gene with protein product		151460		CD45		2169617	Standard	NM_001267798		Approved	LCA, T200, GP180	uc001gur.2	P08575	OTTHUMG00000035702	ENST00000367376.2:c.479C>A	1.37:g.198671561C>A	ENSP00000356346:p.Pro160Gln		196938184	A8K7W6|Q16614|Q9H0Y6	Missense_Mutation	SNP	HMMPfam_Y_phosphatase;HMMPfam_fn3;superfamily_Fibronectin type III;superfamily_(Phosphotyrosine protein) phosphatases II	p.P160Q	ENST00000367376.2	37	c.479		1	.	.	.	.	.	.	.	.	.	.	C	13.10	2.135571	0.37728	.	.	ENSG00000081237	ENST00000367376;ENST00000367366;ENST00000271610;ENST00000442510;ENST00000367367	.	.	.	5.75	3.88	0.44766	.	1.491290	0.04118	N	0.315827	T	0.49304	0.1549	L	0.54323	1.7	0.19300	N	0.99998	D;D;P	0.55172	0.97;0.967;0.627	P;B;B	0.49708	0.62;0.403;0.184	T	0.19647	-1.0299	9	0.32370	T	0.25	.	8.39	0.32522	0.0:0.8217:0.0:0.1783	.	96;201;160	F5GXZ3;Q6Q1P2;P08575	.;.;PTPRC_HUMAN	Q	162;96;201;160;94	.	ENSP00000271610:P201Q	P	+	2	0	PTPRC	196938184	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	0.116000	0.15561	0.781000	0.33589	0.650000	0.86243	CCA	-	NULL		0.557	PTPRC-202	KNOWN	basic|appris_candidate	protein_coding	PTPRC	protein_coding		C			196938184	1	no_errors	NM_002838	genbank	human	reviewed	54_36p	missense	SNP		A
NFASC	23114	genome.wustl.edu	37	1	204970333	204970333	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1616-01A-01W-0553-09	TCGA-24-1616-10A-01W-0553-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	c464b2f6-9cfe-463a-b5e3-9a76cd4480c5	502d962b-e71b-4b9d-a85f-4513c720ee09	g.chr1:204970333C>T	ENST00000401399.1	+	25	3254	c.3055C>T	c.(3055-3057)Ctc>Ttc	p.L1019F	NFASC_ENST00000539706.1_Intron|NFASC_ENST00000495396.1_Intron|NFASC_ENST00000367172.4_Missense_Mutation_p.L1126F|NFASC_ENST00000367171.4_Missense_Mutation_p.L1111F|NFASC_ENST00000338586.6_Intron|NFASC_ENST00000404907.1_Intron|NFASC_ENST00000513543.1_Intron|NFASC_ENST00000367170.4_Missense_Mutation_p.L1047F|NFASC_ENST00000339876.6_Missense_Mutation_p.L1019F|NFASC_ENST00000338515.6_Intron|NFASC_ENST00000367169.4_Intron|NFASC_ENST00000360049.4_Intron|NFASC_ENST00000404076.1_Intron			O94856	NFASC_HUMAN	neurofascin	1126	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|myelination (GO:0042552)|paranodal junction assembly (GO:0030913)|peripheral nervous system development (GO:0007422)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|synapse organization (GO:0050808)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|node of Ranvier (GO:0033268)|paranodal junction (GO:0033010)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)				NS(1)|breast(4)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	81	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			CGTCACGGTGCTCCCCAACAG	0.537																																																0			1											93.0	79.0	83.0					1																	204970333		1567	3582	5149	203236956	SO:0001583	missense	23114			AK027553	CCDS30982.1, CCDS53460.1, CCDS53461.1, CCDS53462.1	1q32.1	2013-02-11	2010-06-24		ENSG00000163531	ENSG00000163531		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	29866	protein-coding gene	gene with protein product		609145	"""neurofascin homolog (chicken)"""			1377696, 8672144	Standard	NM_015090		Approved	NRCAML, KIAA0756, FLJ46866, NF	uc001hbj.3	O94856	OTTHUMG00000151697	ENST00000401399.1:c.3055C>T	1.37:g.204970333C>T	ENSP00000385637:p.Leu1019Phe		203236956	B2RNN8|B3KQZ1|B5MDP6|B5MDR6|B7ZMD8|Q149P5|Q5T2F0|Q5T2F1|Q5T2F2|Q5T2F3|Q5T2F4|Q5T2F5|Q5T2F6|Q5T2F7|Q5T2F9|Q5T2G0|Q5W9F8|Q68DH3|Q6ZQV6|Q7Z3K1|Q96HT1|Q96K50	Missense_Mutation	SNP	HMMPfam_fn3;superfamily_Fibronectin type III;HMMPfam_I-set;HMMPfam_ig;superfamily_Immunoglobulin	p.L1126F	ENST00000401399.1	37	c.3376	CCDS53460.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	7.903|7.903	0.734895|0.734895	0.15574|0.15574	.|.	.|.	ENSG00000163531|ENSG00000163531	ENST00000413225|ENST00000367172;ENST00000367171;ENST00000367170;ENST00000339876;ENST00000401399	.|T;T;T;T;T	.|0.57907	.|0.37;0.37;0.37;0.37;0.37	5.21|5.21	3.1|3.1	0.35709|0.35709	.|.	.|0.873765	.|0.09491	.|N	.|0.794959	T|T	0.39708|0.39708	0.1088|0.1088	L|L	0.29908|0.29908	0.895|0.895	0.58432|0.58432	D|D	0.999993|0.999993	.|B	.|0.22983	.|0.078	.|B	.|0.27608	.|0.081	T|T	0.40515|0.40515	-0.9559|-0.9559	5|10	.|0.52906	.|T	.|0.07	.|.	4.4263|4.4263	0.11505|0.11505	0.1744:0.541:0.0:0.2845|0.1744:0.541:0.0:0.2845	.|.	.|1019	.|O94856-9	.|.	V|F	65|1126;1111;1047;1019;1019	.|ENSP00000356140:L1126F;ENSP00000356139:L1111F;ENSP00000356138:L1047F;ENSP00000344786:L1019F;ENSP00000385637:L1019F	.|ENSP00000344786:L1019F	A|L	+|+	2|1	0|0	NFASC|NFASC	203236956|203236956	0.981000|0.981000	0.34729|0.34729	0.998000|0.998000	0.56505|0.56505	0.999000|0.999000	0.98932|0.98932	0.312000|0.312000	0.19397|0.19397	1.183000|1.183000	0.42943|0.42943	0.655000|0.655000	0.94253|0.94253	GCT|CTC	-	HMMPfam_fn3		0.537	NFASC-001	KNOWN	basic|CCDS	protein_coding	NFASC	protein_coding	OTTHUMT00000131237.1	C	NM_001005388		203236956	1	no_errors	ENST00000367172	ensembl	human	known	54_36p	missense	SNP	0.51	T
PLPPR4	9890	genome.wustl.edu	37	1	99772257	99772257	+	Silent	SNP	C	C	T			TCGA-24-1616-01A-01W-0553-09	TCGA-24-1616-10A-01W-0553-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	c464b2f6-9cfe-463a-b5e3-9a76cd4480c5	502d962b-e71b-4b9d-a85f-4513c720ee09	g.chr1:99772257C>T	ENST00000370185.3	+	7	2480	c.1983C>T	c.(1981-1983)taC>taT	p.Y661Y	LPPR4_ENST00000370184.1_Silent_p.Y503Y|LPPR4_ENST00000457765.1_Silent_p.Y603Y	NM_014839.4	NP_055654.2	Q7Z2D5	LPPR4_HUMAN		661					axonogenesis (GO:0007409)|inner ear development (GO:0048839)|phospholipid dephosphorylation (GO:0046839)	integral component of plasma membrane (GO:0005887)	lipid phosphatase activity (GO:0042577)|phosphatidate phosphatase activity (GO:0008195)	p.Y661Y(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(39)|ovary(3)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	72		all_epithelial(167;3.54e-06)|all_lung(203;0.00139)|Lung NSC(277;0.00202)		Epithelial(280;0.0736)|all cancers(265;0.0975)|COAD - Colon adenocarcinoma(174;0.142)|Lung(183;0.201)|Colorectal(170;0.22)		GCCAAACTTACGAGCTCAACG	0.507																																																1	Substitution - coding silent(1)	ovary(1)	1											70.0	68.0	69.0					1																	99772257		2203	4300	6503	99544845	SO:0001819	synonymous_variant	9890																														ENST00000370185.3:c.1983C>T	1.37:g.99772257C>T			99544845	E7EPS1|O75043|Q5T9R9|Q86XQ5|Q8N3F1|Q96MP0	Silent	SNP	HMMPfam_PAP2;superfamily_Acid phosphatase/Vanadium-dependent haloperoxidase	p.Y661	ENST00000370185.3	37	c.1983	CCDS757.1	1																																																																																			-	NULL		0.507	LPPR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPPR4	protein_coding	OTTHUMT00000029670.2	C			99544845	1	no_errors	NM_014839	genbank	human	reviewed	54_36p	silent	SNP	0.99	T
IKBKE	9641	genome.wustl.edu	37	1	206652405	206652405	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1616-01A-01W-0553-09	TCGA-24-1616-10A-01W-0553-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	c464b2f6-9cfe-463a-b5e3-9a76cd4480c5	502d962b-e71b-4b9d-a85f-4513c720ee09	g.chr1:206652405C>T	ENST00000367120.3	+	10	1485	c.1112C>T	c.(1111-1113)gCc>gTc	p.A371V	IKBKE_ENST00000537984.1_Missense_Mutation_p.A286V	NM_001193322.1|NM_014002.3	NP_001180251.1|NP_054721.1	Q14164	IKKE_HUMAN	inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase epsilon	371			A -> T (in dbSNP:rs17021877). {ECO:0000269|PubMed:17344846, ECO:0000269|Ref.4}.		immune response (GO:0006955)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of type I interferon production (GO:0032480)|NIK/NF-kappaB signaling (GO:0038061)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein phosphorylation (GO:0006468)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|IkappaB kinase activity (GO:0008384)|NF-kappaB-inducing kinase activity (GO:0004704)	p.A371V(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(13)|ovary(3)|skin(2)	32	Breast(84;0.137)					CAGCACATCGCCCACACGACG	0.632																																																1	Substitution - Missense(1)	ovary(1)	1											95.0	85.0	88.0					1																	206652405		2203	4300	6503	204719028	SO:0001583	missense	9641			AB016590	CCDS30996.1, CCDS53464.1, CCDS73019.1	1q31	2014-05-06			ENSG00000143466				14552	protein-coding gene	gene with protein product		605048				10421793, 10882136	Standard	NM_001193321		Approved	IKKE, IKK-i, KIAA0151	uc001hdz.2	Q14164	OTTHUMG00000184613	ENST00000367120.3:c.1112C>T	1.37:g.206652405C>T	ENSP00000356087:p.Ala371Val		204719028	D3DT78|Q3B754|Q3KR43|Q5JTS6	Missense_Mutation	SNP	Pkinase;HMMPfam_Pkinase	p.A371V	ENST00000367120.3	37	c.1112	CCDS30996.1	1	.	.	.	.	.	.	.	.	.	.	C	16.69	3.193519	0.58017	.	.	ENSG00000143466	ENST00000367120;ENST00000537984	T;T	0.63417	-0.04;0.1	5.79	1.72	0.24424	.	0.849418	0.11060	N	0.604030	T	0.44726	0.1307	N	0.22421	0.69	0.23731	N	0.996992	B;B	0.06786	0.001;0.001	B;B	0.06405	0.001;0.002	T	0.26052	-1.0114	10	0.25106	T	0.35	4.5422	8.9536	0.35805	0.0:0.5014:0.3647:0.1339	.	286;371	Q3B754;Q14164	.;IKKE_HUMAN	V	371;286	ENSP00000356087:A371V;ENSP00000444529:A286V	ENSP00000356087:A371V	A	+	2	0	IKBKE	204719028	0.325000	0.24660	0.751000	0.31187	0.976000	0.68499	0.899000	0.28417	0.333000	0.23563	0.655000	0.94253	GCC	-	NULL		0.632	IKBKE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IKBKE	protein_coding	OTTHUMT00000088484.1	C			204719028	1	no_errors	NM_014002	genbank	human	validated	54_36p	missense	SNP	1	T
NUTM2HP	729023	genome.wustl.edu	37	10	52444864	52444864	+	IGR	SNP	A	A	T			TCGA-24-1616-01A-01W-0553-09	TCGA-24-1616-10A-01W-0553-09	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	c464b2f6-9cfe-463a-b5e3-9a76cd4480c5	502d962b-e71b-4b9d-a85f-4513c720ee09	g.chr10:52444864A>T								RP11-564C4.6 (24836 upstream) : ASAH2B (54213 downstream)																							CCCTGGGCTGAGGGCTGCCCG	0.632																																																0			10																																								52114870	SO:0001628	intergenic_variant	729023																															10.37:g.52444864A>T			52114870		RNA	SNP	-	NULL		37	NULL		10																																																																																			-	-	0	0.632					LOC729023			A			52114870	1	pseudogene	XR_038278	genbank	human	model	54_36p	rna	SNP		T
ACADSB	36	genome.wustl.edu	37	10	124802682	124802682	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1616-01A-01W-0553-09	TCGA-24-1616-10A-01W-0553-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	c464b2f6-9cfe-463a-b5e3-9a76cd4480c5	502d962b-e71b-4b9d-a85f-4513c720ee09	g.chr10:124802682G>A	ENST00000358776.4	+	6	816	c.802G>A	c.(802-804)Gtc>Atc	p.V268I	ACADSB_ENST00000368869.4_Missense_Mutation_p.V166I|ACADSB_ENST00000496730.2_3'UTR	NM_001609.3	NP_001600.1	P45954	ACDSB_HUMAN	acyl-CoA dehydrogenase, short/branched chain	268					branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|fatty acid metabolic process (GO:0006631)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)	p.V268I(1)		breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|lung(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	17		all_neural(114;0.0765)|Colorectal(57;0.102)|all_lung(145;0.11)|Lung NSC(174;0.163)		Colorectal(40;0.0811)|COAD - Colon adenocarcinoma(40;0.0835)	L-Isoleucine(DB00167)|Valproic Acid(DB00313)	ATTCGAAAATGTCAAGGTGGG	0.443																																																1	Substitution - Missense(1)	ovary(1)	10											87.0	85.0	86.0					10																	124802682		2203	4300	6503	124792672	SO:0001583	missense	36			U12778	CCDS7634.1	10q25-q26	2014-09-17	2010-04-30		ENSG00000196177	ENSG00000196177	1.3.99.-		91	protein-coding gene	gene with protein product		600301	"""acyl-Coenzyme A dehydrogenase, short/branched chain"""			7698750, 7759115	Standard	NM_001609		Approved	SBCAD, ACAD7	uc001lhb.3	P45954	OTTHUMG00000019200	ENST00000358776.4:c.802G>A	10.37:g.124802682G>A	ENSP00000357873:p.Val268Ile		124792672	B4DQ51|Q5SQN6|Q96CX7	Missense_Mutation	SNP	HMMPfam_Acyl-CoA_dh_1;HMMPfam_Acyl-CoA_dh_M;HMMPfam_Acyl-CoA_dh_N;superfamily_Acyl-CoA dehydrogenase C-terminal domain-like;superfamily_Acyl-CoA dehydrogenase NM domain-like	p.V268I	ENST00000358776.4	37	c.802	CCDS7634.1	10	.	.	.	.	.	.	.	.	.	.	G	20.3	3.974656	0.74360	.	.	ENSG00000196177	ENST00000368869;ENST00000358776	D;D	0.99369	-5.78;-5.78	5.76	5.76	0.90799	Acyl-CoA dehydrogenase/oxidase (1);Acyl-CoA dehydrogenase/oxidase C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.99010	0.9662	M	0.93241	3.395	0.80722	D	1	B	0.31054	0.306	B	0.24006	0.05	D	0.98860	1.0762	10	0.62326	D	0.03	.	19.9857	0.97347	0.0:0.0:1.0:0.0	.	268	P45954	ACDSB_HUMAN	I	166;268	ENSP00000357862:V166I;ENSP00000357873:V268I	ENSP00000357873:V268I	V	+	1	0	ACADSB	124792672	1.000000	0.71417	1.000000	0.80357	0.916000	0.54674	6.578000	0.74032	2.706000	0.92434	0.655000	0.94253	GTC	-	NULL		0.443	ACADSB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACADSB	protein_coding	OTTHUMT00000050843.1	G	NM_001609		124792672	1	no_errors	NM_001609	genbank	human	reviewed	54_36p	missense	SNP	1	A
IGHGP	3505	genome.wustl.edu	37	14	106135242	106135242	+	IGR	SNP	G	G	C			TCGA-24-1616-01A-01W-0553-09	TCGA-24-1616-10A-01W-0553-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	c464b2f6-9cfe-463a-b5e3-9a76cd4480c5	502d962b-e71b-4b9d-a85f-4513c720ee09	g.chr14:106135242G>C								RP11-731F5.2 (19848 upstream) : AL928768.3 (35058 downstream)																							CACCACGCACGTGACCTCAGG	0.587																																																0			14																																								105206287	SO:0001628	intergenic_variant	0																															14.37:g.106135242G>C			105206287		Missense_Mutation	SNP	-	p.R145G		37	c.433		14																																																																																			-	NULL	0	0.587					ENSG00000211894			G			105206287	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000390546	ensembl	human	known	54_36p	missense	SNP	0.04	C
PIRT	644139	genome.wustl.edu	37	17	10728954	10728954	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1616-01A-01W-0553-09	TCGA-24-1616-10A-01W-0553-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	c464b2f6-9cfe-463a-b5e3-9a76cd4480c5	502d962b-e71b-4b9d-a85f-4513c720ee09	g.chr17:10728954C>T	ENST00000580256.2	-	2	647	c.9G>A	c.(7-9)atG>atA	p.M3I		NM_001101387.1	NP_001094857.1	P0C851	PIRT_HUMAN	phosphoinositide-interacting regulator of transient receptor potential channels	3						integral component of membrane (GO:0016021)		p.M3I(1)		endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)	8						GGAGAGTCTCCATCGTCATGG	0.562																																																1	Substitution - Missense(1)	ovary(1)	17											21.0	20.0	20.0					17																	10728954		1932	4098	6030	10669679	SO:0001583	missense	644139			AK021549	CCDS45614.1	17p12	2010-06-04			ENSG00000233670	ENSG00000233670			37239	protein-coding gene	gene with protein product	"""phosphoinositide-interacting regulator of TRPV1"""	612068				18455988	Standard	NM_001101387		Approved		uc010col.3	P0C851		ENST00000580256.2:c.9G>A	17.37:g.10728954C>T	ENSP00000462046:p.Met3Ile		10669679	B7Z648	Missense_Mutation	SNP	-	p.M3I	ENST00000580256.2	37	c.9	CCDS45614.1	17	.	.	.	.	.	.	.	.	.	.	C	16.85	3.237556	0.58886	.	.	ENSG00000233670	ENST00000441732	.	.	.	5.33	4.36	0.52297	.	.	.	.	.	T	0.29749	0.0743	L	0.27053	0.805	0.30200	N	0.798665	B	0.31817	0.341	B	0.28011	0.085	T	0.31280	-0.9949	8	0.87932	D	0	-6.7199	9.7712	0.40591	0.0:0.9079:0.0:0.0921	.	3	P0C851	PIRT_HUMAN	I	3	.	ENSP00000408936:M3I	M	-	3	0	PIRT	10669679	1.000000	0.71417	0.993000	0.49108	0.373000	0.29922	3.659000	0.54489	1.486000	0.48398	0.561000	0.74099	ATG	-	NULL		0.562	PIRT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIRT	protein_coding	OTTHUMT00000441078.2	C	NM_001101387		10669679	-1	no_errors	NM_001101387	genbank	human	validated	54_36p	missense	SNP	1	T
MPEG1	219972	genome.wustl.edu	37	11	58978843	58978843	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1616-01A-01W-0553-09	TCGA-24-1616-10A-01W-0553-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	c464b2f6-9cfe-463a-b5e3-9a76cd4480c5	502d962b-e71b-4b9d-a85f-4513c720ee09	g.chr11:58978843G>C	ENST00000361050.3	-	1	1581	c.1496C>G	c.(1495-1497)gCc>gGc	p.A499G		NM_001039396.1	NP_001034485.1	Q2M385	MPEG1_HUMAN	macrophage expressed 1	499						integral component of membrane (GO:0016021)		p.A499G(1)		NS(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(21)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		all_epithelial(135;0.125)				AAAGTAGCCGGCTGGGCATGA	0.512																																																1	Substitution - Missense(1)	ovary(1)	11											68.0	66.0	67.0					11																	58978843		1870	4107	5977	58735419	SO:0001583	missense	219972			AK097211	CCDS41650.1	11q12.1	2013-07-31				ENSG00000197629			29619	protein-coding gene	gene with protein product	"""macrophage expressed gene 1"""	610390				7888681, 23257510	Standard	NM_001039396		Approved	MPG1	uc001nnu.4	Q2M385		ENST00000361050.3:c.1496C>G	11.37:g.58978843G>C	ENSP00000354335:p.Ala499Gly		58735419	Q2M1T6|Q8TEF8	Missense_Mutation	SNP	-	p.A499G	ENST00000361050.3	37	c.1496	CCDS41650.1	11	.	.	.	.	.	.	.	.	.	.	G	4.395	0.072908	0.08436	.	.	ENSG00000197629	ENST00000361050	T	0.24538	1.85	5.84	4.93	0.64822	.	0.267717	0.36134	N	0.002770	T	0.23965	0.0580	M	0.62723	1.935	0.09310	N	1	P	0.39665	0.682	B	0.30401	0.115	T	0.22243	-1.0222	10	0.49607	T	0.09	-10.3497	12.1306	0.53940	0.0799:0.0:0.9201:0.0	.	499	Q2M385	MPEG1_HUMAN	G	499	ENSP00000354335:A499G	ENSP00000354335:A499G	A	-	2	0	MPEG1	58735419	0.991000	0.36638	0.023000	0.16930	0.017000	0.09413	4.261000	0.58841	1.496000	0.48567	0.655000	0.94253	GCC	-	NULL		0.512	MPEG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MPEG1	protein_coding	OTTHUMT00000370027.1	G	NM_001039396		58735419	-1	no_errors	NM_001039396	genbank	human	validated	54_36p	missense	SNP	0.17	C
PICALM	8301	genome.wustl.edu	37	11	85685795	85685795	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1616-01A-01W-0553-09	TCGA-24-1616-10A-01W-0553-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	c464b2f6-9cfe-463a-b5e3-9a76cd4480c5	502d962b-e71b-4b9d-a85f-4513c720ee09	g.chr11:85685795C>T	ENST00000393346.3	-	19	2048	c.1900G>A	c.(1900-1902)Gtc>Atc	p.V634I	PICALM_ENST00000356360.5_Missense_Mutation_p.V614I|PICALM_ENST00000532317.1_Missense_Mutation_p.V592I|PICALM_ENST00000526033.1_Missense_Mutation_p.V627I|PICALM_ENST00000528398.1_Missense_Mutation_p.V533I			Q13492	PICAL_HUMAN	phosphatidylinositol binding clathrin assembly protein	634					axonogenesis (GO:0007409)|cargo loading into vesicle (GO:0035459)|cell proliferation (GO:0008283)|clathrin coat assembly (GO:0048268)|clathrin-mediated endocytosis (GO:0072583)|dendrite morphogenesis (GO:0048813)|endosomal transport (GO:0016197)|hemopoiesis (GO:0030097)|iron ion homeostasis (GO:0055072)|iron ion import into cell (GO:0097459)|negative regulation of gene expression (GO:0010629)|negative regulation of metalloendopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902963)|negative regulation of receptor-mediated endocytosis (GO:0048261)|positive regulation of aspartic-type endopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902961)|positive regulation of beta-amyloid formation (GO:1902004)|positive regulation of neuron death (GO:1901216)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|receptor internalization (GO:0031623)|receptor-mediated endocytosis (GO:0006898)|regulation of aspartic-type endopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902959)|regulation of endocytosis (GO:0030100)|regulation of protein localization (GO:0032880)|synaptic vesicle maturation (GO:0016188)|vesicle-mediated transport (GO:0016192)	clathrin coat (GO:0030118)|coated pit (GO:0005905)|cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|neurofibrillary tangle (GO:0097418)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|vesicle (GO:0031982)	1-phosphatidylinositol binding (GO:0005545)|clathrin adaptor activity (GO:0035615)|clathrin binding (GO:0030276)|clathrin heavy chain binding (GO:0032050)	p.V634I(1)		endometrium(1)|kidney(2)|large_intestine(2)|liver(1)|lung(10)|ovary(1)|skin(1)|urinary_tract(1)	19		Acute lymphoblastic leukemia(157;7.42e-07)|all_hematologic(158;0.00092)				GGTCTCATGACAGGCTGGCTG	0.408			T	"""MLLT10, MLL"""	"""TALL, AML, """																																		Dom	yes		11	11q14	8301	phosphatidylinositol binding clathrin assembly protein (CALM)		L	1	Substitution - Missense(1)	ovary(1)	11											243.0	203.0	217.0					11																	85685795		2203	4299	6502	85363443	SO:0001583	missense	8301			BC048259	CCDS8272.1, CCDS31653.1, CCDS55783.1, CCDS55784.1	11q14	2008-02-01			ENSG00000073921	ENSG00000073921			15514	protein-coding gene	gene with protein product		603025				8643484	Standard	NM_001206947		Approved	CALM, CLTH	uc001pbm.3	Q13492	OTTHUMG00000166981	ENST00000393346.3:c.1900G>A	11.37:g.85685795C>T	ENSP00000377015:p.Val634Ile		85363443	B4DTM3|E9PN05|F8VPG7|O60700|Q4LE54|Q6GMQ6|Q86XZ9	Missense_Mutation	SNP	HMMPfam_ANTH;superfamily_ENTH/VHS domain;superfamily_GAT-like domain	p.V634I	ENST00000393346.3	37	c.1900	CCDS8272.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.5|20.5	3.998005|3.998005	0.74818|0.74818	.|.	.|.	ENSG00000073921|ENSG00000073921	ENST00000529760;ENST00000532603;ENST00000526961|ENST00000532317;ENST00000526033;ENST00000447890;ENST00000393346;ENST00000528398;ENST00000356360	.|T;T;T;T;T	.|0.55413	.|0.52;0.52;0.52;0.52;0.52	5.87|5.87	5.87|5.87	0.94306|0.94306	.|.	.|0.196377	.|0.43416	.|D	.|0.000577	T|T	0.68559|0.68559	0.3014|0.3014	L|L	0.50333|0.50333	1.59|1.59	0.53005|0.53005	D|D	0.99996|0.99996	.|B;D;B;B;P;B	.|0.53312	.|0.435;0.959;0.223;0.177;0.547;0.063	.|B;D;B;B;B;B	.|0.67103	.|0.152;0.949;0.131;0.185;0.278;0.046	T|T	0.61879|0.61879	-0.6972|-0.6972	5|9	.|.	.|.	.|.	-7.3254|-7.3254	20.5827|20.5827	0.99408|0.99408	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|533;219;642;627;634;592	.|E9PN05;B4DLM1;A8MX97;F8VPG7;Q13492;Q13492-3	.|.;.;.;.;PICAL_HUMAN;.	Y|I	289;115;245|592;627;634;634;533;614	.|ENSP00000436958:V592I;ENSP00000433846:V627I;ENSP00000377015:V634I;ENSP00000434884:V533I;ENSP00000348718:V614I	.|.	C|V	-|-	2|1	0|0	PICALM|PICALM	85363443|85363443	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	5.280000|5.280000	0.65603|0.65603	2.941000|2.941000	0.99782|0.99782	0.655000|0.655000	0.94253|0.94253	TGT|GTC	-	NULL		0.408	PICALM-005	KNOWN	basic|appris_principal|CCDS	protein_coding	PICALM	protein_coding	OTTHUMT00000392224.1	C	NM_007166		85363443	-1	no_errors	NM_007166	genbank	human	validated	54_36p	missense	SNP	1	T
SCN3B	55800	genome.wustl.edu	37	11	123513205	123513205	+	Missense_Mutation	SNP	G	G	A	rs371558196		TCGA-24-1616-01A-01W-0553-09	TCGA-24-1616-10A-01W-0553-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	c464b2f6-9cfe-463a-b5e3-9a76cd4480c5	502d962b-e71b-4b9d-a85f-4513c720ee09	g.chr11:123513205G>A	ENST00000392770.2	-	3	1196	c.394C>T	c.(394-396)Cgg>Tgg	p.R132W	SCN3B_ENST00000299333.3_Missense_Mutation_p.R132W|SCN3B_ENST00000530277.1_Missense_Mutation_p.R132W	NM_018400.3	NP_060870.1	Q9NY72	SCN3B_HUMAN	sodium channel, voltage-gated, type III, beta subunit	132	Ig-like C2-type.				atrial cardiac muscle cell action potential (GO:0086014)|axon guidance (GO:0007411)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|positive regulation of heart rate (GO:0010460)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transporter activity (GO:2000649)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sensory perception of pain (GO:0019233)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|ventricular cardiac muscle cell action potential (GO:0086005)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	ion channel binding (GO:0044325)|sodium channel regulator activity (GO:0017080)|voltage-gated sodium channel activity (GO:0005248)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)	p.R132W(1)		central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(16)|ovary(2)|skin(2)	26		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.37e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0227)	Valproic Acid(DB00313)|Zonisamide(DB00909)	ACAAAGGGCCGATGCGCCTCA	0.597																																																1	Substitution - Missense(1)	ovary(1)	11						G	TRP/ARG,TRP/ARG	0,4404		0,0,2202	94.0	85.0	88.0		394,394	5.1	1.0	11		88	1,8597	1.2+/-3.3	0,1,4298	no	missense,missense	SCN3B	NM_001040151.1,NM_018400.3	101,101	0,1,6500	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	132/216,132/216	123513205	1,13001	2202	4299	6501	123018415	SO:0001583	missense	55800			AJ243396	CCDS8442.1	11q24.1	2014-09-17	2012-02-28		ENSG00000166257	ENSG00000166257		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"", ""Immunoglobulin superfamily / V-set domain containing"""	20665	protein-coding gene	gene with protein product		608214	"""sodium channel, voltage-gated, type III, beta"""			10688874	Standard	XR_428980		Approved	HSA243396	uc001pzb.1	Q9NY72	OTTHUMG00000166006	ENST00000392770.2:c.394C>T	11.37:g.123513205G>A	ENSP00000376523:p.Arg132Trp		123018415	A5H1I5|Q17RL3|Q9ULR2	Missense_Mutation	SNP	HMMPfam_V-set;superfamily_Immunoglobulin	p.R132W	ENST00000392770.2	37	c.394	CCDS8442.1	11	.	.	.	.	.	.	.	.	.	.	G	24.3	4.512158	0.85389	0.0	1.16E-4	ENSG00000166257	ENST00000392770;ENST00000299333;ENST00000530277;ENST00000527836	T;T;T;T	0.66099	-0.19;-0.19;-0.19;-0.19	6.03	5.11	0.69529	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	0.213280	0.47852	D	0.000204	T	0.72914	0.3520	L	0.44542	1.39	0.49915	D	0.999838	D	0.89917	1.0	D	0.68483	0.958	T	0.75844	-0.3174	10	0.66056	D	0.02	-12.554	16.918	0.86156	0.0:0.0:0.8713:0.1287	.	132	Q9NY72	SCN3B_HUMAN	W	132	ENSP00000376523:R132W;ENSP00000299333:R132W;ENSP00000432785:R132W;ENSP00000435554:R132W	ENSP00000299333:R132W	R	-	1	2	SCN3B	123018415	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.713000	0.47194	1.526000	0.49068	0.655000	0.94253	CGG	-	HMMPfam_V-set		0.597	SCN3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN3B	protein_coding	OTTHUMT00000387412.1	G	NM_018400		123018415	-1	no_errors	NM_001040151	genbank	human	reviewed	54_36p	missense	SNP	0.97	A
GNPTAB	79158	genome.wustl.edu	37	12	102153834	102153834	+	Nonsense_Mutation	SNP	G	G	A			TCGA-24-1616-01A-01W-0553-09	TCGA-24-1616-10A-01W-0553-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	c464b2f6-9cfe-463a-b5e3-9a76cd4480c5	502d962b-e71b-4b9d-a85f-4513c720ee09	g.chr12:102153834G>A	ENST00000299314.7	-	16	3485	c.3223C>T	c.(3223-3225)Cag>Tag	p.Q1075*		NM_024312.4	NP_077288.2	Q3T906	GNPTA_HUMAN	N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits	1075					carbohydrate phosphorylation (GO:0046835)|cell differentiation (GO:0030154)|lysosome organization (GO:0007040)|protein secretion (GO:0009306)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|UDP-N-acetylglucosamine-lysosomal-enzyme N-acetylglucosaminephosphotransferase activity (GO:0003976)	p.Q1075*(1)		NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(8)|lung(8)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	37						TAGGATTCCTGAGTTGGTGGA	0.368																																																1	Substitution - Nonsense(1)	ovary(1)	12											204.0	187.0	192.0					12																	102153834		2203	4300	6503	100677965	SO:0001587	stop_gained	79158			AY687932	CCDS9088.1	12q23.3	2013-01-10				ENSG00000111670		"""EF-hand domain containing"""	29670	protein-coding gene	gene with protein product		607840		GNPTA		10574462, 16116615	Standard	NM_024312		Approved	KIAA1208, MGC4170	uc001tit.3	Q3T906	OTTHUMG00000170444	ENST00000299314.7:c.3223C>T	12.37:g.102153834G>A	ENSP00000299314:p.Gln1075*		100677965	A2RRQ9|Q3ZQK2|Q6IPW5|Q86TQ2|Q96N13|Q9ULL2	Nonsense_Mutation	SNP	HMMPfam_Notch;HMMPfam_DMAP_binding;superfamily_EF-hand;superfamily_Notch domain	p.Q1075*	ENST00000299314.7	37	c.3223	CCDS9088.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.16|18.16	3.563092|3.563092	0.65538|0.65538	.|.	.|.	ENSG00000111670|ENSG00000111670	ENST00000299314|ENST00000550718	.|.	.|.	.|.	5.71|5.71	5.71|5.71	0.89125|0.89125	.|.	0.059158|.	0.64402|.	D|.	0.000001|.	.|T	.|0.76615	.|0.4012	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.74417	.|-0.3672	.|4	0.30854|.	T|.	0.27|.	-18.1127|-18.1127	19.8677|19.8677	0.96824|0.96824	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|L	1075|12	.|.	ENSP00000299314:Q1075X|.	Q|S	-|-	1|2	0|0	GNPTAB|GNPTAB	100677965|100677965	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.091000|0.091000	0.18340|0.18340	9.444000|9.444000	0.97578|0.97578	2.709000|2.709000	0.92574|0.92574	0.655000|0.655000	0.94253|0.94253	CAG|TCA	-	NULL		0.368	GNPTAB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNPTAB	protein_coding	OTTHUMT00000409182.1	G			100677965	-1	no_errors	NM_024312	genbank	human	validated	54_36p	nonsense	SNP	1	A
SLCO1B1	10599	genome.wustl.edu	37	12	21329829	21329829	+	Missense_Mutation	SNP	A	A	T			TCGA-24-1616-01A-01W-0553-09	TCGA-24-1616-10A-01W-0553-09	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	c464b2f6-9cfe-463a-b5e3-9a76cd4480c5	502d962b-e71b-4b9d-a85f-4513c720ee09	g.chr12:21329829A>T	ENST00000256958.2	+	5	575	c.479A>T	c.(478-480)aAa>aTa	p.K160I		NM_006446.4	NP_006437.3	Q9Y6L6	SO1B1_HUMAN	solute carrier organic anion transporter family, member 1B1	160					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium-independent organic anion transmembrane transporter activity (GO:0015347)	p.K160I(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(33)|ovary(3)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)	70					Acetylcysteine(DB06151)|Aminohippurate(DB00345)|Atorvastatin(DB01076)|Axitinib(DB06626)|Benzylpenicillin(DB01053)|Bezafibrate(DB01393)|Cabazitaxel(DB06772)|Caspofungin(DB00520)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dabrafenib(DB08912)|Dextrothyroxine(DB00509)|Digoxin(DB00390)|Dinoprostone(DB00917)|Eltrombopag(DB06210)|Estradiol(DB00783)|Estrone(DB00655)|Ezetimibe(DB00973)|Fexofenadine(DB00950)|Fluvastatin(DB01095)|Gadoxetate(DB08884)|Gemfibrozil(DB01241)|Indinavir(DB00224)|Irinotecan(DB00762)|L-Carnitine(DB00583)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Lovastatin(DB00227)|Methotrexate(DB00563)|Mycophenolate mofetil(DB00688)|Nelfinavir(DB00220)|Olmesartan(DB00275)|Ouabain(DB01092)|Pantoprazole(DB00213)|Pazopanib(DB06589)|Penicillamine(DB00859)|Pioglitazone(DB01132)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Quinidine(DB00908)|Repaglinide(DB00912)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Ritonavir(DB00503)|Rosiglitazone(DB00412)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|SIMEPREVIR(DB06290)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sumatriptan(DB00669)|Valsartan(DB00177)|Verapamil(DB00661)	ATAGTGGGAAAAGGTAAGAAT	0.254																																																1	Substitution - Missense(1)	ovary(1)	12											62.0	64.0	63.0					12																	21329829		2203	4282	6485	21221096	SO:0001583	missense	10599				CCDS8685.1	12p12	2013-05-22	2003-11-25	2003-11-26	ENSG00000134538	ENSG00000134538		"""Solute carriers"""	10959	protein-coding gene	gene with protein product		604843	"""solute carrier family 21 (organic anion transporter), member 6"""	SLC21A6		10358072	Standard	NM_006446		Approved	OATP-C, LST-1, OATP1B1	uc001req.4	Q9Y6L6	OTTHUMG00000169047	ENST00000256958.2:c.479A>T	12.37:g.21329829A>T	ENSP00000256958:p.Lys160Ile		21221096	B2R7G2|Q29R64|Q9NQ37|Q9UBF3|Q9UH89	Missense_Mutation	SNP	-	p.K160I	ENST00000256958.2	37	c.479	CCDS8685.1	12	.	.	.	.	.	.	.	.	.	.	A	14.28	2.487099	0.44249	.	.	ENSG00000134538	ENST00000256958	T	0.40225	1.04	3.52	2.24	0.28232	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	1.013910	0.07850	N	0.964410	T	0.43765	0.1262	L	0.35288	1.05	0.27488	N	0.952383	P	0.48230	0.907	P	0.54431	0.752	T	0.35151	-0.9800	10	0.52906	T	0.07	.	6.2733	0.20966	0.7417:0.2583:0.0:0.0	.	160	Q9Y6L6	SO1B1_HUMAN	I	160	ENSP00000256958:K160I	ENSP00000256958:K160I	K	+	2	0	SLCO1B1	21221096	0.967000	0.33354	0.924000	0.36721	0.372000	0.29890	2.321000	0.43805	1.591000	0.50007	0.254000	0.18369	AAA	-	NULL		0.254	SLCO1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLCO1B1	protein_coding	OTTHUMT00000402070.1	A	NM_006446		21221096	1	no_errors	NM_006446	genbank	human	reviewed	54_36p	missense	SNP	0.63	T
SRGAP1	57522	genome.wustl.edu	37	12	64502796	64502796	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1616-01A-01W-0553-09	TCGA-24-1616-10A-01W-0553-09	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	c464b2f6-9cfe-463a-b5e3-9a76cd4480c5	502d962b-e71b-4b9d-a85f-4513c720ee09	g.chr12:64502796A>G	ENST00000355086.3	+	16	2422	c.1898A>G	c.(1897-1899)tAc>tGc	p.Y633C	SRGAP1_ENST00000357825.3_Missense_Mutation_p.Y610C|RP11-196H14.4_ENST00000535806.1_RNA|SRGAP1_ENST00000543397.1_Missense_Mutation_p.Y570C	NM_020762.2	NP_065813.1	Q7Z6B7	SRGP1_HUMAN	SLIT-ROBO Rho GTPase activating protein 1	633	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				axon guidance (GO:0007411)|cell migration (GO:0016477)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho GTPase activator activity (GO:0005100)	p.Y633C(1)		breast(4)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(26)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	65			GBM - Glioblastoma multiforme(3;0.000139)|BRCA - Breast invasive adenocarcinoma(9;0.225)	GBM - Glioblastoma multiforme(28;0.0608)		GTGATGAGGTACCTCTTTGCC	0.453																																																1	Substitution - Missense(1)	ovary(1)	12											135.0	119.0	124.0					12																	64502796		2203	4300	6503	62789063	SO:0001583	missense	57522			AB037725	CCDS8967.1	12q13.13	2011-07-04			ENSG00000196935	ENSG00000196935		"""Rho GTPase activating proteins"""	17382	protein-coding gene	gene with protein product		606523				11672528	Standard	NM_020762		Approved	KIAA1304, ARHGAP13	uc010ssp.1	Q7Z6B7	OTTHUMG00000168750	ENST00000355086.3:c.1898A>G	12.37:g.64502796A>G	ENSP00000347198:p.Tyr633Cys		62789063	Q9H8A3|Q9P2P2	Missense_Mutation	SNP	HMMPfam_RhoGAP;HMMPfam_FCH;HMMPfam_SH3_1;superfamily_SH3-domain;superfamily_GTPase activation domain GAP	p.Y633C	ENST00000355086.3	37	c.1898	CCDS8967.1	12	.	.	.	.	.	.	.	.	.	.	A	23.5	4.421559	0.83559	.	.	ENSG00000196935	ENST00000355086;ENST00000357825;ENST00000543397	T;T;T	0.21734	1.99;1.99;1.99	5.16	5.16	0.70880	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.000000	0.32386	U	0.006173	T	0.57725	0.2073	M	0.93283	3.4	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.996	T	0.70378	-0.4888	9	.	.	.	.	15.7658	0.78126	1.0:0.0:0.0:0.0	.	633;570	Q7Z6B7;G5EA48	SRGP1_HUMAN;.	C	633;610;570	ENSP00000347198:Y633C;ENSP00000350480:Y610C;ENSP00000437948:Y570C	.	Y	+	2	0	SRGAP1	62789063	1.000000	0.71417	1.000000	0.80357	0.709000	0.40893	9.175000	0.94831	2.274000	0.75844	0.524000	0.50904	TAC	-	HMMPfam_RhoGAP		0.453	SRGAP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SRGAP1	protein_coding	OTTHUMT00000400896.1	A			62789063	1	no_errors	NM_020762	genbank	human	validated	54_36p	missense	SNP	1	G
STAB2	55576	genome.wustl.edu	37	12	104131483	104131483	+	Silent	SNP	C	C	T			TCGA-24-1616-01A-01W-0553-09	TCGA-24-1616-10A-01W-0553-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	c464b2f6-9cfe-463a-b5e3-9a76cd4480c5	502d962b-e71b-4b9d-a85f-4513c720ee09	g.chr12:104131483C>T	ENST00000388887.2	+	53	5826	c.5622C>T	c.(5620-5622)gcC>gcT	p.A1874A		NM_017564.9	NP_060034.9			stabilin 2									p.A1874A(1)		NS(4)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(11)|large_intestine(26)|lung(77)|ovary(10)|pancreas(1)|prostate(5)|skin(14)|stomach(2)	174						TGGGTGTGGCCTACGGCATTG	0.478																																																1	Substitution - coding silent(1)	ovary(1)	12											103.0	100.0	101.0					12																	104131483		2203	4300	6503	102655613	SO:0001819	synonymous_variant	55576			AF160476	CCDS31888.1	12q23.3	2007-01-29				ENSG00000136011			18629	protein-coding gene	gene with protein product	"""hyaluronic acid receptor for endocytosis"""	608561				11829752, 12077138	Standard	XR_429107		Approved	DKFZP434E0321, FELL, STAB-2, HARE, FEEL-2	uc001tjw.3	Q8WWQ8	OTTHUMG00000170056	ENST00000388887.2:c.5622C>T	12.37:g.104131483C>T			102655613		Silent	SNP	HMMPfam_Xlink;HMMPfam_Fasciclin;HMMPfam_EGF;HMMPfam_EGF_alliinase;superfamily_Mannose 6-phosphate receptor domain;superfamily_Growth factor receptor domain;HMMPfam_EGF_2;superfamily_C-type lectin-like;superfamily_EGF/Laminin;superfamily_FAS1 domain	p.A1874	ENST00000388887.2	37	c.5622	CCDS31888.1	12																																																																																			-	HMMPfam_Fasciclin		0.478	STAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAB2	protein_coding	OTTHUMT00000407089.1	C			102655613	1	no_errors	NM_017564	genbank	human	reviewed	54_36p	silent	SNP	1	T
ATP8A2	51761	genome.wustl.edu	37	13	26411376	26411376	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1616-01A-01W-0553-09	TCGA-24-1616-10A-01W-0553-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	c464b2f6-9cfe-463a-b5e3-9a76cd4480c5	502d962b-e71b-4b9d-a85f-4513c720ee09	g.chr13:26411376C>T	ENST00000381655.2	+	29	2972	c.2830C>T	c.(2830-2832)Ccc>Tcc	p.P944S	ATP8A2_ENST00000255283.8_Missense_Mutation_p.P879S|ATP8A2_ENST00000491840.1_3'UTR	NM_016529.4	NP_057613.4	Q9NTI2	AT8A2_HUMAN	ATPase, aminophospholipid transporter, class I, type 8A, member 2	904					aging (GO:0007568)|axonogenesis (GO:0007409)|detection of light stimulus involved in visual perception (GO:0050908)|eating behavior (GO:0042755)|inner ear morphogenesis (GO:0042472)|involuntary skeletal muscle contraction (GO:0003011)|negative regulation of cell proliferation (GO:0008285)|neurofilament cytoskeleton organization (GO:0060052)|neuromuscular process controlling posture (GO:0050884)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phospholipid translocation (GO:0061092)|response to auditory stimulus (GO:0010996)|retina layer formation (GO:0010842)|skin development (GO:0043588)	cell projection (GO:0042995)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.P944S(1)		breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(17)|lung(31)|ovary(4)|skin(3)|stomach(1)|urinary_tract(1)	72		Breast(139;0.0201)|Lung SC(185;0.0225)		all cancers(112;0.043)|OV - Ovarian serous cystadenocarcinoma(117;0.0748)|Epithelial(112;0.079)		GCTCAGGTTTCCCCAGCTCTA	0.493																																																1	Substitution - Missense(1)	ovary(1)	13											120.0	114.0	116.0					13																	26411376		1930	4130	6060	25309376	SO:0001583	missense	51761			AL137256	CCDS41873.1	13q12	2010-04-20	2010-03-31		ENSG00000132932	ENSG00000132932	3.6.3.1	"""ATPases / P-type"""	13533	protein-coding gene	gene with protein product		605870	"""ATPase, aminophospholipid transporter-like, Class I, type 8A, member 2"", ""ATPase, aminophospholipid transporter-like, class I, type 8A, member 2"""			11015572, 19778899	Standard	NM_016529		Approved	ATPIB, ML-1	uc001uqk.3	Q9NTI2	OTTHUMG00000016611	ENST00000381655.2:c.2830C>T	13.37:g.26411376C>T	ENSP00000371070:p.Pro944Ser		25309376	Q9H527|Q9NPU6|Q9NTL2|Q9NYM3	Missense_Mutation	SNP	-	p.P944S	ENST00000381655.2	37	c.2830	CCDS41873.1	13	.	.	.	.	.	.	.	.	.	.	C	32	5.161683	0.94727	.	.	ENSG00000132932	ENST00000381655;ENST00000255283;ENST00000544544	D;D	0.99070	-5.39;-5.39	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	D	0.99603	0.9856	H	0.96662	3.86	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.995;0.998;0.991	D	0.97938	1.0324	10	0.87932	D	0	.	20.1184	0.97949	0.0:1.0:0.0:0.0	.	879;724;904	B7Z880;F5GZN5;Q9NTI2	.;.;AT8A2_HUMAN	S	944;879;724	ENSP00000371070:P944S;ENSP00000255283:P879S	ENSP00000255283:P879S	P	+	1	0	ATP8A2	25309376	1.000000	0.71417	0.996000	0.52242	0.997000	0.91878	7.818000	0.86416	2.769000	0.95229	0.655000	0.94253	CCC	-	NULL		0.493	ATP8A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP8A2	protein_coding	OTTHUMT00000044236.2	C	NM_016529		25309376	1	no_errors	NM_016529	genbank	human	validated	54_36p	missense	SNP	1	T
CCNA1	8900	genome.wustl.edu	37	13	37016759	37016759	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1616-01A-01W-0553-09	TCGA-24-1616-10A-01W-0553-09	G	G	A	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	c464b2f6-9cfe-463a-b5e3-9a76cd4480c5	502d962b-e71b-4b9d-a85f-4513c720ee09	g.chr13:37016759G>A	ENST00000255465.4	+	9	1619	c.1355G>A	c.(1354-1356)tGt>tAt	p.C452Y	CCNA1_ENST00000449823.1_Missense_Mutation_p.C408Y|CCNA1_ENST00000418263.1_Missense_Mutation_p.C451Y|CCNA1_ENST00000440264.1_Missense_Mutation_p.C408Y			P78396	CCNA1_HUMAN	cyclin A1	452					G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|male meiosis I (GO:0007141)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|spermatogenesis (GO:0007283)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)		p.C452Y(1)		breast(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(10)|ovary(3)|prostate(1)|skin(2)|stomach(2)|urinary_tract(1)	35		Breast(139;0.014)|Lung SC(185;0.0548)|Prostate(109;0.174)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.91e-07)|Epithelial(112;1.22e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0119)|GBM - Glioblastoma multiforme(144;0.0242)		AGGTACCTGTGTGTGTCCCTC	0.428																																																1	Substitution - Missense(1)	ovary(1)	13											152.0	131.0	138.0					13																	37016759		2203	4300	6503	35914759	SO:0001583	missense	8900			U66838	CCDS9357.1, CCDS45031.1	13q12.3-q13	2014-01-21			ENSG00000133101	ENSG00000133101			1577	protein-coding gene	gene with protein product		604036				9041194	Standard	NM_003914		Approved	CT146	uc001uvr.4	P78396	OTTHUMG00000016733	ENST00000255465.4:c.1355G>A	13.37:g.37016759G>A	ENSP00000255465:p.Cys452Tyr		35914759	B7Z7E3|Q5T3V0|Q5U0G2|Q8IY91	Missense_Mutation	SNP	HMMPfam_Cyclin_C;HMMPfam_Cyclin_N;superfamily_Cyclin-like	p.C452Y	ENST00000255465.4	37	c.1355	CCDS9357.1	13	.	.	.	.	.	.	.	.	.	.	G	0.921	-0.715950	0.03206	.	.	ENSG00000133101	ENST00000440264;ENST00000449823;ENST00000418263;ENST00000255465	T;T;T;T	0.21734	1.99;1.99;1.99;1.99	5.29	4.03	0.46877	Cyclin, C-terminal (1);Cyclin-like (2);	0.564435	0.21027	N	0.081416	T	0.15955	0.0384	L	0.37750	1.13	0.21499	N	0.999669	B;B	0.19706	0.038;0.022	B;B	0.32583	0.01;0.148	T	0.37220	-0.9715	10	0.02654	T	1	.	9.868	0.41157	0.9209:0.0:0.0791:0.0	.	451;452	P78396-2;P78396	.;CCNA1_HUMAN	Y	408;408;451;452	ENSP00000400666:C408Y;ENSP00000409873:C408Y;ENSP00000396479:C451Y;ENSP00000255465:C452Y	ENSP00000255465:C452Y	C	+	2	0	CCNA1	35914759	0.986000	0.35501	0.924000	0.36721	0.877000	0.50540	2.814000	0.48010	0.947000	0.37659	-0.290000	0.09829	TGT	-	HMMPfam_Cyclin_C		0.428	CCNA1-001	KNOWN	basic|CCDS	protein_coding	CCNA1	protein_coding	OTTHUMT00000044514.2	G	NM_003914		35914759	1	no_errors	NM_003914	genbank	human	reviewed	54_36p	missense	SNP	0.77	A
OR4K1	79544	genome.wustl.edu	37	14	20403901	20403901	+	Missense_Mutation	SNP	T	T	C			TCGA-24-1616-01A-01W-0553-09	TCGA-24-1616-10A-01W-0553-09	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	c464b2f6-9cfe-463a-b5e3-9a76cd4480c5	502d962b-e71b-4b9d-a85f-4513c720ee09	g.chr14:20403901T>C	ENST00000285600.4	+	1	135	c.76T>C	c.(76-78)Ttc>Ctc	p.F26L		NM_001004063.2	NP_001004063.2	Q8NGD4	OR4K1_HUMAN	olfactory receptor, family 4, subfamily K, member 1	26						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.F26L(1)		central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(24)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	43	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00124)		ACTTCAACTTTTCTTTTTTGC	0.363																																																1	Substitution - Missense(1)	ovary(1)	14											336.0	375.0	362.0					14																	20403901		2203	4300	6503	19473741	SO:0001583	missense	79544				CCDS32025.1	14q11.2	2013-09-23			ENSG00000155249	ENSG00000155249		"""GPCR / Class A : Olfactory receptors"""	14726	protein-coding gene	gene with protein product							Standard	NM_001004063		Approved		uc001vwj.2	Q8NGD4	OTTHUMG00000170633	ENST00000285600.4:c.76T>C	14.37:g.20403901T>C	ENSP00000285600:p.Phe26Leu		19473741	B9EKV9|Q8NGD6|Q96R73	Missense_Mutation	SNP	-	p.F26L	ENST00000285600.4	37	c.76	CCDS32025.1	14	.	.	.	.	.	.	.	.	.	.	.	5.635	0.301781	0.10678	.	.	ENSG00000155249	ENST00000285600	T	0.00048	8.82	4.77	3.58	0.41010	.	0.336136	0.25909	N	0.027502	T	0.00073	0.0002	N	0.03268	-0.37	0.23798	N	0.996817	B	0.12630	0.006	B	0.14578	0.011	T	0.20075	-1.0286	10	0.05721	T	0.95	.	4.6317	0.12506	0.0:0.0989:0.1973:0.7038	.	26	Q8NGD4	OR4K1_HUMAN	L	26	ENSP00000285600:F26L	ENSP00000285600:F26L	F	+	1	0	OR4K1	19473741	0.000000	0.05858	0.964000	0.40570	0.388000	0.30384	-0.140000	0.10342	0.808000	0.34231	0.459000	0.35465	TTC	-	NULL		0.363	OR4K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4K1	protein_coding	OTTHUMT00000409881.1	T			19473741	1	no_errors	NM_001004063	genbank	human	provisional	54_36p	missense	SNP	0.15	C
DHRS4L2	317749	genome.wustl.edu	37	14	24459529	24459529	+	Missense_Mutation	SNP	T	T	A	rs563512511		TCGA-24-1616-01A-01W-0553-09	TCGA-24-1616-10A-01W-0553-09	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	c464b2f6-9cfe-463a-b5e3-9a76cd4480c5	502d962b-e71b-4b9d-a85f-4513c720ee09	g.chr14:24459529T>A	ENST00000335125.6	+	2	393	c.267T>A	c.(265-267)caT>caA	p.H89Q	DHRS4L2_ENST00000382755.4_Missense_Mutation_p.H87Q|DHRS4L2_ENST00000543805.1_De_novo_Start_InFrame|DHRS4L2_ENST00000558753.1_Missense_Mutation_p.H89Q|DHRS4L2_ENST00000534993.1_De_novo_Start_InFrame|DHRS4L2_ENST00000545240.1_Missense_Mutation_p.H89Q|DHRS4L2_ENST00000397071.1_Missense_Mutation_p.H89Q|DHRS4L2_ENST00000537912.1_Missense_Mutation_p.H89Q	NM_198083.3	NP_932349.2	Q6PKH6	DR4L2_HUMAN	dehydrogenase/reductase (SDR family) member 4 like 2	87						extracellular region (GO:0005576)	oxidoreductase activity (GO:0016491)	p.H89Q(1)		breast(1)|endometrium(2)|kidney(1)|lung(2)|ovary(1)|skin(2)|stomach(1)	10				GBM - Glioblastoma multiforme(265;0.00962)		CTGTGTGCCATGTGGGGAAGG	0.677																																																1	Substitution - Missense(1)	ovary(1)	14											33.0	37.0	36.0					14																	24459529		2200	4298	6498	23529369	SO:0001583	missense	317749				CCDS9606.2, CCDS73621.1	14q11.2	2011-09-14			ENSG00000187630	ENSG00000187630	1.1.-.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	19731	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 25C, member 3"""	615196					Standard	NM_001193635		Approved	SDR25C3	uc001wlf.3	Q6PKH6	OTTHUMG00000028778	ENST00000335125.6:c.267T>A	14.37:g.24459529T>A	ENSP00000334801:p.His89Gln		23529369	Q3YLD4	Missense_Mutation	SNP	-	p.H89Q	ENST00000335125.6	37	c.267	CCDS9606.2	14	.	.	.	.	.	.	.	.	.	.	T	12.28	1.890018	0.33348	.	.	ENSG00000187630	ENST00000348916;ENST00000397071;ENST00000335125;ENST00000537912;ENST00000545240;ENST00000382755	D;T;T;T;T	0.87179	-2.22;0.74;0.74;2.0;2.0	3.5	-1.49	0.08718	NAD(P)-binding domain (1);	0.051427	0.85682	D	0.000000	D	0.89322	0.6682	L	0.58810	1.83	0.80722	D	1	D;D	0.89917	0.997;1.0	D;D	0.79784	0.947;0.993	D	0.86236	0.1640	10	0.72032	D	0.01	.	8.5619	0.33516	0.0:0.4073:0.0:0.5927	.	89;87	F6TD35;Q6PKH6	.;DR4L2_HUMAN	Q	61;89;89;89;89;87	ENSP00000380261:H89Q;ENSP00000334801:H89Q;ENSP00000439942:H89Q;ENSP00000437883:H89Q;ENSP00000372203:H87Q	ENSP00000334801:H89Q	H	+	3	2	DHRS4L2	23529369	0.002000	0.14202	0.997000	0.53966	0.142000	0.21351	-1.911000	0.01583	-0.301000	0.08882	0.338000	0.21704	CAT	-	NULL		0.677	DHRS4L2-001	KNOWN	basic|CCDS	protein_coding	DHRS4L2	protein_coding	OTTHUMT00000071858.4	T			23529369	1	no_errors	NM_198083	genbank	human	validated	54_36p	missense	SNP	1	A
UNC79	57578	genome.wustl.edu	37	14	94120313	94120313	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1616-01A-01W-0553-09	TCGA-24-1616-10A-01W-0553-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	c464b2f6-9cfe-463a-b5e3-9a76cd4480c5	502d962b-e71b-4b9d-a85f-4513c720ee09	g.chr14:94120313C>T	ENST00000393151.2	+	38	6341	c.6341C>T	c.(6340-6342)tCg>tTg	p.S2114L	UNC79_ENST00000256339.4_Missense_Mutation_p.S1937L|UNC79_ENST00000555664.1_Missense_Mutation_p.S2075L|UNC79_ENST00000553484.1_Missense_Mutation_p.S2136L			Q9P2D8	UNC79_HUMAN	unc-79 homolog (C. elegans)	2114					behavioral response to ethanol (GO:0048149)|ion transmembrane transport (GO:0034220)|multicellular organism growth (GO:0035264)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.S1937L(1)		breast(3)|cervix(2)|endometrium(10)|kidney(7)|large_intestine(18)|liver(1)|lung(64)|ovary(1)|prostate(5)|skin(3)|urinary_tract(4)	118						ACCTTAGCCTCGTCTCTGATG	0.507																																																1	Substitution - Missense(1)	ovary(1)	14											164.0	151.0	156.0					14																	94120313		2203	4300	6503	93190066	SO:0001583	missense	57578			AB037830	CCDS9911.2	14q32.13	2011-08-18	2011-08-18	2011-08-18	ENSG00000133958	ENSG00000133958			19966	protein-coding gene	gene with protein product			"""KIAA1409"""	KIAA1409		20714347, 21040849	Standard	NM_020818		Approved		uc001ybs.1	Q9P2D8	OTTHUMG00000029783	ENST00000393151.2:c.6341C>T	14.37:g.94120313C>T	ENSP00000376858:p.Ser2114Leu		93190066	B5MDL6|Q6ZUT7	Missense_Mutation	SNP	-	p.S1937L	ENST00000393151.2	37	c.5810		14	.	.	.	.	.	.	.	.	.	.	C	10.52	1.374600	0.24857	.	.	ENSG00000133958	ENST00000256339;ENST00000555664;ENST00000553484;ENST00000393151;ENST00000393153	T;T;T;T	0.25579	1.79;1.79;1.79;1.79	5.43	5.43	0.79202	.	0.227351	0.45867	D	0.000334	T	0.18964	0.0455	N	0.24115	0.695	0.25783	N	0.984706	B	0.06786	0.001	B	0.08055	0.003	T	0.10268	-1.0637	10	0.39692	T	0.17	-9.64	14.108	0.65104	0.1504:0.8496:0.0:0.0	.	2136	C9JQL1	.	L	1937;2075;2136;2114;2136	ENSP00000256339:S1937L;ENSP00000450868:S2075L;ENSP00000451360:S2136L;ENSP00000376858:S2114L	ENSP00000256339:S1937L	S	+	2	0	KIAA1409	93190066	0.969000	0.33509	0.943000	0.38184	0.907000	0.53573	2.392000	0.44433	2.537000	0.85549	0.655000	0.94253	TCG	-	NULL		0.507	UNC79-006	KNOWN	basic	protein_coding	KIAA1409	protein_coding	OTTHUMT00000412766.1	C	XM_028395		93190066	1	no_errors	NM_020818	genbank	human	validated	54_36p	missense	SNP	1	T
TCL1B	9623	genome.wustl.edu	37	14	96157186	96157186	+	Silent	SNP	C	C	T			TCGA-24-1616-01A-01W-0553-09	TCGA-24-1616-10A-01W-0553-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	c464b2f6-9cfe-463a-b5e3-9a76cd4480c5	502d962b-e71b-4b9d-a85f-4513c720ee09	g.chr14:96157186C>T	ENST00000340722.7	+	2	327	c.276C>T	c.(274-276)ccC>ccT	p.P92P	RP11-1070N10.6_ENST00000461160.1_RNA	NM_004918.3	NP_004909.1	O95988	TCL1B_HUMAN	T-cell leukemia/lymphoma 1B	92								p.P92P(1)		cervix(1)|large_intestine(2)|lung(7)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13		all_cancers(154;0.103)		COAD - Colon adenocarcinoma(157;0.205)|Epithelial(152;0.248)		AGCTCTACCCCGGGAGGAAGT	0.607																																																1	Substitution - coding silent(1)	ovary(1)	14											66.0	69.0	68.0					14																	96157186		2203	4300	6503	95226939	SO:0001819	synonymous_variant	9623			AB018563	CCDS32151.1	14q32.1	2008-09-05			ENSG00000213231	ENSG00000213231			11649	protein-coding gene	gene with protein product		603769				10077617	Standard	NM_004918		Approved	TML1	uc001yez.3	O95988	OTTHUMG00000028912	ENST00000340722.7:c.276C>T	14.37:g.96157186C>T			95226939	A6NEK7|Q6IAR7|Q9UBQ4	Silent	SNP	-	p.P92	ENST00000340722.7	37	c.276	CCDS32151.1	14																																																																																			-	NULL		0.607	TCL1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCL1B	protein_coding	OTTHUMT00000315123.2	C			95226939	1	no_errors	NM_004918	genbank	human	validated	54_36p	silent	SNP		T
IVD	3712	genome.wustl.edu	37	15	40699846	40699846	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1616-01A-01W-0553-09	TCGA-24-1616-10A-01W-0553-09	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	c464b2f6-9cfe-463a-b5e3-9a76cd4480c5	502d962b-e71b-4b9d-a85f-4513c720ee09	g.chr15:40699846A>G	ENST00000249760.2	+	2	497	c.154A>G	c.(154-156)Acc>Gcc	p.T52A	IVD_ENST00000479013.2_Intron|IVD_ENST00000487418.2_Missense_Mutation_p.T55A|IVD_ENST00000490194.1_3'UTR	NM_002225.3	NP_002216.2	P26440	IVD_HUMAN	isovaleryl-CoA dehydrogenase	52					branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|leucine catabolic process (GO:0006552)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)	flavin adenine dinucleotide binding (GO:0050660)|isovaleryl-CoA dehydrogenase activity (GO:0008470)	p.T52A(1)		kidney(1)|lung(5)|ovary(2)|prostate(1)	9		all_cancers(109;1.19e-18)|all_epithelial(112;1.52e-15)|Lung NSC(122;5.14e-11)|all_lung(180;1.27e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;3.65e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0808)	Flavin adenine dinucleotide(DB03147)	GCTTCGTCAGACCATGGCTAA	0.537																																					GBM(31;293 617 7486 32527 34655)											1	Substitution - Missense(1)	ovary(1)	15											140.0	128.0	132.0					15																	40699846		2203	4300	6503	38487138	SO:0001583	missense	3712			AF038317	CCDS10057.1, CCDS10057.2, CCDS53930.1	15q14-q15	2010-05-11	2010-05-11		ENSG00000128928	ENSG00000128928	1.3.99.10		6186	protein-coding gene	gene with protein product		607036	"""isovaleryl Coenzyme A dehydrogenase"", ""isovaleryl CoA dehydrogenase"""			2063866	Standard	NM_002225		Approved	ACAD2	uc001zls.3	P26440	OTTHUMG00000129984	ENST00000249760.2:c.154A>G	15.37:g.40699846A>G	ENSP00000249760:p.Thr52Ala		38487138	B2RCV5|B3KVI7|J3KR54|Q53XZ9|Q96AF6	Missense_Mutation	SNP	HMMPfam_Acyl-CoA_dh_1;HMMPfam_Acyl-CoA_dh_M;HMMPfam_Acyl-CoA_dh_N;superfamily_Acyl-CoA dehydrogenase C-terminal domain-like;superfamily_Acyl-CoA dehydrogenase NM domain-like	p.T52A	ENST00000249760.2	37	c.154		15	.	.	.	.	.	.	.	.	.	.	A	10.87	1.472625	0.26423	.	.	ENSG00000128928	ENST00000249760;ENST00000487418	D;D	0.99706	-6.47;-6.47	5.27	4.16	0.48862	Acyl-CoA dehydrogenase/oxidase (1);Acyl-CoA dehydrogenase, N-terminal (1);Acyl-CoA dehydrogenase/oxidase, N-terminal (1);	0.049858	0.85682	D	0.000000	D	0.97654	0.9231	N	0.17345	0.48	0.58432	D	0.999994	B	0.06786	0.001	B	0.12156	0.007	D	0.97607	1.0127	10	0.13470	T	0.59	.	9.741	0.40418	0.9225:0.0:0.0775:0.0	.	52	P26440	IVD_HUMAN	A	52;55	ENSP00000249760:T52A;ENSP00000418397:T55A	ENSP00000249760:T52A	T	+	1	0	IVD	38487138	1.000000	0.71417	0.995000	0.50966	0.971000	0.66376	4.203000	0.58453	1.028000	0.39785	-0.250000	0.11733	ACC	-	HMMPfam_Acyl-CoA_dh_N		0.537	IVD-201	KNOWN	basic|appris_candidate	protein_coding	IVD	protein_coding		A			38487138	1	no_errors	NM_002225	genbank	human	reviewed	54_36p	missense	SNP	1	G
CDH8	1006	genome.wustl.edu	37	16	61687587	61687587	+	Silent	SNP	G	G	A			TCGA-24-1616-01A-01W-0553-09	TCGA-24-1616-10A-01W-0553-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	c464b2f6-9cfe-463a-b5e3-9a76cd4480c5	502d962b-e71b-4b9d-a85f-4513c720ee09	g.chr16:61687587G>A	ENST00000577390.1	-	12	3279	c.2325C>T	c.(2323-2325)taC>taT	p.Y775Y	CDH8_ENST00000299345.6_Intron|CDH8_ENST00000577730.1_Intron	NM_001796.4	NP_001787.2	P55286	CADH8_HUMAN	cadherin 8, type 2	775					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|response to cold (GO:0009409)|synaptic transmission, glutamatergic (GO:0035249)	axon terminus (GO:0043679)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic cleft (GO:0043083)	calcium ion binding (GO:0005509)	p.Y775Y(1)		biliary_tract(1)|breast(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(22)|liver(2)|lung(49)|ovary(6)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(4)	112		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)		AGTCACTGAGGTAGTCAAAAT	0.483																																																1	Substitution - coding silent(1)	ovary(1)	16											58.0	60.0	59.0					16																	61687587		2203	4300	6503	60245088	SO:0001819	synonymous_variant	1006			L34060	CCDS10802.1	16q22.1	2010-01-26			ENSG00000150394	ENSG00000150394		"""Cadherins / Major cadherins"""	1767	protein-coding gene	gene with protein product		603008				9615235, 2059658	Standard	NM_001796		Approved		uc002eog.2	P55286	OTTHUMG00000137493	ENST00000577390.1:c.2325C>T	16.37:g.61687587G>A			60245088	B3KWC1|Q14DC6|Q9ULB2	Silent	SNP	HMMPfam_Cadherin_C;HMMPfam_Cadherin;superfamily_Cadherin-like	p.Y775	ENST00000577390.1	37	c.2325	CCDS10802.1	16																																																																																			-	HMMPfam_Cadherin_C		0.483	CDH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH8	protein_coding	OTTHUMT00000268754.3	G	NM_001796		60245088	-1	no_errors	NM_001796	genbank	human	reviewed	54_36p	silent	SNP	1	A
TP53	7157	genome.wustl.edu	37	17	7577574	7577574	+	Missense_Mutation	SNP	T	T	C			TCGA-24-1616-01A-01W-0553-09	TCGA-24-1616-10A-01W-0553-09	T	T	C	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	c464b2f6-9cfe-463a-b5e3-9a76cd4480c5	502d962b-e71b-4b9d-a85f-4513c720ee09	g.chr17:7577574T>C	ENST00000269305.4	-	7	896	c.707A>G	c.(706-708)tAc>tGc	p.Y236C	TP53_ENST00000455263.2_Missense_Mutation_p.Y236C|TP53_ENST00000574684.1_5'UTR|TP53_ENST00000445888.2_Missense_Mutation_p.Y236C|TP53_ENST00000413465.2_Missense_Mutation_p.Y236C|TP53_ENST00000420246.2_Missense_Mutation_p.Y236C|TP53_ENST00000359597.4_Missense_Mutation_p.Y236C	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	236	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		Y -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation).|Y -> D (in sporadic cancers; somatic mutation).|Y -> F (in a sporadic cancer; somatic mutation).|Y -> H (in sporadic cancers; somatic mutation).|Y -> N (in sporadic cancers; somatic mutation).|Y -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.Y236C(61)|p.0?(8)|p.?(5)|p.Y143C(5)|p.Y236del(4)|p.Y236S(3)|p.Y236_M237delYM(1)|p.I232_Y236delIHYNY(1)|p.H233fs*6(1)|p.Y236_M243delYMCNSSCM(1)|p.V225fs*23(1)|p.Y236fs*4(1)|p.H233_C242del10(1)|p.N235_Y236delNY(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GTTACACATGTAGTTGTAGTG	0.572		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	94	Substitution - Missense(69)|Deletion - In frame(9)|Whole gene deletion(8)|Unknown(5)|Deletion - Frameshift(2)|Insertion - Frameshift(1)	breast(13)|ovary(13)|lung(9)|haematopoietic_and_lymphoid_tissue(7)|biliary_tract(6)|stomach(6)|oesophagus(6)|upper_aerodigestive_tract(5)|central_nervous_system(5)|urinary_tract(5)|pancreas(5)|prostate(4)|bone(4)|liver(2)|large_intestine(2)|soft_tissue(1)|endometrium(1)	17	GRCh37	CM004907	TP53	M							126.0	100.0	109.0					17																	7577574		2203	4300	6503	7518299	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.707A>G	17.37:g.7577574T>C	ENSP00000269305:p.Tyr236Cys		7518299	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	superfamily_p53-like transcription factors;superfamily_p53 tetramerization domain;P53_tetramer;HMMPfam_P53_tetramer;P53;HMMPfam_P53;P53_TAD;HMMPfam_P53_TAD	p.Y236C	ENST00000269305.4	37	c.707	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	T	16.62	3.173261	0.57584	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99801	-6.81;-6.81;-6.81;-6.81;-6.81;-6.81;-6.81;-6.81	4.09	0.528	0.17089	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.335105	0.32884	N	0.005532	D	0.99582	0.9849	M	0.74258	2.255	0.44570	D	0.997534	D;D;D;D;D;D	0.89917	0.998;0.982;1.0;0.998;0.999;1.0	D;P;D;D;D;D	0.81914	0.974;0.898;0.99;0.985;0.992;0.995	D	0.99253	1.0888	10	0.87932	D	0	-12.7522	10.2884	0.43581	0.222:0.0:0.0:0.778	.	236;236;143;236;236;236	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	C	236;236;236;236;236;236;225;143;104;143	ENSP00000410739:Y236C;ENSP00000352610:Y236C;ENSP00000269305:Y236C;ENSP00000398846:Y236C;ENSP00000391127:Y236C;ENSP00000391478:Y236C;ENSP00000425104:Y104C;ENSP00000423862:Y143C	ENSP00000269305:Y236C	Y	-	2	0	TP53	7518299	1.000000	0.71417	0.992000	0.48379	0.995000	0.86356	1.502000	0.35704	0.034000	0.15491	0.379000	0.24179	TAC	-	HMMPfam_P53		0.572	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	T	NM_000546		7518299	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	missense	SNP	1	C
SCDP1	645313	genome.wustl.edu	37	17	20688237	20688237	+	IGR	SNP	A	A	G			TCGA-24-1616-01A-01W-0553-09	TCGA-24-1616-10A-01W-0553-09	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	c464b2f6-9cfe-463a-b5e3-9a76cd4480c5	502d962b-e71b-4b9d-a85f-4513c720ee09	g.chr17:20688237A>G								AC126365.1 (59280 upstream) : RP11-283C24.1 (3146 downstream)																							GATCACTTTGATTCCTACCTG	0.493																																																0			17																																								20628829	SO:0001628	intergenic_variant	645313																															17.37:g.20688237A>G			20628829		RNA	SNP	-	NULL		37	NULL		17																																																																																			-	-	0	0.493					LOC645313			A			20628829	1	pseudogene	XR_017585	genbank	human	model	54_36p	rna	SNP	0.92	G
DSC3	1825	genome.wustl.edu	37	18	28605882	28605882	+	Splice_Site	SNP	C	C	A			TCGA-24-1616-01A-01W-0553-09	TCGA-24-1616-10A-01W-0553-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	c464b2f6-9cfe-463a-b5e3-9a76cd4480c5	502d962b-e71b-4b9d-a85f-4513c720ee09	g.chr18:28605882C>A	ENST00000360428.4	-	5	555		c.e5-1		DSC3_ENST00000434452.1_Splice_Site	NM_001941.3	NP_001932.2	Q14574	DSC3_HUMAN	desmocollin 3						cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|protein stabilization (GO:0050821)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|desmosome (GO:0030057)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|gamma-catenin binding (GO:0045295)	p.?(1)		endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(6)|lung(29)|ovary(2)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	56			OV - Ovarian serous cystadenocarcinoma(10;0.125)			CAGATTCAACCTAAAAGTAGA	0.259																																																1	Unknown(1)	ovary(1)	18											34.0	35.0	35.0					18																	28605882		2203	4298	6501	26859880	SO:0001630	splice_region_variant	1825			X83929	CCDS32810.1	18q12.1	2014-07-30			ENSG00000134762	ENSG00000134762		"""Cadherins / Major cadherins"""	3037	protein-coding gene	gene with protein product		600271		DSC4		7774948, 8486729	Standard	NM_001941		Approved	CDHF3, DSC, DSC1, DSC2	uc002kwj.4	Q14574	OTTHUMG00000179622	ENST00000360428.4:c.475-1G>T	18.37:g.28605882C>A			26859880	A6NN35|Q14200|Q9HAZ9	Splice_Site	SNP	-	e5-1	ENST00000360428.4	37	c.475-1	CCDS32810.1	18	.	.	.	.	.	.	.	.	.	.	C	18.73	3.686420	0.68157	.	.	ENSG00000134762	ENST00000360428;ENST00000434452	.	.	.	4.94	4.94	0.65067	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.4558	0.87607	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	DSC3	26859880	1.000000	0.71417	1.000000	0.80357	0.850000	0.48378	5.827000	0.69300	2.706000	0.92434	0.655000	0.94253	.	-	-		0.259	DSC3-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_candidate_longest|CCDS	protein_coding	DSC3	protein_coding	OTTHUMT00000447384.1	C	NM_001941, NM_024423	Intron	26859880	-1	no_errors	NM_001941	genbank	human	reviewed	54_36p	splice_site	SNP	1	A
PPP2R1A	5518	genome.wustl.edu	37	19	52716327	52716327	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1616-01A-01W-0553-09	TCGA-24-1616-10A-01W-0553-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	c464b2f6-9cfe-463a-b5e3-9a76cd4480c5	502d962b-e71b-4b9d-a85f-4513c720ee09	g.chr19:52716327G>T	ENST00000322088.6	+	6	829	c.771G>T	c.(769-771)tgG>tgT	p.W257C	PPP2R1A_ENST00000444322.2_Missense_Mutation_p.W202C|PPP2R1A_ENST00000462990.1_Missense_Mutation_p.W78C	NM_014225.5	NP_055040.2	P30153	2AAA_HUMAN	protein phosphatase 2, regulatory subunit A, alpha	257	PP2A subunit B binding.|Polyoma small and medium T antigens Binding.				apoptotic process (GO:0006915)|ceramide metabolic process (GO:0006672)|chromosome segregation (GO:0007059)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|inactivation of MAPK activity (GO:0000188)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope reassembly (GO:0007084)|mRNA metabolic process (GO:0016071)|negative regulation of cell growth (GO:0030308)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine dephosphorylation (GO:0070262)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|protein complex assembly (GO:0006461)|protein dephosphorylation (GO:0006470)|regulation of cell adhesion (GO:0030155)|regulation of cell differentiation (GO:0045595)|regulation of DNA replication (GO:0006275)|regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|response to organic substance (GO:0010033)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|second-messenger-mediated signaling (GO:0019932)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)	antigen binding (GO:0003823)|protein heterodimerization activity (GO:0046982)|protein phosphatase type 2A regulator activity (GO:0008601)|protein serine/threonine phosphatase activity (GO:0004722)	p.W257C(4)		NS(1)|breast(4)|cervix(2)|endometrium(62)|kidney(1)|large_intestine(7)|lung(21)|ovary(32)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	135				GBM - Glioblastoma multiforme(134;0.00456)|OV - Ovarian serous cystadenocarcinoma(262;0.015)		ACAAGTCCTGGCGCGTCCGCT	0.612			Mis		clear cell ovarian carcinoma																																		Dom?	yes		19	19q13.41	5518	"""protein phosphatase 2, regulatory subunit A, alpha"""		E	4	Substitution - Missense(4)	ovary(2)|endometrium(2)	19											44.0	40.0	41.0					19																	52716327		2203	4300	6503	57408139	SO:0001583	missense	5518				CCDS12849.1	19q13	2010-06-18	2010-04-14		ENSG00000105568	ENSG00000105568	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9302	protein-coding gene	gene with protein product	"""protein phosphatase 2A, regulatory subunit A, alpha isoform"", ""protein phosphatase 2, 65kDa regulatory subunit A"""	605983	"""protein phosphatase 2 (formerly 2A), regulatory subunit A (PR 65), alpha isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit A, alpha isoform"""				Standard	NR_033500		Approved	PR65A, PP2A-Aalpha	uc002pyp.3	P30153	OTTHUMG00000137367	ENST00000322088.6:c.771G>T	19.37:g.52716327G>T	ENSP00000324804:p.Trp257Cys		57408139	Q13773|Q6ICQ3|Q96DH3	Missense_Mutation	SNP	HMMPfam_HEAT,superfamily_ARM repeat	p.W257C	ENST00000322088.6	37	c.771	CCDS12849.1	19	.	.	.	.	.	.	.	.	.	.	G	20.8	4.043809	0.75732	.	.	ENSG00000105568	ENST00000423369;ENST00000391791;ENST00000322088;ENST00000444322	T;T	0.06218	3.33;3.33	4.48	4.48	0.54585	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.56097	D	0.000037	T	0.33059	0.0850	H	0.94658	3.565	0.80722	D	1	D;D;D	0.76494	0.999;0.987;0.987	D;P;P	0.64776	0.929;0.545;0.545	T	0.47711	-0.9096	10	0.72032	D	0.01	-14.5139	15.0762	0.72080	0.0:0.0:1.0:0.0	.	202;257;257	F5H3X9;A8K7B7;P30153	.;.;2AAA_HUMAN	C	247;177;257;202	ENSP00000324804:W257C;ENSP00000415067:W202C	ENSP00000324804:W257C	W	+	3	0	PPP2R1A	57408139	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	8.389000	0.90172	2.490000	0.84030	0.655000	0.94253	TGG	-	HMMPfam_HEAT		0.612	PPP2R1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP2R1A	protein_coding	OTTHUMT00000267967.2	G	NM_014225		57408139	1	no_errors	NM_014225	genbank	human	reviewed	54_36p	missense	SNP	1	T
NXPH2	11249	genome.wustl.edu	37	2	139428869	139428869	+	Nonsense_Mutation	SNP	C	C	A			TCGA-24-1616-01A-01W-0553-09	TCGA-24-1616-10A-01W-0553-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	c464b2f6-9cfe-463a-b5e3-9a76cd4480c5	502d962b-e71b-4b9d-a85f-4513c720ee09	g.chr2:139428869C>A	ENST00000272641.3	-	2	524	c.418G>T	c.(418-420)Gga>Tga	p.G140*		NM_007226.2	NP_009157.1	O95156	NXPH2_HUMAN	neurexophilin 2	140	III.				neuropeptide signaling pathway (GO:0007218)	extracellular region (GO:0005576)		p.G140*(1)		endometrium(1)|large_intestine(3)|lung(6)|ovary(3)|prostate(3)|skin(3)|urinary_tract(3)	22				BRCA - Breast invasive adenocarcinoma(221;0.101)		CTGAAGGTTCCATTTCCATGG	0.413																																																1	Substitution - Nonsense(1)	ovary(1)	2											54.0	49.0	50.0					2																	139428869		1885	4123	6008	139145339	SO:0001587	stop_gained	11249			AF043467	CCDS46421.1	2q22.1	2008-05-15			ENSG00000144227	ENSG00000144227			8076	protein-coding gene	gene with protein product		604635				9570794	Standard	NM_007226		Approved	NPH2	uc002tvi.3	O95156	OTTHUMG00000153636	ENST00000272641.3:c.418G>T	2.37:g.139428869C>A	ENSP00000272641:p.Gly140*		139145339	B7WP24|Q494R1|Q75QC3	Nonsense_Mutation	SNP	HMMPfam_Neurexophilin	p.G140*	ENST00000272641.3	37	c.418	CCDS46421.1	2	.	.	.	.	.	.	.	.	.	.	C	29.5	5.014069	0.93404	.	.	ENSG00000144227	ENST00000272641	.	.	.	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-10.8829	20.1253	0.97977	0.0:1.0:0.0:0.0	.	.	.	.	X	140	.	.	G	-	1	0	NXPH2	139145339	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.776000	0.85560	2.832000	0.97577	0.655000	0.94253	GGA	-	HMMPfam_Neurexophilin		0.413	NXPH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NXPH2	protein_coding	OTTHUMT00000331901.1	C			139145339	-1	no_errors	NM_007226	genbank	human	validated	54_36p	nonsense	SNP	1	A
ORC4	5000	genome.wustl.edu	37	2	148730337	148730337	+	Missense_Mutation	SNP	T	T	A			TCGA-24-1616-01A-01W-0553-09	TCGA-24-1616-10A-01W-0553-09	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	c464b2f6-9cfe-463a-b5e3-9a76cd4480c5	502d962b-e71b-4b9d-a85f-4513c720ee09	g.chr2:148730337T>A	ENST00000392857.5	-	4	303	c.196A>T	c.(196-198)Atc>Ttc	p.I66F	ORC4_ENST00000535373.1_Missense_Mutation_p.I66F|ORC4_ENST00000536575.1_Intron|ORC4_ENST00000392858.1_Missense_Mutation_p.I66F|ORC4_ENST00000540442.1_5'UTR|ORC4_ENST00000542387.1_5'UTR|ORC4_ENST00000264169.2_Missense_Mutation_p.I66F	NM_001190879.2|NM_001190882.2|NM_002552.4|NM_181741.3	NP_001177808.1|NP_001177811.1|NP_002543.2|NP_859525.1	O43929	ORC4_HUMAN	origin recognition complex, subunit 4	66					DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	nuclear origin of replication recognition complex (GO:0005664)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|origin recognition complex (GO:0000808)	ATP binding (GO:0005524)|DNA replication origin binding (GO:0003688)|nucleotide binding (GO:0000166)	p.I66F(1)		cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(2)|ovary(2)|pancreas(1)|prostate(1)|urinary_tract(1)	14						CGGGGTCCGATAATAAGGACA	0.333																																																1	Substitution - Missense(1)	ovary(1)	2											69.0	72.0	71.0					2																	148730337		2203	4300	6503	148446807	SO:0001583	missense	5000			AF022108	CCDS2187.1, CCDS54404.1, CCDS54405.1	2q22-q23	2010-10-12	2010-10-12	2010-10-12	ENSG00000115947	ENSG00000115947		"""ATPases / AAA-type"""	8490	protein-coding gene	gene with protein product		603056	"""origin recognition complex, subunit 4 (yeast homolog)-like"", ""origin recognition complex, subunit 4-like (yeast)"", ""origin recognition complex, subunit 4-like (S. cerevisiae)"", ""origin recognition complex, subunit 4 homolog (S. cerevisiae)"""	ORC4L		9353276, 9691185	Standard	NM_181742		Approved	HsORC4, Orc4p	uc002twk.3	O43929	OTTHUMG00000131849	ENST00000392857.5:c.196A>T	2.37:g.148730337T>A	ENSP00000376597:p.Ile66Phe		148446807	B7Z3D0|B7Z5F1|D3DP86|F5H069|Q96C42	Missense_Mutation	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases	p.I66F	ENST00000392857.5	37	c.196	CCDS2187.1	2	.	.	.	.	.	.	.	.	.	.	T	22.0	4.229622	0.79688	.	.	ENSG00000115947	ENST00000264169;ENST00000535373;ENST00000392858;ENST00000392857;ENST00000416719;ENST00000457954;ENST00000440042	T;T;T;T;T;T;T	0.37915	1.17;1.17;1.17;1.17;1.17;1.17;1.17	5.88	1.01	0.19927	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.112463	0.64402	D	0.000006	T	0.36248	0.0960	L	0.43701	1.375	0.80722	D	1	P;P;P	0.47106	0.82;0.89;0.82	P;P;P	0.54889	0.763;0.724;0.584	T	0.18555	-1.0333	10	0.10111	T	0.7	-8.4926	8.9634	0.35860	0.0:0.2852:0.0:0.7148	.	66;66;66	B7Z2M4;A8K7H4;O43929	.;.;ORC4_HUMAN	F	66	ENSP00000264169:I66F;ENSP00000441953:I66F;ENSP00000376598:I66F;ENSP00000376597:I66F;ENSP00000413939:I66F;ENSP00000391484:I66F;ENSP00000403105:I66F	ENSP00000264169:I66F	I	-	1	0	ORC4	148446807	1.000000	0.71417	0.998000	0.56505	0.988000	0.76386	1.753000	0.38359	-0.049000	0.13379	0.533000	0.62120	ATC	-	NULL		0.333	ORC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ORC4L	protein_coding	OTTHUMT00000254797.3	T	NM_181742		148446807	-1	no_errors	NM_002552	genbank	human	reviewed	54_36p	missense	SNP	1	A
GPD2	2820	genome.wustl.edu	37	2	157439369	157439369	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1616-01A-01W-0553-09	TCGA-24-1616-10A-01W-0553-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	c464b2f6-9cfe-463a-b5e3-9a76cd4480c5	502d962b-e71b-4b9d-a85f-4513c720ee09	g.chr2:157439369C>T	ENST00000310454.6	+	17	2495	c.2123C>T	c.(2122-2124)gCa>gTa	p.A708V	GPD2_ENST00000409125.4_Missense_Mutation_p.A481V|GPD2_ENST00000496190.1_3'UTR|GPD2_ENST00000540309.1_3'UTR|GPD2_ENST00000409674.1_Missense_Mutation_p.A708V|GPD2_ENST00000438166.2_Missense_Mutation_p.A708V	NM_001083112.2	NP_001076581.2	P43304	GPDM_HUMAN	glycerol-3-phosphate dehydrogenase 2 (mitochondrial)	708					camera-type eye development (GO:0043010)|cellular lipid metabolic process (GO:0044255)|gluconeogenesis (GO:0006094)|glycerol catabolic process (GO:0019563)|glycerol-3-phosphate metabolic process (GO:0006072)|multicellular organism growth (GO:0035264)|small molecule metabolic process (GO:0044281)	glycerol-3-phosphate dehydrogenase complex (GO:0009331)|mitochondrial inner membrane (GO:0005743)	calcium ion binding (GO:0005509)|glycerol-3-phosphate dehydrogenase activity (GO:0004368)|sn-glycerol-3-phosphate:ubiquinone-8 oxidoreductase activity (GO:0052591)	p.A708V(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|skin(1)|stomach(1)	22						ATGAAAACTGCAGAAGAGAAC	0.438																																																1	Substitution - Missense(1)	ovary(1)	2											112.0	106.0	108.0					2																	157439369		2203	4300	6503	157147615	SO:0001583	missense	2820				CCDS2202.1	2q24.1	2013-01-10			ENSG00000115159	ENSG00000115159	1.1.1.8	"""EF-hand domain containing"""	4456	protein-coding gene	gene with protein product		138430					Standard	NM_001083112		Approved		uc002tzd.4	P43304	OTTHUMG00000131951	ENST00000310454.6:c.2123C>T	2.37:g.157439369C>T	ENSP00000308610:p.Ala708Val		157147615	A8K4V0|B3KSA9|Q59FR1|Q9HAP9	Missense_Mutation	SNP	HMMPfam_efhand;HMMPfam_DAO;superfamily_EF-hand;superfamily_FAD/NAD(P)-binding domain;superfamily_FAD-linked reductases C-terminal domain	p.A708V	ENST00000310454.6	37	c.2123	CCDS2202.1	2	.	.	.	.	.	.	.	.	.	.	C	14.93	2.683068	0.47991	.	.	ENSG00000115159	ENST00000310454;ENST00000409125;ENST00000438166;ENST00000409674	T;T;T;T	0.57436	0.4;0.65;0.4;0.4	5.22	4.34	0.51931	.	0.048803	0.85682	D	0.000000	T	0.36496	0.0969	N	0.17082	0.46	0.54753	D	0.999982	B	0.09022	0.002	B	0.15484	0.013	T	0.09640	-1.0665	10	0.25751	T	0.34	.	13.9405	0.64052	0.0:0.9261:0.0:0.0739	.	708	P43304	GPDM_HUMAN	V	708;481;708;708	ENSP00000308610:A708V;ENSP00000386484:A481V;ENSP00000409708:A708V;ENSP00000386425:A708V	ENSP00000308610:A708V	A	+	2	0	GPD2	157147615	1.000000	0.71417	0.902000	0.35471	0.983000	0.72400	4.621000	0.61233	1.197000	0.43143	0.313000	0.20887	GCA	-	NULL		0.438	GPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPD2	protein_coding	OTTHUMT00000254910.3	C			157147615	1	no_errors	NM_000408	genbank	human	validated	54_36p	missense	SNP	0.98	T
KIDINS220	57498	genome.wustl.edu	37	2	8926463	8926463	+	Silent	SNP	T	T	C			TCGA-24-1616-01A-01W-0553-09	TCGA-24-1616-10A-01W-0553-09	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	c464b2f6-9cfe-463a-b5e3-9a76cd4480c5	502d962b-e71b-4b9d-a85f-4513c720ee09	g.chr2:8926463T>C	ENST00000256707.3	-	16	1993	c.1812A>G	c.(1810-1812)agA>agG	p.R604R	KIDINS220_ENST00000418530.1_Silent_p.R562R|KIDINS220_ENST00000427284.1_Silent_p.R604R|KIDINS220_ENST00000473731.1_Silent_p.R604R|KIDINS220_ENST00000319688.5_Silent_p.R605R	NM_020738.2	NP_065789.1	Q9ULH0	KDIS_HUMAN	kinase D-interacting substrate, 220kDa	604	KAP NTPase.				activation of MAPKK activity (GO:0000186)|cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|dendrite morphogenesis (GO:0048813)|in utero embryonic development (GO:0001701)|nerve growth factor signaling pathway (GO:0038180)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of neuron projection development (GO:0010976)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)|protein complex (GO:0043234)	PDZ domain binding (GO:0030165)	p.R604R(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(25)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	60	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					CACTGGACAGTCTATTGTAAT	0.358																																																1	Substitution - coding silent(1)	ovary(1)	2											132.0	124.0	127.0					2																	8926463		1838	4093	5931	8843914	SO:0001819	synonymous_variant	57498			AK025528	CCDS42650.1	2p24	2013-01-10			ENSG00000134313	ENSG00000134313		"""Ankyrin repeat domain containing"""	29508	protein-coding gene	gene with protein product	"""ankyrin repeat-rich membrane-spanning protein"""	615759				10998417, 10574462	Standard	NM_020738		Approved	ARMS	uc002qzc.2	Q9ULH0	OTTHUMG00000151658	ENST00000256707.3:c.1812A>G	2.37:g.8926463T>C			8843914	A1L4N4|Q4VC08|Q6MZU2|Q9H889|Q9H9E4|Q9NT37|Q9UF42	Silent	SNP	-	p.R604	ENST00000256707.3	37	c.1812	CCDS42650.1	2																																																																																			-	NULL		0.358	KIDINS220-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIDINS220	protein_coding	OTTHUMT00000323408.2	T	NM_020738		8843914	-1	no_errors	NM_020738	genbank	human	validated	54_36p	silent	SNP	0.98	C
TRIM43	129868	genome.wustl.edu	37	2	96259860	96259860	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1616-01A-01W-0553-09	TCGA-24-1616-10A-01W-0553-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	c464b2f6-9cfe-463a-b5e3-9a76cd4480c5	502d962b-e71b-4b9d-a85f-4513c720ee09	g.chr2:96259860G>T	ENST00000272395.2	+	2	225	c.89G>T	c.(88-90)tGt>tTt	p.C30F		NM_001164464.1|NM_138800.1	NP_001157936.1|NP_620155.1	Q96BQ3	TRI43_HUMAN	tripartite motif containing 43	30						intracellular (GO:0005622)	zinc ion binding (GO:0008270)	p.C30F(1)		breast(1)|large_intestine(3)|lung(7)|ovary(1)	12						ACCATCTGCTGTGGGCACAGC	0.527																																																1	Substitution - Missense(1)	ovary(1)	2											67.0	67.0	67.0					2																	96259860		2201	4296	6497	95623587	SO:0001583	missense	129868			BK000505	CCDS2015.1	2q11	2014-02-17	2011-01-25		ENSG00000144015	ENSG00000144015		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19015	protein-coding gene	gene with protein product			"""tripartite motif-containing 43"""				Standard	NM_138800		Approved	TRIM43A	uc002suv.3	Q96BQ3	OTTHUMG00000130401	ENST00000272395.2:c.89G>T	2.37:g.96259860G>T	ENSP00000272395:p.Cys30Phe		95623587	Q53TJ7	Missense_Mutation	SNP	-	p.C30F	ENST00000272395.2	37	c.89	CCDS2015.1	2	.	.	.	.	.	.	.	.	.	.	.	14.28	2.489194	0.44249	.	.	ENSG00000144015	ENST00000272395	T	0.54866	0.55	1.4	1.4	0.22301	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type, conserved site (1);Zinc finger, RING-type (2);Zinc finger, C3HC4 RING-type (1);	.	.	.	.	T	0.81683	0.4874	H	0.99454	4.575	0.35221	D	0.776068	D	0.89917	1.0	D	0.97110	1.0	D	0.86282	0.1668	9	0.87932	D	0	-17.4849	8.855	0.35223	0.0:0.0:1.0:0.0	.	30	Q96BQ3	TRI43_HUMAN	F	30	ENSP00000272395:C30F	ENSP00000272395:C30F	C	+	2	0	TRIM43	95623587	1.000000	0.71417	0.048000	0.18961	0.166000	0.22503	3.927000	0.56499	1.114000	0.41781	0.375000	0.23000	TGT	-	NULL		0.527	TRIM43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM43	protein_coding	OTTHUMT00000252784.1	G	NM_138800		95623587	1	no_errors	NM_138800	genbank	human	provisional	54_36p	missense	SNP	0.92	T
GULP1	51454	genome.wustl.edu	37	2	189449041	189449041	+	Missense_Mutation	SNP	T	T	C			TCGA-24-1616-01A-01W-0553-09	TCGA-24-1616-10A-01W-0553-09	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	c464b2f6-9cfe-463a-b5e3-9a76cd4480c5	502d962b-e71b-4b9d-a85f-4513c720ee09	g.chr2:189449041T>C	ENST00000409580.1	+	11	1373	c.659T>C	c.(658-660)aTt>aCt	p.I220T	GULP1_ENST00000409843.1_Missense_Mutation_p.I220T|GULP1_ENST00000409830.1_Missense_Mutation_p.I220T|GULP1_ENST00000359135.3_Missense_Mutation_p.I220T|GULP1_ENST00000409805.1_Missense_Mutation_p.I117T|GULP1_ENST00000409609.1_Missense_Mutation_p.I220T			Q9UBP9	GULP1_HUMAN	GULP, engulfment adaptor PTB domain containing 1	220					apoptotic process (GO:0006915)|lipid transport (GO:0006869)|phagocytosis, engulfment (GO:0006911)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	signal transducer activity (GO:0004871)	p.I220T(1)		endometrium(3)|large_intestine(2)|lung(5)|ovary(1)|skin(2)	13			OV - Ovarian serous cystadenocarcinoma(117;0.0423)|Epithelial(96;0.158)			TTTGATATGATTCCATTTTCT	0.408																																					Pancreas(178;563 2065 20199 42378 52815)											1	Substitution - Missense(1)	ovary(1)	2											245.0	209.0	221.0					2																	189449041		2203	4300	6503	189157286	SO:0001583	missense	51454			AF191771	CCDS2295.1, CCDS58742.1, CCDS58743.1	2q32.3-q33	2008-02-05			ENSG00000144366	ENSG00000144366			18649	protein-coding gene	gene with protein product		608165				11729193	Standard	NM_001252668		Approved	CED6, CED-6, GULP	uc010fru.3	Q9UBP9	OTTHUMG00000132647	ENST00000409580.1:c.659T>C	2.37:g.189449041T>C	ENSP00000386289:p.Ile220Thr		189157286	B2RB51|B4DQ40|B8ZZ72|D3DPH1|E9PB86|Q53PC1|Q53RF3|Q9BVL3	Missense_Mutation	SNP	HMMPfam_PID;superfamily_PH domain-like	p.I220T	ENST00000409580.1	37	c.659	CCDS2295.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	20.6|20.6	4.016473|4.016473	0.75161|0.75161	.|.	.|.	ENSG00000144366|ENSG00000144366	ENST00000451191;ENST00000433052|ENST00000409843;ENST00000409830;ENST00000409805;ENST00000359135;ENST00000409580;ENST00000409609	.|T;T;T;T;T	.|0.40756	.|1.02;1.02;1.02;1.02;1.02	5.62|5.62	5.62|5.62	0.85841|0.85841	.|.	.|0.313323	.|0.35124	.|N	.|0.003433	T|T	0.46229|0.46229	0.1382|0.1382	L|L	0.44542|0.44542	1.39|1.39	0.49130|0.49130	D|D	0.999753|0.999753	.|P;D;B;B	.|0.56746	.|0.763;0.977;0.03;0.039	.|B;P;B;B	.|0.53593	.|0.124;0.73;0.022;0.01	T|T	0.26258|0.26258	-1.0108|-1.0108	5|10	.|0.14252	.|T	.|0.57	-9.0931|-9.0931	15.0091|15.0091	0.71536|0.71536	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|117;44;220;220	.|E9PB86;Q59EC1;Q9UBP9;B8ZZ72	.|.;.;GULP1_HUMAN;.	L|T	45;105|220;220;117;220;220;220	.|ENSP00000387144:I220T;ENSP00000386732:I220T;ENSP00000352047:I220T;ENSP00000386289:I220T;ENSP00000386867:I220T	.|ENSP00000352047:I220T	F|I	+|+	1|2	0|0	GULP1|GULP1	189157286|189157286	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	6.959000|6.959000	0.76031|0.76031	2.149000|2.149000	0.67028|0.67028	0.528000|0.528000	0.53228|0.53228	TTC|ATT	-	NULL		0.408	GULP1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	GULP1	protein_coding	OTTHUMT00000335722.1	T	NM_016315		189157286	1	no_errors	NM_016315	genbank	human	validated	54_36p	missense	SNP	1	C
KCNH8	131096	genome.wustl.edu	37	3	19322773	19322773	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1616-01A-01W-0553-09	TCGA-24-1616-10A-01W-0553-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_III	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	c464b2f6-9cfe-463a-b5e3-9a76cd4480c5	502d962b-e71b-4b9d-a85f-4513c720ee09	g.chr3:19322773G>T	ENST00000328405.2	+	3	660	c.394G>T	c.(394-396)Gat>Tat	p.D132Y		NM_144633.2	NP_653234.2	Q96L42	KCNH8_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 8	132	PAC. {ECO:0000255|PROSITE- ProRule:PRU00141}.				potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)	p.D132Y(1)		NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(3)|lung(37)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	77						CTCGTTCAAAGATATAACAGA	0.348																																					NSCLC(124;1625 1765 8018 24930 42026)											1	Substitution - Missense(1)	ovary(1)	3											88.0	95.0	93.0					3																	19322773		2203	4299	6502	19297777	SO:0001583	missense	131096			AY053503	CCDS2632.1	3p24.3	2012-07-05			ENSG00000183960	ENSG00000183960		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18864	protein-coding gene	gene with protein product		608260				16382104	Standard	NM_144633		Approved	Kv12.1, elk3	uc003cbk.1	Q96L42	OTTHUMG00000129891	ENST00000328405.2:c.394G>T	3.37:g.19322773G>T	ENSP00000328813:p.Asp132Tyr		19297777	B7Z2I7|Q59GQ6	Missense_Mutation	SNP	HMMPfam_cNMP_binding,superfamily_cAMP-binding domain-like,HMMPfam_Ion_trans,HMMPfam_PAS_3,superfamily_PYP-like sensor domain (PAS domain),superfamily_Voltage-gated potassium channels	p.D132Y	ENST00000328405.2	37	c.394	CCDS2632.1	3	.	.	.	.	.	.	.	.	.	.	G	24.2	4.509352	0.85282	.	.	ENSG00000183960	ENST00000328405	D	0.99936	-8.3	6.17	6.17	0.99709	PAS-associated, C-terminal (1);PAS (1);	0.000000	0.32244	U	0.006369	D	0.99953	0.9980	H	0.94620	3.56	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.994;0.998	D	0.96517	0.9383	9	.	.	.	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	132;132	B7Z398;Q96L42	.;KCNH8_HUMAN	Y	132	ENSP00000328813:D132Y	.	D	+	1	0	KCNH8	19297777	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.476000	0.97823	2.941000	0.99782	0.655000	0.94253	GAT	-	HMMPfam_PAS_3		0.348	KCNH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNH8	protein_coding	OTTHUMT00000252139.2	G	NM_144633		19297777	1	no_errors	NM_144633	genbank	human	reviewed	54_36p	missense	SNP	1	T
ECE2	9718	genome.wustl.edu	37	3	184008373	184008373	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1616-01A-01W-0553-09	TCGA-24-1616-10A-01W-0553-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	c464b2f6-9cfe-463a-b5e3-9a76cd4480c5	502d962b-e71b-4b9d-a85f-4513c720ee09	g.chr3:184008373G>A	ENST00000402825.3	+	15	2038	c.2038G>A	c.(2038-2040)Gcc>Acc	p.A680T	ECE2_ENST00000359140.4_Missense_Mutation_p.A533T|ECE2_ENST00000357474.5_Missense_Mutation_p.A608T|ECE2_ENST00000404464.3_Missense_Mutation_p.A562T|EIF2B5_ENST00000444495.1_Intron	NM_014693.3	NP_055508.3	O60344	ECE2_HUMAN	endothelin converting enzyme 2	680	Endothelin-converting enzyme 2 region.				brain development (GO:0007420)|cardioblast differentiation (GO:0010002)|cell-cell signaling (GO:0007267)|heart development (GO:0007507)|peptide hormone processing (GO:0016486)	cytoplasmic vesicle membrane (GO:0030659)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|methyltransferase activity (GO:0008168)	p.A533T(1)		breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|lung(13)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(4)	49	all_cancers(143;1.39e-10)|Ovarian(172;0.0339)		Epithelial(37;8.28e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			GACAGTGAATGCCTACTACCT	0.612																																																1	Substitution - Missense(1)	ovary(1)	3											87.0	91.0	90.0					3																	184008373		2203	4300	6503	185491067	SO:0001583	missense	9718			AF428263	CCDS3255.1, CCDS33899.1, CCDS3256.2, CCDS43179.1, CCDS46969.1	3q27.1	2007-07-26			ENSG00000145194	ENSG00000145194			13275	protein-coding gene	gene with protein product		610145				11718899	Standard	NM_032331		Approved	KIAA0604, MGC2408	uc003fni.4	O60344	OTTHUMG00000150551	ENST00000402825.3:c.2038G>A	3.37:g.184008373G>A	ENSP00000384223:p.Ala680Thr		185491067	A5PLK8|Q6NTG7|Q6UW36|Q8NFD7|Q96NX3|Q96NX4|Q9BRZ8	Missense_Mutation	SNP	-	p.A680T	ENST00000402825.3	37	c.2038	CCDS3256.2	3	.	.	.	.	.	.	.	.	.	.	G	34	5.377777	0.95945	.	.	ENSG00000145194	ENST00000402825;ENST00000359140;ENST00000404464;ENST00000357474;ENST00000430587	D;D;D;D;D	0.90324	-2.65;-2.65;-2.65;-2.65;-2.65	5.57	5.57	0.84162	Peptidase M13, neprilysin, C-terminal (2);Metallopeptidase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.97854	0.9295	H	0.99689	4.705	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.91635	0.993;0.993;0.993;0.999;0.995;0.988;0.993	D	0.99605	1.0979	10	0.87932	D	0	-19.8882	18.1065	0.89521	0.0:0.0:1.0:0.0	.	282;533;551;562;608;533;680	B4DHU4;B4DKF3;B4DF19;O60344-2;O60344-5;O60344-3;O60344	.;.;.;.;.;.;ECE2_HUMAN	T	680;533;562;608;554	ENSP00000384223:A680T;ENSP00000352052:A533T;ENSP00000385846:A562T;ENSP00000350066:A608T;ENSP00000398444:A554T	ENSP00000350066:A608T	A	+	1	0	ECE2	185491067	1.000000	0.71417	0.995000	0.50966	0.995000	0.86356	9.869000	0.99810	2.616000	0.88540	0.555000	0.69702	GCC	-	NULL		0.612	ECE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ECE2	protein_coding	OTTHUMT00000318874.3	G	NM_014693		185491067	1	no_errors	NM_014693	genbank	human	validated	54_36p	missense	SNP	1	A
AASDH	132949	genome.wustl.edu	37	4	57220264	57220264	+	Nonsense_Mutation	SNP	G	G	A			TCGA-24-1616-01A-01W-0553-09	TCGA-24-1616-10A-01W-0553-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	c464b2f6-9cfe-463a-b5e3-9a76cd4480c5	502d962b-e71b-4b9d-a85f-4513c720ee09	g.chr4:57220264G>A	ENST00000205214.6	-	8	1504	c.1324C>T	c.(1324-1326)Cga>Tga	p.R442*	AASDH_ENST00000602986.1_Nonsense_Mutation_p.R289*|AASDH_ENST00000513376.1_Nonsense_Mutation_p.R342*|AASDH_ENST00000502617.1_Nonsense_Mutation_p.R442*|AASDH_ENST00000451613.1_Nonsense_Mutation_p.R442*|AASDH_ENST00000434343.2_Intron|AASDH_ENST00000510762.1_5'Flank	NM_181806.2	NP_861522.2	Q4L235	ACSF4_HUMAN	aminoadipate-semialdehyde dehydrogenase	442					fatty acid metabolic process (GO:0006631)		acid-thiol ligase activity (GO:0016878)|ATP binding (GO:0005524)	p.R442*(1)		endometrium(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	40	Glioma(25;0.08)|all_neural(26;0.101)	all_hematologic(202;0.0017)				CTGTCTTTTCGTCCCAAAAAA	0.358																																																1	Substitution - Nonsense(1)	ovary(1)	4											95.0	89.0	91.0					4																	57220264		2203	4300	6503	56915021	SO:0001587	stop_gained	132949			AF516672	CCDS3504.1, CCDS68705.1, CCDS68706.1, CCDS75126.1, CCDS75127.1	4q12	2010-12-14			ENSG00000157426	ENSG00000157426	1.2.1.31	"""Acyl-CoA synthetase family"""	23993	protein-coding gene	gene with protein product	"""acyl-CoA synthetase family member 4"""	614365				15865210, 12712191, 17762044	Standard	XM_005265721		Approved	NRPS998, LYS2, ACSF4	uc003hbn.3	Q4L235	OTTHUMG00000128841	ENST00000205214.6:c.1324C>T	4.37:g.57220264G>A	ENSP00000205214:p.Arg442*		56915021	A5D8V3|A5PL22|Q63HK2|Q63HR7|Q6IPP8|Q6TFZ6|Q7Z5Y3|Q96BW4|Q9P064	Nonsense_Mutation	SNP	-	p.R442*	ENST00000205214.6	37	c.1324	CCDS3504.1	4	.	.	.	.	.	.	.	.	.	.	G	38	7.017796	0.98006	.	.	ENSG00000157426	ENST00000205214;ENST00000513376;ENST00000451613;ENST00000503808;ENST00000502617	.	.	.	6.05	4.26	0.50523	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.6433	14.3791	0.66900	0.0:0.0:0.4769:0.5231	.	.	.	.	X	442;342;442;289;442	.	ENSP00000205214:R442X	R	-	1	2	AASDH	56915021	0.993000	0.37304	1.000000	0.80357	0.996000	0.88848	2.109000	0.41863	0.804000	0.34136	0.650000	0.86243	CGA	-	NULL		0.358	AASDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AASDH	protein_coding	OTTHUMT00000250780.1	G	NM_181806		56915021	-1	no_errors	NM_181806	genbank	human	validated	54_36p	nonsense	SNP	0.97	A
LPHN3	23284	genome.wustl.edu	37	4	62812764	62812764	+	Missense_Mutation	SNP	C	C	G	rs201709145		TCGA-24-1616-01A-01W-0553-09	TCGA-24-1616-10A-01W-0553-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	c464b2f6-9cfe-463a-b5e3-9a76cd4480c5	502d962b-e71b-4b9d-a85f-4513c720ee09	g.chr4:62812764C>G	ENST00000514591.1	+	15	2677	c.2348C>G	c.(2347-2349)aCg>aGg	p.T783R	LPHN3_ENST00000506746.1_Missense_Mutation_p.T851R|LPHN3_ENST00000511324.1_Missense_Mutation_p.T851R|LPHN3_ENST00000545650.1_Missense_Mutation_p.T783R|LPHN3_ENST00000507164.1_Missense_Mutation_p.T851R|LPHN3_ENST00000514996.1_Missense_Mutation_p.T783R|LPHN3_ENST00000514157.1_Missense_Mutation_p.T783R|LPHN3_ENST00000506700.1_Missense_Mutation_p.T783R|LPHN3_ENST00000508946.1_Missense_Mutation_p.T783R|LPHN3_ENST00000507625.1_Missense_Mutation_p.T851R|LPHN3_ENST00000508078.1_3'UTR|LPHN3_ENST00000512091.2_Missense_Mutation_p.T783R|LPHN3_ENST00000508693.1_Missense_Mutation_p.T851R|LPHN3_ENST00000504896.1_Missense_Mutation_p.T783R|LPHN3_ENST00000506720.1_Missense_Mutation_p.T851R|LPHN3_ENST00000509896.1_Missense_Mutation_p.T851R			Q9HAR2	LPHN3_HUMAN	latrophilin 3	770					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)	p.T783K(3)		breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(21)|lung(73)|ovary(1)|pancreas(1)|prostate(6)|upper_aerodigestive_tract(1)	125						CCTGTTATTACGGCAGCAATA	0.378																																																3	Substitution - Missense(3)	endometrium(3)	4											173.0	161.0	165.0					4																	62812764		1875	4098	5973	62495359	SO:0001583	missense	23284			AB018311	CCDS54768.1	4q13.1	2014-08-08				ENSG00000150471		"""-"", ""GPCR / Class B : Orphans"""	20974	protein-coding gene	gene with protein product						10994649	Standard	NM_015236		Approved	KIAA0768, LEC3	uc010ihh.3	Q9HAR2		ENST00000514591.1:c.2348C>G	4.37:g.62812764C>G	ENSP00000422533:p.Thr783Arg		62495359	E9PE04|O94867|Q9NWK5	Missense_Mutation	SNP	-	p.T783R	ENST00000514591.1	37	c.2348	CCDS54768.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	23.7|23.7	4.446218|4.446218	0.84101|0.84101	.|.	.|.	ENSG00000150471|ENSG00000150471	ENST00000512091;ENST00000514591;ENST00000509896;ENST00000511324;ENST00000506700;ENST00000545650;ENST00000295349;ENST00000280009;ENST00000507164;ENST00000508693;ENST00000507625;ENST00000514157;ENST00000504896;ENST00000508946;ENST00000506720;ENST00000506746;ENST00000514996|ENST00000502815	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T|.	0.10860|.	2.83;2.83;2.83;2.83;2.83;2.83;2.83;2.83;2.83;2.83;2.83;2.83;2.83;2.83;2.83|.	5.51|5.51	5.51|5.51	0.81932|0.81932	Domain of unknown function DUF3497 (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.65903|.	0.2736|.	L|L	0.36672|0.36672	1.1|1.1	0.80722|0.80722	D|D	1|1	D;D;D|.	0.67145|.	0.994;0.996;0.994|.	P;D;P|.	0.66351|.	0.897;0.943;0.785|.	T|.	0.60672|.	-0.7217|.	10|.	0.87932|.	D|.	0|.	.|.	19.4278|19.4278	0.94751|0.94751	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	783;770;783|.	E9PE04;Q9HAR2;Q9HAR2-2|.	.;LPHN3_HUMAN;.|.	R|X	783;783;851;851;783;783;770;783;851;851;851;783;783;783;851;851;783|240	ENSP00000423388:T783R;ENSP00000422533:T783R;ENSP00000423787:T851R;ENSP00000425033:T851R;ENSP00000424120:T783R;ENSP00000439831:T783R;ENSP00000421476:T851R;ENSP00000424030:T851R;ENSP00000421372:T851R;ENSP00000425201:T783R;ENSP00000423434:T783R;ENSP00000421627:T783R;ENSP00000420931:T851R;ENSP00000425884:T851R;ENSP00000424258:T783R|.	ENSP00000280009:T783R|.	T|Y	+|+	2|3	0|2	LPHN3|LPHN3	62495359|62495359	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.774000|0.774000	0.43823|0.43823	7.818000|7.818000	0.86416|0.86416	2.595000|2.595000	0.87683|0.87683	0.557000|0.557000	0.71058|0.71058	ACG|TAC	-	NULL		0.378	LPHN3-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	LPHN3	protein_coding	OTTHUMT00000361765.1	C			62495359	1	no_errors	NM_015236	genbank	human	reviewed	54_36p	missense	SNP	1	G
ADGRL3-AS1	101927186	genome.wustl.edu	37	4	62971512	62971513	+	RNA	DNP	CT	CT	AA			TCGA-24-1616-01A-01W-0553-09	TCGA-24-1616-10A-01W-0553-09	CT	CT	CT	AA	CT	CT	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	c464b2f6-9cfe-463a-b5e3-9a76cd4480c5	502d962b-e71b-4b9d-a85f-4513c720ee09	g.chr4:62971512_62971513CT>AA	ENST00000506704.1	-	0	456				RP11-84A1.3_ENST00000504135.1_RNA|RP11-84A1.3_ENST00000509461.1_RNA																							TGCCATTTTTCTAGATCTTTGA	0.436																																																0			4																																								62654108			391656																														Exception_encountered	4.37:g.62971512_62971513delinsAA			62654107		Nonsense_Mutation	DNP	-	p.EK86*	ENST00000506704.1	37	c.256_255		4																																																																																			-	NULL		0.436	RP11-84A1.3-003	KNOWN	basic	antisense	LOC391656	antisense	OTTHUMT00000361784.1	CT			62654108	-1	pseudogene	XM_373027	genbank	human	model	54_36p	nonsense	DNP	1.000:1.000	AA
FYB	2533	genome.wustl.edu	37	5	39134376	39134376	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1616-01A-01W-0553-09	TCGA-24-1616-10A-01W-0553-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	c464b2f6-9cfe-463a-b5e3-9a76cd4480c5	502d962b-e71b-4b9d-a85f-4513c720ee09	g.chr5:39134376G>A	ENST00000351578.6	-	9	1941	c.1751C>T	c.(1750-1752)cCt>cTt	p.P584L	FYB_ENST00000505428.1_Missense_Mutation_p.P584L|FYB_ENST00000512982.1_Missense_Mutation_p.P584L|FYB_ENST00000540520.1_Missense_Mutation_p.P594L|FYB_ENST00000515010.1_Missense_Mutation_p.P584L	NM_199335.3	NP_955367.1	O15117	FYB_HUMAN	FYN binding protein	584					immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|NLS-bearing protein import into nucleus (GO:0006607)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|T cell receptor signaling pathway (GO:0050852)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|nucleus (GO:0005634)	receptor binding (GO:0005102)	p.P584L(1)		endometrium(2)|kidney(4)|large_intestine(6)|liver(1)|lung(29)|ovary(2)|upper_aerodigestive_tract(1)	45	all_lung(31;0.000343)		Epithelial(62;0.235)			AGGTCTTGAAGGGGCACCAAG	0.358																																																1	Substitution - Missense(1)	ovary(1)	5											173.0	172.0	173.0					5																	39134376		1855	4103	5958	39170133	SO:0001583	missense	2533			U93049	CCDS47200.1, CCDS54848.1	5p13.1	2012-05-04	2010-05-04		ENSG00000082074	ENSG00000082074			4036	protein-coding gene	gene with protein product		602731	"""FYN-binding protein (FYB-120/130)"""			9115214, 9207119	Standard	NM_001465		Approved	SLAP-130, FYB-120/130	uc011cpl.2	O15117	OTTHUMG00000162071	ENST00000351578.6:c.1751C>T	5.37:g.39134376G>A	ENSP00000316460:p.Pro584Leu		39170133	A8K2Y8|B4DLN2|E9PBV9|O00359|Q9NZI9	Missense_Mutation	SNP	superfamily_SH3-domain;HMMPfam_SH3_2	p.P584L	ENST00000351578.6	37	c.1751	CCDS47200.1	5	.	.	.	.	.	.	.	.	.	.	G	1.135	-0.651161	0.03506	.	.	ENSG00000082074	ENST00000351578;ENST00000515010;ENST00000512982;ENST00000505428;ENST00000540520;ENST00000542542	T;T;T;T;T	0.26373	1.77;1.77;1.74;1.74;1.75	5.93	0.43	0.16515	.	1.749730	0.02482	N	0.088621	T	0.05410	0.0143	N	0.00162	-1.95	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.25117	-1.0141	10	0.14656	T	0.56	-0.8458	2.1762	0.03863	0.508:0.2428:0.1322:0.117	.	594;584	B4DLN2;O15117	.;FYB_HUMAN	L	584;584;584;584;594;584	ENSP00000316460:P584L;ENSP00000426346:P584L;ENSP00000425845:P584L;ENSP00000427114:P584L;ENSP00000442840:P594L	ENSP00000316460:P584L	P	-	2	0	FYB	39170133	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.477000	0.22196	0.100000	0.17581	-0.290000	0.09829	CCT	-	NULL		0.358	FYB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FYB	protein_coding	OTTHUMT00000367098.1	G	NM_001465		39170133	-1	no_errors	NM_001465	genbank	human	validated	54_36p	missense	SNP		A
VCAN	1462	genome.wustl.edu	37	5	82835549	82835549	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1616-01A-01W-0553-09	TCGA-24-1616-10A-01W-0553-09	A	A	G	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	c464b2f6-9cfe-463a-b5e3-9a76cd4480c5	502d962b-e71b-4b9d-a85f-4513c720ee09	g.chr5:82835549A>G	ENST00000265077.3	+	8	7292	c.6727A>G	c.(6727-6729)Aca>Gca	p.T2243A	VCAN_ENST00000513016.1_3'UTR|VCAN_ENST00000342785.4_Intron|VCAN-AS1_ENST00000512090.1_RNA|VCAN-AS1_ENST00000513899.1_RNA|VCAN_ENST00000512590.2_Intron|VCAN_ENST00000343200.5_Missense_Mutation_p.T1256A|VCAN_ENST00000502527.2_Intron	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	2243	GAG-beta.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)	p.T2243A(1)		NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	CATGAGACCAACAATTCAAGA	0.383																																																1	Substitution - Missense(1)	ovary(1)	5											66.0	65.0	66.0					5																	82835549		2203	4300	6503	82871305	SO:0001583	missense	1462			X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.6727A>G	5.37:g.82835549A>G	ENSP00000265077:p.Thr2243Ala		82871305	P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Missense_Mutation	SNP	HMMPfam_Sushi;HMMPfam_Xlink;HMMPfam_Lectin_C;HMMPfam_EGF;HMMPfam_V-set;superfamily_Immunoglobulin;superfamily_C-type lectin-like;superfamily_EGF/Laminin;superfamily_Complement control module/SCR domain	p.T2243A	ENST00000265077.3	37	c.6727	CCDS4060.1	5	.	.	.	.	.	.	.	.	.	.	A	10.33	1.320971	0.23994	.	.	ENSG00000038427	ENST00000265077;ENST00000343200	T;T	0.31510	1.49;1.49	5.93	4.74	0.60224	.	0.513050	0.19204	N	0.120115	T	0.23611	0.0571	L	0.46157	1.445	0.24261	N	0.99528	B;B	0.33171	0.4;0.278	B;B	0.31101	0.124;0.084	T	0.29088	-1.0023	10	0.54805	T	0.06	.	4.5025	0.11870	0.6829:0.1279:0.0668:0.1224	.	1256;2243	P13611-2;P13611	.;CSPG2_HUMAN	A	2243;1256	ENSP00000265077:T2243A;ENSP00000340062:T1256A	ENSP00000265077:T2243A	T	+	1	0	VCAN	82871305	0.000000	0.05858	0.030000	0.17652	0.591000	0.36615	0.073000	0.14640	1.035000	0.39972	0.533000	0.62120	ACA	-	NULL		0.383	VCAN-001	KNOWN	basic|CCDS	protein_coding	VCAN	protein_coding	OTTHUMT00000254092.3	A	NM_004385		82871305	1	no_errors	NM_004385	genbank	human	validated	54_36p	missense	SNP	0.19	G
TTC37	9652	genome.wustl.edu	37	5	94856478	94856478	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1616-01A-01W-0553-09	TCGA-24-1616-10A-01W-0553-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	c464b2f6-9cfe-463a-b5e3-9a76cd4480c5	502d962b-e71b-4b9d-a85f-4513c720ee09	g.chr5:94856478C>G	ENST00000358746.2	-	20	2354	c.2056G>C	c.(2056-2058)Gat>Cat	p.D686H	RNU6-308P_ENST00000390957.1_RNA	NM_014639.3	NP_055454.1	Q6PGP7	TTC37_HUMAN	tetratricopeptide repeat domain 37	686						cytoplasm (GO:0005737)|nucleus (GO:0005634)|Ski complex (GO:0055087)|transcriptionally active chromatin (GO:0035327)		p.D686H(1)		breast(2)|endometrium(6)|kidney(3)|large_intestine(13)|liver(1)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(1)	47						TCAAGATAATCAACTAGAGCT	0.284																																																1	Substitution - Missense(1)	ovary(1)	5											68.0	71.0	70.0					5																	94856478		2203	4298	6501	94882234	SO:0001583	missense	9652			AB002370	CCDS4072.1	5q15	2014-09-17	2008-06-11	2008-06-11	ENSG00000198677	ENSG00000198677		"""Tetratricopeptide (TTC) repeat domain containing"""	23639	protein-coding gene	gene with protein product		614589	"""KIAA0372"""	KIAA0372		9205841	Standard	NM_014639		Approved		uc003klb.3	Q6PGP7	OTTHUMG00000121165	ENST00000358746.2:c.2056G>C	5.37:g.94856478C>G	ENSP00000351596:p.Asp686His		94882234	O15077|Q6PJI3	Missense_Mutation	SNP	-	p.D686H	ENST00000358746.2	37	c.2056	CCDS4072.1	5	.	.	.	.	.	.	.	.	.	.	C	19.51	3.840718	0.71488	.	.	ENSG00000198677	ENST00000358746	T	0.79554	-1.28	5.17	5.17	0.71159	Tetratricopeptide-like helical (1);	0.114763	0.56097	D	0.000030	T	0.76513	0.3998	L	0.56769	1.78	0.49915	D	0.999834	P	0.51147	0.942	B	0.42653	0.394	T	0.77178	-0.2683	10	0.41790	T	0.15	.	10.7833	0.46390	0.0:0.9046:0.0:0.0954	.	686	Q6PGP7	TTC37_HUMAN	H	686	ENSP00000351596:D686H	ENSP00000351596:D686H	D	-	1	0	TTC37	94882234	0.857000	0.29778	0.992000	0.48379	0.991000	0.79684	1.517000	0.35867	2.395000	0.81488	0.650000	0.86243	GAT	-	NULL		0.284	TTC37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC37	protein_coding	OTTHUMT00000241651.1	C	NM_014639		94882234	-1	no_errors	NM_014639	genbank	human	provisional	54_36p	missense	SNP	0.95	G
TTC37	9652	genome.wustl.edu	37	5	94856496	94856496	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1616-01A-01W-0553-09	TCGA-24-1616-10A-01W-0553-09	C	C	A	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	c464b2f6-9cfe-463a-b5e3-9a76cd4480c5	502d962b-e71b-4b9d-a85f-4513c720ee09	g.chr5:94856496C>A	ENST00000358746.2	-	20	2336	c.2038G>T	c.(2038-2040)Gca>Tca	p.A680S	RNU6-308P_ENST00000390957.1_RNA	NM_014639.3	NP_055454.1	Q6PGP7	TTC37_HUMAN	tetratricopeptide repeat domain 37	680						cytoplasm (GO:0005737)|nucleus (GO:0005634)|Ski complex (GO:0055087)|transcriptionally active chromatin (GO:0035327)		p.A680S(1)		breast(2)|endometrium(6)|kidney(3)|large_intestine(13)|liver(1)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(1)	47						GCTGCTTTTGCCATCATAAGA	0.294																																																1	Substitution - Missense(1)	ovary(1)	5											64.0	67.0	66.0					5																	94856496		2203	4298	6501	94882252	SO:0001583	missense	9652			AB002370	CCDS4072.1	5q15	2014-09-17	2008-06-11	2008-06-11	ENSG00000198677	ENSG00000198677		"""Tetratricopeptide (TTC) repeat domain containing"""	23639	protein-coding gene	gene with protein product		614589	"""KIAA0372"""	KIAA0372		9205841	Standard	NM_014639		Approved		uc003klb.3	Q6PGP7	OTTHUMG00000121165	ENST00000358746.2:c.2038G>T	5.37:g.94856496C>A	ENSP00000351596:p.Ala680Ser		94882252	O15077|Q6PJI3	Missense_Mutation	SNP	-	p.A680S	ENST00000358746.2	37	c.2038	CCDS4072.1	5	.	.	.	.	.	.	.	.	.	.	C	25.8	4.675615	0.88445	.	.	ENSG00000198677	ENST00000358746	D	0.81499	-1.5	5.17	5.17	0.71159	Tetratricopeptide-like helical (1);	0.194058	0.44097	D	0.000490	T	0.80989	0.4730	M	0.70275	2.135	0.54753	D	0.999985	P	0.48589	0.912	B	0.43082	0.407	T	0.80915	-0.1169	10	0.31617	T	0.26	.	16.8586	0.86012	0.0:1.0:0.0:0.0	.	680	Q6PGP7	TTC37_HUMAN	S	680	ENSP00000351596:A680S	ENSP00000351596:A680S	A	-	1	0	TTC37	94882252	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	4.274000	0.58921	2.395000	0.81488	0.650000	0.86243	GCA	-	NULL		0.294	TTC37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC37	protein_coding	OTTHUMT00000241651.1	C	NM_014639		94882252	-1	no_errors	NM_014639	genbank	human	provisional	54_36p	missense	SNP	1	A
TTC37	9652	genome.wustl.edu	37	5	94857881	94857881	+	Nonsense_Mutation	SNP	C	C	A			TCGA-24-1616-01A-01W-0553-09	TCGA-24-1616-10A-01W-0553-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	c464b2f6-9cfe-463a-b5e3-9a76cd4480c5	502d962b-e71b-4b9d-a85f-4513c720ee09	g.chr5:94857881C>A	ENST00000358746.2	-	19	2186	c.1888G>T	c.(1888-1890)Gaa>Taa	p.E630*	RNU6-308P_ENST00000390957.1_RNA	NM_014639.3	NP_055454.1	Q6PGP7	TTC37_HUMAN	tetratricopeptide repeat domain 37	630						cytoplasm (GO:0005737)|nucleus (GO:0005634)|Ski complex (GO:0055087)|transcriptionally active chromatin (GO:0035327)		p.E630*(1)		breast(2)|endometrium(6)|kidney(3)|large_intestine(13)|liver(1)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(1)	47						TATATGGATTCTGGGTTCAGC	0.418																																																1	Substitution - Nonsense(1)	ovary(1)	5											218.0	196.0	203.0					5																	94857881		2203	4300	6503	94883637	SO:0001587	stop_gained	9652			AB002370	CCDS4072.1	5q15	2014-09-17	2008-06-11	2008-06-11	ENSG00000198677	ENSG00000198677		"""Tetratricopeptide (TTC) repeat domain containing"""	23639	protein-coding gene	gene with protein product		614589	"""KIAA0372"""	KIAA0372		9205841	Standard	NM_014639		Approved		uc003klb.3	Q6PGP7	OTTHUMG00000121165	ENST00000358746.2:c.1888G>T	5.37:g.94857881C>A	ENSP00000351596:p.Glu630*		94883637	O15077|Q6PJI3	Nonsense_Mutation	SNP	-	p.E630*	ENST00000358746.2	37	c.1888	CCDS4072.1	5	.	.	.	.	.	.	.	.	.	.	C	39	7.302085	0.98196	.	.	ENSG00000198677	ENST00000358746;ENST00000514952	.	.	.	4.72	3.85	0.44370	.	0.547911	0.19517	N	0.112380	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.23891	T	0.37	.	10.2606	0.43425	0.0:0.8398:0.0:0.1602	.	.	.	.	X	630;582	.	ENSP00000351596:E630X	E	-	1	0	TTC37	94883637	0.002000	0.14202	1.000000	0.80357	0.969000	0.65631	0.519000	0.22862	1.120000	0.41904	0.467000	0.42956	GAA	-	NULL		0.418	TTC37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC37	protein_coding	OTTHUMT00000241651.1	C	NM_014639		94883637	-1	no_errors	NM_014639	genbank	human	provisional	54_36p	nonsense	SNP	0.97	A
GABRG2	2566	genome.wustl.edu	37	5	161580301	161580301	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1616-01A-01W-0553-09	TCGA-24-1616-10A-01W-0553-09	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	c464b2f6-9cfe-463a-b5e3-9a76cd4480c5	502d962b-e71b-4b9d-a85f-4513c720ee09	g.chr5:161580301A>G	ENST00000361925.4	+	9	1551	c.1331A>G	c.(1330-1332)tAt>tGt	p.Y444C	GABRG2_ENST00000393933.4_Missense_Mutation_p.Y349C|GABRG2_ENST00000414552.2_Missense_Mutation_p.Y492C|GABRG2_ENST00000356592.3_Missense_Mutation_p.Y452C			P18507	GBRG2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 2	444					adult behavior (GO:0030534)|cellular response to histamine (GO:0071420)|chloride transmembrane transport (GO:1902476)|gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|post-embryonic development (GO:0009791)|synaptic transmission (GO:0007268)|synaptic transmission, GABAergic (GO:0051932)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon (GO:0030424)|cell junction (GO:0030054)|chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|GABA-A receptor complex (GO:1902711)|inhibitory synapse (GO:0060077)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)	p.Y452C(1)		NS(1)|breast(1)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(15)|lung(24)|ovary(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	62	Renal(175;0.000319)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0734)|OV - Ovarian serous cystadenocarcinoma(192;0.135)|Epithelial(171;0.136)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Ginkgo biloba(DB01381)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	ATGGACTCCTATGCTCGGATC	0.473																																																1	Substitution - Missense(1)	ovary(1)	5											276.0	275.0	276.0					5																	161580301		2203	4300	6503	161512879	SO:0001583	missense	2566				CCDS4358.1, CCDS4359.1, CCDS47333.1	5q34	2012-06-22			ENSG00000113327	ENSG00000113327		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4087	protein-coding gene	gene with protein product	"""GABA(A) receptor, gamma 2"""	137164					Standard	NM_198904		Approved		uc010jjc.3	P18507	OTTHUMG00000130350	ENST00000361925.4:c.1331A>G	5.37:g.161580301A>G	ENSP00000354651:p.Tyr444Cys		161512879	F5HB82|Q6GRL6|Q6PCC3|Q9UDB3|Q9UN15	Missense_Mutation	SNP	HMMPfam_Neur_chan_memb;HMMPfam_Neur_chan_LBD;superfamily_Nicotinic receptor ligand binding domain-like;superfamily_Neurotransmitter-gated ion-channel transmembrane pore	p.Y452C	ENST00000361925.4	37	c.1355	CCDS4358.1	5	.	.	.	.	.	.	.	.	.	.	A	19.06	3.753779	0.69648	.	.	ENSG00000113327	ENST00000356592;ENST00000414552;ENST00000361925;ENST00000393933	D;D;D;D	0.85013	-1.93;-1.93;-1.93;-1.93	5.95	5.95	0.96441	Neurotransmitter-gated ion-channel transmembrane domain (1);	0.056659	0.64402	D	0.000001	D	0.92140	0.7508	M	0.73430	2.235	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.92897	0.6336	10	0.87932	D	0	.	16.4237	0.83790	1.0:0.0:0.0:0.0	.	492;444;452	F5HB82;P18507;P18507-2	.;GBRG2_HUMAN;.	C	452;492;444;349	ENSP00000349000:Y452C;ENSP00000410732:Y492C;ENSP00000354651:Y444C;ENSP00000377510:Y349C	ENSP00000349000:Y452C	Y	+	2	0	GABRG2	161512879	1.000000	0.71417	0.997000	0.53966	0.997000	0.91878	9.228000	0.95250	2.279000	0.76181	0.533000	0.62120	TAT	-	HMMPfam_Neur_chan_memb		0.473	GABRG2-002	KNOWN	basic|CCDS	protein_coding	GABRG2	protein_coding	OTTHUMT00000252706.1	A			161512879	1	no_errors	NM_198904	genbank	human	reviewed	54_36p	missense	SNP	1	G
HIST1H1C	3006	genome.wustl.edu	37	6	26056646	26056646	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1616-01A-01W-0553-09	TCGA-24-1616-10A-01W-0553-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_III	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	c464b2f6-9cfe-463a-b5e3-9a76cd4480c5	502d962b-e71b-4b9d-a85f-4513c720ee09	g.chr6:26056646G>C	ENST00000343677.2	-	1	53	c.11C>G	c.(10-12)aCt>aGt	p.T4S		NM_005319.3	NP_005310.1	P16403	H12_HUMAN	histone cluster 1, H1c	4					nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)	nuclear euchromatin (GO:0005719)|nucleosome (GO:0000786)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|poly(A) RNA binding (GO:0044822)	p.T4S(1)		NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(1)|large_intestine(1)|lung(8)|ovary(4)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)	34						GGCAGGAGCAGTCTCGGACAT	0.617																																																1	Substitution - Missense(1)	ovary(1)	6											24.0	28.0	26.0					6																	26056646		2181	4266	6447	26164625	SO:0001583	missense	3006			X57129	CCDS4577.1	6p21.3	2012-10-02	2006-10-11	2003-02-21	ENSG00000187837	ENSG00000187837		"""Histones / Replication-dependent"""	4716	protein-coding gene	gene with protein product		142710	"""H1 histone family, member 2"", ""histone 1, H1c"""	H1F2		2759094, 12408966	Standard	NM_005319		Approved	H1.2, H1s-1, H1c	uc003nfw.3	P16403	OTTHUMG00000016140	ENST00000343677.2:c.11C>G	6.37:g.26056646G>C	ENSP00000339566:p.Thr4Ser		26164625	A8K4I2	Missense_Mutation	SNP	-	p.T4S	ENST00000343677.2	37	c.11	CCDS4577.1	6	.	.	.	.	.	.	.	.	.	.	G	17.20	3.328349	0.60743	.	.	ENSG00000187837	ENST00000343677	T	0.04758	3.56	5.62	5.62	0.85841	.	0.422095	0.25756	N	0.028515	T	0.01661	0.0053	N	0.08118	0	0.39371	D	0.966086	B	0.27853	0.191	B	0.23852	0.049	T	0.57625	-0.7779	10	0.42905	T	0.14	-7.2852	19.0125	0.92879	0.0:0.0:1.0:0.0	.	4	P16403	H12_HUMAN	S	4	ENSP00000339566:T4S	ENSP00000339566:T4S	T	-	2	0	HIST1H1C	26164625	0.977000	0.34250	0.991000	0.47740	0.891000	0.51852	1.858000	0.39408	2.804000	0.96469	0.655000	0.94253	ACT	-	NULL		0.617	HIST1H1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H1C	protein_coding	OTTHUMT00000043372.1	G	NM_005319		26164625	-1	no_errors	NM_005319	genbank	human	reviewed	54_36p	missense	SNP	0.983	C
KCNQ5	56479	genome.wustl.edu	37	6	73787518	73787518	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1616-01A-01W-0553-09	TCGA-24-1616-10A-01W-0553-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	c464b2f6-9cfe-463a-b5e3-9a76cd4480c5	502d962b-e71b-4b9d-a85f-4513c720ee09	g.chr6:73787518G>A	ENST00000370398.1	+	5	935	c.826G>A	c.(826-828)Gtt>Att	p.V276I	KCNQ5_ENST00000355635.3_Missense_Mutation_p.V276I|KCNQ5_ENST00000403813.2_Missense_Mutation_p.V276I|KCNQ5_ENST00000355194.4_Missense_Mutation_p.V276I|KCNQ5_ENST00000414165.2_Missense_Mutation_p.V276I|KCNQ5_ENST00000370392.1_Missense_Mutation_p.V276I|KCNQ5_ENST00000402622.2_Missense_Mutation_p.V276I|KCNQ5_ENST00000342056.2_Missense_Mutation_p.V276I	NM_019842.3	NP_062816.2	Q9NR82	KCNQ5_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 5	276					protein complex assembly (GO:0006461)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|inward rectifier potassium channel activity (GO:0005242)	p.V276I(1)		breast(1)|cervix(1)|endometrium(6)|kidney(7)|large_intestine(13)|lung(15)|ovary(4)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	57		all_epithelial(107;0.116)|Lung NSC(302;0.219)		COAD - Colon adenocarcinoma(1;0.0107)|Colorectal(1;0.0583)	Ezogabine(DB04953)	AGGATTTTTGGTTCTTATTTT	0.343																																					GBM(142;1375 1859 14391 23261 44706)											1	Substitution - Missense(1)	ovary(1)	6											141.0	120.0	127.0					6																	73787518		2203	4300	6503	73844239	SO:0001583	missense	56479			AF202977	CCDS4976.1, CCDS55034.1	6q14	2012-07-05			ENSG00000185760	ENSG00000185760		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6299	protein-coding gene	gene with protein product		607357				10787416, 10816588, 16382104	Standard	NM_019842		Approved	Kv7.5	uc011dyh.2	Q9NR82	OTTHUMG00000015020	ENST00000370398.1:c.826G>A	6.37:g.73787518G>A	ENSP00000359425:p.Val276Ile		73844239	A6NKT6|A6PVT6|A8MSQ5|B4DS33|B5MC83|B7ZL37|F5GZV0|Q17RE1|Q5VVP3|Q86W40|Q9NRN0|Q9NYA6	Missense_Mutation	SNP	HMMPfam_Ion_trans;HMMPfam_KCNQ_channel;superfamily_Voltage-gated potassium channels	p.V276I	ENST00000370398.1	37	c.826	CCDS4976.1	6	.	.	.	.	.	.	.	.	.	.	G	22.6	4.307570	0.81247	.	.	ENSG00000185760	ENST00000342056;ENST00000451840;ENST00000355194;ENST00000370398;ENST00000370392;ENST00000402622;ENST00000355635;ENST00000403813;ENST00000414165	D;D;D;D;D;D;D;D	0.98455	-4.94;-4.94;-4.94;-4.94;-4.94;-4.94;-4.94;-4.94	5.86	5.86	0.93980	Ion transport (1);	0.060780	0.64402	D	0.000003	D	0.97266	0.9106	N	0.13371	0.34	0.53005	D	0.999964	B;P;P;P;D;D	0.60160	0.302;0.914;0.778;0.737;0.987;0.967	B;P;P;B;D;P	0.65140	0.395;0.677;0.674;0.442;0.932;0.852	D	0.98378	1.0557	10	0.56958	D	0.05	.	20.1823	0.98208	0.0:0.0:1.0:0.0	.	276;276;276;276;276;276	F5GZV0;Q9NR82-3;A6PVT6;Q9NR82-2;Q9NR82;Q9NR82-4	.;.;.;.;KCNQ5_HUMAN;.	I	276	ENSP00000345055:V276I;ENSP00000347326:V276I;ENSP00000359425:V276I;ENSP00000359419:V276I;ENSP00000385501:V276I;ENSP00000347853:V276I;ENSP00000384453:V276I;ENSP00000409861:V276I	ENSP00000345055:V276I	V	+	1	0	KCNQ5	73844239	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.771000	0.95319	0.650000	0.86243	GTT	-	HMMPfam_Ion_trans		0.343	KCNQ5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KCNQ5	protein_coding	OTTHUMT00000041198.3	G	NM_019842		73844239	1	no_errors	NM_019842	genbank	human	reviewed	54_36p	missense	SNP	1	A
PLEKHG1	57480	genome.wustl.edu	37	6	151089810	151089810	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1616-01A-01W-0553-09	TCGA-24-1616-10A-01W-0553-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	c464b2f6-9cfe-463a-b5e3-9a76cd4480c5	502d962b-e71b-4b9d-a85f-4513c720ee09	g.chr6:151089810C>T	ENST00000358517.2	+	3	659	c.448C>T	c.(448-450)Ccc>Tcc	p.P150S	PLEKHG1_ENST00000367328.1_Missense_Mutation_p.P150S			Q9ULL1	PKHG1_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 1	150	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.						Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.P150S(1)		breast(3)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|lung(19)|ovary(5)|prostate(4)|stomach(1)|urinary_tract(3)	53			BRCA - Breast invasive adenocarcinoma(37;0.0923)	OV - Ovarian serous cystadenocarcinoma(155;6.69e-13)		AACAAAACTTCCCCTGGGGAC	0.398																																																1	Substitution - Missense(1)	ovary(1)	6											106.0	96.0	99.0					6																	151089810		2203	4300	6503	151131503	SO:0001583	missense	57480			AB033035	CCDS34552.1	6q25.1	2013-01-11			ENSG00000120278	ENSG00000120278		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	20884	protein-coding gene	gene with protein product						10574462	Standard	XM_005267064		Approved	KIAA1209, ARHGEF41	uc003qny.1	Q9ULL1	OTTHUMG00000015824	ENST00000358517.2:c.448C>T	6.37:g.151089810C>T	ENSP00000351318:p.Pro150Ser		151131503	Q5T1F2	Missense_Mutation	SNP	-	p.P150S	ENST00000358517.2	37	c.448	CCDS34552.1	6	.	.	.	.	.	.	.	.	.	.	C	12.93	2.085718	0.36758	.	.	ENSG00000120278	ENST00000367328;ENST00000535018;ENST00000358517	T;T	0.66460	-0.21;-0.21	6.02	5.05	0.67936	Dbl homology (DH) domain (5);	0.247067	0.47455	D	0.000235	T	0.45617	0.1351	M	0.65975	2.015	0.35125	D	0.767386	B;B	0.20164	0.042;0.042	B;B	0.23716	0.048;0.048	T	0.42378	-0.9455	10	0.23891	T	0.37	.	6.782	0.23650	0.0:0.7322:0.0:0.2678	.	150;150	Q5JYA6;Q9ULL1	.;PKHG1_HUMAN	S	150	ENSP00000356297:P150S;ENSP00000351318:P150S	ENSP00000351318:P150S	P	+	1	0	PLEKHG1	151131503	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.478000	0.45189	2.865000	0.98341	0.655000	0.94253	CCC	-	NULL		0.398	PLEKHG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHG1	protein_coding	OTTHUMT00000042691.1	C			151131503	1	no_errors	NM_001029884	genbank	human	provisional	54_36p	missense	SNP	1	T
GCC1	79571	genome.wustl.edu	37	7	127222792	127222792	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1616-01A-01W-0553-09	TCGA-24-1616-10A-01W-0553-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	c464b2f6-9cfe-463a-b5e3-9a76cd4480c5	502d962b-e71b-4b9d-a85f-4513c720ee09	g.chr7:127222792C>T	ENST00000321407.2	-	2	2028	c.1604G>A	c.(1603-1605)cGg>cAg	p.R535Q	GCC1_ENST00000497650.1_5'Flank	NM_024523.5	NP_078799.2	Q96CN9	GCC1_HUMAN	GRIP and coiled-coil domain containing 1	535					protein targeting to Golgi (GO:0000042)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)		p.R535Q(1)		breast(2)|endometrium(6)|kidney(4)|large_intestine(6)|lung(13)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	38						GCAGGAGAGCCGCAGGGAAAT	0.587																																																1	Substitution - Missense(1)	ovary(1)	7											55.0	57.0	56.0					7																	127222792		2203	4300	6503	127010028	SO:0001583	missense	79571			AF525417	CCDS5796.1	7q22.3	2004-03-05	2003-10-17		ENSG00000179562	ENSG00000179562			19095	protein-coding gene	gene with protein product		607418	"""golgi coiled-coil 1"""			10209125	Standard	NM_024523		Approved	FLJ22035, GCC88, GCC1P, MGC20706	uc003vma.3	Q96CN9	OTTHUMG00000023590	ENST00000321407.2:c.1604G>A	7.37:g.127222792C>T	ENSP00000318821:p.Arg535Gln		127010028	Q9H6N7	Missense_Mutation	SNP	-	p.R535Q	ENST00000321407.2	37	c.1604	CCDS5796.1	7	.	.	.	.	.	.	.	.	.	.	C	12.69	2.014971	0.35511	.	.	ENSG00000179562	ENST00000321407	T	0.13657	2.57	5.29	5.29	0.74685	.	0.121836	0.56097	D	0.000021	T	0.08670	0.0215	L	0.37507	1.11	0.58432	D	0.999999	P	0.42248	0.774	B	0.26864	0.074	T	0.21042	-1.0257	10	0.07644	T	0.81	-16.0812	16.7981	0.85607	0.0:1.0:0.0:0.0	.	535	Q96CN9	GCC1_HUMAN	Q	535	ENSP00000318821:R535Q	ENSP00000318821:R535Q	R	-	2	0	GCC1	127010028	1.000000	0.71417	0.966000	0.40874	0.025000	0.11179	5.648000	0.67930	2.625000	0.88918	0.655000	0.94253	CGG	-	NULL		0.587	GCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCC1	protein_coding	OTTHUMT00000059911.3	C	NM_024523		127010028	-1	no_errors	NM_024523	genbank	human	reviewed	54_36p	missense	SNP	1	T
KCTD7	154881	genome.wustl.edu	37	7	66103879	66103879	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1616-01A-01W-0553-09	TCGA-24-1616-10A-01W-0553-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	c464b2f6-9cfe-463a-b5e3-9a76cd4480c5	502d962b-e71b-4b9d-a85f-4513c720ee09	g.chr7:66103879G>A	ENST00000275532.3	+	4	714	c.530G>A	c.(529-531)cGt>cAt	p.R177H	KCTD7_ENST00000443322.1_Missense_Mutation_p.R177H	NM_001167961.2|NM_153033.4	NP_001161433.1|NP_694578.1	Q96MP8	KCTD7_HUMAN	potassium channel tetramerization domain containing 7	177					cell death (GO:0008219)|protein homooligomerization (GO:0051260)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)		p.R177H(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|urinary_tract(1)	16						GCCCGGCTGCGTGCGGTCCAG	0.577																																																1	Substitution - Missense(1)	ovary(1)	7											62.0	63.0	63.0					7																	66103879		2203	4300	6503	65741314	SO:0001583	missense	154881			AK056631	CCDS5534.1, CCDS55117.1	7q11.21	2014-09-17	2013-06-20		ENSG00000243335	ENSG00000243335			21957	protein-coding gene	gene with protein product		611725	"""potassium channel tetramerisation domain containing 7"""			12477932	Standard	NM_001167961		Approved	FLJ32069, EPM3, CLN14	uc003tve.3	Q96MP8	OTTHUMG00000129543	ENST00000275532.3:c.530G>A	7.37:g.66103879G>A	ENSP00000275532:p.Arg177His		65741314	A4D2M4|Q8IVR0	Missense_Mutation	SNP	-	p.R177H	ENST00000275532.3	37	c.530	CCDS5534.1	7	.	.	.	.	.	.	.	.	.	.	g	34	5.320885	0.95682	.	.	ENSG00000243335	ENST00000275532;ENST00000443322	T;T	0.79033	-1.23;-1.23	5.36	5.36	0.76844	.	.	.	.	.	T	0.79411	0.4441	L	0.43152	1.355	0.80722	D	1	D	0.67145	0.996	P	0.51170	0.661	T	0.80476	-0.1366	9	0.52906	T	0.07	.	18.4294	0.90620	0.0:0.0:1.0:0.0	.	177	Q96MP8	KCTD7_HUMAN	H	177	ENSP00000275532:R177H;ENSP00000411624:R177H	ENSP00000275532:R177H	R	+	2	0	KCTD7	65741314	1.000000	0.71417	0.993000	0.49108	0.978000	0.69477	9.097000	0.94193	2.675000	0.91044	0.655000	0.94253	CGT	-	NULL		0.577	KCTD7-001	KNOWN	basic|CCDS	protein_coding	KCTD7	protein_coding	OTTHUMT00000251733.2	G	NM_153033		65741314	1	no_errors	NM_153033	genbank	human	validated	54_36p	missense	SNP	1	A
TNPO3	23534	genome.wustl.edu	37	7	128612519	128612519	+	Silent	SNP	C	C	T			TCGA-24-1616-01A-01W-0553-09	TCGA-24-1616-10A-01W-0553-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	c464b2f6-9cfe-463a-b5e3-9a76cd4480c5	502d962b-e71b-4b9d-a85f-4513c720ee09	g.chr7:128612519C>T	ENST00000265388.5	-	19	2534	c.2391G>A	c.(2389-2391)agG>agA	p.R797R	TNPO3_ENST00000471166.1_Silent_p.R831R|RN7SL306P_ENST00000492941.2_RNA|TNPO3_ENST00000471234.1_Silent_p.R733R|TNPO3_ENST00000393245.1_Silent_p.R831R|TNPO3_ENST00000482320.1_Silent_p.R731R			Q9Y5L0	TNPO3_HUMAN	transportin 3	797					splicing factor protein import into nucleus (GO:0035048)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	receptor activity (GO:0004872)	p.R797R(1)		central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(7)|ovary(2)|prostate(2)|skin(3)	22						CTCGTAGAAACCTCATGACAC	0.448																																					Pancreas(147;583 2585 39696 52331)											1	Substitution - coding silent(1)	ovary(1)	7											111.0	99.0	103.0					7																	128612519		2203	4300	6503	128399755	SO:0001819	synonymous_variant	23534			AF145029	CCDS5809.1, CCDS55162.1	7q32.2	2014-02-03			ENSG00000064419	ENSG00000064419		"""Importins"""	17103	protein-coding gene	gene with protein product	"""importin 12"""	610032	"""limb girdle muscular dystrophy 1F (autosomal dominant)"""	LGMD1F		10366588, 10713112, 23543484, 23667635	Standard	NM_012470		Approved	TRN-SR, MTR10A, TRN-SR2, IPO12	uc003vol.2	Q9Y5L0	OTTHUMG00000158409	ENST00000265388.5:c.2391G>A	7.37:g.128612519C>T			128399755	A4D1K9|C9IZM0|Q6NUM1|Q96G71|Q96GU9|Q9Y3R2	Silent	SNP	HMMPfam_Xpo1;superfamily_ARM repeat	p.R797	ENST00000265388.5	37	c.2391	CCDS5809.1	7																																																																																			-	NULL		0.448	TNPO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNPO3	protein_coding	OTTHUMT00000350929.1	C	NM_012470		128399755	-1	no_errors	NM_012470	genbank	human	validated	54_36p	silent	SNP	1	T
HAS2	3037	genome.wustl.edu	37	8	122626537	122626537	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1616-01A-01W-0553-09	TCGA-24-1616-10A-01W-0553-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	c464b2f6-9cfe-463a-b5e3-9a76cd4480c5	502d962b-e71b-4b9d-a85f-4513c720ee09	g.chr8:122626537C>A	ENST00000303924.4	-	4	2008	c.1471G>T	c.(1471-1473)Ggt>Tgt	p.G491C		NM_005328.2	NP_005319.1	Q92819	HYAS2_HUMAN	hyaluronan synthase 2	491					atrioventricular canal development (GO:0036302)|bone morphogenesis (GO:0060349)|cellular response to fluid shear stress (GO:0071498)|cellular response to interleukin-1 (GO:0071347)|cellular response to platelet-derived growth factor stimulus (GO:0036120)|cellular response to tumor necrosis factor (GO:0071356)|endocardial cushion to mesenchymal transition (GO:0090500)|extracellular matrix assembly (GO:0085029)|extracellular polysaccharide biosynthetic process (GO:0045226)|hyaluronan biosynthetic process (GO:0030213)|kidney development (GO:0001822)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of monocyte aggregation (GO:1900625)|positive regulation of urine volume (GO:0035810)|renal water absorption (GO:0070295)|vasculogenesis (GO:0001570)	integral component of plasma membrane (GO:0005887)	hyaluronan synthase activity (GO:0050501)	p.G491C(1)	HAS2/PLAG1(10)	breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(19)|ovary(5)|skin(1)	38	Lung NSC(37;3.12e-08)|Ovarian(258;0.0254)|Hepatocellular(40;0.0997)|all_neural(195;0.142)		STAD - Stomach adenocarcinoma(47;0.00503)			AAAATCACACCACCCAGGAGG	0.398																																																1	Substitution - Missense(1)	ovary(1)	8											109.0	107.0	107.0					8																	122626537		2203	4300	6503	122695718	SO:0001583	missense	3037			U54804	CCDS6335.1	8q24.12	2013-02-22			ENSG00000170961	ENSG00000170961	2.4.1.212	"""Glycosyltransferase family 2 domain containing"""	4819	protein-coding gene	gene with protein product		601636				9169154	Standard	NM_005328		Approved		uc003yph.2	Q92819	OTTHUMG00000164953	ENST00000303924.4:c.1471G>T	8.37:g.122626537C>A	ENSP00000306991:p.Gly491Cys		122695718	Q32MM3	Missense_Mutation	SNP	HMMPfam_Glycos_transf_2;superfamily_Nucleotide-diphospho-sugar transferases	p.G491C	ENST00000303924.4	37	c.1471	CCDS6335.1	8	.	.	.	.	.	.	.	.	.	.	C	16.93	3.258685	0.59321	.	.	ENSG00000170961	ENST00000303924	T	0.58797	0.31	6.17	5.3	0.74995	.	0.042355	0.85682	D	0.000000	T	0.76572	0.4006	M	0.77486	2.375	0.80722	D	1	D	0.71674	0.998	D	0.78314	0.991	T	0.80348	-0.1420	10	0.87932	D	0	-15.8617	15.699	0.77528	0.0:0.9348:0.0:0.0652	.	491	Q92819	HAS2_HUMAN	C	491	ENSP00000306991:G491C	ENSP00000306991:G491C	G	-	1	0	HAS2	122695718	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.808000	0.86044	1.630000	0.50440	0.655000	0.94253	GGT	-	NULL		0.398	HAS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HAS2	protein_coding	OTTHUMT00000381150.2	C	NM_005328		122695718	-1	no_errors	NM_005328	genbank	human	reviewed	54_36p	missense	SNP	1	A
IFNA17	3451	genome.wustl.edu	37	9	21227987	21227987	+	Silent	SNP	G	G	A			TCGA-24-1616-01A-01W-0553-09	TCGA-24-1616-10A-01W-0553-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	c464b2f6-9cfe-463a-b5e3-9a76cd4480c5	502d962b-e71b-4b9d-a85f-4513c720ee09	g.chr9:21227987G>A	ENST00000413767.2	-	1	234	c.186C>T	c.(184-186)ccC>ccT	p.P62P		NM_021268.2	NP_067091.1	P01571	IFN17_HUMAN	interferon, alpha 17	62					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|natural killer cell activation involved in immune response (GO:0002323)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|T cell activation involved in immune response (GO:0002286)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|type I interferon receptor binding (GO:0005132)	p.P62P(1)		breast(1)|endometrium(2)|lung(4)|ovary(1)|skin(1)	9				Lung(24;2.13e-22)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.116)		ACTCCTCCTGGGGAAGTCCAA	0.512																																																1	Substitution - coding silent(1)	ovary(1)	9											135.0	137.0	136.0					9																	21227987		2203	4300	6503	21217987	SO:0001819	synonymous_variant	3451				CCDS6500.1	9p22	2010-12-10			ENSG00000234829	ENSG00000234829		"""Interferons"""	5422	protein-coding gene	gene with protein product		147583				1385305	Standard	NM_021268		Approved	LEIF2C1, IFN-alphaI	uc003zos.1	P01571	OTTHUMG00000019667	ENST00000413767.2:c.186C>T	9.37:g.21227987G>A			21217987	Q14639|Q4KMT4|Q5VZ53|Q7M4Q4	Silent	SNP	-	p.P62	ENST00000413767.2	37	c.186	CCDS6500.1	9																																																																																			-	NULL		0.512	IFNA17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFNA17	protein_coding	OTTHUMT00000051896.1	G	NM_021268		21217987	-1	no_errors	NM_021268	genbank	human	provisional	54_36p	silent	SNP	0	A
SPATA31D1	389763	genome.wustl.edu	37	9	84609603	84609603	+	Silent	SNP	G	G	A			TCGA-24-1616-01A-01W-0553-09	TCGA-24-1616-10A-01W-0553-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	c464b2f6-9cfe-463a-b5e3-9a76cd4480c5	502d962b-e71b-4b9d-a85f-4513c720ee09	g.chr9:84609603G>A	ENST00000344803.2	+	4	4265	c.4218G>A	c.(4216-4218)agG>agA	p.R1406R		NM_001001670.2	NP_001001670.1	Q6ZQQ2	S31D1_HUMAN	SPATA31 subfamily D, member 1	1406					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)		p.R1406R(1)									AGAAAATTAGGAAAGACACTA	0.498																																																1	Substitution - coding silent(1)	ovary(1)	9											27.0	26.0	26.0					9																	84609603		1865	4108	5973	83799423	SO:0001819	synonymous_variant	389763				CCDS47986.1	9q21.32	2012-10-12	2012-10-12	2012-10-12	ENSG00000214929	ENSG00000214929			37283	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member D1"""	FAM75D1			Standard	NM_001001670		Approved	FLJ46321	uc004amn.3	Q6ZQQ2	OTTHUMG00000169122	ENST00000344803.2:c.4218G>A	9.37:g.84609603G>A			83799423		Silent	SNP	-	p.R1406	ENST00000344803.2	37	c.4218	CCDS47986.1	9																																																																																			-	NULL		0.498	SPATA31D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLJ46321	protein_coding	OTTHUMT00000402325.1	G	NM_001001670		83799423	1	no_errors	NM_001001670	genbank	human	validated	54_36p	silent	SNP		A
SYN1	6853	genome.wustl.edu	37	X	47435601	47435601	+	Missense_Mutation	SNP	T	T	C			TCGA-24-1616-01A-01W-0553-09	TCGA-24-1616-10A-01W-0553-09	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	c464b2f6-9cfe-463a-b5e3-9a76cd4480c5	502d962b-e71b-4b9d-a85f-4513c720ee09	g.chrX:47435601T>C	ENST00000295987.7	-	9	1211	c.1087A>G	c.(1087-1089)Att>Gtt	p.I363V	SYN1_ENST00000340666.4_Missense_Mutation_p.I363V	NM_006950.3	NP_008881.2	P17600	SYN1_HUMAN	synapsin I	363	C; actin-binding and synaptic-vesicle binding.				neurotransmitter secretion (GO:0007269)|regulation of neurotransmitter secretion (GO:0046928)|regulation of synaptic vesicle exocytosis (GO:2000300)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytosol (GO:0005829)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|catalytic activity (GO:0003824)|protein kinase binding (GO:0019901)|transporter activity (GO:0005215)	p.I363V(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|large_intestine(6)|lung(6)|ovary(1)	21						CCCCCAAAAATCTCTGAGCAC	0.577																																																1	Substitution - Missense(1)	ovary(1)	X											120.0	66.0	85.0					X																	47435601		2202	4300	6502	47320545	SO:0001583	missense	6853				CCDS14280.1, CCDS35233.1	Xp11.2	2012-10-02			ENSG00000008056	ENSG00000008056			11494	protein-coding gene	gene with protein product		313440					Standard	NM_133499		Approved		uc004die.3	P17600	OTTHUMG00000021454	ENST00000295987.7:c.1087A>G	X.37:g.47435601T>C	ENSP00000295987:p.Ile363Val		47320545	B1AJQ1|O75825|Q5H9A9	Missense_Mutation	SNP	HMMPfam_Synapsin_N;HMMPfam_Synapsin_C;superfamily_PreATP-grasp domain;superfamily_Glutathione synthetase ATP-binding domain-like	p.I363V	ENST00000295987.7	37	c.1087	CCDS14280.1	X	.	.	.	.	.	.	.	.	.	.	t	4.674	0.125360	0.08931	.	.	ENSG00000008056	ENST00000295987;ENST00000340666	T;T	0.35421	1.76;1.31	4.66	3.49	0.39957	ATP-grasp fold, subdomain 2 (1);Synapsin, ATP-binding domain (1);	0.075411	0.49916	D	0.000126	T	0.25938	0.0632	N	0.25380	0.74	0.44352	D	0.997249	B;B	0.25486	0.127;0.06	B;B	0.31751	0.135;0.047	T	0.05241	-1.0897	10	0.42905	T	0.14	-6.7775	7.6812	0.28515	0.0:0.1042:0.0:0.8958	.	363;363	P17600;P17600-2	SYN1_HUMAN;.	V	363	ENSP00000295987:I363V;ENSP00000343206:I363V	ENSP00000295987:I363V	I	-	1	0	SYN1	47320545	1.000000	0.71417	0.998000	0.56505	0.031000	0.12232	3.034000	0.49751	0.491000	0.27793	-0.449000	0.05564	ATT	-	HMMPfam_Synapsin_C		0.577	SYN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYN1	protein_coding	OTTHUMT00000056445.1	T	NM_006950		47320545	-1	no_errors	NM_006950	genbank	human	reviewed	54_36p	missense	SNP	1	C
TIMM17B	10245	genome.wustl.edu	37	X	48751255	48751255	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1616-01A-01W-0553-09	TCGA-24-1616-10A-01W-0553-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	c464b2f6-9cfe-463a-b5e3-9a76cd4480c5	502d962b-e71b-4b9d-a85f-4513c720ee09	g.chrX:48751255C>G	ENST00000376582.3	-	6	506	c.358G>C	c.(358-360)Ggc>Cgc	p.G120R	TIMM17B_ENST00000495490.2_Missense_Mutation_p.G140R|TIMM17B_ENST00000396779.3_Missense_Mutation_p.G170R|TIMM17B_ENST00000472645.1_5'UTR|TIMM17B_ENST00000465150.2_Missense_Mutation_p.G170R	NM_005834.3	NP_005825.1	O60830	TI17B_HUMAN	translocase of inner mitochondrial membrane 17 homolog B (yeast)	120					cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)	integral component of mitochondrial inner membrane (GO:0031305)|mitochondrial inner membrane presequence translocase complex (GO:0005744)	P-P-bond-hydrolysis-driven protein transmembrane transporter activity (GO:0015450)	p.G120R(1)		kidney(1)|large_intestine(1)|lung(3)|ovary(1)	6						AACAGGATGCCCCCCATCATT	0.617																																																1	Substitution - Missense(1)	ovary(1)	X											41.0	33.0	35.0					X																	48751255		2203	4300	6503	48636199	SO:0001583	missense	10245			AF034790	CCDS14308.1, CCDS55411.1	Xp11.23	2008-02-05			ENSG00000126768	ENSG00000126768			17310	protein-coding gene	gene with protein product		300249				10339406	Standard	NM_001167947		Approved	DXS9822, JM3	uc004dla.2	O60830	OTTHUMG00000034498	ENST00000376582.3:c.358G>C	X.37:g.48751255C>G	ENSP00000365766:p.Gly120Arg		48636199	A8K2E2|J3KPV3|Q9UJV0	Missense_Mutation	SNP	-	p.G120R	ENST00000376582.3	37	c.358	CCDS14308.1	X	.	.	.	.	.	.	.	.	.	.	c	26.2	4.715716	0.89112	.	.	ENSG00000126768	ENST00000376582;ENST00000396779	T;T	0.33438	1.41;1.41	5.18	5.18	0.71444	.	0.000000	0.85682	D	0.000000	T	0.70596	0.3242	H	0.97365	3.99	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.82806	-0.0275	10	0.87932	D	0	-0.2579	16.4133	0.83726	0.0:1.0:0.0:0.0	.	120	O60830	TI17B_HUMAN	R	120;170	ENSP00000365766:G120R;ENSP00000379999:G170R	ENSP00000365766:G120R	G	-	1	0	TIMM17B	48636199	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.755000	0.68750	2.129000	0.65627	0.600000	0.82982	GGC	-	NULL		0.617	TIMM17B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIMM17B	protein_coding	OTTHUMT00000083411.2	C	NM_005834		48636199	-1	no_errors	NM_005834	genbank	human	validated	54_36p	missense	SNP	1	G
ACRC	93953	genome.wustl.edu	37	X	70823745	70823745	+	Silent	SNP	C	C	T			TCGA-24-1616-01A-01W-0553-09	TCGA-24-1616-10A-01W-0553-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	c464b2f6-9cfe-463a-b5e3-9a76cd4480c5	502d962b-e71b-4b9d-a85f-4513c720ee09	g.chrX:70823745C>T	ENST00000373695.1	+	7	1155	c.618C>T	c.(616-618)gaC>gaT	p.D206D	ACRC_ENST00000373696.3_Silent_p.D206D			Q96QF7	ACRC_HUMAN	acidic repeat containing	206	Asp/Ser-rich.					nucleus (GO:0005634)		p.D206D(1)		autonomic_ganglia(1)|breast(1)|endometrium(15)|kidney(4)|large_intestine(4)|lung(20)|ovary(5)|prostate(1)|skin(2)|stomach(1)	54	Renal(35;0.156)					ATTCATCCGACGACAACAGTG	0.502																																																1	Substitution - coding silent(1)	ovary(1)	X											326.0	263.0	285.0					X																	70823745		2203	4300	6503	70740470	SO:0001819	synonymous_variant	93953			AJ311392	CCDS35326.1	Xq13.1	2010-08-05			ENSG00000147174	ENSG00000147174			15805	protein-coding gene	gene with protein product		300369					Standard	NM_052957		Approved		uc004eae.2	Q96QF7	OTTHUMG00000033327	ENST00000373695.1:c.618C>T	X.37:g.70823745C>T			70740470	B9EG62	Silent	SNP	-	p.D206	ENST00000373695.1	37	c.618	CCDS35326.1	X																																																																																			-	NULL		0.502	ACRC-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ACRC	protein_coding	OTTHUMT00000081856.1	C			70740470	1	no_errors	NM_052957	genbank	human	validated	54_36p	silent	SNP	0.04	T
DIAPH2	1730	genome.wustl.edu	37	X	96185750	96185750	+	Missense_Mutation	SNP	A	A	T			TCGA-24-1616-01A-01W-0553-09	TCGA-24-1616-10A-01W-0553-09	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	c464b2f6-9cfe-463a-b5e3-9a76cd4480c5	502d962b-e71b-4b9d-a85f-4513c720ee09	g.chrX:96185750A>T	ENST00000324765.8	+	10	1344	c.997A>T	c.(997-999)Ata>Tta	p.I333L	DIAPH2_ENST00000355827.4_Missense_Mutation_p.I333L|DIAPH2_ENST00000373054.4_Missense_Mutation_p.I329L|DIAPH2_ENST00000373061.3_Missense_Mutation_p.I333L|DIAPH2_ENST00000373049.4_Missense_Mutation_p.I333L			O60879	DIAP2_HUMAN	diaphanous-related formin 2	333	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				actin filament polymerization (GO:0030041)|cytokinesis (GO:0000910)|female gamete generation (GO:0007292)|multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)	endosome (GO:0005768)	receptor binding (GO:0005102)	p.I333L(1)		breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	51						CATGCAGTTTATAAATGCCCT	0.308																																																1	Substitution - Missense(1)	ovary(1)	X											94.0	85.0	88.0					X																	96185750		2203	4299	6502	96072406	SO:0001583	missense	1730			Y15909	CCDS14467.1, CCDS14468.1	Xq22	2013-05-24	2013-05-24		ENSG00000147202	ENSG00000147202			2877	protein-coding gene	gene with protein product		300108	"""diaphanous (Drosophila, homolog) 2"", ""diaphanous homolog 2 (Drosophila)"""			9360932	Standard	NM_006729		Approved	POF, DIA, POF2, DIA2	uc004efu.4	O60879	OTTHUMG00000022689	ENST00000324765.8:c.997A>T	X.37:g.96185750A>T	ENSP00000321348:p.Ile333Leu		96072406	A6NG19|O60878|Q8WX06|Q8WX48|Q9UJL2	Missense_Mutation	SNP	HMMPfam_Drf_DAD;HMMPfam_Drf_FH3;HMMPfam_Drf_GBD;HMMPfam_FH2;superfamily_Formin homology 2 domain (FH2 domain)	p.I333L	ENST00000324765.8	37	c.997	CCDS14467.1	X	.	.	.	.	.	.	.	.	.	.	A	19.06	3.753267	0.69648	.	.	ENSG00000147202	ENST00000373061;ENST00000373054;ENST00000355827;ENST00000373049;ENST00000324765;ENST00000537885	D;D;D;D;D	0.91124	-2.79;-2.79;-2.79;-2.79;-2.79	5.07	5.07	0.68467	GTPase-binding/formin homology 3 (1);Diaphanous FH3 (1);Armadillo-type fold (1);	0.064020	0.56097	D	0.000022	D	0.94879	0.8345	M	0.77486	2.375	0.51482	D	0.999925	D;P;P	0.67145	0.996;0.929;0.823	D;P;D	0.77004	0.989;0.834;0.943	D	0.95443	0.8527	10	0.87932	D	0	.	14.2103	0.65759	1.0:0.0:0.0:0.0	.	333;333;340	O60879;O60879-2;B7ZLJ0	DIAP2_HUMAN;.;.	L	333;329;333;333;333;340	ENSP00000362152:I333L;ENSP00000362145:I329L;ENSP00000348082:I333L;ENSP00000362140:I333L;ENSP00000321348:I333L	ENSP00000321348:I333L	I	+	1	0	DIAPH2	96072406	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.637000	0.91014	1.802000	0.52723	0.481000	0.45027	ATA	-	HMMPfam_Drf_FH3		0.308	DIAPH2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DIAPH2	protein_coding	OTTHUMT00000058871.2	A	NM_006729, NM_007309		96072406	1	no_errors	NM_006729	genbank	human	reviewed	54_36p	missense	SNP	1	T
