#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	SNP	G	G	A			TCGA-29-1688-01A-01W-0633-09	TCGA-29-1688-10A-01W-0633-09	G	G					Unknown	Invalid:failed_liftOver	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	083e3d14-3756-4101-a93d-bc76f2c0d59c	e4318781-2a5f-412b-aaa5-74827d79a63d	g.chrUnknown:0G>A								None (None upstream) : None (None downstream)																								0.0																																																0			MT																																								3746	SO:0001628	intergenic_variant	4535																															Unknown.37:g.0G>A			3746		Missense_Mutation	SNP	HMMPfam_NADHdh,PatternScan_COMPLEX1_ND1_1,PatternScan_COMPLEX1_ND1_2	p.A147T		37	c.439		MT																																																																																			-	HMMPfam_NADHdh	0	0					MT-ND1			G			3746	+1	no_errors	ENST00000361390	ensembl	human	known	54_36p	missense	SNP	NULL	A
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	SNP	G	G	A			TCGA-29-1688-01A-01W-0633-09	TCGA-29-1688-10A-01W-0633-09	G	G					Unknown	Invalid:failed_liftOver	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	083e3d14-3756-4101-a93d-bc76f2c0d59c	e4318781-2a5f-412b-aaa5-74827d79a63d	g.chrUnknown:0G>A								None (None upstream) : None (None downstream)																								0.0																																																0			MT																																								14961	SO:0001628	intergenic_variant	4519																															Unknown.37:g.0G>A			14961		Missense_Mutation	SNP	superfamily_Transmembr_di-haem_cytochrome,HMMPfam_Cytochrom_B_N,HMMPfam_Cytochrom_B_C,superfamily_Cytochrome_b/b6_C	p.D72N		37	c.214		MT																																																																																			-	superfamily_Transmembr_di-haem_cytochrome,HMMPfam_Cytochrom_B_N	0	0					MT-CYB			G			14961	+1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000361789	ensembl	human	known	54_36p	missense	SNP	NULL	A
KRTAP5-5	439915	genome.wustl.edu	37	11	1651411	1651411	+	Missense_Mutation	SNP	G	G	T	rs80015637	byFrequency	TCGA-29-1688-01A-01W-0633-09	TCGA-29-1688-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	083e3d14-3756-4101-a93d-bc76f2c0d59c	e4318781-2a5f-412b-aaa5-74827d79a63d	g.chr11:1651411G>T	ENST00000399676.2	+	1	379	c.341G>T	c.(340-342)gGg>gTg	p.G114V		NM_001001480.2	NP_001001480.2	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	114	8 X 4 AA repeats of C-C-X-P.			Missing (in Ref. 1; BAD20201 and 2; CAF31639). {ECO:0000305}.		keratin filament (GO:0045095)				endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|urinary_tract(1)	33		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		TCCTGTGGGGGGTCCAAGGGG	0.701																																																0			11																																								1607987	SO:0001583	missense	439915			AB125074	CCDS41592.1	11p15.5	2008-10-30			ENSG00000185940	ENSG00000185940		"""Keratin associated proteins"""	23601	protein-coding gene	gene with protein product						15144888	Standard	NM_001001480		Approved	KRTAP5.5, KRTAP5-11	uc001lty.3	Q701N2	OTTHUMG00000057554	ENST00000399676.2:c.341G>T	11.37:g.1651411G>T	ENSP00000382584:p.Gly114Val		1607987	A8MWN2	Missense_Mutation	SNP	PatternScan_MOLYBDOPTERIN_PROK_1,PatternScan_2FE2S_FER_1	p.G114V	ENST00000399676.2	37	c.341	CCDS41592.1	11	.	.	.	.	.	.	.	.	.	.	G	2.185	-0.386757	0.04966	.	.	ENSG00000185940	ENST00000399676;ENST00000422553	T	0.01414	4.92	3.47	3.47	0.39725	.	.	.	.	.	T	0.06600	0.0169	M	0.85859	2.78	0.43745	D	0.996244	D	0.65815	0.995	P	0.57776	0.827	T	0.04053	-1.0981	9	0.59425	D	0.04	.	10.523	0.44931	0.0:0.0:1.0:0.0	.	114	Q701N2	KRA55_HUMAN	V	114;85	ENSP00000382584:G114V	ENSP00000382584:G114V	G	+	2	0	KRTAP5-5	1607987	0.833000	0.29383	0.967000	0.41034	0.024000	0.10985	0.668000	0.25127	1.506000	0.48736	0.418000	0.28097	GGG	-	NULL		0.701	KRTAP5-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP5-5	protein_coding	OTTHUMT00000127919.1	G			1607987	+1	no_errors	NM_001001480	genbank	human	validated	54_36p	missense	SNP	0.325	T
TP53	7157	genome.wustl.edu	37	17	7577105	7577105	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1688-01A-01W-0633-09	TCGA-29-1688-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	083e3d14-3756-4101-a93d-bc76f2c0d59c	e4318781-2a5f-412b-aaa5-74827d79a63d	g.chr17:7577105G>A	ENST00000269305.4	-	8	1022	c.833C>T	c.(832-834)cCt>cTt	p.P278L	TP53_ENST00000359597.4_Missense_Mutation_p.P278L|TP53_ENST00000420246.2_Missense_Mutation_p.P278L|TP53_ENST00000445888.2_Missense_Mutation_p.P278L|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Intron|TP53_ENST00000455263.2_Missense_Mutation_p.P278L	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	278	Interaction with AXIN1. {ECO:0000250}.|Interaction with DNA.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		P -> A (in sporadic cancers; somatic mutation; dbSNP:rs17849781). {ECO:0000269|PubMed:15489334}.|P -> F (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|P -> H (in sporadic cancers; somatic mutation).|P -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:2263646}.|P -> R (in sporadic cancers; somatic mutation).|P -> S (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:2263646, ECO:0000269|PubMed:9450901}.|P -> T (in LFS; germline mutation and in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.P278L(61)|p.P278R(30)|p.P278H(13)|p.0?(8)|p.P278F(3)|p.?(2)|p.P278fs*67(2)|p.A276_R283delACPGRDRR(1)|p.C275fs*20(1)|p.A276fs*64(1)|p.L265_K305del41(1)|p.F270_D281del12(1)|p.V274_P278del(1)|p.S269fs*21(1)|p.V272_K292del21(1)|p.C275_R283delCACPGRDRR(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GTCTCTCCCAGGACAGGCACA	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	128	Substitution - Missense(107)|Whole gene deletion(8)|Deletion - In frame(6)|Deletion - Frameshift(5)|Unknown(2)	large_intestine(18)|lung(17)|skin(15)|upper_aerodigestive_tract(12)|haematopoietic_and_lymphoid_tissue(11)|breast(9)|kidney(8)|central_nervous_system(7)|oesophagus(7)|ovary(7)|stomach(4)|bone(4)|liver(3)|soft_tissue(2)|thyroid(1)|prostate(1)|urinary_tract(1)|autonomic_ganglia(1)	17	GRCh37	CM961376	TP53	M							72.0	63.0	66.0					17																	7577105		2203	4300	6503	7517830	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.833C>T	17.37:g.7577105G>A	ENSP00000269305:p.Pro278Leu		7517830	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	HMMPfam_P53_TAD,HMMPfam_P53,superfamily_p53-like transcription factors,PatternScan_P53,HMMPfam_P53_tetramer,superfamily_p53 tetramerization domain	p.P278L	ENST00000269305.4	37	c.833	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	G	27.3	4.814432	0.90790	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99885	-7.5;-7.5;-7.5;-7.5;-7.5;-7.5	5.13	4.16	0.48862	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.050655	0.85682	N	0.000000	D	0.99891	0.9948	M	0.92459	3.31	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.96442	0.9327	10	0.87932	D	0	-13.7877	11.4227	0.49991	0.0873:0.0:0.9127:0.0	.	278;278;278;278	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	L	278;278;278;278;278;267;146	ENSP00000352610:P278L;ENSP00000269305:P278L;ENSP00000398846:P278L;ENSP00000391127:P278L;ENSP00000391478:P278L;ENSP00000425104:P146L	ENSP00000269305:P278L	P	-	2	0	TP53	7517830	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.573000	0.98181	1.392000	0.46585	0.462000	0.41574	CCT	-	HMMPfam_P53,superfamily_p53-like transcription factors		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	G	NM_000546		7517830	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
CCDC159	126075	genome.wustl.edu	37	19	11462734	11462734	+	Splice_Site	SNP	A	A	C			TCGA-29-1688-01A-01W-0633-09	TCGA-29-1688-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	083e3d14-3756-4101-a93d-bc76f2c0d59c	e4318781-2a5f-412b-aaa5-74827d79a63d	g.chr19:11462734A>C	ENST00000588790.1	+	9	939	c.492A>C	c.(490-492)caA>caC	p.Q164H	CCDC159_ENST00000458408.1_Splice_Site_p.Q164H			P0C7I6	CC159_HUMAN	coiled-coil domain containing 159	279										endometrium(1)|large_intestine(1)|lung(2)|ovary(1)	5						CCTCCACAGAAGCGCAGGAGG	0.562																																																0			19											59.0	62.0	61.0					19																	11462734		1946	4125	6071	11323734	SO:0001630	splice_region_variant	126075			BC038439	CCDS45976.1	19p13.2	2010-02-17			ENSG00000183401	ENSG00000183401			26996	protein-coding gene	gene with protein product							Standard	NM_001080503		Approved		uc010xlt.2	P0C7I6		ENST00000588790.1:c.491-1A>C	19.37:g.11462734A>C			11323734	B4DEG3|B4DWR8|B4E133|B7ZAM4	Missense_Mutation	SNP	NULL	p.Q241H	ENST00000588790.1	37	c.723	CCDS45976.1	19	.	.	.	.	.	.	.	.	.	.	A	13.58	2.279880	0.40294	.	.	ENSG00000183401	ENST00000458408;ENST00000427879	T	0.54866	0.55	4.94	-1.44	0.08856	.	.	.	.	.	T	0.60274	0.2256	L	0.59436	1.845	0.09310	N	0.999999	D;D;D	0.76494	0.999;0.994;0.994	D;P;P	0.70935	0.971;0.896;0.896	T	0.49844	-0.8896	9	0.49607	T	0.09	.	4.9876	0.14198	0.4452:0.1516:0.4033:0.0	.	279;279;164	P0C7I6;P0C7I6-4;P0C7I6-2	CC159_HUMAN;.;.	H	164;279	ENSP00000402239:Q164H	ENSP00000390400:Q279H	Q	+	3	2	CCDC159	11323734	0.258000	0.24033	0.243000	0.24186	0.028000	0.11728	0.105000	0.15333	0.147000	0.19030	-0.262000	0.10625	CAA	-	NULL		0.562	CCDC159-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC126075	protein_coding	OTTHUMT00000458761.1	A	NM_001080503	Missense_Mutation	11323734	+1	no_errors	NM_001080503	genbank	human	validated	54_36p	missense	SNP	0.002	C
GAB4	128954	genome.wustl.edu	37	22	17450977	17450977	+	Missense_Mutation	SNP	C	C	T			TCGA-29-1688-01A-01W-0633-09	TCGA-29-1688-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	083e3d14-3756-4101-a93d-bc76f2c0d59c	e4318781-2a5f-412b-aaa5-74827d79a63d	g.chr22:17450977C>T	ENST00000400588.1	-	4	900	c.793G>A	c.(793-795)Ggt>Agt	p.G265S	GAB4_ENST00000523144.1_Intron	NM_001037814.1	NP_001032903.1	Q2WGN9	GAB4_HUMAN	GRB2-associated binding protein family, member 4	265										breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(24)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	44		all_epithelial(15;0.112)|Lung NSC(13;0.248)				TGGATGTGACCGCTGACCCCA	0.557																																																0			22											88.0	99.0	96.0					22																	17450977		2195	4298	6493	15830977	SO:0001583	missense	128954			AK057252	CCDS42976.1	22q11.2	2013-01-10			ENSG00000215568	ENSG00000215568		"""Pleckstrin homology (PH) domain containing"""	18325	protein-coding gene	gene with protein product							Standard	NM_001037814		Approved		uc002zlw.3	Q2WGN9	OTTHUMG00000149992	ENST00000400588.1:c.793G>A	22.37:g.17450977C>T	ENSP00000383431:p.Gly265Ser		15830977		Missense_Mutation	SNP	superfamily_SSF50729,HMMPfam_PH,HMMSmart_PH	p.G265S	ENST00000400588.1	37	c.793	CCDS42976.1	22	.	.	.	.	.	.	.	.	.	.	C	6.444	0.449970	0.12223	.	.	ENSG00000215568	ENST00000400588	T	0.31510	1.49	1.97	0.86	0.19042	.	0.188749	0.46145	N	0.000304	T	0.17789	0.0427	L	0.42245	1.32	0.26359	N	0.977071	P	0.39181	0.663	B	0.28638	0.092	T	0.12066	-1.0562	10	0.39692	T	0.17	.	6.9692	0.24639	0.0:0.8386:0.0:0.1614	.	265	Q2WGN9	GAB4_HUMAN	S	265	ENSP00000383431:G265S	ENSP00000383431:G265S	G	-	1	0	GAB4	15830977	0.766000	0.28496	0.473000	0.27253	0.028000	0.11728	1.424000	0.34848	0.343000	0.23821	0.411000	0.27672	GGT	-	NULL		0.557	GAB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GAB4	protein_coding	OTTHUMT00000315426.1	C	XM_372882		15830977	-1	no_errors	NM_001037814	genbank	human	provisional	54_36p	missense	SNP	0.913	T
PTPN5	84867	genome.wustl.edu	37	11	18764903	18764903	+	Missense_Mutation	SNP	G	G	C			TCGA-29-1688-01A-01W-0633-09	TCGA-29-1688-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	083e3d14-3756-4101-a93d-bc76f2c0d59c	e4318781-2a5f-412b-aaa5-74827d79a63d	g.chr11:18764903G>C	ENST00000358540.2	-	5	795	c.365C>G	c.(364-366)tCt>tGt	p.S122C	PTPN5_ENST00000396167.2_Intron|PTPN5_ENST00000396171.4_Missense_Mutation_p.S122C|PTPN5_ENST00000396168.1_Missense_Mutation_p.S98C|PTPN5_ENST00000396170.1_Intron|PTPN5_ENST00000496201.2_5'UTR|RP11-1081L13.4_ENST00000527285.1_RNA|PTPN5_ENST00000477854.1_5'UTR	NM_006906.1	NP_008837.1	P54829	PTN5_HUMAN	protein tyrosine phosphatase, non-receptor type 5 (striatum-enriched)	122					peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	phosphotyrosine binding (GO:0001784)|protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(13)|ovary(2)|prostate(1)|skin(4)	27						CGTCAGCAAAGAGGAGACGAG	0.592																																																0			11											142.0	137.0	139.0					11																	18764903		2199	4293	6492	18721479	SO:0001583	missense	84867			BC064807	CCDS7845.1, CCDS41626.1, CCDS60746.1	11p15.1	2011-06-09			ENSG00000110786	ENSG00000110786		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9657	protein-coding gene	gene with protein product		176879				1714595	Standard	NM_001278236		Approved	STEP, PTPSTEP	uc001mpc.4	P54829	OTTHUMG00000134304	ENST00000358540.2:c.365C>G	11.37:g.18764903G>C	ENSP00000351342:p.Ser122Cys		18721479	B3KXG7|B7Z386|B7ZAF5|D3DQY7|Q6P1Z2|Q8N2A1|Q8NDP8	Missense_Mutation	SNP	superfamily_(Phosphotyrosine protein) phosphatases II,HMMSmart_SM00194,HMMPfam_Y_phosphatase,HMMSmart_SM00404,PatternScan_TYR_PHOSPHATASE_1	p.S122C	ENST00000358540.2	37	c.365	CCDS7845.1	11	.	.	.	.	.	.	.	.	.	.	G	8.198	0.797596	0.16327	.	.	ENSG00000110786	ENST00000358540;ENST00000396171;ENST00000396168	T;T;T	0.04049	3.72;3.72;3.73	3.78	3.78	0.43462	.	0.271849	0.26654	N	0.023185	T	0.03434	0.0099	N	0.19112	0.55	0.58432	D	0.999997	P	0.40000	0.698	B	0.34038	0.174	T	0.52563	-0.8559	10	0.66056	D	0.02	.	11.3268	0.49452	0.0:0.0:1.0:0.0	.	122	P54829	PTN5_HUMAN	C	122;122;98	ENSP00000351342:S122C;ENSP00000379474:S122C;ENSP00000379471:S98C	ENSP00000351342:S122C	S	-	2	0	PTPN5	18721479	0.999000	0.42202	0.096000	0.21009	0.057000	0.15508	3.945000	0.56637	2.113000	0.64589	0.561000	0.74099	TCT	-	NULL		0.592	PTPN5-001	KNOWN	basic|CCDS	protein_coding	PTPN5	protein_coding	OTTHUMT00000259196.2	G	NM_001039970		18721479	-1	no_errors	NM_006906	genbank	human	validated	54_36p	missense	SNP	0.056	C
TFIP11	24144	genome.wustl.edu	37	22	26892055	26892055	+	Silent	SNP	G	G	A			TCGA-29-1688-01A-01W-0633-09	TCGA-29-1688-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	083e3d14-3756-4101-a93d-bc76f2c0d59c	e4318781-2a5f-412b-aaa5-74827d79a63d	g.chr22:26892055G>A	ENST00000407690.1	-	12	2116	c.1833C>T	c.(1831-1833)aaC>aaT	p.N611N	TFIP11_ENST00000405938.1_Silent_p.N611N|TFIP11_ENST00000407431.1_Silent_p.N611N|TFIP11_ENST00000407148.1_Silent_p.N611N	NM_012143.2	NP_036275.1	Q9UBB9	TFP11_HUMAN	tuftelin interacting protein 11	611					biomineral tissue development (GO:0031214)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|RNA processing (GO:0006396)|spliceosomal complex disassembly (GO:0000390)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|proteinaceous extracellular matrix (GO:0005578)|spliceosomal complex (GO:0005681)|U2-type post-mRNA release spliceosomal complex (GO:0071008)	DNA binding (GO:0003677)			breast(1)|endometrium(5)|kidney(2)|large_intestine(5)|liver(1)|lung(7)|prostate(2)|skin(1)|urinary_tract(1)	25						TGGGCACTATGTTTTTGACCA	0.527																																																0			22											219.0	225.0	223.0					22																	26892055		2203	4300	6503	25222055	SO:0001819	synonymous_variant	24144			AL050258	CCDS13838.1	22q12.1	2013-01-28			ENSG00000100109	ENSG00000100109		"""G patch domain containing"""	17165	protein-coding gene	gene with protein product		612747				10806191, 11230166	Standard	NM_012143		Approved	TIP39, DKFZP434B194, Spp382	uc003acs.2	Q9UBB9	OTTHUMG00000150883	ENST00000407690.1:c.1833C>T	22.37:g.26892055G>A			25222055	O95908|Q20WL0|Q5H8V8|Q9UGV7|Q9Y2Q8	Silent	SNP	HMMSmart_SM00443,HMMPfam_G-patch,HMMPfam_TFP11	p.N611	ENST00000407690.1	37	c.1833	CCDS13838.1	22																																																																																			-	HMMPfam_TFP11		0.527	TFIP11-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TFIP11	protein_coding	OTTHUMT00000320750.1	G	NM_001008697		25222055	-1	no_errors	NM_001008697	genbank	human	validated	54_36p	silent	SNP	1.000	A
NIPSNAP1	8508	genome.wustl.edu	37	22	29954897	29954897	+	Nonsense_Mutation	SNP	C	C	T			TCGA-29-1688-01A-01W-0633-09	TCGA-29-1688-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	083e3d14-3756-4101-a93d-bc76f2c0d59c	e4318781-2a5f-412b-aaa5-74827d79a63d	g.chr22:29954897C>T	ENST00000216121.7	-	9	1006	c.752G>A	c.(751-753)tGg>tAg	p.W251*		NM_001202502.1|NM_003634.3	NP_001189431.1|NP_003625.2	Q9BPW8	NIPS1_HUMAN	nipsnap homolog 1 (C. elegans)	251					sensory perception of pain (GO:0019233)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|synaptic membrane (GO:0097060)	neurotransmitter binding (GO:0042165)			large_intestine(2)|lung(2)|skin(1)	5						TCTCTTCCTCCAGGCAGCGTT	0.532																																																0			22											120.0	107.0	111.0					22																	29954897		2203	4300	6503	28284897	SO:0001587	stop_gained	8508			AJ001258	CCDS13860.1	22q12	2013-09-12	2001-11-28		ENSG00000184117	ENSG00000184117			7827	protein-coding gene	gene with protein product	"""4-nitrophenylphosphatase domain and non-neuronal SNAP25-like 1"""	603249	"""NIPSNAP, C. elegans, homolog 1"""			9661659	Standard	NM_003634		Approved		uc003afx.4	Q9BPW8	OTTHUMG00000151294	ENST00000216121.7:c.752G>A	22.37:g.29954897C>T	ENSP00000216121:p.Trp251*		28284897	B2RAY3|O43800	Nonsense_Mutation	SNP	HMMPfam_NIPSNAP	p.W251*	ENST00000216121.7	37	c.752	CCDS13860.1	22	.	.	.	.	.	.	.	.	.	.	C	37	6.547481	0.97654	.	.	ENSG00000184117	ENST00000216121	.	.	.	4.59	4.59	0.56863	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-13.0099	17.5802	0.87965	0.0:1.0:0.0:0.0	.	.	.	.	X	251	.	ENSP00000216121:W251X	W	-	2	0	NIPSNAP1	28284897	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.288000	0.78691	2.570000	0.86706	0.555000	0.69702	TGG	-	HMMPfam_NIPSNAP		0.532	NIPSNAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NIPSNAP1	protein_coding	OTTHUMT00000322117.1	C			28284897	-1	no_errors	NM_003634	genbank	human	reviewed	54_36p	nonsense	SNP	1.000	T
XDH	7498	genome.wustl.edu	37	2	31596748	31596748	+	Missense_Mutation	SNP	C	C	A	rs183162063		TCGA-29-1688-01A-01W-0633-09	TCGA-29-1688-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	083e3d14-3756-4101-a93d-bc76f2c0d59c	e4318781-2a5f-412b-aaa5-74827d79a63d	g.chr2:31596748C>A	ENST00000379416.3	-	16	1725	c.1677G>T	c.(1675-1677)caG>caT	p.Q559H		NM_000379.3	NP_000370.2	P47989	XDH_HUMAN	xanthine dehydrogenase	559					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|lactation (GO:0007595)|negative regulation of endothelial cell differentiation (GO:0045602)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of gene expression (GO:0010629)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|negative regulation of vasculogenesis (GO:2001213)|nucleobase-containing small molecule metabolic process (GO:0055086)|positive regulation of p38MAPK cascade (GO:1900745)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|small molecule metabolic process (GO:0044281)|xanthine catabolic process (GO:0009115)	cytosol (GO:0005829)|extracellular space (GO:0005615)|peroxisome (GO:0005777)	2 iron, 2 sulfur cluster binding (GO:0051537)|electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|iron ion binding (GO:0005506)|molybdopterin cofactor binding (GO:0043546)|protein homodimerization activity (GO:0042803)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)|xanthine dehydrogenase activity (GO:0004854)|xanthine oxidase activity (GO:0004855)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(31)|ovary(1)|pancreas(1)|prostate(3)|skin(9)|urinary_tract(1)	74	Acute lymphoblastic leukemia(172;0.155)				Aldesleukin(DB00041)|Allopurinol(DB00437)|Azathioprine(DB00993)|Carboplatin(DB00958)|Carvedilol(DB01136)|Chlorphenesin(DB00856)|Cisplatin(DB00515)|Daunorubicin(DB00694)|Deferoxamine(DB00746)|Doxorubicin(DB00997)|Flavin adenine dinucleotide(DB03147)|L-Carnitine(DB00583)|Menadione(DB00170)|Mercaptopurine(DB01033)|Nitrofural(DB00336)|Procarbazine(DB01168)|Pyrazinamide(DB00339)|Spermine(DB00127)|Trifluoperazine(DB00831)	CTTGGAAGAGCTGGACATCGG	0.498													C|||	1	0.000199681	0.0	0.0	5008	,	,		18590	0.001		0.0	False		,,,				2504	0.0				Colon(66;682 1445 30109 40147)											0			2											48.0	46.0	47.0					2																	31596748		2203	4300	6503	31450252	SO:0001583	missense	7498			D11456	CCDS1775.1	2p23.1	2009-07-10	2003-03-20		ENSG00000158125	ENSG00000158125	1.17.1.4		12805	protein-coding gene	gene with protein product		607633	"""xanthene dehydrogenase"""			8224915	Standard	NM_000379		Approved	XOR, XO	uc002rnv.1	P47989	OTTHUMG00000099385	ENST00000379416.3:c.1677G>T	2.37:g.31596748C>A	ENSP00000368727:p.Gln559His		31450252	Q16681|Q16712|Q4PJ16	Missense_Mutation	SNP	superfamily_Ferredoxin,HMMPfam_Fer2,PatternScan_2FE2S_FER_1,HMMPfam_Fer2_2,superfamily_2Fe-2S_bind,superfamily_FAD-binding_2,HMMPfam_FAD_binding_5,superfamily_CO_deh_flav_C,HMMPfam_CO_deh_flav_C,superfamily_Aldxan_dh_hamm,HMMPfam_Ald_Xan_dh_C,superfamily_Ald_xan_DH_mo_bd,HMMPfam_Ald_Xan_dh_C2,PatternScan_MOLYBDOPTERIN_EUK	p.Q559H	ENST00000379416.3	37	c.1677	CCDS1775.1	2	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	8.380	0.837375	0.16891	.	.	ENSG00000158125	ENST00000379416	T	0.11712	2.75	5.75	4.88	0.63580	Aldehyde oxidase/xanthine dehydrogenase, a/b hammerhead (1);	0.160911	0.56097	N	0.000026	T	0.22166	0.0534	M	0.90309	3.105	0.58432	D	0.999998	B	0.10296	0.003	B	0.15052	0.012	T	0.02220	-1.1193	10	0.72032	D	0.01	.	12.8994	0.58117	0.1197:0.8144:0.0:0.0659	.	559	P47989	XDH_HUMAN	H	559	ENSP00000368727:Q559H	ENSP00000368727:Q559H	Q	-	3	2	XDH	31450252	1.000000	0.71417	1.000000	0.80357	0.115000	0.19883	1.228000	0.32588	0.787000	0.33731	-0.808000	0.03180	CAG	-	superfamily_Aldxan_dh_hamm		0.498	XDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XDH	protein_coding	OTTHUMT00000216840.1	C	NM_000379		31450252	-1	no_errors	NM_000379	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
MOCOS	55034	genome.wustl.edu	37	18	33785064	33785064	+	Missense_Mutation	SNP	A	A	G			TCGA-29-1688-01A-01W-0633-09	TCGA-29-1688-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	083e3d14-3756-4101-a93d-bc76f2c0d59c	e4318781-2a5f-412b-aaa5-74827d79a63d	g.chr18:33785064A>G	ENST00000261326.5	+	6	1064	c.1043A>G	c.(1042-1044)cAc>cGc	p.H348R		NM_017947.2	NP_060417.2			molybdenum cofactor sulfurase											breast(2)|endometrium(5)|kidney(1)|large_intestine(10)|liver(1)|lung(15)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	43						ATAAAGCAGCACACCTTCACC	0.423																																																0			18											95.0	87.0	90.0					18																	33785064		2203	4300	6503	32039062	SO:0001583	missense	55034			AK000740	CCDS11919.1	18q12	2003-12-18			ENSG00000075643	ENSG00000075643			18234	protein-coding gene	gene with protein product		613274				11302742	Standard	NM_017947		Approved	HMCS, FLJ20733, MOS	uc002kzq.4	Q96EN8	OTTHUMG00000132590	ENST00000261326.5:c.1043A>G	18.37:g.33785064A>G	ENSP00000261326:p.His348Arg		32039062		Missense_Mutation	SNP	superfamily_PLP-dependent transferases,HMMPfam_Aminotran_5,superfamily_PK beta-barrel domain-like,HMMPfam_MOSC_N,HMMPfam_MOSC	p.H348R	ENST00000261326.5	37	c.1043	CCDS11919.1	18	.	.	.	.	.	.	.	.	.	.	A	16.07	3.017709	0.54576	.	.	ENSG00000075643	ENST00000261326	T	0.25579	1.79	5.89	5.89	0.94794	Pyridoxal phosphate-dependent transferase, major domain (1);Aminotransferase, class V/Cysteine desulfurase (1);	0.000000	0.85682	D	0.000000	T	0.38134	0.1029	L	0.48986	1.54	0.50813	D	0.999898	P	0.45902	0.868	P	0.53518	0.728	T	0.04509	-1.0946	10	0.40728	T	0.16	-29.9737	14.2667	0.66123	1.0:0.0:0.0:0.0	.	348	Q96EN8	MOCOS_HUMAN	R	348	ENSP00000261326:H348R	ENSP00000261326:H348R	H	+	2	0	MOCOS	32039062	1.000000	0.71417	1.000000	0.80357	0.048000	0.14542	9.185000	0.94900	2.247000	0.74100	0.523000	0.50628	CAC	-	superfamily_PLP-dependent transferases,HMMPfam_Aminotran_5		0.423	MOCOS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MOCOS	protein_coding	OTTHUMT00000255801.1	A			32039062	+1	no_errors	NM_017947	genbank	human	validated	54_36p	missense	SNP	1.000	G
VCP	7415	genome.wustl.edu	37	9	35067954	35067954	+	Missense_Mutation	SNP	T	T	A			TCGA-29-1688-01A-01W-0633-09	TCGA-29-1688-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	083e3d14-3756-4101-a93d-bc76f2c0d59c	e4318781-2a5f-412b-aaa5-74827d79a63d	g.chr9:35067954T>A	ENST00000358901.6	-	3	1131	c.236A>T	c.(235-237)gAt>gTt	p.D79V		NM_007126.3	NP_009057.1	P55072	TERA_HUMAN	valosin containing protein	79					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|aggresome assembly (GO:0070842)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER to Golgi vesicle-mediated transport (GO:0006888)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|establishment of protein localization (GO:0045184)|positive regulation of Lys63-specific deubiquitinase activity (GO:1903007)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of protein K63-linked deubiquitination (GO:1903006)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein homooligomerization (GO:0051260)|protein N-linked glycosylation via asparagine (GO:0018279)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|retrograde protein transport, ER to cytosol (GO:0030970)|translesion synthesis (GO:0019985)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|Hrd1p ubiquitin ligase complex (GO:0000836)|intracellular membrane-bounded organelle (GO:0043231)|lipid particle (GO:0005811)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|proteasome complex (GO:0000502)|site of double-strand break (GO:0035861)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|deubiquitinase activator activity (GO:0035800)|lipid binding (GO:0008289)|poly(A) RNA binding (GO:0044822)|polyubiquitin binding (GO:0031593)|protein domain specific binding (GO:0019904)|protein phosphatase binding (GO:0019903)|ubiquitin-specific protease binding (GO:1990381)			breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	24			LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)			AATCTTCTCATCAGAACAAGT	0.463																																																0			9											154.0	131.0	139.0					9																	35067954		2203	4300	6503	35057954	SO:0001583	missense	7415			AC004472	CCDS6573.1	9p13.3	2014-09-17	2011-01-25		ENSG00000165280	ENSG00000165280		"""ATPases / AAA-type"""	12666	protein-coding gene	gene with protein product		601023	"""valosin-containing protein"""			8595912, 7553851	Standard	NM_007126		Approved	IBMPFD, p97	uc003zvy.2	P55072	OTTHUMG00000019855	ENST00000358901.6:c.236A>T	9.37:g.35067954T>A	ENSP00000351777:p.Asp79Val		35057954	B2R5T8|Q0V924|Q2TAI5|Q969G7|Q9UCD5	Missense_Mutation	SNP	superfamily_ADC-like,HMMPfam_CDC48_N,superfamily_Cdc48 domain 2-like,HMMPfam_CDC48_2,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00382,HMMPfam_AAA,PatternScan_AAA	p.D79V	ENST00000358901.6	37	c.236	CCDS6573.1	9	.	.	.	.	.	.	.	.	.	.	T	16.56	3.157026	0.57259	.	.	ENSG00000165280	ENST00000358901;ENST00000448530;ENST00000417448	D;D;D	0.82893	-1.66;-1.66;-1.66	5.73	5.73	0.89815	ATPase, AAA-type, VAT, N-terminal (1);Aspartate decarboxylase-like fold (2);	0.000000	0.85682	D	0.000000	D	0.84665	0.5522	M	0.83012	2.62	0.80722	D	1	B	0.23806	0.091	B	0.21917	0.037	T	0.82358	-0.0497	10	0.45353	T	0.12	-37.9873	16.0173	0.80450	0.0:0.0:0.0:1.0	.	79	P55072	TERA_HUMAN	V	79;34;34	ENSP00000351777:D79V;ENSP00000392088:D34V;ENSP00000399456:D34V	ENSP00000351777:D79V	D	-	2	0	VCP	35057954	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.922000	0.87538	2.181000	0.69327	0.533000	0.62120	GAT	-	superfamily_ADC-like,HMMPfam_CDC48_N		0.463	VCP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VCP	protein_coding	OTTHUMT00000052290.1	T	NM_007126		35057954	-1	no_errors	NM_007126	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
SPG11	80208	genome.wustl.edu	37	15	44951447	44951447	+	Missense_Mutation	SNP	A	A	C			TCGA-29-1688-01A-01W-0633-09	TCGA-29-1688-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	083e3d14-3756-4101-a93d-bc76f2c0d59c	e4318781-2a5f-412b-aaa5-74827d79a63d	g.chr15:44951447A>C	ENST00000261866.7	-	3	513	c.497T>G	c.(496-498)cTg>cGg	p.L166R	SPG11_ENST00000535302.2_Missense_Mutation_p.L166R|SPG11_ENST00000558319.1_Missense_Mutation_p.L166R|SPG11_ENST00000559193.1_Missense_Mutation_p.L166R|SPG11_ENST00000427534.2_Missense_Mutation_p.L166R	NM_025137.3	NP_079413.3	Q96JI7	SPTCS_HUMAN	spastic paraplegia 11 (autosomal recessive)	166					cell death (GO:0008219)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(24)|ovary(5)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	72		all_cancers(109;1.29e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;1.34e-07)|all_lung(180;1.21e-06)|Melanoma(134;0.0122)		all cancers(107;2.93e-22)|GBM - Glioblastoma multiforme(94;1.55e-06)|COAD - Colon adenocarcinoma(120;0.0432)|Colorectal(105;0.0484)|Lung(196;0.104)|LUSC - Lung squamous cell carcinoma(244;0.214)		GTTGATGAACAGTAATGATGT	0.343																																																0			15											97.0	96.0	96.0					15																	44951447		2198	4298	6496	42738739	SO:0001583	missense	80208				CCDS10112.1, CCDS53939.1	15q13-q15	2007-11-13			ENSG00000104133	ENSG00000104133			11226	protein-coding gene	gene with protein product	"""spatacsin"""	610844	"""KIAA1840"""	KIAA1840		10408536, 17322883	Standard	NM_001160227		Approved	FLJ21439	uc001ztx.3	Q96JI7	OTTHUMG00000131199	ENST00000261866.7:c.497T>G	15.37:g.44951447A>C	ENSP00000261866:p.Leu166Arg		42738739	A8KAX9|B9EK60|F5H3N6|Q4VC11|Q58G86|Q69YG6|Q6NW01|Q8N270|Q8TBU9|Q9H734	Missense_Mutation	SNP	PatternScan_GLYCOSYL_HYDROL_F1_1	p.L166R	ENST00000261866.7	37	c.497	CCDS10112.1	15	.	.	.	.	.	.	.	.	.	.	A	20.8	4.056158	0.76074	.	.	ENSG00000104133	ENST00000261866;ENST00000535302;ENST00000427534	D;T;T	0.81908	-1.55;-1.3;-1.29	5.99	5.99	0.97316	.	0.189925	0.34531	N	0.003894	D	0.89891	0.6846	M	0.68952	2.095	0.38077	D	0.936567	D;D;D;D	0.89917	0.973;0.997;0.996;1.0	P;D;D;D	0.78314	0.851;0.959;0.943;0.991	D	0.91885	0.5519	10	0.87932	D	0	.	14.7717	0.69684	1.0:0.0:0.0:0.0	.	166;166;166;166	C4B7M2;F5H3N6;B9EK60;Q96JI7	.;.;.;SPTCS_HUMAN	R	166	ENSP00000261866:L166R;ENSP00000445278:L166R;ENSP00000396110:L166R	ENSP00000261866:L166R	L	-	2	0	SPG11	42738739	0.966000	0.33281	0.989000	0.46669	0.941000	0.58515	5.626000	0.67777	2.304000	0.77564	0.529000	0.55759	CTG	-	NULL		0.343	SPG11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPG11	protein_coding	OTTHUMT00000253927.1	A			42738739	-1	no_errors	NM_025137	genbank	human	reviewed	54_36p	missense	SNP	0.895	C
KRBOX1	100506243	genome.wustl.edu	37	3	42931270	42931270	+	Intron	SNP	G	G	T			TCGA-29-1688-01A-01W-0633-09	TCGA-29-1688-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	083e3d14-3756-4101-a93d-bc76f2c0d59c	e4318781-2a5f-412b-aaa5-74827d79a63d	g.chr3:42931270G>T	ENST00000426937.1	+	3	131				RP11-141M3.5_ENST00000471537.1_RNA			C9JBD0	KRBX1_HUMAN	KRAB box domain containing 1						regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	nucleic acid binding (GO:0003676)			lung(2)	2						ACTGACCAAGGCAGTGGCAAG	0.388																																																0			3																																								42906274	SO:0001627	intron_variant	729102				CCDS54572.1	3p22.1	2014-02-12	2010-07-29		ENSG00000240747	ENSG00000240747		"""-"""	38708	protein-coding gene	gene with protein product							Standard	NM_001205272		Approved		uc003cmm.4	C9JBD0	OTTHUMG00000156448	ENST00000426937.1:c.-163-19015G>T	3.37:g.42931270G>T			42906274	B4DJE8	RNA	SNP	-	NULL	ENST00000426937.1	37	NULL	CCDS54572.1	3																																																																																			-	-		0.388	KRBOX1-008	PUTATIVE	basic|appris_principal|CCDS	protein_coding	LOC729102	protein_coding	OTTHUMT00000344162.1	G	NM_001205272		42906274	+1	pseudogene	XR_015895	genbank	human	model	54_36p	rna	SNP	0.117	T
ZNF487	642819	genome.wustl.edu	37	10	43991368	43991368	+	Intron	SNP	G	G	C			TCGA-29-1688-01A-01W-0633-09	TCGA-29-1688-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	083e3d14-3756-4101-a93d-bc76f2c0d59c	e4318781-2a5f-412b-aaa5-74827d79a63d	g.chr10:43991368G>C	ENST00000431662.1	+	7	1293							B1APH4	ZN487_HUMAN	zinc finger protein 487						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)										TTTTTTCTTTGAGTATCAATA	0.338																																																0			10																																								43311374	SO:0001627	intron_variant	0					10q11.21	2013-06-03	2013-03-06	2013-03-06	ENSG00000243660	ENSG00000243660			23488	other	unknown			"""KRAB domain only 1"", ""zinc finger protein 487, pseudogene"""	KRBO1, ZNF487P			Standard	NR_026693		Approved			B1APH4	OTTHUMG00000185507	ENST00000431662.1:c.1294-96G>C	10.37:g.43991368G>C			43311374	B1APH5|B7Z7S5	RNA	SNP	-	NULL	ENST00000431662.1	37	NULL		10																																																																																			-	-		0.338	ZNF487-201	KNOWN	basic|appris_principal	protein_coding	LOC100130881	protein_coding		G	XM_926224		43311374	+1	pseudogene	XR_037727	genbank	human	model	54_36p	rna	SNP	0.000	C
ZFP36	7538	genome.wustl.edu	37	19	39898420	39898420	+	Missense_Mutation	SNP	C	C	A			TCGA-29-1688-01A-01W-0633-09	TCGA-29-1688-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	083e3d14-3756-4101-a93d-bc76f2c0d59c	e4318781-2a5f-412b-aaa5-74827d79a63d	g.chr19:39898420C>A	ENST00000248673.3	+	2	120	c.62C>A	c.(61-63)tCc>tAc	p.S21Y	ZFP36_ENST00000597629.1_Missense_Mutation_p.S27Y|MIR4530_ENST00000581459.1_RNA|ZFP36_ENST00000594045.1_3'UTR	NM_003407.3	NP_003398.2	P26651	TTP_HUMAN	ZFP36 ring finger protein	21					3'-UTR-mediated mRNA stabilization (GO:0070935)|gene expression (GO:0010467)|intracellular signal transduction (GO:0035556)|mRNA catabolic process (GO:0006402)|mRNA metabolic process (GO:0016071)|negative regulation of inflammatory response (GO:0050728)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of tumor necrosis factor production (GO:0032680)|response to starvation (GO:0042594)|RNA destabilization (GO:0050779)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|nucleus (GO:0005634)	14-3-3 protein binding (GO:0071889)|AU-rich element binding (GO:0017091)|C-C chemokine binding (GO:0019957)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|mRNA 3'-UTR AU-rich region binding (GO:0035925)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|single-stranded RNA binding (GO:0003727)			large_intestine(1)|lung(5)|pancreas(1)	7	all_cancers(60;6.54e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;1.53e-06)|Ovarian(47;0.0512)		Epithelial(26;2.92e-26)|all cancers(26;2.01e-23)|Lung(45;0.000499)|LUSC - Lung squamous cell carcinoma(53;0.000657)			CCCGTGCCATCCGACCATGGA	0.687																																					NSCLC(67;1164 1324 12056 21056 30097)											0			19											89.0	99.0	96.0					19																	39898420		2202	4298	6500	44590260	SO:0001583	missense	7538			M63625	CCDS12534.1, CCDS12534.2	19q13.1	2012-11-27	2012-11-27			ENSG00000128016		"""RING-type (C3HC4) zinc fingers"""	12862	protein-coding gene	gene with protein product		190700	"""zinc finger protein 36, C3H type, homolog (mouse)"""			1699942	Standard	NM_003407		Approved	RNF162A, TIS11, G0S24, TTP, NUP475, tristetraprolin	uc002olh.2	P26651		ENST00000248673.3:c.62C>A	19.37:g.39898420C>A	ENSP00000248673:p.Ser21Tyr		44590260	B2RA54	Missense_Mutation	SNP	superfamily_SSF90229,HMMSmart_ZnF_C3H1,HMMPfam_zf-CCCH	p.S21Y	ENST00000248673.3	37	c.62		19	.	.	.	.	.	.	.	.	.	.	C	8.905	0.957371	0.18507	.	.	ENSG00000128016	ENST00000248673	T	0.19105	2.17	3.88	2.84	0.33178	.	1.417720	0.05465	U	0.551912	T	0.15825	0.0381	N	0.19112	0.55	0.09310	N	1	P	0.37864	0.61	B	0.35550	0.205	T	0.30563	-0.9974	10	0.72032	D	0.01	-4.2541	9.0171	0.36177	0.0:0.8879:0.0:0.1121	.	21	P26651	TTP_HUMAN	Y	21	ENSP00000248673:S21Y	ENSP00000248673:S21Y	S	+	2	0	ZFP36	44590260	0.002000	0.14202	0.217000	0.23759	0.139000	0.21198	1.540000	0.36115	0.837000	0.34925	0.478000	0.44815	TCC	-	NULL		0.687	ZFP36-201	KNOWN	basic|appris_candidate	protein_coding	ZFP36	protein_coding		C			44590260	+1	no_errors	NM_003407	genbank	human	provisional	54_36p	missense	SNP	0.014	A
ZMIZ2	83637	genome.wustl.edu	37	7	44804967	44804967	+	Silent	SNP	G	G	A			TCGA-29-1688-01A-01W-0633-09	TCGA-29-1688-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	083e3d14-3756-4101-a93d-bc76f2c0d59c	e4318781-2a5f-412b-aaa5-74827d79a63d	g.chr7:44804967G>A	ENST00000309315.4	+	16	2154	c.2031G>A	c.(2029-2031)acG>acA	p.T677T	ZMIZ2_ENST00000433667.1_Silent_p.T645T|ZMIZ2_ENST00000413916.1_Silent_p.T619T|ZMIZ2_ENST00000265346.7_Silent_p.T651T|ZMIZ2_ENST00000441627.1_Silent_p.T677T	NM_031449.3	NP_113637.3	Q8NF64	ZMIZ2_HUMAN	zinc finger, MIZ-type containing 2	677					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)|nuclear replication fork (GO:0043596)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|zinc ion binding (GO:0008270)			breast(3)|endometrium(2)|kidney(3)|large_intestine(6)|lung(10)|ovary(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35						TCGACCCCACGTGCAGCTGGA	0.662																																					NSCLC(20;604 852 1948 16908 50522)											0			7											43.0	47.0	46.0					7																	44804967		2145	4244	6389	44771492	SO:0001819	synonymous_variant	83637			AK090415	CCDS43576.1, CCDS43577.1, CCDS75591.1	7p13	2009-11-06			ENSG00000122515	ENSG00000122515		"""Zinc fingers, MIZ-type"""	22229	protein-coding gene	gene with protein product		611196					Standard	XM_005249866		Approved	KIAA1886, hZIMP7, ZIMP7, DKFZp761I2123, NET27	uc003tlr.3	Q8NF64	OTTHUMG00000155817	ENST00000309315.4:c.2031G>A	7.37:g.44804967G>A			44771492	A4D2K7|D3DVL1|O94790|Q0VGB4|Q659A8|Q6JKL5|Q8WTX8|Q96Q01|Q9BQH7	Silent	SNP	superfamily_RING/U-box,HMMPfam_zf-MIZ	p.T677	ENST00000309315.4	37	c.2031	CCDS43576.1	7																																																																																			-	NULL		0.662	ZMIZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZMIZ2	protein_coding	OTTHUMT00000341790.1	G	NM_031449		44771492	+1	no_errors	NM_031449	genbank	human	validated	54_36p	silent	SNP	0.485	A
C16orf87	388272	genome.wustl.edu	37	16	46858348	46858348	+	Missense_Mutation	SNP	C	C	G			TCGA-29-1688-01A-01W-0633-09	TCGA-29-1688-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	083e3d14-3756-4101-a93d-bc76f2c0d59c	e4318781-2a5f-412b-aaa5-74827d79a63d	g.chr16:46858348C>G	ENST00000285697.4	-	2	374	c.113G>C	c.(112-114)aGc>aCc	p.S38T	C16orf87_ENST00000564250.1_5'UTR|C16orf87_ENST00000394806.2_Missense_Mutation_p.S38T	NM_001001436.2	NP_001001436.1	Q6PH81	CP087_HUMAN	chromosome 16 open reading frame 87	38										large_intestine(4)|urinary_tract(1)	5						AAGTTTTCTGCTAATAAATAT	0.274																																																0			16											80.0	81.0	80.0					16																	46858348		2202	4293	6495	45415849	SO:0001583	missense	388272				CCDS10724.1	16q11.2	2008-08-08			ENSG00000155330	ENSG00000155330			33754	protein-coding gene	gene with protein product							Standard	NM_001001436		Approved		uc002eek.1	Q6PH81	OTTHUMG00000132538	ENST00000285697.4:c.113G>C	16.37:g.46858348C>G	ENSP00000285697:p.Ser38Thr		45415849	Q63HN9	Missense_Mutation	SNP	HMMPfam_UPF0547	p.S38T	ENST00000285697.4	37	c.113	CCDS10724.1	16	.	.	.	.	.	.	.	.	.	.	C	15.59	2.877336	0.51801	.	.	ENSG00000155330	ENST00000285697;ENST00000394806	.	.	.	5.69	4.74	0.60224	.	0.000000	0.85682	D	0.000000	T	0.73361	0.3577	L	0.52573	1.65	0.54753	D	0.99998	P	0.47677	0.899	D	0.67231	0.95	T	0.74957	-0.3487	9	0.59425	D	0.04	.	13.87	0.63612	0.0:0.9252:0.0:0.0748	.	38	Q6PH81	CP087_HUMAN	T	38	.	ENSP00000285697:S38T	S	-	2	0	C16orf87	45415849	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.482000	0.73613	1.414000	0.47017	0.460000	0.39030	AGC	-	HMMPfam_UPF0547		0.274	C16orf87-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C16orf87	protein_coding	OTTHUMT00000255738.2	C	NM_001001436		45415849	-1	no_errors	NM_001001436	genbank	human	predicted	54_36p	missense	SNP	1.000	G
SULF2	55959	genome.wustl.edu	37	20	46319008	46319008	+	Missense_Mutation	SNP	C	C	T			TCGA-29-1688-01A-01W-0633-09	TCGA-29-1688-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	083e3d14-3756-4101-a93d-bc76f2c0d59c	e4318781-2a5f-412b-aaa5-74827d79a63d	g.chr20:46319008C>T	ENST00000359930.4	-	5	1450	c.599G>A	c.(598-600)aGc>aAc	p.S200N	SULF2_ENST00000484875.1_Missense_Mutation_p.S200N|SULF2_ENST00000467815.1_Missense_Mutation_p.S200N|SULF2_ENST00000361612.4_Missense_Mutation_p.S200N	NM_018837.3	NP_061325.1	Q8IWU5	SULF2_HUMAN	sulfatase 2	200					bone development (GO:0060348)|cartilage development (GO:0051216)|chondrocyte development (GO:0002063)|embryonic skeletal system development (GO:0048706)|esophagus smooth muscle contraction (GO:0014846)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|heparan sulfate proteoglycan metabolic process (GO:0030201)|innervation (GO:0060384)|kidney development (GO:0001822)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation vascular endothelial growth factor production (GO:0010575)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	arylsulfatase activity (GO:0004065)|calcium ion binding (GO:0005509)|N-acetylglucosamine-6-sulfatase activity (GO:0008449)			breast(2)|endometrium(4)|kidney(1)|large_intestine(7)|lung(22)|ovary(4)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	54						GAAGCTCACGCTGTCATTGGT	0.587																																																0			20											128.0	102.0	111.0					20																	46319008		2203	4300	6503	45752415	SO:0001583	missense	55959			AY101176	CCDS13408.1, CCDS13409.1, CCDS13409.2	20q13.12-q13.13	2008-05-14			ENSG00000196562	ENSG00000196562			20392	protein-coding gene	gene with protein product		610013				12368295	Standard	NM_018837		Approved	KIAA1247, HSULF-2, SULF-2	uc002xto.3	Q8IWU5	OTTHUMG00000032675	ENST00000359930.4:c.599G>A	20.37:g.46319008C>T	ENSP00000353007:p.Ser200Asn		45752415	E1P5U6|Q5JYE1|Q6UX86|Q96SG2|Q9H1H0|Q9UJR3|Q9ULH3	Missense_Mutation	SNP	HMMPfam_Sulfatase,superfamily_Alkaline phosphatase-like,PatternScan_SULFATASE_1	p.S200N	ENST00000359930.4	37	c.599	CCDS13408.1	20	.	.	.	.	.	.	.	.	.	.	C	31	5.087077	0.94100	.	.	ENSG00000196562	ENST00000359930;ENST00000484875;ENST00000361612;ENST00000467815	D;D;D;D	0.98666	-5.06;-5.06;-5.06;-5.06	4.53	4.53	0.55603	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.329365	0.38005	N	0.001859	D	0.99162	0.9710	M	0.84683	2.71	0.80722	D	1	D;D;D	0.76494	0.985;0.993;0.999	P;P;D	0.85130	0.888;0.901;0.997	D	0.99445	1.0939	10	0.87932	D	0	-21.2317	17.4357	0.87552	0.0:1.0:0.0:0.0	.	200;200;200	G3XAE6;Q8IWU5-2;Q8IWU5	.;.;SULF2_HUMAN	N	200	ENSP00000353007:S200N;ENSP00000418290:S200N;ENSP00000354662:S200N;ENSP00000418442:S200N	ENSP00000353007:S200N	S	-	2	0	SULF2	45752415	1.000000	0.71417	0.997000	0.53966	0.932000	0.56968	7.648000	0.83479	2.341000	0.79615	0.543000	0.68304	AGC	-	HMMPfam_Sulfatase,superfamily_Alkaline phosphatase-like		0.587	SULF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SULF2	protein_coding	OTTHUMT00000079606.1	C	NM_018837		45752415	-1	no_errors	NM_018837	genbank	human	validated	54_36p	missense	SNP	1.000	T
HDC	3067	genome.wustl.edu	37	15	50540483	50540483	+	Missense_Mutation	SNP	G	G	A	rs143418383		TCGA-29-1688-01A-01W-0633-09	TCGA-29-1688-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	083e3d14-3756-4101-a93d-bc76f2c0d59c	e4318781-2a5f-412b-aaa5-74827d79a63d	g.chr15:50540483G>A	ENST00000267845.3	-	10	1501	c.1099C>T	c.(1099-1101)Cgg>Tgg	p.R367W	HDC_ENST00000543581.1_Intron	NM_002112.3	NP_002103.2	Q9UBI9	HDC_HUMAN	histidine decarboxylase	0					respiratory tube development (GO:0030323)	membrane (GO:0016020)				breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(13)|lung(25)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		all_lung(180;0.0138)		all cancers(107;1.12e-06)|GBM - Glioblastoma multiforme(94;9.95e-05)		CCGAAGGACCGAATCACGAAC	0.522																																					GBM(95;1627 1936 6910 9570)											0			15						G	TRP/ARG	0,4392		0,0,2196	95.0	84.0	88.0		1099	5.5	1.0	15	dbSNP_134	88	1,8589	1.2+/-3.3	0,1,4294	no	missense	HDC	NM_002112.3	101	0,1,6490	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	367/663	50540483	1,12981	2196	4295	6491	48327775	SO:0001583	missense	3067				CCDS10134.1	15q21.2	2013-09-20			ENSG00000140287	ENSG00000140287	4.1.1.22		4855	protein-coding gene	gene with protein product		142704				1487235	Standard	NM_002112		Approved		uc001zxz.3	P19113	OTTHUMG00000131644	ENST00000267845.3:c.1099C>T	15.37:g.50540483G>A	ENSP00000267845:p.Arg367Trp		48327775		Missense_Mutation	SNP	superfamily_PyrdxlP-dep_Trfase_major,HMMPfam_Pyridoxal_deC,PatternScan_DDC_GAD_HDC_YDC	p.R367W	ENST00000267845.3	37	c.1099	CCDS10134.1	15	.	.	.	.	.	.	.	.	.	.	G	29.1	4.975961	0.92982	0.0	1.16E-4	ENSG00000140287	ENST00000267845	T	0.59224	0.28	5.47	5.47	0.80525	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.112472	0.64402	D	0.000012	D	0.84023	0.5381	H	0.97491	4.015	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89121	0.3503	10	0.87932	D	0	-20.3057	14.2738	0.66167	0.0:0.0:0.8512:0.1488	.	367	P19113	DCHS_HUMAN	W	367	ENSP00000267845:R367W	ENSP00000267845:R367W	R	-	1	2	HDC	48327775	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.526000	0.81920	2.579000	0.87056	0.650000	0.86243	CGG	-	superfamily_PyrdxlP-dep_Trfase_major,HMMPfam_Pyridoxal_deC		0.522	HDC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HDC	protein_coding	OTTHUMT00000254540.1	G			48327775	-1	no_errors	NM_002112	genbank	human	validated	54_36p	missense	SNP	1.000	A
P4HTM	54681	genome.wustl.edu	37	3	49042397	49042397	+	Missense_Mutation	SNP	A	A	G			TCGA-29-1688-01A-01W-0633-09	TCGA-29-1688-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	083e3d14-3756-4101-a93d-bc76f2c0d59c	e4318781-2a5f-412b-aaa5-74827d79a63d	g.chr3:49042397A>G	ENST00000383729.4	+	6	1362	c.991A>G	c.(991-993)Agt>Ggt	p.S331G	WDR6_ENST00000608424.1_5'Flank|WDR6_ENST00000395474.3_5'Flank|WDR6_ENST00000448293.1_5'Flank|WDR6_ENST00000415265.2_5'Flank|P4HTM_ENST00000343546.4_Missense_Mutation_p.S331G	NM_177939.2	NP_808808.1	Q9NXG6	P4HTM_HUMAN	prolyl 4-hydroxylase, transmembrane (endoplasmic reticulum)	331	Fe2OG dioxygenase. {ECO:0000255|PROSITE- ProRule:PRU00805}.					endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)			NS(1)|breast(2)|kidney(1)|large_intestine(1)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	21					Vitamin C(DB00126)	CCACGTGGACAGTGGGCCTGT	0.612																																																0			3											127.0	99.0	109.0					3																	49042397		2203	4300	6503	49017401	SO:0001583	missense	54681				CCDS2781.2, CCDS43089.1	3p21.31	2009-01-14			ENSG00000178467	ENSG00000178467			28858	protein-coding gene	gene with protein product	"""Prolyl hydroxlase domain-containing 4"", ""hypoxia inducible factor prolyl 4 hydroxylase"""	614584				12163023, 17726031	Standard	XR_245139		Approved	P4H-TM, PHD4, PH4, HIFPH4, FLJ20262, EGLN4, PH-4	uc003cvh.3	Q9NXG6	OTTHUMG00000074057	ENST00000383729.4:c.991A>G	3.37:g.49042397A>G	ENSP00000373235:p.Ser331Gly		49017401	Q6PAG6|Q8TCJ9|Q8WV55|Q96F22|Q9BW77	Missense_Mutation	SNP	superfamily_SSF47473,HMMSmart_P4Hc,PatternScan_EF_HAND_1,HMMPfam_2OG-FeII_Oxy	p.S331G	ENST00000383729.4	37	c.991	CCDS43089.1	3	.	.	.	.	.	.	.	.	.	.	A	23.9	4.474900	0.84640	.	.	ENSG00000178467	ENST00000383729;ENST00000343546	T	0.59224	0.28	5.29	5.29	0.74685	Oxoglutarate/iron-dependent oxygenase (2);Prolyl 4-hydroxylase, alpha subunit (1);	0.084818	0.85682	D	0.000000	T	0.56247	0.1972	L	0.31065	0.9	0.49483	D	0.999792	B;P	0.38745	0.136;0.645	B;P	0.46975	0.143;0.533	T	0.59451	-0.7452	10	0.52906	T	0.07	-10.3247	15.3015	0.73955	1.0:0.0:0.0:0.0	.	331;331	Q9NXG6-3;Q9NXG6	.;P4HTM_HUMAN	G	331	ENSP00000373235:S331G	ENSP00000341422:S331G	S	+	1	0	P4HTM	49017401	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	8.852000	0.92215	2.017000	0.59298	0.529000	0.55759	AGT	-	HMMSmart_P4Hc,HMMPfam_2OG-FeII_Oxy		0.612	P4HTM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	P4HTM	protein_coding	OTTHUMT00000157211.1	A	NM_177938		49017401	+1	no_errors	NM_177938	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
SPATA18	132671	genome.wustl.edu	37	4	52938174	52938174	+	Missense_Mutation	SNP	G	G	C			TCGA-29-1688-01A-01W-0633-09	TCGA-29-1688-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	083e3d14-3756-4101-a93d-bc76f2c0d59c	e4318781-2a5f-412b-aaa5-74827d79a63d	g.chr4:52938174G>C	ENST00000295213.4	+	6	984	c.610G>C	c.(610-612)Gag>Cag	p.E204Q	SPATA18_ENST00000419395.2_Missense_Mutation_p.E172Q|SPATA18_ENST00000506829.1_3'UTR	NM_145263.2	NP_660306.1	Q8TC71	MIEAP_HUMAN	spermatogenesis associated 18	204					cellular response to DNA damage stimulus (GO:0006974)|mitochondrial protein catabolic process (GO:0035694)|mitochondrion degradation by induced vacuole formation (GO:0035695)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrial outer membrane (GO:0005741)				breast(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(20)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	41			GBM - Glioblastoma multiforme(4;1.77e-13)|LUSC - Lung squamous cell carcinoma(32;0.00204)			TTGGAGCTTGGAGGAGCGGAA	0.522																																																0			4											83.0	75.0	78.0					4																	52938174		2203	4300	6503	52632931	SO:0001583	missense	132671			BC025396	CCDS3489.1, CCDS75124.1	4q11	2012-01-23	2012-01-23		ENSG00000163071	ENSG00000163071			29579	protein-coding gene	gene with protein product		612814	"""spermatogenesis associated 18 homolog (rat)"""			21300779	Standard	XR_245253		Approved	FLJ32906	uc003gzl.3	Q8TC71	OTTHUMG00000128698	ENST00000295213.4:c.610G>C	4.37:g.52938174G>C	ENSP00000295213:p.Glu204Gln		52632931	B4E2R0|E5RLK1|Q8IY48|Q8N7D7	Missense_Mutation	SNP	NULL	p.E204Q	ENST00000295213.4	37	c.610	CCDS3489.1	4	.	.	.	.	.	.	.	.	.	.	G	15.62	2.887899	0.52014	.	.	ENSG00000163071	ENST00000295213;ENST00000419395	T;T	0.58210	0.35;1.6	4.17	4.17	0.49024	.	1.932380	0.02219	N	0.063844	T	0.59689	0.2212	L	0.44542	1.39	0.09310	N	1	D;D;P	0.57899	0.966;0.981;0.844	P;P;P	0.50570	0.644;0.644;0.447	T	0.53697	-0.8402	10	0.51188	T	0.08	-3.7791	12.2745	0.54726	0.0:0.0:1.0:0.0	.	172;204;204	Q8TC71-2;Q8TC71;Q96M13	.;MIEAP_HUMAN;.	Q	204;172	ENSP00000295213:E204Q;ENSP00000415309:E172Q	ENSP00000295213:E204Q	E	+	1	0	SPATA18	52632931	.	.	0.175000	0.22980	0.019000	0.09904	.	.	2.600000	0.87896	0.585000	0.79938	GAG	-	NULL		0.522	SPATA18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA18	protein_coding	OTTHUMT00000250597.2	G	NM_145263		52632931	+1	no_errors	NM_145263	genbank	human	provisional	54_36p	missense	SNP	0.004	C
ZNF609	23060	genome.wustl.edu	37	15	64792020	64792020	+	Silent	SNP	G	G	A			TCGA-29-1688-01A-01W-0633-09	TCGA-29-1688-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	083e3d14-3756-4101-a93d-bc76f2c0d59c	e4318781-2a5f-412b-aaa5-74827d79a63d	g.chr15:64792020G>A	ENST00000326648.3	+	1	530	c.402G>A	c.(400-402)ctG>ctA	p.L134L	ZNF609_ENST00000416172.1_Silent_p.L134L	NM_015042.1	NP_055857.1	O15014	ZN609_HUMAN	zinc finger protein 609	134						nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(3)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(9)|lung(11)|ovary(1)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						CTGGAGGCCTGGTTGCTGCTA	0.572																																																0			15											47.0	50.0	49.0					15																	64792020		2203	4300	6503	62579073	SO:0001819	synonymous_variant	23060			BC014251	CCDS32270.1	15q22.1	2008-05-02				ENSG00000180357		"""Zinc fingers, C2H2-type"""	29003	protein-coding gene	gene with protein product						9205841	Standard	NM_015042		Approved	KIAA0295	uc002ann.3	O15014		ENST00000326648.3:c.402G>A	15.37:g.64792020G>A			62579073	Q0D2I2	Silent	SNP	HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1	p.L134	ENST00000326648.3	37	c.402	CCDS32270.1	15																																																																																			-	NULL		0.572	ZNF609-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF609	protein_coding	OTTHUMT00000418130.1	G	XM_042833		62579073	+1	no_errors	NM_015042	genbank	human	provisional	54_36p	silent	SNP	0.998	A
NOL11	25926	genome.wustl.edu	37	17	65734086	65734086	+	Missense_Mutation	SNP	G	G	T			TCGA-29-1688-01A-01W-0633-09	TCGA-29-1688-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	083e3d14-3756-4101-a93d-bc76f2c0d59c	e4318781-2a5f-412b-aaa5-74827d79a63d	g.chr17:65734086G>T	ENST00000253247.4	+	13	1642	c.1527G>T	c.(1525-1527)ttG>ttT	p.L509F	SNORA38B_ENST00000363524.1_RNA|NOL11_ENST00000535137.1_Missense_Mutation_p.L327F	NM_015462.3	NP_056277.2	Q9H8H0	NOL11_HUMAN	nucleolar protein 11	509					maturation of SSU-rRNA (GO:0030490)|positive regulation of transcription of nuclear large rRNA transcript from RNA polymerase I promoter (GO:1901838)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|t-UTP complex (GO:0034455)	poly(A) RNA binding (GO:0044822)			haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(3)|upper_aerodigestive_tract(1)	11	all_cancers(12;1.54e-10)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0518)|COAD - Colon adenocarcinoma(4;0.0977)|LUSC - Lung squamous cell carcinoma(166;0.24)			AAATTTTCTTGAGGTAAGTTA	0.328																																																0			17											88.0	92.0	90.0					17																	65734086		2203	4300	6503	63164548	SO:0001583	missense	25926			AK023702	CCDS11671.1	17q24.2	2005-08-08							24557	protein-coding gene	gene with protein product		615366				12477932	Standard	NM_015462		Approved	DKFZP586L0724	uc002jgd.1	Q9H8H0		ENST00000253247.4:c.1527G>T	17.37:g.65734086G>T	ENSP00000253247:p.Leu509Phe		63164548	B7Z5V9|Q7L5S1|Q9UG18	Missense_Mutation	SNP	HMMPfam_NUC205	p.L509F	ENST00000253247.4	37	c.1527	CCDS11671.1	17	.	.	.	.	.	.	.	.	.	.	G	12.39	1.922921	0.33908	.	.	ENSG00000130935	ENST00000253247;ENST00000535137	T	0.66099	-0.19	5.11	-2.95	0.05564	.	0.259871	0.34025	N	0.004327	T	0.62258	0.2413	M	0.75264	2.295	0.44579	D	0.997542	P	0.51933	0.949	P	0.46718	0.525	T	0.67304	-0.5704	10	0.72032	D	0.01	-4.0679	12.2458	0.54571	0.6286:0.0:0.3714:0.0	.	509	Q9H8H0	NOL11_HUMAN	F	509;327	ENSP00000253247:L509F	ENSP00000253247:L509F	L	+	3	2	NOL11	63164548	0.995000	0.38212	0.963000	0.40424	0.046000	0.14306	0.373000	0.20484	-0.669000	0.05289	-0.897000	0.02905	TTG	-	NULL		0.328	NOL11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOL11	protein_coding	OTTHUMT00000448074.1	G	NM_015462		63164548	+1	no_errors	NM_015462	genbank	human	provisional	54_36p	missense	SNP	0.993	T
UACA	55075	genome.wustl.edu	37	15	70972006	70972006	+	Missense_Mutation	SNP	T	T	C	rs373823406		TCGA-29-1688-01A-01W-0633-09	TCGA-29-1688-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	083e3d14-3756-4101-a93d-bc76f2c0d59c	e4318781-2a5f-412b-aaa5-74827d79a63d	g.chr15:70972006T>C	ENST00000322954.6	-	10	1017	c.832A>G	c.(832-834)Aca>Gca	p.T278A	UACA_ENST00000379983.2_Missense_Mutation_p.T265A|UACA_ENST00000559183.1_5'Flank|UACA_ENST00000539319.1_Missense_Mutation_p.T169A|UACA_ENST00000560441.1_Missense_Mutation_p.T265A	NM_018003.2	NP_060473.2	Q9BZF9	UACA_HUMAN	uveal autoantigen with coiled-coil domains and ankyrin repeats	278					intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|negative regulation of inflammatory response (GO:0050728)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of protein import into nucleus (GO:0042307)|response to UV (GO:0009411)	apoptosome (GO:0043293)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)				breast(2)|endometrium(7)|kidney(4)|large_intestine(13)|lung(17)|ovary(2)|pancreas(1)|prostate(2)|skin(2)	50						TGCATGTGTGTCAAATTTCGC	0.333																																																0			15						T	ALA/THR,ALA/THR	1,4397	2.1+/-5.4	0,1,2198	117.0	104.0	108.0		793,832	-11.3	0.0	15		108	0,8594		0,0,4297	no	missense,missense	UACA	NM_001008224.1,NM_018003.2	58,58	0,1,6495	CC,CT,TT		0.0,0.0227,0.0077	benign,benign	265/1404,278/1417	70972006	1,12991	2199	4297	6496	68759060	SO:0001583	missense	55075			AF322916	CCDS10235.1, CCDS32280.1	15q22-q24	2013-01-10			ENSG00000137831	ENSG00000137831		"""Ankyrin repeat domain containing"""	15947	protein-coding gene	gene with protein product		612516				11162650, 10997877	Standard	NM_001008224		Approved	FLJ10128, KIAA1561	uc002asr.3	Q9BZF9	OTTHUMG00000133363	ENST00000322954.6:c.832A>G	15.37:g.70972006T>C	ENSP00000314556:p.Thr278Ala		68759060	G3XAG2|Q14DD3|Q8N3B8|Q96NH6|Q9HCL1|Q9NWC6	Missense_Mutation	SNP	superfamily_ANK,HMMSmart_ANK,HMMPfam_Ank,HMMPfam_Pox_A_type_inc	p.T278A	ENST00000322954.6	37	c.832	CCDS10235.1	15	.	.	.	.	.	.	.	.	.	.	T	2.703	-0.270634	0.05716	2.27E-4	0.0	ENSG00000137831	ENST00000322954;ENST00000379983;ENST00000395362;ENST00000539319	T;T;T	0.76968	1.39;1.4;-1.06	5.64	-11.3	0.00108	.	0.932149	0.09044	N	0.856852	T	0.43100	0.1232	N	0.08118	0	0.39422	D	0.966935	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.0;0.0;0.0;0.001	T	0.11060	-1.0603	10	0.15499	T	0.54	-0.3331	2.1425	0.03778	0.2677:0.2607:0.3443:0.1273	.	169;278;278;265	F5H2B9;B7ZKM6;Q9BZF9;G3XAG2	.;.;UACA_HUMAN;.	A	278;265;265;169	ENSP00000314556:T278A;ENSP00000369319:T265A;ENSP00000438667:T169A	ENSP00000314556:T278A	T	-	1	0	UACA	68759060	0.003000	0.15002	0.008000	0.14137	0.852000	0.48524	-1.164000	0.03135	-2.001000	0.00964	-1.540000	0.00911	ACA	-	NULL		0.333	UACA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	UACA	protein_coding	OTTHUMT00000257199.2	T			68759060	-1	no_errors	NM_018003	genbank	human	validated	54_36p	missense	SNP	0.012	C
SLC7A3	84889	genome.wustl.edu	37	X	70147771	70147771	+	Missense_Mutation	SNP	G	G	T			TCGA-29-1688-01A-01W-0633-09	TCGA-29-1688-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	083e3d14-3756-4101-a93d-bc76f2c0d59c	e4318781-2a5f-412b-aaa5-74827d79a63d	g.chrX:70147771G>T	ENST00000374299.3	-	6	1064	c.920C>A	c.(919-921)aCc>aAc	p.T307N	SLC7A3_ENST00000298085.4_Missense_Mutation_p.T307N			Q8WY07	CTR3_HUMAN	solute carrier family 7 (cationic amino acid transporter, y+ system), member 3	307					amino acid transport (GO:0006865)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	arginine transmembrane transporter activity (GO:0015181)|L-lysine transmembrane transporter activity (GO:0015189)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|liver(1)|lung(9)|ovary(1)|urinary_tract(1)	31	Renal(35;0.156)				L-Arginine(DB00125)|L-Lysine(DB00123)|L-Ornithine(DB00129)	CATCATCAGGGTGAGTGCAGA	0.532																																																0			X											136.0	107.0	117.0					X																	70147771		2203	4300	6503	70064496	SO:0001583	missense	84889			AF320612	CCDS14404.1	Xq12	2013-05-22			ENSG00000165349	ENSG00000165349		"""Solute carriers"""	11061	protein-coding gene	gene with protein product		300443				11591158	Standard	NM_001048164		Approved	CAT-3, ATRC3, FLJ14541	uc004dyn.3	Q8WY07	OTTHUMG00000021780	ENST00000374299.3:c.920C>A	X.37:g.70147771G>T	ENSP00000363417:p.Thr307Asn		70064496	D3DVU7|Q5JQR2|Q8N185|Q8NCA7|Q96SZ7	Missense_Mutation	SNP	HMMPfam_AA_permease	p.T307N	ENST00000374299.3	37	c.920	CCDS14404.1	X	.	.	.	.	.	.	.	.	.	.	G	19.19	3.779518	0.70107	.	.	ENSG00000165349	ENST00000374299;ENST00000298085	D;D	0.89810	-2.57;-2.57	5.15	4.29	0.51040	Amino acid permease domain (1);	0.000000	0.85682	D	0.000000	D	0.96457	0.8844	H	0.98542	4.26	0.58432	D	0.999998	D	0.63880	0.993	D	0.79784	0.993	D	0.96845	0.9621	10	0.87932	D	0	.	11.9578	0.52991	0.0854:0.0:0.9146:0.0	.	307	Q8WY07	CTR3_HUMAN	N	307	ENSP00000363417:T307N;ENSP00000298085:T307N	ENSP00000298085:T307N	T	-	2	0	SLC7A3	70064496	1.000000	0.71417	0.965000	0.40720	0.991000	0.79684	7.639000	0.83342	1.167000	0.42706	0.468000	0.43344	ACC	-	HMMPfam_AA_permease		0.532	SLC7A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC7A3	protein_coding	OTTHUMT00000057080.1	G	NM_032803		70064496	-1	no_errors	NM_001048164	genbank	human	validated	54_36p	missense	SNP	1.000	T
XIST	7503	genome.wustl.edu	37	X	73065346	73065346	+	lincRNA	SNP	G	G	A			TCGA-29-1688-01A-01W-0633-09	TCGA-29-1688-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	083e3d14-3756-4101-a93d-bc76f2c0d59c	e4318781-2a5f-412b-aaa5-74827d79a63d	g.chrX:73065346G>A	ENST00000429829.1	-	0	7242					NR_001564.2				X inactive specific transcript (non-protein coding)																		AGGAAGATTGGAGGTGGGGTG	0.458																																																0			X											143.0	131.0	135.0					X																	73065346		876	1991	2867	72982071			7503			M97168		Xq13.2	2013-12-18	2013-02-07		ENSG00000229807	ENSG00000229807		"""Long non-coding RNAs"", ""-"""	12810	non-coding RNA	RNA, long non-coding	"""long intergenic non-protein coding RNA 1"""	314670	"""X (inactive)-specific transcript"", ""X (inactive)-specific transcript (non-protein coding)"""	DXS399E		1985261, 2034279	Standard	NR_001564		Approved	NCRNA00001, DXS1089, swd66, LINC00001	uc004ebm.2		OTTHUMG00000021839		X.37:g.73065346G>A			72982071		RNA	SNP	-	NULL	ENST00000429829.1	37	NULL		X																																																																																			-	-		0.458	XIST-001	KNOWN	basic	lincRNA	XIST	lincRNA	OTTHUMT00000057239.1	G	NR_001564		72982071	-1	no_errors	NR_001564	genbank	human	reviewed	54_36p	rna	SNP	0.000	A
RPL18P13	441775	genome.wustl.edu	37	16	76269254	76269254	+	lincRNA	SNP	G	G	A			TCGA-29-1688-01A-01W-0633-09	TCGA-29-1688-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	083e3d14-3756-4101-a93d-bc76f2c0d59c	e4318781-2a5f-412b-aaa5-74827d79a63d	g.chr16:76269254G>A	ENST00000568714.1	-	0	135																											GAACCCGCACGTCATCTGTTA	0.582																																																0			16																																								74826755			441775																															16.37:g.76269254G>A			74826755		RNA	SNP	-	NULL	ENST00000568714.1	37	NULL		16																																																																																			-	-		0.582	RP11-150D5.2-001	KNOWN	basic	lincRNA	LOC441775	lincRNA	OTTHUMT00000434958.1	G			74826755	-1	pseudogene	XR_042366	genbank	human	model	54_36p	rna	SNP	0.992	A
HIP1	3092	genome.wustl.edu	37	7	75189132	75189132	+	Missense_Mutation	SNP	C	C	T			TCGA-29-1688-01A-01W-0633-09	TCGA-29-1688-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	083e3d14-3756-4101-a93d-bc76f2c0d59c	e4318781-2a5f-412b-aaa5-74827d79a63d	g.chr7:75189132C>T	ENST00000336926.6	-	14	1305	c.1279G>A	c.(1279-1281)Gcc>Acc	p.A427T	HIP1_ENST00000434438.2_Missense_Mutation_p.A427T	NM_005338.5	NP_005329.3	O00291	HIP1_HUMAN	huntingtin interacting protein 1	427	pDED.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell differentiation (GO:0030154)|clathrin coat assembly (GO:0048268)|endocytosis (GO:0006897)|positive regulation of receptor-mediated endocytosis (GO:0048260)|regulation of apoptotic process (GO:0042981)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	clathrin-coated vesicle (GO:0030136)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	clathrin binding (GO:0030276)|phosphatidylinositol binding (GO:0035091)|structural constituent of cytoskeleton (GO:0005200)			breast(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(25)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51						CAGTCGTCGGCCGCCTGCTGC	0.642			T	PDGFRB	CMML																																		Dom	yes		7	7q11.23	3092	huntingtin interacting protein 1		L	0			7											23.0	25.0	24.0					7																	75189132		2202	4298	6500	75027068	SO:0001583	missense	3092			AF052288	CCDS34669.1, CCDS59060.1	7q11.23	2008-07-18			ENSG00000127946	ENSG00000127946			4913	protein-coding gene	gene with protein product		601767				9140394, 9147654	Standard	NM_005338		Approved	ILWEQ	uc003uds.2	O00291	OTTHUMG00000156050	ENST00000336926.6:c.1279G>A	7.37:g.75189132C>T	ENSP00000336747:p.Ala427Thr		75027068	B4E3I7|E7ES17|O00328|Q2TB58|Q8TDL4	Missense_Mutation	SNP	HMMPfam_ANTH,superfamily_ENTH/VHS domain,HMMSmart_SM00273,superfamily_ARM repeat,superfamily_I/LWEQ domain (Pfam 01608),HMMSmart_SM00307,HMMPfam_I_LWEQ	p.A427T	ENST00000336926.6	37	c.1279	CCDS34669.1	7	.	.	.	.	.	.	.	.	.	.	C	11.17	1.560325	0.27827	.	.	ENSG00000127946	ENST00000336926;ENST00000434438	T;T	0.14144	2.75;2.53	5.62	4.73	0.59995	.	0.819184	0.11733	N	0.534763	T	0.12050	0.0293	L	0.44542	1.39	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.06405	0.002;0.001	T	0.35748	-0.9776	10	0.14252	T	0.57	-4.201	9.266	0.37641	0.0:0.7595:0.1576:0.0829	.	427;427	E7ES17;O00291	.;HIP1_HUMAN	T	427	ENSP00000336747:A427T;ENSP00000410300:A427T	ENSP00000336747:A427T	A	-	1	0	HIP1	75027068	0.000000	0.05858	0.003000	0.11579	0.861000	0.49209	0.575000	0.23729	1.361000	0.45981	0.655000	0.94253	GCC	-	NULL		0.642	HIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIP1	protein_coding	OTTHUMT00000342863.2	C	NM_005338		75027068	-1	no_errors	NM_005338	genbank	human	reviewed	54_36p	missense	SNP	0.004	T
LOC440311	440311	genome.wustl.edu	37	15	95400123	95400123	+	lincRNA	SNP	G	G	A			TCGA-29-1688-01A-01W-0633-09	TCGA-29-1688-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	083e3d14-3756-4101-a93d-bc76f2c0d59c	e4318781-2a5f-412b-aaa5-74827d79a63d	g.chr15:95400123G>A	ENST00000602330.1	-	0	117																											AGAAGCGGGCGTTCCGCGAGA	0.502																																																0			15																																								93201127			440311																															15.37:g.95400123G>A			93201127		RNA	SNP	-	NULL	ENST00000602330.1	37	NULL		15																																																																																			-	-		0.502	CTD-2576F9.2-001	KNOWN	basic	lincRNA	LOC440311	lincRNA	OTTHUMT00000467393.1	G			93201127	+1	pseudogene	XR_016779	genbank	human	model	54_36p	rna	SNP	0.016	A
LOXL4	84171	genome.wustl.edu	37	10	100017747	100017747	+	Silent	SNP	G	G	A			TCGA-29-1688-01A-01W-0633-09	TCGA-29-1688-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	083e3d14-3756-4101-a93d-bc76f2c0d59c	e4318781-2a5f-412b-aaa5-74827d79a63d	g.chr10:100017747G>A	ENST00000260702.3	-	7	1246	c.1096C>T	c.(1096-1098)Ctg>Ttg	p.L366L	RP11-34A14.3_ENST00000433374.1_RNA	NM_032211.6	NP_115587.6	Q96JB6	LOXL4_HUMAN	lysyl oxidase-like 4	366	SRCR 3. {ECO:0000255|PROSITE- ProRule:PRU00196}.					extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|receptor complex (GO:0043235)	copper ion binding (GO:0005507)|protein-lysine 6-oxidase activity (GO:0004720)|scavenger receptor activity (GO:0005044)			breast(1)|endometrium(6)|kidney(1)|large_intestine(3)|lung(8)|ovary(4)|prostate(1)|skin(2)	26		Colorectal(252;0.234)		Epithelial(162;2.14e-11)|all cancers(201;2.49e-09)		CCTTGGCCCAGCCGGGCCCCA	0.627																																																0			10											65.0	71.0	69.0					10																	100017747		2203	4300	6503	100007737	SO:0001819	synonymous_variant	84171			AF338441	CCDS7473.1	10q24	2008-08-01			ENSG00000138131	ENSG00000138131			17171	protein-coding gene	gene with protein product		607318				11292829	Standard	XM_005270216		Approved	FLJ21889, LOXC	uc001kpa.1	Q96JB6	OTTHUMG00000018874	ENST00000260702.3:c.1096C>T	10.37:g.100017747G>A			100007737	Q5W0B3|Q96DY1|Q96PC0|Q9H6T5	Silent	SNP	superfamily_SRCR-like,HMMSmart_SM00202,HMMPfam_SRCR,PatternScan_SRCR_1,HMMPfam_Lysyl_oxidase,PatternScan_LYSYL_OXIDASE	p.L366	ENST00000260702.3	37	c.1096	CCDS7473.1	10																																																																																			-	superfamily_SRCR-like,HMMSmart_SM00202,HMMPfam_SRCR		0.627	LOXL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOXL4	protein_coding	OTTHUMT00000049766.1	G	NM_032211		100007737	-1	no_errors	NM_032211	genbank	human	reviewed	54_36p	silent	SNP	0.977	A
HSP90B1	7184	genome.wustl.edu	37	12	104335447	104335447	+	Missense_Mutation	SNP	A	A	T			TCGA-29-1688-01A-01W-0633-09	TCGA-29-1688-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	083e3d14-3756-4101-a93d-bc76f2c0d59c	e4318781-2a5f-412b-aaa5-74827d79a63d	g.chr12:104335447A>T	ENST00000299767.5	+	10	1453	c.1271A>T	c.(1270-1272)gAt>gTt	p.D424V		NM_003299.2	NP_003290.1	P14625	ENPL_HUMAN	heat shock protein 90kDa beta (Grp94), member 1	424					actin rod assembly (GO:0031247)|activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|cellular response to ATP (GO:0071318)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|protein folding (GO:0006457)|protein transport (GO:0015031)|regulation of phosphoprotein phosphatase activity (GO:0043666)|response to hypoxia (GO:0001666)|sequestering of calcium ion (GO:0051208)|toll-like receptor signaling pathway (GO:0002224)	cytosol (GO:0005829)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|low-density lipoprotein particle receptor binding (GO:0050750)|protein phosphatase binding (GO:0019903)|RNA binding (GO:0003723)|virion binding (GO:0046790)			central_nervous_system(1)|kidney(5)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|skin(1)|urinary_tract(4)	29					Rifabutin(DB00615)	GACTTCCATGATATGATGCCT	0.408																																																0			12											133.0	125.0	128.0					12																	104335447		2203	4300	6503	102859577	SO:0001583	missense	7184			AY040226	CCDS9094.1	12q24.2-q24.3	2011-09-02	2006-02-24	2006-02-24		ENSG00000166598		"""Heat shock proteins / HSPC"""	12028	protein-coding gene	gene with protein product		191175	"""tumor rejection antigen (gp96) 1"""	TRA1		16269234	Standard	NM_003299		Approved	GP96, GRP94	uc001tkb.2	P14625	OTTHUMG00000170118	ENST00000299767.5:c.1271A>T	12.37:g.104335447A>T	ENSP00000299767:p.Asp424Val		102859577	Q96A97	Missense_Mutation	SNP	superfamily_ATP_bd_ATPase,PatternScan_HSP90,HMMPfam_HATPase_c,HMMSmart_HATPase_c,HMMPfam_HSP90,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_SSF110942,PatternScan_ER_TARGET	p.D424V	ENST00000299767.5	37	c.1271	CCDS9094.1	12	.	.	.	.	.	.	.	.	.	.	A	26.6	4.756044	0.89843	.	.	ENSG00000166598	ENST00000299767;ENST00000421266	T	0.13196	2.61	5.34	5.34	0.76211	Ribosomal protein S5 domain 2-type fold (1);	0.000000	0.85682	D	0.000000	T	0.50701	0.1631	H	0.95043	3.615	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.67051	-0.5768	10	0.87932	D	0	.	15.318	0.74095	1.0:0.0:0.0:0.0	.	424	P14625	ENPL_HUMAN	V	424;174	ENSP00000299767:D424V	ENSP00000299767:D424V	D	+	2	0	HSP90B1	102859577	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.339000	0.96797	1.997000	0.58415	0.533000	0.62120	GAT	-	HMMPfam_HSP90,superfamily_Ribosomal_S5_D2-typ_fold		0.408	HSP90B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSP90B1	protein_coding	OTTHUMT00000407349.1	A	NM_003299		102859577	+1	no_errors	NM_003299	genbank	human	provisional	54_36p	missense	SNP	1.000	T
IL1RAPL2	26280	genome.wustl.edu	37	X	104984676	104984676	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1688-01A-01W-0633-09	TCGA-29-1688-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	083e3d14-3756-4101-a93d-bc76f2c0d59c	e4318781-2a5f-412b-aaa5-74827d79a63d	g.chrX:104984676G>A	ENST00000372582.1	+	8	1796	c.1040G>A	c.(1039-1041)cGt>cAt	p.R347H	IL1RAPL2_ENST00000485671.1_3'UTR|IL1RAPL2_ENST00000344799.4_Missense_Mutation_p.R347H	NM_017416.1	NP_059112.1	Q9NP60	IRPL2_HUMAN	interleukin 1 receptor accessory protein-like 2	347	Ig-like C2-type 3.				central nervous system development (GO:0007417)|cytokine-mediated signaling pathway (GO:0019221)	integral component of membrane (GO:0016021)	interleukin-1 receptor activity (GO:0004908)|interleukin-1, Type II, blocking receptor activity (GO:0004910)			breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(14)|lung(23)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						GTTTTGCTGCGTAAAAAGGGT	0.368																																																0			X											59.0	51.0	54.0					X																	104984676		2203	4300	6503	104871332	SO:0001583	missense	26280			AF181285	CCDS14517.1	Xq22	2013-01-11			ENSG00000189108	ENSG00000189108		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5997	protein-coding gene	gene with protein product		300277				10757639	Standard	NM_017416		Approved	IL-1R9, TIGIRR-1, IL1RAPL-2, IL1R9	uc004elz.1	Q9NP60	OTTHUMG00000022141	ENST00000372582.1:c.1040G>A	X.37:g.104984676G>A	ENSP00000361663:p.Arg347His		104871332	Q2M3U3|Q9NZN0	Missense_Mutation	SNP	superfamily_Immunoglobulin,HMMSmart_SM00409,HMMPfam_ig,superfamily_Toll/Interleukin receptor TIR domain,HMMSmart_SM00255,HMMPfam_TIR	p.R347H	ENST00000372582.1	37	c.1040	CCDS14517.1	X	.	.	.	.	.	.	.	.	.	.	G	11.70	1.718262	0.30503	.	.	ENSG00000189108	ENST00000372582;ENST00000344799	T;T	0.77620	-1.11;-1.11	5.61	5.61	0.85477	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000002	T	0.77025	0.4070	L	0.27053	0.805	0.80722	D	1	D	0.71674	0.998	P	0.55161	0.77	T	0.74583	-0.3617	10	0.25106	T	0.35	.	17.5047	0.87741	0.0:0.0:1.0:0.0	.	347	Q9NP60	IRPL2_HUMAN	H	347	ENSP00000361663:R347H;ENSP00000344976:R347H	ENSP00000344976:R347H	R	+	2	0	IL1RAPL2	104871332	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.989000	0.49393	2.348000	0.79779	0.600000	0.82982	CGT	-	HMMSmart_SM00409		0.368	IL1RAPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL1RAPL2	protein_coding	OTTHUMT00000057785.1	G	NM_017416		104871332	+1	no_errors	NM_017416	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
IKBKAP	8518	genome.wustl.edu	37	9	111640961	111640961	+	Silent	SNP	C	C	T			TCGA-29-1688-01A-01W-0633-09	TCGA-29-1688-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	083e3d14-3756-4101-a93d-bc76f2c0d59c	e4318781-2a5f-412b-aaa5-74827d79a63d	g.chr9:111640961C>T	ENST00000374647.5	-	34	3949	c.3642G>A	c.(3640-3642)gaG>gaA	p.E1214E	IKBKAP_ENST00000537196.1_Silent_p.E865E|IKBKAP_ENST00000467959.1_5'Flank	NM_003640.3	NP_003631.2	O95163	ELP1_HUMAN	inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase complex-associated protein	1214					chromatin organization (GO:0006325)|immune response (GO:0006955)|positive regulation of cell migration (GO:0030335)|protein complex assembly (GO:0006461)|protein phosphorylation (GO:0006468)|regulation of protein kinase activity (GO:0045859)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|transcription elongation from RNA polymerase II promoter (GO:0006368)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|Elongator holoenzyme complex (GO:0033588)|nucleolus (GO:0005730)|transcription elongation factor complex (GO:0008023)	phosphorylase kinase regulator activity (GO:0008607)|signal transducer activity (GO:0004871)			NS(2)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(7)|large_intestine(4)|lung(13)|ovary(2)|pancreas(1)|prostate(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	53						GGGCCAGGTCCTCCAGCGGAC	0.478																																																0			9											240.0	237.0	238.0					9																	111640961		2203	4300	6503	110680782	SO:0001819	synonymous_variant	8518			AF044195	CCDS6773.1	9q31	2014-09-17	2003-12-02		ENSG00000070061	ENSG00000070061		"""Elongator acetyltransferase complex subunits"""	5959	protein-coding gene	gene with protein product	"""elongator acetyltransferase complex subunit 1"""	603722	"""dysautonomia (Riley-Day syndrome, hereditary sensory autonomic neuropathy type III)"""	DYS		9751059, 11179008	Standard	NM_003640		Approved	IKAP, TOT1, ELP1, IKI3	uc004bdm.4	O95163	OTTHUMG00000020465	ENST00000374647.5:c.3642G>A	9.37:g.111640961C>T			110680782	Q5JSV2|Q9H327|Q9UG87	Silent	SNP	HMMPfam_IKI3,superfamily_Amine_DH_B_like	p.E1214	ENST00000374647.5	37	c.3642	CCDS6773.1	9																																																																																			-	NULL		0.478	IKBKAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IKBKAP	protein_coding	OTTHUMT00000053574.1	C			110680782	-1	no_errors	NM_003640	genbank	human	reviewed	54_36p	silent	SNP	1.000	T
ADAM12	8038	genome.wustl.edu	37	10	127738188	127738188	+	Missense_Mutation	SNP	C	C	G			TCGA-29-1688-01A-01W-0633-09	TCGA-29-1688-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	083e3d14-3756-4101-a93d-bc76f2c0d59c	e4318781-2a5f-412b-aaa5-74827d79a63d	g.chr10:127738188C>G	ENST00000368679.4	-	15	1978	c.1669G>C	c.(1669-1671)Gat>Cat	p.D557H	ADAM12_ENST00000368676.4_Missense_Mutation_p.D557H|ADAM12_ENST00000467145.1_5'UTR	NM_003474.4	NP_003465.3	O43184	ADA12_HUMAN	ADAM metallopeptidase domain 12	557	Cys-rich.				cell adhesion (GO:0007155)|epidermal growth factor receptor signaling pathway (GO:0007173)|myoblast fusion (GO:0007520)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			biliary_tract(1)|breast(7)|central_nervous_system(4)|endometrium(5)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	69		all_epithelial(44;7.06e-05)|all_lung(145;0.00563)|Lung NSC(174;0.00834)|Colorectal(57;0.102)|all_neural(114;0.107)|Breast(234;0.22)		COAD - Colon adenocarcinoma(40;0.141)|Colorectal(40;0.216)		CCATAAGGATCACCTGCAGAA	0.463																																																0			10											118.0	119.0	118.0					10																	127738188		2203	4300	6503	127728178	SO:0001583	missense	8038			AF023476	CCDS7653.1, CCDS7654.1	10q26	2008-07-29	2008-07-29		ENSG00000148848	ENSG00000148848		"""ADAM metallopeptidase domain containing"""	190	protein-coding gene	gene with protein product	"""meltrin alpha"""	602714	"""a disintegrin and metalloproteinase domain 12 (meltrin alpha)"""			9417060, 18342566	Standard	NM_003474		Approved	MCMPMltna, MLTN	uc001ljk.2	O43184	OTTHUMG00000019243	ENST00000368679.4:c.1669G>C	10.37:g.127738188C>G	ENSP00000357668:p.Asp557His		127728178	O60470|Q5JRP0|Q5JRP1|Q6P9E3|Q6UWB0	Missense_Mutation	SNP	"HMMPfam_Pep_M12B_propep,superfamily_Metalloproteases (""zincins"") catalytic domain,HMMPfam_Reprolysin,HMMPfam_Disintegrin,HMMSmart_SM00050,superfamily_Blood coagulation inhibitor (disintegrin),PatternScan_DISINTEGRIN_1,HMMSmart_SM00608,HMMPfam_ADAM_CR,HMMPfam_EGF_2"	p.D557H	ENST00000368679.4	37	c.1669	CCDS7653.1	10	.	.	.	.	.	.	.	.	.	.	C	25.9	4.684310	0.88639	.	.	ENSG00000148848	ENST00000368679;ENST00000368676	T;T	0.25579	1.79;1.79	4.9	4.9	0.64082	ADAM, cysteine-rich (2);	0.000000	0.85682	D	0.000000	T	0.61236	0.2331	M	0.91818	3.245	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.81914	0.989;0.982;0.982;0.982;0.995	T	0.70999	-0.4719	10	0.87932	D	0	.	18.6296	0.91355	0.0:1.0:0.0:0.0	.	554;554;557;554;557	A8K6G4;O43184-3;O43184-2;O43184-4;O43184	.;.;.;.;ADA12_HUMAN	H	557	ENSP00000357668:D557H;ENSP00000357665:D557H	ENSP00000357665:D557H	D	-	1	0	ADAM12	127728178	1.000000	0.71417	0.892000	0.35008	0.841000	0.47740	7.416000	0.80143	2.699000	0.92147	0.655000	0.94253	GAT	-	HMMSmart_SM00608,HMMPfam_ADAM_CR		0.463	ADAM12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM12	protein_coding	OTTHUMT00000050961.1	C			127728178	-1	no_errors	NM_003474	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
OCRL	4952	genome.wustl.edu	37	X	128724235	128724235	+	Silent	SNP	C	C	T			TCGA-29-1688-01A-01W-0633-09	TCGA-29-1688-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	083e3d14-3756-4101-a93d-bc76f2c0d59c	e4318781-2a5f-412b-aaa5-74827d79a63d	g.chrX:128724235C>T	ENST00000371113.4	+	24	2859	c.2694C>T	c.(2692-2694)agC>agT	p.S898S	OCRL_ENST00000357121.5_Silent_p.S890S	NM_000276.3	NP_000267.2	Q01968	OCRL_HUMAN	oculocerebrorenal syndrome of Lowe	898	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				cilium assembly (GO:0042384)|in utero embryonic development (GO:0001701)|inositol phosphate metabolic process (GO:0043647)|lipid metabolic process (GO:0006629)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|Golgi stack (GO:0005795)|Golgi-associated vesicle (GO:0005798)|nucleus (GO:0005634)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	inositol phosphate phosphatase activity (GO:0052745)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)			breast(1)|endometrium(3)|kidney(4)|large_intestine(11)|lung(24)|ovary(2)|upper_aerodigestive_tract(3)	48						TGCTTGGGAGCGAAGAAGACT	0.478																																																0			X											186.0	182.0	183.0					X																	128724235		2203	4300	6503	128551916	SO:0001819	synonymous_variant	4952			U57627	CCDS35393.1, CCDS35394.1	Xq25	2014-06-18			ENSG00000122126	ENSG00000122126			8108	protein-coding gene	gene with protein product		300535					Standard	NM_001587		Approved	OCRL1	uc004euq.3	Q01968	OTTHUMG00000022706	ENST00000371113.4:c.2694C>T	X.37:g.128724235C>T			128551916	A6NKI1|A8KAP2|B7ZLX2|O60800|Q15684|Q15774|Q4VY09|Q4VY10|Q5JQF1|Q5JQF2|Q9UJG5|Q9UMA5	Silent	SNP	superfamily_DNase I-like,HMMSmart_SM00128,HMMPfam_Exo_endo_phos,superfamily_GTPase activation domain GAP,HMMSmart_SM00324,HMMPfam_RhoGAP	p.S898	ENST00000371113.4	37	c.2694	CCDS35393.1	X																																																																																			-	NULL		0.478	OCRL-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	OCRL	protein_coding	OTTHUMT00000058917.1	C	NM_000276		128551916	+1	no_errors	NM_000276	genbank	human	reviewed	54_36p	silent	SNP	0.625	T
SLC9A6	10479	genome.wustl.edu	37	X	135106547	135106547	+	Silent	SNP	G	G	T			TCGA-29-1688-01A-01W-0633-09	TCGA-29-1688-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	083e3d14-3756-4101-a93d-bc76f2c0d59c	e4318781-2a5f-412b-aaa5-74827d79a63d	g.chrX:135106547G>T	ENST00000370698.3	+	12	1460	c.1425G>T	c.(1423-1425)cgG>cgT	p.R475R	SLC9A6_ENST00000370701.1_Silent_p.R455R|SLC9A6_ENST00000370695.4_Silent_p.R507R	NM_006359.2	NP_006350.1	Q92581	SL9A6_HUMAN	solute carrier family 9, subfamily A (NHE6, cation proton antiporter 6), member 6	475					axon extension (GO:0048675)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|dendrite extension (GO:0097484)|dendritic spine development (GO:0060996)|ion transport (GO:0006811)|neuron projection morphogenesis (GO:0048812)|regulation of neurotrophin TRK receptor signaling pathway (GO:0051386)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|synapse organization (GO:0050808)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon terminus (GO:0043679)|axonal spine (GO:0044308)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|early endosome membrane (GO:0031901)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)|synapse (GO:0045202)	sodium:proton antiporter activity (GO:0015385)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(18)|ovary(2)|upper_aerodigestive_tract(1)	33	Acute lymphoblastic leukemia(192;0.000127)					CTTATGCACGGCAAATGATGT	0.463																																																0			X											295.0	201.0	233.0					X																	135106547		2203	4300	6503	134934213	SO:0001819	synonymous_variant	10479			AF030409	CCDS14654.1, CCDS44003.1, CCDS55504.1	Xq26.3	2013-05-22	2012-03-22		ENSG00000198689	ENSG00000198689		"""Solute carriers"""	11079	protein-coding gene	gene with protein product		300231	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 6"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 6"""			9507001	Standard	NM_001042537		Approved	NHE6, KIAA0267	uc004ezk.3	Q92581	OTTHUMG00000022498	ENST00000370698.3:c.1425G>T	X.37:g.135106547G>T			134934213	A6NIQ9|A8K160|B4DU30|B7ZAE0|Q3ZCW7|Q5JPP8|Q5JPP9|Q86VS0	Silent	SNP	HMMPfam_Na_H_Exchanger	p.R507	ENST00000370698.3	37	c.1521	CCDS14654.1	X																																																																																			-	HMMPfam_Na_H_Exchanger		0.463	SLC9A6-001	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	SLC9A6	protein_coding	OTTHUMT00000058450.1	G	NM_006359		134934213	+1	no_errors	NM_001042537	genbank	human	validated	54_36p	silent	SNP	0.998	T
SLITRK4	139065	genome.wustl.edu	37	X	142718171	142718171	+	Missense_Mutation	SNP	G	G	T			TCGA-29-1688-01A-01W-0633-09	TCGA-29-1688-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	083e3d14-3756-4101-a93d-bc76f2c0d59c	e4318781-2a5f-412b-aaa5-74827d79a63d	g.chrX:142718171G>T	ENST00000381779.4	-	2	979	c.754C>A	c.(754-756)Ctt>Att	p.L252I	SLITRK4_ENST00000338017.4_Missense_Mutation_p.L252I|SLITRK4_ENST00000356928.1_Missense_Mutation_p.L252I	NM_001184749.2|NM_001184750.1|NM_173078.4	NP_001171678.1|NP_001171679.1|NP_775101.1	Q8IW52	SLIK4_HUMAN	SLIT and NTRK-like family, member 4	252	LRRCT 1.					integral component of membrane (GO:0016021)				autonomic_ganglia(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(11)|lung(27)|ovary(2)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	60	Acute lymphoblastic leukemia(192;6.56e-05)					TCTTTTAAAAGCCTTCCATAT	0.443																																																0			X											69.0	62.0	65.0					X																	142718171		2203	4300	6503	142545837	SO:0001583	missense	139065			BC040986	CCDS14679.1	Xq27.3	2004-06-23			ENSG00000179542	ENSG00000179542			23502	protein-coding gene	gene with protein product		300562				14557068	Standard	NM_001184749		Approved	DKFZp547M2010	uc004fby.3	Q8IW52	OTTHUMG00000022580	ENST00000381779.4:c.754C>A	X.37:g.142718171G>T	ENSP00000371198:p.Leu252Ile		142545837	Q5JXG3|Q8TCM8|Q96DL3	Missense_Mutation	SNP	superfamily_L domain-like,HMMSmart_SM00369,HMMPfam_LRR_1,HMMSmart_SM00365,HMMSmart_SM00082,HMMPfam_LRRNT	p.L252I	ENST00000381779.4	37	c.754	CCDS14679.1	X	.	.	.	.	.	.	.	.	.	.	G	13.27	2.187553	0.38609	.	.	ENSG00000179542	ENST00000381779;ENST00000356928;ENST00000338017	T;T;T	0.41758	0.99;0.99;0.99	5.64	5.64	0.86602	Cysteine-rich flanking region, C-terminal (1);	0.000000	0.64402	D	0.000001	T	0.45558	0.1348	L	0.37697	1.125	0.54753	D	0.999985	D	0.57257	0.979	P	0.55222	0.771	T	0.38045	-0.9679	10	0.48119	T	0.1	-9.947	10.7273	0.46077	0.0892:0.0:0.9108:0.0	.	252	Q8IW52	SLIK4_HUMAN	I	252	ENSP00000371198:L252I;ENSP00000349400:L252I;ENSP00000336627:L252I	ENSP00000336627:L252I	L	-	1	0	SLITRK4	142545837	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	5.670000	0.68088	2.358000	0.79984	0.600000	0.82982	CTT	-	superfamily_L domain-like,HMMSmart_SM00082		0.443	SLITRK4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SLITRK4	protein_coding	OTTHUMT00000058617.1	G	NM_173078		142545837	-1	no_errors	NM_173078	genbank	human	validated	54_36p	missense	SNP	1.000	T
TCERG1	10915	genome.wustl.edu	37	5	145849168	145849168	+	Silent	SNP	A	A	G			TCGA-29-1688-01A-01W-0633-09	TCGA-29-1688-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	083e3d14-3756-4101-a93d-bc76f2c0d59c	e4318781-2a5f-412b-aaa5-74827d79a63d	g.chr5:145849168A>G	ENST00000296702.5	+	7	1298	c.1260A>G	c.(1258-1260)gcA>gcG	p.A420A	TCERG1_ENST00000394421.2_Silent_p.A399A	NM_006706.3	NP_006697.2	O14776	TCRG1_HUMAN	transcription elongation regulator 1	420					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription corepressor activity (GO:0001106)|transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(3)|endometrium(5)|kidney(4)|large_intestine(18)|lung(9)|ovary(2)|prostate(3)|skin(1)	46		Lung NSC(249;0.00188)|all_lung(500;0.00307)|all_neural(839;0.0424)|Breast(839;0.0743)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TTGCTATTGCAGCTTCACCTG	0.378																																																0			5											173.0	189.0	183.0					5																	145849168		2203	4298	6501	145829361	SO:0001819	synonymous_variant	10915			AF017789	CCDS4282.1, CCDS43379.1	5q31	2010-01-25	2002-01-24	2002-01-25	ENSG00000113649	ENSG00000113649			15630	protein-coding gene	gene with protein product	"""transcription factor CA150"", ""co-activator of 150 kDa"", ""TATA box binding protein (TBP)-associated factor, RNA polymerase II, S, 150kD"", ""TATA box-binding protein-associated factor 2S"""	605409	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, S, 150kD"""	TAF2S		9315662, 11003711	Standard	XM_005268365		Approved	CA150, Urn1	uc003lob.3	O14776	OTTHUMG00000129683	ENST00000296702.5:c.1260A>G	5.37:g.145849168A>G			145829361	Q2NKN2|Q59EA1	Silent	SNP	superfamily_WW domain,HMMSmart_SM00456,HMMPfam_WW,PatternScan_WW_DOMAIN_1,superfamily_FF domain,HMMSmart_SM00441,HMMPfam_FF	p.A420	ENST00000296702.5	37	c.1260	CCDS4282.1	5																																																																																			-	NULL		0.378	TCERG1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TCERG1	protein_coding	OTTHUMT00000251886.1	A	NM_001040006		145829361	+1	no_errors	NM_006706	genbank	human	reviewed	54_36p	silent	SNP	0.993	G
Unknown	0	genome.wustl.edu	37	X	150394504	150394504	+	IGR	SNP	C	C	A			TCGA-29-1688-01A-01W-0633-09	TCGA-29-1688-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	083e3d14-3756-4101-a93d-bc76f2c0d59c	e4318781-2a5f-412b-aaa5-74827d79a63d	g.chrX:150394504C>A								AF003625.3 (43177 upstream) : VMA21 (170482 downstream)																							TAGATTGCAACACTCTTTTGA	0.343																																																0			X																																								150145162	SO:0001628	intergenic_variant	286456																															X.37:g.150394504C>A			150145162		RNA	SNP	-	NULL		37	NULL		X																																																																																			-	-	0	0.343					LOC286456			C			150145162	-1	pseudogene	XR_016302	genbank	human	model	54_36p	rna	SNP	0.953	A
BCAP31	10134	genome.wustl.edu	37	X	152981133	152981133	+	Missense_Mutation	SNP	C	C	T			TCGA-29-1688-01A-01W-0633-09	TCGA-29-1688-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	083e3d14-3756-4101-a93d-bc76f2c0d59c	e4318781-2a5f-412b-aaa5-74827d79a63d	g.chrX:152981133C>T	ENST00000345046.6	-	4	612	c.205G>A	c.(205-207)Gaa>Aaa	p.E69K	BCAP31_ENST00000468947.1_5'UTR|BCAP31_ENST00000441714.1_Missense_Mutation_p.E69K|BCAP31_ENST00000458587.2_Missense_Mutation_p.E136K	NM_001256447.1	NP_001243376.1	P51572	BAP31_HUMAN	B-cell receptor-associated protein 31	69					antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|negative regulation of endoplasmic reticulum calcium ion concentration (GO:0032471)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)|protein localization to endoplasmic reticulum exit site (GO:0070973)|spermatogenesis (GO:0007283)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|integral component of plasma membrane (GO:0005887)|lipid particle (GO:0005811)|membrane (GO:0016020)				endometrium(2)|large_intestine(2)|lung(2)|prostate(1)	7	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					TTCCGAATTTCGCGCACGGCA	0.552																																																0			X											169.0	133.0	145.0					X																	152981133		2203	4300	6503	152634327	SO:0001583	missense	10134			X81109	CCDS14727.1, CCDS48191.1	Xq28	2005-10-11			ENSG00000185825	ENSG00000185825			16695	protein-coding gene	gene with protein product		300398					Standard	NM_001139441		Approved	DXS1357E, BAP31, 6C6-Ag, CDM	uc011mza.1	P51572	OTTHUMG00000024218	ENST00000345046.6:c.205G>A	X.37:g.152981133C>T	ENSP00000343458:p.Glu69Lys		152634327	B3KQ79|D3DWV5|Q13836|Q96CF0	Missense_Mutation	SNP	HMMPfam_Bap31	p.E69K	ENST00000345046.6	37	c.205	CCDS14727.1	X	.	.	.	.	.	.	.	.	.	.	C	20.3	3.971527	0.74246	.	.	ENSG00000185825	ENST00000441714;ENST00000345046;ENST00000426131;ENST00000458587;ENST00000442093;ENST00000429550;ENST00000416815;ENST00000423827;ENST00000430088	.	.	.	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	D	0.84165	0.5412	M	0.89095	3.005	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.94	D	0.84795	0.0781	9	0.34782	T	0.22	-27.19	16.8983	0.86106	0.0:1.0:0.0:0.0	.	69;136	P51572;B3KQ79	BAP31_HUMAN;.	K	69;69;136;136;69;69;69;69;69	.	ENSP00000343458:E69K	E	-	1	0	BCAP31	152634327	1.000000	0.71417	0.219000	0.23793	0.091000	0.18340	6.934000	0.75880	2.252000	0.74401	0.468000	0.43344	GAA	-	HMMPfam_Bap31		0.552	BCAP31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCAP31	protein_coding	OTTHUMT00000061071.1	C	NM_005745		152634327	-1	no_errors	NM_005745	genbank	human	reviewed	54_36p	missense	SNP	0.998	T
RNF32	140545	genome.wustl.edu	37	7	156447365	156447365	+	Missense_Mutation	SNP	G	G	A	rs576205900		TCGA-29-1688-01A-01W-0633-09	TCGA-29-1688-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	083e3d14-3756-4101-a93d-bc76f2c0d59c	e4318781-2a5f-412b-aaa5-74827d79a63d	g.chr7:156447365G>A	ENST00000405335.1	+	5	779	c.370G>A	c.(370-372)Gtg>Atg	p.V124M	RNF32_ENST00000311822.8_Missense_Mutation_p.V124M|RNF32_ENST00000392741.2_Missense_Mutation_p.V124M|RNF32_ENST00000317955.5_Missense_Mutation_p.V124M|AC005534.8_ENST00000455709.1_RNA|RNF32_ENST00000432459.2_Missense_Mutation_p.V124M|RNF32_ENST00000392743.2_Missense_Mutation_p.V124M|RNF32_ENST00000343665.4_Missense_Mutation_p.V124M|RNF32_ENST00000480011.1_3'UTR			Q9H0A6	RNF32_HUMAN	ring finger protein 32	124						aggresome (GO:0016235)|endosome (GO:0005768)	zinc ion binding (GO:0008270)			cervix(2)|endometrium(3)|kidney(1)|large_intestine(2)|lung(5)|upper_aerodigestive_tract(2)	15	Ovarian(565;0.218)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.00291)	UCEC - Uterine corpus endometrioid carcinoma (81;0.169)		AGGGGACTCCGTGCAACCATG	0.537													G|||	1	0.000199681	0.0008	0.0	5008	,	,		19074	0.0		0.0	False		,,,				2504	0.0															0			7											119.0	98.0	105.0					7																	156447365		2203	4300	6503	156140126	SO:0001583	missense	140545				CCDS5944.1	7q36	2013-08-05			ENSG00000105982	ENSG00000105982		"""RING-type (C3HC4) zinc fingers"""	17118	protein-coding gene	gene with protein product		610241				11890671	Standard	NM_001184996		Approved	FKSG33, HSD15, LMBR2	uc003wmr.3	Q9H0A6	OTTHUMG00000151440	ENST00000405335.1:c.370G>A	7.37:g.156447365G>A	ENSP00000385285:p.Val124Met		156140126	Q6FIB3|Q6X7T4|Q8N6V8|Q8TDG0|Q96BM5|Q9Y6U1	Missense_Mutation	SNP	superfamily_RING/U-box,HMMSmart_SM00184,HMMPfam_zf-C3HC4,HMMPfam_IQ	p.V124M	ENST00000405335.1	37	c.370	CCDS5944.1	7	.	.	.	.	.	.	.	.	.	.	G	1.202	-0.632229	0.03584	.	.	ENSG00000105982	ENST00000404282;ENST00000432459;ENST00000317955;ENST00000405335;ENST00000311822;ENST00000392743;ENST00000392741;ENST00000343665	D;D;D;D;D;D;D;T	0.91792	-2.91;-2.91;-2.91;-2.91;-2.91;-2.91;-2.91;1.99	5.34	-1.57	0.08506	.	0.921976	0.09543	N	0.787990	T	0.69433	0.3110	N	0.00972	-1.085	0.09310	N	1	B;B;B;B	0.27380	0.024;0.177;0.09;0.063	B;B;B;B	0.15052	0.006;0.012;0.008;0.005	T	0.63646	-0.6590	10	0.22109	T	0.4	-0.4096	1.7924	0.03054	0.301:0.2551:0.3196:0.1242	.	124;124;124;124	Q9H0A6-4;G5E940;Q9H0A6-2;Q9H0A6	.;.;.;RNF32_HUMAN	M	124	ENSP00000385815:V124M;ENSP00000405588:V124M;ENSP00000315950:V124M;ENSP00000385285:V124M;ENSP00000308894:V124M;ENSP00000376499:V124M;ENSP00000376497:V124M;ENSP00000341185:V124M	ENSP00000308894:V124M	V	+	1	0	RNF32	156140126	0.000000	0.05858	0.001000	0.08648	0.021000	0.10359	-0.512000	0.06313	-0.551000	0.06175	-0.302000	0.09304	GTG	-	NULL		0.537	RNF32-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RNF32	protein_coding	OTTHUMT00000322660.2	G	NM_030936		156140126	+1	no_errors	NM_030936	genbank	human	reviewed	54_36p	missense	SNP	0.003	A
LMBR1	64327	genome.wustl.edu	37	7	156518149	156518149	+	Missense_Mutation	SNP	C	C	T			TCGA-29-1688-01A-01W-0633-09	TCGA-29-1688-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	083e3d14-3756-4101-a93d-bc76f2c0d59c	e4318781-2a5f-412b-aaa5-74827d79a63d	g.chr7:156518149C>T	ENST00000353442.5	-	14	1374	c.1138G>A	c.(1138-1140)Gat>Aat	p.D380N	LMBR1_ENST00000359422.4_Missense_Mutation_p.D228N|LMBR1_ENST00000354505.4_Missense_Mutation_p.D421N|LMBR1_ENST00000540390.1_Missense_Mutation_p.D359N	NM_022458.3	NP_071903.2	Q8WVP7	LMBR1_HUMAN	limb development membrane protein 1	380					embryonic digit morphogenesis (GO:0042733)	integral component of membrane (GO:0016021)				breast(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(9)|skin(1)	18	Ovarian(565;0.218)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.00231)	UCEC - Uterine corpus endometrioid carcinoma (81;0.208)		GTTGTGTCATCTTTCTTGGGA	0.403																																																0			7											144.0	148.0	147.0					7																	156518149		2203	4300	6503	156210910	SO:0001583	missense	64327			AF107454	CCDS5945.1	7q36.3	2013-08-05	2013-08-05	2005-07-25	ENSG00000105983	ENSG00000105983			13243	protein-coding gene	gene with protein product		605522	"""chromosome 7 open reading frame 2"", ""limb region 1 homolog (mouse)"""	C7orf2		10329000, 11090342	Standard	NM_022458		Approved	ACHP, FLJ11665, ZRS	uc003wmw.4	Q8WVP7	OTTHUMG00000151510	ENST00000353442.5:c.1138G>A	7.37:g.156518149C>T	ENSP00000326604:p.Asp380Asn		156210910	A4D242|Q8N3E3|Q96QZ5|Q9H5N0|Q9HAG9|Q9UDN5|Q9Y6U2	Missense_Mutation	SNP	HMMPfam_LMBR1	p.D380N	ENST00000353442.5	37	c.1138	CCDS5945.1	7	.	.	.	.	.	.	.	.	.	.	C	18.99	3.740672	0.69304	.	.	ENSG00000105983	ENST00000353442;ENST00000316198;ENST00000359422;ENST00000415428;ENST00000354505;ENST00000540390	T;T;T;T;T	0.28454	1.61;1.61;1.61;1.61;1.61	5.26	5.26	0.73747	LMBR1-like membrane protein (1);	0.100772	0.64402	D	0.000002	T	0.29491	0.0735	N	0.11427	0.14	0.80722	D	1	P;B;P	0.47484	0.896;0.012;0.896	P;B;P	0.53224	0.721;0.027;0.721	T	0.07790	-1.0754	10	0.27785	T	0.31	-17.7176	17.416	0.87500	0.0:1.0:0.0:0.0	.	359;421;380	B7Z633;Q8WVP7-3;Q8WVP7	.;.;LMBR1_HUMAN	N	380;22;228;419;421;359	ENSP00000326604:D380N;ENSP00000352392:D228N;ENSP00000408256:D419N;ENSP00000346500:D421N;ENSP00000445509:D359N	ENSP00000326700:D22N	D	-	1	0	LMBR1	156210910	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	6.971000	0.76105	2.613000	0.88420	0.591000	0.81541	GAT	-	HMMPfam_LMBR1		0.403	LMBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LMBR1	protein_coding	OTTHUMT00000347939.3	C	NM_022458		156210910	-1	no_errors	NM_022458	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
ABCC5	10057	genome.wustl.edu	37	3	183665282	183665282	+	Missense_Mutation	SNP	C	C	G			TCGA-29-1688-01A-01W-0633-09	TCGA-29-1688-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	083e3d14-3756-4101-a93d-bc76f2c0d59c	e4318781-2a5f-412b-aaa5-74827d79a63d	g.chr3:183665282C>G	ENST00000334444.6	-	23	3484	c.3244G>C	c.(3244-3246)Gat>Cat	p.D1082H	ABCC5_ENST00000265586.6_Missense_Mutation_p.D1039H	NM_005688.2	NP_005679.2	O15440	MRP5_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 5	1082	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan biosynthetic process (GO:0030213)|hyaluronan metabolic process (GO:0030212)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	62	all_cancers(143;1.85e-10)|Ovarian(172;0.0303)		Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)		Adefovir Dipivoxil(DB00718)|Alprostadil(DB00770)|Atorvastatin(DB01076)|Cisplatin(DB00515)|Dinoprostone(DB00917)|Dipyridamole(DB00975)|Fluorouracil(DB00544)|Glutathione(DB00143)|Mercaptopurine(DB01033)|Probenecid(DB01032)|Rifampicin(DB01045)|Sildenafil(DB00203)|Sulfinpyrazone(DB01138)|Zidovudine(DB00495)	TGGTTGTCATCCAGCAGCTCC	0.522																																																0			3											42.0	51.0	48.0					3																	183665282		1968	4160	6128	185147976	SO:0001583	missense	10057			AF104942	CCDS33898.1, CCDS43176.1	3q27	2012-03-14			ENSG00000114770	ENSG00000114770		"""ATP binding cassette transporters / subfamily C"""	56	protein-coding gene	gene with protein product		605251				8894702, 9827529	Standard	XM_005247058		Approved	MRP5, SMRP, EST277145, MOAT-C	uc003fmg.3	O15440	OTTHUMG00000156871	ENST00000334444.6:c.3244G>C	3.37:g.183665282C>G	ENSP00000333926:p.Asp1082His		185147976	B9EIQ2|O14517|Q29ZA9|Q29ZB1|Q86UX3|Q86W30|Q9UN85|Q9UNP5|Q9UQC3	Missense_Mutation	SNP	superfamily_Multidrug resistance ABC transporter MsbA N-terminal domain,HMMPfam_ABC_membrane,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00382,HMMPfam_ABC_tran,PatternScan_ABC_TRANSPORTER_1	p.D1082H	ENST00000334444.6	37	c.3244	CCDS43176.1	3	.	.	.	.	.	.	.	.	.	.	C	23.9	4.472908	0.84640	.	.	ENSG00000114770	ENST00000334444;ENST00000265586	D;D	0.95171	-2.7;-3.63	5.53	5.53	0.82687	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.98535	0.9511	H	0.97829	4.085	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.99525	1.0959	10	0.87932	D	0	-20.1302	19.4656	0.94935	0.0:1.0:0.0:0.0	.	1039;1082	Q86UX3;O15440	.;MRP5_HUMAN	H	1082;1039	ENSP00000333926:D1082H;ENSP00000265586:D1039H	ENSP00000265586:D1039H	D	-	1	0	ABCC5	185147976	1.000000	0.71417	1.000000	0.80357	0.758000	0.43043	7.802000	0.85969	2.607000	0.88179	0.655000	0.94253	GAT	-	superfamily_Multidrug resistance ABC transporter MsbA N-terminal domain,HMMPfam_ABC_membrane		0.522	ABCC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCC5	protein_coding	OTTHUMT00000346350.1	C	NM_005688		185147976	-1	no_errors	NM_005688	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
NRP2	8828	genome.wustl.edu	37	2	206641244	206641244	+	Missense_Mutation	SNP	C	C	G			TCGA-29-1688-01A-01W-0633-09	TCGA-29-1688-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	083e3d14-3756-4101-a93d-bc76f2c0d59c	e4318781-2a5f-412b-aaa5-74827d79a63d	g.chr2:206641244C>G	ENST00000357118.4	+	16	2731	c.2700C>G	c.(2698-2700)caC>caG	p.H900Q	NRP2_ENST00000272849.3_Missense_Mutation_p.H905Q|NRP2_ENST00000540178.1_Intron|NRP2_ENST00000357785.5_Intron|NRP2_ENST00000360409.3_Intron|NRP2_ENST00000412873.2_Intron|NRP2_ENST00000540841.1_Intron	NM_201267.1	NP_957719	Q99435	NELL2_HUMAN	neuropilin 2	0						extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(14)|lung(19)|ovary(1)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	52						GTGGCTCGCACTGCTGAGGGC	0.527											OREG0015157	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				0			2											79.0	75.0	76.0					2																	206641244		2203	4300	6503	206349489	SO:0001583	missense	8828			AF016098	CCDS2364.1, CCDS2365.1, CCDS46496.1, CCDS46497.1, CCDS46498.1, CCDS46499.1	2q33.3	2008-05-23			ENSG00000118257	ENSG00000118257			8005	protein-coding gene	gene with protein product		602070				9529250, 9331348	Standard	NM_003872		Approved	VEGF165R2	uc002vaw.3	O60462	OTTHUMG00000132893	ENST00000357118.4:c.2700C>G	2.37:g.206641244C>G	ENSP00000349632:p.His900Gln	2161	206349489	B7Z2U7|B7Z5Q4|B7Z9J5|B7Z9U3|Q96JS2	Missense_Mutation	SNP	superfamily_Spermadhesin CUB domain,HMMPfam_CUB,HMMSmart_SM00042,HMMSmart_SM00231,superfamily_Galactose-binding domain-like,HMMPfam_F5_F8_type_C,PatternScan_FA58C_1,PatternScan_FA58C_2,HMMSmart_SM00137,HMMPfam_MAM	p.H905Q	ENST00000357118.4	37	c.2715	CCDS46498.1	2	.	.	.	.	.	.	.	.	.	.	C	2.111	-0.403849	0.04832	.	.	ENSG00000118257	ENST00000357118;ENST00000272849	D;D	0.86694	-2.15;-2.16	5.42	4.49	0.54785	.	.	.	.	.	T	0.81437	0.4822	.	.	.	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.78028	-0.2364	8	0.54805	T	0.06	.	10.9926	0.47557	0.0:0.6948:0.2294:0.0759	.	900;905	O60462-4;O60462-5	.;.	Q	900;905	ENSP00000349632:H900Q;ENSP00000272849:H905Q	ENSP00000272849:H905Q	H	+	3	2	NRP2	206349489	0.994000	0.37717	0.999000	0.59377	0.480000	0.33159	0.482000	0.22276	2.537000	0.85549	0.655000	0.94253	CAC	-	NULL		0.527	NRP2-003	KNOWN	basic|CCDS	protein_coding	NRP2	protein_coding	OTTHUMT00000336465.1	C			206349489	+1	no_errors	NM_018534	genbank	human	reviewed	54_36p	missense	SNP	0.942	G
C2orf80	389073	genome.wustl.edu	37	2	209036792	209036792	+	Missense_Mutation	SNP	C	C	T	rs199911442		TCGA-29-1688-01A-01W-0633-09	TCGA-29-1688-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	083e3d14-3756-4101-a93d-bc76f2c0d59c	e4318781-2a5f-412b-aaa5-74827d79a63d	g.chr2:209036792C>T	ENST00000341287.4	-	7	569	c.374G>A	c.(373-375)cGa>cAa	p.R125Q	C2orf80_ENST00000453017.1_Intron|C2orf80_ENST00000451346.1_Missense_Mutation_p.R106Q	NM_001099334.2	NP_001092804	Q0P641	CB080_HUMAN	chromosome 2 open reading frame 80	125										endometrium(2)|large_intestine(3)|lung(6)|skin(2)	13						AGATGAAACTCGGGGAACCTG	0.473													C|||	1	0.000199681	0.0	0.0	5008	,	,		19880	0.001		0.0	False		,,,				2504	0.0															0			2											180.0	187.0	185.0					2																	209036792		1947	4155	6102	208745037	SO:0001583	missense	389073			AC016697, AW136505, BC035737	CCDS42809.1	2q33.3	2013-10-31			ENSG00000188674	ENSG00000188674			34352	protein-coding gene	gene with protein product	"""gonad development associated 1"""	615536				22080834, 24055526	Standard	NM_001099334		Approved	LOC389073, GONDA1	uc002vcr.3	Q0P641	OTTHUMG00000154751	ENST00000341287.4:c.374G>A	2.37:g.209036792C>T	ENSP00000343171:p.Arg125Gln		208745037	A6NKZ3	Missense_Mutation	SNP	NULL	p.R125Q	ENST00000341287.4	37	c.374	CCDS42809.1	2	.	.	.	.	.	.	.	.	.	.	C	8.365	0.833949	0.16820	.	.	ENSG00000188674	ENST00000451342;ENST00000341287;ENST00000451346;ENST00000423952	T;T;T;T	0.37235	1.23;1.71;1.64;1.21	5.12	2.25	0.28309	.	0.338343	0.21632	N	0.071479	T	0.19167	0.0460	N	0.19112	0.55	0.09310	N	1	B	0.20780	0.048	B	0.12837	0.008	T	0.19745	-1.0296	10	0.20046	T	0.44	-0.2042	6.965	0.24617	0.0:0.6229:0.0:0.3771	.	125	Q0P641	CB080_HUMAN	Q	50;125;106;38	ENSP00000389385:R50Q;ENSP00000343171:R125Q;ENSP00000405393:R106Q;ENSP00000413016:R38Q	ENSP00000343171:R125Q	R	-	2	0	C2orf80	208745037	0.001000	0.12720	0.094000	0.20943	0.302000	0.27658	-0.394000	0.07296	0.376000	0.24707	0.557000	0.71058	CGA	-	NULL		0.473	C2orf80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C2orf80	protein_coding	OTTHUMT00000336931.1	C	NM_001099334		208745037	-1	no_errors	NM_001099334	genbank	human	validated	54_36p	missense	SNP	0.146	T
KCNH1	3756	genome.wustl.edu	37	1	210970949	210970949	+	Missense_Mutation	SNP	C	C	T			TCGA-29-1688-01A-01W-0633-09	TCGA-29-1688-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	083e3d14-3756-4101-a93d-bc76f2c0d59c	e4318781-2a5f-412b-aaa5-74827d79a63d	g.chr1:210970949C>T	ENST00000271751.4	-	9	1843	c.1816G>A	c.(1816-1818)Gac>Aac	p.D606N	KCNH1_ENST00000367007.4_Missense_Mutation_p.D579N			O95259	KCNH1_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 1	606					myoblast fusion (GO:0007520)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|phosphorelay sensor kinase activity (GO:0000155)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(13)|lung(35)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	68				OV - Ovarian serous cystadenocarcinoma(81;0.0109)|all cancers(67;0.141)|Epithelial(68;0.185)		TAGATGAGGTCCCCTGGGGCA	0.612																																																0			1											81.0	82.0	82.0					1																	210970949		2203	4300	6503	209037572	SO:0001583	missense	3756			AJ001366	CCDS1496.1, CCDS31015.1	1q32.2	2012-07-05			ENSG00000143473	ENSG00000143473		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6250	protein-coding gene	gene with protein product		603305				9738473, 16382104	Standard	NM_172362		Approved	Kv10.1, eag, h-eag, eag1	uc001hib.2	O95259	OTTHUMG00000036309	ENST00000271751.4:c.1816G>A	1.37:g.210970949C>T	ENSP00000271751:p.Asp606Asn		209037572	B1AQ26|O76035|Q14CL3	Missense_Mutation	SNP	superfamily_PYP-like sensor domain (PAS domain),HMMSmart_SM00086,superfamily_Voltage-gated potassium channels,HMMPfam_Ion_trans,superfamily_cAMP-binding domain-like,HMMSmart_SM00100,HMMPfam_cNMP_binding	p.D606N	ENST00000271751.4	37	c.1816	CCDS1496.1	1	.	.	.	.	.	.	.	.	.	.	C	34	5.372182	0.95923	.	.	ENSG00000143473	ENST00000271751;ENST00000367007	D;D	0.97138	-4.26;-4.26	5.36	5.36	0.76844	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (3);	0.096811	0.64402	D	0.000001	D	0.98814	0.9600	M	0.92219	3.285	0.80722	D	1	D;D	0.63880	0.993;0.966	D;D	0.68192	0.956;0.956	D	0.99659	1.0993	10	0.87932	D	0	.	19.0956	0.93249	0.0:1.0:0.0:0.0	.	579;606	Q14CL3;O95259	.;KCNH1_HUMAN	N	606;579	ENSP00000271751:D606N;ENSP00000355974:D579N	ENSP00000271751:D606N	D	-	1	0	KCNH1	209037572	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	7.531000	0.81973	2.506000	0.84524	0.655000	0.94253	GAC	-	superfamily_cAMP-binding domain-like,HMMSmart_SM00100,HMMPfam_cNMP_binding		0.612	KCNH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNH1	protein_coding	OTTHUMT00000088332.1	C	NM_002238		209037572	-1	no_errors	NM_172362	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
CCDC108	255101	genome.wustl.edu	37	2	219896026	219896026	+	Splice_Site	SNP	C	C	T			TCGA-29-1688-01A-01W-0633-09	TCGA-29-1688-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	083e3d14-3756-4101-a93d-bc76f2c0d59c	e4318781-2a5f-412b-aaa5-74827d79a63d	g.chr2:219896026C>T	ENST00000341552.5	-	8	900	c.817G>A	c.(817-819)Gac>Aac	p.D273N	CCDC108_ENST00000409865.3_Splice_Site_p.D262N|CCDC108_ENST00000441968.1_Splice_Site_p.D273N|CCDC108_ENST00000453220.1_Splice_Site_p.D273N|CCDC108_ENST00000410037.1_Splice_Site_p.D208N	NM_194302.2	NP_919278.2	Q6ZU64	CC108_HUMAN	coiled-coil domain containing 108	273						integral component of membrane (GO:0016021)	poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(18)|liver(1)|lung(34)|ovary(2)|pancreas(1)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	80		Renal(207;0.0915)		Epithelial(149;1.12e-06)|all cancers(144;0.000196)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GTGGGCAGGTCCCTGGGGGTG	0.667																																																0			2											21.0	26.0	24.0					2																	219896026		2203	4300	6503	219604270	SO:0001630	splice_region_variant	255101			NM_194302, AL833882, AK127189	CCDS2430.2, CCDS2431.2, CCDS63125.1, CCDS63126.1	2q35	2008-02-05			ENSG00000181378	ENSG00000181378			25325	protein-coding gene	gene with protein product		614270				12477932	Standard	NM_194302		Approved	DKFZp434O0527, MGC35338	uc002vjl.2	Q6ZU64	OTTHUMG00000133013	ENST00000341552.5:c.816-1G>A	2.37:g.219896026C>T			219604270	A2BDD8|E9PCR1|E9PG25|E9PG72|Q6ZSR8|Q8N0T4|Q8NDJ3	Missense_Mutation	SNP	PatternScan_MGMT,superfamily_PapD-like	p.D273N	ENST00000341552.5	37	c.817	CCDS2430.2	2	.	.	.	.	.	.	.	.	.	.	C	31	5.065039	0.93898	.	.	ENSG00000181378	ENST00000341552;ENST00000441968;ENST00000453220;ENST00000409865;ENST00000410037;ENST00000441164	T;T;T;T;T	0.07908	3.43;3.43;3.43;3.15;3.15	5.37	5.37	0.77165	PapD-like (1);	0.154505	0.30043	N	0.010541	T	0.29749	0.0743	M	0.78637	2.42	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79108	0.992;0.988	T	0.01444	-1.1353	10	0.27082	T	0.32	-27.8536	17.2845	0.87137	0.0:1.0:0.0:0.0	.	262;273	E9PG25;Q6ZU64	.;CC108_HUMAN	N	273;273;273;262;208;207	ENSP00000340776:D273N;ENSP00000413377:D273N;ENSP00000409117:D273N;ENSP00000386945:D262N;ENSP00000386258:D208N	ENSP00000340776:D273N	D	-	1	0	CCDC108	219604270	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.869000	0.56062	2.517000	0.84864	0.650000	0.86243	GAC	-	superfamily_PapD-like		0.667	CCDC108-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCDC108	protein_coding	OTTHUMT00000256598.4	C	NM_194302	Missense_Mutation	219604270	-1	no_errors	NM_194302	genbank	human	provisional	54_36p	missense	SNP	1.000	T
ITPKB	3707	genome.wustl.edu	37	1	226923900	226923900	+	Silent	SNP	G	G	A			TCGA-29-1688-01A-01W-0633-09	TCGA-29-1688-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	083e3d14-3756-4101-a93d-bc76f2c0d59c	e4318781-2a5f-412b-aaa5-74827d79a63d	g.chr1:226923900G>A	ENST00000272117.3	-	1	1259	c.1260C>T	c.(1258-1260)tcC>tcT	p.S420S	ITPKB_ENST00000366784.1_Silent_p.S420S|ITPKB_ENST00000429204.1_Silent_p.S420S			P27987	IP3KB_HUMAN	inositol-trisphosphate 3-kinase B	420					cell surface receptor signaling pathway (GO:0007166)|inositol phosphate metabolic process (GO:0043647)|MAPK cascade (GO:0000165)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of Ras protein signal transduction (GO:0046579)|positive thymic T cell selection (GO:0045059)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)			central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(13)|ovary(4)|prostate(1)|skin(1)	30		Prostate(94;0.0773)				CAGGGCCTACGGAGGCCAGGG	0.677																																					Colon(84;110 1851 5306 33547)											0			1											18.0	22.0	21.0					1																	226923900		2133	4269	6402	224990523	SO:0001819	synonymous_variant	3707			AJ242780	CCDS1555.1	1q42.12	2011-04-28	2011-04-28		ENSG00000143772	ENSG00000143772	2.7.1.127		6179	protein-coding gene	gene with protein product		147522	"""inositol 1,4,5-trisphosphate 3-kinase B"""			1654894, 1330886	Standard	NM_002221		Approved	IP3KB, IP3-3KB	uc010pvo.2	P27987	OTTHUMG00000037582	ENST00000272117.3:c.1260C>T	1.37:g.226923900G>A			224990523	Q5VWL9|Q5VWM0|Q96BZ2|Q96JS1|Q9UH47	Silent	SNP	HMMPfam_IPK,superfamily_SAICAR synthase-like	p.S420	ENST00000272117.3	37	c.1260	CCDS1555.1	1																																																																																			-	NULL		0.677	ITPKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITPKB	protein_coding	OTTHUMT00000091632.1	G	NM_002221		224990523	-1	no_errors	NM_002221	genbank	human	reviewed	54_36p	silent	SNP	0.000	A
COL6A3	1293	genome.wustl.edu	37	2	238275911	238275911	+	Missense_Mutation	SNP	A	A	G			TCGA-29-1688-01A-01W-0633-09	TCGA-29-1688-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	083e3d14-3756-4101-a93d-bc76f2c0d59c	e4318781-2a5f-412b-aaa5-74827d79a63d	g.chr2:238275911A>G	ENST00000295550.4	-	11	5371	c.4919T>C	c.(4918-4920)aTt>aCt	p.I1640T	COL6A3_ENST00000346358.4_Missense_Mutation_p.I1440T|COL6A3_ENST00000472056.1_Missense_Mutation_p.I1033T|COL6A3_ENST00000353578.4_Missense_Mutation_p.I1434T|COL6A3_ENST00000347401.3_Missense_Mutation_p.I1439T|COL6A3_ENST00000409809.1_Missense_Mutation_p.I1434T	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	1640	Nonhelical region.|VWFA 9. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		CAGGAACACAATGTCTGCTTT	0.378																																																0			2											63.0	56.0	58.0					2																	238275911		2203	4300	6503	237940650	SO:0001583	missense	1293			X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.4919T>C	2.37:g.238275911A>G	ENSP00000295550:p.Ile1640Thr		237940650	A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Missense_Mutation	SNP	HMMSmart_SM00327,superfamily_vWA-like,HMMPfam_VWA,HMMPfam_Collagen,superfamily_Fibronectin type III,superfamily_BPTI-like,HMMSmart_SM00131,HMMPfam_Kunitz_BPTI,PatternScan_BPTI_KUNITZ_1	p.I1640T	ENST00000295550.4	37	c.4919	CCDS33412.1	2	.	.	.	.	.	.	.	.	.	.	A	15.85	2.953948	0.53293	.	.	ENSG00000163359	ENST00000295550;ENST00000347401;ENST00000353578;ENST00000472056;ENST00000409809;ENST00000346358	D;D;D;D;D;D	0.88277	-2.36;-2.36;-2.36;-2.36;-2.36;-2.36	5.5	5.5	0.81552	von Willebrand factor, type A (3);	0.109263	0.40064	N	0.001196	D	0.94631	0.8269	M	0.85373	2.75	0.58432	D	0.999999	D;D;D	0.67145	0.996;0.982;0.978	D;D;P	0.69654	0.965;0.918;0.686	D	0.95409	0.8496	10	0.87932	D	0	.	15.5966	0.76587	1.0:0.0:0.0:0.0	.	1033;1434;1640	E9PFQ6;P12111-2;P12111	.;.;CO6A3_HUMAN	T	1640;1439;1434;1033;1434;1440	ENSP00000295550:I1640T;ENSP00000315609:I1439T;ENSP00000315873:I1434T;ENSP00000418285:I1033T;ENSP00000386844:I1434T;ENSP00000295546:I1440T	ENSP00000295550:I1640T	I	-	2	0	COL6A3	237940650	1.000000	0.71417	0.973000	0.42090	0.944000	0.59088	9.262000	0.95591	2.080000	0.62538	0.533000	0.62120	ATT	-	superfamily_vWA-like,HMMSmart_SM00327,HMMPfam_VWA		0.378	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL6A3	protein_coding	OTTHUMT00000315790.2	A	NM_004369		237940650	-1	no_errors	NM_004369	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
TRIM58	25893	genome.wustl.edu	37	1	248039460	248039460	+	Missense_Mutation	SNP	C	C	T			TCGA-29-1688-01A-01W-0633-09	TCGA-29-1688-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	083e3d14-3756-4101-a93d-bc76f2c0d59c	e4318781-2a5f-412b-aaa5-74827d79a63d	g.chr1:248039460C>T	ENST00000366481.3	+	6	1178	c.1130C>T	c.(1129-1131)cCt>cTt	p.P377L	OR2W3_ENST00000537741.1_Intron	NM_015431.3	NP_056246.3	Q8NG06	TRI58_HUMAN	tripartite motif containing 58	377	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(39)|ovary(4)|pancreas(1)|skin(7)|stomach(1)	63	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0286)	OV - Ovarian serous cystadenocarcinoma(106;0.0319)			ACGCCATCTCCTGAGAATGGG	0.572																																																0			1											111.0	111.0	111.0					1																	248039460		2203	4300	6503	246106083	SO:0001583	missense	25893			AF327057	CCDS1636.1	1q44	2013-01-09	2011-01-25		ENSG00000162722	ENSG00000162722		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	24150	protein-coding gene	gene with protein product			"""tripartite motif-containing 58"""				Standard	NM_015431		Approved	BIA2	uc001ido.3	Q8NG06	OTTHUMG00000040203	ENST00000366481.3:c.1130C>T	1.37:g.248039460C>T	ENSP00000355437:p.Pro377Leu		246106083	Q6B0H9	Missense_Mutation	SNP	superfamily_SSF57850,HMMSmart_RING,HMMPfam_zf-C3HC4,PatternScan_ZF_RING_1,HMMPfam_zf-B_box,HMMSmart_BBOX,HMMSmart_PRY,HMMPfam_SPRY,HMMSmart_SPRY	p.P377L	ENST00000366481.3	37	c.1130	CCDS1636.1	1	.	.	.	.	.	.	.	.	.	.	C	14.72	2.618430	0.46736	.	.	ENSG00000162722	ENST00000366481	T	0.70516	-0.49	4.05	4.05	0.47172	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.000000	0.56097	D	0.000026	D	0.84247	0.5430	M	0.83384	2.64	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.86690	0.1922	10	0.87932	D	0	.	14.5446	0.68020	0.0:1.0:0.0:0.0	.	377	Q8NG06	TRI58_HUMAN	L	377	ENSP00000355437:P377L	ENSP00000355437:P377L	P	+	2	0	TRIM58	246106083	0.883000	0.30277	0.303000	0.25071	0.182000	0.23217	4.227000	0.58612	2.559000	0.86315	0.650000	0.86243	CCT	-	HMMPfam_SPRY,HMMSmart_SPRY		0.572	TRIM58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM58	protein_coding	OTTHUMT00000096860.1	C	NM_015431		246106083	+1	no_errors	NM_015431	genbank	human	validated	54_36p	missense	SNP	0.235	T
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	DEL	CA	CA	-			TCGA-29-1688-01A-01W-0633-09	TCGA-29-1688-10A-01W-0633-09	CA	CA					Unknown	Invalid:failed_liftOver	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	083e3d14-3756-4101-a93d-bc76f2c0d59c	e4318781-2a5f-412b-aaa5-74827d79a63d	g.chrUnknown:0delCA								None (None upstream) : None (None downstream)																								0.0																																																0			MT																																								517	SO:0001628	intergenic_variant	0																															Unknown.37:g.0delCA			516		RNA	DEL	-	NULL		37	NULL		MT																																																																																			(deletion:rna[155,931])	-	0	0					ENSG00000223073			CA			517	+1	no_errors	ENST00000411141	ensembl	human	novel	54_36p	rna	DEL	NULL	-
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	DEL	AT	AT	-			TCGA-29-1688-01A-01W-0633-09	TCGA-29-1688-10A-01W-0633-09	AT	AT					Unknown	Invalid:failed_liftOver	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	083e3d14-3756-4101-a93d-bc76f2c0d59c	e4318781-2a5f-412b-aaa5-74827d79a63d	g.chrUnknown:0delAT								None (None upstream) : None (None downstream)																								0.0																																																0			MT																																								7672	SO:0001628	intergenic_variant	0																															Unknown.37:g.0delAT			7671		Frame_Shift_Del	DEL	HMMPfam_COX2_TM,superfamily_Cytochrome c oxidase subunit II-like transmembrane region,superfamily_Cupredoxins,HMMPfam_COX2,PatternScan_COX2	p.M29fs		37	c.85_86		MT																																																																																			(deletion:cds_exon[7587,8270])	HMMPfam_COX2_TM,superfamily_Cytochrome c oxidase subunit II-like transmembrane region	0	0					MT-CO2			AT			7672	+1	no_errors	ENST00000361739	ensembl	human	known	54_36p	frame_shift_del	DEL	NULL	-
CD109	135228	genome.wustl.edu	37	6	74407296	74407297	+	Splice_Site	INS	-	-	T	rs144858532		TCGA-29-1688-01A-01W-0633-09	TCGA-29-1688-10A-01W-0633-09	-	-					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	083e3d14-3756-4101-a93d-bc76f2c0d59c	e4318781-2a5f-412b-aaa5-74827d79a63d	g.chr6:74407296_74407297insT	ENST00000287097.5	+	2	359		c.e2+1		CD109_ENST00000437994.2_Splice_Site|RP11-553A21.3_ENST00000428865.2_RNA|CD109_ENST00000422508.2_Splice_Site			Q6YHK3	CD109_HUMAN	CD109 molecule						negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of wound healing (GO:0061045)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)|transforming growth factor beta binding (GO:0050431)			NS(2)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(18)|liver(2)|lung(26)|ovary(2)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						TTTGAAAAAGGTAAGATAAACA	0.431																																																0			6																																								74464018	SO:0001630	splice_region_variant	135228			AF410459	CCDS4982.1, CCDS55038.1, CCDS55039.1	6q14.1	2008-02-05	2006-03-28		ENSG00000156535	ENSG00000156535		"""CD molecules"""	21685	protein-coding gene	gene with protein product		608859	"""CD109 antigen (Gov platelet alloantigens)"""			11861284, 11861285	Standard	XM_005248659		Approved	FLJ38569, DKFZp762L1111, CPAMD7	uc003php.3	Q6YHK3	OTTHUMG00000015040	ENST00000287097.5:c.247+1->T	6.37:g.74407297_74407297dupT			74464017	A5YKK4|B2R948|B3KW25|Q0P6K7|Q5SYA8|Q5XUM7|Q5XUM9|Q6MZI7|Q8N3A7|Q8N915|Q8TDJ2|Q8TDJ3	Splice_Site	INS	-	e2+1	ENST00000287097.5	37	c.247+1_247+1	CCDS4982.1	6																																																																																			-	-		0.431	CD109-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD109	protein_coding	OTTHUMT00000041230.3	-	NM_133493	Intron	74464018	+1	no_errors	NM_133493	genbank	human	validated	54_36p	splice_site_ins	INS	1.000:0.996	T
PSMD14	10213	genome.wustl.edu	37	2	162175361	162175372	+	In_Frame_Del	DEL	GGAGGTATGCCT	GGAGGTATGCCT	-	rs202245412		TCGA-29-1688-01A-01W-0633-09	TCGA-29-1688-10A-01W-0633-09	GGAGGTATGCCT	GGAGGTATGCCT					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	083e3d14-3756-4101-a93d-bc76f2c0d59c	e4318781-2a5f-412b-aaa5-74827d79a63d	g.chr2:162175361_162175372delGGAGGTATGCCT	ENST00000409682.3	+	3	729_740	c.25_36delGGAGGTATGCCT	c.(25-36)ggaggtatgcctdel	p.GGMP9del		NM_005805.5	NP_005796.1	O00487	PSDE_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 14	9					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|double-strand break repair via homologous recombination (GO:0000724)|double-strand break repair via nonhomologous end joining (GO:0006303)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of endopeptidase activity (GO:0010950)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K63-linked deubiquitination (GO:0070536)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle, lid subcomplex (GO:0008541)	endopeptidase activator activity (GO:0061133)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|proteasome binding (GO:0070628)|ubiquitin thiolesterase activity (GO:0004221)	p.P12P(1)		breast(1)|endometrium(1)|large_intestine(2)|lung(6)|prostate(2)	12						TAGACTTGGAGGAGGTATGCCTGGACTGGGCC	0.358																																																1	Substitution - coding silent(1)	endometrium(1)	2																																								161883618	SO:0001651	inframe_deletion	10213			U86782	CCDS46437.1	2q14.3	2008-05-22			ENSG00000115233	ENSG00000115233		"""Proteasome (prosome, macropain) subunits"""	16889	protein-coding gene	gene with protein product		607173				9374539	Standard	NM_005805		Approved	POH1, pad1, Rpn11	uc002ubu.3	O00487	OTTHUMG00000153882	ENST00000409682.3:c.25_36delGGAGGTATGCCT	2.37:g.162175361_162175372delGGAGGTATGCCT	ENSP00000386541:p.Gly9_Pro12del		161883607	B3KNW2|O00176	In_Frame_Del	DEL	HMMPfam_Mov34,superfamily_JAB1/MPN domain,HMMSmart_SM00232	p.GMPG10in_frame_del	ENST00000409682.3	37	c.25_36	CCDS46437.1	2																																																																																			(deletion:cds_exon[161883583,161883630])	NULL		0.358	PSMD14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMD14	protein_coding	OTTHUMT00000332833.1	GGAGGTATGCCT	NM_005805		161883618	+1	no_errors	NM_005805	genbank	human	validated	54_36p	in_frame_del	DEL	1.000:1.000:1.000:1.000:1.000:0.999:1.000:1.000:1.000:1.000:1.000:1.000	-
OR2G6	391211	genome.wustl.edu	37	1	248685102	248685115	+	Frame_Shift_Del	DEL	ACTCCAGACTCCAC	ACTCCAGACTCCAC	-			TCGA-29-1688-01A-01W-0633-09	TCGA-29-1688-10A-01W-0633-09	ACTCCAGACTCCAC	ACTCCAGACTCCAC					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	083e3d14-3756-4101-a93d-bc76f2c0d59c	e4318781-2a5f-412b-aaa5-74827d79a63d	g.chr1:248685102_248685115delACTCCAGACTCCAC	ENST00000343414.4	+	1	187_200	c.155_168delACTCCAGACTCCAC	c.(154-168)gactccagactccacfs	p.DSRLH52fs		NM_001013355.1	NP_001013373.1	Q5TZ20	OR2G6_HUMAN	olfactory receptor, family 2, subfamily G, member 6	52						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S53Y(2)|p.L55V(1)|p.S53S(1)|p.S53*(1)		NS(1)|cervix(1)|endometrium(2)|large_intestine(7)|lung(40)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	61	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0156)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TGTTGTCTGGACTCCAGACTCCACACTCCAATGT	0.472																																																5	Substitution - Missense(3)|Substitution - Nonsense(1)|Substitution - coding silent(1)	lung(5)	1																																								246751738	SO:0001589	frameshift_variant	391211				CCDS31119.1	1q44	2012-08-09			ENSG00000188558	ENSG00000188558		"""GPCR / Class A : Olfactory receptors"""	27019	protein-coding gene	gene with protein product							Standard	NM_001013355		Approved		uc001ien.1	Q5TZ20	OTTHUMG00000040462	ENST00000343414.4:c.155_168delACTCCAGACTCCAC	1.37:g.248685102_248685115delACTCCAGACTCCAC	ENSP00000341291:p.Asp52fs		246751725	B2RP33	Frame_Shift_Del	DEL	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.R54fs	ENST00000343414.4	37	c.155_168	CCDS31119.1	1																																																																																			(deletion:cds_exon[246751571,246752521])	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1		0.472	OR2G6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2G6	protein_coding	OTTHUMT00000097358.1	ACTCCAGACTCCAC	XM_372842		246751738	+1	no_errors	NM_001013355	genbank	human	validated	54_36p	frame_shift_del	DEL	0.024:0.002:0.002:0.004:0.001:0.001:0.003:0.079:0.991:0.997:0.994:0.994:0.984:0.717	-
