#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
TNFRSF9	3604	broad.mit.edu	37	1	8000029	8000029	+	Missense_Mutation	SNP	A	A	T			TCGA-25-2398-01A-01W-0799-08	TCGA-25-2398-10A-01W-0799-08	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	b4b3281b-5dfc-434d-a9a6-2c2d94123220	ba4008d0-ef83-4cba-af98-742284b48779	g.chr1:8000029A>T	ENST00000377507.3	-	2	192	c.26T>A	c.(25-27)gTa>gAa	p.V9E		NM_001561.5	NP_001552.2	Q07011	TNR9_HUMAN	tumor necrosis factor receptor superfamily, member 9	9					apoptotic process (GO:0006915)|negative regulation of cell proliferation (GO:0008285)	integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)	p.V9E(1)		NS(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	19	Ovarian(185;0.0634)|all_lung(157;0.151)	all_epithelial(116;9.63e-21)|all_lung(118;1.29e-06)|Lung NSC(185;7.5e-06)|Renal(390;0.000147)|Breast(348;0.000625)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;2.93e-71)|GBM - Glioblastoma multiforme(8;3.72e-37)|Colorectal(212;7e-08)|COAD - Colon adenocarcinoma(227;7.71e-06)|Kidney(185;5.33e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000419)|KIRC - Kidney renal clear cell carcinoma(229;0.000979)|STAD - Stomach adenocarcinoma(132;0.00103)|READ - Rectum adenocarcinoma(331;0.0649)		CAGAGTGGCTACTATGTTGTA	0.428																																																1	Substitution - Missense(1)	ovary(1)	1											118.0	104.0	109.0					1																	8000029		2203	4300	6503	7922616	SO:0001583	missense	3604			L12964	CCDS92.1	1p36	2008-02-05			ENSG00000049249	ENSG00000049249		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11924	protein-coding gene	gene with protein product		602250		ILA		8262389, 8639902	Standard	NM_001561		Approved	CD137, 4-1BB	uc001aot.3	Q07011	OTTHUMG00000001223	ENST00000377507.3:c.26T>A	1.37:g.8000029A>T	ENSP00000366729:p.Val9Glu		7922616		Missense_Mutation	SNP	ENST00000377507.3	37	CCDS92.1	.	.	.	.	.	.	.	.	.	.	A	11.84	1.759146	0.31137	.	.	ENSG00000049249	ENST00000377507	T	0.08193	3.12	4.43	3.21	0.36854	.	0.193215	0.33670	N	0.004673	T	0.05823	0.0152	L	0.34521	1.04	0.09310	N	1	B	0.32203	0.36	B	0.27796	0.083	T	0.29640	-1.0005	10	0.45353	T	0.12	-12.3035	6.7621	0.23546	0.7914:0.0:0.0:0.2086	.	9	Q07011	TNR9_HUMAN	E	9	ENSP00000366729:V9E	ENSP00000366729:V9E	V	-	2	0	TNFRSF9	7922616	0.037000	0.19845	0.059000	0.19551	0.005000	0.04900	1.611000	0.36879	1.974000	0.57490	0.460000	0.39030	GTA		0.428	TNFRSF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000003622.1		
YBX1	4904	broad.mit.edu	37	1	43149119	43149119	+	Missense_Mutation	SNP	G	G	T			TCGA-25-2398-01A-01W-0799-08	TCGA-25-2398-10A-01W-0799-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	b4b3281b-5dfc-434d-a9a6-2c2d94123220	ba4008d0-ef83-4cba-af98-742284b48779	g.chr1:43149119G>T	ENST00000321358.7	+	2	351	c.212G>T	c.(211-213)gGa>gTa	p.G71V	YBX1_ENST00000467957.1_3'UTR|RP5-994D16.3_ENST00000414339.1_lincRNA	NM_004559.3	NP_004550.2	P67809	YBOX1_HUMAN	Y box binding protein 1	71	CSD.|Interaction with ss-DNA.				CRD-mediated mRNA stabilization (GO:0070934)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of striated muscle cell differentiation (GO:0051154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell division (GO:0051781)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription from RNA polymerase II promoter (GO:0006366)	CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|extracellular vesicular exosome (GO:0070062)|histone pre-mRNA 3'end processing complex (GO:0071204)|intracellular membrane-bounded organelle (GO:0043231)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|U12-type spliceosomal complex (GO:0005689)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)	p.G71V(1)		large_intestine(2)|lung(4)|ovary(4)|prostate(4)|upper_aerodigestive_tract(2)	16	Ovarian(52;0.00744)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				GTAAGGAACGGATATGGTTTC	0.488																																																1	Substitution - Missense(1)	ovary(1)	1											119.0	118.0	118.0					1																	43149119		2203	4300	6503	42921706	SO:0001583	missense	4904			BC013838	CCDS470.1	1p34	2008-02-05	2005-08-11	2005-08-11	ENSG00000065978	ENSG00000065978			8014	protein-coding gene	gene with protein product		154030	"""nuclease sensitive element binding protein 1"""	NSEP1		1891370, 3174636	Standard	NM_004559		Approved	YB-1, YB1, DBPB, NSEP-1, MDR-NF1, BP-8, CSDB, CSDA2	uc001chs.3	P67809	OTTHUMG00000007523	ENST00000321358.7:c.212G>T	1.37:g.43149119G>T	ENSP00000361626:p.Gly71Val		42921706	P16990|P16991|Q14972|Q15325|Q5FVF0	Missense_Mutation	SNP	ENST00000321358.7	37	CCDS470.1	.	.	.	.	.	.	.	.	.	.	G	15.79	2.938041	0.52972	.	.	ENSG00000065978	ENST00000321358;ENST00000332220;ENST00000318612	T;T	0.70869	-0.52;-0.01	4.84	3.91	0.45181	Cold shock protein (1);Nucleic acid-binding, OB-fold-like (1);Cold-shock protein, DNA-binding (2);Nucleic acid-binding, OB-fold (1);	0.098719	0.64402	D	0.000001	D	0.84911	0.5577	H	0.97186	3.955	0.80722	D	1	D	0.63046	0.992	P	0.57502	0.822	D	0.86032	0.1514	10	0.87932	D	0	.	7.0001	0.24805	0.0943:0.1779:0.7278:0.0	.	71	P67809	YBOX1_HUMAN	V	71;71;67	ENSP00000361626:G71V;ENSP00000405937:G71V	ENSP00000361621:G67V	G	+	2	0	YBX1	42921706	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.977000	0.76141	1.120000	0.41904	0.655000	0.94253	GGA		0.488	YBX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019786.2	NM_004559	
NPR1	4881	broad.mit.edu	37	1	153659765	153659765	+	Silent	SNP	G	G	A			TCGA-25-2398-01A-01W-0799-08	TCGA-25-2398-10A-01W-0799-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	b4b3281b-5dfc-434d-a9a6-2c2d94123220	ba4008d0-ef83-4cba-af98-742284b48779	g.chr1:153659765G>A	ENST00000368680.3	+	13	2497	c.2025G>A	c.(2023-2025)aaG>aaA	p.K675K		NM_000906.3	NP_000897.3	P16066	ANPRA_HUMAN	natriuretic peptide receptor 1	675	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				body fluid secretion (GO:0007589)|cell surface receptor signaling pathway (GO:0007166)|cGMP biosynthetic process (GO:0006182)|dopamine metabolic process (GO:0042417)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell growth (GO:0030308)|negative regulation of smooth muscle cell proliferation (GO:0048662)|positive regulation of cGMP biosynthetic process (GO:0030828)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of urine volume (GO:0035810)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of blood pressure (GO:0008217)|regulation of blood vessel size (GO:0050880)|regulation of vascular permeability (GO:0043114)|regulation of vasodilation (GO:0042312)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|G-protein coupled peptide receptor activity (GO:0008528)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)|protein kinase activity (GO:0004672)	p.K675K(1)		NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|liver(1)|lung(17)|ovary(4)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	42	all_lung(78;3.75e-32)|Lung NSC(65;1.37e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)		Amyl Nitrite(DB01612)|Erythrityl Tetranitrate(DB01613)|Isosorbide Dinitrate(DB00883)|Nesiritide(DB04899)|Nitroglycerin(DB00727)|Nitroprusside(DB00325)	TTGTGCTCAAGATCACCGACT	0.537																																					Pancreas(141;1349 1870 15144 15830 40702)											1	Substitution - coding silent(1)	ovary(1)	1											135.0	110.0	119.0					1																	153659765		2203	4300	6503	151926389	SO:0001819	synonymous_variant	4881			BC063304	CCDS1051.1	1q21-q22	2014-03-03	2014-03-03		ENSG00000169418	ENSG00000169418			7943	protein-coding gene	gene with protein product	"""guanylate cyclase A"""	108960	"""atrionatriuretic peptide receptor A"", ""natriuretic peptide receptor A"""	ANPRA, NPRA		1979052	Standard	NM_000906		Approved	GUCY2A, ANPa	uc001fcs.4	P16066	OTTHUMG00000037085	ENST00000368680.3:c.2025G>A	1.37:g.153659765G>A			151926389	B0ZBF0|Q5SR08|Q6P4Q3	Silent	SNP	ENST00000368680.3	37	CCDS1051.1																																																																																				0.537	NPR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090034.1	NM_000906	
PFKP	5214	broad.mit.edu	37	10	3174604	3174604	+	Missense_Mutation	SNP	G	G	C	rs377741118		TCGA-25-2398-01A-01W-0799-08	TCGA-25-2398-10A-01W-0799-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	b4b3281b-5dfc-434d-a9a6-2c2d94123220	ba4008d0-ef83-4cba-af98-742284b48779	g.chr10:3174604G>C	ENST00000381125.4	+	18	1957	c.1881G>C	c.(1879-1881)aaG>aaC	p.K627N	PFKP_ENST00000381075.2_Missense_Mutation_p.K619N|PFKP_ENST00000381072.1_Missense_Mutation_p.K45N	NM_002627.4	NP_002618.1	Q01813	PFKAP_HUMAN	phosphofructokinase, platelet	627	C-terminal regulatory PFK domain 2.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose 6-phosphate metabolic process (GO:0006002)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	6-phosphofructokinase activity (GO:0003872)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein complex binding (GO:0032403)	p.K627N(1)		breast(2)|central_nervous_system(4)|endometrium(3)|large_intestine(3)|lung(10)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	31				GBM - Glioblastoma multiforme(1;0.000975)|all cancers(11;0.00351)|Epithelial(11;0.142)		AGAAAATGAAGACCACCATCC	0.493																																																1	Substitution - Missense(1)	ovary(1)	10											131.0	130.0	130.0					10																	3174604		2203	4300	6503	3164604	SO:0001583	missense	5214			AK092597	CCDS7059.1, CCDS55698.1	10p15.3-p15.2	2006-08-25			ENSG00000067057	ENSG00000067057	2.7.1.11		8878	protein-coding gene	gene with protein product	"""Phosphofructokinase, platelet type"""	171840					Standard	NM_002627		Approved	PFK-C, PFKF	uc001igp.3	Q01813	OTTHUMG00000017556	ENST00000381125.4:c.1881G>C	10.37:g.3174604G>C	ENSP00000370517:p.Lys627Asn		3164604	B3KS15|Q5VSR7|Q5VSR8	Missense_Mutation	SNP	ENST00000381125.4	37	CCDS7059.1	.	.	.	.	.	.	.	.	.	.	g	28.4	4.914291	0.92178	.	.	ENSG00000067057	ENST00000381125;ENST00000397834;ENST00000381075;ENST00000381072	T;T;T	0.80566	-1.39;-1.39;-1.39	5.19	5.19	0.71726	Phosphofructokinase domain (2);	0.098655	0.64402	D	0.000002	D	0.89525	0.6740	M	0.77103	2.36	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.989;0.989;1.0	D	0.90345	0.4362	10	0.59425	D	0.04	.	16.2224	0.82265	0.0:0.0:1.0:0.0	.	619;619;627	B3KS15;Q5VSR7;Q01813	.;.;K6PP_HUMAN	N	627;616;619;45	ENSP00000370517:K627N;ENSP00000370465:K619N;ENSP00000370462:K45N	ENSP00000370462:K45N	K	+	3	2	PFKP	3164604	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	2.007000	0.40883	2.422000	0.82143	0.655000	0.94253	AAG		0.493	PFKP-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046454.1	NM_002627	
PSD	5662	broad.mit.edu	37	10	104176300	104176300	+	Missense_Mutation	SNP	C	C	T			TCGA-25-2398-01A-01W-0799-08	TCGA-25-2398-10A-01W-0799-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	b4b3281b-5dfc-434d-a9a6-2c2d94123220	ba4008d0-ef83-4cba-af98-742284b48779	g.chr10:104176300C>T	ENST00000020673.5	-	2	1022	c.496G>A	c.(496-498)Gcc>Acc	p.A166T	PSD_ENST00000406432.1_Missense_Mutation_p.A166T|PSD_ENST00000492902.2_5'Flank	NM_001270966.1|NM_002779.4	NP_001257895.1|NP_002770.3	A5PKW4	PSD1_HUMAN	pleckstrin and Sec7 domain containing	166	Pro-rich.				neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)|signal transducer activity (GO:0004871)	p.A166T(1)		breast(4)|endometrium(2)|large_intestine(5)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	34				Epithelial(162;1.27e-08)|all cancers(201;2.85e-07)		CCAGGTAGGGCCGAGCCTCCT	0.667																																																1	Substitution - Missense(1)	ovary(1)	10											20.0	23.0	22.0					10																	104176300		2202	4298	6500	104166290	SO:0001583	missense	5662			X99688	CCDS31272.1, CCDS73187.1	10q24	2013-01-10	2004-04-28		ENSG00000059915	ENSG00000059915		"""Pleckstrin homology (PH) domain containing"""	9507	protein-coding gene	gene with protein product		602327	"""pleckstrin and Sec7 domain protein"""			9417912	Standard	NM_002779		Approved	KIAA2011, TYL, PSD1	uc009xxd.2	A5PKW4	OTTHUMG00000018954	ENST00000020673.5:c.496G>A	10.37:g.104176300C>T	ENSP00000020673:p.Ala166Thr		104166290	B1AKX7|D3DR87|Q15673|Q8IVG0	Missense_Mutation	SNP	ENST00000020673.5	37	CCDS31272.1	.	.	.	.	.	.	.	.	.	.	C	5.980	0.364821	0.11296	.	.	ENSG00000059915	ENST00000020673;ENST00000541902;ENST00000406432	T;T	0.19806	2.12;2.12	4.74	1.92	0.25849	.	0.569721	0.15821	N	0.243002	T	0.08802	0.0218	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.39820	-0.9595	10	0.12430	T	0.62	.	7.7667	0.28984	0.0:0.7378:0.0:0.2622	.	166	A5PKW4	PSD1_HUMAN	T	166;69;166	ENSP00000020673:A166T;ENSP00000384830:A166T	ENSP00000020673:A166T	A	-	1	0	PSD	104166290	0.004000	0.15560	0.029000	0.17559	0.086000	0.17979	0.892000	0.28322	0.246000	0.21394	-0.254000	0.11334	GCC		0.667	PSD-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050041.2		
OR6A2	8590	broad.mit.edu	37	11	6816144	6816144	+	Missense_Mutation	SNP	G	G	A	rs373299055		TCGA-25-2398-01A-01W-0799-08	TCGA-25-2398-10A-01W-0799-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	b4b3281b-5dfc-434d-a9a6-2c2d94123220	ba4008d0-ef83-4cba-af98-742284b48779	g.chr11:6816144G>A	ENST00000332601.3	-	1	984	c.796C>T	c.(796-798)Cgg>Tgg	p.R266W		NM_003696.2	NP_003687.2	O95222	OR6A2_HUMAN	olfactory receptor, family 6, subfamily A, member 2	266					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R266W(1)		breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(4)|pancreas(1)|skin(1)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)	29		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.78e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		GCCTTTGGCCGAGCATAGATG	0.473																																																1	Substitution - Missense(1)	ovary(1)	11						G	TRP/ARG	0,4402		0,0,2201	108.0	102.0	104.0		796	1.8	1.0	11		104	1,8591	1.2+/-3.3	0,1,4295	no	missense	OR6A2	NM_003696.2	101	0,1,6496	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	266/328	6816144	1,12993	2201	4296	6497	6772720	SO:0001583	missense	8590			AB065822	CCDS7772.1	11p15.4	2012-08-09		2004-03-10	ENSG00000184933	ENSG00000184933		"""GPCR / Class A : Olfactory receptors"""	15301	protein-coding gene	gene with protein product		608495		OR6A2P, OR6A1			Standard	NM_003696		Approved	OR11-55	uc001mes.1	O95222	OTTHUMG00000165736	ENST00000332601.3:c.796C>T	11.37:g.6816144G>A	ENSP00000330384:p.Arg266Trp		6772720	Q3MJC7|Q6IF35|Q9H206	Missense_Mutation	SNP	ENST00000332601.3	37	CCDS7772.1	.	.	.	.	.	.	.	.	.	.	G	17.12	3.308845	0.60305	0.0	1.16E-4	ENSG00000184933	ENST00000332601	T	0.37915	1.17	4.97	1.82	0.25136	GPCR, rhodopsin-like superfamily (1);	0.000000	0.51477	D	0.000092	T	0.57140	0.2033	M	0.76838	2.35	0.31840	N	0.623583	D	0.89917	1.0	D	0.97110	1.0	T	0.65298	-0.6202	10	0.87932	D	0	.	10.7903	0.46429	0.0:0.0:0.4465:0.5535	.	266	O95222	OR6A2_HUMAN	W	266	ENSP00000330384:R266W	ENSP00000330384:R266W	R	-	1	2	OR6A2	6772720	0.000000	0.05858	0.963000	0.40424	0.731000	0.41821	0.153000	0.16323	0.280000	0.22209	0.655000	0.94253	CGG		0.473	OR6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385981.1	NM_003696	
A2ML1	144568	broad.mit.edu	37	12	8990997	8990997	+	Silent	SNP	G	G	A	rs372520121		TCGA-25-2398-01A-01W-0799-08	TCGA-25-2398-10A-01W-0799-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	b4b3281b-5dfc-434d-a9a6-2c2d94123220	ba4008d0-ef83-4cba-af98-742284b48779	g.chr12:8990997G>A	ENST00000299698.7	+	9	1101	c.921G>A	c.(919-921)gcG>gcA	p.A307A		NM_001282424.1|NM_144670.4	NP_001269353.1|NP_653271			alpha-2-macroglobulin-like 1									p.A307A(1)		NS(2)|breast(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(2)|lung(36)|ovary(2)|skin(4)|stomach(1)|urinary_tract(1)	80						TTGGATATGCGTACAGCCATC	0.463																																																1	Substitution - coding silent(1)	ovary(1)	12						G		1,3921		0,1,1960	160.0	152.0	155.0		921	-2.4	0.0	12		155	0,8302		0,0,4151	no	coding-synonymous	A2ML1	NM_144670.3		0,1,6111	AA,AG,GG		0.0,0.0255,0.0082		307/1455	8990997	1,12223	1961	4151	6112	8882264	SO:0001819	synonymous_variant	144568			AK057908	CCDS8596.2, CCDS73439.1	12p13	2010-12-14	2005-09-01	2005-09-01	ENSG00000166535	ENSG00000166535			23336	protein-coding gene	gene with protein product		610627	"""C3 and PZP-like, alpha-2-macroglobulin domain containing 9"""	CPAMD9		16298998	Standard	NM_144670		Approved	FLJ25179	uc001quz.5	A8K2U0	OTTHUMG00000128499	ENST00000299698.7:c.921G>A	12.37:g.8990997G>A			8882264		Silent	SNP	ENST00000299698.7	37	CCDS8596.2																																																																																				0.463	A2ML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250304.3	NM_144670	
PDE1B	5153	broad.mit.edu	37	12	54970410	54970410	+	Missense_Mutation	SNP	G	G	A			TCGA-25-2398-01A-01W-0799-08	TCGA-25-2398-10A-01W-0799-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	b4b3281b-5dfc-434d-a9a6-2c2d94123220	ba4008d0-ef83-4cba-af98-742284b48779	g.chr12:54970410G>A	ENST00000243052.3	+	14	1868	c.1432G>A	c.(1432-1434)Gtg>Atg	p.V478M	PDE1B_ENST00000550620.1_Missense_Mutation_p.V458M|PDE1B_ENST00000538346.1_Missense_Mutation_p.V437M|PDE1B_ENST00000394277.3_3'UTR|PPP1R1A_ENST00000547431.1_3'UTR	NM_000924.3	NP_000915.1	Q01064	PDE1B_HUMAN	phosphodiesterase 1B, calmodulin-dependent	478	Catalytic. {ECO:0000250}.				activation of phospholipase C activity (GO:0007202)|apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cGMP catabolic process (GO:0046069)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|locomotory behavior (GO:0007626)|monocyte differentiation (GO:0030224)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of dopamine metabolic process (GO:0042053)|regulation of neurotransmitter levels (GO:0001505)|response to amphetamine (GO:0001975)|serotonin metabolic process (GO:0042428)|signal transduction (GO:0007165)|visual learning (GO:0008542)	cytosol (GO:0005829)|neuronal cell body (GO:0043025)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|calcium- and calmodulin-regulated 3',5'-cyclic-GMP phosphodiesterase activity (GO:0048101)|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity (GO:0004117)|metal ion binding (GO:0046872)	p.V478M(2)		endometrium(1)|kidney(3)|large_intestine(4)|lung(16)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(4)	31					Bepridil(DB01244)|Caffeine(DB00201)|Felodipine(DB01023)|Nicardipine(DB00622)	CAACCCTGATGTGGTCAGCTT	0.582																																																2	Substitution - Missense(2)	ovary(1)|kidney(1)	12											79.0	66.0	71.0					12																	54970410		2203	4300	6503	53256677	SO:0001583	missense	5153			U56976	CCDS8882.1, CCDS53800.1, CCDS73477.1	12q13	2008-03-18				ENSG00000123360	3.1.4.17	"""Phosphodiesterases"""	8775	protein-coding gene	gene with protein product		171891		PDES1B		8855339, 9419816	Standard	NM_000924		Approved		uc001sgd.2	Q01064	OTTHUMG00000169844	ENST00000243052.3:c.1432G>A	12.37:g.54970410G>A	ENSP00000243052:p.Val478Met		53256677	Q92825|Q96KP3	Missense_Mutation	SNP	ENST00000243052.3	37	CCDS8882.1	.	.	.	.	.	.	.	.	.	.	G	14.70	2.613025	0.46631	.	.	ENSG00000123360	ENST00000243052;ENST00000538346;ENST00000550620	T;T;T	0.69561	-0.41;-0.4;-0.4	4.86	2.91	0.33838	.	0.000000	0.38897	N	0.001527	T	0.38852	0.1056	N	0.08118	0	0.80722	D	1	B;B	0.16166	0.016;0.004	B;B	0.13407	0.009;0.004	T	0.32052	-0.9921	10	0.35671	T	0.21	.	4.1359	0.10170	0.1921:0.2062:0.6017:0.0	.	458;478	Q01064-2;Q01064	.;PDE1B_HUMAN	M	478;437;458	ENSP00000243052:V478M;ENSP00000442559:V437M;ENSP00000448519:V458M	ENSP00000243052:V478M	V	+	1	0	PDE1B	53256677	0.989000	0.36119	0.997000	0.53966	0.915000	0.54546	2.222000	0.42926	2.403000	0.81681	0.561000	0.74099	GTG		0.582	PDE1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406203.1		
TIMELESS	8914	broad.mit.edu	37	12	56817082	56817082	+	Silent	SNP	A	A	G			TCGA-25-2398-01A-01W-0799-08	TCGA-25-2398-10A-01W-0799-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	b4b3281b-5dfc-434d-a9a6-2c2d94123220	ba4008d0-ef83-4cba-af98-742284b48779	g.chr12:56817082A>G	ENST00000553532.1	-	18	2418	c.2268T>C	c.(2266-2268)agT>agC	p.S756S	TIMELESS_ENST00000229201.4_Silent_p.S755S|TIMELESS_ENST00000554616.1_Intron					timeless circadian clock									p.S756S(1)		NS(1)|breast(2)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(8)|lung(14)|ovary(7)|pancreas(2)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	49						CAGCAGGGTCACTAAGCAGAC	0.483																																																1	Substitution - coding silent(1)	ovary(1)	12											103.0	104.0	104.0					12																	56817082		2203	4300	6503	55103349	SO:0001819	synonymous_variant	8914			AF098162	CCDS8918.1	12q13.3	2012-12-14	2012-12-14		ENSG00000111602	ENSG00000111602			11813	protein-coding gene	gene with protein product	"""Tof1 homolog (S. cerevisiae)"", ""timeless circadian clock 1"""	603887	"""timeless (Drosophila) homolog"", ""timeless homolog (Drosophila)"""			9856465	Standard	NM_003920		Approved	hTIM, TIM, TIM1	uc001slf.2	Q9UNS1	OTTHUMG00000170600	ENST00000553532.1:c.2268T>C	12.37:g.56817082A>G			55103349		Silent	SNP	ENST00000553532.1	37	CCDS8918.1																																																																																				0.483	TIMELESS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000409771.1	NM_003920	
MTIF3	219402	broad.mit.edu	37	13	28011388	28011388	+	Silent	SNP	C	C	A	rs138161348		TCGA-25-2398-01A-01W-0799-08	TCGA-25-2398-10A-01W-0799-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	b4b3281b-5dfc-434d-a9a6-2c2d94123220	ba4008d0-ef83-4cba-af98-742284b48779	g.chr13:28011388C>A	ENST00000381116.1	-	6	717	c.483G>T	c.(481-483)ctG>ctT	p.L161L	MTIF3_ENST00000381120.3_Silent_p.L161L|MTIF3_ENST00000431572.2_Silent_p.L161L|MTIF3_ENST00000461838.1_5'UTR|MTIF3_ENST00000405591.2_Silent_p.L161L			Q9H2K0	IF3M_HUMAN	mitochondrial translational initiation factor 3	161					formation of translation initiation complex (GO:0001732)|regulation of translational initiation (GO:0006446)|ribosome disassembly (GO:0032790)	mitochondrion (GO:0005739)	ribosomal small subunit binding (GO:0043024)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)	p.L161L(1)		endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	7		Lung SC(185;0.0161)	Colorectal(13;0.00042)|READ - Rectum adenocarcinoma(15;0.105)	all cancers(112;0.108)|OV - Ovarian serous cystadenocarcinoma(117;0.157)		AAGACAAAATCAGTTCCTTTC	0.408																																																1	Substitution - coding silent(1)	ovary(1)	13						C	,,,	1,4405	2.1+/-5.4	0,1,2202	101.0	92.0	95.0		483,483,483,483	-11.7	0.0	13	dbSNP_134	95	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	MTIF3	NM_001166261.1,NM_001166262.1,NM_001166263.1,NM_152912.4	,,,	0,1,6502	AA,AC,CC		0.0,0.0227,0.0077	,,,	161/279,161/279,161/279,161/279	28011388	1,13005	2203	4300	6503	26909388	SO:0001819	synonymous_variant	219402			BC046166	CCDS9322.1	13q12.2	2007-05-03			ENSG00000122033	ENSG00000122033			29788	protein-coding gene	gene with protein product						12095986	Standard	NM_152912		Approved	IF-3mt, IF3(mt)	uc001uri.3	Q9H2K0	OTTHUMG00000016633	ENST00000381116.1:c.483G>T	13.37:g.28011388C>A			26909388	Q05BL8|Q5W0V0|Q86X68	Silent	SNP	ENST00000381116.1	37	CCDS9322.1																																																																																				0.408	MTIF3-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044300.1	NM_152912	
SYNE2	23224	broad.mit.edu	37	14	64689908	64689908	+	Splice_Site	SNP	A	A	C			TCGA-25-2398-01A-01W-0799-08	TCGA-25-2398-10A-01W-0799-08	A	A	C	C	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	b4b3281b-5dfc-434d-a9a6-2c2d94123220	ba4008d0-ef83-4cba-af98-742284b48779	g.chr14:64689908A>C	ENST00000344113.4	+	112	20335	c.20123A>C	c.(20122-20124)cAa>cCa	p.Q6708P	SYNE2_ENST00000554584.1_Splice_Site_p.Q6624P|SYNE2_ENST00000555002.1_Splice_Site_p.Q3365P|SYNE2_ENST00000441438.2_Splice_Site_p.Q253P|SYNE2_ENST00000358025.3_Splice_Site_p.Q6731P|SYNE2_ENST00000555022.1_Splice_Site_p.Q586P|SYNE2_ENST00000458046.2_Splice_Site_p.Q379P|SYNE2_ENST00000554805.1_Splice_Site_p.Q491P|ESR2_ENST00000542956.1_Intron|SYNE2_ENST00000357395.3_Splice_Site_p.Q3093P|SYNE2_ENST00000394768.2_Splice_Site_p.Q3093P	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	6708					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)	p.Q6731P(1)		NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		TGTTTTCAGCAACTGGAAAAG	0.428																																																1	Substitution - Missense(1)	ovary(1)	14											76.0	77.0	77.0					14																	64689908		2203	4300	6503	63759661	SO:0001630	splice_region_variant	23224			AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.20122-1A>C	14.37:g.64689908A>C			63759661	Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	ENST00000344113.4	37	CCDS41963.1	.	.	.	.	.	.	.	.	.	.	A	12.62	1.993076	0.35131	.	.	ENSG00000054654	ENST00000358025;ENST00000357395;ENST00000344113;ENST00000554584;ENST00000261678;ENST00000555002;ENST00000394768;ENST00000555022;ENST00000554805;ENST00000458046;ENST00000441438	T;T;T;T;T;T;T;T;T;T	0.35048	1.33;1.33;1.33;1.33;1.33;1.33;1.33;1.33;1.33;1.33	5.53	4.35	0.52113	.	0.000000	0.45606	D	0.000344	T	0.58495	0.2126	M	0.81112	2.525	0.80722	D	1	D;D;D;D;P;D;D;D	0.60160	0.978;0.982;0.987;0.987;0.943;0.98;0.969;0.98	P;D;P;P;P;P;P;P	0.64506	0.719;0.926;0.854;0.854;0.71;0.777;0.703;0.804	T	0.62695	-0.6800	10	0.87932	D	0	.	11.6907	0.51514	0.9296:0.0:0.0704:0.0	.	365;3093;253;379;1110;6624;6708;6731	B4DND7;Q8WXH0-7;Q8WXH0-6;Q8WXH0-5;Q7Z362;G3V5X4;Q8WXH0;Q8WXH0-2	.;.;.;.;.;.;SYNE2_HUMAN;.	P	6731;3093;6708;6624;6630;3365;3093;586;491;379;253	ENSP00000350719:Q6731P;ENSP00000349969:Q3093P;ENSP00000341781:Q6708P;ENSP00000452570:Q6624P;ENSP00000450831:Q3365P;ENSP00000378249:Q3093P;ENSP00000451009:Q586P;ENSP00000450605:Q491P;ENSP00000391937:Q379P;ENSP00000396794:Q253P	ENSP00000261678:Q6630P	Q	+	2	0	SYNE2	63759661	1.000000	0.71417	1.000000	0.80357	0.789000	0.44602	3.851000	0.55926	0.875000	0.35847	0.533000	0.62120	CAA		0.428	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276994.2	NM_182914	Missense_Mutation
OCA2	4948	broad.mit.edu	37	15	28228549	28228549	+	Missense_Mutation	SNP	G	G	C			TCGA-25-2398-01A-01W-0799-08	TCGA-25-2398-10A-01W-0799-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	b4b3281b-5dfc-434d-a9a6-2c2d94123220	ba4008d0-ef83-4cba-af98-742284b48779	g.chr15:28228549G>C	ENST00000354638.3	-	14	1600	c.1445C>G	c.(1444-1446)aCt>aGt	p.T482S	OCA2_ENST00000382996.2_Missense_Mutation_p.T482S|OCA2_ENST00000353809.5_Missense_Mutation_p.T458S	NM_000275.2	NP_000266.2	Q04671	P_HUMAN	oculocutaneous albinism II	482					cell proliferation (GO:0008283)|eye pigment biosynthetic process (GO:0006726)|melanin biosynthetic process (GO:0042438)|melanocyte differentiation (GO:0030318)|spermatid development (GO:0007286)|tyrosine transport (GO:0015828)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|melanosome membrane (GO:0033162)	L-tyrosine transmembrane transporter activity (GO:0005302)|transporter activity (GO:0005215)	p.T482S(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|lung(48)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	85		all_lung(180;2.93e-12)|Breast(32;0.000315)|Colorectal(260;0.234)		all cancers(64;5.03e-07)|Epithelial(43;2.13e-06)|BRCA - Breast invasive adenocarcinoma(123;0.045)		CCCGATGGCAGTGGCAGCTCC	0.483									Oculocutaneous Albinism																																							1	Substitution - Missense(1)	ovary(1)	15											147.0	120.0	129.0					15																	28228549		2203	4300	6503	25902144	SO:0001583	missense	4948	Familial Cancer Database			CCDS10020.1, CCDS73701.1	15q12	2013-01-08	2008-01-30		ENSG00000104044	ENSG00000104044			8101	protein-coding gene	gene with protein product	"""melanocyte-specific transporter protein"""	611409	"""oculocutaneous albinism II (pink-eye dilution (murine) homolog)"", ""eye color 3 (brown)"", ""eye color 2 (central brown)"", ""oculocutaneous albinism II (pink-eye dilution homolog, mouse)"""	D15S12, P, EYCL3, EYCL2			Standard	NM_000275		Approved	BEY2, EYCL, BEY, BEY1	uc001zbh.4	Q04671	OTTHUMG00000128871	ENST00000354638.3:c.1445C>G	15.37:g.28228549G>C	ENSP00000346659:p.Thr482Ser		25902144	Q15211|Q15212|Q96EN1|Q9UMI5	Missense_Mutation	SNP	ENST00000354638.3	37	CCDS10020.1	.	.	.	.	.	.	.	.	.	.	G	25.9	4.682744	0.88542	.	.	ENSG00000104044	ENST00000354638;ENST00000353809;ENST00000382996	D;D;D	0.91792	-2.91;-2.91;-2.91	5.33	5.33	0.75918	Divalent ion symporter (1);	0.000000	0.85682	D	0.000000	D	0.97306	0.9119	H	0.94264	3.515	0.50467	D	0.999874	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.986	D	0.98352	1.0544	10	0.87932	D	0	-18.2996	18.0075	0.89213	0.0:0.0:1.0:0.0	.	458;482	Q04671-2;Q04671	.;P_HUMAN	S	482;458;482	ENSP00000346659:T482S;ENSP00000261276:T458S;ENSP00000372457:T482S	ENSP00000261276:T458S	T	-	2	0	OCA2	25902144	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	8.987000	0.93497	2.493000	0.84123	0.655000	0.94253	ACT		0.483	OCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250823.1	NM_000275	
INO80	54617	broad.mit.edu	37	15	41276060	41276060	+	Silent	SNP	G	G	A			TCGA-25-2398-01A-01W-0799-08	TCGA-25-2398-10A-01W-0799-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	b4b3281b-5dfc-434d-a9a6-2c2d94123220	ba4008d0-ef83-4cba-af98-742284b48779	g.chr15:41276060G>A	ENST00000361937.3	-	34	4561	c.4137C>T	c.(4135-4137)gaC>gaT	p.D1379D	INO80_ENST00000401393.3_Silent_p.D1379D|INO80_ENST00000561244.1_5'Flank			Q9ULG1	INO80_HUMAN	INO80 complex subunit	1379	Assembles INO80 complex module consisting of conserved components INO80B, INO80C, ACTR5, RVBL1, RVBL2.				ATP catabolic process (GO:0006200)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|chromatin remodeling (GO:0006338)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|mitotic sister chromatid segregation (GO:0000070)|positive regulation of cell growth (GO:0030307)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|spindle assembly (GO:0051225)|UV-damage excision repair (GO:0070914)	Ino80 complex (GO:0031011)|microtubule (GO:0005874)|nucleus (GO:0005634)	alpha-tubulin binding (GO:0043014)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)	p.D1379D(2)		NS(1)|breast(4)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	49						TGACCAGCATGTCACTGCTGC	0.552																																																2	Substitution - coding silent(2)	ovary(2)	15											115.0	92.0	99.0					15																	41276060		2203	4300	6503	39063352	SO:0001819	synonymous_variant	54617			AB033085	CCDS10071.1	15q15.1	2013-08-21	2013-08-21	2008-08-07	ENSG00000128908	ENSG00000128908	3.6.1.3	"""INO80 complex subunits"""	26956	protein-coding gene	gene with protein product	"""INO80 complex subunit A"""	610169	"""INO80 complex homolog 1 (S. cerevisiae)"", ""INO80 homolog (S. cerevisiae)"""	INOC1		16298340, 16230350, 20237820	Standard	NM_017553		Approved	KIAA1259, Ino80, hINO80, INO80A	uc001zni.3	Q9ULG1	OTTHUMG00000130209	ENST00000361937.3:c.4137C>T	15.37:g.41276060G>A			39063352	A6H8X4|Q9NTG6	Silent	SNP	ENST00000361937.3	37	CCDS10071.1																																																																																				0.552	INO80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252527.2	NM_017553	
MGRN1	23295	broad.mit.edu	37	16	4718285	4718285	+	Missense_Mutation	SNP	C	C	T			TCGA-25-2398-01A-01W-0799-08	TCGA-25-2398-10A-01W-0799-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	b4b3281b-5dfc-434d-a9a6-2c2d94123220	ba4008d0-ef83-4cba-af98-742284b48779	g.chr16:4718285C>T	ENST00000399577.5	+	8	791	c.698C>T	c.(697-699)tCt>tTt	p.S233F	MGRN1_ENST00000415496.1_Missense_Mutation_p.S234F|MGRN1_ENST00000588994.1_Missense_Mutation_p.S233F|MGRN1_ENST00000262370.7_Missense_Mutation_p.S233F|MGRN1_ENST00000586183.1_Missense_Mutation_p.S233F	NM_001142290.2	NP_001135762.1	O60291	MGRN1_HUMAN	mahogunin ring finger 1, E3 ubiquitin protein ligase	233					endosome to lysosome transport (GO:0008333)|negative regulation of cAMP-mediated signaling (GO:0043951)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.S233F(1)		endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|ovary(3)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	18						GGCAGCTTCTCTGTGAAGCCT	0.498																																																1	Substitution - Missense(1)	ovary(1)	16											89.0	89.0	89.0					16																	4718285		1947	4150	6097	4658286	SO:0001583	missense	23295			AB011116	CCDS42115.1, CCDS45401.1, CCDS45402.1, CCDS45401.2, CCDS59256.1	16p13	2012-02-23	2012-02-23					"""RING-type (C3HC4) zinc fingers"""	20254	protein-coding gene	gene with protein product		607559	"""mahogunin, ring finger 1"""			9628581	Standard	NM_015246		Approved	KIAA0544, RNF156	uc002cxa.3	O60291		ENST00000399577.5:c.698C>T	16.37:g.4718285C>T	ENSP00000382487:p.Ser233Phe		4658286	A4URL3|A4URL4|Q86W76	Missense_Mutation	SNP	ENST00000399577.5	37	CCDS45402.1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.028957	0.75504	.	.	ENSG00000102858	ENST00000262370;ENST00000399577;ENST00000415496;ENST00000536343	T;T;T;T	0.32023	1.47;1.47;1.47;1.47	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	T	0.51907	0.1702	L	0.53249	1.67	0.80722	D	1	D;D;D;D;D;D	0.89917	0.999;1.0;0.993;0.999;0.997;0.999	D;D;P;D;D;D	0.97110	1.0;0.991;0.904;0.979;0.964;0.999	T	0.46205	-0.9208	10	0.52906	T	0.07	-25.6343	16.5603	0.84551	0.0:1.0:0.0:0.0	.	233;233;233;234;233;233	O60291-4;O60291-3;B4DR12;E9PB19;O60291-2;O60291	.;.;.;.;.;MGRN1_HUMAN	F	233;233;234;233	ENSP00000262370:S233F;ENSP00000382487:S233F;ENSP00000393311:S234F;ENSP00000443810:S233F	ENSP00000262370:S233F	S	+	2	0	MGRN1	4658286	0.817000	0.29147	0.946000	0.38457	0.965000	0.64279	1.653000	0.37323	2.684000	0.91462	0.650000	0.86243	TCT		0.498	MGRN1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000432060.2		
IL21R	50615	broad.mit.edu	37	16	27460252	27460252	+	Missense_Mutation	SNP	G	G	A			TCGA-25-2398-01A-01W-0799-08	TCGA-25-2398-10A-01W-0799-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	b4b3281b-5dfc-434d-a9a6-2c2d94123220	ba4008d0-ef83-4cba-af98-742284b48779	g.chr16:27460252G>A	ENST00000337929.3	+	9	1738	c.1265G>A	c.(1264-1266)gGg>gAg	p.G422E	IL21R-AS1_ENST00000563191.1_RNA|IL21R_ENST00000395754.4_Missense_Mutation_p.G422E|IL21R_ENST00000395755.1_Missense_Mutation_p.G422E|IL21R_ENST00000564089.1_Missense_Mutation_p.G422E	NM_181078.2	NP_851564.1	Q9HBE5	IL21R_HUMAN	interleukin 21 receptor	422					interleukin-21-mediated signaling pathway (GO:0038114)|natural killer cell activation (GO:0030101)	integral component of membrane (GO:0016021)	interleukin-21 receptor activity (GO:0001532)	p.G422E(1)		breast(2)|large_intestine(3)|lung(1)|ovary(2)	8						TTGGATGCAGGGACCACAGTC	0.647			T	BCL6	NHL																																		Dom	yes		16	16p11	50615	interleukin 21 receptor		L	1	Substitution - Missense(1)	ovary(1)	16											45.0	50.0	48.0					16																	27460252		2197	4300	6497	27367753	SO:0001583	missense	50615			AF254067	CCDS10630.1	16p11	2014-09-17			ENSG00000103522	ENSG00000103522		"""Interleukins and interleukin receptors"", ""CD molecules"""	6006	protein-coding gene	gene with protein product		605383				11081504	Standard	NM_181078		Approved	CD360	uc002dos.2	Q9HBE5	OTTHUMG00000131675	ENST00000337929.3:c.1265G>A	16.37:g.27460252G>A	ENSP00000338010:p.Gly422Glu		27367753	A8K9E8|D3DWF7|Q96HZ1|Q9HB91	Missense_Mutation	SNP	ENST00000337929.3	37	CCDS10630.1	.	.	.	.	.	.	.	.	.	.	G	6.898	0.535210	0.13188	.	.	ENSG00000103522	ENST00000337929;ENST00000395755;ENST00000395754	T;T;T	0.33216	1.42;1.42;1.42	5.0	-3.58	0.04597	.	1.139300	0.06325	N	0.705119	T	0.15955	0.0384	L	0.33485	1.01	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.27806	-1.0063	10	0.12766	T	0.61	-6.5059	0.8974	0.01266	0.3474:0.3039:0.1956:0.1531	.	422	Q9HBE5	IL21R_HUMAN	E	422	ENSP00000338010:G422E;ENSP00000379104:G422E;ENSP00000379103:G422E	ENSP00000338010:G422E	G	+	2	0	IL21R	27367753	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.326000	0.07965	-0.444000	0.07170	0.561000	0.74099	GGG		0.647	IL21R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254578.2	NM_181078	
KRTAP9-3	83900	broad.mit.edu	37	17	39388981	39388981	+	Silent	SNP	T	T	C	rs143261478	byFrequency	TCGA-25-2398-01A-01W-0799-08	TCGA-25-2398-10A-01W-0799-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	b4b3281b-5dfc-434d-a9a6-2c2d94123220	ba4008d0-ef83-4cba-af98-742284b48779	g.chr17:39388981T>C	ENST00000411528.2	+	1	267	c.228T>C	c.(226-228)tgT>tgC	p.C76C		NM_031962.2	NP_114168.1	Q9BYQ3	KRA93_HUMAN	keratin associated protein 9-3	76	16 X 5 AA repeats of C-C-[RQVSHE]-[SPTN]- [TASPI].					keratin filament (GO:0045095)		p.C76C(2)		breast(1)|endometrium(3)|lung(2)|ovary(1)|prostate(1)	8		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000397)			CTTCCTGCTGTAGCACACCCT	0.602													.|||	6	0.00119808	0.0045	0.0	5008	,	,		20538	0.0		0.0	False		,,,				2504	0.0															2	Substitution - coding silent(2)	ovary(1)|endometrium(1)	17						C		4,4196		1,2,2097	82.0	83.0	82.0		228	1.4	0.0	17	dbSNP_134	82	4,8596		0,4,4296	no	coding-synonymous	KRTAP9-3	NM_031962.2		1,6,6393	CC,CT,TT		0.0465,0.0952,0.0625		76/160	39388981	8,12792	2100	4300	6400	36642507	SO:0001819	synonymous_variant	83900			AJ406947	CCDS11385.1	17q21.2	2013-06-25			ENSG00000204873	ENSG00000204873		"""Keratin associated proteins"""	16927	protein-coding gene	gene with protein product						11279113	Standard	NM_031962		Approved	KAP9.3	uc021txg.1	Q9BYQ3	OTTHUMG00000133427	ENST00000411528.2:c.228T>C	17.37:g.39388981T>C			36642507		Silent	SNP	ENST00000411528.2	37	CCDS11385.1																																																																																				0.602	KRTAP9-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257290.1		
GPR142	350383	broad.mit.edu	37	17	72363841	72363841	+	Nonsense_Mutation	SNP	G	G	A			TCGA-25-2398-01A-01W-0799-08	TCGA-25-2398-10A-01W-0799-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	b4b3281b-5dfc-434d-a9a6-2c2d94123220	ba4008d0-ef83-4cba-af98-742284b48779	g.chr17:72363841G>A	ENST00000335666.4	+	1	245	c.197G>A	c.(196-198)tGg>tAg	p.W66*		NM_181790.1	NP_861455.1	Q7Z601	GP142_HUMAN	G protein-coupled receptor 142	66						cell junction (GO:0030054)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.W66*(1)		central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(21)|ovary(2)|prostate(1)|skin(4)	35						GGGGGAAGCTGGGACCTCCGA	0.552																																																1	Substitution - Nonsense(1)	ovary(1)	17											71.0	64.0	66.0					17																	72363841		2203	4300	6503	69875436	SO:0001587	stop_gained	350383			AY255622	CCDS11698.1	17q25.2	2012-08-21				ENSG00000257008		"""GPCR / Class A : Orphans"""	20088	protein-coding gene	gene with protein product		609046				14623098	Standard	NM_181790		Approved	PGR2	uc010wqy.2	Q7Z601		ENST00000335666.4:c.197G>A	17.37:g.72363841G>A	ENSP00000335158:p.Trp66*		69875436	A4CYJ8|Q86SL3	Nonsense_Mutation	SNP	ENST00000335666.4	37	CCDS11698.1	.	.	.	.	.	.	.	.	.	.	G	17.32	3.360129	0.61403	.	.	ENSG00000257008	ENST00000335666	.	.	.	2.41	1.4	0.22301	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.8334	0.23923	0.1556:0.0:0.8444:0.0	.	.	.	.	X	66	.	ENSP00000335158:W66X	W	+	2	0	GPR142	69875436	1.000000	0.71417	0.002000	0.10522	0.011000	0.07611	5.093000	0.64517	0.340000	0.23745	0.558000	0.71614	TGG		0.552	GPR142-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442545.1	NM_181790	
CETN1	1068	broad.mit.edu	37	18	580898	580898	+	Missense_Mutation	SNP	C	C	T			TCGA-25-2398-01A-01W-0799-08	TCGA-25-2398-10A-01W-0799-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	b4b3281b-5dfc-434d-a9a6-2c2d94123220	ba4008d0-ef83-4cba-af98-742284b48779	g.chr18:580898C>T	ENST00000327228.3	+	1	532	c.490C>T	c.(490-492)Cgg>Tgg	p.R164W		NM_004066.1	NP_004057.1	Q12798	CETN1_HUMAN	centrin, EF-hand protein, 1	164	EF-hand 4. {ECO:0000255|PROSITE- ProRule:PRU00448}.				cellular response to heat (GO:0034605)|mitotic nuclear division (GO:0007067)	centriole (GO:0005814)|centrosome (GO:0005813)|photoreceptor connecting cilium (GO:0032391)|spindle pole (GO:0000922)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|calcium ion binding (GO:0005509)|nucleic acid binding (GO:0003676)	p.R164W(1)		breast(2)|cervix(1)|endometrium(3)|large_intestine(6)|lung(9)|ovary(2)|upper_aerodigestive_tract(2)	25						GGAGTTCCTTCGGATCATGAA	0.537																																																1	Substitution - Missense(1)	ovary(1)	18											70.0	69.0	69.0					18																	580898		2203	4296	6499	570898	SO:0001583	missense	1068			U03270	CCDS11820.1	18p11.32	2013-01-10			ENSG00000177143	ENSG00000177143		"""EF-hand domain containing"""	1866	protein-coding gene	gene with protein product		603187		CETN		8175926	Standard	NM_004066		Approved	CEN1	uc002kko.1	Q12798	OTTHUMG00000131471	ENST00000327228.3:c.490C>T	18.37:g.580898C>T	ENSP00000319052:p.Arg164Trp		570898	B2R536	Missense_Mutation	SNP	ENST00000327228.3	37	CCDS11820.1	.	.	.	.	.	.	.	.	.	.	C	14.78	2.637164	0.47049	.	.	ENSG00000177143	ENST00000327228	T	0.79352	-1.26	5.2	3.25	0.37280	EF-hand-like domain (1);	0.089351	0.49916	D	0.000137	T	0.79661	0.4484	M	0.87827	2.91	0.51482	D	0.999922	B	0.32968	0.392	B	0.33121	0.158	T	0.80074	-0.1534	10	0.87932	D	0	.	12.0149	0.53309	0.3944:0.6055:0.0:0.0	.	164	Q12798	CETN1_HUMAN	W	164	ENSP00000319052:R164W	ENSP00000319052:R164W	R	+	1	2	CETN1	570898	0.831000	0.29352	0.018000	0.16275	0.893000	0.52053	1.625000	0.37029	0.733000	0.32492	0.655000	0.94253	CGG		0.537	CETN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254314.2	NM_004066	
ALPK2	115701	broad.mit.edu	37	18	56203552	56203552	+	Silent	SNP	G	G	A			TCGA-25-2398-01A-01W-0799-08	TCGA-25-2398-10A-01W-0799-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	b4b3281b-5dfc-434d-a9a6-2c2d94123220	ba4008d0-ef83-4cba-af98-742284b48779	g.chr18:56203552G>A	ENST00000361673.3	-	5	4080	c.3867C>T	c.(3865-3867)gcC>gcT	p.A1289A	RP11-1151B14.4_ENST00000591360.1_RNA	NM_052947.3	NP_443179.3	Q86TB3	ALPK2_HUMAN	alpha-kinase 2	1289						nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.A1289A(1)|p.A650A(1)		NS(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(33)|ovary(7)|prostate(1)|skin(10)|upper_aerodigestive_tract(2)	84						TTTCAGAGGGGGCCAATTCAG	0.512																																																2	Substitution - coding silent(2)	ovary(2)	18											126.0	116.0	120.0					18																	56203552		2203	4300	6503	54354532	SO:0001819	synonymous_variant	115701			AY044450	CCDS11966.2	18q21.31	2013-01-11			ENSG00000198796	ENSG00000198796		"""Immunoglobulin superfamily / I-set domain containing"""	20565	protein-coding gene	gene with protein product	"""heart alpha-kinase"""					10021370	Standard	NM_052947		Approved	HAK	uc002lhj.4	Q86TB3	OTTHUMG00000132755	ENST00000361673.3:c.3867C>T	18.37:g.56203552G>A			54354532	Q6ZUX0|Q8NAT5|Q96L95	Silent	SNP	ENST00000361673.3	37	CCDS11966.2																																																																																				0.512	ALPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256126.1	NM_052947	
FBXO15	201456	broad.mit.edu	37	18	71740792	71740792	+	Silent	SNP	C	C	A			TCGA-25-2398-01A-01W-0799-08	TCGA-25-2398-10A-01W-0799-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	b4b3281b-5dfc-434d-a9a6-2c2d94123220	ba4008d0-ef83-4cba-af98-742284b48779	g.chr18:71740792C>A	ENST00000419743.2	-	10	1516	c.1437G>T	c.(1435-1437)ctG>ctT	p.L479L	FBXO15_ENST00000269500.5_Silent_p.L403L|FBXO15_ENST00000580806.1_5'UTR	NM_001142958.1	NP_001136430.1	Q8NCQ5	FBX15_HUMAN	F-box protein 15	479						SCF ubiquitin ligase complex (GO:0019005)		p.L403L(1)		autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)	27		Esophageal squamous(42;0.103)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.143)		TGATCCACACCAGCTCCACGT	0.483																																																1	Substitution - coding silent(1)	ovary(1)	18											261.0	248.0	252.0					18																	71740792		2203	4300	6503	69891772	SO:0001819	synonymous_variant	201456			AK094215	CCDS45884.1	18q22.3	2006-03-09	2004-06-15		ENSG00000141665	ENSG00000141665		"""F-boxes /  ""other"""""	13617	protein-coding gene	gene with protein product		609093	"""F-box only protein 15"""			12665572	Standard	NM_152676		Approved	MGC39671, FBX15	uc002llf.2	Q8NCQ5	OTTHUMG00000132842	ENST00000419743.2:c.1437G>T	18.37:g.71740792C>A			69891772	B3KST3	Silent	SNP	ENST00000419743.2	37	CCDS45884.1																																																																																				0.483	FBXO15-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000444223.1	NM_152676	
TUBB4A	10382	broad.mit.edu	37	19	6495297	6495297	+	Missense_Mutation	SNP	C	C	T			TCGA-25-2398-01A-01W-0799-08	TCGA-25-2398-10A-01W-0799-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	b4b3281b-5dfc-434d-a9a6-2c2d94123220	ba4008d0-ef83-4cba-af98-742284b48779	g.chr19:6495297C>T	ENST00000264071.2	-	4	1584	c.1213G>A	c.(1213-1215)Gag>Aag	p.E405K	TUBB4A_ENST00000540257.1_Missense_Mutation_p.E405K|CTD-2396E7.9_ENST00000599292.1_RNA|CTD-2396E7.10_ENST00000596027.1_RNA			P04350	TBB4A_HUMAN	tubulin, beta 4A class IVa	405					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based process (GO:0007017)|mitotic cell cycle (GO:0000278)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cilium (GO:0005929)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|internode region of axon (GO:0033269)|microtubule (GO:0005874)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)	p.E405K(1)									AACTCCATCTCGTCCATGCCC	0.612																																																1	Substitution - Missense(1)	ovary(1)	19											139.0	124.0	129.0					19																	6495297		2203	4298	6501	6446297	SO:0001583	missense	10382			AK075307	CCDS12168.1	19p13.3	2014-02-05	2011-10-11	2011-10-10	ENSG00000104833	ENSG00000104833		"""Tubulins"""	20774	protein-coding gene	gene with protein product	"""class IVa beta-tubulin"""	602662	"""tubulin, beta 4"", ""tubulin, beta 4 class IVa"", ""dystonia 4, torsion (autosomal dominant)"""	TUBB4, DYT4		6865944, 6462917, 23595291	Standard	NM_001289123		Approved	beta-5	uc002mfg.1	P04350		ENST00000264071.2:c.1213G>A	19.37:g.6495297C>T	ENSP00000264071:p.Glu405Lys		6446297	B3KQP4|Q969E5	Missense_Mutation	SNP	ENST00000264071.2	37	CCDS12168.1	.	.	.	.	.	.	.	.	.	.	C	17.50	3.404082	0.62288	.	.	ENSG00000104833	ENST00000264071;ENST00000540257;ENST00000412858	T;T	0.73681	-0.77;-0.77	3.43	3.43	0.39272	.	0.000000	0.64402	U	0.000002	D	0.85106	0.5621	H	0.99074	4.42	0.53688	D	0.999974	P	0.52842	0.956	B	0.42625	0.393	D	0.91054	0.4880	10	0.87932	D	0	.	13.6752	0.62449	0.0:1.0:0.0:0.0	.	405	P04350	TBB4A_HUMAN	K	405;405;323	ENSP00000264071:E405K;ENSP00000443590:E405K	ENSP00000264071:E405K	E	-	1	0	TUBB4	6446297	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.681000	0.84073	1.473000	0.48159	0.306000	0.20318	GAG		0.612	TUBB4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457841.1	NM_006087	
TRMT1	55621	broad.mit.edu	37	19	13220216	13220216	+	Missense_Mutation	SNP	G	G	A			TCGA-25-2398-01A-01W-0799-08	TCGA-25-2398-10A-01W-0799-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	b4b3281b-5dfc-434d-a9a6-2c2d94123220	ba4008d0-ef83-4cba-af98-742284b48779	g.chr19:13220216G>A	ENST00000592062.1	-	13	1946	c.1376C>T	c.(1375-1377)aCa>aTa	p.T459I	TRMT1_ENST00000221504.8_Missense_Mutation_p.T430I|TRMT1_ENST00000357720.4_Missense_Mutation_p.T459I|TRMT1_ENST00000437766.1_Missense_Mutation_p.T459I			Q9NXH9	TRM1_HUMAN	tRNA methyltransferase 1 homolog (S. cerevisiae)	459	Trm1 methyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00958}.						metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|tRNA (guanine-N2-)-methyltransferase activity (GO:0004809)|tRNA binding (GO:0000049)	p.T459I(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	14			OV - Ovarian serous cystadenocarcinoma(19;6.08e-22)	GBM - Glioblastoma multiforme(1328;0.0356)		GAGGCTTGGTGTGTTGCAGTG	0.622																																																1	Substitution - Missense(1)	ovary(1)	19											102.0	97.0	98.0					19																	13220216		2203	4300	6503	13081216	SO:0001583	missense	55621			AF196479	CCDS12293.1, CCDS45997.1	19p13.13	2012-06-12	2012-06-12						25980	protein-coding gene	gene with protein product		611669				10982862	Standard	NM_001142554		Approved	FLJ20244, TRM1	uc002mwl.3	Q9NXH9		ENST00000592062.1:c.1376C>T	19.37:g.13220216G>A	ENSP00000466967:p.Thr459Ile		13081216	O76103|Q548Y5|Q8WVA6	Missense_Mutation	SNP	ENST00000592062.1	37	CCDS12293.1	.	.	.	.	.	.	.	.	.	.	G	12.67	2.008932	0.35415	.	.	ENSG00000104907	ENST00000357720;ENST00000437766;ENST00000221504	.	.	.	4.76	4.76	0.60689	.	0.000000	0.85682	D	0.000000	T	0.62319	0.2418	M	0.66939	2.045	0.58432	D	0.999994	B;B	0.33777	0.026;0.425	B;B	0.36378	0.041;0.223	T	0.62751	-0.6788	9	0.33141	T	0.24	-17.5447	15.2722	0.73712	0.0:0.0:1.0:0.0	.	430;459	Q9NXH9-2;Q9NXH9	.;TRM1_HUMAN	I	459;459;430	.	ENSP00000221504:T430I	T	-	2	0	TRMT1	13081216	1.000000	0.71417	0.937000	0.37676	0.436000	0.31835	5.846000	0.69444	2.199000	0.70637	0.462000	0.41574	ACA		0.622	TRMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452780.2	NM_017722	
ARHGAP35	2909	broad.mit.edu	37	19	47423688	47423688	+	Nonsense_Mutation	SNP	C	C	T			TCGA-25-2398-01A-01W-0799-08	TCGA-25-2398-10A-01W-0799-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	b4b3281b-5dfc-434d-a9a6-2c2d94123220	ba4008d0-ef83-4cba-af98-742284b48779	g.chr19:47423688C>T	ENST00000404338.3	+	1	1756	c.1756C>T	c.(1756-1758)Cag>Tag	p.Q586*		NM_004491.4	NP_004482.4	Q9NRY4	RHG35_HUMAN	Rho GTPase activating protein 35	586					axon guidance (GO:0007411)|camera-type eye development (GO:0043010)|forebrain development (GO:0030900)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of vascular permeability (GO:0043116)|neural tube closure (GO:0001843)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|GTP binding (GO:0005525)|Rho GTPase activator activity (GO:0005100)|transcription corepressor activity (GO:0003714)	p.Q586*(1)									TGACCGGAATCAGAAAAATTC	0.493																																																1	Substitution - Nonsense(1)	ovary(1)	19											105.0	104.0	104.0					19																	47423688		1901	4120	6021	52115528	SO:0001587	stop_gained	2909			M73077	CCDS46127.1	19q13.32	2011-06-29	2011-06-07	2011-06-07	ENSG00000160007	ENSG00000160007		"""Rho GTPase activating proteins"""	4591	protein-coding gene	gene with protein product		605277	"""glucocorticoid receptor DNA binding factor 1"""	GRLF1		1894621, 20675588	Standard	NM_004491		Approved	GRF-1, p190ARhoGAP, P190A, KIAA1722, p190RhoGAP	uc010ekv.3	Q9NRY4		ENST00000404338.3:c.1756C>T	19.37:g.47423688C>T	ENSP00000385720:p.Gln586*		52115528	A7E2A4|Q14452|Q9C0E1	Nonsense_Mutation	SNP	ENST00000404338.3	37	CCDS46127.1	.	.	.	.	.	.	.	.	.	.	C	37	6.533927	0.97641	.	.	ENSG00000160007	ENST00000317082;ENST00000501576;ENST00000404338	.	.	.	5.95	5.95	0.96441	.	0.358447	0.33110	N	0.005263	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05833	T	0.94	-33.0817	19.1646	0.93551	0.0:1.0:0.0:0.0	.	.	.	.	X	586	.	ENSP00000324820:Q586X	Q	+	1	0	ARHGAP35	52115528	0.965000	0.33210	1.000000	0.80357	0.995000	0.86356	2.170000	0.42443	2.824000	0.97209	0.655000	0.94253	CAG		0.493	ARHGAP35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466652.1	NM_004491	
ZNF611	81856	broad.mit.edu	37	19	53208487	53208487	+	Silent	SNP	T	T	A			TCGA-25-2398-01A-01W-0799-08	TCGA-25-2398-10A-01W-0799-08	T	T	A	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	b4b3281b-5dfc-434d-a9a6-2c2d94123220	ba4008d0-ef83-4cba-af98-742284b48779	g.chr19:53208487T>A	ENST00000319783.1	-	7	2137	c.1821A>T	c.(1819-1821)tcA>tcT	p.S607S	ZNF611_ENST00000543227.1_Silent_p.S607S|ZNF611_ENST00000540744.1_Silent_p.S607S|ZNF611_ENST00000595798.1_Silent_p.S538S|ZNF611_ENST00000602162.1_Silent_p.S538S|ZNF611_ENST00000602046.1_5'Flank|ZNF611_ENST00000453741.2_Silent_p.S538S	NM_030972.3	NP_112234.3	Q8N823	ZN611_HUMAN	zinc finger protein 611	607					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S607S(1)		breast(1)|endometrium(4)|kidney(4)|large_intestine(10)|lung(12)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				OV - Ovarian serous cystadenocarcinoma(262;0.0233)|GBM - Glioblastoma multiforme(134;0.04)		AATGAAGGGATGACCTGCGAC	0.448																																																1	Substitution - coding silent(1)	ovary(1)	19											249.0	227.0	235.0					19																	53208487		2203	4300	6503	57900299	SO:0001819	synonymous_variant	81856			AK091389	CCDS12855.1, CCDS54312.1	19q13.42	2013-01-08			ENSG00000213020	ENSG00000213020		"""Zinc fingers, C2H2-type"", ""-"""	28766	protein-coding gene	gene with protein product						12477932	Standard	NM_030972		Approved	MGC5384	uc010ydq.2	Q8N823	OTTHUMG00000154908	ENST00000319783.1:c.1821A>T	19.37:g.53208487T>A			57900299	B3KRD5|Q69YG9	Silent	SNP	ENST00000319783.1	37	CCDS12855.1																																																																																				0.448	ZNF611-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337612.1	NM_030972	
ZNF776	284309	broad.mit.edu	37	19	58265193	58265193	+	Missense_Mutation	SNP	G	G	C			TCGA-25-2398-01A-01W-0799-08	TCGA-25-2398-10A-01W-0799-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	b4b3281b-5dfc-434d-a9a6-2c2d94123220	ba4008d0-ef83-4cba-af98-742284b48779	g.chr19:58265193G>C	ENST00000317178.5	+	3	958	c.695G>C	c.(694-696)aGa>aCa	p.R232T		NM_173632.3	NP_775903.3	Q68DI1	ZN776_HUMAN	zinc finger protein 776	232					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R190T(1)		cervix(1)|endometrium(2)|kidney(13)|large_intestine(3)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	31		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0256)		CTTCTCCCTAGAGAAGGACCT	0.413																																																1	Substitution - Missense(1)	ovary(1)	19											78.0	79.0	79.0					19																	58265193		2203	4300	6503	62957005	SO:0001583	missense	284309			AK095607	CCDS12962.2	19q13.43	2013-01-08			ENSG00000152443	ENSG00000152443		"""Zinc fingers, C2H2-type"", ""-"""	26765	protein-coding gene	gene with protein product							Standard	NM_173632		Approved	FLJ38288		Q68DI1	OTTHUMG00000156943	ENST00000317178.5:c.695G>C	19.37:g.58265193G>C	ENSP00000321812:p.Arg232Thr		62957005	Q6ZS36|Q8N968	Missense_Mutation	SNP	ENST00000317178.5	37	CCDS12962.2	.	.	.	.	.	.	.	.	.	.	G	5.530	0.282654	0.10458	.	.	ENSG00000152443	ENST00000317178	T	0.60424	0.19	1.67	0.537	0.17144	.	.	.	.	.	T	0.46908	0.1417	L	0.58810	1.83	0.23016	N	0.998428	P;P	0.44195	0.801;0.828	B;B	0.36289	0.134;0.221	T	0.38735	-0.9647	9	0.87932	D	0	.	6.6452	0.22931	0.1698:0.0:0.8302:0.0	.	232;232	Q68DI1;B4DSC6	ZN776_HUMAN;.	T	232	ENSP00000321812:R232T	ENSP00000321812:R232T	R	+	2	0	ZNF776	62957005	0.000000	0.05858	0.002000	0.10522	0.114000	0.19823	-0.083000	0.11286	0.043000	0.15746	0.305000	0.20034	AGA		0.413	ZNF776-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346722.2	NM_173632	
INPP5D	3635	broad.mit.edu	37	2	233990542	233990542	+	Nonsense_Mutation	SNP	C	C	G			TCGA-25-2398-01A-01W-0799-08	TCGA-25-2398-10A-01W-0799-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	b4b3281b-5dfc-434d-a9a6-2c2d94123220	ba4008d0-ef83-4cba-af98-742284b48779	g.chr2:233990542C>G	ENST00000359570.5	+	4	437	c.437C>G	c.(436-438)tCa>tGa	p.S146*	INPP5D_ENST00000474278.1_3'UTR|INPP5D_ENST00000538935.1_Nonsense_Mutation_p.S146*			Q92835	SHIP1_HUMAN	inositol polyphosphate-5-phosphatase, 145kDa	146					apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|determination of adult lifespan (GO:0008340)|immunoglobulin mediated immune response (GO:0016064)|inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of bone resorption (GO:0045779)|negative regulation of immune response (GO:0050777)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of monocyte differentiation (GO:0045656)|negative regulation of neutrophil differentiation (GO:0045659)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of signal transduction (GO:0009968)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of apoptotic process (GO:0043065)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of erythrocyte differentiation (GO:0045648)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)	cytosol (GO:0005829)|membrane (GO:0016020)	inositol-polyphosphate 5-phosphatase activity (GO:0004445)|phosphatidylinositol trisphosphate phosphatase activity (GO:0034594)	p.F28L(1)		central_nervous_system(1)|ovary(1)	2		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0273)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0843)		Epithelial(121;1.16e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000479)|LUSC - Lung squamous cell carcinoma(224;0.00655)|Lung(119;0.00802)|GBM - Glioblastoma multiforme(43;0.0185)		GTTCCTTTTTCAAACGAGAAT	0.587																																					NSCLC(82;1215 1426 16163 20348 41018)											1	Substitution - Missense(1)	ovary(1)	2											38.0	44.0	42.0					2																	233990542		2139	4246	6385	233698786	SO:0001587	stop_gained	3635			U57650	CCDS74672.1	2q37.1	2013-02-14	2002-08-29		ENSG00000168918	ENSG00000168918		"""SH2 domain containing"""	6079	protein-coding gene	gene with protein product		601582	"""inositol polyphosphate-5-phosphatase, 145kD"""			8643691, 8874179	Standard	NM_001017915		Approved	SHIP, hp51CN	uc010zmp.2	Q92835	OTTHUMG00000133688	ENST00000359570.5:c.437C>G	2.37:g.233990542C>G	ENSP00000352575:p.Ser146*		233698786	O00145|Q13544|Q13545|Q6P5A4|Q92656|Q9UE80	Nonsense_Mutation	SNP	ENST00000359570.5	37		.	.	.	.	.	.	.	.	.	.	C	12.93	2.084393	0.36758	.	.	ENSG00000168918	ENST00000422935;ENST00000451407;ENST00000359570;ENST00000538935	.	.	.	5.23	-0.88	0.10610	.	2.413690	0.01580	N	0.021043	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.39692	T	0.17	.	6.0724	0.19897	0.0:0.4547:0.1264:0.4189	.	.	.	.	X	145;146;146;146	.	ENSP00000352575:S146X	S	+	2	0	INPP5D	233698786	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.243000	0.08915	-0.548000	0.06199	0.650000	0.86243	TCA		0.587	INPP5D-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001017915	
ZNF217	7764	broad.mit.edu	37	20	52192307	52192307	+	Missense_Mutation	SNP	C	C	G			TCGA-25-2398-01A-01W-0799-08	TCGA-25-2398-10A-01W-0799-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	b4b3281b-5dfc-434d-a9a6-2c2d94123220	ba4008d0-ef83-4cba-af98-742284b48779	g.chr20:52192307C>G	ENST00000371471.2	-	4	3421	c.2996G>C	c.(2995-2997)tGt>tCt	p.C999S	ZNF217_ENST00000302342.3_Missense_Mutation_p.C999S|RP4-724E16.2_ENST00000424252.1_RNA			O75362	ZN217_HUMAN	zinc finger protein 217	999					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone deacetylase complex (GO:0000118)|nucleoplasm (GO:0005654)	metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.C999S(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(13)|lung(17)|ovary(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	50	all_cancers(1;6.75e-17)|all_epithelial(1;1.76e-18)|Breast(2;3.83e-14)|Lung NSC(4;9.04e-07)|all_lung(4;2.5e-06)|Ovarian(1;0.0398)		BRCA - Breast invasive adenocarcinoma(1;9.88e-17)|Epithelial(1;1.56e-14)|all cancers(1;9.44e-13)|STAD - Stomach adenocarcinoma(23;0.0474)|Colorectal(105;0.198)			AGCAGGCACACAAGTGTAAAG	0.522																																																1	Substitution - Missense(1)	ovary(1)	20											61.0	58.0	59.0					20																	52192307		2203	4300	6503	51625714	SO:0001583	missense	7764			AF041259	CCDS13443.1	20q13.2	2013-01-08			ENSG00000171940	ENSG00000171940		"""Zinc fingers, C2H2-type"""	13009	protein-coding gene	gene with protein product		602967				9671742	Standard	NM_006526		Approved	ZABC1	uc002xwq.4	O75362	OTTHUMG00000032764	ENST00000371471.2:c.2996G>C	20.37:g.52192307C>G	ENSP00000360526:p.Cys999Ser		51625714	E1P5Y6|Q14DB8	Missense_Mutation	SNP	ENST00000371471.2	37	CCDS13443.1	.	.	.	.	.	.	.	.	.	.	C	17.10	3.302726	0.60195	.	.	ENSG00000171940	ENST00000371471;ENST00000302342;ENST00000437222;ENST00000395971	T;T	0.11495	2.77;2.77	4.79	4.79	0.61399	.	0.463445	0.23003	N	0.053056	T	0.26702	0.0653	L	0.59436	1.845	0.19575	N	0.999961	D	0.71674	0.998	P	0.60682	0.878	T	0.02758	-1.1114	10	0.72032	D	0.01	-8.6365	15.6137	0.76748	0.0:1.0:0.0:0.0	.	999	O75362	ZN217_HUMAN	S	999;999;87;159	ENSP00000360526:C999S;ENSP00000304308:C999S	ENSP00000304308:C999S	C	-	2	0	ZNF217	51625714	0.942000	0.31987	0.008000	0.14137	0.003000	0.03518	2.890000	0.48609	2.208000	0.71279	0.650000	0.86243	TGT		0.522	ZNF217-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079757.2	NM_006526	
KREMEN1	83999	broad.mit.edu	37	22	29537934	29537934	+	Missense_Mutation	SNP	C	C	T			TCGA-25-2398-01A-01W-0799-08	TCGA-25-2398-10A-01W-0799-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	b4b3281b-5dfc-434d-a9a6-2c2d94123220	ba4008d0-ef83-4cba-af98-742284b48779	g.chr22:29537934C>T	ENST00000407188.1	+	9	1256	c.1256C>T	c.(1255-1257)tCc>tTc	p.S419F	KREMEN1_ENST00000400335.4_Missense_Mutation_p.S404F|KREMEN1_ENST00000400338.2_Missense_Mutation_p.S421F|KREMEN1_ENST00000327813.5_Missense_Mutation_p.S421F			Q96MU8	KREM1_HUMAN	kringle containing transmembrane protein 1	419					cell communication (GO:0007154)|regulation of canonical Wnt signaling pathway (GO:0060828)|Wnt signaling pathway (GO:0016055)	integral component of membrane (GO:0016021)|membrane (GO:0016020)		p.S421F(1)		breast(1)|endometrium(3)|large_intestine(2)|lung(8)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)	20						CTTGACAGATCCCATCGTGTT	0.443																																																1	Substitution - Missense(1)	ovary(1)	22											64.0	63.0	63.0					22																	29537934		1864	4102	5966	27867934	SO:0001583	missense	83999			AB059618	CCDS43000.1, CCDS13849.1, CCDS43000.2	22q12.1	2008-03-27	2002-11-13	2002-11-15	ENSG00000183762	ENSG00000183762			17550	protein-coding gene	gene with protein product		609898	"""kringle containing transmembrane protein"""	KREMEN		11267660	Standard	NM_001039570		Approved	KRM1	uc011akm.1	Q96MU8	OTTHUMG00000030987	ENST00000407188.1:c.1256C>T	22.37:g.29537934C>T	ENSP00000385431:p.Ser419Phe		27867934	B0QY46|B0QY47|B1AJR5|Q5TIB9|Q6P3X6|Q9BY70|Q9UGS5|Q9UGU1	Missense_Mutation	SNP	ENST00000407188.1	37	CCDS43000.2	.	.	.	.	.	.	.	.	.	.	C	20.9	4.067780	0.76301	.	.	ENSG00000183762	ENST00000400335;ENST00000400338;ENST00000327813;ENST00000407188	T;T;T;T	0.66280	-0.15;-0.19;-0.2;-0.19	5.06	5.06	0.68205	.	0.099662	0.43747	D	0.000539	T	0.65471	0.2694	L	0.29908	0.895	0.80722	D	1	P;D;P	0.57257	0.769;0.979;0.828	P;P;P	0.58454	0.507;0.839;0.555	T	0.68588	-0.5369	10	0.87932	D	0	.	14.6712	0.68945	0.0:1.0:0.0:0.0	.	419;421;404	Q96MU8;Q96MU8-2;Q96MU8-3	KREM1_HUMAN;.;.	F	404;421;421;419	ENSP00000383189:S404F;ENSP00000383192:S421F;ENSP00000331242:S421F;ENSP00000385431:S419F	ENSP00000331242:S421F	S	+	2	0	KREMEN1	27867934	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	3.055000	0.49916	2.733000	0.93635	0.655000	0.94253	TCC		0.443	KREMEN1-004	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320947.1		
PIK3IP1	113791	broad.mit.edu	37	22	31679151	31679151	+	Silent	SNP	C	C	G			TCGA-25-2398-01A-01W-0799-08	TCGA-25-2398-10A-01W-0799-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture			Illumina GAIIx	b4b3281b-5dfc-434d-a9a6-2c2d94123220	ba4008d0-ef83-4cba-af98-742284b48779	g.chr22:31679151C>G	ENST00000215912.5	-	6	894	c.711G>C	c.(709-711)gtG>gtC	p.V237V	PIK3IP1_ENST00000441972.1_3'UTR|PIK3IP1_ENST00000487265.2_Silent_p.V158V	NM_052880.4	NP_443112.2	Q96FE7	P3IP1_HUMAN	phosphoinositide-3-kinase interacting protein 1	237					negative regulation of phosphatidylinositol 3-kinase activity (GO:0043553)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	phosphatidylinositol 3-kinase catalytic subunit binding (GO:0036313)	p.V237V(1)		large_intestine(2)|lung(1)|ovary(1)	4						TGGTGTGGACCACGACAGTCT	0.602																																																1	Substitution - coding silent(1)	ovary(1)	22											98.0	70.0	79.0					22																	31679151		2203	4300	6503	30009151	SO:0001819	synonymous_variant	113791			BC011049	CCDS13893.1, CCDS46690.1	22q12.2	2007-04-13			ENSG00000100100	ENSG00000100100			24942	protein-coding gene	gene with protein product						12477932	Standard	NM_052880		Approved	HGFL, MGC17330	uc003akm.3	Q96FE7	OTTHUMG00000151256	ENST00000215912.5:c.711G>C	22.37:g.31679151C>G			30009151	B4DRR9|D1MEI0|O00318|Q49A94|Q86YW2|Q8NCJ9	Silent	SNP	ENST00000215912.5	37	CCDS13893.1																																																																																				0.602	PIK3IP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321939.1	NM_052880	
SENP7	57337	broad.mit.edu	37	3	101050938	101050938	+	Silent	SNP	G	G	A			TCGA-25-2398-01A-01W-0799-08	TCGA-25-2398-10A-01W-0799-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	b4b3281b-5dfc-434d-a9a6-2c2d94123220	ba4008d0-ef83-4cba-af98-742284b48779	g.chr3:101050938G>A	ENST00000394095.2	-	19	2642	c.2589C>T	c.(2587-2589)ctC>ctT	p.L863L	SENP7_ENST00000348610.3_Silent_p.L830L|SENP7_ENST00000314261.7_Silent_p.L797L|SENP7_ENST00000358203.3_Silent_p.L699L|SENP7_ENST00000394091.1_Silent_p.L699L|SENP7_ENST00000394085.3_Silent_p.L51L|SENP7_ENST00000394094.2_Silent_p.L798L	NM_001282802.1|NM_020654.3	NP_001269731.1|NP_065705.3	Q9BQF6	SENP7_HUMAN	SUMO1/sentrin specific peptidase 7	863	Protease.					intracellular (GO:0005622)|nucleus (GO:0005634)	cysteine-type peptidase activity (GO:0008234)	p.L797L(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(16)|lung(15)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44						AAATGACTGCGAGATACCAGT	0.383																																																1	Substitution - coding silent(1)	ovary(1)	3											114.0	108.0	110.0					3																	101050938		2203	4300	6503	102533628	SO:0001819	synonymous_variant	57337				CCDS2941.2, CCDS43121.1, CCDS63704.1, CCDS63705.1, CCDS63706.1	3q12	2008-02-05	2005-08-17		ENSG00000138468	ENSG00000138468			30402	protein-coding gene	gene with protein product		612846	"""SUMO1/sentrin specific protease 7"""			11214970, 11230166	Standard	NM_001282802		Approved		uc003dut.3	Q9BQF6	OTTHUMG00000149927	ENST00000394095.2:c.2589C>T	3.37:g.101050938G>A			102533628	A1L3A5|A8MW39|B7WNW8|Q7Z3F4|Q96PS5|Q9C0F6|Q9HBT5	Silent	SNP	ENST00000394095.2	37	CCDS2941.2																																																																																				0.383	SENP7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313957.2	NM_020654	
WDR55	54853	broad.mit.edu	37	5	140048817	140048817	+	Missense_Mutation	SNP	A	A	C			TCGA-25-2398-01A-01W-0799-08	TCGA-25-2398-10A-01W-0799-08	A	A	C	C	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	b4b3281b-5dfc-434d-a9a6-2c2d94123220	ba4008d0-ef83-4cba-af98-742284b48779	g.chr5:140048817A>C	ENST00000358337.5	+	6	1051	c.814A>C	c.(814-816)Act>Cct	p.T272P	WDR55_ENST00000520764.1_3'UTR	NM_017706.4	NP_060176	Q9H6Y2	WDR55_HUMAN	WD repeat domain 55	272					rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)		p.T272P(1)		NS(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(2)|prostate(1)	9			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TACTGGCTCCACTGATGGAGT	0.557																																																1	Substitution - Missense(1)	ovary(1)	5											73.0	66.0	68.0					5																	140048817		2203	4300	6503	140029001	SO:0001583	missense	54853			AK000202	CCDS4235.1	5q31.3	2013-01-09			ENSG00000120314	ENSG00000120314		"""WD repeat domain containing"""	25971	protein-coding gene	gene with protein product						12477932	Standard	NM_017706		Approved	FLJ20195, FLJ21702	uc003lgr.4	Q9H6Y2	OTTHUMG00000129506	ENST00000358337.5:c.814A>C	5.37:g.140048817A>C	ENSP00000351100:p.Thr272Pro		140029001	Q9NXK4	Missense_Mutation	SNP	ENST00000358337.5	37	CCDS4235.1	.	.	.	.	.	.	.	.	.	.	A	14.93	2.683764	0.47991	.	.	ENSG00000120314	ENST00000358337	T	0.42513	0.97	5.21	5.21	0.72293	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.146929	0.42964	D	0.000628	T	0.35219	0.0924	L	0.36672	1.1	0.51767	D	0.999937	P;P	0.50066	0.795;0.931	B;B	0.42462	0.388;0.358	T	0.09250	-1.0683	10	0.30854	T	0.27	-12.1186	14.0647	0.64821	1.0:0.0:0.0:0.0	.	111;272	G3V1J0;Q9H6Y2	.;WDR55_HUMAN	P	272	ENSP00000351100:T272P	ENSP00000351100:T272P	T	+	1	0	WDR55	140029001	1.000000	0.71417	0.996000	0.52242	0.822000	0.46500	7.048000	0.76606	1.955000	0.56771	0.377000	0.23210	ACT		0.557	WDR55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251680.3	NM_017706	
MUC21	394263	broad.mit.edu	37	6	30954260	30954260	+	Missense_Mutation	SNP	G	G	A	rs200529075		TCGA-25-2398-01A-01W-0799-08	TCGA-25-2398-10A-01W-0799-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	b4b3281b-5dfc-434d-a9a6-2c2d94123220	ba4008d0-ef83-4cba-af98-742284b48779	g.chr6:30954260G>A	ENST00000376296.3	+	2	549	c.308G>A	c.(307-309)aGc>aAc	p.S103N	MUC21_ENST00000486149.2_5'UTR	NM_001010909.2	NP_001010909.2	Q5SSG8	MUC21_HUMAN	mucin 21, cell surface associated	103	28 X 15 AA approximate tandem repeats.|Ser-rich.				cellular protein metabolic process (GO:0044267)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-substrate adhesion (GO:0010812)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.S103N(1)		NS(4)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	42						AGTGGGATCAGCATAGCCACC	0.577																																																1	Substitution - Missense(1)	ovary(1)	6											217.0	189.0	198.0					6																	30954260		2203	4300	6503	31062239	SO:0001583	missense	394263			AK056612	CCDS34388.1	6p21.33	2008-05-14	2008-05-14	2008-05-14	ENSG00000204544	ENSG00000204544		"""Mucins"""	21661	protein-coding gene	gene with protein product	"""epiglycanin"""		"""chromosome 6 open reading frame 205"""	C6orf205		17977904	Standard	NM_001010909		Approved	bCX31G15.2	uc003nsh.2	Q5SSG8	OTTHUMG00000031216	ENST00000376296.3:c.308G>A	6.37:g.30954260G>A	ENSP00000365473:p.Ser103Asn		31062239	B0UZT7|B4DQ55|C9JMK2|D9N007|Q0VGF1|Q3B7T2|Q5SS94|Q6UXC5	Missense_Mutation	SNP	ENST00000376296.3	37	CCDS34388.1	.	.	.	.	.	.	.	.	.	.	G	11.48	1.652768	0.29336	.	.	ENSG00000204544	ENST00000450707;ENST00000376296	T	0.03441	3.93	2.69	1.67	0.24075	.	.	.	.	.	T	0.02494	0.0076	L	0.29908	0.895	0.09310	N	1	D	0.65815	0.995	P	0.61003	0.882	T	0.50717	-0.8795	8	.	.	.	.	4.664	0.12657	0.0:0.2399:0.5149:0.2452	.	103	Q5SSG8	MUC21_HUMAN	N	103	ENSP00000365473:S103N	.	S	+	2	0	MUC21	31062239	0.000000	0.05858	0.005000	0.12908	0.015000	0.08874	-1.327000	0.02682	1.534000	0.49203	0.485000	0.47835	AGC		0.577	MUC21-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000128579.3	NM_001010909	
GPR141	353345	broad.mit.edu	37	7	37780789	37780789	+	Missense_Mutation	SNP	A	A	G			TCGA-25-2398-01A-01W-0799-08	TCGA-25-2398-10A-01W-0799-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	b4b3281b-5dfc-434d-a9a6-2c2d94123220	ba4008d0-ef83-4cba-af98-742284b48779	g.chr7:37780789A>G	ENST00000447769.1	+	4	1083	c.794A>G	c.(793-795)tAt>tGt	p.Y265C	GPR141_ENST00000461610.1_Intron|EPDR1_ENST00000476620.1_Intron|GPR141_ENST00000334425.1_Missense_Mutation_p.Y265C			Q7Z602	GP141_HUMAN	G protein-coupled receptor 141	265						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.Y265C(1)		NS(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(13)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						GTTGCATTTTATAACGAAATC	0.393																																																1	Substitution - Missense(1)	ovary(1)	7											158.0	153.0	154.0					7																	37780789		2203	4300	6503	37747314	SO:0001583	missense	353345			AY288420	CCDS5451.1	7p14.1	2012-08-21			ENSG00000187037	ENSG00000187037		"""GPCR / Class A : Orphans"""	19997	protein-coding gene	gene with protein product		609045				12679517, 14623098	Standard	NM_181791		Approved	PGR13	uc003tfm.1	Q7Z602	OTTHUMG00000102105	ENST00000447769.1:c.794A>G	7.37:g.37780789A>G	ENSP00000390410:p.Tyr265Cys		37747314	A4D1X7|Q0VAR5|Q86SP3	Missense_Mutation	SNP	ENST00000447769.1	37	CCDS5451.1	.	.	.	.	.	.	.	.	.	.	A	15.35	2.806083	0.50421	.	.	ENSG00000187037	ENST00000447769;ENST00000334425	T;T	0.38560	1.13;1.13	5.2	5.2	0.72013	GPCR, rhodopsin-like superfamily (1);	0.227139	0.36932	N	0.002340	T	0.58637	0.2136	M	0.68952	2.095	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	T	0.57991	-0.7715	10	0.40728	T	0.16	-24.8984	9.8243	0.40903	0.8467:0.0:0.0:0.1533	.	265	Q7Z602	GP141_HUMAN	C	265	ENSP00000390410:Y265C;ENSP00000334540:Y265C	ENSP00000334540:Y265C	Y	+	2	0	GPR141	37747314	0.997000	0.39634	0.998000	0.56505	0.755000	0.42902	6.306000	0.72810	2.324000	0.78689	0.533000	0.62120	TAT		0.393	GPR141-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219943.2	NM_181791	
MAGI2	9863	broad.mit.edu	37	7	77885616	77885616	+	Missense_Mutation	SNP	C	C	T			TCGA-25-2398-01A-01W-0799-08	TCGA-25-2398-10A-01W-0799-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	b4b3281b-5dfc-434d-a9a6-2c2d94123220	ba4008d0-ef83-4cba-af98-742284b48779	g.chr7:77885616C>T	ENST00000354212.4	-	10	1944	c.1691G>A	c.(1690-1692)cGg>cAg	p.R564Q	MAGI2_ENST00000522391.1_Missense_Mutation_p.R564Q|MAGI2_ENST00000419488.1_Missense_Mutation_p.R564Q|MAGI2_ENST00000535697.1_Missense_Mutation_p.R401Q|MAGI2_ENST00000536571.1_Missense_Mutation_p.R396Q	NM_012301.3	NP_036433.2	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 2	564					cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|glomerular visceral epithelial cell development (GO:0072015)|mitotic cell cycle arrest (GO:0071850)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein kinase B signaling (GO:0051898)|nerve growth factor signaling pathway (GO:0038180)|planar cell polarity pathway involved in axis elongation (GO:0003402)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of receptor internalization (GO:0002092)|protein heterooligomerization (GO:0051291)|receptor clustering (GO:0043113)|SMAD protein signal transduction (GO:0060395)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|late endosome (GO:0005770)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)|synapse (GO:0045202)|tight junction (GO:0005923)	beta-1 adrenergic receptor binding (GO:0031697)|phosphatase binding (GO:0019902)|receptor signaling complex scaffold activity (GO:0030159)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|type II activin receptor binding (GO:0070699)	p.R564Q(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(37)|ovary(5)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(3)	84		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				ATGAGGCGGCCGATCTGTTAT	0.502																																																1	Substitution - Missense(1)	ovary(1)	7											114.0	95.0	102.0					7																	77885616		2203	4300	6503	77723552	SO:0001583	missense	9863			AB014605	CCDS5594.1, CCDS75623.1	7q21	2005-08-09			ENSG00000187391	ENSG00000187391			18957	protein-coding gene	gene with protein product		606382				10681527, 9734811	Standard	XM_005250725		Approved	AIP1, ARIP1, KIAA0705, ACVRIP1, MAGI-2	uc003ugx.3	Q86UL8	OTTHUMG00000130697	ENST00000354212.4:c.1691G>A	7.37:g.77885616C>T	ENSP00000346151:p.Arg564Gln		77723552	A4D1C1|A7E2C3|O60434|O60510|Q86UI7|Q9NP44|Q9UDQ5|Q9UDU1	Missense_Mutation	SNP	ENST00000354212.4	37	CCDS5594.1	.	.	.	.	.	.	.	.	.	.	C	14.40	2.523655	0.44866	.	.	ENSG00000187391	ENST00000419488;ENST00000354212;ENST00000536298;ENST00000522391;ENST00000536571;ENST00000535697	T;T;T;T;T	0.10099	3.03;3.03;2.91;3.88;3.88	5.94	5.94	0.96194	.	0.000000	0.33217	U	0.005150	T	0.14313	0.0346	N	0.19112	0.55	0.58432	D	0.999992	D;B;B;B;B;D	0.71674	0.997;0.101;0.071;0.071;0.105;0.998	P;B;B;B;B;P	0.54590	0.756;0.1;0.004;0.006;0.019;0.703	T	0.14559	-1.0468	10	0.10636	T	0.68	.	19.3473	0.94370	0.0:1.0:0.0:0.0	.	401;396;564;564;564;564	F5GWH1;F5GWK7;B7Z4H4;E7EWI0;Q86UL8-2;Q86UL8	.;.;.;.;.;MAGI2_HUMAN	Q	564;564;564;564;396;401	ENSP00000405766:R564Q;ENSP00000346151:R564Q;ENSP00000428389:R564Q;ENSP00000441584:R396Q;ENSP00000441603:R401Q	ENSP00000346151:R564Q	R	-	2	0	MAGI2	77723552	0.987000	0.35691	1.000000	0.80357	0.990000	0.78478	2.625000	0.46452	2.816000	0.96949	0.561000	0.74099	CGG		0.502	MAGI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253197.3	NM_012301	
TRPV5	56302	broad.mit.edu	37	7	142625188	142625188	+	Silent	SNP	G	G	T			TCGA-25-2398-01A-01W-0799-08	TCGA-25-2398-10A-01W-0799-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	b4b3281b-5dfc-434d-a9a6-2c2d94123220	ba4008d0-ef83-4cba-af98-742284b48779	g.chr7:142625188G>T	ENST00000265310.1	-	7	1252	c.904C>A	c.(904-906)Cga>Aga	p.R302R	TRPV5_ENST00000442623.1_Silent_p.R302R	NM_019841.4	NP_062815.2	Q9NQA5	TRPV5_HUMAN	transient receptor potential cation channel, subfamily V, member 5	302					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|ion transmembrane transport (GO:0034220)|protein tetramerization (GO:0051262)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)	p.R302R(1)		NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(14)|lung(32)|ovary(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	67	Melanoma(164;0.059)					CATACCTCTCGTTTATCAGAG	0.527																																																1	Substitution - coding silent(1)	ovary(1)	7											109.0	92.0	98.0					7																	142625188		2203	4300	6503	142335310	SO:0001819	synonymous_variant	56302			AJ271207	CCDS5875.1	7q34	2013-01-10	2002-01-29	2002-02-01	ENSG00000127412	ENSG00000127412		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	3145	protein-coding gene	gene with protein product		606679	"""epithelial calcium channel 1"""	ECAC1		10944439, 10945469, 16382100	Standard	NM_019841		Approved	CaT2	uc003wby.1	Q9NQA5	OTTHUMG00000157157	ENST00000265310.1:c.904C>A	7.37:g.142625188G>T			142335310	A4D2H7|E9PBZ6|Q8N4C1|Q8NDW5|Q8NDX7|Q8NDX8|Q96PM6	Silent	SNP	ENST00000265310.1	37	CCDS5875.1																																																																																				0.527	TRPV5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347660.1	NM_019841	
ZNF212	7988	broad.mit.edu	37	7	148951470	148951470	+	Silent	SNP	G	G	A			TCGA-25-2398-01A-01W-0799-08	TCGA-25-2398-10A-01W-0799-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	b4b3281b-5dfc-434d-a9a6-2c2d94123220	ba4008d0-ef83-4cba-af98-742284b48779	g.chr7:148951470G>A	ENST00000335870.2	+	5	1580	c.1452G>A	c.(1450-1452)ctG>ctA	p.L484L		NM_012256.3	NP_036388.2	Q9UDV6	ZN212_HUMAN	zinc finger protein 212	484					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|zinc ion binding (GO:0008270)	p.L484L(1)		endometrium(2)|kidney(1)|large_intestine(4)|ovary(1)|prostate(1)	9	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00171)			GGGGTGGGCTGGCCCTGGAGC	0.652																																																1	Substitution - coding silent(1)	ovary(1)	7											32.0	36.0	35.0					7																	148951470		2203	4300	6503	148582403	SO:0001819	synonymous_variant	7988			U38864	CCDS5896.1	7q36.1	2013-01-08			ENSG00000170260	ENSG00000170260		"""Zinc fingers, C2H2-type"", ""-"""	13004	protein-coding gene	gene with protein product		602386				9169157	Standard	NM_012256		Approved	C2H2-150	uc003wfp.3	Q9UDV6	OTTHUMG00000158968	ENST00000335870.2:c.1452G>A	7.37:g.148951470G>A			148582403	B2RCF4|Q13396|Q8N664	Silent	SNP	ENST00000335870.2	37	CCDS5896.1																																																																																				0.652	ZNF212-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352710.1	NM_012256	
ARMCX2	9823	broad.mit.edu	37	X	100912140	100912140	+	Silent	SNP	C	C	T			TCGA-25-2398-01A-01W-0799-08	TCGA-25-2398-10A-01W-0799-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	b4b3281b-5dfc-434d-a9a6-2c2d94123220	ba4008d0-ef83-4cba-af98-742284b48779	g.chrX:100912140C>T	ENST00000328766.5	-	5	888	c.435G>A	c.(433-435)gtG>gtA	p.V145V	ARMCX2_ENST00000467416.1_5'Flank|ARMCX2_ENST00000330154.2_Silent_p.V145V|ARMCX2_ENST00000356824.4_Silent_p.V145V	NM_014782.5	NP_055597.1	Q7L311	ARMX2_HUMAN	armadillo repeat containing, X-linked 2	145	Ala-rich.					integral component of membrane (GO:0016021)		p.V145V(1)		NS(1)|breast(4)|endometrium(3)|kidney(1)|large_intestine(2)|lung(10)|ovary(6)|prostate(1)|skin(1)	29						GGGCCTCTGTCACCCCGGGAG	0.637																																																1	Substitution - coding silent(1)	ovary(1)	X											33.0	35.0	35.0					X																	100912140		2203	4297	6500	100798796	SO:0001819	synonymous_variant	9823			AB011084	CCDS14490.1	Xq21.33-q22.2	2014-03-21			ENSG00000184867	ENSG00000184867		"""Armadillo repeat containing"""	16869	protein-coding gene	gene with protein product		300363				9628581, 11162520, 16221301, 22569362	Standard	XM_005278109		Approved	ALEX2, KIAA0512, GASP9	uc004eif.3	Q7L311	OTTHUMG00000022038	ENST00000328766.5:c.435G>A	X.37:g.100912140C>T			100798796	O60267|Q5H9D9	Silent	SNP	ENST00000328766.5	37	CCDS14490.1																																																																																				0.637	ARMCX2-011	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057586.1	NM_014782	
