#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
EPB41	2035	broad.mit.edu	37	1	29391597	29391597	+	Missense_Mutation	SNP	G	G	C			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr1:29391597G>C	ENST00000343067.4	+	16	2238	c.2111G>C	c.(2110-2112)tGg>tCg	p.W704S	EPB41_ENST00000347529.3_Missense_Mutation_p.W615S|EPB41_ENST00000373798.1_Missense_Mutation_p.W704S|EPB41_ENST00000373797.1_Missense_Mutation_p.W690S|EPB41_ENST00000373800.3_Missense_Mutation_p.W462S|EPB41_ENST00000349460.4_Missense_Mutation_p.W481S|EPB41_ENST00000398863.2_Missense_Mutation_p.W650S|EPB41_ENST00000356093.2_Missense_Mutation_p.W671S	NM_001166005.1	NP_001159477.1	P11171	41_HUMAN	erythrocyte membrane protein band 4.1	704	Spectrin--actin-binding.				actin cytoskeleton organization (GO:0030036)|blood circulation (GO:0008015)|cortical actin cytoskeleton organization (GO:0030866)|positive regulation of protein binding (GO:0032092)	cortical cytoskeleton (GO:0030863)|extrinsic component of membrane (GO:0019898)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	1-phosphatidylinositol binding (GO:0005545)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.W481S(1)		NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(2)|urinary_tract(1)	14		Colorectal(325;3.46e-05)|Prostate(1639;0.000244)|Lung NSC(340;0.00328)|all_lung(284;0.00412)|Breast(348;0.00765)|all_neural(195;0.0199)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)|Medulloblastoma(700;0.123)		Colorectal(126;3.12e-07)|COAD - Colon adenocarcinoma(152;1.21e-05)|STAD - Stomach adenocarcinoma(196;0.00395)|KIRC - Kidney renal clear cell carcinoma(1967;0.0249)|BRCA - Breast invasive adenocarcinoma(304;0.0289)|READ - Rectum adenocarcinoma(331;0.0757)		CCTAGTGAATGGGATAAACGC	0.448																																																1	Substitution - Missense(1)	ovary(1)	1											136.0	119.0	125.0					1																	29391597		2203	4300	6503	29264184	SO:0001583	missense	2035			BC039079	CCDS330.1, CCDS331.1, CCDS332.1, CCDS53288.1, CCDS53289.1	1p33-p32	2014-05-09	2014-05-09		ENSG00000159023	ENSG00000159023			3377	protein-coding gene	gene with protein product		130500	"""elliptocytosis 1, RH-linked"""	EL1			Standard	NM_001166005		Approved	4.1R	uc001brm.2	P11171	OTTHUMG00000003644	ENST00000343067.4:c.2111G>C	1.37:g.29391597G>C	ENSP00000345259:p.Trp704Ser		29264184	B1ALH8|B1ALH9|D3DPM9|D3DPN0|P11176|Q14245|Q5TB35|Q5VXN8|Q8IXV9|Q9Y578|Q9Y579	Missense_Mutation	SNP	ENST00000343067.4	37	CCDS53288.1	.	.	.	.	.	.	.	.	.	.	G	23.8	4.455854	0.84209	.	.	ENSG00000159023	ENST00000358989;ENST00000343067;ENST00000356093;ENST00000398863;ENST00000398861;ENST00000398865;ENST00000349460;ENST00000373800;ENST00000347529;ENST00000373798;ENST00000373797	D;D;D;D;D;D;D;D	0.96136	-2.86;-3.23;-2.04;-3.92;-2.85;-2.31;-2.86;-3.47	5.99	5.99	0.97316	SAB (1);	0.000000	0.85682	D	0.000000	D	0.97626	0.9222	M	0.73598	2.24	0.80722	D	1	D;D;D;D;D;D;D;D;P	0.89917	0.993;1.0;0.996;1.0;1.0;1.0;0.999;0.998;0.508	D;D;D;D;D;D;D;D;B	0.97110	0.969;0.997;0.975;1.0;1.0;0.994;0.986;0.994;0.257	D	0.97282	0.9918	10	0.51188	T	0.08	.	19.4659	0.94939	0.0:0.0:1.0:0.0	.	544;650;704;671;690;667;615;462;481	E9PEX0;E9PEW9;P11171;P11171-2;P11171-7;Q59F12;P11171-5;P11171-4;P11171-3	.;.;41_HUMAN;.;.;.;.;.;.	S	667;704;671;650;544;690;481;462;615;704;690	ENSP00000345259:W704S;ENSP00000348397:W671S;ENSP00000381839:W650S;ENSP00000317597:W481S;ENSP00000362906:W462S;ENSP00000290100:W615S;ENSP00000362904:W704S;ENSP00000362903:W690S	ENSP00000345259:W704S	W	+	2	0	EPB41	29264184	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.476000	0.97823	2.840000	0.97914	0.655000	0.94253	TGG		0.448	EPB41-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010312.1	NM_203342	
NKAIN1	79570	broad.mit.edu	37	1	31654706	31654706	+	Splice_Site	SNP	C	C	G			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr1:31654706C>G	ENST00000373736.2	-	6	621		c.e6+1		NKAIN1_ENST00000263693.1_Splice_Site|NKAIN1_ENST00000398657.2_Splice_Site|NKAIN1_ENST00000528449.1_5'Flank	NM_024522.2	NP_078798.2	Q4KMZ8	NKAI1_HUMAN	Na+/K+ transporting ATPase interacting 1							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.?(1)		breast(1)|cervix(1)|endometrium(1)|kidney(2)|ovary(1)|prostate(1)	7		Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.127)|Breast(348;0.141)|all_neural(195;0.146)|Medulloblastoma(700;0.151)		STAD - Stomach adenocarcinoma(196;0.0184)|READ - Rectum adenocarcinoma(331;0.148)		CCGTGACCCACGTGTACAGAG	0.662																																																1	Unknown(1)	ovary(1)	1											20.0	26.0	24.0					1																	31654706		2202	4298	6500	31427293	SO:0001630	splice_region_variant	79570			AK022712	CCDS339.1, CCDS339.2	1p35.2	2010-06-25	2007-10-04	2007-10-04	ENSG00000084628	ENSG00000084628		"""Na+/K+ transporting ATPase interacting"""	25743	protein-coding gene	gene with protein product		612871	"""family with sequence similarity 77, member C"""	FAM77C		17606467	Standard	NM_024522		Approved	FLJ12650	uc010ogd.2	Q4KMZ8	OTTHUMG00000003788	ENST00000373736.2:c.614+1G>C	1.37:g.31654706C>G			31427293	A2VDJ3|B7Z5F5|B7Z5W9|Q9H9M7	Splice_Site	SNP	ENST00000373736.2	37	CCDS339.2	.	.	.	.	.	.	.	.	.	.	C	27.3	4.815793	0.90790	.	.	ENSG00000084628	ENST00000373736;ENST00000263693;ENST00000398657;ENST00000526106	.	.	.	4.74	3.83	0.44106	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.5494	0.56218	0.0:0.9201:0.0:0.0799	.	.	.	.	.	-1	.	.	.	-	.	.	NKAIN1	31427293	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	5.482000	0.66833	1.221000	0.43506	0.561000	0.74099	.		0.662	NKAIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010655.2	NM_024522	Intron
PCSK9	255738	broad.mit.edu	37	1	55512296	55512296	+	Missense_Mutation	SNP	G	G	T			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr1:55512296G>T	ENST00000302118.5	+	3	790	c.500G>T	c.(499-501)cGg>cTg	p.R167L	PCSK9_ENST00000543384.1_Intron|PCSK9_ENST00000452118.2_Missense_Mutation_p.R167L	NM_174936.3	NP_777596.2	Q8NBP7	PCSK9_HUMAN	proprotein convertase subtilisin/kexin type 9	167					apoptotic process (GO:0006915)|cellular response to insulin stimulus (GO:0032869)|cellular response to starvation (GO:0009267)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|kidney development (GO:0001822)|lipoprotein metabolic process (GO:0042157)|liver development (GO:0001889)|low-density lipoprotein particle receptor catabolic process (GO:0032802)|lysosomal transport (GO:0007041)|negative regulation of low-density lipoprotein particle clearance (GO:0010989)|negative regulation of receptor recycling (GO:0001920)|neurogenesis (GO:0022008)|neuron differentiation (GO:0030182)|phospholipid metabolic process (GO:0006644)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of receptor internalization (GO:0002092)|protein autoprocessing (GO:0016540)|proteolysis (GO:0006508)|regulation of low-density lipoprotein particle receptor catabolic process (GO:0032803)|regulation of neuron apoptotic process (GO:0043523)|regulation of receptor activity (GO:0010469)|triglyceride metabolic process (GO:0006641)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle (GO:0030134)|extracellular space (GO:0005615)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|late endosome (GO:0005770)|lysosome (GO:0005764)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	apolipoprotein binding (GO:0034185)|apolipoprotein receptor binding (GO:0034190)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein particle receptor binding (GO:0050750)|poly(A) RNA binding (GO:0044822)|protein self-association (GO:0043621)|serine-type endopeptidase activity (GO:0004252)|sodium channel inhibitor activity (GO:0019871)|very-low-density lipoprotein particle binding (GO:0034189)|very-low-density lipoprotein particle receptor binding (GO:0070326)	p.R167L(1)		NS(2)|breast(2)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(1)|liver(2)|lung(4)|ovary(3)|prostate(3)|skin(1)|urinary_tract(1)	32						CCACGGTACCGGGCGGATGAA	0.622																																					Pancreas(137;1454 1827 5886 22361 42375)											1	Substitution - Missense(1)	ovary(1)	1											60.0	59.0	59.0					1																	55512296		2203	4300	6503	55284884	SO:0001583	missense	255738			AX207686	CCDS603.1	1p34.1-p32	2014-09-17	2003-05-13		ENSG00000169174	ENSG00000169174			20001	protein-coding gene	gene with protein product		607786	"""hypercholesterolemia, autosomal dominant 3"""	HCHOLA3		12552133, 12730697	Standard	NM_174936		Approved	NARC-1, FH3	uc001cyf.2	Q8NBP7	OTTHUMG00000008136	ENST00000302118.5:c.500G>T	1.37:g.55512296G>T	ENSP00000303208:p.Arg167Leu		55284884	A8T640|C0JYY9|Q5PSM5|Q5SZQ2	Missense_Mutation	SNP	ENST00000302118.5	37	CCDS603.1	.	.	.	.	.	.	.	.	.	.	G	13.30	2.196734	0.38806	.	.	ENSG00000169174	ENST00000302118;ENST00000452118	T;T	0.77098	-1.07;-0.56	4.55	-1.03	0.10102	Peptidase S8/S53, subtilisin/kexin/sedolisin (2);	1.726230	0.03275	N	0.185375	T	0.47210	0.1433	N	0.01668	-0.77	0.09310	N	1	B	0.18610	0.029	B	0.12156	0.007	T	0.38112	-0.9676	10	0.25106	T	0.35	-5.7805	1.0035	0.01482	0.3349:0.2839:0.2418:0.1394	.	167	Q8NBP7	PCSK9_HUMAN	L	167	ENSP00000303208:R167L;ENSP00000401598:R167L	ENSP00000303208:R167L	R	+	2	0	PCSK9	55284884	0.003000	0.15002	0.052000	0.19188	0.254000	0.26022	0.282000	0.18829	0.122000	0.18314	-0.367000	0.07326	CGG		0.622	PCSK9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022280.1	NM_174936	
MAGI3	260425	broad.mit.edu	37	1	114191913	114191913	+	Missense_Mutation	SNP	G	G	C			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr1:114191913G>C	ENST00000307546.9	+	13	2285	c.2210G>C	c.(2209-2211)gGc>gCc	p.G737A	MAGI3_ENST00000369615.1_Missense_Mutation_p.G737A|MAGI3_ENST00000369611.4_Missense_Mutation_p.G737A|MAGI3_ENST00000369617.4_Missense_Mutation_p.G762A	NM_001142782.1	NP_001136254.1	Q5TCQ9	MAGI3_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 3	762					apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|nucleotide phosphorylation (GO:0046939)|positive regulation of JUN kinase activity (GO:0043507)|viral process (GO:0016032)	membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	ATP binding (GO:0005524)|guanylate kinase activity (GO:0004385)	p.G737A(1)		NS(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(9)|ovary(3)|prostate(7)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	41	Lung SC(450;0.184)	all_cancers(81;2.34e-09)|all_epithelial(167;7.41e-09)|all_lung(203;7.13e-06)|Lung NSC(69;1.2e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TCAGGGTTTGGCTTCAGGGTG	0.393																																																1	Substitution - Missense(1)	ovary(1)	1											126.0	126.0	126.0					1																	114191913		2203	4300	6503	113993436	SO:0001583	missense	260425			AF213259	CCDS860.1, CCDS44196.1	1p12-p11.2	2008-02-05			ENSG00000081026	ENSG00000081026			29647	protein-coding gene	gene with protein product		615943				10997877, 10748157	Standard	NM_152900		Approved	MAGI-3	uc001edk.3	Q5TCQ9	OTTHUMG00000011737	ENST00000307546.9:c.2210G>C	1.37:g.114191913G>C	ENSP00000304604:p.Gly737Ala		113993436	Q5TCQ8|Q5TCR0|Q9H2V6|Q9H5Y8|Q9HBC4|Q9HCD8	Missense_Mutation	SNP	ENST00000307546.9	37	CCDS44196.1	.	.	.	.	.	.	.	.	.	.	G	27.9	4.874332	0.91664	.	.	ENSG00000081026	ENST00000369617;ENST00000307546;ENST00000369615;ENST00000369611	D;D;D;D	0.90261	-2.64;-2.64;-2.64;-2.64	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	D	0.97523	0.9189	H	0.98664	4.295	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	D	0.98922	1.0784	10	0.87932	D	0	-20.3727	19.3991	0.94620	0.0:0.0:1.0:0.0	.	737;737;762	Q5TCQ9-4;Q5TCQ9-3;Q5TCQ9-2	.;.;.	A	762;737;737;737	ENSP00000358630:G762A;ENSP00000304604:G737A;ENSP00000358628:G737A;ENSP00000358624:G737A	ENSP00000304604:G737A	G	+	2	0	MAGI3	113993436	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.212000	0.95126	2.583000	0.87209	0.655000	0.94253	GGC		0.393	MAGI3-004	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000032429.1	NM_152900	
CHD1L	9557	broad.mit.edu	37	1	146751843	146751843	+	Missense_Mutation	SNP	A	A	T			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr1:146751843A>T	ENST00000369258.4	+	15	1704	c.1684A>T	c.(1684-1686)Agc>Tgc	p.S562C	CHD1L_ENST00000467213.1_3'UTR|CHD1L_ENST00000431239.1_Missense_Mutation_p.S468C|CHD1L_ENST00000361293.5_Missense_Mutation_p.S281C|CHD1L_ENST00000369259.3_Missense_Mutation_p.S358C	NM_001256336.1|NM_004284.4|NM_024568.2	NP_001243265.1|NP_004275.4|NP_078844.2	Q86WJ1	CHD1L_HUMAN	chromodomain helicase DNA binding protein 1-like	562					ATP catabolic process (GO:0006200)|cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|DNA duplex unwinding (GO:0032508)|DNA repair (GO:0006281)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|nucleotide binding (GO:0000166)	p.S562C(1)		breast(2)|endometrium(4)|kidney(1)|large_intestine(4)|lung(15)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	33	all_hematologic(923;0.0487)					AGAAGGAGGGAGCAGAGATCA	0.517																																																1	Substitution - Missense(1)	ovary(1)	1											75.0	69.0	71.0					1																	146751843		2203	4300	6503	145218467	SO:0001583	missense	9557			AF054177	CCDS927.1, CCDS58021.1, CCDS58022.1, CCDS72882.1	1q21.1	2008-02-05			ENSG00000131778	ENSG00000131778			1916	protein-coding gene	gene with protein product		613039				9653160	Standard	NM_004284		Approved	ALC1	uc001epm.5	Q86WJ1	OTTHUMG00000150271	ENST00000369258.4:c.1684A>T	1.37:g.146751843A>T	ENSP00000358262:p.Ser562Cys		145218467	A5YM64|B4DDE1|B5MDZ7|Q53EZ3|Q5VXX7|Q6DD94|Q6PK83|Q86XH3|Q96HF7|Q96SP3|Q9BVJ1|Q9NVV8	Missense_Mutation	SNP	ENST00000369258.4	37	CCDS927.1	.	.	.	.	.	.	.	.	.	.	A	16.55	3.155849	0.57259	.	.	ENSG00000131778	ENST00000431239;ENST00000369259;ENST00000369258;ENST00000361293	D;T;D;D	0.89617	-2.54;-1.41;-2.45;-1.53	5.96	0.953	0.19590	.	0.937914	0.09256	N	0.827229	D	0.82733	0.5101	L	0.48642	1.525	0.09310	N	1	B;D;P	0.55385	0.429;0.971;0.88	B;P;B	0.53593	0.211;0.73;0.401	T	0.72434	-0.4295	10	0.56958	D	0.05	.	8.1521	0.31148	0.6783:0.0:0.3217:0.0	.	468;358;562	Q86WJ1-2;Q86WJ1-3;Q86WJ1	.;.;CHD1L_HUMAN	C	468;358;562;281	ENSP00000389031:S468C;ENSP00000358263:S358C;ENSP00000358262:S562C;ENSP00000355100:S281C	ENSP00000355100:S281C	S	+	1	0	CHD1L	145218467	0.847000	0.29606	0.009000	0.14445	0.848000	0.48234	2.885000	0.48570	-0.083000	0.12618	0.533000	0.62120	AGC		0.517	CHD1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040377.1	NM_004284	
SV2A	9900	broad.mit.edu	37	1	149881048	149881048	+	Missense_Mutation	SNP	G	G	A			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr1:149881048G>A	ENST00000369146.3	-	7	1745	c.1255C>T	c.(1255-1257)Cgc>Tgc	p.R419C	SV2A_ENST00000369145.1_Missense_Mutation_p.R419C	NM_001278719.1|NM_014849.3	NP_001265648.1|NP_055664.3	Q7L0J3	SV2A_HUMAN	synaptic vesicle glycoprotein 2A	419					cellular calcium ion homeostasis (GO:0006874)|neurotransmitter transport (GO:0006836)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|presynaptic active zone (GO:0048786)|synaptic vesicle (GO:0008021)|synaptic vesicle membrane (GO:0030672)	protein kinase binding (GO:0019901)|receptor activity (GO:0004872)|transmembrane transporter activity (GO:0022857)	p.R419C(2)		breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(8)|lung(16)|ovary(6)|pancreas(1)|prostate(8)|skin(2)|urinary_tract(2)	55	Breast(34;0.00769)|all_hematologic(923;0.127)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)		Levetiracetam(DB01202)	ACCCCCCAGCGCTGGTACCAG	0.577																																																2	Substitution - Missense(2)	ovary(1)|pancreas(1)	1											70.0	71.0	71.0					1																	149881048		2203	4300	6503	148147672	SO:0001583	missense	9900			AB018279	CCDS940.1	1q21.2	2008-02-05			ENSG00000159164	ENSG00000159164			20566	protein-coding gene	gene with protein product		185860				7681585, 10611374	Standard	NM_014849		Approved	SV2, KIAA0736	uc001etg.3	Q7L0J3	OTTHUMG00000012209	ENST00000369146.3:c.1255C>T	1.37:g.149881048G>A	ENSP00000358142:p.Arg419Cys		148147672	D3DUZ7|O94841|Q5QNX8|Q7Z3L6|Q8NBJ6|Q9BVZ9	Missense_Mutation	SNP	ENST00000369146.3	37	CCDS940.1	.	.	.	.	.	.	.	.	.	.	G	24.0	4.482079	0.84747	.	.	ENSG00000159164	ENST00000369146;ENST00000369145	T;T	0.71222	0.47;-0.55	5.38	5.38	0.77491	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.196250	0.45361	D	0.000374	T	0.78091	0.4229	L	0.57536	1.79	0.80722	D	1	D	0.89917	1.0	D	0.70487	0.969	T	0.78383	-0.2225	10	0.59425	D	0.04	-14.8051	16.6795	0.85288	0.0:0.0:1.0:0.0	.	419	Q7L0J3	SV2A_HUMAN	C	419	ENSP00000358142:R419C;ENSP00000358141:R419C	ENSP00000358141:R419C	R	-	1	0	SV2A	148147672	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.555000	0.60767	2.813000	0.96785	0.655000	0.94253	CGC		0.577	SV2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033754.1		
ASH1L	55870	broad.mit.edu	37	1	155448981	155448981	+	Missense_Mutation	SNP	A	A	G			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr1:155448981A>G	ENST00000368346.3	-	3	4319	c.3680T>C	c.(3679-3681)tTt>tCt	p.F1227S	ASH1L_ENST00000392403.3_Missense_Mutation_p.F1227S			Q9NR48	ASH1L_HUMAN	ash1 (absent, small, or homeotic)-like (Drosophila)	1227					cell-cell signaling (GO:0007267)|DNA packaging (GO:0006323)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|tight junction (GO:0005923)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)	p.F1227S(1)		autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(13)|large_intestine(28)|lung(39)|ovary(2)|pancreas(1)|prostate(6)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(4)	124	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			AACATGCTCAAAAGAATGCCT	0.408																																																1	Substitution - Missense(1)	ovary(1)	1											160.0	166.0	164.0					1																	155448981		2203	4300	6503	153715605	SO:0001583	missense	55870			AB037841	CCDS1113.2	1q22	2013-01-28			ENSG00000116539	ENSG00000116539		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	19088	protein-coding gene	gene with protein product		607999				10860993, 16545939	Standard	NM_018489		Approved	huASH1, ASH1, ASH1L1, KMT2H	uc001fkt.3	Q9NR48	OTTHUMG00000014011	ENST00000368346.3:c.3680T>C	1.37:g.155448981A>G	ENSP00000357330:p.Phe1227Ser		153715605	Q59GP1|Q5T714|Q5T715|Q9P2C7	Missense_Mutation	SNP	ENST00000368346.3	37		.	.	.	.	.	.	.	.	.	.	A	12.14	1.849557	0.32699	.	.	ENSG00000116539	ENST00000368346;ENST00000392403	D;D	0.90444	-2.67;-2.67	5.16	5.16	0.70880	.	0.138133	0.49916	D	0.000128	T	0.79353	0.4431	N	0.24115	0.695	0.80722	D	1	B;B	0.33044	0.274;0.395	B;B	0.33339	0.078;0.162	T	0.82859	-0.0249	10	0.59425	D	0.04	.	14.8729	0.70471	1.0:0.0:0.0:0.0	.	1227;1227	Q9NR48;Q9NR48-2	ASH1L_HUMAN;.	S	1227	ENSP00000357330:F1227S;ENSP00000376204:F1227S	ENSP00000357330:F1227S	F	-	2	0	ASH1L	153715605	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.580000	0.82523	2.181000	0.69327	0.477000	0.44152	TTT		0.408	ASH1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000039400.1	NM_018489	
DAP3	7818	broad.mit.edu	37	1	155698874	155698874	+	Silent	SNP	C	C	T			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr1:155698874C>T	ENST00000368336.5	+	8	769	c.645C>T	c.(643-645)agC>agT	p.S215S	DAP3_ENST00000421487.2_Silent_p.S181S|DAP3_ENST00000471642.2_Silent_p.S174S|DAP3_ENST00000535183.1_Silent_p.S174S|MSTO1_ENST00000452804.2_Intron|DAP3_ENST00000343043.3_Silent_p.S215S|MSTO1_ENST00000538143.1_Intron	NM_001199849.1|NM_004632.3	NP_001186778.1|NP_004623.1	P51398	RT29_HUMAN	death associated protein 3	215					apoptotic mitochondrial changes (GO:0008637)|apoptotic signaling pathway (GO:0097190)	mitochondrial ribosome (GO:0005761)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|small ribosomal subunit (GO:0015935)	poly(A) RNA binding (GO:0044822)	p.S215S(1)		breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(12)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	24	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)					AGAGAGAAAGCACTGAGAAAG	0.388																																																1	Substitution - coding silent(1)	ovary(1)	1											95.0	106.0	102.0					1																	155698874		2203	4300	6503	153965498	SO:0001819	synonymous_variant	7818			X83544	CCDS1120.1, CCDS55646.1, CCDS55647.1	1q22	2012-11-14			ENSG00000132676	ENSG00000132676		"""Mitochondrial ribosomal proteins / small subunits"""	2673	protein-coding gene	gene with protein product	"""mitochondrial 28S ribosomal protein S29"""	602074				7499268, 9284927	Standard	NM_004632		Approved	MRPS29, DAP-3, MRP-S29, bMRP-10, MGC126058, MGC126059, DKFZp686G12159	uc001flr.3	P51398	OTTHUMG00000035439	ENST00000368336.5:c.645C>T	1.37:g.155698874C>T			153965498	B4DP59|B4DY62|E7EM60|Q13044|Q68CT7|Q96Q20	Silent	SNP	ENST00000368336.5	37	CCDS1120.1																																																																																				0.388	DAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086042.1	NM_004632	
SLC25A44	9673	broad.mit.edu	37	1	156180069	156180069	+	Missense_Mutation	SNP	G	G	C			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr1:156180069G>C	ENST00000359511.4	+	4	964	c.792G>C	c.(790-792)caG>caC	p.Q264H	PMF1-BGLAP_ENST00000490491.1_5'Flank|SLC25A44_ENST00000469537.1_3'UTR|PMF1-BGLAP_ENST00000320139.5_5'Flank|PMF1_ENST00000368273.4_5'Flank|PMF1_ENST00000368279.3_5'Flank|PMF1_ENST00000368277.3_5'Flank|SLC25A44_ENST00000423538.2_Missense_Mutation_p.Q241H|PMF1-BGLAP_ENST00000368276.4_5'Flank|PMF1_ENST00000567140.1_5'Flank|PMF1_ENST00000565805.1_5'Flank	NM_014655.2	NP_055470.1	Q96H78	S2544_HUMAN	solute carrier family 25, member 44	264					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)		p.Q264H(1)		breast(3)|kidney(2)|large_intestine(2)|lung(1)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14	Hepatocellular(266;0.158)					CCTTCAGACAGCTGATGGCAG	0.542																																																1	Substitution - Missense(1)	ovary(1)	1											167.0	157.0	161.0					1																	156180069		2203	4300	6503	154446693	SO:0001583	missense	9673			AB007915	CCDS1133.1, CCDS72943.1	1q22	2013-05-22			ENSG00000160785	ENSG00000160785		"""Solute carriers"""	29036	protein-coding gene	gene with protein product		610824				16949250	Standard	NM_001286184		Approved	FLJ90431, KIAA0446	uc001fnp.3	Q96H78	OTTHUMG00000014816	ENST00000359511.4:c.792G>C	1.37:g.156180069G>C	ENSP00000352497:p.Gln264His		154446693	O75034	Missense_Mutation	SNP	ENST00000359511.4	37	CCDS1133.1	.	.	.	.	.	.	.	.	.	.	G	12.08	1.830331	0.32329	.	.	ENSG00000160785	ENST00000359511;ENST00000423538	T;T	0.79554	-1.28;-1.28	4.8	2.83	0.33086	Mitochondrial carrier domain (2);	0.000000	0.85682	D	0.000000	T	0.57961	0.2089	L	0.41124	1.26	0.58432	D	0.999994	B;B;B	0.19817	0.039;0.027;0.027	B;B;B	0.24155	0.01;0.051;0.051	T	0.49916	-0.8888	10	0.30854	T	0.27	-0.4055	11.9888	0.53163	0.1417:0.0:0.8583:0.0	.	241;241;264	E9PGQ0;B4DGC4;Q96H78	.;.;S2544_HUMAN	H	264;241	ENSP00000352497:Q264H;ENSP00000407560:Q241H	ENSP00000352497:Q264H	Q	+	3	2	SLC25A44	154446693	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	2.170000	0.42443	0.200000	0.20447	-1.851000	0.00568	CAG		0.542	SLC25A44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040856.1	NM_014655	
LGR6	59352	broad.mit.edu	37	1	202283969	202283969	+	Missense_Mutation	SNP	A	A	G			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr1:202283969A>G	ENST00000367278.3	+	17	1696	c.1607A>G	c.(1606-1608)gAc>gGc	p.D536G	LGR6_ENST00000255432.7_Missense_Mutation_p.D484G|LGR6_ENST00000439764.2_Missense_Mutation_p.D397G	NM_001017403.1	NP_001017403.1	Q9HBX8	LGR6_HUMAN	leucine-rich repeat containing G protein-coupled receptor 6	536					G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of Wnt signaling pathway (GO:0030177)|Wnt signaling pathway (GO:0016055)	integral component of plasma membrane (GO:0005887)|trans-Golgi network membrane (GO:0032588)|vesicle (GO:0031982)	transmembrane signaling receptor activity (GO:0004888)	p.D536G(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(16)|ovary(3)|pancreas(1)|prostate(3)|skin(3)	36						GAGATGGAGGACTCAAAGCCA	0.577																																																1	Substitution - Missense(1)	ovary(1)	1											106.0	94.0	98.0					1																	202283969		2203	4300	6503	200550592	SO:0001583	missense	59352			AF190501	CCDS1424.1, CCDS30971.1, CCDS30972.1	1q32.1	2012-08-21	2011-01-25		ENSG00000133067	ENSG00000133067		"""GPCR / Class A : Orphans"""	19719	protein-coding gene	gene with protein product		606653	"""leucine-rich repeat-containing G protein-coupled receptor 6"""			10935549	Standard	XM_005245404		Approved	FLJ14471	uc001gxu.3	Q9HBX8	OTTHUMG00000041383	ENST00000367278.3:c.1607A>G	1.37:g.202283969A>G	ENSP00000356247:p.Asp536Gly		200550592	Q5T509|Q5T512|Q6UY15|Q86VU0|Q96K69|Q9BYD7	Missense_Mutation	SNP	ENST00000367278.3	37	CCDS30971.1	.	.	.	.	.	.	.	.	.	.	A	15.23	2.771123	0.49680	.	.	ENSG00000133067	ENST00000367278;ENST00000255432;ENST00000439764	D;D;D	0.85955	-2.05;-2.05;-2.05	5.43	5.43	0.79202	.	0.165668	0.53938	D	0.000059	D	0.84343	0.5451	L	0.52266	1.64	0.52099	D	0.999947	P;B;B	0.39424	0.673;0.059;0.34	B;B;B	0.42653	0.248;0.098;0.394	D	0.85484	0.1181	10	0.56958	D	0.05	.	15.529	0.75936	1.0:0.0:0.0:0.0	.	397;484;536	Q9HBX8-1;Q9HBX8-2;Q9HBX8	.;.;LGR6_HUMAN	G	536;484;397	ENSP00000356247:D536G;ENSP00000255432:D484G;ENSP00000387869:D397G	ENSP00000255432:D484G	D	+	2	0	LGR6	200550592	1.000000	0.71417	0.990000	0.47175	0.449000	0.32228	9.324000	0.96373	2.066000	0.61787	0.451000	0.29950	GAC		0.577	LGR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000099143.1	NM_021636	
EIF2D	1939	broad.mit.edu	37	1	206772937	206772937	+	Missense_Mutation	SNP	G	G	T			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr1:206772937G>T	ENST00000271764.2	-	10	1290	c.1082C>A	c.(1081-1083)tCc>tAc	p.S361Y	EIF2D_ENST00000472709.2_5'Flank|EIF2D_ENST00000367114.3_Missense_Mutation_p.S237Y	NM_006893.2	NP_008824.2	P41214	EIF2D_HUMAN	eukaryotic translation initiation factor 2D	361					formation of translation preinitiation complex (GO:0001731)|intracellular protein transport (GO:0006886)|IRES-dependent translational initiation (GO:0002192)|ribosome disassembly (GO:0032790)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	receptor activity (GO:0004872)|translation initiation factor activity (GO:0003743)	p.S361Y(1)		autonomic_ganglia(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(3)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	23						GGAGGTCGGGGAGGGCTCGGG	0.522																																																1	Substitution - Missense(1)	ovary(1)	1											66.0	77.0	74.0					1																	206772937		2203	4300	6503	204839560	SO:0001583	missense	1939			BC001585	CCDS1465.1, CCDS55680.1	1q32.1	2014-05-06	2011-01-19	2011-01-19	ENSG00000143486	ENSG00000143486			6583	protein-coding gene	gene with protein product		613709				20566627	Standard	NM_001201478		Approved	LGTN	uc001heh.2	P41214	OTTHUMG00000184619	ENST00000271764.2:c.1082C>A	1.37:g.206772937G>T	ENSP00000271764:p.Ser361Tyr		204839560	Q5SY40|Q8IXV3|Q96DG3|Q96TG7|Q9NR27|Q9NSN0|Q9NV18|Q9NZ21	Missense_Mutation	SNP	ENST00000271764.2	37	CCDS1465.1	.	.	.	.	.	.	.	.	.	.	G	17.75	3.467237	0.63625	.	.	ENSG00000143486	ENST00000367114;ENST00000271764	T;T	0.46063	0.88;1.45	5.48	5.48	0.80851	.	0.262894	0.41712	D	0.000827	T	0.47229	0.1434	L	0.53249	1.67	0.33971	D	0.646871	P;P	0.51537	0.946;0.676	P;B	0.49999	0.628;0.3	T	0.63532	-0.6616	10	0.62326	D	0.03	-11.3296	11.4044	0.49889	0.0835:0.0:0.9165:0.0	.	237;361	P41214-2;P41214	.;EIF2D_HUMAN	Y	237;361	ENSP00000356081:S237Y;ENSP00000271764:S361Y	ENSP00000271764:S361Y	S	-	2	0	EIF2D	204839560	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.689000	0.46993	2.549000	0.85964	0.655000	0.94253	TCC		0.522	EIF2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088475.1	NM_006893	
MARK1	4139	broad.mit.edu	37	1	220808804	220808804	+	Silent	SNP	C	C	G			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr1:220808804C>G	ENST00000366917.4	+	12	1475	c.1209C>G	c.(1207-1209)tcC>tcG	p.S403S	MARK1_ENST00000366918.4_Silent_p.S381S|MARK1_ENST00000402574.1_Silent_p.S268S					MAP/microtubule affinity-regulating kinase 1									p.S403S(1)		central_nervous_system(2)|endometrium(9)|kidney(6)|large_intestine(12)|lung(22)|ovary(4)|pancreas(1)|skin(3)|stomach(3)|urinary_tract(1)	63				GBM - Glioblastoma multiforme(131;0.0407)		CTCTTCAGTCCCCTGCTCACC	0.463																																																1	Substitution - coding silent(1)	ovary(1)	1											84.0	78.0	80.0					1																	220808804		2203	4300	6503	218875427	SO:0001819	synonymous_variant	4139			AF154845	CCDS31029.2, CCDS65789.1, CCDS73033.1, CCDS73034.1	1q41	2013-06-27			ENSG00000116141	ENSG00000116141			6896	protein-coding gene	gene with protein product		606511				9108484	Standard	NM_018650		Approved	MARK, PAR-1C	uc001hmn.4	Q9P0L2	OTTHUMG00000037351	ENST00000366917.4:c.1209C>G	1.37:g.220808804C>G			218875427		Silent	SNP	ENST00000366917.4	37	CCDS31029.2																																																																																				0.463	MARK1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090899.1		
GALNT2	2590	broad.mit.edu	37	1	230338902	230338902	+	Silent	SNP	C	C	T			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture;Sequenom			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr1:230338902C>T	ENST00000366672.4	+	3	312	c.240C>T	c.(238-240)gaC>gaT	p.D80D	GALNT2_ENST00000541865.1_5'UTR|GALNT2_ENST00000543760.1_Silent_p.D42D	NM_004481.3	NP_004472.1	Q10471	GALT2_HUMAN	polypeptide N-acetylgalactosaminyltransferase 2	80					cellular protein metabolic process (GO:0044267)|immunoglobulin biosynthetic process (GO:0002378)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)|protein O-linked glycosylation via serine (GO:0018242)|protein O-linked glycosylation via threonine (GO:0018243)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	carbohydrate binding (GO:0030246)|manganese ion binding (GO:0030145)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.D80D(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|prostate(5)|skin(2)	32	Breast(184;0.193)|Ovarian(103;0.249)	all_cancers(173;0.156)|Prostate(94;0.179)				GGTGGCCAGACTTTAACCAGG	0.512																																																1	Substitution - coding silent(1)	ovary(1)	1											147.0	148.0	147.0					1																	230338902		2203	4300	6503	228405525	SO:0001819	synonymous_variant	2590			BC041120	CCDS1582.1	1q41-q42	2014-03-13	2014-03-13		ENSG00000143641	ENSG00000143641	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4124	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 2"""	602274	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 2 (GalNAc-T2)"""			9592121, 7592619	Standard	NM_004481		Approved	GalNAc-T2	uc010pwa.1	Q10471	OTTHUMG00000037771	ENST00000366672.4:c.240C>T	1.37:g.230338902C>T			228405525	A8K1Y3|B7Z8V8|C5HU00|Q9NPY4	Silent	SNP	ENST00000366672.4	37	CCDS1582.1																																																																																				0.512	GALNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092158.1	NM_004481	
SLC35F3	148641	broad.mit.edu	37	1	234452363	234452363	+	Missense_Mutation	SNP	C	C	A			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture;Sequenom			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr1:234452363C>A	ENST00000366617.3	+	4	865	c.637C>A	c.(637-639)Ctc>Atc	p.L213I	SLC35F3_ENST00000366618.3_Missense_Mutation_p.L282I			Q8IY50	S35F3_HUMAN	solute carrier family 35, member F3	213					thiamine transport (GO:0015888)	integral component of membrane (GO:0016021)		p.L282I(1)		breast(2)|endometrium(3)|kidney(2)|large_intestine(7)|lung(13)|ovary(2)|skin(2)|urinary_tract(1)	32	Ovarian(103;0.0454)	all_cancers(173;0.145)|Prostate(94;0.0885)	OV - Ovarian serous cystadenocarcinoma(106;0.00531)			GGCCGCCATCCTCGCCATCGC	0.577																																																1	Substitution - Missense(1)	ovary(1)	1											278.0	273.0	275.0					1																	234452363		2203	4300	6503	232518986	SO:0001583	missense	148641				CCDS1600.1, CCDS73050.1	1q42.3	2013-05-22			ENSG00000183780	ENSG00000183780		"""Solute carriers"""	23616	protein-coding gene	gene with protein product							Standard	XM_005273070		Approved	FLJ37712	uc001hvy.1	Q8IY50	OTTHUMG00000037929	ENST00000366617.3:c.637C>A	1.37:g.234452363C>A	ENSP00000355576:p.Leu213Ile		232518986	Q5TDD6|Q8N9C9	Missense_Mutation	SNP	ENST00000366617.3	37		.	.	.	.	.	.	.	.	.	.	C	17.38	3.374162	0.61735	.	.	ENSG00000183780	ENST00000366618;ENST00000366617	T;T	0.30714	1.52;1.52	5.73	4.81	0.61882	Drug/metabolite transporter (1);	0.131978	0.56097	D	0.000026	T	0.31606	0.0802	L	0.56769	1.78	0.52501	D	0.999957	P;P	0.43392	0.805;0.649	P;B	0.45753	0.492;0.359	T	0.01879	-1.1255	10	0.20046	T	0.44	-25.4074	8.3229	0.32140	0.0:0.7856:0.0:0.2144	.	213;282	Q8IY50;Q8IY50-2	S35F3_HUMAN;.	I	282;213	ENSP00000355577:L282I;ENSP00000355576:L213I	ENSP00000355576:L213I	L	+	1	0	SLC35F3	232518986	0.998000	0.40836	1.000000	0.80357	0.982000	0.71751	1.188000	0.32102	2.695000	0.91970	0.655000	0.94253	CTC		0.577	SLC35F3-002	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000128322.1	NM_173508	
GATA3	2625	broad.mit.edu	37	10	8100622	8100622	+	Missense_Mutation	SNP	C	C	T			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr10:8100622C>T	ENST00000346208.3	+	3	1051	c.596C>T	c.(595-597)tCc>tTc	p.S199F	GATA3_ENST00000379328.3_Missense_Mutation_p.S199F|GATA3_ENST00000461472.1_3'UTR			P23771	GATA3_HUMAN	GATA binding protein 3	199					anatomical structure formation involved in morphogenesis (GO:0048646)|anatomical structure morphogenesis (GO:0009653)|aortic valve morphogenesis (GO:0003180)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|canonical Wnt signaling pathway involved in metanephric kidney development (GO:0061290)|cardiac right ventricle morphogenesis (GO:0003215)|cell fate determination (GO:0001709)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|cellular response to interferon-alpha (GO:0035457)|cellular response to interleukin-4 (GO:0071353)|cellular response to tumor necrosis factor (GO:0071356)|defense response (GO:0006952)|developmental growth (GO:0048589)|ear development (GO:0043583)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|interferon-gamma secretion (GO:0072643)|interleukin-4 secretion (GO:0072602)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|lymphocyte migration (GO:0072676)|male gonad development (GO:0008584)|mast cell differentiation (GO:0060374)|mesenchymal to epithelial transition (GO:0060231)|mesonephros development (GO:0001823)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell motility (GO:2000146)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell proliferation involved in mesonephros development (GO:2000607)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway involved in ureteric bud formation (GO:2000703)|negative regulation of glial cell-derived neurotrophic factor receptor signaling pathway involved in ureteric bud formation (GO:2000734)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of transcription, DNA-templated (GO:0045892)|nephric duct formation (GO:0072179)|nephric duct morphogenesis (GO:0072178)|neuron migration (GO:0001764)|norepinephrine biosynthetic process (GO:0042421)|otic vesicle development (GO:0071599)|parathyroid gland development (GO:0060017)|parathyroid hormone secretion (GO:0035898)|pharyngeal system development (GO:0060037)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of interleukin-13 production (GO:0032736)|positive regulation of interleukin-13 secretion (GO:2000667)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-5 production (GO:0032754)|positive regulation of interleukin-5 secretion (GO:2000664)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of signal transduction (GO:0009967)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of thyroid hormone generation (GO:2000611)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ureteric bud formation (GO:0072107)|post-embryonic development (GO:0009791)|pro-T cell differentiation (GO:0002572)|regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043370)|regulation of cellular response to X-ray (GO:2000683)|regulation of cytokine biosynthetic process (GO:0042035)|regulation of establishment of cell polarity (GO:2000114)|regulation of histone H3-K27 methylation (GO:0061085)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to gamma radiation (GO:0010332)|response to virus (GO:0009615)|signal transduction (GO:0007165)|sympathetic nervous system development (GO:0048485)|T cell receptor signaling pathway (GO:0050852)|T-helper 2 cell differentiation (GO:0045064)|thymic T cell selection (GO:0045061)|thymus development (GO:0048538)|TOR signaling (GO:0031929)|transcription from RNA polymerase II promoter (GO:0006366)|type IV hypersensitivity (GO:0001806)|ureter maturation (GO:0035799)|ureteric bud formation (GO:0060676)|uterus development (GO:0060065)|ventricular septum development (GO:0003281)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|enhancer sequence-specific DNA binding (GO:0001158)|HMG box domain binding (GO:0071837)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|zinc ion binding (GO:0008270)	p.S199F(1)		NS(1)|breast(44)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(24)|ovary(3)|skin(2)	87						CTGGAGTCGTCCCACTCCCGT	0.682			"""F, N, S"""		breast		"""HDR syndrome (HYPOPARATHYROIDISM, SENSORINEURAL DEAFNESS, AND RENAL DISEASE)"""																																Rec	yes		10	10p15	2625	GATA binding protein 3	yes	E	1	Substitution - Missense(1)	ovary(1)	10											86.0	77.0	80.0					10																	8100622		2203	4299	6502	8140628	SO:0001583	missense	2625			X55122	CCDS7083.1, CCDS31143.1	10p15	2013-01-25	2001-11-28		ENSG00000107485	ENSG00000107485		"""GATA zinc finger domain containing"""	4172	protein-coding gene	gene with protein product		131320	"""GATA-binding protein 3"""			2050118, 15087456	Standard	NM_002051		Approved	HDR	uc001ijz.3	P23771	OTTHUMG00000017640	ENST00000346208.3:c.596C>T	10.37:g.8100622C>T	ENSP00000341619:p.Ser199Phe		8140628	Q5VWG7|Q5VWG8|Q96J16	Missense_Mutation	SNP	ENST00000346208.3	37	CCDS7083.1	.	.	.	.	.	.	.	.	.	.	C	13.78	2.340082	0.41398	.	.	ENSG00000107485	ENST00000379328;ENST00000346208	D;D	0.96802	-4.13;-4.11	5.55	5.55	0.83447	.	0.448028	0.25732	N	0.028663	D	0.94958	0.8369	L	0.57536	1.79	0.27964	N	0.936649	B;B	0.22346	0.068;0.006	B;B	0.20384	0.029;0.015	D	0.86734	0.1950	10	0.27785	T	0.31	-24.6358	19.5043	0.95108	0.0:1.0:0.0:0.0	.	199;199	P23771;P23771-2	GATA3_HUMAN;.	F	199	ENSP00000368632:S199F;ENSP00000341619:S199F	ENSP00000341619:S199F	S	+	2	0	GATA3	8140628	0.317000	0.24589	0.171000	0.22900	0.662000	0.39071	4.747000	0.62141	2.607000	0.88179	0.561000	0.74099	TCC		0.682	GATA3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000046719.1	NM_001002295	
EPC1	80314	broad.mit.edu	37	10	32560725	32560725	+	Missense_Mutation	SNP	T	T	G			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	T	T	G	G	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr10:32560725T>G	ENST00000263062.8	-	14	2464	c.2195A>C	c.(2194-2196)cAc>cCc	p.H732P	EPC1_ENST00000319778.6_Missense_Mutation_p.H709P|RP11-166N17.1_ENST00000415731.2_RNA|EPC1_ENST00000375110.2_Missense_Mutation_p.H659P	NM_025209.2	NP_079485.1	Q9H2F5	EPC1_HUMAN	enhancer of polycomb homolog 1 (Drosophila)	732					chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of growth (GO:0040008)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Piccolo NuA4 histone acetyltransferase complex (GO:0032777)		p.H732P(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(8)|ovary(5)|urinary_tract(1)	24		Prostate(175;0.0199)				CAGTGCACTGTGGGAACTTGA	0.433																																																1	Substitution - Missense(1)	ovary(1)	10											179.0	170.0	173.0					10																	32560725		2203	4300	6503	32600731	SO:0001583	missense	80314			AF277374	CCDS7172.1, CCDS60511.1, CCDS73083.1	10p11	2005-12-12			ENSG00000120616	ENSG00000120616			19876	protein-coding gene	gene with protein product		610999				10976108	Standard	NM_025209		Approved	Epl1	uc001iwg.2	Q9H2F5	OTTHUMG00000017925	ENST00000263062.8:c.2195A>C	10.37:g.32560725T>G	ENSP00000263062:p.His732Pro		32600731	B4DSC3|D3DRX7|Q5VW54|Q5VW56|Q5VW58|Q8NAQ4|Q8NE21|Q96LF4|Q96RR6|Q9H7T7	Missense_Mutation	SNP	ENST00000263062.8	37	CCDS7172.1	.	.	.	.	.	.	.	.	.	.	T	15.13	2.742593	0.49151	.	.	ENSG00000120616	ENST00000375110;ENST00000319778;ENST00000263062	.	.	.	5.52	5.52	0.82312	.	0.343089	0.36665	N	0.002474	T	0.66277	0.2773	L	0.48642	1.525	0.43191	D	0.995022	B;B;D	0.61697	0.0;0.0;0.99	B;B;P	0.59357	0.0;0.002;0.856	T	0.64356	-0.6427	9	0.34782	T	0.22	-4.4886	15.6876	0.77424	0.0:0.0:0.0:1.0	.	659;709;732	Q9H2F5-3;Q9H2F5-2;Q9H2F5	.;.;EPC1_HUMAN	P	659;709;732	.	ENSP00000263062:H732P	H	-	2	0	EPC1	32600731	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.844000	0.55873	2.101000	0.63845	0.378000	0.23410	CAC		0.433	EPC1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000047484.1		
ARHGAP22	58504	broad.mit.edu	37	10	49654532	49654532	+	Missense_Mutation	SNP	C	C	G			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr10:49654532C>G	ENST00000249601.4	-	10	2295	c.1999G>C	c.(1999-2001)Gag>Cag	p.E667Q	ARHGAP22_ENST00000477708.2_Missense_Mutation_p.E500Q|ARHGAP22_ENST00000435790.2_Missense_Mutation_p.E673Q|ARHGAP22_ENST00000374170.1_Missense_Mutation_p.E508Q|ARHGAP22_ENST00000417247.2_Missense_Mutation_p.E577Q|ARHGAP22_ENST00000374172.1_Missense_Mutation_p.E558Q|ARHGAP22_ENST00000417912.2_Missense_Mutation_p.E683Q	NM_001256024.1|NM_021226.3	NP_001242953.1|NP_067049.2	Q7Z5H3	RHG22_HUMAN	Rho GTPase activating protein 22	667					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription, DNA-templated (GO:0006355)|small GTPase mediated signal transduction (GO:0007264)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)	p.E667Q(1)		endometrium(3)|large_intestine(3)|lung(7)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						TTCCTCCTCTCCGCATCCTCC	0.502																																																1	Substitution - Missense(1)	ovary(1)	10											147.0	140.0	142.0					10																	49654532		2203	4300	6503	49324538	SO:0001583	missense	58504			AY324801	CCDS7227.1, CCDS58079.1, CCDS58080.1, CCDS58081.1	10q11.23	2013-01-10			ENSG00000128805	ENSG00000128805		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	30320	protein-coding gene	gene with protein product		610585				8619474	Standard	NM_021226		Approved	RhoGAP2	uc010qgm.3	Q7Z5H3	OTTHUMG00000018176	ENST00000249601.4:c.1999G>C	10.37:g.49654532C>G	ENSP00000249601:p.Glu667Gln		49324538	A0AVP7|A5YM75|B4DED8|B9EGA0|C9JDM2|O00152|Q6ZSB0	Missense_Mutation	SNP	ENST00000249601.4	37	CCDS7227.1	.	.	.	.	.	.	.	.	.	.	C	18.42	3.619823	0.66787	.	.	ENSG00000128805	ENST00000249601;ENST00000374172;ENST00000374170;ENST00000477708;ENST00000417247;ENST00000435790;ENST00000417912	T;T;T;T;T;T;T	0.62105	0.05;0.05;0.05;0.05;0.05;0.05;0.05	4.16	4.16	0.48862	.	0.000000	0.85682	D	0.000000	T	0.78916	0.4359	M	0.78916	2.43	0.58432	D	0.999992	D;D;D;D;D;D	0.89917	0.999;0.999;0.998;0.999;1.0;1.0	D;D;D;D;D;D	0.85130	0.994;0.994;0.994;0.994;0.997;0.997	T	0.82313	-0.0519	10	0.62326	D	0.03	.	15.4296	0.75081	0.0:1.0:0.0:0.0	.	673;667;683;667;577;500	B4DED8;A6NDI7;Q7Z5H3-2;Q7Z5H3;Q7Z5H3-3;D6R9V6	.;.;.;RHG22_HUMAN;.;.	Q	667;558;508;500;577;673;683	ENSP00000249601:E667Q;ENSP00000363287:E558Q;ENSP00000363285:E508Q;ENSP00000422868:E500Q;ENSP00000410054:E577Q;ENSP00000416701:E673Q;ENSP00000412461:E683Q	ENSP00000249601:E667Q	E	-	1	0	ARHGAP22	49324538	1.000000	0.71417	0.769000	0.31535	0.367000	0.29736	7.632000	0.83247	1.869000	0.54173	0.491000	0.48974	GAG		0.502	ARHGAP22-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000358767.1	NM_021226	
ADK	132	broad.mit.edu	37	10	75984351	75984351	+	Splice_Site	SNP	T	T	G			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	T	T	G	G	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr10:75984351T>G	ENST00000286621.2	+	3	244		c.e3+2		ADK_ENST00000539909.1_Splice_Site|ADK_ENST00000372734.3_Splice_Site|ADK_ENST00000541550.1_Intron	NM_006721.3	NP_006712.2	P55263	ADK_HUMAN	adenosine kinase						adenosine metabolic process (GO:0046085)|AMP salvage (GO:0044209)|circadian regulation of gene expression (GO:0032922)|dATP biosynthetic process (GO:0006175)|nucleobase-containing small molecule metabolic process (GO:0055086)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of T cell proliferation (GO:0042102)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|ribonucleoside monophosphate biosynthetic process (GO:0009156)|small molecule metabolic process (GO:0044281)|type B pancreatic cell proliferation (GO:0044342)	cytosol (GO:0005829)|nucleus (GO:0005634)	adenosine kinase activity (GO:0004001)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|phosphotransferase activity, alcohol group as acceptor (GO:0016773)|poly(A) RNA binding (GO:0044822)	p.?(1)		breast(1)|large_intestine(2)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	8	Prostate(51;0.0112)|Ovarian(15;0.148)				Abacavir(DB01048)|Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)|Adenosine(DB00640)|Ribavirin(DB00811)	CAAGGAACTGTAAGTGCATTA	0.308																																																1	Unknown(1)	ovary(1)	10											111.0	98.0	102.0					10																	75984351		2203	4300	6503	75654357	SO:0001630	splice_region_variant	132			U50196	CCDS7343.1, CCDS7344.1, CCDS55716.1, CCDS55717.1	10q22.2	2006-02-21			ENSG00000156110	ENSG00000156110	2.7.1.20		257	protein-coding gene	gene with protein product	"""adenosine 5'-phosphotransferase"""	102750				8577746	Standard	NM_001123		Approved	AK	uc001jwi.3	P55263	OTTHUMG00000018506	ENST00000286621.2:c.194+2T>G	10.37:g.75984351T>G			75654357	B7Z783|B7Z800|O00741|O00742|Q16710|Q5JQ10|Q5JQ11|Q9BTN2	Splice_Site	SNP	ENST00000286621.2	37	CCDS7343.1	.	.	.	.	.	.	.	.	.	.	T	17.55	3.417497	0.62622	.	.	ENSG00000156110	ENST00000539909;ENST00000286621;ENST00000372734	.	.	.	5.0	5.0	0.66597	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.2994	0.49295	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	ADK	75654357	1.000000	0.71417	1.000000	0.80357	0.748000	0.42578	4.632000	0.61311	2.237000	0.73441	0.459000	0.35465	.		0.308	ADK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048763.1	NM_001123, NM_006721	Intron
SORCS3	22986	broad.mit.edu	37	10	106675692	106675692	+	Splice_Site	SNP	T	T	C			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture;Sequenom			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr10:106675692T>C	ENST00000369701.3	+	3	1022		c.e3+2			NM_014978.1	NP_055793.1	Q9UPU3	SORC3_HUMAN	sortilin-related VPS10 domain containing receptor 3						learning (GO:0007612)|memory (GO:0007613)|neuropeptide signaling pathway (GO:0007218)|regulation of long term synaptic depression (GO:1900452)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal postsynaptic density (GO:0097481)	neuropeptide receptor activity (GO:0008188)	p.?(1)		autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(19)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	131		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)		AAAAGGAAGGTAAGAGACTGG	0.448																																					NSCLC(116;1497 1690 7108 13108 14106)											1	Unknown(1)	ovary(1)	10											113.0	97.0	102.0					10																	106675692		2203	4300	6503	106665682	SO:0001630	splice_region_variant	22986			AB028982	CCDS7558.1	10q23-q25	2006-04-12			ENSG00000156395	ENSG00000156395			16699	protein-coding gene	gene with protein product		606285				11499680	Standard	NM_014978		Approved	KIAA1059, SORCS	uc001kyi.1	Q9UPU3	OTTHUMG00000019011	ENST00000369701.3:c.795+2T>C	10.37:g.106675692T>C			106665682	Q5VXF9|Q9NQJ2	Splice_Site	SNP	ENST00000369701.3	37	CCDS7558.1	.	.	.	.	.	.	.	.	.	.	T	25.0	4.590249	0.86851	.	.	ENSG00000156395	ENST00000369701	.	.	.	5.32	5.32	0.75619	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.2815	0.73787	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	SORCS3	106665682	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.694000	0.84235	2.015000	0.59207	0.533000	0.62120	.		0.448	SORCS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050221.1	NM_014978	Intron
NR1H3	10062	broad.mit.edu	37	11	47282969	47282969	+	Missense_Mutation	SNP	G	G	A			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr11:47282969G>A	ENST00000467728.1	+	4	1915	c.677G>A	c.(676-678)cGg>cAg	p.R226Q	NR1H3_ENST00000405576.1_Missense_Mutation_p.R181Q|NR1H3_ENST00000441012.2_Missense_Mutation_p.R226Q|NR1H3_ENST00000529540.1_3'UTR|NR1H3_ENST00000405853.3_Missense_Mutation_p.R226Q|NR1H3_ENST00000481889.2_Missense_Mutation_p.R181Q|NR1H3_ENST00000407404.1_Missense_Mutation_p.R226Q|NR1H3_ENST00000527949.1_Missense_Mutation_p.R135Q|NR1H3_ENST00000395397.3_Missense_Mutation_p.R181Q			Q13133	NR1H3_HUMAN	nuclear receptor subfamily 1, group H, member 3	226	Ligand-binding. {ECO:0000255}.				apoptotic cell clearance (GO:0043277)|cellular lipid metabolic process (GO:0044255)|cellular response to lipopolysaccharide (GO:0071222)|cholesterol homeostasis (GO:0042632)|gene expression (GO:0010467)|lipid homeostasis (GO:0055088)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interferon-gamma-mediated signaling pathway (GO:0060336)|negative regulation of lipid transport (GO:0032369)|negative regulation of macrophage activation (GO:0043031)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|negative regulation of pancreatic juice secretion (GO:0090188)|negative regulation of pinocytosis (GO:0048550)|negative regulation of proteolysis (GO:0045861)|negative regulation of secretion of lysosomal enzymes (GO:0090341)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of cholesterol homeostasis (GO:2000189)|positive regulation of cholesterol transport (GO:0032376)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of toll-like receptor 4 signaling pathway (GO:0034145)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of triglyceride biosynthetic process (GO:0010867)|regulation of cholesterol homeostasis (GO:2000188)|regulation of circadian rhythm (GO:0042752)|response to progesterone (GO:0032570)|sterol homeostasis (GO:0055092)|transcription initiation from RNA polymerase II promoter (GO:0006367)|triglyceride homeostasis (GO:0070328)	nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	cholesterol binding (GO:0015485)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|steroid hormone receptor activity (GO:0003707)|sterol response element binding (GO:0032810)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.R226Q(1)		endometrium(1)|kidney(2)|large_intestine(6)|lung(6)|ovary(5)	20						CAGTGTAACCGGCGCTCCTTT	0.622																																																1	Substitution - Missense(1)	ovary(1)	11											56.0	54.0	54.0					11																	47282969		2201	4298	6499	47239545	SO:0001583	missense	10062			U22662	CCDS7929.1, CCDS44584.1, CCDS44585.1, CCDS73285.1	11p11.2	2013-01-16			ENSG00000025434	ENSG00000025434		"""Nuclear hormone receptors"""	7966	protein-coding gene	gene with protein product	"""liver X receptor-alpha"""	602423				8621574, 7744246	Standard	NM_005693		Approved	LXR-a, RLD-1	uc009ylm.3	Q13133	OTTHUMG00000150628	ENST00000467728.1:c.677G>A	11.37:g.47282969G>A	ENSP00000420656:p.Arg226Gln		47239545	A8K3J9|D3DQR1|Q8IW13|Q96H87	Missense_Mutation	SNP	ENST00000467728.1	37	CCDS7929.1	.	.	.	.	.	.	.	.	.	.	G	4.656	0.122010	0.08931	.	.	ENSG00000025434	ENST00000395397;ENST00000405576;ENST00000481889;ENST00000531660;ENST00000407404;ENST00000441012;ENST00000467728;ENST00000405853;ENST00000527949	D;D;D;T;D;D;D;D;D	0.95001	-3.58;-3.07;-3.0;0.92;-3.08;-3.58;-3.58;-3.08;-3.28	5.35	0.195	0.15151	Nuclear hormone receptor, ligand-binding (2);	0.490245	0.21912	N	0.067300	T	0.78394	0.4276	N	0.01705	-0.755	0.23459	N	0.997636	B;B;B;B;B	0.19583	0.0;0.0;0.0;0.037;0.001	B;B;B;B;B	0.08055	0.0;0.0;0.0;0.003;0.002	T	0.69453	-0.5141	10	0.09590	T	0.72	.	5.4135	0.16360	0.4661:0.0:0.4031:0.1308	.	232;181;226;181;226	B4DXU5;B5MBY7;Q13133;E9PLL4;Q13133-2	.;.;NR1H3_HUMAN;.;.	Q	181;181;181;92;226;226;226;226;135	ENSP00000378793:R181Q;ENSP00000385073:R181Q;ENSP00000433271:R181Q;ENSP00000434650:R92Q;ENSP00000385801:R226Q;ENSP00000387946:R226Q;ENSP00000420656:R226Q;ENSP00000384745:R226Q;ENSP00000432073:R135Q	ENSP00000378793:R181Q	R	+	2	0	NR1H3	47239545	0.938000	0.31826	0.247000	0.24249	0.929000	0.56500	1.643000	0.37217	-0.041000	0.13558	-0.732000	0.03574	CGG		0.622	NR1H3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319214.3		
OOSP2	219990	broad.mit.edu	37	11	59814511	59814511	+	Missense_Mutation	SNP	T	T	A			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	T	T	A	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr11:59814511T>A	ENST00000278855.2	+	4	627	c.442T>A	c.(442-444)Tta>Ata	p.L148I		NM_173801.3	NP_776162.2	Q86WS3	OOSP2_HUMAN		148						extracellular region (GO:0005576)		p.L148I(1)		breast(1)|lung(9)|ovary(2)|prostate(2)|skin(1)	15						AGCAGAAGAGTTAGGATTATT	0.358																																																1	Substitution - Missense(1)	ovary(1)	11											107.0	108.0	108.0					11																	59814511		2201	4295	6496	59571087	SO:0001583	missense	219990																														ENST00000278855.2:c.442T>A	11.37:g.59814511T>A	ENSP00000278855:p.Leu148Ile		59571087	E9PJA4|Q8N9U6	Missense_Mutation	SNP	ENST00000278855.2	37	CCDS7979.1	.	.	.	.	.	.	.	.	.	.	T	14.85	2.659368	0.47467	.	.	ENSG00000149507	ENST00000278855	.	.	.	3.28	-1.98	0.07480	.	0.343029	0.16247	N	0.222868	T	0.45875	0.1364	L	0.50333	1.59	0.80722	D	1	D	0.60160	0.987	P	0.50405	0.64	T	0.45963	-0.9225	9	0.49607	T	0.09	-5.1687	3.3138	0.07026	0.2264:0.3779:0.0:0.3956	.	148	Q86WS3	PLACL_HUMAN	I	148	.	ENSP00000278855:L148I	L	+	1	2	PLAC1L	59571087	0.573000	0.26676	0.949000	0.38748	0.867000	0.49689	-1.124000	0.03260	-0.428000	0.07339	-0.388000	0.06559	TTA		0.358	PLAC1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394411.1		
OR8D1	283159	broad.mit.edu	37	11	124180084	124180084	+	Missense_Mutation	SNP	G	G	C			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr11:124180084G>C	ENST00000357821.2	-	1	649	c.579C>G	c.(577-579)caC>caG	p.H193Q		NM_001002917.1	NP_001002917.1	Q8WZ84	OR8D1_HUMAN	olfactory receptor, family 8, subfamily D, member 1	193						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.H193Q(1)		kidney(1)|large_intestine(1)|lung(7)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0528)		GCTCATTGAGGTGTGTGTTGG	0.463																																																1	Substitution - Missense(1)	ovary(1)	11											59.0	48.0	52.0					11																	124180084		2200	4299	6499	123685294	SO:0001583	missense	283159			AF238489	CCDS31706.1	11q25	2012-08-09			ENSG00000196341	ENSG00000196341		"""GPCR / Class A : Olfactory receptors"""	8481	protein-coding gene	gene with protein product				OR8D3			Standard	NM_001002917		Approved	OST004	uc010sag.2	Q8WZ84	OTTHUMG00000165977	ENST00000357821.2:c.579C>G	11.37:g.124180084G>C	ENSP00000350474:p.His193Gln		123685294	B2RNL4|Q6IEW1|Q8NGH0	Missense_Mutation	SNP	ENST00000357821.2	37	CCDS31706.1	.	.	.	.	.	.	.	.	.	.	g	10.55	1.382482	0.24944	.	.	ENSG00000196341	ENST00000357821	T	0.00076	8.76	4.29	-7.86	0.01187	GPCR, rhodopsin-like superfamily (1);	1.358100	0.05592	U	0.574897	T	0.00109	0.0003	L	0.27944	0.81	0.09310	N	1	B	0.18166	0.026	B	0.16289	0.015	T	0.25082	-1.0142	10	0.72032	D	0.01	.	4.0686	0.09872	0.5499:0.0846:0.2233:0.1422	.	193	Q8WZ84	OR8D1_HUMAN	Q	193	ENSP00000350474:H193Q	ENSP00000350474:H193Q	H	-	3	2	OR8D1	123685294	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.462000	0.00997	-1.344000	0.02216	-0.363000	0.07495	CAC		0.463	OR8D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387285.1	NM_001002917	
ABCC9	10060	broad.mit.edu	37	12	22012550	22012550	+	Silent	SNP	C	C	T	rs587780845		TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr12:22012550C>T	ENST00000261201.4	-	20	2474	c.2475G>A	c.(2473-2475)gcG>gcA	p.A825A	ABCC9_ENST00000345162.2_Silent_p.A789A|RP11-729I10.2_ENST00000539874.1_RNA|ABCC9_ENST00000261200.4_Silent_p.A825A	NM_005691.2	NP_005682.2	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 9	825	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				defense response to virus (GO:0051607)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	ATP-sensitive potassium channel complex (GO:0008282)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcomere (GO:0030017)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium channel activity (GO:0005267)|potassium channel regulator activity (GO:0015459)|sulfonylurea receptor activity (GO:0008281)|transporter activity (GO:0005215)	p.A825A(1)		NS(2)|breast(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|lung(56)|ovary(4)|pancreas(1)|prostate(4)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(5)	118					Adenosine triphosphate(DB00171)|Glyburide(DB01016)	TTTGATACAGCGCTCGTGCCA	0.398																																																1	Substitution - coding silent(1)	ovary(1)	12											189.0	187.0	188.0					12																	22012550		2203	4300	6503	21903817	SO:0001819	synonymous_variant	10060			AF061323	CCDS8693.1, CCDS8694.1	12p12.1	2014-09-17			ENSG00000069431	ENSG00000069431		"""ATP binding cassette transporters / subfamily C"""	60	protein-coding gene	gene with protein product	"""sulfonylurea receptor 2"""	601439				9457174, 15034580	Standard	NM_020297		Approved	SUR2, CMD1O	uc001rfh.3	O60706	OTTHUMG00000169094	ENST00000261201.4:c.2475G>A	12.37:g.22012550C>T			21903817	O60707	Silent	SNP	ENST00000261201.4	37	CCDS8694.1																																																																																				0.398	ABCC9-002	KNOWN	not_organism_supported|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000402230.1	NM_005691	
LRRK2	120892	broad.mit.edu	37	12	40715934	40715934	+	Missense_Mutation	SNP	C	C	A			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr12:40715934C>A	ENST00000298910.7	+	36	5326	c.5268C>A	c.(5266-5268)gaC>gaA	p.D1756E		NM_198578.3	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	1756					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|autophagy (GO:0006914)|cellular protein localization (GO:0034613)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|endocytosis (GO:0006897)|exploration behavior (GO:0035640)|GTP catabolic process (GO:0006184)|intracellular distribution of mitochondria (GO:0048312)|intracellular signal transduction (GO:0035556)|locomotory exploration behavior (GO:0035641)|MAPK cascade (GO:0000165)|negative regulation of GTPase activity (GO:0034260)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of late endosome to lysosome transport (GO:1902823)|negative regulation of peroxidase activity (GO:2000469)|negative regulation of protein binding (GO:0032091)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein processing (GO:0010955)|negative regulation of protein processing involved in protein targeting to mitochondrion (GO:1903217)|negative regulation of protein targeting to mitochondrion (GO:1903215)|negative regulation of thioredoxin peroxidase activity by peptidyl-threonine phosphorylation (GO:1903125)|neuromuscular junction development (GO:0007528)|neuron death (GO:0070997)|neuron projection morphogenesis (GO:0048812)|olfactory bulb development (GO:0021772)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of autophagy (GO:0010508)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of programmed cell death (GO:0043068)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein autoubiquitination (GO:1902499)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of kidney size (GO:0035564)|regulation of locomotion (GO:0040012)|regulation of membrane potential (GO:0042391)|regulation of mitochondrial depolarization (GO:0051900)|regulation of neuroblast proliferation (GO:1902692)|regulation of neuron death (GO:1901214)|regulation of neuron maturation (GO:0014041)|regulation of protein kinase A signaling (GO:0010738)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of synaptic vesicle exocytosis (GO:2000300)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic side of mitochondrial outer membrane (GO:0032473)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)|ATP binding (GO:0005524)|clathrin binding (GO:0030276)|glycoprotein binding (GO:0001948)|GTP binding (GO:0005525)|GTP-dependent protein kinase activity (GO:0034211)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|MAP kinase kinase activity (GO:0004708)|peroxidase inhibitor activity (GO:0036479)|protein homodimerization activity (GO:0042803)|protein kinase A binding (GO:0051018)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|tubulin binding (GO:0015631)	p.D1756E(1)		NS(3)|biliary_tract(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(23)|large_intestine(31)|lung(55)|ovary(15)|pancreas(2)|prostate(4)|skin(4)|stomach(9)|upper_aerodigestive_tract(7)|urinary_tract(2)	181	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				AAGTCTTAGACAATCATCCAG	0.348																																																1	Substitution - Missense(1)	ovary(1)	12											74.0	77.0	76.0					12																	40715934		2203	4299	6502	39002201	SO:0001583	missense	120892			AK026776	CCDS31774.1	12q12	2011-07-21			ENSG00000188906	ENSG00000188906		"""Parkinson disease"""	18618	protein-coding gene	gene with protein product		609007	"""Parkinson disease (autosomal dominant) 8"""	PARK8		15541308	Standard	NM_198578		Approved	ROCO2, DKFZp434H2111, FLJ45829, RIPK7	uc001rmg.4	Q5S007	OTTHUMG00000059742	ENST00000298910.7:c.5268C>A	12.37:g.40715934C>A	ENSP00000298910:p.Asp1756Glu		39002201	A6NJU2|Q6ZS50|Q8NCX9	Missense_Mutation	SNP	ENST00000298910.7	37	CCDS31774.1	.	.	.	.	.	.	.	.	.	.	C	1.420	-0.573068	0.03882	.	.	ENSG00000188906	ENST00000298910	T	0.69175	-0.38	5.73	-0.191	0.13252	.	0.153463	0.64402	D	0.000019	T	0.35682	0.0940	N	0.10916	0.065	0.25457	N	0.987959	B;B	0.13145	0.001;0.007	B;B	0.09377	0.003;0.004	T	0.14896	-1.0456	10	0.11794	T	0.64	.	4.342	0.11115	0.2345:0.4447:0.0:0.3208	.	1756;1756	Q17RV3;Q5S007	.;LRRK2_HUMAN	E	1756	ENSP00000298910:D1756E	ENSP00000298910:D1756E	D	+	3	2	LRRK2	39002201	0.976000	0.34144	0.054000	0.19295	0.983000	0.72400	0.298000	0.19120	-0.338000	0.08413	-0.378000	0.06908	GAC		0.348	LRRK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277179.1	XM_058513	
HOXC6	3223	broad.mit.edu	37	12	54422532	54422532	+	Missense_Mutation	SNP	C	C	A			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr12:54422532C>A	ENST00000243108.4	+	1	391	c.227C>A	c.(226-228)tCc>tAc	p.S76Y	RP11-834C11.12_ENST00000513209.1_Intron|RP11-834C11.14_ENST00000512206.1_RNA|HOXC4_ENST00000303406.4_Intron|HOXC6_ENST00000394331.3_5'UTR	NM_004503.3	NP_004494.1	P09630	HXC6_HUMAN	homeobox C6	76					anterior/posterior pattern specification (GO:0009952)|embryonic skeletal system development (GO:0048706)|multicellular organismal development (GO:0007275)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.S76Y(1)|p.S76C(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(5)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						GGATCTAATTCCTTTTACCAG	0.493																																																2	Substitution - Missense(2)	ovary(1)|lung(1)	12											111.0	105.0	107.0					12																	54422532		2203	4300	6503	52708799	SO:0001583	missense	3223				CCDS8871.1, CCDS41792.1	12q13.13	2011-06-20	2005-12-22		ENSG00000197757	ENSG00000197757		"""Homeoboxes / ANTP class : HOXL subclass"""	5128	protein-coding gene	gene with protein product		142972	"""homeo box C6"""	HOX3C, HOX3		1973146, 1358459	Standard	NM_153693		Approved		uc001sev.3	P09630	OTTHUMG00000160027	ENST00000243108.4:c.227C>A	12.37:g.54422532C>A	ENSP00000243108:p.Ser76Tyr		52708799	B2RBV2|Q6DK09	Missense_Mutation	SNP	ENST00000243108.4	37	CCDS8871.1	.	.	.	.	.	.	.	.	.	.	C	13.39	2.224020	0.39300	.	.	ENSG00000197757	ENST00000243108	D	0.92595	-3.07	5.54	5.54	0.83059	.	0.111569	0.64402	D	0.000011	D	0.88507	0.6455	L	0.34521	1.04	0.80722	D	1	P	0.44816	0.844	B	0.40534	0.332	D	0.88074	0.2802	10	0.39692	T	0.17	.	18.4191	0.90582	0.0:1.0:0.0:0.0	.	76	P09630	HXC6_HUMAN	Y	76	ENSP00000243108:S76Y	ENSP00000243108:S76Y	S	+	2	0	HOXC6	52708799	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.357000	0.44125	2.884000	0.98904	0.655000	0.94253	TCC		0.493	HOXC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358943.2		
ESYT1	23344	broad.mit.edu	37	12	56531357	56531357	+	Silent	SNP	G	G	A			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr12:56531357G>A	ENST00000394048.5	+	18	2277	c.2013G>A	c.(2011-2013)aaG>aaA	p.K671K	ESYT1_ENST00000541590.1_Silent_p.K681K|ESYT1_ENST00000267113.4_Silent_p.K681K	NM_001184796.1|NM_015292.2	NP_001171725.1|NP_056107.1	Q9BSJ8	ESYT1_HUMAN	extended synaptotagmin-like protein 1	671	C2 3. {ECO:0000255|PROSITE- ProRule:PRU00041}.				lipid transport (GO:0006869)	integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)	p.K671K(1)		breast(2)|endometrium(2)|large_intestine(4)|lung(10)|ovary(5)|prostate(1)|skin(3)|urinary_tract(1)	28						GACTGGTGAAGGGCAAGTCAG	0.542																																																1	Substitution - coding silent(1)	ovary(1)	12											149.0	152.0	151.0					12																	56531357		2203	4300	6503	54817624	SO:0001819	synonymous_variant	23344			AK074368	CCDS8904.1, CCDS53801.1	12q13.2	2014-07-02	2009-06-23	2009-06-23		ENSG00000139641		"""Synaptotagmins"""	29534	protein-coding gene	gene with protein product			"""family with sequence similarity 62 (C2 domain containing), member A"""	FAM62A		9872452, 10350628, 17672888	Standard	NM_015292		Approved	MBC2, KIAA0747	uc001sjr.3	Q9BSJ8		ENST00000394048.5:c.2013G>A	12.37:g.56531357G>A			54817624	A0FGR7|A8K2S2|O94848|Q6PJN4|Q9H6J1|Q9H6W2|Q9Y416	Silent	SNP	ENST00000394048.5	37	CCDS8904.1																																																																																				0.542	ESYT1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000407906.1	NM_015292	
NAV3	89795	broad.mit.edu	37	12	78516048	78516048	+	Missense_Mutation	SNP	A	A	T			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr12:78516048A>T	ENST00000397909.2	+	16	4251	c.4078A>T	c.(4078-4080)Act>Tct	p.T1360S	NAV3_ENST00000536525.2_Missense_Mutation_p.T1360S|NAV3_ENST00000228327.6_Missense_Mutation_p.T1360S|NAV3_ENST00000266692.7_Intron			Q8IVL0	NAV3_HUMAN	neuron navigator 3	1360	Ser-rich.					membrane (GO:0016020)|nuclear envelope (GO:0005635)		p.T1360S(1)		NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						CAGCAAGGATACTCCGAGCTA	0.572										HNSCC(70;0.22)																																						1	Substitution - Missense(1)	ovary(1)	12											110.0	106.0	107.0					12																	78516048		2024	4188	6212	77040179	SO:0001583	missense	89795			AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.4078A>T	12.37:g.78516048A>T	ENSP00000381007:p.Thr1360Ser		77040179	Q8NFW7|Q9Y2E7	Missense_Mutation	SNP	ENST00000397909.2	37		.	.	.	.	.	.	.	.	.	.	A	13.05	2.119944	0.37436	.	.	ENSG00000067798	ENST00000536525;ENST00000397909;ENST00000228327;ENST00000550788	T;T;T;T	0.25414	1.81;1.83;1.8;2.34	5.96	5.96	0.96718	.	0.000000	0.41294	U	0.000916	T	0.41558	0.1164	L	0.45581	1.43	0.80722	D	1	D;D;D	0.71674	0.993;0.998;0.993	P;D;P	0.77557	0.867;0.99;0.775	T	0.13899	-1.0492	10	0.09084	T	0.74	-22.5856	16.4338	0.83864	1.0:0.0:0.0:0.0	.	1360;1360;1360	E7EUC6;Q8IVL0;Q8IVL0-2	.;NAV3_HUMAN;.	S	1360;1360;1360;3	ENSP00000446132:T1360S;ENSP00000381007:T1360S;ENSP00000228327:T1360S;ENSP00000448303:T3S	ENSP00000228327:T1360S	T	+	1	0	NAV3	77040179	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.313000	0.78978	2.270000	0.75569	0.533000	0.62120	ACT		0.572	NAV3-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000406812.1	NM_001024383	
CDK17	5128	broad.mit.edu	37	12	96683034	96683034	+	Missense_Mutation	SNP	C	C	G			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr12:96683034C>G	ENST00000261211.3	-	11	1632	c.1029G>C	c.(1027-1029)aaG>aaC	p.K343N	CDK17_ENST00000542666.1_Missense_Mutation_p.K290N|CDK17_ENST00000553042.1_5'Flank|CDK17_ENST00000543119.2_Missense_Mutation_p.K343N	NM_001170464.2|NM_002595.4	NP_001163935.1|NP_002586.2	Q00537	CDK17_HUMAN	cyclin-dependent kinase 17	343	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				protein phosphorylation (GO:0006468)		ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)	p.K343N(1)		breast(1)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(6)|lung(11)|ovary(4)|prostate(2)|skin(1)	37						TTGAGTAGGTCTTTGTGGGAA	0.428																																																1	Substitution - Missense(1)	ovary(1)	12											209.0	178.0	188.0					12																	96683034		2203	4300	6503	95207165	SO:0001583	missense	5128				CCDS9061.1, CCDS53819.1	12q23.1	2011-11-08	2009-12-16	2009-12-16		ENSG00000059758		"""Cyclin-dependent kinases"""	8750	protein-coding gene	gene with protein product		603440	"""PCTAIRE protein kinase 2"""	PCTK2		9370357, 19884882	Standard	NM_001170464		Approved	PCTAIRE2	uc009ztk.3	Q00537		ENST00000261211.3:c.1029G>C	12.37:g.96683034C>G	ENSP00000261211:p.Lys343Asn		95207165	A8K1U6|B2RCQ2|Q8NEB8	Missense_Mutation	SNP	ENST00000261211.3	37	CCDS9061.1	.	.	.	.	.	.	.	.	.	.	C	18.57	3.652147	0.67472	.	.	ENSG00000059758	ENST00000261211;ENST00000543119;ENST00000542666	T;T;T	0.66099	-0.19;-0.19;-0.19	5.29	4.4	0.53042	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.67618	0.2912	L	0.33668	1.02	0.54753	D	0.999986	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.68307	-0.5443	10	0.52906	T	0.07	-14.8119	10.4092	0.44282	0.0:0.8498:0.0:0.1502	.	343;343	A8K1U6;Q00537	.;CDK17_HUMAN	N	343;343;290	ENSP00000261211:K343N;ENSP00000444459:K343N;ENSP00000442926:K290N	ENSP00000261211:K343N	K	-	3	2	CDK17	95207165	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	3.872000	0.56085	1.361000	0.45981	-0.251000	0.11542	AAG		0.428	CDK17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408751.1	NM_002595	
SBNO1	55206	broad.mit.edu	37	12	123795646	123795646	+	Missense_Mutation	SNP	A	A	G			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture;Sequenom			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr12:123795646A>G	ENST00000602398.1	-	25	3378	c.3251T>C	c.(3250-3252)cTg>cCg	p.L1084P	SBNO1_ENST00000602750.1_Missense_Mutation_p.L1083P|SBNO1_ENST00000267176.4_Missense_Mutation_p.L1083P|SBNO1_ENST00000420886.2_Missense_Mutation_p.L1084P			A3KN83	SBNO1_HUMAN	strawberry notch homolog 1 (Drosophila)	1084					regulation of transcription, DNA-templated (GO:0006355)			p.L1083P(1)		NS(2)|breast(6)|cervix(2)|endometrium(8)|kidney(3)|large_intestine(11)|lung(18)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(2)	62	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000701)|Epithelial(86;0.00197)		TACATTTATCAGGCCAACGCC	0.383																																																1	Substitution - Missense(1)	ovary(1)	12											123.0	113.0	116.0					12																	123795646		2203	4300	6503	122361599	SO:0001583	missense	55206			AK001563	CCDS9246.1, CCDS53844.1	12q24.31	2006-10-06	2006-10-06			ENSG00000139697			22973	protein-coding gene	gene with protein product		614274	"""sno, strawberry notch homolog 1 (Drosophila)"""				Standard	NM_018183		Approved	MOP3, FLJ10701, FLJ10833, Sno	uc010tap.2	A3KN83		ENST00000602398.1:c.3251T>C	12.37:g.123795646A>G	ENSP00000473665:p.Leu1084Pro		122361599	Q05C06|Q3ZTS3|Q9H3T8|Q9NVB2	Missense_Mutation	SNP	ENST00000602398.1	37	CCDS53844.1	.	.	.	.	.	.	.	.	.	.	A	23.2	4.389576	0.82902	.	.	ENSG00000139697	ENST00000420886;ENST00000267176	T;T	0.41065	1.01;1.02	5.39	5.39	0.77823	.	0.000000	0.64402	D	0.000006	T	0.70727	0.3257	M	0.89785	3.06	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.81914	0.989;0.982;0.995	T	0.78018	-0.2368	10	0.72032	D	0.01	-8.0694	15.4536	0.75297	1.0:0.0:0.0:0.0	.	1084;1083;195	A3KN83;A3KN83-2;B3KUC1	SBNO1_HUMAN;.;.	P	1084;1083	ENSP00000387361:L1084P;ENSP00000267176:L1083P	ENSP00000267176:L1083P	L	-	2	0	SBNO1	122361599	1.000000	0.71417	0.995000	0.50966	0.954000	0.61252	8.428000	0.90278	2.048000	0.60808	0.392000	0.25879	CTG		0.383	SBNO1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000467684.1	NM_018183	
CENPJ	55835	broad.mit.edu	37	13	25486797	25486797	+	Missense_Mutation	SNP	T	T	A			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	T	T	A	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture;Sequenom			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr13:25486797T>A	ENST00000381884.4	-	2	552	c.367A>T	c.(367-369)Aat>Tat	p.N123Y	CENPJ_ENST00000545981.1_Missense_Mutation_p.N123Y	NM_018451.4	NP_060921.3	Q9HC77	CENPJ_HUMAN	centromere protein J	123					cell division (GO:0051301)|centriole replication (GO:0007099)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|microtubule polymerization (GO:0046785)|mitotic cell cycle (GO:0000278)|regulation of centriole replication (GO:0046599)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|gamma-tubulin small complex (GO:0008275)|microtubule (GO:0005874)	protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)|tubulin binding (GO:0015631)	p.N123Y(1)		endometrium(5)|kidney(4)|large_intestine(14)|lung(13)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.00793)|Epithelial(112;0.0411)|OV - Ovarian serous cystadenocarcinoma(117;0.139)		ATGAAGTCATTTTTGTTTTCT	0.423																																																1	Substitution - Missense(1)	ovary(1)	13											164.0	153.0	157.0					13																	25486797		2203	4300	6503	24384797	SO:0001583	missense	55835			AF139625	CCDS9310.1	13q12.12	2013-11-05			ENSG00000151849	ENSG00000151849			17272	protein-coding gene	gene with protein product	"""centrosomal P4.1-associated protein"""	609279	"""microcephaly, primary autosomal recessive 6"""	MCPH6		11003675, 22699936	Standard	NM_018451		Approved	CPAP, BM032, LAP, LIP1, Sas-4, SASS4, SCKL4	uc001upt.5	Q9HC77	OTTHUMG00000016595	ENST00000381884.4:c.367A>T	13.37:g.25486797T>A	ENSP00000371308:p.Asn123Tyr		24384797	Q2KHM6|Q5JPD5|Q5T6R5|Q96KS5|Q9C067	Missense_Mutation	SNP	ENST00000381884.4	37	CCDS9310.1	.	.	.	.	.	.	.	.	.	.	T	10.76	1.441442	0.25900	.	.	ENSG00000151849	ENST00000381884;ENST00000545981;ENST00000445729	T;T	0.18657	2.2;2.2	5.69	4.51	0.55191	.	0.842434	0.10924	N	0.619158	T	0.24044	0.0582	M	0.70595	2.14	0.09310	N	1	P	0.41265	0.744	B	0.34038	0.174	T	0.14559	-1.0468	10	0.62326	D	0.03	.	10.7146	0.46005	0.0:0.0:0.175:0.825	.	123	Q9HC77	CENPJ_HUMAN	Y	123	ENSP00000371308:N123Y;ENSP00000441090:N123Y	ENSP00000371308:N123Y	N	-	1	0	CENPJ	24384797	0.998000	0.40836	0.095000	0.20976	0.003000	0.03518	1.390000	0.34464	0.976000	0.38417	-0.331000	0.08364	AAT		0.423	CENPJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044209.1	NM_018451	
PROSER1	80209	broad.mit.edu	37	13	39600450	39600450	+	Silent	SNP	G	G	C			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr13:39600450G>C	ENST00000352251.3	-	6	1277	c.444C>G	c.(442-444)ccC>ccG	p.P148P	PROSER1_ENST00000350125.3_Silent_p.P126P|PROSER1_ENST00000484434.3_5'Flank	NM_025138.4	NP_079414.3	Q86XN7	PRSR1_HUMAN	proline and serine rich 1	148								p.P148P(1)									GTCTTCCTTTGGGATATGGAT	0.403																																																1	Substitution - coding silent(1)	ovary(1)	13											134.0	140.0	138.0					13																	39600450		2203	4300	6503	38498450	SO:0001819	synonymous_variant	80209			AK022723	CCDS9368.2	13q13.2	2011-08-09	2011-08-09	2011-08-09	ENSG00000120685	ENSG00000120685			20291	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 23"""	C13orf23			Standard	NM_025138		Approved	bA50D16.2, FLJ12661	uc001uwy.4	Q86XN7	OTTHUMG00000016764	ENST00000352251.3:c.444C>G	13.37:g.39600450G>C			38498450	A6NJ97|Q6P2S2|Q7Z3X5|Q8N3D2|Q8N3P1|Q9H9M1	Silent	SNP	ENST00000352251.3	37	CCDS9368.2																																																																																				0.403	PROSER1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044607.5	NM_025138	
STK24	8428	broad.mit.edu	37	13	99115945	99115945	+	Splice_Site	SNP	G	G	C	rs201143273		TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture;Sequenom			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr13:99115945G>C	ENST00000376547.3	-	7	1110	c.965C>G	c.(964-966)gCg>gGg	p.A322G	STK24_ENST00000397517.2_Splice_Site_p.A310G|STK24_ENST00000539966.1_Splice_Site_p.A291G	NM_003576.3	NP_003567.2	Q9Y6E0	STK24_HUMAN	serine/threonine kinase 24	322					apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|execution phase of apoptosis (GO:0097194)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|negative regulation of cell migration (GO:0030336)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of axon regeneration (GO:0048679)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.A322G(1)		NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(7)|ovary(1)|skin(1)	17	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.233)			GCCGACTTACGCGTCGGAATC	0.512																																																1	Substitution - Missense(1)	ovary(1)	13											92.0	80.0	84.0					13																	99115945		2203	4300	6503	97913946	SO:0001630	splice_region_variant	8428			AF024636	CCDS9488.1, CCDS32001.1, CCDS66573.1	13q31.2-q32.3	2010-06-25	2010-06-25		ENSG00000102572	ENSG00000102572			11403	protein-coding gene	gene with protein product	"""STE20-like kinase 3"", ""sterile 20-like kinase 3"""	604984	"""serine/threonine kinase 24 (Ste20, yeast homolog)"""			9353338, 10644707	Standard	NM_003576		Approved	MST-3, MST3, MST3B, STK3, STE20	uc001vnn.1	Q9Y6E0	OTTHUMG00000017250	ENST00000376547.3:c.965+1C>G	13.37:g.99115945G>C			97913946	O14840|Q5JV92	Missense_Mutation	SNP	ENST00000376547.3	37	CCDS9488.1	.	.	.	.	.	.	.	.	.	.	G	3.830	-0.035921	0.07497	.	.	ENSG00000102572	ENST00000397517;ENST00000376554;ENST00000376547;ENST00000376541;ENST00000539966;ENST00000418038;ENST00000376533;ENST00000543110	T;T;T;T;T	0.72282	-0.6;3.8;-0.59;-0.64;1.53	5.09	3.33	0.38152	.	0.643479	0.14010	U	0.347529	T	0.42177	0.1191	N	0.05230	-0.09	0.22888	N	0.99861	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.0;0.0;0.001	T	0.20140	-1.0284	9	.	.	.	.	2.5962	0.04855	0.1635:0.1463:0.5396:0.1506	.	291;310;322	B4DR80;Q5U0E6;Q9Y6E0	.;.;STK24_HUMAN	G	310;111;322;125;291;32;298;310	ENSP00000380651:A310G;ENSP00000365737:A111G;ENSP00000365730:A322G;ENSP00000442539:A291G;ENSP00000402810:A32G	.	A	-	2	0	STK24	97913946	0.006000	0.16342	0.048000	0.18961	0.049000	0.14656	0.045000	0.14013	0.525000	0.28522	0.591000	0.81541	GCG		0.512	STK24-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045549.2	NM_003576	Missense_Mutation
MDGA2	161357	broad.mit.edu	37	14	47342702	47342702	+	Missense_Mutation	SNP	G	G	T			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr14:47342702G>T	ENST00000399232.2	-	14	2843	c.2479C>A	c.(2479-2481)Cct>Act	p.P827T	MDGA2_ENST00000399222.3_Missense_Mutation_p.P29T|MDGA2_ENST00000439988.3_Missense_Mutation_p.P896T|MDGA2_ENST00000426342.1_Missense_Mutation_p.P598T|MDGA2_ENST00000357362.3_Missense_Mutation_p.P598T	NM_001113498.2	NP_001106970.3	Q7Z553	MDGA2_HUMAN	MAM domain containing glycosylphosphatidylinositol anchor 2	827	MAM. {ECO:0000255|PROSITE- ProRule:PRU00128}.				pattern specification process (GO:0007389)|spinal cord motor neuron differentiation (GO:0021522)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)		p.P598T(1)		breast(3)|endometrium(4)|kidney(2)|large_intestine(14)|lung(41)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(5)	76						GGTCCATAAGGGTTTTTGGGA	0.383																																																1	Substitution - Missense(1)	ovary(1)	14											164.0	158.0	160.0					14																	47342702		1855	4107	5962	46412452	SO:0001583	missense	161357			AI859192	CCDS41948.1, CCDS45098.1, CCDS45098.2, CCDS45098.3	14q21.2	2013-01-29	2007-04-03	2007-04-03	ENSG00000139915	ENSG00000139915		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19835	protein-coding gene	gene with protein product		611128	"""MAM domain containing 1"""	MAMDC1		15019943	Standard	NM_001113498		Approved		uc001wwj.4	Q7Z553	OTTHUMG00000029429	ENST00000399232.2:c.2479C>A	14.37:g.47342702G>T	ENSP00000382178:p.Pro827Thr		46412452	F6W3S7|J3KPX6	Missense_Mutation	SNP	ENST00000399232.2	37		.	.	.	.	.	.	.	.	.	.	G	20.6	4.017368	0.75161	.	.	ENSG00000139915	ENST00000439988;ENST00000426342;ENST00000399232;ENST00000399222;ENST00000357362	T;T;T;T;T	0.66815	-0.08;0.16;-0.23;2.99;0.16	5.37	4.48	0.54585	Concanavalin A-like lectin/glucanase (1);MAM domain (3);	0.000000	0.51477	U	0.000091	T	0.61173	0.2326	L	0.56769	1.78	0.80722	D	1	B;P	0.39352	0.029;0.669	B;B	0.34931	0.033;0.192	T	0.66677	-0.5863	10	0.87932	D	0	.	12.9946	0.58640	0.0791:0.0:0.9209:0.0	.	598;827	F6W3S7;Q7Z553	.;MDGA2_HUMAN	T	827;598;896;29;598	ENSP00000400011:P827T;ENSP00000405456:P598T;ENSP00000382178:P896T;ENSP00000382168:P29T;ENSP00000349925:P598T	ENSP00000349925:P598T	P	-	1	0	MDGA2	46412452	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.582000	0.82546	1.396000	0.46663	0.467000	0.42956	CCT		0.383	MDGA2-001	KNOWN	upstream_ATG|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000073352.5	NM_182830	
SYNE2	23224	broad.mit.edu	37	14	64542702	64542702	+	Missense_Mutation	SNP	G	G	C			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr14:64542702G>C	ENST00000344113.4	+	54	11118	c.10906G>C	c.(10906-10908)Gag>Cag	p.E3636Q	SYNE2_ENST00000394768.2_5'UTR|SYNE2_ENST00000555002.1_Missense_Mutation_p.E270Q|SYNE2_ENST00000357395.3_5'UTR|SYNE2_ENST00000554584.1_Missense_Mutation_p.E3669Q|SYNE2_ENST00000358025.3_Missense_Mutation_p.E3636Q	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	3636					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)	p.E3636Q(1)		NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		ACTAACTTTTGAGAATATTAT	0.373																																																1	Substitution - Missense(1)	ovary(1)	14											69.0	70.0	69.0					14																	64542702		2203	4300	6503	63612455	SO:0001583	missense	23224			AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.10906G>C	14.37:g.64542702G>C	ENSP00000341781:p.Glu3636Gln		63612455	Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	ENST00000344113.4	37	CCDS41963.1	.	.	.	.	.	.	.	.	.	.	G	13.34	2.206913	0.39003	.	.	ENSG00000054654	ENST00000358025;ENST00000344113;ENST00000554584;ENST00000261678;ENST00000555002	T;T;T;T	0.59772	0.58;0.58;0.24;3.94	5.76	4.87	0.63330	.	0.273612	0.31872	N	0.006923	T	0.56124	0.1964	L	0.32530	0.975	0.80722	D	1	D;D;D	0.56746	0.961;0.961;0.977	P;P;P	0.53593	0.541;0.541;0.73	T	0.57499	-0.7801	10	0.49607	T	0.09	.	10.3138	0.43725	0.2055:0.0:0.7945:0.0	.	3670;3636;3636	D4YW74;Q8WXH0;Q8WXH0-2	.;SYNE2_HUMAN;.	Q	3636;3636;3669;3669;270	ENSP00000350719:E3636Q;ENSP00000341781:E3636Q;ENSP00000452570:E3669Q;ENSP00000450831:E270Q	ENSP00000261678:E3669Q	E	+	1	0	SYNE2	63612455	0.963000	0.33076	0.893000	0.35052	0.968000	0.65278	1.637000	0.37155	1.574000	0.49760	0.655000	0.94253	GAG		0.373	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276994.2	NM_182914	
CCNDBP1	23582	broad.mit.edu	37	15	43478058	43478058	+	Silent	SNP	G	G	A			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr15:43478058G>A	ENST00000300213.4	+	2	392	c.150G>A	c.(148-150)gaG>gaA	p.E50E	EPB42_ENST00000563128.1_Intron|RP11-473C18.3_ENST00000565685.1_RNA|CCNDBP1_ENST00000356633.5_De_novo_Start_OutOfFrame	NM_012142.4	NP_036274.3	O95273	CCDB1_HUMAN	cyclin D-type binding-protein 1	50	Interaction with RPLP0.|Interaction with TCF3.|Required for interaction with CCND1.				cell cycle (GO:0007049)|regulation of cell cycle (GO:0051726)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.E50E(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)	13		all_cancers(109;3.31e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;8.42e-07)		TTAATCGAGAGATGTTCTGGA	0.622																																																1	Substitution - coding silent(1)	ovary(1)	15											39.0	42.0	41.0					15																	43478058		2203	4299	6502	41265350	SO:0001819	synonymous_variant	23582			AF082569	CCDS10092.1	15q14-q15	2008-07-18			ENSG00000166946	ENSG00000166946			1587	protein-coding gene	gene with protein product	"""D-type cyclin-interacting protein 1"", ""MAID protein"", ""HHM Protein"", ""grap2 cyclin interacting protein"""	607089				10801854	Standard	NM_012142		Approved	DIP1, GCIP	uc001zqv.3	O95273	OTTHUMG00000130703	ENST00000300213.4:c.150G>A	15.37:g.43478058G>A			41265350	A8K3Q0|A8K3U2|Q6ZQN9|Q7Z519|Q8NBS7|Q8NBY2|Q9NS19|Q9NYH3|Q9UHX9	Silent	SNP	ENST00000300213.4	37	CCDS10092.1																																																																																				0.622	CCNDBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253203.1	NM_012142	
FBN1	2200	broad.mit.edu	37	15	48818377	48818377	+	Missense_Mutation	SNP	C	C	G			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr15:48818377C>G	ENST00000316623.5	-	9	1393	c.938G>C	c.(937-939)tGc>tCc	p.C313S		NM_000138.4	NP_000129	P35555	FBN1_HUMAN	fibrillin 1	313	EGF-like 5; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|kidney development (GO:0001822)|sequestering of BMP in extracellular matrix (GO:0035582)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|skeletal system development (GO:0001501)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)	p.C313S(1)		NS(1)|breast(5)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|liver(1)|lung(49)|ovary(4)|pancreas(1)|prostate(9)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	139		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		GGGACATTTGCAAAAGTAACT	0.403																																																1	Substitution - Missense(1)	ovary(1)	15											127.0	114.0	118.0					15																	48818377		2197	4296	6493	46605669	SO:0001583	missense	2200			X63556	CCDS32232.1	15q21.1	2014-09-17	2006-04-25			ENSG00000166147			3603	protein-coding gene	gene with protein product	"""Marfan syndrome"""	134797	"""fibrillin 1 (Marfan syndrome)"""	FBN, MFS1, WMS		10036187, 12525539	Standard	NM_000138		Approved	MASS, OCTD, SGS	uc001zwx.2	P35555		ENST00000316623.5:c.938G>C	15.37:g.48818377C>G	ENSP00000325527:p.Cys313Ser		46605669	B2RUU0|D2JYH6|Q15972|Q75N87	Missense_Mutation	SNP	ENST00000316623.5	37	CCDS32232.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.067182	0.76301	.	.	ENSG00000166147	ENST00000316623	D	0.99264	-5.65	5.63	5.63	0.86233	EGF-like calcium-binding, conserved site (1);EGF-like region, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.99739	0.9897	H	0.98833	4.345	0.80722	D	1	D	0.62365	0.991	D	0.78314	0.991	D	0.97160	0.9837	10	0.87932	D	0	.	20.0442	0.97604	0.0:1.0:0.0:0.0	.	313	P35555	FBN1_HUMAN	S	313	ENSP00000325527:C313S	ENSP00000325527:C313S	C	-	2	0	FBN1	46605669	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.776000	0.85560	2.814000	0.96858	0.655000	0.94253	TGC		0.403	FBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417355.1		
MYO5C	55930	broad.mit.edu	37	15	52517286	52517286	+	Missense_Mutation	SNP	T	T	G			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	T	T	G	G	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr15:52517286T>G	ENST00000261839.7	-	27	3512	c.3351A>C	c.(3349-3351)gaA>gaC	p.E1117D		NM_018728.3	NP_061198.2	Q9NQX4	MYO5C_HUMAN	myosin VC	1117						extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.E1117D(1)		breast(1)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(7)|large_intestine(15)|lung(12)|ovary(7)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	66				all cancers(107;0.0137)		TTCTTACATCTTCAATGTCAT	0.318																																																1	Substitution - Missense(1)	ovary(1)	15											139.0	122.0	127.0					15																	52517286		1849	4094	5943	50304578	SO:0001583	missense	55930			AF272390	CCDS42036.1	15q21	2011-09-27				ENSG00000128833		"""Myosins / Myosin superfamily : Class V"""	7604	protein-coding gene	gene with protein product	"""myosin 5C"""	610022				11870218	Standard	NM_018728		Approved	MGC74969	uc010bff.3	Q9NQX4		ENST00000261839.7:c.3351A>C	15.37:g.52517286T>G	ENSP00000261839:p.Glu1117Asp		50304578	Q6P1W8	Missense_Mutation	SNP	ENST00000261839.7	37	CCDS42036.1	.	.	.	.	.	.	.	.	.	.	T	14.64	2.597012	0.46318	.	.	ENSG00000128833	ENST00000261839	T	0.17370	2.28	5.89	3.62	0.41486	.	0.185758	0.44688	D	0.000427	T	0.10252	0.0251	N	0.22421	0.69	0.80722	D	1	B	0.02656	0.0	B	0.09377	0.004	T	0.15809	-1.0424	10	0.23891	T	0.37	.	8.1059	0.30885	0.0:0.214:0.0:0.786	.	1117	Q9NQX4	MYO5C_HUMAN	D	1117	ENSP00000261839:E1117D	ENSP00000261839:E1117D	E	-	3	2	MYO5C	50304578	1.000000	0.71417	0.992000	0.48379	0.995000	0.86356	1.418000	0.34782	1.057000	0.40506	0.533000	0.62120	GAA		0.318	MYO5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419562.1	NM_018728	
ARIH1	25820	broad.mit.edu	37	15	72847705	72847705	+	Splice_Site	SNP	G	G	A			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr15:72847705G>A	ENST00000379887.4	+	4	995		c.e4+1			NM_005744.3	NP_005735.2	Q9Y4X5	ARI1_HUMAN	ariadne RBR E3 ubiquitin protein ligase 1						cytokine-mediated signaling pathway (GO:0019221)|protein ubiquitination (GO:0016567)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|ubiquitin ligase complex (GO:0000151)	small conjugating protein ligase activity (GO:0019787)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(4)|large_intestine(3)|lung(4)|prostate(1)|skin(1)	14						CATGGGTCAGGTAAAGATATC	0.348																																																0			15											109.0	106.0	107.0					15																	72847705		2198	4297	6495	70634759	SO:0001630	splice_region_variant	25820			AF072832	CCDS10244.1	15q24	2013-10-03	2013-10-03		ENSG00000166233	ENSG00000166233			689	protein-coding gene	gene with protein product	"""ariadne, Drosophila, homolog of"""	605624	"""ariadne (Drosophila) homolog, ubiquitin-conjugating enzyme E2-binding protein, 1"", ""ariadne homolog, ubiquitin-conjugating enzyme E2 binding protein, 1 (Drosophila)"""			10521492, 24058416	Standard	NM_005744		Approved	HARI, HHARI, UBCH7BP, ARI	uc002aut.4	Q9Y4X5	OTTHUMG00000133474	ENST00000379887.4:c.681+1G>A	15.37:g.72847705G>A			70634759	B2R6U3|O76026|Q9H3T6|Q9UEN0|Q9UP39	Splice_Site	SNP	ENST00000379887.4	37	CCDS10244.1	.	.	.	.	.	.	.	.	.	.	G	17.23	3.337038	0.60963	.	.	ENSG00000166233	ENST00000379887;ENST00000299305	.	.	.	5.2	5.2	0.72013	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.6838	0.91557	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ARIH1	70634759	1.000000	0.71417	1.000000	0.80357	0.481000	0.33189	9.291000	0.96070	2.582000	0.87167	0.460000	0.39030	.		0.348	ARIH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257350.1	NM_005744	Intron
SRCAP	10847	broad.mit.edu	37	16	30731635	30731635	+	Silent	SNP	C	C	G			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr16:30731635C>G	ENST00000262518.4	+	19	3355	c.2970C>G	c.(2968-2970)gtC>gtG	p.V990V	SRCAP_ENST00000395059.2_Silent_p.V990V|SRCAP_ENST00000344771.4_Silent_p.V990V	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	990	Pro-rich.				histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)	p.V990V(1)		NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			CCAAGCCAGTCAAGATGAAGG	0.572																																																1	Substitution - coding silent(1)	ovary(1)	16											94.0	103.0	100.0					16																	30731635		2197	4300	6497	30639136	SO:0001819	synonymous_variant	10847			AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.2970C>G	16.37:g.30731635C>G			30639136	B0JZA6|O15026|Q7Z744|Q9Y5L9	Silent	SNP	ENST00000262518.4	37	CCDS10689.2																																																																																				0.572	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255523.1	NM_006662	
ZNF232	7775	broad.mit.edu	37	17	5009793	5009793	+	Nonsense_Mutation	SNP	C	C	A			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr17:5009793C>A	ENST00000250076.3	-	5	1315	c.661G>T	c.(661-663)Gaa>Taa	p.E221*	ZNF232_ENST00000575538.1_5'UTR|ZNF232_ENST00000416429.2_3'UTR|ZNF232_ENST00000575898.1_Nonsense_Mutation_p.E212*	NM_014519.2	NP_055334.2	Q9UNY5	ZN232_HUMAN	zinc finger protein 232	194					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E221*(1)		kidney(1)|large_intestine(2)|liver(1)|lung(4)|ovary(1)|prostate(2)	11						GGGCCATCTTCTGTAACAACT	0.383																																																1	Substitution - Nonsense(1)	ovary(1)	17											72.0	69.0	70.0					17																	5009793		2203	4300	6503	4950517	SO:0001587	stop_gained	7775			AF080169	CCDS11068.1	17p13.2	2013-01-09			ENSG00000167840	ENSG00000167840		"""-"", ""Zinc fingers, C2H2-type"""	13026	protein-coding gene	gene with protein product						11311944	Standard	NM_014519		Approved	ZSCAN11	uc002gat.3	Q9UNY5	OTTHUMG00000099450	ENST00000250076.3:c.661G>T	17.37:g.5009793C>A	ENSP00000250076:p.Glu221*		4950517		Nonsense_Mutation	SNP	ENST00000250076.3	37	CCDS11068.1	.	.	.	.	.	.	.	.	.	.	C	17.68	3.449070	0.63178	.	.	ENSG00000167840	ENST00000250076	.	.	.	2.79	2.79	0.32731	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.21540	T	0.41	.	9.2565	0.37586	0.0:1.0:0.0:0.0	.	.	.	.	X	221	.	ENSP00000250076:E221X	E	-	1	0	ZNF232	4950517	0.010000	0.17322	0.684000	0.30055	0.963000	0.63663	0.756000	0.26419	1.857000	0.53885	0.655000	0.94253	GAA		0.383	ZNF232-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216915.1	NM_014519	
SCIMP	388325	broad.mit.edu	37	17	5114168	5114168	+	Silent	SNP	T	T	G			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	T	T	G	G	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr17:5114168T>G	ENST00000574081.1	-	5	470	c.366A>C	c.(364-366)ccA>ccC	p.P122P	RP11-333E1.1_ENST00000575601.1_RNA|SCIMP_ENST00000399600.4_Silent_p.P115P|RP11-333E1.1_ENST00000571689.1_RNA	NM_001271842.1|NM_207103.3	NP_001258771.1|NP_996986.1	Q6UWF3	SCIMP_HUMAN	SLP adaptor and CSK interacting membrane protein	122	Pro-rich.				positive regulation of ERK1 and ERK2 cascade (GO:0070374)	immunological synapse (GO:0001772)|integral component of membrane (GO:0016021)|leading edge membrane (GO:0031256)|membrane (GO:0016020)|tetraspanin-enriched microdomain (GO:0097197)|uropod membrane (GO:0031259)		p.P122P(1)									CAATGTAGCTTGGGATGGAAA	0.408																																																1	Substitution - coding silent(1)	ovary(1)	17											147.0	137.0	140.0					17																	5114168		1853	4102	5955	5054892	SO:0001819	synonymous_variant	388325			AY358809	CCDS42242.1, CCDS62044.1	17p13.2	2011-11-24	2011-11-23	2011-11-23	ENSG00000161929	ENSG00000161929			33504	protein-coding gene	gene with protein product	"""SLP65/SLP76, Csk-interacting membrane protein"""	614406	"""chromosome 17 open reading frame 87"""	C17orf87		21930792	Standard	NM_207103		Approved	DTFT5783, UNQ5783, FLJ32580, MGC163426, MGC163428	uc002gbh.3	Q6UWF3	OTTHUMG00000132914	ENST00000574081.1:c.366A>C	17.37:g.5114168T>G			5054892	A6XGL4|B4DLK1|Q96MD0	Silent	SNP	ENST00000574081.1	37	CCDS42242.1																																																																																				0.408	SCIMP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256425.2	NM_207103	
TP53	7157	broad.mit.edu	37	17	7577082	7577082	+	Missense_Mutation	SNP	C	C	T			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA;Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr17:7577082C>T	ENST00000269305.4	-	8	1045	c.856G>A	c.(856-858)Gaa>Aaa	p.E286K	TP53_ENST00000455263.2_Missense_Mutation_p.E286K|TP53_ENST00000359597.4_Missense_Mutation_p.E286K|TP53_ENST00000413465.2_Intron|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Missense_Mutation_p.E286K|TP53_ENST00000445888.2_Missense_Mutation_p.E286K	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	286	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		E -> A (in LFS; germline mutation and in sporadic cancers; somatic mutation).|E -> D (in sporadic cancers; somatic mutation).|E -> G (in sporadic cancers; somatic mutation).|E -> K (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:11023613, ECO:0000269|PubMed:8316628}.|E -> L (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|E -> Q (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:8829627}.|E -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.E286K(58)|p.E286*(22)|p.0?(8)|p.E286Q(5)|p.?(2)|p.E286fs*59(2)|p.E286fs*17(2)|p.R283fs*16(2)|p.R282_E287delRRTEEE(1)|p.L265_K305del41(1)|p.T284fs*57(1)|p.T284_G293del10(1)|p.E285_L289delEEENL(1)|p.R283fs*56(1)|p.E285fs*13(1)|p.G279fs*59(1)|p.R283fs*59(1)|p.V272_K292del21(1)|p.E285_N288delEEEN(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AGATTCTCTTCCTCTGTGCGC	0.557		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	112	Substitution - Missense(63)|Substitution - Nonsense(22)|Deletion - Frameshift(11)|Whole gene deletion(8)|Deletion - In frame(6)|Unknown(2)	lung(18)|upper_aerodigestive_tract(13)|breast(10)|large_intestine(9)|urinary_tract(9)|skin(9)|oesophagus(9)|haematopoietic_and_lymphoid_tissue(8)|liver(7)|central_nervous_system(6)|bone(4)|ovary(3)|stomach(2)|vulva(1)|soft_tissue(1)|eye(1)|biliary_tract(1)|endometrium(1)	17	GRCh37	CM076567	TP53	M							95.0	81.0	86.0					17																	7577082		2203	4300	6503	7517807	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.856G>A	17.37:g.7577082C>T	ENSP00000269305:p.Glu286Lys		7517807	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	22.6	4.310731	0.81358	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99856	-7.21;-7.21;-7.21;-7.21;-7.21;-7.21	4.99	4.99	0.66335	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99883	0.9944	M	0.92077	3.27	0.58432	D	0.999999	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.77557	0.983;0.985;0.982;0.99	D	0.96355	0.9261	10	0.87932	D	0	-23.2961	15.807	0.78520	0.0:1.0:0.0:0.0	.	286;286;286;286	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	K	286;286;286;286;286;275;154	ENSP00000352610:E286K;ENSP00000269305:E286K;ENSP00000398846:E286K;ENSP00000391127:E286K;ENSP00000391478:E286K;ENSP00000425104:E154K	ENSP00000269305:E286K	E	-	1	0	TP53	7517807	1.000000	0.71417	0.972000	0.41901	0.455000	0.32408	7.587000	0.82613	2.579000	0.87056	0.462000	0.41574	GAA		0.557	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
FAM222B	55731	broad.mit.edu	37	17	27085623	27085623	+	Missense_Mutation	SNP	G	G	C			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr17:27085623G>C	ENST00000341217.5	-	3	1569	c.1354C>G	c.(1354-1356)Ccc>Gcc	p.P452A	FAM222B_ENST00000582266.1_3'UTR|FAM222B_ENST00000452648.3_Missense_Mutation_p.P452A|FAM222B_ENST00000581407.1_Missense_Mutation_p.P452A	NM_018182.2	NP_060652.2	Q8WU58	F222B_HUMAN	family with sequence similarity 222, member B	452								p.P452A(1)									TTCCACAGGGGTTGGAAGTAG	0.612																																																1	Substitution - Missense(1)	ovary(1)	17											26.0	27.0	27.0					17																	27085623		1999	4163	6162	24109750	SO:0001583	missense	55731			AK001562	CCDS45637.1, CCDS74022.1	17q11.2	2012-04-27	2012-04-27	2012-04-27	ENSG00000173065	ENSG00000173065			25563	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 63"""	C17orf63			Standard	NM_001288631		Approved	FLJ10700	uc010way.1	Q8WU58		ENST00000341217.5:c.1354C>G	17.37:g.27085623G>C	ENSP00000343115:p.Pro452Ala		24109750	Q9H6F3|Q9NVJ4|Q9NXN6	Missense_Mutation	SNP	ENST00000341217.5	37	CCDS45637.1	.	.	.	.	.	.	.	.	.	.	G	10.68	1.418857	0.25552	.	.	ENSG00000173065	ENST00000341217;ENST00000452648	T;T	0.35973	1.28;1.28	5.1	5.1	0.69264	.	0.054441	0.64402	D	0.000001	T	0.37156	0.0993	L	0.59436	1.845	0.52501	D	0.999957	B	0.28971	0.229	B	0.27608	0.081	T	0.12682	-1.0538	10	0.27785	T	0.31	-5.7948	17.6825	0.88248	0.0:0.0:1.0:0.0	.	452	Q8WU58	CQ063_HUMAN	A	452	ENSP00000343115:P452A;ENSP00000413645:P452A	ENSP00000343115:P452A	P	-	1	0	C17orf63	24109750	1.000000	0.71417	1.000000	0.80357	0.555000	0.35460	5.995000	0.70631	2.636000	0.89361	0.655000	0.94253	CCC		0.612	FAM222B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446703.1	NM_018182	
EVI2B	2124	broad.mit.edu	37	17	29632179	29632179	+	Missense_Mutation	SNP	G	G	A			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr17:29632179G>A	ENST00000330927.4	-	2	603	c.449C>T	c.(448-450)tCa>tTa	p.S150L	NF1_ENST00000358273.4_Intron|NF1_ENST00000356175.3_Intron|EVI2B_ENST00000544462.1_Missense_Mutation_p.S165L|EVI2B_ENST00000577894.1_Missense_Mutation_p.S150L	NM_006495.3	NP_006486.3	P34910	EVI2B_HUMAN	ecotropic viral integration site 2B	150						integral component of plasma membrane (GO:0005887)		p.0?(8)|p.?(3)|p.S150L(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|urinary_tract(1)	12		all_cancers(10;6.97e-11)|all_epithelial(10;0.0051)|all_hematologic(16;0.0149)|Breast(31;0.0155)|Myeloproliferative disorder(56;0.0255)|Acute lymphoblastic leukemia(14;0.0257)|all_lung(9;0.0468)|Lung NSC(157;0.094)		UCEC - Uterine corpus endometrioid carcinoma (4;6.64e-05)|all cancers(4;6.88e-13)|Epithelial(4;8.95e-12)|OV - Ovarian serous cystadenocarcinoma(4;1.01e-11)|GBM - Glioblastoma multiforme(4;0.184)		GACAGATGATGATTGTTGAGT	0.428																																																12	Whole gene deletion(8)|Unknown(3)|Substitution - Missense(1)	soft_tissue(7)|autonomic_ganglia(2)|lung(1)|ovary(1)|central_nervous_system(1)	17											325.0	284.0	298.0					17																	29632179		2203	4300	6503	26656305	SO:0001583	missense	2124				CCDS11266.1	17q11.2	2011-08-11			ENSG00000185862	ENSG00000185862		"""CD molecules"""	3500	protein-coding gene	gene with protein product		158381				1903357	Standard	NM_006495		Approved	D17S376, EVDB, CD361	uc002hgk.2	P34910	OTTHUMG00000132869	ENST00000330927.4:c.449C>T	17.37:g.29632179G>A	ENSP00000333779:p.Ser150Leu		26656305	B7Z4A7	Missense_Mutation	SNP	ENST00000330927.4	37	CCDS11266.1	.	.	.	.	.	.	.	.	.	.	G	15.43	2.832575	0.50845	.	.	ENSG00000185862	ENST00000330927;ENST00000544462	T;T	0.50001	0.77;0.76	5.55	4.58	0.56647	.	0.464481	0.17830	N	0.160572	T	0.34164	0.0888	N	0.22421	0.69	0.30102	N	0.80733	B;B	0.17268	0.021;0.021	B;B	0.13407	0.009;0.009	T	0.34104	-0.9842	10	0.72032	D	0.01	-0.0231	10.3006	0.43650	0.0911:0.0:0.9089:0.0	.	165;150	B7Z4A7;P34910	.;EVI2B_HUMAN	L	150;165	ENSP00000333779:S150L;ENSP00000439738:S165L	ENSP00000333779:S150L	S	-	2	0	EVI2B	26656305	0.000000	0.05858	0.659000	0.29680	0.157000	0.22087	0.167000	0.16602	1.343000	0.45638	0.561000	0.74099	TCA		0.428	EVI2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256349.2	NM_006495	
KRT28	162605	broad.mit.edu	37	17	38950147	38950147	+	Missense_Mutation	SNP	A	A	G			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr17:38950147A>G	ENST00000306658.7	-	6	1195	c.1130T>C	c.(1129-1131)cTc>cCc	p.L377P		NM_181535.3	NP_853513.2			keratin 28									p.L377P(1)		NS(1)|breast(3)|endometrium(1)|kidney(1)|large_intestine(4)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	30		Breast(137;0.000301)				CTTGACATCGAGGAGATGCTC	0.522																																					Melanoma(19;789 869 15380 26882 39836)											1	Substitution - Missense(1)	ovary(1)	17											155.0	149.0	151.0					17																	38950147		2203	4300	6503	36203673	SO:0001583	missense	162605			AK129827	CCDS11376.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000173908	ENSG00000173908		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	30842	protein-coding gene	gene with protein product			"""keratin 25D"""	KRT25D		16831889	Standard	NM_181535		Approved		uc002hvh.1	Q7Z3Y7	OTTHUMG00000133365	ENST00000306658.7:c.1130T>C	17.37:g.38950147A>G	ENSP00000305263:p.Leu377Pro		36203673		Missense_Mutation	SNP	ENST00000306658.7	37	CCDS11376.1	.	.	.	.	.	.	.	.	.	.	A	15.45	2.836607	0.50951	.	.	ENSG00000173908	ENST00000306658	D	0.93488	-3.23	5.7	5.7	0.88788	Filament (1);	0.000000	0.47852	D	0.000208	D	0.98140	0.9386	H	0.98612	4.28	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99624	1.0984	10	0.87932	D	0	.	15.4391	0.75168	1.0:0.0:0.0:0.0	.	377	Q7Z3Y7	K1C28_HUMAN	P	377	ENSP00000305263:L377P	ENSP00000305263:L377P	L	-	2	0	KRT28	36203673	1.000000	0.71417	0.152000	0.22495	0.008000	0.06430	9.336000	0.96533	2.295000	0.77249	0.528000	0.53228	CTC		0.522	KRT28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257201.2	NM_181535	
DNAJC7	7266	broad.mit.edu	37	17	40141523	40141523	+	Missense_Mutation	SNP	G	G	C	rs200650446		TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr17:40141523G>C	ENST00000457167.4	-	7	888	c.652C>G	c.(652-654)Ctt>Gtt	p.L218V	DNAJC7_ENST00000316603.7_Missense_Mutation_p.L162V|DNAJC7_ENST00000426588.3_Missense_Mutation_p.L162V	NM_003315.3	NP_003306.3	Q99615	DNJC7_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 7	218					chaperone cofactor-dependent protein refolding (GO:0070389)|protein folding (GO:0006457)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	heat shock protein binding (GO:0031072)	p.L208V(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)	9		all_cancers(22;0.00273)|Breast(137;0.00104)|all_epithelial(22;0.0305)				TAAAGGCAAAGACCTCGTACA	0.468																																					Colon(63;618 1117 8600 10857 19751)											1	Substitution - Missense(1)	ovary(1)	17											190.0	180.0	183.0					17																	40141523		1949	4151	6100	37395049	SO:0001583	missense	7266			U46571	CCDS45677.1, CCDS45678.1	17q11.2	2013-01-10				ENSG00000168259		"""Heat shock proteins / DNAJ (HSP40)"", ""Tetratricopeptide (TTC) repeat domain containing"""	12392	protein-coding gene	gene with protein product		601964		TTC2		8836031, 11147971	Standard	NR_029431		Approved	TPR2	uc002hyo.3	Q99615		ENST00000457167.4:c.652C>G	17.37:g.40141523G>C	ENSP00000406463:p.Leu218Val		37395049	Q7Z784	Missense_Mutation	SNP	ENST00000457167.4	37	CCDS45677.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.023988	0.75390	.	.	ENSG00000168259	ENST00000457167;ENST00000426588;ENST00000316603	T;T;T	0.64260	-0.09;-0.09;-0.09	5.42	4.45	0.53987	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	T	0.77751	0.4177	M	0.79123	2.44	0.58432	D	0.999997	D;D;D	0.65815	0.985;0.995;0.995	D;D;D	0.70227	0.953;0.968;0.968	T	0.79179	-0.1910	10	0.51188	T	0.08	-3.6159	14.4311	0.67251	0.072:0.0:0.928:0.0	.	207;162;218	Q59EH7;Q7Z784;Q99615	.;.;DNJC7_HUMAN	V	218;162;162	ENSP00000406463:L218V;ENSP00000394327:L162V;ENSP00000313311:L162V	ENSP00000313311:L162V	L	-	1	0	DNAJC7	37395049	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.103000	0.64578	2.561000	0.86390	0.462000	0.41574	CTT		0.468	DNAJC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453366.2		
ABCA5	23461	broad.mit.edu	37	17	67266804	67266804	+	Missense_Mutation	SNP	G	G	T			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr17:67266804G>T	ENST00000392676.3	-	22	3044	c.2980C>A	c.(2980-2982)Cat>Aat	p.H994N	ABCA5_ENST00000392677.2_Missense_Mutation_p.H995N|ABCA5_ENST00000588877.1_Missense_Mutation_p.H994N			Q8WWZ7	ABCA5_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 5	994					cholesterol efflux (GO:0033344)|high-density lipoprotein particle remodeling (GO:0034375)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|reverse cholesterol transport (GO:0043691)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.H994N(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(18)|lung(19)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	54	Breast(10;3.72e-11)				Tacrolimus(DB00864)	ACATTTAAATGATAAAGATAG	0.294																																																1	Substitution - Missense(1)	ovary(1)	17											106.0	120.0	115.0					17																	67266804		2203	4271	6474	64778399	SO:0001583	missense	23461			U66672	CCDS11685.1	17q24.3	2012-03-14			ENSG00000154265	ENSG00000154265		"""ATP binding cassette transporters / subfamily A"""	35	protein-coding gene	gene with protein product		612503				8894702	Standard	NM_172232		Approved	EST90625	uc002jig.2	Q8WWZ7		ENST00000392676.3:c.2980C>A	17.37:g.67266804G>T	ENSP00000376443:p.His994Asn		64778399	Q8IVJ2|Q96LJ1|Q96MS4|Q96PZ9|Q9NY14	Missense_Mutation	SNP	ENST00000392676.3	37	CCDS11685.1	.	.	.	.	.	.	.	.	.	.	G	11.21	1.571155	0.28003	.	.	ENSG00000154265	ENST00000392677;ENST00000392676	D;D	0.82619	-1.63;-1.63	5.45	3.4	0.38934	.	0.639543	0.15332	N	0.267971	T	0.79981	0.4540	L	0.57536	1.79	0.23657	N	0.997186	B	0.21821	0.061	B	0.24974	0.057	T	0.65631	-0.6121	9	.	.	.	.	12.9233	0.58245	0.0:0.0:0.5786:0.4213	.	994	Q8WWZ7	ABCA5_HUMAN	N	995;994	ENSP00000376444:H995N;ENSP00000376443:H994N	.	H	-	1	0	ABCA5	64778399	0.906000	0.30813	0.999000	0.59377	0.995000	0.86356	0.584000	0.23864	0.620000	0.30215	0.591000	0.81541	CAT		0.294	ABCA5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000450654.1	NM_018672	
TRIM47	91107	broad.mit.edu	37	17	73872052	73872052	+	Silent	SNP	G	G	A			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr17:73872052G>A	ENST00000254816.2	-	4	1157	c.1131C>T	c.(1129-1131)tgC>tgT	p.C377C	TRIM47_ENST00000587339.1_Silent_p.C139C|RP11-552F3.9_ENST00000586076.1_RNA	NM_033452.2	NP_258411.2	Q96LD4	TRI47_HUMAN	tripartite motif containing 47	377						cytoplasm (GO:0005737)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)	p.C377C(1)		autonomic_ganglia(1)|breast(3)|endometrium(1)|large_intestine(3)|lung(7)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	22			Epithelial(20;4.23e-06)|all cancers(21;5.24e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00092)|LUSC - Lung squamous cell carcinoma(166;0.154)			ACTGGTTGACGCAGGCCACGG	0.672																																																1	Substitution - coding silent(1)	ovary(1)	17											55.0	51.0	52.0					17																	73872052		2203	4300	6503	71383647	SO:0001819	synonymous_variant	91107			AY026763	CCDS32737.1	17q25	2013-01-09	2011-01-25			ENSG00000132481		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19020	protein-coding gene	gene with protein product		611041	"""tripartite motif-containing 47"""				Standard	NM_033452		Approved	GOA, RNF100	uc002jpw.3	Q96LD4		ENST00000254816.2:c.1131C>T	17.37:g.73872052G>A			71383647	Q96AD0|Q96GU5|Q9BRN7	Silent	SNP	ENST00000254816.2	37	CCDS32737.1																																																																																				0.672	TRIM47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448934.1		
MYOM1	8736	broad.mit.edu	37	18	3126832	3126832	+	Missense_Mutation	SNP	C	C	T			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr18:3126832C>T	ENST00000356443.4	-	19	3191	c.2858G>A	c.(2857-2859)gGa>gAa	p.G953E	MYOM1_ENST00000261606.7_Missense_Mutation_p.G857E|MYOM1_ENST00000582016.1_5'UTR|MYOM1_ENST00000400569.3_Missense_Mutation_p.G953E	NM_003803.3|NM_019856.1	NP_003794.3|NP_062830.1	P52179	MYOM1_HUMAN	myomesin 1	953	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				muscle contraction (GO:0006936)	M band (GO:0031430)|striated muscle myosin thick filament (GO:0005863)	identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|structural constituent of muscle (GO:0008307)	p.G953E(1)		NS(2)|autonomic_ganglia(1)|central_nervous_system(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(20)|ovary(4)|pancreas(1)|prostate(4)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	77						TTGCTTCCATCCAAGAACCAT	0.448																																																1	Substitution - Missense(1)	ovary(1)	18											83.0	74.0	77.0					18																	3126832		1931	4146	6077	3116832	SO:0001583	missense	8736			AF185573	CCDS45823.1, CCDS45824.1	18p11.31	2014-09-17	2012-10-17		ENSG00000101605	ENSG00000101605		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7613	protein-coding gene	gene with protein product	"""skelemin"""	603508	"""myomesin 1 (skelemin) (185kD)"", ""myomesin 1 (skelemin) 185kDa"", ""myomesin 1, 185kDa"""			9806852	Standard	NM_019856		Approved		uc002klp.3	P52179	OTTHUMG00000178209	ENST00000356443.4:c.2858G>A	18.37:g.3126832C>T	ENSP00000348821:p.Gly953Glu		3116832	Q14BD6|Q6H969|Q6ZUU0	Missense_Mutation	SNP	ENST00000356443.4	37	CCDS45824.1	.	.	.	.	.	.	.	.	.	.	C	11.51	1.659743	0.29515	.	.	ENSG00000101605	ENST00000356443;ENST00000400569;ENST00000261606	T;T;T	0.55052	0.54;0.54;0.54	5.46	3.63	0.41609	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.106126	0.64402	D	0.000006	T	0.38214	0.1032	L	0.31664	0.95	0.42869	D	0.994131	P;B	0.41131	0.739;0.091	B;B	0.40901	0.343;0.139	T	0.08146	-1.0736	10	0.12430	T	0.62	.	11.0062	0.47635	0.0:0.7998:0.1298:0.0705	.	857;953	P52179-2;P52179	.;MYOM1_HUMAN	E	953;953;857	ENSP00000348821:G953E;ENSP00000383413:G953E;ENSP00000261606:G857E	ENSP00000261606:G857E	G	-	2	0	MYOM1	3116832	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.936000	0.56568	0.637000	0.30526	0.655000	0.94253	GGA		0.448	MYOM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000441037.2	NM_003803	
ST8SIA5	29906	broad.mit.edu	37	18	44268806	44268806	+	Missense_Mutation	SNP	G	G	T			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture;Sequenom			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr18:44268806G>T	ENST00000315087.7	-	4	1048	c.388C>A	c.(388-390)Ctc>Atc	p.L130I	ST8SIA5_ENST00000538168.1_Missense_Mutation_p.L166I|ST8SIA5_ENST00000536490.1_Missense_Mutation_p.L99I|ST8SIA5_ENST00000590497.1_5'UTR	NM_013305.4	NP_037437.2	O15466	SIA8E_HUMAN	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 5	130					carbohydrate metabolic process (GO:0005975)|glycosphingolipid biosynthetic process (GO:0006688)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	integral component of Golgi membrane (GO:0030173)	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity (GO:0003828)|sialyltransferase activity (GO:0008373)	p.L130I(1)		kidney(1)|large_intestine(10)|lung(7)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(2)	22						TCATACTTGAGCTTTGTCCCC	0.597																																																1	Substitution - Missense(1)	ovary(1)	18											167.0	142.0	151.0					18																	44268806		2203	4300	6503	42522804	SO:0001583	missense	29906			U91641	CCDS11930.1	18q12.3	2013-03-01	2003-01-14	2005-02-07	ENSG00000101638	ENSG00000101638		"""Sialyltransferases"""	17827	protein-coding gene	gene with protein product	"""ST8Sia V"""	607162	"""sialyltransferase 8E (alpha-2, 8-polysialytransferase)"""	SIAT8E		9199191	Standard	XM_005258250		Approved		uc002lcj.1	O15466	OTTHUMG00000132643	ENST00000315087.7:c.388C>A	18.37:g.44268806G>T	ENSP00000321343:p.Leu130Ile		42522804	B7Z1K9|Q6IAW7	Missense_Mutation	SNP	ENST00000315087.7	37	CCDS11930.1	.	.	.	.	.	.	.	.	.	.	G	17.57	3.421927	0.62622	.	.	ENSG00000101638	ENST00000315087;ENST00000538168;ENST00000536490	T;T;T	0.31247	1.5;1.5;1.5	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	T	0.45074	0.1324	L	0.36672	1.1	0.80722	D	1	D;B;D	0.89917	0.999;0.379;1.0	D;P;D	0.91635	0.997;0.549;0.999	T	0.10941	-1.0608	10	0.09843	T	0.71	-8.5351	19.5805	0.95465	0.0:0.0:1.0:0.0	.	99;166;130	F5H8D1;B7Z1K9;O15466	.;.;SIA8E_HUMAN	I	130;166;99	ENSP00000321343:L130I;ENSP00000445492:L166I;ENSP00000443683:L99I	ENSP00000321343:L130I	L	-	1	0	ST8SIA5	42522804	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.317000	0.72862	2.629000	0.89072	0.561000	0.74099	CTC		0.597	ST8SIA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255892.1	NM_013305	
MALT1	10892	broad.mit.edu	37	18	56390338	56390338	+	Silent	SNP	C	C	T			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr18:56390338C>T	ENST00000348428.3	+	10	1335	c.1077C>T	c.(1075-1077)ctC>ctT	p.L359L	MALT1_ENST00000345724.3_Silent_p.L348L|RP11-126O1.4_ENST00000588835.1_RNA	NM_006785.2|NM_173844.1	NP_006776.1|NP_776216.1	Q9UDY8	MALT1_HUMAN	mucosa associated lymphoid tissue lymphoma translocation gene 1	359	Caspase-like.				activation of NF-kappaB-inducing kinase activity (GO:0007250)|B-1 B cell differentiation (GO:0001923)|defense response (GO:0006952)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|nuclear export (GO:0051168)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell cytokine production (GO:0002726)|protein oligomerization (GO:0051259)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of apoptotic process (GO:0042981)|regulation of T cell receptor signaling pathway (GO:0050856)|response to fungus (GO:0009620)|response to molecule of bacterial origin (GO:0002237)|T cell proliferation (GO:0042098)|T cell receptor signaling pathway (GO:0050852)	CBM complex (GO:0032449)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	cysteine-type endopeptidase activity (GO:0004197)|peptidase activity (GO:0008233)|protein self-association (GO:0043621)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)	p.L348L(1)		central_nervous_system(1)|large_intestine(7)|lung(1)|ovary(2)|skin(1)	12						ACCCCAAGCTCAAAGCTCCTT	0.403			T	BIRC3	MALT																																		Dom	yes		18	18q21	10892	mucosa associated lymphoid tissue lymphoma translocation gene 1		L	1	Substitution - coding silent(1)	ovary(1)	18											133.0	126.0	128.0					18																	56390338		2203	4300	6503	54541318	SO:0001819	synonymous_variant	10892				CCDS11967.1, CCDS11968.1	18q21	2013-01-11			ENSG00000172175	ENSG00000172175		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6819	protein-coding gene	gene with protein product	"""paracaspase"""	604860		MLT		10339464, 10406266, 10523859	Standard	NM_006785		Approved		uc002lhm.1	Q9UDY8	OTTHUMG00000132761	ENST00000348428.3:c.1077C>T	18.37:g.56390338C>T			54541318	Q9NTB7|Q9ULX4	Silent	SNP	ENST00000348428.3	37	CCDS11967.1																																																																																				0.403	MALT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256132.2		
ADNP2	22850	broad.mit.edu	37	18	77896601	77896601	+	Missense_Mutation	SNP	T	T	C	rs11553022		TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr18:77896601T>C	ENST00000262198.4	+	4	3760	c.3305T>C	c.(3304-3306)aTa>aCa	p.I1102T		NM_014913.3	NP_055728.1	Q6IQ32	ADNP2_HUMAN	ADNP homeobox 2	1102					cellular response to oxidative stress (GO:0034599)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell death (GO:0060548)|neuron differentiation (GO:0030182)|positive regulation of cell growth (GO:0030307)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.I1102T(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(9)|liver(1)|lung(15)|ovary(5)|prostate(2)	42		all_cancers(4;1.06e-15)|all_epithelial(4;2.36e-10)|all_lung(4;0.000302)|Lung NSC(4;0.000518)|Esophageal squamous(42;0.0212)|Ovarian(4;0.0256)|all_hematologic(56;0.15)|Melanoma(33;0.2)		Epithelial(2;1.1e-11)|OV - Ovarian serous cystadenocarcinoma(15;7.54e-09)|BRCA - Breast invasive adenocarcinoma(31;0.00247)|STAD - Stomach adenocarcinoma(84;0.164)		ATGAAAGCAATAAAAAATCAC	0.313																																																1	Substitution - Missense(1)	ovary(1)	18											36.0	39.0	38.0					18																	77896601		2180	4285	6465	75997592	SO:0001583	missense	22850			AB020670	CCDS32853.1	18q23	2013-01-07	2007-07-17	2007-07-17	ENSG00000101544	ENSG00000101544		"""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	23803	protein-coding gene	gene with protein product			"""zinc finger protein 508"""	ZNF508			Standard	NM_014913		Approved	KIAA0863	uc002lnw.3	Q6IQ32	OTTHUMG00000172535	ENST00000262198.4:c.3305T>C	18.37:g.77896601T>C	ENSP00000262198:p.Ile1102Thr		75997592	A8K951|O94943|Q9H9P3	Missense_Mutation	SNP	ENST00000262198.4	37	CCDS32853.1	.	.	.	.	.	.	.	.	.	.	T	14.93	2.682038	0.47991	.	.	ENSG00000101544	ENST00000262198	D	0.91577	-2.87	4.43	4.43	0.53597	Homeodomain-related (1);Homeobox (1);Homeodomain-like (1);	0.078755	0.52532	D	0.000062	D	0.93080	0.7797	L	0.59436	1.845	0.41585	D	0.988769	D	0.76494	0.999	D	0.64776	0.929	D	0.92862	0.6306	9	.	.	.	-25.6408	13.8693	0.63608	0.0:0.0:0.0:1.0	.	1102	Q6IQ32	ADNP2_HUMAN	T	1102	ENSP00000262198:I1102T	.	I	+	2	0	ADNP2	75997592	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	2.490000	0.45294	1.873000	0.54277	0.459000	0.35465	ATA		0.313	ADNP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418979.1	NM_014913	
BEST2	54831	broad.mit.edu	37	19	12866268	12866268	+	Nonsense_Mutation	SNP	C	C	T			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr19:12866268C>T	ENST00000549706.1	+	6	1036	c.712C>T	c.(712-714)Cag>Tag	p.Q238*	BEST2_ENST00000553030.1_Nonsense_Mutation_p.Q238*|BEST2_ENST00000042931.1_Nonsense_Mutation_p.Q238*			Q8NFU1	BEST2_HUMAN	bestrophin 2	238					chloride transmembrane transport (GO:1902476)|membrane depolarization (GO:0051899)|sensory perception of smell (GO:0007608)	chloride channel complex (GO:0034707)|cilium (GO:0005929)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)	p.Q238*(1)		breast(3)|endometrium(1)|large_intestine(4)|lung(2)|ovary(1)|pancreas(1)	12						CGTGTACACGCAGGTAACCCC	0.498																																																1	Substitution - Nonsense(1)	ovary(1)	19											135.0	131.0	132.0					19																	12866268		1994	4176	6170	12727268	SO:0001587	stop_gained	54831			AF440756	CCDS42506.1	19p13.13	2014-08-12	2006-10-18	2006-10-18	ENSG00000039987	ENSG00000039987		"""Ion channels / Chloride channels : Calcium activated : Bestrophins"""	17107	protein-coding gene	gene with protein product		607335	"""vitelliform macular dystrophy 2-like 1"""	VMD2L1		12032738, 16912113	Standard	NM_017682		Approved	FLJ20132	uc002mux.3	Q8NFU1	OTTHUMG00000169293	ENST00000549706.1:c.712C>T	19.37:g.12866268C>T	ENSP00000448310:p.Gln238*		12727268	Q53YQ8|Q9NXP0	Nonsense_Mutation	SNP	ENST00000549706.1	37	CCDS42506.1	.	.	.	.	.	.	.	.	.	.	C	39	7.302286	0.98196	.	.	ENSG00000039987	ENST00000549706;ENST00000553030;ENST00000042931	.	.	.	4.13	4.13	0.48395	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-30.5097	15.6627	0.77199	0.0:1.0:0.0:0.0	.	.	.	.	X	238	.	ENSP00000042931:Q238X	Q	+	1	0	BEST2	12727268	1.000000	0.71417	0.998000	0.56505	0.712000	0.41017	7.458000	0.80787	2.283000	0.76528	0.544000	0.68410	CAG		0.498	BEST2-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403343.1	NM_017682	
ZNF14	7561	broad.mit.edu	37	19	19824901	19824901	+	Splice_Site	SNP	T	T	G			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	T	T	G	G	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture;Sequenom			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr19:19824901T>G	ENST00000344099.3	-	3	328	c.190A>C	c.(190-192)Aga>Cga	p.R64R		NM_021030.2	NP_066358.2	P17017	ZNF14_HUMAN	zinc finger protein 14	64	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R64R(1)		breast(1)|cervix(2)|endometrium(1)|large_intestine(9)|lung(8)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	32		Renal(1328;0.0474)				GCAACTCACCTTCGATTTTTC	0.373																																																1	Substitution - coding silent(1)	ovary(1)	19											107.0	100.0	102.0					19																	19824901		2203	4300	6503	19685901	SO:0001630	splice_region_variant	7561			AA286756	CCDS12409.1	19p13.11	2013-01-08	2006-05-10					"""Zinc fingers, C2H2-type"", ""-"""	12924	protein-coding gene	gene with protein product		194556	"""zinc finger protein 14 (KOX 6)"""				Standard	NM_021030		Approved	KOX6, GIOT-4	uc002nnk.1	P17017		ENST00000344099.3:c.191+1A>C	19.37:g.19824901T>G			19685901	B9EGA4|Q9ULZ5	Silent	SNP	ENST00000344099.3	37	CCDS12409.1																																																																																				0.373	ZNF14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460775.1	NM_021030	Silent
PRKD2	25865	broad.mit.edu	37	19	47184991	47184991	+	Missense_Mutation	SNP	C	C	G	rs117052447	byFrequency	TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr19:47184991C>G	ENST00000291281.4	-	15	2211	c.1986G>C	c.(1984-1986)ttG>ttC	p.L662F	PRKD2_ENST00000600194.1_Missense_Mutation_p.L505F|PRKD2_ENST00000433867.1_Missense_Mutation_p.L662F|PRKD2_ENST00000593492.1_5'UTR|PRKD2_ENST00000601806.1_Missense_Mutation_p.L505F|PRKD2_ENST00000595515.1_Missense_Mutation_p.L662F			Q9BZL6	KPCD2_HUMAN	protein kinase D2	662	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial tube morphogenesis (GO:0061154)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell adhesion (GO:0045785)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of T cell receptor signaling pathway (GO:0050862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|T cell receptor signaling pathway (GO:0050852)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)	p.L662F(1)		central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(13)|ovary(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(1)	41		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000189)|all cancers(93;0.000545)|Epithelial(262;0.0219)|GBM - Glioblastoma multiforme(486;0.0353)		GAAGGTGTCTCAAAGCCACCA	0.512																																																1	Substitution - Missense(1)	ovary(1)	19											87.0	79.0	82.0					19																	47184991		2203	4300	6503	51876831	SO:0001583	missense	25865			AF151021	CCDS12689.1, CCDS59401.1	19q13.2	2013-01-10				ENSG00000105287		"""Pleckstrin homology (PH) domain containing"""	17293	protein-coding gene	gene with protein product		607074				11042152, 11062248	Standard	NM_001079880		Approved	PKD2, HSPC187, DKFZP586E0820	uc002pfj.3	Q9BZL6		ENST00000291281.4:c.1986G>C	19.37:g.47184991C>G	ENSP00000291281:p.Leu662Phe		51876831	Q8TB08|Q9P0T6|Q9Y3X8	Missense_Mutation	SNP	ENST00000291281.4	37	CCDS12689.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.973132	0.74246	.	.	ENSG00000105287	ENST00000291281;ENST00000433867	D;D	0.90788	-2.73;-2.73	4.58	4.58	0.56647	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.50627	D	0.000110	D	0.95617	0.8575	M	0.84511	2.7	0.58432	D	0.999998	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.997;0.999;1.0	D	0.96398	0.9294	10	0.87932	D	0	-24.8904	16.5455	0.84444	0.0:1.0:0.0:0.0	.	662;147;662	E7ER94;A0JLT6;Q9BZL6	.;.;KPCD2_HUMAN	F	662	ENSP00000291281:L662F;ENSP00000393978:L662F	ENSP00000291281:L662F	L	-	3	2	PRKD2	51876831	1.000000	0.71417	0.987000	0.45799	0.989000	0.77384	1.948000	0.40303	2.277000	0.76020	0.555000	0.69702	TTG		0.512	PRKD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466591.1	NM_016457	
DHX34	9704	broad.mit.edu	37	19	47856734	47856734	+	Missense_Mutation	SNP	T	T	G	rs570955855		TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	T	T	G	G	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr19:47856734T>G	ENST00000328771.4	+	2	796	c.447T>G	c.(445-447)ttT>ttG	p.F149L		NM_014681.5	NP_055496.2	Q14147	DHX34_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 34	149					negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process (GO:0000956)	membrane (GO:0016020)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)	p.F149L(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(8)|ovary(5)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36		all_cancers(25;1.65e-09)|all_epithelial(76;9.95e-08)|all_lung(116;7.27e-07)|Lung NSC(112;1.6e-06)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		all cancers(93;7.16e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000489)|GBM - Glioblastoma multiforme(486;0.00413)|Epithelial(262;0.0132)		AGCAGGCATTTGGGCGTCTGG	0.652																																																1	Substitution - Missense(1)	ovary(1)	19											53.0	52.0	52.0					19																	47856734		2203	4300	6503	52548574	SO:0001583	missense	9704			D50924	CCDS12700.1	19q13.3	2003-06-13	2003-06-13	2003-06-13	ENSG00000134815	ENSG00000134815		"""DEAH-boxes"""	16719	protein-coding gene	gene with protein product		615475	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 34"""	DDX34		10708517, 8590280	Standard	NM_014681		Approved	KIAA0134	uc010xyn.2	Q14147	OTTHUMG00000149959	ENST00000328771.4:c.447T>G	19.37:g.47856734T>G	ENSP00000331907:p.Phe149Leu		52548574	B4DMY8	Missense_Mutation	SNP	ENST00000328771.4	37	CCDS12700.1	.	.	.	.	.	.	.	.	.	.	T	10.86	1.469597	0.26423	.	.	ENSG00000134815	ENST00000328771;ENST00000257252	T	0.09911	2.93	5.69	-7.76	0.01232	DEAD-like helicase (1);	0.129157	0.35525	N	0.003157	T	0.05960	0.0155	L	0.33485	1.01	0.30083	N	0.809042	P;B	0.43519	0.809;0.075	B;B	0.37943	0.261;0.025	T	0.05209	-1.0899	10	0.25751	T	0.34	.	13.556	0.61759	0.0:0.578:0.0952:0.3268	.	149;149	Q14147;B4E3G3	DHX34_HUMAN;.	L	149	ENSP00000331907:F149L	ENSP00000257252:F149L	F	+	3	2	DHX34	52548574	0.000000	0.05858	0.046000	0.18839	0.297000	0.27493	-1.005000	0.03674	-1.650000	0.01506	-0.451000	0.05528	TTT		0.652	DHX34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314313.3	NM_014681	
TPO	7173	broad.mit.edu	37	2	1418211	1418211	+	Missense_Mutation	SNP	C	C	G	rs140794688		TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr2:1418211C>G	ENST00000345913.4	+	2	122	c.31C>G	c.(31-33)Ctg>Gtg	p.L11V	TPO_ENST00000382269.3_Missense_Mutation_p.L11V|TPO_ENST00000329066.4_Missense_Mutation_p.L11V|TPO_ENST00000497517.2_Intron|TPO_ENST00000346956.3_Missense_Mutation_p.L11V|TPO_ENST00000337415.3_Missense_Mutation_p.L11V|TPO_ENST00000382198.1_Missense_Mutation_p.L11V|TPO_ENST00000539820.1_Missense_Mutation_p.L11V|TPO_ENST00000349624.3_Missense_Mutation_p.L11V|TPO_ENST00000382201.3_Missense_Mutation_p.L11V	NM_000547.5	NP_000538.3	P07202	PERT_HUMAN	thyroid peroxidase	11					cellular nitrogen compound metabolic process (GO:0034641)|embryonic hemopoiesis (GO:0035162)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|iodide peroxidase activity (GO:0004447)|peroxidase activity (GO:0004601)	p.L11V(1)		breast(1)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(14)|liver(2)|lung(33)|ovary(8)|pancreas(6)|prostate(4)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	95	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Dextrothyroxine(DB00509)|Methimazole(DB00763)|Propylthiouracil(DB00550)	GTCTGTCACGCTGGTTATGGC	0.498																																																1	Substitution - Missense(1)	ovary(1)	2											88.0	81.0	83.0					2																	1418211		2203	4300	6503	1397218	SO:0001583	missense	7173				CCDS1643.1, CCDS1644.1, CCDS1646.1	2p25	2008-02-05			ENSG00000115705	ENSG00000115705	1.11.1.7		12015	protein-coding gene	gene with protein product		606765					Standard	NM_175722		Approved	TPX	uc002qww.3	P07202	OTTHUMG00000090271	ENST00000345913.4:c.31C>G	2.37:g.1418211C>G	ENSP00000318820:p.Leu11Val		1397218	P09934|P09935|Q8IUL0|Q8NF94|Q8NF95|Q8NF96|Q8NF97|Q8TCI9	Missense_Mutation	SNP	ENST00000345913.4	37	CCDS1643.1	.	.	.	.	.	.	.	.	.	.	C	11.81	1.751118	0.31046	.	.	ENSG00000115705	ENST00000382269;ENST00000337415;ENST00000345913;ENST00000346956;ENST00000349624;ENST00000539820;ENST00000329066;ENST00000382201;ENST00000423320;ENST00000382198	T;T;T;T;T;T;T;T;T;T	0.68624	0.1;-0.32;-0.34;-0.25;-0.03;0.1;-0.34;-0.21;0.17;-0.03	5.39	2.1	0.27182	.	1.071720	0.07287	N	0.871802	T	0.63850	0.2546	L	0.57536	1.79	0.09310	N	1	P;P;P;P;P	0.51537	0.946;0.872;0.946;0.946;0.91	P;B;P;P;B	0.45639	0.488;0.392;0.488;0.488;0.294	T	0.51694	-0.8673	10	0.37606	T	0.19	-14.4496	5.6919	0.17835	0.4064:0.4996:0.0:0.0939	.	11;11;11;11;11	P07202-4;P07202-5;E9PFM6;P07202-2;P07202	.;.;.;.;PERT_HUMAN	V	11	ENSP00000371704:L11V;ENSP00000337263:L11V;ENSP00000318820:L11V;ENSP00000263886:L11V;ENSP00000332044:L11V;ENSP00000444840:L11V;ENSP00000329869:L11V;ENSP00000371636:L11V;ENSP00000390994:L11V;ENSP00000371633:L11V	ENSP00000329869:L11V	L	+	1	2	TPO	1397218	0.010000	0.17322	0.017000	0.16124	0.004000	0.04260	0.433000	0.21477	0.745000	0.32763	0.655000	0.94253	CTG		0.498	TPO-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206594.2	NM_000547	
SLC5A7	60482	broad.mit.edu	37	2	108626706	108626706	+	Missense_Mutation	SNP	G	G	A			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr2:108626706G>A	ENST00000264047.2	+	9	1408	c.1132G>A	c.(1132-1134)Gtt>Att	p.V378I	SLC5A7_ENST00000409059.1_Missense_Mutation_p.V378I|SLC5A7_ENST00000540517.1_Missense_Mutation_p.V273I	NM_021815.2	NP_068587.1	Q9GZV3	SC5A7_HUMAN	solute carrier family 5 (sodium/choline cotransporter), member 7	378					acetylcholine biosynthetic process (GO:0008292)|cell death (GO:0008219)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	choline binding (GO:0033265)|choline transmembrane transporter activity (GO:0015220)|choline:sodium symporter activity (GO:0005307)	p.V378I(2)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(23)|ovary(2)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	49					Choline(DB00122)	CAAAGAAATCGTTTGGGTTAT	0.443																																																2	Substitution - Missense(2)	ovary(1)|pancreas(1)	2											148.0	120.0	129.0					2																	108626706		2203	4300	6503	107993138	SO:0001583	missense	60482			AF276871	CCDS2074.1	2q12	2013-07-19	2013-07-19		ENSG00000115665	ENSG00000115665		"""Solute carriers"""	14025	protein-coding gene	gene with protein product		608761	"""solute carrier family 5 (choline transporter), member 7"""			11027560	Standard	NM_021815		Approved	hCHT, CHT1	uc002tdv.3	Q9GZV3	OTTHUMG00000130959	ENST00000264047.2:c.1132G>A	2.37:g.108626706G>A	ENSP00000264047:p.Val378Ile		107993138	Q53TF2	Missense_Mutation	SNP	ENST00000264047.2	37	CCDS2074.1	.	.	.	.	.	.	.	.	.	.	G	8.887	0.953064	0.18431	.	.	ENSG00000115665	ENST00000409059;ENST00000540517;ENST00000264047	D;D;D	0.89050	-2.46;-2.46;-2.46	5.85	2.92	0.33932	.	0.168277	0.51477	N	0.000083	T	0.79724	0.4495	N	0.25647	0.755	0.49915	D	0.999832	B	0.06786	0.001	B	0.10450	0.005	T	0.70360	-0.4893	10	0.31617	T	0.26	-25.0208	8.2684	0.31829	0.1388:0.0:0.7353:0.1259	.	378	Q9GZV3	SC5A7_HUMAN	I	378;273;378	ENSP00000387346:V378I;ENSP00000445351:V273I;ENSP00000264047:V378I	ENSP00000264047:V378I	V	+	1	0	SLC5A7	107993138	1.000000	0.71417	0.256000	0.24389	0.798000	0.45092	4.104000	0.57790	0.773000	0.33404	-0.143000	0.13931	GTT		0.443	SLC5A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253562.1		
MAP3K19	80122	broad.mit.edu	37	2	135738768	135738768	+	Nonsense_Mutation	SNP	A	A	T			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture;Sequenom			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr2:135738768A>T	ENST00000375845.3	-	9	3573	c.3543T>A	c.(3541-3543)tgT>tgA	p.C1181*	MAP3K19_ENST00000392917.3_Nonsense_Mutation_p.C313*|MAP3K19_ENST00000358371.4_Nonsense_Mutation_p.C1068*|MAP3K19_ENST00000392918.3_Nonsense_Mutation_p.C315*|MAP3K19_ENST00000392915.1_3'UTR|MAP3K19_ENST00000315513.3_Nonsense_Mutation_p.C42*|MAP3K19_ENST00000375844.3_Nonsense_Mutation_p.C363*	NM_001018044.2|NM_025052.3	NP_001018054.1|NP_079328.3	Q56UN5	M3K19_HUMAN	mitogen-activated protein kinase kinase kinase 19	1181	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.						ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.C1181*(1)|p.C533*(1)									GATGTACCACACAGTTCTCAT	0.418																																																2	Substitution - Nonsense(2)	ovary(2)	2											145.0	142.0	143.0					2																	135738768		2203	4300	6503	135455238	SO:0001587	stop_gained	80122			AK026727	CCDS2176.2, CCDS33293.1, CCDS63021.1, CCDS63020.1, CCDS63022.1	2q21.3	2012-10-16	2012-10-16	2012-10-16	ENSG00000176601	ENSG00000176601		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	26249	protein-coding gene	gene with protein product			"""Yeast Sps1/Ste20-related kinase 4 (S. cerevisiae)"", ""yeast Sps1/Ste20-related kinase 4 (S. cerevisiae)"", ""YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)"""	YSK4		12477932	Standard	NM_001282883		Approved	FLJ23074	uc002tue.1	Q56UN5	OTTHUMG00000074083	ENST00000375845.3:c.3543T>A	2.37:g.135738768A>T	ENSP00000365005:p.Cys1181*		135455238	B2RP57|B7ZMH9|E2QRE3|Q56UN1|Q56UN2|Q56UN3|Q56UN4|Q8N4E9|Q9H5T2	Nonsense_Mutation	SNP	ENST00000375845.3	37	CCDS2176.2	.	.	.	.	.	.	.	.	.	.	A	23.7	4.445499	0.84101	.	.	ENSG00000176601	ENST00000375845;ENST00000358371;ENST00000375844;ENST00000392918;ENST00000392917;ENST00000437365;ENST00000315513	.	.	.	5.88	1.02	0.19986	.	0.000000	0.50627	D	0.000112	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.34782	T	0.22	.	5.4219	0.16405	0.5741:0.1383:0.2877:0.0	.	.	.	.	X	1181;1068;363;315;313;571;42	.	ENSP00000321160:C42X	C	-	3	2	YSK4	135455238	0.995000	0.38212	1.000000	0.80357	0.986000	0.74619	0.585000	0.23879	0.154000	0.19237	-0.254000	0.11334	TGT		0.418	MAP3K19-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000158244.1	NM_025052	
NEB	4703	broad.mit.edu	37	2	152499124	152499124	+	Silent	SNP	G	G	T			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr2:152499124G>T	ENST00000172853.10	-	60	8484	c.8337C>A	c.(8335-8337)atC>atA	p.I2779I	NEB_ENST00000427231.2_Silent_p.I2779I|NEB_ENST00000604864.1_Silent_p.I2779I|NEB_ENST00000603639.1_Silent_p.I2779I|NEB_ENST00000409198.1_Silent_p.I2779I|NEB_ENST00000397345.3_Silent_p.I2779I			P20929	NEBU_HUMAN	nebulin	2779					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)	p.I2779I(1)		NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		TGGCTGCCTTGATAGGAATGG	0.393																																																1	Substitution - coding silent(1)	ovary(1)	2											81.0	79.0	80.0					2																	152499124		1890	4112	6002	152207370	SO:0001819	synonymous_variant	4703			X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.8337C>A	2.37:g.152499124G>T			152207370	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Silent	SNP	ENST00000172853.10	37																																																																																					0.393	NEB-201	KNOWN	basic	protein_coding	protein_coding		NM_004543	
TTN	7273	broad.mit.edu	37	2	179429242	179429242	+	Missense_Mutation	SNP	A	A	G	rs369868913		TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr2:179429242A>G	ENST00000591111.1	-	276	76918	c.76694T>C	c.(76693-76695)aTt>aCt	p.I25565T	TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.I18266T|TTN_ENST00000460472.2_Missense_Mutation_p.I18141T|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.I18333T|TTN_ENST00000342992.6_Missense_Mutation_p.I24638T|TTN-AS1_ENST00000586831.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.I27206T|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA			Q8WZ42	TITIN_HUMAN	titin	25565	Fibronectin type-III 86. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.I18141T(1)|p.I24636T(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTTTTCTACAATATAACCTGT	0.413																																																2	Substitution - Missense(2)	ovary(2)	2						A	THR/ILE,THR/ILE,THR/ILE,THR/ILE	0,3744		0,0,1872	77.0	71.0	73.0		54998,54797,73913,54422	5.0	0.0	2		73	1,8229		0,1,4114	no	missense,missense,missense,missense	TTN	NM_133437.3,NM_133432.3,NM_133378.4,NM_003319.4	89,89,89,89	0,1,5986	GG,GA,AA		0.0122,0.0,0.0084	benign,benign,benign,benign	18333/27119,18266/27052,24638/33424,18141/26927	179429242	1,11973	1872	4115	5987	179137488	SO:0001583	missense	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.76694T>C	2.37:g.179429242A>G	ENSP00000465570:p.Ile25565Thr		179137488	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	A	7.313	0.615344	0.14129	0.0	1.22E-4	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.55760	0.5;0.5;0.5;0.5	6.16	5.01	0.66863	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.46560	0.1399	L	0.42686	1.345	0.37270	D	0.907353	B;B;B;B	0.06786	0.001;0.001;0.001;0.0	B;B;B;B	0.12156	0.003;0.003;0.007;0.007	T	0.49322	-0.8952	9	0.87932	D	0	.	12.5328	0.56126	0.9353:0.0:0.0647:0.0	.	18141;18266;18333;25565	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	T	24638;18141;18333;18266;18139	ENSP00000343764:I24638T;ENSP00000434586:I18141T;ENSP00000340554:I18333T;ENSP00000352154:I18266T	ENSP00000340554:I18333T	I	-	2	0	TTN	179137488	1.000000	0.71417	0.015000	0.15790	0.555000	0.35460	6.309000	0.72825	1.143000	0.42306	0.528000	0.53228	ATT		0.413	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
NCKAP1	10787	broad.mit.edu	37	2	183790515	183790515	+	Missense_Mutation	SNP	T	T	C			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr2:183790515T>C	ENST00000361354.4	-	31	3674	c.3302A>G	c.(3301-3303)gAt>gGt	p.D1101G	NCKAP1_ENST00000360982.2_Missense_Mutation_p.D1107G|NCKAP1_ENST00000478449.1_5'Flank	NM_013436.3	NP_038464.1	Q9Y2A7	NCKP1_HUMAN	NCK-associated protein 1	1101					apical protein localization (GO:0045176)|apoptotic process (GO:0006915)|basal protein localization (GO:0045175)|central nervous system development (GO:0007417)|embryonic body morphogenesis (GO:0010172)|embryonic foregut morphogenesis (GO:0048617)|embryonic heart tube development (GO:0035050)|endoderm development (GO:0007492)|establishment or maintenance of actin cytoskeleton polarity (GO:0030950)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|lamellipodium assembly (GO:0030032)|mesodermal cell migration (GO:0008078)|neural tube closure (GO:0001843)|notochord morphogenesis (GO:0048570)|paraxial mesoderm morphogenesis (GO:0048340)|positive regulation of Arp2/3 complex-mediated actin nucleation (GO:2000601)|positive regulation of lamellipodium assembly (GO:0010592)|protein stabilization (GO:0050821)|Rac protein signal transduction (GO:0016601)|regulation of protein localization (GO:0032880)|somitogenesis (GO:0001756)|zygotic determination of anterior/posterior axis, embryo (GO:0007354)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|SCAR complex (GO:0031209)	protein complex binding (GO:0032403)	p.D1107G(1)		breast(3)|cervix(2)|endometrium(3)|kidney(4)|large_intestine(11)|lung(16)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	45			OV - Ovarian serous cystadenocarcinoma(117;0.0942)|Epithelial(96;0.209)			TTCCAAAAGATCCATTGTAAG	0.284																																																1	Substitution - Missense(1)	ovary(1)	2											101.0	98.0	99.0					2																	183790515		2203	4299	6502	183498760	SO:0001583	missense	10787			AB014509	CCDS2287.1, CCDS2288.1	2q32	2009-08-14			ENSG00000061676	ENSG00000061676			7666	protein-coding gene	gene with protein product		604891				10673335, 12181570, 9344857	Standard	NM_013436		Approved	Nap1, HEM2, NAP125	uc002upb.4	Q9Y2A7	OTTHUMG00000132623	ENST00000361354.4:c.3302A>G	2.37:g.183790515T>C	ENSP00000355348:p.Asp1101Gly		183498760	O60329|Q53QN5|Q53S94|Q53Y35	Missense_Mutation	SNP	ENST00000361354.4	37	CCDS2287.1	.	.	.	.	.	.	.	.	.	.	T	21.1	4.104547	0.77096	.	.	ENSG00000061676	ENST00000361354;ENST00000360982	T;T	0.38240	1.15;1.15	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	T	0.65133	0.2662	M	0.85945	2.785	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.997	T	0.71337	-0.4623	10	0.72032	D	0.01	-17.3627	15.7957	0.78409	0.0:0.0:0.0:1.0	.	1101;1107	Q9Y2A7;Q9Y2A7-2	NCKP1_HUMAN;.	G	1101;1107	ENSP00000355348:D1101G;ENSP00000354251:D1107G	ENSP00000354251:D1107G	D	-	2	0	NCKAP1	183498760	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.948000	0.87774	2.127000	0.65507	0.528000	0.53228	GAT		0.284	NCKAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255867.2	NM_205842	
HECW2	57520	broad.mit.edu	37	2	197184519	197184519	+	Missense_Mutation	SNP	C	C	G			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr2:197184519C>G	ENST00000260983.3	-	9	1277	c.1095G>C	c.(1093-1095)caG>caC	p.Q365H	HECW2_ENST00000409111.1_Missense_Mutation_p.Q9H	NM_020760.1	NP_065811.1	Q9P2P5	HECW2_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2	365					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.Q365H(1)		biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(24)|lung(45)|ovary(5)|pancreas(2)|prostate(2)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	113						TAGAGCACACCTGGCTGTCGT	0.517																																																1	Substitution - Missense(1)	ovary(1)	2											100.0	87.0	91.0					2																	197184519		2203	4300	6503	196892764	SO:0001583	missense	57520			AL390186	CCDS33354.1	2q32.3	2004-12-13			ENSG00000138411	ENSG00000138411			29853	protein-coding gene	gene with protein product						10718198, 12890487	Standard	NM_020760		Approved	KIAA1301, NEDL2	uc002utm.1	Q9P2P5	OTTHUMG00000154435	ENST00000260983.3:c.1095G>C	2.37:g.197184519C>G	ENSP00000260983:p.Gln365His		196892764	B8ZZB4|Q17RT5|Q68DF8|Q9NPS9	Missense_Mutation	SNP	ENST00000260983.3	37	CCDS33354.1	.	.	.	.	.	.	.	.	.	.	C	0.830	-0.745586	0.03065	.	.	ENSG00000138411	ENST00000409111;ENST00000260983	T;T	0.30448	1.53;1.53	5.43	-10.9	0.00192	.	1.428700	0.04438	N	0.370451	T	0.10852	0.0265	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.29579	-1.0007	10	0.46703	T	0.11	.	0.8874	0.01247	0.276:0.132:0.1998:0.3922	.	365	Q9P2P5	HECW2_HUMAN	H	9;365	ENSP00000386775:Q9H;ENSP00000260983:Q365H	ENSP00000260983:Q365H	Q	-	3	2	HECW2	196892764	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-1.392000	0.02523	-3.876000	0.00096	-0.140000	0.14226	CAG		0.517	HECW2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335199.3	NM_020760	
ASIC4	55515	broad.mit.edu	37	2	220402768	220402768	+	Nonstop_Mutation	SNP	G	G	T			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr2:220402768G>T	ENST00000347842.3	+	9	1958	c.1944G>T	c.(1942-1944)taG>taT	p.*648Y	ASIC4_ENST00000358078.4_Nonstop_Mutation_p.*667Y	NM_182847.2	NP_878267.2	Q96FT7	ASIC4_HUMAN	acid-sensing (proton-gated) ion channel family member 4	0					ion transmembrane transport (GO:0034220)|sodium ion transmembrane transport (GO:0035725)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)	ion channel activity (GO:0005216)|sodium channel activity (GO:0005272)|sodium ion transmembrane transporter activity (GO:0015081)	p.*667Y(1)									TTGCTTGCTAGGACGGTGCTG	0.647																																																1	Nonstop extension(1)	ovary(1)	2											39.0	36.0	37.0					2																	220402768		2201	4300	6501	220111012	SO:0001578	stop_lost	55515			AJ271643	CCDS2442.1	2q36.1	2012-02-22	2012-02-22	2012-02-22	ENSG00000072182	ENSG00000072182		"""Ion channels / Acid-sensing (proton-gated) ion channels"""	21263	protein-coding gene	gene with protein product		606715	"""amiloride-sensitive cation channel 4, pituitary"", ""amiloride-sensitive cation channel family member 4, pituitary"""	ACCN4		10852210	Standard	NM_182847		Approved	BNAC4	uc002vma.3	Q96FT7	OTTHUMG00000058928	ENST00000347842.3:c.1944G>T	2.37:g.220402768G>T	ENSP00000326627:p.*648Tyrext*108		220111012	Q53SB7|Q6GMS1|Q6PIN9|Q9NQA4	Nonstop_Mutation	SNP	ENST00000347842.3	37	CCDS2442.1	.	.	.	.	.	.	.	.	.	.	G	11.34	1.610971	0.28712	.	.	ENSG00000072182	ENST00000347842;ENST00000358078	.	.	.	4.31	3.42	0.39159	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.4296	0.50032	0.0879:0.0:0.9121:0.0	.	.	.	.	Y	648;667	.	.	X	+	3	2	ACCN4	220111012	1.000000	0.71417	0.994000	0.49952	0.811000	0.45836	2.776000	0.47709	1.168000	0.42723	0.655000	0.94253	TAG		0.647	ASIC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000130263.1	NM_018674	
CAPN10	11132	broad.mit.edu	37	2	241528815	241528815	+	Missense_Mutation	SNP	A	A	C			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	A	A	C	C	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr2:241528815A>C	ENST00000391984.2	+	2	393	c.197A>C	c.(196-198)aAg>aCg	p.K66T	CAPN10_ENST00000352879.4_Intron|CAPN10_ENST00000354082.4_Missense_Mutation_p.K66T|CAPN10-AS1_ENST00000567819.1_RNA|CAPN10_ENST00000404753.3_Missense_Mutation_p.K66T|CAPN10_ENST00000270364.7_Missense_Mutation_p.K66T|CAPN10_ENST00000391982.2_Missense_Mutation_p.K66T	NM_023083.3	NP_075571	Q9HC96	CAN10_HUMAN	calpain 10	66	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				actin cytoskeleton reorganization (GO:0031532)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to insulin stimulus (GO:0032869)|positive regulation of glucose import (GO:0046326)|positive regulation of insulin secretion (GO:0032024)|positive regulation of intracellular transport (GO:0032388)|positive regulation of type B pancreatic cell apoptotic process (GO:2000676)|proteolysis (GO:0006508)|type B pancreatic cell apoptotic process (GO:0097050)	cell (GO:0005623)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|cytoskeletal protein binding (GO:0008092)|SNARE binding (GO:0000149)	p.K66T(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(11)|ovary(3)|urinary_tract(1)	27		all_epithelial(40;1.72e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0294)|all_neural(83;0.0459)|Lung NSC(271;0.094)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;1.13e-31)|all cancers(36;3.24e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.82e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;5.1e-06)|Lung(119;0.00168)|Colorectal(34;0.00495)|LUSC - Lung squamous cell carcinoma(224;0.00813)|COAD - Colon adenocarcinoma(134;0.032)		GGGCAGGTGAAGCAGGGGCTG	0.607																																																1	Substitution - Missense(1)	ovary(1)	2											85.0	95.0	91.0					2																	241528815		2203	4300	6503	241177488	SO:0001583	missense	11132			AF089088	CCDS33420.1, CCDS42838.1	2q37.3	2008-05-22			ENSG00000142330	ENSG00000142330			1477	protein-coding gene	gene with protein product		605286				11017071, 11018080	Standard	NM_023083		Approved		uc002vzk.2	Q9HC96	OTTHUMG00000133358	ENST00000391984.2:c.197A>C	2.37:g.241528815A>C	ENSP00000375844:p.Lys66Thr		241177488	A8MVS7|Q4ZFV1|Q8NCD4|Q96IG4|Q96JI2|Q9HC89|Q9HC90|Q9HC91|Q9HC92|Q9HC93|Q9HC94|Q9HC95	Missense_Mutation	SNP	ENST00000391984.2	37	CCDS42838.1	.	.	.	.	.	.	.	.	.	.	A	13.80	2.344471	0.41498	.	.	ENSG00000142330	ENST00000391984;ENST00000391982;ENST00000404753;ENST00000270364;ENST00000354082	D;D;D;D;D	0.87412	-2.25;-2.25;-2.25;-2.25;-2.25	4.54	3.38	0.38709	Peptidase C2, calpain, catalytic domain (3);	0.000000	0.85682	D	0.000000	D	0.90628	0.7061	M	0.65677	2.01	0.48632	D	0.999689	D;D;D;D	0.76494	0.999;0.999;0.997;0.963	D;D;D;P	0.71414	0.957;0.973;0.933;0.906	D	0.88682	0.3203	10	0.52906	T	0.07	.	8.1279	0.31010	0.9008:0.0:0.0992:0.0	.	66;66;66;66	B7Z6G3;Q9HC96-7;Q9HC96-3;Q9HC96	.;.;.;CAN10_HUMAN	T	66	ENSP00000375844:K66T;ENSP00000375842:K66T;ENSP00000384422:K66T;ENSP00000270364:K66T;ENSP00000270362:K66T	ENSP00000270361:K66T	K	+	2	0	CAPN10	241177488	1.000000	0.71417	1.000000	0.80357	0.904000	0.53231	6.714000	0.74692	0.604000	0.29930	0.533000	0.62120	AAG		0.607	CAPN10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257191.3	NM_023083	
FARP2	9855	broad.mit.edu	37	2	242402804	242402804	+	Silent	SNP	C	C	T			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr2:242402804C>T	ENST00000264042.3	+	16	1902	c.1732C>T	c.(1732-1734)Ctg>Ttg	p.L578L	FARP2_ENST00000373287.4_Silent_p.L578L|FARP2_ENST00000545004.1_Silent_p.L578L	NM_014808.2	NP_055623.1	O94887	FARP2_HUMAN	FERM, RhoGEF and pleckstrin domain protein 2	578	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				actin cytoskeleton reorganization (GO:0031532)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|neuron remodeling (GO:0016322)|osteoclast differentiation (GO:0030316)|podosome assembly (GO:0071800)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of integrin activation (GO:0033623)|regulation of Rac GTPase activity (GO:0032314)|semaphorin-plexin signaling pathway (GO:0071526)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)	Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.L578L(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(18)|ovary(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	43		all_cancers(19;4.88e-34)|all_epithelial(40;4.81e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Lung NSC(271;0.0886)|Ovarian(221;0.0905)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;1.81e-33)|all cancers(36;1.61e-30)|OV - Ovarian serous cystadenocarcinoma(60;6.83e-15)|Kidney(56;1.19e-08)|KIRC - Kidney renal clear cell carcinoma(57;8.98e-08)|BRCA - Breast invasive adenocarcinoma(100;1.49e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00125)|Colorectal(34;0.0199)|COAD - Colon adenocarcinoma(134;0.121)		TCTGATGACGCTGCTCTTCTC	0.597																																																1	Substitution - coding silent(1)	ovary(1)	2											140.0	112.0	121.0					2																	242402804		2203	4300	6503	242051477	SO:0001819	synonymous_variant	9855			AB018336	CCDS33424.1, CCDS63197.1	2q37.3	2013-01-10			ENSG00000006607	ENSG00000006607		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	16460	protein-coding gene	gene with protein product						9872452, 12351724	Standard	NM_001282984		Approved	KIAA0793, FIR, PLEKHC3, FRG	uc002wbi.2	O94887	OTTHUMG00000151574	ENST00000264042.3:c.1732C>T	2.37:g.242402804C>T			242051477	B7Z6J8|F5GZ84|Q53QM5|Q8WU27|Q9UFE7	Silent	SNP	ENST00000264042.3	37	CCDS33424.1																																																																																				0.597	FARP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323153.1		
PLCB4	5332	broad.mit.edu	37	20	9440287	9440287	+	Silent	SNP	A	A	G			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture;Sequenom			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr20:9440287A>G	ENST00000378493.1	+	31	3057	c.3042A>G	c.(3040-3042)aaA>aaG	p.K1014K	PLCB4_ENST00000378501.2_Silent_p.K1014K|PLCB4_ENST00000334005.3_Silent_p.K1014K|PLCB4_ENST00000278655.4_Silent_p.K1014K|PLCB4_ENST00000414679.2_Silent_p.K1026K|PLCB4_ENST00000378473.3_Silent_p.K1026K|PLCB4_ENST00000492632.1_Intron			Q15147	PLCB4_HUMAN	phospholipase C, beta 4	1014					inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|dendrite (GO:0030425)|nucleus (GO:0005634)|postsynaptic density (GO:0014069)|smooth endoplasmic reticulum (GO:0005790)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)	p.K1014K(1)		NS(2)|breast(4)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(11)|liver(4)|lung(34)|ovary(3)|pancreas(1)|prostate(1)|skin(19)|upper_aerodigestive_tract(1)	87						AACAGGTCAAAGAGATTGTAG	0.473																																																1	Substitution - coding silent(1)	ovary(1)	20											64.0	55.0	58.0					20																	9440287		2203	4300	6503	9388287	SO:0001819	synonymous_variant	5332				CCDS13104.1, CCDS13105.1, CCDS54447.1	20p12	2008-03-18			ENSG00000101333	ENSG00000101333	3.1.4.11		9059	protein-coding gene	gene with protein product		600810				8530101	Standard	NM_000933		Approved		uc021wam.1	Q15147	OTTHUMG00000031853	ENST00000378493.1:c.3042A>G	20.37:g.9440287A>G			9388287	B7ZLK6|E2QRH8|Q17R56|Q5JYS8|Q5JYS9|Q5JYT0|Q5JYT3|Q5JYT4|Q9BQW5|Q9BQW6|Q9BQW8|Q9UJQ2	Silent	SNP	ENST00000378493.1	37	CCDS13105.1																																																																																				0.473	PLCB4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000077948.2		
KIAA1755	85449	broad.mit.edu	37	20	36870196	36870196	+	Missense_Mutation	SNP	C	C	T	rs561742884		TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr20:36870196C>T	ENST00000279024.4	-	3	608	c.337G>A	c.(337-339)Gag>Aag	p.E113K		NM_001029864.1	NP_001025035.1	Q5JYT7	K1755_HUMAN	KIAA1755	113								p.E113K(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(31)|ovary(5)|pancreas(2)|skin(4)|stomach(1)	54		Myeloproliferative disorder(115;0.00874)				GACTGCTCCTCCTGGGGCTCC	0.552													C|||	1	0.000199681	0.0	0.0014	5008	,	,		19452	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	20											90.0	88.0	89.0					20																	36870196		2203	4300	6503	36303610	SO:0001583	missense	85449			AB051542	CCDS33467.1	20q11.23	2007-12-07			ENSG00000149633	ENSG00000149633			29372	protein-coding gene	gene with protein product						11214970	Standard	NM_001029864		Approved	RP5-1054A22.3	uc002xhy.1	Q5JYT7	OTTHUMG00000032436	ENST00000279024.4:c.337G>A	20.37:g.36870196C>T	ENSP00000279024:p.Glu113Lys		36303610	Q9C0A8	Missense_Mutation	SNP	ENST00000279024.4	37	CCDS33467.1	.	.	.	.	.	.	.	.	.	.	C	17.99	3.522837	0.64747	.	.	ENSG00000149633	ENST00000279024	T	0.06068	3.35	5.71	3.62	0.41486	.	0.123818	0.36444	N	0.002585	T	0.09774	0.0240	L	0.60455	1.87	0.09310	N	1	P	0.48407	0.91	P	0.45099	0.469	T	0.11299	-1.0593	10	0.42905	T	0.14	.	11.116	0.48259	0.1259:0.5149:0.3593:0.0	.	113	Q5JYT7	K1755_HUMAN	K	113	ENSP00000279024:E113K	ENSP00000279024:E113K	E	-	1	0	KIAA1755	36303610	0.510000	0.26171	0.996000	0.52242	0.964000	0.63967	1.228000	0.32588	1.364000	0.46038	0.561000	0.74099	GAG		0.552	KIAA1755-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079144.3	NM_001029864	
PIWIL3	440822	broad.mit.edu	37	22	25115513	25115513	+	Missense_Mutation	SNP	G	G	C			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr22:25115513G>C	ENST00000332271.5	-	21	2991	c.2575C>G	c.(2575-2577)Ctg>Gtg	p.L859V	PIWIL3_ENST00000532537.2_5'UTR|PIWIL3_ENST00000527701.1_Missense_Mutation_p.L741V|PIWIL3_ENST00000533313.1_Missense_Mutation_p.L741V	NM_001008496.3|NM_001255975.1	NP_001008496.2|NP_001242904.1	Q7Z3Z3	PIWL3_HUMAN	piwi-like RNA-mediated gene silencing 3	859	Piwi. {ECO:0000255|PROSITE- ProRule:PRU00150}.				cell differentiation (GO:0030154)|gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|regulation of translation (GO:0006417)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)	RNA binding (GO:0003723)	p.L859V(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(14)|lung(15)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	50						AGGTAAGCCAGCTTGTGGGCA	0.458																																																1	Substitution - Missense(1)	ovary(1)	22											121.0	110.0	114.0					22																	25115513		2203	4300	6503	23445513	SO:0001583	missense	440822			AB079368	CCDS33623.1	22q11.23	2013-02-15	2013-02-15		ENSG00000184571	ENSG00000184571		"""Argonaute/PIWI family"""	18443	protein-coding gene	gene with protein product		610314	"""piwi-like 3 (Drosophila)"""			12906857	Standard	NM_001008496		Approved	HIWI3	uc003abd.2	Q7Z3Z3	OTTHUMG00000150788	ENST00000332271.5:c.2575C>G	22.37:g.25115513G>C	ENSP00000330031:p.Leu859Val		23445513		Missense_Mutation	SNP	ENST00000332271.5	37	CCDS33623.1	.	.	.	.	.	.	.	.	.	.	G	12.34	1.907280	0.33628	.	.	ENSG00000184571	ENST00000332271;ENST00000533313;ENST00000527701	T;T;T	0.18810	2.19;2.19;2.19	3.14	3.14	0.36123	Stem cell self-renewal protein Piwi (3);Ribonuclease H-like (1);	0.000000	0.56097	D	0.000031	T	0.35537	0.0935	M	0.63843	1.955	0.51767	D	0.999934	D;P;D	0.89917	1.0;0.944;1.0	D;D;D	0.91635	0.999;0.928;0.999	T	0.05801	-1.0863	10	0.30078	T	0.28	-13.9851	6.3275	0.21253	0.1346:0.0:0.8654:0.0	.	741;850;859	E9PIP6;B4DYF7;Q7Z3Z3	.;.;PIWL3_HUMAN	V	859;741;741	ENSP00000330031:L859V;ENSP00000431843:L741V;ENSP00000435718:L741V	ENSP00000330031:L859V	L	-	1	2	PIWIL3	23445513	1.000000	0.71417	0.997000	0.53966	0.067000	0.16453	1.734000	0.38166	2.082000	0.62665	0.555000	0.69702	CTG		0.458	PIWIL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320084.2	NM_001008496	
LIMK2	3985	broad.mit.edu	37	22	31662052	31662052	+	Missense_Mutation	SNP	C	C	G	rs115056007		TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture;Sequenom			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr22:31662052C>G	ENST00000331728.4	+	8	1089	c.975C>G	c.(973-975)atC>atG	p.I325M	LIMK2_ENST00000406516.1_Missense_Mutation_p.I247M|LIMK2_ENST00000340552.4_Missense_Mutation_p.I304M|LIMK2_ENST00000333611.4_Missense_Mutation_p.I304M|LIMK2_ENST00000444929.2_Missense_Mutation_p.I79M	NM_005569.3	NP_005560.1	P53671	LIMK2_HUMAN	LIM domain kinase 2	325					phosphorylation (GO:0016310)|spermatogenesis (GO:0007283)	cis-Golgi network (GO:0005801)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)	p.I325M(1)		endometrium(7)|kidney(3)|large_intestine(6)|lung(6)|ovary(2)|prostate(4)|skin(1)	29						CACAGCAGATCTTCCGGCCCT	0.582																																																1	Substitution - Missense(1)	ovary(1)	22											96.0	93.0	94.0					22																	31662052		2203	4300	6503	29992052	SO:0001583	missense	3985			D45906	CCDS13891.1, CCDS13892.1, CCDS33637.1	22q12	2005-01-21			ENSG00000182541	ENSG00000182541			6614	protein-coding gene	gene with protein product		601988				8537403, 10591208	Standard	NM_005569		Approved		uc003akh.3	P53671	OTTHUMG00000151251	ENST00000331728.4:c.975C>G	22.37:g.31662052C>G	ENSP00000332687:p.Ile325Met		29992052	A8K6H5|Q7KZ80|Q7L3H5|Q96E10|Q99464|Q9UFU0	Missense_Mutation	SNP	ENST00000331728.4	37	CCDS13891.1	.	.	.	.	.	.	.	.	.	.	C	19.07	3.756504	0.69648	.	.	ENSG00000182541	ENST00000406516;ENST00000444929;ENST00000331728;ENST00000436394;ENST00000333611;ENST00000340552	D;D;D;D;D	0.89270	-2.49;-2.49;-2.49;-2.49;-2.49	4.97	2.62	0.31277	Protein kinase-like domain (1);	0.096917	0.64402	D	0.000001	D	0.93141	0.7816	M	0.78637	2.42	0.49130	D	0.999752	D;D;D;D;D	0.89917	1.0;0.999;1.0;0.999;0.998	D;D;D;D;D	0.79784	0.993;0.976;0.985;0.977;0.991	D	0.92367	0.5902	10	0.87932	D	0	-29.1955	10.5525	0.45097	0.0:0.8291:0.0:0.1709	.	357;304;79;325;247	F5GY29;Q7L3H5;E7EUC1;P53671;B5MC51	.;.;.;LIMK2_HUMAN;.	M	247;79;325;357;304;304	ENSP00000384602:I247M;ENSP00000409522:I79M;ENSP00000332687:I325M;ENSP00000330470:I304M;ENSP00000339916:I304M	ENSP00000332687:I325M	I	+	3	3	LIMK2	29992052	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	1.358000	0.34102	0.488000	0.27723	0.467000	0.42956	ATC		0.582	LIMK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321911.1	NM_016733	
MKL1	57591	broad.mit.edu	37	22	40827433	40827433	+	Missense_Mutation	SNP	G	G	C			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr22:40827433G>C	ENST00000355630.3	-	6	705	c.115C>G	c.(115-117)Ctg>Gtg	p.L39V	MKL1_ENST00000396617.3_Missense_Mutation_p.L39V|MKL1_ENST00000407029.1_Missense_Mutation_p.L39V|MKL1_ENST00000402042.1_Missense_Mutation_p.L39V|MKL1_ENST00000402630.1_Missense_Mutation_p.L39V	NM_020831.3	NP_065882.1	Q969V6	MKL1_HUMAN	megakaryoblastic leukemia (translocation) 1	39	Mediates interaction with SCAI and ACTB. {ECO:0000250}.				negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription via serum response element binding (GO:0010735)|smooth muscle cell differentiation (GO:0051145)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	actin binding (GO:0003779)|actin monomer binding (GO:0003785)|leucine zipper domain binding (GO:0043522)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription regulatory region sequence-specific DNA binding (GO:0000976)	p.L39V(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(13)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	30						ATCCTGACCAGCTCCGATCTC	0.468			T	RBM15	acute megakaryocytic leukemia																																		Dom	yes		22	22q13	57591	megakaryoblastic leukemia (translocation) 1		L	1	Substitution - Missense(1)	ovary(1)	22											296.0	264.0	275.0					22																	40827433		2203	4300	6503	39157379	SO:0001583	missense	57591			AB037859	CCDS14003.1, CCDS74865.1, CCDS74866.1	22q13	2008-06-12			ENSG00000196588	ENSG00000196588			14334	protein-coding gene	gene with protein product	"""megakaryocytic acute leukemia"", ""myocardin-related transcription factor A"", ""basic, SAP and coiled-coil domain"""	606078				11431691, 12019265, 14970199	Standard	XM_005261692		Approved	KIAA1438, MAL, MRTF-A, BSAC	uc003ayw.1	Q969V6	OTTHUMG00000151146	ENST00000355630.3:c.115C>G	22.37:g.40827433G>C	ENSP00000347847:p.Leu39Val		39157379	Q8TCL1|Q96SC5|Q96SC6|Q9P2B0	Missense_Mutation	SNP	ENST00000355630.3	37	CCDS14003.1	.	.	.	.	.	.	.	.	.	.	G	23.7	4.446039	0.84101	.	.	ENSG00000196588	ENST00000355630;ENST00000396617;ENST00000402042;ENST00000407029;ENST00000402630;ENST00000422851	D;D;D;D;D;D	0.99839	-7.07;-7.07;-7.07;-7.07;-7.07;-7.07	4.4	4.4	0.53042	.	0.000000	0.64402	D	0.000006	D	0.99750	0.9900	M	0.80746	2.51	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.87578	0.998;0.994;0.994	D	0.96868	0.9637	10	0.87932	D	0	-18.5245	12.0667	0.53592	0.0832:0.0:0.9167:0.0	.	39;39;39	B0QY83;E7ER32;Q969V6	.;.;MKL1_HUMAN	V	39;39;39;39;39;66	ENSP00000347847:L39V;ENSP00000379861:L39V;ENSP00000385584:L39V;ENSP00000385835:L39V;ENSP00000385076:L39V;ENSP00000398478:L66V	ENSP00000347847:L39V	L	-	1	2	MKL1	39157379	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	4.051000	0.57412	2.456000	0.83038	0.650000	0.86243	CTG		0.468	MKL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321522.1	NM_020831	
LSMEM2	132228	broad.mit.edu	37	3	50324588	50324588	+	Missense_Mutation	SNP	C	C	G			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr3:50324588C>G	ENST00000316436.3	+	4	537	c.450C>G	c.(448-450)agC>agG	p.S150R	IFRD2_ENST00000484043.1_5'Flank	NM_153215.1	NP_694947.1	Q8N112	LSME2_HUMAN	leucine-rich single-pass membrane protein 2	150						integral component of membrane (GO:0016021)		p.S150R(1)									CCAGCCTCAGCCAGCTTCGGA	0.602																																																1	Substitution - Missense(1)	ovary(1)	3											56.0	52.0	54.0					3																	50324588		2203	4300	6503	50299592	SO:0001583	missense	132228			AK095927	CCDS2814.1	3p21.31	2013-03-08	2013-03-08	2013-03-08	ENSG00000179564	ENSG00000179564			26781	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 45"""	C3orf45			Standard	NM_153215		Approved	FLJ38608	uc003cyz.3	Q8N112	OTTHUMG00000156938	ENST00000316436.3:c.450C>G	3.37:g.50324588C>G	ENSP00000315081:p.Ser150Arg		50299592		Missense_Mutation	SNP	ENST00000316436.3	37	CCDS2814.1	.	.	.	.	.	.	.	.	.	.	C	18.35	3.604007	0.66445	.	.	ENSG00000179564	ENST00000316436	.	.	.	4.72	3.84	0.44239	.	0.212129	0.34531	N	0.003884	T	0.30262	0.0759	N	0.14661	0.345	0.27136	N	0.961768	D	0.57571	0.98	P	0.52957	0.714	T	0.07347	-1.0777	9	0.66056	D	0.02	1.6057	8.5605	0.33507	0.0:0.8954:0.0:0.1046	.	150	Q8N112	CC045_HUMAN	R	150	.	ENSP00000315081:S150R	S	+	3	2	C3orf45	50299592	1.000000	0.71417	1.000000	0.80357	0.909000	0.53808	0.404000	0.20999	1.214000	0.43395	0.561000	0.74099	AGC		0.602	LSMEM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346671.1	NM_153215	
EOGT	285203	broad.mit.edu	37	3	69057654	69057654	+	Missense_Mutation	SNP	C	C	T			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr3:69057654C>T	ENST00000383701.3	-	5	978	c.236G>A	c.(235-237)tGc>tAc	p.C79Y	EOGT_ENST00000540764.1_5'UTR|EOGT_ENST00000295571.5_Missense_Mutation_p.C79Y|EOGT_ENST00000540955.1_5'UTR	NM_001278689.1	NP_001265618.1	Q5NDL2	EOGT_HUMAN	EGF domain-specific O-linked N-acetylglucosamine (GlcNAc) transferase	79					protein O-linked glycosylation (GO:0006493)	endoplasmic reticulum (GO:0005783)	protein N-acetylglucosaminyltransferase activity (GO:0016262)	p.C79Y(1)									ATAACCCCAGCAGTACTTTAG	0.388																																																1	Substitution - Missense(1)	ovary(1)	3											144.0	138.0	140.0					3																	69057654		2203	4300	6503	69140344	SO:0001583	missense	285203			AK091089	CCDS2908.1, CCDS63684.1	3p14.1	2013-10-11	2012-05-21	2012-05-21	ENSG00000163378	ENSG00000163378	2.4.1.255		28526	protein-coding gene	gene with protein product	"""AER61 glycosyltransferase"""	614789	"""chromosome 3 open reading frame 64"""	C3orf64		22310717	Standard	NM_001278689		Approved	AER61, FLJ33770	uc003dnk.3	Q5NDL2	OTTHUMG00000156279	ENST00000383701.3:c.236G>A	3.37:g.69057654C>T	ENSP00000373206:p.Cys79Tyr		69140344	A8K2U1|B4DFH5|L7X1M5|Q6MZY0|Q6P985|Q6ZTV0	Missense_Mutation	SNP	ENST00000383701.3	37		.	.	.	.	.	.	.	.	.	.	C	18.72	3.683557	0.68157	.	.	ENSG00000163378	ENST00000383701;ENST00000295571;ENST00000424374;ENST00000456376	.	.	.	5.45	4.58	0.56647	.	0.137872	0.64402	D	0.000002	T	0.79215	0.4408	M	0.84082	2.675	0.80722	D	1	D;B	0.89917	1.0;0.208	D;B	0.72075	0.976;0.077	T	0.82489	-0.0432	9	0.87932	D	0	.	12.8685	0.57953	0.0:0.9245:0.0:0.0755	.	79;79	Q5NDL2;Q5NDL2-3	AER61_HUMAN;.	Y	79	.	ENSP00000295571:C79Y	C	-	2	0	C3orf64	69140344	1.000000	0.71417	0.999000	0.59377	0.977000	0.68977	6.465000	0.73538	1.442000	0.47568	0.563000	0.77884	TGC		0.388	EOGT-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000343722.1	NM_173654	
GPR27	2850	broad.mit.edu	37	3	71804076	71804076	+	Silent	SNP	C	C	T			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr3:71804076C>T	ENST00000304411.2	+	1	876	c.876C>T	c.(874-876)ctC>ctT	p.L292L	EIF4E3_ENST00000295612.3_5'Flank|EIF4E3_ENST00000448225.1_5'Flank|EIF4E3_ENST00000421769.2_5'Flank	NM_018971.1	NP_061844.1	Q9NS67	GPR27_HUMAN	G protein-coupled receptor 27	292					signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.L292L(1)		kidney(1)|lung(2)|ovary(1)|prostate(1)	5		Prostate(10;0.00899)		BRCA - Breast invasive adenocarcinoma(55;1.78e-05)|Epithelial(33;5.75e-05)|Lung(16;0.0012)|LUSC - Lung squamous cell carcinoma(21;0.00156)		TCACGCTGCTCTTCCTGCTCC	0.711																																																1	Substitution - coding silent(1)	ovary(1)	3											34.0	43.0	40.0					3																	71804076		2199	4300	6499	71886766	SO:0001819	synonymous_variant	2850			AB040799	CCDS2915.1	3p21-p14	2012-08-21			ENSG00000170837	ENSG00000170837		"""GPCR / Class A : Orphans"""	4482	protein-coding gene	gene with protein product		605187				10833454	Standard	NM_018971		Approved	SREB1	uc011bge.2	Q9NS67	OTTHUMG00000158810	ENST00000304411.2:c.876C>T	3.37:g.71804076C>T			71886766		Silent	SNP	ENST00000304411.2	37	CCDS2915.1																																																																																				0.711	GPR27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352303.1	NM_018971	
CLDND1	56650	broad.mit.edu	37	3	98235671	98235671	+	Silent	SNP	G	G	C			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr3:98235671G>C	ENST00000503004.1	-	5	1473	c.594C>G	c.(592-594)ctC>ctG	p.L198L	CLDND1_ENST00000394180.2_Silent_p.L198L|CLDND1_ENST00000341181.6_Silent_p.L198L|CLDND1_ENST00000502288.1_Intron|CLDND1_ENST00000508503.1_5'UTR|CLDND1_ENST00000507874.1_Intron|CLDND1_ENST00000510545.1_Silent_p.L198L|CLDND1_ENST00000437922.1_Silent_p.L221L|CLDND1_ENST00000513287.1_Silent_p.L198L|CLDND1_ENST00000394181.2_Silent_p.L198L|CLDND1_ENST00000511081.1_Silent_p.L103L|CLDND1_ENST00000394185.2_Silent_p.L198L			Q9NY35	CLDN1_HUMAN	claudin domain containing 1	198						apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|integral component of membrane (GO:0016021)		p.L198L(1)		central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(4)|ovary(1)	9						GTTTCTGGTGGAGTAGTTCAA	0.453																																																1	Substitution - coding silent(1)	ovary(1)	3											132.0	115.0	120.0					3																	98235671		2203	4300	6503	99718361	SO:0001819	synonymous_variant	56650			AF116664	CCDS2930.1, CCDS43116.1	3q12.1	2005-12-23	2005-12-23	2005-12-23		ENSG00000080822			1322	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 4"""	C3orf4			Standard	NM_001040181		Approved		uc003dst.3	Q9NY35		ENST00000503004.1:c.594C>G	3.37:g.98235671G>C			99718361	B3KQR1|D3DN36|F2Z2D9|Q502Y8|Q6UVX2|Q9BUZ9|Q9NZZ5|Q9Y4S9	Silent	SNP	ENST00000503004.1	37	CCDS2930.1																																																																																				0.453	CLDND1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359071.1	NM_019895	
ERICH6	131831	broad.mit.edu	37	3	150377801	150377801	+	Nonsense_Mutation	SNP	T	T	A			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	T	T	A	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr3:150377801T>A	ENST00000295910.6	-	14	1922	c.1870A>T	c.(1870-1872)Aaa>Taa	p.K624*	FAM194A_ENST00000491361.1_Nonsense_Mutation_p.K478*	NM_152394.3	NP_689607.2												p.K624*(1)		NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	38						TGCTTTAATTTTTCCCAAACC	0.378																																																1	Substitution - Nonsense(1)	ovary(1)	3											103.0	109.0	107.0					3																	150377801		2203	4300	6503	151860491	SO:0001587	stop_gained	131831																														ENST00000295910.6:c.1870A>T	3.37:g.150377801T>A	ENSP00000295910:p.Lys624*		151860491		Nonsense_Mutation	SNP	ENST00000295910.6	37	CCDS3151.2	.	.	.	.	.	.	.	.	.	.	T	37	6.289080	0.97444	.	.	ENSG00000163645	ENST00000295910;ENST00000491361;ENST00000313811	.	.	.	5.22	5.22	0.72569	.	0.264721	0.32533	N	0.005965	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-23.8008	14.431	0.67251	0.0:0.0:0.0:1.0	.	.	.	.	X	624;478;582	.	ENSP00000295910:K624X	K	-	1	0	FAM194A	151860491	0.997000	0.39634	0.016000	0.15963	0.978000	0.69477	5.007000	0.63984	2.108000	0.64289	0.529000	0.55759	AAA		0.378	FAM194A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257666.1		
SPATA16	83893	broad.mit.edu	37	3	172766803	172766803	+	Missense_Mutation	SNP	T	T	C			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr3:172766803T>C	ENST00000351008.3	-	3	877	c.694A>G	c.(694-696)Aca>Gca	p.T232A		NM_031955.5	NP_114161.3	Q9BXB7	SPT16_HUMAN	spermatogenesis associated 16	232					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)		p.T232A(1)		breast(2)|cervix(1)|large_intestine(8)|lung(20)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	43	Ovarian(172;0.00319)|Breast(254;0.197)		LUSC - Lung squamous cell carcinoma(14;1.48e-14)|Lung(28;6.63e-14)			ACAAGCTTTGTCTCAATGAAA	0.398																																																1	Substitution - Missense(1)	ovary(1)	3											125.0	110.0	115.0					3																	172766803		2203	4300	6503	174249497	SO:0001583	missense	83893			AF345909	CCDS3221.1	3q26.31	2009-01-05			ENSG00000144962	ENSG00000144962			29935	protein-coding gene	gene with protein product		609856				12529416, 17847006	Standard	NM_031955		Approved	NYD-SP12	uc003fin.4	Q9BXB7	OTTHUMG00000156865	ENST00000351008.3:c.694A>G	3.37:g.172766803T>C	ENSP00000341765:p.Thr232Ala		174249497	Q0R0N4|Q0R0S0|Q0R0W2|Q0R129|Q0R131|Q0R140|Q0R1B8|Q0R1G5|Q0R1I2|Q0R1J6|Q0R1S4|Q0R202|Q0R280|Q0R2F8|Q0R2N6|Q0R2N7|Q0R2R0|Q0R2R1|Q0R2S3|Q0R2S4|Q0R2S5|Q0R2T4|Q0R2T7|Q0R2U2|Q0R2U8|Q0R2U9|Q0R2V5|Q0R2V7|Q8NE67	Missense_Mutation	SNP	ENST00000351008.3	37	CCDS3221.1	.	.	.	.	.	.	.	.	.	.	T	18.07	3.541344	0.65085	.	.	ENSG00000144962	ENST00000351008	T	0.21031	2.03	5.07	3.9	0.45041	Tetratricopeptide-like helical (1);	0.000000	0.56097	D	0.000032	T	0.15825	0.0381	L	0.29908	0.895	0.31194	N	0.700549	B	0.19935	0.04	B	0.19666	0.026	T	0.08207	-1.0733	10	0.87932	D	0	-9.8041	9.5027	0.39028	0.0:0.0824:0.0:0.9176	.	232	Q9BXB7	SPT16_HUMAN	A	232	ENSP00000341765:T232A	ENSP00000341765:T232A	T	-	1	0	SPATA16	174249497	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	2.333000	0.43912	0.876000	0.35872	0.533000	0.62120	ACA		0.398	SPATA16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346322.1	NM_031955	
KNG1	3827	broad.mit.edu	37	3	186459434	186459434	+	Missense_Mutation	SNP	C	C	T	rs199853757		TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr3:186459434C>T	ENST00000265023.4	+	10	1461	c.1249C>T	c.(1249-1251)Cgg>Tgg	p.R417W	KNG1_ENST00000287611.2_Intron|RP11-573D15.8_ENST00000596329.1_RNA|RP11-573D15.8_ENST00000596632.1_RNA|RP11-573D15.8_ENST00000609652.1_RNA|RP11-573D15.8_ENST00000354642.2_RNA|RP11-573D15.8_ENST00000609726.1_RNA|RP11-573D15.8_ENST00000599314.1_RNA|KNG1_ENST00000447445.1_Intron	NM_001102416.2	NP_001095886.1	P01042	KNG1_HUMAN	kininogen 1	417					blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|inflammatory response (GO:0006954)|negative regulation of blood coagulation (GO:0030195)|negative regulation of cell adhesion (GO:0007162)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of proteolysis (GO:0045861)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of urine volume (GO:0035810)|smooth muscle contraction (GO:0006939)|vasodilation (GO:0042311)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	cysteine-type endopeptidase inhibitor activity (GO:0004869)|heparin binding (GO:0008201)|receptor binding (GO:0005102)|zinc ion binding (GO:0008270)			endometrium(1)|lung(15)|prostate(1)|skin(2)|stomach(2)	21	all_cancers(143;8.96e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;4.12e-20)	GBM - Glioblastoma multiforme(93;0.0798)		AGATGAAGAGCGGGATTCAGG	0.438													C|||	1	0.000199681	0.0008	0.0	5008	,	,		22324	0.0		0.0	False		,,,				2504	0.0															0			3						C	,TRP/ARG,	2,4402	4.2+/-10.8	0,2,2200	88.0	91.0	90.0		,1249,	2.0	0.0	3		90	0,8598		0,0,4299	yes	intron,missense,intron	KNG1	NM_000893.3,NM_001102416.2,NM_001166451.1	,101,	0,2,6499	TT,TC,CC		0.0,0.0454,0.0154	,benign,	,417/645,	186459434	2,13000	2202	4299	6501	187942128	SO:0001583	missense	3827				CCDS3281.1, CCDS43183.1, CCDS54695.1	3q27.3	2014-05-15	2004-05-21	2004-05-26	ENSG00000113889	ENSG00000113889		"""Endogenous ligands"""	6383	protein-coding gene	gene with protein product	"""alpha-2-thiol proteinase inhibitor"", ""bradykinin"""	612358	"""kininogen"""	KNG, BDK		1733668	Standard	NM_000893		Approved	BK	uc011bsa.2	P01042	OTTHUMG00000150348	ENST00000265023.4:c.1249C>T	3.37:g.186459434C>T	ENSP00000265023:p.Arg417Trp		187942128	A8K474|B2RCR2|C9JEX1|P01043|Q53EQ0|Q6PAU9|Q7M4P1	Missense_Mutation	SNP	ENST00000265023.4	37	CCDS43183.1	.	.	.	.	.	.	.	.	.	.	C	6.629	0.484417	0.12641	4.54E-4	0.0	ENSG00000113889	ENST00000265023	T	0.15718	2.4	5.85	1.98	0.26296	.	1.785970	0.02663	N	0.107721	T	0.12390	0.0301	N	0.21448	0.665	0.18873	N	0.999981	B	0.11235	0.004	B	0.06405	0.002	T	0.25537	-1.0129	9	.	.	.	1.2309	5.1007	0.14759	0.2998:0.544:0.0:0.1561	.	417	P01042	KNG1_HUMAN	W	417	ENSP00000265023:R417W	.	R	+	1	2	KNG1	187942128	0.089000	0.21612	0.045000	0.18777	0.006000	0.05464	0.389000	0.20751	0.150000	0.19136	0.655000	0.94253	CGG		0.438	KNG1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317738.1	NM_001102416	
DLG1	1739	broad.mit.edu	37	3	196842949	196842949	+	Missense_Mutation	SNP	G	G	C			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture;Sequenom			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr3:196842949G>C	ENST00000419354.1	-	14	1677	c.1391C>G	c.(1390-1392)cCt>cGt	p.P464R	DLG1_ENST00000448528.2_Missense_Mutation_p.P464R|DLG1_ENST00000422288.1_Missense_Mutation_p.P413R|DLG1_ENST00000392382.2_Missense_Mutation_p.P431R|DLG1_ENST00000450955.1_Missense_Mutation_p.P431R|DLG1_ENST00000357674.4_Missense_Mutation_p.P431R|DLG1_ENST00000443183.1_Missense_Mutation_p.P348R|DLG1_ENST00000346964.2_Missense_Mutation_p.P464R|DLG1_ENST00000452595.1_Missense_Mutation_p.P348R|DLG1_ENST00000314062.3_Missense_Mutation_p.P413R			Q12959	DLG1_HUMAN	discs, large homolog 1 (Drosophila)	464					actin filament organization (GO:0007015)|activation of protein kinase activity (GO:0032147)|amyloid precursor protein metabolic process (GO:0042982)|axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|cortical actin cytoskeleton organization (GO:0030866)|dephosphorylation (GO:0016311)|embryonic skeletal system morphogenesis (GO:0048704)|endothelial cell proliferation (GO:0001935)|establishment or maintenance of cell polarity (GO:0007163)|hard palate development (GO:0060022)|immunological synapse formation (GO:0001771)|lens development in camera-type eye (GO:0002088)|membrane raft organization (GO:0031579)|mitotic cell cycle checkpoint (GO:0007093)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of T cell proliferation (GO:0042130)|nucleotide phosphorylation (GO:0046939)|peristalsis (GO:0030432)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell proliferation (GO:0008284)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of potassium ion transport (GO:0043268)|protein localization to plasma membrane (GO:0072659)|regulation of membrane potential (GO:0042391)|regulation of myelination (GO:0031641)|regulation of sodium ion transmembrane transport (GO:1902305)|reproductive structure development (GO:0048608)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle tissue development (GO:0048745)|synaptic transmission (GO:0007268)|T cell activation (GO:0042110)|T cell cytokine production (GO:0002369)|tight junction assembly (GO:0070830)|viral process (GO:0016032)	basal lamina (GO:0005605)|basolateral plasma membrane (GO:0016323)|cell junction (GO:0030054)|cell projection membrane (GO:0031253)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|immunological synapse (GO:0001772)|intercalated disc (GO:0014704)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|membrane raft (GO:0045121)|microtubule (GO:0005874)|MPP7-DLG1-LIN7 complex (GO:0097025)|myelin sheath abaxonal region (GO:0035748)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|tight junction (GO:0005923)	cytoskeletal protein binding (GO:0008092)|guanylate kinase activity (GO:0004385)|ion channel binding (GO:0044325)|L27 domain binding (GO:0097016)|mitogen-activated protein kinase kinase binding (GO:0031434)|phosphatase binding (GO:0019902)|phosphoprotein phosphatase activity (GO:0004721)|potassium channel regulator activity (GO:0015459)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)	p.P464R(1)		breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|liver(1)|lung(9)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	26	all_cancers(143;6.22e-10)|Ovarian(172;0.0418)|Breast(254;0.0589)	Lung NSC(153;0.133)	Epithelial(36;3.23e-24)|all cancers(36;2.15e-22)|OV - Ovarian serous cystadenocarcinoma(49;3.88e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.0148)		AACTTTTCTAGGTTCCCTAAA	0.333																																																1	Substitution - Missense(1)	ovary(1)	3											67.0	72.0	71.0					3																	196842949		2202	4300	6502	198327346	SO:0001583	missense	1739			U13897	CCDS3327.1, CCDS43194.1, CCDS56300.1, CCDS56301.1, CCDS75072.1	3q29	2008-12-15	2001-11-28		ENSG00000075711	ENSG00000075711			2900	protein-coding gene	gene with protein product	"""discs large homolog 1"", ""presynaptic protein SAP97"", ""synapse-associated protein 97"""	601014	"""discs, large (Drosophila) homolog 1"""			7937897, 8825652	Standard	NM_004087		Approved	SAP97, SAP-97, hdlg, DLGH1, dJ1061C18.1.1	uc003fxn.4	Q12959	OTTHUMG00000047972	ENST00000419354.1:c.1391C>G	3.37:g.196842949G>C	ENSP00000407531:p.Pro464Arg		198327346	A5YKK7|B4DGU1|B4DGZ8|B7ZMM0|B9EIQ5|D3DXB8|D3DXB9|E7EWL7|E9PG21|Q12958	Missense_Mutation	SNP	ENST00000419354.1	37	CCDS43194.1	.	.	.	.	.	.	.	.	.	.	G	25.8	4.676378	0.88445	.	.	ENSG00000075711	ENST00000346964;ENST00000359922;ENST00000357674;ENST00000381807;ENST00000314062;ENST00000419354;ENST00000452595;ENST00000422288;ENST00000448528;ENST00000443183;ENST00000392382;ENST00000450955;ENST00000447466	T;T;T;T;T;T;T;T;T;T;T	0.54071	0.59;0.59;0.59;0.59;0.59;0.59;0.59;0.59;0.59;0.59;2.18	5.62	5.62	0.85841	PDZ/DHR/GLGF (1);PDZ-associated domain of NMDA receptors (1);	0.000000	0.85682	D	0.000000	T	0.74756	0.3758	M	0.76838	2.35	0.80722	D	1	D;D;D;D;D;D;D	0.89917	0.99;0.999;0.999;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	0.929;0.99;0.991;1.0;0.996;0.995;0.996	T	0.77289	-0.2643	10	0.87932	D	0	.	18.6485	0.91421	0.0:0.0:1.0:0.0	.	431;348;348;348;431;464;464	Q12959-4;E9PG21;E7EWL7;B4DGU1;Q12959-3;Q12959;Q12959-2	.;.;.;.;.;DLG1_HUMAN;.	R	464;464;431;464;413;464;348;413;464;348;431;431;273	ENSP00000345731:P464R;ENSP00000350303:P431R;ENSP00000321087:P413R;ENSP00000407531:P464R;ENSP00000398939:P348R;ENSP00000413238:P413R;ENSP00000391732:P464R;ENSP00000396658:P348R;ENSP00000376187:P431R;ENSP00000411278:P431R;ENSP00000398702:P273R	ENSP00000321087:P413R	P	-	2	0	DLG1	198327346	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.378000	0.97191	2.662000	0.90505	0.591000	0.81541	CCT		0.333	DLG1-008	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000258170.2	NM_004087	
CD38	952	broad.mit.edu	37	4	15818256	15818256	+	Missense_Mutation	SNP	G	G	C			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr4:15818256G>C	ENST00000226279.3	+	2	493	c.356G>C	c.(355-357)tGc>tCc	p.C119S		NM_001775.2	NP_001766.2	P28907	CD38_HUMAN	CD38 molecule	119					apoptotic signaling pathway (GO:0097190)|B cell receptor signaling pathway (GO:0050853)|female pregnancy (GO:0007565)|long term synaptic depression (GO:0060292)|negative regulation of apoptotic process (GO:0043066)|negative regulation of bone resorption (GO:0045779)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cell growth (GO:0030307)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of insulin secretion (GO:0032024)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vasoconstriction (GO:0045907)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to hydroperoxide (GO:0033194)|response to hypoxia (GO:0001666)|response to interleukin-1 (GO:0070555)|response to progesterone (GO:0032570)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	NAD(P)+ nucleosidase activity (GO:0050135)|NAD+ nucleosidase activity (GO:0003953)|phosphorus-oxygen lyase activity (GO:0016849)|transferase activity (GO:0016740)	p.C119S(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(2)|prostate(1)|stomach(1)	14						ACCGTACCTTGCAACAAGGTA	0.388																																																1	Substitution - Missense(1)	ovary(1)	4											104.0	97.0	100.0					4																	15818256		2203	4300	6503	15427354	SO:0001583	missense	952			D84276	CCDS3417.1	4p15.32	2010-05-04	2006-03-28		ENSG00000004468	ENSG00000004468	3.2.2.5	"""CD molecules"""	1667	protein-coding gene	gene with protein product	"""ADP-ribosyl cyclase 1"", ""NAD(+) nucleosidase"""	107270	"""CD38 antigen (p45)"""			9074508, 2319135	Standard	NM_001775		Approved		uc003gol.1	P28907	OTTHUMG00000048206	ENST00000226279.3:c.356G>C	4.37:g.15818256G>C	ENSP00000226279:p.Cys119Ser		15427354	O00121|O00122|Q96HY4	Missense_Mutation	SNP	ENST00000226279.3	37	CCDS3417.1	.	.	.	.	.	.	.	.	.	.	G	9.332	1.060859	0.19987	.	.	ENSG00000004468	ENST00000226279;ENST00000540195;ENST00000510674	T;T	0.46063	0.88;0.88	5.57	5.57	0.84162	NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.63426	0.2510	M	0.82630	2.6	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.62964	-0.6742	10	0.05959	T	0.93	-26.0496	16.4727	0.84115	0.0:0.0:1.0:0.0	.	119;119	P28907;B2R880	CD38_HUMAN;.	S	119;119;13	ENSP00000226279:C119S;ENSP00000423047:C13S	ENSP00000226279:C119S	C	+	2	0	CD38	15427354	0.990000	0.36364	0.796000	0.32109	0.144000	0.21451	5.376000	0.66178	2.624000	0.88883	0.563000	0.77884	TGC		0.388	CD38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250322.2	NM_001775	
DCUN1D4	23142	broad.mit.edu	37	4	52740446	52740446	+	Missense_Mutation	SNP	G	G	C	rs142966675		TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr4:52740446G>C	ENST00000334635.5	+	4	326	c.146G>C	c.(145-147)cGg>cCg	p.R49P	DCUN1D4_ENST00000381437.4_5'UTR|DCUN1D4_ENST00000381441.3_Missense_Mutation_p.R49P|DCUN1D4_ENST00000513800.1_3'UTR|DCUN1D4_ENST00000451288.2_Missense_Mutation_p.R93P	NM_001040402.1	NP_001035492.1	Q92564	DCNL4_HUMAN	DCN1, defective in cullin neddylation 1, domain containing 4	49						nucleus (GO:0005634)		p.R49P(1)		endometrium(2)|large_intestine(2)|lung(2)|ovary(2)|skin(1)	9			GBM - Glioblastoma multiforme(4;1.93e-11)|LUSC - Lung squamous cell carcinoma(32;0.00654)			GGAAGTCTGCGGTCTTGCAGT	0.383																																																1	Substitution - Missense(1)	ovary(1)	4											125.0	122.0	123.0					4																	52740446		2203	4300	6503	52435203	SO:0001583	missense	23142			D87466	CCDS3487.2, CCDS33982.1, CCDS75123.1	4q11	2013-06-10	2013-06-10		ENSG00000109184	ENSG00000109184			28998	protein-coding gene	gene with protein product		612977	"""DCN1, defective in cullin neddylation 1, domain containing 4 (S. cerevisiae)"""			15988528	Standard	XM_005265731		Approved	KIAA0276	uc003gze.3	Q92564	OTTHUMG00000128700	ENST00000334635.5:c.146G>C	4.37:g.52740446G>C	ENSP00000334625:p.Arg49Pro		52435203	B4DH25|Q7Z3F3|Q7Z6B8	Missense_Mutation	SNP	ENST00000334635.5	37	CCDS33982.1	.	.	.	.	.	.	.	.	.	.	g	18.67	3.673407	0.67928	.	.	ENSG00000109184	ENST00000334635;ENST00000381441;ENST00000505403;ENST00000451288	.	.	.	5.18	4.34	0.51931	.	0.394763	0.26971	N	0.021575	T	0.48077	0.1480	N	0.22421	0.69	0.80722	D	1	P;P;P	0.48089	0.876;0.901;0.905	B;P;B	0.50970	0.423;0.655;0.32	T	0.49978	-0.8881	9	0.59425	D	0.04	-8.7843	11.2283	0.48897	0.0843:0.0:0.9157:0.0	.	93;49;49	B4DH25;Q92564-2;Q92564	.;.;DCNL4_HUMAN	P	49;49;93;93	.	ENSP00000334625:R49P	R	+	2	0	DCUN1D4	52435203	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.188000	0.77739	1.194000	0.43101	0.651000	0.88453	CGG		0.383	DCUN1D4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250599.2	NM_015115	
DDX4	54514	broad.mit.edu	37	5	55034823	55034823	+	Missense_Mutation	SNP	A	A	C			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	A	A	C	C	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr5:55034823A>C	ENST00000505374.1	+	2	124	c.32A>C	c.(31-33)aAc>aCc	p.N11T	DDX4_ENST00000354991.5_Missense_Mutation_p.N11T|SLC38A9_ENST00000504880.1_Intron|DDX4_ENST00000353507.5_Missense_Mutation_p.N11T|DDX4_ENST00000514278.2_Missense_Mutation_p.N11T|DDX4_ENST00000508580.1_3'UTR	NM_024415.2	NP_077726.1	Q9NQI0	DDX4_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 4	11					male meiosis I (GO:0007141)|multicellular organismal development (GO:0007275)|regulation of protein localization (GO:0032880)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|pi-body (GO:0071546)|piP-body (GO:0071547)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|nucleic acid binding (GO:0003676)	p.N11T(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(8)|ovary(1)|skin(3)|upper_aerodigestive_tract(2)	24		Lung NSC(810;6.93e-05)|all_neural(839;0.00409)|Prostate(74;0.0107)|Breast(144;0.0544)|Ovarian(174;0.223)				GCAGAAATCAACCCTCATATG	0.313																																																1	Substitution - Missense(1)	ovary(1)	5											122.0	129.0	127.0					5																	55034823		2203	4300	6503	55070580	SO:0001583	missense	54514			AF262962	CCDS3969.1, CCDS47208.1, CCDS54854.1, CCDS54855.1	5p15.2-p13.1	2008-02-05	2003-06-13		ENSG00000152670	ENSG00000152670		"""DEAD-boxes"""	18700	protein-coding gene	gene with protein product		605281	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 4"""			10920202, 11850529	Standard	NM_001142549		Approved	VASA	uc003jqg.4	Q9NQI0	OTTHUMG00000097044	ENST00000505374.1:c.32A>C	5.37:g.55034823A>C	ENSP00000424838:p.Asn11Thr		55070580	A8K8Q2|B3KSF4|D6RDK4|E9PCD8|Q5M7Z3|Q86VX0|Q9NT92|Q9NYB1	Missense_Mutation	SNP	ENST00000505374.1	37	CCDS3969.1	.	.	.	.	.	.	.	.	.	.	A	4.383	0.070737	0.08436	.	.	ENSG00000152670	ENST00000353507;ENST00000514278;ENST00000505374;ENST00000506511;ENST00000515709;ENST00000506848;ENST00000514679;ENST00000354991	T;T;T;T;T;T;T	0.44482	2.01;2.01;2.04;3.51;0.92;0.93;2.01	4.25	1.76	0.24704	.	0.801478	0.11186	N	0.590402	T	0.19967	0.0480	N	0.12182	0.205	0.22017	N	0.999414	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.0;0.001;0.0	T	0.28073	-1.0055	10	0.14252	T	0.57	-6.8734	4.4352	0.11547	0.6942:0.1998:0.106:0.0	.	11;11;11	D6RDK4;Q9NQI0-2;Q9NQI0	.;.;DDX4_HUMAN	T	11	ENSP00000334167:N11T;ENSP00000425359:N11T;ENSP00000424838:N11T;ENSP00000427167:N11T;ENSP00000424779:N11T;ENSP00000424112:N11T;ENSP00000347087:N11T	ENSP00000334167:N11T	N	+	2	0	DDX4	55070580	0.996000	0.38824	0.801000	0.32222	0.849000	0.48306	1.487000	0.35540	0.263000	0.21812	0.402000	0.26972	AAC		0.313	DDX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214147.2	NM_024415	
KCNMB1	3779	broad.mit.edu	37	5	169812362	169812362	+	Silent	SNP	G	G	C	rs112318935		TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr5:169812362G>C	ENST00000274629.4	-	2	532	c.90C>G	c.(88-90)acC>acG	p.T30T	KCNIP1_ENST00000518527.1_Intron|KCNIP1_ENST00000377360.4_Intron|KCNMB1_ENST00000521859.1_Silent_p.T30T	NM_004137.3	NP_004128.1	Q16558	KCMB1_HUMAN	potassium large conductance calcium-activated channel, subfamily M, beta member 1	30					blood coagulation (GO:0007596)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|response to calcium ion (GO:0051592)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|potassium channel regulator activity (GO:0015459)	p.T30T(1)		endometrium(1)|large_intestine(1)|lung(7)|ovary(2)	11	Renal(175;0.000159)|Lung NSC(126;0.0165)|all_lung(126;0.026)	Medulloblastoma(196;0.0109)|all_neural(177;0.0146)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.175)	Miconazole(DB01110)|Procaine(DB00721)	GGATGTAGTAGGTGATGACGG	0.592																																																1	Substitution - coding silent(1)	ovary(1)	5											161.0	132.0	142.0					5																	169812362		2203	4300	6503	169744940	SO:0001819	synonymous_variant	3779			AF035046	CCDS4373.1	5q34	2012-02-23			ENSG00000145936	ENSG00000145936		"""Potassium channels"""	6285	protein-coding gene	gene with protein product	"""BK channel beta subunit"""	603951				8799178, 9888999	Standard	NM_004137		Approved	hslo-beta	uc003maq.2	Q16558	OTTHUMG00000130439	ENST00000274629.4:c.90C>G	5.37:g.169812362G>C			169744940	O00707|O00708|P78475|Q53YR0|Q8TAX3|Q93005	Silent	SNP	ENST00000274629.4	37	CCDS4373.1																																																																																				0.592	KCNMB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252830.3		
JARID2	3720	broad.mit.edu	37	6	15512443	15512443	+	Missense_Mutation	SNP	C	C	A			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr6:15512443C>A	ENST00000341776.2	+	14	3201	c.2957C>A	c.(2956-2958)tCc>tAc	p.S986Y	JARID2_ENST00000397311.3_Missense_Mutation_p.S814Y	NM_004973.3	NP_004964.2	Q92833	JARD2_HUMAN	jumonji, AT rich interactive domain 2	986	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|liver development (GO:0001889)|negative regulation of cell proliferation (GO:0008285)|negative regulation of histone methylation (GO:0031061)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone H3-K9 methylation (GO:0051574)|spleen development (GO:0048536)|stem cell differentiation (GO:0048863)|thymus development (GO:0048538)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.S986Y(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(15)|lung(19)|ovary(3)|pancreas(1)|prostate(5)|stomach(1)	59	Breast(50;0.0142)|Ovarian(93;0.103)	all_hematologic(90;0.00612)				CCCCAGATCTCCCCGGAGGTG	0.617																																																1	Substitution - Missense(1)	ovary(1)	6											83.0	69.0	74.0					6																	15512443		2203	4300	6503	15620422	SO:0001583	missense	3720			U57592	CCDS4533.1, CCDS58996.1	6p24-p23	2008-02-05	2006-10-06	2004-01-30	ENSG00000008083	ENSG00000008083			6196	protein-coding gene	gene with protein product		601594	"""jumonji (mouse) homolog"", ""Jumonji, AT rich interactive domain 2"""	JMJ		8894700	Standard	NM_001267040		Approved		uc003nbj.4	Q92833	OTTHUMG00000014293	ENST00000341776.2:c.2957C>A	6.37:g.15512443C>A	ENSP00000341280:p.Ser986Tyr		15620422	A8K9Z6|B7Z5S5|B7Z8L0|Q5U5L5|Q86X63	Missense_Mutation	SNP	ENST00000341776.2	37	CCDS4533.1	.	.	.	.	.	.	.	.	.	.	C	27.0	4.793200	0.90453	.	.	ENSG00000008083	ENST00000341776;ENST00000397311	T;T	0.68765	-0.35;-0.35	5.01	5.01	0.66863	Transcription factor jumonji/aspartyl beta-hydroxylase (2);Transcription factor jumonji (1);	0.000000	0.85682	D	0.000000	D	0.82337	0.5015	M	0.89353	3.025	0.80722	D	1	D	0.69078	0.997	D	0.69479	0.964	D	0.85778	0.1359	10	0.72032	D	0.01	-11.7206	18.679	0.91540	0.0:1.0:0.0:0.0	.	986	Q92833	JARD2_HUMAN	Y	986;814	ENSP00000341280:S986Y;ENSP00000380478:S814Y	ENSP00000341280:S986Y	S	+	2	0	JARID2	15620422	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.763000	0.85283	2.472000	0.83506	0.603000	0.83216	TCC		0.617	JARID2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000039926.1	NM_004973	
HIST1H1A	3024	broad.mit.edu	37	6	26017456	26017456	+	Missense_Mutation	SNP	G	G	C			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture;Sequenom			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr6:26017456G>C	ENST00000244573.3	-	1	584	c.505C>G	c.(505-507)Cca>Gca	p.P169A		NM_005325.3	NP_005316.1	Q02539	H11_HUMAN	histone cluster 1, H1a	169					nucleosome assembly (GO:0006334)|spermatogenesis (GO:0007283)	nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleosome (GO:0000786)	chromatin DNA binding (GO:0031490)	p.P169A(1)		cervix(1)|endometrium(4)|kidney(1)|large_intestine(3)|ovary(3)|prostate(1)	13						GGTTTTTTTGGATTCTTGGAG	0.473																																																1	Substitution - Missense(1)	ovary(1)	6											172.0	184.0	180.0					6																	26017456		2203	4300	6503	26125435	SO:0001583	missense	3024			AF531299	CCDS4569.1	6p22.1	2012-11-16	2006-10-11	2003-02-21	ENSG00000124610	ENSG00000124610		"""Histones / Replication-dependent"""	4715	protein-coding gene	gene with protein product		142709	"""H1 histone family, member 1"", ""histone 1, H1a"""	H1F1		2759094, 12408966	Standard	NM_005325		Approved	H1.1, H1a	uc003nfo.3	Q02539	OTTHUMG00000016413	ENST00000244573.3:c.505C>G	6.37:g.26017456G>C	ENSP00000244573:p.Pro169Ala		26125435	Q3MJ34	Missense_Mutation	SNP	ENST00000244573.3	37	CCDS4569.1	.	.	.	.	.	.	.	.	.	.	N	0.011	-1.698871	0.00725	.	.	ENSG00000124610	ENST00000244573	T	0.44881	0.91	4.31	3.44	0.39384	.	0.125811	0.53938	D	0.000042	T	0.09024	0.0223	N	0.20445	0.575	0.52501	D	0.999955	P	0.52316	0.952	B	0.38842	0.283	T	0.05370	-1.0889	10	0.09590	T	0.72	-11.0625	7.9061	0.29763	0.0885:0.1619:0.7496:0.0	.	169	Q02539	H11_HUMAN	A	169	ENSP00000244573:P169A	ENSP00000244573:P169A	P	-	1	0	HIST1H1A	26125435	1.000000	0.71417	0.038000	0.18304	0.009000	0.06853	5.315000	0.65810	1.110000	0.41699	0.609000	0.83330	CCA		0.473	HIST1H1A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043884.1	NM_005325	
UHRF1BP1	54887	broad.mit.edu	37	6	34826116	34826116	+	Silent	SNP	G	G	C			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr6:34826116G>C	ENST00000192788.5	+	14	2154	c.1983G>C	c.(1981-1983)ctG>ctC	p.L661L	UHRF1BP1_ENST00000452449.2_Silent_p.L661L	NM_017754.3	NP_060224.3	Q6BDS2	URFB1_HUMAN	UHRF1 binding protein 1	661							histone deacetylase binding (GO:0042826)|identical protein binding (GO:0042802)	p.L661L(1)		breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(11)|lung(24)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	54						TTAGCCTTCTGCACATGCTTT	0.498																																																1	Substitution - coding silent(1)	ovary(1)	6											173.0	159.0	163.0					6																	34826116		1928	4151	6079	34934094	SO:0001819	synonymous_variant	54887			AB126777	CCDS43455.1	6p21.31	2008-10-28	2008-08-15	2007-11-27	ENSG00000065060	ENSG00000065060			21216	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 107"""	C6orf107			Standard	NM_017754		Approved	FLJ20302, dJ349A12.1, ICBP90	uc003oju.4	Q6BDS2	OTTHUMG00000014557	ENST00000192788.5:c.1983G>C	6.37:g.34826116G>C			34934094	Q9NXE0	Silent	SNP	ENST00000192788.5	37	CCDS43455.1																																																																																				0.498	UHRF1BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040260.1	NM_017754	
PTCRA	171558	broad.mit.edu	37	6	42890861	42890861	+	Missense_Mutation	SNP	T	T	A			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	T	T	A	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr6:42890861T>A	ENST00000304672.1	+	2	236	c.155T>A	c.(154-156)gTt>gAt	p.V52D	PTCRA_ENST00000441198.1_Intron|PTCRA_ENST00000446507.1_Intron	NM_001243168.1|NM_138296.2	NP_001230097.1|NP_612153.2	Q6ISU1	PTCRA_HUMAN	pre T-cell antigen receptor alpha	52					negative regulation of thymocyte apoptotic process (GO:0070244)	integral component of membrane (GO:0016021)		p.V52D(1)		large_intestine(2)|lung(4)|ovary(2)	8	Colorectal(47;0.196)		all cancers(41;0.000731)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|OV - Ovarian serous cystadenocarcinoma(102;0.0218)|Kidney(15;0.0388)			GTCCTTGATGTTGCACCCCCT	0.612																																																1	Substitution - Missense(1)	ovary(1)	6											162.0	137.0	145.0					6																	42890861		2203	4300	6503	42998839	SO:0001583	missense	171558			AF084941	CCDS4874.1, CCDS59019.1, CCDS59020.1, CCDS75457.1	6p21.3	2008-02-05			ENSG00000171611	ENSG00000171611			21290	protein-coding gene	gene with protein product		606817				8618853, 9842925	Standard	NM_138296		Approved	PTA, PT-ALPHA	uc021yzp.1	Q6ISU1	OTTHUMG00000014709	ENST00000304672.1:c.155T>A	6.37:g.42890861T>A	ENSP00000304447:p.Val52Asp		42998839	Q5TFZ7	Missense_Mutation	SNP	ENST00000304672.1	37	CCDS4874.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	13.88|13.88	2.369198|2.369198	0.42003|0.42003	.|.	.|.	ENSG00000171611|ENSG00000171611	ENST00000418903|ENST00000304672	.|T	.|0.43688	.|0.94	5.84|5.84	-4.87|-4.87	0.03123|0.03123	.|Immunoglobulin-like fold (1);	.|0.923968	.|0.08971	.|N	.|0.867241	T|T	0.31670|0.31670	0.0804|0.0804	L|L	0.27053|0.27053	0.805|0.805	0.09310|0.09310	N|N	0.999994|0.999994	.|D	.|0.89917	.|1.0	.|D	.|0.75020	.|0.985	T|T	0.42207|0.42207	-0.9465|-0.9465	6|10	0.87932|0.87932	D|D	0|0	-1.6237|-1.6237	13.824|13.824	0.63340|0.63340	0.0:0.6111:0.0:0.3889|0.0:0.6111:0.0:0.3889	.|.	.|52	.|Q6ISU1	.|PTCRA_HUMAN	M|D	63|52	.|ENSP00000304447:V52D	ENSP00000407061:L63M|ENSP00000304447:V52D	L|V	+|+	1|2	2|0	PTCRA|PTCRA	42998839|42998839	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.370000|0.370000	0.29829|0.29829	-0.100000|-0.100000	0.10990|0.10990	-1.233000|-1.233000	0.02551|0.02551	-1.007000|-1.007000	0.02485|0.02485	TTG|GTT		0.612	PTCRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040565.2	NM_138296	
CAPN11	11131	broad.mit.edu	37	6	44145089	44145089	+	Nonsense_Mutation	SNP	C	C	T			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr6:44145089C>T	ENST00000398776.1	+	12	1386	c.1348C>T	c.(1348-1350)Cag>Tag	p.Q450*	CAPN11_ENST00000542245.1_Nonsense_Mutation_p.Q450*	NM_007058.3	NP_008989.2	Q9UMQ6	CAN11_HUMAN	calpain 11	450	Domain III.				proteolysis (GO:0006508)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|peptidase activity (GO:0008233)	p.Q450*(1)		breast(3)|endometrium(5)|kidney(1)|large_intestine(5)|lung(17)|ovary(1)|pancreas(1)|prostate(2)|stomach(1)	36	all_cancers(18;3.19e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			GGCCCTAATGCAGAAGAACTG	0.612																																																1	Substitution - Nonsense(1)	ovary(1)	6											45.0	50.0	48.0					6																	44145089		2104	4252	6356	44253067	SO:0001587	stop_gained	11131			AJ242832	CCDS47436.1	6p12	2013-01-10			ENSG00000137225	ENSG00000137225		"""EF-hand domain containing"""	1478	protein-coding gene	gene with protein product		604822				10409436	Standard	NM_007058		Approved		uc003owt.1	Q9UMQ6	OTTHUMG00000014758	ENST00000398776.1:c.1348C>T	6.37:g.44145089C>T	ENSP00000381758:p.Gln450*		44253067	B2RA64|Q5T3G1|Q8N4R5	Nonsense_Mutation	SNP	ENST00000398776.1	37	CCDS47436.1	.	.	.	.	.	.	.	.	.	.	C	39	7.642852	0.98406	.	.	ENSG00000137225	ENST00000398776;ENST00000542245	.	.	.	4.79	4.79	0.61399	.	0.355316	0.21210	N	0.078338	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	16.9818	0.86329	0.0:1.0:0.0:0.0	.	.	.	.	X	450	.	ENSP00000381758:Q450X	Q	+	1	0	CAPN11	44253067	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.651000	0.83577	2.483000	0.83821	0.561000	0.74099	CAG		0.612	CAPN11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040714.3		
TTK	7272	broad.mit.edu	37	6	80745120	80745120	+	Missense_Mutation	SNP	C	C	G			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture;Sequenom			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr6:80745120C>G	ENST00000369798.2	+	16	2021	c.1910C>G	c.(1909-1911)aCa>aGa	p.T637R	TTK_ENST00000509894.1_Missense_Mutation_p.T636R|TTK_ENST00000230510.3_Missense_Mutation_p.T636R	NM_001166691.1|NM_003318.4	NP_001160163.1|NP_003309.2	P33981	TTK_HUMAN	TTK protein kinase	637	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				chromosome separation (GO:0051304)|mitotic spindle assembly checkpoint (GO:0007094)|mitotic spindle organization (GO:0007052)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|spindle organization (GO:0007051)	membrane (GO:0016020)|spindle (GO:0005819)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)	p.T621R(1)		endometrium(4)|kidney(2)|large_intestine(12)|lung(22)|ovary(7)|pancreas(1)|prostate(1)|stomach(3)|urinary_tract(1)	53		all_cancers(76;0.00177)|Acute lymphoblastic leukemia(125;1.24e-05)|all_hematologic(105;0.00223)|all_epithelial(107;0.2)		BRCA - Breast invasive adenocarcinoma(397;0.0321)		GCAGTTCACACAATCCATCAA	0.299																																																1	Substitution - Missense(1)	ovary(1)	6											88.0	85.0	86.0					6																	80745120		2203	4300	6503	80801839	SO:0001583	missense	7272				CCDS4993.1, CCDS55040.1	6q14.1	2014-04-07			ENSG00000112742	ENSG00000112742			12401	protein-coding gene	gene with protein product	"""cancer/testis antigen 96"", ""monopolar spindle 1 kinase"""	604092				1639825	Standard	NM_003318		Approved	MPS1, MPS1L1, CT96, MPH1	uc003pjc.3	P33981	OTTHUMG00000015088	ENST00000369798.2:c.1910C>G	6.37:g.80745120C>G	ENSP00000358813:p.Thr637Arg		80801839	A8K8U5|B2RDW2|E1P543|Q15272|Q5TCS0|Q9BW51|Q9NTM0	Missense_Mutation	SNP	ENST00000369798.2	37	CCDS4993.1	.	.	.	.	.	.	.	.	.	.	C	19.07	3.755717	0.69648	.	.	ENSG00000112742	ENST00000509894;ENST00000230510;ENST00000369798	T;T;T	0.65549	-0.16;-0.16;-0.16	5.62	3.81	0.43845	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.146153	0.64402	D	0.000010	T	0.51346	0.1669	N	0.21508	0.67	0.58432	D	0.999992	D;D	0.89917	1.0;1.0	D;D	0.91635	0.996;0.999	T	0.51764	-0.8664	10	0.28530	T	0.3	.	10.4182	0.44335	0.1337:0.7956:0.0:0.0706	.	637;636	P33981;A8K8U5	TTK_HUMAN;.	R	636;636;637	ENSP00000422936:T636R;ENSP00000230510:T636R;ENSP00000358813:T637R	ENSP00000230510:T636R	T	+	2	0	TTK	80801839	1.000000	0.71417	0.997000	0.53966	0.968000	0.65278	5.688000	0.68227	0.699000	0.31761	0.467000	0.42956	ACA		0.299	TTK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041316.2		
DOPEY1	23033	broad.mit.edu	37	6	83847764	83847764	+	Missense_Mutation	SNP	T	T	C			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr6:83847764T>C	ENST00000349129.2	+	21	4263	c.4003T>C	c.(4003-4005)Tat>Cat	p.Y1335H	DOPEY1_ENST00000369739.3_Missense_Mutation_p.Y1326H|DOPEY1_ENST00000237163.5_Missense_Mutation_p.Y1316H|DOPEY1_ENST00000484282.1_3'UTR	NM_015018.3	NP_055833.2	Q5JWR5	DOP1_HUMAN	dopey family member 1	1335					protein transport (GO:0015031)			p.Y1335H(1)		breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(16)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	67		all_cancers(76;2.29e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.00203)		BRCA - Breast invasive adenocarcinoma(397;0.053)		AGAGAACTGGTATAGCTGTGG	0.383																																																1	Substitution - Missense(1)	ovary(1)	6											91.0	91.0	91.0					6																	83847764		2203	4300	6503	83904483	SO:0001583	missense	23033			AK027030	CCDS4996.1, CCDS64467.1	6q15	2013-03-05	2006-02-02	2006-02-02	ENSG00000083097	ENSG00000083097			21194	protein-coding gene	gene with protein product			"""KIAA1117"""	KIAA1117		16301316, 16303751, 10931277	Standard	NM_015018		Approved	dJ202D23.2	uc011dyy.2	Q5JWR5	OTTHUMG00000016365	ENST00000349129.2:c.4003T>C	6.37:g.83847764T>C	ENSP00000195654:p.Tyr1335His		83904483	Q86XV1|Q9H5J5|Q9NSL4|Q9UPN5|Q9Y414	Missense_Mutation	SNP	ENST00000349129.2	37	CCDS4996.1	.	.	.	.	.	.	.	.	.	.	T	16.87	3.241510	0.58995	.	.	ENSG00000083097	ENST00000349129;ENST00000237163;ENST00000369739	T;T	0.37058	1.22;1.23	6.16	6.16	0.99307	.	0.000000	0.85682	D	0.000000	T	0.36054	0.0953	N	0.19112	0.55	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.83275	0.996;0.994;0.994	T	0.27088	-1.0084	10	0.38643	T	0.18	.	16.8061	0.85666	0.0:0.0:0.0:1.0	.	1226;1326;1335	E1P545;B2RWN9;Q5JWR5	.;.;DOP1_HUMAN	H	1335;1316;1316	ENSP00000195654:Y1335H;ENSP00000237163:Y1316H	ENSP00000237163:Y1316H	Y	+	1	0	DOPEY1	83904483	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.499000	0.81566	2.367000	0.80283	0.528000	0.53228	TAT		0.383	DOPEY1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043785.2	NM_015018	
FRK	2444	broad.mit.edu	37	6	116325071	116325071	+	Missense_Mutation	SNP	A	A	T			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture;Sequenom			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr6:116325071A>T	ENST00000606080.1	-	2	881	c.435T>A	c.(433-435)agT>agA	p.S145R	FRK_ENST00000538210.1_5'Flank	NM_002031.2	NP_002022.1	P42685	FRK_HUMAN	fyn-related Src family tyrosine kinase	145	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				cell differentiation (GO:0030154)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)	p.S145R(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(10)|ovary(3)|pancreas(1)|skin(1)|urinary_tract(1)	27		all_cancers(87;0.00559)|all_epithelial(87;0.00738)|Colorectal(196;0.0465)		all cancers(137;0.0128)|OV - Ovarian serous cystadenocarcinoma(136;0.0209)|GBM - Glioblastoma multiforme(226;0.0459)|Epithelial(106;0.0625)	Regorafenib(DB08896)	TTTGGCTTTCACTTTCTCTGA	0.388																																																1	Substitution - Missense(1)	ovary(1)	6											92.0	85.0	87.0					6																	116325071		2203	4300	6503	116431764	SO:0001583	missense	2444			U00803	CCDS5103.1	6q21-q22.3	2014-06-25	2014-06-25		ENSG00000111816	ENSG00000111816	2.7.10.1	"""SH2 domain containing"""	3955	protein-coding gene	gene with protein product		606573	"""PTK5 protein tyrosine kinase 5"", ""fyn-related kinase"""	PTK5		7510261	Standard	NM_002031		Approved	RAK, GTK	uc003pwi.1	P42685	OTTHUMG00000015424	ENST00000606080.1:c.435T>A	6.37:g.116325071A>T	ENSP00000476145:p.Ser145Arg		116431764	B4DY49|Q13128|Q9NTR5	Missense_Mutation	SNP	ENST00000606080.1	37	CCDS5103.1	.	.	.	.	.	.	.	.	.	.	A	15.34	2.805848	0.50421	.	.	ENSG00000111816	ENST00000368626	D	0.94793	-3.52	5.97	2.31	0.28768	SH2 motif (5);	0.000000	0.85682	D	0.000000	D	0.91304	0.7258	M	0.88031	2.925	0.80722	D	1	B	0.24317	0.101	B	0.24541	0.054	D	0.87380	0.2356	10	0.72032	D	0.01	.	9.5341	0.39211	0.7288:0.0:0.2712:0.0	.	145	P42685	FRK_HUMAN	R	145	ENSP00000357615:S145R	ENSP00000357615:S145R	S	-	3	2	FRK	116431764	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	1.514000	0.35834	0.163000	0.19507	0.533000	0.62120	AGT		0.388	FRK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041924.2	NM_002031	
THEMIS	387357	broad.mit.edu	37	6	128150780	128150780	+	Missense_Mutation	SNP	G	G	C			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr6:128150780G>C	ENST00000368248.2	-	3	698	c.550C>G	c.(550-552)Cta>Gta	p.L184V	THEMIS_ENST00000368250.1_Missense_Mutation_p.L105V|THEMIS_ENST00000543064.1_Missense_Mutation_p.L184V|THEMIS_ENST00000537166.1_Missense_Mutation_p.L149V	NM_001010923.2	NP_001010923.1	Q8N1K5	THMS1_HUMAN	thymocyte selection associated	184	CABIT 1.				negative T cell selection (GO:0043383)|positive T cell selection (GO:0043368)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.L184V(1)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|liver(1)|lung(28)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(3)	60						ATCTCCTTTAGAGTGTAAATA	0.368																																																1	Substitution - Missense(1)	ovary(1)	6											134.0	130.0	131.0					6																	128150780		2203	4300	6503	128192473	SO:0001583	missense	387357			AK094863	CCDS34534.1, CCDS55055.1	6q22.33	2012-02-08	2009-06-25	2009-06-25	ENSG00000172673	ENSG00000172673			21569	protein-coding gene	gene with protein product	"""thymocyte expressed molecule involved in selection"""	613607	"""chromosome 6 open reading frame 207"", ""chromosome 6 open reading frame 190"", ""thymocyte selection pathway associated"""	C6orf207, C6orf190, TSEPA		19597499, 19597498, 19597497	Standard	NM_001010923		Approved	bA325O24.4, FLJ40584, bA325O24.3	uc011ebt.2	Q8N1K5	OTTHUMG00000015534	ENST00000368248.2:c.550C>G	6.37:g.128150780G>C	ENSP00000357231:p.Leu184Val		128192473	A1L4F0|A8K7N1|B3KT31|B3KW32|B3KY07|F5H1J9|Q5T3C4|Q5T3C5|Q6MZT7	Missense_Mutation	SNP	ENST00000368248.2	37	CCDS34534.1	.	.	.	.	.	.	.	.	.	.	G	14.82	2.648121	0.47258	.	.	ENSG00000172673	ENST00000368250;ENST00000543064;ENST00000368248;ENST00000537166	T;T;T;T	0.18016	2.24;2.24;2.24;2.24	6.14	3.45	0.39498	.	0.000000	0.64402	D	0.000002	T	0.31009	0.0783	M	0.80422	2.495	0.38031	D	0.935154	D;D	0.89917	1.0;1.0	D;D	0.87578	0.997;0.998	T	0.23655	-1.0182	10	0.87932	D	0	-10.382	12.2594	0.54642	0.185:0.0:0.815:0.0	.	184;184	F5H1J9;Q8N1K5	.;THMS1_HUMAN	V	105;184;184;149	ENSP00000357233:L105V;ENSP00000439594:L184V;ENSP00000357231:L184V;ENSP00000439863:L149V	ENSP00000357231:L184V	L	-	1	2	THEMIS	128192473	0.998000	0.40836	0.836000	0.33094	0.585000	0.36419	2.077000	0.41557	0.475000	0.27415	-0.205000	0.12727	CTA		0.368	THEMIS-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		NM_001010923	
ARG1	383	broad.mit.edu	37	6	131897815	131897815	+	Missense_Mutation	SNP	G	G	T			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture;Sequenom			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr6:131897815G>T	ENST00000368087.3	+	2	209	c.70G>T	c.(70-72)Gtg>Ttg	p.V24L	ARG1_ENST00000498260.1_3'UTR|ARG1_ENST00000356962.2_Missense_Mutation_p.V24L|MED23_ENST00000354577.4_Intron			P05089	ARGI1_HUMAN	arginase 1	24					arginine catabolic process (GO:0006527)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to glucagon stimulus (GO:0071377)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to interleukin-4 (GO:0071353)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen biosynthetic process (GO:0032964)|liver development (GO:0001889)|lung development (GO:0030324)|mammary gland involution (GO:0060056)|maternal process involved in female pregnancy (GO:0060135)|positive regulation of endothelial cell proliferation (GO:0001938)|protein homotrimerization (GO:0070207)|regulation of L-arginine import (GO:0010963)|response to amine (GO:0014075)|response to amino acid (GO:0043200)|response to axon injury (GO:0048678)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to herbicide (GO:0009635)|response to manganese ion (GO:0010042)|response to methylmercury (GO:0051597)|response to selenium ion (GO:0010269)|response to vitamin A (GO:0033189)|response to vitamin E (GO:0033197)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)|urea cycle (GO:0000050)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	arginase activity (GO:0004053)|manganese ion binding (GO:0030145)	p.V24L(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|ovary(1)|skin(3)	14	Breast(56;0.0753)			GBM - Glioblastoma multiforme(226;0.0106)|OV - Ovarian serous cystadenocarcinoma(155;0.0713)	L-Ornithine(DB00129)	ACGAGGAGGGGTGGAAGAAGG	0.388																																																1	Substitution - Missense(1)	ovary(1)	6											100.0	101.0	101.0					6																	131897815		2203	4300	6503	131939508	SO:0001583	missense	383				CCDS5145.1, CCDS59038.1	6q23	2013-05-01	2013-05-01		ENSG00000118520	ENSG00000118520	3.5.3.1		663	protein-coding gene	gene with protein product		608313	"""arginase, liver"""			22959135	Standard	NM_000045		Approved		uc003qcp.2	P05089	OTTHUMG00000015566	ENST00000368087.3:c.70G>T	6.37:g.131897815G>T	ENSP00000357066:p.Val24Leu		131939508	A6NEA0|Q5JWT5|Q5JWT6|Q8TE72|Q9BS50	Missense_Mutation	SNP	ENST00000368087.3	37	CCDS5145.1	.	.	.	.	.	.	.	.	.	.	G	28.7	4.940386	0.92526	.	.	ENSG00000118520	ENST00000368087;ENST00000356962;ENST00000476845	D;D;D	0.84800	-1.9;-1.9;-1.9	5.37	5.37	0.77165	Ureohydrolase domain (1);	0.000000	0.85682	D	0.000000	D	0.92054	0.7482	M	0.90814	3.15	0.80722	D	1	D;D	0.54964	0.962;0.969	P;P	0.60473	0.802;0.875	D	0.93388	0.6749	10	0.87932	D	0	-6.0575	16.6037	0.84822	0.0:0.0:1.0:0.0	.	24;24	P05089-2;P05089	.;ARGI1_HUMAN	L	24	ENSP00000357066:V24L;ENSP00000349446:V24L;ENSP00000417694:V24L	ENSP00000349446:V24L	V	+	1	0	ARG1	131939508	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	5.173000	0.65010	2.535000	0.85469	0.655000	0.94253	GTG		0.388	ARG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042223.1		
TAAR6	319100	broad.mit.edu	37	6	132891644	132891644	+	Missense_Mutation	SNP	C	C	A			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr6:132891644C>A	ENST00000275198.1	+	1	184	c.184C>A	c.(184-186)Cag>Aag	p.Q62K		NM_175067.1	NP_778237.1	Q96RI8	TAAR6_HUMAN	trace amine associated receptor 6	62					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|trace-amine receptor activity (GO:0001594)	p.Q62K(1)		cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(19)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	41	Breast(56;0.112)			OV - Ovarian serous cystadenocarcinoma(155;0.006)|GBM - Glioblastoma multiforme(226;0.00792)		CCATTTCAAGCAGCTGCACTC	0.537																																																1	Substitution - Missense(1)	ovary(1)	6											201.0	175.0	184.0					6																	132891644		2203	4300	6503	132933337	SO:0001583	missense	319100			AF380192	CCDS5155.1	6q23.1	2012-08-08	2005-02-23	2005-02-24	ENSG00000146383	ENSG00000146383		"""GPCR / Class A : Trace amine associated receptors"""	20978	protein-coding gene	gene with protein product		608923	"""trace amine receptor 4"""	TRAR4		11459929, 15718104	Standard	NM_175067		Approved	TA4	uc011eck.2	Q96RI8	OTTHUMG00000015579	ENST00000275198.1:c.184C>A	6.37:g.132891644C>A	ENSP00000275198:p.Gln62Lys		132933337	Q5VUQ4	Missense_Mutation	SNP	ENST00000275198.1	37	CCDS5155.1	.	.	.	.	.	.	.	.	.	.	C	14.87	2.663463	0.47572	.	.	ENSG00000146383	ENST00000275198;ENST00000539228	T	0.69926	-0.44	4.84	3.05	0.35203	GPCR, rhodopsin-like superfamily (1);	0.000000	0.49916	D	0.000127	T	0.32763	0.0840	N	0.25031	0.7	0.28445	N	0.916599	B	0.19445	0.036	B	0.29267	0.1	T	0.23833	-1.0177	10	0.35671	T	0.21	-6.9222	10.6496	0.45640	0.0:0.5964:0.3302:0.0734	.	62	Q96RI8	TAAR6_HUMAN	K	62;45	ENSP00000275198:Q62K	ENSP00000275198:Q62K	Q	+	1	0	TAAR6	132933337	0.990000	0.36364	0.831000	0.32960	0.395000	0.30598	1.499000	0.35671	0.619000	0.30197	0.563000	0.77884	CAG		0.537	TAAR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042255.1	NM_175067	
FNDC1	84624	broad.mit.edu	37	6	159654033	159654033	+	Missense_Mutation	SNP	G	G	T			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr6:159654033G>T	ENST00000297267.9	+	11	2689	c.2489G>T	c.(2488-2490)aGg>aTg	p.R830M	FNDC1_ENST00000340366.6_Missense_Mutation_p.R767M	NM_032532.2	NP_115921.2	Q4ZHG4	FNDC1_HUMAN	fibronectin type III domain containing 1	830					cellular response to hypoxia (GO:0071456)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of protein phosphorylation (GO:0001934)|regulation of protein transport (GO:0051223)	cell-cell junction (GO:0005911)|extracellular region (GO:0005576)|mitochondrial membrane (GO:0031966)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.R830M(1)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(29)|liver(2)|lung(23)|ovary(3)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)	93		Breast(66;0.000781)|Ovarian(120;0.0308)|Prostate(117;0.195)		OV - Ovarian serous cystadenocarcinoma(65;2.6e-16)|BRCA - Breast invasive adenocarcinoma(81;1.06e-05)		GCCAACGGGAGGTCTCCAAGC	0.677																																																1	Substitution - Missense(1)	ovary(1)	6											22.0	26.0	25.0					6																	159654033		2004	4177	6181	159574023	SO:0001583	missense	84624			AB058769	CCDS47512.1	6q25	2013-02-11			ENSG00000164694	ENSG00000164694		"""Fibronectin type III domain containing"""	21184	protein-coding gene	gene with protein product		609991	"""fibronectin type III domain containing 2"""	FNDC2		11347906	Standard	NM_032532		Approved	bA243O10.1, KIAA1866, dJ322A24.1	uc010kjv.3	Q4ZHG4	OTTHUMG00000015927	ENST00000297267.9:c.2489G>T	6.37:g.159654033G>T	ENSP00000297267:p.Arg830Met		159574023	A6H8X2|B7ZBR4|B7ZBR5|B9EK49|Q5JPI0|Q5VU31|Q5VU32|Q5VXX4|Q70CQ6|Q96JG1	Missense_Mutation	SNP	ENST00000297267.9	37	CCDS47512.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.39|12.39	1.923848|1.923848	0.34002|0.34002	.|.	.|.	ENSG00000164694|ENSG00000164694	ENST00000329629|ENST00000297267;ENST00000340366	.|T;T	.|0.13420	.|2.59;2.67	5.53|5.53	4.66|4.66	0.58398|0.58398	.|.	.|0.591113	.|0.16670	.|N	.|0.204394	T|T	0.14917|0.14917	0.0360|0.0360	L|L	0.36672|0.36672	1.1|1.1	0.09310|0.09310	N|N	1|1	.|D;D	.|0.89917	.|1.0;0.999	.|D;D	.|0.76071	.|0.987;0.927	T|T	0.07501|0.07501	-1.0769|-1.0769	5|10	.|0.87932	.|D	.|0	-16.672|-16.672	11.7307|11.7307	0.51735|0.51735	0.0838:0.0:0.9162:0.0|0.0838:0.0:0.9162:0.0	.|.	.|767;830	.|Q4ZHG4-2;Q4ZHG4	.|.;FNDC1_HUMAN	D|M	725|830;767	.|ENSP00000297267:R830M;ENSP00000342460:R767M	.|ENSP00000297267:R830M	E|R	+|+	3|2	2|0	FNDC1|FNDC1	159574023|159574023	0.390000|0.390000	0.25213|0.25213	0.000000|0.000000	0.03702|0.03702	0.420000|0.420000	0.31355|0.31355	2.605000|2.605000	0.46283|0.46283	1.339000|1.339000	0.45563|0.45563	0.655000|0.655000	0.94253|0.94253	GAG|AGG		0.677	FNDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042897.3	NM_032532	
TNRC18	84629	broad.mit.edu	37	7	5410134	5410134	+	Missense_Mutation	SNP	C	C	G			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr7:5410134C>G	ENST00000430969.1	-	11	4439	c.4091G>C	c.(4090-4092)gGa>gCa	p.G1364A	TNRC18_ENST00000399537.4_Missense_Mutation_p.G1364A	NM_001080495.2	NP_001073964.2	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	1364							chromatin binding (GO:0003682)	p.G419A(1)		central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)	11		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		GGCCTGGGCTCCAGCAGCACC	0.657																																																1	Substitution - Missense(1)	ovary(1)	7											15.0	15.0	15.0					7																	5410134		1997	4169	6166	5376660	SO:0001583	missense	84629			U80753	CCDS47534.1	7p22.1	2012-04-17			ENSG00000182095	ENSG00000182095		"""Trinucleotide (CAG) repeat containing"""	11962	protein-coding gene	gene with protein product						9225980	Standard	NM_001080495		Approved	CAGL79, TNRC18A, KIAA1856	uc003soi.4	O15417	OTTHUMG00000151831	ENST00000430969.1:c.4091G>C	7.37:g.5410134C>G	ENSP00000395538:p.Gly1364Ala		5376660	A8MX41|Q96JH1|Q96K91	Missense_Mutation	SNP	ENST00000430969.1	37	CCDS47534.1	.	.	.	.	.	.	.	.	.	.	C	2.210	-0.380913	0.05000	.	.	ENSG00000182095	ENST00000399537;ENST00000430969;ENST00000399544;ENST00000327499	T;T	0.10573	2.86;2.86	4.72	1.44	0.22558	.	0.537261	0.13975	N	0.349903	T	0.05090	0.0136	L	0.28740	0.885	0.09310	N	1	B	0.18013	0.025	B	0.08055	0.003	T	0.43261	-0.9402	10	0.02654	T	1	.	2.4248	0.04457	0.4259:0.3516:0.1165:0.106	.	1364	O15417	TNC18_HUMAN	A	1364;1364;419;419	ENSP00000382452:G1364A;ENSP00000395538:G1364A	ENSP00000330383:G419A	G	-	2	0	TNRC18	5376660	0.000000	0.05858	0.011000	0.14972	0.149000	0.21700	0.824000	0.27379	0.398000	0.25338	0.313000	0.20887	GGA		0.657	TNRC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
ZKSCAN5	23660	broad.mit.edu	37	7	99123674	99123674	+	Missense_Mutation	SNP	G	G	C			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr7:99123674G>C	ENST00000394170.2	+	6	1262	c.1011G>C	c.(1009-1011)aaG>aaC	p.K337N	ZKSCAN5_ENST00000451158.1_Missense_Mutation_p.K337N|ZKSCAN5_ENST00000326775.5_Missense_Mutation_p.K337N	NM_014569.3	NP_055384.1	Q9Y2L8	ZKSC5_HUMAN	zinc finger with KRAB and SCAN domains 5	337					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.K337N(1)		breast(3)|endometrium(1)|kidney(1)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	21	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)					TCAGCCCTAAGCAAAGCACAC	0.517																																																1	Substitution - Missense(1)	ovary(1)	7											78.0	63.0	68.0					7																	99123674		2203	4300	6503	98961610	SO:0001583	missense	23660			AF170025	CCDS5667.1	7q22	2013-01-09	2007-02-20	2007-02-20	ENSG00000196652	ENSG00000196652		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	12867	protein-coding gene	gene with protein product		611272	"""zinc finger protein homologous to Zfp95 in mouse"", ""zinc finger protein 95 homolog (mouse)"""	ZFP95		10585779	Standard	NM_014569		Approved	ZNF914, ZSCAN37	uc003uqv.3	Q9Y2L8	OTTHUMG00000156749	ENST00000394170.2:c.1011G>C	7.37:g.99123674G>C	ENSP00000377725:p.Lys337Asn		98961610	A4D280|D6W5S9	Missense_Mutation	SNP	ENST00000394170.2	37	CCDS5667.1	.	.	.	.	.	.	.	.	.	.	G	10.25	1.299698	0.23650	.	.	ENSG00000196652	ENST00000537357;ENST00000326775;ENST00000451158;ENST00000394170	T;T;T	0.05580	3.42;3.42;3.42	4.64	3.75	0.43078	.	0.000000	0.53938	D	0.000048	T	0.10809	0.0264	N	0.22421	0.69	0.35467	D	0.796983	D;D	0.71674	0.983;0.998	P;D	0.76071	0.656;0.987	T	0.06180	-1.0841	10	0.72032	D	0.01	.	6.362	0.21433	0.1936:0.0:0.8064:0.0	.	337;337	Q8N718;Q9Y2L8	.;ZKSC5_HUMAN	N	337	ENSP00000322872:K337N;ENSP00000392104:K337N;ENSP00000377725:K337N	ENSP00000322872:K337N	K	+	3	2	ZKSCAN5	98961610	0.063000	0.20901	0.982000	0.44146	0.290000	0.27261	1.318000	0.33643	2.590000	0.87494	0.655000	0.94253	AAG		0.517	ZKSCAN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345597.1	NM_014569	
VCPIP1	80124	broad.mit.edu	37	8	67577756	67577756	+	Missense_Mutation	SNP	C	C	G			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr8:67577756C>G	ENST00000310421.4	-	1	1696	c.1438G>C	c.(1438-1440)Gtt>Ctt	p.V480L	C8orf44-SGK3_ENST00000519289.1_5'Flank|C8orf44_ENST00000521889.1_5'Flank|C8orf44_ENST00000519561.1_5'Flank	NM_025054.4	NP_079330.2	Q96JH7	VCIP1_HUMAN	valosin containing protein (p97)/p47 complex interacting protein 1	480					endoplasmic reticulum membrane fusion (GO:0016320)|Golgi reassembly (GO:0090168)|mitotic nuclear division (GO:0007067)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)	ubiquitin-specific protease activity (GO:0004843)	p.V480L(1)		breast(7)|central_nervous_system(2)|cervix(2)|endometrium(3)|kidney(6)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		Lung NSC(129;0.142)|all_lung(136;0.227)	Epithelial(68;0.000771)|OV - Ovarian serous cystadenocarcinoma(28;0.00248)|all cancers(69;0.00296)|BRCA - Breast invasive adenocarcinoma(89;0.149)			TCTGGAGGAACATGAAGTTCA	0.453																																					NSCLC(179;265 2915 6144 43644)											1	Substitution - Missense(1)	ovary(1)	8											140.0	142.0	141.0					8																	67577756		2203	4300	6503	67740310	SO:0001583	missense	80124			AB058753	CCDS6192.1	8q13	2014-02-24			ENSG00000175073	ENSG00000175073		"""OTU domain containing"""	30897	protein-coding gene	gene with protein product		611745				11347906, 12509440	Standard	NM_025054		Approved	VCIP135, KIAA1850, FLJ23132, DUBA3	uc003xwn.3	Q96JH7	OTTHUMG00000164560	ENST00000310421.4:c.1438G>C	8.37:g.67577756C>G	ENSP00000309031:p.Val480Leu		67740310	Q504T4|Q86T93|Q86W01|Q8N3A9|Q9H5R8	Missense_Mutation	SNP	ENST00000310421.4	37	CCDS6192.1	.	.	.	.	.	.	.	.	.	.	C	13.91	2.378982	0.42207	.	.	ENSG00000175073	ENST00000310421	T	0.31769	1.48	5.29	5.29	0.74685	.	0.000000	0.85682	D	0.000000	T	0.52484	0.1737	L	0.57536	1.79	0.80722	D	1	D	0.58970	0.984	D	0.68192	0.956	T	0.44283	-0.9338	10	0.37606	T	0.19	-12.0444	18.9562	0.92659	0.0:1.0:0.0:0.0	.	480	Q96JH7	VCIP1_HUMAN	L	480	ENSP00000309031:V480L	ENSP00000309031:V480L	V	-	1	0	VCPIP1	67740310	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.913000	0.63341	2.459000	0.83118	0.655000	0.94253	GTT		0.453	VCPIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379227.1		
ARFGEF1	10565	broad.mit.edu	37	8	68139375	68139375	+	Missense_Mutation	SNP	C	C	T			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr8:68139375C>T	ENST00000262215.3	-	27	4302	c.3913G>A	c.(3913-3915)Gtc>Atc	p.V1305I	ARFGEF1_ENST00000518230.1_Missense_Mutation_p.V143I|ARFGEF1_ENST00000520381.1_Missense_Mutation_p.V759I	NM_006421.4	NP_006412.2	Q9Y6D6	BIG1_HUMAN	ADP-ribosylation factor guanine nucleotide-exchange factor 1 (brefeldin A-inhibited)	1305					endomembrane system organization (GO:0010256)|exocytosis (GO:0006887)|Golgi organization (GO:0007030)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of Rho GTPase activity (GO:0034259)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein glycosylation in Golgi (GO:0090284)|positive regulation of wound healing (GO:0090303)|protein transport (GO:0015031)|regulation of ARF protein signal transduction (GO:0032012)|regulation of establishment of cell polarity (GO:2000114)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|small nuclear ribonucleoprotein complex (GO:0030532)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|guanyl-nucleotide exchange factor activity (GO:0005085)|myosin binding (GO:0017022)|protein kinase A regulatory subunit binding (GO:0034237)	p.V1305I(1)		breast(1)|endometrium(14)|kidney(4)|large_intestine(17)|lung(20)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.0043)|OV - Ovarian serous cystadenocarcinoma(28;0.00578)|all cancers(69;0.0173)|BRCA - Breast invasive adenocarcinoma(89;0.206)			TACTCACTGACAATGTGCCCG	0.373																																																1	Substitution - Missense(1)	ovary(1)	8											79.0	73.0	75.0					8																	68139375		2203	4299	6502	68301929	SO:0001583	missense	10565			AF084520	CCDS6199.1	8q13	2011-08-18	2011-08-18		ENSG00000066777	ENSG00000066777			15772	protein-coding gene	gene with protein product		604141				10212200, 8917509	Standard	NM_006421		Approved	DKFZP434L057, BIG1, ARFGEP1, p200	uc003xxo.2	Q9Y6D6	OTTHUMG00000164626	ENST00000262215.3:c.3913G>A	8.37:g.68139375C>T	ENSP00000262215:p.Val1305Ile		68301929	Q9NV46|Q9UFV2|Q9UNL0	Missense_Mutation	SNP	ENST00000262215.3	37	CCDS6199.1	.	.	.	.	.	.	.	.	.	.	C	15.25	2.778174	0.49786	.	.	ENSG00000066777	ENST00000520381;ENST00000262215;ENST00000518230	T;T;T	0.71103	-0.05;-0.54;-0.13	5.56	5.56	0.83823	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.45856	0.1363	N	0.03608	-0.345	0.58432	D	0.999999	P;B;B	0.36282	0.546;0.017;0.046	B;B;B	0.31442	0.13;0.009;0.009	T	0.53697	-0.8402	10	0.07482	T	0.82	.	19.5224	0.95190	0.0:1.0:0.0:0.0	.	1305;783;759	Q9Y6D6;Q59FY5;E5RIF2	BIG1_HUMAN;.;.	I	759;1305;143	ENSP00000428429:V759I;ENSP00000262215:V1305I;ENSP00000430891:V143I	ENSP00000262215:V1305I	V	-	1	0	ARFGEF1	68301929	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	7.818000	0.86416	2.611000	0.88343	0.585000	0.79938	GTC		0.373	ARFGEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379441.4	NM_006421	
ZC2HC1A	51101	broad.mit.edu	37	8	79610699	79610699	+	Missense_Mutation	SNP	C	C	T			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr8:79610699C>T	ENST00000263849.4	+	7	757	c.655C>T	c.(655-657)Ctt>Ttt	p.L219F		NM_016010.2	NP_057094.2	Q96GY0	ZC21A_HUMAN	zinc finger, C2HC-type containing 1A	219							metal ion binding (GO:0046872)	p.L219F(1)									GGGAAACAAACTTCAGACCTT	0.343																																																1	Substitution - Missense(1)	ovary(1)	8											124.0	120.0	121.0					8																	79610699		2203	4300	6503	79773254	SO:0001583	missense	51101				CCDS6223.1	8q21.11	2013-01-10	2012-02-03	2012-02-03	ENSG00000104427	ENSG00000104427		"""Zinc fingers, C2HC-type containing"""	24277	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 70"", ""family with sequence similarity 164, member A"""	C8orf70, FAM164A		10810093	Standard	NM_016010		Approved	CGI-62	uc003ybd.3	Q96GY0	OTTHUMG00000164619	ENST00000263849.4:c.655C>T	8.37:g.79610699C>T	ENSP00000263849:p.Leu219Phe		79773254	Q9Y372	Missense_Mutation	SNP	ENST00000263849.4	37	CCDS6223.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	8.883|8.883	0.952160|0.952160	0.18431|0.18431	.|.	.|.	ENSG00000104427|ENSG00000104427	ENST00000263849|ENST00000519307	T|.	0.44482|.	0.92|.	5.85|5.85	3.9|3.9	0.45041|0.45041	.|.	1.077760|.	0.06950|.	N|.	0.814486|.	T|T	0.42562|0.42562	0.1208|0.1208	N|N	0.22421|0.22421	0.69|0.69	0.80722|0.80722	D|D	1|1	B|.	0.25955|.	0.138|.	B|.	0.21151|.	0.033|.	T|T	0.11542|0.11542	-1.0583|-1.0583	9|5	.|.	.|.	.|.	-7.5087|-7.5087	9.309|9.309	0.37891|0.37891	0.1783:0.6301:0.1916:0.0|0.1783:0.6301:0.1916:0.0	.|.	219|.	Q96GY0|.	F164A_HUMAN|.	F|I	219|51	ENSP00000263849:L219F|.	.|.	L|T	+|+	1|2	0|0	FAM164A|FAM164A	79773254|79773254	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.874000|0.874000	0.50279|0.50279	1.286000|1.286000	0.33273|0.33273	2.767000|2.767000	0.95098|0.95098	0.557000|0.557000	0.71058|0.71058	CTT|ACT		0.343	ZC2HC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379423.2	NM_016010	
PKHD1L1	93035	broad.mit.edu	37	8	110534995	110534995	+	Missense_Mutation	SNP	G	G	C			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr8:110534995G>C	ENST00000378402.5	+	75	12310	c.12206G>C	c.(12205-12207)aGg>aCg	p.R4069T		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	4069					immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.R4073T(1)		NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			CCAGTTGAAAGGTCTGCATTT	0.512										HNSCC(38;0.096)																																						1	Substitution - Missense(1)	ovary(1)	8											54.0	57.0	56.0					8																	110534995		2178	4278	6456	110604171	SO:0001583	missense	93035			AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.12206G>C	8.37:g.110534995G>C	ENSP00000367655:p.Arg4069Thr		110604171	Q567P2|Q9UF27	Missense_Mutation	SNP	ENST00000378402.5	37	CCDS47911.1	.	.	.	.	.	.	.	.	.	.	G	10.92	1.486654	0.26686	.	.	ENSG00000205038	ENST00000378402;ENST00000526472	D;D	0.85955	-2.05;-1.88	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	T	0.80929	0.4718	M	0.64997	1.995	0.31713	N	0.639229	P	0.36144	0.539	B	0.28709	0.093	T	0.78940	-0.2006	10	0.10111	T	0.7	.	17.913	0.88940	0.0:0.0:1.0:0.0	.	4069	Q86WI1	PKHL1_HUMAN	T	4069;997	ENSP00000367655:R4069T;ENSP00000437376:R997T	ENSP00000367655:R4069T	R	+	2	0	PKHD1L1	110604171	1.000000	0.71417	1.000000	0.80357	0.218000	0.24690	4.467000	0.60155	2.831000	0.97527	0.650000	0.86243	AGG		0.512	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381017.1	NM_177531	
PARP10	84875	broad.mit.edu	37	8	145058881	145058881	+	Missense_Mutation	SNP	A	A	C			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	A	A	C	C	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr8:145058881A>C	ENST00000313028.7	-	5	1383	c.1289T>G	c.(1288-1290)gTg>gGg	p.V430G	PARP10_ENST00000524918.1_Missense_Mutation_p.V430G|PARP10_ENST00000525773.1_Missense_Mutation_p.V442G|PARP10_ENST00000533665.1_5'Flank	NM_032789.3	NP_116178.2	Q53GL7	PAR10_HUMAN	poly (ADP-ribose) polymerase family, member 10	430					negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of gene expression (GO:0010629)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein import into nucleus, translocation (GO:0033159)|negative regulation of protein K63-linked ubiquitination (GO:1900045)|negative regulation of viral genome replication (GO:0045071)|protein ADP-ribosylation (GO:0006471)|protein auto-ADP-ribosylation (GO:0070213)|protein poly-ADP-ribosylation (GO:0070212)|regulation of chromatin assembly (GO:0010847)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	K63-linked polyubiquitin binding (GO:0070530)|NAD+ ADP-ribosyltransferase activity (GO:0003950)	p.V430G(1)		NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(9)|ovary(4)|pancreas(1)|upper_aerodigestive_tract(2)	27	all_cancers(97;8.2e-11)|all_epithelial(106;1.1e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.31e-40)|Epithelial(56;1.16e-39)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			TCCTGGGCTCACAGGCCCTGC	0.617																																																1	Substitution - Missense(1)	ovary(1)	8											123.0	120.0	121.0					8																	145058881		2203	4300	6503	145130869	SO:0001583	missense	84875			AK027370	CCDS34960.1	8q24	2010-02-16				ENSG00000178685		"""Poly (ADP-ribose) polymerases"""	25895	protein-coding gene	gene with protein product		609564				15273990	Standard	NM_032789		Approved	FLJ14464	uc003zal.4	Q53GL7		ENST00000313028.7:c.1289T>G	8.37:g.145058881A>C	ENSP00000325618:p.Val430Gly		145130869	Q8N2I0|Q8WV05|Q96CH7|Q96K72	Missense_Mutation	SNP	ENST00000313028.7	37	CCDS34960.1	.	.	.	.	.	.	.	.	.	.	A	2.828	-0.243216	0.05906	.	.	ENSG00000178685	ENST00000524918;ENST00000534861;ENST00000313028;ENST00000525773	T;T;T	0.10668	2.85;2.86;2.86	2.89	-4.56	0.03431	.	1.655720	0.04409	N	0.365635	T	0.09730	0.0239	L	0.50333	1.59	0.09310	N	1	B;B;B	0.14438	0.01;0.01;0.01	B;B;B	0.11329	0.006;0.006;0.006	T	0.44742	-0.9308	10	0.59425	D	0.04	.	3.4191	0.07386	0.3662:0.1693:0.0:0.4645	.	442;430;430	E9PNI7;E9PK67;Q53GL7	.;.;PAR10_HUMAN	G	430;136;430;442	ENSP00000431620:V430G;ENSP00000325618:V430G;ENSP00000434776:V442G	ENSP00000325618:V430G	V	-	2	0	PARP10	145130869	0.000000	0.05858	0.017000	0.16124	0.019000	0.09904	-0.650000	0.05378	-0.399000	0.07668	0.451000	0.29950	GTG		0.617	PARP10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000383866.1	NM_032789	
CENPP	401541	broad.mit.edu	37	9	95094528	95094528	+	Missense_Mutation	SNP	C	C	A			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture;Sequenom			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr9:95094528C>A	ENST00000375587.3	+	2	699	c.184C>A	c.(184-186)Cat>Aat	p.H62N		NM_001012267.1	NP_001012267.1	Q6IPU0	CENPP_HUMAN	centromere protein P	62					CENP-A containing nucleosome assembly (GO:0034080)|mitotic cell cycle (GO:0000278)|nucleosome assembly (GO:0006334)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)		p.H62N(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(8)|ovary(2)|prostate(1)|skin(1)	16						TCAGCTTGGACATTTAGAATC	0.343																																																1	Substitution - Missense(1)	ovary(1)	9											73.0	70.0	71.0					9																	95094528		2203	4300	6503	94134349	SO:0001583	missense	401541			AK091247	CCDS35063.1, CCDS69618.1	9q22.31	2013-11-05			ENSG00000188312	ENSG00000188312			32933	protein-coding gene	gene with protein product		611505				16622419, 16622420	Standard	NM_001286969		Approved	RP11-19J3.3, CENP-P	uc004arz.3	Q6IPU0	OTTHUMG00000020228	ENST00000375587.3:c.184C>A	9.37:g.95094528C>A	ENSP00000364737:p.His62Asn		94134349	B3KRA5|B3KS17|Q5T9F8|Q5T9F9	Missense_Mutation	SNP	ENST00000375587.3	37	CCDS35063.1	.	.	.	.	.	.	.	.	.	.	C	0.427	-0.905243	0.02453	.	.	ENSG00000188312	ENST00000375587	.	.	.	5.16	4.25	0.50352	.	0.922896	0.09246	N	0.828575	T	0.46405	0.1391	L	0.42245	1.32	0.80722	D	1	B	0.33694	0.421	B	0.24541	0.054	T	0.19192	-1.0313	9	0.19147	T	0.46	-1.7998	11.6725	0.51411	0.1779:0.8221:0.0:0.0	.	62	Q6IPU0	CENPP_HUMAN	N	62	.	ENSP00000364737:H62N	H	+	1	0	CENPP	94134349	0.806000	0.28996	0.996000	0.52242	0.541000	0.35023	0.328000	0.19681	1.469000	0.48083	0.551000	0.68910	CAT		0.343	CENPP-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053098.1	NM_001012267	
PTCH1	5727	broad.mit.edu	37	9	98218563	98218563	+	Missense_Mutation	SNP	C	C	A			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr9:98218563C>A	ENST00000331920.6	-	19	3600	c.3301G>T	c.(3301-3303)Gct>Tct	p.A1101S	PTCH1_ENST00000429896.2_Missense_Mutation_p.A950S|PTCH1_ENST00000375274.2_Missense_Mutation_p.A1100S|PTCH1_ENST00000430669.2_Missense_Mutation_p.A1035S|PTCH1_ENST00000421141.1_Missense_Mutation_p.A950S|PTCH1_ENST00000418258.1_Missense_Mutation_p.A950S|PTCH1_ENST00000437951.1_Missense_Mutation_p.A1035S	NM_000264.3	NP_000255.2	Q13635	PTC1_HUMAN	patched 1	1101					brain development (GO:0007420)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation involved in kidney development (GO:0061005)|cell proliferation involved in metanephros development (GO:0072203)|cellular response to cholesterol (GO:0071397)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|embryonic organ development (GO:0048568)|epidermis development (GO:0008544)|glucose homeostasis (GO:0042593)|heart morphogenesis (GO:0003007)|hindlimb morphogenesis (GO:0035137)|in utero embryonic development (GO:0001701)|keratinocyte proliferation (GO:0043616)|limb morphogenesis (GO:0035108)|mammary gland duct morphogenesis (GO:0060603)|mammary gland epithelial cell differentiation (GO:0060644)|negative regulation of cell division (GO:0051782)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural plate axis specification (GO:0021997)|neural tube closure (GO:0001843)|neural tube patterning (GO:0021532)|organ morphogenesis (GO:0009887)|pharyngeal system development (GO:0060037)|positive regulation of cholesterol efflux (GO:0010875)|protein processing (GO:0016485)|protein targeting to plasma membrane (GO:0072661)|regulation of mitotic cell cycle (GO:0007346)|regulation of protein localization (GO:0032880)|regulation of smoothened signaling pathway (GO:0008589)|renal system development (GO:0072001)|response to chlorate (GO:0010157)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to mechanical stimulus (GO:0009612)|response to retinoic acid (GO:0032526)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|somite development (GO:0061053)|spinal cord motor neuron differentiation (GO:0021522)	axonal growth cone (GO:0044295)|caveola (GO:0005901)|dendritic growth cone (GO:0044294)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|midbody (GO:0030496)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|primary cilium (GO:0072372)	cholesterol binding (GO:0015485)|cyclin binding (GO:0030332)|hedgehog family protein binding (GO:0097108)|hedgehog receptor activity (GO:0008158)|heparin binding (GO:0008201)|smoothened binding (GO:0005119)	p.A1101S(2)|p.V1057_L1102del(1)		NS(8)|bone(33)|breast(10)|central_nervous_system(95)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(8)|kidney(2)|large_intestine(18)|lung(22)|meninges(1)|oesophagus(3)|ovary(6)|prostate(2)|skin(262)|upper_aerodigestive_tract(11)|urinary_tract(2)|vulva(1)	490		Medulloblastoma(1;7.87e-06)|all_neural(1;0.000555)|Acute lymphoblastic leukemia(62;0.136)				CATACCAAAGCAACGTGAACG	0.498																																																3	Substitution - Missense(2)|Deletion - In frame(1)	ovary(2)|central_nervous_system(1)	9											138.0	110.0	120.0					9																	98218563		2203	4300	6503	97258384	SO:0001583	missense	5727			AI494442	CCDS6714.1, CCDS43851.1, CCDS47995.1, CCDS47996.1	9q22.1-q31	2014-09-17	2010-06-24	2006-09-26	ENSG00000185920	ENSG00000185920			9585	protein-coding gene	gene with protein product		601309	"""patched (Drosophila) homolog"", ""patched homolog (Drosophila)"", ""patched homolog 1 (Drosophila)"""	NBCCS, PTCH		8658145	Standard	NM_001083603		Approved	BCNS	uc004avk.4	Q13635	OTTHUMG00000020280	ENST00000331920.6:c.3301G>T	9.37:g.98218563C>A	ENSP00000332353:p.Ala1101Ser		97258384	A3KBI9|E9PEJ8|Q13463|Q5R1U7|Q5R1U9|Q5R1V0|Q5VZC0|Q5VZC2|Q86XG7	Missense_Mutation	SNP	ENST00000331920.6	37	CCDS6714.1	.	.	.	.	.	.	.	.	.	.	C	18.78	3.696707	0.68386	.	.	ENSG00000185920	ENST00000331920;ENST00000437951;ENST00000421141;ENST00000418258;ENST00000375275;ENST00000430669;ENST00000429896;ENST00000375274	D;D;D;D;D;D;D	0.95482	-3.72;-3.72;-3.72;-3.72;-3.72;-3.72;-3.72	5.45	5.45	0.79879	.	0.049462	0.85682	D	0.000000	D	0.96479	0.8851	L	0.47716	1.5	0.80722	D	1	B;D;P	0.62365	0.383;0.991;0.771	B;D;P	0.63877	0.321;0.919;0.475	D	0.95847	0.8871	10	0.40728	T	0.16	-18.5009	19.2907	0.94098	0.0:1.0:0.0:0.0	.	1035;1100;1101	Q13635-3;Q13635-2;Q13635	.;.;PTC1_HUMAN	S	1101;1035;950;950;537;1035;950;1100	ENSP00000332353:A1101S;ENSP00000389744:A1035S;ENSP00000399981:A950S;ENSP00000396135:A950S;ENSP00000410287:A1035S;ENSP00000414823:A950S;ENSP00000364423:A1100S	ENSP00000332353:A1101S	A	-	1	0	PTCH1	97258384	1.000000	0.71417	1.000000	0.80357	0.576000	0.36127	4.632000	0.61311	2.575000	0.86900	0.655000	0.94253	GCT		0.498	PTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053229.2	NM_000264	
GALNT12	79695	broad.mit.edu	37	9	101585623	101585623	+	Missense_Mutation	SNP	C	C	G			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr9:101585623C>G	ENST00000375011.3	+	2	457	c.457C>G	c.(457-459)Ctt>Gtt	p.L153V		NM_024642.4	NP_078918.3	Q8IXK2	GLT12_HUMAN	polypeptide N-acetylgalactosaminyltransferase 12	153	Catalytic subdomain A.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.L153V(1)		breast(1)|endometrium(2)|large_intestine(3)|lung(8)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	17		Acute lymphoblastic leukemia(62;0.0559)				GTCAACTCTCCTTCGGACAGT	0.443																																																1	Substitution - Missense(1)	ovary(1)	9											105.0	103.0	104.0					9																	101585623		2203	4300	6503	100625444	SO:0001583	missense	79695			AB078146	CCDS6737.1	9q22.33	2014-03-13	2014-03-13		ENSG00000119514	ENSG00000119514	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	19877	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 12"""	610290	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 12 (GalNAc-T12)"""			12135769	Standard	NM_024642		Approved	GalNAc-T12	uc004ayz.3	Q8IXK2	OTTHUMG00000020348	ENST00000375011.3:c.457C>G	9.37:g.101585623C>G	ENSP00000364150:p.Leu153Val		100625444	Q5TCF7|Q8NG54|Q96CT9|Q9H771	Missense_Mutation	SNP	ENST00000375011.3	37	CCDS6737.1	.	.	.	.	.	.	.	.	.	.	C	19.02	3.744988	0.69418	.	.	ENSG00000119514	ENST00000375011	T	0.59502	0.26	5.37	4.47	0.54385	Glycosyl transferase, family 2 (1);	0.065887	0.64402	D	0.000009	T	0.72819	0.3508	M	0.76938	2.355	0.49798	D	0.999824	D	0.76494	0.999	D	0.87578	0.998	T	0.75351	-0.3348	10	0.87932	D	0	.	8.6798	0.34201	0.0:0.8263:0.0:0.1737	.	153	Q8IXK2	GLT12_HUMAN	V	153	ENSP00000364150:L153V	ENSP00000364150:L153V	L	+	1	0	GALNT12	100625444	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.255000	0.51484	2.477000	0.83638	0.655000	0.94253	CTT		0.443	GALNT12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053382.1	NM_024642	
CTNNAL1	8727	broad.mit.edu	37	9	111739271	111739271	+	Missense_Mutation	SNP	T	T	G			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	T	T	G	G	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr9:111739271T>G	ENST00000325551.4	-	8	1245	c.1159A>C	c.(1159-1161)Agt>Cgt	p.S387R	CTNNAL1_ENST00000488130.1_5'UTR|CTNNAL1_ENST00000374595.4_Missense_Mutation_p.S387R|CTNNAL1_ENST00000325580.6_Missense_Mutation_p.S387R	NM_003798.2	NP_003789.1	Q9UBT7	CTNL1_HUMAN	catenin (cadherin-associated protein), alpha-like 1	387					cell adhesion (GO:0007155)|Rho protein signal transduction (GO:0007266)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	structural molecule activity (GO:0005198)	p.S387R(1)		cervix(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(5)|ovary(1)|prostate(4)|urinary_tract(2)	25				STAD - Stomach adenocarcinoma(157;0.0768)		AGACTGTGACTGATTTTCAAA	0.303																																																1	Substitution - Missense(1)	ovary(1)	9											114.0	102.0	106.0					9																	111739271		2191	4293	6484	110779092	SO:0001583	missense	8727			AF030233	CCDS6775.1, CCDS69638.1	9q31.2	2008-07-21			ENSG00000119326	ENSG00000119326			2512	protein-coding gene	gene with protein product	"""alpha-catulin"", ""alpha2-catulin"""	604785				9806841	Standard	XM_005252291		Approved	CLLP, alpha-CATU	uc004bdo.1	Q9UBT7	OTTHUMG00000020466	ENST00000325551.4:c.1159A>C	9.37:g.111739271T>G	ENSP00000320434:p.Ser387Arg		110779092	B5BU47|O76084|Q53FQ2|Q5JTQ7|Q5JTQ8|Q9Y401	Missense_Mutation	SNP	ENST00000325551.4	37	CCDS6775.1	.	.	.	.	.	.	.	.	.	.	T	9.974	1.226372	0.22542	.	.	ENSG00000119326	ENST00000374595;ENST00000325551;ENST00000325580	T;T;T	0.38887	1.63;1.77;1.11	5.56	3.12	0.35913	.	0.219043	0.56097	D	0.000032	T	0.35653	0.0939	L	0.40543	1.245	0.27035	N	0.964153	B;P;P;B	0.51351	0.427;0.944;0.698;0.427	B;P;P;B	0.50049	0.327;0.629;0.465;0.327	T	0.13845	-1.0494	10	0.23302	T	0.38	-3.9213	4.413	0.11443	0.1685:0.0992:0.0:0.7323	.	387;387;387;387	B2RBI4;Q9UBT7-3;Q9UBT7-2;Q9UBT7	.;.;.;CTNL1_HUMAN	R	387	ENSP00000363723:S387R;ENSP00000320434:S387R;ENSP00000323351:S387R	ENSP00000320434:S387R	S	-	1	0	CTNNAL1	110779092	1.000000	0.71417	0.996000	0.52242	0.923000	0.55619	2.533000	0.45667	0.351000	0.24027	-0.408000	0.06270	AGT		0.303	CTNNAL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053577.1	NM_003798	
OR1K1	392392	broad.mit.edu	37	9	125562795	125562795	+	Missense_Mutation	SNP	C	C	T	rs552980669		TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chr9:125562795C>T	ENST00000277309.2	+	1	426	c.394C>T	c.(394-396)Ccc>Tcc	p.P132S		NM_080859.1	NP_543135.1	Q8NGR3	OR1K1_HUMAN	olfactory receptor, family 1, subfamily K, member 1	132						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.P132S(1)		endometrium(1)|large_intestine(8)|lung(2)|ovary(1)|skin(4)|stomach(1)	17						GCACCCCCTCCCCTATGCCAC	0.607													C|||	1	0.000199681	0.0	0.0	5008	,	,		21180	0.0		0.0	False		,,,				2504	0.001															1	Substitution - Missense(1)	ovary(1)	9											96.0	65.0	75.0					9																	125562795		2203	4300	6503	124602616	SO:0001583	missense	392392			AL359512	CCDS35132.1	9q33	2013-09-20			ENSG00000165204	ENSG00000165204		"""GPCR / Class A : Olfactory receptors"""	8212	protein-coding gene	gene with protein product							Standard	NM_080859		Approved	hg99, MNAB	uc011lze.2	Q8NGR3	OTTHUMG00000020625	ENST00000277309.2:c.394C>T	9.37:g.125562795C>T	ENSP00000277309:p.Pro132Ser		124602616	B9EH41|Q4VXB7|Q96R23	Missense_Mutation	SNP	ENST00000277309.2	37	CCDS35132.1	.	.	.	.	.	.	.	.	.	.	C	10.62	1.400229	0.25291	.	.	ENSG00000165204	ENST00000277309	T	0.01295	5.04	4.49	1.62	0.23740	GPCR, rhodopsin-like superfamily (1);	0.000000	0.41097	U	0.000953	T	0.00666	0.0022	N	0.01048	-1.04	0.22050	N	0.999393	B	0.02656	0.0	B	0.01281	0.0	T	0.49113	-0.8973	10	0.66056	D	0.02	.	8.8535	0.35214	0.0:0.7446:0.0:0.2554	.	132	Q8NGR3	OR1K1_HUMAN	S	132	ENSP00000277309:P132S	ENSP00000277309:P132S	P	+	1	0	OR1K1	124602616	0.999000	0.42202	0.760000	0.31359	0.189000	0.23516	5.243000	0.65395	0.154000	0.19237	0.563000	0.77884	CCC		0.607	OR1K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053958.1		
WWC3	55841	broad.mit.edu	37	X	10085308	10085308	+	Silent	SNP	C	C	G			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chrX:10085308C>G	ENST00000380861.4	+	11	1600	c.1209C>G	c.(1207-1209)ccC>ccG	p.P403P	WWC3_ENST00000454666.1_Silent_p.P403P	NM_015691.3	NP_056506.2	Q9ULE0	WWC3_HUMAN	WWC family member 3	403	Ser-rich.				negative regulation of hippo signaling (GO:0035331)|negative regulation of organ growth (GO:0046621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	cytosol (GO:0005829)	kinase binding (GO:0019900)|protein complex scaffold (GO:0032947)	p.P403P(1)		NS(1)|breast(3)|endometrium(10)|kidney(1)|large_intestine(11)|lung(17)|ovary(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	52						ACGAGAAGCCCGACGCTGAGG	0.662																																																1	Substitution - coding silent(1)	ovary(1)	X											69.0	68.0	68.0					X																	10085308		2203	4300	6503	10045308	SO:0001819	synonymous_variant	55841			AK091936	CCDS14136.1	Xp22.32	2008-02-05			ENSG00000047644	ENSG00000047644		"""WW, C2 and coiled-coil domain containing"""	29237	protein-coding gene	gene with protein product						10574462	Standard	NM_015691		Approved	KIAA1280, BM042	uc004csx.4	Q9ULE0	OTTHUMG00000021123	ENST00000380861.4:c.1209C>G	X.37:g.10085308C>G			10045308	A8KA96|Q659C1|Q9BTQ1	Silent	SNP	ENST00000380861.4	37	CCDS14136.1																																																																																				0.662	WWC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055725.1	NM_015691	
HDX	139324	broad.mit.edu	37	X	83724007	83724007	+	Missense_Mutation	SNP	T	T	C			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chrX:83724007T>C	ENST00000297977.5	-	3	835	c.724A>G	c.(724-726)Aac>Gac	p.N242D	HDX_ENST00000373177.2_Missense_Mutation_p.N242D|HDX_ENST00000506585.2_Missense_Mutation_p.N184D	NM_001177479.1|NM_144657.4	NP_001170950.1|NP_653258.2	Q7Z353	HDX_HUMAN	highly divergent homeobox	242						nucleus (GO:0005634)	DNA binding (GO:0003677)	p.N242D(1)		breast(1)|endometrium(6)|kidney(2)|large_intestine(12)|liver(1)|lung(19)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	48						CCACATAAGTTATGTAATGCT	0.433																																					Pancreas(53;231 1169 36156 43751 51139)											1	Substitution - Missense(1)	ovary(1)	X											109.0	97.0	101.0					X																	83724007		2203	4300	6503	83610663	SO:0001583	missense	139324			BX538112	CCDS35342.1, CCDS55456.1	Xq21.1	2012-03-09	2007-07-13	2007-07-13	ENSG00000165259	ENSG00000165259		"""Homeoboxes / POU class"""	26411	protein-coding gene	gene with protein product			"""chromosome X open reading frame 43"""	CXorf43			Standard	NM_144657		Approved	FLJ30678	uc004eek.2	Q7Z353	OTTHUMG00000021926	ENST00000297977.5:c.724A>G	X.37:g.83724007T>C	ENSP00000297977:p.Asn242Asp		83610663	A8K1Y5|B7ZL18|Q5JZB4|Q96NK7	Missense_Mutation	SNP	ENST00000297977.5	37	CCDS35342.1	.	.	.	.	.	.	.	.	.	.	T	2.082	-0.410493	0.04799	.	.	ENSG00000165259	ENST00000297977;ENST00000373177;ENST00000506585;ENST00000449553	T;T;T;T	0.44083	1.5;1.49;1.5;0.93	4.92	4.92	0.64577	.	0.522456	0.20989	N	0.082061	T	0.31796	0.0808	L	0.50333	1.59	0.09310	N	0.999992	B	0.26672	0.156	B	0.19666	0.026	T	0.15037	-1.0451	10	0.22706	T	0.39	-22.6686	6.4473	0.21883	0.0:0.1914:0.0:0.8086	.	242	Q7Z353	HDX_HUMAN	D	242;184;242;184	ENSP00000297977:N242D;ENSP00000362272:N184D;ENSP00000423670:N242D;ENSP00000387790:N184D	ENSP00000297977:N242D	N	-	1	0	HDX	83610663	0.993000	0.37304	0.993000	0.49108	0.519000	0.34347	1.528000	0.35985	1.930000	0.55929	0.417000	0.27973	AAC		0.433	HDX-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057379.2	NM_144657	
SLITRK2	84631	broad.mit.edu	37	X	144905479	144905479	+	Missense_Mutation	SNP	A	A	C			TCGA-25-1326-01A-01W-0492-08	TCGA-25-1326-10A-01W-0492-08	A	A	C	C	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	2382465c-8120-4000-8fdb-d3638bc78fd2	a128c90e-8006-4c36-8452-1fcecaf4c7a2	g.chrX:144905479A>C	ENST00000370490.1	+	1	5791	c.1536A>C	c.(1534-1536)aaA>aaC	p.K512N	SLITRK2_ENST00000434188.2_Missense_Mutation_p.K512N|SLITRK2_ENST00000447897.2_Missense_Mutation_p.K512N|SLITRK2_ENST00000428560.2_Missense_Mutation_p.K512N|SLITRK2_ENST00000413937.2_Missense_Mutation_p.K512N			Q9H156	SLIK2_HUMAN	SLIT and NTRK-like family, member 2	512					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)		p.K512N(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(17)|lung(40)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	86	Acute lymphoblastic leukemia(192;6.56e-05)					TGCCCGTGAAAGGGGTTCTGG	0.507																																																1	Substitution - Missense(1)	ovary(1)	X											73.0	77.0	76.0					X																	144905479		2203	4300	6503	144713171	SO:0001583	missense	84631			Y19205	CCDS14680.1	Xq27.3	2008-02-05	2004-03-11		ENSG00000185985	ENSG00000185985			13449	protein-coding gene	gene with protein product		300561	"""slit-like 1 (Drosophila)"""	SLITL1		11347906, 14557068	Standard	NM_032539		Approved	KIAA1854, CXorf2	uc011mwr.2	Q9H156	OTTHUMG00000022595	ENST00000370490.1:c.1536A>C	X.37:g.144905479A>C	ENSP00000359521:p.Lys512Asn		144713171	A8K117|Q2KHN3|Q5JXB1|Q8NBC7|Q96JH3	Missense_Mutation	SNP	ENST00000370490.1	37	CCDS14680.1	.	.	.	.	.	.	.	.	.	.	A	8.929	0.963031	0.18583	.	.	ENSG00000185985	ENST00000335565;ENST00000447897;ENST00000370490;ENST00000434188;ENST00000413937;ENST00000428560	T;T;T;T;T;T	0.51071	0.76;0.72;0.72;0.72;0.72;0.72	5.84	3.45	0.39498	.	0.243657	0.38326	N	0.001722	T	0.29491	0.0735	N	0.12527	0.23	0.36928	D	0.89176	B	0.20164	0.042	B	0.29942	0.109	T	0.13602	-1.0503	10	0.51188	T	0.08	-9.5006	6.7505	0.23485	0.7289:0.0:0.2711:0.0	.	512	Q9H156	SLIK2_HUMAN	N	512	ENSP00000334374:K512N;ENSP00000411681:K512N;ENSP00000359521:K512N;ENSP00000397015:K512N;ENSP00000407347:K512N;ENSP00000412010:K512N	ENSP00000334374:K512N	K	+	3	2	SLITRK2	144713171	0.998000	0.40836	1.000000	0.80357	0.541000	0.35023	0.680000	0.25306	0.313000	0.23062	0.486000	0.48141	AAA		0.507	SLITRK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058633.1	NM_032539	
