#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
KANK1	23189	genome.wustl.edu	37	9	730134	730134	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chr9:730134G>C	ENST00000382303.1	+	8	3434	c.2782G>C	c.(2782-2784)Gaa>Caa	p.E928Q	KANK1_ENST00000382297.2_Missense_Mutation_p.E928Q|KANK1_ENST00000382293.3_Missense_Mutation_p.E770Q|KANK1_ENST00000489369.1_3'UTR	NM_001256876.1	NP_001243805.1	Q14678	KANK1_HUMAN	KN motif and ankyrin repeat domains 1	928					negative regulation of actin filament polymerization (GO:0030837)|negative regulation of cell migration (GO:0030336)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of lamellipodium morphogenesis (GO:2000393)|negative regulation of neuron projection development (GO:0010977)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of ruffle assembly (GO:1900028)|negative regulation of substrate adhesion-dependent cell spreading (GO:1900025)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation of wound healing (GO:0090303)|regulation of establishment of cell polarity (GO:2000114)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	beta-catenin binding (GO:0008013)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(9)|lung(8)|ovary(3)|pancreas(1)|prostate(3)|stomach(4)|upper_aerodigestive_tract(1)	43		Lung NSC(10;9.84e-12)|all_lung(10;1.02e-11)|Breast(48;0.128)		Epithelial(6;0.000153)|OV - Ovarian serous cystadenocarcinoma(1;0.000358)|Lung(218;0.0222)		GCCTGAGCAAGAAGTGGGGAC	0.522																																																0			9											71.0	61.0	64.0					9																	730134		2203	4300	6503	720134	SO:0001583	missense	23189			AL833161	CCDS6441.1, CCDS34976.1	9p24.3	2013-01-10	2008-01-29	2008-01-29	ENSG00000107104	ENSG00000107104		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	19309	protein-coding gene	gene with protein product		607704	"""ankyrin repeat domain 15"""	ANKRD15		12133830, 17996375, 19554261	Standard	NM_015158		Approved	KIAA0172, KANK	uc003zgn.2	Q14678	OTTHUMG00000019434	ENST00000382303.1:c.2782G>C	9.37:g.730134G>C	ENSP00000371740:p.Glu928Gln		720134	A2A2W8|D3DRH3|Q5W0W0|Q8IY65|Q8WX74	Missense_Mutation	SNP	superfamily_ANK,HMMSmart_ANK,HMMPfam_Ank	p.E928Q	ENST00000382303.1	37	c.2782	CCDS34976.1	9	.	.	.	.	.	.	.	.	.	.	G	12.30	1.896754	0.33535	.	.	ENSG00000107104	ENST00000382303;ENST00000354485;ENST00000382297;ENST00000382293	T;T;T	0.17528	2.27;2.27;2.27	5.91	5.02	0.67125	.	0.337537	0.25581	N	0.029684	T	0.12817	0.0311	L	0.38531	1.155	0.80722	D	1	B;B	0.33413	0.017;0.411	B;B	0.24155	0.01;0.051	T	0.08785	-1.0705	10	0.26408	T	0.33	-12.7557	13.2538	0.60066	0.073:0.0:0.927:0.0	.	928;928	Q5W0W1;Q14678	.;KANK1_HUMAN	Q	928;928;928;770	ENSP00000371740:E928Q;ENSP00000371734:E928Q;ENSP00000371730:E770Q	ENSP00000346479:E928Q	E	+	1	0	KANK1	720134	0.838000	0.29461	0.011000	0.14972	0.145000	0.21501	2.520000	0.45554	1.512000	0.48834	0.655000	0.94253	GAA	-	superfamily_ANK		0.522	KANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KANK1	protein_coding	OTTHUMT00000051484.2	G	NM_015158		720134	+1	no_errors	NM_015158	genbank	human	reviewed	54_36p	missense	SNP	0.069	C
PDYN	5173	genome.wustl.edu	37	20	1961029	1961029	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chr20:1961029C>A	ENST00000217305.2	-	4	930	c.705G>T	c.(703-705)aaG>aaT	p.K235N	PDYN_ENST00000539905.1_Missense_Mutation_p.K235N|RP4-684O24.5_ENST00000446562.1_RNA|PDYN_ENST00000540134.1_Missense_Mutation_p.K235N	NM_001190892.1|NM_001190898.2|NM_024411.4	NP_001177821.1|NP_001177827.1|NP_077722.1	P01213	PDYN_HUMAN	prodynorphin	235					cell death (GO:0008219)|neuropeptide signaling pathway (GO:0007218)|synaptic transmission (GO:0007268)	extracellular region (GO:0005576)|plasma membrane (GO:0005886)				endometrium(3)|kidney(1)|large_intestine(5)|lung(22)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						GAGTCACCACCTTGAACTGGC	0.527																																																0			20											98.0	107.0	104.0					20																	1961029		2203	4300	6503	1909029	SO:0001583	missense	5173				CCDS13023.1	20p13	2014-09-17			ENSG00000101327	ENSG00000101327		"""Endogenous ligands"""	8820	protein-coding gene	gene with protein product	"""preproenkephalin B"", ""rimorphin"", ""beta-neoendorphin"", ""dynorphin"", ""leu-enkephalin"", ""leumorphin"", ""neoendorphin-dynorphin-enkephalin prepropeptide"""	131340	"""spinocerebellar ataxia 23"""	SCA23		21035104	Standard	NM_001190892		Approved	PENKB, ADCA	uc021vzs.1	P01213	OTTHUMG00000031683	ENST00000217305.2:c.705G>T	20.37:g.1961029C>A	ENSP00000217305:p.Lys235Asn		1909029	A8K0Q3	Missense_Mutation	SNP	HMMPfam_Opiods_neuropep,PatternScan_OPIOIDS_PRECURSOR	p.K235N	ENST00000217305.2	37	c.705	CCDS13023.1	20	.	.	.	.	.	.	.	.	.	.	C	18.73	3.686143	0.68157	.	.	ENSG00000101327	ENST00000539905;ENST00000540134;ENST00000217305	D;D;D	0.82167	-1.58;-1.58;-1.58	5.0	2.92	0.33932	.	0.000000	0.85682	D	0.000000	D	0.89033	0.6600	M	0.82323	2.585	0.53005	D	0.999967	D	0.89917	1.0	D	0.91635	0.999	D	0.86613	0.1874	10	0.30078	T	0.28	-33.3712	7.9016	0.29738	0.0:0.7337:0.1684:0.0979	.	235	P01213	PDYN_HUMAN	N	235	ENSP00000440185:K235N;ENSP00000442259:K235N;ENSP00000217305:K235N	ENSP00000217305:K235N	K	-	3	2	PDYN	1909029	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	1.478000	0.35442	1.328000	0.45358	0.313000	0.20887	AAG	-	NULL		0.527	PDYN-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PDYN	protein_coding	OTTHUMT00000077569.2	C			1909029	-1	no_errors	NM_024411	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
FBXO18	84893	genome.wustl.edu	37	10	5948332	5948332	+	Nonsense_Mutation	SNP	C	C	T			TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chr10:5948332C>T	ENST00000362091.4	+	3	605	c.490C>T	c.(490-492)Caa>Taa	p.Q164*	FBXO18_ENST00000470089.1_3'UTR|FBXO18_ENST00000397269.3_5'UTR|FBXO18_ENST00000379999.5_Nonsense_Mutation_p.Q215*	NM_001258453.1|NM_178150.2	NP_001245382.1|NP_835363.1	Q8NFZ0	FBX18_HUMAN	F-box protein, helicase, 18	164	F-box. {ECO:0000255|PROSITE- ProRule:PRU00080}.				DNA catabolic process, endonucleolytic (GO:0000737)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902231)|positive regulation of protein phosphorylation (GO:0001934)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)			NS(2)|breast(2)|kidney(2)|large_intestine(16)|lung(9)|ovary(2)|prostate(3)|skin(3)|stomach(1)	40						GGAGGCCAGGCAAGAAGCAGA	0.572																																																0			10											53.0	48.0	49.0					10																	5948332		2203	4300	6503	5988338	SO:0001587	stop_gained	84893			AK095343	CCDS7072.1, CCDS7073.1, CCDS73064.1	10p15.1	2004-08-24	2004-06-15		ENSG00000134452	ENSG00000134452		"""F-boxes /  ""other"""""	13620	protein-coding gene	gene with protein product		607222	"""F-box only protein 18"""			10531037, 11956208	Standard	NM_032807		Approved	FBH1, FLJ14590, Fbx18	uc001iit.4	Q8NFZ0	OTTHUMG00000017609	ENST00000362091.4:c.490C>T	10.37:g.5948332C>T	ENSP00000355415:p.Gln164*		5988338	Q5JVB0|Q5JVB1|Q7Z4Q6|Q7Z4R0|Q8N1P5|Q8N586|Q96E82|Q96K67|Q96SW7|Q9UFB2	Nonsense_Mutation	SNP	superfamily_SSF81383,HMMPfam_F-box,HMMSmart_FBOX,superfamily_SSF52540	p.Q215*	ENST00000362091.4	37	c.643	CCDS7072.1	10	.	.	.	.	.	.	.	.	.	.	C	15.44	2.835185	0.50951	.	.	ENSG00000134452	ENST00000362091;ENST00000379999	.	.	.	5.76	2.49	0.30216	.	1.357460	0.04153	N	0.321677	.	.	.	.	.	.	0.18873	N	0.999988	.	.	.	.	.	.	.	.	.	.	0.14252	T	0.57	-0.0752	7.2325	0.26051	0.0:0.6218:0.0:0.3782	.	.	.	.	X	164;215	.	ENSP00000355415:Q164X	Q	+	1	0	FBXO18	5988338	0.000000	0.05858	0.016000	0.15963	0.009000	0.06853	0.357000	0.20199	0.789000	0.33779	-0.140000	0.14226	CAA	-	NULL		0.572	FBXO18-009	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO18	protein_coding	OTTHUMT00000046596.1	C	NM_032807		5988338	+1	no_errors	NM_032807	genbank	human	reviewed	54_36p	nonsense	SNP	0.000	T
VWF	7450	genome.wustl.edu	37	12	6120846	6120846	+	Missense_Mutation	SNP	A	A	T			TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chr12:6120846A>T	ENST00000261405.5	-	34	6033	c.5779T>A	c.(5779-5781)Tgc>Agc	p.C1927S		NM_000552.3	NP_000543	P04275	VWF_HUMAN	von Willebrand factor	1927					blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|extracellular matrix organization (GO:0030198)|hemostasis (GO:0007599)|liver development (GO:0001889)|placenta development (GO:0001890)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein homooligomerization (GO:0051260)|response to wounding (GO:0009611)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)|Weibel-Palade body (GO:0033093)	chaperone binding (GO:0051087)|collagen binding (GO:0005518)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|immunoglobulin binding (GO:0019865)|integrin binding (GO:0005178)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(41)|ovary(7)|pancreas(2)|prostate(6)|skin(15)|stomach(1)|upper_aerodigestive_tract(5)	129					Antihemophilic Factor(DB00025)	CTGTTAGGGCACGAAGGCCTC	0.607																																																0			12	GRCh37	CM930738	VWF	M							30.0	29.0	29.0					12																	6120846		2203	4300	6503	5991107	SO:0001583	missense	7450				CCDS8539.1	12p13.3	2014-09-17			ENSG00000110799	ENSG00000110799		"""Endogenous ligands"""	12726	protein-coding gene	gene with protein product		613160		F8VWF		2251280	Standard	NM_000552		Approved		uc001qnn.1	P04275	OTTHUMG00000168265	ENST00000261405.5:c.5779T>A	12.37:g.6120846A>T	ENSP00000261405:p.Cys1927Ser		5991107	Q8TCE8|Q99806	Missense_Mutation	SNP	HMMSmart_SM00216,HMMPfam_VWD,HMMPfam_C8,superfamily_Serine proterase inhibitors,HMMPfam_TIL,HMMSmart_SM00214,HMMSmart_SM00215,superfamily_PMP inhibitors,superfamily_vWA-like,HMMSmart_SM00327,HMMPfam_VWA,HMMPfam_VWC,PatternScan_VWFC_1,HMMSmart_SM00041,PatternScan_CTCK_1	p.C1927S	ENST00000261405.5	37	c.5779	CCDS8539.1	12	.	.	.	.	.	.	.	.	.	.	.	14.92	2.678740	0.47886	.	.	ENSG00000110799	ENST00000261405	T	0.75477	-0.94	5.03	5.03	0.67393	.	0.000000	0.45361	D	0.000378	D	0.85405	0.5689	M	0.77820	2.39	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	D	0.87142	0.2203	10	0.66056	D	0.02	.	13.7556	0.62935	1.0:0.0:0.0:0.0	.	1927	P04275	VWF_HUMAN	S	1927	ENSP00000261405:C1927S	ENSP00000261405:C1927S	C	-	1	0	VWF	5991107	1.000000	0.71417	0.922000	0.36590	0.533000	0.34776	8.133000	0.89605	2.110000	0.64415	0.455000	0.32223	TGC	-	NULL		0.607	VWF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	VWF	protein_coding	OTTHUMT00000399020.1	A	NM_000552		5991107	-1	no_errors	NM_000552	genbank	human	reviewed	54_36p	missense	SNP	0.997	T
OR56B3P	401675	genome.wustl.edu	37	11	6150184	6150184	+	Silent	SNP	C	C	T			TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chr11:6150184C>T	ENST00000316517.2	+	1	345	c.345C>T	c.(343-345)ttC>ttT	p.F115F	RP11-290F24.3_ENST00000529961.1_RNA					olfactory receptor, family 56, subfamily B, member 3 pseudogene																		CAGGCATCTTCCTCTGCATGG	0.468																																																0			11																																								6106760	SO:0001819	synonymous_variant	0					11p15.4	2013-09-24			ENSG00000180913	ENSG00000180913		"""GPCR / Class A : Olfactory receptors"""	15247	pseudogene	pseudogene							Standard	NG_004390		Approved					ENST00000316517.2:c.345C>T	11.37:g.6150184C>T			6106760		Silent	SNP	superfamily_SSF81321,HMMPfam_7tm_1	p.F115	ENST00000316517.2	37	c.345		11																																																																																			-	superfamily_SSF81321,HMMPfam_7tm_1		0.468	OR56B3P-201	KNOWN	basic|appris_principal	protein_coding	ENSG00000180913	protein_coding		C			6106760	+1	no_errors	ENST00000316517	ensembl	human	known	54_36p	silent	SNP	0.040	T
TP53	7157	genome.wustl.edu	37	17	7577096	7577096	+	Missense_Mutation	SNP	T	T	A	rs587781525		TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chr17:7577096T>A	ENST00000269305.4	-	8	1031	c.842A>T	c.(841-843)gAc>gTc	p.D281V	TP53_ENST00000420246.2_Missense_Mutation_p.D281V|TP53_ENST00000413465.2_Intron|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.D281V|TP53_ENST00000359597.4_Missense_Mutation_p.D281V|TP53_ENST00000445888.2_Missense_Mutation_p.D281V	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	281	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		D -> A (in sporadic cancers; somatic mutation).|D -> E (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1459726}.|D -> G (in a brain tumor with no family history; germline mutation and in sporadic cancers; somatic mutation).|D -> H (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|D -> N (in LFS; germline mutation and in sporadic cancers; somatic mutation).|D -> R (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|D -> V (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|D -> Y (in sporadic cancers; somatic mutation).|DR -> EW (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.D281G(10)|p.0?(8)|p.D281V(5)|p.?(2)|p.D281fs*63(2)|p.R280_D281delRD(2)|p.D281A(2)|p.D281>AGPY(2)|p.A276_R283delACPGRDRR(1)|p.D281R(1)|p.C275fs*20(1)|p.L265_K305del41(1)|p.D281_R282delDR(1)|p.F270_D281del12(1)|p.G279fs*59(1)|p.R280fs*62(1)|p.S269fs*21(1)|p.V272_K292del21(1)|p.C275_R283delCACPGRDRR(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TGTGCGCCGGTCTCTCCCAGG	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	44	Substitution - Missense(18)|Deletion - In frame(8)|Whole gene deletion(8)|Deletion - Frameshift(4)|Unknown(2)|Complex - frameshift(2)|Complex - insertion inframe(2)	haematopoietic_and_lymphoid_tissue(8)|upper_aerodigestive_tract(7)|breast(5)|lung(5)|ovary(4)|bone(4)|large_intestine(3)|central_nervous_system(3)|stomach(2)|urinary_tract(2)|oesophagus(1)	17	GRCh37	CM004343|CM056068	TP53	M							82.0	70.0	74.0					17																	7577096		2203	4300	6503	7517821	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.842A>T	17.37:g.7577096T>A	ENSP00000269305:p.Asp281Val		7517821	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	HMMPfam_P53_TAD,HMMPfam_P53,superfamily_p53-like transcription factors,PatternScan_P53,HMMPfam_P53_tetramer,superfamily_p53 tetramerization domain	p.D281V	ENST00000269305.4	37	c.842	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	T	27.0	4.794528	0.90453	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99872	-7.37;-7.37;-7.37;-7.37;-7.37;-7.37	5.13	5.13	0.70059	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99876	0.9941	M	0.92649	3.33	0.80722	D	1	D;D;D;D	0.89917	0.998;1.0;0.998;0.991	D;D;D;D	0.97110	0.99;1.0;0.99;0.99	D	0.96385	0.9284	10	0.87932	D	0	-25.6697	12.9367	0.58319	0.0:0.0:0.0:1.0	.	281;281;281;281	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	V	281;281;281;281;281;270;149	ENSP00000352610:D281V;ENSP00000269305:D281V;ENSP00000398846:D281V;ENSP00000391127:D281V;ENSP00000391478:D281V;ENSP00000425104:D149V	ENSP00000269305:D281V	D	-	2	0	TP53	7517821	1.000000	0.71417	0.993000	0.49108	0.970000	0.65996	7.802000	0.85969	2.154000	0.67381	0.379000	0.24179	GAC	-	HMMPfam_P53,superfamily_p53-like transcription factors		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	T	NM_000546		7517821	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
MTCL1	23255	genome.wustl.edu	37	18	8796300	8796300	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chr18:8796300C>G	ENST00000306329.11	+	7	3038	c.3038C>G	c.(3037-3039)aCc>aGc	p.T1013S	SOGA2_ENST00000359865.3_Missense_Mutation_p.T694S|SOGA2_ENST00000400050.3_Missense_Mutation_p.T653S|SOGA2_ENST00000518815.1_Missense_Mutation_p.T9S|SOGA2_ENST00000517570.1_Missense_Mutation_p.T653S|SOGA2_ENST00000306285.7_Missense_Mutation_p.T9S																							TTGCAAAACACCCTCCATGAG	0.493																																																0			18											133.0	120.0	124.0					18																	8796300		2203	4300	6503	8786300	SO:0001583	missense	23255																														ENST00000306329.11:c.3038C>G	18.37:g.8796300C>G	ENSP00000305027:p.Thr1013Ser		8786300		Missense_Mutation	SNP	NULL	p.T694S	ENST00000306329.11	37	c.2081		18	.	.	.	.	.	.	.	.	.	.	C	9.055	0.993017	0.19043	.	.	ENSG00000168502	ENST00000306329;ENST00000517570;ENST00000359865;ENST00000400050;ENST00000306285	T;T;T;T	0.42131	0.98;0.98;0.98;0.98	5.76	2.81	0.32909	.	0.784196	0.11548	N	0.553050	T	0.30293	0.0760	N	0.25647	0.755	0.09310	N	0.999992	B;B	0.20052	0.024;0.041	B;B	0.14578	0.005;0.011	T	0.20438	-1.0275	10	0.45353	T	0.12	-9.5542	9.9482	0.41623	0.2427:0.5674:0.1899:0.0	.	1004;694	Q9Y4B5;Q9Y4B5-3	CC165_HUMAN;.	S	715;653;694;653;9	ENSP00000429556:T653S;ENSP00000352927:T694S;ENSP00000382924:T653S;ENSP00000303670:T9S	ENSP00000303670:T9S	T	+	2	0	CCDC165	8786300	0.950000	0.32346	0.015000	0.15790	0.671000	0.39405	1.678000	0.37586	0.346000	0.23899	-0.795000	0.03280	ACC	-	NULL		0.493	SOGA2-015	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	KIAA0802	protein_coding	OTTHUMT00000444141.1	C			8786300	+1	no_errors	NM_015210	genbank	human	predicted	54_36p	missense	SNP	0.575	G
A2M	2	genome.wustl.edu	37	12	9243045	9243045	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chr12:9243045G>T	ENST00000318602.7	-	20	2810	c.2503C>A	c.(2503-2505)Cta>Ata	p.L835I		NM_000014.4	NP_000005	P01023	A2MG_HUMAN	alpha-2-macroglobulin	835					blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of complement activation, lectin pathway (GO:0001869)|negative regulation of endopeptidase activity (GO:0010951)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|stem cell differentiation (GO:0048863)	blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule lumen (GO:0031093)	calcium-dependent protein binding (GO:0048306)|enzyme binding (GO:0019899)|growth factor binding (GO:0019838)|interleukin-1 binding (GO:0019966)|interleukin-8 binding (GO:0019959)|protease binding (GO:0002020)|receptor binding (GO:0005102)|serine-type endopeptidase inhibitor activity (GO:0004867)|tumor necrosis factor binding (GO:0043120)			breast(1)|central_nervous_system(6)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(17)|lung(30)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	77					Bacitracin(DB00626)|Becaplermin(DB00102)|Ocriplasmin(DB08888)	GGGACAGCTAGGAAGGCGGGA	0.532																																																0			12											88.0	91.0	90.0					12																	9243045		2135	4275	6410	9134312	SO:0001583	missense	2			BX647329, X68728, M11313	CCDS44827.1	12p13.31	2010-02-24			ENSG00000175899	ENSG00000175899			7	protein-coding gene	gene with protein product		103950					Standard	XM_006719056		Approved	FWP007, S863-7, CPAMD5	uc001qvk.1	P01023	OTTHUMG00000150267	ENST00000318602.7:c.2503C>A	12.37:g.9243045G>T	ENSP00000323929:p.Leu835Ile		9134312	Q13677|Q59F47|Q5QTS0|Q68DN2|Q6PIY3|Q6PN97	Missense_Mutation	SNP	PatternScan_TONB_DEPENDENT_REC_1,HMMPfam_A2M_N,HMMPfam_A2M_N_2,HMMPfam_A2M,superfamily_Terpenoid cyclases/Protein prenyltransferases,HMMPfam_Thiol-ester_cl,PatternScan_ALPHA_2_MACROGLOBULIN,HMMPfam_A2M_comp,superfamily_Alpha-macroglobulin receptor domain,HMMPfam_A2M_recep	p.L835I	ENST00000318602.7	37	c.2503	CCDS44827.1	12	.	.	.	.	.	.	.	.	.	.	G	11.76	1.736061	0.30774	.	.	ENSG00000175899	ENST00000318602;ENST00000540099	T	0.13778	2.56	5.23	2.13	0.27403	.	0.650416	0.13779	N	0.363319	T	0.24236	0.0587	M	0.87547	2.89	0.25293	N	0.989348	P	0.48998	0.918	P	0.49502	0.613	T	0.13442	-1.0509	10	0.40728	T	0.16	.	3.256	0.06832	0.158:0.1375:0.563:0.1415	.	835	P01023	A2MG_HUMAN	I	835;850	ENSP00000323929:L835I	ENSP00000323929:L835I	L	-	1	2	A2M	9134312	0.009000	0.17119	0.832000	0.32986	0.043000	0.13939	0.016000	0.13377	0.656000	0.30886	0.655000	0.94253	CTA	-	NULL		0.532	A2M-001	KNOWN	basic|appris_principal|CCDS	protein_coding	A2M	protein_coding	OTTHUMT00000317233.2	G	NM_000014		9134312	-1	no_errors	NM_000014	genbank	human	reviewed	54_36p	missense	SNP	0.837	T
COL5A3	50509	genome.wustl.edu	37	19	10104340	10104340	+	Silent	SNP	A	A	C			TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chr19:10104340A>C	ENST00000264828.3	-	18	1735	c.1650T>G	c.(1648-1650)cgT>cgG	p.R550R	CTD-2553C6.1_ENST00000592332.1_RNA	NM_015719.3	NP_056534.2	P25940	CO5A3_HUMAN	collagen, type V, alpha 3	550	Triple-helical region.				axon guidance (GO:0007411)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)			NS(2)|breast(3)|central_nervous_system(2)|endometrium(11)|kidney(23)|large_intestine(12)|liver(2)|lung(35)|ovary(8)|prostate(5)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	116			Epithelial(33;7.11e-05)			CATCGAAGCCACGATCACCCT	0.582																																																0			19											157.0	133.0	141.0					19																	10104340		2203	4300	6503	9965340	SO:0001819	synonymous_variant	50509			AF177941	CCDS12222.1	19p13.2	2013-01-16			ENSG00000080573	ENSG00000080573		"""Collagens"""	14864	protein-coding gene	gene with protein product		120216				10722718	Standard	NM_015719		Approved		uc002mmq.1	P25940	OTTHUMG00000150019	ENST00000264828.3:c.1650T>G	19.37:g.10104340A>C			9965340	Q9NZQ6	Silent	SNP	HMMSmart_SM00210,superfamily_Concanavalin A-like lectins/glucanases,HMMPfam_Laminin_G_2,HMMPfam_Collagen,HMMSmart_SM00038,HMMPfam_COLFI	p.R550	ENST00000264828.3	37	c.1650	CCDS12222.1	19																																																																																			-	HMMPfam_Collagen		0.582	COL5A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL5A3	protein_coding	OTTHUMT00000315788.1	A	NM_015719		9965340	-1	no_errors	NM_015719	genbank	human	reviewed	54_36p	silent	SNP	0.994	C
TSPAN16	26526	genome.wustl.edu	37	19	11408870	11408870	+	Missense_Mutation	SNP	C	C	T	rs143650478	byFrequency	TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chr19:11408870C>T	ENST00000316737.1	+	2	272	c.122C>T	c.(121-123)gCc>gTc	p.A41V	TSPAN16_ENST00000592955.1_Missense_Mutation_p.A41V|TSPAN16_ENST00000590327.1_Missense_Mutation_p.A41V|CTC-510F12.4_ENST00000586356.1_RNA	NM_012466.2	NP_036598.1	Q9UKR8	TSN16_HUMAN	tetraspanin 16	41						integral component of membrane (GO:0016021)				breast(1)|endometrium(3)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)|skin(2)|stomach(1)	12						TGTGGAGGGGCCTCTCTGACG	0.517																																																0			19											175.0	146.0	156.0					19																	11408870		2203	4300	6503	11269870	SO:0001583	missense	26526			BC029908	CCDS12256.1, CCDS62549.1, CCDS62550.1	19p13.2	2013-02-14	2005-03-21	2005-03-21	ENSG00000130167	ENSG00000130167		"""Tetraspanins"""	30725	protein-coding gene	gene with protein product			"""transmembrane 4 superfamily member 16"""	TM4SF16		10500248	Standard	NM_012466		Approved	TM4-B, TM-8	uc002mqv.1	Q9UKR8	OTTHUMG00000180833	ENST00000316737.1:c.122C>T	19.37:g.11408870C>T	ENSP00000319486:p.Ala41Val		11269870	K7EN22|K7EPD8|Q8N6J7	Missense_Mutation	SNP	PatternScan_TM4_1,HMMPfam_Tetraspannin,superfamily_Tetraspanin	p.A41V	ENST00000316737.1	37	c.122	CCDS12256.1	19	.	.	.	.	.	.	.	.	.	.	C	17.34	3.365908	0.61513	.	.	ENSG00000130167	ENST00000316737;ENST00000337994	T;T	0.35421	1.31;2.72	3.57	3.57	0.40892	.	1.026800	0.07820	N	0.959602	T	0.34279	0.0892	L	0.35723	1.085	0.09310	N	1	P	0.41420	0.749	B	0.42163	0.378	T	0.19745	-1.0296	10	0.51188	T	0.08	-6.5183	10.972	0.47444	0.0:1.0:0.0:0.0	.	41	Q9UKR8	TSN16_HUMAN	V	41	ENSP00000319486:A41V;ENSP00000338759:A41V	ENSP00000319486:A41V	A	+	2	0	TSPAN16	11269870	0.000000	0.05858	0.004000	0.12327	0.004000	0.04260	0.433000	0.21477	2.287000	0.76781	0.462000	0.41574	GCC	-	HMMPfam_Tetraspannin		0.517	TSPAN16-001	KNOWN	basic|CCDS	protein_coding	TSPAN16	protein_coding	OTTHUMT00000453204.1	C	NM_012466		11269870	+1	no_errors	NM_012466	genbank	human	reviewed	54_36p	missense	SNP	0.005	T
CTNND2	1501	genome.wustl.edu	37	5	11411708	11411708	+	Missense_Mutation	SNP	A	A	T			TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chr5:11411708A>T	ENST00000304623.8	-	5	568	c.379T>A	c.(379-381)Tgt>Agt	p.C127S	CTNND2_ENST00000458100.2_5'UTR|CTNND2_ENST00000503622.1_Missense_Mutation_p.C36S|CTNND2_ENST00000359640.2_Missense_Mutation_p.C127S|CTNND2_ENST00000511377.1_Missense_Mutation_p.C36S	NM_001332.2	NP_001323.1	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	127					cell adhesion (GO:0007155)|learning (GO:0007612)|morphogenesis of a branching structure (GO:0001763)|multicellular organismal development (GO:0007275)|regulation of synaptic plasticity (GO:0048167)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(29)|liver(1)|lung(71)|ovary(4)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	136						GACCTAATACAGGAGTCCACC	0.378																																																0			5											131.0	122.0	125.0					5																	11411708		2203	4300	6503	11464708	SO:0001583	missense	1501			U52828	CCDS3881.1, CCDS75227.1, CCDS75228.1	5p15.2	2013-02-14	2012-08-15		ENSG00000169862	ENSG00000169862		"""Armadillo repeat containing"""	2516	protein-coding gene	gene with protein product	"""neural plakophilin-related arm-repeat protein"""	604275	"""catenin (cadherin-associated protein), delta 2 (neural plakophilin-related arm-repeat protein)"""			9342840, 9223106	Standard	XM_005248251		Approved	NPRAP, GT24	uc003jfa.1	Q9UQB3	OTTHUMG00000090511	ENST00000304623.8:c.379T>A	5.37:g.11411708A>T	ENSP00000307134:p.Cys127Ser		11464708	B0FTZ7|O00379|O15390|O43206|O43840|Q13589|Q9UM66|Q9UPM3	Missense_Mutation	SNP	superfamily_ARM repeat,HMMPfam_Arm,HMMSmart_SM00185	p.C127S	ENST00000304623.8	37	c.379	CCDS3881.1	5	.	.	.	.	.	.	.	.	.	.	A	21.5	4.164115	0.78339	.	.	ENSG00000169862	ENST00000304623;ENST00000359640;ENST00000511377;ENST00000503622;ENST00000502551;ENST00000513598;ENST00000508761	T;T;T;D	0.85411	-0.96;-1.03;-0.98;-1.98	5.86	5.86	0.93980	Armadillo-like helical (1);	0.000000	0.85682	D	0.000000	D	0.90452	0.7010	M	0.61703	1.905	0.80722	D	1	P;D	0.55800	0.932;0.973	P;D	0.66196	0.879;0.942	D	0.89249	0.3589	10	0.34782	T	0.22	-10.7514	16.2612	0.82547	1.0:0.0:0.0:0.0	.	36;127	B4DRK2;Q9UQB3	.;CTND2_HUMAN	S	127;127;36;36;113;36;113	ENSP00000307134:C127S;ENSP00000352661:C127S;ENSP00000426510:C36S;ENSP00000426887:C36S	ENSP00000307134:C127S	C	-	1	0	CTNND2	11464708	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.893000	0.92498	2.244000	0.73946	0.477000	0.44152	TGT	-	NULL		0.378	CTNND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTNND2	protein_coding	OTTHUMT00000206999.1	A	NM_001332		11464708	-1	no_errors	NM_001332	genbank	human	validated	54_36p	missense	SNP	1.000	T
BOD1L1	259282	genome.wustl.edu	37	4	13617086	13617086	+	Nonsense_Mutation	SNP	G	G	A			TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chr4:13617086G>A	ENST00000040738.5	-	3	544	c.409C>T	c.(409-411)Cag>Tag	p.Q137*		NM_148894.2	NP_683692.2	Q8NFC6	BD1L1_HUMAN	biorientation of chromosomes in cell division 1-like 1	137						nucleus (GO:0005634)	DNA binding (GO:0003677)										TCCACAACCTGAGAAATAATT	0.378																																																0			4											120.0	118.0	119.0					4																	13617086		2203	4300	6503	13226184	SO:0001587	stop_gained	259282			AF528529	CCDS3411.2	4p16.1	2012-04-10	2012-04-10	2012-04-10	ENSG00000038219	ENSG00000038219			31792	protein-coding gene	gene with protein product			"""family with sequence similarity 44, member A"", ""biorientation of chromosomes in cell division 1-like"""	FAM44A, BOD1L			Standard	XM_005248150		Approved	FLJ33215, KIAA1327	uc003gmz.1	Q8NFC6	OTTHUMG00000090659	ENST00000040738.5:c.409C>T	4.37:g.13617086G>A	ENSP00000040738:p.Gln137*		13226184	Q6P0M8|Q96AL1|Q9H6G0|Q9NTD6|Q9P2L9	Nonsense_Mutation	SNP	superfamily_SSF81995,HMMPfam_AT_hook,HMMSmart_AT_hook	p.Q137*	ENST00000040738.5	37	c.409	CCDS3411.2	4	.	.	.	.	.	.	.	.	.	.	G	37	6.543585	0.97650	.	.	ENSG00000038219	ENST00000040738	.	.	.	5.51	5.51	0.81932	.	0.000000	0.40640	N	0.001058	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	-5.5179	19.7872	0.96444	0.0:0.0:1.0:0.0	.	.	.	.	X	137	.	ENSP00000040738:Q137X	Q	-	1	0	BOD1L	13226184	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.420000	0.97426	2.741000	0.93983	0.655000	0.94253	CAG	-	superfamily_SSF81995		0.378	BOD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BOD1L	protein_coding	OTTHUMT00000207321.1	G	NM_148894		13226184	-1	no_errors	NM_148894	genbank	human	validated	54_36p	nonsense	SNP	1.000	A
ATXN3L	92552	genome.wustl.edu	37	X	13337978	13337978	+	Missense_Mutation	SNP	C	C	G	rs201381068		TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chrX:13337978C>G	ENST00000380622.2	-	1	540	c.76G>C	c.(76-78)Gaa>Caa	p.E26Q	GS1-600G8.3_ENST00000431486.1_RNA	NM_001135995.1	NP_001129467.1	Q9H3M9	ATX3L_HUMAN	ataxin 3-like	26	Josephin. {ECO:0000255|PROSITE- ProRule:PRU00331}.				protein deubiquitination (GO:0016579)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	omega peptidase activity (GO:0008242)|ubiquitin-specific protease activity (GO:0004843)			endometrium(3)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	28						CTAAAATATTCTCCTTGCAAT	0.418																																																0			X											104.0	87.0	92.0					X																	13337978		1568	3582	5150	13247899	SO:0001583	missense	92552				CCDS48080.1	Xp22	2010-09-30			ENSG00000123594	ENSG00000123594			24173	protein-coding gene	gene with protein product		300920					Standard	NM_001135995		Approved	MJDL	uc010ned.3	Q9H3M9	OTTHUMG00000021146	ENST00000380622.2:c.76G>C	X.37:g.13337978C>G	ENSP00000369996:p.Glu26Gln		13247899	B2RNY8	Missense_Mutation	SNP	HMMPfam_Josephin,HMMPfam_UIM,HMMSmart_UIM	p.E26Q	ENST00000380622.2	37	c.76	CCDS48080.1	X	.	.	.	.	.	.	.	.	.	.	C	11.59	1.683593	0.29872	.	.	ENSG00000123594	ENST00000380622	T	0.45668	0.89	0.943	0.943	0.19531	.	0.000000	0.85682	D	0.000000	T	0.31231	0.0790	L	0.38175	1.15	0.41583	D	0.988757	P	0.35401	0.499	B	0.38500	0.275	T	0.12372	-1.0550	10	0.54805	T	0.06	.	7.4471	0.27217	0.0:1.0:0.0:0.0	.	26	Q9H3M9	ATX3L_HUMAN	Q	26	ENSP00000369996:E26Q	ENSP00000369996:E26Q	E	-	1	0	ATXN3L	13247899	1.000000	0.71417	0.067000	0.19924	0.053000	0.15095	4.824000	0.62701	0.740000	0.32651	0.422000	0.28245	GAA	-	HMMPfam_Josephin		0.418	ATXN3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATXN3L	protein_coding	OTTHUMT00000055785.2	C	NM_001135995		13247899	-1	no_errors	ENST00000380622	ensembl	human	known	54_36p	missense	SNP	1.000	G
CYP4F22	126410	genome.wustl.edu	37	19	15640576	15640576	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chr19:15640576C>A	ENST00000269703.3	+	4	478	c.279C>A	c.(277-279)caC>caA	p.H93Q	CYP4F22_ENST00000601005.2_Missense_Mutation_p.H93Q	NM_173483.3	NP_775754.2	Q6NT55	CP4FN_HUMAN	cytochrome P450, family 4, subfamily F, polypeptide 22	93						endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)			endometrium(6)|large_intestine(9)|lung(16)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|soft_tissue(1)	37						ACAACATGCACCATGTACTCT	0.542																																																0			19											194.0	142.0	160.0					19																	15640576		2203	4300	6503	15501576	SO:0001583	missense	126410				CCDS12331.1	19p13.12	2013-11-11			ENSG00000171954	ENSG00000171954		"""Cytochrome P450s"""	26820	protein-coding gene	gene with protein product		611495				16436457	Standard	NM_173483		Approved	FLJ39501	uc002nbh.4	Q6NT55	OTTHUMG00000182451	ENST00000269703.3:c.279C>A	19.37:g.15640576C>A	ENSP00000269703:p.His93Gln		15501576	Q8N8H4	Missense_Mutation	SNP	superfamily_Cytochrome_P450,HMMPfam_p450,PatternScan_CYTOCHROME_P450	p.H93Q	ENST00000269703.3	37	c.279	CCDS12331.1	19	.	.	.	.	.	.	.	.	.	.	C	11.15	1.553733	0.27739	.	.	ENSG00000171954	ENST00000269703	D	0.87966	-2.32	5.23	-2.35	0.06684	.	0.588964	0.17284	N	0.179897	T	0.59689	0.2212	N	0.01576	-0.805	0.09310	N	1	B	0.06786	0.001	B	0.16722	0.016	T	0.53606	-0.8415	10	0.33940	T	0.23	.	1.6684	0.02807	0.1321:0.35:0.1289:0.389	.	93	Q6NT55	CP4FN_HUMAN	Q	93	ENSP00000269703:H93Q	ENSP00000269703:H93Q	H	+	3	2	CYP4F22	15501576	0.000000	0.05858	0.000000	0.03702	0.062000	0.15995	-0.156000	0.10100	-0.584000	0.05913	0.462000	0.41574	CAC	-	superfamily_Cytochrome_P450,HMMPfam_p450		0.542	CYP4F22-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP4F22	protein_coding	OTTHUMT00000461338.2	C	NM_173483		15501576	+1	no_errors	NM_173483	genbank	human	reviewed	54_36p	missense	SNP	0.000	A
KIAA0430	9665	genome.wustl.edu	37	16	15695884	15695884	+	Silent	SNP	G	G	A			TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chr16:15695884G>A	ENST00000396368.3	-	23	4796	c.4590C>T	c.(4588-4590)caC>caT	p.H1530H	KIAA0430_ENST00000540441.2_Silent_p.H1365H|KIAA0430_ENST00000548025.1_Silent_p.H1527H|KIAA0430_ENST00000602337.1_Silent_p.H1527H|KIAA0430_ENST00000344181.3_Silent_p.H1213H|KIAA0430_ENST00000547936.1_5'Flank|KIAA0430_ENST00000551742.1_Silent_p.H1530H	NM_001184998.1|NM_001184999.1|NM_014647.3	NP_001171927.1|NP_001171928.1|NP_055462.2	Q9Y4F3	MARF1_HUMAN	KIAA0430	1530	HTH OST-type 8. {ECO:0000255|PROSITE- ProRule:PRU00975}.				double-strand break repair (GO:0006302)|female meiotic division (GO:0007143)|negative regulation of phosphatase activity (GO:0010923)|oogenesis (GO:0048477)|regulation of gene expression (GO:0010468)	membrane (GO:0016020)|peroxisome (GO:0005777)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(4)|endometrium(8)|kidney(4)|large_intestine(2)|lung(13)|ovary(3)|prostate(5)|skin(1)	40						CCACGCTGCTGTGGCCGTAGG	0.502																																																0			16											143.0	140.0	141.0					16																	15695884		1887	4122	6009	15603385	SO:0001819	synonymous_variant	9665			AB007890	CCDS10562.2, CCDS53990.1, CCDS55991.1	16p13.11	2013-01-11			ENSG00000166783	ENSG00000166783		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	29562	protein-coding gene	gene with protein product	"""limkain b1"", ""protein phosphatase 1, regulatory subunit 34"", ""meiosis arrest female 1"""	614593				9455477, 10493829, 15932519, 22442484, 23090997	Standard	NM_014647		Approved	LKAP, PPP1R34, Marf1	uc010uzw.2	Q9Y4F3	OTTHUMG00000129884	ENST00000396368.3:c.4590C>T	16.37:g.15695884G>A			15603385	A8MSK2|B2RNX2|B4DYY9|B7ZMG1|B7ZMG2|F8VV09|Q6P1R6|Q8WYR2|Q9Y4J9	Silent	SNP	HMMPfam_DUF537,superfamily_RNA-binding domain RBD,HMMSmart_SM00360	p.H1530	ENST00000396368.3	37	c.4590	CCDS10562.2	16																																																																																			-	NULL		0.502	KIAA0430-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA0430	protein_coding	OTTHUMT00000252131.2	G	NM_014647		15603385	-1	no_errors	NM_014647	genbank	human	validated	54_36p	silent	SNP	0.663	A
SEC23B	10483	genome.wustl.edu	37	20	18541310	18541310	+	Missense_Mutation	SNP	A	A	C			TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chr20:18541310A>C	ENST00000336714.3	+	20	2662	c.2230A>C	c.(2230-2232)Atc>Ctc	p.I744L	SEC23B_ENST00000377475.3_Missense_Mutation_p.I744L|SEC23B_ENST00000262544.2_Missense_Mutation_p.I744L|SEC23B_ENST00000377465.1_Missense_Mutation_p.I744L	NM_006363.4|NM_032985.4|NM_032986.3	NP_006354.2|NP_116780.1|NP_116781.1	Q15437	SC23B_HUMAN	Sec23 homolog B (S. cerevisiae)	744					ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	COPII vesicle coat (GO:0030127)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|liver(2)|lung(14)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	32						TGGAGCACCCATCCTAACTGA	0.438																																																0			20											146.0	131.0	136.0					20																	18541310		2203	4300	6503	18489310	SO:0001583	missense	10483			X97065	CCDS13137.1	20p11.23	2010-02-09	2001-11-28		ENSG00000101310	ENSG00000101310			10702	protein-coding gene	gene with protein product		610512	"""Sec23 (S. cerevisiae) homolog B"", ""congenital dyserythropoietic anemia, type II"""	CDAN2		8898360, 10329445, 19621418	Standard	NM_032985		Approved	CDA-II, CDAII, HEMPAS	uc002wrb.2	Q15437	OTTHUMG00000031976	ENST00000336714.3:c.2230A>C	20.37:g.18541310A>C	ENSP00000338844:p.Ile744Leu		18489310	D3DW33|Q503A9|Q5W183|Q9BS15|Q9BSI2|Q9H1D7	Missense_Mutation	SNP	superfamily_SSF81995,superfamily_Znf_Sec23_Sec24,HMMPfam_zf-Sec23_Sec24,HMMPfam_Sec23_trunk,superfamily_SSF53300,HMMPfam_Sec23_BS,superfamily_Sec23_helical,HMMPfam_Sec23_helical,superfamily_SSF82754,HMMPfam_Gelsolin	p.I744L	ENST00000336714.3	37	c.2230	CCDS13137.1	20	.	.	.	.	.	.	.	.	.	.	A	18.33	3.601270	0.66445	.	.	ENSG00000101310	ENST00000336714;ENST00000262544;ENST00000377475;ENST00000377465;ENST00000422877	D;D;D;D;D	0.93307	-3.2;-3.2;-3.2;-3.2;-3.2	4.75	4.75	0.60458	.	0.000000	0.85682	D	0.000000	D	0.91459	0.7304	L	0.59912	1.85	0.80722	D	1	B;B	0.20671	0.047;0.023	B;B	0.21708	0.036;0.016	D	0.89657	0.3874	10	0.59425	D	0.04	-20.3085	13.8974	0.63781	1.0:0.0:0.0:0.0	.	726;744	B4DJW8;Q15437	.;SC23B_HUMAN	L	744;744;744;744;223	ENSP00000338844:I744L;ENSP00000262544:I744L;ENSP00000366695:I744L;ENSP00000366685:I744L;ENSP00000409882:I223L	ENSP00000262544:I744L	I	+	1	0	SEC23B	18489310	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	9.057000	0.93889	2.121000	0.65114	0.533000	0.62120	ATC	-	superfamily_SSF82754		0.438	SEC23B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SEC23B	protein_coding	OTTHUMT00000078184.5	A			18489310	+1	no_errors	NM_006363	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
TUBGCP5	114791	genome.wustl.edu	37	15	22855183	22855183	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chr15:22855183G>A	ENST00000283645.4	+	13	1774	c.1644G>A	c.(1642-1644)atG>atA	p.M548I	TUBGCP5_ENST00000453949.2_Missense_Mutation_p.M548I|TUBGCP5_ENST00000559846.1_3'UTR	NM_052903.4	NP_443135.3	Q96RT8	GCP5_HUMAN	tubulin, gamma complex associated protein 5	548					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|gamma-tubulin ring complex (GO:0008274)|microtubule (GO:0005874)|nucleus (GO:0005634)|spindle pole (GO:0000922)	microtubule binding (GO:0008017)			breast(5)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(23)|prostate(1)|skin(2)|urinary_tract(1)	46		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;2.86e-06)|Epithelial(43;2.63e-05)|BRCA - Breast invasive adenocarcinoma(123;0.000949)		AGCACACCATGGTGTCCTTCC	0.527																																																0			15											72.0	66.0	68.0					15																	22855183		2203	4300	6503	20406624	SO:0001583	missense	114791			AB067486	CCDS73697.1, CCDS73698.1	15q11.1	2014-04-17			ENSG00000153575	ENSG00000275835			18600	protein-coding gene	gene with protein product	"""gamma-tubulin complex component GCP5"""	608147				11694571	Standard	NM_052903		Approved	GCP5, KIAA1899	uc001yur.4	Q96RT8	OTTHUMG00000188371	ENST00000283645.4:c.1644G>A	15.37:g.22855183G>A	ENSP00000283645:p.Met548Ile		20406624	E9PB12|Q6IQ52|Q96PY8	Missense_Mutation	SNP	HMMPfam_Spc97_Spc98	p.M548I	ENST00000283645.4	37	c.1644	CCDS10008.1	15	.	.	.	.	.	.	.	.	.	.	G	16.06	3.014956	0.54468	.	.	ENSG00000153575	ENST00000283645;ENST00000453949	T;T	0.09445	2.98;2.98	4.88	4.88	0.63580	.	0.000000	0.85682	D	0.000000	T	0.13114	0.0318	L	0.43152	1.355	0.80722	D	1	B;B;B	0.31383	0.321;0.321;0.321	B;B;B	0.35039	0.194;0.194;0.194	T	0.11842	-1.0571	10	0.21540	T	0.41	-33.7183	18.5854	0.91187	0.0:0.0:1.0:0.0	.	548;548;548	A8K1E4;Q96RT8;E9PB12	.;GCP5_HUMAN;.	I	548	ENSP00000283645:M548I;ENSP00000409217:M548I	ENSP00000283645:M548I	M	+	3	0	TUBGCP5	20406624	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.627000	0.90974	2.686000	0.91538	0.655000	0.94253	ATG	-	HMMPfam_Spc97_Spc98		0.527	TUBGCP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBGCP5	protein_coding	OTTHUMT00000250998.2	G	NM_052903		20406624	+1	no_errors	NM_001102610	genbank	human	validated	54_36p	missense	SNP	1.000	A
RALGAPA2	57186	genome.wustl.edu	37	20	20486158	20486158	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chr20:20486158G>A	ENST00000202677.7	-	34	4956	c.4949C>T	c.(4948-4950)gCa>gTa	p.A1650V		NM_020343.3	NP_065076.2	Q2PPJ7	RGPA2_HUMAN	Ral GTPase activating protein, alpha subunit 2 (catalytic)	1650	Rap-GAP. {ECO:0000255|PROSITE- ProRule:PRU00165}.				activation of Ral GTPase activity (GO:0032859)|membrane organization (GO:0061024)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	protein heterodimerization activity (GO:0046982)|Ral GTPase activator activity (GO:0017123)			endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(1)|lung(25)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	54						GTAAAACACTGCGATTTTGTG	0.348																																																0			20											91.0	79.0	83.0					20																	20486158		1869	4114	5983	20434158	SO:0001583	missense	57186			AL078634, DQ310704	CCDS46584.1	20p11.23	2009-09-09	2009-09-09	2009-09-09	ENSG00000188559	ENSG00000188559			16207	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 74"""	C20orf74		16490346, 19520869	Standard	NM_020343		Approved	dJ1049G11.4, AS250, KIAA1272, RapGAPalpha2	uc002wrz.3	Q2PPJ7	OTTHUMG00000032010	ENST00000202677.7:c.4949C>T	20.37:g.20486158G>A	ENSP00000202677:p.Ala1650Val		20434158	Q4VXU6|Q5JUA3|Q5JUA4|Q5T9K3|Q96CX9|Q9BQT7|Q9H9D9|Q9ULE8	Missense_Mutation	SNP	superfamily_Rap/Ran-GAP (Pfam 02145),HMMPfam_Rap_GAP	p.A1650V	ENST00000202677.7	37	c.4949	CCDS46584.1	20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	35|35	5.467366|5.467366	0.96257|0.96257	.|.	.|.	ENSG00000188559|ENSG00000188559	ENST00000417022;ENST00000202677|ENST00000430436;ENST00000427175	D;D|.	0.94232|.	-3.38;-3.38|.	5.97|5.97	5.97|5.97	0.96955|0.96955	Rap/ran-GAP (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|.	0.87152|.	0.6106|.	M|M	0.92970|0.92970	3.365|3.365	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.97110|.	0.999;0.999;1.0|.	D|.	0.88999|.	0.3420|.	10|.	0.87932|.	D|.	0|.	.|.	20.4238|20.4238	0.99064|0.99064	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1488;1650;1650|.	A8MSM5;Q2PPJ7-2;Q2PPJ7|.	.;.;RGPA2_HUMAN|.	V|X	80;1650|1467;61	ENSP00000408332:A80V;ENSP00000202677:A1650V|.	ENSP00000202677:A1650V|.	A|Q	-|-	2|1	0|0	RALGAPA2|RALGAPA2	20434158|20434158	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	9.764000|9.764000	0.98949|0.98949	2.828000|2.828000	0.97474|0.97474	0.655000|0.655000	0.94253|0.94253	GCA|CAG	-	superfamily_Rap/Ran-GAP (Pfam 02145)		0.348	RALGAPA2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	C20orf74	protein_coding	OTTHUMT00000471941.1	G	NM_020343		20434158	-1	no_errors	NM_020343	genbank	human	validated	54_36p	missense	SNP	1.000	A
SLCO1C1	53919	genome.wustl.edu	37	12	20903691	20903691	+	Missense_Mutation	SNP	A	A	T			TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chr12:20903691A>T	ENST00000266509.2	+	14	2249	c.1881A>T	c.(1879-1881)agA>agT	p.R627S	SLCO1C1_ENST00000381552.1_Missense_Mutation_p.R627S|SLCO1C1_ENST00000545604.1_Missense_Mutation_p.R627S|SLCO1C1_ENST00000540354.1_Missense_Mutation_p.R578S|SLCO1C1_ENST00000545102.1_Missense_Mutation_p.R509S	NM_017435.4	NP_059131.1	Q9NYB5	SO1C1_HUMAN	solute carrier organic anion transporter family, member 1C1	627					sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			NS(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	60	Esophageal squamous(101;0.149)				Conjugated Estrogens(DB00286)|Dextrothyroxine(DB00509)|Diclofenac(DB00586)|Digoxin(DB00390)|Dinoprostone(DB00917)|Estradiol(DB00783)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Meclofenamic acid(DB00939)|Methotrexate(DB00563)|Ouabain(DB01092)|Phenytoin(DB00252)|Probenecid(DB01032)	GTGGAAGTAGAGGATCATGCA	0.393																																																0			12											133.0	123.0	126.0					12																	20903691		2203	4300	6503	20794958	SO:0001583	missense	53919			AF260704	CCDS8683.1, CCDS53757.1, CCDS53758.1, CCDS53759.1	12p12.2	2013-05-22	2003-11-25	2003-11-26	ENSG00000139155	ENSG00000139155		"""Solute carriers"""	13819	protein-coding gene	gene with protein product		613389	"""solute carrier family 21 (organic anion transporter), member 14"""	SLC21A14			Standard	NM_017435		Approved	OATP-F, OATP1C1, OATP1	uc010sii.2	Q9NYB5	OTTHUMG00000168966	ENST00000266509.2:c.1881A>T	12.37:g.20903691A>T	ENSP00000266509:p.Arg627Ser		20794958	B7Z251|B7Z3Q3|B7Z8P1|F5GZD6|Q5JPA4	Missense_Mutation	SNP	superfamily_MFS_gen_substrate_transporter,HMMPfam_OATP,superfamily_SSF100895,HMMSmart_KAZAL,HMMPfam_Kazal_2	p.R627S	ENST00000266509.2	37	c.1881	CCDS8683.1	12	.	.	.	.	.	.	.	.	.	.	A	17.02	3.282800	0.59867	.	.	ENSG00000139155	ENST00000545604;ENST00000540354;ENST00000266509;ENST00000381552;ENST00000545102	T;T;T;T;T	0.39229	1.09;1.09;1.09;1.09;1.09	5.32	5.32	0.75619	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.322024	0.36665	N	0.002468	T	0.45175	0.1329	L	0.47716	1.5	0.58432	D	0.999999	B;B;B;B	0.25312	0.123;0.07;0.016;0.032	B;B;B;B	0.39339	0.062;0.297;0.063;0.091	T	0.38908	-0.9639	10	0.35671	T	0.21	.	13.6737	0.62440	1.0:0.0:0.0:0.0	.	509;578;627;627	F5GZD6;B7Z3Q3;Q5JPA4;Q9NYB5	.;.;.;SO1C1_HUMAN	S	627;578;627;627;509	ENSP00000444149:R627S;ENSP00000438665:R578S;ENSP00000266509:R627S;ENSP00000370964:R627S;ENSP00000444527:R509S	ENSP00000266509:R627S	R	+	3	2	SLCO1C1	20794958	0.998000	0.40836	0.989000	0.46669	0.991000	0.79684	3.844000	0.55873	2.229000	0.72834	0.533000	0.62120	AGA	-	superfamily_MFS_gen_substrate_transporter,HMMPfam_OATP		0.393	SLCO1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLCO1C1	protein_coding	OTTHUMT00000401765.1	A	NM_017435		20794958	+1	no_errors	NM_017435	genbank	human	reviewed	54_36p	missense	SNP	0.996	T
DNAH11	8701	genome.wustl.edu	37	7	21778420	21778420	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chr7:21778420G>A	ENST00000409508.3	+	47	7778	c.7747G>A	c.(7747-7749)Gtg>Atg	p.V2583M	DNAH11_ENST00000328843.6_Missense_Mutation_p.V2590M	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	2590	AAA 3. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						CATGCCTGAAGTGGACTTATA	0.403									Kartagener syndrome																																							0			7											51.0	52.0	52.0					7																	21778420		2163	4275	6438	21744945	SO:0001583	missense	8701	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.7747G>A	7.37:g.21778420G>A	ENSP00000475939:p.Val2583Met		21744945	Q9UJ82	Missense_Mutation	SNP	HMMPfam_DHC_N1,HMMPfam_DHC_N2,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00382,PatternScan_THIOL_PROTEASE_HIS,HMMPfam_AAA_5,PatternScan_WD_REPEATS_1,HMMPfam_Dynein_heavy	p.V2590M	ENST00000409508.3	37	c.7768		7	.	.	.	.	.	.	.	.	.	.	G	17.32	3.358974	0.61403	.	.	ENSG00000105877	ENST00000328843	T	0.50001	0.76	5.41	5.41	0.78517	ATPase, AAA+ type, core (1);	0.059613	0.64402	D	0.000003	T	0.61098	0.2320	.	.	.	0.80722	D	1	D	0.55172	0.97	P	0.52646	0.705	T	0.63386	-0.6649	9	0.56958	D	0.05	.	19.1761	0.93603	0.0:0.0:1.0:0.0	.	2590	Q96DT5	DYH11_HUMAN	M	2590	ENSP00000330671:V2590M	ENSP00000330671:V2590M	V	+	1	0	DNAH11	21744945	1.000000	0.71417	0.998000	0.56505	0.109000	0.19521	6.391000	0.73208	2.689000	0.91719	0.655000	0.94253	GTG	-	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00382		0.403	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	DNAH11	protein_coding	OTTHUMT00000326582.6	G	NM_003777		21744945	+1	no_errors	ENST00000328843	ensembl	human	known	54_36p	missense	SNP	1.000	A
CEBPE	1053	genome.wustl.edu	37	14	23586943	23586943	+	Missense_Mutation	SNP	A	A	C			TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chr14:23586943A>C	ENST00000206513.5	-	2	1123	c.599T>G	c.(598-600)gTg>gGg	p.V200G		NM_001805.3	NP_001796.2	Q15744	CEBPE_HUMAN	CCAAT/enhancer binding protein (C/EBP), epsilon	200					cellular response to lipopolysaccharide (GO:0071222)|cytokine biosynthetic process (GO:0042089)|defense response (GO:0006952)|defense response to bacterium (GO:0042742)|macrophage differentiation (GO:0030225)|phagocytosis (GO:0006909)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			large_intestine(2)|lung(3)|ovary(2)|prostate(1)|skin(1)	9	all_cancers(95;4.6e-05)			GBM - Glioblastoma multiforme(265;0.0064)		ATCTTTGTTCACTGCCTTCTT	0.647																																					NSCLC(63;1230 1818 14565 22565)											0			14											60.0	63.0	62.0					14																	23586943		2203	4300	6503	22656783	SO:0001583	missense	1053				CCDS9589.1	14q11.2	2014-09-17			ENSG00000092067	ENSG00000092067		"""basic leucine zipper proteins"""	1836	protein-coding gene	gene with protein product		600749				8661101	Standard	NM_001805		Approved	CRP1	uc001wiv.2	Q15744	OTTHUMG00000028719	ENST00000206513.5:c.599T>G	14.37:g.23586943A>C	ENSP00000206513:p.Val200Gly		22656783	Q15745|Q8IYI2|Q99803	Missense_Mutation	SNP	PatternScan_BZIP_BASIC,HMMSmart_BRLZ,HMMPfam_bZIP_2	p.V200G	ENST00000206513.5	37	c.599	CCDS9589.1	14	.	.	.	.	.	.	.	.	.	.	A	25.9	4.688318	0.88639	.	.	ENSG00000092067	ENST00000206513	T	0.49432	0.78	5.2	5.2	0.72013	.	0.059548	0.64402	D	0.000004	T	0.49932	0.1586	L	0.29908	0.895	0.80722	D	1	D	0.65815	0.995	P	0.54889	0.763	T	0.54781	-0.8242	10	0.87932	D	0	-25.8804	14.0425	0.64684	1.0:0.0:0.0:0.0	.	200	Q15744	CEBPE_HUMAN	G	200	ENSP00000206513:V200G	ENSP00000206513:V200G	V	-	2	0	CEBPE	22656783	1.000000	0.71417	0.996000	0.52242	0.939000	0.58152	9.292000	0.96076	1.956000	0.56807	0.533000	0.62120	GTG	-	NULL		0.647	CEBPE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEBPE	protein_coding	OTTHUMT00000071716.2	A	NM_001805		22656783	-1	no_errors	NM_001805	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
INTS9	55756	genome.wustl.edu	37	8	28717044	28717044	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chr8:28717044C>A	ENST00000521022.1	-	2	127	c.46G>T	c.(46-48)Gtg>Ttg	p.V16L	INTS9_ENST00000521777.1_5'UTR|INTS9_ENST00000397363.4_Intron|INTS9_ENST00000416984.2_Missense_Mutation_p.V16L	NM_018250.3	NP_060720.2	Q9NV88	INT9_HUMAN	integrator complex subunit 9	16					snRNA processing (GO:0016180)	cytoplasm (GO:0005737)|integrator complex (GO:0032039)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|pancreas(2)|prostate(1)|urinary_tract(2)	19		Ovarian(32;0.0439)		KIRC - Kidney renal clear cell carcinoma(542;0.127)|Kidney(114;0.152)		AATTTGAGCACATTGCATGGT	0.393																																																0			8											199.0	161.0	174.0					8																	28717044		2203	4300	6503	28772963	SO:0001583	missense	55756			BC025267	CCDS34873.1, CCDS55215.1, CCDS55216.1	8p21.1	2008-02-05			ENSG00000104299	ENSG00000104299			25592	protein-coding gene	gene with protein product		611352				16239144	Standard	NM_001172562		Approved	FLJ10871, CPSF2L, RC-74	uc011lav.2	Q9NV88	OTTHUMG00000164030	ENST00000521022.1:c.46G>T	8.37:g.28717044C>A	ENSP00000429065:p.Val16Leu		28772963	B7Z560|B7Z6M5|O00224|Q8TB16	Missense_Mutation	SNP	NULL	p.V16L	ENST00000521022.1	37	c.46	CCDS34873.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.37|12.37	1.916937|1.916937	0.33815|0.33815	.|.	.|.	ENSG00000104299|ENSG00000104299	ENST00000524081|ENST00000521022;ENST00000416984;ENST00000541706;ENST00000523436	.|T;T;T	.|0.39406	.|1.1;1.11;1.08	5.24|5.24	3.44|3.44	0.39384|0.39384	.|.	.|0.139231	.|0.49916	.|D	.|0.000137	T|T	0.25121|0.25121	0.0610|0.0610	N|N	0.21240|0.21240	0.645|0.645	0.80722|0.80722	D|D	1|1	.|B;B;B	.|0.16802	.|0.019;0.001;0.0	.|B;B;B	.|0.20384	.|0.029;0.006;0.004	T|T	0.07214|0.07214	-1.0784|-1.0784	5|10	.|0.06099	.|T	.|0.92	-6.9031|-6.9031	11.6925|11.6925	0.51525|0.51525	0.0:0.8562:0.0:0.1438|0.0:0.8562:0.0:0.1438	.|.	.|16;16;16	.|B7Z6M5;G3XAN1;Q9NV88	.|.;.;INT9_HUMAN	F|L	7|16;16;15;16	.|ENSP00000429065:V16L;ENSP00000398208:V16L;ENSP00000427789:V16L	.|ENSP00000398208:V16L	C|V	-|-	2|1	0|0	INTS9|INTS9	28772963|28772963	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.999000|0.999000	0.98932|0.98932	4.986000|4.986000	0.63851|0.63851	0.600000|0.600000	0.29862|0.29862	0.655000|0.655000	0.94253|0.94253	TGT|GTG	-	NULL		0.393	INTS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INTS9	protein_coding	OTTHUMT00000376846.1	C	NM_018250		28772963	-1	no_errors	NM_018250	genbank	human	validated	54_36p	missense	SNP	1.000	A
MAGEB4	4115	genome.wustl.edu	37	X	30261146	30261146	+	Silent	SNP	T	T	C			TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chrX:30261146T>C	ENST00000378982.2	+	1	1090	c.894T>C	c.(892-894)aaT>aaC	p.N298N	MAGEB1_ENST00000397550.1_5'Flank|MAGEB1_ENST00000378981.3_5'Flank	NM_002367.3	NP_002358.1	O15481	MAGB4_HUMAN	melanoma antigen family B, 4	298	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	27						CCACCCCCAATAACTTCCCAC	0.527																																																0			X											67.0	66.0	67.0					X																	30261146		2202	4300	6502	30171067	SO:0001819	synonymous_variant	4115				CCDS14221.1	Xp21.3	2009-03-17			ENSG00000120289	ENSG00000120289			6811	protein-coding gene	gene with protein product	"""melanoma-associated antigen B4"", ""cancer/testis antigen family 3, member 6"""	300153				9441743	Standard	NM_002367		Approved	MGC33144, CT3.6	uc004dcb.3	O15481	OTTHUMG00000021321	ENST00000378982.2:c.894T>C	X.37:g.30261146T>C			30171067	B2R9G0|Q6FHH4|Q8IZ00	Silent	SNP	HMMPfam_MAGE	p.N298	ENST00000378982.2	37	c.894	CCDS14221.1	X																																																																																			-	NULL		0.527	MAGEB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEB4	protein_coding	OTTHUMT00000056159.1	T	NM_002367		30171067	+1	no_errors	NM_002367	genbank	human	reviewed	54_36p	silent	SNP	0.000	C
LYPLA2P1	653639	genome.wustl.edu	37	6	33333519	33333519	+	IGR	SNP	T	T	C			TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chr6:33333519T>C								DAXX (42728 upstream) : KIFC1 (25793 downstream)																							CACTGGAGGATGGCCAGGTCC	0.662																																																0			6																																								33441497	SO:0001628	intergenic_variant	653639																															6.37:g.33333519T>C			33441497		RNA	SNP	-	NULL		37	NULL		6																																																																																			-	-	0	0.662					LYPLA2P1			T			33441497	-1	pseudogene	NR_001444	genbank	human	provisional	54_36p	rna	SNP	0.887	C
NFS1	9054	genome.wustl.edu	37	20	34262982	34262982	+	Silent	SNP	T	T	G	rs374989904		TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chr20:34262982T>G	ENST00000374092.4	-	8	1003	c.933A>C	c.(931-933)gcA>gcC	p.A311A	NFS1_ENST00000374085.1_Silent_p.A251A|NFS1_ENST00000540053.1_Silent_p.A109A|RP1-309K20.6_ENST00000541176.2_5'Flank|NFS1_ENST00000498084.1_5'Flank|NFS1_ENST00000541387.1_Silent_p.A260A|NFS1_ENST00000397425.1_Silent_p.A251A	NM_021100.4	NP_066923.3	Q9Y697	NFS1_HUMAN	NFS1 cysteine desulfurase	311					cysteine metabolic process (GO:0006534)|iron incorporation into metallo-sulfur cluster (GO:0018283)|Mo-molybdopterin cofactor biosynthetic process (GO:0006777)|molybdopterin cofactor biosynthetic process (GO:0032324)|protein complex assembly (GO:0006461)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	cysteine desulfurase activity (GO:0031071)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	18	Lung NSC(9;0.00608)|all_lung(11;0.00918)		BRCA - Breast invasive adenocarcinoma(18;0.0886)		L-Alanine(DB00160)|L-Cysteine(DB00151)	TCTCTTGCTGTGCCACCTCAC	0.617																																																0			20											66.0	66.0	66.0					20																	34262982		2203	4300	6503	33726396	SO:0001819	synonymous_variant	9054			AF097025	CCDS13262.1, CCDS56185.1	20q11.22	2013-08-06	2013-08-06		ENSG00000244005	ENSG00000244005	2.8.1.7		15910	protein-coding gene	gene with protein product		603485	"""nitrogen fixation 1 (S. cerevisiae, homolog)"", ""NFS1 nitrogen fixation 1 homolog (S. cerevisiae)"""			9885568, 16847322	Standard	NM_021100		Approved	NifS, IscS	uc002xdw.2	Q9Y697	OTTHUMG00000032361	ENST00000374092.4:c.933A>C	20.37:g.34262982T>G			33726396	B3KMA5|B4DXK9|E1P5R8|F5GYK5|Q6P0L8|Q9NTZ5|Q9Y481	Silent	SNP	superfamily_PLP-dependent transferases,HMMPfam_Aminotran_5,PatternScan_AA_TRANSFER_CLASS_5	p.A311	ENST00000374092.4	37	c.933	CCDS13262.1	20																																																																																			-	superfamily_PLP-dependent transferases,HMMPfam_Aminotran_5		0.617	NFS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NFS1	protein_coding	OTTHUMT00000078936.4	T	NM_021100		33726396	-1	no_errors	NM_021100	genbank	human	reviewed	54_36p	silent	SNP	1.000	G
FAM47A	158724	genome.wustl.edu	37	X	34148800	34148800	+	Silent	SNP	C	C	T	rs372096171		TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chrX:34148800C>T	ENST00000346193.3	-	1	1647	c.1596G>A	c.(1594-1596)ccG>ccA	p.P532P		NM_203408.3	NP_981953.2	Q5JRC9	FA47A_HUMAN	family with sequence similarity 47, member A	532										NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(5)|large_intestine(17)|lung(44)|ovary(5)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	97						TGGGAGGCTCCGGACCGAGAC	0.657																																																0			X						C		0,3825		0,0,1627,571	42.0	48.0	46.0		1596	-0.3	0.0	X		46	1,6719		0,1,2425,1868	no	coding-synonymous	FAM47A	NM_203408.3		0,1,4052,2439	TT,TC,CC,C		0.0149,0.0,0.0095		532/792	34148800	1,10544	2198	4294	6492	34058721	SO:0001819	synonymous_variant	158724			BC026171	CCDS43926.1	Xp21.1	2004-08-09			ENSG00000185448	ENSG00000185448			29962	protein-coding gene	gene with protein product	"""similar to hypothetical protein FLJ35782"""					12477932	Standard	NM_203408		Approved	MGC27003	uc004ddg.3	Q5JRC9	OTTHUMG00000021339	ENST00000346193.3:c.1596G>A	X.37:g.34148800C>T			34058721	A8K8I9|Q8TAA0	Silent	SNP	NULL	p.P532	ENST00000346193.3	37	c.1596	CCDS43926.1	X																																																																																			-	NULL		0.657	FAM47A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM47A	protein_coding	OTTHUMT00000056205.1	C	NM_203408		34058721	-1	no_errors	NM_203408	genbank	human	predicted	54_36p	silent	SNP	0.000	T
CCIN	881	genome.wustl.edu	37	9	36169916	36169916	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chr9:36169916G>T	ENST00000335119.2	+	1	528	c.417G>T	c.(415-417)ttG>ttT	p.L139F		NM_005893.2	NP_005884.2	Q13939	CALI_HUMAN	calicin	139	BACK.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)				breast(3)|endometrium(2)|large_intestine(4)|liver(2)|lung(5)|ovary(1)|skin(4)	21			STAD - Stomach adenocarcinoma(86;0.228)			ACCTCTTCTTGGCTGAGCTGT	0.517																																																0			9											128.0	115.0	119.0					9																	36169916		2203	4300	6503	36159916	SO:0001583	missense	881			Z46967	CCDS6599.1	9p13.1	2013-10-02			ENSG00000185972	ENSG00000185972		"""BTB/POZ domain containing"""	1568	protein-coding gene	gene with protein product		603960				7641791	Standard	NM_005893		Approved	KBTBD14, BTBD20	uc003zzb.4	Q13939	OTTHUMG00000019901	ENST00000335119.2:c.417G>T	9.37:g.36169916G>T	ENSP00000334996:p.Leu139Phe		36159916	Q9BXG7	Missense_Mutation	SNP	superfamily_POZ domain,HMMPfam_BTB,HMMSmart_SM00225,HMMPfam_BACK,superfamily_Galactose oxidase central domain,HMMSmart_SM00612,HMMPfam_Kelch_1,PatternScan_MULTICOPPER_OXIDASE1	p.L139F	ENST00000335119.2	37	c.417	CCDS6599.1	9	.	.	.	.	.	.	.	.	.	.	G	13.62	2.291814	0.40594	.	.	ENSG00000185972	ENST00000335119	T	0.65916	-0.18	5.54	3.72	0.42706	BTB/Kelch-associated (2);	0.000000	0.43747	D	0.000532	T	0.60143	0.2246	L	0.29908	0.895	0.34103	D	0.66209	D	0.69078	0.997	D	0.81914	0.995	T	0.62181	-0.6908	10	0.02654	T	1	.	8.7342	0.34519	0.1746:0.0:0.8254:0.0	.	139	Q13939	CALI_HUMAN	F	139	ENSP00000334996:L139F	ENSP00000334996:L139F	L	+	3	2	CCIN	36159916	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	0.992000	0.29667	0.836000	0.34901	-0.253000	0.11424	TTG	-	HMMPfam_BACK		0.517	CCIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCIN	protein_coding	OTTHUMT00000052418.1	G	NM_005893		36159916	+1	no_errors	NM_005893	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
BRCA1	672	genome.wustl.edu	37	17	41256249	41256249	+	Nonsense_Mutation	SNP	C	C	A	rs80357754		TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chr17:41256249C>A	ENST00000357654.3	-	6	449	c.331G>T	c.(331-333)Gaa>Taa	p.E111*	BRCA1_ENST00000309486.4_5'UTR|BRCA1_ENST00000491747.2_Nonsense_Mutation_p.E111*|BRCA1_ENST00000351666.3_Nonsense_Mutation_p.E111*|BRCA1_ENST00000352993.3_Nonsense_Mutation_p.E111*|BRCA1_ENST00000354071.3_Nonsense_Mutation_p.E111*|BRCA1_ENST00000591534.1_Intron|BRCA1_ENST00000586385.1_Intron|BRCA1_ENST00000591849.1_Intron|BRCA1_ENST00000493795.1_Nonsense_Mutation_p.E64*|BRCA1_ENST00000346315.3_Nonsense_Mutation_p.E111*|BRCA1_ENST00000468300.1_Nonsense_Mutation_p.E111*|BRCA1_ENST00000471181.2_Nonsense_Mutation_p.E111*	NM_007294.3	NP_009225.1	P38398	BRCA1_HUMAN	breast cancer 1, early onset	111					androgen receptor signaling pathway (GO:0030521)|apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to indole-3-methanol (GO:0071681)|cellular response to tumor necrosis factor (GO:0071356)|chromosome segregation (GO:0007059)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|fatty acid biosynthetic process (GO:0006633)|G2 DNA damage checkpoint (GO:0031572)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of centriole replication (GO:0046600)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of DNA repair (GO:0045739)|positive regulation of gene expression (GO:0010628)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K9 acetylation (GO:2000617)|positive regulation of histone H4-K16 acetylation (GO:2000620)|positive regulation of histone H4-K20 methylation (GO:0070512)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation vascular endothelial growth factor production (GO:0010575)|postreplication repair (GO:0006301)|protein autoubiquitination (GO:0051865)|protein K6-linked ubiquitination (GO:0085020)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to estrogen (GO:0043627)|response to ionizing radiation (GO:0010212)	BRCA1-A complex (GO:0070531)|BRCA1-BARD1 complex (GO:0031436)|chromosome (GO:0005694)|cytoplasm (GO:0005737)|gamma-tubulin ring complex (GO:0008274)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ribonucleoprotein complex (GO:0030529)|ubiquitin ligase complex (GO:0000151)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|RNA binding (GO:0003723)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(30)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(28)|ovary(36)|skin(2)|stomach(4)|urinary_tract(2)	120		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)		GAGTTATTTTCCTTTTTTGCA	0.328			"""D, Mis, N, F, S"""		ovarian	"""breast, ovarian"""		Homologous recombination	Hereditary Breast-Ovarian Cancer, BRCA1 type	TCGA Ovarian(2;0.000030)																												yes	Rec	yes	Hereditary breast/ovarian cancer	17	17q21	672	familial breast/ovarian cancer gene 1		E	0			17											165.0	158.0	161.0					17																	41256249		2203	4300	6503	38509775	SO:0001587	stop_gained	672	Familial Cancer Database		U14680	CCDS11453.1, CCDS11454.1, CCDS11455.1, CCDS11456.1, CCDS11459.1, CCDS11455.2, CCDS11456.2, CCDS11459.2, CCDS11454.2	17q21.31	2014-09-17			ENSG00000012048	ENSG00000012048		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1100	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 1"", ""protein phosphatase 1, regulatory subunit 53"""	113705				1676470	Standard	NM_007300		Approved	RNF53, BRCC1, PPP1R53	uc002ict.3	P38398	OTTHUMG00000157426	ENST00000357654.3:c.331G>T	17.37:g.41256249C>A	ENSP00000350283:p.Glu111*		38509775	O15129|Q1RMC1|Q3LRJ0|Q3LRJ6|Q6IN79|Q7KYU9	Nonsense_Mutation	SNP	superfamily_RING/U-box,HMMSmart_SM00184,HMMPfam_zf-C3HC4,PatternScan_ZF_RING_1,HMMPfam_BRCT,HMMSmart_SM00292,superfamily_BRCT domain	p.E111*	ENST00000357654.3	37	c.331	CCDS11453.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	23.8|23.8	4.461792|4.461792	0.84425|0.84425	.|.	.|.	ENSG00000012048|ENSG00000012048	ENST00000357654;ENST00000412061;ENST00000354071;ENST00000352993;ENST00000346315;ENST00000351666;ENST00000468300;ENST00000393691;ENST00000471181;ENST00000493795;ENST00000491747;ENST00000478531;ENST00000484087;ENST00000493919;ENST00000487825;ENST00000470026;ENST00000477152;ENST00000494123;ENST00000476777;ENST00000489037|ENST00000473961	.|.	.|.	.|.	5.32|5.32	-2.12|-2.12	0.07165|0.07165	.|.	0.654924|.	0.14113|.	N|.	0.340572|.	.|T	.|0.44201	.|0.1282	.|.	.|.	.|.	0.37212|0.37212	D|D	0.90486|0.90486	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.43925	.|-0.9361	.|4	0.52906|.	T|.	0.07|.	.|.	5.9019|5.9019	0.18972|0.18972	0.0:0.3641:0.3927:0.2432|0.0:0.3641:0.3927:0.2432	.|.	.|.	.|.	.|.	X|S	111;111;111;111;111;111;111;64;111;64;111;111;27;64;27;111;85;111;111;85|18	.|.	ENSP00000246907:E111X|.	E|R	-|-	1|3	0|2	BRCA1|BRCA1	38509775|38509775	0.736000|0.736000	0.28164|0.28164	0.958000|0.958000	0.39756|0.39756	0.959000|0.959000	0.62525|0.62525	0.051000|0.051000	0.14141|0.14141	-0.186000|-0.186000	0.10533|0.10533	0.655000|0.655000	0.94253|0.94253	GAA|AGG	-	NULL		0.328	BRCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRCA1	protein_coding	OTTHUMT00000348798.2	C	NM_007294		38509775	-1	no_errors	NM_007294	genbank	human	reviewed	54_36p	nonsense	SNP	0.139	A
ATXN7L3	56970	genome.wustl.edu	37	17	42275012	42275012	+	Silent	SNP	G	G	C			TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chr17:42275012G>C	ENST00000454077.2	-	2	137	c.138C>G	c.(136-138)ggC>ggG	p.G46G	ATXN7L3_ENST00000593073.1_Intron|ATXN7L3_ENST00000389384.4_Silent_p.G46G|CTB-175E5.7_ENST00000586560.1_RNA	NM_020218.1	NP_064603.1			ataxin 7-like 3											kidney(1)|large_intestine(1)|lung(7)|ovary(1)|skin(2)	12		Breast(137;0.00765)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.113)		AGAAGAAGTAGCCACACTTGA	0.572																																																0			17											150.0	152.0	152.0					17																	42275012		2012	4192	6204	39630538	SO:0001819	synonymous_variant	0			AK056002	CCDS42345.1, CCDS45697.1	17q21	2010-03-10			ENSG00000087152	ENSG00000087152			25416	protein-coding gene	gene with protein product						15115762	Standard	NM_001098833		Approved	DKFZp761G2113	uc002ifz.3	Q14CW9		ENST00000454077.2:c.138C>G	17.37:g.42275012G>C			39630538		Silent	SNP	HMMPfam_Sgf11,HMMPfam_SCA7	p.G46	ENST00000454077.2	37	c.138	CCDS45697.1	17																																																																																			-	NULL		0.572	ATXN7L3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATXN7L3	protein_coding	OTTHUMT00000457724.1	G			39630538	-1	no_errors	NM_020218	genbank	human	validated	54_36p	silent	SNP	1.000	C
KMT2B	9757	genome.wustl.edu	37	19	36210703	36210703	+	Missense_Mutation	SNP	C	C	T	rs200918556	byFrequency	TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chr19:36210703C>T	ENST00000222270.7	+	3	454	c.454C>T	c.(454-456)Cgg>Tgg	p.R152W	KMT2B_ENST00000341701.1_Missense_Mutation_p.R152W|KMT2B_ENST00000420124.1_Missense_Mutation_p.R152W|KMT2B_ENST00000607650.1_RNA	NM_014727.1	NP_055542.1	Q9UMN6	KMT2B_HUMAN	lysine (K)-specific methyltransferase 2B	152					chromatin-mediated maintenance of transcription (GO:0048096)|gene silencing (GO:0016458)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|oocyte differentiation (GO:0009994)|ovarian follicle development (GO:0001541)|ovulation (GO:0030728)|regulation of histone H3-K4 methylation (GO:0051569)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)										GCCCCGAGGTCGGGGTCGCAA	0.617													C|||	3	0.000599042	0.0023	0.0	5008	,	,		16663	0.0		0.0	False		,,,				2504	0.0															0			19						C	TRP/ARG	5,3831		0,5,1913	72.0	79.0	77.0		454	5.1	1.0	19		77	0,8248		0,0,4124	yes	missense	MLL4	NM_014727.1	101	0,5,6037	TT,TC,CC		0.0,0.1303,0.0414	probably-damaging	152/2716	36210703	5,12079	1918	4124	6042	40902543	SO:0001583	missense	0			AJ007041	CCDS46055.1	19q13.1	2014-02-18			ENSG00000105663	ENSG00000272333		"""Chromatin-modifying enzymes / K-methyltransferases"""	15840	protein-coding gene	gene with protein product	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila) 4"""	606834				10409430, 10637508	Standard	XM_006723513		Approved	KIAA0304, MLL2, TRX2, HRX2, WBP7, MLL1B, MLL4		Q9UMN6	OTTHUMG00000048119	ENST00000222270.7:c.454C>T	19.37:g.36210703C>T	ENSP00000222270:p.Arg152Trp		40902543	O15022|O95836|Q96GP2|Q96IP3|Q9UK25|Q9Y668|Q9Y669	Missense_Mutation	SNP	HMMPfam_AT_hook,HMMPfam_zf-CXXC,superfamily_FYVE/PHD zinc finger,HMMSmart_SM00249,HMMPfam_PHD,PatternScan_ZF_PHD_1,HMMPfam_FYRN,HMMSmart_SM00541,HMMPfam_FYRC,HMMSmart_SM00542,superfamily_SET domain,HMMPfam_SET,HMMSmart_SM00317,HMMSmart_SM00508	p.R152W	ENST00000222270.7	37	c.454	CCDS46055.1	19	2	9.157509157509158E-4	2	0.0040650406504065045	0	0.0	0	0.0	0	0.0	C	18.88	3.718135	0.68844	0.001303	0.0	ENSG00000105663	ENST00000222270;ENST00000420124;ENST00000341701	D;D;T	0.85088	-1.94;-1.94;0.62	5.06	5.06	0.68205	AT hook, DNA-binding motif (1);	0.000000	0.38326	N	0.001738	D	0.85323	0.5670	N	0.14661	0.345	0.38899	D	0.957286	D	0.89917	1.0	D	0.77557	0.99	D	0.88078	0.2805	10	0.87932	D	0	.	13.7988	0.63188	0.0:1.0:0.0:0.0	.	152	Q9UMN6	MLL4_HUMAN	W	152	ENSP00000222270:R152W;ENSP00000398837:R152W;ENSP00000345761:R152W	ENSP00000222270:R152W	R	+	1	2	AD000671.1	40902543	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.169000	0.42434	2.632000	0.89209	0.561000	0.74099	CGG	-	NULL		0.617	KMT2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	uc010eei.1	protein_coding		C	NM_014727		40902543	+1	no_errors	ENST00000222270	ensembl	human	known	54_36p	missense	SNP	1.000	T
EFCAB13	124989	genome.wustl.edu	37	17	45468910	45468910	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chr17:45468910G>C	ENST00000331493.2	+	15	2101	c.1690G>C	c.(1690-1692)Gaa>Caa	p.E564Q	EFCAB13_ENST00000517484.1_Missense_Mutation_p.E468Q	NM_152347.4	NP_689560.3	Q8IY85	EFC13_HUMAN	EF-hand calcium binding domain 13	564						cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)										TTCTAAGCCAGAATTTAAGAA	0.333																																																0			17											66.0	69.0	68.0					17																	45468910		2203	4299	6502	42823909	SO:0001583	missense	124989			BC036407	CCDS11512.1, CCDS56034.1	17q21.32	2013-01-11	2012-07-20	2012-07-20	ENSG00000178852	ENSG00000178852		"""EF-hand domain containing"""	26864	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 57"""	C17orf57			Standard	NM_152347		Approved	FLJ40342	uc002iln.3	Q8IY85	OTTHUMG00000164767	ENST00000331493.2:c.1690G>C	17.37:g.45468910G>C	ENSP00000332111:p.Glu564Gln		42823909	G3V128|Q49AG9	Missense_Mutation	SNP	superfamily_EF-hand	p.E564Q	ENST00000331493.2	37	c.1690	CCDS11512.1	17	.	.	.	.	.	.	.	.	.	.	G	14.83	2.651386	0.47362	.	.	ENSG00000178852	ENST00000331493;ENST00000517484;ENST00000344176;ENST00000523842	T;T;T	0.71698	-0.16;-0.59;0.3	3.2	2.22	0.28083	EF-hand-like domain (1);	0.563019	0.16379	N	0.217000	T	0.78253	0.4254	M	0.61703	1.905	0.25173	N	0.990268	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.87578	0.991;0.998;0.998	T	0.64732	-0.6338	10	0.66056	D	0.02	0.2218	6.356	0.21402	0.1371:0.0:0.8629:0.0	.	516;564;468	Q8N7U2;Q8IY85;G3V128	.;CQ057_HUMAN;.	Q	564;468;516;90	ENSP00000332111:E564Q;ENSP00000430048:E468Q;ENSP00000429566:E90Q	ENSP00000332111:E564Q	E	+	1	0	C17orf57	42823909	0.998000	0.40836	0.982000	0.44146	0.864000	0.49448	3.112000	0.50368	0.892000	0.36259	-0.373000	0.07131	GAA	-	superfamily_EF-hand		0.333	EFCAB13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C17orf57	protein_coding	OTTHUMT00000380147.4	G	NM_152347		42823909	+1	no_errors	NM_152347	genbank	human	predicted	54_36p	missense	SNP	0.752	C
SEMG2	6407	genome.wustl.edu	37	20	43850940	43850940	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chr20:43850940G>C	ENST00000372769.3	+	2	757	c.667G>C	c.(667-669)Gtg>Ctg	p.V223L		NM_003008.2	NP_002999.1	Q02383	SEMG2_HUMAN	semenogelin II	223	Repeat-rich region.				sexual reproduction (GO:0019953)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|secretory granule (GO:0030141)	structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(3)|endometrium(6)|kidney(2)|large_intestine(6)|lung(9)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	36		Myeloproliferative disorder(115;0.0122)				TTACCAAAATGTGGTTGACGT	0.378																																																0			20											113.0	105.0	108.0					20																	43850940		2203	4300	6503	43284354	SO:0001583	missense	6407				CCDS13346.1	20q12-q13.1	2008-07-02			ENSG00000124157	ENSG00000124157			10743	protein-coding gene	gene with protein product	"""Semenogelin 2"""	182141				1517240, 9523691	Standard	NM_003008		Approved	SGII	uc002xnk.3	Q02383	OTTHUMG00000032566	ENST00000372769.3:c.667G>C	20.37:g.43850940G>C	ENSP00000361855:p.Val223Leu		43284354	Q53ZU2|Q6X2M5|Q6X2M6	Missense_Mutation	SNP	HMMPfam_Semenogelin	p.V223L	ENST00000372769.3	37	c.667	CCDS13346.1	20	.	.	.	.	.	.	.	.	.	.	G	11.29	1.595478	0.28445	.	.	ENSG00000124157	ENST00000372769	T	0.12039	2.72	1.38	0.256	0.15567	.	.	.	.	.	T	0.19967	0.0480	M	0.68593	2.085	0.09310	N	1	P;D;D	0.57571	0.908;0.98;0.98	P;P;P	0.51415	0.519;0.669;0.669	T	0.11591	-1.0581	9	0.59425	D	0.04	.	4.4245	0.11497	0.0:0.0:0.6153:0.3847	.	223;223;223	A8K6Z6;Q6IRW3;Q02383	.;.;SEMG2_HUMAN	L	223	ENSP00000361855:V223L	ENSP00000361855:V223L	V	+	1	0	SEMG2	43284354	0.001000	0.12720	0.002000	0.10522	0.002000	0.02628	-0.459000	0.06728	0.089000	0.17243	0.655000	0.94253	GTG	-	HMMPfam_Semenogelin		0.378	SEMG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMG2	protein_coding	OTTHUMT00000079417.1	G	NM_003008		43284354	+1	no_errors	NM_003008	genbank	human	reviewed	54_36p	missense	SNP	0.007	C
DNAJC22	79962	genome.wustl.edu	37	12	49745258	49745258	+	Silent	SNP	C	C	T			TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chr12:49745258C>T	ENST00000549441.2	+	4	2203	c.999C>T	c.(997-999)ccC>ccT	p.P333P	DNAJC22_ENST00000395069.3_Silent_p.P333P			Q8N4W6	DJC22_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 22	333	J. {ECO:0000255|PROSITE- ProRule:PRU00286}.					integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|liver(2)|lung(1)|ovary(1)|pancreas(1)	10						TGAGTCAACCCAGGAAGCCCT	0.562																																																0			12											42.0	44.0	44.0					12																	49745258		2203	4300	6503	48031525	SO:0001819	synonymous_variant	79962			AK055747	CCDS8785.1	12q13.12	2011-09-02		2008-07-08	ENSG00000178401	ENSG00000178401		"""Heat shock proteins / DNAJ (HSP40)"""	25802	protein-coding gene	gene with protein product	"""wurst homolog (Drosophila)"""					17558392	Standard	NM_024902		Approved	wus, FLJ13236	uc001rua.3	Q8N4W6		ENST00000549441.2:c.999C>T	12.37:g.49745258C>T			48031525	B3KP54	Silent	SNP	PatternScan_DNAJ_1,superfamily_DnaJ_N,HMMSmart_DnaJ,HMMPfam_DnaJ	p.P333	ENST00000549441.2	37	c.999	CCDS8785.1	12																																																																																			-	superfamily_DnaJ_N,HMMSmart_DnaJ,HMMPfam_DnaJ		0.562	DNAJC22-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	DNAJC22	protein_coding	OTTHUMT00000404302.2	C	NM_024902		48031525	+1	no_errors	NM_024902	genbank	human	provisional	54_36p	silent	SNP	0.007	T
PTCHD4	442213	genome.wustl.edu	37	6	47976659	47976659	+	Silent	SNP	C	C	T			TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chr6:47976659C>T	ENST00000339488.4	-	2	651	c.618G>A	c.(616-618)caG>caA	p.Q206Q	PTCHD4_ENST00000543600.1_Silent_p.Q189Q	NM_001013732.3	NP_001013754.3	Q6ZW05	PTHD4_HUMAN	patched domain containing 4	206						integral component of membrane (GO:0016021)	hedgehog receptor activity (GO:0008158)										GATGCTCCTCCTGGAGCTTCC	0.498																																																0			6											63.0	61.0	61.0					6																	47976659		1900	4131	6031	48084618	SO:0001819	synonymous_variant	442213				CCDS34473.2	6p12.3	2012-02-06	2012-02-06	2012-02-06	ENSG00000244694	ENSG00000244694			21345	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 138"""	C6orf138			Standard	NM_001013732		Approved	dJ402H5.2, FLJ41841	uc011dwm.2	Q6ZW05	OTTHUMG00000150404	ENST00000339488.4:c.618G>A	6.37:g.47976659C>T			48084618	B0QZ29|B4DRK3|Q5T884	Silent	SNP	HMMPfam_Patched,superfamily_SSF82866	p.Q189	ENST00000339488.4	37	c.567	CCDS34473.2	6	.	.	.	.	.	.	.	.	.	.	C	6.616	0.482132	0.12581	.	.	ENSG00000244694	ENST00000398738	.	.	.	6.16	5.29	0.74685	.	.	.	.	.	T	0.65502	0.2697	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.61917	-0.6964	4	.	.	.	.	15.9802	0.80102	0.0:0.9349:0.0:0.0651	.	.	.	.	R	206	.	.	G	-	1	0	C6orf138	48084618	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.905000	0.48727	2.937000	0.99478	0.650000	0.86243	GGA	-	HMMPfam_Patched,superfamily_SSF82866		0.498	PTCHD4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	C6orf138	protein_coding	OTTHUMT00000317987.2	C	NM_001013732		48084618	-1	no_errors	NM_001013732	genbank	human	validated	54_36p	silent	SNP	1.000	T
PTPRJ	5795	genome.wustl.edu	37	11	48186054	48186054	+	Missense_Mutation	SNP	T	T	A			TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chr11:48186054T>A	ENST00000418331.2	+	24	4194	c.3842T>A	c.(3841-3843)aTg>aAg	p.M1281K		NM_002843.3	NP_002834.3	Q12913	PTPRJ_HUMAN	protein tyrosine phosphatase, receptor type, J	1281	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				contact inhibition (GO:0060242)|heart development (GO:0007507)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of platelet-derived growth factor receptor signaling pathway (GO:0010642)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of T cell receptor signaling pathway (GO:0050860)|negative regulation of vascular permeability (GO:0043116)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive chemotaxis (GO:0050918)|positive regulation of cell adhesion (GO:0045785)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of cell adhesion (GO:0030155)|vasculogenesis (GO:0001570)	cell projection (GO:0042995)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|mitogen-activated protein kinase binding (GO:0051019)|phosphatase activity (GO:0016791)|platelet-derived growth factor receptor binding (GO:0005161)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)			breast(3)|endometrium(7)|kidney(7)|large_intestine(5)|lung(15)|ovary(1)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	52						AGGCCTTTAATGGTGCAGACA	0.408																																																0			11											189.0	166.0	174.0					11																	48186054		2201	4298	6499	48142630	SO:0001583	missense	5795			U10886	CCDS7945.1, CCDS44596.1	11p11.2	2013-02-11			ENSG00000149177	ENSG00000149177		"""CD molecules"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9673	protein-coding gene	gene with protein product		600925				7937872, 7994032	Standard	NM_001098503		Approved	DEP1, HPTPeta, CD148	uc001ngp.4	Q12913	OTTHUMG00000166573	ENST00000418331.2:c.3842T>A	11.37:g.48186054T>A	ENSP00000400010:p.Met1281Lys		48142630	Q15255|Q6P4H4|Q8NHM2|Q9UDA9	Missense_Mutation	SNP	HMMSmart_FN3,HMMPfam_fn3,superfamily_FN_III-like,superfamily_SSF52799,HMMSmart_PTPc,HMMPfam_Y_phosphatase,PatternScan_TYR_PHOSPHATASE_1	p.M1281K	ENST00000418331.2	37	c.3842	CCDS7945.1	11	.	.	.	.	.	.	.	.	.	.	T	22.1	4.239664	0.79800	.	.	ENSG00000149177	ENST00000418331	T	0.16897	2.31	4.47	4.47	0.54385	Protein-tyrosine phosphatase, receptor/non-receptor type (4);Protein-tyrosine/Dual-specificity phosphatase (1);	.	.	.	.	T	0.58666	0.2138	H	0.99090	4.425	0.80722	D	1	D	0.76494	0.999	D	0.70227	0.968	T	0.75396	-0.3332	9	0.87932	D	0	.	11.9917	0.53180	0.0:0.0:0.0:1.0	.	1281	Q12913	PTPRJ_HUMAN	K	1281	ENSP00000400010:M1281K	ENSP00000400010:M1281K	M	+	2	0	PTPRJ	48142630	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.909000	0.87444	1.785000	0.52413	0.528000	0.53228	ATG	-	superfamily_SSF52799,HMMSmart_PTPc,HMMPfam_Y_phosphatase		0.408	PTPRJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRJ	protein_coding	OTTHUMT00000390525.1	T			48142630	+1	no_errors	NM_002843	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
FAM186B	84070	genome.wustl.edu	37	12	49994734	49994734	+	Missense_Mutation	SNP	A	A	T			TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chr12:49994734A>T	ENST00000257894.2	-	4	850	c.689T>A	c.(688-690)gTc>gAc	p.V230D	FAM186B_ENST00000551047.1_Intron|FAM186B_ENST00000544141.1_Missense_Mutation_p.V140D|PRPF40B_ENST00000508736.1_3'UTR	NM_032130.2	NP_115506.1	Q8IYM0	F186B_HUMAN	family with sequence similarity 186, member B	230						protein complex (GO:0043234)				breast(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						GATGGCCCTGACCTCCCCCTT	0.567																																																0			12											124.0	93.0	104.0					12																	49994734		2203	4300	6503	48281001	SO:0001583	missense	84070			AL136748	CCDS8788.1	12q13.12	2008-09-17	2008-09-17	2008-09-17	ENSG00000135436	ENSG00000135436			25296	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 25"""	C12orf25		11230166	Standard	NM_032130		Approved	DKFZP434J0113	uc001ruo.3	Q8IYM0	OTTHUMG00000167427	ENST00000257894.2:c.689T>A	12.37:g.49994734A>T	ENSP00000257894:p.Val230Asp		48281001	B4DZ15|Q8TCP7|Q9H0L3	Missense_Mutation	SNP	NULL	p.V230D	ENST00000257894.2	37	c.689	CCDS8788.1	12	.	.	.	.	.	.	.	.	.	.	A	17.66	3.445042	0.63178	.	.	ENSG00000135436	ENST00000544141;ENST00000257894	T;T	0.16457	2.34;2.55	5.11	1.5	0.22942	.	0.545794	0.15447	N	0.261900	T	0.25791	0.0628	L	0.43923	1.385	0.45261	D	0.998266	D;D	0.71674	0.997;0.998	D;D	0.65010	0.931;0.925	T	0.02275	-1.1184	9	.	.	.	-6.9084	6.6854	0.23142	0.7162:0.0:0.2838:0.0	.	140;230	B4DZ15;Q8IYM0	.;F186B_HUMAN	D	140;230	ENSP00000438569:V140D;ENSP00000257894:V230D	.	V	-	2	0	FAM186B	48281001	0.952000	0.32445	0.965000	0.40720	0.935000	0.57460	1.014000	0.29950	0.087000	0.17167	-0.263000	0.10527	GTC	-	NULL		0.567	FAM186B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM186B	protein_coding	OTTHUMT00000394583.2	A	NM_032130		48281001	-1	no_errors	NM_032130	genbank	human	predicted	54_36p	missense	SNP	0.271	T
CACNA1F	778	genome.wustl.edu	37	X	49075818	49075818	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chrX:49075818C>T	ENST00000376265.2	-	21	2729	c.2668G>A	c.(2668-2670)Gct>Act	p.A890T	CACNA1F_ENST00000480889.1_5'Flank|CACNA1F_ENST00000323022.5_Missense_Mutation_p.A879T|CACNA1F_ENST00000376251.1_Missense_Mutation_p.A825T	NM_005183.2	NP_005174.2	O60840	CAC1F_HUMAN	calcium channel, voltage-dependent, L type, alpha 1F subunit	890					axonogenesis (GO:0007409)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|dendrite morphogenesis (GO:0048813)|detection of light stimulus involved in visual perception (GO:0050908)|membrane depolarization during action potential (GO:0086010)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|perikaryon (GO:0043204)|photoreceptor outer segment (GO:0001750)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			autonomic_ganglia(1)|breast(8)|central_nervous_system(3)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(24)|ovary(5)|prostate(3)|skin(4)|urinary_tract(1)	85					Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Nimodipine(DB00393)|Spironolactone(DB00421)|Verapamil(DB00661)	GGGTCCTCAGCGGCCAGGGAC	0.597													c|||	1	0.000264901	0.0	0.0014	3775	,	,		14672	0.0		0.0	False		,,,				2504	0.0															0			X											74.0	60.0	65.0					X																	49075818		2203	4300	6503	48962762	SO:0001583	missense	778			AA019975	CCDS35253.1, CCDS59166.1, CCDS59167.1	Xp11.23	2013-01-23	2007-02-16		ENSG00000102001	ENSG00000102001		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1393	protein-coding gene	gene with protein product		300110	"""Aland island eye disease (Forsius-Eriksson ocular albinism, ocular albinism type 2)"""	CSNB2, AIED		9344658, 9662400, 16382099, 12111638, 17525176	Standard	NM_005183		Approved	Cav1.4, JM8, JMC8, CSNBX2, CORDX3, CSNB2A, OA2	uc010nip.3	O60840	OTTHUMG00000022703	ENST00000376265.2:c.2668G>A	X.37:g.49075818C>T	ENSP00000365441:p.Ala890Thr		48962762	A6NI29|F5CIQ9|O43901|O95226|Q9UHB1	Missense_Mutation	SNP	superfamily_Voltage-gated potassium channels,HMMPfam_Ion_trans,HMMPfam_Ca_chan_IQ	p.A890T	ENST00000376265.2	37	c.2668	CCDS35253.1	X	.	.	.	.	.	.	.	.	.	.	.	21.6	4.172312	0.78452	.	.	ENSG00000102001	ENST00000376251;ENST00000323022;ENST00000376265	D;D;D	0.97505	-4.41;-4.41;-4.41	4.95	4.95	0.65309	.	0.347783	0.32459	N	0.006071	D	0.98466	0.9489	M	0.84773	2.715	0.58432	D	0.999997	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.97	D	0.99675	1.0997	10	0.87932	D	0	.	15.9731	0.80036	0.0:1.0:0.0:0.0	.	879;890	F5CIQ9;O60840	.;CAC1F_HUMAN	T	825;879;890	ENSP00000365427:A825T;ENSP00000321618:A879T;ENSP00000365441:A890T	ENSP00000321618:A879T	A	-	1	0	CACNA1F	48962762	1.000000	0.71417	0.946000	0.38457	0.331000	0.28603	5.901000	0.69861	2.286000	0.76751	0.500000	0.49745	GCT	-	superfamily_Voltage-gated potassium channels		0.597	CACNA1F-007	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNA1F	protein_coding	OTTHUMT00000358157.1	C	NM_005183		48962762	-1	no_errors	NM_005183	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
SHROOM4	57477	genome.wustl.edu	37	X	50381261	50381261	+	Missense_Mutation	SNP	A	A	T			TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chrX:50381261A>T	ENST00000289292.7	-	3	600	c.317T>A	c.(316-318)cTg>cAg	p.L106Q	SHROOM4_ENST00000460112.3_5'UTR|SHROOM4_ENST00000376020.2_Missense_Mutation_p.L106Q			Q9ULL8	SHRM4_HUMAN	shroom family member 4	106					actin cytoskeleton organization (GO:0030036)|actin filament organization (GO:0007015)|brain development (GO:0007420)|cognition (GO:0050890)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|myosin II complex (GO:0016460)|stress fiber (GO:0001725)	actin filament binding (GO:0051015)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(5)|large_intestine(6)|liver(1)|lung(20)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	52	Ovarian(276;0.236)					TCCCTCCAGCAGCTTGGCCAC	0.562																																																0			X											90.0	58.0	69.0					X																	50381261		2203	4300	6503	50398001	SO:0001583	missense	57477			AB033028	CCDS35277.1	Xp11.22	2008-02-05			ENSG00000158352	ENSG00000158352			29215	protein-coding gene	gene with protein product		300579				10574462, 16615870	Standard	NR_027121		Approved	KIAA1202	uc004dpe.2	Q9ULL8	OTTHUMG00000021521	ENST00000289292.7:c.317T>A	X.37:g.50381261A>T	ENSP00000289292:p.Leu106Gln		50398001	A7E2X9|D6RFW0|Q96LA0	Missense_Mutation	SNP	superfamily_PDZ domain-like,HMMSmart_SM00228,HMMPfam_ASD1,HMMPfam_ASD2	p.L106Q	ENST00000289292.7	37	c.317	CCDS35277.1	X	.	.	.	.	.	.	.	.	.	.	A	13.31	2.200488	0.38905	.	.	ENSG00000158352	ENST00000289292;ENST00000376020	T;T	0.13196	2.61;2.61	5.17	4.01	0.46588	.	0.105878	0.40144	N	0.001171	T	0.29223	0.0727	M	0.66939	2.045	0.42420	D	0.992635	D	0.64830	0.994	P	0.61397	0.888	T	0.01488	-1.1342	10	0.72032	D	0.01	.	9.1876	0.37180	0.911:0.0:0.089:0.0	.	106	Q9ULL8	SHRM4_HUMAN	Q	106	ENSP00000289292:L106Q;ENSP00000365188:L106Q	ENSP00000289292:L106Q	L	-	2	0	SHROOM4	50398001	1.000000	0.71417	0.998000	0.56505	0.816000	0.46133	5.562000	0.67346	0.629000	0.30376	-0.314000	0.08810	CTG	-	NULL		0.562	SHROOM4-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	SHROOM4	protein_coding	OTTHUMT00000056564.4	A	NM_020717		50398001	-1	no_errors	NM_020717	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
KRT2	3849	genome.wustl.edu	37	12	53039212	53039212	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chr12:53039212G>T	ENST00000309680.3	-	9	1532	c.1511C>A	c.(1510-1512)aCa>aAa	p.T504K		NM_000423.2	NP_000414.2	P35908	K22E_HUMAN	keratin 2	504	Tail.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte activation (GO:0032980)|keratinocyte migration (GO:0051546)|keratinocyte proliferation (GO:0043616)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(18)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	32				BRCA - Breast invasive adenocarcinoma(357;0.19)		GGTGCTGCTTGTCACAGCTGC	0.547																																																0			12											152.0	137.0	142.0					12																	53039212		2203	4300	6503	51325479	SO:0001583	missense	3849				CCDS8835.1	12q13.13	2013-01-16	2008-08-01	2006-07-17	ENSG00000172867	ENSG00000172867		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6439	protein-coding gene	gene with protein product	"""epidermal ichthyosis bullosa of Siemens"""	600194	"""keratin 2A (epidermal ichthyosis bullosa of Siemens)"""	KRT2A		7524919, 16831889	Standard	NM_000423		Approved	KRTE	uc001sat.3	P35908	OTTHUMG00000169748	ENST00000309680.3:c.1511C>A	12.37:g.53039212G>T	ENSP00000310861:p.Thr504Lys		51325479	Q4VAQ2	Missense_Mutation	SNP	HMMPfam_Filament,PatternScan_IF	p.T504K	ENST00000309680.3	37	c.1511	CCDS8835.1	12	.	.	.	.	.	.	.	.	.	.	G	14.46	2.541872	0.45280	.	.	ENSG00000172867	ENST00000309680	D	0.90788	-2.73	4.59	2.62	0.31277	.	.	.	.	.	T	0.75273	0.3827	N	0.08118	0	0.31133	N	0.707542	P	0.44877	0.845	B	0.36719	0.231	T	0.74365	-0.3689	9	0.44086	T	0.13	.	3.8713	0.09038	0.2027:0.2142:0.5831:0.0	.	504	P35908	K22E_HUMAN	K	504	ENSP00000310861:T504K	ENSP00000310861:T504K	T	-	2	0	KRT2	51325479	0.622000	0.27085	0.999000	0.59377	0.955000	0.61496	0.591000	0.23969	2.281000	0.76405	0.561000	0.74099	ACA	-	NULL		0.547	KRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT2	protein_coding	OTTHUMT00000405704.1	G	NM_000423		51325479	-1	no_errors	NM_000423	genbank	human	reviewed	54_36p	missense	SNP	0.702	T
CCDC70	83446	genome.wustl.edu	37	13	52439768	52439768	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chr13:52439768G>A	ENST00000242819.4	+	2	550	c.254G>A	c.(253-255)gGt>gAt	p.G85D		NM_031290.2	NP_112580.2	Q6NSX1	CCD70_HUMAN	coiled-coil domain containing 70	85						extracellular region (GO:0005576)|plasma membrane (GO:0005886)				breast(1)|large_intestine(4)|lung(7)|skin(2)|urinary_tract(1)	15		Breast(56;0.000207)|Lung NSC(96;0.00145)|Prostate(109;0.0107)|Hepatocellular(98;0.065)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;2.4e-08)		CAGATCCTGGGTTTTTGGGAA	0.463																																																0			13											51.0	60.0	57.0					13																	52439768		2198	4296	6494	51337769	SO:0001583	missense	83446				CCDS9431.1	13q14.3	2006-02-07			ENSG00000123171	ENSG00000123171			25303	protein-coding gene	gene with protein product						11230166	Standard	NM_031290		Approved	DKFZP434K1172, FLJ25853	uc001vfu.4	Q6NSX1	OTTHUMG00000016950	ENST00000242819.4:c.254G>A	13.37:g.52439768G>A	ENSP00000242819:p.Gly85Asp		51337769	Q8N7A8|Q9H097	Missense_Mutation	SNP	NULL	p.G85D	ENST00000242819.4	37	c.254	CCDS9431.1	13	.	.	.	.	.	.	.	.	.	.	G	0.997	-0.692038	0.03303	.	.	ENSG00000123171	ENST00000242819	T	0.30714	1.52	5.31	-1.1	0.09872	.	0.370017	0.23389	N	0.048705	T	0.21062	0.0507	M	0.68317	2.08	0.09310	N	1	B	0.10296	0.003	B	0.09377	0.004	T	0.16571	-1.0398	10	0.18710	T	0.47	-16.6601	1.1714	0.01826	0.315:0.2517:0.3048:0.1286	.	85	Q6NSX1	CCD70_HUMAN	D	85	ENSP00000242819:G85D	ENSP00000242819:G85D	G	+	2	0	CCDC70	51337769	0.989000	0.36119	0.049000	0.19019	0.013000	0.08279	1.478000	0.35442	-0.026000	0.13895	-0.253000	0.11424	GGT	-	NULL		0.463	CCDC70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC70	protein_coding	OTTHUMT00000045033.2	G	NM_031290		51337769	+1	no_errors	NM_031290	genbank	human	validated	54_36p	missense	SNP	0.070	A
PSME4	23198	genome.wustl.edu	37	2	54164553	54164553	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chr2:54164553G>C	ENST00000404125.1	-	5	725	c.670C>G	c.(670-672)Cca>Gca	p.P224A	PSME4_ENST00000421748.2_Intron	NM_014614.2	NP_055429.2	Q14997	PSME4_HUMAN	proteasome (prosome, macropain) activator subunit 4	224					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|spermatogenesis, exchange of chromosomal proteins (GO:0035093)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)|spermatoproteasome complex (GO:1990111)	lysine-acetylated histone binding (GO:0070577)|peptidase activator activity (GO:0016504)			breast(5)|endometrium(8)|kidney(1)|large_intestine(11)|lung(26)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(2)	60			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			TGAAGTTCTGGAGGAAGGGAG	0.333																																																0			2											99.0	106.0	103.0					2																	54164553		2203	4300	6503	54018057	SO:0001583	missense	23198			D38521	CCDS33197.2	2p16.1	2003-04-14			ENSG00000068878	ENSG00000068878		"""Proteasome (prosome, macropain) subunits"""	20635	protein-coding gene	gene with protein product		607705				7584044, 12093752	Standard	NM_014614		Approved	PA200, KIAA0077	uc002rxp.2	Q14997	OTTHUMG00000151852	ENST00000404125.1:c.670C>G	2.37:g.54164553G>C	ENSP00000384211:p.Pro224Ala		54018057	Q1XBG4|Q1XBG5|Q1XBG6|Q2M1Z0|Q6IPR2|Q86XF8	Missense_Mutation	SNP	superfamily_ARM repeat,HMMPfam_HEAT	p.P110A	ENST00000404125.1	37	c.328	CCDS33197.2	2	.	.	.	.	.	.	.	.	.	.	G	20.8	4.047107	0.75846	.	.	ENSG00000068878	ENST00000404125	T	0.26373	1.74	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	T	0.47783	0.1464	M	0.66939	2.045	0.80722	D	1	D	0.89917	1.0	D	0.70227	0.968	T	0.25676	-1.0125	10	0.10902	T	0.67	.	19.6495	0.95795	0.0:0.0:1.0:0.0	.	224	Q14997	PSME4_HUMAN	A	224	ENSP00000384211:P224A	ENSP00000374643:P224A	P	-	1	0	PSME4	54018057	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.813000	0.99286	2.717000	0.92951	0.585000	0.79938	CCA	-	NULL		0.333	PSME4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSME4	protein_coding	OTTHUMT00000324163.1	G	XM_040158		54018057	-1	no_errors	NM_014614	genbank	human	validated	54_36p	missense	SNP	1.000	C
HMGB1P1	10357	genome.wustl.edu	37	20	56064013	56064013	+	IGR	SNP	C	C	G	rs376324037	byFrequency	TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chr20:56064013C>G								RBM38 (79624 upstream) : CTCFL (7021 downstream)														p.R24L(1)									ATGCTCCTCCCGACAAGTTTG	0.428																																																1	Substitution - Missense(1)	lung(1)	20											115.0	116.0	115.0					20																	56064013		2203	4299	6502	55497419	SO:0001628	intergenic_variant	10357																															20.37:g.56064013C>G			55497419		Missense_Mutation	SNP	PatternScan_HMG_BOX_1,superfamily_HMG-box,HMMPfam_HMG_box,HMMSmart_HMG	p.R24P		37	c.71		20																																																																																			-	superfamily_HMG-box,HMMPfam_HMG_box,HMMSmart_HMG	0	0.428					HMGB1L1			C			55497419	-1	no_errors	NM_001008735	genbank	human	provisional	54_36p	missense	SNP	1.000	G
KIF5A	3798	genome.wustl.edu	37	12	57957265	57957265	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chr12:57957265C>T	ENST00000455537.2	+	2	447	c.173C>T	c.(172-174)aCt>aTt	p.T58I	KIF5A_ENST00000286452.5_Intron	NM_004984.2	NP_004975.2	Q12840	KIF5A_HUMAN	kinesin family member 5A	58	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|protein localization (GO:0008104)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)			breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|liver(1)|lung(32)|ovary(2)|prostate(2)|skin(2)	62						CCAAACACGACTCAAGAGCAA	0.423																																																0			12											106.0	95.0	98.0					12																	57957265		2203	4300	6503	56243532	SO:0001583	missense	3798			U06698	CCDS8945.1	12q13.13	2011-07-15	2004-02-13			ENSG00000155980		"""Kinesins"""	6323	protein-coding gene	gene with protein product		602821	"""spastic paraplegia 10 (autosomal dominant)"""	SPG10		9858832, 10441583, 16489470	Standard	NM_004984		Approved	D12S1889, NKHC, MY050	uc001sor.1	Q12840	OTTHUMG00000170143	ENST00000455537.2:c.173C>T	12.37:g.57957265C>T	ENSP00000408979:p.Thr58Ile		56243532	A6H8M5|Q4LE26	Missense_Mutation	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00129,HMMPfam_Kinesin,PatternScan_KINESIN_MOTOR_DOMAIN1,superfamily_Prefoldin	p.T58I	ENST00000455537.2	37	c.173	CCDS8945.1	12	.	.	.	.	.	.	.	.	.	.	C	22.0	4.228429	0.79576	.	.	ENSG00000155980	ENST00000455537	T	0.74737	-0.87	4.59	4.59	0.56863	Kinesin, motor domain (4);	0.000000	0.85682	D	0.000000	D	0.90696	0.7081	H	0.96604	3.85	0.80722	D	1	D	0.54772	0.968	D	0.70227	0.968	D	0.93256	0.6639	10	0.72032	D	0.01	.	17.3911	0.87431	0.0:1.0:0.0:0.0	.	58	Q12840	KIF5A_HUMAN	I	58	ENSP00000408979:T58I	ENSP00000408979:T58I	T	+	2	0	KIF5A	56243532	0.996000	0.38824	1.000000	0.80357	0.964000	0.63967	3.580000	0.53907	2.835000	0.97688	0.650000	0.86243	ACT	-	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00129,HMMPfam_Kinesin		0.423	KIF5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF5A	protein_coding	OTTHUMT00000407634.1	C	NM_004984		56243532	+1	no_errors	NM_004984	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
DTX3	196403	genome.wustl.edu	37	12	58000985	58000985	+	Silent	SNP	G	G	A			TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chr12:58000985G>A	ENST00000548198.1	+	3	1843	c.339G>A	c.(337-339)gaG>gaA	p.E113E	DTX3_ENST00000548804.1_Silent_p.E113E|DTX3_ENST00000551632.1_Silent_p.E116E|ARHGEF25_ENST00000333972.7_5'Flank|DTX3_ENST00000337737.3_Silent_p.E113E			Q8N9I9	DTX3_HUMAN	deltex 3, E3 ubiquitin ligase	113					Notch signaling pathway (GO:0007219)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|large_intestine(1)|lung(6)|urinary_tract(1)	12	Melanoma(17;0.122)					GTGGAGGGGAGCACCCTGAGA	0.687																																																0			12											21.0	24.0	23.0					12																	58000985		1900	4107	6007	56287252	SO:0001819	synonymous_variant	196403			AK094385	CCDS41800.1, CCDS66410.1	12q13.2	2014-01-28	2014-01-28			ENSG00000178498		"""RING-type (C3HC4) zinc fingers"""	24457	protein-coding gene	gene with protein product		613142	"""deltex 3 homolog (Drosophila)"", ""deltex homolog 3 (Drosophila)"""			12670957	Standard	XM_005268697		Approved	FLJ34766, RNF154	uc001sow.1	Q8N9I9		ENST00000548198.1:c.339G>A	12.37:g.58000985G>A			56287252	Q53ZZ2|Q8NAU6|Q8NDS8	Silent	SNP	superfamily_RING/U-box,HMMSmart_SM00184,HMMPfam_zf-C3HC4,PatternScan_ZF_RING_1	p.E113	ENST00000548198.1	37	c.339	CCDS41800.1	12																																																																																			-	NULL		0.687	DTX3-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	DTX3	protein_coding	OTTHUMT00000407848.1	G	NM_178502		56287252	+1	no_errors	NM_178502	genbank	human	provisional	54_36p	silent	SNP	0.997	A
DST	667	genome.wustl.edu	37	6	56472966	56472966	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chr6:56472966C>G	ENST00000361203.3	-	36	5834	c.5827G>C	c.(5827-5829)Gaa>Caa	p.E1943Q	DST_ENST00000312431.6_Missense_Mutation_p.E1943Q|DST_ENST00000446842.2_Missense_Mutation_p.E1617Q|DST_ENST00000370754.5_Missense_Mutation_p.E2121Q|DST_ENST00000421834.2_Intron|DST_ENST00000244364.6_Intron|DST_ENST00000370769.4_Missense_Mutation_p.E1943Q|DST_ENST00000370788.2_Intron			Q03001	DYST_HUMAN	dystonin	1943					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			TTACAAGCTTCTAAATCTCCT	0.348																																																0			6											73.0	74.0	73.0					6																	56472966		1804	4064	5868	56580925	SO:0001583	missense	667			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.5827G>C	6.37:g.56472966C>G	ENSP00000354508:p.Glu1943Gln		56580925	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	HMMSmart_SM00150,superfamily_Spectrin repeat,HMMPfam_Spectrin,superfamily_Plakin repeat,HMMSmart_SM00250,HMMPfam_Plectin,PatternScan_RIBOSOMAL_L23	p.E1617Q	ENST00000361203.3	37	c.4849		6	.	.	.	.	.	.	.	.	.	.	C	11.91	1.780701	0.31502	.	.	ENSG00000151914	ENST00000370754;ENST00000370769;ENST00000446842;ENST00000312431;ENST00000361203;ENST00000439203	T;T;T;D;T;T	0.82893	-0.17;-0.17;0.79;-1.66;-0.19;-0.48	5.39	5.39	0.77823	.	0.234543	0.29616	N	0.011646	T	0.71584	0.3357	.	.	.	0.30798	N	0.740163	B	0.31125	0.309	B	0.30251	0.113	T	0.76454	-0.2953	8	0.66056	D	0.02	.	15.5005	0.75695	0.0:0.8612:0.1388:0.0	.	1617	Q03001-9	.	Q	2121;1943;1617;1943;1943;1617	ENSP00000359790:E2121Q;ENSP00000359805:E1943Q;ENSP00000393645:E1617Q;ENSP00000307959:E1943Q;ENSP00000354508:E1943Q;ENSP00000404924:E1617Q	ENSP00000307959:E1943Q	E	-	1	0	DST	56580925	0.996000	0.38824	0.999000	0.59377	0.817000	0.46193	1.632000	0.37102	2.685000	0.91497	0.557000	0.71058	GAA	-	NULL		0.348	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	DST	protein_coding	OTTHUMT00000041021.3	C	NM_001723		56580925	-1	no_errors	NM_020388	genbank	human	reviewed	54_36p	missense	SNP	0.961	G
MTG2	26164	genome.wustl.edu	37	20	60775755	60775755	+	Silent	SNP	C	C	T			TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chr20:60775755C>T	ENST00000370823.3	+	7	861	c.843C>T	c.(841-843)ggC>ggT	p.G281G	MTG2_ENST00000436421.2_Silent_p.G123G|MTG2_ENST00000536470.1_Silent_p.G53G	NM_015666.3	NP_056481.1	Q9H4K7	MTG2_HUMAN	mitochondrial ribosome-associated GTPase 2	281	Localized in the mitochondria.|Not localized in the mitochondria.|OBG-type G.				GTP catabolic process (GO:0006184)|regulation of mitochondrial translation (GO:0070129)|regulation of respiratory system process (GO:0044065)|ribosome biogenesis (GO:0042254)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial ribosome (GO:0005761)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|magnesium ion binding (GO:0000287)										ACATCCCCGGCATCATACGAG	0.632																																																0			20											61.0	66.0	65.0					20																	60775755		2203	4299	6502	60209150	SO:0001819	synonymous_variant	26164			AK001603	CCDS13492.1	20q13.33	2013-05-24	2013-05-24	2013-05-24	ENSG00000101181	ENSG00000101181			16239	protein-coding gene	gene with protein product		610919	"""GTP-binding protein 5 (putative)"", ""GTP binding protein 5 (putative)"""	GTPBP5		17054726, 23396448	Standard	NM_015666		Approved	FLJ10741, dJ1005F21.2, ObgH1		Q9H4K7	OTTHUMG00000032897	ENST00000370823.3:c.843C>T	20.37:g.60775755C>T			60209150	A6NDR3|B4DR85|Q96I17|Q9NVG9|Q9UFR4	Silent	SNP	superfamily_GTP1_OBG_sub,HMMPfam_GTP1_OBG,HMMPfam_MMR_HSR1,superfamily_SSF52540	p.G281	ENST00000370823.3	37	c.843	CCDS13492.1	20																																																																																			-	HMMPfam_MMR_HSR1,superfamily_SSF52540		0.632	MTG2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	GTPBP5	protein_coding	OTTHUMT00000079989.1	C	NM_015666		60209150	+1	no_errors	NM_015666	genbank	human	validated	54_36p	silent	SNP	0.137	T
RGS9	8787	genome.wustl.edu	37	17	63206701	63206701	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chr17:63206701C>A	ENST00000262406.9	+	17	1452	c.1385C>A	c.(1384-1386)gCc>gAc	p.A462D	RGS9_ENST00000449996.3_Missense_Mutation_p.A459D|RGS9_ENST00000443584.3_Missense_Mutation_p.A459D	NM_003835.3	NP_003826.2	O75916	RGS9_HUMAN	regulator of G-protein signaling 9	462					dopamine receptor signaling pathway (GO:0007212)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|response to estrogen (GO:0043627)|rhodopsin mediated signaling pathway (GO:0016056)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|heterotrimeric G-protein complex (GO:0005834)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|signal transducer activity (GO:0004871)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(8)|liver(2)|lung(12)|ovary(2)|prostate(3)|skin(3)	41						CGAGAAGCAGCCAACACTGTG	0.577																																																0			17											64.0	70.0	68.0					17																	63206701		2045	4202	6247	60637163	SO:0001583	missense	8787			AF071476	CCDS42373.1, CCDS45764.1	17q24	2008-07-18	2007-08-14			ENSG00000108370		"""Regulators of G-protein signaling"""	10004	protein-coding gene	gene with protein product	"""regulator of G protein signalling 9"", ""regulator of G protein signalling 9L"", ""regulator of G-protein signaling 9L"""	604067	"""regulator of G-protein signalling 9"""			9765512	Standard	NM_003835		Approved	PERRS, RGS9L, MGC26458, MGC111763	uc002jfe.3	O75916		ENST00000262406.9:c.1385C>A	17.37:g.63206701C>A	ENSP00000262406:p.Ala462Asp		60637163	A8K3C0|O75573|Q696R2|Q8TD64|Q8TD65|Q9HC32|Q9HC33	Missense_Mutation	SNP	"superfamily_""Winged helix"" DNA-binding domain,HMMSmart_SM00049,HMMPfam_DEP,superfamily_Transducin (heterotrimeric G protein) gamma chain,HMMPfam_G-gamma,HMMSmart_SM00224,superfamily_Regulator of G-protein signaling RGS,HMMPfam_RGS,HMMSmart_SM00315"	p.A462D	ENST00000262406.9	37	c.1385	CCDS42373.1	17	.	.	.	.	.	.	.	.	.	.	C	12.33	1.906290	0.33628	.	.	ENSG00000108370	ENST00000262406;ENST00000449996	T;T	0.44083	0.98;0.93	5.16	5.16	0.70880	.	0.000000	0.85682	D	0.000000	T	0.62307	0.2417	L	0.53249	1.67	0.51482	D	0.999928	P;D;D	0.89917	0.931;1.0;1.0	P;D;D	0.91635	0.522;0.998;0.999	T	0.64317	-0.6436	10	0.72032	D	0.01	.	19.013	0.92881	0.0:1.0:0.0:0.0	.	462;462;459	A8K1G1;O75916;O75916-5	.;RGS9_HUMAN;.	D	462;459	ENSP00000262406:A462D;ENSP00000396329:A459D	ENSP00000262406:A462D	A	+	2	0	RGS9	60637163	1.000000	0.71417	0.998000	0.56505	0.599000	0.36880	4.299000	0.59073	2.571000	0.86741	0.655000	0.94253	GCC	-	NULL		0.577	RGS9-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RGS9	protein_coding	OTTHUMT00000445885.1	C	NM_003835		60637163	+1	no_errors	NM_003835	genbank	human	validated	54_36p	missense	SNP	1.000	A
ZSCAN5B	342933	genome.wustl.edu	37	19	56704331	56704331	+	Missense_Mutation	SNP	T	T	A			TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chr19:56704331T>A	ENST00000586855.2	-	2	404	c.91A>T	c.(91-93)Act>Tct	p.T31S	ZSCAN5B_ENST00000358992.3_Missense_Mutation_p.T31S			A6NJL1	ZSA5B_HUMAN	zinc finger and SCAN domain containing 5B	31					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|endometrium(5)|large_intestine(3)|lung(23)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37						CCAAGTTGAGTTTCTGGGGAC	0.552																																																0			19											66.0	57.0	60.0					19																	56704331		692	1591	2283	61396143	SO:0001583	missense	342933				CCDS46203.1	19q13.42	2013-01-08			ENSG00000197213	ENSG00000197213		"""-"", ""Zinc fingers, C2H2-type"""	34246	protein-coding gene	gene with protein product							Standard	NM_001080456		Approved	ZNF495B, ZNF371	uc010ygh.2	A6NJL1		ENST00000586855.2:c.91A>T	19.37:g.56704331T>A	ENSP00000466072:p.Thr31Ser		61396143		Missense_Mutation	SNP	HMMPfam_SCAN,HMMSmart_SCAN,superfamily_SSF57667,HMMPfam_zf-C2H2,HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1	p.T31S	ENST00000586855.2	37	c.91	CCDS46203.1	19	.	.	.	.	.	.	.	.	.	.	T	7.218	0.596759	0.13875	.	.	ENSG00000197213	ENST00000358992	T	0.05319	3.46	1.42	-1.12	0.09808	.	.	.	.	.	T	0.07954	0.0199	M	0.72118	2.19	0.09310	N	1	P	0.50443	0.935	P	0.45753	0.492	T	0.29882	-0.9997	9	0.12766	T	0.61	.	4.3711	0.11247	0.0:0.4391:0.0:0.5609	.	31	A6NJL1	ZSA5B_HUMAN	S	31	ENSP00000351883:T31S	ENSP00000351883:T31S	T	-	1	0	ZSCAN5B	61396143	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.158000	0.16422	-0.424000	0.07382	0.260000	0.18958	ACT	-	NULL		0.552	ZSCAN5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZSCAN5B	protein_coding	OTTHUMT00000457834.2	T	NM_001080456		61396143	-1	no_errors	ENST00000358992	ensembl	human	known	54_36p	missense	SNP	0.001	A
USP29	57663	genome.wustl.edu	37	19	57641014	57641014	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chr19:57641014C>G	ENST00000254181.4	+	4	1425	c.971C>G	c.(970-972)cCc>cGc	p.P324R	USP29_ENST00000598197.1_Missense_Mutation_p.P324R	NM_020903.2	NP_065954.1	Q9HBJ7	UBP29_HUMAN	ubiquitin specific peptidase 29	324	USP.				ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitin thiolesterase activity (GO:0004221)			breast(3)|endometrium(4)|kidney(3)|large_intestine(15)|lung(47)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	85		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		GAATATATTCCCTTTGAGGCT	0.383																																																0			19											89.0	89.0	89.0					19																	57641014		2203	4300	6503	62332826	SO:0001583	missense	57663				CCDS33124.1	19q13.4	2008-06-23	2005-08-08			ENSG00000131864		"""Ubiquitin-specific peptidases"""	18563	protein-coding gene	gene with protein product		609546	"""ubiquitin specific protease 29"""			12838346	Standard	NM_020903		Approved		uc002qny.3	Q9HBJ7		ENST00000254181.4:c.971C>G	19.37:g.57641014C>G	ENSP00000254181:p.Pro324Arg		62332826		Missense_Mutation	SNP	superfamily_SSF54001,HMMPfam_UCH,PatternScan_UCH_2_1,PatternScan_UCH_2_2	p.P324R	ENST00000254181.4	37	c.971	CCDS33124.1	19	.	.	.	.	.	.	.	.	.	.	C	14.35	2.510584	0.44660	.	.	ENSG00000131864	ENST00000254181	T	0.29397	1.57	2.68	2.68	0.31781	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.116792	0.29699	U	0.011438	T	0.46580	0.1400	L	0.56340	1.77	0.09310	N	1	D	0.89917	1.0	D	0.80764	0.994	T	0.16335	-1.0406	10	0.51188	T	0.08	-2.6709	11.5289	0.50597	0.0:1.0:0.0:0.0	.	324	Q9HBJ7	UBP29_HUMAN	R	324	ENSP00000254181:P324R	ENSP00000254181:P324R	P	+	2	0	USP29	62332826	0.957000	0.32711	0.010000	0.14722	0.015000	0.08874	4.441000	0.59981	1.767000	0.52121	0.655000	0.94253	CCC	-	superfamily_SSF54001,HMMPfam_UCH		0.383	USP29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP29	protein_coding	OTTHUMT00000465075.1	C			62332826	+1	no_errors	NM_020903	genbank	human	validated	54_36p	missense	SNP	0.209	G
ZSCAN22	342945	genome.wustl.edu	37	19	58849914	58849914	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chr19:58849914G>T	ENST00000329665.4	+	3	845	c.698G>T	c.(697-699)tGg>tTg	p.W233L		NM_181846.2	NP_862829.1	P10073	ZSC22_HUMAN	zinc finger and SCAN domain containing 22	233					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|pancreas(1)|prostate(2)	16		all_cancers(17;3.11e-12)|all_epithelial(17;9.43e-09)|Colorectal(82;0.000256)|Lung NSC(17;0.000607)|all_lung(17;0.0024)|all_neural(62;0.0412)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0289)		TCTAGTGCGTGGCCAAACCTC	0.522																																																0			19											166.0	175.0	172.0					19																	58849914		2203	4300	6503	63541726	SO:0001583	missense	342945			M20675	CCDS12975.1	19q13.43	2013-01-08	2006-09-20	2006-09-20				"""-"", ""Zinc fingers, C2H2-type"""	4929	protein-coding gene	gene with protein product	"""oncogene HKR2"""	165260	"""zinc finger protein 50"", ""GLI-Kruppel family member HKR2"""	ZNF50, HKR2		2850480, 1505991	Standard	NM_181846		Approved		uc002qsc.2	P10073		ENST00000329665.4:c.698G>T	19.37:g.58849914G>T	ENSP00000332433:p.Trp233Leu		63541726	Q15922|Q7Z3L8	Missense_Mutation	SNP	HMMPfam_SCAN,HMMSmart_SCAN,HMMPfam_zf-C2H2,HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1,superfamily_SSF57667	p.W233L	ENST00000329665.4	37	c.698	CCDS12975.1	19	.	.	.	.	.	.	.	.	.	.	G	2.698	-0.271623	0.05716	.	.	ENSG00000182318	ENST00000329665	T	0.06933	3.24	4.02	1.69	0.24217	.	.	.	.	.	T	0.04272	0.0118	N	0.24115	0.695	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.45948	-0.9226	9	0.10111	T	0.7	.	2.5747	0.04803	0.2219:0.0:0.5224:0.2558	.	233	P10073	ZSC22_HUMAN	L	233	ENSP00000332433:W233L	ENSP00000332433:W233L	W	+	2	0	ZSCAN22	63541726	0.024000	0.19004	0.085000	0.20634	0.142000	0.21351	1.767000	0.38501	0.876000	0.35872	0.313000	0.20887	TGG	-	NULL		0.522	ZSCAN22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZSCAN22	protein_coding	OTTHUMT00000466765.1	G	NM_181846		63541726	+1	no_errors	NM_181846	genbank	human	validated	54_36p	missense	SNP	0.001	T
SPRED2	200734	genome.wustl.edu	37	2	65559137	65559137	+	Missense_Mutation	SNP	T	T	C			TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chr2:65559137T>C	ENST00000356388.4	-	4	611	c.422A>G	c.(421-423)gAt>gGt	p.D141G	SPRED2_ENST00000443619.2_Missense_Mutation_p.D138G|SPRED2_ENST00000474228.1_5'UTR	NM_181784.2	NP_861449.2	Q7Z698	SPRE2_HUMAN	sprouty-related, EVH1 domain containing 2	141					inactivation of MAPK activity (GO:0000188)|multicellular organismal development (GO:0007275)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|regulation of protein deacetylation (GO:0090311)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein serine/threonine kinase inhibitor activity (GO:0030291)|stem cell factor receptor binding (GO:0005173)			breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(11)|lung(7)|ovary(2)|upper_aerodigestive_tract(3)	34						AACGTCATCATCGCCAAGCTC	0.363																																																0			2											103.0	95.0	98.0					2																	65559137		2203	4300	6503	65412641	SO:0001583	missense	200734			AF052178	CCDS33211.1, CCDS46308.1	2p14	2003-06-02			ENSG00000198369	ENSG00000198369			17722	protein-coding gene	gene with protein product		609292					Standard	NM_181784		Approved	Spred-2, FLJ21897, FLJ31917	uc002sdr.4	Q7Z698	OTTHUMG00000152737	ENST00000356388.4:c.422A>G	2.37:g.65559137T>C	ENSP00000348753:p.Asp141Gly		65412641	A1L3V4|B7Z5K7|D6W5F7|E9PEP0|Q2NKX6	Missense_Mutation	SNP	HMMPfam_WH1,HMMSmart_SM00461,superfamily_PH domain-like,HMMPfam_Sprouty	p.D141G	ENST00000356388.4	37	c.422	CCDS33211.1	2	.	.	.	.	.	.	.	.	.	.	T	24.0	4.482570	0.84747	.	.	ENSG00000198369	ENST00000356388;ENST00000443619;ENST00000452315;ENST00000421087	T;T;T;T	0.78481	-1.18;-1.18;-1.18;-0.24	6.17	6.17	0.99709	.	0.042841	0.85682	D	0.000000	T	0.81721	0.4882	M	0.78637	2.42	0.80722	D	1	B;P	0.43857	0.399;0.819	B;B	0.43889	0.104;0.435	D	0.84223	0.0462	10	0.72032	D	0.01	-25.4468	16.8222	0.85835	0.0:0.0:0.0:1.0	.	138;141	E9PEP0;Q7Z698	.;SPRE2_HUMAN	G	141;138;156;73	ENSP00000348753:D141G;ENSP00000393697:D138G;ENSP00000390595:D156G;ENSP00000407627:D73G	ENSP00000348753:D141G	D	-	2	0	SPRED2	65412641	1.000000	0.71417	0.996000	0.52242	0.886000	0.51366	7.218000	0.77991	2.371000	0.80710	0.533000	0.62120	GAT	-	NULL		0.363	SPRED2-001	KNOWN	basic|CCDS	protein_coding	SPRED2	protein_coding	OTTHUMT00000327632.1	T			65412641	-1	no_errors	NM_181784	genbank	human	validated	54_36p	missense	SNP	1.000	C
LMOD3	56203	genome.wustl.edu	37	3	69171391	69171391	+	Silent	SNP	G	G	C	rs184423475	byFrequency	TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chr3:69171391G>C	ENST00000420581.2	-	1	326	c.147C>G	c.(145-147)ccC>ccG	p.P49P	LMOD3_ENST00000489031.1_Silent_p.P49P|LMOD3_ENST00000475434.1_Silent_p.P49P	NM_198271.3	NP_938012.2	Q0VAK6	LMOD3_HUMAN	leiomodin 3 (fetal)	49						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(3)|ovary(1)	13		Lung NSC(201;0.0193)|Prostate(884;0.174)		BRCA - Breast invasive adenocarcinoma(55;7.88e-05)|Epithelial(33;0.000839)|LUSC - Lung squamous cell carcinoma(21;0.0119)|Lung(16;0.0191)|KIRC - Kidney renal clear cell carcinoma(39;0.205)|Kidney(39;0.24)		TCATTCCCACGGGAAGGCTGG	0.443																																																0			3											78.0	74.0	75.0					3																	69171391		1867	4107	5974	69254081	SO:0001819	synonymous_variant	56203			AK096900	CCDS46862.1	3p14.1	2003-03-07			ENSG00000163380	ENSG00000163380			6649	protein-coding gene	gene with protein product							Standard	NM_198271		Approved		uc003dns.2	Q0VAK6	OTTHUMG00000158774	ENST00000420581.2:c.147C>G	3.37:g.69171391G>C			69254081	B4DT85|Q0JTT2|Q5JPG6|Q8IUK4|Q96LS4	Silent	SNP	HMMPfam_Tropomodulin,superfamily_RNI-like,HMMPfam_WH2	p.P49	ENST00000420581.2	37	c.147	CCDS46862.1	3																																																																																			-	NULL		0.443	LMOD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LMOD3	protein_coding	OTTHUMT00000352138.1	G	XM_067529		69254081	-1	no_errors	NM_198271	genbank	human	validated	54_36p	silent	SNP	0.789	C
AP003498.1	0	genome.wustl.edu	37	11	71373434	71373434	+	RNA	SNP	C	C	A			TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chr11:71373434C>A	ENST00000408531.1	-	0	149																											GTTTTGCTAACAATGGCAGGG	0.468																																																0			11																																								71051082			0																															11.37:g.71373434C>A			71051082		RNA	SNP	-	NULL	ENST00000408531.1	37	NULL		11																																																																																			-	-		0.468	AP003498.1-201	NOVEL	basic	miRNA	LOC100132362	miRNA		C			71051082	-1	pseudogene	XR_042359	genbank	human	model	54_36p	rna	SNP	0.000	A
CABS1	85438	genome.wustl.edu	37	4	71201436	71201436	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chr4:71201436C>A	ENST00000273936.5	+	1	754	c.680C>A	c.(679-681)aCt>aAt	p.T227N		NM_033122.3	NP_149113.3	Q96KC9	CABS1_HUMAN	calcium-binding protein, spermatid-specific 1	227					spermatogenesis (GO:0007283)	mitochondrial inner membrane (GO:0005743)|motile cilium (GO:0031514)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(4)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						AGCTTCACTACTATTCCAGAC	0.443																																																0			4											87.0	92.0	90.0					4																	71201436		2203	4299	6502	71236025	SO:0001583	missense	85438			AF380838	CCDS3539.1	4q13.3	2013-10-11	2011-01-25	2011-01-25	ENSG00000145309	ENSG00000145309			30710	protein-coding gene	gene with protein product	"""casein-like phosphoprotein"""		"""chromosome 4 open reading frame 35"""	C4orf35		19208547, 19271754	Standard	NM_033122		Approved	NYD-SP26, FLJ32897, CLPH	uc003hff.3	Q96KC9	OTTHUMG00000129405	ENST00000273936.5:c.680C>A	4.37:g.71201436C>A	ENSP00000273936:p.Thr227Asn		71236025	B2RCB5|Q86UE0|Q96M17	Missense_Mutation	SNP	NULL	p.T227N	ENST00000273936.5	37	c.680	CCDS3539.1	4	.	.	.	.	.	.	.	.	.	.	C	12.04	1.817895	0.32145	.	.	ENSG00000145309	ENST00000273936	T	0.29142	1.58	4.57	2.83	0.33086	.	0.177484	0.27455	N	0.019292	T	0.33381	0.0861	L	0.29908	0.895	0.22435	N	0.999106	D	0.57571	0.98	P	0.60068	0.868	T	0.03662	-1.1015	10	0.62326	D	0.03	-46.7677	6.4544	0.21922	0.0:0.7853:0.0:0.2147	.	227	Q96KC9	CABS1_HUMAN	N	227	ENSP00000273936:T227N	ENSP00000273936:T227N	T	+	2	0	CABS1	71236025	0.017000	0.18338	0.302000	0.25058	0.037000	0.13140	0.920000	0.28705	1.284000	0.44531	0.655000	0.94253	ACT	-	NULL		0.443	CABS1-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	C4orf35	protein_coding	OTTHUMT00000251561.3	C	NM_033122		71236025	+1	no_errors	NM_033122	genbank	human	validated	54_36p	missense	SNP	0.971	A
CYP11A1	1583	genome.wustl.edu	37	15	74630410	74630410	+	Missense_Mutation	SNP	A	A	T			TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chr15:74630410A>T	ENST00000268053.6	-	9	1623	c.1469T>A	c.(1468-1470)cTc>cAc	p.L490H	CYP11A1_ENST00000419019.2_Missense_Mutation_p.L332H|CYP11A1_ENST00000358632.4_Missense_Mutation_p.L332H	NM_000781.2	NP_000772.2	P05108	CP11A_HUMAN	cytochrome P450, family 11, subfamily A, polypeptide 1	490					biphenyl metabolic process (GO:0018879)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to antibiotic (GO:0071236)|cellular response to cadmium ion (GO:0071276)|cellular response to cAMP (GO:0071320)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to peptide hormone stimulus (GO:0071375)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cellular response to tumor necrosis factor (GO:0071356)|cerebellum development (GO:0021549)|cholesterol metabolic process (GO:0008203)|dibenzo-p-dioxin metabolic process (GO:0018894)|estrogen biosynthetic process (GO:0006703)|fractalkine metabolic process (GO:0050756)|granulosa cell differentiation (GO:0060014)|hippocampus development (GO:0021766)|Leydig cell differentiation (GO:0033327)|maternal process involved in female pregnancy (GO:0060135)|mating behavior (GO:0007617)|phenol-containing compound metabolic process (GO:0018958)|phthalate metabolic process (GO:0018963)|progesterone biosynthetic process (GO:0006701)|response to alkaloid (GO:0043279)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to fungicide (GO:0060992)|response to gamma radiation (GO:0010332)|response to genistein (GO:0033595)|response to hydrogen peroxide (GO:0042542)|response to insecticide (GO:0017085)|response to L-ascorbic acid (GO:0033591)|response to salt stress (GO:0009651)|response to vitamin E (GO:0033197)|Schwann cell differentiation (GO:0014037)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|testosterone biosynthetic process (GO:0061370)|vitamin D metabolic process (GO:0042359)|xenobiotic metabolic process (GO:0006805)	mitochondrial crista (GO:0030061)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|perikaryon (GO:0043204)	cholesterol binding (GO:0015485)|cholesterol monooxygenase (side-chain-cleaving) activity (GO:0008386)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(3)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	20					Aminoglutethimide(DB00357)|Cholecalciferol(DB00169)|Clomifene(DB00882)|Clotrimazole(DB00257)|Dexamethasone(DB01234)|Digitoxin(DB01396)|Digoxin(DB00390)|Dinoprostone(DB00917)|Glutethimide(DB01437)|Ketoconazole(DB01026)|Omeprazole(DB00338)|Saquinavir(DB01232)|Terbinafine(DB00857)|Testosterone(DB00624)	CACATCGCTGAGGTGTTGGAT	0.522																																					Esophageal Squamous(87;818 1337 4093 9268 37314)											0			15											154.0	135.0	142.0					15																	74630410		2198	4297	6495	72417463	SO:0001583	missense	1583			AK056794	CCDS32291.1, CCDS45303.1	15q23-q24	2010-05-04	2003-01-14	2003-01-17	ENSG00000140459	ENSG00000140459	1.14.15.6	"""Cytochrome P450s"""	2590	protein-coding gene	gene with protein product	"""cholesterol monooxygenase (side-chain-cleaving)"""	118485	"""cytochrome P450, subfamily XIA (cholesterol side chain cleavage)"""	CYP11A			Standard	NM_000781		Approved	P450SCC	uc002axt.2	P05108	OTTHUMG00000150716	ENST00000268053.6:c.1469T>A	15.37:g.74630410A>T	ENSP00000268053:p.Leu490His		72417463	A8K8D5|B3KPU8|G3XAD7|Q15081|Q16805|Q8N1A7	Missense_Mutation	SNP	HMMPfam_p450,superfamily_Cytochrome P450,PatternScan_CYTOCHROME_P450	p.L490H	ENST00000268053.6	37	c.1469	CCDS32291.1	15	.	.	.	.	.	.	.	.	.	.	A	1.566	-0.535380	0.04082	.	.	ENSG00000140459	ENST00000268053;ENST00000358632;ENST00000419019;ENST00000452422	T;T;T	0.68025	-0.3;-0.3;-0.3	5.15	5.15	0.70609	.	0.690904	0.14825	N	0.296186	T	0.46870	0.1415	N	0.13043	0.29	0.09310	N	0.999992	B;B	0.23128	0.08;0.031	B;B	0.20384	0.029;0.008	T	0.30880	-0.9963	10	0.41790	T	0.15	-13.1644	6.7554	0.23510	0.7635:0.1549:0.0816:0.0	.	460;490	B4DTE5;P05108	.;CP11A_HUMAN	H	490;332;332;255	ENSP00000268053:L490H;ENSP00000351455:L332H;ENSP00000405488:L332H	ENSP00000268053:L490H	L	-	2	0	CYP11A1	72417463	0.021000	0.18746	0.013000	0.15412	0.020000	0.10135	2.591000	0.46163	1.937000	0.56155	0.448000	0.29417	CTC	-	HMMPfam_p450,superfamily_Cytochrome P450		0.522	CYP11A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP11A1	protein_coding	OTTHUMT00000319737.1	A			72417463	-1	no_errors	NM_000781	genbank	human	reviewed	54_36p	missense	SNP	0.001	T
ADNP2	22850	genome.wustl.edu	37	18	77894466	77894466	+	Silent	SNP	C	C	T			TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chr18:77894466C>T	ENST00000262198.4	+	4	1625	c.1170C>T	c.(1168-1170)ctC>ctT	p.L390L		NM_014913.3	NP_055728.1	Q6IQ32	ADNP2_HUMAN	ADNP homeobox 2	390	Pro-rich.				cellular response to oxidative stress (GO:0034599)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell death (GO:0060548)|neuron differentiation (GO:0030182)|positive regulation of cell growth (GO:0030307)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(9)|liver(1)|lung(15)|ovary(5)|prostate(2)	42		all_cancers(4;1.06e-15)|all_epithelial(4;2.36e-10)|all_lung(4;0.000302)|Lung NSC(4;0.000518)|Esophageal squamous(42;0.0212)|Ovarian(4;0.0256)|all_hematologic(56;0.15)|Melanoma(33;0.2)		Epithelial(2;1.1e-11)|OV - Ovarian serous cystadenocarcinoma(15;7.54e-09)|BRCA - Breast invasive adenocarcinoma(31;0.00247)|STAD - Stomach adenocarcinoma(84;0.164)		CTAGTGTCCTCCCCATAAATC	0.537																																																0			18											89.0	87.0	88.0					18																	77894466		2203	4300	6503	75995457	SO:0001819	synonymous_variant	22850			AB020670	CCDS32853.1	18q23	2013-01-07	2007-07-17	2007-07-17	ENSG00000101544	ENSG00000101544		"""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	23803	protein-coding gene	gene with protein product			"""zinc finger protein 508"""	ZNF508			Standard	NM_014913		Approved	KIAA0863	uc002lnw.3	Q6IQ32	OTTHUMG00000172535	ENST00000262198.4:c.1170C>T	18.37:g.77894466C>T			75995457	A8K951|O94943|Q9H9P3	Silent	SNP	superfamily_C2H2 and C2HC zinc fingers,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1,superfamily_Homeodomain-like,HMMSmart_SM00389	p.L390	ENST00000262198.4	37	c.1170	CCDS32853.1	18																																																																																			-	NULL		0.537	ADNP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADNP2	protein_coding	OTTHUMT00000418979.1	C	NM_014913		75995457	+1	no_errors	NM_014913	genbank	human	validated	54_36p	silent	SNP	0.972	T
ANGEL1	23357	genome.wustl.edu	37	14	77272845	77272845	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chr14:77272845C>T	ENST00000251089.2	-	5	1406	c.1294G>A	c.(1294-1296)Ggg>Agg	p.G432R	ANGEL1_ENST00000554941.1_5'Flank|ANGEL1_ENST00000557179.1_5'Flank	NM_015305.3	NP_056120.2	Q9UNK9	ANGE1_HUMAN	angel homolog 1 (Drosophila)	432										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(2)|lung(9)|ovary(2)|skin(1)|stomach(1)|urinary_tract(1)	22			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0285)		TTTAGGTCCCCGCACAAGATG	0.572																																																0			14											81.0	71.0	74.0					14																	77272845		2203	4300	6503	76342598	SO:0001583	missense	23357			AF111169	CCDS9852.1	14q24.3	2014-06-17		2005-08-04	ENSG00000013523	ENSG00000013523			19961	protein-coding gene	gene with protein product				KIAA0759		11943475	Standard	NM_015305		Approved	Ccr4e	uc001xsv.3	Q9UNK9	OTTHUMG00000171494	ENST00000251089.2:c.1294G>A	14.37:g.77272845C>T	ENSP00000251089:p.Gly432Arg		76342598	B4DWL7|O94859|Q8NCS9	Missense_Mutation	SNP	HMMPfam_Exo_endo_phos,superfamily_Exo_endo_phos	p.G432R	ENST00000251089.2	37	c.1294	CCDS9852.1	14	.	.	.	.	.	.	.	.	.	.	C	32	5.141365	0.94560	.	.	ENSG00000013523	ENST00000251089	D	0.99701	-6.45	5.96	5.96	0.96718	Endonuclease/exonuclease/phosphatase (2);	0.000000	0.85682	D	0.000000	D	0.99829	0.9923	H	0.94620	3.56	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97267	0.9908	10	0.87932	D	0	-7.9416	20.422	0.99049	0.0:1.0:0.0:0.0	.	432	Q9UNK9	ANGE1_HUMAN	R	432	ENSP00000251089:G432R	ENSP00000251089:G432R	G	-	1	0	ANGEL1	76342598	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.818000	0.86416	2.832000	0.97577	0.655000	0.94253	GGG	-	HMMPfam_Exo_endo_phos,superfamily_Exo_endo_phos		0.572	ANGEL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANGEL1	protein_coding	OTTHUMT00000413712.2	C	NM_015305		76342598	-1	no_errors	NM_015305	genbank	human	validated	54_36p	missense	SNP	1.000	T
NRXN3	9369	genome.wustl.edu	37	14	79746760	79746760	+	Silent	SNP	C	C	T			TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chr14:79746760C>T	ENST00000557594.1	+	1	1079	c.126C>T	c.(124-126)tcC>tcT	p.S42S	NRXN3_ENST00000554719.1_Intron|NRXN3_ENST00000428277.2_Silent_p.S42S|NRXN3_ENST00000281127.7_Silent_p.S42S|NRXN3_ENST00000335750.5_Intron	NM_001272020.1	NP_001258949.1	Q9HDB5	NRX3B_HUMAN	neurexin 3	42					adult behavior (GO:0030534)|angiogenesis (GO:0001525)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(23)|lung(40)|ovary(3)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(9)|urinary_tract(1)	104		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		TAGCTTCCTCCTCCTCCACCT	0.567																																																0			14											217.0	192.0	201.0					14																	79746760		2203	4300	6503	78816513	SO:0001819	synonymous_variant	9369			AB018286	CCDS9870.1, CCDS9871.1, CCDS45145.1, CCDS61515.1	14q31	2010-01-19				ENSG00000021645			8010	protein-coding gene	gene with protein product		600567	"""chromosome 14 open reading frame 60"""	C14orf60		11944992, 12379233	Standard	NM_004796		Approved	KIAA0743	uc001xun.4	Q9HDB5		ENST00000557594.1:c.126C>T	14.37:g.79746760C>T			78816513	A5PKW8|A8MPU5|B3KPM7|Q6NUR0|Q8IUD8	Silent	SNP	superfamily_ConA_like_lec_gl,HMMSmart_LamG,HMMPfam_Laminin_G_2,HMMSmart_4.1m	p.S42	ENST00000557594.1	37	c.126		14																																																																																			-	NULL		0.567	NRXN3-004	NOVEL	basic	protein_coding	NRXN3	protein_coding	OTTHUMT00000413790.1	C	NM_001105250		78816513	+1	no_errors	NM_001105250	genbank	human	reviewed	54_36p	silent	SNP	1.000	T
FOLH1B	219595	genome.wustl.edu	37	11	89391865	89391865	+	RNA	SNP	G	G	A			TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chr11:89391865G>A	ENST00000532352.1	+	0	481							Q9HBA9	FOH1B_HUMAN	folate hydrolase 1B							cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(26)|ovary(4)|skin(4)|urinary_tract(2)	48						CAATTGCTCTGGGAAAATTGT	0.343																																																0			11																																								89031513			0			AF261715		11q14.3	2014-03-18			ENSG00000134612	ENSG00000134612			13636	protein-coding gene	gene with protein product	"""prostate specific membrane antigen like protein"", ""Cell growth-inhibiting gene 26 protein"", ""glutamate carboxypeptidase III"""	609020	"""folate hydrolase 2"""	FOLH2, FOLHP		9838072, 14716746	Standard	NM_153696		Approved	PSMAL, GCPIII	uc001pda.3	Q9HBA9	OTTHUMG00000167376		11.37:g.89391865G>A			89031513		Missense_Mutation	SNP	superfamily_Transferrin receptor ectodomain apical domain,HMMPfam_PA,superfamily_Zn-dependent exopeptidases,HMMPfam_Peptidase_M28,superfamily_Transferrin receptor ectodomain C-terminal domain,HMMPfam_TFR_dimer	p.G178R	ENST00000532352.1	37	c.532		11																																																																																			-	superfamily_Transferrin receptor ectodomain apical domain,HMMPfam_PA		0.343	FOLH1B-004	KNOWN	basic	processed_transcript	uc001pda.1	pseudogene	OTTHUMT00000395421.1	G	NM_153696		89031513	+1	no_start_codon	ENST00000389724	ensembl	human	known	54_36p	missense	SNP	1.000	A
CTSL	1514	genome.wustl.edu	37	9	90343539	90343539	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chr9:90343539G>T	ENST00000343150.5	+	5	1326	c.436G>T	c.(436-438)Gct>Tct	p.A146S	CTSL_ENST00000340342.6_Missense_Mutation_p.A146S|CTSL_ENST00000495822.1_Intron|CTSL_ENST00000342020.5_Missense_Mutation_p.A146S			P07711	CATL1_HUMAN	cathepsin L	146					adaptive immune response (GO:0002250)|antigen processing and presentation (GO:0019882)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cellular response to thyroid hormone stimulus (GO:0097067)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|macrophage apoptotic process (GO:0071888)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|toll-like receptor signaling pathway (GO:0002224)	endolysosome lumen (GO:0036021)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|nucleus (GO:0005634)	collagen binding (GO:0005518)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|fibronectin binding (GO:0001968)|histone binding (GO:0042393)|proteoglycan binding (GO:0043394)										TGCTACTGGTGCTCTTGAAGG	0.438																																																0			9											152.0	156.0	155.0					9																	90343539		2203	4300	6503	89533359	SO:0001583	missense	1514			X12451	CCDS6675.1	9q21.33	2013-06-27	2013-06-27	2013-06-27	ENSG00000135047	ENSG00000135047	3.4.22.15	"""Cathepsins"""	2537	protein-coding gene	gene with protein product		116880	"""cathepsin L1"""	CTSL1		8419312, 2835398	Standard	NM_145918		Approved	FLJ31037	uc004apk.4	P07711	OTTHUMG00000020149	ENST00000343150.5:c.436G>T	9.37:g.90343539G>T	ENSP00000345344:p.Ala146Ser		89533359	Q6IAV1|Q96QJ0	Missense_Mutation	SNP	superfamily_SSF54001,HMMPfam_Inhibitor_I29,HMMPfam_Peptidase_C1,HMMSmart_Pept_C1,PatternScan_THIOL_PROTEASE_CYS,PatternScan_THIOL_PROTEASE_HIS,PatternScan_THIOL_PROTEASE_ASN	p.A146S	ENST00000343150.5	37	c.436	CCDS6675.1	9	.	.	.	.	.	.	.	.	.	.	G	15.82	2.944774	0.53079	.	.	ENSG00000135047	ENST00000343150;ENST00000340342;ENST00000342020	T;T;T	0.25912	1.77;1.77;1.77	4.51	1.39	0.22231	Peptidase C1A, papain C-terminal (3);	0.277125	0.39909	N	0.001225	T	0.20981	0.0505	N	0.17723	0.515	0.80722	D	1	B	0.23854	0.092	B	0.40375	0.327	T	0.04017	-1.0984	10	0.11182	T	0.66	.	13.8398	0.63432	0.0:0.0:0.4899:0.5101	.	146	P07711	CATL1_HUMAN	S	146	ENSP00000345344:A146S;ENSP00000365061:A146S;ENSP00000340470:A146S	ENSP00000365061:A146S	A	+	1	0	CTSL1	89533359	0.986000	0.35501	0.115000	0.21578	0.970000	0.65996	1.851000	0.39338	0.486000	0.27676	0.655000	0.94253	GCT	-	superfamily_SSF54001,HMMPfam_Peptidase_C1,HMMSmart_Pept_C1		0.438	CTSL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTSL1	protein_coding	OTTHUMT00000052936.1	G	NM_001912		89533359	+1	no_errors	NM_001912	genbank	human	reviewed	54_36p	missense	SNP	0.977	T
MOAP1	64112	genome.wustl.edu	37	14	93650084	93650084	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chr14:93650084G>T	ENST00000556883.1	-	2	988	c.504C>A	c.(502-504)ttC>ttA	p.F168L	MOAP1_ENST00000298894.4_Missense_Mutation_p.F168L|TMEM251_ENST00000415050.2_5'Flank|TMEM251_ENST00000283534.4_5'Flank|RP11-371E8.4_ENST00000557574.1_5'Flank			Q96BY2	MOAP1_HUMAN	modulator of apoptosis 1	168					apoptotic signaling pathway (GO:0097190)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|positive regulation of apoptotic process (GO:0043065)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:0001844)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(4)|ovary(1)|skin(2)	13		all_cancers(154;0.00528)|Acute lymphoblastic leukemia(33;0.0497)|all_epithelial(191;0.125)|all_neural(303;0.13)		Epithelial(152;0.178)|all cancers(159;0.2)|COAD - Colon adenocarcinoma(157;0.204)		ccctgcccgagaacactctca	0.507																																																0			14											72.0	76.0	75.0					14																	93650084		2203	4300	6503	92719837	SO:0001583	missense	64112			BC015044	CCDS9908.1	14q32.12	2012-02-09			ENSG00000165943	ENSG00000165943		"""Paraneoplastic Ma antigens"""	16658	protein-coding gene	gene with protein product	"""paraneoplastic Ma antigen family member 4"""	609485				11060313	Standard	NM_022151		Approved	MAP-1, PNMA4	uc001ybj.3	Q96BY2	OTTHUMG00000169184	ENST00000556883.1:c.504C>A	14.37:g.93650084G>T	ENSP00000451594:p.Phe168Leu		92719837	B2RDF6|Q9H833|Q9HAS1	Missense_Mutation	SNP	NULL	p.F168L	ENST00000556883.1	37	c.504	CCDS9908.1	14	.	.	.	.	.	.	.	.	.	.	G	14.92	2.679712	0.47886	.	.	ENSG00000165943	ENST00000298894;ENST00000556883	T;T	0.14144	2.53;2.53	3.78	3.78	0.43462	.	.	.	.	.	T	0.35828	0.0945	M	0.78049	2.395	0.33866	D	0.634402	D	0.67145	0.996	D	0.73380	0.98	T	0.50825	-0.8782	9	0.72032	D	0.01	5.2174	11.5084	0.50481	0.0:0.0:1.0:0.0	.	168	Q96BY2	MOAP1_HUMAN	L	168	ENSP00000298894:F168L;ENSP00000451594:F168L	ENSP00000298894:F168L	F	-	3	2	MOAP1	92719837	0.998000	0.40836	0.986000	0.45419	0.080000	0.17528	1.869000	0.39519	2.411000	0.81874	0.650000	0.86243	TTC	-	NULL		0.507	MOAP1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MOAP1	protein_coding	OTTHUMT00000412685.1	G			92719837	-1	no_errors	NM_022151	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
MUC17	140453	genome.wustl.edu	37	7	100677930	100677930	+	Missense_Mutation	SNP	A	A	T			TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chr7:100677930A>T	ENST00000306151.4	+	3	3297	c.3233A>T	c.(3232-3234)cAa>cTa	p.Q1078L		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	1078	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					ACTTATTCTCAAGCCAGTTCA	0.502																																																0			7											443.0	369.0	394.0					7																	100677930		2203	4300	6503	100464650	SO:0001583	missense	140453			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.3233A>T	7.37:g.100677930A>T	ENSP00000302716:p.Gln1078Leu		100464650	O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	superfamily_EGF/Laminin,PatternScan_EGF_1,superfamily_SEA domain,HMMSmart_SM00200,HMMPfam_SEA	p.Q1078L	ENST00000306151.4	37	c.3233	CCDS34711.1	7	.	.	.	.	.	.	.	.	.	.	A	4.186	0.033177	0.08101	.	.	ENSG00000169876	ENST00000306151	T	0.02345	4.33	0.74	0.74	0.18330	.	.	.	.	.	T	0.01800	0.0057	N	0.14661	0.345	0.09310	N	1	B	0.18166	0.026	B	0.09377	0.004	T	0.47947	-0.9077	9	0.26408	T	0.33	.	5.8089	0.18456	1.0:0.0:0.0:0.0	.	1078	Q685J3	MUC17_HUMAN	L	1078	ENSP00000302716:Q1078L	ENSP00000302716:Q1078L	Q	+	2	0	MUC17	100464650	0.000000	0.05858	0.000000	0.03702	0.023000	0.10783	0.196000	0.17176	0.602000	0.29896	0.113000	0.15668	CAA	-	NULL		0.502	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC17	protein_coding	OTTHUMT00000347161.1	A	NM_001040105		100464650	+1	no_errors	NM_001040105	genbank	human	provisional	54_36p	missense	SNP	0.358	T
ZFPM2	23414	genome.wustl.edu	37	8	106811145	106811145	+	Silent	SNP	A	A	C			TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chr8:106811145A>C	ENST00000407775.2	+	7	1183	c.933A>C	c.(931-933)cgA>cgC	p.R311R	RP11-152P17.2_ENST00000521622.1_RNA|ZFPM2_ENST00000522296.1_3'UTR|RP11-152P17.2_ENST00000520594.1_RNA|RP11-152P17.2_ENST00000520433.1_RNA|RP11-152P17.2_ENST00000518932.1_RNA|RP11-152P17.2_ENST00000524045.2_RNA|ZFPM2_ENST00000378472.4_Silent_p.R42R|ZFPM2_ENST00000517361.1_Silent_p.R179R|ZFPM2_ENST00000520492.1_Silent_p.R179R|RP11-152P17.2_ENST00000509144.2_RNA	NM_012082.3	NP_036214.2	Q8WW38	FOG2_HUMAN	zinc finger protein, FOG family member 2	311					blood coagulation (GO:0007596)|embryonic organ development (GO:0048568)|gonadal mesoderm development (GO:0007506)|in utero embryonic development (GO:0001701)|lung development (GO:0030324)|negative regulation of cell death (GO:0060548)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of female gonad development (GO:2000195)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract septum morphogenesis (GO:0003148)|positive regulation of male gonad development (GO:2000020)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|right ventricular cardiac muscle tissue morphogenesis (GO:0003221)|vasculogenesis (GO:0001570)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(4)|breast(6)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(11)|liver(2)|lung(48)|ovary(4)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	99			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)			CAAATGCTCGAGCTCTAGAAA	0.438																																																0			8											104.0	104.0	104.0					8																	106811145		1932	4155	6087	106880321	SO:0001819	synonymous_variant	23414			AF119334	CCDS47908.1	8q23	2013-01-10	2012-11-27		ENSG00000169946	ENSG00000169946		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	16700	protein-coding gene	gene with protein product		603693	"""zinc finger protein, multitype 2"""			9927675, 10438528	Standard	NM_012082		Approved	FOG2, hFOG-2, ZNF89B, ZC2HC11B	uc003ymd.3	Q8WW38	OTTHUMG00000164818	ENST00000407775.2:c.933A>C	8.37:g.106811145A>C			106880321	Q32MA6|Q9NPL7|Q9NPS4|Q9UNI5	Silent	SNP	superfamily_C2H2 and C2HC zinc fingers,HMMSmart_SM00355,HMMPfam_zf-C2H2,PatternScan_ZINC_FINGER_C2H2_1	p.R311	ENST00000407775.2	37	c.933	CCDS47908.1	8																																																																																			-	HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1,superfamily_C2H2 and C2HC zinc fingers		0.438	ZFPM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFPM2	protein_coding	OTTHUMT00000380614.1	A			106880321	+1	no_errors	NM_012082	genbank	human	reviewed	54_36p	silent	SNP	0.998	C
VAV3	10451	genome.wustl.edu	37	1	108417536	108417536	+	Missense_Mutation	SNP	C	C	A	rs372445365		TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chr1:108417536C>A	ENST00000370056.4	-	2	582	c.308G>T	c.(307-309)cGt>cTt	p.R103L	VAV3_ENST00000371846.4_Missense_Mutation_p.R38L|VAV3_ENST00000527011.1_Missense_Mutation_p.R103L	NM_006113.4	NP_006104.4	Q9UKW4	VAV3_HUMAN	vav 3 guanine nucleotide exchange factor	103	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|cellular response to DNA damage stimulus (GO:0006974)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cell adhesion (GO:0045785)|positive regulation of GTPase activity (GO:0043547)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of signal transduction (GO:0009967)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to drug (GO:0042493)|small GTPase mediated signal transduction (GO:0007264)|vesicle fusion (GO:0006906)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|SH3/SH2 adaptor activity (GO:0005070)			NS(2)|breast(5)|endometrium(4)|kidney(2)|large_intestine(14)|lung(20)|ovary(6)|prostate(3)|stomach(1)|urinary_tract(1)	58		all_epithelial(167;5.38e-05)|all_lung(203;0.000314)|Lung NSC(277;0.000594)		Colorectal(144;0.0331)|Lung(183;0.128)|Epithelial(280;0.204)		TCCAAAGTCACGAACATCAAA	0.358																																																0			1											80.0	76.0	77.0					1																	108417536		2203	4300	6503	108219059	SO:0001583	missense	10451			AF118886	CCDS785.1, CCDS44181.1	1p13.3	2013-02-14	2007-07-25		ENSG00000134215	ENSG00000134215		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	12659	protein-coding gene	gene with protein product		605541	"""vav 3 oncogene"""				Standard	NM_001079874		Approved		uc001dvk.1	Q9UKW4	OTTHUMG00000010995	ENST00000370056.4:c.308G>T	1.37:g.108417536C>A	ENSP00000359073:p.Arg103Leu		108219059	B1AMM0|B1APV5|B4E232|B7ZLR1|E9PQ97|O60498|O95230|Q9Y5X8	Missense_Mutation	SNP	HMMPfam_CH,superfamily_Calponin-homology domain CH-domain,HMMSmart_SM00033,superfamily_DBL homology domain (DH-domain),HMMPfam_RhoGEF,HMMSmart_SM00325,PatternScan_DH_1,superfamily_PH domain-like,HMMPfam_PH,HMMSmart_SM00233,superfamily_Cysteine-rich domain,HMMSmart_SM00109,PatternScan_ZF_DAG_PE_1,HMMPfam_C1_1,superfamily_SH3-domain,HMMSmart_SM00326,HMMPfam_SH3_2,superfamily_SH2 domain,HMMSmart_SM00252,HMMPfam_SH2,HMMPfam_SH3_1	p.R103L	ENST00000370056.4	37	c.308	CCDS785.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	34|34	5.400919|5.400919	0.96030|0.96030	.|.	.|.	ENSG00000134215|ENSG00000134215	ENST00000370056;ENST00000527011;ENST00000371846|ENST00000490388	T;T;T|.	0.40756|.	1.02;1.02;1.02|.	6.08|6.08	6.08|6.08	0.98989|0.98989	Calponin homology domain (5);|.	0.124032|.	0.53938|.	D|.	0.000055|.	T|T	0.74038|0.74038	0.3664|0.3664	M|M	0.78285|0.78285	2.405|2.405	0.58432|0.58432	D|D	0.999997|0.999997	B;B;P|.	0.40834|.	0.075;0.272;0.73|.	B;B;P|.	0.54270|.	0.097;0.166;0.747|.	T|T	0.72097|0.72097	-0.4393|-0.4393	10|5	0.51188|.	T|.	0.08|.	.|.	19.2273|19.2273	0.93822|0.93822	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	103;103;103|.	B7ZLR1;E9PQ97;Q9UKW4|.	.;.;VAV3_HUMAN|.	L|L	103;103;38|98	ENSP00000359073:R103L;ENSP00000432540:R103L;ENSP00000360912:R38L|.	ENSP00000359073:R103L|.	R|V	-|-	2|1	0|0	VAV3|VAV3	108219059|108219059	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	7.302000|7.302000	0.78861|0.78861	2.894000|2.894000	0.99253|0.99253	0.655000|0.655000	0.94253|0.94253	CGT|GTG	-	HMMPfam_CH,superfamily_Calponin-homology domain CH-domain,HMMSmart_SM00033		0.358	VAV3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VAV3	protein_coding	OTTHUMT00000030242.2	C	NM_006113		108219059	-1	no_errors	NM_006113	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
SARS	6301	genome.wustl.edu	37	1	109756748	109756748	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chr1:109756748G>A	ENST00000234677.2	+	1	209	c.134G>A	c.(133-135)cGa>cAa	p.R45Q	SARS_ENST00000369923.4_Missense_Mutation_p.R45Q	NM_006513.3	NP_006504.2	P49591	SYSC_HUMAN	seryl-tRNA synthetase	45					gene expression (GO:0010467)|selenocysteinyl-tRNA(Sec) biosynthetic process (GO:0097056)|seryl-tRNA aminoacylation (GO:0006434)|translation (GO:0006412)|tRNA aminoacylation for protein translation (GO:0006418)|tRNA processing (GO:0008033)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|RNA binding (GO:0003723)|serine-tRNA ligase activity (GO:0004828)	p.R45Q(1)		central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	17		all_epithelial(167;7.64e-05)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0301)|Lung(183;0.0677)|COAD - Colon adenocarcinoma(174;0.116)|Epithelial(280;0.233)	L-Serine(DB00133)	GAGTGGCGACGATGTAAGTAC	0.592																																																1	Substitution - Missense(1)	lung(1)	1											113.0	90.0	98.0					1																	109756748		2203	4300	6503	109558271	SO:0001583	missense	6301			BC009390	CCDS795.1	1p13.3	2011-07-01			ENSG00000031698	ENSG00000031698	6.1.1.11	"""Aminoacyl tRNA synthetases / Class II"""	10537	protein-coding gene	gene with protein product	"""serine tRNA ligase 1, cytoplasmic"""	607529				9431993	Standard	NM_006513		Approved	SERS	uc001dwu.2	P49591	OTTHUMG00000011726	ENST00000234677.2:c.134G>A	1.37:g.109756748G>A	ENSP00000234677:p.Arg45Gln		109558271	B2R6Y9|Q5T5C8|Q9NSE3	Missense_Mutation	SNP	HMMPfam_Seryl_tRNA_N,superfamily_tRNA-binding arm,superfamily_Class II aaRS and biotin synthetases,HMMPfam_tRNA-synt_2b	p.R45Q	ENST00000234677.2	37	c.134	CCDS795.1	1	.	.	.	.	.	.	.	.	.	.	G	14.27	2.484204	0.44147	.	.	ENSG00000031698	ENST00000234677;ENST00000369923	T;T	0.41065	1.01;1.01	5.38	5.38	0.77491	tRNA-binding arm (1);Seryl-tRNA synthetase, class IIa, N-terminal (2);	0.064498	0.64402	D	0.000010	T	0.08179	0.0204	N	0.02985	-0.445	0.38518	D	0.948649	B;B;B;B	0.18610	0.017;0.006;0.029;0.017	B;B;B;B	0.12156	0.003;0.002;0.007;0.003	T	0.21484	-1.0244	10	0.13853	T	0.58	-5.5081	11.4738	0.50286	0.0825:0.0:0.9175:0.0	.	45;45;45;45	Q0VGA5;Q53HA4;Q5T5C7;P49591	.;.;.;SYSC_HUMAN	Q	45	ENSP00000234677:R45Q;ENSP00000358939:R45Q	ENSP00000234677:R45Q	R	+	2	0	SARS	109558271	1.000000	0.71417	1.000000	0.80357	0.729000	0.41735	3.684000	0.54671	2.805000	0.96524	0.460000	0.39030	CGA	-	HMMPfam_Seryl_tRNA_N,superfamily_tRNA-binding arm		0.592	SARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SARS	protein_coding	OTTHUMT00000032394.2	G	NM_006513		109558271	+1	no_errors	NM_006513	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
GPAM	57678	genome.wustl.edu	37	10	113917015	113917015	+	Missense_Mutation	SNP	A	A	T			TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chr10:113917015A>T	ENST00000348367.4	-	19	2310	c.2113T>A	c.(2113-2115)Tac>Aac	p.Y705N	GPAM_ENST00000423155.1_Missense_Mutation_p.Y705N|GPAM_ENST00000369425.1_Missense_Mutation_p.Y705N			Q9HCL2	GPAT1_HUMAN	glycerol-3-phosphate acyltransferase, mitochondrial	705					acyl-CoA metabolic process (GO:0006637)|CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|defense response to virus (GO:0051607)|fatty acid homeostasis (GO:0055089)|fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|interleukin-2 secretion (GO:0070970)|negative regulation of activation-induced cell death of T cells (GO:0070236)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of multicellular organism growth (GO:0040018)|regulation of cytokine secretion (GO:0050707)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)	glycerol-3-phosphate O-acyltransferase activity (GO:0004366)			breast(2)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31				Epithelial(162;0.0306)|all cancers(201;0.123)		ACCTTCAGGTAGCAATCTCGC	0.468																																					Ovarian(161;1017 2606 18293 52943)											0			10											196.0	170.0	179.0					10																	113917015		2203	4300	6503	113907005	SO:0001583	missense	57678			AL832464	CCDS7570.1	10q25.3	2009-07-15			ENSG00000119927	ENSG00000119927			24865	protein-coding gene	gene with protein product	"""glycerol-3-phosphate acyltransferase 1, mitochondrial"""	602395				10997877, 8369314	Standard	NM_020918		Approved	KIAA1560, MGC26846, GPAT1	uc001kzp.3	Q9HCL2	OTTHUMG00000019055	ENST00000348367.4:c.2113T>A	10.37:g.113917015A>T	ENSP00000265276:p.Tyr705Asn		113907005	Q5VW51|Q86TA3	Missense_Mutation	SNP	superfamily_SSF69593,HMMPfam_Acyltransferase,HMMSmart_PlsC	p.Y705N	ENST00000348367.4	37	c.2113	CCDS7570.1	10	.	.	.	.	.	.	.	.	.	.	A	20.2	3.947296	0.73672	.	.	ENSG00000119927	ENST00000348367;ENST00000423155;ENST00000369425	T;T;T	0.74526	-0.39;-0.39;-0.85	5.63	5.63	0.86233	.	0.067142	0.64402	D	0.000008	T	0.81278	0.4789	M	0.63843	1.955	0.80722	D	1	D;D	0.64830	0.994;0.984	P;P	0.58077	0.832;0.77	T	0.80935	-0.1160	10	0.40728	T	0.16	-13.3908	14.7118	0.69238	1.0:0.0:0.0:0.0	.	705;705	Q5VW52;Q9HCL2	.;GPAT1_HUMAN	N	705	ENSP00000265276:Y705N;ENSP00000409242:Y705N;ENSP00000358433:Y705N	ENSP00000265276:Y705N	Y	-	1	0	GPAM	113907005	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.280000	0.89903	2.265000	0.75225	0.533000	0.62120	TAC	-	NULL		0.468	GPAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPAM	protein_coding	OTTHUMT00000050377.1	A	NM_020918		113907005	-1	no_errors	NM_020918	genbank	human	validated	54_36p	missense	SNP	1.000	T
GOLGB1	2804	genome.wustl.edu	37	3	121415453	121415453	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chr3:121415453C>A	ENST00000340645.5	-	13	4027	c.3902G>T	c.(3901-3903)gGa>gTa	p.G1301V	GOLGB1_ENST00000393667.3_Missense_Mutation_p.G1306V	NM_001256487.1|NM_001256488.1|NM_004487.4	NP_001243416.1|NP_001243417.1|NP_004478.3	Q14789	GOGB1_HUMAN	golgin B1	1301					Golgi organization (GO:0007030)	cis-Golgi network (GO:0005801)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(2)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(26)|liver(2)|lung(36)|ovary(7)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(13)	119				GBM - Glioblastoma multiforme(114;0.0989)		AACAGAAGTTCCGCCCTGCAG	0.453																																																0			3											81.0	81.0	81.0					3																	121415453		2203	4300	6503	122898143	SO:0001583	missense	2804			X75304	CCDS3004.1, CCDS58847.1, CCDS74989.1	3q13	2010-02-12	2010-02-12	2007-07-27	ENSG00000173230	ENSG00000173230			4429	protein-coding gene	gene with protein product	"""macrogolgin"", ""golgi integral membrane protein 1"""	602500	"""golgi autoantigen, golgin subfamily b, macrogolgin (with transmembrane signal), 1"", ""golgin B1, golgi integral membrane protein"""			7691276, 15004235	Standard	NM_001256486		Approved	GCP, GCP372, giantin, GOLIM1	uc010hrc.4	Q14789	OTTHUMG00000159411	ENST00000340645.5:c.3902G>T	3.37:g.121415453C>A	ENSP00000341848:p.Gly1301Val		122898143	B2ZZ91|D3DN92|E7EP74|Q14398	Missense_Mutation	SNP	superfamily_Spectrin repeat,superfamily_Prefoldin,HMMSmart_SM00340	p.G1301V	ENST00000340645.5	37	c.3902	CCDS3004.1	3	.	.	.	.	.	.	.	.	.	.	C	0.025	-1.377939	0.01204	.	.	ENSG00000173230	ENST00000340645;ENST00000393667;ENST00000494517	T;T;T	0.22743	2.53;2.53;1.94	5.88	-2.86	0.05717	.	1.691530	0.02623	N	0.103446	T	0.14184	0.0343	N	0.22421	0.69	0.09310	N	1	B;B;B;B;B	0.20988	0.05;0.05;0.05;0.05;0.05	B;B;B;B;B	0.21917	0.037;0.023;0.014;0.014;0.023	T	0.22695	-1.0209	10	0.34782	T	0.22	.	5.9835	0.19421	0.0:0.3502:0.265:0.3848	.	1226;1265;1306;1306;1301	F1T0J2;E7EU81;E7EP74;B2ZZ91;Q14789	.;.;.;.;GOGB1_HUMAN	V	1301;1306;1265	ENSP00000341848:G1301V;ENSP00000377275:G1306V;ENSP00000418231:G1265V	ENSP00000341848:G1301V	G	-	2	0	GOLGB1	122898143	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	-0.527000	0.06200	-0.778000	0.04566	-0.302000	0.09304	GGA	-	NULL		0.453	GOLGB1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GOLGB1	protein_coding	OTTHUMT00000355159.1	C	NM_004487		122898143	-1	no_errors	NM_004487	genbank	human	validated	54_36p	missense	SNP	0.000	A
FAT4	79633	genome.wustl.edu	37	4	126408599	126408599	+	Missense_Mutation	SNP	A	A	T			TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chr4:126408599A>T	ENST00000394329.3	+	16	12929	c.12916A>T	c.(12916-12918)Act>Tct	p.T4306S	FAT4_ENST00000335110.5_Missense_Mutation_p.T2547S	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	4306	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						CCACTGGCACACTTTTCTAAT	0.403																																																0			4											80.0	82.0	82.0					4																	126408599		2203	4300	6503	126628049	SO:0001583	missense	79633			AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.12916A>T	4.37:g.126408599A>T	ENSP00000377862:p.Thr4306Ser		126628049	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	superfamily_Cadherin,HMMPfam_Cadherin,HMMSmart_CA,PatternScan_CADHERIN_1,superfamily_SSF57196,HMMSmart_EGF,PatternScan_EGF_1,PatternScan_EGF_2,PatternScan_EGF_CA,HMMPfam_EGF_CA,HMMSmart_EGF_CA,PatternScan_ASX_HYDROXYL,superfamily_ConA_like_lec_gl,HMMSmart_LamG,HMMPfam_Laminin_G_2,HMMPfam_EGF	p.T4249S	ENST00000394329.3	37	c.12745	CCDS3732.3	4	.	.	.	.	.	.	.	.	.	.	A	9.761	1.170050	0.21621	.	.	ENSG00000196159	ENST00000394329;ENST00000335110	T;T	0.79141	-1.15;-1.24	5.06	2.44	0.29823	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.248964	0.20502	U	0.091070	T	0.55673	0.1935	N	0.17764	0.52	0.33612	D	0.603661	B;B;B	0.09022	0.002;0.001;0.0	B;B;B	0.12837	0.005;0.008;0.005	T	0.49799	-0.8901	10	0.09084	T	0.74	.	5.3503	0.16032	0.6832:0.0:0.0971:0.2197	.	2547;4306;4306	Q6V0I7-2;Q6V0I7;Q6V0I7-3	.;FAT4_HUMAN;.	S	4306;2547	ENSP00000377862:T4306S;ENSP00000335169:T2547S	ENSP00000335169:T2547S	T	+	1	0	FAT4	126628049	1.000000	0.71417	0.957000	0.39632	0.722000	0.41435	3.887000	0.56197	0.766000	0.33244	0.528000	0.53228	ACT	-	superfamily_ConA_like_lec_gl,HMMSmart_LamG,HMMPfam_Laminin_G_2		0.403	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT4	protein_coding	OTTHUMT00000256765.2	A	NM_024582		126628049	+1	no_errors	NM_024582	genbank	human	validated	54_36p	missense	SNP	0.997	T
DBH	1621	genome.wustl.edu	37	9	136507431	136507431	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chr9:136507431C>T	ENST00000393056.2	+	3	601	c.589C>T	c.(589-591)Ctc>Ttc	p.L197F		NM_000787.3	NP_000778.3	P09172	DOPO_HUMAN	dopamine beta-hydroxylase (dopamine beta-monooxygenase)	197					behavioral response to ethanol (GO:0048149)|blood vessel remodeling (GO:0001974)|catecholamine biosynthetic process (GO:0042423)|cellular nitrogen compound metabolic process (GO:0034641)|cytokine production (GO:0001816)|dopamine catabolic process (GO:0042420)|fear response (GO:0042596)|glucose homeostasis (GO:0042593)|homoiothermy (GO:0042309)|leukocyte mediated immunity (GO:0002443)|leukocyte migration (GO:0050900)|locomotory behavior (GO:0007626)|maternal behavior (GO:0042711)|memory (GO:0007613)|norepinephrine biosynthetic process (GO:0042421)|positive regulation of vasoconstriction (GO:0045907)|regulation of cell proliferation (GO:0042127)|regulation of extrinsic apoptotic signaling pathway (GO:2001236)|response to amphetamine (GO:0001975)|response to pain (GO:0048265)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|secretory granule lumen (GO:0034774)	catalytic activity (GO:0003824)|copper ion binding (GO:0005507)|dopamine beta-monooxygenase activity (GO:0004500)|L-ascorbic acid binding (GO:0031418)			central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(9)|liver(1)|lung(6)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	36				OV - Ovarian serous cystadenocarcinoma(145;2.33e-07)|Epithelial(140;1.5e-06)|all cancers(34;1.66e-05)	Disulfiram(DB00822)|Dopamine(DB00988)|Propylthiouracil(DB00550)|Vitamin C(DB00126)	GAGGGTGCAGCTCCTGAAGCC	0.627																																																0			9											55.0	54.0	54.0					9																	136507431		2203	4300	6503	135497252	SO:0001583	missense	1621			X13256	CCDS6977.2	9q34	2013-06-03			ENSG00000123454	ENSG00000123454	1.14.17.1		2689	protein-coding gene	gene with protein product		609312					Standard	NM_000787		Approved	DBM	uc004cel.3	P09172	OTTHUMG00000020878	ENST00000393056.2:c.589C>T	9.37:g.136507431C>T	ENSP00000376776:p.Leu197Phe		135497252	Q5T381|Q96AG2	Missense_Mutation	SNP	HMMSmart_DoH,HMMPfam_DOMON,superfamily_PHM_PNGase_F,HMMPfam_Cu2_monooxygen,PatternScan_CU2_MONOOXYGENASE_1,HMMPfam_Cu2_monoox_C,PatternScan_CU2_MONOOXYGENASE_2	p.L197F	ENST00000393056.2	37	c.589	CCDS6977.2	9	.	.	.	.	.	.	.	.	.	.	C	19.23	3.787537	0.70337	.	.	ENSG00000123454	ENST00000393056;ENST00000371880;ENST00000263611	T;T	0.59224	0.28;0.28	4.97	4.97	0.65823	DOMON domain (1);PHM/PNGase F domain (1);	0.061993	0.64402	D	0.000003	T	0.79149	0.4397	M	0.84683	2.71	0.58432	D	0.999999	D	0.64830	0.994	D	0.74674	0.984	T	0.83119	-0.0119	10	0.72032	D	0.01	-20.0068	18.2251	0.89914	0.0:1.0:0.0:0.0	.	197	P09172	DOPO_HUMAN	F	197;134;134	ENSP00000376776:L197F;ENSP00000263611:L134F	ENSP00000263611:L134F	L	+	1	0	DBH	135497252	1.000000	0.71417	1.000000	0.80357	0.636000	0.38137	5.609000	0.67661	2.309000	0.77851	0.491000	0.48974	CTC	-	HMMSmart_DoH,superfamily_PHM_PNGase_F,HMMPfam_Cu2_monooxygen		0.627	DBH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DBH	protein_coding	OTTHUMT00000054929.2	C	NM_000787		135497252	+1	no_errors	NM_000787	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
BRD8	10902	genome.wustl.edu	37	5	137497831	137497831	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chr5:137497831C>A	ENST00000254900.5	-	16	2463	c.2092G>T	c.(2092-2094)Gtc>Ttc	p.V698F	BRD8_ENST00000455658.2_Missense_Mutation_p.V657F|BRD8_ENST00000515014.1_5'UTR|BRD8_ENST00000230901.5_Missense_Mutation_p.V771F|BRD8_ENST00000402931.1_Missense_Mutation_p.V698F|BRD8_ENST00000411594.2_Missense_Mutation_p.V701F	NM_139199.1	NP_631938	Q9H0E9	BRD8_HUMAN	bromodomain containing 8	698					cell surface receptor signaling pathway (GO:0007166)|chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|intracellular receptor signaling pathway (GO:0030522)|regulation of growth (GO:0040008)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)	mitochondrion (GO:0005739)|NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Swr1 complex (GO:0000812)	sequence-specific DNA binding transcription factor activity (GO:0003700)|thyroid hormone receptor activity (GO:0004887)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(9)|ovary(1)|prostate(1)|skin(1)|stomach(3)|urinary_tract(1)	35			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			TCACTACAGACAGAGCTGAAA	0.413																																																0			5											119.0	107.0	111.0					5																	137497831		2203	4300	6503	137525730	SO:0001583	missense	10902			AF016270	CCDS4198.1, CCDS34241.1, CCDS54907.1	5q31	2008-02-05			ENSG00000112983	ENSG00000112983			19874	protein-coding gene	gene with protein product		602848				8611617, 9368056	Standard	NM_001164326		Approved	SMAP, p120	uc003lcf.1	Q9H0E9	OTTHUMG00000129204	ENST00000254900.5:c.2092G>T	5.37:g.137497831C>A	ENSP00000254900:p.Val698Phe		137525730	O43178|Q15355|Q58AB0|Q59GN0|Q969M9	Missense_Mutation	SNP	superfamily_Bromodomain,HMMSmart_SM00297,HMMPfam_Bromodomain	p.V698F	ENST00000254900.5	37	c.2092	CCDS4198.1	5	.	.	.	.	.	.	.	.	.	.	C	20.1	3.936220	0.73442	.	.	ENSG00000112983	ENST00000254900;ENST00000454473;ENST00000418329;ENST00000230901;ENST00000402931;ENST00000411594;ENST00000239899;ENST00000455658;ENST00000511898	T;T;T;T;T;T;T	0.34072	1.76;1.39;1.38;1.53;1.53;1.38;1.52	6.17	5.3	0.74995	Bromodomain (1);	0.234704	0.43579	D	0.000545	T	0.45054	0.1323	N	0.24115	0.695	0.58432	D	0.999999	D;D;D;D;D;D;D;P	0.76494	0.999;0.995;0.998;0.997;0.998;0.994;0.999;0.868	D;D;D;P;P;P;D;B	0.74023	0.977;0.945;0.94;0.852;0.905;0.854;0.982;0.243	T	0.31420	-0.9944	10	0.21014	T	0.42	-12.4032	16.7039	0.85366	0.0:0.8706:0.1294:0.0	.	657;682;477;771;701;592;771;698	F8W820;B4DN43;B4DMS9;A8K1N6;Q9H0E9-4;Q9H0E9-3;Q9H0E9-2;Q9H0E9	.;.;.;.;.;.;.;BRD8_HUMAN	F	698;727;696;771;698;701;592;657;166	ENSP00000254900:V698F;ENSP00000398067:V727F;ENSP00000398873:V696F;ENSP00000230901:V771F;ENSP00000384845:V698F;ENSP00000394330:V701F;ENSP00000408396:V657F	ENSP00000230901:V771F	V	-	1	0	BRD8	137525730	1.000000	0.71417	1.000000	0.80357	0.660000	0.38997	3.759000	0.55227	1.609000	0.50190	-0.175000	0.13238	GTC	-	superfamily_Bromodomain		0.413	BRD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRD8	protein_coding	OTTHUMT00000251282.3	C	NM_006696		137525730	-1	no_errors	NM_139199	genbank	human	reviewed	54_36p	missense	SNP	0.998	A
MAGEC1	9947	genome.wustl.edu	37	X	140996466	140996466	+	Silent	SNP	G	G	A			TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chrX:140996466G>A	ENST00000285879.4	+	4	3562	c.3276G>A	c.(3274-3276)aaG>aaA	p.K1092K	MAGEC1_ENST00000406005.2_Silent_p.K159K	NM_005462.4	NP_005453.2	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	1092	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(22)|lung(60)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(1)	127	Acute lymphoblastic leukemia(192;6.56e-05)					CCATGCTAAAGAATACCGTCC	0.453										HNSCC(15;0.026)																																						0			X											149.0	136.0	140.0					X																	140996466		2203	4300	6503	140824132	SO:0001819	synonymous_variant	9947			AF064589	CCDS35417.1	Xq26	2009-03-18			ENSG00000155495	ENSG00000155495			6812	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 1"""	300223				9485030, 9618514	Standard	NM_005462		Approved	MAGE-C1, CT7, MGC39366, CT7.1	uc004fbt.3	O60732	OTTHUMG00000022569	ENST00000285879.4:c.3276G>A	X.37:g.140996466G>A			140824132	A0PK03|O75451|Q8TCV4	Silent	SNP	HMMPfam_MAGE	p.K1092	ENST00000285879.4	37	c.3276	CCDS35417.1	X																																																																																			-	NULL		0.453	MAGEC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAGEC1	protein_coding	OTTHUMT00000058604.1	G	NM_005462		140824132	+1	no_errors	NM_005462	genbank	human	reviewed	54_36p	silent	SNP	0.000	A
PIP	5304	genome.wustl.edu	37	7	142832360	142832360	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chr7:142832360G>A	ENST00000291009.3	+	2	209	c.169G>A	c.(169-171)Gca>Aca	p.A57T		NM_002652.2	NP_002643.1	P12273	PIP_HUMAN	prolactin-induced protein	57					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|negative regulation of T cell apoptotic process (GO:0070233)|positive regulation of gene expression (GO:0010628)|proteolysis (GO:0006508)|regulation of immune system process (GO:0002682)|retina homeostasis (GO:0001895)	apical plasma membrane (GO:0016324)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	actin binding (GO:0003779)|aspartic-type endopeptidase activity (GO:0004190)|glycoprotein binding (GO:0001948)|IgG binding (GO:0019864)|protein dimerization activity (GO:0046983)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(7)|ovary(1)|skin(1)	18	Melanoma(164;0.059)	Ovarian(593;2.82e-05)|Breast(660;0.012)		BRCA - Breast invasive adenocarcinoma(188;0.0026)|LUSC - Lung squamous cell carcinoma(290;0.0733)|Lung(243;0.08)		TGCAGTGCTTGCAGTTCAAAC	0.383																																																0			7											62.0	56.0	58.0					7																	142832360		2203	4299	6502	142542482	SO:0001583	missense	5304				CCDS34768.1	7q34	2013-09-19			ENSG00000159763	ENSG00000159763			8993	protein-coding gene	gene with protein product	"""prolactin-inducible protein"""	176720				2727805, 1955075	Standard	NM_002652		Approved	GCDFP-15, GCDFP15, GPIP4	uc003wcf.1	P12273	OTTHUMG00000152635	ENST00000291009.3:c.169G>A	7.37:g.142832360G>A	ENSP00000291009:p.Ala57Thr		142542482	A0A963|A0A9C3|A0A9F3|A4D2I1	Missense_Mutation	SNP	HMMPfam_SVA	p.A57T	ENST00000291009.3	37	c.169	CCDS34768.1	7	.	.	.	.	.	.	.	.	.	.	G	3.340	-0.134769	0.06711	.	.	ENSG00000159763	ENST00000291009	T	0.11277	2.79	4.55	-6.27	0.02026	.	1.707640	0.02789	N	0.121872	T	0.02727	0.0082	N	0.01576	-0.805	0.09310	N	1	B	0.13594	0.008	B	0.09377	0.004	T	0.34428	-0.9829	10	0.09590	T	0.72	.	3.0779	0.06253	0.3179:0.1352:0.4164:0.1305	.	57	P12273	PIP_HUMAN	T	57	ENSP00000291009:A57T	ENSP00000291009:A57T	A	+	1	0	PIP	142542482	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.751000	0.01821	-1.325000	0.02269	-2.420000	0.00218	GCA	-	HMMPfam_SVA		0.383	PIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIP	protein_coding	OTTHUMT00000327089.1	G	NM_002652		142542482	+1	no_errors	NM_002652	genbank	human	validated	54_36p	missense	SNP	0.000	A
ABLIM3	22885	genome.wustl.edu	37	5	148619336	148619336	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chr5:148619336C>A	ENST00000506113.1	+	12	1571	c.1089C>A	c.(1087-1089)aaC>aaA	p.N363K	ABLIM3_ENST00000508983.1_Missense_Mutation_p.N363K|ABLIM3_ENST00000309868.7_Missense_Mutation_p.N363K|AC012613.2_ENST00000523176.1_RNA|RP11-331K21.1_ENST00000522685.1_RNA|ABLIM3_ENST00000326685.7_Missense_Mutation_p.N301K|ABLIM3_ENST00000519549.1_3'UTR|RP11-331K21.1_ENST00000512647.2_RNA|ABLIM3_ENST00000356541.3_Missense_Mutation_p.N301K|ABLIM3_ENST00000504238.1_Missense_Mutation_p.N301K			O94929	ABLM3_HUMAN	actin binding LIM protein family, member 3	363					actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|cilium assembly (GO:0042384)|lamellipodium assembly (GO:0030032)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|stress fiber (GO:0001725)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(13)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	34			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCTACGAGAACCTGGACCTCC	0.642																																																0			5											73.0	78.0	76.0					5																	148619336		2203	4300	6503	148599529	SO:0001583	missense	22885			AB020650	CCDS4294.1	5q33.1	2008-02-05			ENSG00000173210	ENSG00000173210			29132	protein-coding gene	gene with protein product		611305					Standard	XM_005268392		Approved	KIAA0843	uc003lpy.2	O94929	OTTHUMG00000129932	ENST00000506113.1:c.1089C>A	5.37:g.148619336C>A	ENSP00000425394:p.Asn363Lys		148599529	A8K121|Q19VH3|Q658S1|Q68CI5|Q9BV32	Missense_Mutation	SNP	HMMSmart_SM00132,superfamily_Glucocorticoid receptor-like (DNA-binding domain),PatternScan_LIM_DOMAIN_1,HMMPfam_LIM,superfamily_VHP Villin headpiece domain,HMMPfam_VHP,HMMSmart_SM00153	p.N363K	ENST00000506113.1	37	c.1089	CCDS4294.1	5	.	.	.	.	.	.	.	.	.	.	C	13.34	2.207341	0.39003	.	.	ENSG00000173210	ENST00000326685;ENST00000356541;ENST00000309868;ENST00000506113;ENST00000504238;ENST00000508983	T;T;T;T;T;T	0.39056	1.1;1.1;1.1;1.1;1.1;1.1	5.0	3.17	0.36434	.	0.264028	0.48286	D	0.000190	T	0.19087	0.0458	N	0.08118	0	0.41441	D	0.987929	B;B;B	0.20261	0.01;0.043;0.001	B;B;B	0.21151	0.033;0.03;0.008	T	0.05920	-1.0856	10	0.15952	T	0.53	.	7.1718	0.25722	0.0:0.7076:0.1395:0.1528	.	301;301;363	O94929-3;O94929-2;O94929	.;.;ABLM3_HUMAN	K	301;301;363;363;301;363	ENSP00000315841:N301K;ENSP00000348938:N301K;ENSP00000310309:N363K;ENSP00000425394:N363K;ENSP00000421183:N301K;ENSP00000420855:N363K	ENSP00000310309:N363K	N	+	3	2	ABLIM3	148599529	0.998000	0.40836	1.000000	0.80357	0.989000	0.77384	0.712000	0.25779	1.326000	0.45319	0.462000	0.41574	AAC	-	NULL		0.642	ABLIM3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ABLIM3	protein_coding	OTTHUMT00000373435.1	C	NM_014945		148599529	+1	no_errors	NM_014945	genbank	human	validated	54_36p	missense	SNP	0.985	A
SPARC	6678	genome.wustl.edu	37	5	151055727	151055727	+	Missense_Mutation	SNP	A	A	T			TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chr5:151055727A>T	ENST00000231061.4	-	2	336	c.23T>A	c.(22-24)cTc>cAc	p.L8H	CTB-113P19.1_ENST00000518905.1_RNA|CTB-113P19.1_ENST00000510576.2_RNA	NM_003118.3	NP_003109.1	P09486	SPRC_HUMAN	secreted protein, acidic, cysteine-rich (osteonectin)	8					blood coagulation (GO:0007596)|bone development (GO:0060348)|cellular response to growth factor stimulus (GO:0071363)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|inner ear development (GO:0048839)|lung development (GO:0030324)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell proliferation (GO:0001937)|ossification (GO:0001503)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of endothelial cell migration (GO:0010595)|regulation of cell morphogenesis (GO:0022604)|response to cadmium ion (GO:0046686)|response to calcium ion (GO:0051592)|response to cAMP (GO:0051591)|response to cytokine (GO:0034097)|response to ethanol (GO:0045471)|response to glucocorticoid (GO:0051384)|response to gravity (GO:0009629)|response to L-ascorbic acid (GO:0033591)|response to lead ion (GO:0010288)|response to lipopolysaccharide (GO:0032496)|response to peptide hormone (GO:0043434)|signal transduction (GO:0007165)	basement membrane (GO:0005604)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endocytic vesicle lumen (GO:0071682)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|nuclear matrix (GO:0016363)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|platelet alpha granule membrane (GO:0031092)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix binding (GO:0050840)			central_nervous_system(3)|large_intestine(5)|lung(5)|ovary(1)|urinary_tract(1)	15		Medulloblastoma(196;0.109)|all_hematologic(541;0.122)	Kidney(363;0.000171)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)	OV - Ovarian serous cystadenocarcinoma(192;0.00118)		CAGGCAAAGGAGAAAGAAGAT	0.517																																																0			5											48.0	49.0	48.0					5																	151055727		2203	4300	6503	151035920	SO:0001583	missense	6678				CCDS4318.1	5q31-q33	2012-10-02			ENSG00000113140	ENSG00000113140			11219	protein-coding gene	gene with protein product	"""cysteine-rich protein"", ""osteonectin"""	182120		ON		2838412, 3410046	Standard	NM_003118		Approved		uc003lui.4	P09486	OTTHUMG00000130122	ENST00000231061.4:c.23T>A	5.37:g.151055727A>T	ENSP00000231061:p.Leu8His		151035920	D3DQH9|Q6IBK4	Missense_Mutation	SNP	superfamily_EGF/Laminin,HMMSmart_SM00274,HMMPfam_FOLN,PatternScan_OSTEONECTIN_1,HMMSmart_SM00280,HMMPfam_Kazal_1,superfamily_Kazal-type serine protease inhibitors,HMMPfam_SPARC_Ca_bdg,superfamily_EF-hand,PatternScan_OSTEONECTIN_2,PatternScan_EF_HAND_1	p.L8H	ENST00000231061.4	37	c.23	CCDS4318.1	5	.	.	.	.	.	.	.	.	.	.	A	22.6	4.317226	0.81469	.	.	ENSG00000113140	ENST00000231061;ENST00000539687;ENST00000522348	T;T;T	0.62941	1.55;1.05;-0.01	5.49	5.49	0.81192	.	0.191834	0.46442	D	0.000290	T	0.62146	0.2404	L	0.59436	1.845	0.39089	D	0.961062	P	0.40398	0.716	B	0.41646	0.362	T	0.69213	-0.5204	10	0.66056	D	0.02	-17.4437	13.8238	0.63338	1.0:0.0:0.0:0.0	.	8	P09486	SPRC_HUMAN	H	8	ENSP00000231061:L8H;ENSP00000444998:L8H;ENSP00000429152:L8H	ENSP00000231061:L8H	L	-	2	0	SPARC	151035920	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.085000	0.89518	2.081000	0.62600	0.477000	0.44152	CTC	-	NULL		0.517	SPARC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPARC	protein_coding	OTTHUMT00000252430.1	A	NM_003118		151035920	-1	no_errors	NM_003118	genbank	human	provisional	54_36p	missense	SNP	1.000	T
LCE1D	353134	genome.wustl.edu	37	1	152770314	152770314	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chr1:152770314A>G	ENST00000326233.6	+	2	87	c.44A>G	c.(43-45)aAg>aGg	p.K15R		NM_178352.2	NP_848129.1	Q5T752	LCE1D_HUMAN	late cornified envelope 1D	15	Cys-rich.				cellular response to calcium ion (GO:0071277)|cognition (GO:0050890)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)				large_intestine(1)	1	Lung NSC(65;3.97e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCCCctcccaagtgcactccc	0.612																																																0			1											50.0	49.0	49.0					1																	152770314		2106	3947	6053	151036938	SO:0001583	missense	353134				CCDS1025.1	1q21.3	2008-02-05			ENSG00000172155	ENSG00000172155		"""Late cornified envelopes"""	29465	protein-coding gene	gene with protein product		612606				11698679	Standard	NM_178352		Approved	LEP4	uc009wnp.3	Q5T752	OTTHUMG00000012444	ENST00000326233.6:c.44A>G	1.37:g.152770314A>G	ENSP00000316737:p.Lys15Arg		151036938		Missense_Mutation	SNP	NULL	p.K15R	ENST00000326233.6	37	c.44	CCDS1025.1	1	.	.	.	.	.	.	.	.	.	.	A	10.93	1.490021	0.26686	.	.	ENSG00000172155	ENST00000326233	T	0.06068	3.35	3.78	2.59	0.31030	.	.	.	.	.	T	0.11623	0.0283	M	0.88310	2.945	0.21256	N	0.999746	D	0.64830	0.994	P	0.60609	0.877	T	0.09058	-1.0692	9	0.87932	D	0	.	6.4046	0.21658	0.7813:0.0:0.0:0.2187	.	15	Q5T752	LCE1D_HUMAN	R	15	ENSP00000316737:K15R	ENSP00000316737:K15R	K	+	2	0	LCE1D	151036938	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.769000	0.47654	0.411000	0.25702	0.435000	0.28638	AAG	-	NULL		0.612	LCE1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCE1D	protein_coding	OTTHUMT00000034657.2	A	NM_178352		151036938	+1	no_errors	NM_178352	genbank	human	validated	54_36p	missense	SNP	0.999	G
PRPF40A	55660	genome.wustl.edu	37	2	153529517	153529517	+	Missense_Mutation	SNP	T	T	C			TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chr2:153529517T>C	ENST00000410080.1	-	12	1721	c.1180A>G	c.(1180-1182)Atg>Gtg	p.M394V		NM_017892.3	NP_060362.3	O75400	PR40A_HUMAN	PRP40 pre-mRNA processing factor 40 homolog A (S. cerevisiae)	421	FF 1.				cell cycle (GO:0007049)|cell division (GO:0051301)|cell migration (GO:0016477)|cytoskeleton organization (GO:0007010)|mRNA processing (GO:0006397)|regulation of cell shape (GO:0008360)|regulation of cytokinesis (GO:0032465)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|prostate(1)|urinary_tract(1)	21						TTAATAATCATTTTCATAGCC	0.313																																																0			2											85.0	83.0	83.0					2																	153529517		1826	4081	5907	153237763	SO:0001583	missense	55660			AF049523	CCDS46430.1	2q23.3	2010-01-25	2007-01-12	2006-01-13	ENSG00000196504	ENSG00000196504			16463	protein-coding gene	gene with protein product		612941	"""formin-binding protein 3"", ""formin binding protein 3"", ""PRP40 pre-mRNA processing factor 40 homolog A (yeast)"""	FNBP3		9724750, 12460579	Standard	NM_017892		Approved	FLJ20585, FBP11, HYPA, NY-REN-6, HIP10, FBP-11, FLAF1, Prp40	uc002tyh.4	O75400	OTTHUMG00000154031	ENST00000410080.1:c.1180A>G	2.37:g.153529517T>C	ENSP00000386458:p.Met394Val		153237763	O43856|O75404|Q8TBQ1|Q9H782|Q9NWU9|Q9P0Q2|Q9Y5A8	Missense_Mutation	SNP	superfamily_WW domain,HMMSmart_SM00456,HMMPfam_WW,PatternScan_WW_DOMAIN_1,superfamily_FF domain,HMMSmart_SM00441,HMMPfam_FF	p.M394V	ENST00000410080.1	37	c.1180	CCDS46430.1	2	.	.	.	.	.	.	.	.	.	.	T	15.05	2.718742	0.48622	.	.	ENSG00000196504	ENST00000410080;ENST00000356402;ENST00000440252;ENST00000359961;ENST00000545856	T;T	0.27256	1.68;1.68	5.44	5.44	0.79542	FF domain (4);	0.084158	0.85682	D	0.000000	T	0.15435	0.0372	N	0.03000	-0.44	0.48762	D	0.999705	B;P	0.42518	0.072;0.782	B;P	0.46144	0.071;0.505	T	0.21930	-1.0231	10	0.12103	T	0.63	-11.2322	15.8019	0.78458	0.0:0.0:0.0:1.0	.	421;394	O75400;E9PFS0	PR40A_HUMAN;.	V	394;403;290;341;421	ENSP00000386458:M394V;ENSP00000444656:M421V	ENSP00000348770:M403V	M	-	1	0	PRPF40A	153237763	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.188000	0.50958	2.199000	0.70637	0.533000	0.62120	ATG	-	superfamily_FF domain,HMMSmart_SM00441,HMMPfam_FF		0.313	PRPF40A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRPF40A	protein_coding	OTTHUMT00000333559.2	T	XM_371575		153237763	-1	no_errors	NM_017892	genbank	human	validated	54_36p	missense	SNP	1.000	C
BCAN	63827	genome.wustl.edu	37	1	156621290	156621290	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chr1:156621290C>G	ENST00000329117.5	+	7	1442	c.1106C>G	c.(1105-1107)gCc>gGc	p.A369G	BCAN_ENST00000361588.5_Missense_Mutation_p.A369G|RP11-284F21.7_ENST00000448869.1_RNA	NM_021948.4	NP_068767.3	Q96GW7	PGCB_HUMAN	brevican	369					carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|hippocampus development (GO:0021766)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|hyaluronic acid binding (GO:0005540)			cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	55	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					tccaacccagcctccaaccca	0.587																																																0			1											43.0	42.0	42.0					1																	156621290		2203	4300	6503	154887914	SO:0001583	missense	63827			BC027971	CCDS1149.1, CCDS1150.1	1q31	2013-05-07			ENSG00000132692	ENSG00000132692		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	23059	protein-coding gene	gene with protein product	"""chondroitin sulfate proteoglycan 7"", ""brevican proteoglycan"""	600347				11054543, 11873941	Standard	NM_021948		Approved	BEHAB, MGC13038, CSPG7	uc001fpp.3	Q96GW7	OTTHUMG00000033322	ENST00000329117.5:c.1106C>G	1.37:g.156621290C>G	ENSP00000331210:p.Ala369Gly		154887914	D3DVC2|Q5SZ10|Q5T3I5|Q8TBB9|Q9HBK1|Q9HBK4	Missense_Mutation	SNP	HMMPfam_V-set,HMMSmart_SM00409,superfamily_Immunoglobulin,HMMSmart_SM00406,PatternScan_IG_MHC,superfamily_C-type lectin-like,HMMSmart_SM00445,HMMPfam_Xlink,PatternScan_LINK_1,superfamily_EGF/Laminin,HMMSmart_SM00181,HMMPfam_EGF,PatternScan_EGF_1,PatternScan_EGF_2,HMMSmart_SM00034,HMMPfam_Lectin_C,PatternScan_C_TYPE_LECTIN_1,superfamily_Complement control module/SCR domain,HMMPfam_Sushi,HMMSmart_SM00032	p.A369G	ENST00000329117.5	37	c.1106	CCDS1149.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	1.889|1.889	-0.455950|-0.455950	0.04540|0.04540	.|.	.|.	ENSG00000132692|ENSG00000132692	ENST00000329117;ENST00000361588|ENST00000255029	T;T|.	0.14640|.	2.49;3.21|.	4.72|4.72	-0.99|-0.99	0.10238|0.10238	.|.	0.552370|.	0.15466|.	N|.	0.260887|.	T|T	0.05640|0.05640	0.0148|0.0148	L|L	0.27053|0.27053	0.805|0.805	0.09310|0.09310	N|N	1|1	B;B|.	0.02656|.	0.0;0.0|.	B;B|.	0.09377|.	0.0;0.004|.	T|T	0.35871|0.35871	-0.9771|-0.9771	10|6	0.35671|0.13470	T|T	0.21|0.59	-0.5246|-0.5246	0.4184|0.4184	0.00452|0.00452	0.2887:0.3151:0.141:0.2552|0.2887:0.3151:0.141:0.2552	.|.	369;369|.	Q96GW7;Q96GW7-2|.	PGCB_HUMAN;.|.	G|A	369|310	ENSP00000331210:A369G;ENSP00000354925:A369G|.	ENSP00000331210:A369G|ENSP00000255029:P310A	A|P	+|+	2|1	0|0	BCAN|BCAN	154887914|154887914	0.000000|0.000000	0.05858|0.05858	0.049000|0.049000	0.19019|0.19019	0.266000|0.266000	0.26442|0.26442	-0.319000|-0.319000	0.08039|0.08039	-0.041000|-0.041000	0.13558|0.13558	0.655000|0.655000	0.94253|0.94253	GCC|CCT	-	NULL		0.587	BCAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCAN	protein_coding	OTTHUMT00000081844.2	C	NM_021948		154887914	+1	no_errors	NM_021948	genbank	human	validated	54_36p	missense	SNP	0.002	G
TENM2	57451	genome.wustl.edu	37	5	167625899	167625899	+	Missense_Mutation	SNP	A	A	T			TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chr5:167625899A>T	ENST00000518659.1	+	16	2981	c.2942A>T	c.(2941-2943)cAc>cTc	p.H981L	TENM2_ENST00000520394.1_Missense_Mutation_p.H749L|TENM2_ENST00000519204.1_Missense_Mutation_p.H860L|TENM2_ENST00000545108.1_Missense_Mutation_p.H981L|TENM2_ENST00000403607.2_Missense_Mutation_p.H805L	NM_001122679.1	NP_001116151.1	Q9NT68	TEN2_HUMAN	teneurin transmembrane protein 2	981					axon guidance (GO:0007411)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of filopodium assembly (GO:0051491)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)										TTGACTCTACACTTTGAGCGA	0.542																																																0			5											95.0	98.0	97.0					5																	167625899		2077	4213	6290	167558477	SO:0001583	missense	57451			AB032953		5q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000145934	ENSG00000145934			29943	protein-coding gene	gene with protein product		610119	"""odz, odd Oz/ten-m homolog 2 (Drosophila)"""	ODZ2		10625539	Standard	NM_001122679		Approved	KIAA1127, Ten-M2	uc010jjd.3	Q9NT68	OTTHUMG00000162928	ENST00000518659.1:c.2942A>T	5.37:g.167625899A>T	ENSP00000429430:p.His981Leu		167558477	Q9ULU2	Missense_Mutation	SNP	HMMPfam_Ten_N,superfamily_EGF/Laminin,HMMSmart_SM00181,HMMPfam_EGF_2,PatternScan_EGF_1,PatternScan_EGF_2,HMMPfam_EGF,superfamily_Concanavalin A-like lectins/glucanases,superfamily_Carboxypeptidase regulatory domain,superfamily_NHL repeat,HMMPfam_NHL,HMMPfam_RHS_repeat	p.H981L	ENST00000518659.1	37	c.2942		5	.	.	.	.	.	.	.	.	.	.	A	7.507	0.653817	0.14580	.	.	ENSG00000145934	ENST00000518659;ENST00000545108;ENST00000519204;ENST00000520394;ENST00000403607	T;T;T;T;T	0.13196	2.61;2.61;2.61;2.61;2.61	5.52	5.52	0.82312	Carboxypeptidase-like, regulatory domain (1);Carboxypeptidase, regulatory domain (1);	0.270728	0.43579	D	0.000550	T	0.08133	0.0203	N	0.08118	0	0.54753	D	0.999988	B;B;B	0.32467	0.108;0.014;0.372	B;B;B	0.28385	0.089;0.017;0.08	T	0.35251	-0.9796	10	0.37606	T	0.19	.	15.6352	0.76946	1.0:0.0:0.0:0.0	.	981;981;749	F5H2D1;Q9NT68;F8VNQ3	.;TEN2_HUMAN;.	L	981;981;860;749;805	ENSP00000429430:H981L;ENSP00000438635:H981L;ENSP00000428964:H860L;ENSP00000427874:H749L;ENSP00000384905:H805L	ENSP00000384905:H805L	H	+	2	0	ODZ2	167558477	1.000000	0.71417	1.000000	0.80357	0.718000	0.41266	4.557000	0.60782	2.096000	0.63516	0.460000	0.39030	CAC	-	superfamily_Concanavalin A-like lectins/glucanases,superfamily_Carboxypeptidase regulatory domain		0.542	TENM2-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	ODZ2	protein_coding	OTTHUMT00000376096.1	A	NM_001122679		167558477	+1	no_errors	ENST00000388903	ensembl	human	known	54_36p	missense	SNP	1.000	T
NEK1	4750	genome.wustl.edu	37	4	170327813	170327813	+	Missense_Mutation	SNP	T	T	C			TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chr4:170327813T>C	ENST00000439128.2	-	30	3864	c.3224A>G	c.(3223-3225)gAc>gGc	p.D1075G	NEK1_ENST00000507142.1_Missense_Mutation_p.D1103G|NEK1_ENST00000511633.1_Missense_Mutation_p.D1059G|NEK1_ENST00000512193.1_Missense_Mutation_p.D1006G|NEK1_ENST00000510533.1_Missense_Mutation_p.D1031G	NM_012224.2	NP_036356.1	Q96PY6	NEK1_HUMAN	NIMA-related kinase 1	1075					cellular response to DNA damage stimulus (GO:0006974)|cilium assembly (GO:0042384)|mitotic nuclear division (GO:0007067)|response to ionizing radiation (GO:0010212)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|pericentriolar material (GO:0000242)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			NS(1)|breast(3)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|ovary(2)|prostate(2)|stomach(1)	45		Prostate(90;0.00601)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.0287)|KIRC - Kidney renal clear cell carcinoma(143;0.0325)|Kidney(143;0.0385)|LUSC - Lung squamous cell carcinoma(193;0.14)		TTCAAGATTGTCTTGACGAAC	0.338																																																0			4											77.0	71.0	73.0					4																	170327813		1825	4081	5906	170564388	SO:0001583	missense	4750			AB067488	CCDS47162.1, CCDS56348.1, CCDS56349.1, CCDS56350.1, CCDS56351.1	4q32.3	2012-11-15	2012-11-15		ENSG00000137601	ENSG00000137601			7744	protein-coding gene	gene with protein product		604588	"""NIMA (never in mitosis gene a)-related kinase 1"""			1382974, 8274451	Standard	NM_012224		Approved	NY-REN-55, KIAA1901	uc003isd.2	Q96PY6	OTTHUMG00000160963	ENST00000439128.2:c.3224A>G	4.37:g.170327813T>C	ENSP00000408020:p.Asp1075Gly		170564388	G5E9Z3|Q05DG5|Q14CB7|Q5H9T1|Q6PIB8|Q96SS2|Q9H6P7|Q9Y594	Missense_Mutation	SNP	superfamily_Protein kinase-like (PK-like),HMMSmart_SM00219,HMMSmart_SM00220,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_ST	p.D1075G	ENST00000439128.2	37	c.3224	CCDS47162.1	4	.	.	.	.	.	.	.	.	.	.	T	16.82	3.229318	0.58777	.	.	ENSG00000137601	ENST00000439128;ENST00000511633;ENST00000510533;ENST00000507142;ENST00000512193	T;T;T;T;T	0.52754	0.65;0.65;0.65;0.65;0.65	5.03	5.03	0.67393	.	0.086607	0.49916	D	0.000132	T	0.61924	0.2386	M	0.63428	1.95	0.33641	D	0.60722	D;D;D;D;P	0.62365	0.968;0.984;0.968;0.991;0.947	P;P;P;P;B	0.58970	0.703;0.849;0.747;0.763;0.37	T	0.75045	-0.3456	10	0.66056	D	0.02	.	15.049	0.71850	0.0:0.0:0.0:1.0	.	1006;1059;1103;1031;1075	Q96PY6-4;G5E9Z3;Q96PY6-3;Q96PY6-2;Q96PY6	.;.;.;.;NEK1_HUMAN	G	1075;1059;1031;1103;1006	ENSP00000408020:D1075G;ENSP00000423332:D1059G;ENSP00000427653:D1031G;ENSP00000424757:D1103G;ENSP00000424938:D1006G	ENSP00000408020:D1075G	D	-	2	0	NEK1	170564388	1.000000	0.71417	0.998000	0.56505	0.517000	0.34286	4.896000	0.63222	1.998000	0.58463	0.482000	0.46254	GAC	-	NULL		0.338	NEK1-001	KNOWN	basic|CCDS	protein_coding	NEK1	protein_coding	OTTHUMT00000363157.3	T			170564388	-1	no_errors	NM_012224	genbank	human	validated	54_36p	missense	SNP	0.997	C
RANP6	100128266	genome.wustl.edu	37	4	174555409	174555409	+	IGR	SNP	A	A	G			TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chr4:174555409A>G								RP11-475B2.1 (39702 upstream) : RP11-161D15.2 (262135 downstream)																							AGGTGGCTATACACTTCTCAA	0.463																																																0			4																																								174791984	SO:0001628	intergenic_variant	0																															4.37:g.174555409A>G			174791984		RNA	SNP	-	NULL		37	NULL		4																																																																																			-	-	0	0.463					LOC100128266			A			174791984	-1	pseudogene	XR_037888	genbank	human	model	54_36p	rna	SNP	0.019	G
N4BP3	23138	genome.wustl.edu	37	5	177547467	177547467	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chr5:177547467C>A	ENST00000274605.5	+	3	978	c.619C>A	c.(619-621)Ccc>Acc	p.P207T		NM_015111.1	NP_055926.1	O15049	N4BP3_HUMAN	NEDD4 binding protein 3	207						cytoplasmic vesicle (GO:0031410)|membrane (GO:0016020)				breast(2)|endometrium(3)|kidney(1)|large_intestine(1)|lung(1)|skin(1)	9	all_cancers(89;0.00294)|Renal(175;0.000269)|Lung NSC(126;0.00858)|all_lung(126;0.0139)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TGGCCCTAGCCCCTTCAGCTC	0.672																																																0			5											53.0	58.0	56.0					5																	177547467		2201	4299	6500	177480073	SO:0001583	missense	23138			AB002339	CCDS34307.1	5q35.3	2012-05-17				ENSG00000145911			29852	protein-coding gene	gene with protein product						9205841, 11717310	Standard	XM_006714834		Approved	LZTS4	uc003mik.1	O15049		ENST00000274605.5:c.619C>A	5.37:g.177547467C>A	ENSP00000274605:p.Pro207Thr		177480073	B4DIL3|D3DWP3|Q6ZSQ6|Q7Z6I3	Missense_Mutation	SNP	HMMPfam_Fez1	p.P207T	ENST00000274605.5	37	c.619	CCDS34307.1	5	.	.	.	.	.	.	.	.	.	.	C	15.52	2.859379	0.51376	.	.	ENSG00000145911	ENST00000274605	T	0.00583	6.41	5.0	4.11	0.48088	.	0.541990	0.20860	N	0.084373	T	0.00695	0.0023	L	0.41824	1.3	0.33216	D	0.554089	B	0.06786	0.001	B	0.04013	0.001	T	0.35724	-0.9777	10	0.54805	T	0.06	-26.0836	12.3937	0.55373	0.1693:0.8307:0.0:0.0	.	207	O15049	N4BP3_HUMAN	T	207	ENSP00000274605:P207T	ENSP00000274605:P207T	P	+	1	0	N4BP3	177480073	1.000000	0.71417	0.998000	0.56505	0.723000	0.41478	3.003000	0.49505	1.291000	0.44653	0.563000	0.77884	CCC	-	NULL		0.672	N4BP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	N4BP3	protein_coding	OTTHUMT00000373552.2	C	NM_015111		177480073	+1	no_errors	NM_015111	genbank	human	validated	54_36p	missense	SNP	0.980	A
RNF130	55819	genome.wustl.edu	37	5	179405240	179405240	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chr5:179405240A>G	ENST00000261947.4	-	5	1209	c.811T>C	c.(811-813)Tat>Cat	p.Y271H	RNF130_ENST00000522208.2_Missense_Mutation_p.Y271H|RNF130_ENST00000521389.1_Missense_Mutation_p.Y271H	NM_001280801.1	NP_001267730.1			ring finger protein 130											breast(2)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|upper_aerodigestive_tract(2)	17	all_cancers(89;5.49e-05)|all_epithelial(37;1.94e-05)|Renal(175;0.000159)|Lung NSC(126;0.00118)|all_lung(126;0.00212)	all_cancers(40;0.0294)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TTCTGCTTATAGCTCTCTATG	0.373																																					GBM(24;432 554 38471 39699 51728)											0			5											140.0	124.0	130.0					5																	179405240		2203	4300	6503	179337846	SO:0001583	missense	55819			AF155650	CCDS4451.1, CCDS64340.1	5q35.3	2013-01-09			ENSG00000113269	ENSG00000113269		"""RING-type (C3HC4) zinc fingers"""	18280	protein-coding gene	gene with protein product						10806348	Standard	NM_018434		Approved	GP, G1RZFP, GOLIATH	uc003mll.1	Q86XS8	OTTHUMG00000130909	ENST00000261947.4:c.811T>C	5.37:g.179405240A>G	ENSP00000261947:p.Tyr271His		179337846		Missense_Mutation	SNP	PatternScan_ZF_RING_1,superfamily_SSF52025,HMMPfam_PA,superfamily_SSF57850,HMMSmart_RING,HMMPfam_zf-C3HC4	p.Y271H	ENST00000261947.4	37	c.811		5	.	.	.	.	.	.	.	.	.	.	A	25.2	4.617618	0.87359	.	.	ENSG00000113269	ENST00000522208;ENST00000521389;ENST00000261947	T;T;T	0.45668	0.89;0.89;0.89	5.65	5.65	0.86999	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, RING-H2-type (1);	0.000000	0.85682	D	0.000000	T	0.70491	0.3230	M	0.88979	2.995	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.77024	-0.2741	10	0.87932	D	0	.	15.8125	0.78576	1.0:0.0:0.0:0.0	.	288;271	Q59EL1;Q86XS8	.;GOLI_HUMAN	H	271	ENSP00000429509:Y271H;ENSP00000430237:Y271H;ENSP00000261947:Y271H	ENSP00000261947:Y271H	Y	-	1	0	RNF130	179337846	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	8.215000	0.89762	2.275000	0.75901	0.459000	0.35465	TAT	-	superfamily_SSF57850,HMMSmart_RING,HMMPfam_zf-C3HC4		0.373	RNF130-003	PUTATIVE	basic|exp_conf	protein_coding	RNF130	protein_coding	OTTHUMT00000374205.1	A	NM_018434		179337846	-1	no_errors	NM_018434	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
KCNMB3	27094	genome.wustl.edu	37	3	178968712	178968712	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chr3:178968712G>C	ENST00000314235.5	-	2	590	c.79C>G	c.(79-81)Cct>Gct	p.P27A	KCNMB3_ENST00000392685.2_Missense_Mutation_p.P23A|KCNMB3_ENST00000349697.2_Missense_Mutation_p.P25A|KCNMB3_ENST00000485523.1_Missense_Mutation_p.P5A|KCNMB3_ENST00000497599.1_Missense_Mutation_p.P25A	NM_014407.3	NP_055222.3	Q9NPA1	KCMB3_HUMAN	potassium large conductance calcium-activated channel, subfamily M beta member 3	27					action potential (GO:0001508)|blood coagulation (GO:0007596)|detection of calcium ion (GO:0005513)|neuronal action potential (GO:0019228)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|potassium channel regulator activity (GO:0015459)			NS(1)|large_intestine(1)|lung(2)|stomach(1)	5	all_cancers(143;5.6e-17)|Ovarian(172;0.0172)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;2.41e-27)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.03)		Miconazole(DB01110)|Procaine(DB00721)	CCTGAGGCAGGAAAGGCTGTC	0.522																																																0			3											116.0	108.0	111.0					3																	178968712		2203	4300	6503	180451406	SO:0001583	missense	27094			AF139471	CCDS3225.1, CCDS3226.1, CCDS43172.1, CCDS43173.1, CCDS54683.1	3q26.3-q27	2010-09-30			ENSG00000171121	ENSG00000171121		"""Potassium channels"""	6287	protein-coding gene	gene with protein product		605222		KCNMB2, KCNMBL		10585773	Standard	NM_001163677		Approved		uc003fjm.3	Q9NPA1	OTTHUMG00000157337	ENST00000314235.5:c.79C>G	3.37:g.178968712G>C	ENSP00000319370:p.Pro27Ala		180451406	B7Z9C9|D3DNR2|E9PER5|Q9NPG7|Q9NRM9|Q9UHN3	Missense_Mutation	SNP	PatternScan_PPASE,HMMPfam_CaKB	p.P27A	ENST00000314235.5	37	c.79	CCDS3226.1	3	.	.	.	.	.	.	.	.	.	.	G	15.93	2.977661	0.53720	.	.	ENSG00000171121	ENST00000497599;ENST00000392685;ENST00000349697;ENST00000314235;ENST00000485523	T;T;T;T;T	0.18174	2.23;2.9;2.94;2.99;2.94	6.07	-2.26	0.06867	.	1.472700	0.04038	N	0.302650	T	0.06645	0.0170	N	0.08118	0	0.09310	N	1	B;B;B;B;B	0.33171	0.001;0.007;0.012;0.4;0.278	B;B;B;B;B	0.30855	0.006;0.022;0.022;0.121;0.057	T	0.16424	-1.0403	10	0.11485	T	0.65	-11.5657	2.8077	0.05432	0.3266:0.1341:0.4086:0.1307	.	25;25;5;23;27	E9PER5;Q9NPA1-2;Q9NPA1-4;Q9NPA1-3;Q9NPA1	.;.;.;.;KCMB3_HUMAN	A	25;23;25;27;5	ENSP00000417091:P25A;ENSP00000376451:P23A;ENSP00000327866:P25A;ENSP00000319370:P27A;ENSP00000418536:P5A	ENSP00000319370:P27A	P	-	1	0	KCNMB3	180451406	0.006000	0.16342	0.000000	0.03702	0.636000	0.38137	-0.235000	0.09016	-0.622000	0.05626	0.650000	0.86243	CCT	-	NULL		0.522	KCNMB3-004	KNOWN	basic|CCDS	protein_coding	KCNMB3	protein_coding	OTTHUMT00000348484.1	G			180451406	-1	no_errors	NM_014407	genbank	human	reviewed	54_36p	missense	SNP	0.003	C
TARBP1	6894	genome.wustl.edu	37	1	234556500	234556500	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chr1:234556500A>G	ENST00000040877.1	-	21	3502	c.3503T>C	c.(3502-3504)gTg>gCg	p.V1168A		NM_005646.3	NP_005637.3	Q13395	TARB1_HUMAN	TAR (HIV-1) RNA binding protein 1	1168					regulation of transcription from RNA polymerase II promoter (GO:0006357)|RNA processing (GO:0006396)	nucleus (GO:0005634)	RNA binding (GO:0003723)|RNA methyltransferase activity (GO:0008173)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(7)|large_intestine(6)|lung(22)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	55	Ovarian(103;0.0339)	all_cancers(173;0.00995)|Prostate(94;0.0115)|all_epithelial(177;0.172)	OV - Ovarian serous cystadenocarcinoma(106;0.000263)			TCGGTTTTTCACTCTGTGCTG	0.378																																																0			1											122.0	132.0	129.0					1																	234556500		2203	4300	6503	232623123	SO:0001583	missense	6894				CCDS1601.1	1q42.2	2012-06-12	2007-06-26		ENSG00000059588	ENSG00000059588			11568	protein-coding gene	gene with protein product	"""tRNA methyltransferase 3 homolog (S. cerevisiae)"""	605052	"""Tar (HIV-1) RNA binding protein 1"""			1936997	Standard	NM_005646		Approved	TRP-185, TRM3	uc001hwd.3	Q13395	OTTHUMG00000037947	ENST00000040877.1:c.3503T>C	1.37:g.234556500A>G	ENSP00000040877:p.Val1168Ala		232623123	Q9H581	Missense_Mutation	SNP	superfamily_ARM-type_fold,superfamily_SSF75217,HMMPfam_SpoU_methylase	p.V1168A	ENST00000040877.1	37	c.3503	CCDS1601.1	1	.	.	.	.	.	.	.	.	.	.	A	18.72	3.685144	0.68157	.	.	ENSG00000059588	ENST00000040877	T	0.06768	3.26	5.74	5.74	0.90152	Armadillo-type fold (1);	0.209260	0.41097	D	0.000960	T	0.10594	0.0259	L	0.53249	1.67	0.47819	D	0.999527	B	0.34015	0.435	B	0.30401	0.115	T	0.10222	-1.0639	10	0.30078	T	0.28	-18.6971	15.6946	0.77484	1.0:0.0:0.0:0.0	.	1168	Q13395	TARB1_HUMAN	A	1168	ENSP00000040877:V1168A	ENSP00000040877:V1168A	V	-	2	0	TARBP1	232623123	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.001000	0.88508	2.186000	0.69663	0.528000	0.53228	GTG	-	superfamily_ARM-type_fold		0.378	TARBP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	TARBP1	protein_coding	OTTHUMT00000092616.1	A	NM_005646		232623123	-1	no_errors	NM_005646	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
OPN3	23596	genome.wustl.edu	37	1	241755350	241755350	+	IGR	SNP	C	C	A			TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chr1:241755350C>A	ENST00000366554.2	-	0	2620				KMO_ENST00000366559.4_Silent_p.R452R|KMO_ENST00000366558.3_Silent_p.R439R|KMO_ENST00000366557.4_Silent_p.R418R|OPN3_ENST00000469376.1_5'Flank	NM_014322.2	NP_055137.2	Q9H1Y3	OPN3_HUMAN	opsin 3						detection of light stimulus (GO:0009583)|detection of visible light (GO:0009584)|G-protein coupled receptor signaling pathway (GO:0007186)|phototransduction (GO:0007602)|protein-chromophore linkage (GO:0018298)|regulation of circadian rhythm (GO:0042752)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	G-protein coupled photoreceptor activity (GO:0008020)|G-protein coupled receptor activity (GO:0004930)|photoreceptor activity (GO:0009881)			endometrium(1)|large_intestine(5)|lung(5)	11	Ovarian(103;0.103)|all_lung(81;0.23)	all_cancers(173;0.0231)	OV - Ovarian serous cystadenocarcinoma(106;0.0125)			CTTTCCTCCGCTTGAGAAGAC	0.448																																																0			1											170.0	145.0	153.0					1																	241755350		2203	4300	6503	239821973	SO:0001628	intergenic_variant	8564			AF140242	CCDS31072.1	1q43	2014-06-13	2008-04-16		ENSG00000054277	ENSG00000054277		"""GPCR / Class A : Opsin receptors"""	14007	protein-coding gene	gene with protein product	"""panopsin"", ""protein phosphatase 1, regulatory subunit 116"""	606695	"""encephalopsin"""	ECPN		10234000, 11401433	Standard	NM_014322		Approved	ERO, NMO-1, encephalopsin, PPP1R116	uc001hza.3	Q9H1Y3	OTTHUMG00000039691		1.37:g.241755350C>A			239821973	Q8IX08|Q9Y344	Silent	SNP	superfamily_FAD/NAD(P)-binding domain,HMMPfam_DAO	p.R452	ENST00000366554.2	37	c.1356	CCDS31072.1	1	.	.	.	.	.	.	.	.	.	.	C	2.970	-0.212579	0.06140	.	.	ENSG00000117009	ENST00000366555	.	.	.	5.4	1.03	0.20045	.	.	.	.	.	T	0.23370	0.0565	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.22138	-1.0225	4	.	.	.	.	3.3413	0.07119	0.1924:0.5025:0.0:0.3051	.	.	.	.	I	138	.	.	L	+	1	0	KMO	239821973	0.000000	0.05858	0.008000	0.14137	0.005000	0.04900	-0.434000	0.06939	0.385000	0.24970	0.650000	0.86243	CTT	-	NULL		0.448	OPN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KMO	protein_coding	OTTHUMT00000095713.1	C	NM_014322		239821973	+1	no_errors	NM_003679	genbank	human	validated	54_36p	silent	SNP	0.005	A
FBXL12	54850	genome.wustl.edu	37	19	9931254	9931263	+	5'Flank	DEL	ATATACACAC	ATATACACAC	-	rs71188840|rs375527443|rs368108275|rs10409680	byFrequency	TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	ATATACACAC	ATATACACAC					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chr19:9931254_9931263delATATACACAC	ENST00000247977.4	-	0	0				FBXL12_ENST00000585379.1_Intron|FBXL12_ENST00000586651.1_5'Flank|FBXL12_ENST00000586469.1_5'Flank|FBXL12_ENST00000589626.1_5'Flank|FBXL12_ENST00000586073.1_5'Flank|FBXL12_ENST00000592067.1_5'Flank|AC008752.1_ENST00000401283.1_RNA|SNORA70_ENST00000363367.1_RNA|FBXL12_ENST00000588922.1_5'Flank	NM_017703.1	NP_060173.1	Q9NXK8	FXL12_HUMAN	F-box and leucine-rich repeat protein 12						protein ubiquitination (GO:0016567)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|ubiquitin ligase complex (GO:0000151)				endometrium(4)|kidney(1)|large_intestine(2)|liver(1)|lung(2)	10						atatatatatatataCACACACACACACAC	0.452																																																0			19																																								9792263	SO:0001631	upstream_gene_variant	0			AK000195	CCDS12218.1	19p13.2	2011-06-09				ENSG00000127452		"""F-boxes / Leucine-rich repeats"""	13611	protein-coding gene	gene with protein product		609079				10531037	Standard	XM_005259964		Approved	FLJ20188, Fbl12	uc002mme.3	Q9NXK8			19.37:g.9931254_9931263delATATACACAC	Exception_encountered		9792254	B3KSJ8|Q9H5K4	RNA	DEL	-	NULL	ENST00000247977.4	37	NULL	CCDS12218.1	19																																																																																			(deletion:rna[9792204,9792281])	-		0.452	FBXL12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000216102	protein_coding	OTTHUMT00000450265.1	ATATACACAC	NM_017703		9792263	+1	no_errors	ENST00000401283	ensembl	human	novel	54_36p	rna	DEL	0.000:0.000:0.000:0.001:0.001:0.001:0.001:0.000:0.001:0.000	-
GPRC5B	51704	genome.wustl.edu	37	16	19883796	19883804	+	In_Frame_Del	DEL	GACAGAGCA	GACAGAGCA	-	rs376667953		TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	GACAGAGCA	GACAGAGCA					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chr16:19883796_19883804delGACAGAGCA	ENST00000300571.2	-	2	555_563	c.364_372delTGCTCTGTC	c.(364-372)tgctctgtcdel	p.CSV122del	GPRC5B_ENST00000535671.1_In_Frame_Del_p.CSV122del|GPRC5B_ENST00000569479.1_In_Frame_Del_p.CSV122del|GPRC5B_ENST00000537135.1_In_Frame_Del_p.CSV148del|GPRC5B_ENST00000569847.1_In_Frame_Del_p.CSV122del	NM_016235.1	NP_057319.1	Q9NZH0	GPC5B_HUMAN	G protein-coupled receptor, class C, group 5, member B	122					glucose homeostasis (GO:0042593)|locomotory behavior (GO:0007626)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein tyrosine kinase activity (GO:0061098)	cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane raft (GO:0045121)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|G-protein coupled receptor binding (GO:0001664)|protein kinase activator activity (GO:0030295)|protein kinase binding (GO:0019901)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(11)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25						GGAAGCGGCGGACAGAGCAGATGGTCTCG	0.651																																																0			16																																								19791305	SO:0001651	inframe_deletion	51704			AF202640	CCDS10581.1	16p12	2014-01-30	2014-01-30		ENSG00000167191	ENSG00000167191		"""GPCR / Class C : Orphans"""	13308	protein-coding gene	gene with protein product		605948	"""G protein-coupled receptor, family C, group 1, member B"", ""G protein-coupled receptor, family C, group 5, member B"""			10493829, 10783259	Standard	XM_005255357		Approved	RAIG-2	uc002dgt.3	Q9NZH0	OTTHUMG00000131460	ENST00000300571.2:c.364_372delTGCTCTGTC	16.37:g.19883796_19883804delGACAGAGCA	ENSP00000300571:p.Cys122_Val124del		19791297	D2DFB0|O75205|Q8NBZ8	In_Frame_Del	DEL	PatternScan_G_PROTEIN_RECEP_F3_1,PatternScan_G_PROTEIN_RECEP_F3_2,PatternScan_G_PROTEIN_RECEP_F3_3,HMMPfam_7tm_3	p.CSV122in_frame_del	ENST00000300571.2	37	c.372_364	CCDS10581.1	16																																																																																			(deletion:cds_exon[19790639,19791668])	HMMPfam_7tm_3		0.651	GPRC5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPRC5B	protein_coding	OTTHUMT00000254285.1	GACAGAGCA			19791305	-1	no_errors	NM_016235	genbank	human	reviewed	54_36p	in_frame_del	DEL	0.010:0.007:0.001:0.000:0.847:0.971:0.997:1.000:1.000	-
CELSR2	1952	genome.wustl.edu	37	1	109793348	109793349	+	Frame_Shift_Del	DEL	TG	TG	-			TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	TG	TG					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chr1:109793348_109793349delTG	ENST00000271332.3	+	1	708_709	c.647_648delTG	c.(646-648)ctgfs	p.L216fs		NM_001408.2	NP_001399.1	Q9HCU4	CELR2_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 2	216	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cerebrospinal fluid secretion (GO:0033326)|cilium assembly (GO:0042384)|cilium movement (GO:0003341)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neural plate anterior/posterior regionalization (GO:0021999)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of cell-cell adhesion (GO:0022407)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|ventricular system development (GO:0021591)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(27)|ovary(5)|prostate(1)|skin(3)|urinary_tract(2)	82		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		GCAGGTCGACTGGAGTACACCA	0.629																																					NSCLC(158;1285 2011 34800 34852 42084)											0			1																																								109594872	SO:0001589	frameshift_variant	1952			D87469	CCDS796.1	1p13.3	2014-08-08	2013-02-18		ENSG00000143126	ENSG00000143126		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3231	protein-coding gene	gene with protein product		604265	"""cadherin, EGF LAG seven-pass G-type receptor 2, flamingo (Drosophila) homolog"""	EGFL2		9693030, 10907856	Standard	NM_001408		Approved	KIAA0279, MEGF3, Flamingo1, CDHF10	uc001dxa.4	Q9HCU4	OTTHUMG00000012003	ENST00000271332.3:c.647_648delTG	1.37:g.109793348_109793349delTG	ENSP00000271332:p.Leu216fs		109594871	Q5T2Y7|Q92566	Frame_Shift_Del	DEL	PatternScan_G_PROTEIN_RECEP_F2_1,PatternScan_G_PROTEIN_RECEP_F2_2,superfamily_Cadherin,HMMPfam_Cadherin,HMMSmart_CA,PatternScan_CADHERIN_1,superfamily_SSF57196,HMMSmart_EGF,HMMPfam_EGF,PatternScan_EGF_1,PatternScan_EGF_2,HMMSmart_EGF_CA,superfamily_ConA_like_lec_gl,HMMSmart_LamG,HMMPfam_Laminin_G_2,PatternScan_ASX_HYDROXYL,HMMSmart_TNFR,HMMPfam_Laminin_EGF,HMMSmart_EGF_Lam,PatternScan_EGF_LAM_1,HMMSmart_HormR,HMMPfam_HRM,HMMPfam_GPS,HMMSmart_GPS,HMMPfam_7tm_2	p.L216fs	ENST00000271332.3	37	c.647_648	CCDS796.1	1																																																																																			(deletion:cds_exon[109594225,109597534])	superfamily_Cadherin,HMMPfam_Cadherin,HMMSmart_CA		0.629	CELSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CELSR2	protein_coding	OTTHUMT00000033200.1	TG	NM_001408		109594872	+1	no_errors	NM_001408	genbank	human	reviewed	54_36p	frame_shift_del	DEL	1.000:0.998	-
RNU1-59P	106480167	genome.wustl.edu	37	1	144534187	144534188	+	RNA	DEL	CG	CG	-	rs145815129|rs10578984		TCGA-24-1847-01A-01W-0633-09	TCGA-24-1847-10A-01W-0634-09	CG	CG					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	57a6aa0e-360f-4715-aa71-64ac651cdd40	b78b51da-368f-4bbd-8c53-6fd874b4fc13	g.chr1:144534187_144534188delCG	ENST00000364829.1	+	0	150_151									RNA, U1 small nuclear 59, pseudogene																		gaattgcgttcgcgctttcttc	0.441																																																0			1																																								143245545			0					1q21.1	2013-05-15			ENSG00000201699	ENSG00000201699			48401	pseudogene	RNA, pseudogene							Standard			Approved						1.37:g.144534189_144534190delCG			143245544		RNA	DEL	-	NULL	ENST00000364829.1	37	NULL		1																																																																																			(deletion:rna[143245395,143245556])	-		0.441	RNU1-59P-201	KNOWN	basic	snRNA	ENSG00000201699	snRNA		CG			143245545	+1	no_errors	ENST00000364829	ensembl	human	known	54_36p	rna	DEL	1.000:1.000	-
