#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
TRIB3	57761	genome.wustl.edu	37	20	376869	376869	+	Silent	SNP	G	G	A			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr20:376869G>A	ENST00000217233.3	+	4	1165	c.612G>A	c.(610-612)gaG>gaA	p.E204E	TRIB3_ENST00000422053.2_Silent_p.E231E	NM_021158.3	NP_066981.2	Q96RU7	TRIB3_HUMAN	tribbles pseudokinase 3	204	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular lipid metabolic process (GO:0044255)|cellular response to insulin stimulus (GO:0032869)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of protein binding (GO:0032092)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein phosphorylation (GO:0006468)|regulation of glucose transport (GO:0010827)|regulation of MAP kinase activity (GO:0043405)|response to endoplasmic reticulum stress (GO:0034976)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase binding (GO:0019901)|protein kinase inhibitor activity (GO:0004860)|transcription corepressor activity (GO:0003714)|transferase activity, transferring phosphorus-containing groups (GO:0016772)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase regulator activity (GO:0055106)			breast(1)|central_nervous_system(3)|endometrium(2)|large_intestine(3)|lung(9)|ovary(2)|skin(1)	21		all_epithelial(17;0.165)|Lung NSC(37;0.191)|Breast(17;0.231)		Colorectal(46;0.101)|COAD - Colon adenocarcinoma(99;0.112)		AGAACCTGGAGGACTCCTGCG	0.602																																					Melanoma(101;421 2374 19538)											0			20											58.0	57.0	57.0					20																	376869		2203	4300	6503	324869	SO:0001819	synonymous_variant	57761			AF250311	CCDS12997.1	20p13-p12.2	2013-10-03	2013-10-03	2004-05-04	ENSG00000101255	ENSG00000101255			16228	protein-coding gene	gene with protein product		607898	"""chromosome 20 open reading frame 97"", ""tribbles homolog 3 (Drosophila)"""	C20orf97		12791994, 16715410	Standard	XM_005260773		Approved	dJ1103G7.3, TRB3	uc002wdm.3	Q96RU7	OTTHUMG00000031627	ENST00000217233.3:c.612G>A	20.37:g.376869G>A			324869	Q53GU4|Q53ZW7|Q6I9Y9|Q8TAI6|Q9H5M8|Q9NUD2	Silent	SNP	superfamily_Kinase_like,HMMPfam_Pkinase	p.E204	ENST00000217233.3	37	c.612	CCDS12997.1	20																																																																																			-	superfamily_Kinase_like		0.602	TRIB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIB3	protein_coding	OTTHUMT00000077441.2	G	NM_021158		324869	+1	no_errors	NM_021158	genbank	human	reviewed	54_36p	silent	SNP	0.972	A
DIP2C	22982	genome.wustl.edu	37	10	415516	415516	+	Silent	SNP	C	C	T			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr10:415516C>T	ENST00000280886.6	-	18	2136	c.2049G>A	c.(2047-2049)ctG>ctA	p.L683L	DIP2C_ENST00000540204.1_Silent_p.L4L|DIP2C_ENST00000381496.3_Silent_p.L576L	NM_014974.2	NP_055789.1	Q9Y2E4	DIP2C_HUMAN	DIP2 disco-interacting protein 2 homolog C (Drosophila)	683						nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(8)|endometrium(6)|kidney(10)|large_intestine(13)|lung(26)|ovary(3)|prostate(6)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(4)	81		all_cancers(4;0.00336)|all_lung(4;0.00732)|Lung NSC(4;0.00785)|all_epithelial(10;0.0159)|Colorectal(49;0.235)	OV - Ovarian serous cystadenocarcinoma(33;0.136)	Epithelial(11;0.0123)|all cancers(11;0.0467)|Lung(33;0.0864)|OV - Ovarian serous cystadenocarcinoma(14;0.106)		CCCCATAGGTCAGTCCATGCA	0.572																																																0			10											111.0	102.0	105.0					10																	415516		2203	4300	6503	405516	SO:0001819	synonymous_variant	22982			BC035216	CCDS7054.1	10p15.3	2006-01-13	2006-01-13	2006-01-13	ENSG00000151240	ENSG00000151240			29150	protein-coding gene	gene with protein product		611380	"""KIAA0934"""	KIAA0934			Standard	NM_014974		Approved		uc001ifp.3	Q9Y2E4	OTTHUMG00000017532	ENST00000280886.6:c.2049G>A	10.37:g.415516C>T			405516	B4DPI5|Q5SS78	Silent	SNP	PatternScan_AMP_BINDING,HMMPfam_DMAP_binding,superfamily_SSF56801,HMMPfam_AMP-binding	p.L683	ENST00000280886.6	37	c.2049	CCDS7054.1	10																																																																																			-	superfamily_SSF56801		0.572	DIP2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DIP2C	protein_coding	OTTHUMT00000046389.1	C	NM_014974		405516	-1	no_errors	NM_014974	genbank	human	reviewed	54_36p	silent	SNP	0.997	T
MUC5B	727897	genome.wustl.edu	37	11	1265638	1265638	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr11:1265638G>A	ENST00000529681.1	+	31	7586	c.7528G>A	c.(7528-7530)Gcc>Acc	p.A2510T	RP11-532E4.2_ENST00000532061.2_RNA|MUC5B_ENST00000447027.1_Missense_Mutation_p.A2513T	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	2510	11 X approximate tandem repeats, Ser/Thr- rich.|7 X Cys-rich subdomain repeats.|Thr-rich.			Missing (in Ref. 6; AAB61398). {ECO:0000305}.	cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CAGCTCCAAAGCCACTCCCTT	0.642																																																0			11											6.0	8.0	7.0					11																	1265638		1682	3813	5495	1222214	SO:0001583	missense	727897			U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.7528G>A	11.37:g.1265638G>A	ENSP00000436812:p.Ala2510Thr		1222214	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	HMMSmart_SM00216,HMMPfam_VWD,HMMPfam_C8,superfamily_Serine proterase inhibitors,HMMPfam_TIL,HMMSmart_SM00214,HMMSmart_SM00215,superfamily_PMP inhibitors,PatternScan_VWFC_1,HMMPfam_VWC,HMMSmart_SM00041,HMMPfam_Cys_knot,PatternScan_CTCK_1	p.A2513T	ENST00000529681.1	37	c.7537	CCDS44515.2	11	.	.	.	.	.	.	.	.	.	.	G	6.170	0.399598	0.11696	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844;ENST00000537836	T;T	0.17854	2.25;2.44	2.68	-5.37	0.02681	.	.	.	.	.	T	0.09730	0.0239	L	0.33245	0.995	0.09310	N	1	B;B	0.18741	0.03;0.03	B;B	0.12837	0.008;0.008	T	0.28427	-1.0044	9	0.87932	D	0	.	2.024	0.03515	0.3847:0.1322:0.3529:0.1302	.	3148;2513	A7Y9J9;E9PBJ0	.;.	T	2510;2513;2482;2525;55	ENSP00000436812:A2510T;ENSP00000415793:A2513T	ENSP00000343037:A2482T	A	+	1	0	MUC5B	1222214	0.000000	0.05858	0.000000	0.03702	0.049000	0.14656	-1.511000	0.02260	-2.420000	0.00564	0.184000	0.17185	GCC	-	NULL		0.642	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	MUC5B	protein_coding	OTTHUMT00000390041.2	G	XM_001126093		1222214	+1	no_errors	NM_002458	genbank	human	validated	54_36p	missense	SNP	0.000	A
ADARB2	105	genome.wustl.edu	37	10	1568842	1568842	+	Intron	SNP	G	G	T			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr10:1568842G>T	ENST00000381312.1	-	2	426				ADARB2-AS1_ENST00000381301.3_RNA	NM_018702.3	NP_061172.1	Q9NS39	RED2_HUMAN	adenosine deaminase, RNA-specific, B2 (non-functional)						mRNA processing (GO:0006397)	nucleus (GO:0005634)	adenosine deaminase activity (GO:0004000)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|single-stranded RNA binding (GO:0003727)			breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(17)|prostate(2)|skin(1)|urinary_tract(1)	41		all_epithelial(10;0.059)|Colorectal(49;0.0815)		all cancers(11;0.0224)|GBM - Glioblastoma multiforme(2;0.0414)|Epithelial(11;0.165)		ctcaccagatgcagatgctgg	0.612																																																0			10																																								1558842	SO:0001627	intron_variant	0			AF034837	CCDS7058.1	10p15.3	2013-05-20	2013-05-20		ENSG00000185736	ENSG00000185736	3.5.-.-		227	protein-coding gene	gene with protein product	"""RED2 homolog (rat)"""	602065	"""adenosine deaminase, RNA-specific, B2 (RED2 homolog rat)"", ""adenosine deaminase, RNA-specific, B2"""			9272162, 10836796	Standard	NM_018702		Approved	RED2, hRED2, ADAR3	uc009xhq.3	Q9NS39	OTTHUMG00000017543	ENST00000381312.1:c.101-147487C>A	10.37:g.1568842G>T			1558842	B2RPJ5|Q5VUT6|Q5VW42	RNA	SNP	-	NULL	ENST00000381312.1	37	NULL	CCDS7058.1	10																																																																																			-	-		0.612	ADARB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCRNA00168	protein_coding	OTTHUMT00000046426.1	G	NM_018702		1558842	+1	rna_with_coding_region	NM_001098830	genbank	human	provisional	54_36p	rna	SNP	0.000	T
TMC2	117532	genome.wustl.edu	37	20	2542553	2542553	+	Missense_Mutation	SNP	G	G	C			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr20:2542553G>C	ENST00000358864.1	+	4	466	c.451G>C	c.(451-453)Gag>Cag	p.E151Q		NM_080751.2	NP_542789.2	Q8TDI7	TMC2_HUMAN	transmembrane channel-like 2	151	Arg/Asp/Glu/Lys-rich (highly charged).				detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|vestibular reflex (GO:0060005)	integral component of membrane (GO:0016021)|stereocilium bundle tip (GO:0032426)	voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(3)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(14)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35						CCTGTCCGAGGAGGAACTGGC	0.607																																																0			20											74.0	69.0	71.0					20																	2542553		2203	4300	6503	2490553	SO:0001583	missense	117532			AF417580	CCDS13029.2	20p13	2010-08-05	2003-02-23		ENSG00000149488	ENSG00000149488			16527	protein-coding gene	gene with protein product		606707	"""transmembrane, cochlear expressed, 2"""	C20orf145		11850618, 12906855	Standard	XM_005260660		Approved	dJ686C3.3	uc002wgf.1	Q8TDI7	OTTHUMG00000031698	ENST00000358864.1:c.451G>C	20.37:g.2542553G>C	ENSP00000351732:p.Glu151Gln		2490553	Q5JXT0|Q5JXT1|Q6UWW4|Q6ZS41|Q8N9F3|Q9BYN2|Q9BYN3|Q9BYN4|Q9BYN5	Missense_Mutation	SNP	HMMPfam_TMC	p.E151Q	ENST00000358864.1	37	c.451	CCDS13029.2	20	.	.	.	.	.	.	.	.	.	.	G	20.5	3.999950	0.74818	.	.	ENSG00000149488	ENST00000358864	T	0.51071	0.72	4.66	4.66	0.58398	.	0.132084	0.49305	D	0.000149	T	0.60470	0.2271	M	0.64997	1.995	0.31344	N	0.68329	D;D	0.64830	0.994;0.99	D;P	0.63033	0.91;0.815	T	0.60999	-0.7151	10	0.24483	T	0.36	-23.9993	13.7971	0.63177	0.0:0.0:1.0:0.0	.	151;151	Q8TDI7-3;Q8TDI7	.;TMC2_HUMAN	Q	151	ENSP00000351732:E151Q	ENSP00000351732:E151Q	E	+	1	0	TMC2	2490553	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	7.229000	0.78088	2.528000	0.85240	0.563000	0.77884	GAG	-	NULL		0.607	TMC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMC2	protein_coding	OTTHUMT00000077601.2	G			2490553	+1	no_errors	NM_080751	genbank	human	validated	54_36p	missense	SNP	1.000	C
SRRM2	23524	genome.wustl.edu	37	16	2817697	2817697	+	Missense_Mutation	SNP	T	T	C			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr16:2817697T>C	ENST00000301740.8	+	11	7717	c.7168T>C	c.(7168-7170)Tac>Cac	p.Y2390H	AC092117.2_ENST00000581119.1_RNA|SRRM2_ENST00000574593.1_3'UTR	NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	2390	Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						CCTTTCTGCCTACGAGCGTGT	0.622																																																0			16											70.0	67.0	68.0					16																	2817697		2198	4300	6498	2757698	SO:0001583	missense	23524			AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.7168T>C	16.37:g.2817697T>C	ENSP00000301740:p.Tyr2390His		2757698	A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Missense_Mutation	SNP	HMMPfam_cwf21	p.Y2390H	ENST00000301740.8	37	c.7168	CCDS32373.1	16	.	.	.	.	.	.	.	.	.	.	T	10.16	1.273211	0.23221	.	.	ENSG00000167978	ENST00000301740;ENST00000544933	T	0.78595	-1.19	5.77	5.77	0.91146	.	0.000000	0.56097	D	0.000022	T	0.79488	0.4454	N	0.19112	0.55	0.32618	N	0.523708	D	0.71674	0.998	D	0.78314	0.991	D	0.84213	0.0457	10	0.72032	D	0.01	-10.9935	12.479	0.55831	0.0:0.0:0.0:1.0	.	2390	Q9UQ35	SRRM2_HUMAN	H	2390;1642	ENSP00000301740:Y2390H	ENSP00000301740:Y2390H	Y	+	1	0	SRRM2	2757698	0.974000	0.33945	0.995000	0.50966	0.451000	0.32288	2.802000	0.47916	2.202000	0.70862	0.533000	0.62120	TAC	-	NULL		0.622	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRRM2	protein_coding	OTTHUMT00000436411.1	T			2757698	+1	no_errors	NM_016333	genbank	human	validated	54_36p	missense	SNP	0.914	C
CSMD1	64478	genome.wustl.edu	37	8	2875999	2875999	+	Splice_Site	SNP	C	C	A			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr8:2875999C>A	ENST00000520002.1	-	53	8587	c.8032G>T	c.(8032-8034)Gct>Tct	p.A2678S	CSMD1_ENST00000602557.1_Splice_Site_p.A2678S|CSMD1_ENST00000537824.1_Splice_Site_p.A2677S|CSMD1_ENST00000602723.1_Intron|CSMD1_ENST00000400186.3_Intron|CSMD1_ENST00000542608.1_Intron			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	2678	Sushi 17. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		ATGAATTTACCCAGACATCGA	0.438																																																0			8											174.0	170.0	172.0					8																	2875999		1936	4145	6081	2863406	SO:0001630	splice_region_variant	64478					8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.8032+1G>T	8.37:g.2875999C>A			2863406	Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	superfamily_Spermadhesin CUB domain,HMMPfam_CUB,HMMSmart_SM00042,superfamily_Complement control module/SCR domain,HMMPfam_Sushi,HMMSmart_SM00032	p.G2678V	ENST00000520002.1	37	c.8033		8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	21.0|21.0	4.076911|4.076911	0.76415|0.76415	.|.	.|.	ENSG00000183117|ENSG00000183117	ENST00000520002;ENST00000318252;ENST00000537824|ENST00000335551	T;T|.	0.25749|.	1.78;1.78|.	5.19|5.19	5.19|5.19	0.71726|0.71726	Complement control module (2);Sushi/SCR/CCP (1);|.	0.293641|.	0.31697|.	N|.	0.007220|.	D|D	0.83041|0.83041	0.5168|0.5168	M|M	0.85859|0.85859	2.78|2.78	0.80722|0.80722	D|D	1|1	D;B|.	0.63880|.	0.993;0.248|.	P;B|.	0.59487|.	0.858;0.146|.	D|D	0.84785|0.84785	0.0775|0.0775	9|5	.|.	.|.	.|.	.|.	19.0734|19.0734	0.93150|0.93150	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	2678;2678|.	E5RIG2;Q96PZ7|.	.;CSMD1_HUMAN|.	S|V	2678;2539;2677|2094	ENSP00000430733:A2678S;ENSP00000441462:A2677S|.	.|.	A|G	-|-	1|2	0|0	CSMD1|CSMD1	2863406|2863406	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.798000|0.798000	0.45092|0.45092	7.612000|7.612000	0.82975|0.82975	2.574000|2.574000	0.86865|0.86865	0.650000|0.650000	0.86243|0.86243	GCT|GGC	-	NULL		0.438	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	CSMD1	protein_coding	OTTHUMT00000374500.2	C	NM_033225	Missense_Mutation	2863406	-1	pseudogene:no_stop_codon:bad_bp_length_for_coding_region	NM_033225	genbank	human	validated	54_36p	missense	SNP	1.000	A
HTT	3064	genome.wustl.edu	37	4	3237100	3237100	+	Missense_Mutation	SNP	C	C	T	rs144891713		TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr4:3237100C>T	ENST00000355072.5	+	62	8691	c.8546C>T	c.(8545-8547)cCg>cTg	p.P2849L	HTT_ENST00000513806.1_3'UTR	NM_002111.6	NP_002102	P42858	HD_HUMAN	huntingtin	2849					anterior/posterior pattern specification (GO:0009952)|axon cargo transport (GO:0008088)|cell aging (GO:0007569)|citrulline metabolic process (GO:0000052)|determination of adult lifespan (GO:0008340)|dopamine receptor signaling pathway (GO:0007212)|endoplasmic reticulum organization (GO:0007029)|endosomal transport (GO:0016197)|ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|Golgi organization (GO:0007030)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insulin secretion (GO:0030073)|iron ion homeostasis (GO:0055072)|L-glutamate import (GO:0051938)|lactate biosynthetic process from pyruvate (GO:0019244)|locomotory behavior (GO:0007626)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|neural plate formation (GO:0021990)|neuron apoptotic process (GO:0051402)|neuron development (GO:0048666)|olfactory lobe development (GO:0021988)|organ development (GO:0048513)|paraxial mesoderm formation (GO:0048341)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|protein import into nucleus (GO:0006606)|quinolinate biosynthetic process (GO:0019805)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of protein phosphatase type 2A activity (GO:0034047)|regulation of synaptic plasticity (GO:0048167)|response to calcium ion (GO:0051592)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|social behavior (GO:0035176)|spermatogenesis (GO:0007283)|striatum development (GO:0021756)|urea cycle (GO:0000050)|vesicle transport along microtubule (GO:0047496)|visual learning (GO:0008542)	autophagic vacuole (GO:0005776)|axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	beta-tubulin binding (GO:0048487)|diazepam binding (GO:0050809)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|transcription factor binding (GO:0008134)			breast(1)|cervix(2)|endometrium(14)|kidney(5)|large_intestine(23)|lung(28)|ovary(4)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	87		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		GACGTAGGGCCGGAATTTTCA	0.527													C|||	1	0.000199681	0.0	0.0	5008	,	,		22837	0.0		0.001	False		,,,				2504	0.0															0			4						C	LEU/PRO	0,4206		0,0,2103	107.0	106.0	106.0		8546	4.9	0.9	4	dbSNP_134	106	1,8441		0,1,4220	no	missense	HTT	NM_002111.6	98	0,1,6323	TT,TC,CC		0.0118,0.0,0.0079	possibly-damaging	2849/3143	3237100	1,12647	2103	4221	6324	3206898	SO:0001583	missense	3064			L12392	CCDS43206.1	4p16.3	2014-09-17	2007-12-04	2007-12-04	ENSG00000197386	ENSG00000197386		"""Endogenous ligands"""	4851	protein-coding gene	gene with protein product		613004	"""huntingtin (Huntington disease)"""	HD		8458085	Standard	NM_002111		Approved	IT15	uc021xkv.1	P42858	OTTHUMG00000159916	ENST00000355072.5:c.8546C>T	4.37:g.3237100C>T	ENSP00000347184:p.Pro2849Leu		3206898	Q9UQB7	Missense_Mutation	SNP	superfamily_ARM repeat,HMMPfam_HEAT	p.P2849L	ENST00000355072.5	37	c.8546	CCDS43206.1	4	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	21.4	4.144996	0.77888	0.0	1.18E-4	ENSG00000197386	ENST00000355072	T	0.05382	3.45	4.89	4.89	0.63831	.	0.202296	0.47093	D	0.000258	T	0.06645	0.0170	L	0.40543	1.245	0.58432	D	0.999999	P	0.45986	0.87	B	0.33846	0.171	T	0.24261	-1.0165	10	0.66056	D	0.02	.	17.3868	0.87418	0.0:1.0:0.0:0.0	.	2849	P42858	HD_HUMAN	L	2849	ENSP00000347184:P2849L	ENSP00000347184:P2849L	P	+	2	0	HTT	3206898	1.000000	0.71417	0.916000	0.36221	0.961000	0.63080	5.567000	0.67378	2.425000	0.82216	0.462000	0.41574	CCG	-	NULL		0.527	HTT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTT	protein_coding	OTTHUMT00000358234.2	C	NM_002111		3206898	+1	no_errors	NM_002111	genbank	human	reviewed	54_36p	missense	SNP	0.717	T
ZSCAN32	54925	genome.wustl.edu	37	16	3433207	3433207	+	Missense_Mutation	SNP	C	C	T			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr16:3433207C>T	ENST00000396852.4	-	7	2046	c.1739G>A	c.(1738-1740)gGg>gAg	p.G580E	ZSCAN32_ENST00000304926.3_Missense_Mutation_p.G368E|ZSCAN32_ENST00000439568.2_Missense_Mutation_p.G291E|NAA60_ENST00000576906.1_Intron|ZSCAN32_ENST00000396846.3_Missense_Mutation_p.G580E	NM_001284527.1|NM_001284529.1	NP_001271456.1|NP_001271458.1	Q9NX65	ZSC32_HUMAN	zinc finger and SCAN domain containing 32	580					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)										CCCACATTGCCCACACTGATA	0.547																																																0			16											107.0	104.0	105.0					16																	3433207		2197	4300	6497	3373208	SO:0001583	missense	54925			AK000424	CCDS10503.1, CCDS66920.1, CCDS66921.1	16p13.3	2013-01-09	2013-01-09	2013-01-09	ENSG00000140987	ENSG00000140987		"""-"", ""Zinc fingers, C2H2-type"""	20812	protein-coding gene	gene with protein product			"""zinc finger protein 434"""	ZNF434			Standard	XM_005255402		Approved	FLJ20417	uc002cux.4	Q9NX65	OTTHUMG00000129357	ENST00000396852.4:c.1739G>A	16.37:g.3433207C>T	ENSP00000380061:p.Gly580Glu		3373208	B4DWL5|C9JB03|Q6WMU8|Q7Z6G2|Q8NFX8|Q9BU74	Missense_Mutation	SNP	superfamily_SSF57667,HMMPfam_zf-C2H2,HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1	p.G368E	ENST00000396852.4	37	c.1103		16	.	.	.	.	.	.	.	.	.	.	C	7.862	0.726348	0.15439	.	.	ENSG00000140987	ENST00000304926;ENST00000396852;ENST00000396846;ENST00000439568	T;T;T;T	0.07114	3.22;3.22;3.22;3.22	3.68	1.69	0.24217	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.05318	0.0141	N	0.02103	-0.685	0.09310	N	1	D;B	0.57257	0.979;0.135	P;B	0.57846	0.828;0.127	T	0.31752	-0.9932	9	0.20519	T	0.43	.	3.9447	0.09343	0.0:0.5669:0.1998:0.2333	.	368;580	Q9NX65;Q6WMU8	ZN434_HUMAN;.	E	368;580;580;291	ENSP00000302502:G368E;ENSP00000380061:G580E;ENSP00000380057:G580E;ENSP00000391787:G291E	ENSP00000302502:G368E	G	-	2	0	ZNF434	3373208	0.000000	0.05858	0.115000	0.21578	0.925000	0.55904	-2.046000	0.01409	0.109000	0.17891	0.655000	0.94253	GGG	-	superfamily_SSF57667,HMMPfam_zf-C2H2,HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1		0.547	ZSCAN32-002	KNOWN	basic|appris_principal	protein_coding	ZNF434	protein_coding	OTTHUMT00000251509.2	C	NM_017810		3373208	-1	no_errors	NM_017810	genbank	human	provisional	54_36p	missense	SNP	0.000	T
LOC101927708	101927708	genome.wustl.edu	37	11	3581048	3581048	+	RNA	SNP	T	T	G	rs78918274		TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr11:3581048T>G	ENST00000527970.1	-	0	285				AC127526.1_ENST00000408092.1_RNA																							CAGAACCCATTCTGGTGGTGG	0.413																																																0			11																																								3537624			0																															11.37:g.3581048T>G			3537624		RNA	SNP	-	NULL	ENST00000527970.1	37	NULL		11																																																																																			-	-		0.413	RP13-726E6.2-002	KNOWN	basic	processed_transcript	LOC100128423	processed_transcript	OTTHUMT00000392273.1	T			3537624	+1	pseudogene	XR_038258	genbank	human	model	54_36p	rna	SNP	1.000	G
LYAR	55646	genome.wustl.edu	37	4	4285446	4285446	+	Silent	SNP	T	T	G			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr4:4285446T>G	ENST00000343470.4	-	3	264	c.24A>C	c.(22-24)gcA>gcC	p.A8A	LYAR_ENST00000452476.1_Silent_p.A8A	NM_017816.2	NP_060286	Q9NX58	LYAR_HUMAN	Ly1 antibody reactive	8						nucleolus (GO:0005730)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			endometrium(2)|large_intestine(6)|liver(2)|lung(5)|ovary(1)|prostate(1)	17				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		ATTCACCACATGCATTGCATG	0.343																																																0			4											86.0	79.0	82.0					4																	4285446		2203	4300	6503	4336347	SO:0001819	synonymous_variant	55646			AL136750	CCDS3374.1	4p16.3	2013-01-10	2012-12-07		ENSG00000145220	ENSG00000145220		"""Zinc fingers, C2HC-type containing"""	26021	protein-coding gene	gene with protein product			"""Ly1 antibody reactive homolog (mouse)"""			11230166, 8491376	Standard	NM_001145725		Approved	ZC2HC2, ZLYAR	uc003ght.3	Q9NX58	OTTHUMG00000125477	ENST00000343470.4:c.24A>C	4.37:g.4285446T>G			4336347	D3DVS4|Q6FI78|Q9NYS1	Silent	SNP	HMMPfam_zf-LYAR	p.A8	ENST00000343470.4	37	c.24	CCDS3374.1	4																																																																																			-	NULL		0.343	LYAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LYAR	protein_coding	OTTHUMT00000246800.2	T	NM_017816		4336347	-1	no_errors	NM_017816	genbank	human	validated	54_36p	silent	SNP	0.923	G
SEC14L5	9717	genome.wustl.edu	37	16	5009296	5009296	+	5'UTR	SNP	G	G	C			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr16:5009296G>C	ENST00000251170.7	+	0	152					NM_014692.1	NP_055507.1	O43304	S14L5_HUMAN	SEC14-like 5 (S. cerevisiae)							integral component of membrane (GO:0016021)|intracellular (GO:0005622)	transporter activity (GO:0005215)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(9)|ovary(1)|skin(1)	29						CCCCTGCCTGGTGACCTCCAT	0.597																																																0			16											75.0	77.0	76.0					16																	5009296		2117	4247	6364	4949297	SO:0001623	5_prime_UTR_variant	9717			AB007880	CCDS45403.1	16p13.3	2008-02-05				ENSG00000103184			29032	protein-coding gene	gene with protein product						9455477	Standard	NM_014692		Approved	KIAA0420, PRELID4B	uc002cye.2	O43304		ENST00000251170.7:c.-29G>C	16.37:g.5009296G>C			4949297		Missense_Mutation	SNP	HMMPfam_PRELI,superfamily_CRAL/TRIO N-terminal domain,HMMPfam_CRAL_TRIO_N,HMMSmart_SM00516,superfamily_CRAL/TRIO domain,HMMPfam_CRAL_TRIO,superfamily_Supernatant protein factor (SPF) C-terminal domain	p.G51A	ENST00000251170.7	37	c.152	CCDS45403.1	16																																																																																			-	NULL		0.597	SEC14L5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC14L5	protein_coding	OTTHUMT00000434379.1	G			4949297	+1	no_start_codon	ENST00000251170	ensembl	human	known	54_36p	missense	SNP	0.001	C
MUC16	94025	genome.wustl.edu	37	19	9066621	9066621	+	Missense_Mutation	SNP	T	T	C			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr19:9066621T>C	ENST00000397910.4	-	3	21028	c.20825A>G	c.(20824-20826)aAg>aGg	p.K6942R		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	6944	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TGACTCTCTCTTAATTTTTGT	0.438																																																0			19											209.0	197.0	201.0					19																	9066621		1936	4151	6087	8927621	SO:0001583	missense	94025			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.20825A>G	19.37:g.9066621T>C	ENSP00000381008:p.Lys6942Arg		8927621	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	PatternScan_ATPASE_ALPHA_BETA,superfamily_SEA domain,HMMSmart_SM00200,HMMPfam_SEA	p.K6942R	ENST00000397910.4	37	c.20825	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	t	5.346	0.249224	0.10130	.	.	ENSG00000181143	ENST00000397910	T	0.02552	4.25	2.77	0.516	0.17019	.	.	.	.	.	T	0.02267	0.0070	N	0.22421	0.69	.	.	.	B	0.31968	0.349	B	0.34385	0.181	T	0.41716	-0.9493	8	0.87932	D	0	.	2.8085	0.05434	0.0:0.1562:0.271:0.5728	.	6942	B5ME49	.	R	6942	ENSP00000381008:K6942R	ENSP00000381008:K6942R	K	-	2	0	MUC16	8927621	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.269000	0.02834	0.034000	0.15491	0.334000	0.21626	AAG	-	NULL		0.438	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	protein_coding	OTTHUMT00000402806.1	T	NM_024690		8927621	-1	no_errors	NM_024690	genbank	human	validated	54_36p	missense	SNP	0.000	C
TAS2R1	50834	genome.wustl.edu	37	5	9629406	9629406	+	Missense_Mutation	SNP	G	G	T			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr5:9629406G>T	ENST00000382492.2	-	1	1057	c.739C>A	c.(739-741)Ctc>Atc	p.L247I	CTD-2001E22.1_ENST00000504182.2_RNA	NM_019599.2	NP_062545.1	Q9NYW7	TA2R1_HUMAN	taste receptor, type 2, member 1	247					chemosensory behavior (GO:0007635)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(19)|ovary(3)|prostate(1)|skin(1)|stomach(1)	39						AGAGAAGAGAGAAAAACTTTT	0.458																																																0			5											79.0	85.0	83.0					5																	9629406		2203	4300	6503	9682406	SO:0001583	missense	50834			AF227129	CCDS3876.1	5p15	2012-08-22			ENSG00000169777	ENSG00000169777		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14909	protein-coding gene	gene with protein product		604796				10761934, 10766242	Standard	NM_019599		Approved	T2R1, TRB7	uc003jem.1	Q9NYW7	OTTHUMG00000090500	ENST00000382492.2:c.739C>A	5.37:g.9629406G>T	ENSP00000371932:p.Leu247Ile		9682406	Q646G8	Missense_Mutation	SNP	HMMPfam_TAS2R,superfamily_SSF81321	p.L247I	ENST00000382492.2	37	c.739	CCDS3876.1	5	.	.	.	.	.	.	.	.	.	.	G	6.601	0.479354	0.12581	.	.	ENSG00000169777	ENST00000382492	T	0.00700	5.82	5.55	-8.35	0.00984	.	2.044220	0.02617	N	0.102817	T	0.00580	0.0019	L	0.28458	0.855	0.09310	N	1	B	0.25772	0.134	B	0.24848	0.056	T	0.47923	-0.9079	9	.	.	.	.	0.3038	0.00277	0.311:0.2606:0.1567:0.2717	.	247	Q9NYW7	TA2R1_HUMAN	I	247	ENSP00000371932:L247I	.	L	-	1	0	TAS2R1	9682406	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.433000	0.00472	-1.509000	0.01798	-0.165000	0.13383	CTC	-	HMMPfam_TAS2R,superfamily_SSF81321		0.458	TAS2R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS2R1	protein_coding	OTTHUMT00000206988.2	G			9682406	-1	no_errors	NM_019599	genbank	human	reviewed	54_36p	missense	SNP	0.000	T
COL5A3	50509	genome.wustl.edu	37	19	10112511	10112511	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr19:10112511G>A	ENST00000264828.3	-	7	981	c.896C>T	c.(895-897)cCt>cTt	p.P299L		NM_015719.3	NP_056534.2	P25940	CO5A3_HUMAN	collagen, type V, alpha 3	299	Nonhelical region.				axon guidance (GO:0007411)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)			NS(2)|breast(3)|central_nervous_system(2)|endometrium(11)|kidney(23)|large_intestine(12)|liver(2)|lung(35)|ovary(8)|prostate(5)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	116			Epithelial(33;7.11e-05)			GGGGGTCGGAGGCAGATTTGG	0.582											OREG0025228	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				0			19											150.0	125.0	133.0					19																	10112511		2203	4300	6503	9973511	SO:0001583	missense	50509			AF177941	CCDS12222.1	19p13.2	2013-01-16			ENSG00000080573	ENSG00000080573		"""Collagens"""	14864	protein-coding gene	gene with protein product		120216				10722718	Standard	NM_015719		Approved		uc002mmq.1	P25940	OTTHUMG00000150019	ENST00000264828.3:c.896C>T	19.37:g.10112511G>A	ENSP00000264828:p.Pro299Leu	662	9973511	Q9NZQ6	Missense_Mutation	SNP	HMMSmart_SM00210,superfamily_Concanavalin A-like lectins/glucanases,HMMPfam_Laminin_G_2,HMMPfam_Collagen,HMMSmart_SM00038,HMMPfam_COLFI	p.P299L	ENST00000264828.3	37	c.896	CCDS12222.1	19	.	.	.	.	.	.	.	.	.	.	G	17.83	3.484414	0.63962	.	.	ENSG00000080573	ENST00000264828	D	0.89050	-2.46	4.95	2.72	0.32119	.	1.820960	0.03253	N	0.182170	T	0.81508	0.4837	N	0.22421	0.69	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.65298	-0.6202	10	0.29301	T	0.29	.	4.8679	0.13618	0.1159:0.0:0.6767:0.2074	.	299	P25940	CO5A3_HUMAN	L	299	ENSP00000264828:P299L	ENSP00000264828:P299L	P	-	2	0	COL5A3	9973511	0.012000	0.17670	0.019000	0.16419	0.796000	0.44982	0.672000	0.25187	0.588000	0.29660	0.462000	0.41574	CCT	-	NULL		0.582	COL5A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL5A3	protein_coding	OTTHUMT00000315788.1	G	NM_015719		9973511	-1	no_errors	NM_015719	genbank	human	reviewed	54_36p	missense	SNP	0.000	A
PRSS55	203074	genome.wustl.edu	37	8	10389015	10389015	+	Missense_Mutation	SNP	G	G	T			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr8:10389015G>T	ENST00000328655.3	+	3	598	c.558G>T	c.(556-558)tgG>tgT	p.W186C	PRSS51_ENST00000523024.1_RNA|PRSS55_ENST00000522210.1_Missense_Mutation_p.W186C	NM_198464.3	NP_940866.2	Q6UWB4	PRS55_HUMAN	protease, serine, 55	186	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	serine-type endopeptidase activity (GO:0004252)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(14)|ovary(1)|prostate(1)|skin(1)	31						CTGCCACATGGCGCGAATGCT	0.607																																																0			8											58.0	55.0	56.0					8																	10389015		2203	4300	6503	10426425	SO:0001583	missense	203074			AY358867	CCDS5976.1, CCDS56523.1	8p23.1	2014-01-21			ENSG00000184647	ENSG00000184647		"""Serine peptidases / Serine peptidases"""	30824	protein-coding gene	gene with protein product		615144				12975309, 18844450	Standard	NM_198464		Approved	T-SP1, UNQ9391, CT153	uc003wta.3	Q6UWB4	OTTHUMG00000129345	ENST00000328655.3:c.558G>T	8.37:g.10389015G>T	ENSP00000333003:p.Trp186Cys		10426425	E5RJX5	Missense_Mutation	SNP	superfamily_Trypsin-like serine proteases,HMMSmart_SM00020,HMMPfam_Trypsin,PatternScan_TRYPSIN_HIS,PatternScan_TRYPSIN_SER	p.W186C	ENST00000328655.3	37	c.558	CCDS5976.1	8	.	.	.	.	.	.	.	.	.	.	G	18.14	3.557757	0.65425	.	.	ENSG00000184647	ENST00000328655;ENST00000522210	D;D	0.88586	-2.4;-2.4	4.98	4.98	0.66077	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.32719	N	0.005728	D	0.92951	0.7757	L	0.61218	1.895	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.92496	0.6004	10	0.49607	T	0.09	.	14.4796	0.67573	0.0:0.0:1.0:0.0	.	186	Q6UWB4	PRS55_HUMAN	C	186	ENSP00000333003:W186C;ENSP00000430459:W186C	ENSP00000333003:W186C	W	+	3	0	PRSS55	10426425	1.000000	0.71417	0.822000	0.32727	0.016000	0.09150	6.127000	0.71642	2.684000	0.91462	0.655000	0.94253	TGG	-	superfamily_Trypsin-like serine proteases,HMMSmart_SM00020,HMMPfam_Trypsin		0.607	PRSS55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UNQ9391	protein_coding	OTTHUMT00000251493.3	G	NM_198464		10426425	+1	no_errors	NM_198464	genbank	human	validated	54_36p	missense	SNP	0.916	T
ODC1	4953	genome.wustl.edu	37	2	10583919	10583919	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr2:10583919G>A	ENST00000234111.4	-	6	1003	c.493C>T	c.(493-495)Cgt>Tgt	p.R165C	ODC1_ENST00000405333.1_Missense_Mutation_p.R165C|ODC1_ENST00000446285.1_5'Flank|SNORA80B_ENST00000383906.1_RNA	NM_002539.1	NP_002530.1	P11926	DCOR_HUMAN	ornithine decarboxylase 1	165					cellular nitrogen compound metabolic process (GO:0034641)|kidney development (GO:0001822)|polyamine metabolic process (GO:0006595)|positive regulation of cell proliferation (GO:0008284)|putrescine biosynthetic process from ornithine (GO:0033387)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of protein catabolic process (GO:0042176)|response to virus (GO:0009615)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ornithine decarboxylase activity (GO:0004586)|protein homodimerization activity (GO:0042803)			NS(1)|central_nervous_system(1)|large_intestine(7)|lung(5)|ovary(1)|prostate(1)|skin(3)	19	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.11)|OV - Ovarian serous cystadenocarcinoma(76;0.161)	Spermine(DB00127)	ACACTGAGACGACAGACTGCT	0.463																																																0			2											122.0	114.0	116.0					2																	10583919		2203	4300	6503	10501370	SO:0001583	missense	4953				CCDS1672.1	2p25	2012-10-02			ENSG00000115758	ENSG00000115758	4.1.1.17		8109	protein-coding gene	gene with protein product		165640					Standard	NM_002539		Approved	ODC	uc002rao.1	P11926	OTTHUMG00000090450	ENST00000234111.4:c.493C>T	2.37:g.10583919G>A	ENSP00000234111:p.Arg165Cys		10501370	Q53TU3|Q6LDS9	Missense_Mutation	SNP	HMMPfam_Orn_Arg_deC_N,superfamily_PLP-binding barrel,PatternScan_ODR_DC_2_1,PatternScan_ODR_DC_2_2,superfamily_Alanine racemase C-terminal domain-like,HMMPfam_Orn_DAP_Arg_deC	p.R165C	ENST00000234111.4	37	c.493	CCDS1672.1	2	.	.	.	.	.	.	.	.	.	.	G	16.28	3.079504	0.55753	.	.	ENSG00000115758	ENST00000234111;ENST00000405333;ENST00000537630	T;T	0.49139	0.79;0.79	5.75	4.87	0.63330	Orn/DAP/Arg decarboxylase 2, N-terminal (1);	0.046617	0.85682	N	0.000000	T	0.44871	0.1314	L	0.54965	1.715	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.33828	-0.9853	10	0.41790	T	0.15	.	14.6395	0.68714	0.0696:0.0:0.9304:0.0	.	165	P11926	DCOR_HUMAN	C	165;165;36	ENSP00000234111:R165C;ENSP00000385333:R165C	ENSP00000234111:R165C	R	-	1	0	ODC1	10501370	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	6.401000	0.73256	1.431000	0.47355	0.655000	0.94253	CGT	-	HMMPfam_Orn_Arg_deC_N,superfamily_PLP-binding barrel		0.463	ODC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ODC1	protein_coding	OTTHUMT00000206896.2	G			10501370	-1	no_errors	NM_002539	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
EMP2	2013	genome.wustl.edu	37	16	10626768	10626768	+	Silent	SNP	G	G	C			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr16:10626768G>C	ENST00000359543.3	-	5	707	c.498C>G	c.(496-498)cgC>cgG	p.R166R	EMP2_ENST00000566033.1_5'Flank|RP11-27M24.1_ENST00000535363.1_RNA|EMP2_ENST00000536829.1_Silent_p.R166R	NM_001424.4	NP_001415.1	P54851	EMP2_HUMAN	epithelial membrane protein 2	166					cell proliferation (GO:0008283)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of integrin-mediated signaling pathway (GO:2001046)|regulation of glomerular filtration (GO:0003093)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	integrin binding (GO:0005178)			NS(1)|endometrium(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	6						AACTCTATTTGCGCTTCCTCA	0.473																																					GBM(158;2021 2691 14714 39478)											0			16											83.0	77.0	79.0					16																	10626768		2197	4300	6497	10534269	SO:0001819	synonymous_variant	2013			U52100	CCDS10541.1	16p13.2	2008-08-01			ENSG00000213853	ENSG00000213853			3334	protein-coding gene	gene with protein product		602334				8996089, 10331954, 16216233	Standard	NM_001424		Approved	XMP	uc002czx.3	P54851	OTTHUMG00000129752	ENST00000359543.3:c.498C>G	16.37:g.10626768G>C			10534269	B2R7V6|D3DUF8	Silent	SNP	HMMPfam_PMP22_Claudin,PatternScan_PMP22_1,PatternScan_PMP22_2	p.R166	ENST00000359543.3	37	c.498	CCDS10541.1	16																																																																																			-	NULL		0.473	EMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EMP2	protein_coding	OTTHUMT00000251965.1	G	NM_001424		10534269	-1	no_errors	NM_001424	genbank	human	validated	54_36p	silent	SNP	1.000	C
RNA5-8SP6	100873336	genome.wustl.edu	37	Y	10037825	10037825	+	RNA	SNP	T	T	C			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chrY:10037825T>C	ENST00000515896.1	+	0	62									RNA, 5.8S ribosomal pseudogene 6																		GCTGTGAGAATTAATGTGAAT	0.517																																																0			Y																																								10647825			0					Yp11.2	2012-08-07	2012-08-07	2012-08-07	ENSG00000251705	ENSG00000251705			41960	pseudogene	RNA, pseudogene			"""RNA, 5.8S ribosomal 6"""	RN5-8S6			Standard	NG_033474		Approved						Y.37:g.10037825T>C			10647825		Missense_Mutation	SNP	NULL	p.I7T	ENST00000515896.1	37	c.20		Y																																																																																			-	NULL		0.517	RNA5-8SP6-201	KNOWN	basic	rRNA	LOC100132755	rRNA		T			10647825	+1	no_errors	XM_001713806	genbank	human	model	54_36p	missense	SNP	1.000	C
CTR9	9646	genome.wustl.edu	37	11	10794080	10794080	+	Missense_Mutation	SNP	T	T	G			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr11:10794080T>G	ENST00000361367.2	+	20	2884	c.2458T>G	c.(2458-2460)Tta>Gta	p.L820V		NM_014633.3	NP_055448.1	Q6PD62	CTR9_HUMAN	CTR9, Paf1/RNA polymerase II complex component	820					cellular response to lipopolysaccharide (GO:0071222)|endodermal cell fate commitment (GO:0001711)|histone H2B ubiquitination (GO:0033523)|histone H3-K4 trimethylation (GO:0080182)|histone monoubiquitination (GO:0010390)|interleukin-6-mediated signaling pathway (GO:0070102)|JAK-STAT cascade (GO:0007259)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K79 methylation (GO:2001162)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	Cdc73/Paf1 complex (GO:0016593)|transcriptionally active chromatin (GO:0035327)				breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(7)|lung(12)|ovary(2)|pancreas(1)|stomach(1)	40				all cancers(16;1.64e-07)|Epithelial(150;2.47e-07)|BRCA - Breast invasive adenocarcinoma(625;0.111)		GTGTTCTGACTTACTGAGCCA	0.428																																																0			11											56.0	57.0	57.0					11																	10794080		2201	4294	6495	10750656	SO:0001583	missense	9646			D63875	CCDS7805.1	11p15.3	2013-07-03	2013-07-03	2006-05-22	ENSG00000198730	ENSG00000198730		"""Tetratricopeptide (TTC) repeat domain containing"""	16850	protein-coding gene	gene with protein product		609366	"""SH2 domain binding protein 1 (tetratricopeptide repeat containing)"", ""Ctr9, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)"""	SH2BP1		8590280, 8636124	Standard	NM_014633		Approved	KIAA0155, TSBP, p150TSP	uc001mja.3	Q6PD62	OTTHUMG00000165789	ENST00000361367.2:c.2458T>G	11.37:g.10794080T>G	ENSP00000355013:p.Leu820Val		10750656	D3DQV8|Q15015	Missense_Mutation	SNP	superfamily_SSF48452,HMMPfam_TPR_1,HMMSmart_TPR	p.L820V	ENST00000361367.2	37	c.2458	CCDS7805.1	11	.	.	.	.	.	.	.	.	.	.	T	20.2	3.942475	0.73672	.	.	ENSG00000198730	ENST00000361367	T	0.55588	0.51	5.74	4.63	0.57726	.	0.000000	0.64402	D	0.000001	T	0.60805	0.2297	M	0.88570	2.965	0.58432	D	0.999999	P	0.50528	0.936	P	0.45681	0.49	T	0.67848	-0.5564	10	0.51188	T	0.08	-9.8481	9.2906	0.37784	0.0:0.1368:0.0:0.8632	.	820	Q6PD62	CTR9_HUMAN	V	820	ENSP00000355013:L820V	ENSP00000355013:L820V	L	+	1	2	CTR9	10750656	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.483000	0.45233	2.193000	0.70182	0.482000	0.46254	TTA	-	NULL		0.428	CTR9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTR9	protein_coding	OTTHUMT00000386215.1	T	NM_014633		10750656	+1	no_errors	NM_014633	genbank	human	provisional	54_36p	missense	SNP	1.000	G
TAS2R9	50835	genome.wustl.edu	37	12	10962144	10962144	+	Silent	SNP	A	A	G			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr12:10962144A>G	ENST00000240691.2	-	1	623	c.531T>C	c.(529-531)acT>acC	p.T177T	TAS2R8_ENST00000240615.2_5'Flank	NM_023917.2	NP_076406.1	Q9NYW1	TA2R9_HUMAN	taste receptor, type 2, member 9	177					detection of chemical stimulus involved in sensory perception of taste (GO:0050912)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	taste receptor activity (GO:0008527)			endometrium(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17						ACTGTTTGAAAGTACCTGGAA	0.378																																																0			12											67.0	67.0	67.0					12																	10962144		2202	4300	6502	10853411	SO:0001819	synonymous_variant	50835			AF227135	CCDS8633.1	12p13	2012-08-22			ENSG00000121381	ENSG00000121381		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14917	protein-coding gene	gene with protein product		604795				10761934, 10766242	Standard	NM_023917		Approved	T2R9, TRB6	uc001qyx.3	Q9NYW1	OTTHUMG00000168507	ENST00000240691.2:c.531T>C	12.37:g.10962144A>G			10853411	Q502V7|Q50KT0|Q50KT1|Q645W9	Silent	SNP	HMMPfam_TAS2R,superfamily_SSF81321	p.T177	ENST00000240691.2	37	c.531	CCDS8633.1	12																																																																																			-	HMMPfam_TAS2R,superfamily_SSF81321		0.378	TAS2R9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS2R9	protein_coding	OTTHUMT00000399933.1	A			10853411	-1	no_errors	NM_023917	genbank	human	reviewed	54_36p	silent	SNP	0.003	G
PHF14	9678	genome.wustl.edu	37	7	11022425	11022425	+	Missense_Mutation	SNP	C	C	T			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr7:11022425C>T	ENST00000403050.3	+	3	991	c.539C>T	c.(538-540)cCa>cTa	p.P180L	PHF14_ENST00000445996.2_Intron	NM_014660.3	NP_055475.2	O94880	PHF14_HUMAN	PHD finger protein 14	180					lung alveolus development (GO:0048286)|negative regulation of mesenchymal cell proliferation involved in lung development (GO:2000791)|negative regulation of platelet-derived growth factor receptor-alpha signaling pathway (GO:2000584)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			NS(2)|breast(1)|endometrium(4)|kidney(5)|large_intestine(5)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	35				UCEC - Uterine corpus endometrioid carcinoma (126;0.205)		GTCAGCGAGCCAAAAAAATGG	0.493																																																0			7											90.0	89.0	90.0					7																	11022425		2025	4199	6224	10988950	SO:0001583	missense	9678			AB018326	CCDS47542.1	7p21.3	2013-01-28			ENSG00000106443	ENSG00000106443		"""Zinc fingers, PHD-type"""	22203	protein-coding gene	gene with protein product						9872452	Standard	NM_014660		Approved	KIAA0783	uc003sry.2	O94880	OTTHUMG00000150463	ENST00000403050.3:c.539C>T	7.37:g.11022425C>T	ENSP00000385795:p.Pro180Leu		10988950	A7MCZ3|B4DI82	Missense_Mutation	SNP	superfamily_FYVE_PHD_ZnF,HMMSmart_PHD,HMMPfam_PHD,PatternScan_ZF_PHD_1,HMMSmart_RING	p.P180L	ENST00000403050.3	37	c.539	CCDS47542.1	7	.	.	.	.	.	.	.	.	.	.	C	18.12	3.552791	0.65425	.	.	ENSG00000106443	ENST00000403050	T	0.75260	-0.92	5.11	5.11	0.69529	.	0.000000	0.85682	D	0.000000	T	0.78679	0.4321	N	0.19112	0.55	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.996	T	0.80763	-0.1237	10	0.52906	T	0.07	.	18.7138	0.91668	0.0:1.0:0.0:0.0	.	180;180	A8MSQ1;O94880	.;PHF14_HUMAN	L	180	ENSP00000385795:P180L	ENSP00000385795:P180L	P	+	2	0	PHF14	10988950	1.000000	0.71417	1.000000	0.80357	0.655000	0.38815	7.651000	0.83577	2.641000	0.89580	0.585000	0.79938	CCA	-	NULL		0.493	PHF14-001	KNOWN	basic|CCDS	protein_coding	PHF14	protein_coding	OTTHUMT00000318212.1	C	NM_014660		10988950	+1	no_errors	NM_001007157	genbank	human	validated	54_36p	missense	SNP	1.000	T
MASP2	10747	genome.wustl.edu	37	1	11106666	11106666	+	Missense_Mutation	SNP	T	T	C	rs72550870	byFrequency	TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr1:11106666T>C	ENST00000400897.3	-	3	374	c.359A>G	c.(358-360)gAc>gGc	p.D120G	MASP2_ENST00000400898.3_Missense_Mutation_p.D120G	NM_006610.3	NP_006601.2	O00187	MASP2_HUMAN	mannan-binding lectin serine peptidase 2	120	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.		D -> G (in MASPD; found in a patient suffering from frequent infections and chronic inflammatory disease; strongly decreases affinity for MBL2 and FCN2; dbSNP:rs72550870). {ECO:0000269|PubMed:12904520, ECO:0000269|PubMed:16029433, ECO:0000269|PubMed:17252003}.		complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|complement activation, lectin pathway (GO:0001867)|innate immune response (GO:0045087)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|complement component C4b binding (GO:0001855)|peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)			biliary_tract(1)|endometrium(2)|large_intestine(6)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	23	Ovarian(185;0.249)	Lung NSC(185;1.04e-05)|all_lung(284;1.31e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00262)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.071)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.12e-07)|COAD - Colon adenocarcinoma(227;7.07e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|Kidney(185;0.000722)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|READ - Rectum adenocarcinoma(331;0.0487)|STAD - Stomach adenocarcinoma(313;0.192)		GTTGGAGTAGTCGGAGCGGAA	0.632													T|||	60	0.0119808	0.0008	0.0231	5008	,	,		18982	0.0		0.0388	False		,,,				2504	0.0041				GBM(35;611 746 20780 22741 36496)											0			1	GRCh37	CM032009	MASP2	M	rs72550870	T	GLY/ASP,GLY/ASP	26,4380	32.6+/-62.9	0,26,2177	55.0	46.0	49.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	359,359	4.8	1.0	1	dbSNP_130	49	248,8352	96.3+/-158.1	7,234,4059	yes	missense,missense	MASP2	NM_006610.3,NM_139208.2	94,94	7,260,6236	CC,CT,TT		2.8837,0.5901,2.1067	probably-damaging,probably-damaging	120/687,120/186	11106666	274,12732	2203	4300	6503	11029253	SO:0001583	missense	10747			X98400	CCDS123.1, CCDS124.1	1p36.3-p36.2	2014-09-17	2005-08-17		ENSG00000009724	ENSG00000009724			6902	protein-coding gene	gene with protein product		605102	"""mannan-binding lectin serine protease 2"", ""mannan-binding lectin serine peptidase 1 pseudogene 1"", ""mannan-binding lectin serine protease 1 pseudogene 1"""	MASP1P1		9087411, 9777418	Standard	NM_006610		Approved		uc001aru.3	O00187	OTTHUMG00000002121	ENST00000400897.3:c.359A>G	1.37:g.11106666T>C	ENSP00000383690:p.Asp120Gly		11029253	A8K458|A8MWJ2|O75754|Q5TEQ5|Q5TER0|Q96QG4|Q9BZH0|Q9H498|Q9H499|Q9UBP3|Q9UC48|Q9ULC7|Q9UMV3|Q9Y270	Missense_Mutation	SNP	superfamily_Spermadhesin CUB domain,HMMSmart_SM00042,HMMPfam_CUB,superfamily_EGF/Laminin,PatternScan_EGF_CA,HMMSmart_SM00179,HMMSmart_SM00181,PatternScan_ASX_HYDROXYL,PatternScan_EGF_2,superfamily_Complement control module/SCR domain,HMMPfam_Sushi,HMMSmart_SM00032,superfamily_Trypsin-like serine proteases,HMMSmart_SM00020,HMMPfam_Trypsin,PatternScan_TRYPSIN_SER	p.D120G	ENST00000400897.3	37	c.359	CCDS123.1	1	38	0.0173992673992674	0	0.0	9	0.024861878453038673	0	0.0	29	0.03825857519788918	T	24.6	4.551799	0.86127	0.005901	0.028837	ENSG00000009724	ENST00000400897;ENST00000400898	T;T	0.39056	1.1;1.1	4.77	4.77	0.60923	CUB (5);	0.058181	0.64402	D	0.000004	T	0.38374	0.1038	M	0.91249	3.19	0.80722	A	1	D;D	0.67145	0.996;0.984	D;D	0.71184	0.954;0.972	T	0.74163	-0.3754	9	0.87932	D	0	.	13.2718	0.60165	0.0:0.0:0.0:1.0	.	120;120	O00187-2;O00187	.;MASP2_HUMAN	G	120	ENSP00000383690:D120G;ENSP00000383691:D120G	ENSP00000383690:D120G	D	-	2	0	MASP2	11029253	1.000000	0.71417	0.998000	0.56505	0.912000	0.54170	7.628000	0.83189	1.772000	0.52199	0.460000	0.39030	GAC	-	superfamily_Spermadhesin CUB domain,HMMSmart_SM00042,HMMPfam_CUB		0.632	MASP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MASP2	protein_coding	OTTHUMT00000006072.1	T	NM_006610		11029253	-1	no_errors	NM_006610	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
EXOSC10	5394	genome.wustl.edu	37	1	11129695	11129695	+	Silent	SNP	C	C	T			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr1:11129695C>T	ENST00000376936.4	-	22	2458	c.2409G>A	c.(2407-2409)aaG>aaA	p.K803K	RP4-635E18.7_ENST00000452378.1_RNA|EXOSC10_ENST00000304457.7_Silent_p.K778K|EXOSC10_ENST00000544779.1_3'UTR	NM_001001998.1	NP_001001998.1	Q01780	EXOSX_HUMAN	exosome component 10	803					CUT catabolic process (GO:0071034)|dosage compensation by inactivation of X chromosome (GO:0009048)|histone mRNA catabolic process (GO:0071044)|maturation of 5.8S rRNA (GO:0000460)|nuclear mRNA surveillance (GO:0071028)|nuclear polyadenylation-dependent rRNA catabolic process (GO:0071035)|nuclear retention of unspliced pre-mRNA at the site of transcription (GO:0071048)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)	cytoplasm (GO:0005737)|exosome (RNase complex) (GO:0000178)|membrane (GO:0016020)|nuclear exosome (RNase complex) (GO:0000176)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcriptionally active chromatin (GO:0035327)	3'-5' exonuclease activity (GO:0008408)|exoribonuclease activity (GO:0004532)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(9)|prostate(1)|stomach(3)|upper_aerodigestive_tract(1)	27	Ovarian(185;0.249)	Lung NSC(185;1.74e-05)|all_lung(284;2.05e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00262)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;4.18e-07)|COAD - Colon adenocarcinoma(227;8.33e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000315)|Kidney(185;0.000832)|KIRC - Kidney renal clear cell carcinoma(229;0.00269)|READ - Rectum adenocarcinoma(331;0.0526)|STAD - Stomach adenocarcinoma(313;0.202)		CCTTTGGCTTCTTGGAAATTT	0.478																																					Colon(179;105 1987 14326 27364 29542)											0			1											422.0	436.0	431.0					1																	11129695		2203	4300	6503	11052282	SO:0001819	synonymous_variant	5394			BC073788	CCDS126.1, CCDS30584.1	1p36.22	2008-02-05	2004-06-16	2004-06-18	ENSG00000171824	ENSG00000171824			9138	protein-coding gene	gene with protein product	"""polymyositis/scleroderma autoantigen 2 (100kD)"""	605960	"""polymyositis/scleroderma autoantigen 2, 100kDa"""	PMSCL2		1383382, 1644924	Standard	NM_001001998		Approved	PM-Scl, PM/Scl-100, Rrp6p, RRP6, p2, p3, p4	uc001asa.3	Q01780	OTTHUMG00000002123	ENST00000376936.4:c.2409G>A	1.37:g.11129695C>T			11052282	B1AKQ0|B1AKQ1|Q15158	Silent	SNP	HMMPfam_PMC2NT,HMMPfam_3_5_exonuc,HMMSmart_SM00474,superfamily_Ribonuclease H-like,HMMSmart_SM00341,HMMPfam_HRDC	p.K803	ENST00000376936.4	37	c.2409	CCDS30584.1	1																																																																																			-	NULL		0.478	EXOSC10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EXOSC10	protein_coding	OTTHUMT00000006078.1	C	NM_001001998		11052282	-1	no_errors	NM_001001998	genbank	human	validated	54_36p	silent	SNP	0.899	T
MTOR	2475	genome.wustl.edu	37	1	11294270	11294270	+	Missense_Mutation	SNP	G	G	C			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr1:11294270G>C	ENST00000361445.4	-	14	2337	c.2261C>G	c.(2260-2262)gCc>gGc	p.A754G		NM_004958.3	NP_004949.1	P42345	MTOR_HUMAN	mechanistic target of rapamycin (serine/threonine kinase)	754					cell growth (GO:0016049)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell development (GO:0007281)|growth (GO:0040007)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of autophagy (GO:0010507)|negative regulation of cell size (GO:0045792)|negative regulation of macroautophagy (GO:0016242)|negative regulation of NFAT protein import into nucleus (GO:0051534)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|phosphatidylinositol-mediated signaling (GO:0048015)|phosphorylation (GO:0016310)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of gene expression (GO:0010628)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of carbohydrate utilization (GO:0043610)|regulation of fatty acid beta-oxidation (GO:0031998)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of protein kinase activity (GO:0045859)|regulation of Rac GTPase activity (GO:0032314)|regulation of response to food (GO:0032095)|response to amino acid (GO:0043200)|response to nutrient (GO:0007584)|response to stress (GO:0006950)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|phosphatidylinositol 3-kinase complex (GO:0005942)|PML body (GO:0016605)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	ATP binding (GO:0005524)|drug binding (GO:0008144)|kinase activity (GO:0016301)|phosphoprotein binding (GO:0051219)|protein serine/threonine kinase activity (GO:0004674)|ribosome binding (GO:0043022)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)			breast(5)|central_nervous_system(7)|endometrium(20)|kidney(34)|large_intestine(21)|lung(43)|ovary(9)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	149					Everolimus(DB01590)|Pimecrolimus(DB00337)|Sirolimus(DB00877)|Temsirolimus(DB06287)	CAGCATGCGGGCACTCTGCTC	0.512																																																0			1											124.0	129.0	127.0					1																	11294270		2203	4300	6503	11216857	SO:0001583	missense	2475			L34075	CCDS127.1	1p36	2014-09-17	2009-05-29	2009-05-29	ENSG00000198793	ENSG00000198793			3942	protein-coding gene	gene with protein product	"""FK506 binding protein 12-rapamycin associated protein 2"", ""rapamycin target protein"", ""FKBP12-rapamycin complex-associated protein 1"", ""FKBP-rapamycin associated protein"", ""rapamycin associated protein FRAP2"", ""dJ576K7.1 (FK506 binding protein 12-rapamycin associated protein 1)"", ""rapamycin and FKBP12 target 1"", ""mammalian target of rapamycin"""	601231	"""FK506 binding protein 12-rapamycin associated protein 1"""	FRAP, FRAP2, FRAP1		8008069, 8660990	Standard	NM_004958		Approved	RAFT1, RAPT1, FLJ44809	uc001asd.3	P42345	OTTHUMG00000002001	ENST00000361445.4:c.2261C>G	1.37:g.11294270G>C	ENSP00000354558:p.Ala754Gly		11216857	Q4LE76|Q5TER1|Q6LE87|Q96QG3|Q9Y4I3	Missense_Mutation	SNP	superfamily_ARM-type_fold,superfamily_SSF48452,HMMPfam_FAT,HMMPfam_Rapamycin_bind,superfamily_FRAP_FKBP12_bind,superfamily_Kinase_like,HMMPfam_PI3_PI4_kinase,HMMSmart_PI3Kc,PatternScan_PI3_4_KINASE_1,PatternScan_PI3_4_KINASE_2,HMMPfam_FATC	p.A754G	ENST00000361445.4	37	c.2261	CCDS127.1	1	.	.	.	.	.	.	.	.	.	.	G	34	5.324621	0.95708	.	.	ENSG00000198793	ENST00000361445;ENST00000539766	T	0.68331	-0.32	5.7	5.7	0.88788	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.82637	0.5080	M	0.93678	3.445	0.80722	D	1	D	0.56968	0.978	P	0.50617	0.646	D	0.87353	0.2339	10	0.87932	D	0	.	19.8344	0.96650	0.0:0.0:1.0:0.0	.	754	P42345	MTOR_HUMAN	G	754	ENSP00000354558:A754G	ENSP00000354558:A754G	A	-	2	0	MTOR	11216857	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.434000	0.97515	2.696000	0.92011	0.561000	0.74099	GCC	-	superfamily_ARM-type_fold		0.512	MTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRAP1	protein_coding	OTTHUMT00000005558.1	G	NM_004958		11216857	-1	no_errors	NM_004958	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
MCM10	55388	genome.wustl.edu	37	10	13222465	13222465	+	Missense_Mutation	SNP	A	A	G			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr10:13222465A>G	ENST00000484800.2	+	7	894	c.791A>G	c.(790-792)gAa>gGa	p.E264G	MCM10_ENST00000378694.1_Missense_Mutation_p.E263G|MCM10_ENST00000378714.3_Missense_Mutation_p.E263G			Q7L590	MCM10_HUMAN	minichromosome maintenance complex component 10	264	OB-fold domain. {ECO:0000250}.				cell proliferation (GO:0008283)|DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)			central_nervous_system(1)|large_intestine(4)|ovary(2)|skin(1)|stomach(1)	9						TCCTCCACAGAAATGAACAAG	0.433																																																0			10											81.0	79.0	79.0					10																	13222465		2203	4300	6503	13262471	SO:0001583	missense	55388			AB042719	CCDS7095.1, CCDS7096.1	10p13	2008-08-01	2007-04-04		ENSG00000065328	ENSG00000065328			18043	protein-coding gene	gene with protein product		609357	"""MCM10 minichromosome maintenance deficient 10 (S. cerevisiae)"""			11095689, 17699597	Standard	NM_018518		Approved	PRO2249, CNA43, DNA43	uc001ima.3	Q7L590	OTTHUMG00000017694	ENST00000484800.2:c.791A>G	10.37:g.13222465A>G	ENSP00000418268:p.Glu264Gly		13262471	A8K9I6|B7ZKZ8|Q3MIR3|Q7LD55|Q96GX4|Q96NB6|Q9H0D7|Q9H3P9|Q9P177	Missense_Mutation	SNP	HMMPfam_zf-primase,HMMPfam_Mcm10	p.E264G	ENST00000484800.2	37	c.791	CCDS7096.1	10	.	.	.	.	.	.	.	.	.	.	A	28.4	4.917946	0.92249	.	.	ENSG00000065328	ENST00000378714;ENST00000361282;ENST00000484800;ENST00000378694	T;T;T	0.17213	2.3;2.3;2.29	5.82	5.82	0.92795	.	0.046577	0.85682	D	0.000000	T	0.45276	0.1334	M	0.85710	2.77	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.998	D;D;D	0.70487	0.969;0.96;0.913	T	0.41945	-0.9480	10	0.26408	T	0.33	-5.4569	16.1814	0.81903	1.0:0.0:0.0:0.0	.	263;263;264	Q5T670;Q7L590-2;Q7L590	.;.;MCM10_HUMAN	G	263;264;264;263	ENSP00000367986:E263G;ENSP00000418268:E264G;ENSP00000367966:E263G	ENSP00000354945:E264G	E	+	2	0	MCM10	13262471	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.713000	0.91408	2.234000	0.73211	0.533000	0.62120	GAA	-	NULL		0.433	MCM10-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MCM10	protein_coding	OTTHUMT00000356853.1	A	NM_182751		13262471	+1	no_errors	NM_182751	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
TCEANC	170082	genome.wustl.edu	37	X	13680753	13680753	+	Silent	SNP	T	T	C			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chrX:13680753T>C	ENST00000380600.1	+	2	213	c.126T>C	c.(124-126)caT>caC	p.H42H	TCEANC_ENST00000314720.4_Silent_p.H72H|TCEANC_ENST00000490617.1_3'UTR|TCEANC_ENST00000544987.1_Silent_p.H42H|TCEANC_ENST00000545566.1_Silent_p.H42H			Q8N8B7	TEANC_HUMAN	transcription elongation factor A (SII) N-terminal and central domain containing	42	TFIIS N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00649}.				regulation of DNA-templated transcription, elongation (GO:0032784)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			central_nervous_system(1)|large_intestine(5)|lung(2)|pancreas(1)	9						CTAAGGAGCATCTCCAGGAGA	0.438																																																0			X											96.0	90.0	92.0					X																	13680753		1924	4121	6045	13590674	SO:0001819	synonymous_variant	170082				CCDS48081.1, CCDS75954.1	Xp22.2	2009-01-30			ENSG00000176896	ENSG00000176896			28277	protein-coding gene	gene with protein product						12477932	Standard	XM_005274454		Approved	MGC17403	uc010neg.1	Q8N8B7	OTTHUMG00000021154	ENST00000380600.1:c.126T>C	X.37:g.13680753T>C			13590674	A6NI06|B2RDM3	Silent	SNP	HMMPfam_TFIIS,superfamily_Conserved domain common to transcription factors TFIIS elongin A CRSP70,superfamily_Elongation factor TFIIS domain 2,HMMSmart_SM00510,HMMPfam_TFIIS_M,superfamily_Zinc beta-ribbon	p.H72	ENST00000380600.1	37	c.216		X																																																																																			-	HMMPfam_TFIIS,superfamily_Conserved domain common to transcription factors TFIIS elongin A CRSP70		0.438	TCEANC-002	KNOWN	basic|appris_principal	protein_coding	TCEANC	protein_coding	OTTHUMT00000055796.1	T	NM_152634		13590674	+1	no_errors	NM_152634	genbank	human	validated	54_36p	silent	SNP	0.348	C
ZFYVE20	64145	genome.wustl.edu	37	3	15115825	15115825	+	Missense_Mutation	SNP	C	C	G			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr3:15115825C>G	ENST00000253699.3	-	14	2432	c.1819G>C	c.(1819-1821)Ggc>Cgc	p.G607R	ZFYVE20_ENST00000476527.2_Missense_Mutation_p.G607R	NM_022340.2	NP_071735.2	Q9H1K0	RBNS5_HUMAN	zinc finger, FYVE domain containing 20	607	Necessary for the interaction with EHD1.				blood coagulation (GO:0007596)|endosomal transport (GO:0016197)|protein transport (GO:0015031)	endosome (GO:0005768)|endosome membrane (GO:0010008)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)			NS(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(10)|skin(3)|stomach(1)|urinary_tract(2)	26						CGCTCCTGGCCAACGGCTGGG	0.597																																																0			3											45.0	49.0	48.0					3																	15115825		2203	4300	6503	15090829	SO:0001583	missense	64145			AY009133	CCDS2623.1	3p25.1	2014-01-15			ENSG00000131381	ENSG00000131381		"""Zinc fingers, FYVE domain containing"""	20759	protein-coding gene	gene with protein product		609511				11062261	Standard	XR_427283		Approved	Rabenosyn-5	uc003bzm.1	Q9H1K0	OTTHUMG00000129860	ENST00000253699.3:c.1819G>C	3.37:g.15115825C>G	ENSP00000253699:p.Gly607Arg		15090829	B4DWY8|C9J4P5|Q3KP30|Q59EY8|Q8NAQ1	Missense_Mutation	SNP	HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1,HMMSmart_FYVE,HMMPfam_FYVE,superfamily_FYVE_PHD_ZnF	p.G607R	ENST00000253699.3	37	c.1819	CCDS2623.1	3	.	.	.	.	.	.	.	.	.	.	C	3.883	-0.025595	0.07589	.	.	ENSG00000131381	ENST00000253699;ENST00000476527	T;T	0.51817	0.69;0.69	5.43	-0.0493	0.13835	.	0.648887	0.16801	N	0.198955	T	0.34513	0.0900	L	0.51422	1.61	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.20174	-1.0283	10	0.23891	T	0.37	-5.5239	6.2646	0.20919	0.0:0.3919:0.2831:0.325	.	607	Q9H1K0	RBNS5_HUMAN	R	607	ENSP00000253699:G607R;ENSP00000422551:G607R	ENSP00000253699:G607R	G	-	1	0	ZFYVE20	15090829	0.007000	0.16637	0.025000	0.17156	0.155000	0.21991	0.048000	0.14078	-0.075000	0.12798	0.491000	0.48974	GGC	-	NULL		0.597	ZFYVE20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFYVE20	protein_coding	OTTHUMT00000252102.2	C	NM_022340		15090829	-1	no_errors	NM_022340	genbank	human	validated	54_36p	missense	SNP	0.008	G
IGSF21	84966	genome.wustl.edu	37	1	18692038	18692038	+	Missense_Mutation	SNP	C	C	T			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr1:18692038C>T	ENST00000251296.1	+	6	1245	c.862C>T	c.(862-864)Cgc>Tgc	p.R288C		NM_032880.4	NP_116269.3	Q96ID5	IGS21_HUMAN	immunoglobin superfamily, member 21	288						extracellular region (GO:0005576)				endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(16)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	40		Colorectal(325;0.000147)|Renal(390;0.00145)|all_lung(284;0.00366)|Lung NSC(340;0.00376)|Breast(348;0.00387)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0121)|BRCA - Breast invasive adenocarcinoma(304;5.52e-05)|Kidney(64;0.00103)|KIRC - Kidney renal clear cell carcinoma(64;0.0102)|STAD - Stomach adenocarcinoma(196;0.0118)|READ - Rectum adenocarcinoma(331;0.157)		CTACTTCCTGCGCCACAGCCG	0.627																																																0			1											104.0	98.0	100.0					1																	18692038		2203	4300	6503	18564625	SO:0001583	missense	84966			AK075316	CCDS184.1	1p36.13	2013-01-29			ENSG00000117154	ENSG00000117154		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	28246	protein-coding gene	gene with protein product						12477932	Standard	NM_032880		Approved	MGC15730, RP11-121A23.1	uc001bau.2	Q96ID5	OTTHUMG00000002432	ENST00000251296.1:c.862C>T	1.37:g.18692038C>T	ENSP00000251296:p.Arg288Cys		18564625	Q8NBR8	Missense_Mutation	SNP	superfamily_SSF48726,HMMPfam_V-set,HMMSmart_IG	p.R288C	ENST00000251296.1	37	c.862	CCDS184.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.19|19.19	3.779041|3.779041	0.70107|0.70107	.|.	.|.	ENSG00000117154|ENSG00000117154	ENST00000412684|ENST00000251296	.|T	.|0.57107	.|0.42	4.28|4.28	3.36|3.36	0.38483|0.38483	.|.	.|0.193098	.|0.53938	.|D	.|0.000057	T|T	0.46151|0.46151	0.1378|0.1378	N|N	0.19112|0.19112	0.55|0.55	0.50039|0.50039	D|D	0.999843|0.999843	.|D	.|0.76494	.|0.999	.|P	.|0.51895	.|0.683	T|T	0.44143|0.44143	-0.9347|-0.9347	5|10	.|0.42905	.|T	.|0.14	-17.0717|-17.0717	12.6356|12.6356	0.56681|0.56681	0.1669:0.8331:0.0:0.0|0.1669:0.8331:0.0:0.0	.|.	.|288	.|Q96ID5	.|IGS21_HUMAN	V|C	240|288	.|ENSP00000251296:R288C	.|ENSP00000251296:R288C	A|R	+|+	2|1	0|0	IGSF21|IGSF21	18564625|18564625	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	3.343000|3.343000	0.52167|0.52167	1.148000|1.148000	0.42385|0.42385	0.561000|0.561000	0.74099|0.74099	GCG|CGC	-	superfamily_SSF48726		0.627	IGSF21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGSF21	protein_coding	OTTHUMT00000006924.1	C	NM_032880		18564625	+1	no_errors	NM_032880	genbank	human	provisional	54_36p	missense	SNP	1.000	T
PSD3	23362	genome.wustl.edu	37	8	18725468	18725468	+	Missense_Mutation	SNP	G	G	T			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr8:18725468G>T	ENST00000327040.8	-	4	1452	c.1350C>A	c.(1348-1350)gaC>gaA	p.D450E	PSD3_ENST00000523619.1_Missense_Mutation_p.D385E|PSD3_ENST00000440756.2_Missense_Mutation_p.D450E	NM_015310.3	NP_056125.3	Q9NYI0	PSD3_HUMAN	pleckstrin and Sec7 domain containing 3	450					neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(8)|ovary(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20				Colorectal(111;0.0281)|READ - Rectum adenocarcinoma(644;0.183)		AAGAAGTGTTGTCCAAAATGG	0.463																																																0			8											129.0	126.0	127.0					8																	18725468		1938	4151	6089	18769748	SO:0001583	missense	23362			AF243495	CCDS34854.1, CCDS43720.1	8p21.3	2013-01-10			ENSG00000156011	ENSG00000156011		"""Pleckstrin homology (PH) domain containing"""	19093	protein-coding gene	gene with protein product		614440					Standard	NM_206909		Approved	KIAA0942, HCA67, EFA6R, DKFZp761K1423	uc003wza.3	Q9NYI0	OTTHUMG00000163711	ENST00000327040.8:c.1350C>A	8.37:g.18725468G>T	ENSP00000324127:p.Asp450Glu		18769748	A6NFQ4|E9KL50|Q6B003|Q9Y2F1	Missense_Mutation	SNP	HMMSmart_Sec7,HMMPfam_Sec7,superfamily_Sec7,superfamily_SSF50729,HMMPfam_PH,HMMSmart_PH	p.D450E	ENST00000327040.8	37	c.1350	CCDS43720.1	8	.	.	.	.	.	.	.	.	.	.	G	12.02	1.812883	0.32053	.	.	ENSG00000156011	ENST00000327040;ENST00000440756;ENST00000523619	T;T;T	0.06687	3.27;3.27;3.27	5.18	1.9	0.25705	.	0.080094	0.50627	N	0.000113	T	0.05044	0.0135	L	0.32530	0.975	0.25194	N	0.990102	B	0.19817	0.039	B	0.19666	0.026	T	0.42916	-0.9423	10	0.09084	T	0.74	.	5.7341	0.18057	0.4486:0.0:0.5514:0.0	.	450	E9KL50	.	E	450;450;385	ENSP00000324127:D450E;ENSP00000401704:D450E;ENSP00000430640:D385E	ENSP00000324127:D450E	D	-	3	2	PSD3	18769748	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	2.470000	0.45119	0.697000	0.31718	-0.237000	0.12165	GAC	-	NULL		0.463	PSD3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PSD3	protein_coding	OTTHUMT00000374867.1	G	NM_015310		18769748	-1	no_errors	NM_015310	genbank	human	validated	54_36p	missense	SNP	1.000	T
HAPLN4	404037	genome.wustl.edu	37	19	19371771	19371771	+	Missense_Mutation	SNP	T	T	G			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr19:19371771T>G	ENST00000291481.7	-	3	398	c.335A>C	c.(334-336)tAc>tCc	p.Y112S	AC138430.4_ENST00000586064.2_RNA	NM_023002.2	NP_075378.1	Q86UW8	HPLN4_HUMAN	hyaluronan and proteoglycan link protein 4	112	Ig-like C2-type.				cell adhesion (GO:0007155)	proteinaceous extracellular matrix (GO:0005578)	hyaluronic acid binding (GO:0005540)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(7)|pancreas(1)|prostate(1)	16			Epithelial(12;0.00575)		Hyaluronan(DB08818)	CCGCCCACGGTAGCTGCCGAA	0.677																																																0			19											44.0	46.0	45.0					19																	19371771		2203	4299	6502	19232771	SO:0001583	missense	404037			AB107883	CCDS12398.1	19p13.1	2013-01-11						"""Immunoglobulin superfamily / V-set domain containing"""	31357	protein-coding gene	gene with protein product	"""brain link protein 2"""					12663660	Standard	NM_023002		Approved	BRAL2, KIAA1926	uc002nmb.3	Q86UW8		ENST00000291481.7:c.335A>C	19.37:g.19371771T>G	ENSP00000291481:p.Tyr112Ser		19232771	A5PKW5|Q96PW2	Missense_Mutation	SNP	HMMPfam_V-set,superfamily_Immunoglobulin,HMMSmart_SM00409,HMMSmart_SM00408,HMMSmart_SM00406,HMMSmart_SM00445,HMMPfam_Xlink,superfamily_C-type lectin-like,PatternScan_LINK_1	p.Y112S	ENST00000291481.7	37	c.335	CCDS12398.1	19	.	.	.	.	.	.	.	.	.	.	T	20.7	4.035748	0.75617	.	.	ENSG00000187664	ENST00000291481	T	0.67523	-0.27	4.52	4.52	0.55395	Immunoglobulin V-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.077106	0.53938	D	0.000051	T	0.80859	0.4704	M	0.87547	2.89	0.42077	D	0.991235	D	0.76494	0.999	D	0.72982	0.979	T	0.83031	-0.0162	10	0.87932	D	0	-32.2415	7.3886	0.26897	0.1942:0.0:0.0:0.8058	.	112	Q86UW8	HPLN4_HUMAN	S	112	ENSP00000291481:Y112S	ENSP00000291481:Y112S	Y	-	2	0	HAPLN4	19232771	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	2.291000	0.43540	1.890000	0.54733	0.459000	0.35465	TAC	-	HMMPfam_V-set,superfamily_Immunoglobulin,HMMSmart_SM00409,HMMSmart_SM00408,HMMSmart_SM00406		0.677	HAPLN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HAPLN4	protein_coding	OTTHUMT00000460117.2	T	NM_023002		19232771	-1	no_errors	NM_023002	genbank	human	validated	54_36p	missense	SNP	0.998	G
TMEM191A	84222	genome.wustl.edu	37	22	21053111	21053111	+	RNA	SNP	G	G	A			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr22:21053111G>A	ENST00000450925.2	+	0	0					NR_026815.1		Q9H0A3	T191A_HUMAN	transmembrane protein 191A (pseudogene)							integral component of membrane (GO:0016021)											TGGGCTGGCCGGGGTTGGCAG	0.612																																																0			22																																								19383111			648980			AL136879		22q11.21	2012-04-20	2012-04-20		ENSG00000226287	ENSG00000226287			25317	pseudogene	pseudogene			"""transmembrane protein 191A"""			11230166	Standard	NR_026815		Approved	DKFZp434N035, TMEM191AP	uc002zsx.1	Q9H0A3	OTTHUMG00000150164		22.37:g.21053111G>A			19383111	B2R8E2	Silent	SNP	HMMPfam_RhoGAP	p.P28	ENST00000450925.2	37	c.84		22																																																																																			-	NULL		0.612	TMEM191A-001	KNOWN	basic	processed_transcript	LOC648980	processed_transcript	OTTHUMT00000316649.1	G			19383111	-1	pseudogene	XM_941280	genbank	human	model	54_36p	silent	SNP	1.000	A
OR11H4	390442	genome.wustl.edu	37	14	20711900	20711900	+	Missense_Mutation	SNP	G	G	C			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr14:20711900G>C	ENST00000315409.2	+	1	1003	c.950G>C	c.(949-951)gGa>gCa	p.G317A		NM_001004479.1	NP_001004479.1	Q8NGC9	O11H4_HUMAN	olfactory receptor, family 11, subfamily H, member 4	317						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(3)|lung(11)|ovary(1)|upper_aerodigestive_tract(1)	29	all_cancers(95;0.000888)		Epithelial(56;1.75e-06)|all cancers(55;1.22e-05)	GBM - Glioblastoma multiforme(265;0.0146)		GTCCTGTTTGGAATGAGAATT	0.393																																																0			14											68.0	70.0	69.0					14																	20711900		2203	4300	6503	19781740	SO:0001583	missense	390442				CCDS32034.1	14q11.2	2013-09-24			ENSG00000176198	ENSG00000176198		"""GPCR / Class A : Olfactory receptors"""	15347	protein-coding gene	gene with protein product							Standard	NM_001004479		Approved		uc010tld.2	Q8NGC9	OTTHUMG00000170852	ENST00000315409.2:c.950G>C	14.37:g.20711900G>C	ENSP00000318997:p.Gly317Ala		19781740	B2RNQ4|Q6IF07	Missense_Mutation	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.G317A	ENST00000315409.2	37	c.950	CCDS32034.1	14	.	.	.	.	.	.	.	.	.	.	G	2.226	-0.377294	0.05000	.	.	ENSG00000176198	ENST00000315409	T	0.37584	1.19	4.7	4.7	0.59300	.	0.403440	0.20929	N	0.083125	T	0.21761	0.0524	N	0.25245	0.725	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.10567	-1.0624	10	0.18710	T	0.47	-0.5165	8.7024	0.34334	0.1023:0.0:0.8977:0.0	.	317	Q8NGC9	O11H4_HUMAN	A	317	ENSP00000318997:G317A	ENSP00000318997:G317A	G	+	2	0	OR11H4	19781740	0.644000	0.27277	0.107000	0.21349	0.435000	0.31806	-0.331000	0.07914	2.437000	0.82529	0.655000	0.94253	GGA	-	superfamily_Family A G protein-coupled receptor-like		0.393	OR11H4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR11H4	protein_coding	OTTHUMT00000410678.1	G			19781740	+1	no_errors	NM_001004479	genbank	human	provisional	54_36p	missense	SNP	0.015	C
SLCO1C1	53919	genome.wustl.edu	37	12	20870126	20870126	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr12:20870126G>A	ENST00000266509.2	+	7	1105	c.737G>A	c.(736-738)tGt>tAt	p.C246Y	SLCO1C1_ENST00000540354.1_Missense_Mutation_p.C197Y|SLCO1C1_ENST00000381552.1_Missense_Mutation_p.C246Y|SLCO1C1_ENST00000545102.1_Missense_Mutation_p.C128Y|SLCO1C1_ENST00000545604.1_Missense_Mutation_p.C246Y	NM_017435.4	NP_059131.1	Q9NYB5	SO1C1_HUMAN	solute carrier organic anion transporter family, member 1C1	246					sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			NS(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	60	Esophageal squamous(101;0.149)				Conjugated Estrogens(DB00286)|Dextrothyroxine(DB00509)|Diclofenac(DB00586)|Digoxin(DB00390)|Dinoprostone(DB00917)|Estradiol(DB00783)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Meclofenamic acid(DB00939)|Methotrexate(DB00563)|Ouabain(DB01092)|Phenytoin(DB00252)|Probenecid(DB01032)	GGCTCATTATGTGCCAAACTA	0.338																																																0			12											203.0	185.0	191.0					12																	20870126		2203	4300	6503	20761393	SO:0001583	missense	53919			AF260704	CCDS8683.1, CCDS53757.1, CCDS53758.1, CCDS53759.1	12p12.2	2013-05-22	2003-11-25	2003-11-26	ENSG00000139155	ENSG00000139155		"""Solute carriers"""	13819	protein-coding gene	gene with protein product		613389	"""solute carrier family 21 (organic anion transporter), member 14"""	SLC21A14			Standard	NM_017435		Approved	OATP-F, OATP1C1, OATP1	uc010sii.2	Q9NYB5	OTTHUMG00000168966	ENST00000266509.2:c.737G>A	12.37:g.20870126G>A	ENSP00000266509:p.Cys246Tyr		20761393	B7Z251|B7Z3Q3|B7Z8P1|F5GZD6|Q5JPA4	Missense_Mutation	SNP	superfamily_MFS_gen_substrate_transporter,HMMPfam_OATP,superfamily_SSF100895,HMMSmart_KAZAL,HMMPfam_Kazal_2	p.C246Y	ENST00000266509.2	37	c.737	CCDS8683.1	12	.	.	.	.	.	.	.	.	.	.	G	21.6	4.178700	0.78564	.	.	ENSG00000139155	ENST00000545604;ENST00000540354;ENST00000266509;ENST00000381552;ENST00000545102	T;T;T;T;T	0.80566	0.34;0.34;0.34;0.34;-1.39	5.76	5.76	0.90799	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	D	0.92351	0.7573	M	0.91090	3.175	0.80722	D	1	D;D;D;D	0.89917	1.0;0.993;0.993;0.993	D;D;D;D	0.83275	0.996;0.972;0.972;0.961	D	0.93083	0.6493	10	0.66056	D	0.02	.	19.9561	0.97218	0.0:0.0:1.0:0.0	.	128;197;246;246	F5GZD6;B7Z3Q3;Q5JPA4;Q9NYB5	.;.;.;SO1C1_HUMAN	Y	246;197;246;246;128	ENSP00000444149:C246Y;ENSP00000438665:C197Y;ENSP00000266509:C246Y;ENSP00000370964:C246Y;ENSP00000444527:C128Y	ENSP00000266509:C246Y	C	+	2	0	SLCO1C1	20761393	1.000000	0.71417	1.000000	0.80357	0.758000	0.43043	9.405000	0.97313	2.725000	0.93324	0.591000	0.81541	TGT	-	superfamily_MFS_gen_substrate_transporter,HMMPfam_OATP		0.338	SLCO1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLCO1C1	protein_coding	OTTHUMT00000401765.1	G	NM_017435		20761393	+1	no_errors	NM_017435	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
EIF4G3	8672	genome.wustl.edu	37	1	21191172	21191172	+	Nonsense_Mutation	SNP	C	C	A			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr1:21191172C>A	ENST00000264211.8	-	16	2829	c.2635G>T	c.(2635-2637)Gaa>Taa	p.E879*	EIF4G3_ENST00000537738.1_Nonsense_Mutation_p.E369*|EIF4G3_ENST00000400422.1_Nonsense_Mutation_p.E879*|EIF4G3_ENST00000374935.3_Nonsense_Mutation_p.E599*|EIF4G3_ENST00000536266.1_Nonsense_Mutation_p.E483*|EIF4G3_ENST00000602326.1_Nonsense_Mutation_p.E885*|EIF4G3_ENST00000374937.3_Nonsense_Mutation_p.E885*	NM_003760.4	NP_003751.2	O43432	IF4G3_HUMAN	eukaryotic translation initiation factor 4 gamma, 3	879	MIF4G. {ECO:0000255|PROSITE- ProRule:PRU00698}.|eIF3/EIF4A-binding. {ECO:0000250}.				cytokine-mediated signaling pathway (GO:0019221)|positive regulation of meiosis I (GO:0060903)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of translation (GO:0045727)|regulation of translational initiation (GO:0006446)|spermatogenesis (GO:0007283)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)	poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(18)|lung(20)|ovary(1)|prostate(4)|skin(3)|stomach(1)|urinary_tract(3)	70		all_lung(284;2.61e-06)|Lung NSC(340;2.81e-06)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00149)|Ovarian(437;0.00338)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.023)|COAD - Colon adenocarcinoma(152;5.42e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000327)|GBM - Glioblastoma multiforme(114;0.000696)|Kidney(64;0.0018)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(64;0.0185)|READ - Rectum adenocarcinoma(331;0.124)|Lung(427;0.191)		TTGGCTTCTTCCAGTTCATCA	0.428																																																0			1											111.0	103.0	105.0					1																	21191172		2203	4300	6503	21063759	SO:0001587	stop_gained	8672			AF012072	CCDS214.1, CCDS55580.1, CCDS59192.1, CCDS72723.1	1p36.12	2008-02-05			ENSG00000075151	ENSG00000075151			3298	protein-coding gene	gene with protein product		603929				9418880	Standard	NM_001198801		Approved	eIF4GII	uc001bef.3	O43432	OTTHUMG00000002624	ENST00000264211.8:c.2635G>T	1.37:g.21191172C>A	ENSP00000264211:p.Glu879*		21063759	B9EGQ7|Q15597|Q504Z1|Q5SWC3|Q8NEN1	Nonsense_Mutation	SNP	superfamily_ARM repeat,HMMPfam_MIF4G,HMMSmart_SM00543,HMMPfam_MA3,HMMSmart_SM00544,superfamily_PH domain-like,HMMSmart_SM00515,HMMPfam_W2	p.E879*	ENST00000264211.8	37	c.2635	CCDS214.1	1	.	.	.	.	.	.	.	.	.	.	C	46	12.873233	0.99702	.	.	ENSG00000075151	ENST00000264211;ENST00000400415;ENST00000400422;ENST00000374935;ENST00000537738;ENST00000374937;ENST00000536266	.	.	.	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-18.9817	19.2046	0.93724	0.0:1.0:0.0:0.0	.	.	.	.	X	879;1075;879;599;369;885;483	.	ENSP00000264211:E879X	E	-	1	0	EIF4G3	21063759	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	6.026000	0.70873	2.548000	0.85928	0.585000	0.79938	GAA	-	superfamily_ARM repeat,HMMPfam_MIF4G,HMMSmart_SM00543		0.428	EIF4G3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	EIF4G3	protein_coding	OTTHUMT00000007467.3	C	NM_003760		21063759	-1	no_errors	NM_003760	genbank	human	validated	54_36p	nonsense	SNP	1.000	A
DNAH11	8701	genome.wustl.edu	37	7	21584750	21584750	+	Missense_Mutation	SNP	T	T	C			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr7:21584750T>C	ENST00000409508.3	+	2	509	c.478T>C	c.(478-480)Tct>Cct	p.S160P	DNAH11_ENST00000328843.6_Missense_Mutation_p.S160P	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	160	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						TGGACATGTATCTGCTTTCCT	0.333									Kartagener syndrome																																							0			7											72.0	68.0	69.0					7																	21584750		1837	4093	5930	21551275	SO:0001583	missense	8701	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.478T>C	7.37:g.21584750T>C	ENSP00000475939:p.Ser160Pro		21551275	Q9UJ82	Missense_Mutation	SNP	HMMPfam_DHC_N1,HMMPfam_DHC_N2,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00382,PatternScan_THIOL_PROTEASE_HIS,HMMPfam_AAA_5,PatternScan_WD_REPEATS_1,HMMPfam_Dynein_heavy	p.S160P	ENST00000409508.3	37	c.478		7	.	.	.	.	.	.	.	.	.	.	T	8.713	0.912518	0.17907	.	.	ENSG00000105877	ENST00000328843	T	0.24908	1.83	5.6	3.22	0.36961	.	0.514735	0.21161	N	0.079146	T	0.16727	0.0402	L	0.35854	1.095	0.29494	N	0.855439	B	0.02656	0.0	B	0.01281	0.0	T	0.14587	-1.0467	10	0.31617	T	0.26	.	4.6042	0.12368	0.7114:0.0:0.0946:0.1941	.	160	Q96DT5	DYH11_HUMAN	P	160	ENSP00000330671:S160P	ENSP00000330671:S160P	S	+	1	0	DNAH11	21551275	0.992000	0.36948	0.980000	0.43619	0.254000	0.26022	1.369000	0.34227	0.496000	0.27904	0.533000	0.62120	TCT	-	NULL		0.333	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	DNAH11	protein_coding	OTTHUMT00000326582.6	T	NM_003777		21551275	+1	no_errors	ENST00000328843	ensembl	human	known	54_36p	missense	SNP	0.890	C
JPH4	84502	genome.wustl.edu	37	14	24040581	24040581	+	Silent	SNP	G	G	A			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr14:24040581G>A	ENST00000397118.3	-	6	2261	c.1359C>T	c.(1357-1359)ccC>ccT	p.P453P	JPH4_ENST00000356300.4_Silent_p.P453P|JPH4_ENST00000544177.1_Silent_p.P118P	NM_032452.2	NP_115828.2	Q96JJ6	JPH4_HUMAN	junctophilin 4	453					calcium ion transport into cytosol (GO:0060402)|learning (GO:0007612)|neuromuscular process controlling balance (GO:0050885)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of synaptic plasticity (GO:0048167)	dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|smooth endoplasmic reticulum (GO:0005790)				endometrium(1)|large_intestine(2)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22	all_cancers(95;0.000251)			GBM - Glioblastoma multiforme(265;0.00654)		ATCCCTCTGAGGGGGTCAGTC	0.672																																																0			14											43.0	44.0	43.0					14																	24040581		2203	4300	6503	23110421	SO:0001819	synonymous_variant	84502			AB058734	CCDS9603.1	14q11	2004-05-28	2004-05-28	2004-05-28	ENSG00000092051	ENSG00000092051			20156	protein-coding gene	gene with protein product			"""junctophilin like 1"""	JPHL1		11347906	Standard	NM_032452		Approved	KIAA1831	uc001wkr.2	Q96JJ6	OTTHUMG00000028769	ENST00000397118.3:c.1359C>T	14.37:g.24040581G>A			23110421	D3DS53|Q8ND44|Q96DQ0	Silent	SNP	superfamily_SSF82185,HMMSmart_MORN,HMMPfam_MORN	p.P453	ENST00000397118.3	37	c.1359	CCDS9603.1	14																																																																																			-	NULL		0.672	JPH4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	JPH4	protein_coding	OTTHUMT00000413853.1	G	NM_032452		23110421	-1	no_errors	NM_032452	genbank	human	reviewed	54_36p	silent	SNP	0.971	A
C1QTNF9B	387911	genome.wustl.edu	37	13	24470988	24470988	+	Silent	SNP	G	G	A	rs374662312		TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr13:24470988G>A	ENST00000382140.2	-	3	198	c.138C>T	c.(136-138)gaC>gaT	p.D46D	C1QTNF9B_ENST00000382057.3_Silent_p.D46D|C1QTNF9B-AS1_ENST00000417034.1_RNA|C1QTNF9B_ENST00000382145.1_Silent_p.D46D|C1QTNF9B_ENST00000556521.1_5'UTR|C1QTNF9B_ENST00000382137.3_Silent_p.D46D			B2RNN3	C1T9B_HUMAN	C1q and tumor necrosis factor related protein 9B	46	Collagen-like 1.					collagen trimer (GO:0005581)|extracellular vesicular exosome (GO:0070062)				breast(1)|central_nervous_system(1)|large_intestine(3)|lung(1)	6						CCTTCGCTCCGTCTCGTCCAT	0.542													G|||	1	0.000199681	0.0	0.0	5008	,	,		23710	0.001		0.0	False		,,,				2504	0.0															0			13						G		0,4406		0,0,2203	111.0	103.0	106.0		138	-8.0	0.8	13		106	1,8593	1.2+/-3.3	0,1,4296	no	coding-synonymous	C1QTNF9B	NM_001007537.1		0,1,6499	AA,AG,GG		0.0116,0.0,0.0077		46/334	24470988	1,12999	2203	4297	6500	23368988	SO:0001819	synonymous_variant	387911			BC110413	CCDS31947.1	13q12.12	2011-05-08			ENSG00000205863	ENSG00000205863			34072	protein-coding gene	gene with protein product		614148				17544811	Standard	NM_001007537		Approved	CTRP9B	uc010tcv.1	B2RNN3	OTTHUMG00000016570	ENST00000382140.2:c.138C>T	13.37:g.24470988G>A			23368988	A2A3T6|B9EH31|Q0VGC5|Q5VX65|Q5VX66|Q8IUU4	Silent	SNP	HMMPfam_Collagen,HMMSmart_SM00110,superfamily_TNF-like,HMMPfam_C1q	p.D46	ENST00000382140.2	37	c.138	CCDS31947.1	13																																																																																			-	HMMPfam_Collagen		0.542	C1QTNF9B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	RP11-45B20.2	protein_coding	OTTHUMT00000044162.3	G	NM_001007537		23368988	-1	no_errors	NM_001007537	genbank	human	provisional	54_36p	silent	SNP	0.990	A
C1QTNF9	338872	genome.wustl.edu	37	13	24890279	24890279	+	Silent	SNP	C	C	T	rs374313886		TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr13:24890279C>T	ENST00000382071.2	+	2	223	c.138C>T	c.(136-138)gaC>gaT	p.D46D	C1QTNF9-AS1_ENST00000449656.1_RNA|RP11-307N16.6_ENST00000382141.4_3'UTR|C1QTNF9_ENST00000332018.4_Silent_p.D46D			P0C862	C1T9A_HUMAN	C1q and tumor necrosis factor related protein 9	46	Collagen-like 1.					collagen trimer (GO:0005581)|extracellular region (GO:0005576)				endometrium(1)|kidney(2)|lung(6)	9		all_cancers(29;3.55e-20)|all_epithelial(30;4.25e-17)|all_lung(29;1.04e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.00565)|Epithelial(112;0.027)|OV - Ovarian serous cystadenocarcinoma(117;0.115)|Lung(94;0.159)		ATGGACGAGACGGAGCGAAGG	0.542																																																0			13						C		0,4406		0,0,2203	81.0	73.0	76.0		138	-7.7	0.8	13		76	1,8591	818.2+/-406.9	0,1,4295	no	coding-synonymous	C1QTNF9	NM_178540.3		0,1,6498	TT,TC,CC		0.0116,0.0,0.0077		46/334	24890279	1,12997	2203	4296	6499	23788279	SO:0001819	synonymous_variant	338872			BC040438	CCDS9306.1	13q12.12	2010-08-18			ENSG00000240654	ENSG00000240654			28732	protein-coding gene	gene with protein product		614285				12975309, 18787108	Standard	NM_178540		Approved	MGC48915, CTRP9, C1QTNF9A, AQL1	uc001upj.3	P0C862	OTTHUMG00000016576	ENST00000382071.2:c.138C>T	13.37:g.24890279C>T			23788279	A2A3T6|Q0VGC5|Q5VX65|Q5VX66|Q8IUU4	Silent	SNP	HMMPfam_Collagen,HMMSmart_C1Q,superfamily_TNF_like,HMMPfam_C1q	p.D46	ENST00000382071.2	37	c.138	CCDS9306.1	13																																																																																			-	HMMPfam_Collagen		0.542	C1QTNF9-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	C1QTNF9	protein_coding	OTTHUMT00000044177.1	C	NM_178540		23788279	+1	no_errors	NM_178540	genbank	human	validated	54_36p	silent	SNP	1.000	T
LYPLA2	11313	genome.wustl.edu	37	1	24124334	24124334	+	IGR	SNP	G	G	T			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr1:24124334G>T	ENST00000374514.3	+	0	1810				GALE_ENST00000470383.1_5'Flank|GALE_ENST00000374497.3_Missense_Mutation_p.L127M	NM_007260.2	NP_009191.1	O95372	LYPA2_HUMAN	lysophospholipase II						fatty acid metabolic process (GO:0006631)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	hydrolase activity (GO:0016787)			endometrium(3)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	8		Colorectal(325;3.46e-05)|Renal(390;0.000219)|Lung NSC(340;0.000233)|all_lung(284;0.000321)|Breast(348;0.0044)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;1.79e-24)|Colorectal(126;4.8e-08)|COAD - Colon adenocarcinoma(152;2.83e-06)|GBM - Glioblastoma multiforme(114;4.22e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000946)|KIRC - Kidney renal clear cell carcinoma(1967;0.00314)|STAD - Stomach adenocarcinoma(196;0.0123)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0827)|LUSC - Lung squamous cell carcinoma(448;0.184)		CTGAACACCAGGTTCTTCACC	0.592																																																0			1											64.0	62.0	63.0					1																	24124334		2203	4300	6503	23996921	SO:0001628	intergenic_variant	2582			AF098668	CCDS241.1	1p36.11	2008-08-08			ENSG00000011009	ENSG00000011009	3.1.1.5		6738	protein-coding gene	gene with protein product							Standard	NM_007260		Approved	APT-2	uc001bht.3	O95372	OTTHUMG00000002961		1.37:g.24124334G>T			23996921	Q7Z4Z2	Missense_Mutation	SNP	superfamily_NAD(P)-binding Rossmann-fold domains,HMMPfam_Epimerase	p.L127M	ENST00000374514.3	37	c.379	CCDS241.1	1	.	.	.	.	.	.	.	.	.	.	G	15.96	2.985756	0.53934	.	.	ENSG00000117308	ENST00000374498;ENST00000374497;ENST00000429356;ENST00000418277;ENST00000425913;ENST00000445705	D;D;D;D;D	0.89939	-2.59;-2.59;-2.59;-2.59;-2.59	4.59	2.66	0.31614	NAD-dependent epimerase/dehydratase (1);NAD(P)-binding domain (1);	0.170210	0.41500	D	0.000862	D	0.91064	0.7188	M	0.79343	2.45	0.43569	D	0.995893	P;D;P;P	0.56287	0.728;0.975;0.824;0.824	P;P;P;P	0.62184	0.527;0.899;0.631;0.631	D	0.88251	0.2916	10	0.39692	T	0.17	-10.04	3.5659	0.07900	0.2565:0.0:0.4652:0.2783	.	53;63;127;127	B3KQ39;E9PH43;Q38G75;Q14376	.;.;.;GALE_HUMAN	M	63;127;63;63;127;127	ENSP00000363621:L127M;ENSP00000398585:L63M;ENSP00000414719:L63M;ENSP00000393359:L127M;ENSP00000398257:L127M	ENSP00000363621:L127M	L	-	1	2	GALE	23996921	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	1.129000	0.31381	1.157000	0.42530	0.561000	0.74099	CTG	-	superfamily_NAD(P)-binding Rossmann-fold domains,HMMPfam_Epimerase		0.592	LYPLA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALE	protein_coding	OTTHUMT00000008245.1	G			23996921	-1	no_errors	NM_000403	genbank	human	reviewed	54_36p	missense	SNP	0.998	T
PHF12	57649	genome.wustl.edu	37	17	27234624	27234624	+	Missense_Mutation	SNP	C	C	T			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr17:27234624C>T	ENST00000332830.4	-	13	3335	c.2525G>A	c.(2524-2526)tGc>tAc	p.C842Y	PHF12_ENST00000582655.1_5'Flank|PHF12_ENST00000577226.1_3'UTR	NM_001033561.1	NP_001028733.1			PHD finger protein 12											breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(8)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	30	all_cancers(5;1.95e-14)|all_epithelial(6;5e-18)|Lung NSC(42;0.01)		Epithelial(11;1.64e-05)|all cancers(11;7.47e-05)|BRCA - Breast invasive adenocarcinoma(11;9.79e-05)			GTAGAATATGCAGGCATGTTT	0.547																																																0			17											110.0	86.0	94.0					17																	27234624		2203	4300	6503	24258750	SO:0001583	missense	57649			AB040956	CCDS11247.1, CCDS32598.1	17q11.2	2013-01-28			ENSG00000109118	ENSG00000109118		"""Zinc fingers, PHD-type"""	20816	protein-coding gene	gene with protein product						11390640	Standard	XM_005258015		Approved	PF1, KIAA1523	uc002hdg.1	Q96QT6	OTTHUMG00000132676	ENST00000332830.4:c.2525G>A	17.37:g.27234624C>T	ENSP00000329933:p.Cys842Tyr		24258750		Missense_Mutation	SNP	superfamily_FYVE/PHD zinc finger,HMMSmart_SM00249,HMMPfam_PHD,PatternScan_ZF_PHD_1,superfamily_SMAD/FHA domain	p.C842Y	ENST00000332830.4	37	c.2525	CCDS32598.1	17	.	.	.	.	.	.	.	.	.	.	C	22.9	4.355731	0.82243	.	.	ENSG00000109118	ENST00000332830	T	0.40756	1.02	4.34	4.34	0.51931	Forkhead-associated (FHA) domain (2);SMAD/FHA domain (1);	0.000000	0.85682	D	0.000000	T	0.61489	0.2351	L	0.61218	1.895	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.77557	0.99;0.99	T	0.66356	-0.5944	10	0.87932	D	0	-33.9633	15.5957	0.76578	0.0:1.0:0.0:0.0	.	824;842	B4DFE2;Q96QT6	.;PHF12_HUMAN	Y	842	ENSP00000329933:C842Y	ENSP00000329933:C842Y	C	-	2	0	PHF12	24258750	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.130000	0.77235	2.221000	0.72209	0.467000	0.42956	TGC	-	superfamily_SMAD/FHA domain		0.547	PHF12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHF12	protein_coding	OTTHUMT00000255941.1	C	NM_020889		24258750	-1	no_errors	NM_001033561	genbank	human	validated	54_36p	missense	SNP	1.000	T
NFE2L3	9603	genome.wustl.edu	37	7	26224693	26224693	+	Missense_Mutation	SNP	C	C	G			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr7:26224693C>G	ENST00000056233.3	+	4	1634	c.1375C>G	c.(1375-1377)Cat>Gat	p.H459D		NM_004289.6	NP_004280.5	Q9Y4A8	NF2L3_HUMAN	nuclear factor, erythroid 2-like 3	459					transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)|skin(5)|urinary_tract(7)	29						TAGTTCCCATCATGACTTAGA	0.413																																																0			7											166.0	170.0	169.0					7																	26224693		2203	4300	6503	26191218	SO:0001583	missense	9603			AB010812	CCDS5396.1	7p15.2	2013-08-23	2013-08-23		ENSG00000050344	ENSG00000050344		"""basic leucine zipper proteins"""	7783	protein-coding gene	gene with protein product		604135	"""nuclear factor (erythroid-derived 2)-like 3"""			10037736	Standard	NM_004289		Approved	Nrf3	uc003sxq.3	Q9Y4A8	OTTHUMG00000023882	ENST00000056233.3:c.1375C>G	7.37:g.26224693C>G	ENSP00000056233:p.His459Asp		26191218	Q6NUS0|Q7Z498|Q86UJ4|Q86VR5|Q9UQA4	Missense_Mutation	SNP	superfamily_Euk_transcr_DNA,HMMPfam_bZIP_1,HMMSmart_BRLZ,PatternScan_BZIP_BASIC	p.H459D	ENST00000056233.3	37	c.1375	CCDS5396.1	7	.	.	.	.	.	.	.	.	.	.	C	0.550	-0.849708	0.02651	.	.	ENSG00000050344	ENST00000056233;ENST00000398175	T	0.28255	1.62	4.97	-0.768	0.11013	.	0.432757	0.26390	N	0.024650	T	0.13841	0.0335	N	0.16602	0.42	0.09310	N	1	B	0.12630	0.006	B	0.08055	0.003	T	0.27773	-1.0064	10	0.15952	T	0.53	-0.8328	7.627	0.28218	0.0:0.3219:0.4651:0.213	.	459	Q9Y4A8	NF2L3_HUMAN	D	459;165	ENSP00000056233:H459D	ENSP00000056233:H459D	H	+	1	0	NFE2L3	26191218	0.000000	0.05858	0.000000	0.03702	0.024000	0.10985	-0.127000	0.10547	-0.045000	0.13468	-0.324000	0.08512	CAT	-	NULL		0.413	NFE2L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NFE2L3	protein_coding	OTTHUMT00000214088.1	C			26191218	+1	no_errors	NM_004289	genbank	human	reviewed	54_36p	missense	SNP	0.004	G
AC003101.1	0	genome.wustl.edu	37	17	29902622	29902622	+	Silent	SNP	C	C	T			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr17:29902622C>T	ENST00000412403.1	+	3	403	c.399C>T	c.(397-399)gtC>gtT	p.V133V	MIR365B_ENST00000362317.1_RNA|MIR4725_ENST00000581700.1_RNA																							GAATGTACGTCCAAAATAAGA	0.507																																																0			17																																								26926735	SO:0001819	synonymous_variant	0																														ENST00000412403.1:c.399C>T	17.37:g.29902622C>T			26926735		Silent	SNP	NULL	p.V91	ENST00000412403.1	37	c.273		17																																																																																			-	NULL		0.507	AC003101.1-001	PUTATIVE	basic|appris_principal	protein_coding	LOC100130112	protein_coding	OTTHUMT00000256194.1	C			26926735	+1	no_errors	XM_001724608	genbank	human	model	54_36p	silent	SNP	0.000	T
AGBL5	60509	genome.wustl.edu	37	2	27293051	27293051	+	Missense_Mutation	SNP	T	T	C			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr2:27293051T>C	ENST00000360131.4	+	15	2740	c.2581T>C	c.(2581-2583)Tac>Cac	p.Y861H		NM_021831.5	NP_068603.4	Q8NDL9	CBPC5_HUMAN	ATP/GTP binding protein-like 5	861					protein branching point deglutamylation (GO:0035611)|protein deglutamylation (GO:0035608)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(8)|ovary(3)|pancreas(1)|prostate(2)|skin(1)	28	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTGGAATTGTTACAGCAGGGG	0.557																																																0			2											123.0	116.0	118.0					2																	27293051		1858	4096	5954	27146555	SO:0001583	missense	60509			BC007415	CCDS1732.3, CCDS42665.1	2p23.3	2014-06-23			ENSG00000084693	ENSG00000084693			26147	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 5"""	615900				24022482	Standard	NM_001035507		Approved	FLJ21839, CCP5	uc002rie.3	Q8NDL9	OTTHUMG00000128406	ENST00000360131.4:c.2581T>C	2.37:g.27293051T>C	ENSP00000353249:p.Tyr861His		27146555	A2VDI7|B7WPG9|B7Z7I7|D6W548|Q53SW0|Q53SZ0|Q96IK8|Q9H6V0|Q9H8P8	Missense_Mutation	SNP	superfamily_Zn-dependent exopeptidases,HMMPfam_Peptidase_M14	p.Y861H	ENST00000360131.4	37	c.2581	CCDS1732.3	2	.	.	.	.	.	.	.	.	.	.	T	10.09	1.255484	0.22965	.	.	ENSG00000084693	ENST00000360131	T	0.18960	2.18	5.21	4.05	0.47172	.	0.536827	0.18963	N	0.126346	T	0.13329	0.0323	N	0.24115	0.695	0.29465	N	0.857492	B	0.06786	0.001	B	0.10450	0.005	T	0.09773	-1.0659	10	0.48119	T	0.1	-13.018	6.5993	0.22691	0.0:0.1142:0.0:0.8858	.	861	Q8NDL9	CBPC5_HUMAN	H	861	ENSP00000353249:Y861H	ENSP00000353249:Y861H	Y	+	1	0	AGBL5	27146555	1.000000	0.71417	1.000000	0.80357	0.605000	0.37080	2.009000	0.40903	0.996000	0.38943	0.459000	0.35465	TAC	-	NULL		0.557	AGBL5-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AGBL5	protein_coding	OTTHUMT00000309033.1	T	NM_021831		27146555	+1	no_errors	NM_021831	genbank	human	validated	54_36p	missense	SNP	1.000	C
SLC5A6	8884	genome.wustl.edu	37	2	27430474	27430474	+	Silent	SNP	C	C	T	rs192221724	byFrequency	TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr2:27430474C>T	ENST00000310574.3	-	3	518	c.45G>A	c.(43-45)tcG>tcA	p.S15S	SLC5A6_ENST00000408041.1_Silent_p.S15S	NM_021095.2	NP_066918.2	Q9Y289	SC5A6_HUMAN	solute carrier family 5 (sodium/multivitamin and iodide cotransporter), member 6	15					biotin metabolic process (GO:0006768)|biotin transport (GO:0015878)|pantothenate metabolic process (GO:0015939)|pantothenate transmembrane transport (GO:0015887)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	brush border membrane (GO:0031526)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|vesicle membrane (GO:0012506)	sodium-dependent multivitamin transmembrane transporter activity (GO:0008523)			endometrium(2)|kidney(2)|large_intestine(3)|lung(8)|ovary(3)|prostate(1)|skin(1)	20	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Biotin(DB00121)|gabapentin enacarbil(DB08872)|Lipoic Acid(DB00166)	CGCTTGTGCCCGAGGTTGGGG	0.567													C|||	3	0.000599042	0.0	0.0014	5008	,	,		22834	0.0		0.002	False		,,,				2504	0.0															0			2						C		1,4405	2.1+/-5.4	0,1,2202	133.0	109.0	117.0		45	-8.3	0.0	2		117	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	SLC5A6	NM_021095.2		0,3,6500	TT,TC,CC		0.0233,0.0227,0.0231		15/636	27430474	3,13003	2203	4300	6503	27283978	SO:0001819	synonymous_variant	8884			AF069307	CCDS1740.1	2p23	2013-07-19	2013-07-19		ENSG00000138074	ENSG00000138074		"""Solute carriers"""	11041	protein-coding gene	gene with protein product		604024	"""solute carrier family 5 (sodium-dependent vitamin transporter), member 6"""			9516450, 10329687	Standard	NM_021095		Approved	SMVT	uc002rjd.3	Q9Y289	OTTHUMG00000097075	ENST00000310574.3:c.45G>A	2.37:g.27430474C>T			27283978	B2RB85|D6W549|Q969Y5	Silent	SNP	PatternScan_NA_SOLUT_SYMP_2,HMMPfam_SSF,PatternScan_NA_SOLUT_SYMP_1	p.S15	ENST00000310574.3	37	c.45	CCDS1740.1	2																																																																																			-	NULL		0.567	SLC5A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC5A6	protein_coding	OTTHUMT00000214194.1	C	NM_021095		27283978	-1	no_errors	NM_021095	genbank	human	provisional	54_36p	silent	SNP	0.000	T
ATRAID	51374	genome.wustl.edu	37	2	27439404	27439404	+	Missense_Mutation	SNP	G	G	T			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr2:27439404G>T	ENST00000606999.1	+	6	559	c.501G>T	c.(499-501)gaG>gaT	p.E167D	CAD_ENST00000403525.1_5'Flank|ATRAID_ENST00000405489.3_Missense_Mutation_p.E109D|ATRAID_ENST00000380171.3_Missense_Mutation_p.E222D|CAD_ENST00000264705.4_5'Flank	NM_001170795.1	NP_001164266.1	Q6UW56	ARAID_HUMAN	all-trans retinoic acid-induced differentiation factor	167	EGF-like. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell differentiation (GO:0030154)|negative regulation of cyclin catabolic process (GO:2000599)|negative regulation of osteoblast proliferation (GO:0033689)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of gene expression (GO:0010468)	integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)											TGTGTCCTGAGAATGGATCTT	0.423																																																0			2											346.0	335.0	339.0					2																	27439404		2203	4300	6503	27292908	SO:0001583	missense	51374			BC021237	CCDS1741.1, CCDS46243.1, CCDS62877.1	2p23.3	2012-08-01	2012-07-30	2012-07-30	ENSG00000138085	ENSG00000138085			24090	protein-coding gene	gene with protein product	"""apoptosis-related protein 3"""		"""chromosome 2 open reading frame 28"""	C2orf28		17524364, 21723284	Standard	NM_016085		Approved	HSPC013, p18, APR3	uc002rjf.3	Q6UW56	OTTHUMG00000128405	ENST00000606999.1:c.501G>T	2.37:g.27439404G>T	ENSP00000476080:p.Glu167Asp		27292908	A8C1S2|A8K779|Q96FF6|Q96RT2|Q9Y2R7|Q9Y5L7	Missense_Mutation	SNP	HMMSmart_EGF,PatternScan_EGF_1,PatternScan_EGF_2	p.E222D	ENST00000606999.1	37	c.666		2	.	.	.	.	.	.	.	.	.	.	G	18.23	3.577011	0.65878	.	.	ENSG00000138085	ENST00000380171;ENST00000405489	D;T	0.85484	-1.99;1.01	5.61	2.86	0.33363	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.046644	0.85682	D	0.000000	D	0.89976	0.6871	M	0.75264	2.295	0.38244	D	0.941411	D;D	0.76494	0.999;0.998	D;D	0.80764	0.994;0.99	D	0.88858	0.3324	10	0.66056	D	0.02	-22.9724	7.6911	0.28569	0.2554:0.0:0.7446:0.0	.	167;222	Q6UW56;Q6UW56-3	APR3_HUMAN;.	D	222;109	ENSP00000369518:E222D;ENSP00000384033:E109D	ENSP00000369518:E222D	E	+	3	2	C2orf28	27292908	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.218000	0.42889	0.330000	0.23485	0.561000	0.74099	GAG	-	HMMSmart_EGF		0.423	ATRAID-007	NOVEL	basic|appris_principal	protein_coding	C2orf28	protein_coding	OTTHUMT00000470709.1	G	NM_016085		27292908	+1	no_errors	NM_080592	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
LTN1	26046	genome.wustl.edu	37	21	30343693	30343693	+	Missense_Mutation	SNP	G	G	C			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr21:30343693G>C	ENST00000361371.5	-	7	963	c.884C>G	c.(883-885)tCc>tGc	p.S295C	LTN1_ENST00000389194.2_Missense_Mutation_p.S341C|LTN1_ENST00000389195.2_Missense_Mutation_p.S341C			O94822	LTN1_HUMAN	listerin E3 ubiquitin protein ligase 1	295					protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(12)|lung(19)|ovary(5)|pancreas(1)|prostate(2)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)	60						GCTCACTTTGGATGCTTCCTC	0.423																																																0			21											237.0	223.0	228.0					21																	30343693		2203	4300	6503	29265564	SO:0001583	missense	26046			AK001915	CCDS33527.1, CCDS33527.2	21q21.3	2013-01-09	2010-09-17	2010-09-17	ENSG00000198862	ENSG00000198862		"""RING-type (C3HC4) zinc fingers"""	13082	protein-coding gene	gene with protein product	"""listerin"""	613083	"""chromosome 21 open reading frame 98"", ""zinc finger protein 294"", ""ring finger protein 160"""	C21orf98, C21orf10, ZNF294, RNF160		20835226, 19196968	Standard	NM_015565		Approved	KIAA0714, FLJ11053, LISTERIN	uc002ymr.2	O94822	OTTHUMG00000078803	ENST00000361371.5:c.884C>G	21.37:g.30343693G>C	ENSP00000354977:p.Ser295Cys		29265564	A6NL41|A7E2D0|B2RTS0|C9J7U3|J3KPL4|Q05C47|Q9H8M4|Q9NUY5|Q9P0E9	Missense_Mutation	SNP	superfamily_ARM repeat,superfamily_RING/U-box,HMMSmart_SM00744,HMMPfam_zf-C3HC4	p.S295C	ENST00000361371.5	37	c.884		21	.	.	.	.	.	.	.	.	.	.	G	18.87	3.716472	0.68844	.	.	ENSG00000198862	ENST00000389194;ENST00000361371;ENST00000446611;ENST00000389195	T;T;T	0.67865	3.46;3.46;-0.29	4.66	4.66	0.58398	Armadillo-like helical (1);Armadillo-type fold (1);	0.465872	0.23088	N	0.052071	T	0.63885	0.2549	L	0.54323	1.7	0.43467	D	0.99567	P	0.50710	0.938	B	0.40101	0.319	T	0.72250	-0.4348	10	0.72032	D	0.01	.	18.1081	0.89526	0.0:0.0:1.0:0.0	.	295	O94822	LTN1_HUMAN	C	341;295;297;341	ENSP00000373846:S341C;ENSP00000354977:S295C;ENSP00000373847:S341C	ENSP00000354977:S295C	S	-	2	0	LTN1	29265564	1.000000	0.71417	0.998000	0.56505	0.939000	0.58152	4.822000	0.62686	2.579000	0.87056	0.650000	0.86243	TCC	-	superfamily_ARM repeat		0.423	LTN1-008	NOVEL	basic|appris_principal	protein_coding	RNF160	protein_coding	OTTHUMT00000472108.1	G	NM_015565		29265564	-1	no_errors	NM_015565	genbank	human	validated	54_36p	missense	SNP	1.000	C
ITGAL	3683	genome.wustl.edu	37	16	30528974	30528974	+	Missense_Mutation	SNP	C	C	G			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr16:30528974C>G	ENST00000356798.6	+	27	3161	c.2981C>G	c.(2980-2982)cCt>cGt	p.P994R	ITGAL_ENST00000358164.5_Missense_Mutation_p.P910R|ITGAL_ENST00000433423.2_Missense_Mutation_p.P228R	NM_002209.2	NP_002200.2	P20701	ITAL_HUMAN	integrin, alpha L (antigen CD11A (p180), lymphocyte function-associated antigen 1; alpha polypeptide)	994					activated T cell proliferation (GO:0050798)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)|extracellular matrix organization (GO:0030198)|heterophilic cell-cell adhesion (GO:0007157)|inflammatory response (GO:0006954)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of T cell proliferation (GO:0042102)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)|T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:0002291)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|integrin alphaL-beta2 complex (GO:0034687)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|ICAM-3 receptor activity (GO:0030369)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(10)|kidney(4)|large_intestine(12)|lung(32)|ovary(3)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	76					Antithymocyte globulin(DB00098)|Efalizumab(DB00095)|Lovastatin(DB00227)	TCCTAGGAGCCTCCCGTGCCC	0.637																																					NSCLC(110;1462 1641 3311 33990 49495)											0			16											50.0	49.0	49.0					16																	30528974		2197	4300	6497	30436475	SO:0001583	missense	3683				CCDS32433.1, CCDS45461.1	16p13.1-p11	2010-03-23				ENSG00000005844		"""CD molecules"", ""Integrins"""	6148	protein-coding gene	gene with protein product		153370		CD11A		3284962	Standard	NM_002209		Approved	LFA-1	uc002dyi.4	P20701		ENST00000356798.6:c.2981C>G	16.37:g.30528974C>G	ENSP00000349252:p.Pro994Arg		30436475	O43746|Q45H73|Q96HB1|Q9UBC8	Missense_Mutation	SNP	superfamily_Integrin alpha N-terminal domain,HMMSmart_SM00191,superfamily_vWA-like,HMMSmart_SM00327,HMMPfam_VWA,HMMPfam_FG-GAP,HMMPfam_Integrin_alpha2,superfamily_Integrin domains,PatternScan_INTEGRIN_ALPHA,HMMPfam_Integrin_alpha	p.P994R	ENST00000356798.6	37	c.2981	CCDS32433.1	16	.	.	.	.	.	.	.	.	.	.	C	16.15	3.042193	0.55003	.	.	ENSG00000005844	ENST00000356798;ENST00000358164;ENST00000433423	T;T;T	0.42131	0.98;0.98;0.98	5.13	5.13	0.70059	Integrin alpha-2 (1);	0.116668	0.39341	N	0.001387	T	0.63426	0.2510	M	0.75447	2.3	0.80722	D	1	D;D;D	0.89917	1.0;0.996;0.996	D;D;D	0.79784	0.993;0.984;0.984	T	0.64850	-0.6310	10	0.54805	T	0.06	.	13.9512	0.64118	0.0:1.0:0.0:0.0	.	228;910;994	B4E021;Q96HB1;P20701	.;.;ITAL_HUMAN	R	994;910;228	ENSP00000349252:P994R;ENSP00000350886:P910R;ENSP00000409377:P228R	ENSP00000349252:P994R	P	+	2	0	ITGAL	30436475	0.020000	0.18652	0.787000	0.31911	0.022000	0.10575	2.546000	0.45778	2.657000	0.90304	0.563000	0.77884	CCT	-	HMMPfam_Integrin_alpha2		0.637	ITGAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGAL	protein_coding	OTTHUMT00000434508.2	C			30436475	+1	no_errors	NM_002209	genbank	human	reviewed	54_36p	missense	SNP	0.429	G
HEATR9	256957	genome.wustl.edu	37	17	34193737	34193737	+	Silent	SNP	G	G	A	rs113048475		TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr17:34193737G>A	ENST00000311880.2	-	2	277	c.129C>T	c.(127-129)tcC>tcT	p.S43S	AC015849.2_ENST00000413928.1_RNA|C17orf66_ENST00000587585.1_5'UTR|C17orf66_ENST00000592980.1_Silent_p.S43S	NM_152781.2	NP_689994.2	A2RTY3	HEAT9_HUMAN		43					hematopoietic progenitor cell differentiation (GO:0002244)					breast(3)|central_nervous_system(1)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(6)|lung(11)|skin(2)|stomach(4)	38		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0184)		CCTGGTAGCAGGACAAGGGCA	0.498																																																0			17											152.0	134.0	140.0					17																	34193737		2203	4300	6503	31217850	SO:0001819	synonymous_variant	256957																														ENST00000311880.2:c.129C>T	17.37:g.34193737G>A			31217850	B4DX21|B4DXA4|B4DXF0|Q8N4R4|Q96M46	Silent	SNP	superfamily_ARM repeat	p.S43	ENST00000311880.2	37	c.129	CCDS11299.1	17																																																																																			-	NULL		0.498	C17orf66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C17orf66	protein_coding	OTTHUMT00000256487.1	G			31217850	-1	no_errors	NM_152781	genbank	human	validated	54_36p	silent	SNP	0.973	A
ZSCAN20	7579	genome.wustl.edu	37	1	33960898	33960898	+	Missense_Mutation	SNP	A	A	G			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr1:33960898A>G	ENST00000361328.3	+	8	3107	c.2954A>G	c.(2953-2955)aAg>aGg	p.K985R		NM_145238.3	NP_660281	P17040	ZSC20_HUMAN	zinc finger and SCAN domain containing 20	985					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(11)|ovary(2)|pancreas(1)|stomach(1)	31		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)				ACGGGAGAGAAGCCGTATAAG	0.473																																																0			1											66.0	74.0	71.0					1																	33960898		2117	4259	6376	33733485	SO:0001583	missense	7579			X52360	CCDS41300.1	1p34.3	2013-01-08	2007-02-20	2007-02-20	ENSG00000121903	ENSG00000121903		"""-"", ""Zinc fingers, C2H2-type"""	13093	protein-coding gene	gene with protein product		611315	"""zinc finger protein 31 (KOX 29)"", ""zinc finger protein 31"""	ZNF360, ZNF31		2288909	Standard	NM_145238		Approved	KOX29	uc001bxj.4	P17040	OTTHUMG00000004173	ENST00000361328.3:c.2954A>G	1.37:g.33960898A>G	ENSP00000355053:p.Lys985Arg		33733485	A8K2D0|B1ALI4|B1ALI5|B1ALI6|Q6ZN23|Q96FA9|Q96H84	Missense_Mutation	SNP	HMMPfam_SCAN,HMMSmart_SM00431,HMMSmart_SM00717,superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1	p.K985R	ENST00000361328.3	37	c.2954	CCDS41300.1	1	.	.	.	.	.	.	.	.	.	.	A	19.33	3.807230	0.70797	.	.	ENSG00000121903	ENST00000326544;ENST00000361328;ENST00000401072	.	.	.	5.76	4.63	0.57726	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.64402	D	0.000011	T	0.45994	0.1370	N	0.04132	-0.27	0.38728	D	0.953608	B;P	0.51147	0.425;0.942	B;P	0.62435	0.169;0.902	T	0.53975	-0.8362	9	0.42905	T	0.14	-20.4874	10.1002	0.42499	0.9208:0.0:0.0792:0.0	.	984;985	P17040-3;P17040	.;ZSC20_HUMAN	R	985;919;919	.	ENSP00000324450:K985R	K	+	2	0	ZSCAN20	33733485	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.549000	0.60726	0.992000	0.38840	0.533000	0.62120	AAG	-	superfamily_C2H2 and C2HC zinc fingers		0.473	ZSCAN20-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ZSCAN20	protein_coding	OTTHUMT00000277003.2	A	NM_145238		33733485	+1	no_errors	NM_145238	genbank	human	validated	54_36p	missense	SNP	1.000	G
ANKS1A	23294	genome.wustl.edu	37	6	34962178	34962178	+	Missense_Mutation	SNP	T	T	G			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr6:34962178T>G	ENST00000360359.3	+	10	1540	c.1402T>G	c.(1402-1404)Ttg>Gtg	p.L468V	ANKS1A_ENST00000535627.1_Intron	NM_015245.2	NP_056060.2	Q92625	ANS1A_HUMAN	ankyrin repeat and sterile alpha motif domain containing 1A	468					ephrin receptor signaling pathway (GO:0048013)|neuron remodeling (GO:0016322)|substrate-dependent cell migration (GO:0006929)	cytoplasm (GO:0005737)|neuron projection (GO:0043005)|nucleus (GO:0005634)				cervix(2)|endometrium(3)|large_intestine(4)|lung(16)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31						GAAAGTGGTGTTGGTGGATGG	0.468																																																0			6											155.0	143.0	147.0					6																	34962178		2203	4300	6503	35070156	SO:0001583	missense	23294			D86982	CCDS4798.1	6p21.31	2013-01-10	2006-02-17	2006-02-17	ENSG00000064999	ENSG00000064999		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	20961	protein-coding gene	gene with protein product		608994	"""ankyrin repeat and SAM domain containing 1"", ""ankyrin repeat and sterile alpha motif domain containing 1"""	ANKS1		9039502	Standard	NM_015245		Approved	KIAA0229	uc003ojx.4	Q92625	OTTHUMG00000014559	ENST00000360359.3:c.1402T>G	6.37:g.34962178T>G	ENSP00000353518:p.Leu468Val		35070156	A2RUC1|B4DQW8|Q5JYI9|Q5SYR2|Q86WQ7	Missense_Mutation	SNP	HMMPfam_Ank,superfamily_ANK,HMMSmart_ANK,superfamily_SAM_homology,HMMSmart_SAM,HMMPfam_SAM_1,superfamily_SSF50729,HMMSmart_PTB,HMMPfam_PID	p.L468V	ENST00000360359.3	37	c.1402	CCDS4798.1	6	.	.	.	.	.	.	.	.	.	.	T	7.700	0.692912	0.15039	.	.	ENSG00000064999	ENST00000360359	T	0.41065	1.01	5.49	-0.304	0.12788	.	0.790812	0.10683	N	0.646168	T	0.07143	0.0181	N	0.08118	0	0.09310	N	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.31110	-0.9955	10	0.56958	D	0.05	-2.4165	3.2552	0.06828	0.1203:0.0839:0.3998:0.396	.	468	Q92625	ANS1A_HUMAN	V	468	ENSP00000353518:L468V	ENSP00000353518:L468V	L	+	1	2	ANKS1A	35070156	0.000000	0.05858	0.001000	0.08648	0.052000	0.14988	0.152000	0.16302	0.311000	0.23014	0.460000	0.39030	TTG	-	NULL		0.468	ANKS1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKS1A	protein_coding	OTTHUMT00000040262.1	T	XM_166478		35070156	+1	no_errors	NM_015245	genbank	human	validated	54_36p	missense	SNP	0.004	G
TSHZ3	57616	genome.wustl.edu	37	19	31767779	31767779	+	Missense_Mutation	SNP	G	G	C			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr19:31767779G>C	ENST00000240587.4	-	2	3247	c.2920C>G	c.(2920-2922)Ccc>Gcc	p.P974A		NM_020856.2	NP_065907.2	Q63HK5	TSH3_HUMAN	teashirt zinc finger homeobox 3	974					in utero embryonic development (GO:0001701)|kidney morphogenesis (GO:0060993)|kidney smooth muscle cell differentiation (GO:0072195)|lung development (GO:0030324)|metanephros development (GO:0001656)|musculoskeletal movement (GO:0050881)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of smooth muscle cell differentiation (GO:0051152)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|sensory perception of touch (GO:0050975)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)|ureteric peristalsis (GO:0072105)	growth cone (GO:0030426)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(15)|kidney(9)|large_intestine(20)|lung(60)|ovary(4)|pancreas(2)|prostate(4)|skin(5)	123	Esophageal squamous(110;0.226)					AAGAAGACGGGGTGGCCAGTG	0.517																																																0			19											70.0	65.0	67.0					19																	31767779		2203	4300	6503	36459619	SO:0001583	missense	57616			AL136805	CCDS12421.2	19q13.11	2013-11-20	2007-07-16	2006-03-14	ENSG00000121297	ENSG00000121297		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	30700	protein-coding gene	gene with protein product	"""teashirt 3"""	614119	"""zinc finger protein 537"", ""teashirt family zinc finger 3"""	ZNF537			Standard	NM_020856		Approved	KIAA1474, TSH3	uc002nsy.4	Q63HK5	OTTHUMG00000150184	ENST00000240587.4:c.2920C>G	19.37:g.31767779G>C	ENSP00000240587:p.Pro974Ala		36459619	Q9H0G6|Q9P254	Missense_Mutation	SNP	PatternScan_HOMEOBOX_1,HMMPfam_zf-C2H2,HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1,superfamily_Homeodomain_like,HMMSmart_HOX,HMMPfam_Homeobox	p.P974A	ENST00000240587.4	37	c.2920	CCDS12421.2	19	.	.	.	.	.	.	.	.	.	.	G	22.0	4.237381	0.79800	.	.	ENSG00000121297	ENST00000240587	T	0.17054	2.3	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	T	0.42108	0.1188	L	0.60455	1.87	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	T	0.10730	-1.0617	10	0.87932	D	0	-26.5514	20.1434	0.98067	0.0:0.0:1.0:0.0	.	974	Q63HK5	TSH3_HUMAN	A	974	ENSP00000240587:P974A	ENSP00000240587:P974A	P	-	1	0	TSHZ3	36459619	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.441000	0.97557	2.760000	0.94817	0.591000	0.81541	CCC	-	NULL		0.517	TSHZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSHZ3	protein_coding	OTTHUMT00000316743.2	G	NM_020856		36459619	-1	no_errors	NM_020856	genbank	human	validated	54_36p	missense	SNP	1.000	C
RPS4XP6	391777	genome.wustl.edu	37	5	37085586	37085586	+	IGR	SNP	T	T	C			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr5:37085586T>C								NIPBL (19071 upstream) : C5orf42 (20743 downstream)																							CTCATGATGCTCACAGCATCC	0.428																																																0			5																																								37121343	SO:0001628	intergenic_variant	391777																															5.37:g.37085586T>C			37121343		RNA	SNP	-	NULL		37	NULL		5																																																																																			-	-	0	0.428					LOC391777			T			37121343	+1	pseudogene	XR_016978	genbank	human	model	54_36p	rna	SNP	1.000	C
SNIP1	79753	genome.wustl.edu	37	1	38022549	38022549	+	5'Flank	SNP	C	C	T			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr1:38022549C>T	ENST00000296215.6	-	0	0				SNIP1_ENST00000468040.1_5'Flank|DNALI1_ENST00000541606.1_5'Flank|DNALI1_ENST00000296218.7_Missense_Mutation_p.A7V	NM_024700.3	NP_078976.2	Q8TAD8	SNIP1_HUMAN	Smad nuclear interacting protein 1						I-kappaB kinase/NF-kappaB signaling (GO:0007249)|production of miRNAs involved in gene silencing by miRNA (GO:0035196)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(2)|cervix(2)|endometrium(1)|large_intestine(3)|lung(15)|ovary(1)|upper_aerodigestive_tract(1)	25		Myeloproliferative disorder(586;0.0393)				GCAAACAAGGCCCACACTGGA	0.657																																																0			1											62.0	56.0	58.0					1																	38022549		2203	4300	6503	37795136	SO:0001631	upstream_gene_variant	7802				CCDS419.1	1p34.3	2010-07-06			ENSG00000163877	ENSG00000163877			30587	protein-coding gene	gene with protein product		608241				10887155, 15378006	Standard	NM_024700		Approved		uc001cbi.4	Q8TAD8	OTTHUMG00000004225		1.37:g.38022549C>T	Exception_encountered		37795136	Q96SP9|Q9H9T7	Missense_Mutation	SNP	HMMPfam_Ax_dynein_light	p.A7V	ENST00000296215.6	37	c.20	CCDS419.1	1	.	.	.	.	.	.	.	.	.	.	C	10.61	1.397365	0.25205	.	.	ENSG00000163879	ENST00000296218	T	0.42900	0.96	4.77	3.85	0.44370	.	0.460041	0.17884	N	0.158765	T	0.53965	0.1829	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.55724	-0.8096	7	0.54805	T	0.06	0.2486	12.0089	0.53276	0.1734:0.8266:0.0:0.0	.	.	.	.	V	7	ENSP00000296218:A7V	ENSP00000296218:A7V	A	+	2	0	DNALI1	37795136	0.450000	0.25697	0.867000	0.34043	0.544000	0.35116	0.626000	0.24492	1.365000	0.46057	0.491000	0.48974	GCC	-	NULL		0.657	SNIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNALI1	protein_coding	OTTHUMT00000012169.2	C	NM_024700		37795136	+1	no_errors	NM_003462	genbank	human	reviewed	54_36p	missense	SNP	0.675	T
DISP2	85455	genome.wustl.edu	37	15	40659780	40659780	+	Silent	SNP	G	G	T			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr15:40659780G>T	ENST00000267889.3	+	8	1554	c.1467G>T	c.(1465-1467)acG>acT	p.T489T	RP11-64K12.4_ENST00000558421.1_RNA	NM_033510.1	NP_277045.1	A7MBM2	DISP2_HUMAN	dispatched homolog 2 (Drosophila)	489	SSD. {ECO:0000255|PROSITE- ProRule:PRU00199}.				smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)				breast(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(12)|ovary(4)	30		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;3.39e-06)|Colorectal(105;0.0114)|READ - Rectum adenocarcinoma(2;0.0649)|BRCA - Breast invasive adenocarcinoma(123;0.0798)|Lung(196;0.15)|LUAD - Lung adenocarcinoma(183;0.247)		TCCAGGACACGGTGTACCCCT	0.627																																																0			15											109.0	102.0	104.0					15																	40659780		2203	4300	6503	38447072	SO:0001819	synonymous_variant	85455			AB051529	CCDS10056.1	15q14	2004-01-15			ENSG00000140323	ENSG00000140323			19712	protein-coding gene	gene with protein product		607503				11214970, 10619433	Standard	NM_033510		Approved	DISPB, KIAA1742, HsT16908	uc001zlk.1	A7MBM2	OTTHUMG00000129983	ENST00000267889.3:c.1467G>T	15.37:g.40659780G>T			38447072	Q6AHW3|Q9C0C1	Silent	SNP	superfamily_SSF82866	p.T489	ENST00000267889.3	37	c.1467	CCDS10056.1	15																																																																																			-	superfamily_SSF82866		0.627	DISP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DISP2	protein_coding	OTTHUMT00000252249.1	G	NM_033510		38447072	+1	no_errors	NM_033510	genbank	human	reviewed	54_36p	silent	SNP	0.711	T
MPP3	4356	genome.wustl.edu	37	17	41886367	41886367	+	Missense_Mutation	SNP	G	G	A	rs202078532	byFrequency	TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr17:41886367G>A	ENST00000398389.4	-	19	1703	c.1538C>T	c.(1537-1539)aCg>aTg	p.T513M	MPP3_ENST00000398393.1_Missense_Mutation_p.T538M	NM_001932.4	NP_001923.2	Q13368	MPP3_HUMAN	membrane protein, palmitoylated 3 (MAGUK p55 subfamily member 3)	513	Guanylate kinase-like. {ECO:0000255|PROSITE-ProRule:PRU00100}.				nucleotide phosphorylation (GO:0046939)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)	guanylate kinase activity (GO:0004385)			endometrium(2)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	26		Breast(137;0.00394)		BRCA - Breast invasive adenocarcinoma(366;0.119)		CATAGGTGGCGTTTTTCTTTT	0.408													G|||	3	0.000599042	0.0	0.0	5008	,	,		18489	0.0		0.001	False		,,,				2504	0.002															0			17						G	MET/THR	0,3658		0,0,1829	136.0	133.0	134.0		1538	2.9	0.9	17		134	1,8159		0,1,4079	yes	missense	MPP3	NM_001932.4	81	0,1,5908	AA,AG,GG		0.0123,0.0,0.0085	benign	513/586	41886367	1,11817	1829	4080	5909	39241893	SO:0001583	missense	4356				CCDS42344.1	17q12-q21	2008-07-18			ENSG00000161647	ENSG00000161647			7221	protein-coding gene	gene with protein product	"""MAGUK p55 subfamily member 3"", ""discs, large (Drosophila) homolog 3"", ""membrane protein palmitoylated 3"""	601114		DLG3		8824795	Standard	NR_003562		Approved		uc002iei.4	Q13368	OTTHUMG00000133838	ENST00000398389.4:c.1538C>T	17.37:g.41886367G>A	ENSP00000381425:p.Thr513Met		39241893	B2R7N0|D3DX47|Q4GX05|Q6PGR3|Q86SV1	Missense_Mutation	SNP	HMMSmart_SM00569,HMMPfam_L27,superfamily_PDZ domain-like,HMMPfam_PDZ,HMMSmart_SM00228,superfamily_SH3-domain,HMMSmart_SM00326,HMMPfam_SH3_2,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00072,PatternScan_GUANYLATE_KINASE_1,HMMPfam_Guanylate_kin	p.T513M	ENST00000398389.4	37	c.1538	CCDS42344.1	17	.	.	.	.	.	.	.	.	.	.	G	13.87	2.366648	0.41902	0.0	1.23E-4	ENSG00000161647	ENST00000398393;ENST00000398389	T;T	0.45668	0.89;0.89	5.06	2.94	0.34122	Guanylate kinase/L-type calcium channel (1);Guanylate kinase (2);	0.368200	0.30068	N	0.010486	T	0.28665	0.0710	L	0.34521	1.04	0.37191	D	0.903938	B;B	0.15930	0.015;0.015	B;B	0.20184	0.017;0.028	T	0.20840	-1.0263	10	0.45353	T	0.12	.	6.184	0.20488	0.0935:0.0:0.6495:0.257	.	513;538	Q13368;D3DX46	MPP3_HUMAN;.	M	538;513	ENSP00000381430:T538M;ENSP00000381425:T513M	ENSP00000381425:T513M	T	-	2	0	MPP3	39241893	0.517000	0.26226	0.891000	0.34965	0.914000	0.54420	0.961000	0.29267	1.491000	0.48482	0.655000	0.94253	ACG	-	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00072		0.408	MPP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MPP3	protein_coding	OTTHUMT00000258371.1	G	NM_001932		39241893	-1	no_errors	NM_001932	genbank	human	reviewed	54_36p	missense	SNP	0.854	A
MYRIP	25924	genome.wustl.edu	37	3	39942341	39942341	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr3:39942341G>A	ENST00000302541.6	+	2	376	c.34G>A	c.(34-36)Gat>Aat	p.D12N	MYRIP_ENST00000425621.1_Missense_Mutation_p.D12N|MYRIP_ENST00000444716.1_Missense_Mutation_p.D12N|MYRIP_ENST00000396217.3_De_novo_Start_InFrame	NM_001284423.1|NM_001284426.1|NM_015460.2	NP_001271352.1|NP_001271355.1|NP_056275.2	Q8NFW9	MYRIP_HUMAN	myosin VIIA and Rab interacting protein	12	RabBD. {ECO:0000255|PROSITE- ProRule:PRU00234}.				intracellular protein transport (GO:0006886)|positive regulation of insulin secretion (GO:0032024)	actin cytoskeleton (GO:0015629)|dense core granule (GO:0031045)|exocyst (GO:0000145)|melanosome (GO:0042470)|perinuclear region of cytoplasm (GO:0048471)|photoreceptor outer segment (GO:0001750)|synapse (GO:0045202)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|liver(2)|lung(10)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34				KIRC - Kidney renal clear cell carcinoma(284;0.174)|Kidney(284;0.206)		TGGTTTGACTGATGATGAAAC	0.423																																																0			3											167.0	156.0	160.0					3																	39942341		2203	4300	6503	39917345	SO:0001583	missense	25924			AF396687	CCDS2689.1, CCDS68390.1, CCDS68391.1, CCDS68392.1	3p21.33	2010-08-20			ENSG00000170011	ENSG00000170011		"""A-kinase anchor proteins"""	19156	protein-coding gene	gene with protein product	"""synaptotagmin-like protein homologue lacking C2 domains-c"", ""rab effector MYRIP"", ""Slp homologue lacking C2 domains"""	611790				11964381, 12221080	Standard	NM_001284425		Approved	DKFZp586F1018, exophilin-8, MyRIP, SLAC2-C, SLAC2C	uc003cka.3	Q8NFW9	OTTHUMG00000131392	ENST00000302541.6:c.34G>A	3.37:g.39942341G>A	ENSP00000301972:p.Asp12Asn		39917345	B3KWM3|B3KWW4|B7Z2H1|B7Z9V3|G3XAI8|Q32M41|Q32M42|Q569F7|Q8IUF5|Q9Y3V4	Missense_Mutation	SNP	superfamily_FYVE_PHD_ZnF,HMMPfam_MOBP	p.D12N	ENST00000302541.6	37	c.34	CCDS2689.1	3	.	.	.	.	.	.	.	.	.	.	G	23.1	4.369389	0.82463	.	.	ENSG00000170011	ENST00000444716;ENST00000302541;ENST00000425621	T;T;T	0.78481	-1.18;-1.18;-1.18	5.37	5.37	0.77165	Zinc finger, RING/FYVE/PHD-type (1);Rab-binding domain (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.64402	D	0.000006	D	0.85737	0.5766	L	0.57536	1.79	0.80722	D	1	D;D;P	0.67145	0.987;0.996;0.49	D;D;B	0.78314	0.971;0.991;0.104	D	0.84578	0.0659	9	.	.	.	.	17.0286	0.86454	0.0:0.0:1.0:0.0	.	12;12;12	B3KWW4;G3XAI8;Q8NFW9	.;.;MYRIP_HUMAN	N	12	ENSP00000398665:D12N;ENSP00000301972:D12N;ENSP00000389323:D12N	.	D	+	1	0	MYRIP	39917345	1.000000	0.71417	0.671000	0.29857	0.999000	0.98932	6.831000	0.75324	2.703000	0.92315	0.650000	0.86243	GAT	-	superfamily_FYVE_PHD_ZnF		0.423	MYRIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYRIP	protein_coding	OTTHUMT00000254181.2	G	NM_015460		39917345	+1	no_errors	NM_015460	genbank	human	validated	54_36p	missense	SNP	0.965	A
ELL3	80237	genome.wustl.edu	37	15	44068300	44068300	+	Missense_Mutation	SNP	A	A	G			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr15:44068300A>G	ENST00000319359.3	-	3	859	c.218T>C	c.(217-219)gTg>gCg	p.V73A	RP11-296A16.1_ENST00000417761.2_3'UTR|ELL3_ENST00000497465.1_5'Flank|SERF2_ENST00000381359.1_5'Flank	NM_025165.2	NP_079441.1	Q9HB65	ELL3_HUMAN	elongation factor RNA polymerase II-like 3	73					DNA-templated transcription, elongation (GO:0006354)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of epithelial to mesenchymal transition (GO:0010717)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)	nucleolus (GO:0005730)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)	enhancer binding (GO:0035326)			cervix(1)|kidney(1)|large_intestine(5)|lung(4)|ovary(1)|skin(1)	13		all_cancers(109;7.57e-15)|all_epithelial(112;3.51e-12)|Lung NSC(122;4.72e-08)|all_lung(180;4.9e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;7.81e-07)		ACACTGGGACACTATGAAGGA	0.597																																																0			15											95.0	85.0	88.0					15																	44068300		2198	4298	6496	41855592	SO:0001583	missense	80237			AF276512	CCDS10102.1	15q15.1	2008-02-05			ENSG00000128886	ENSG00000128886			23113	protein-coding gene	gene with protein product		609885				10882741	Standard	NM_025165		Approved	FLJ22637	uc001zsw.1	Q9HB65	OTTHUMG00000059936	ENST00000319359.3:c.218T>C	15.37:g.44068300A>G	ENSP00000320346:p.Val73Ala		41855592	B3KQ66|B3KX08|Q6I9Z7|Q9H634	Missense_Mutation	SNP	HMMPfam_ELL,HMMPfam_Occludin_ELL	p.V73A	ENST00000319359.3	37	c.218	CCDS10102.1	15	.	.	.	.	.	.	.	.	.	.	A	22.7	4.326744	0.81690	.	.	ENSG00000128886	ENST00000319359;ENST00000433927	T;T	0.32753	1.44;1.44	5.67	4.54	0.55810	.	0.235731	0.29900	N	0.010912	T	0.36358	0.0964	M	0.80028	2.48	0.29293	N	0.86919	B;B	0.16603	0.018;0.018	B;B	0.23419	0.046;0.046	T	0.41698	-0.9494	10	0.72032	D	0.01	-31.5468	8.3416	0.32247	0.9109:0.0:0.0891:0.0	.	73;27	Q9HB65;B3KQ66	ELL3_HUMAN;.	A	73;103	ENSP00000320346:V73A;ENSP00000404209:V103A	ENSP00000320346:V73A	V	-	2	0	ELL3	41855592	0.997000	0.39634	1.000000	0.80357	0.958000	0.62258	2.959000	0.49153	0.978000	0.38470	0.533000	0.62120	GTG	-	HMMPfam_ELL		0.597	ELL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELL3	protein_coding	OTTHUMT00000133236.2	A	NM_025165		41855592	-1	no_errors	NM_025165	genbank	human	validated	54_36p	missense	SNP	0.999	G
VDAC3	7419	genome.wustl.edu	37	8	42260891	42260891	+	Missense_Mutation	SNP	C	C	A			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr8:42260891C>A	ENST00000022615.4	+	8	682	c.614C>A	c.(613-615)tCc>tAc	p.S205Y	VDAC3_ENST00000521158.1_Missense_Mutation_p.S206Y|VDAC3_ENST00000392935.3_Missense_Mutation_p.S206Y|VDAC3_ENST00000522572.1_Intron			Q9Y277	VDAC3_HUMAN	voltage-dependent anion channel 3	205					adenine transport (GO:0015853)	extracellular vesicular exosome (GO:0070062)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|pore complex (GO:0046930)	nucleotide binding (GO:0000166)|porin activity (GO:0015288)|voltage-gated anion channel activity (GO:0008308)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)	7	all_cancers(6;3.86e-23)|all_lung(13;6.47e-12)|Lung NSC(13;1.08e-10)|Ovarian(28;0.00769)|Prostate(17;0.0119)|Lung SC(25;0.211)	all_lung(54;0.00671)|Lung NSC(58;0.0184)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	BRCA - Breast invasive adenocarcinoma(8;3.48e-10)|OV - Ovarian serous cystadenocarcinoma(14;0.00266)|Lung(22;0.00849)|LUSC - Lung squamous cell carcinoma(45;0.024)		Dihydroxyaluminium(DB01375)	ATTGAAACATCCATAAACCTT	0.403																																																0			8											198.0	173.0	181.0					8																	42260891		2203	4300	6503	42380048	SO:0001583	missense	7419			AF038962	CCDS6131.1, CCDS47850.1	8p11.21	2011-11-15			ENSG00000078668	ENSG00000078668		"""Voltage-dependent anion channels"""	12674	protein-coding gene	gene with protein product		610029				9653160, 9781040	Standard	NM_001135694		Approved	HD-VDAC3	uc003xpc.3	Q9Y277	OTTHUMG00000164168	ENST00000022615.4:c.614C>A	8.37:g.42260891C>A	ENSP00000022615:p.Ser205Tyr		42380048	Q9UIS0	Missense_Mutation	SNP	HMMPfam_Porin_3,PatternScan_EUKARYOTIC_PORIN	p.S205Y	ENST00000022615.4	37	c.614	CCDS6131.1	8	.	.	.	.	.	.	.	.	.	.	C	33	5.264312	0.95399	.	.	ENSG00000078668	ENST00000392935;ENST00000521158;ENST00000022615	T;T;T	0.42900	0.96;0.96;0.96	5.73	5.73	0.89815	.	0.058092	0.64402	D	0.000001	T	0.61451	0.2348	M	0.68952	2.095	0.80722	D	1	D	0.61697	0.99	P	0.60541	0.876	T	0.62728	-0.6793	10	0.87932	D	0	-8.5242	17.7591	0.88459	0.0:1.0:0.0:0.0	.	205	Q9Y277	VDAC3_HUMAN	Y	206;206;205	ENSP00000442811:S206Y;ENSP00000428845:S206Y;ENSP00000022615:S205Y	ENSP00000022615:S205Y	S	+	2	0	VDAC3	42380048	1.000000	0.71417	0.993000	0.49108	0.982000	0.71751	7.776000	0.85560	2.854000	0.98071	0.655000	0.94253	TCC	-	HMMPfam_Porin_3		0.403	VDAC3-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	VDAC3	protein_coding	OTTHUMT00000377574.1	C			42380048	+1	no_errors	NM_005662	genbank	human	validated	54_36p	missense	SNP	0.987	A
PIAS2	9063	genome.wustl.edu	37	18	44435553	44435553	+	Missense_Mutation	SNP	C	C	A			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr18:44435553C>A	ENST00000585916.1	-	4	609	c.610G>T	c.(610-612)Gat>Tat	p.D204Y	PIAS2_ENST00000324794.7_Missense_Mutation_p.D204Y|PIAS2_ENST00000545673.1_5'UTR	NM_004671.3	NP_004662.2	O75928	PIAS2_HUMAN	protein inhibitor of activated STAT, 2	204	PINIT. {ECO:0000255|PROSITE- ProRule:PRU00799}.				androgen receptor signaling pathway (GO:0030521)|negative regulation of androgen receptor signaling pathway (GO:0060766)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein sumoylation (GO:0016925)|regulation of osteoblast differentiation (GO:0045667)|transcription, DNA-templated (GO:0006351)	nuclear body (GO:0016604)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|SUMO ligase activity (GO:0019789)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(8)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	22						ACTGTATAATCTCTCCTACCA	0.353																																																0			18											75.0	76.0	76.0					18																	44435553		2203	4300	6503	42689551	SO:0001583	missense	9063			AF077953	CCDS32824.1, CCDS32825.1	18q12.1-q12.3	2011-10-11				ENSG00000078043		"""Zinc fingers, MIZ-type"""	17311	protein-coding gene	gene with protein product	"""zinc finger, MIZ-type containing 4"""	603567				9724754, 9256341	Standard	NM_004671		Approved	PIASX-BETA, miz, PIASX-ALPHA, ZMIZ4	uc002lck.3	O75928		ENST00000585916.1:c.610G>T	18.37:g.44435553C>A	ENSP00000465676:p.Asp204Tyr		42689551	O75927|Q96BT5|Q96KE3	Missense_Mutation	SNP	HMMPfam_SAP,HMMSmart_SM00513,superfamily_RING/U-box,HMMPfam_zf-MIZ	p.D204Y	ENST00000585916.1	37	c.610	CCDS32824.1	18	.	.	.	.	.	.	.	.	.	.	C	17.66	3.443747	0.63067	.	.	ENSG00000078043	ENST00000398654;ENST00000262161;ENST00000398651;ENST00000324794	T	0.48201	0.82	5.45	5.45	0.79879	PINIT domain (1);	0.000000	0.85682	D	0.000000	T	0.60599	0.2281	M	0.76574	2.34	0.80722	D	1	B;B;B;P	0.36874	0.314;0.18;0.072;0.572	B;B;B;B	0.44278	0.17;0.248;0.111;0.445	T	0.64888	-0.6301	10	0.87932	D	0	-1.3067	19.2762	0.94032	0.0:1.0:0.0:0.0	.	208;204;204;204	O75928-3;Q2TA77;O75928-2;O75928	.;.;.;PIAS2_HUMAN	Y	204;204;200;204	ENSP00000317163:D204Y	ENSP00000262161:D204Y	D	-	1	0	PIAS2	42689551	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.286000	0.78671	2.553000	0.86117	0.591000	0.81541	GAT	-	NULL		0.353	PIAS2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	PIAS2	protein_coding	OTTHUMT00000445656.2	C	NM_004671		42689551	-1	no_errors	NM_004671	genbank	human	validated	54_36p	missense	SNP	1.000	A
C5orf28	64417	genome.wustl.edu	37	5	43453800	43453800	+	Missense_Mutation	SNP	T	T	C			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr5:43453800T>C	ENST00000500337.2	-	4	603	c.272A>G	c.(271-273)gAt>gGt	p.D91G	C5orf28_ENST00000512085.1_Missense_Mutation_p.D91G|C5orf28_ENST00000537319.1_Intron|C5orf28_ENST00000510130.1_Intron|C5orf28_ENST00000511525.1_Intron|C5orf28_ENST00000397080.3_Missense_Mutation_p.D91G			Q0VDI3	CE028_HUMAN	chromosome 5 open reading frame 28	91						integral component of membrane (GO:0016021)				breast(1)|kidney(1)|large_intestine(2)|lung(5)	9	Lung NSC(6;2.07e-05)					GTGGTCTACATCAATAACAGA	0.368																																																0			5											84.0	86.0	85.0					5																	43453800		2203	4300	6503	43489557	SO:0001583	missense	64417			AK025310	CCDS3945.1	5p12	2011-01-25			ENSG00000151881	ENSG00000151881			26139	protein-coding gene	gene with protein product						12477932	Standard	NM_022483		Approved	FLJ21657	uc003jny.3	Q0VDI3	OTTHUMG00000131150	ENST00000500337.2:c.272A>G	5.37:g.43453800T>C	ENSP00000426067:p.Asp91Gly		43489557	B2RDA6|Q9H6Z2	Missense_Mutation	SNP	NULL	p.D91G	ENST00000500337.2	37	c.272	CCDS3945.1	5	.	.	.	.	.	.	.	.	.	.	T	24.9	4.581172	0.86748	.	.	ENSG00000151881	ENST00000500337;ENST00000397080;ENST00000512085;ENST00000506860	.	.	.	5.36	5.36	0.76844	.	0.099165	0.64402	D	0.000001	D	0.83972	0.5370	M	0.87180	2.865	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.87118	0.2189	9	0.87932	D	0	-9.7523	15.7086	0.77606	0.0:0.0:0.0:1.0	.	91	Q0VDI3	CE028_HUMAN	G	91	.	ENSP00000380270:D91G	D	-	2	0	C5orf28	43489557	1.000000	0.71417	0.924000	0.36721	0.996000	0.88848	7.630000	0.83225	2.173000	0.68751	0.454000	0.30748	GAT	-	NULL		0.368	C5orf28-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	C5orf28	protein_coding	OTTHUMT00000368003.1	T	NM_022483		43489557	-1	no_errors	NM_022483	genbank	human	validated	54_36p	missense	SNP	1.000	C
CELSR1	9620	genome.wustl.edu	37	22	46792623	46792623	+	Missense_Mutation	SNP	C	C	G			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr22:46792623C>G	ENST00000262738.3	-	13	5721	c.5722G>C	c.(5722-5724)Gtg>Ctg	p.V1908L		NM_014246.1	NP_055061.1	Q9NYQ6	CELR1_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 1	1908	EGF-like 6; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anterior/posterior pattern specification (GO:0009952)|apical protein localization (GO:0045176)|central nervous system development (GO:0007417)|establishment of body hair planar orientation (GO:0048105)|establishment of planar polarity (GO:0001736)|establishment of planar polarity of embryonic epithelium (GO:0042249)|G-protein coupled receptor signaling pathway (GO:0007186)|hair follicle development (GO:0001942)|homophilic cell adhesion (GO:0007156)|inner ear morphogenesis (GO:0042472)|lateral sprouting involved in lung morphogenesis (GO:0060490)|locomotory behavior (GO:0007626)|neural tube closure (GO:0001843)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|orthogonal dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060488)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060489)|protein localization involved in establishment of planar polarity (GO:0090251)|regulation of actin cytoskeleton organization (GO:0032956)|Rho protein signal transduction (GO:0007266)|wound healing (GO:0042060)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|protein dimerization activity (GO:0046983)|transmembrane signaling receptor activity (GO:0004888)			breast(8)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(13)|lung(27)|ovary(2)|pancreas(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(3)	95		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		CAGGCATCCACACAGTTTATT	0.592																																																0			22											52.0	41.0	45.0					22																	46792623		2202	4300	6502	45171287	SO:0001583	missense	9620			AF231024	CCDS14076.1	22q13.31	2014-08-08	2013-02-18		ENSG00000075275	ENSG00000075275		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	1850	protein-coding gene	gene with protein product	"""flamingo homolog 2 (Drosophila)"""	604523	"""cadherin, EGF LAG seven-pass G-type receptor 1, flamingo (Drosophila) homolog"""			9339365	Standard	XM_006724383		Approved	ME2, HFMI2, FMI2, CDHF9	uc003bhw.1	Q9NYQ6	OTTHUMG00000150423	ENST00000262738.3:c.5722G>C	22.37:g.46792623C>G	ENSP00000262738:p.Val1908Leu		45171287	O95722|Q5TH47|Q9BWQ5|Q9Y506|Q9Y526	Missense_Mutation	SNP	superfamily_Cadherin-like,HMMPfam_Cadherin,HMMSmart_SM00112,PatternScan_CADHERIN_1,superfamily_EGF/Laminin,HMMSmart_SM00181,HMMPfam_EGF,PatternScan_EGF_1,PatternScan_EGF_2,HMMSmart_SM00179,superfamily_Concanavalin A-like lectins/glucanases,HMMSmart_SM00282,HMMPfam_Laminin_G_2,PatternScan_ASX_HYDROXYL,HMMPfam_Laminin_EGF,HMMSmart_SM00180,PatternScan_EGF_LAM_1,HMMSmart_SM00008,HMMPfam_HRM,HMMPfam_GPS,HMMSmart_SM00303,HMMPfam_7tm_2	p.V1908L	ENST00000262738.3	37	c.5722	CCDS14076.1	22	.	.	.	.	.	.	.	.	.	.	C	10.61	1.397285	0.25205	.	.	ENSG00000075275	ENST00000262738	T	0.69175	-0.38	4.45	3.42	0.39159	Epidermal growth factor-like (1);EGF-like region, conserved site (1);Epidermal growth factor-like, type 3 (1);	0.205114	0.31134	U	0.008197	T	0.52980	0.1768	L	0.42529	1.33	0.80722	D	1	B;B	0.27765	0.188;0.012	B;B	0.25614	0.062;0.013	T	0.46345	-0.9198	10	0.30078	T	0.28	.	7.5245	0.27647	0.1637:0.7498:0.0:0.0865	.	229;1908	B7Z7U7;Q9NYQ6	.;CELR1_HUMAN	L	1908	ENSP00000262738:V1908L	ENSP00000262738:V1908L	V	-	1	0	CELSR1	45171287	0.871000	0.30034	0.764000	0.31436	0.405000	0.30901	1.640000	0.37186	1.014000	0.39417	0.561000	0.74099	GTG	-	superfamily_Concanavalin A-like lectins/glucanases,HMMSmart_SM00179,superfamily_EGF/Laminin,HMMSmart_SM00181,PatternScan_EGF_2		0.592	CELSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CELSR1	protein_coding	OTTHUMT00000318037.1	C	NM_014246		45171287	-1	no_errors	NM_014246	genbank	human	reviewed	54_36p	missense	SNP	0.948	G
NASP	4678	genome.wustl.edu	37	1	46083181	46083181	+	Missense_Mutation	SNP	C	C	T			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr1:46083181C>T	ENST00000350030.3	+	14	2291	c.2204C>T	c.(2203-2205)gCc>gTc	p.A735V	NASP_ENST00000402363.3_Missense_Mutation_p.A737V|NASP_ENST00000530073.1_3'UTR|NASP_ENST00000372052.4_Missense_Mutation_p.A369V|NASP_ENST00000537798.1_Missense_Mutation_p.A671V|NASP_ENST00000351223.3_Missense_Mutation_p.A396V	NM_002482.3	NP_002473.2	P49321	NASP_HUMAN	nuclear autoantigenic sperm protein (histone-binding)	735					blastocyst development (GO:0001824)|cell cycle (GO:0007049)|cell proliferation (GO:0008283)|DNA replication (GO:0006260)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone exchange (GO:0043486)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)	Hsp90 protein binding (GO:0051879)			breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(6)|ovary(1)|pancreas(1)|prostate(3)|skin(1)	17	Acute lymphoblastic leukemia(166;0.155)|Lung SC(450;0.211)					GCAAAGAAAGCCAAACAAGAG	0.468																																																0			1											98.0	91.0	93.0					1																	46083181		2203	4300	6503	45855768	SO:0001583	missense	4678			M97856	CCDS524.1, CCDS525.1, CCDS55597.1	1p34.1	2013-01-10			ENSG00000132780	ENSG00000132780		"""Tetratricopeptide (TTC) repeat domain containing"""	7644	protein-coding gene	gene with protein product		603185				1426632	Standard	NM_002482		Approved	FLB7527, FLJ31599, FLJ35510, MGC19722, MGC20372, MGC2297, DKFZp547F162, PRO1999	uc001coi.2	P49321	OTTHUMG00000007826	ENST00000350030.3:c.2204C>T	1.37:g.46083181C>T	ENSP00000255120:p.Ala735Val		45855768	A8K6H2|B4DQP3|D3DQ07|F5H3J2|Q53GW5|Q5T622|Q5T625|Q96A69|Q9BTW2	Missense_Mutation	SNP	HMMPfam_TPR_1,HMMSmart_TPR,superfamily_SSF48452,HMMPfam_SHNi-TPR	p.A737V	ENST00000350030.3	37	c.2210	CCDS524.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.78|18.78	3.696259|3.696259	0.68386|0.68386	.|.	.|.	ENSG00000132780|ENSG00000132780	ENST00000537798;ENST00000402363;ENST00000341288;ENST00000350030;ENST00000372052;ENST00000351223|ENST00000531612	T;T;T;T;T|.	0.52526|.	0.71;0.71;0.66;0.74;0.71|.	4.56|4.56	4.56|4.56	0.56223|0.56223	.|.	0.339265|.	0.35407|.	N|.	0.003233|.	T|T	0.55705|0.55705	0.1937|0.1937	L|L	0.27053|0.27053	0.805|0.805	0.37300|0.37300	D|D	0.908642|0.908642	D;B;P;P|.	0.69078|.	0.997;0.158;0.495;0.629|.	P;B;B;B|.	0.61397|.	0.888;0.046;0.132;0.259|.	T|T	0.57201|0.57201	-0.7852|-0.7852	10|5	0.87932|.	D|.	0|.	-0.559|-0.559	17.8837|17.8837	0.88848|0.88848	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	671;396;735;737|.	F5H3J2;Q5T626;P49321;P49321-3|.	.;.;NASP_HUMAN;.|.	V|S	671;737;635;735;369;396|235	ENSP00000438871:A671V;ENSP00000384529:A737V;ENSP00000255120:A735V;ENSP00000361122:A369V;ENSP00000255121:A396V|.	ENSP00000345532:A635V|.	A|P	+|+	2|1	0|0	NASP|NASP	45855768|45855768	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.989000|0.989000	0.77384|0.77384	1.784000|1.784000	0.38674|0.38674	2.516000|2.516000	0.84829|0.84829	0.563000|0.563000	0.77884|0.77884	GCC|CCA	-	NULL		0.468	NASP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NASP	protein_coding	OTTHUMT00000021533.2	C	NM_002482		45855768	+1	no_errors	NM_172164	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
IPP	3652	genome.wustl.edu	37	1	46212055	46212055	+	Missense_Mutation	SNP	G	G	C			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr1:46212055G>C	ENST00000396478.3	-	2	131	c.29C>G	c.(28-30)gCt>gGt	p.A10G		NM_005897.2	NP_005888.1	Q9Y573	IPP_HUMAN	intracisternal A particle-promoted polypeptide	10						actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	actin binding (GO:0003779)			central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(6)|lung(5)|ovary(1)|stomach(2)	20	Acute lymphoblastic leukemia(166;0.155)					AGGACTATCAGCAGCCTTGGG	0.403																																																0			1											99.0	92.0	95.0					1																	46212055		2203	4300	6503	45984642	SO:0001583	missense	3652			BC032544	CCDS30702.1, CCDS44132.1	1p34-p32	2013-01-30			ENSG00000197429	ENSG00000197429		"""Kelch-like"", ""BTB/POZ domain containing"""	6108	protein-coding gene	gene with protein product	"""kelch-like family member 27"""	147485				1905535, 8432546	Standard	NM_005897		Approved	KLHL27	uc001cou.3	Q9Y573	OTTHUMG00000008004	ENST00000396478.3:c.29C>G	1.37:g.46212055G>C	ENSP00000379739:p.Ala10Gly		45984642	A2A6V4|D3DQ11|Q8N5C3	Missense_Mutation	SNP	superfamily_POZ domain,HMMPfam_BTB,HMMSmart_SM00225,HMMPfam_BACK,superfamily_Galactose oxidase central domain,HMMPfam_Kelch_1,HMMSmart_SM00612	p.A10G	ENST00000396478.3	37	c.29	CCDS30702.1	1	.	.	.	.	.	.	.	.	.	.	G	8.787	0.929581	0.18131	.	.	ENSG00000197429	ENST00000359942;ENST00000396478	T;T	0.74315	-0.64;-0.83	5.5	-7.47	0.01365	BTB/POZ fold (1);	1.510910	0.03531	N	0.222470	T	0.51176	0.1659	N	0.12182	0.205	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.37753	-0.9692	10	0.39692	T	0.17	.	5.9938	0.19483	0.0795:0.3202:0.4209:0.1794	.	10;10	Q9Y573;A2A6V3	IPP_HUMAN;.	G	10	ENSP00000353024:A10G;ENSP00000379739:A10G	ENSP00000353024:A10G	A	-	2	0	IPP	45984642	0.003000	0.15002	0.021000	0.16686	0.131000	0.20780	0.068000	0.14531	-1.103000	0.03019	-1.053000	0.02334	GCT	-	NULL		0.403	IPP-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	IPP	protein_coding	OTTHUMT00000021974.3	G	NM_005897		45984642	-1	no_errors	NM_005897	genbank	human	reviewed	54_36p	missense	SNP	0.003	C
SKA1	220134	genome.wustl.edu	37	18	47902254	47902254	+	Silent	SNP	C	C	T			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr18:47902254C>T	ENST00000285116.3	+	2	265	c.54C>T	c.(52-54)ggC>ggT	p.G18G	SKA1_ENST00000417656.2_Silent_p.G18G|SKA1_ENST00000398452.2_Silent_p.G18G|SKA1_ENST00000488454.1_5'UTR	NM_001039535.2|NM_145060.3	NP_001034624.1|NP_659497.1	Q96BD8	SKA1_HUMAN	spindle and kinetochore associated complex subunit 1	18					cell division (GO:0051301)|chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|regulation of microtubule polymerization or depolymerization (GO:0031110)	condensed chromosome outer kinetochore (GO:0000940)|cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)|spindle microtubule (GO:0005876)	microtubule binding (GO:0008017)			breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|lung(6)|ovary(1)|prostate(1)	13						AAAAGATTGGCAATATTAAGA	0.318																																																0			18											88.0	91.0	90.0					18																	47902254		2203	4300	6503	46156252	SO:0001819	synonymous_variant	220134			BC015706	CCDS11946.1	18q21.1	2013-01-17	2009-08-19	2009-08-19	ENSG00000154839	ENSG00000154839			28109	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 24"""	C18orf24		17093495	Standard	NM_145060		Approved	MGC10200	uc002leu.3	Q96BD8	OTTHUMG00000132685	ENST00000285116.3:c.54C>T	18.37:g.47902254C>T			46156252	B2R9Y6|B4E0P4	Silent	SNP	HMMPfam_DUF1395	p.G18	ENST00000285116.3	37	c.54	CCDS11946.1	18																																																																																			-	HMMPfam_DUF1395		0.318	SKA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C18orf24	protein_coding	OTTHUMT00000255982.2	C	NM_145060		46156252	+1	no_errors	NM_001039535	genbank	human	validated	54_36p	silent	SNP	0.386	T
MAST2	23139	genome.wustl.edu	37	1	46489462	46489462	+	Silent	SNP	G	G	T			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr1:46489462G>T	ENST00000361297.2	+	15	1873	c.1590G>T	c.(1588-1590)cgG>cgT	p.R530R	MAST2_ENST00000372009.2_Silent_p.R460R	NM_015112.2	NP_055927.2			microtubule associated serine/threonine kinase 2											breast(1)|lung(3)|ovary(5)|stomach(2)	11	Acute lymphoblastic leukemia(166;0.155)|Lung SC(450;0.184)					TTCTGGTGCGGCACAAGTCCA	0.572																																																0			1											63.0	66.0	65.0					1																	46489462		2203	4300	6503	46262049	SO:0001819	synonymous_variant	23139			AB047005	CCDS41326.1	1p34.1	2008-02-05			ENSG00000086015	ENSG00000086015			19035	protein-coding gene	gene with protein product		612257					Standard	NM_015112		Approved	MAST205, KIAA0807	uc001cov.3	Q6P0Q8	OTTHUMG00000008007	ENST00000361297.2:c.1590G>T	1.37:g.46489462G>T			46262049		Silent	SNP	HMMPfam_DUF1908,superfamily_Protein kinase-like (PK-like),HMMSmart_SM00219,HMMSmart_SM00220,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ST,HMMPfam_Pkinase_C,superfamily_PDZ domain-like,HMMSmart_SM00228,HMMPfam_PDZ	p.R530	ENST00000361297.2	37	c.1590	CCDS41326.1	1																																																																																			-	superfamily_Protein kinase-like (PK-like),HMMSmart_SM00219,HMMSmart_SM00220,HMMPfam_Pkinase		0.572	MAST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAST2	protein_coding	OTTHUMT00000021977.1	G	NM_015112		46262049	+1	no_errors	NM_015112	genbank	human	validated	54_36p	silent	SNP	0.998	T
HTR2A	3356	genome.wustl.edu	37	13	47409023	47409023	+	Missense_Mutation	SNP	C	C	G	rs574628777	byFrequency	TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr13:47409023C>G	ENST00000378688.4	-	3	1496	c.1365G>C	c.(1363-1365)gaG>gaC	p.E455D	HTR2A_ENST00000542664.1_Missense_Mutation_p.E455D|HTR2A_ENST00000543956.1_Missense_Mutation_p.E371D			P28223	5HT2A_HUMAN	5-hydroxytryptamine (serotonin) receptor 2A, G protein-coupled	455					activation of phospholipase C activity (GO:0007202)|aging (GO:0007568)|artery smooth muscle contraction (GO:0014824)|behavioral response to cocaine (GO:0048148)|cell death (GO:0008219)|cellular calcium ion homeostasis (GO:0006874)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|memory (GO:0007613)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phospholipase C-activating serotonin receptor signaling pathway (GO:0007208)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of glycolytic process (GO:0045821)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol biosynthetic process (GO:0010513)|positive regulation of vasoconstriction (GO:0045907)|protein localization to cytoskeleton (GO:0044380)|regulation of behavior (GO:0050795)|regulation of dopamine secretion (GO:0014059)|regulation of hormone secretion (GO:0046883)|release of sequestered calcium ion into cytosol (GO:0051209)|response to drug (GO:0042493)|serotonin receptor signaling pathway (GO:0007210)|sleep (GO:0030431)|synaptic transmission (GO:0007268)|temperature homeostasis (GO:0001659)|urinary bladder smooth muscle contraction (GO:0014832)	cell body fiber (GO:0070852)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	1-(4-iodo-2,5-dimethoxyphenyl)propan-2-amine binding (GO:0071886)|drug binding (GO:0008144)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|liver(1)|lung(10)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	36		all_lung(13;7.2e-10)|Lung NSC(96;3.77e-07)|Breast(56;2.06e-05)|Prostate(109;0.00116)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)|Myeloproliferative disorder(33;0.0333)		GBM - Glioblastoma multiforme(144;4.67e-05)|COAD - Colon adenocarcinoma(199;0.224)	Acepromazine(DB01614)|Amisulpride(DB06288)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinitapride(DB08810)|Cisapride(DB00604)|Clomipramine(DB01242)|Clozapine(DB00363)|Cyclobenzaprine(DB00924)|Cyproheptadine(DB00434)|Desipramine(DB01151)|Donepezil(DB00843)|Doxepin(DB01142)|Epinastine(DB00751)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Flupentixol(DB00875)|Fluspirilene(DB04842)|Haloperidol(DB00502)|Iloperidone(DB04946)|Imipramine(DB00458)|Ketamine(DB01221)|Lisuride(DB00589)|Loxapine(DB00408)|Lurasidone(DB08815)|Maprotiline(DB00934)|Mesoridazine(DB00933)|Methotrimeprazine(DB01403)|Methysergide(DB00247)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Molindone(DB01618)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Paliperidone(DB01267)|Paroxetine(DB00715)|Pergolide(DB01186)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Remoxipride(DB00409)|Risperidone(DB00734)|Ropinirole(DB00268)|Sertindole(DB06144)|Thioproperazine(DB01622)|Thioridazine(DB00679)|Thiothixene(DB01623)|Trazodone(DB00656)|Trimipramine(DB00726)|Yohimbine(DB01392)|Ziprasidone(DB00246)	CTTTAGAAGCCTCTTCAGAAT	0.443																																																0			13											137.0	132.0	133.0					13																	47409023		2203	4300	6503	46307024	SO:0001583	missense	3356			X57830	CCDS9405.1, CCDS53867.1	13q14-q21	2012-08-08	2012-02-03		ENSG00000102468	ENSG00000102468		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5293	protein-coding gene	gene with protein product		182135	"""5-hydroxytryptamine (serotonin) receptor 2A"""	HTR2		8035173	Standard	NM_000621		Approved	5-HT2A	uc010acr.4	P28223	OTTHUMG00000016881	ENST00000378688.4:c.1365G>C	13.37:g.47409023C>G	ENSP00000367959:p.Glu455Asp		46307024	B2RAC5|B4DZ79|F5GWE8|Q5T8C0	Missense_Mutation	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.E455D	ENST00000378688.4	37	c.1365	CCDS9405.1	13	.	.	.	.	.	.	.	.	.	.	C	0.020	-1.436156	0.01108	.	.	ENSG00000102468	ENST00000378688;ENST00000543956;ENST00000542664	T;T;T	0.61392	0.48;0.11;0.48	5.73	-5.39	0.02664	.	0.739762	0.14002	N	0.348037	T	0.24005	0.0581	N	0.08118	0	0.09310	N	1	B;B	0.11235	0.004;0.0	B;B	0.13407	0.009;0.001	T	0.17198	-1.0377	10	0.17369	T	0.5	.	2.4011	0.04401	0.3234:0.3295:0.2459:0.1012	.	371;455	F5GWE8;P28223	.;5HT2A_HUMAN	D	455;371;455	ENSP00000367959:E455D;ENSP00000441861:E371D;ENSP00000437737:E455D	ENSP00000367959:E455D	E	-	3	2	HTR2A	46307024	0.017000	0.18338	0.000000	0.03702	0.019000	0.09904	0.193000	0.17116	-1.052000	0.03222	-1.008000	0.02478	GAG	-	NULL		0.443	HTR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTR2A	protein_coding	OTTHUMT00000044835.3	C	NM_000621		46307024	-1	no_errors	NM_000621	genbank	human	validated	54_36p	missense	SNP	0.000	G
AXL	558	genome.wustl.edu	37	19	41749581	41749581	+	Missense_Mutation	SNP	G	G	C			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr19:41749581G>C	ENST00000301178.4	+	12	1696	c.1506G>C	c.(1504-1506)aaG>aaC	p.K502N	AXL_ENST00000593513.1_Missense_Mutation_p.K234N|AXL_ENST00000359092.3_Missense_Mutation_p.K493N	NM_001278599.1|NM_021913.3	NP_001265528.1|NP_068713	P30530	UFO_HUMAN	AXL receptor tyrosine kinase	502					apoptotic cell clearance (GO:0043277)|blood vessel remodeling (GO:0001974)|cell maturation (GO:0048469)|cellular response to extracellular stimulus (GO:0031668)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to interferon-alpha (GO:0035457)|cellular response to lipopolysaccharide (GO:0071222)|dendritic cell differentiation (GO:0097028)|enzyme linked receptor protein signaling pathway (GO:0007167)|erythrocyte homeostasis (GO:0034101)|forebrain cell migration (GO:0021885)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|natural killer cell differentiation (GO:0001779)|negative regulation of dendritic cell apoptotic process (GO:2000669)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of lymphocyte activation (GO:0051250)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of tumor necrosis factor production (GO:0032720)|neuron migration (GO:0001764)|organ regeneration (GO:0031100)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phagocytosis (GO:0006909)|platelet activation (GO:0030168)|positive regulation of cytokine-mediated signaling pathway (GO:0001961)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of protein kinase B signaling (GO:0051897)|protein kinase B signaling (GO:0043491)|secretion by cell (GO:0032940)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|substrate adhesion-dependent cell spreading (GO:0034446)|vagina development (GO:0060068)	cell surface (GO:0009986)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|phosphatidylserine binding (GO:0001786)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(3)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(9)|lung(12)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)	48						GCGTGCGCAAGTCCTACAGTC	0.567																																																0			19											168.0	145.0	153.0					19																	41749581		2203	4300	6503	46441421	SO:0001583	missense	558			M76125	CCDS12574.1, CCDS12575.1, CCDS62677.1	19q13.1	2013-02-11				ENSG00000167601	2.7.10.1	"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	905	protein-coding gene	gene with protein product		109135				1656220	Standard	NM_021913		Approved	UFO, JTK11	uc010ehj.3	P30530		ENST00000301178.4:c.1506G>C	19.37:g.41749581G>C	ENSP00000301178:p.Lys502Asn		46441421	Q8N5L2|Q9UD27	Missense_Mutation	SNP	HMMPfam_V-set,superfamily_Immunoglobulin,HMMSmart_SM00409,superfamily_Fibronectin type III,HMMSmart_SM00060,HMMPfam_fn3,superfamily_Protein kinase-like (PK-like),HMMPfam_Pkinase_Tyr,HMMSmart_SM00219,HMMSmart_SM00220,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_TYR	p.K502N	ENST00000301178.4	37	c.1506	CCDS12575.1	19	.	.	.	.	.	.	.	.	.	.	g	17.63	3.437017	0.62955	.	.	ENSG00000167601	ENST00000301178;ENST00000359092	T;T	0.76060	-0.99;-0.95	3.9	0.517	0.17025	.	0.224766	0.37012	N	0.002294	T	0.74114	0.3674	L	0.46157	1.445	0.28837	N	0.896829	D;D	0.59357	0.985;0.975	P;P	0.58620	0.842;0.698	T	0.67511	-0.5652	10	0.62326	D	0.03	-13.1221	6.874	0.24137	0.5098:0.0:0.4902:0.0	.	493;502	P30530-2;P30530	.;UFO_HUMAN	N	502;493	ENSP00000301178:K502N;ENSP00000351995:K493N	ENSP00000301178:K502N	K	+	3	2	AXL	46441421	0.999000	0.42202	0.999000	0.59377	0.982000	0.71751	0.489000	0.22387	0.097000	0.17492	0.549000	0.68633	AAG	-	NULL		0.567	AXL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AXL	protein_coding	OTTHUMT00000463323.2	G			46441421	+1	no_errors	NM_021913	genbank	human	reviewed	54_36p	missense	SNP	0.998	C
RAD54L	8438	genome.wustl.edu	37	1	46726971	46726971	+	Missense_Mutation	SNP	C	C	T			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr1:46726971C>T	ENST00000371975.4	+	8	1479	c.805C>T	c.(805-807)Ccc>Tcc	p.P269S	RAD54L_ENST00000473251.1_3'UTR|RAD54L_ENST00000442598.1_Missense_Mutation_p.P269S	NM_003579.3	NP_003570.2	Q92698	RAD54_HUMAN	RAD54-like (S. cerevisiae)	269	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				chromosome organization (GO:0051276)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA strand renaturation (GO:0000733)|double-strand break repair via homologous recombination (GO:0000724)|meiotic nuclear division (GO:0007126)|response to drug (GO:0042493)|response to ionizing radiation (GO:0010212)	nucleus (GO:0005634)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			breast(2)|cervix(1)|kidney(3)|large_intestine(5)|liver(1)|lung(6)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	25	Acute lymphoblastic leukemia(166;0.155)	Breast(1374;0.0634)		KIRC - Kidney renal clear cell carcinoma(1967;0.000896)		GGTGTCTTCTCCCATCCTCAT	0.423								Direct reversal of damage;Homologous recombination																																								0			1											127.0	110.0	116.0					1																	46726971		2203	4300	6503	46499558	SO:0001583	missense	8438			X97795	CCDS532.1	1p32	2008-02-05	2001-11-28		ENSG00000085999	ENSG00000085999			9826	protein-coding gene	gene with protein product		603615	"""RAD54 (S.cerevisiae)-like"""			8805304	Standard	NM_003579		Approved	hHR54, hRAD54, RAD54A	uc009vye.2	Q92698	OTTHUMG00000007772	ENST00000371975.4:c.805C>T	1.37:g.46726971C>T	ENSP00000361043:p.Pro269Ser		46499558	Q5TE31|Q6IUY3	Missense_Mutation	SNP	HMMSmart_DEXDc,superfamily_SSF52540,HMMPfam_SNF2_N,HMMSmart_HELICc,HMMPfam_Helicase_C	p.P269S	ENST00000371975.4	37	c.805	CCDS532.1	1	.	.	.	.	.	.	.	.	.	.	C	19.98	3.926332	0.73327	.	.	ENSG00000085999	ENST00000442598;ENST00000371975;ENST00000535499	D;D	0.93189	-3.18;-3.18	5.71	5.71	0.89125	DEAD-like helicase (2);SNF2-related (1);	0.050938	0.85682	D	0.000000	D	0.95739	0.8614	M	0.67953	2.075	0.80722	D	1	B;D	0.67145	0.109;0.996	B;D	0.74023	0.263;0.982	D	0.94009	0.7282	10	0.30078	T	0.28	-15.2134	15.6991	0.77528	0.0:0.8639:0.1361:0.0	.	89;269	G3V1N0;Q92698	.;RAD54_HUMAN	S	269;269;89	ENSP00000396113:P269S;ENSP00000361043:P269S	ENSP00000361043:P269S	P	+	1	0	RAD54L	46499558	1.000000	0.71417	1.000000	0.80357	0.361000	0.29550	7.818000	0.86416	2.873000	0.98535	0.561000	0.74099	CCC	-	HMMSmart_DEXDc,superfamily_SSF52540,HMMPfam_SNF2_N		0.423	RAD54L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAD54L	protein_coding	OTTHUMT00000021272.1	C	NM_003579		46499558	+1	no_errors	NM_003579	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
RB1	5925	genome.wustl.edu	37	13	49027156	49027156	+	Nonsense_Mutation	SNP	C	C	T	rs587778864		TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr13:49027156C>T	ENST00000267163.4	+	18	1861	c.1723C>T	c.(1723-1725)Caa>Taa	p.Q575*		NM_000321.2	NP_000312.2	P06400	RB_HUMAN	retinoblastoma 1	575	Domain A.|Pocket; binds T and E1A.				androgen receptor signaling pathway (GO:0030521)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell morphogenesis involved in neuron differentiation (GO:0048667)|chromatin remodeling (GO:0006338)|digestive tract development (GO:0048565)|enucleate erythrocyte differentiation (GO:0043353)|G1/S transition of mitotic cell cycle (GO:0000082)|glial cell apoptotic process (GO:0034349)|hepatocyte apoptotic process (GO:0097284)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|myoblast differentiation (GO:0045445)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron maturation (GO:0042551)|neuron projection development (GO:0031175)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to chromosome, centromeric region (GO:0071459)|Ras protein signal transduction (GO:0007265)|regulation of centromere complex assembly (GO:0090230)|regulation of cohesin localization to chromatin (GO:0071922)|regulation of lipid kinase activity (GO:0043550)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|sister chromatid biorientation (GO:0031134)|skeletal muscle cell differentiation (GO:0035914)|striated muscle cell differentiation (GO:0051146)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|Rb-E2F complex (GO:0035189)|spindle (GO:0005819)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|phosphoprotein binding (GO:0051219)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.0?(15)|p.?(10)|p.Q575fs*35(1)		NS(3)|adrenal_gland(1)|bone(22)|breast(30)|central_nervous_system(48)|cervix(3)|endometrium(14)|eye(95)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(20)|kidney(3)|large_intestine(10)|liver(3)|lung(153)|oesophagus(1)|ovary(13)|pancreas(5)|pituitary(1)|prostate(14)|salivary_gland(2)|skin(9)|soft_tissue(9)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(31)	496		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	TCTTATTAAACAATCAAAGGA	0.338		6	"""D, Mis, N, F, S"""		"""retinoblastoma, sarcoma, breast, small cell lung"""	"""retinoblastoma, sarcoma, breast, small cell lung"""			Hereditary Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)																												yes	Rec	yes	Familial retinoblastoma	13	13q14	5925	retinoblastoma gene		"""L, E, M, O"""	26	Whole gene deletion(15)|Unknown(10)|Deletion - Frameshift(1)	bone(10)|haematopoietic_and_lymphoid_tissue(4)|breast(4)|eye(2)|adrenal_gland(1)|soft_tissue(1)|endometrium(1)|urinary_tract(1)|lung(1)|liver(1)	13	GRCh37	CM961232	RB1	M							108.0	103.0	104.0					13																	49027156		2203	4300	6503	47925157	SO:0001587	stop_gained	5925	Familial Cancer Database		M15400	CCDS31973.1	13q14.2	2014-09-17	2008-07-31		ENSG00000139687	ENSG00000139687		"""Endogenous ligands"""	9884	protein-coding gene	gene with protein product	"""prepro-retinoblastoma-associated protein"", ""protein phosphatase 1, regulatory subunit 130"""	614041	"""osteosarcoma"""	OSRC		1857421, 15057823	Standard	NM_000321		Approved	RB, PPP1R130	uc001vcb.3	P06400	OTTHUMG00000016900	ENST00000267163.4:c.1723C>T	13.37:g.49027156C>T	ENSP00000267163:p.Gln575*		47925157	A8K5E3|P78499|Q5VW46|Q8IZL4	Nonsense_Mutation	SNP	HMMPfam_RB_A,superfamily_Cyclin-like,HMMPfam_RB_B,HMMSmart_SM00385,HMMPfam_Rb_C	p.Q575*	ENST00000267163.4	37	c.1723	CCDS31973.1	13	.	.	.	.	.	.	.	.	.	.	C	39	7.663582	0.98419	.	.	ENSG00000139687	ENST00000542917;ENST00000267163	.	.	.	5.75	5.75	0.90469	.	0.127807	0.56097	D	0.000036	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	.	19.5489	0.95310	0.0:1.0:0.0:0.0	.	.	.	.	X	554;575	.	ENSP00000267163:Q575X	Q	+	1	0	RB1	47925157	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.496000	0.60360	2.717000	0.92951	0.655000	0.94253	CAA	-	superfamily_Cyclin-like		0.338	RB1-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	RB1	protein_coding	OTTHUMT00000044884.1	C			47925157	+1	no_errors	NM_000321	genbank	human	reviewed	54_36p	nonsense	SNP	1.000	T
HUS1	3364	genome.wustl.edu	37	7	48018116	48018116	+	Silent	SNP	C	C	T	rs369316512		TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr7:48018116C>T	ENST00000258774.5	-	3	278	c.255G>A	c.(253-255)tcG>tcA	p.S85S	HUS1_ENST00000432325.1_Silent_p.S64S	NM_004507.3	NP_004498.1	O60921	HUS1_HUMAN	HUS1 checkpoint homolog (S. pombe)	85					cellular response to DNA damage stimulus (GO:0006974)|cellular response to ionizing radiation (GO:0071479)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|double-strand break repair via homologous recombination (GO:0000724)|embryo development (GO:0009790)|mitotic cell cycle checkpoint (GO:0007093)|negative regulation of DNA replication (GO:0008156)|protein phosphorylation (GO:0006468)|regulation of protein phosphorylation (GO:0001932)|response to UV (GO:0009411)	checkpoint clamp complex (GO:0030896)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|liver(1)|lung(3)|ovary(2)|prostate(1)	13		Breast(660;0.00139)				ATAAGTTTTCCGATGTTAGCT	0.428								Direct reversal of damage;Other conserved DNA damage response genes																													Ovarian(103;466 1517 21788 34610 43890)											0			7						C		0,4406		0,0,2203	86.0	81.0	83.0		255	-2.5	0.2	7		83	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	HUS1	NM_004507.3		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		85/281	48018116	1,13005	2203	4300	6503	47984641	SO:0001819	synonymous_variant	3364			Y16893	CCDS34635.1	7p13-p12	2008-08-08	2001-11-28		ENSG00000136273	ENSG00000136273			5309	protein-coding gene	gene with protein product	"""hus1+-like protein"""	603760	"""HUS1 (S. pombe) checkpoint homolog"""			9878245, 9524127	Standard	NM_004507		Approved		uc003tod.2	O60921	OTTHUMG00000155645	ENST00000258774.5:c.255G>A	7.37:g.48018116C>T			47984641	B4DFI9	Silent	SNP	HMMPfam_Hus1	p.S85	ENST00000258774.5	37	c.255	CCDS34635.1	7																																																																																			-	HMMPfam_Hus1		0.428	HUS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HUS1	protein_coding	OTTHUMT00000340952.1	C	NM_004507		47984641	-1	no_errors	NM_004507	genbank	human	reviewed	54_36p	silent	SNP	0.857	T
PTCHD4	442213	genome.wustl.edu	37	6	48036193	48036193	+	Missense_Mutation	SNP	C	C	T			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr6:48036193C>T	ENST00000339488.4	-	1	232	c.199G>A	c.(199-201)Gag>Aag	p.E67K	PTCHD4_ENST00000543600.1_Missense_Mutation_p.E50K	NM_001013732.3	NP_001013754.3	Q6ZW05	PTHD4_HUMAN	patched domain containing 4	67						integral component of membrane (GO:0016021)	hedgehog receptor activity (GO:0008158)										AGGTCGCCCTCGGGCTGGAAG	0.662																																																0			6											30.0	34.0	32.0					6																	48036193		1976	4164	6140	48144152	SO:0001583	missense	442213				CCDS34473.2	6p12.3	2012-02-06	2012-02-06	2012-02-06	ENSG00000244694	ENSG00000244694			21345	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 138"""	C6orf138			Standard	NM_001013732		Approved	dJ402H5.2, FLJ41841	uc011dwm.2	Q6ZW05	OTTHUMG00000150404	ENST00000339488.4:c.199G>A	6.37:g.48036193C>T	ENSP00000341914:p.Glu67Lys		48144152	B0QZ29|B4DRK3|Q5T884	Missense_Mutation	SNP	HMMPfam_Patched,superfamily_SSF82866	p.E50K	ENST00000339488.4	37	c.148	CCDS34473.2	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.67|17.67	3.447249|3.447249	0.63178|0.63178	.|.	.|.	ENSG00000244694|ENSG00000244694	ENST00000339488;ENST00000543600|ENST00000398738	D;T|.	0.93019|.	-3.15;0.48|.	4.56|4.56	4.56|4.56	0.56223|0.56223	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.66694|0.66694	0.2815|0.2815	M|M	0.68317|0.68317	2.08|2.08	0.80722|0.80722	D|D	1|1	P;P|.	0.44044|.	0.649;0.825|.	B;B|.	0.29663|.	0.097;0.105|.	T|T	0.67381|0.67381	-0.5685|-0.5685	10|5	0.40728|.	T|.	0.16|.	.|.	17.3669|17.3669	0.87366|0.87366	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	67;50|.	Q6ZW05;B0QZ29|.	CF138_HUMAN;.|.	K|Q	67;50|66	ENSP00000341914:E67K;ENSP00000439864:E50K|.	ENSP00000341914:E67K|.	E|R	-|-	1|2	0|0	C6orf138|C6orf138	48144152|48144152	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.942000|0.942000	0.58702|0.58702	7.387000|7.387000	0.79785|0.79785	2.071000|2.071000	0.62044|0.62044	0.545000|0.545000	0.68477|0.68477	GAG|CGA	-	HMMPfam_Patched		0.662	PTCHD4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	C6orf138	protein_coding	OTTHUMT00000317987.2	C	NM_001013732		48144152	-1	no_errors	NM_001013732	genbank	human	validated	54_36p	missense	SNP	1.000	T
EBP	10682	genome.wustl.edu	37	X	48382289	48382289	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chrX:48382289G>A	ENST00000495186.1	+	2	953	c.130G>A	c.(130-132)Gtg>Atg	p.V44M	EBP_ENST00000276096.6_Intron	NM_006579.2	NP_006570.1	Q15125	EBP_HUMAN	emopamil binding protein (sterol isomerase)	44					cholesterol biosynthetic process (GO:0006695)|cholesterol metabolic process (GO:0008203)|drug transmembrane transport (GO:0006855)|hemopoiesis (GO:0030097)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)	C-8 sterol isomerase activity (GO:0000247)|cholestenol delta-isomerase activity (GO:0047750)|drug transmembrane transporter activity (GO:0015238)|steroid delta-isomerase activity (GO:0004769)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|endometrium(2)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)|stomach(1)	11					Tamoxifen(DB00675)	GGTCTTAGTCGTGACCACATG	0.557																																					Ovarian(41;550 1000 33077 33474 52335)											0			X											164.0	134.0	144.0					X																	48382289		2203	4300	6503	48267233	SO:0001583	missense	10682			Z37986	CCDS14300.1	Xp11.23-p11.22	2013-05-22	2001-11-28		ENSG00000147155	ENSG00000147155			3133	protein-coding gene	gene with protein product	"""3-beta-hydroxysteroid-delta-8,delta-7-isomerase"", ""Chondrodysplasia punctata-2, X-linked dominant (Happle syndrome)"", ""sterol 8-isomerase"""	300205	"""emopamil-binding protein (sterol isomerase)"""	CDPX2		7706302, 8938429	Standard	NM_006579		Approved	CPX, CPXD, CHO2	uc004djx.4	Q15125	OTTHUMG00000034482	ENST00000495186.1:c.130G>A	X.37:g.48382289G>A	ENSP00000417052:p.Val44Met		48267233	Q6FGL3|Q6IBI9	Missense_Mutation	SNP	HMMPfam_EBP	p.V44M	ENST00000495186.1	37	c.130	CCDS14300.1	X	.	.	.	.	.	.	.	.	.	.	G	10.44	1.351148	0.24512	.	.	ENSG00000147155	ENST00000495186;ENST00000446158;ENST00000414061	D;D;D	0.98120	-4.73;-4.73;-4.73	5.72	2.98	0.34508	.	0.555807	0.18236	N	0.147385	D	0.96787	0.8951	M	0.78637	2.42	0.09310	N	1	D	0.56746	0.977	P	0.50270	0.636	D	0.90892	0.4762	10	0.26408	T	0.33	-0.7433	4.7991	0.13287	0.183:0.0:0.6463:0.1706	.	44	Q15125	EBP_HUMAN	M	44	ENSP00000417052:V44M;ENSP00000390031:V44M;ENSP00000405832:V44M	ENSP00000405832:V44M	V	+	1	0	EBP	48267233	0.119000	0.22226	0.000000	0.03702	0.077000	0.17291	0.977000	0.29475	0.206000	0.20587	-0.279000	0.10071	GTG	-	HMMPfam_EBP		0.557	EBP-004	KNOWN	basic|appris_principal|CCDS	protein_coding	EBP	protein_coding	OTTHUMT00000083372.1	G	NM_006579		48267233	+1	no_errors	NM_006579	genbank	human	reviewed	54_36p	missense	SNP	0.538	A
AP4E1	23431	genome.wustl.edu	37	15	51233907	51233907	+	Missense_Mutation	SNP	G	G	T			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr15:51233907G>T	ENST00000261842.5	+	10	1217	c.1111G>T	c.(1111-1113)Gct>Tct	p.A371S	AP4E1_ENST00000560508.1_Missense_Mutation_p.A296S	NM_001252127.1|NM_007347.4	NP_001239056.1|NP_031373.2	Q9UPM8	AP4E1_HUMAN	adaptor-related protein complex 4, epsilon 1 subunit	371					intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	coated pit (GO:0005905)|Golgi apparatus (GO:0005794)|membrane coat (GO:0030117)				breast(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(5)|skin(2)	27				all cancers(107;0.000893)|GBM - Glioblastoma multiforme(94;0.00364)		TCCTACTCTGGCTCTTCAACA	0.343																																																0			15											141.0	133.0	136.0					15																	51233907		2196	4293	6489	49021199	SO:0001583	missense	23431			AB030653	CCDS32240.1, CCDS58362.1	15q21.2	2014-09-17			ENSG00000081014	ENSG00000081014			573	protein-coding gene	gene with protein product		607244				10436028, 21620353	Standard	NM_007347		Approved	AP-4-EPSILON, SPG51	uc001zyx.2	Q9UPM8	OTTHUMG00000172458	ENST00000261842.5:c.1111G>T	15.37:g.51233907G>T	ENSP00000261842:p.Ala371Ser		49021199	A0AVD6|A1L4A9|A6NNX7|H0YKX4|Q68D31|Q9Y588	Missense_Mutation	SNP	superfamily_ARM-type_fold,HMMPfam_Adaptin_N,HMMPfam_Coatamer_beta_C	p.A371S	ENST00000261842.5	37	c.1111	CCDS32240.1	15	.	.	.	.	.	.	.	.	.	.	G	18.60	3.659963	0.67586	.	.	ENSG00000081014	ENST00000261842	T	0.13089	2.62	6.04	6.04	0.98038	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.45677	0.1354	M	0.84511	2.7	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.41448	-0.9508	10	0.72032	D	0.01	-17.7167	19.583	0.95478	0.0:0.0:1.0:0.0	.	371	Q9UPM8	AP4E1_HUMAN	S	371	ENSP00000261842:A371S	ENSP00000261842:A371S	A	+	1	0	AP4E1	49021199	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.473000	0.97714	2.873000	0.98535	0.563000	0.77884	GCT	-	superfamily_ARM-type_fold,HMMPfam_Adaptin_N		0.343	AP4E1-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	AP4E1	protein_coding	OTTHUMT00000418656.1	G			49021199	+1	no_errors	NM_007347	genbank	human	validated	54_36p	missense	SNP	1.000	T
MIOX	55586	genome.wustl.edu	37	22	50926451	50926451	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr22:50926451G>A	ENST00000216075.6	+	4	388	c.314G>A	c.(313-315)gGc>gAc	p.G105D	MIOX_ENST00000395733.3_Missense_Mutation_p.G105D|MIOX_ENST00000395732.3_Missense_Mutation_p.G105D	NM_017584.5	NP_060054.4	Q9UGB7	MIOX_HUMAN	myo-inositol oxygenase	105					inositol catabolic process (GO:0019310)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|inclusion body (GO:0016234)	aldo-keto reductase (NADP) activity (GO:0004033)|ferric iron binding (GO:0008199)|inositol oxygenase activity (GO:0050113)|NADP binding (GO:0050661)|oxidoreductase activity, acting on NAD(P)H (GO:0016651)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen (GO:0016701)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	13		all_cancers(38;4.58e-14)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		ACAGCGGAGGGCATCCGGAAG	0.642																																																0			22											50.0	47.0	48.0					22																	50926451		2203	4300	6503	49273317	SO:0001583	missense	55586			AF197129	CCDS14092.1	22q13.3	2008-06-11	2005-06-15	2005-06-15	ENSG00000100253	ENSG00000100253			14522	protein-coding gene	gene with protein product	"""kidney-specific protein 32"""	606774	"""aldehyde reductase (aldose reductase) like 6"""	ALDRL6		10944187, 11716759	Standard	NM_017584		Approved		uc003bll.1	Q9UGB7	OTTHUMG00000150207	ENST00000216075.6:c.314G>A	22.37:g.50926451G>A	ENSP00000216075:p.Gly105Asp		49273317	Q05DJ6|Q5S8C9|Q9BZZ1|Q9UHB8	Missense_Mutation	SNP	HMMPfam_DUF706	p.G105D	ENST00000216075.6	37	c.314	CCDS14092.1	22	.	.	.	.	.	.	.	.	.	.	G	22.1	4.240347	0.79912	.	.	ENSG00000100253	ENST00000395733;ENST00000216075;ENST00000395732;ENST00000451761	.	.	.	4.23	4.23	0.50019	.	0.000000	0.85682	D	0.000000	T	0.76849	0.4045	M	0.71036	2.16	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.998	D;D;D	0.76575	0.981;0.988;0.935	T	0.80051	-0.1544	9	0.72032	D	0.01	-57.453	14.1269	0.65228	0.0:0.0:1.0:0.0	.	105;105;105	Q9UGB7-2;A6PVH2;Q9UGB7	.;.;MIOX_HUMAN	D	105;105;105;100	.	ENSP00000216075:G105D	G	+	2	0	MIOX	49273317	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	7.239000	0.78182	2.165000	0.68154	0.491000	0.48974	GGC	-	HMMPfam_DUF706		0.642	MIOX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIOX	protein_coding	OTTHUMT00000316835.1	G	NM_017584		49273317	+1	no_errors	NM_017584	genbank	human	validated	54_36p	missense	SNP	1.000	A
ZNF233	353355	genome.wustl.edu	37	19	44778683	44778683	+	Missense_Mutation	SNP	A	A	T			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr19:44778683A>T	ENST00000391958.2	+	5	1997	c.1870A>T	c.(1870-1872)Atg>Ttg	p.M624L	ZNF235_ENST00000589799.1_Intron|ZNF233_ENST00000334152.1_Missense_Mutation_p.M606L|ZNF233_ENST00000592581.1_3'UTR	NM_181756.2	NP_861421.2	A6NK53	ZN233_HUMAN	zinc finger protein 233	624					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(4)|skin(3)|urinary_tract(1)	20		Prostate(69;0.0435)|all_neural(266;0.226)				TAAATGTGGCATGTGTGGTAA	0.428																																																0			19											101.0	99.0	100.0					19																	44778683		2203	4300	6503	49470523	SO:0001583	missense	353355			AY166792	CCDS33047.1	19q13.31	2013-01-08				ENSG00000159915		"""Zinc fingers, C2H2-type"", ""-"""	30946	protein-coding gene	gene with protein product						12743021	Standard	NM_001207005		Approved	FLJ38032	uc021uvi.1	A6NK53		ENST00000391958.2:c.1870A>T	19.37:g.44778683A>T	ENSP00000375820:p.Met624Leu		49470523	B2RN78|B2RN79|Q86WL8	Missense_Mutation	SNP	superfamily_KRAB domain (Kruppel-associated box Pfam 01352),HMMPfam_KRAB,HMMSmart_SM00349,superfamily_C2H2 and C2HC zinc fingers,HMMSmart_SM00355,HMMPfam_zf-C2H2,PatternScan_ZINC_FINGER_C2H2_1	p.M624L	ENST00000391958.2	37	c.1870	CCDS33047.1	19	.	.	.	.	.	.	.	.	.	.	A	12.61	1.990030	0.35131	.	.	ENSG00000159915	ENST00000334152;ENST00000391958;ENST00000280305	T;T	0.06068	3.35;3.35	4.08	-3.41	0.04839	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.01940	0.0061	N	0.00510	-1.415	0.09310	N	1	B	0.23490	0.086	B	0.22152	0.038	T	0.47861	-0.9084	9	0.72032	D	0.01	-0.3414	10.3474	0.43913	0.155:0.1483:0.6966:0.0	.	624	A6NK53	ZN233_HUMAN	L	606;624;519	ENSP00000334957:M606L;ENSP00000375820:M624L	ENSP00000280305:M519L	M	+	1	0	ZNF233	49470523	0.000000	0.05858	0.000000	0.03702	0.984000	0.73092	-1.742000	0.01835	-0.255000	0.09486	0.496000	0.49642	ATG	-	superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1		0.428	ZNF233-001	KNOWN	basic|CCDS	protein_coding	ZNF233	protein_coding	OTTHUMT00000460737.1	A	NM_181756		49470523	+1	no_errors	NM_181756	genbank	human	provisional	54_36p	missense	SNP	0.000	T
SCN8A	6334	genome.wustl.edu	37	12	52106913	52106913	+	Intron	SNP	C	C	G			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr12:52106913C>G	ENST00000354534.6	+	11	1813				SCN8A_ENST00000550891.1_Intron|SCN8A_ENST00000545061.1_Intron	NM_001177984.2|NM_014191.3	NP_001171455.1|NP_055006.1	Q9UQD0	SCN8A_HUMAN	sodium channel, voltage gated, type VIII, alpha subunit						adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|membrane depolarization during action potential (GO:0086010)|muscle organ development (GO:0007517)|myelination (GO:0042552)|nervous system development (GO:0007399)|neuromuscular process (GO:0050905)|neuronal action potential (GO:0019228)|peripheral nervous system development (GO:0007422)|response to toxic substance (GO:0009636)|sensory perception of sound (GO:0007605)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	ATP binding (GO:0005524)|voltage-gated sodium channel activity (GO:0005248)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(19)|ovary(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55				BRCA - Breast invasive adenocarcinoma(357;0.181)	Valproic Acid(DB00313)	CTCTGCCTCTCTTGCATAACT	0.323																																																0			12																																								50393180	SO:0001627	intron_variant	728522			AB027567	CCDS44891.1, CCDS53794.1	12q13.1	2012-02-26	2007-01-23			ENSG00000196876		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10596	protein-coding gene	gene with protein product		600702	"""sodium channel, voltage gated, type VIII, alpha polypeptide"""	MED		7670495, 9828131, 16382098	Standard	NM_014191		Approved	Nav1.6, NaCh6, PN4, CerIII	uc001ryw.4	Q9UQD0		ENST00000354534.6:c.1635+6414C>G	12.37:g.52106913C>G			50393180	B9VWG8|O95788|Q9NYX2|Q9UPB2	RNA	SNP	-	NULL	ENST00000354534.6	37	NULL	CCDS44891.1	12																																																																																			-	-		0.323	SCN8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC728522	protein_coding	OTTHUMT00000404372.3	C	NM_014191		50393180	-1	pseudogene	XR_015716	genbank	human	model	54_36p	rna	SNP	1.000	G
AGAP7P	653268	genome.wustl.edu	37	10	51483196	51483196	+	Missense_Mutation	SNP	G	G	T	rs375333966		TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr10:51483196G>T	ENST00000374095.5	-	2	395	c.270C>A	c.(268-270)ttC>ttA	p.F90L		NM_001077685.1	NP_001071153.1	Q5VUJ5	AGAP7_HUMAN		90					regulation of ARF GTPase activity (GO:0032312)		ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			kidney(1)|large_intestine(1)|lung(7)|ovary(1)|skin(1)	11						AGTTCCTCTGGAATATTGTGC	0.343													N|||	1	0.000199681	0.0008	0.0	5008	,	,		14826	0.0		0.0	False		,,,				2504	0.0															0			10						G	LEU/PHE	9,3307		0,9,1649	10.0	10.0	10.0		270	-0.6	0.1	10		10	0,7166		0,0,3583	no	missense	AGAP7	NM_001077685.1	22	0,9,5232	TT,TG,GG		0.0,0.2714,0.0859	possibly-damaging	90/664	51483196	9,10473	1658	3583	5241	51153202	SO:0001583	missense	0																														ENST00000374095.5:c.270C>A	10.37:g.51483196G>T	ENSP00000363208:p.Phe90Leu		51153202	A6NGH4	Missense_Mutation	SNP	superfamily_SSF50729,HMMPfam_PH,HMMSmart_PH,superfamily_ArfGAP,HMMPfam_ArfGap,HMMSmart_ArfGap,superfamily_ANK,HMMSmart_ANK,HMMPfam_Ank	p.F90L	ENST00000374095.5	37	c.270	CCDS41524.1	10	.	.	.	.	.	.	.	.	.	.	.	12.94	2.089554	0.36855	0.002714	0.0	ENSG00000204169	ENST00000374095	D	0.86297	-2.1	0.589	-0.64	0.11493	.	0.000000	0.64402	N	0.000014	D	0.82388	0.5026	M	0.76938	2.355	0.19775	N	0.99995	B	0.33494	0.414	B	0.31016	0.123	T	0.73745	-0.3886	10	0.66056	D	0.02	.	4.9132	0.13833	0.273:0.0:0.727:0.0	.	90	Q5VUJ5	AGAP7_HUMAN	L	90	ENSP00000363208:F90L	ENSP00000363208:F90L	F	-	3	2	AGAP7	51153202	1.000000	0.71417	0.083000	0.20561	0.017000	0.09413	1.622000	0.36997	-0.270000	0.09285	0.175000	0.17021	TTC	-	NULL		0.343	AGAP7-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	AGAP7	protein_coding	OTTHUMT00000048033.1	G			51153202	-1	no_errors	NM_001077685	genbank	human	provisional	54_36p	missense	SNP	0.996	T
CSAD	51380	genome.wustl.edu	37	12	53554037	53554037	+	Missense_Mutation	SNP	C	C	T			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr12:53554037C>T	ENST00000444623.1	-	14	1300	c.1033G>A	c.(1033-1035)Gtg>Atg	p.V345M	CSAD_ENST00000379846.1_Missense_Mutation_p.V198M|CSAD_ENST00000453446.2_Missense_Mutation_p.V345M|RP11-1136G11.8_ENST00000550908.1_lincRNA|CSAD_ENST00000379843.3_Missense_Mutation_p.V198M|CSAD_ENST00000267085.4_Missense_Mutation_p.V372M	NM_001244705.1	NP_001231634.1	Q9Y600	CSAD_HUMAN	cysteine sulfinic acid decarboxylase	345					cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)|sulfur amino acid catabolic process (GO:0000098)|sulfur amino acid metabolic process (GO:0000096)|taurine biosynthetic process (GO:0042412)		pyridoxal phosphate binding (GO:0030170)|sulfinoalanine decarboxylase activity (GO:0004782)			kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(4)	14					L-Cysteine(DB00151)	TCCAGAGCCACATCGTAGAAC	0.597																																					Ovarian(109;252 1546 16882 28524 44645)											0			12											115.0	103.0	107.0					12																	53554037		2203	4300	6503	51840304	SO:0001583	missense	51380			AB044561	CCDS8848.2, CCDS58235.1	12q13.11-q14.3	2008-08-04			ENSG00000139631	ENSG00000139631			18966	protein-coding gene	gene with protein product	"""P-selectin cytoplasmic tail-associated protein"""					15489334	Standard	NM_015989		Approved	PCAP, CSD	uc001sbz.3	Q9Y600	OTTHUMG00000048076	ENST00000444623.1:c.1033G>A	12.37:g.53554037C>T	ENSP00000415485:p.Val345Met		51840304	A8K0U4|Q4QQH9|Q9UNJ5|Q9Y601	Missense_Mutation	SNP	superfamily_PLP-dependent transferases,HMMPfam_Pyridoxal_deC	p.V345M	ENST00000444623.1	37	c.1033	CCDS58235.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.18|15.18	2.758015|2.758015	0.49468|0.49468	.|.	.|.	ENSG00000139631|ENSG00000139631	ENST00000379850|ENST00000308926;ENST00000379843;ENST00000267085;ENST00000379846;ENST00000444623;ENST00000398047;ENST00000453446	.|T;T;T;T;T	.|0.42900	.|0.96;0.96;0.96;0.96;0.96	4.67|4.67	4.67|4.67	0.58626|0.58626	.|Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	.|0.366001	.|0.28187	.|N	.|0.016276	T|T	0.44074|0.44074	0.1276|0.1276	M|M	0.89601|0.89601	3.045|3.045	0.18873|0.18873	N|N	0.999989|0.999989	.|P;B;P	.|0.40515	.|0.551;0.349;0.719	.|B;B;B	.|0.33890	.|0.171;0.169;0.172	T|T	0.56619|0.56619	-0.7949|-0.7949	5|10	.|0.48119	.|T	.|0.1	-18.7481|-18.7481	6.8218|6.8218	0.23861|0.23861	0.0:0.7265:0.1803:0.0932|0.0:0.7265:0.1803:0.0932	.|.	.|372;345;198	.|Q9Y600-3;Q9Y600;Q9Y600-2	.|.;CSAD_HUMAN;.	Y|M	370|434;198;372;198;345;306;345	.|ENSP00000369172:V198M;ENSP00000267085:V372M;ENSP00000369175:V198M;ENSP00000415485:V345M;ENSP00000410648:V345M	.|ENSP00000267085:V372M	C|V	-|-	2|1	0|0	CSAD|CSAD	51840304|51840304	0.343000|0.343000	0.24818|0.24818	0.980000|0.980000	0.43619|0.43619	0.993000|0.993000	0.82548|0.82548	0.660000|0.660000	0.25009|0.25009	2.597000|2.597000	0.87782|0.87782	0.655000|0.655000	0.94253|0.94253	TGT|GTG	-	superfamily_PLP-dependent transferases,HMMPfam_Pyridoxal_deC		0.597	CSAD-017	KNOWN	basic|appris_principal|CCDS	protein_coding	CSAD	protein_coding	OTTHUMT00000343697.1	C	NM_015989		51840304	-1	no_errors	NM_015989	genbank	human	validated	54_36p	missense	SNP	0.142	T
EHD2	30846	genome.wustl.edu	37	19	48229101	48229101	+	Missense_Mutation	SNP	G	G	T			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr19:48229101G>T	ENST00000263277.3	+	4	786	c.535G>T	c.(535-537)Gcg>Tcg	p.A179S	EHD2_ENST00000538399.1_Missense_Mutation_p.A43S|CTD-2571L23.8_ENST00000599924.1_lincRNA	NM_014601.3	NP_055416.2	Q9NZN4	EHD2_HUMAN	EH-domain containing 2	179	Dynamin-type G.				blood coagulation (GO:0007596)|cortical actin cytoskeleton organization (GO:0030866)|endocytic recycling (GO:0032456)|endocytosis (GO:0006897)|positive regulation of endocytic recycling (GO:2001137)|positive regulation of myoblast fusion (GO:1901741)|protein localization to plasma membrane (GO:0072659)	caveola (GO:0005901)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|nucleic acid binding (GO:0003676)			endometrium(3)|large_intestine(7)|lung(2)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	19		all_cancers(25;6.74e-07)|all_lung(116;2.02e-05)|Lung NSC(112;3.77e-05)|all_epithelial(76;4.89e-05)|all_neural(266;0.0332)|Ovarian(192;0.086)		OV - Ovarian serous cystadenocarcinoma(262;0.000336)|all cancers(93;0.000415)|Epithelial(262;0.0132)|GBM - Glioblastoma multiforme(486;0.0537)		GCGCTGGTTCGCGGAGCGCGT	0.637																																																0			19											39.0	36.0	37.0					19																	48229101		2203	4300	6503	52920913	SO:0001583	missense	30846			AF181263	CCDS12704.1	19q13.3	2014-08-12			ENSG00000024422	ENSG00000024422		"""EF-hand domain containing"""	3243	protein-coding gene	gene with protein product		605890		PAST2		10673336	Standard	NM_014601		Approved		uc002phj.4	Q9NZN4	OTTHUMG00000183266	ENST00000263277.3:c.535G>T	19.37:g.48229101G>T	ENSP00000263277:p.Ala179Ser		52920913	B2RDH9|B4DNU6|Q96CB6	Missense_Mutation	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMPfam_Dynamin_N,superfamily_EF-hand,HMMSmart_SM00027,PatternScan_EF_HAND_1	p.A179S	ENST00000263277.3	37	c.535	CCDS12704.1	19	.	.	.	.	.	.	.	.	.	.	G	25.5	4.642101	0.87859	.	.	ENSG00000024422	ENST00000263277;ENST00000539439;ENST00000540364;ENST00000538399	D;D	0.97114	-4.25;-4.25	3.52	3.52	0.40303	Dynamin, GTPase domain (1);	0.065812	0.64402	D	0.000015	D	0.98169	0.9395	M	0.83953	2.67	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.98563	1.0642	10	0.62326	D	0.03	-26.7688	12.9714	0.58515	0.0:0.0:1.0:0.0	.	179	Q9NZN4	EHD2_HUMAN	S	179;179;169;43	ENSP00000263277:A179S;ENSP00000439036:A43S	ENSP00000263277:A179S	A	+	1	0	EHD2	52920913	1.000000	0.71417	0.981000	0.43875	0.990000	0.78478	7.814000	0.86154	1.702000	0.51228	0.456000	0.33151	GCG	-	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMPfam_Dynamin_N		0.637	EHD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EHD2	protein_coding	OTTHUMT00000465851.1	G			52920913	+1	no_errors	NM_014601	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
HUWE1	10075	genome.wustl.edu	37	X	53622190	53622190	+	Silent	SNP	A	A	G			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chrX:53622190A>G	ENST00000342160.3	-	29	3794	c.3337T>C	c.(3337-3339)Tta>Cta	p.L1113L	HUWE1_ENST00000218328.8_Silent_p.L1113L|HUWE1_ENST00000262854.6_Silent_p.L1113L			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	1113					base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						TGCCAAGATAACCCCTTAGTC	0.502																																																0			X											102.0	77.0	85.0					X																	53622190		2203	4300	6503	53638915	SO:0001819	synonymous_variant	10075			AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.3337T>C	X.37:g.53622190A>G			53638915	O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Silent	SNP	HMMPfam_DUF908,superfamily_ARM repeat,HMMPfam_DUF913,superfamily_UBA-like,HMMPfam_UBA,HMMSmart_SM00165,HMMPfam_WWE,superfamily_Hect E3 ligase catalytic domain,HMMSmart_SM00119,HMMPfam_HECT	p.L1113	ENST00000342160.3	37	c.3337	CCDS35301.1	X	.	.	.	.	.	.	.	.	.	.	A	10.29	1.309440	0.23821	.	.	ENSG00000086758	ENST00000427052	.	.	.	5.68	5.68	0.88126	.	.	.	.	.	T	0.57140	0.2033	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.57883	-0.7734	4	.	.	.	.	6.5769	0.22571	0.8232:0.0:0.1768:0.0	.	.	.	.	A	146	.	.	V	-	2	0	HUWE1	53638915	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	4.439000	0.59968	2.016000	0.59253	0.486000	0.48141	GTT	-	NULL		0.502	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HUWE1	protein_coding	OTTHUMT00000056766.1	A	XM_497119		53638915	-1	no_errors	NM_031407	genbank	human	validated	54_36p	silent	SNP	1.000	G
TRPM4	54795	genome.wustl.edu	37	19	49686045	49686045	+	Missense_Mutation	SNP	A	A	G	rs568416785	byFrequency	TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr19:49686045A>G	ENST00000252826.5	+	11	1600	c.1474A>G	c.(1474-1476)Aaa>Gaa	p.K492E	TRPM4_ENST00000427978.2_Missense_Mutation_p.K492E|TRPM4_ENST00000355712.5_Missense_Mutation_p.K138E	NM_017636.3	NP_060106.2	Q8TD43	TRPM4_HUMAN	transient receptor potential cation channel, subfamily M, member 4	492			Missing.		calcium ion transmembrane transport (GO:0070588)|cardiac conduction (GO:0061337)|dendritic cell chemotaxis (GO:0002407)|ion transmembrane transport (GO:0034220)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell proliferation (GO:0008284)|protein sumoylation (GO:0016925)|regulation of membrane potential (GO:0042391)|regulation of T cell cytokine production (GO:0002724)|transmembrane transport (GO:0055085)|vasoconstriction (GO:0042310)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)	p.K487_L498delKAPALKGGAAEL(1)		breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(18)|ovary(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	49		all_lung(116;8.54e-05)|Lung NSC(112;0.000139)|all_neural(266;0.0506)|Ovarian(192;0.15)		all cancers(93;2.88e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000222)|GBM - Glioblastoma multiforme(486;0.00339)|Epithelial(262;0.00751)		CCCAGCCCTAAAAGGGGGAGC	0.692																																																1	Deletion - In frame(1)	ovary(1)	19											20.0	23.0	22.0					19																	49686045		2201	4293	6494	54377857	SO:0001583	missense	54795			AK000048	CCDS33073.1, CCDS56098.1	19q13.3	2011-12-14				ENSG00000130529		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17993	protein-coding gene	gene with protein product		606936				11535825, 16382100	Standard	NM_017636		Approved	FLJ20041	uc002pmw.3	Q8TD43		ENST00000252826.5:c.1474A>G	19.37:g.49686045A>G	ENSP00000252826:p.Lys492Glu		54377857	A2RU25|Q7Z5D9|Q96L84|Q9NXV1	Missense_Mutation	SNP	HMMPfam_Ion_trans	p.K492E	ENST00000252826.5	37	c.1474	CCDS33073.1	19	.	.	.	.	.	.	.	.	.	.	a	0.885	-0.727440	0.03158	.	.	ENSG00000130529	ENST00000252826;ENST00000427978;ENST00000355712	T;T;T	0.58652	0.38;0.32;0.51	4.18	-0.663	0.11410	.	0.710584	0.13350	N	0.394503	T	0.25568	0.0622	N	0.08118	0	0.09310	N	1	B;B;B;B	0.27351	0.176;0.019;0.123;0.003	B;B;B;B	0.26517	0.07;0.019;0.057;0.002	T	0.26258	-1.0108	10	0.05721	T	0.95	-0.1134	4.1806	0.10374	0.4688:0.0:0.3709:0.1603	.	138;318;492;492	B4DIX5;Q8TD43-2;Q8TD43-3;Q8TD43	.;.;.;TRPM4_HUMAN	E	492;492;138	ENSP00000252826:K492E;ENSP00000407492:K492E;ENSP00000347944:K138E	ENSP00000252826:K492E	K	+	1	0	TRPM4	54377857	0.001000	0.12720	0.000000	0.03702	0.013000	0.08279	1.066000	0.30604	-0.138000	0.11434	0.358000	0.22013	AAA	-	NULL		0.692	TRPM4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRPM4	protein_coding	OTTHUMT00000465543.2	A	NM_017636		54377857	+1	no_errors	NM_017636	genbank	human	provisional	54_36p	missense	SNP	0.006	G
TRIM51HP	440041	genome.wustl.edu	37	11	55059734	55059734	+	IGR	SNP	G	G	C			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr11:55059734G>C								TRIM48 (21139 upstream) : TRIM51HP (3147 downstream)																							AGAGACTGCAGTGAGTGTCCT	0.443																																																0			11																																								54816310	SO:0001628	intergenic_variant	0																															11.37:g.55059734G>C			54816310		Missense_Mutation	SNP	superfamily_RING/U-box,HMMSmart_SM00184,HMMPfam_zf-C3HC4,HMMPfam_zf-B_box,HMMPfam_SPRY	p.H393Q		37	c.1179		11																																																																																			-	HMMPfam_SPRY	0	0.443					ENSG00000166007			G			54816310	-1	no_start_codon:no_stop_codon	ENST00000309470	ensembl	human	known	54_36p	missense	SNP	0.001	C
OR4A15	81328	genome.wustl.edu	37	11	55135853	55135853	+	Missense_Mutation	SNP	A	A	G	rs369716493		TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr11:55135853A>G	ENST00000314706.3	+	1	494	c.494A>G	c.(493-495)aAt>aGt	p.N165S		NM_001005275.1	NP_001005275.1	Q8NGL6	O4A15_HUMAN	olfactory receptor, family 4, subfamily A, member 15	165						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(48)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	71						ATCACCATGAATCGTCGAGTC	0.433																																																0			11						A	SER/ASN	0,4402		0,0,2201	231.0	209.0	216.0		494	-0.4	0.4	11		216	1,8591	1.2+/-3.3	0,1,4295	no	missense	OR4A15	NM_001005275.1	46	0,1,6496	GG,GA,AA		0.0116,0.0,0.0077	benign	165/345	55135853	1,12993	2201	4296	6497	54892429	SO:0001583	missense	81328			AB065776	CCDS31500.1	11q11	2012-08-09			ENSG00000181958	ENSG00000181958		"""GPCR / Class A : Olfactory receptors"""	15152	protein-coding gene	gene with protein product							Standard	NM_001005275		Approved		uc010rif.2	Q8NGL6	OTTHUMG00000166711	ENST00000314706.3:c.494A>G	11.37:g.55135853A>G	ENSP00000325065:p.Asn165Ser		54892429	Q6IFL4|Q96R65	Missense_Mutation	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.N165S	ENST00000314706.3	37	c.494	CCDS31500.1	11	.	.	.	.	.	.	.	.	.	.	A	0.960	-0.703597	0.03255	0.0	1.16E-4	ENSG00000181958	ENST00000314706	T	0.00873	5.59	3.48	-0.394	0.12434	GPCR, rhodopsin-like superfamily (1);	0.248994	0.28393	N	0.015511	T	0.00580	0.0019	N	0.11724	0.165	0.09310	N	0.999996	B	0.23490	0.086	B	0.23275	0.045	T	0.49103	-0.8974	10	0.17369	T	0.5	.	7.1376	0.25537	0.6748:0.0:0.3252:0.0	.	165	Q8NGL6	O4A15_HUMAN	S	165	ENSP00000325065:N165S	ENSP00000325065:N165S	N	+	2	0	OR4A15	54892429	0.000000	0.05858	0.371000	0.25978	0.054000	0.15201	-2.080000	0.01368	0.031000	0.15407	0.403000	0.27427	AAT	-	superfamily_SSF81321,HMMPfam_7tm_1		0.433	OR4A15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4A15	protein_coding	OTTHUMT00000391161.1	A	NM_001005275		54892429	+1	no_errors	NM_001005275	genbank	human	provisional	54_36p	missense	SNP	0.203	G
STX16	8675	genome.wustl.edu	37	20	57243055	57243055	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr20:57243055G>A	ENST00000371141.4	+	4	989	c.265G>A	c.(265-267)Gtt>Att	p.V89I	STX16_ENST00000359617.4_Missense_Mutation_p.V36I|STX16_ENST00000358029.4_Missense_Mutation_p.V85I|STX16_ENST00000361830.3_Missense_Mutation_p.V89I|STX16-NPEPL1_ENST00000530122.1_Missense_Mutation_p.V89I|STX16_ENST00000371132.4_Missense_Mutation_p.V68I|STX16_ENST00000496003.1_3'UTR|STX16_ENST00000361770.5_Missense_Mutation_p.V72I|STX16_ENST00000355957.5_Missense_Mutation_p.V72I	NM_001001433.2	NP_001001433.1	O14662	STX16_HUMAN	syntaxin 16	89					intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|SNARE complex (GO:0031201)	SNAP receptor activity (GO:0005484)			breast(1)|cervix(1)|large_intestine(3)|lung(9)|ovary(1)|pancreas(1)|urinary_tract(1)	17	all_lung(29;0.0175)		BRCA - Breast invasive adenocarcinoma(13;3.73e-09)|Epithelial(14;8.54e-06)|all cancers(14;6.89e-05)			TCAGTATGATGTTGGCCGGAT	0.478																																																0			20											122.0	111.0	115.0					20																	57243055		2203	4300	6503	56676461	SO:0001583	missense	8675			AF038897	CCDS13468.1, CCDS13469.1, CCDS46619.1, CCDS46620.1, CCDS56199.1	20q13.32	2008-07-02			ENSG00000124222	ENSG00000124222			11431	protein-coding gene	gene with protein product		603666				9464276, 9587053, 15800843	Standard	NM_003763		Approved	hsyn16, SYN16	uc002xzi.3	O14662	OTTHUMG00000033084	ENST00000371141.4:c.265G>A	20.37:g.57243055G>A	ENSP00000360183:p.Val89Ile		56676461	A6NK32|A6NN69|A8MPP0|B7ZBN1|B7ZBN2|B7ZBN3|E1P5M0|E1P607|O14661|O14663|O60517|Q5W084|Q5W086|Q5W087|Q5XKI6|Q6GMS8|Q9H0Z0|Q9H1T7|Q9H1T8|Q9UIX5	Missense_Mutation	SNP	superfamily_t-snare proteins,HMMPfam_Syntaxin,HMMSmart_SM00397,HMMPfam_SNARE,PatternScan_SYNTAXIN	p.V89I	ENST00000371141.4	37	c.265	CCDS13468.1	20	.	.	.	.	.	.	.	.	.	.	G	10.34	1.324470	0.24080	.	.	ENSG00000124222	ENST00000458280;ENST00000355957;ENST00000361770;ENST00000312283;ENST00000412911;ENST00000359617;ENST00000371141;ENST00000371138;ENST00000371132;ENST00000358029;ENST00000361830;ENST00000438253	T;T;T;T;T;T;T;T;T;T;T	0.08546	3.08;3.08;3.08;3.08;3.08;3.08;3.08;3.08;3.08;3.08;3.08	5.31	2.27	0.28462	t-SNARE (1);Syntaxin, N-terminal (1);	0.210963	0.39759	U	0.001268	T	0.03095	0.0091	N	0.04320	-0.23	0.80722	D	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.12837	0.002;0.002;0.001;0.008	T	0.39563	-0.9608	10	0.06625	T	0.88	.	9.2146	0.37339	0.3172:0.0:0.6828:0.0	.	85;72;68;89	Q6GMS8;O14662-4;O14662-2;O14662	.;.;.;STX16_HUMAN	I	36;72;72;36;36;36;89;36;68;85;89;31	ENSP00000388348:V36I;ENSP00000348229:V72I;ENSP00000355408:V72I;ENSP00000312086:V36I;ENSP00000416852:V36I;ENSP00000352634:V36I;ENSP00000360183:V89I;ENSP00000360173:V68I;ENSP00000350723:V85I;ENSP00000354445:V89I;ENSP00000401801:V31I	ENSP00000360180:V36I	V	+	1	0	STX16	56676461	0.999000	0.42202	0.999000	0.59377	0.984000	0.73092	3.025000	0.49681	0.636000	0.30508	-0.225000	0.12378	GTT	-	superfamily_t-snare proteins,HMMPfam_Syntaxin		0.478	STX16-002	KNOWN	basic|CCDS	protein_coding	STX16	protein_coding	OTTHUMT00000080517.2	G	NM_001001433		56676461	+1	no_errors	NM_001001433	genbank	human	reviewed	54_36p	missense	SNP	0.999	A
PRG2	5553	genome.wustl.edu	37	11	57156628	57156628	+	Missense_Mutation	SNP	A	A	G			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr11:57156628A>G	ENST00000311862.5	-	3	294	c.221T>C	c.(220-222)gTt>gCt	p.V74A	RP11-872D17.8_ENST00000529411.1_Missense_Mutation_p.V179A|PRG2_ENST00000533605.1_Missense_Mutation_p.V74A|PRG2_ENST00000525955.1_Missense_Mutation_p.V74A	NM_001243245.1|NM_002728.4	NP_001230174.1|NP_002719.3	P13727	PRG2_HUMAN	proteoglycan 2, bone marrow (natural killer cell activator, eosinophil granule major basic protein)	74					defense response to bacterium (GO:0042742)|defense response to nematode (GO:0002215)|immune response (GO:0006955)|negative regulation of interleukin-10 production (GO:0032693)|positive regulation of interleukin-4 production (GO:0032753)	cytoplasmic vesicle (GO:0031410)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	carbohydrate binding (GO:0030246)|heparin binding (GO:0008201)			central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(4)	10				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	Sargramostim(DB00020)	GATAGACTCAACAGCCCCATC	0.552																																																0			11											152.0	142.0	145.0					11																	57156628		2201	4296	6497	56913204	SO:0001583	missense	5553			BC005929	CCDS7955.1, CCDS58133.1	11q12	2005-11-25				ENSG00000186652			9362	protein-coding gene	gene with protein product		605601				1565101	Standard	NM_001243245		Approved	MBP, BMPG		P13727		ENST00000311862.5:c.221T>C	11.37:g.57156628A>G	ENSP00000312134:p.Val74Ala		56913204	A6XMW0|B2R5I1|P81448|Q14227|Q6ICT2	Missense_Mutation	SNP	HMMSmart_SM00034,superfamily_C-type lectin-like,HMMPfam_Lectin_C,PatternScan_C_TYPE_LECTIN_1	p.V74A	ENST00000311862.5	37	c.221	CCDS7955.1	11	.	.	.	.	.	.	.	.	.	.	A	7.341	0.620812	0.14193	.	.	ENSG00000186652;ENSG00000186652;ENSG00000186652;ENSG00000254979	ENST00000311862;ENST00000533605;ENST00000525955;ENST00000529411	T;T;T;T	0.32272	3.1;2.91;3.1;1.46	4.27	-4.0	0.04057	.	2.596690	0.02049	N	0.049905	T	0.19565	0.0470	N	0.22421	0.69	0.09310	N	1	B;B	0.26547	0.001;0.152	B;B	0.24974	0.001;0.057	T	0.13710	-1.0499	10	0.27082	T	0.32	.	7.1159	0.25416	0.2804:0.1721:0.5475:0.0	.	74;74	A6XMW0;P13727	.;PRG2_HUMAN	A	74;74;74;179	ENSP00000312134:V74A;ENSP00000433231:V74A;ENSP00000433016:V74A;ENSP00000431536:V179A	ENSP00000312134:V74A	V	-	2	0	RP11-872D17.8;PRG2	56913204	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-0.101000	0.10973	-0.724000	0.04908	-0.379000	0.06801	GTT	-	NULL		0.552	PRG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRG2	protein_coding	OTTHUMT00000392468.1	A	NM_002728		56913204	-1	no_errors	NM_002728	genbank	human	reviewed	54_36p	missense	SNP	0.000	G
SLC43A3	29015	genome.wustl.edu	37	11	57182556	57182556	+	Nonsense_Mutation	SNP	G	G	A			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr11:57182556G>A	ENST00000395123.2	-	10	1097	c.793C>T	c.(793-795)Cag>Tag	p.Q265*	SLC43A3_ENST00000533524.1_Nonsense_Mutation_p.Q278*|SLC43A3_ENST00000352187.1_Nonsense_Mutation_p.Q265*|SLC43A3_ENST00000528098.1_5'Flank|SLC43A3_ENST00000395124.1_Nonsense_Mutation_p.Q265*|SLC43A3_ENST00000529554.1_Nonsense_Mutation_p.Q265*	NM_001278201.1|NM_014096.2	NP_001265130.1|NP_054815.2	Q8NBI5	S43A3_HUMAN	solute carrier family 43, member 3	265					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|large_intestine(10)|lung(4)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	27						CGGAGTTCCTGCTTCTGCCCT	0.567																																																0			11											83.0	79.0	80.0					11																	57182556		2201	4296	6497	56939132	SO:0001587	stop_gained	29015			AL157431	CCDS7956.1, CCDS60784.1	11q11	2013-05-22			ENSG00000134802	ENSG00000134802		"""Solute carriers"""	17466	protein-coding gene	gene with protein product	"""likely ortholog of mouse embryonic epithelial gene 1"""					7531438, 11704567	Standard	NM_017611		Approved	SEEEG-1, Eeg1, DKFZp762A227, FOAP-13, PRO1659	uc001nki.3	Q8NBI5	OTTHUMG00000167113	ENST00000395123.2:c.793C>T	11.37:g.57182556G>A	ENSP00000378555:p.Gln265*		56939132	B4DNR8|E7EQD2|Q9NSS4	Nonsense_Mutation	SNP	superfamily_MFS_gen_substrate_transporter	p.Q265*	ENST00000395123.2	37	c.793	CCDS7956.1	11	.	.	.	.	.	.	.	.	.	.	G	12.16	1.855822	0.32791	.	.	ENSG00000134802	ENST00000395123;ENST00000395124;ENST00000352187;ENST00000529554;ENST00000533524;ENST00000530005	.	.	.	5.16	0.913	0.19354	.	1.161120	0.05953	N	0.639158	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05959	T	0.93	-1.993	4.1652	0.10303	0.0781:0.1377:0.4997:0.2845	.	.	.	.	X	265;265;265;265;278;265	.	ENSP00000337561:Q265X	Q	-	1	0	SLC43A3	56939132	0.000000	0.05858	0.004000	0.12327	0.127000	0.20565	0.080000	0.14802	0.186000	0.20125	0.563000	0.77884	CAG	-	superfamily_MFS_gen_substrate_transporter		0.567	SLC43A3-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	SLC43A3	protein_coding	OTTHUMT00000393057.1	G	NM_017611		56939132	-1	no_errors	NM_014096	genbank	human	validated	54_36p	nonsense	SNP	0.280	A
ZNF766	90321	genome.wustl.edu	37	19	52785429	52785429	+	Silent	SNP	T	T	A			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr19:52785429T>A	ENST00000439461.1	+	2	127	c.84T>A	c.(82-84)ccT>ccA	p.P28P	ZNF766_ENST00000593612.1_Silent_p.P43P|CTD-2525I3.5_ENST00000594865.1_RNA|MIR643_ENST00000385267.1_RNA|ZNF766_ENST00000599581.1_Silent_p.P28P|ZNF766_ENST00000359102.4_Silent_p.P43P|ZNF766_ENST00000600821.1_Silent_p.P23P	NM_001010851.2	NP_001010851.1	Q5HY98	ZN766_HUMAN	zinc finger protein 766	28	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)	17				GBM - Glioblastoma multiforme(134;0.00236)|OV - Ovarian serous cystadenocarcinoma(262;0.00871)		GCCTGGACCCTGTGCAGAAGG	0.488																																																0			19											177.0	181.0	180.0					19																	52785429		2203	4300	6503	57477241	SO:0001819	synonymous_variant	90321			AK024074	CCDS46163.1	19q13.33	2013-01-08				ENSG00000196214		"""Zinc fingers, C2H2-type"", ""-"""	28063	protein-coding gene	gene with protein product							Standard	XM_006723458		Approved		uc002pyr.1	Q5HY98		ENST00000439461.1:c.84T>A	19.37:g.52785429T>A			57477241	B2RNE0|Q7Z326	Silent	SNP	superfamily_KRAB domain (Kruppel-associated box Pfam 01352),HMMPfam_KRAB,HMMSmart_SM00349,superfamily_C2H2 and C2HC zinc fingers,HMMSmart_SM00355,HMMPfam_zf-C2H2,PatternScan_ZINC_FINGER_C2H2_1	p.P28	ENST00000439461.1	37	c.84	CCDS46163.1	19																																																																																			-	superfamily_KRAB domain (Kruppel-associated box Pfam 01352),HMMPfam_KRAB,HMMSmart_SM00349		0.488	ZNF766-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF766	protein_coding	OTTHUMT00000462764.1	T	NM_001010851		57477241	+1	no_errors	NM_001010851	genbank	human	validated	54_36p	silent	SNP	0.705	A
MRC2	9902	genome.wustl.edu	37	17	60768059	60768059	+	Missense_Mutation	SNP	C	C	A			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr17:60768059C>A	ENST00000303375.5	+	27	4351	c.3949C>A	c.(3949-3951)Cac>Aac	p.H1317N	MRC2_ENST00000446119.2_Missense_Mutation_p.H183N	NM_006039.4	NP_006030.2	Q9UBG0	MRC2_HUMAN	mannose receptor, C type 2	1317	C-type lectin 8. {ECO:0000255|PROSITE- ProRule:PRU00040}.				collagen catabolic process (GO:0030574)|endocytosis (GO:0006897)|osteoblast differentiation (GO:0001649)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|collagen binding (GO:0005518)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(11)|lung(28)|ovary(2)|prostate(1)|skin(3)	53						TGTCTGGGAGCACCTGCAGAG	0.622																																																0			17											77.0	77.0	77.0					17																	60768059		2203	4300	6503	58121791	SO:0001583	missense	9902			AB014609	CCDS11634.1	17q23	2011-08-30				ENSG00000011028		"""CD molecules"", ""C-type lectin domain containing"""	16875	protein-coding gene	gene with protein product		612264				9734811, 8702911	Standard	NM_006039		Approved	KIAA0709, ENDO180, CLEC13E, CD280	uc002jad.4	Q9UBG0		ENST00000303375.5:c.3949C>A	17.37:g.60768059C>A	ENSP00000307513:p.His1317Asn		58121791	A6H8K4|D3DU08|Q7LGE7|Q9Y5P9	Missense_Mutation	SNP	superfamily_Ricin B-like lectins,HMMSmart_SM00458,HMMPfam_Ricin_B_lectin,superfamily_Kringle-like,HMMSmart_SM00059,HMMPfam_fn2,PatternScan_FN2_1,superfamily_C-type lectin-like,HMMSmart_SM00034,HMMPfam_Lectin_C,PatternScan_C_TYPE_LECTIN_1,PatternScan_LIPOCALIN	p.H1317N	ENST00000303375.5	37	c.3949	CCDS11634.1	17	.	.	.	.	.	.	.	.	.	.	C	16.94	3.262031	0.59431	.	.	ENSG00000011028	ENST00000303375;ENST00000446119	T;T	0.07688	3.17;3.17	4.14	3.17	0.36434	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.000000	0.85682	D	0.000000	T	0.13884	0.0336	L	0.33485	1.01	0.53688	D	0.999976	P;P	0.51240	0.912;0.943	P;P	0.58873	0.673;0.847	T	0.06075	-1.0847	10	0.27785	T	0.31	-22.806	12.1015	0.53788	0.0:0.9157:0.0:0.0843	.	183;1317	E7EME3;Q9UBG0	.;MRC2_HUMAN	N	1317;183	ENSP00000307513:H1317N;ENSP00000400445:H183N	ENSP00000307513:H1317N	H	+	1	0	MRC2	58121791	1.000000	0.71417	1.000000	0.80357	0.838000	0.47535	5.615000	0.67702	0.954000	0.37851	-0.254000	0.11334	CAC	-	superfamily_C-type lectin-like,HMMSmart_SM00034,HMMPfam_Lectin_C		0.622	MRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRC2	protein_coding	OTTHUMT00000445152.1	C			58121791	+1	no_errors	NM_006039	genbank	human	validated	54_36p	missense	SNP	1.000	A
LILRB2	10288	genome.wustl.edu	37	19	54782895	54782895	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr19:54782895G>A	ENST00000391749.4	-	6	998	c.727C>T	c.(727-729)Ctc>Ttc	p.L243F	LILRB2_ENST00000391746.1_Missense_Mutation_p.L243F|LILRB2_ENST00000434421.1_Missense_Mutation_p.L127F|LILRB2_ENST00000314446.5_Missense_Mutation_p.L243F|LILRB2_ENST00000391748.1_Missense_Mutation_p.L243F|LILRB2_ENST00000471216.1_5'Flank	NM_001278406.1	NP_001265335.1	Q8N423	LIRB2_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 2	243	Ig-like C2-type 3.				cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular defense response (GO:0006968)|cellular response to lipopolysaccharide (GO:0071222)|Fc receptor mediated inhibitory signaling pathway (GO:0002774)|heterotypic cell-cell adhesion (GO:0034113)|immune response (GO:0006955)|immune response-inhibiting cell surface receptor signaling pathway (GO:0002767)|negative regulation of antigen processing and presentation (GO:0002578)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of regulatory T cell differentiation (GO:0045591)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of T cell tolerance induction (GO:0002666)|regulation of dendritic cell differentiation (GO:2001198)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|inhibitory MHC class I receptor activity (GO:0032396)|MHC class I protein binding (GO:0042288)|MHC class Ib protein binding (GO:0023029)|protein phosphatase 1 binding (GO:0008157)|receptor activity (GO:0004872)			breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(30)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	44	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		ACACACTGGAGGGTCAGGCTT	0.597																																																0			19											96.0	98.0	97.0					19																	54782895		2203	4300	6503	59474707	SO:0001583	missense	10288			AF000574	CCDS12886.1, CCDS42612.1, CCDS62791.1, CCDS62792.1	19q13.4	2013-01-11			ENSG00000131042	ENSG00000131042		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6606	protein-coding gene	gene with protein product		604815				9151699, 9079806	Standard	XM_006722966		Approved	LIR-2, ILT4, MIR-10, LIR2, CD85d, MIR10	uc002qfb.3	Q8N423	OTTHUMG00000064896	ENST00000391749.4:c.727C>T	19.37:g.54782895G>A	ENSP00000375629:p.Leu243Phe		59474707	A8MU67|C9JF29|O75017|Q8NHJ7|Q8NHJ8	Missense_Mutation	SNP	superfamily_Immunoglobulin,HMMSmart_SM00409,HMMSmart_SM00408,HMMPfam_ig	p.L243F	ENST00000391749.4	37	c.727	CCDS12886.1	19	.	.	.	.	.	.	.	.	.	.	G	15.36	2.811382	0.50527	.	.	ENSG00000131042	ENST00000391748;ENST00000314446;ENST00000391749;ENST00000391746;ENST00000434421	T;T;T;T;T	0.01665	4.7;4.7;4.7;4.7;4.7	2.6	0.0235	0.14137	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.172078	0.27406	N	0.019504	T	0.05868	0.0153	M	0.78456	2.415	0.19945	N	0.999944	P;P;P	0.41848	0.727;0.757;0.763	P;P;P	0.53266	0.651;0.722;0.582	T	0.05402	-1.0887	10	0.72032	D	0.01	.	8.6243	0.33879	0.0:0.4567:0.5433:0.0	.	243;260;243	A8MU67;E7EVY1;Q8N423	.;.;LIRB2_HUMAN	F	243;243;243;243;127	ENSP00000375628:L243F;ENSP00000319960:L243F;ENSP00000375629:L243F;ENSP00000375626:L243F;ENSP00000410117:L127F	ENSP00000319960:L243F	L	-	1	0	LILRB2	59474707	0.984000	0.35163	0.045000	0.18777	0.179000	0.23085	0.699000	0.25586	-0.043000	0.13513	0.449000	0.29647	CTC	-	superfamily_Immunoglobulin,HMMSmart_SM00409,HMMSmart_SM00408,HMMPfam_ig		0.597	LILRB2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LILRB2	protein_coding	OTTHUMT00000139510.1	G			59474707	-1	no_errors	NM_005874	genbank	human	reviewed	54_36p	missense	SNP	0.450	A
SERPINB3	6317	genome.wustl.edu	37	18	61324221	61324221	+	Splice_Site	SNP	C	C	A			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr18:61324221C>A	ENST00000283752.5	-	7	756		c.e7-1		SERPINB3_ENST00000332821.8_Intron|SERPINB11_ENST00000489748.1_RNA	NM_006919.2	NP_008850.1	P29508	SPB3_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 3						negative regulation of catalytic activity (GO:0043086)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of peptidase activity (GO:0010466)|negative regulation of proteolysis (GO:0045861)|regulation of proteolysis (GO:0030162)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)|virus receptor activity (GO:0001618)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(14)|ovary(1)|skin(5)|upper_aerodigestive_tract(2)	36						TGTATGTATTCTACAATAAAT	0.358																																																0			18											100.0	84.0	90.0					18																	61324221		2203	4300	6503	59475201	SO:0001630	splice_region_variant	6317			U19568	CCDS11987.1	18q21.3	2014-02-18	2005-08-18		ENSG00000057149	ENSG00000057149		"""Serine (or cysteine) peptidase inhibitors"""	10569	protein-coding gene	gene with protein product		600517	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 3"""	SCC, SCCA1		7724531, 24172014	Standard	NM_006919		Approved	T4-A, HsT1196	uc002lji.3	P29508	OTTHUMG00000060403	ENST00000283752.5:c.613-1G>T	18.37:g.61324221C>A			59475201	A6NDM2|B2RBT5|B3W5Y6|Q53H28|Q53YB5|Q86VF3|Q86W04|Q8IWL4|Q8IXI3|Q96J21|Q9BYF8	Splice_Site	SNP	-	e6-1	ENST00000283752.5	37	c.613-1	CCDS11987.1	18	.	.	.	.	.	.	.	.	.	.	C	3.890	-0.024173	0.07634	.	.	ENSG00000057149	ENST00000283752	.	.	.	2.64	0.75	0.18387	.	.	.	.	.	.	.	.	.	.	.	0.21290	N	0.999732	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.8927	0.24238	0.0:0.7156:0.1777:0.1067	.	.	.	.	.	-1	.	.	.	-	.	.	SERPINB3	59475201	0.988000	0.35896	0.001000	0.08648	0.016000	0.09150	3.074000	0.50065	0.181000	0.19994	0.455000	0.32223	.	-	-		0.358	SERPINB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPINB3	protein_coding	OTTHUMT00000133791.1	C	NM_006919	Intron	59475201	-1	no_errors	NM_006919	genbank	human	validated	54_36p	splice_site	SNP	0.717	A
SERPINB2	5055	genome.wustl.edu	37	18	61569115	61569115	+	Splice_Site	SNP	C	C	G	rs141012637		TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr18:61569115C>G	ENST00000299502.4	+	6	757	c.677C>G	c.(676-678)tCg>tGg	p.S226W	SERPINB2_ENST00000482254.1_3'UTR|SERPINB2_ENST00000457692.1_Splice_Site_p.S226W	NM_002575.2	NP_002566.1	P05120	PAI2_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 2	226					blood coagulation (GO:0007596)|fibrinolysis (GO:0042730)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|central_nervous_system(2)|endometrium(4)|large_intestine(7)|liver(1)|lung(12)|prostate(2)|skin(2)|stomach(1)	32		Esophageal squamous(42;0.131)			Tenecteplase(DB00031)|Urokinase(DB00013)	CGTGTAAACTCGGTATGAGAC	0.378																																																0			18											90.0	94.0	92.0					18																	61569115		2203	4300	6503	59720095	SO:0001630	splice_region_variant	5055			Y00630	CCDS11989.1	18q21.3	2014-02-18	2005-08-18		ENSG00000197632	ENSG00000197632		"""Serine (or cysteine) peptidase inhibitors"""	8584	protein-coding gene	gene with protein product		173390	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 2"""	PLANH2, PAI2		24172014	Standard	NM_002575		Approved	HsT1201	uc002ljo.3	P05120	OTTHUMG00000060592	ENST00000299502.4:c.678+1C>G	18.37:g.61569115C>G			59720095	Q96E96	Missense_Mutation	SNP	HMMPfam_Serpin,superfamily_Prot_inh_serpin,HMMSmart_SERPIN,PatternScan_SERPIN	p.S226W	ENST00000299502.4	37	c.677	CCDS11989.1	18	.	.	.	.	.	.	.	.	.	.	C	16.27	3.076690	0.55753	.	.	ENSG00000197632	ENST00000299502;ENST00000457692	T;T	0.12361	2.69;2.69	5.79	-6.43	0.01926	Serpin domain (3);	1.451420	0.03810	N	0.265745	T	0.31104	0.0786	M	0.76938	2.355	0.58432	D	0.999998	D;D	0.62365	0.991;0.991	P;P	0.58928	0.848;0.772	T	0.59904	-0.7366	10	0.87932	D	0	.	10.4209	0.44350	0.143:0.1777:0.0:0.6794	.	226;226	B2R7Y0;P05120	.;PAI2_HUMAN	W	226	ENSP00000299502:S226W;ENSP00000401645:S226W	ENSP00000299502:S226W	S	+	2	0	SERPINB2	59720095	0.000000	0.05858	0.012000	0.15200	0.822000	0.46500	-1.505000	0.02273	-1.252000	0.02491	-0.142000	0.14014	TCG	-	HMMPfam_Serpin,superfamily_Prot_inh_serpin,HMMSmart_SERPIN		0.378	SERPINB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPINB2	protein_coding	OTTHUMT00000134009.1	C	NM_002575	Missense_Mutation	59720095	+1	no_errors	NM_002575	genbank	human	validated	54_36p	missense	SNP	0.667	G
CDH8	1006	genome.wustl.edu	37	16	62055072	62055072	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr16:62055072G>A	ENST00000577390.1	-	2	1190	c.236C>T	c.(235-237)cCg>cTg	p.P79L	CDH8_ENST00000299345.6_Missense_Mutation_p.P79L|CDH8_ENST00000577730.1_Missense_Mutation_p.P79L|CDH8_ENST00000584337.1_Missense_Mutation_p.P79L	NM_001796.4	NP_001787.2	P55286	CADH8_HUMAN	cadherin 8, type 2	79	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|response to cold (GO:0009409)|synaptic transmission, glutamatergic (GO:0035249)	axon terminus (GO:0043679)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic cleft (GO:0043083)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(22)|liver(2)|lung(49)|ovary(6)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(4)	112		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)		AACAAGAATCGGTTCAGGTCC	0.413																																																0			16											58.0	56.0	57.0					16																	62055072		2203	4299	6502	60612573	SO:0001583	missense	1006			L34060	CCDS10802.1	16q22.1	2010-01-26			ENSG00000150394	ENSG00000150394		"""Cadherins / Major cadherins"""	1767	protein-coding gene	gene with protein product		603008				9615235, 2059658	Standard	NM_001796		Approved		uc002eog.2	P55286	OTTHUMG00000137493	ENST00000577390.1:c.236C>T	16.37:g.62055072G>A	ENSP00000462701:p.Pro79Leu		60612573	B3KWC1|Q14DC6|Q9ULB2	Missense_Mutation	SNP	superfamily_Cadherin,HMMPfam_Cadherin,HMMSmart_CA,PatternScan_CADHERIN_1,HMMPfam_Cadherin_C	p.P79L	ENST00000577390.1	37	c.236	CCDS10802.1	16	.	.	.	.	.	.	.	.	.	.	G	31	5.093724	0.94149	.	.	ENSG00000150394	ENST00000299345	T	0.00753	5.74	6.03	6.03	0.97812	Cadherin (1);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.02888	0.0086	M	0.90252	3.1	0.80722	D	1	B	0.22080	0.064	B	0.20577	0.03	T	0.32745	-0.9895	10	0.87932	D	0	.	20.5568	0.99304	0.0:0.0:1.0:0.0	.	79	P55286	CADH8_HUMAN	L	79	ENSP00000299345:P79L	ENSP00000299345:P79L	P	-	2	0	CDH8	60612573	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.395000	0.97266	2.861000	0.98227	0.655000	0.94253	CCG	-	superfamily_Cadherin,HMMPfam_Cadherin		0.413	CDH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH8	protein_coding	OTTHUMT00000268754.3	G	NM_001796		60612573	-1	no_errors	NM_001796	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
DAGLA	747	genome.wustl.edu	37	11	61511046	61511046	+	Silent	SNP	G	G	A			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr11:61511046G>A	ENST00000257215.5	+	20	2330	c.2214G>A	c.(2212-2214)gaG>gaA	p.E738E	RP11-467L20.10_ENST00000536405.1_lincRNA	NM_006133.2	NP_006124.1	Q9Y4D2	DGLA_HUMAN	diacylglycerol lipase, alpha	738					arachidonic acid metabolic process (GO:0019369)|blood coagulation (GO:0007596)|cell death (GO:0008219)|diacylglycerol catabolic process (GO:0046340)|endocannabinoid signaling pathway (GO:0071926)|neuroblast proliferation (GO:0007405)|neurotransmitter biosynthetic process (GO:0042136)|platelet activation (GO:0030168)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|liver(2)|lung(17)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(4)	43				READ - Rectum adenocarcinoma(4;0.219)		GCTTCTCGGAGGGGCGGCTGC	0.677																																																0			11											55.0	69.0	64.0					11																	61511046		2186	4237	6423	61267622	SO:0001819	synonymous_variant	747			AB014559	CCDS31578.1	11q12.3	2008-03-18	2007-02-28	2007-02-28		ENSG00000134780	3.1.1.-		1165	protein-coding gene	gene with protein product	"""neural stem cell-derived dendrite regulator"""	614015	"""chromosome 11 open reading frame 11"""	C11orf11		9734811	Standard	NM_006133		Approved	KIAA0659, NSDDR, DAGLALPHA	uc001nsa.3	Q9Y4D2		ENST00000257215.5:c.2214G>A	11.37:g.61511046G>A			61267622	A7E233|Q6WQJ0	Silent	SNP	superfamily_SSF53474,HMMPfam_Lipase_3,PatternScan_LIPASE_SER	p.E738	ENST00000257215.5	37	c.2214	CCDS31578.1	11																																																																																			-	NULL		0.677	DAGLA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DAGLA	protein_coding	OTTHUMT00000398516.1	G	NM_006133		61267622	+1	no_errors	NM_006133	genbank	human	validated	54_36p	silent	SNP	0.997	A
ZNF773	374928	genome.wustl.edu	37	19	58016107	58016107	+	Missense_Mutation	SNP	T	T	C			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr19:58016107T>C	ENST00000282292.4	+	2	256	c.116T>C	c.(115-117)cTc>cCc	p.L39P	ZNF773_ENST00000593916.1_Missense_Mutation_p.L38P|ZNF773_ENST00000599847.1_Missense_Mutation_p.L39P|AC003005.4_ENST00000601674.1_3'UTR|ZNF773_ENST00000598770.1_Missense_Mutation_p.L38P	NM_198542.1	NP_940944.1	Q6PK81	ZN773_HUMAN	zinc finger protein 773	39	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	22		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0254)		CAGAGGCTCCTCTACCGCAAT	0.532																																																0			19											143.0	122.0	129.0					19																	58016107		2203	4297	6500	62707919	SO:0001583	missense	374928			BC005167	CCDS33134.1	19q13.43	2013-01-08	2006-12-15	2006-12-15		ENSG00000152439		"""Zinc fingers, C2H2-type"", ""-"""	30487	protein-coding gene	gene with protein product			"""zinc finger protein 419B"""	ZNF419B		12477932	Standard	NM_198542		Approved	MGC4728	uc002qox.3	Q6PK81		ENST00000282292.4:c.116T>C	19.37:g.58016107T>C	ENSP00000282292:p.Leu39Pro		62707919	Q96DL8	Missense_Mutation	SNP	superfamily_KRAB domain (Kruppel-associated box Pfam 01352),HMMPfam_KRAB,HMMSmart_SM00349,superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1	p.L39P	ENST00000282292.4	37	c.116	CCDS33134.1	19	.	.	.	.	.	.	.	.	.	.	T	12.14	1.849753	0.32699	.	.	ENSG00000152439	ENST00000332030;ENST00000282292	T	0.05513	3.43	1.39	1.39	0.22231	Krueppel-associated box (4);	.	.	.	.	T	0.34774	0.0909	H	0.98089	4.145	0.24527	N	0.994139	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.11372	-1.0590	9	0.87932	D	0	.	6.8571	0.24046	0.0:0.0:0.0:1.0	.	38;39	Q6PK81-2;Q6PK81	.;ZN773_HUMAN	P	62;39	ENSP00000282292:L39P	ENSP00000282292:L39P	L	+	2	0	ZNF773	62707919	0.115000	0.22152	0.027000	0.17364	0.765000	0.43378	3.925000	0.56484	0.898000	0.36418	0.254000	0.18369	CTC	-	superfamily_KRAB domain (Kruppel-associated box Pfam 01352),HMMPfam_KRAB,HMMSmart_SM00349		0.532	ZNF773-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF773	protein_coding	OTTHUMT00000466475.1	T	NM_198542		62707919	+1	no_errors	NM_198542	genbank	human	provisional	54_36p	missense	SNP	0.261	C
SYNE2	23224	genome.wustl.edu	37	14	64632115	64632115	+	Missense_Mutation	SNP	C	C	A			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr14:64632115C>A	ENST00000344113.4	+	90	16804	c.16592C>A	c.(16591-16593)cCt>cAt	p.P5531H	SYNE2_ENST00000555002.1_Missense_Mutation_p.P2165H|SYNE2_ENST00000394768.2_Missense_Mutation_p.P1916H|SYNE2_ENST00000358025.3_Missense_Mutation_p.P5531H|SYNE2_ENST00000357395.3_Missense_Mutation_p.P1916H|ESR2_ENST00000542956.1_Intron|SYNE2_ENST00000554584.1_Intron	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	5531					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		AAAGAAAATCCTGACTCATTC	0.358																																																0			14											110.0	119.0	116.0					14																	64632115		2203	4300	6503	63701868	SO:0001583	missense	23224			AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.16592C>A	14.37:g.64632115C>A	ENSP00000341781:p.Pro5531His		63701868	Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	superfamily_Calponin-homology,HMMPfam_CH,PatternScan_ACTININ_1,HMMSmart_CH,PatternScan_ACTININ_2,superfamily_Spectrin,HMMSmart_SPEC,HMMPfam_Spectrin,superfamily_4_helix_cytokine,HMMPfam_KASH	p.P5531H	ENST00000344113.4	37	c.16592	CCDS41963.1	14	.	.	.	.	.	.	.	.	.	.	C	17.47	3.396968	0.62177	.	.	ENSG00000054654	ENST00000358025;ENST00000357395;ENST00000344113;ENST00000555002;ENST00000394768	T;T;T;T;T	0.50813	0.73;4.02;0.73;4.08;4.02	5.93	5.05	0.67936	.	0.382752	0.22332	N	0.061449	T	0.64713	0.2623	M	0.69823	2.125	0.80722	D	1	D;D;D	0.67145	0.993;0.994;0.996	P;P;D	0.64595	0.887;0.865;0.927	T	0.67019	-0.5776	10	0.56958	D	0.05	.	12.4667	0.55762	0.0:0.9217:0.0:0.0783	.	1916;5531;5531	Q8WXH0-7;Q8WXH0;Q8WXH0-2	.;SYNE2_HUMAN;.	H	5531;1916;5531;2165;1916	ENSP00000350719:P5531H;ENSP00000349969:P1916H;ENSP00000341781:P5531H;ENSP00000450831:P2165H;ENSP00000378249:P1916H	ENSP00000341781:P5531H	P	+	2	0	SYNE2	63701868	0.598000	0.26882	0.819000	0.32651	0.993000	0.82548	1.498000	0.35660	1.513000	0.48852	0.655000	0.94253	CCT	-	NULL		0.358	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNE2	protein_coding	OTTHUMT00000276994.2	C	NM_182914		63701868	+1	no_errors	NM_182914	genbank	human	validated	54_36p	missense	SNP	0.755	A
LINC00922	283867	genome.wustl.edu	37	16	65345357	65345357	+	lincRNA	SNP	C	C	T			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr16:65345357C>T	ENST00000569736.1	-	0	778				RP11-256I9.3_ENST00000562656.1_lincRNA	NR_027755.1				long intergenic non-protein coding RNA 922																		CCCATGCCTTCACGAATGTAT	0.458																																																0			16											181.0	165.0	170.0					16																	65345357		1937	4151	6088	63902858			283867			BC037902, BC104446		16q21	2013-05-24			ENSG00000261742	ENSG00000261742		"""Long non-coding RNAs"""	27545	non-coding RNA	RNA, long non-coding							Standard	NR_027755		Approved				OTTHUMG00000172812		16.37:g.65345357C>T			63902858		Missense_Mutation	SNP	NULL	p.E74K	ENST00000569736.1	37	c.220		16																																																																																			-	NULL		0.458	LINC00922-001	KNOWN	basic	lincRNA	LOC283867	lincRNA	OTTHUMT00000420601.2	C	NR_027755		63902858	-1	no_errors	NM_001101346	genbank	human	inferred	54_36p	missense	SNP	0.000	T
NRBF2	29982	genome.wustl.edu	37	10	64913839	64913839	+	Missense_Mutation	SNP	C	C	A			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr10:64913839C>A	ENST00000277746.6	+	4	906	c.725C>A	c.(724-726)aCc>aAc	p.T242N	NRBF2_ENST00000435510.2_Missense_Mutation_p.T232N	NM_030759.3	NP_110386.2	Q96F24	NRBF2_HUMAN	nuclear receptor binding factor 2	242					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)				large_intestine(2)|lung(3)|skin(1)	6	Prostate(12;0.0119)|all_hematologic(501;0.191)					GCCTCCTCAACCTGGCAGAAG	0.473																																																0			10											47.0	46.0	47.0					10																	64913839		2203	4300	6503	64583845	SO:0001583	missense	29982			D82519	CCDS7268.1, CCDS60537.1	10q22.1	2012-11-01			ENSG00000148572	ENSG00000148572			19692	protein-coding gene	gene with protein product	"""comodulator of PPAR and RXR 1"", ""comodulator of PPAR and RXR 2"""					10786636	Standard	NM_001282405		Approved	DKFZp564C1664, FLJ30395, COPR1, COPR2	uc001jmj.4	Q96F24	OTTHUMG00000018309	ENST00000277746.6:c.725C>A	10.37:g.64913839C>A	ENSP00000277746:p.Thr242Asn		64583845	A6PW36|B4DWS0|Q86UR2|Q96NP6|Q9H0S9|Q9H2I2	Missense_Mutation	SNP	HMMPfam_DUF1875	p.T242N	ENST00000277746.6	37	c.725	CCDS7268.1	10	.	.	.	.	.	.	.	.	.	.	C	11.68	1.710107	0.30322	.	.	ENSG00000148572	ENST00000277746;ENST00000395241;ENST00000435510	.	.	.	5.78	3.87	0.44632	.	0.610628	0.18966	N	0.126254	T	0.46718	0.1407	L	0.47716	1.5	0.30148	N	0.80329	B;B	0.34103	0.437;0.119	B;B	0.37601	0.254;0.119	T	0.49597	-0.8923	9	0.49607	T	0.09	-9.5136	16.4634	0.84071	0.0:0.753:0.247:0.0	.	232;242	B4DWS0;Q96F24	.;NRBF2_HUMAN	N	242;192;232	.	ENSP00000277746:T242N	T	+	2	0	NRBF2	64583845	0.001000	0.12720	0.957000	0.39632	0.723000	0.41478	0.803000	0.27083	0.737000	0.32582	0.563000	0.77884	ACC	-	HMMPfam_DUF1875		0.473	NRBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NRBF2	protein_coding	OTTHUMT00000048247.1	C	NM_030759		64583845	+1	no_errors	NM_030759	genbank	human	validated	54_36p	missense	SNP	0.499	A
CD248	57124	genome.wustl.edu	37	11	66083141	66083141	+	Missense_Mutation	SNP	A	A	G			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr11:66083141A>G	ENST00000311330.3	-	1	1374	c.1358T>C	c.(1357-1359)gTc>gCc	p.V453A	RP11-867G23.13_ENST00000534065.1_RNA	NM_020404.2	NP_065137.1	Q9HCU0	CD248_HUMAN	CD248 molecule, endosialin	453	Pro-rich.				anatomical structure regression (GO:0060033)|cell migration (GO:0016477)|lymph node development (GO:0048535)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|extracellular matrix binding (GO:0050840)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|ovary(1)|prostate(1)|urinary_tract(2)	26						CGTGGCAGAGACCACCACAGG	0.662																																																0			11											103.0	98.0	100.0					11																	66083141		2200	4295	6495	65839717	SO:0001583	missense	57124			AF279142	CCDS8134.1	11q13	2006-04-12	2006-03-28	2005-02-11	ENSG00000174807	ENSG00000174807		"""CD molecules"""	18219	protein-coding gene	gene with protein product	"""endosialin"", ""tumor endothelial marker 1"""	606064	"""CD164 sialomucin-like 1"", ""CD248 antigen, endosialin"""	CD164L1		10947988, 11084048	Standard	NM_020404		Approved	TEM1	uc001ohm.1	Q9HCU0	OTTHUMG00000167073	ENST00000311330.3:c.1358T>C	11.37:g.66083141A>G	ENSP00000308117:p.Val453Ala		65839717	Q2M2V5|Q3SX55|Q96KB6	Missense_Mutation	SNP	superfamily_C-type lectin-like,HMMSmart_SM00034,HMMPfam_Lectin_C,superfamily_EGF/Laminin,HMMSmart_SM00181,HMMPfam_EGF,PatternScan_EGF_2,HMMSmart_SM00179,PatternScan_EGF_CA,HMMPfam_EGF_CA,PatternScan_ASX_HYDROXYL	p.V453A	ENST00000311330.3	37	c.1358	CCDS8134.1	11	.	.	.	.	.	.	.	.	.	.	A	5.605	0.296455	0.10622	.	.	ENSG00000174807	ENST00000311330	D	0.87571	-2.27	4.32	1.99	0.26369	.	0.834824	0.10066	N	0.720303	T	0.72795	0.3505	N	0.12182	0.205	0.09310	N	0.999995	B	0.02656	0.0	B	0.04013	0.001	T	0.56780	-0.7922	10	0.22109	T	0.4	-15.6653	6.0657	0.19862	0.6856:0.0:0.3144:0.0	.	453	Q9HCU0	CD248_HUMAN	A	453	ENSP00000308117:V453A	ENSP00000308117:V453A	V	-	2	0	CD248	65839717	0.590000	0.26815	0.805000	0.32314	0.382000	0.30200	1.823000	0.39062	0.312000	0.23038	0.374000	0.22700	GTC	-	NULL		0.662	CD248-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD248	protein_coding	OTTHUMT00000392922.2	A	NM_020404		65839717	-1	no_errors	NM_020404	genbank	human	validated	54_36p	missense	SNP	0.000	G
TRIM55	84675	genome.wustl.edu	37	8	67040639	67040639	+	Missense_Mutation	SNP	A	A	C			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr8:67040639A>C	ENST00000315962.4	+	2	642	c.269A>C	c.(268-270)cAt>cCt	p.H90P	TRIM55_ENST00000276573.7_Missense_Mutation_p.H90P|TRIM55_ENST00000353317.5_Missense_Mutation_p.H90P|TRIM55_ENST00000350034.4_Missense_Mutation_p.H90P	NM_184085.1	NP_908973.1	Q9BYV6	TRI55_HUMAN	tripartite motif containing 55	90					signal transduction (GO:0007165)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|signal transducer activity (GO:0004871)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(13)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(2)	39		Lung NSC(129;0.138)|all_lung(136;0.221)	Epithelial(68;0.0136)|all cancers(69;0.0582)|BRCA - Breast invasive adenocarcinoma(89;0.0628)|OV - Ovarian serous cystadenocarcinoma(28;0.0904)			TTGGATAGACATGGGGTATAT	0.507																																																0			8											161.0	160.0	160.0					8																	67040639		2203	4300	6503	67203193	SO:0001583	missense	84675			AJ291712	CCDS6184.1, CCDS6185.1, CCDS6186.1, CCDS6187.1	8q13.1	2013-01-09	2011-01-25	2004-11-17	ENSG00000147573	ENSG00000147573		"""RING-type (C3HC4) zinc fingers"", ""Tripartite motif containing / Tripartite motif containing"""	14215	protein-coding gene	gene with protein product		606469	"""ring finger protein 29"", ""tripartite motif-containing 55"""	RNF29		11243782	Standard	NM_033058		Approved	MURF-2	uc003xvv.3	Q9BYV6	OTTHUMG00000164473	ENST00000315962.4:c.269A>C	8.37:g.67040639A>C	ENSP00000323913:p.His90Pro		67203193	B3KRC0|B3KRJ3|Q53XX3|Q8IUD9|Q8IUE4|Q96DV2|Q96DV3|Q9BYV5	Missense_Mutation	SNP	superfamily_RING/U-box,HMMSmart_SM00184,HMMPfam_zf-C3HC4,PatternScan_ZF_RING_1,HMMPfam_zf-B_box,HMMSmart_SM00336	p.H90P	ENST00000315962.4	37	c.269	CCDS6184.1	8	.	.	.	.	.	.	.	.	.	.	A	28.2	4.902148	0.92035	.	.	ENSG00000147573	ENST00000315962;ENST00000353317;ENST00000276573;ENST00000350034	T;T;T;T	0.38887	1.55;1.58;1.55;1.11	5.81	5.81	0.92471	Zinc finger, RING/FYVE/PHD-type (1);	0.000000	0.85682	D	0.000000	T	0.67097	0.2857	M	0.80982	2.52	0.80722	D	1	D;D;D;D	0.89917	1.0;0.998;0.994;0.982	D;D;D;D	0.80764	0.994;0.983;0.966;0.926	T	0.70905	-0.4745	10	0.59425	D	0.04	.	16.1677	0.81782	1.0:0.0:0.0:0.0	.	90;90;90;90	Q9BYV6-4;Q9BYV6-2;Q9BYV6;Q9BYV6-3	.;.;TRI55_HUMAN;.	P	90	ENSP00000323913:H90P;ENSP00000297348:H90P;ENSP00000276573:H90P;ENSP00000332302:H90P	ENSP00000276573:H90P	H	+	2	0	TRIM55	67203193	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.332000	0.96446	2.218000	0.71995	0.528000	0.53228	CAT	-	superfamily_RING/U-box		0.507	TRIM55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM55	protein_coding	OTTHUMT00000378921.1	A	NM_184085		67203193	+1	no_errors	NM_184085	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
SDK2	54549	genome.wustl.edu	37	17	71384151	71384151	+	Silent	SNP	C	C	T	rs147384840	byFrequency	TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr17:71384151C>T	ENST00000392650.3	-	30	4218	c.4218G>A	c.(4216-4218)ccG>ccA	p.P1406P	SDK2_ENST00000388726.3_Silent_p.P1406P	NM_001144952.1	NP_001138424.1	Q58EX2	SDK2_HUMAN	sidekick cell adhesion molecule 2	1406	Fibronectin type-III 9. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(15)|lung(31)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	86						GCTGCACCATCGGCCTGCTGG	0.682													C|||	16	0.00319489	0.0008	0.0072	5008	,	,		16365	0.0		0.004	False		,,,				2504	0.0061															0			17						C		4,4368		0,4,2182	12.0	11.0	11.0		4218	-9.0	0.2	17	dbSNP_134	11	59,8477		0,59,4209	no	coding-synonymous	SDK2	NM_001144952.1		0,63,6391	TT,TC,CC		0.6912,0.0915,0.4881		1406/2173	71384151	63,12845	2186	4268	6454	68895746	SO:0001819	synonymous_variant	54549			AB040947	CCDS45769.1	17q21.31	2013-02-11	2011-12-09		ENSG00000069188	ENSG00000069188		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19308	protein-coding gene	gene with protein product		607217	"""sidekick homolog 2 (chicken)"""			12230981, 15213259	Standard	NM_001144952		Approved	FLJ10832, KIAA1514	uc010dfm.3	Q58EX2	OTTHUMG00000152726	ENST00000392650.3:c.4218G>A	17.37:g.71384151C>T			68895746	A6NMR8|C9JA57|Q86VY3|Q9NTD2|Q9NVB3|Q9P214	Silent	SNP	HMMSmart_IGc2,HMMPfam_ig,superfamily_SSF48726,HMMPfam_I-set,HMMSmart_IG,superfamily_FN_III-like,HMMSmart_FN3,HMMPfam_fn3	p.P1085	ENST00000392650.3	37	c.3255	CCDS45769.1	17																																																																																			-	superfamily_FN_III-like,HMMSmart_FN3,HMMPfam_fn3		0.682	SDK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SDK2	protein_coding	OTTHUMT00000327598.2	C	NM_019064		68895746	-1	no_errors	ENST00000334543	ensembl	human	known	54_36p	silent	SNP	0.058	T
MARVELD3	91862	genome.wustl.edu	37	16	71674836	71674836	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr16:71674836G>A	ENST00000299952.4	+	3	1182	c.1139G>A	c.(1138-1140)cGt>cAt	p.R380H	MARVELD3_ENST00000561682.1_Intron|MARVELD3_ENST00000565261.1_3'UTR|PHLPP2_ENST00000540628.1_3'UTR	NM_001017967.3|NM_001271329.1	NP_001017967.2|NP_001258258.1	Q96A59	MALD3_HUMAN	MARVEL domain containing 3	383	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.				cell-cell junction organization (GO:0045216)|tight junction assembly (GO:0070830)	cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|tight junction (GO:0005923)				NS(1)|endometrium(3)|large_intestine(5)|lung(6)|skin(2)	17		Ovarian(137;0.125)				CTGGCCCTGCGTAGCTACCGA	0.572																																																0			16											55.0	44.0	48.0					16																	71674836		2198	4300	6498	70232337	SO:0001583	missense	91862			BC013376	CCDS10904.1, CCDS32478.1, CCDS59270.1	16q22.2	2008-02-05	2004-07-12	2004-07-14	ENSG00000140832	ENSG00000140832			30525	protein-coding gene	gene with protein product		614094	"""MARVEL (membrane-associating) domain containing 3"""	MRVLDC3			Standard	NM_001017967		Approved		uc002fat.4	Q96A59	OTTHUMG00000137591	ENST00000299952.4:c.1139G>A	16.37:g.71674836G>A	ENSP00000299952:p.Arg380His		70232337	A8K820|H3BQM5|Q96MJ4	Missense_Mutation	SNP	HMMPfam_MARVEL	p.R380H	ENST00000299952.4	37	c.1139	CCDS32478.1	16	.	.	.	.	.	.	.	.	.	.	G	18.66	3.671990	0.67928	.	.	ENSG00000140832	ENST00000299952	D	0.87412	-2.25	5.67	4.72	0.59763	.	0.152170	0.52532	D	0.000067	D	0.90359	0.6983	.	.	.	0.80722	D	1	D	0.63046	0.992	P	0.59288	0.855	D	0.90300	0.4329	9	0.87932	D	0	-25.0948	7.3175	0.26509	0.0844:0.0:0.7485:0.1671	.	380	Q96A59-2	.	H	380	ENSP00000299952:R380H	ENSP00000299952:R380H	R	+	2	0	MARVELD3	70232337	0.993000	0.37304	0.971000	0.41717	0.672000	0.39443	1.081000	0.30791	1.407000	0.46875	0.655000	0.94253	CGT	-	HMMPfam_MARVEL		0.572	MARVELD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MARVELD3	protein_coding	OTTHUMT00000268990.1	G	NM_052858		70232337	+1	no_errors	NM_001017967	genbank	human	validated	54_36p	missense	SNP	0.976	A
NLGN3	54413	genome.wustl.edu	37	X	70387254	70387254	+	Missense_Mutation	SNP	T	T	C			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chrX:70387254T>C	ENST00000358741.3	+	7	1610	c.1307T>C	c.(1306-1308)tTt>tCt	p.F436S	NLGN3_ENST00000374051.3_Missense_Mutation_p.F416S|NLGN3_ENST00000536169.1_Missense_Mutation_p.F396S|NLGN3_ENST00000476589.1_3'UTR	NM_181303.1	NP_851820.1	Q9NZ94	NLGN3_HUMAN	neuroligin 3	436					adult behavior (GO:0030534)|axon extension (GO:0048675)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|oligodendrocyte differentiation (GO:0048709)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor-mediated endocytosis (GO:0006898)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of long-term synaptic potentiation (GO:1900271)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of synaptic transmission (GO:0050804)|regulation of terminal button organization (GO:2000331)|rhythmic synaptic transmission (GO:0060024)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse organization (GO:0050808)|visual learning (GO:0008542)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|endocytic vesicle (GO:0030139)|excitatory synapse (GO:0060076)|integral component of plasma membrane (GO:0005887)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|receptor activity (GO:0004872)	p.F416C(1)		biliary_tract(1)|breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(10)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	37	Renal(35;0.156)					GTCTCCAATTTTGTGGACAAT	0.527																																					Esophageal Squamous(103;760 1488 16849 22250 40351)											1	Substitution - Missense(1)	large_intestine(1)	X											139.0	104.0	116.0					X																	70387254		2203	4300	6503	70303979	SO:0001583	missense	54413			AB040913	CCDS14407.1, CCDS55441.1, CCDS55442.1	Xq13.1	2008-08-01			ENSG00000196338	ENSG00000196338			14289	protein-coding gene	gene with protein product		300336				10767552, 10819331	Standard	NM_181303		Approved	HNL3, KIAA1480, ASPGX1, AUTSX1	uc004dzd.2	Q9NZ94	OTTHUMG00000021790	ENST00000358741.3:c.1307T>C	X.37:g.70387254T>C	ENSP00000351591:p.Phe436Ser		70303979	B2RBK1|D2X2H6|D3DVV0|D3DVV1|Q86V51|Q8NCD0|Q9NZ95|Q9NZ96|Q9NZ97|Q9P248	Missense_Mutation	SNP	HMMPfam_COesterase,superfamily_SSF53474,PatternScan_CARBOXYLESTERASE_B_2	p.F416S	ENST00000358741.3	37	c.1247	CCDS55441.1	X	.	.	.	.	.	.	.	.	.	.	T	16.41	3.115687	0.56505	.	.	ENSG00000196338	ENST00000536169;ENST00000374051;ENST00000395855;ENST00000358741	T;T;T;T	0.68025	-0.3;-0.3;-0.3;-0.3	5.14	5.14	0.70334	Carboxylesterase, type B (1);	0.097389	0.64402	D	0.000001	T	0.77308	0.4111	L	0.51853	1.615	0.80722	D	1	D;D;D	0.89917	0.994;0.992;1.0	D;D;D	0.87578	0.961;0.958;0.998	T	0.79766	-0.1665	10	0.87932	D	0	.	14.1479	0.65362	0.0:0.0:0.0:1.0	.	396;436;416	D3DVV1;Q9NZ94;Q9NZ94-2	.;NLGN3_HUMAN;.	S	396;416;396;436	ENSP00000445298:F396S;ENSP00000363163:F416S;ENSP00000379196:F396S;ENSP00000351591:F436S	ENSP00000351591:F436S	F	+	2	0	NLGN3	70303979	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.868000	0.87116	1.916000	0.55485	0.352000	0.21897	TTT	-	HMMPfam_COesterase,superfamily_SSF53474		0.527	NLGN3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	NLGN3	protein_coding	OTTHUMT00000057121.1	T	NM_018977		70303979	+1	no_errors	NM_018977	genbank	human	validated	54_36p	missense	SNP	1.000	C
COL9A1	1297	genome.wustl.edu	37	6	71011706	71011706	+	Missense_Mutation	SNP	G	G	T			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr6:71011706G>T	ENST00000357250.6	-	2	244	c.86C>A	c.(85-87)cCc>cAc	p.P29H	COL9A1_ENST00000370496.3_Missense_Mutation_p.P29H	NM_001851.4	NP_001842.3	P20849	CO9A1_HUMAN	collagen, type IX, alpha 1	29	Nonhelical region (NC4).				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|organ morphogenesis (GO:0009887)|tissue homeostasis (GO:0001894)	collagen type IX trimer (GO:0005594)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(44)|ovary(5)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)	80						GCCCTTACTGGGGCGACGCTT	0.458																																																0			6											40.0	41.0	41.0					6																	71011706		2203	4300	6503	71068427	SO:0001583	missense	1297				CCDS4971.1, CCDS47447.1	6q13	2013-05-07			ENSG00000112280	ENSG00000112280		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2217	protein-coding gene	gene with protein product		120210				1429648	Standard	NM_001851		Approved		uc003pfg.4	P20849	OTTHUMG00000014988	ENST00000357250.6:c.86C>A	6.37:g.71011706G>T	ENSP00000349790:p.Pro29His		71068427	Q13699|Q13700|Q5TF52|Q6P467|Q96BM8|Q99225|Q9H151|Q9H152|Q9Y6P2|Q9Y6P3	Missense_Mutation	SNP	HMMSmart_TSPN,superfamily_ConA_like_lec_gl,HMMPfam_Collagen	p.P29H	ENST00000357250.6	37	c.86	CCDS4971.1	6	.	.	.	.	.	.	.	.	.	.	G	20.7	4.032596	0.75504	.	.	ENSG00000112280	ENST00000357250;ENST00000370496	D;D	0.91124	-2.46;-2.79	6.07	5.16	0.70880	.	0.359580	0.27558	N	0.018839	T	0.82139	0.4972	N	0.24115	0.695	0.80722	D	1	P	0.37955	0.612	B	0.40101	0.319	T	0.83349	-0.0004	10	0.42905	T	0.14	.	17.4183	0.87507	0.0:0.134:0.866:0.0	.	29	P20849	CO9A1_HUMAN	H	29	ENSP00000349790:P29H;ENSP00000359527:P29H	ENSP00000349790:P29H	P	-	2	0	COL9A1	71068427	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	3.592000	0.53993	2.884000	0.98904	0.655000	0.94253	CCC	-	NULL		0.458	COL9A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL9A1	protein_coding	OTTHUMT00000041131.2	G			71068427	-1	no_errors	NM_001851	genbank	human	reviewed	54_36p	missense	SNP	0.996	T
SIPA1L1	26037	genome.wustl.edu	37	14	72138315	72138315	+	Missense_Mutation	SNP	C	C	T			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr14:72138315C>T	ENST00000555818.1	+	8	3083	c.2735C>T	c.(2734-2736)aCc>aTc	p.T912I	SIPA1L1_ENST00000381232.3_Missense_Mutation_p.T912I|SIPA1L1_ENST00000358550.2_Missense_Mutation_p.T912I|SIPA1L1_ENST00000537413.1_Missense_Mutation_p.T387I	NM_001284247.1|NM_015556.1	NP_001271176.1|NP_056371.1	O43166	SI1L1_HUMAN	signal-induced proliferation-associated 1 like 1	912					actin cytoskeleton reorganization (GO:0031532)|activation of Rap GTPase activity (GO:0032861)|ephrin receptor signaling pathway (GO:0048013)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rap GTPase activity (GO:0032317)|regulation of synaptic plasticity (GO:0048167)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(1)|large_intestine(22)|liver(2)|lung(25)|ovary(3)|prostate(3)|skin(3)|stomach(1)	78				all cancers(60;0.00169)|BRCA - Breast invasive adenocarcinoma(234;0.00912)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)		TCAACTGACACCAGCCTCAAA	0.418																																																0			14											106.0	102.0	103.0					14																	72138315		2203	4300	6503	71208068	SO:0001583	missense	26037			AB007900	CCDS9807.1, CCDS61490.1, CCDS61491.1	14q24.1	2003-12-11				ENSG00000197555			20284	protein-coding gene	gene with protein product						9858596	Standard	XM_005267514		Approved	KIAA0440, E6TP1	uc001xmr.1	O43166		ENST00000555818.1:c.2735C>T	14.37:g.72138315C>T	ENSP00000450832:p.Thr912Ile		71208068	J3KP19|O95321|Q9UDU4|Q9UNU4	Missense_Mutation	SNP	superfamily_Rap/Ran-GAP (Pfam 02145),HMMPfam_Rap_GAP,superfamily_PDZ domain-like,HMMPfam_PDZ,HMMSmart_SM00228	p.T912I	ENST00000555818.1	37	c.2735	CCDS9807.1	14	.	.	.	.	.	.	.	.	.	.	C	6.272	0.418334	0.11870	.	.	ENSG00000197555	ENST00000381232;ENST00000555818;ENST00000358550;ENST00000537413	T;T;T;D	0.84516	-1.03;-1.04;-1.03;-1.86	5.86	0.739	0.18324	.	0.370112	0.36972	N	0.002313	T	0.80874	0.4707	L	0.47716	1.5	0.38672	D	0.95232	B;B;B;P;B	0.42456	0.02;0.012;0.005;0.78;0.079	B;B;B;P;B	0.44696	0.036;0.008;0.01;0.458;0.014	T	0.75161	-0.3415	10	0.25751	T	0.34	-3.4003	11.7231	0.51693	0.3236:0.4682:0.2082:0.0	.	387;912;387;912;912	F5GYF8;A6H8W6;B4DYX7;O43166-2;O43166	.;.;.;.;SI1L1_HUMAN	I	912;912;912;387	ENSP00000370630:T912I;ENSP00000450832:T912I;ENSP00000351352:T912I;ENSP00000440682:T387I	ENSP00000351352:T912I	T	+	2	0	SIPA1L1	71208068	1.000000	0.71417	0.800000	0.32199	0.062000	0.15995	2.643000	0.46604	-0.056000	0.13221	-0.188000	0.12872	ACC	-	NULL		0.418	SIPA1L1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SIPA1L1	protein_coding	OTTHUMT00000412806.1	C	NM_015556		71208068	+1	no_errors	NM_015556	genbank	human	provisional	54_36p	missense	SNP	1.000	T
NCOA2	10499	genome.wustl.edu	37	8	71069270	71069270	+	Missense_Mutation	SNP	A	A	T			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr8:71069270A>T	ENST00000452400.2	-	11	1511	c.1330T>A	c.(1330-1332)Tct>Act	p.S444T	NCOA2_ENST00000524223.1_Intron	NM_006540.2	NP_006531.1	Q15596	NCOA2_HUMAN	nuclear receptor coactivator 2	444					cellular lipid metabolic process (GO:0044255)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of glucose metabolic process (GO:0010906)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|signal transducer activity (GO:0004871)|thyroid hormone receptor coactivator activity (GO:0030375)|transcription coactivator activity (GO:0003713)		PAX3/NCOA2(4)|HEY1/NCOA2(10)	NS(1)|breast(4)|endometrium(7)|kidney(4)|large_intestine(10)|lung(25)|ovary(1)|pancreas(2)|prostate(2)|skin(4)	60	Breast(64;0.201)		Epithelial(68;0.0147)|OV - Ovarian serous cystadenocarcinoma(28;0.0455)|all cancers(69;0.0606)			ATTCCCCCAGAACCACCAAAC	0.502			T	"""RUNXBP2, HEY1"""	"""AML, Chondrosarcoma"""																																		Dom	yes		8	8q13.1	10499	nuclear receptor coactivator 2 (TIF2)		L	0			8											127.0	121.0	123.0					8																	71069270		1958	4145	6103	71231824	SO:0001583	missense	10499			X97674	CCDS47872.1	8q13.3	2011-07-01			ENSG00000140396	ENSG00000140396		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7669	protein-coding gene	gene with protein product		601993				9111344, 8670870	Standard	XM_005251128		Approved	TIF2, GRIP1, NCoA-2, KAT13C, bHLHe75	uc003xyn.1	Q15596	OTTHUMG00000164671	ENST00000452400.2:c.1330T>A	8.37:g.71069270A>T	ENSP00000399968:p.Ser444Thr		71231824	Q14CD2	Missense_Mutation	SNP	superfamily_HLH_basic,HMMSmart_HLH,HMMPfam_PAS,HMMSmart_PAS,superfamily_SSF55785,HMMSmart_PAC,HMMPfam_SRC-1,superfamily_Nuc_recept_coact,HMMPfam_Nuc_rec_co-act,HMMPfam_DUF1518	p.S444T	ENST00000452400.2	37	c.1330	CCDS47872.1	8	.	.	.	.	.	.	.	.	.	.	A	13.42	2.230404	0.39399	.	.	ENSG00000140396	ENST00000452400	T	0.01725	4.67	5.93	4.71	0.59529	.	0.052114	0.85682	D	0.000000	T	0.02304	0.0071	L	0.48642	1.525	0.80722	D	1	P	0.40431	0.717	B	0.35607	0.206	T	0.61287	-0.7093	10	0.45353	T	0.12	.	12.874	0.57980	0.8644:0.1356:0.0:0.0	.	444	Q15596	NCOA2_HUMAN	T	444	ENSP00000399968:S444T	ENSP00000399968:S444T	S	-	1	0	NCOA2	71231824	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.259000	0.65485	2.263000	0.75096	0.533000	0.62120	TCT	-	NULL		0.502	NCOA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCOA2	protein_coding	OTTHUMT00000379696.1	A			71231824	-1	no_errors	NM_006540	genbank	human	validated	54_36p	missense	SNP	1.000	T
RNF121	55298	genome.wustl.edu	37	11	71693956	71693956	+	Silent	SNP	C	C	G			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr11:71693956C>G	ENST00000361756.3	+	4	754	c.393C>G	c.(391-393)acC>acG	p.T131T	RNF121_ENST00000545854.1_Silent_p.T50T|RNF121_ENST00000530137.1_Silent_p.T99T|RNF121_ENST00000490867.1_3'UTR|RNF121_ENST00000533380.1_Intron|RNF121_ENST00000393713.3_Silent_p.T99T	NM_018320.4	NP_060790.2	Q9H920	RN121_HUMAN	ring finger protein 121	131						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			endometrium(3)|kidney(2)|large_intestine(1)|lung(6)|urinary_tract(1)	13						TACAGACAACCCCAAGGTGAG	0.488																																																0			11											106.0	92.0	97.0					11																	71693956		2200	4293	6493	71371604	SO:0001819	synonymous_variant	55298			AK001961	CCDS8203.1, CCDS73343.1	11q13.3	2008-02-05			ENSG00000137522	ENSG00000137522		"""RING-type (C3HC4) zinc fingers"""	21070	protein-coding gene	gene with protein product							Standard	NM_018320		Approved	FLJ11099	uc001ora.3	Q9H920	OTTHUMG00000157023	ENST00000361756.3:c.393C>G	11.37:g.71693956C>G			71371604	B3KSW8|Q6IA57|Q6P449|Q96DB4	Silent	SNP	PatternScan_ZF_RING_1,superfamily_SSF57850,HMMSmart_RING	p.T131	ENST00000361756.3	37	c.393	CCDS8203.1	11																																																																																			-	NULL		0.488	RNF121-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF121	protein_coding	OTTHUMT00000347132.1	C	NM_018320		71371604	+1	no_errors	NM_018320	genbank	human	reviewed	54_36p	silent	SNP	0.788	G
RLIM	51132	genome.wustl.edu	37	X	73815786	73815786	+	Silent	SNP	T	T	C			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chrX:73815786T>C	ENST00000332687.6	-	2	245	c.27A>G	c.(25-27)aaA>aaG	p.K9K	RLIM_ENST00000349225.2_Silent_p.K9K	NM_016120.3	NP_057204.2	Q9NVW2	RNF12_HUMAN	ring finger protein, LIM domain interacting	9					negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein ubiquitination (GO:0016567)|random inactivation of X chromosome (GO:0060816)|transcription, DNA-templated (GO:0006351)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	ligase activity (GO:0016874)|transcription corepressor activity (GO:0003714)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						CACCACTTCCTTTGTCATTGG	0.378																																					Esophageal Squamous(169;1899 1923 14997 18818 32118)											0			X											62.0	56.0	58.0					X																	73815786		2203	4300	6503	73732511	SO:0001819	synonymous_variant	51132			AF155109	CCDS14427.1	Xq13-q21	2013-01-09	2009-02-17	2009-02-17	ENSG00000131263	ENSG00000131263		"""RING-type (C3HC4) zinc fingers"""	13429	protein-coding gene	gene with protein product	"""ring zinc finger protein NY-REN-43antigen"", ""LIM domain interacting ring finger protein"""	300379	"""ring finger protein 12"""	RNF12		10508479	Standard	NM_016120		Approved	NY-REN-43, MGC15161	uc004ebw.3	Q9NVW2	OTTHUMG00000021859	ENST00000332687.6:c.27A>G	X.37:g.73815786T>C			73732511	B2RBQ1|D3DTE0|Q96D38|Q9Y598	Silent	SNP	superfamily_RING/U-box,HMMSmart_SM00184,HMMPfam_zf-C3HC4	p.K9	ENST00000332687.6	37	c.27	CCDS14427.1	X																																																																																			-	NULL		0.378	RLIM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RLIM	protein_coding	OTTHUMT00000057268.1	T	NM_016120		73732511	-1	no_errors	NM_016120	genbank	human	reviewed	54_36p	silent	SNP	1.000	C
YLPM1	56252	genome.wustl.edu	37	14	75287834	75287834	+	Silent	SNP	C	C	T			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr14:75287834C>T	ENST00000552421.1	+	16	4111	c.3987C>T	c.(3985-3987)agC>agT	p.S1329S	YLPM1_ENST00000546901.1_3'UTR|YLPM1_ENST00000325680.7_Silent_p.S2035S|YLPM1_ENST00000238571.3_Silent_p.S1800S			P49750	YLPM1_HUMAN	YLP motif containing 1	1840					regulation of telomere maintenance (GO:0032204)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			breast(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(12)|lung(24)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	62			KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00162)		AAGAGGAAAGCGAACTGGTAG	0.343																																																0			14											69.0	82.0	78.0					14																	75287834		1819	4016	5835	74357587	SO:0001819	synonymous_variant	56252			AK090435	CCDS45135.1	14q24.3	2014-06-13	2004-07-15	2004-07-15	ENSG00000119596	ENSG00000119596			17798	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 169"""		"""chromosome 14 open reading frame 170"""	C14orf170		7596406	Standard	NM_019589		Approved	ZAP, PPP1R169	uc001xqj.4	P49750	OTTHUMG00000172503	ENST00000552421.1:c.3987C>T	14.37:g.75287834C>T			74357587	P49752|Q96I64|Q9P1V7	Silent	SNP	HMMPfam_YLP,superfamily_P-loop containing nucleoside triphosphate hydrolases	p.S2035	ENST00000552421.1	37	c.6105		14	.	.	.	.	.	.	.	.	.	.	C	13.07	2.127033	0.37533	.	.	ENSG00000119596	ENST00000554107	.	.	.	5.54	5.54	0.83059	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-1.5856	7.2335	0.26057	0.0:0.7954:0.0:0.2046	.	.	.	.	X	67	.	.	R	+	1	2	YLPM1	74357587	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.274000	0.43390	2.609000	0.88269	0.655000	0.94253	CGA	-	NULL		0.343	YLPM1-008	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	YLPM1	protein_coding	OTTHUMT00000404450.1	C	NM_019589		74357587	+1	no_errors	NM_019589	genbank	human	validated	54_36p	silent	SNP	1.000	T
CXCL8	3576	genome.wustl.edu	37	4	74607310	74607310	+	Missense_Mutation	SNP	C	C	T			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr4:74607310C>T	ENST00000307407.3	+	2	269	c.116C>T	c.(115-117)aCa>aTa	p.T39I	IL8_ENST00000401931.1_Missense_Mutation_p.T39I	NM_000584.3	NP_000575.1	P10145	IL8_HUMAN		39					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|angiogenesis (GO:0001525)|calcium-mediated signaling (GO:0019722)|cell cycle arrest (GO:0007050)|cellular component movement (GO:0006928)|cellular protein metabolic process (GO:0044267)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to tumor necrosis factor (GO:0071356)|chemotaxis (GO:0006935)|embryonic digestive tract development (GO:0048566)|endoplasmic reticulum unfolded protein response (GO:0030968)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|induction of positive chemotaxis (GO:0050930)|inflammatory response (GO:0006954)|intracellular signal transduction (GO:0035556)|negative regulation of cell proliferation (GO:0008285)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|neutrophil activation (GO:0042119)|neutrophil chemotaxis (GO:0030593)|positive regulation of neutrophil chemotaxis (GO:0090023)|receptor internalization (GO:0031623)|regulation of cell adhesion (GO:0030155)|regulation of single stranded viral RNA replication via double stranded DNA intermediate (GO:0045091)|response to endoplasmic reticulum stress (GO:0034976)|response to molecule of bacterial origin (GO:0002237)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	chemokine activity (GO:0008009)|interleukin-8 receptor binding (GO:0005153)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)|ovary(2)|urinary_tract(1)	6	Breast(15;0.00102)		all cancers(17;0.00169)|Lung(101;0.128)|LUSC - Lung squamous cell carcinoma(112;0.187)	LUSC - Lung squamous cell carcinoma(721;0.008)		TGCATAAAGACATACTCCAAA	0.398																																																0			4											93.0	89.0	90.0					4																	74607310		2203	4300	6503	74826174	SO:0001583	missense	3576																														ENST00000307407.3:c.116C>T	4.37:g.74607310C>T	ENSP00000306512:p.Thr39Ile		74826174	B2R4L8|Q6FGF6|Q6LAE6|Q96RG6|Q9C077|Q9UCE1|Q9UCR8|Q9UCR9|Q9UCS0	Missense_Mutation	SNP	HMMPfam_IL8,superfamily_Interleukin 8-like chemokines,HMMSmart_SM00199,PatternScan_SMALL_CYTOKINES_CXC	p.T39I	ENST00000307407.3	37	c.116	CCDS34005.1	4	.	.	.	.	.	.	.	.	.	.	C	7.131	0.579930	0.13686	.	.	ENSG00000169429	ENST00000307407;ENST00000401931	T;T	0.05258	3.47;3.47	4.96	3.23	0.37069	CXC chemokine, conserved site (1);Chemokine interleukin-8-like domain (3);	0.092492	0.85682	N	0.000000	T	0.06325	0.0163	.	.	.	0.20074	N	0.999939	B;B	0.18166	0.026;0.026	B;B	0.21917	0.037;0.022	T	0.28808	-1.0032	9	0.59425	D	0.04	-11.294	9.3915	0.38376	0.0:0.8224:0.0:0.1776	.	39;39	C9J4T6;P10145	.;IL8_HUMAN	I	39	ENSP00000306512:T39I;ENSP00000385908:T39I	ENSP00000306512:T39I	T	+	2	0	IL8	74826174	0.001000	0.12720	0.005000	0.12908	0.091000	0.18340	0.093000	0.15086	0.613000	0.30089	0.585000	0.79938	ACA	-	HMMPfam_IL8,superfamily_Interleukin 8-like chemokines,HMMSmart_SM00199,PatternScan_SMALL_CYTOKINES_CXC		0.398	IL8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	IL8	protein_coding	OTTHUMT00000322211.1	C			74826174	+1	no_errors	NM_000584	genbank	human	reviewed	54_36p	missense	SNP	0.245	T
HIP1	3092	genome.wustl.edu	37	7	75192534	75192534	+	Silent	SNP	C	C	T			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr7:75192534C>T	ENST00000336926.6	-	10	863	c.837G>A	c.(835-837)ctG>ctA	p.L279L	HIP1_ENST00000434438.2_Silent_p.L279L	NM_005338.5	NP_005329.3	O00291	HIP1_HUMAN	huntingtin interacting protein 1	279					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell differentiation (GO:0030154)|clathrin coat assembly (GO:0048268)|endocytosis (GO:0006897)|positive regulation of receptor-mediated endocytosis (GO:0048260)|regulation of apoptotic process (GO:0042981)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	clathrin-coated vesicle (GO:0030136)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	clathrin binding (GO:0030276)|phosphatidylinositol binding (GO:0035091)|structural constituent of cytoskeleton (GO:0005200)			breast(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(25)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51						TGAAGTACTGCAGGTTGCTGG	0.577			T	PDGFRB	CMML																																		Dom	yes		7	7q11.23	3092	huntingtin interacting protein 1		L	0			7											78.0	72.0	74.0					7																	75192534		2203	4300	6503	75030470	SO:0001819	synonymous_variant	3092			AF052288	CCDS34669.1, CCDS59060.1	7q11.23	2008-07-18			ENSG00000127946	ENSG00000127946			4913	protein-coding gene	gene with protein product		601767				9140394, 9147654	Standard	NM_005338		Approved	ILWEQ	uc003uds.2	O00291	OTTHUMG00000156050	ENST00000336926.6:c.837G>A	7.37:g.75192534C>T			75030470	B4E3I7|E7ES17|O00328|Q2TB58|Q8TDL4	Silent	SNP	HMMPfam_ANTH,superfamily_ENTH/VHS domain,HMMSmart_SM00273,superfamily_ARM repeat,superfamily_I/LWEQ domain (Pfam 01608),HMMSmart_SM00307,HMMPfam_I_LWEQ	p.L279	ENST00000336926.6	37	c.837	CCDS34669.1	7																																																																																			-	HMMPfam_ANTH,superfamily_ARM repeat		0.577	HIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIP1	protein_coding	OTTHUMT00000342863.2	C	NM_005338		75030470	-1	no_errors	NM_005338	genbank	human	reviewed	54_36p	silent	SNP	0.854	T
NDST2	8509	genome.wustl.edu	37	10	75565513	75565513	+	Missense_Mutation	SNP	C	C	A			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr10:75565513C>A	ENST00000309979.6	-	8	2134	c.1578G>T	c.(1576-1578)atG>atT	p.M526I	RP11-574K11.31_ENST00000603027.1_Missense_Mutation_p.M526I|NDST2_ENST00000299641.4_Missense_Mutation_p.M403I			P52849	NDST2_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 2	526	Heparan sulfate N-deacetylase 2.				carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|hydrolase activity (GO:0016787)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(11)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	30	Prostate(51;0.0112)					ACAGATGGGTCATAAAGATGC	0.522																																																0			10											96.0	86.0	90.0					10																	75565513		2203	4300	6503	75235519	SO:0001583	missense	8509			U36601	CCDS7335.1	10q22	2007-03-14			ENSG00000166507	ENSG00000166507		"""Sulfotransferases, membrane-bound"""	7681	protein-coding gene	gene with protein product		603268				9601056	Standard	NM_003635		Approved	NST2, HSST2	uc001jvk.2	P52849	OTTHUMG00000018489	ENST00000309979.6:c.1578G>T	10.37:g.75565513C>A	ENSP00000310657:p.Met526Ile		75235519	Q2TB32|Q59H89	Missense_Mutation	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMPfam_Sulfotransfer_1	p.M526I	ENST00000309979.6	37	c.1578	CCDS7335.1	10	.	.	.	.	.	.	.	.	.	.	C	34	5.399393	0.96030	.	.	ENSG00000166507	ENST00000309979;ENST00000299641	T;T	0.53423	0.88;0.62	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.73466	0.3590	M	0.88704	2.975	0.80722	D	1	D;D;D	0.62365	0.983;0.991;0.962	P;P;P	0.61132	0.718;0.884;0.694	T	0.77558	-0.2543	10	0.87932	D	0	.	20.3854	0.98941	0.0:1.0:0.0:0.0	.	403;196;526	B4E139;B4DQU1;P52849	.;.;NDST2_HUMAN	I	526;403	ENSP00000310657:M526I;ENSP00000299641:M403I	ENSP00000299641:M403I	M	-	3	0	NDST2	75235519	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.818000	0.86416	2.825000	0.97269	0.655000	0.94253	ATG	-	NULL		0.522	NDST2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	NDST2	protein_coding	OTTHUMT00000048710.1	C	NM_003635		75235519	-1	no_errors	NM_003635	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
Unknown	0	genome.wustl.edu	37	3	75720081	75720081	+	IGR	SNP	C	C	T	rs199821754		TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr3:75720081C>T								FRG2C (3710 upstream) : LINC00960 (3482 downstream)																							GACAGAAAAACGGTCTTCTGC	0.582																																																0			3																																								75802771	SO:0001628	intergenic_variant	401074																															3.37:g.75720081C>T			75802771		Missense_Mutation	SNP	NULL	p.T19M		37	c.56		3																																																																																			-	NULL	0	0.582					LOC401074			C			75802771	+1	no_errors	XM_001714392	genbank	human	model	54_36p	missense	SNP	0.000	T
SH2D7	646892	genome.wustl.edu	37	15	78393418	78393418	+	Missense_Mutation	SNP	T	T	A			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr15:78393418T>A	ENST00000328828.5	+	5	823	c.823T>A	c.(823-825)Tcc>Acc	p.S275T	SH2D7_ENST00000409568.2_Missense_Mutation_p.S139T	NM_001101404.1	NP_001094874.1	A6NKC9	SH2D7_HUMAN	SH2 domain containing 7	275										endometrium(2)|kidney(2)|lung(3)	7						CCAGGCCTACTCCCCAGGCAG	0.637																																																0			15											23.0	28.0	26.0					15																	78393418		1940	4135	6075	76180473	SO:0001583	missense	0				CCDS45315.1	15q25.1	2013-02-14			ENSG00000183476	ENSG00000183476		"""SH2 domain containing"""	34549	protein-coding gene	gene with protein product							Standard	NM_001101404		Approved	LOC646892	uc010blb.1	A6NKC9	OTTHUMG00000154271	ENST00000328828.5:c.823T>A	15.37:g.78393418T>A	ENSP00000327846:p.Ser275Thr		76180473		Missense_Mutation	SNP	HMMSmart_SH2,superfamily_SSF55550,HMMPfam_SH2	p.S275T	ENST00000328828.5	37	c.823	CCDS45315.1	15	.	.	.	.	.	.	.	.	.	.	T	15.35	2.807315	0.50421	.	.	ENSG00000183476	ENST00000409568;ENST00000328828	T;T	0.46451	0.87;1.32	4.17	3.04	0.35103	.	0.848992	0.10108	N	0.715005	T	0.42086	0.1187	L	0.34521	1.04	0.09310	N	1	D	0.56968	0.978	P	0.55615	0.78	T	0.17198	-1.0377	10	0.27785	T	0.31	-13.078	6.242	0.20795	0.0:0.1158:0.0:0.8842	.	275	A6NKC9	SH2D7_HUMAN	T	139;275	ENSP00000386676:S139T;ENSP00000327846:S275T	ENSP00000327846:S275T	S	+	1	0	SH2D7	76180473	0.020000	0.18652	0.014000	0.15608	0.445000	0.32107	0.837000	0.27558	0.752000	0.32923	0.459000	0.35465	TCC	-	NULL		0.637	SH2D7-002	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	SH2D7	protein_coding	OTTHUMT00000334660.2	T	NM_001101404		76180473	+1	no_errors	NM_001101404	genbank	human	provisional	54_36p	missense	SNP	0.027	A
RASGRF1	5923	genome.wustl.edu	37	15	79290536	79290536	+	Missense_Mutation	SNP	G	G	C			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr15:79290536G>C	ENST00000419573.3	-	20	3190	c.2916C>G	c.(2914-2916)aaC>aaG	p.N972K	RASGRF1_ENST00000394745.3_Missense_Mutation_p.N188K|RASGRF1_ENST00000558480.2_Missense_Mutation_p.N956K|RASGRF1_ENST00000560334.1_5'UTR	NM_002891.4	NP_002882.3	Q13972	RGRF1_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 1	972					activation of Rac GTPase activity (GO:0032863)|cell proliferation (GO:0008283)|long-term memory (GO:0007616)|neuron projection development (GO:0031175)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of Rac protein signal transduction (GO:0035020)|regulation of Ras protein signal transduction (GO:0046578)|regulation of synaptic plasticity (GO:0048167)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|growth cone (GO:0030426)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(18)|lung(23)|ovary(2)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						TGAGCTCATCGTTGGTCTCAA	0.577																																																0			15											142.0	113.0	123.0					15																	79290536		2196	4293	6489	77077591	SO:0001583	missense	5923			M91815	CCDS10309.1, CCDS42065.1, CCDS45320.1	15q24	2013-01-10			ENSG00000058335	ENSG00000058335		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9875	protein-coding gene	gene with protein product		606600		GRF1		7684828, 1379731	Standard	NM_153815		Approved	CDC25L, CDC25, GRF55, H-GRF55, GNRP, PP13187	uc002beq.3	Q13972	OTTHUMG00000144172	ENST00000419573.3:c.2916C>G	15.37:g.79290536G>C	ENSP00000405963:p.Asn972Lys		77077591	F8VPA5|H0YKF2|J3KQP9|Q16027	Missense_Mutation	SNP	superfamily_PH domain-like,HMMPfam_PH,HMMSmart_SM00233,HMMPfam_IQ,superfamily_DBL homology domain (DH-domain),HMMPfam_RhoGEF,HMMSmart_SM00325,PatternScan_DH_1,superfamily_Ras GEF,HMMSmart_SM00229,HMMPfam_RasGEF_N,HMMSmart_SM00147,HMMPfam_RasGEF,PatternScan_RASGEF	p.N972K	ENST00000419573.3	37	c.2916	CCDS10309.1	15	.	.	.	.	.	.	.	.	.	.	G	5.692	0.312243	0.10789	.	.	ENSG00000058335	ENST00000419573;ENST00000394741;ENST00000394745	T;T	0.31510	1.49;1.49	4.34	-8.68	0.00859	Ras guanine nucleotide exchange factor, domain (1);Ras-like guanine nucleotide exchange factor, N-terminal (1);	0.055954	0.64402	D	0.000002	T	0.38295	0.1035	M	0.62723	1.935	0.29427	N	0.860137	P;P;P;P	0.46784	0.884;0.645;0.696;0.798	P;B;B;B	0.51415	0.669;0.168;0.333;0.428	T	0.65512	-0.6150	10	0.72032	D	0.01	.	19.086	0.93203	0.822:0.0:0.178:0.0	.	368;956;974;956	B7Z6Z6;Q8IUU5;Q13972;F8VPA5	.;.;RGRF1_HUMAN;.	K	972;956;188	ENSP00000405963:N972K;ENSP00000378228:N188K	ENSP00000378224:N956K	N	-	3	2	RASGRF1	77077591	0.002000	0.14202	0.001000	0.08648	0.119000	0.20118	-0.073000	0.11468	-3.154000	0.00230	-2.664000	0.00146	AAC	-	superfamily_Ras GEF,HMMPfam_RasGEF_N,HMMSmart_SM00229		0.577	RASGRF1-001	KNOWN	basic|CCDS	protein_coding	RASGRF1	protein_coding	OTTHUMT00000291371.3	G	NM_002891		77077591	-1	no_errors	NM_002891	genbank	human	reviewed	54_36p	missense	SNP	0.217	C
BRWD3	254065	genome.wustl.edu	37	X	79947320	79947320	+	Splice_Site	SNP	A	A	T			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chrX:79947320A>T	ENST00000373275.4	-	30	3698		c.e30+1		BRWD3_ENST00000473691.1_Splice_Site	NM_153252.4	NP_694984	Q6RI45	BRWD3_HUMAN	bromodomain and WD repeat domain containing 3						cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)					breast(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(39)|ovary(4)|prostate(2)|skin(3)	87						CATTCATCATACCCAGGGAAA	0.438																																																0			X											73.0	62.0	66.0					X																	79947320		2203	4300	6503	79833976	SO:0001630	splice_region_variant	254065				CCDS14447.1	Xq21.1	2013-01-09			ENSG00000165288	ENSG00000165288		"""WD repeat domain containing"""	17342	protein-coding gene	gene with protein product		300553				15543602, 16094372	Standard	NM_153252		Approved	FLJ38568, MRX93	uc004edt.3	Q6RI45	OTTHUMG00000021908	ENST00000373275.4:c.3481+1T>A	X.37:g.79947320A>T			79833976	C9IZ39|C9J3F3|Q2T9J6|Q5JRN1|Q6RI37|Q6RI42|Q6RI44|Q8N916	Splice_Site	SNP	-	e30+2	ENST00000373275.4	37	c.3481+2	CCDS14447.1	X	.	.	.	.	.	.	.	.	.	.	A	19.22	3.786203	0.70337	.	.	ENSG00000165288	ENST00000373275	.	.	.	4.57	4.57	0.56435	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.2229	0.59899	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	BRWD3	79833976	1.000000	0.71417	0.986000	0.45419	0.855000	0.48748	8.761000	0.91691	1.692000	0.51112	0.425000	0.28330	.	-	-		0.438	BRWD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRWD3	protein_coding	OTTHUMT00000057344.1	A	NM_153252	Intron	79833976	-1	no_errors	NM_153252	genbank	human	validated	54_36p	splice_site	SNP	1.000	T
PPFIA2	8499	genome.wustl.edu	37	12	81719569	81719569	+	Nonsense_Mutation	SNP	T	T	A			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr12:81719569T>A	ENST00000549396.1	-	22	2789	c.2629A>T	c.(2629-2631)Aga>Tga	p.R877*	PPFIA2_ENST00000333447.7_Nonsense_Mutation_p.R859*|PPFIA2_ENST00000548586.1_Nonsense_Mutation_p.R877*|PPFIA2_ENST00000549325.1_Nonsense_Mutation_p.R859*|PPFIA2_ENST00000552948.1_Nonsense_Mutation_p.R877*|PPFIA2_ENST00000443686.3_Nonsense_Mutation_p.R778*|PPFIA2_ENST00000541017.1_Nonsense_Mutation_p.R94*|PPFIA2_ENST00000407050.4_Nonsense_Mutation_p.R803*|PPFIA2_ENST00000550584.2_Nonsense_Mutation_p.R877*|PPFIA2_ENST00000541570.2_Nonsense_Mutation_p.R444*|PPFIA2_ENST00000550359.2_Nonsense_Mutation_p.R724*|PPFIA2_ENST00000545296.2_Intron	NM_001220476.1|NM_001282536.1|NM_003625.3	NP_001207405.1|NP_001269465.1|NP_003616.2	O75334	LIPA2_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2	877					cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|presynaptic active zone (GO:0048786)				NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(37)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)	85						TTCTTTAGTCTTCGATCCTTC	0.393																																																0			12											87.0	83.0	84.0					12																	81719569		1810	4074	5884	80243700	SO:0001587	stop_gained	8499			AF034799	CCDS55850.1, CCDS55851.1, CCDS55852.1, CCDS55853.1, CCDS55854.1, CCDS55855.1, CCDS55856.1, CCDS55857.1, CCDS59236.1, CCDS73503.1	12q21.31	2013-01-10						"""Sterile alpha motif (SAM) domain containing"""	9246	protein-coding gene	gene with protein product	"""Liprin-alpha2"""	603143				9624153	Standard	NM_003625		Approved		uc031qis.1	O75334		ENST00000549396.1:c.2629A>T	12.37:g.81719569T>A	ENSP00000450337:p.Arg877*		80243700	B3KVT5|B3KXA0|B7Z2A6|B7Z3U9|B7Z663|B7ZKZ5|E7ERB8|E7ETG6|F8VP68|Q2M3G8	Nonsense_Mutation	SNP	superfamily_SAM/Pointed domain,HMMSmart_SM00454,HMMPfam_SAM_1,HMMPfam_SAM_2	p.R877*	ENST00000549396.1	37	c.2629	CCDS55857.1	12	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	T|T|T	37|37|37	6.511910|6.511910|6.511910	0.97624|0.97624|0.97624	.|.|.	.|.|.	ENSG00000139220|ENSG00000139220|ENSG00000139220	ENST00000550018|ENST00000551147|ENST00000549396;ENST00000549325;ENST00000541570;ENST00000541017;ENST00000407050;ENST00000541501;ENST00000333447;ENST00000548586;ENST00000443686;ENST00000552948	.|.|.	.|.|.	.|.|.	5.83|5.83|5.83	4.64|4.64|4.64	0.57946|0.57946|0.57946	.|.|.	.|.|0.000000	.|.|0.85682	.|.|D	.|.|0.000000	T|T|.	0.33818|0.33818|.	0.0876|0.0876|.	.|.|.	.|.|.	.|.|.	0.80722|0.80722|0.80722	A|A|A	1|1|1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	T|T|.	0.33523|0.33523|.	-0.9865|-0.9865|.	3|3|.	.|.|0.02654	.|.|T	.|.|1	-15.1506|-15.1506|-15.1506	13.495|13.495|13.495	0.61421|0.61421|0.61421	0.0:0.0:0.1384:0.8615|0.0:0.0:0.1384:0.8615|0.0:0.0:0.1384:0.8615	.|.|.	.|.|.	.|.|.	.|.|.	D|M|X	7|39|877;859;444;94;803;888;859;877;778;877	.|.|.	.|.|ENSP00000327416:R859X	E|K|R	-|-|-	3|2|1	2|0|2	PPFIA2|PPFIA2|PPFIA2	80243700|80243700|80243700	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.947000|0.947000|0.947000	0.59692|0.59692|0.59692	3.221000|3.221000|3.221000	0.51215|0.51215|0.51215	2.217000|2.217000|2.217000	0.71921|0.71921|0.71921	0.477000|0.477000|0.477000	0.44152|0.44152|0.44152	GAA|AAG|AGA	-	NULL		0.393	PPFIA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PPFIA2	protein_coding	OTTHUMT00000408030.1	T			80243700	-1	no_errors	NM_003625	genbank	human	reviewed	54_36p	nonsense	SNP	0.998	A
ACOT12	134526	genome.wustl.edu	37	5	80659643	80659643	+	Silent	SNP	G	G	A			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr5:80659643G>A	ENST00000307624.3	-	4	352	c.324C>T	c.(322-324)ttC>ttT	p.F108F	ACOT12_ENST00000513751.1_Silent_p.F108F	NM_130767.2	NP_570123.1	Q8WYK0	ACO12_HUMAN	acyl-CoA thioesterase 12	108	Acyl coenzyme A hydrolase 1.				acetyl-CoA metabolic process (GO:0006084)|acyl-CoA metabolic process (GO:0006637)|fatty acid metabolic process (GO:0006631)|pyruvate metabolic process (GO:0006090)	cytosol (GO:0005829)	acetyl-CoA hydrolase activity (GO:0003986)|ATP binding (GO:0005524)|carboxylic ester hydrolase activity (GO:0052689)|lipid binding (GO:0008289)			cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(7)|ovary(2)	23		Lung NSC(167;0.0176)|all_lung(232;0.0205)|Ovarian(174;0.135)		OV - Ovarian serous cystadenocarcinoma(54;1.37e-45)|Epithelial(54;1.25e-39)|all cancers(79;5.01e-34)		CAAATGTGGAGAAAGCCACAC	0.353																																																0			5											113.0	109.0	110.0					5																	80659643		2203	4300	6503	80695399	SO:0001819	synonymous_variant	134526			AB078619	CCDS4055.1	5q14.1	2011-09-13			ENSG00000172497	ENSG00000172497		"""Acyl CoA thioesterases"", ""StAR-related lipid transfer (START) domain containing"""	24436	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 15"""	614315				16103133, 16940157	Standard	NM_130767		Approved	Cach, THEAL, STARD15	uc003khl.4	Q8WYK0	OTTHUMG00000131305	ENST00000307624.3:c.324C>T	5.37:g.80659643G>A			80695399	B3KVK9|Q5FWE9	Silent	SNP	superfamily_Thioesterase/thiol ester dehydrase-isomerase,HMMPfam_4HBT,superfamily_Bet v1-like,HMMPfam_START	p.F108	ENST00000307624.3	37	c.324	CCDS4055.1	5																																																																																			-	superfamily_Thioesterase/thiol ester dehydrase-isomerase		0.353	ACOT12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACOT12	protein_coding	OTTHUMT00000254074.1	G	NM_130767		80695399	-1	no_errors	NM_130767	genbank	human	validated	54_36p	silent	SNP	1.000	A
HDX	139324	genome.wustl.edu	37	X	83723899	83723899	+	Silent	SNP	G	G	A			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chrX:83723899G>A	ENST00000297977.5	-	3	943	c.832C>T	c.(832-834)Ctg>Ttg	p.L278L	HDX_ENST00000373177.2_Silent_p.L278L|HDX_ENST00000506585.2_Silent_p.L220L	NM_001177479.1|NM_144657.4	NP_001170950.1|NP_653258.2	Q7Z353	HDX_HUMAN	highly divergent homeobox	278						nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(6)|kidney(2)|large_intestine(12)|liver(1)|lung(19)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	48						TTTCCTCCCAGAATTCTCTGG	0.458																																					Pancreas(53;231 1169 36156 43751 51139)											0			X											95.0	90.0	91.0					X																	83723899		2203	4300	6503	83610555	SO:0001819	synonymous_variant	139324			BX538112	CCDS35342.1, CCDS55456.1	Xq21.1	2012-03-09	2007-07-13	2007-07-13	ENSG00000165259	ENSG00000165259		"""Homeoboxes / POU class"""	26411	protein-coding gene	gene with protein product			"""chromosome X open reading frame 43"""	CXorf43			Standard	NM_144657		Approved	FLJ30678	uc004eek.2	Q7Z353	OTTHUMG00000021926	ENST00000297977.5:c.832C>T	X.37:g.83723899G>A			83610555	A8K1Y5|B7ZL18|Q5JZB4|Q96NK7	Silent	SNP	HMMSmart_SM00389,superfamily_Homeodomain-like,HMMPfam_Homeobox	p.L278	ENST00000297977.5	37	c.832	CCDS35342.1	X																																																																																			-	NULL		0.458	HDX-003	KNOWN	basic|appris_principal|CCDS	protein_coding	HDX	protein_coding	OTTHUMT00000057379.2	G	NM_144657		83610555	-1	no_errors	NM_144657	genbank	human	provisional	54_36p	silent	SNP	1.000	A
WDR63	126820	genome.wustl.edu	37	1	85561635	85561635	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr1:85561635G>A	ENST00000294664.6	+	11	1375	c.1195G>A	c.(1195-1197)Gac>Aac	p.D399N	WDR63_ENST00000370596.1_Missense_Mutation_p.D360N|WDR63_ENST00000326813.8_Missense_Mutation_p.D360N	NM_145172.3	NP_660155.2	Q8IWG1	WDR63_HUMAN	WD repeat domain 63	399										NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(13)|ovary(2)|skin(2)|upper_aerodigestive_tract(3)	36				all cancers(265;0.00391)|Epithelial(280;0.00922)|Colorectal(170;0.166)		GAGCCCAGATGACATCTTCTG	0.368																																																0			1											159.0	155.0	156.0					1																	85561635		2203	4300	6503	85334223	SO:0001583	missense	126820				CCDS702.1, CCDS72818.1	1p22.3	2014-02-21	2013-02-19	2013-02-19	ENSG00000162643	ENSG00000162643		"""WD repeat domain containing"""	30711	protein-coding gene	gene with protein product						21953912	Standard	XM_005270438		Approved	DIC3, FLJ30067, NYD-SP29	uc001dkt.3	Q8IWG1	OTTHUMG00000009953	ENST00000294664.6:c.1195G>A	1.37:g.85561635G>A	ENSP00000294664:p.Asp399Asn		85334223	A8K988|Q96L72|Q96NU4	Missense_Mutation	SNP	superfamily_WD40 repeat-like,HMMSmart_SM00320,HMMPfam_WD40,PatternScan_WD_REPEATS_1	p.D399N	ENST00000294664.6	37	c.1195	CCDS702.1	1	.	.	.	.	.	.	.	.	.	.	G	34	5.343842	0.95807	.	.	ENSG00000162643	ENST00000370596;ENST00000326813;ENST00000294664	T;T;T	0.46063	0.88;0.88;0.88	5.65	5.65	0.86999	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.67785	0.2930	M	0.88640	2.97	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.991	T	0.72833	-0.4173	10	0.62326	D	0.03	-17.5067	19.728	0.96172	0.0:0.0:1.0:0.0	.	360;399	Q8IWG1-2;Q8IWG1	.;WDR63_HUMAN	N	360;360;399	ENSP00000359628:D360N;ENSP00000317463:D360N;ENSP00000294664:D399N	ENSP00000294664:D399N	D	+	1	0	WDR63	85334223	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.769000	0.91742	2.662000	0.90505	0.585000	0.79938	GAC	-	superfamily_WD40 repeat-like,HMMSmart_SM00320,HMMPfam_WD40		0.368	WDR63-002	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR63	protein_coding	OTTHUMT00000027565.2	G	NM_145172		85334223	+1	no_errors	NM_145172	genbank	human	validated	54_36p	missense	SNP	1.000	A
IGKV2D-26	28884	genome.wustl.edu	37	2	90025289	90025289	+	RNA	SNP	G	G	T			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr2:90025289G>T	ENST00000390268.2	+	0	167									immunoglobulin kappa variable 2D-26																		TGCAGGTCTAGTCAGAGCCTC	0.502																																																0			2																																								89662590			0			X12689		2p11.2	2012-02-08			ENSG00000211623	ENSG00000211623		"""Immunoglobulins / IGK locus"""	5798	other	immunoglobulin gene							Standard	NG_000833		Approved				OTTHUMG00000151606		2.37:g.90025289G>T			89662590		Missense_Mutation	SNP	HMMPfam_V-set,superfamily_SSF48726,HMMSmart_IGv	p.S46I	ENST00000390268.2	37	c.137		2																																																																																			-	HMMPfam_V-set,superfamily_SSF48726,HMMSmart_IGv		0.502	IGKV2D-26-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	ENSG00000211623	IG_V_gene	OTTHUMT00000323278.2	G	NG_000833		89662590	+1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000390268	ensembl	human	known	54_36p	missense	SNP	0.834	T
TIGD2	166815	genome.wustl.edu	37	4	90035332	90035332	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr4:90035332G>A	ENST00000317005.2	+	1	1365	c.1207G>A	c.(1207-1209)Gga>Aga	p.G403R	RP11-84C13.1_ENST00000603357.1_lincRNA|FAM13A_ENST00000502459.1_5'Flank	NM_145715.2	NP_663761.1	Q4W5G0	TIGD2_HUMAN	tigger transposable element derived 2	403						nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	14		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;3.86e-05)		CATTGATGAAGGAGCCATTTT	0.383																																																0			4											93.0	93.0	93.0					4																	90035332		2203	4300	6503	90254355	SO:0001583	missense	166815			AK027653	CCDS3633.1	4q21.3	2013-02-21			ENSG00000180346	ENSG00000180346			18333	protein-coding gene	gene with protein product		612973					Standard	NM_145715		Approved		uc003hsk.3	Q4W5G0	OTTHUMG00000130946	ENST00000317005.2:c.1207G>A	4.37:g.90035332G>A	ENSP00000317170:p.Gly403Arg		90254355		Missense_Mutation	SNP	HMMPfam_CENP-B_N,superfamily_Homeodomain_like,HMMPfam_CenpB-DNA-bind,HMMSmart_CENPB,HMMPfam_DDE	p.G403R	ENST00000317005.2	37	c.1207	CCDS3633.1	4	.	.	.	.	.	.	.	.	.	.	G	10.83	1.462098	0.26248	.	.	ENSG00000180346	ENST00000317005	T	0.23147	1.92	4.56	2.69	0.31865	.	0.000000	0.41823	D	0.000814	T	0.15132	0.0365	L	0.34521	1.04	0.28612	N	0.908592	P	0.46064	0.872	B	0.40165	0.321	T	0.08452	-1.0721	10	0.13853	T	0.58	-7.5249	7.5101	0.27569	0.0:0.1816:0.6309:0.1875	.	403	Q4W5G0	TIGD2_HUMAN	R	403	ENSP00000317170:G403R	ENSP00000317170:G403R	G	+	1	0	TIGD2	90254355	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.103000	0.31062	1.103000	0.41568	0.460000	0.39030	GGA	-	NULL		0.383	TIGD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIGD2	protein_coding	OTTHUMT00000253545.2	G	NM_145715		90254355	+1	no_errors	NM_145715	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
ACTA2	59	genome.wustl.edu	37	10	90694661	90694661	+	IGR	SNP	A	A	G			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr10:90694661A>G	ENST00000458208.1	-	0	1756				ACTA2-AS1_ENST00000437930.4_RNA|STAMBPL1_ENST00000371927.3_Intron	NM_001141945.1	NP_001135417.1	P62736	ACTA_HUMAN	actin, alpha 2, smooth muscle, aorta						glomerular mesangial cell development (GO:0072144)|muscle contraction (GO:0006936)|regulation of blood pressure (GO:0008217)|response to virus (GO:0009615)|vascular smooth muscle contraction (GO:0014829)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|smooth muscle contractile fiber (GO:0030485)	ATP binding (GO:0005524)|protein kinase binding (GO:0019901)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|skin(1)|urinary_tract(2)	17		Colorectal(252;0.0161)		Colorectal(12;0.000123)|COAD - Colon adenocarcinoma(12;0.00018)		ACAGAACCGAAGTGCAGCTCC	0.403											OREG0020356	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				0			10																																								90684641	SO:0001628	intergenic_variant	0			X13839	CCDS7392.1	10q23.31	2014-09-17			ENSG00000107796	ENSG00000107796			130	protein-coding gene	gene with protein product		102620				2398629	Standard	NM_001141945		Approved	ACTSA	uc001kfp.3	P62736	OTTHUMG00000018700		10.37:g.90694661A>G		1276	90684641	B2R8A4|P03996|P04108|Q6FI19	Missense_Mutation	SNP	NULL	p.S126G	ENST00000458208.1	37	c.376	CCDS7392.1	10																																																																																			-	NULL		0.403	ACTA2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC100132116	protein_coding	OTTHUMT00000049264.1	A	NM_001613		90684641	+1	no_errors	XM_001724437	genbank	human	model	54_36p	missense	SNP	0.001	G
ALG2	85365	genome.wustl.edu	37	9	101980334	101980334	+	Missense_Mutation	SNP	C	C	G	rs376229898		TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr9:101980334C>G	ENST00000476832.1	-	2	1194	c.1133G>C	c.(1132-1134)cGt>cCt	p.R378P	ALG2_ENST00000319033.6_Missense_Mutation_p.R285P	NM_033087.3	NP_149078.1	O75340	PDCD6_HUMAN	ALG2, alpha-1,3/1,6-mannosyltransferase	0					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|cellular response to heat (GO:0034605)|intracellular protein transport (GO:0006886)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of TOR signaling (GO:0032007)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|proteolysis (GO:0006508)|response to calcium ion (GO:0051592)|vascular endothelial growth factor receptor-2 signaling pathway (GO:0036324)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	binding, bridging (GO:0060090)|calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|calcium-dependent protein binding (GO:0048306)|protein dimerization activity (GO:0046983)			breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(11)|ovary(2)|prostate(2)	22		Acute lymphoblastic leukemia(62;0.0559)				GGAAGGTTCACGGATGAACTT	0.488																																																0			9											103.0	106.0	105.0					9																	101980334		2203	4300	6503	101020155	SO:0001583	missense	85365			AK027417	CCDS6739.1	9q31.1	2013-02-22	2013-02-22		ENSG00000119523	ENSG00000119523	2.4.1.132, 2.4.1.257	"""Glycosyltransferase group 1 domain containing"""	23159	protein-coding gene	gene with protein product		607905	"""asparagine-linked glycosylation 2 homolog (yeast, alpha-1,3-mannosyltransferase)"", ""asparagine-linked glycosylation 2, alpha-1,3-mannosyltransferase homolog (S. cerevisiae)"""			12684507	Standard	NR_024532		Approved	CDGIi, FLJ14511, hALPG2, NET38	uc004azf.3	Q9H553	OTTHUMG00000020355	ENST00000476832.1:c.1133G>C	9.37:g.101980334C>G	ENSP00000417764:p.Arg378Pro		101020155	B2RD16|E7ESR3|Q2YDC2|Q5TZS0	Missense_Mutation	SNP	superfamily_UDP-Glycosyltransferase/glycogen phosphorylase,HMMPfam_Glycos_transf_1	p.R378P	ENST00000476832.1	37	c.1133	CCDS6739.1	9	.	.	.	.	.	.	.	.	.	.	C	14.12	2.439346	0.43326	.	.	ENSG00000119523	ENST00000476832;ENST00000319033	T;T	0.76839	-1.05;-1.05	5.87	-1.21	0.09524	Glycosyl transferase, family 1 (1);	0.528955	0.22209	N	0.063125	T	0.78929	0.4361	M	0.62266	1.93	0.26640	N	0.9723	P;P	0.49635	0.926;0.506	P;B	0.54499	0.754;0.418	T	0.72228	-0.4354	10	0.34782	T	0.22	-16.6618	11.1905	0.48681	0.0:0.4574:0.0:0.5426	.	285;378	Q9H553-2;Q9H553	.;ALG2_HUMAN	P	378;285	ENSP00000417764:R378P;ENSP00000326609:R285P	ENSP00000432675:R285P	R	-	2	0	ALG2	101020155	0.010000	0.17322	0.209000	0.23619	0.995000	0.86356	-0.198000	0.09505	-0.020000	0.14032	-0.290000	0.09829	CGT	-	superfamily_UDP-Glycosyltransferase/glycogen phosphorylase,HMMPfam_Glycos_transf_1		0.488	ALG2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ALG2	protein_coding	OTTHUMT00000215080.1	C	NM_033087		101020155	-1	no_errors	NM_033087	genbank	human	reviewed	54_36p	missense	SNP	0.067	G
MSANTD3	91283	genome.wustl.edu	37	9	103213045	103213045	+	Missense_Mutation	SNP	C	C	A			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr9:103213045C>A	ENST00000395067.2	+	3	896	c.625C>A	c.(625-627)Caa>Aaa	p.Q209K	TMEFF1_ENST00000334943.6_Intron|MSANTD3_ENST00000489377.1_3'UTR|MSANTD3-TMEFF1_ENST00000502978.1_Intron	NM_001198805.1|NM_001198806.1|NM_080655.2	NP_001185734.1|NP_001185735.1|NP_542386.1	Q96H12	MSD3_HUMAN	Myb/SANT-like DNA-binding domain containing 3	209										endometrium(2)|lung(2)	4						GTCCATCTTACAACTGCAACT	0.418																																																0			9											89.0	74.0	79.0					9																	103213045		2203	4300	6503	102252866	SO:0001583	missense	91283			BC008993	CCDS6749.1, CCDS56579.1	9q31.1	2012-03-13	2012-03-13	2012-03-13	ENSG00000066697	ENSG00000066697			23370	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 30"""	C9orf30			Standard	NM_080655		Approved	MGC17337		Q96H12	OTTHUMG00000020365	ENST00000395067.2:c.625C>A	9.37:g.103213045C>A	ENSP00000378506:p.Gln209Lys		102252866	B2RC35|Q5T726|Q5T727|Q5T728	Missense_Mutation	SNP	NULL	p.Q209K	ENST00000395067.2	37	c.625	CCDS6749.1	9	.	.	.	.	.	.	.	.	.	.	C	17.47	3.397604	0.62177	.	.	ENSG00000066697	ENST00000395067	.	.	.	5.55	5.55	0.83447	.	.	.	.	.	T	0.44912	0.1316	N	0.08118	0	0.80722	D	1	P	0.34587	0.458	B	0.39152	0.292	T	0.48570	-0.9024	8	0.42905	T	0.14	-11.5384	18.5024	0.90887	0.0:1.0:0.0:0.0	.	209	Q96H12	CI030_HUMAN	K	209	.	ENSP00000378506:Q209K	Q	+	1	0	C9orf30	102252866	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.623000	0.54224	2.604000	0.88044	0.467000	0.42956	CAA	-	NULL		0.418	MSANTD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf30	protein_coding	OTTHUMT00000053410.1	C	NM_080655		102252866	+1	no_errors	NM_080655	genbank	human	predicted	54_36p	missense	SNP	1.000	A
SORCS3	22986	genome.wustl.edu	37	10	106675593	106675593	+	Missense_Mutation	SNP	C	C	T			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr10:106675593C>T	ENST00000369701.3	+	3	925	c.698C>T	c.(697-699)tCg>tTg	p.S233L		NM_014978.1	NP_055793.1	Q9UPU3	SORC3_HUMAN	sortilin-related VPS10 domain containing receptor 3	233					learning (GO:0007612)|memory (GO:0007613)|neuropeptide signaling pathway (GO:0007218)|regulation of long term synaptic depression (GO:1900452)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal postsynaptic density (GO:0097481)	neuropeptide receptor activity (GO:0008188)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(19)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	131		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)		ACCTGCAGGTCGACAGATTAT	0.463																																					NSCLC(116;1497 1690 7108 13108 14106)											0			10											128.0	114.0	119.0					10																	106675593		2203	4300	6503	106665583	SO:0001583	missense	22986			AB028982	CCDS7558.1	10q23-q25	2006-04-12			ENSG00000156395	ENSG00000156395			16699	protein-coding gene	gene with protein product		606285				11499680	Standard	NM_014978		Approved	KIAA1059, SORCS	uc001kyi.1	Q9UPU3	OTTHUMG00000019011	ENST00000369701.3:c.698C>T	10.37:g.106675593C>T	ENSP00000358715:p.Ser233Leu		106665583	Q5VXF9|Q9NQJ2	Missense_Mutation	SNP	superfamily_SSF110296,HMMSmart_VPS10,HMMPfam_PKD,superfamily_PKD	p.S233L	ENST00000369701.3	37	c.698	CCDS7558.1	10	.	.	.	.	.	.	.	.	.	.	C	29.7	5.031940	0.93575	.	.	ENSG00000156395	ENST00000369701	T	0.34472	1.36	5.49	5.49	0.81192	VPS10 (1);	0.148318	0.47093	D	0.000259	T	0.56499	0.1989	L	0.46157	1.445	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	T	0.57682	-0.7769	10	0.87932	D	0	.	19.369	0.94477	0.0:1.0:0.0:0.0	.	233	Q9UPU3	SORC3_HUMAN	L	233	ENSP00000358715:S233L	ENSP00000358715:S233L	S	+	2	0	SORCS3	106665583	1.000000	0.71417	0.990000	0.47175	0.972000	0.66771	7.481000	0.81124	2.573000	0.86826	0.655000	0.94253	TCG	-	superfamily_SSF110296,HMMSmart_VPS10		0.463	SORCS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SORCS3	protein_coding	OTTHUMT00000050221.1	C	NM_014978		106665583	+1	no_errors	NM_014978	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
SLC44A1	23446	genome.wustl.edu	37	9	108127850	108127850	+	Missense_Mutation	SNP	C	C	G			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr9:108127850C>G	ENST00000374720.3	+	11	1587	c.1340C>G	c.(1339-1341)tCt>tGt	p.S447C	SLC44A1_ENST00000374723.1_Missense_Mutation_p.S447C|SLC44A1_ENST00000374724.1_Missense_Mutation_p.S447C|SLC44A1_ENST00000343170.7_Missense_Mutation_p.S239C	NM_080546.3	NP_536856.2	Q8WWI5	CTL1_HUMAN	solute carrier family 44 (choline transporter), member 1	447					choline transport (GO:0015871)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)	choline transmembrane transporter activity (GO:0015220)			breast(4)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(16)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	38					Choline(DB00122)	GCAAAAGGATCTTTCATTATC	0.363																																																0			9											126.0	116.0	119.0					9																	108127850		2203	4300	6503	107167671	SO:0001583	missense	23446			AJ420812	CCDS6763.1, CCDS75868.1	9q31.2	2014-01-28	2013-07-17	2005-09-06	ENSG00000070214	ENSG00000070214		"""CD molecules"", ""Solute carriers"""	18798	protein-coding gene	gene with protein product		606105	"""CDW92 antigen"""	CDW92		11698453, 10677542	Standard	NM_080546		Approved	CDw92, CTL1, CHTL1, CD92	uc004bcn.3	Q8WWI5	OTTHUMG00000020421	ENST00000374720.3:c.1340C>G	9.37:g.108127850C>G	ENSP00000363852:p.Ser447Cys		107167671	A6NLZ9|Q5VUB3|Q8WVB0|Q96KU3|Q9NY69	Missense_Mutation	SNP	HMMPfam_DUF580	p.S447C	ENST00000374720.3	37	c.1340	CCDS6763.1	9	.	.	.	.	.	.	.	.	.	.	C	31	5.081504	0.94050	.	.	ENSG00000070214	ENST00000374723;ENST00000374720;ENST00000374724;ENST00000343170	T;T;T;T	0.58652	0.32;0.32;0.32;0.32	5.82	5.82	0.92795	.	0.163418	0.56097	D	0.000033	D	0.82683	0.5090	M	0.92219	3.285	0.80722	D	1	D;D;D	0.67145	0.996;0.996;0.992	D;D;D	0.72625	0.978;0.978;0.924	D	0.86061	0.1532	10	0.87932	D	0	-9.3178	20.1064	0.97896	0.0:1.0:0.0:0.0	.	447;447;447	Q8WWI5-3;Q8WWI5-2;Q8WWI5	.;.;CTL1_HUMAN	C	447;447;447;239	ENSP00000363855:S447C;ENSP00000363852:S447C;ENSP00000363856:S447C;ENSP00000341856:S239C	ENSP00000341856:S239C	S	+	2	0	SLC44A1	107167671	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.818000	0.86416	2.745000	0.94114	0.650000	0.86243	TCT	-	HMMPfam_DUF580		0.363	SLC44A1-003	KNOWN	alternative_3_UTR|basic|appris_candidate_longest|CCDS	protein_coding	SLC44A1	protein_coding	OTTHUMT00000053500.1	C	NM_080546		107167671	+1	no_errors	NM_080546	genbank	human	validated	54_36p	missense	SNP	1.000	G
TMEM119	338773	genome.wustl.edu	37	12	108985969	108985969	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr12:108985969G>A	ENST00000392806.3	-	2	359	c.191C>T	c.(190-192)cCc>cTc	p.P64L		NM_181724.2	NP_859075.2	Q4V9L6	TM119_HUMAN	transmembrane protein 119	64					osteoblast differentiation (GO:0001649)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				large_intestine(2)|lung(3)|ovary(1)|skin(1)	7						CATCGATGTGGGGCTGAGGGC	0.682																																																0			12											28.0	34.0	32.0					12																	108985969		2203	4299	6502	107510098	SO:0001583	missense	338773			AK075501	CCDS9119.1	12q23.3	2014-02-12				ENSG00000183160			27884	protein-coding gene	gene with protein product						12975309	Standard	NM_181724		Approved		uc001tng.3	Q4V9L6		ENST00000392806.3:c.191C>T	12.37:g.108985969G>A	ENSP00000376553:p.Pro64Leu		107510098	Q6UXE5|Q8N2F5	Missense_Mutation	SNP	NULL	p.P64L	ENST00000392806.3	37	c.191	CCDS9119.1	12	.	.	.	.	.	.	.	.	.	.	G	12.38	1.919897	0.33908	.	.	ENSG00000183160	ENST00000392806;ENST00000549031	T;T	0.57595	0.39;0.4	4.6	1.5	0.22942	.	0.530450	0.18762	N	0.131858	T	0.45538	0.1347	M	0.65975	2.015	0.48185	D	0.999603	B	0.14012	0.009	B	0.14578	0.011	T	0.34502	-0.9826	10	0.38643	T	0.18	-7.5003	6.464	0.21971	0.1656:0.1473:0.6871:0.0	.	64	Q4V9L6	TM119_HUMAN	L	64	ENSP00000376553:P64L;ENSP00000448583:P64L	ENSP00000376553:P64L	P	-	2	0	TMEM119	107510098	1.000000	0.71417	0.996000	0.52242	0.092000	0.18411	2.804000	0.47931	0.495000	0.27882	0.407000	0.27541	CCC	-	NULL		0.682	TMEM119-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM119	protein_coding	OTTHUMT00000403900.1	G	NM_181724		107510098	-1	no_errors	NM_181724	genbank	human	validated	54_36p	missense	SNP	0.998	A
RANBP2	5903	genome.wustl.edu	37	2	109369927	109369927	+	Missense_Mutation	SNP	G	G	C			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr2:109369927G>C	ENST00000283195.6	+	14	2089	c.1963G>C	c.(1963-1965)Gct>Cct	p.A655P		NM_006267.4	NP_006258.3	P49792	RBP2_HUMAN	RAN binding protein 2	655					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of glucokinase activity (GO:0033132)|protein folding (GO:0006457)|protein import into nucleus (GO:0006606)|protein sumoylation (GO:0016925)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)	ligase activity (GO:0016874)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|Ran GTPase binding (GO:0008536)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)		RANBP2/ALK(34)	NS(1)|biliary_tract(1)|breast(3)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(21)|large_intestine(19)|lung(51)|pancreas(1)|prostate(8)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	129						CATAACTTTTGCTATATTGGA	0.318																																																0			2											18.0	21.0	20.0					2																	109369927		1452	2641	4093	108736359	SO:0001583	missense	5903			D42063	CCDS2079.1	2q13	2013-11-14			ENSG00000153201	ENSG00000153201		"""Tetratricopeptide (TTC) repeat domain containing"""	9848	protein-coding gene	gene with protein product		601181	"""acute necrotizing encephalopathy 1 (autosomal dominant)"""	ANE1		7724562, 19118815	Standard	NM_006267		Approved	NUP358, ADANE	uc002tem.4	P49792	OTTHUMG00000130981	ENST00000283195.6:c.1963G>C	2.37:g.109369927G>C	ENSP00000283195:p.Ala655Pro		108736359	Q13074|Q15280|Q53TE2|Q59FH7	Missense_Mutation	SNP	superfamily_SSF48452,HMMPfam_TPR_1,superfamily_SSF50729,HMMSmart_RanBD,HMMPfam_Ran_BP1,HMMPfam_zf-RanBP,HMMSmart_ZnF_RBZ,PatternScan_ZF_RANBP2_1,superfamily_CSA_PPIase,HMMPfam_Pro_isomerase,PatternScan_CSA_PPIASE_1	p.A655P	ENST00000283195.6	37	c.1963	CCDS2079.1	2	.	.	.	.	.	.	.	.	.	.	G	21.0	4.076503	0.76415	.	.	ENSG00000153201	ENST00000409491;ENST00000283195	T	0.50001	0.76	4.92	4.92	0.64577	.	.	.	.	.	T	0.68329	0.2989	M	0.69823	2.125	0.36883	D	0.889529	D	0.89917	1.0	D	0.71414	0.973	T	0.76421	-0.2965	9	0.87932	D	0	-15.3546	18.0933	0.89480	0.0:0.0:1.0:0.0	.	655	P49792	RBP2_HUMAN	P	655	ENSP00000283195:A655P	ENSP00000283195:A655P	A	+	1	0	RANBP2	108736359	1.000000	0.71417	0.997000	0.53966	0.981000	0.71138	5.253000	0.65452	2.432000	0.82394	0.650000	0.86243	GCT	-	NULL		0.318	RANBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RANBP2	protein_coding	OTTHUMT00000253594.1	G	NM_006267		108736359	+1	no_errors	NM_006267	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
RGAG1	57529	genome.wustl.edu	37	X	109696544	109696544	+	Missense_Mutation	SNP	C	C	A			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chrX:109696544C>A	ENST00000465301.2	+	3	2945	c.2699C>A	c.(2698-2700)cCa>cAa	p.P900Q	RGAG1_ENST00000540313.1_Missense_Mutation_p.P900Q	NM_020769.2	NP_065820.1	Q8NET4	RGAG1_HUMAN	retrotransposon gag domain containing 1	900								p.P900Q(1)		NS(1)|autonomic_ganglia(1)|breast(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	73						GTGTCCTCACCACTAGTAAGA	0.537																																																1	Substitution - Missense(1)	lung(1)	X											99.0	102.0	101.0					X																	109696544		2200	4294	6494	109583200	SO:0001583	missense	57529			AY121804	CCDS14552.1	Xq23	2008-02-05			ENSG00000243978	ENSG00000243978			29245	protein-coding gene	gene with protein product						10718198, 15716091, 16093683	Standard	NM_020769		Approved	KIAA1318, Mart9, Mar9	uc004eor.2	Q8NET4	OTTHUMG00000022196	ENST00000465301.2:c.2699C>A	X.37:g.109696544C>A	ENSP00000419786:p.Pro900Gln		109583200	Q9P2M8	Missense_Mutation	SNP	HMMPfam_Retrotrans_gag	p.P900Q	ENST00000465301.2	37	c.2699	CCDS14552.1	X	.	.	.	.	.	.	.	.	.	.	C	17.61	3.432186	0.62844	.	.	ENSG00000243978	ENST00000465301;ENST00000540313	T;T	0.57907	0.37;0.37	4.19	2.42	0.29668	.	0.542706	0.13978	N	0.349696	T	0.60971	0.2310	M	0.68593	2.085	0.09310	N	1	D	0.55385	0.971	P	0.58454	0.839	T	0.49254	-0.8959	9	.	.	.	-2.2552	5.5825	0.17258	0.0:0.7468:0.0:0.2532	.	900	Q8NET4	RGAG1_HUMAN	Q	900	ENSP00000419786:P900Q;ENSP00000441452:P900Q	.	P	+	2	0	RGAG1	109583200	0.002000	0.14202	0.001000	0.08648	0.648000	0.38561	1.122000	0.31295	0.530000	0.28619	0.513000	0.50165	CCA	-	NULL		0.537	RGAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGAG1	protein_coding	OTTHUMT00000057906.2	C	NM_020769		109583200	+1	no_errors	NM_020769	genbank	human	provisional	54_36p	missense	SNP	0.049	A
KCNC4	3749	genome.wustl.edu	37	1	110766384	110766384	+	Missense_Mutation	SNP	A	A	G			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr1:110766384A>G	ENST00000369787.3	+	2	1504	c.1477A>G	c.(1477-1479)Aag>Gag	p.K493E	KCNC4_ENST00000412512.2_Intron|KCNC4_ENST00000413138.3_Missense_Mutation_p.K493E|KCNC4_ENST00000438661.2_Missense_Mutation_p.K493E	NM_004978.4	NP_004969.2	Q03721	KCNC4_HUMAN	potassium voltage-gated channel, Shaw-related subfamily, member 4	493					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of neurotransmitter secretion (GO:0046928)|synaptic transmission (GO:0007268)	axon terminus (GO:0043679)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|liver(2)|lung(11)|ovary(1)|skin(2)	32		all_cancers(81;9.88e-06)|all_epithelial(167;3.23e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0238)|all cancers(265;0.0693)|Epithelial(280;0.0748)|Colorectal(144;0.112)|LUSC - Lung squamous cell carcinoma(189;0.135)		CAAGAAACGGAAGAAGCACGT	0.617																																																0			1											93.0	93.0	93.0					1																	110766384		2203	4300	6503	110567907	SO:0001583	missense	3749			BC101769	CCDS821.1, CCDS44193.1	1p21	2012-07-05			ENSG00000116396	ENSG00000116396		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6236	protein-coding gene	gene with protein product		176265	"""chromosome 1 open reading frame 30"""	C1orf30		1920536, 1740329, 16382104	Standard	NM_004978		Approved	Kv3.4, HKSHIIIC	uc001dzh.3	Q03721	OTTHUMG00000011037	ENST00000369787.3:c.1477A>G	1.37:g.110766384A>G	ENSP00000358802:p.Lys493Glu		110567907	Q3MIM4|Q5TBI6	Missense_Mutation	SNP	superfamily_POZ domain,HMMSmart_SM00225,HMMPfam_K_tetra,superfamily_Voltage-gated potassium channels,HMMPfam_Ion_trans	p.K493E	ENST00000369787.3	37	c.1477	CCDS821.1	1	.	.	.	.	.	.	.	.	.	.	A	15.55	2.867711	0.51588	.	.	ENSG00000116396	ENST00000369787;ENST00000413138;ENST00000438661	D;D;D	0.97352	-4.35;-4.35;-4.35	4.89	4.89	0.63831	.	0.000000	0.85682	D	0.000000	D	0.95943	0.8679	M	0.64997	1.995	0.52099	D	0.999944	B;B;D	0.54047	0.112;0.037;0.964	B;B;P	0.61477	0.082;0.054;0.889	D	0.94750	0.7926	10	0.10636	T	0.68	.	10.8685	0.46869	0.9226:0.0:0.0774:0.0	.	493;493;493	Q03721;Q03721-3;Q03721-2	KCNC4_HUMAN;.;.	E	493	ENSP00000358802:K493E;ENSP00000388029:K493E;ENSP00000393655:K493E	ENSP00000358802:K493E	K	+	1	0	KCNC4	110567907	1.000000	0.71417	0.886000	0.34754	0.962000	0.63368	7.528000	0.81941	1.960000	0.56953	0.379000	0.24179	AAG	-	superfamily_Voltage-gated potassium channels		0.617	KCNC4-004	KNOWN	basic|CCDS	protein_coding	KCNC4	protein_coding	OTTHUMT00000052146.2	A	NM_001039574		110567907	+1	no_errors	NM_004978	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
KCNV1	27012	genome.wustl.edu	37	8	110984852	110984852	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr8:110984852G>A	ENST00000524391.1	-	3	1658	c.626C>T	c.(625-627)gCc>gTc	p.A209V	RP11-696P8.2_ENST00000530667.1_RNA|KCNV1_ENST00000297404.1_Missense_Mutation_p.A209V			Q6PIU1	KCNV1_HUMAN	potassium channel, subfamily V, member 1	209					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|ion channel inhibitor activity (GO:0008200)|potassium channel regulator activity (GO:0015459)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(20)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	37	all_neural(195;0.219)		OV - Ovarian serous cystadenocarcinoma(57;5.35e-13)			AAAGATACGGGCAGCTGTGGA	0.517																																																0			8											97.0	90.0	92.0					8																	110984852		2203	4300	6503	111054028	SO:0001583	missense	27012			AF167082	CCDS6314.1	8q23.2	2011-07-05				ENSG00000164794		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18861	protein-coding gene	gene with protein product		608164				8670833, 16382104	Standard	NM_014379		Approved	Kv8.1	uc003ynr.4	Q6PIU1		ENST00000524391.1:c.626C>T	8.37:g.110984852G>A	ENSP00000435954:p.Ala209Val		111054028	Q9UHJ4	Missense_Mutation	SNP	superfamily_POZ domain,HMMSmart_SM00225,HMMPfam_K_tetra,superfamily_Voltage-gated potassium channels,HMMPfam_Ion_trans	p.A209V	ENST00000524391.1	37	c.626	CCDS6314.1	8	.	.	.	.	.	.	.	.	.	.	G	24.2	4.505936	0.85282	.	.	ENSG00000164794	ENST00000524391;ENST00000297404;ENST00000545728	D;D	0.97598	-4.45;-4.45	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	D	0.98036	0.9353	M	0.81942	2.565	0.58432	D	0.999996	D	0.67145	0.996	P	0.57679	0.825	D	0.98894	1.0774	10	0.87932	D	0	.	18.0477	0.89337	0.0:0.0:1.0:0.0	.	209	Q6PIU1	KCNV1_HUMAN	V	209;209;85	ENSP00000435954:A209V;ENSP00000297404:A209V	ENSP00000297404:A209V	A	-	2	0	KCNV1	111054028	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	6.565000	0.73974	2.499000	0.84300	0.557000	0.71058	GCC	-	superfamily_Voltage-gated potassium channels		0.517	KCNV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNV1	protein_coding	OTTHUMT00000385525.1	G	NM_014379		111054028	-1	no_errors	NM_014379	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
XPNPEP1	7511	genome.wustl.edu	37	10	111625033	111625033	+	Missense_Mutation	SNP	T	T	G			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr10:111625033T>G	ENST00000502935.1	-	21	2029	c.1910A>C	c.(1909-1911)gAt>gCt	p.D637A	XPNPEP1_ENST00000369683.1_Missense_Mutation_p.D523A|XPNPEP1_ENST00000369680.4_Missense_Mutation_p.D594A|XPNPEP1_ENST00000322238.8_Missense_Mutation_p.D613A					X-prolyl aminopeptidase (aminopeptidase P) 1, soluble											endometrium(2)|kidney(9)|large_intestine(4)|lung(9)|ovary(3)|pancreas(2)|skin(1)|urinary_tract(1)	31		Breast(234;0.174)		Epithelial(162;1.64e-05)|all cancers(201;0.000564)|BRCA - Breast invasive adenocarcinoma(275;0.0721)		CCCAATCACATCCCTGCAGGT	0.498																																																0			10											132.0	113.0	120.0					10																	111625033		2203	4300	6503	111615023	SO:0001583	missense	7511				CCDS7560.1, CCDS7560.2, CCDS53576.1	10q25.3	2006-01-16	2002-07-17		ENSG00000108039	ENSG00000108039	3.4.11.9		12822	protein-coding gene	gene with protein product		602443	"""X-prolyl aminopeptidase (aminopeptidase P)-like"""	XPNPEP, XPNPEPL1, XPNPEPL			Standard	NM_020383		Approved		uc001kyp.2	Q9NQW7	OTTHUMG00000019029	ENST00000502935.1:c.1910A>C	10.37:g.111625033T>G	ENSP00000421566:p.Asp637Ala		111615023		Missense_Mutation	SNP	HMMPfam_Creatinase_N,superfamily_Creatinase/aminopeptidase,HMMPfam_Peptidase_M24,PatternScan_PROLINE_PEPTIDASE	p.D594A	ENST00000502935.1	37	c.1781	CCDS7560.2	10	.	.	.	.	.	.	.	.	.	.	T	17.15	3.316690	0.60524	.	.	ENSG00000108039	ENST00000502935;ENST00000369683;ENST00000322238;ENST00000369680	.	.	.	5.06	5.06	0.68205	.	0.169418	0.51477	D	0.000094	T	0.53769	0.1817	L	0.38175	1.15	0.50467	D	0.99987	B;B	0.09022	0.002;0.002	B;B	0.20184	0.028;0.01	T	0.53251	-0.8465	9	0.56958	D	0.05	-11.3839	13.4174	0.60976	0.0:0.0:0.0:1.0	.	637;594	G5E9Y2;Q9NQW7	.;XPP1_HUMAN	A	637;523;613;594	.	ENSP00000324011:D613A	D	-	2	0	XPNPEP1	111615023	1.000000	0.71417	0.947000	0.38551	0.989000	0.77384	7.430000	0.80321	1.914000	0.55421	0.533000	0.62120	GAT	-	NULL		0.498	XPNPEP1-015	KNOWN	basic|CCDS	protein_coding	XPNPEP1	protein_coding	OTTHUMT00000050264.2	T			111615023	-1	no_errors	NM_020383	genbank	human	provisional	54_36p	missense	SNP	0.995	G
OAS3	4940	genome.wustl.edu	37	12	113384554	113384554	+	Missense_Mutation	SNP	C	C	G			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr12:113384554C>G	ENST00000228928.7	+	4	822	c.643C>G	c.(643-645)Cta>Gta	p.L215V	OAS3_ENST00000546638.1_3'UTR|RP1-71H24.1_ENST00000552784.1_RNA	NM_006187.2	NP_006178.2	Q9Y6K5	OAS3_HUMAN	2'-5'-oligoadenylate synthetase 3, 100kDa	215	OAS domain 1.				cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of viral genome replication (GO:0045071)|nucleobase-containing compound metabolic process (GO:0006139)|regulation of ribonuclease activity (GO:0060700)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	2'-5'-oligoadenylate synthetase activity (GO:0001730)|ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(8)|lung(6)|ovary(1)|skin(2)	27						ACAGGTGTGCCTACAGGGGTT	0.592																																																0			12											25.0	28.0	27.0					12																	113384554		2138	4259	6397	111868937	SO:0001583	missense	4940			AF063613	CCDS44981.1	12q24.2	2008-05-02	2002-08-29			ENSG00000111331			8088	protein-coding gene	gene with protein product		603351	"""2'-5'-oligoadenylate synthetase 3 (100 kD)"""			9790745	Standard	NM_006187		Approved		uc001tug.3	Q9Y6K5	OTTHUMG00000169795	ENST00000228928.7:c.643C>G	12.37:g.113384554C>G	ENSP00000228928:p.Leu215Val		111868937	Q2HJ14|Q9H3P5	Missense_Mutation	SNP	superfamily_Nucleotidyltransferase,PatternScan_25A_SYNTH_1,HMMPfam_OAS1_C,superfamily_PAP/OAS1 substrate-binding domain,PatternScan_25A_SYNTH_2,HMMPfam_NTP_transf_2	p.L215V	ENST00000228928.7	37	c.643	CCDS44981.1	12	.	.	.	.	.	.	.	.	.	.	C	9.149	1.015745	0.19355	.	.	ENSG00000111331	ENST00000228928;ENST00000323881	T	0.42131	0.98	3.83	0.726	0.18248	-oligoadenylate synthetase 1, domain 2/C-terminal (2);-5&apos (2);2&apos (2);	.	.	.	.	T	0.21962	0.0529	N	0.14661	0.345	0.09310	N	1	B	0.16802	0.019	B	0.17433	0.018	T	0.21999	-1.0229	9	0.62326	D	0.03	.	2.1686	0.03844	0.2019:0.4869:0.1964:0.1148	.	215	Q9Y6K5	OAS3_HUMAN	V	215	ENSP00000228928:L215V	ENSP00000228928:L215V	L	+	1	2	OAS3	111868937	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	-0.261000	0.08694	0.026000	0.15269	-0.176000	0.13171	CTA	-	HMMPfam_OAS1_C,superfamily_PAP/OAS1 substrate-binding domain		0.592	OAS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OAS3	protein_coding	OTTHUMT00000405920.1	C			111868937	+1	no_errors	NM_006187	genbank	human	reviewed	54_36p	missense	SNP	0.001	G
APC	324	genome.wustl.edu	37	5	112174469	112174469	+	Missense_Mutation	SNP	A	A	G			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr5:112174469A>G	ENST00000457016.1	+	16	3558	c.3178A>G	c.(3178-3180)Ata>Gta	p.I1060V	CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000257430.4_Missense_Mutation_p.I1060V|APC_ENST00000508376.2_Missense_Mutation_p.I1060V			P25054	APC_HUMAN	adenomatous polyposis coli	1060	Responsible for down-regulation through a process mediated by direct ubiquitination.|Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		AGAAGATGAAATAAAACAAAG	0.358		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	1	Unknown(1)	skin(1)	5											69.0	66.0	67.0					5																	112174469		2202	4300	6502	112202368	SO:0001583	missense	324	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.3178A>G	5.37:g.112174469A>G	ENSP00000413133:p.Ile1060Val		112202368	D3DT03|Q15162|Q15163|Q93042	Missense_Mutation	SNP	superfamily_ARM repeat,HMMSmart_SM00185,HMMPfam_Arm,HMMPfam_APC_15aa,HMMPfam_APC_crr,HMMPfam_SAMP,HMMPfam_APC_basic,HMMPfam_EB1_binding	p.I1060V	ENST00000457016.1	37	c.3178	CCDS4107.1	5	.	.	.	.	.	.	.	.	.	.	A	9.673	1.147349	0.21288	.	.	ENSG00000134982	ENST00000457016;ENST00000507379;ENST00000257430;ENST00000508376;ENST00000512211	D;D;D;D;D	0.93133	-2.43;-3.17;-2.43;-2.43;-2.61	5.61	4.38	0.52667	.	0.396562	0.31519	N	0.007503	D	0.83709	0.5313	N	0.14661	0.345	0.29512	N	0.854168	B;B	0.17465	0.022;0.022	B;B	0.12156	0.007;0.007	T	0.68428	-0.5411	10	0.02654	T	1	-8.2844	12.3737	0.55269	0.8594:0.1406:0.0:0.0	.	1062;1060	Q4LE70;P25054	.;APC_HUMAN	V	1060;1042;1060;1060;1060	ENSP00000413133:I1060V;ENSP00000423224:I1042V;ENSP00000257430:I1060V;ENSP00000427089:I1060V;ENSP00000423828:I1060V	ENSP00000257430:I1060V	I	+	1	0	APC	112202368	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.606000	0.54095	2.146000	0.66826	0.533000	0.62120	ATA	-	NULL		0.358	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	APC	protein_coding	OTTHUMT00000250738.2	A	NM_000038		112202368	+1	no_errors	NM_000038	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
CDC16	8881	genome.wustl.edu	37	13	115011486	115011486	+	Missense_Mutation	SNP	C	C	G			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr13:115011486C>G	ENST00000356221.3	+	10	967	c.859C>G	c.(859-861)Ctt>Gtt	p.L287V	CDC16_ENST00000360383.3_Missense_Mutation_p.L287V|CDC16_ENST00000375308.1_Missense_Mutation_p.L193V|CDC16_ENST00000252457.5_Missense_Mutation_p.L286V|CDC16_ENST00000252458.6_Missense_Mutation_p.L193V|CDC16_ENST00000375310.1_Missense_Mutation_p.L193V|CDC16_ENST00000375312.3_Missense_Mutation_p.L193V|MIR548AR_ENST00000582191.1_RNA			Q13042	CDC16_HUMAN	cell division cycle 16	287					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of mitosis (GO:0007088)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|spindle (GO:0005819)				endometrium(3)|kidney(2)|large_intestine(5)|liver(2)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22	Lung NSC(43;0.00299)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0191)|all_epithelial(44;0.00716)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.238)	BRCA - Breast invasive adenocarcinoma(86;0.0886)			ACTTTTCTATCTTTCTCATAA	0.269																																																0			13											148.0	136.0	140.0					13																	115011486		2201	4297	6498	114029588	SO:0001583	missense	8881			U18291	CCDS9542.2	13q34	2013-01-17	2013-01-17		ENSG00000130177	ENSG00000130177		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1720	protein-coding gene	gene with protein product	"""anaphase-promoting complex, subunit 6"""	603461	"""CDC16 (cell division cycle 16, S. cerevisiae, homolog)"", ""CDC16 cell division cycle 16 homolog (S. cerevisiae)"", ""cell division cycle 16 homolog (S. cerevisiae)"""			7736578	Standard	NM_001078645		Approved	APC6, ANAPC6, CUT9	uc001vul.1	Q13042	OTTHUMG00000017402	ENST00000356221.3:c.859C>G	13.37:g.115011486C>G	ENSP00000348554:p.Leu287Val		114029588	A2A365|Q5T8C8|Q96AE6|Q9Y564	Missense_Mutation	SNP	superfamily_TPR-like,HMMPfam_TPR_1,HMMSmart_SM00028	p.L287V	ENST00000356221.3	37	c.859	CCDS9542.2	13	.	.	.	.	.	.	.	.	.	.	C	17.01	3.278400	0.59758	.	.	ENSG00000130177	ENST00000360383;ENST00000375312;ENST00000356221;ENST00000375310;ENST00000252457;ENST00000375308;ENST00000252458	T;T;T;T;T	0.53857	0.6;0.6;0.6;0.6;0.6	6.04	6.04	0.98038	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	T	0.54095	0.1837	L	0.28115	0.83	0.80722	D	1	D;D;P	0.56746	0.965;0.977;0.915	P;P;B	0.51999	0.671;0.687;0.276	T	0.44221	-0.9342	9	.	.	.	-8.7327	20.5948	0.99439	0.0:1.0:0.0:0.0	.	286;286;287	Q13042-3;Q13042-2;Q13042	.;.;CDC16_HUMAN	V	287;193;287;193;286;193;193	ENSP00000353549:L287V;ENSP00000348554:L287V;ENSP00000364459:L193V;ENSP00000252457:L286V;ENSP00000364457:L193V	.	L	+	1	0	CDC16	114029588	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.497000	0.73674	2.873000	0.98535	0.563000	0.77884	CTT	-	superfamily_TPR-like		0.269	CDC16-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CDC16	protein_coding	OTTHUMT00000276737.1	C	NM_003903		114029588	+1	no_errors	NM_001078645	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
HABP2	3026	genome.wustl.edu	37	10	115343116	115343116	+	Splice_Site	SNP	T	T	C			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr10:115343116T>C	ENST00000351270.3	+	10	1332	c.1236T>C	c.(1234-1236)atT>atC	p.I412I	HABP2_ENST00000542051.1_Splice_Site_p.I386I|HABP2_ENST00000541666.1_3'UTR	NM_004132.3	NP_004123.1	Q14520	HABP2_HUMAN	hyaluronan binding protein 2	412	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cell adhesion (GO:0007155)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	glycosaminoglycan binding (GO:0005539)|serine-type endopeptidase activity (GO:0004252)			breast(2)|endometrium(1)|kidney(1)|large_intestine(5)|lung(8)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)	23		Colorectal(252;0.0233)|Breast(234;0.0672)		Epithelial(162;0.00319)|all cancers(201;0.0112)	Hyaluronan(DB08818)	ACAATGATATTGGCAAGTTCC	0.428																																																0			10											94.0	93.0	94.0					10																	115343116		2203	4300	6503	115333106	SO:0001630	splice_region_variant	3026				CCDS7577.1, CCDS53579.1	10q25.3	2008-08-01	2001-11-28		ENSG00000148702	ENSG00000148702			4798	protein-coding gene	gene with protein product	"""plasma hyaluronan binding protein"", ""factor VII activating protein"""	603924	"""hyaluronan-binding protein 2"""			8827452, 12437095	Standard	NM_004132		Approved	HABP, PHBP, HGFAL, FSAP	uc001lai.4	Q14520	OTTHUMG00000019073	ENST00000351270.3:c.1237+1T>C	10.37:g.115343116T>C			115333106	A8K467|B7Z8U5|F5H5M6|O00663	Silent	SNP	superfamily_EGF/Laminin,HMMSmart_SM00179,HMMSmart_SM00181,HMMPfam_EGF,PatternScan_EGF_1,PatternScan_EGF_2,superfamily_Kringle-like,HMMSmart_SM00130,HMMPfam_Kringle,PatternScan_KRINGLE_1,superfamily_Trypsin-like serine proteases,HMMSmart_SM00020,HMMPfam_Trypsin,PatternScan_TRYPSIN_HIS,PatternScan_TRYPSIN_SER	p.I412	ENST00000351270.3	37	c.1236	CCDS7577.1	10																																																																																			-	superfamily_Trypsin-like serine proteases,HMMSmart_SM00020,HMMPfam_Trypsin		0.428	HABP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HABP2	protein_coding	OTTHUMT00000050428.1	T	NM_004132	Silent	115333106	+1	no_errors	NM_004132	genbank	human	reviewed	54_36p	silent	SNP	0.966	C
CXCR5	643	genome.wustl.edu	37	11	118764862	118764862	+	Silent	SNP	C	C	G			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr11:118764862C>G	ENST00000292174.4	+	2	785	c.609C>G	c.(607-609)acC>acG	p.T203T	BCL9L_ENST00000334801.3_3'UTR	NM_001716.4|NM_032966.2	NP_001707.1|NP_116743.1	P32302	CXCR5_HUMAN	chemokine (C-X-C motif) receptor 5	203					B cell activation (GO:0042113)|cellular component movement (GO:0006928)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|lymph node development (GO:0048535)|positive regulation of cytokinesis (GO:0032467)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-X-C chemokine receptor activity (GO:0016494)|G-protein coupled receptor activity (GO:0004930)			breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(5)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.103)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.62e-05)		CACGTTGCACCTTCTCCCAAG	0.577																																																0			11											79.0	64.0	69.0					11																	118764862		2200	4295	6495	118270072	SO:0001819	synonymous_variant	643			X68829	CCDS8402.1	11q23.3	2012-08-08	2008-01-22	2008-01-22	ENSG00000160683	ENSG00000160683		"""CD molecules"", ""GPCR / Class A : Chemokine receptors : C-X-C motif"""	1060	protein-coding gene	gene with protein product		601613	"""Burkitt lymphoma receptor 1, GTP-binding protein"", ""Burkitt lymphoma receptor 1, GTP binding protein (chemokine (C-X-C motif) receptor 5)"""	BLR1		1425907	Standard	NM_001716		Approved	MDR15, CD185	uc001pue.4	P32302	OTTHUMG00000166345	ENST00000292174.4:c.609C>G	11.37:g.118764862C>G			118270072	Q14811	Silent	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.T158	ENST00000292174.4	37	c.474	CCDS8402.1	11																																																																																			-	superfamily_SSF81321,HMMPfam_7tm_1		0.577	CXCR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CXCR5	protein_coding	OTTHUMT00000389309.1	C	NM_001716		118270072	+1	no_errors	NM_032966	genbank	human	reviewed	54_36p	silent	SNP	0.003	G
WDR3	10885	genome.wustl.edu	37	1	118484436	118484436	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr1:118484436G>A	ENST00000349139.5	+	9	1002	c.955G>A	c.(955-957)Gat>Aat	p.D319N		NM_006784.2	NP_006775.1	Q9UNX4	WDR3_HUMAN	WD repeat domain 3	319						nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(2)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(9)|liver(2)|lung(22)|prostate(2)|upper_aerodigestive_tract(1)	49	Esophageal squamous(2;0.162)	all_cancers(81;2.72e-05)|Acute lymphoblastic leukemia(138;1e-08)|all_epithelial(167;4.4e-07)|all_lung(203;1.7e-06)|Lung NSC(69;1.98e-05)|Prostate(1639;0.00955)|Breast(1374;0.244)		OV - Ovarian serous cystadenocarcinoma(397;1.39e-08)|Epithelial(280;1.82e-07)|all cancers(265;2.04e-05)|Lung(183;0.0525)|BRCA - Breast invasive adenocarcinoma(282;0.0695)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.185)		GAAGAAAATGGATAAGAAGAT	0.348																																																0			1											81.0	79.0	80.0					1																	118484436		2203	4298	6501	118285959	SO:0001583	missense	10885			AF083217	CCDS898.1	1p12	2013-01-09			ENSG00000065183	ENSG00000065183		"""WD repeat domain containing"""	12755	protein-coding gene	gene with protein product		604737				10395803	Standard	NM_006784		Approved	FLJ12796, UTP12, DIP2	uc010oxe.1	Q9UNX4	OTTHUMG00000012197	ENST00000349139.5:c.955G>A	1.37:g.118484436G>A	ENSP00000308179:p.Asp319Asn		118285959		Missense_Mutation	SNP	superfamily_WD40 repeat-like,HMMSmart_SM00320,HMMPfam_WD40,PatternScan_WD_REPEATS_1,HMMPfam_Utp12	p.D319N	ENST00000349139.5	37	c.955	CCDS898.1	1	.	.	.	.	.	.	.	.	.	.	G	14.23	2.474382	0.43942	.	.	ENSG00000065183	ENST00000349139	T	0.51574	0.7	5.18	5.18	0.71444	WD40-repeat-containing domain (1);	0.205394	0.50627	D	0.000110	T	0.24044	0.0582	L	0.43152	1.355	0.80722	D	1	P	0.34462	0.454	B	0.23275	0.045	T	0.08027	-1.0742	10	0.18276	T	0.48	-20.7796	19.0357	0.92976	0.0:0.0:1.0:0.0	.	319	Q9UNX4	WDR3_HUMAN	N	319	ENSP00000308179:D319N	ENSP00000308179:D319N	D	+	1	0	WDR3	118285959	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	5.994000	0.70623	2.559000	0.86315	0.650000	0.86243	GAT	-	NULL		0.348	WDR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR3	protein_coding	OTTHUMT00000033720.2	G	NM_006784		118285959	+1	no_errors	NM_006784	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
ADAM30	11085	genome.wustl.edu	37	1	120437780	120437780	+	Missense_Mutation	SNP	C	C	T			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr1:120437780C>T	ENST00000369400.1	-	1	1338	c.1180G>A	c.(1180-1182)Gga>Aga	p.G394R		NM_021794.3	NP_068566.2	Q9UKF2	ADA30_HUMAN	ADAM metallopeptidase domain 30	394					binding of sperm to zona pellucida (GO:0007339)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(11)|lung(16)|ovary(2)|skin(2)	38	all_cancers(5;7.07e-10)|all_epithelial(5;1.62e-10)|all_neural(166;0.153)|Breast(55;0.234)	all_lung(203;1.55e-06)|Lung NSC(69;1.04e-05)|all_epithelial(167;0.00138)		Lung(183;0.0204)|LUSC - Lung squamous cell carcinoma(189;0.117)		TAACCTAGTCCTGGGATATTA	0.418																																																0			1											126.0	131.0	129.0					1																	120437780		2203	4300	6503	120239303	SO:0001583	missense	11085			AF171932	CCDS907.1	1p12	2012-05-16	2005-08-18		ENSG00000134249	ENSG00000134249		"""ADAM metallopeptidase domain containing"""	208	protein-coding gene	gene with protein product		604779	"""a disintegrin and metalloproteinase domain 30"""				Standard	NM_021794		Approved	svph4	uc001eij.3	Q9UKF2	OTTHUMG00000012176	ENST00000369400.1:c.1180G>A	1.37:g.120437780C>T	ENSP00000358407:p.Gly394Arg		120239303	A8K8W8|Q5T3X6|Q9UKF1	Missense_Mutation	SNP	"HMMPfam_Pep_M12B_propep,superfamily_Metalloproteases (""zincins"") catalytic domain,HMMPfam_Reprolysin,HMMPfam_Disintegrin,HMMSmart_SM00050,superfamily_Blood coagulation inhibitor (disintegrin),PatternScan_DISINTEGRIN_1,HMMSmart_SM00608,HMMPfam_ADAM_CR,PatternScan_EGF_2"	p.G394R	ENST00000369400.1	37	c.1180	CCDS907.1	1	.	.	.	.	.	.	.	.	.	.	C	7.798	0.713000	0.15306	.	.	ENSG00000134249	ENST00000369400;ENST00000543066	T	0.01178	5.22	4.88	2.94	0.34122	Metallopeptidase, catalytic domain (1);	0.638340	0.13710	N	0.368162	T	0.00384	0.0012	L	0.37561	1.115	0.09310	N	1	B	0.16396	0.017	B	0.17098	0.017	T	0.43523	-0.9386	10	0.14656	T	0.56	.	7.0008	0.24809	0.0:0.7846:0.0:0.2154	.	394	Q9UKF2	ADA30_HUMAN	R	394	ENSP00000358407:G394R	ENSP00000358407:G394R	G	-	1	0	ADAM30	120239303	0.115000	0.22152	0.024000	0.17045	0.080000	0.17528	0.347000	0.20014	1.241000	0.43820	0.563000	0.77884	GGA	-	NULL		0.418	ADAM30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM30	protein_coding	OTTHUMT00000033678.1	C	NM_021794		120239303	-1	no_errors	NM_021794	genbank	human	reviewed	54_36p	missense	SNP	0.373	T
CD80	941	genome.wustl.edu	37	3	119256071	119256071	+	Missense_Mutation	SNP	C	C	A			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr3:119256071C>A	ENST00000264246.3	-	4	975	c.613G>T	c.(613-615)Gat>Tat	p.D205Y	CD80_ENST00000383669.3_Missense_Mutation_p.D205Y|CD80_ENST00000478182.1_Missense_Mutation_p.D205Y|CD80_ENST00000383668.3_Intron	NM_005191.3	NP_005182.1	P33681	CD80_HUMAN	CD80 molecule	205	Ig-like C2-type.				cell-cell signaling (GO:0007267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of granulocyte macrophage colony-stimulating factor biosynthetic process (GO:0045425)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of signal transduction (GO:0009967)|positive regulation of T-helper 1 cell differentiation (GO:0045627)|positive regulation of transcription, DNA-templated (GO:0045893)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)|viral process (GO:0016032)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	coreceptor activity (GO:0015026)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|upper_aerodigestive_tract(2)	12					Abatacept(DB01281)|Belatacept(DB06681)	ATATTGAAATCCAGTTTGCTG	0.403																																					Melanoma(132;135 1764 1806 5833 14593)											0			3											223.0	193.0	203.0					3																	119256071		2203	4300	6503	120738761	SO:0001583	missense	941				CCDS2989.1	3q13.3-q21	2013-01-11	2006-03-31		ENSG00000121594	ENSG00000121594		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"""	1700	protein-coding gene	gene with protein product	"""B-lymphocyte activation antigen B7"""	112203	"""CD80 antigen (CD28 antigen ligand 1, B7-1 antigen)"", ""CD80 molecule """	CD28LG, CD28LG1		1370389	Standard	NM_005191		Approved	B7.1, B7-1	uc003ecq.3	P33681	OTTHUMG00000159419	ENST00000264246.3:c.613G>T	3.37:g.119256071C>A	ENSP00000264246:p.Asp205Tyr		120738761	Q5DTA9|Q5DTB0	Missense_Mutation	SNP	HMMSmart_SM00409,superfamily_Immunoglobulin,HMMPfam_V-set,HMMPfam_C2-set_2	p.D205Y	ENST00000264246.3	37	c.613	CCDS2989.1	3	.	.	.	.	.	.	.	.	.	.	C	11.48	1.650447	0.29336	.	.	ENSG00000121594	ENST00000264246;ENST00000478182;ENST00000383669	T;T;T	0.76186	-1.0;-1.0;-1.0	5.19	3.41	0.39046	CD80-like, immunoglobulin C2-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.528716	0.17383	N	0.176221	D	0.83566	0.5282	M	0.80028	2.48	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.76071	0.985;0.987	T	0.81165	-0.1057	10	0.54805	T	0.06	-9.3437	6.3274	0.21251	0.0:0.597:0.291:0.1121	.	205;205	Q5DTB0;P33681	.;CD80_HUMAN	Y	205	ENSP00000264246:D205Y;ENSP00000418364:D205Y;ENSP00000373165:D205Y	ENSP00000264246:D205Y	D	-	1	0	CD80	120738761	0.950000	0.32346	0.946000	0.38457	0.040000	0.13550	0.451000	0.21779	0.759000	0.33084	-0.145000	0.13849	GAT	-	superfamily_Immunoglobulin,HMMPfam_C2-set_2		0.403	CD80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD80	protein_coding	OTTHUMT00000355196.1	C	NM_005191		120738761	-1	no_errors	NM_005191	genbank	human	validated	54_36p	missense	SNP	0.763	A
DNAH10	196385	genome.wustl.edu	37	12	124377947	124377947	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr12:124377947G>A	ENST00000409039.3	+	52	8834	c.8809G>A	c.(8809-8811)Ggg>Agg	p.G2937R		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	2937	AAA 4. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		GTCGCCAGTGGGGGACACCCT	0.577																																																0			12											62.0	66.0	65.0					12																	124377947		2011	4185	6196	122943900	SO:0001583	missense	196385			AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.8809G>A	12.37:g.124377947G>A	ENSP00000386770:p.Gly2937Arg		122943900	C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Missense_Mutation	SNP	HMMPfam_DHC_N1,HMMPfam_DHC_N2,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00382,HMMPfam_AAA_5,HMMPfam_Dynein_heavy	p.G2937R	ENST00000409039.3	37	c.8809	CCDS9255.2	12	.	.	.	.	.	.	.	.	.	.	G	28.7	4.947080	0.92593	.	.	ENSG00000197653	ENST00000409039	T	0.60548	0.18	4.7	4.7	0.59300	Dynein heavy chain, P-loop containing D4 domain (1);	0.000000	0.64402	U	0.000001	D	0.85344	0.5675	H	0.98199	4.17	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.91002	0.4843	10	0.87932	D	0	.	18.1884	0.89799	0.0:0.0:1.0:0.0	.	2937	Q8IVF4	DYH10_HUMAN	R	2937	ENSP00000386770:G2937R	ENSP00000386770:G2937R	G	+	1	0	DNAH10	122943900	1.000000	0.71417	0.984000	0.44739	0.855000	0.48748	9.522000	0.98032	2.621000	0.88768	0.561000	0.74099	GGG	-	NULL		0.577	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH10	protein_coding	OTTHUMT00000335420.3	G			122943900	+1	no_errors	ENST00000409039	ensembl	human	known	54_36p	missense	SNP	1.000	A
KIAA1109	84162	genome.wustl.edu	37	4	123225953	123225953	+	Splice_Site	SNP	G	G	C			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr4:123225953G>C	ENST00000264501.4	+	56	9860	c.9487G>C	c.(9487-9489)Ggt>Cgt	p.G3163R	KIAA1109_ENST00000455637.1_Splice_Site_p.G3163R|KIAA1109_ENST00000388738.3_Splice_Site_p.G3163R			Q2LD37	K1109_HUMAN	KIAA1109	3163					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						AATCTGCTAGGGTATTCAAGT	0.338																																																0			4											90.0	82.0	85.0					4																	123225953		1837	4086	5923	123445403	SO:0001630	splice_region_variant	84162			AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.9487-1G>C	4.37:g.123225953G>C			123445403	Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Missense_Mutation	SNP	PatternScan_ASP_PROTEASE,HMMPfam_FSA_C	p.G3163R	ENST00000264501.4	37	c.9487	CCDS43267.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.04|14.04	2.417455|2.417455	0.42918|0.42918	.|.	.|.	ENSG00000138688|ENSG00000138688	ENST00000419325|ENST00000264501;ENST00000388738;ENST00000455637	.|T;T;T	.|0.16073	.|2.37;2.37;2.37	5.81|5.81	5.81|5.81	0.92471|0.92471	.|.	0.000000|0.000000	0.85682|0.85682	D|D	0.000000|0.000000	T|T	0.31638|0.31638	0.0803|0.0803	N|N	0.25890|0.25890	0.77|0.77	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.97110	.|1.0;0.999	T|T	0.01524|0.01524	-1.1333|-1.1333	6|9	.|.	.|.	.|.	.|.	20.081|20.081	0.97775|0.97775	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|3163;3163	.|Q2LD37-6;Q2LD37	.|.;K1109_HUMAN	A|R	1120|3163	.|ENSP00000264501:G3163R;ENSP00000373390:G3163R;ENSP00000389925:G3163R	.|.	G|G	+|+	2|1	0|0	KIAA1109|KIAA1109	123445403|123445403	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.954000|0.954000	0.61252|0.61252	9.713000|9.713000	0.98740|0.98740	2.753000|2.753000	0.94483|0.94483	0.555000|0.555000	0.69702|0.69702	GGG|GGT	-	NULL		0.338	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1109	protein_coding	OTTHUMT00000316415.1	G	NM_020797	Missense_Mutation	123445403	+1	no_errors	NM_015312	genbank	human	validated	54_36p	missense	SNP	1.000	C
SEMA5B	54437	genome.wustl.edu	37	3	122641231	122641231	+	Nonsense_Mutation	SNP	G	G	A			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr3:122641231G>A	ENST00000357599.3	-	11	1722	c.1336C>T	c.(1336-1338)Cag>Tag	p.Q446*	SEMA5B_ENST00000451055.2_Nonsense_Mutation_p.Q500*|SEMA5B_ENST00000195173.4_Nonsense_Mutation_p.Q446*	NM_001031702.3|NM_001256348.1	NP_001026872.2|NP_001243277.1	Q9P283	SEM5B_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5B	446	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(13)|lung(26)|ovary(2)|pancreas(3)|skin(2)|upper_aerodigestive_tract(3)	55				GBM - Glioblastoma multiforme(114;0.0367)		AAGAGGCGCTGCGCGTCCTGC	0.701																																																0			3											30.0	29.0	29.0					3																	122641231		2203	4300	6503	124123921	SO:0001587	stop_gained	54437			AB040878	CCDS35491.1, CCDS58848.1, CCDS74995.1	3q21.1	2008-07-18			ENSG00000082684	ENSG00000082684		"""Semaphorins"""	10737	protein-coding gene	gene with protein product		609298		SEMAG		8817451	Standard	NM_001256346		Approved	SemG, KIAA1445, FLJ10372	uc031sbm.1	Q9P283	OTTHUMG00000140392	ENST00000357599.3:c.1336C>T	3.37:g.122641231G>A	ENSP00000350215:p.Gln446*		124123921	A8K5U2|B7Z393|F8W9U8|Q6DD89|Q6UY12|Q9NW17	Nonsense_Mutation	SNP	superfamily_Sema domain,HMMPfam_Sema,HMMSmart_SM00630,HMMPfam_PSI,HMMSmart_SM00423,superfamily_Plexin repeat,superfamily_TSP-1 type 1 repeat,HMMSmart_SM00209,HMMPfam_TSP_1	p.Q446*	ENST00000357599.3	37	c.1336	CCDS35491.1	3	.	.	.	.	.	.	.	.	.	.	G	42	9.684846	0.99238	.	.	ENSG00000082684	ENST00000357599;ENST00000195173;ENST00000418793;ENST00000451055;ENST00000393583	.	.	.	5.29	5.29	0.74685	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.41790	T	0.15	.	18.0865	0.89458	0.0:0.0:1.0:0.0	.	.	.	.	X	446;446;388;500;446	.	ENSP00000195173:Q446X	Q	-	1	0	SEMA5B	124123921	1.000000	0.71417	0.964000	0.40570	0.966000	0.64601	9.589000	0.98235	2.759000	0.94783	0.591000	0.81541	CAG	-	superfamily_Sema domain,HMMPfam_Sema,HMMSmart_SM00630		0.701	SEMA5B-001	KNOWN	basic|CCDS	protein_coding	SEMA5B	protein_coding	OTTHUMT00000277165.1	G	NM_001031702		124123921	-1	no_errors	NM_001031702	genbank	human	validated	54_36p	nonsense	SNP	1.000	A
DCAF12L2	340578	genome.wustl.edu	37	X	125299587	125299587	+	Silent	SNP	G	G	A			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chrX:125299587G>A	ENST00000360028.2	-	1	347	c.321C>T	c.(319-321)aaC>aaT	p.N107N	DCAF12L2_ENST00000538699.1_Silent_p.N107N			Q5VW00	DC122_HUMAN	DDB1 and CUL4 associated factor 12-like 2	107										NS(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(36)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(3)	64						CCTGCCTGGCGTTCAGCCACT	0.647																																																0			X											70.0	62.0	65.0					X																	125299587		2203	4300	6503	125127268	SO:0001819	synonymous_variant	340578			AL445072	CCDS43991.1	Xq25	2013-01-09	2009-07-17	2009-07-17	ENSG00000198354	ENSG00000198354		"""WD repeat domain containing"""	32950	protein-coding gene	gene with protein product			"""WD repeat domain 40C"""	WDR40C			Standard	NM_001013628		Approved		uc004euk.2	Q5VW00	OTTHUMG00000022348	ENST00000360028.2:c.321C>T	X.37:g.125299587G>A			125127268	B2RN42	Silent	SNP	PatternScan_WD_REPEATS_1,superfamily_WD40_like,HMMSmart_WD40,HMMPfam_WD40	p.N107	ENST00000360028.2	37	c.321	CCDS43991.1	X																																																																																			-	superfamily_WD40_like		0.647	DCAF12L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR40C	protein_coding	OTTHUMT00000058181.1	G	NM_001013628		125127268	-1	no_errors	NM_001013628	genbank	human	provisional	54_36p	silent	SNP	1.000	A
PLXNA4	91584	genome.wustl.edu	37	7	131910930	131910930	+	Missense_Mutation	SNP	C	C	T			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr7:131910930C>T	ENST00000359827.3	-	8	2934	c.1972G>A	c.(1972-1974)Gtc>Atc	p.V658I	PLXNA4_ENST00000321063.4_Missense_Mutation_p.V658I			Q9HCM2	PLXA4_HUMAN	plexin A4	658	PSI 2.				anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						GAATTGTGGACGCTGCAATTG	0.517																																																0			7											137.0	137.0	137.0					7																	131910930		1985	4169	6154	131561470	SO:0001583	missense	91584			AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.1972G>A	7.37:g.131910930C>T	ENSP00000352882:p.Val658Ile		131561470	A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Missense_Mutation	SNP	superfamily_Sema domain,HMMPfam_Sema,HMMSmart_SM00630,HMMPfam_PSI,HMMSmart_SM00423,superfamily_Plexin repeat,HMMSmart_SM00429,superfamily_E set domains,HMMPfam_TIG,HMMPfam_Plexin_cytopl,superfamily_GTPase activation domain GAP	p.V658I	ENST00000359827.3	37	c.1972	CCDS43646.1	7	.	.	.	.	.	.	.	.	.	.	C	27.5	4.840054	0.91117	.	.	ENSG00000221866	ENST00000321063;ENST00000359827	T;T	0.17528	2.27;2.27	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	T	0.28566	0.0707	L	0.60455	1.87	0.80722	D	1	D	0.56287	0.975	P	0.49226	0.603	T	0.00595	-1.1653	10	0.36615	T	0.2	.	19.2008	0.93711	0.0:1.0:0.0:0.0	.	658	Q9HCM2	PLXA4_HUMAN	I	658	ENSP00000323194:V658I;ENSP00000352882:V658I	ENSP00000323194:V658I	V	-	1	0	PLXNA4	131561470	1.000000	0.71417	0.980000	0.43619	0.980000	0.70556	7.755000	0.85180	2.722000	0.93159	0.655000	0.94253	GTC	-	HMMPfam_PSI,HMMSmart_SM00423		0.517	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNA4	protein_coding	OTTHUMT00000338422.2	C	NM_181775		131561470	-1	no_errors	NM_020911	genbank	human	validated	54_36p	missense	SNP	1.000	T
EBF3	253738	genome.wustl.edu	37	10	131761261	131761261	+	Missense_Mutation	SNP	G	G	T			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr10:131761261G>T	ENST00000355311.5	-	3	372	c.300C>A	c.(298-300)aaC>aaA	p.N100K	EBF3_ENST00000368648.3_Missense_Mutation_p.N100K			Q9H4W6	COE3_HUMAN	early B-cell factor 3	100					multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(23)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	44		all_cancers(35;1.8e-08)|all_epithelial(44;8.26e-08)|Lung NSC(174;0.0091)|all_lung(145;0.0123)|Breast(234;0.039)|all_neural(114;0.0722)|Colorectal(57;0.0764)		OV - Ovarian serous cystadenocarcinoma(35;0.00513)		TTTTCTCGTTGTTTGGCTCCT	0.572																																																0			10											210.0	195.0	200.0					10																	131761261		2203	4300	6503	131651251	SO:0001583	missense	253738				CCDS31314.1	10q26.3	2007-03-30			ENSG00000108001	ENSG00000108001			19087	protein-coding gene	gene with protein product		607407				12355068	Standard	NM_001005463		Approved	COE3, DKFZp667B0210	uc001lki.2	Q9H4W6	OTTHUMG00000019265	ENST00000355311.5:c.300C>A	10.37:g.131761261G>T	ENSP00000347463:p.Asn100Lys		131651251	A0AUY1|Q5T6H9|Q9H4W5	Missense_Mutation	SNP	PatternScan_COE,HMMSmart_SM00429,superfamily_E set domains,HMMPfam_TIG	p.N100K	ENST00000355311.5	37	c.300		10	.	.	.	.	.	.	.	.	.	.	G	14.90	2.672782	0.47781	.	.	ENSG00000108001	ENST00000355311;ENST00000368648	T;T	0.40476	1.03;1.03	5.42	4.51	0.55191	.	0.053436	0.64402	D	0.000001	T	0.22437	0.0541	N	0.08118	0	0.80722	D	1	B	0.21688	0.059	B	0.23852	0.049	T	0.06127	-1.0844	10	0.21014	T	0.42	-20.7256	10.4485	0.44507	0.1519:0.0:0.8481:0.0	.	100	Q9H4W6-2	.	K	100	ENSP00000347463:N100K;ENSP00000357637:N100K	ENSP00000347463:N100K	N	-	3	2	EBF3	131651251	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.830000	0.69324	1.260000	0.44134	0.650000	0.86243	AAC	-	NULL		0.572	EBF3-001	KNOWN	basic|appris_principal	protein_coding	EBF3	protein_coding	OTTHUMT00000051015.2	G	NM_001005463		131651251	-1	no_errors	NM_001005463	genbank	human	validated	54_36p	missense	SNP	1.000	T
OC90	729330	genome.wustl.edu	37	8	133053927	133053927	+	Missense_Mutation	SNP	G	G	T			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr8:133053927G>T	ENST00000443356.2	-	5	275	c.189C>A	c.(187-189)ttC>ttA	p.F63L	OC90_ENST00000262283.5_Missense_Mutation_p.F259L|OC90_ENST00000254627.3_Missense_Mutation_p.F63L|OC90_ENST00000603859.1_Missense_Mutation_p.F63L			Q02509	OC90_HUMAN	otoconin 90	63					lipid catabolic process (GO:0016042)|phospholipid metabolic process (GO:0006644)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|phospholipase A2 activity (GO:0004623)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(3)|lung(23)|ovary(2)|prostate(1)|skin(1)	37	Esophageal squamous(12;0.00693)|Ovarian(258;0.00769)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000805)			GCAGCCAGGTGAAGTGGGGGC	0.577																																																0			8											23.0	23.0	23.0					8																	133053927		1954	4141	6095	133123109	SO:0001583	missense	729330			Z14310	CCDS47919.1	8q24.22	2011-03-01			ENSG00000253117	ENSG00000253117			8100	protein-coding gene	gene with protein product		601658		PLA2L		10329003, 9860971	Standard	NM_001080399		Approved		uc011lix.1	Q02509	OTTHUMG00000164672	ENST00000443356.2:c.189C>A	8.37:g.133053927G>T	ENSP00000390050:p.Phe63Leu		133123109	B4DNG8	Missense_Mutation	SNP	HMMSmart_SM00085,superfamily_Phospholipase A2 PLA2,HMMPfam_Phospholip_A2_1,PatternScan_PA2_HIS,PatternScan_PA2_ASP	p.F47L	ENST00000443356.2	37	c.141		8	.	.	.	.	.	.	.	.	.	.	G	21.6	4.178121	0.78564	.	.	ENSG00000253117;ENSG00000253117;ENSG00000258417	ENST00000254627;ENST00000443356;ENST00000262283	T;T;T	0.40476	1.08;1.1;1.03	5.73	4.67	0.58626	.	0.051447	0.85682	D	0.000000	T	0.51415	0.1673	L	0.36672	1.1	0.36278	D	0.855589	D;D	0.76494	0.999;0.999	D;D	0.72982	0.979;0.953	T	0.54330	-0.8310	10	0.37606	T	0.19	-29.997	12.8814	0.58020	0.0889:0.0:0.9111:0.0	.	63;63	Q02509-2;Q02509	.;OC90_HUMAN	L	63;63;259	ENSP00000254627:F63L;ENSP00000390050:F63L;ENSP00000262283:F259L	ENSP00000254627:F63L	F	-	3	2	RP11-240B13.2;OC90	133123109	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.206000	0.58473	2.714000	0.92807	0.591000	0.81541	TTC	-	NULL		0.577	OC90-201	KNOWN	basic	protein_coding	OC90	protein_coding		G	NM_001080399		133123109	-1	no_errors	NM_001080399	genbank	human	validated	54_36p	missense	SNP	1.000	T
ANKRD34A	284615	genome.wustl.edu	37	1	145474033	145474033	+	Silent	SNP	A	A	G			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr1:145474033A>G	ENST00000323397.4	+	4	1998	c.705A>G	c.(703-705)ccA>ccG	p.P235P	RP11-315I20.1_ENST00000600340.1_RNA	NM_001039888.2	NP_001034977.1	Q69YU3	AN34A_HUMAN	ankyrin repeat domain 34A	235	Pro-rich.					cytoplasm (GO:0005737)				endometrium(2)|kidney(2)|large_intestine(2)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)	20	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					CCAAACCACCACGCCATCCCC	0.622																																																0			1											71.0	82.0	78.0					1																	145474033		2203	4300	6503	144185390	SO:0001819	synonymous_variant	284615			AK128050	CCDS72874.1	1q21.1	2013-01-10	2007-11-20	2007-11-20	ENSG00000181039	ENSG00000272031		"""Ankyrin repeat domain containing"""	27639	protein-coding gene	gene with protein product			"""ankyrin repeat domain 34"""	ANKRD34			Standard	NM_001039888		Approved		uc001enq.1	Q69YU3	OTTHUMG00000013740	ENST00000323397.4:c.705A>G	1.37:g.145474033A>G			144185390	B3KSU3	Silent	SNP	HMMSmart_SM00248,HMMPfam_Ank,superfamily_Ankyrin repeat	p.P235	ENST00000323397.4	37	c.705	CCDS30829.1	1																																																																																			-	NULL		0.622	ANKRD34A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD34A	protein_coding	OTTHUMT00000038512.1	A			144185390	+1	no_errors	NM_001039888	genbank	human	validated	54_36p	silent	SNP	0.825	G
ZNF827	152485	genome.wustl.edu	37	4	146859537	146859537	+	Missense_Mutation	SNP	T	T	C			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr4:146859537T>C	ENST00000508784.1	-	1	250	c.23A>G	c.(22-24)cAg>cGg	p.Q8R	ZNF827_ENST00000513320.1_Missense_Mutation_p.Q8R|ZNF827_ENST00000379448.4_Missense_Mutation_p.Q8R			Q17R98	ZN827_HUMAN	zinc finger protein 827	8					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	48	all_hematologic(180;0.151)					GCGCTTGGGCTGCTCCTGCTT	0.572																																																0			4											311.0	231.0	258.0					4																	146859537		2203	4300	6503	147078987	SO:0001583	missense	152485			AK091130	CCDS34072.1	4q31.22	2013-01-08			ENSG00000151612	ENSG00000151612		"""Zinc fingers, C2H2-type"""	27193	protein-coding gene	gene with protein product						12477932	Standard	NM_178835		Approved		uc003ikm.3	Q17R98	OTTHUMG00000161362	ENST00000508784.1:c.23A>G	4.37:g.146859537T>C	ENSP00000421863:p.Gln8Arg		147078987	B7ZL52|Q7Z4S7|Q8N279	Missense_Mutation	SNP	superfamily_SSF57667,HMMPfam_zf-C2H2,HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1	p.Q8R	ENST00000508784.1	37	c.23		4	.	.	.	.	.	.	.	.	.	.	t	11.73	1.724486	0.30593	.	.	ENSG00000151612	ENST00000508784;ENST00000513320;ENST00000379448;ENST00000440280	T;T;T	0.07327	3.2;3.27;3.24	4.39	3.19	0.36642	.	0.547807	0.17677	U	0.165760	T	0.12178	0.0296	N	0.14661	0.345	0.29346	N	0.865704	B;P;P	0.51449	0.0;0.909;0.945	B;P;D	0.67900	0.0;0.901;0.954	T	0.05162	-1.0902	10	0.59425	D	0.04	.	8.2817	0.31904	0.0:0.0992:0.0:0.9008	.	8;8;8	G5E9Z1;Q17R98;Q17R98-2	.;ZN827_HUMAN;.	R	8	ENSP00000421863:Q8R;ENSP00000423130:Q8R;ENSP00000368761:Q8R	ENSP00000368761:Q8R	Q	-	2	0	ZNF827	147078987	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	5.382000	0.66213	0.661000	0.30985	0.228000	0.17796	CAG	-	NULL		0.572	ZNF827-001	KNOWN	basic|appris_candidate_longest	protein_coding	ZNF827	protein_coding	OTTHUMT00000364654.2	T	NM_178835		147078987	-1	no_errors	NM_178835	genbank	human	validated	54_36p	missense	SNP	1.000	C
PRPF3	9129	genome.wustl.edu	37	1	150316937	150316937	+	Silent	SNP	A	A	T			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr1:150316937A>T	ENST00000324862.6	+	12	1719	c.1554A>T	c.(1552-1554)cgA>cgT	p.R518R	PRPF3_ENST00000467329.1_3'UTR|PRPF3_ENST00000543398.1_3'UTR|PRPF3_ENST00000414970.2_Silent_p.R469R	NM_004698.2	NP_004689.1	O43395	PRPF3_HUMAN	pre-mRNA processing factor 3	518					mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	Cajal body (GO:0015030)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U4/U6 x U5 tri-snRNP complex (GO:0046540)	identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			breast(1)|kidney(3)|large_intestine(2)|lung(9)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	Lung NSC(24;5.57e-29)|Breast(34;0.000844)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)	Colorectal(1306;0.0149)		ACGCTGCCCGAAAACTCACAG	0.463																																					Ovarian(168;1070 2670 5178 20729)											0			1											104.0	110.0	108.0					1																	150316937		2203	4300	6503	148583561	SO:0001819	synonymous_variant	9129			AF001947	CCDS951.1	1q21.1	2013-07-16	2013-06-10		ENSG00000117360	ENSG00000117360			17348	protein-coding gene	gene with protein product		607301	"""retinitis pigmentosa 18 (autosomal dominant)"", ""PRP3 pre-mRNA processing factor 3 homolog (yeast)"", ""PRP3 pre-mRNA processing factor 3 homolog (S. cerevisiae)"""	RP18			Standard	NM_004698		Approved	Prp3, hPrp3, SNRNP90	uc001eum.4	O43395	OTTHUMG00000012807	ENST00000324862.6:c.1554A>T	1.37:g.150316937A>T			148583561	B4DSY9|O43446|Q5VT54	Silent	SNP	superfamily_PWI domain,HMMSmart_SM00311,HMMPfam_PWI,HMMPfam_PRP3	p.R518	ENST00000324862.6	37	c.1554	CCDS951.1	1																																																																																			-	HMMPfam_PRP3		0.463	PRPF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRPF3	protein_coding	OTTHUMT00000035836.1	A	NM_004698		148583561	+1	no_errors	NM_004698	genbank	human	reviewed	54_36p	silent	SNP	0.999	T
PDE6A	5145	genome.wustl.edu	37	5	149245735	149245735	+	Missense_Mutation	SNP	T	T	C			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr5:149245735T>C	ENST00000255266.5	-	20	2475	c.2356A>G	c.(2356-2358)Aag>Gag	p.K786E		NM_000440.2	NP_000431.2	P16499	PDE6A_HUMAN	phosphodiesterase 6A, cGMP-specific, rod, alpha	786					cytosolic calcium ion homeostasis (GO:0051480)|GMP metabolic process (GO:0046037)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina development in camera-type eye (GO:0060041)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)|plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(13)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)	44			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)		Caffeine(DB00201)	GGGCCTACCTTGTAGACGAAG	0.478																																																0			5											127.0	117.0	121.0					5																	149245735		2203	4300	6503	149225928	SO:0001583	missense	5145				CCDS4299.1	5q31.2-q34	2013-02-14			ENSG00000132915	ENSG00000132915	3.1.4.17	"""Phosphodiesterases"""	8785	protein-coding gene	gene with protein product		180071		PDEA		2155175	Standard	NM_000440		Approved	RP43	uc003lrg.4	P16499	OTTHUMG00000130047	ENST00000255266.5:c.2356A>G	5.37:g.149245735T>C	ENSP00000255266:p.Lys786Glu		149225928	Q0P638	Missense_Mutation	SNP	superfamily_SSF55781,HMMPfam_GAF,HMMSmart_GAF,superfamily_SSF109604,HMMSmart_HDc,HMMPfam_PDEase_I,PatternScan_PDEASE_I	p.K786E	ENST00000255266.5	37	c.2356	CCDS4299.1	5	.	.	.	.	.	.	.	.	.	.	T	27.3	4.814527	0.90790	.	.	ENSG00000132915	ENST00000255266	T	0.74209	-0.82	5.22	5.22	0.72569	5&apos (2);-cyclic nucleotide phosphodiesterase, catalytic domain (2);3&apos (2);	0.000000	0.85682	D	0.000000	T	0.73048	0.3537	N	0.21508	0.67	0.58432	D	0.999997	D	0.57899	0.981	P	0.60415	0.874	T	0.70077	-0.4971	10	0.22706	T	0.39	.	13.053	0.58964	0.0:0.0:0.0:1.0	.	786	P16499	PDE6A_HUMAN	E	786	ENSP00000255266:K786E	ENSP00000255266:K786E	K	-	1	0	PDE6A	149225928	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	7.338000	0.79269	1.969000	0.57287	0.379000	0.24179	AAG	-	superfamily_SSF109604,HMMPfam_PDEase_I		0.478	PDE6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDE6A	protein_coding	OTTHUMT00000252326.2	T			149225928	-1	no_errors	NM_000440	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
PI4KB	5298	genome.wustl.edu	37	1	151288881	151288881	+	Missense_Mutation	SNP	C	C	T			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr1:151288881C>T	ENST00000368873.1	-	2	245	c.77G>A	c.(76-78)gGg>gAg	p.G26E	PI4KB_ENST00000529142.1_Intron|PI4KB_ENST00000368874.4_Missense_Mutation_p.G26E|PI4KB_ENST00000271657.5_Missense_Mutation_p.G38E|PI4KB_ENST00000368875.2_Missense_Mutation_p.G38E|PI4KB_ENST00000368872.1_Missense_Mutation_p.G26E			Q9UBF8	PI4KB_HUMAN	phosphatidylinositol 4-kinase, catalytic, beta	26					phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi membrane (GO:0000139)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)	1-phosphatidylinositol 4-kinase activity (GO:0004430)|ATP binding (GO:0005524)			breast(3)|endometrium(5)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	27	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			CAGGGACCCCCCATTATTCCC	0.587																																					Colon(154;765 1838 9854 28443 37492)											0			1											39.0	39.0	39.0					1																	151288881		2203	4300	6503	149555505	SO:0001583	missense	5298			AB005910	CCDS993.1, CCDS55637.1, CCDS55638.1	1q21	2008-02-05	2007-08-14	2007-08-02	ENSG00000143393	ENSG00000143393			8984	protein-coding gene	gene with protein product		602758		PIK4CB		9020160, 9405938	Standard	NM_002651		Approved	PI4K-BETA, pi4K92	uc001exu.3	Q9UBF8	OTTHUMG00000012348	ENST00000368873.1:c.77G>A	1.37:g.151288881C>T	ENSP00000357867:p.Gly26Glu		149555505	B4DGI2|O15096|P78405|Q5VWB9|Q5VWC0|Q5VWC1|Q9BWR6	Missense_Mutation	SNP	superfamily_Protein kinase-like (PK-like),HMMPfam_PI3_PI4_kinase,HMMSmart_SM00146,PatternScan_PI3_4_KINASE_1,PatternScan_PI3_4_KINASE_2	p.G38E	ENST00000368873.1	37	c.113		1	.	.	.	.	.	.	.	.	.	.	C	15.39	2.819830	0.50633	.	.	ENSG00000143393	ENST00000368874;ENST00000368875;ENST00000271657;ENST00000368873;ENST00000368872;ENST00000438243	T;T;T;T;T;T	0.38077	1.16;1.16;1.16;1.16;1.16;1.16	5.53	5.53	0.82687	.	0.425300	0.26383	N	0.024692	T	0.19886	0.0478	N	0.14661	0.345	0.40508	D	0.980711	P;B;B	0.47350	0.894;0.137;0.121	P;B;B	0.45506	0.483;0.007;0.016	T	0.03514	-1.1029	10	0.62326	D	0.03	-22.6333	17.004	0.86388	0.0:1.0:0.0:0.0	.	26;26;26	E9PIH4;Q9UBF8;Q9UBF8-2	.;PI4KB_HUMAN;.	E	26;38;38;26;26;26	ENSP00000357868:G26E;ENSP00000357869:G38E;ENSP00000271657:G38E;ENSP00000357867:G26E;ENSP00000357866:G26E;ENSP00000394719:G26E	ENSP00000271657:G38E	G	-	2	0	PI4KB	149555505	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	3.720000	0.54933	2.882000	0.98803	0.655000	0.94253	GGG	-	NULL		0.587	PI4KB-002	KNOWN	basic	protein_coding	PI4KB	protein_coding	OTTHUMT00000034400.3	C	NM_002651		149555505	-1	no_errors	NM_002651	genbank	human	provisional	54_36p	missense	SNP	0.986	T
RPTN	126638	genome.wustl.edu	37	1	152128919	152128919	+	Missense_Mutation	SNP	G	G	T			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr1:152128919G>T	ENST00000316073.3	-	3	720	c.656C>A	c.(655-657)gCt>gAt	p.A219D		NM_001122965.1	NP_001116437.1	Q6XPR3	RPTN_HUMAN	repetin	219	Gln-rich.					cornified envelope (GO:0001533)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|endometrium(14)|kidney(2)|large_intestine(1)|lung(32)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	59						CTGCCATTTAGCCTGGCCACT	0.413																																																0			1											239.0	204.0	215.0					1																	152128919		1568	3582	5150	150395543	SO:0001583	missense	126638			AK096436	CCDS41397.1	1q21.3	2013-01-10			ENSG00000215853	ENSG00000215853		"""EF-hand domain containing"""	26809	protein-coding gene	gene with protein product		613259				15854042	Standard	NM_001122965		Approved	FLJ39117	uc001ezs.1	Q6XPR3	OTTHUMG00000154095	ENST00000316073.3:c.656C>A	1.37:g.152128919G>T	ENSP00000317895:p.Ala219Asp		150395543	B7ZBZ3	Missense_Mutation	SNP	superfamily_EF-hand,HMMPfam_S_100,HMMPfam_efhand,PatternScan_S100_CABP,PatternScan_EF_HAND_1	p.A219D	ENST00000316073.3	37	c.656	CCDS41397.1	1	.	.	.	.	.	.	.	.	.	.	G	8.398	0.841394	0.16963	.	.	ENSG00000215853	ENST00000316073	T	0.11169	2.8	4.26	0.853	0.19001	.	.	.	.	.	T	0.01800	0.0057	N	0.19112	0.55	0.09310	N	1	B	0.28128	0.201	B	0.18871	0.023	T	0.45264	-0.9273	9	0.15499	T	0.54	1.1994	11.2546	0.49045	0.0:0.0:0.3412:0.6588	.	219	Q6XPR3	RPTN_HUMAN	D	219	ENSP00000317895:A219D	ENSP00000317895:A219D	A	-	2	0	RPTN	150395543	0.950000	0.32346	0.000000	0.03702	0.009000	0.06853	1.889000	0.39718	0.350000	0.24002	0.442000	0.29010	GCT	-	NULL		0.413	RPTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPTN	protein_coding	OTTHUMT00000333867.1	G	XM_371312		150395543	-1	no_errors	ENST00000316073	ensembl	human	known	54_36p	missense	SNP	0.000	T
FLG	2312	genome.wustl.edu	37	1	152283746	152283746	+	Missense_Mutation	SNP	C	C	T			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr1:152283746C>T	ENST00000368799.1	-	3	3651	c.3616G>A	c.(3616-3618)Gcc>Acc	p.A1206T	FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	1206	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCATGGGAGGCATCAGACCTT	0.557									Ichthyosis																																							0			1											332.0	337.0	335.0					1																	152283746		2203	4298	6501	150550370	SO:0001583	missense	2312	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.3616G>A	1.37:g.152283746C>T	ENSP00000357789:p.Ala1206Thr		150550370	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	superfamily_SSF47473,HMMPfam_S_100,PatternScan_S100_CABP,PatternScan_EF_HAND_1,HMMPfam_Filaggrin	p.A1206T	ENST00000368799.1	37	c.3616	CCDS30860.1	1	.	.	.	.	.	.	.	.	.	.	C	7.375	0.627643	0.14257	.	.	ENSG00000143631	ENST00000368799	T	0.01767	4.65	2.85	-5.31	0.02730	.	.	.	.	.	T	0.00754	0.0025	M	0.76574	2.34	0.09310	N	1	B	0.32409	0.37	B	0.30105	0.111	T	0.37865	-0.9687	9	0.13853	T	0.58	.	10.5783	0.45240	0.2974:0.7026:0.0:0.0	.	1206	P20930	FILA_HUMAN	T	1206	ENSP00000357789:A1206T	ENSP00000357789:A1206T	A	-	1	0	FLG	150550370	0.004000	0.15560	0.000000	0.03702	0.001000	0.01503	0.625000	0.24477	-0.637000	0.05516	-0.746000	0.03513	GCC	-	NULL		0.557	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG	protein_coding	OTTHUMT00000033742.1	C	NM_002016		150550370	-1	no_errors	NM_002016	genbank	human	provisional	54_36p	missense	SNP	0.001	T
KMT2C	58508	genome.wustl.edu	37	7	151860200	151860200	+	Missense_Mutation	SNP	T	T	A			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr7:151860200T>A	ENST00000262189.6	-	43	10680	c.10462A>T	c.(10462-10464)Ata>Tta	p.I3488L	KMT2C_ENST00000355193.2_Missense_Mutation_p.I3488L	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	3488	Gln-rich.				histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										CCTTGTTGTATATTCTGCTGC	0.463																																																0			7											137.0	137.0	137.0					7																	151860200		2203	4300	6503	151491133	SO:0001583	missense	58508			AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.10462A>T	7.37:g.151860200T>A	ENSP00000262189:p.Ile3488Leu		151491133	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	PatternScan_HMGI_Y,HMMPfam_AT_hook,HMMSmart_SM00249,superfamily_FYVE/PHD zinc finger,HMMPfam_PHD,HMMSmart_SM00184,PatternScan_ZF_PHD_1,PatternScan_ATPASE_ALPHA_BETA,HMMSmart_SM00398,HMMPfam_HMG_box,HMMPfam_FYRN,HMMSmart_SM00541,HMMPfam_FYRC,HMMSmart_SM00542,superfamily_SET domain,HMMPfam_SET,HMMSmart_SM00317,HMMSmart_SM00508	p.I3488L	ENST00000262189.6	37	c.10462	CCDS5931.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	2.906|2.906	-0.226480|-0.226480	0.06022|0.06022	.|.	.|.	ENSG00000055609|ENSG00000055609	ENST00000262189;ENST00000355193;ENST00000424877|ENST00000360104	D;D;D|.	0.87729|.	-1.53;-1.54;-2.29|.	5.09|5.09	-3.82|-3.82	0.04281|0.04281	.|.	1.027110|.	0.07809|.	N|.	0.957870|.	T|T	0.24160|0.24160	0.0585|0.0585	N|N	0.03324|0.03324	-0.35|-0.35	0.42308|0.42308	D|D	0.992204|0.992204	B;B;B|.	0.06786|.	0.0;0.001;0.0|.	B;B;B|.	0.08055|.	0.001;0.003;0.0|.	T|T	0.09640|0.09640	-1.0665|-1.0665	10|5	0.25106|.	T|.	0.35|.	.|.	8.5989|8.5989	0.33732|0.33732	0.0:0.2549:0.493:0.252|0.0:0.2549:0.493:0.252	.|.	3488;2549;3488|.	Q8NEZ4;Q8NEZ4-2;Q8NEZ4-3|.	MLL3_HUMAN;.;.|.	L|F	3488;3488;74|993	ENSP00000262189:I3488L;ENSP00000347325:I3488L;ENSP00000410411:I74L|.	ENSP00000262189:I3488L|.	I|Y	-|-	1|2	0|0	MLL3|MLL3	151491133|151491133	0.001000|0.001000	0.12720|0.12720	0.000000|0.000000	0.03702|0.03702	0.015000|0.015000	0.08874|0.08874	-0.216000|-0.216000	0.09266|0.09266	-0.557000|-0.557000	0.06126|0.06126	0.533000|0.533000	0.62120|0.62120	ATA|TAT	-	NULL		0.463	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MLL3	protein_coding	OTTHUMT00000318887.3	T			151491133	-1	no_errors	NM_170606	genbank	human	reviewed	54_36p	missense	SNP	0.140	A
SYNE1	23345	genome.wustl.edu	37	6	152826375	152826375	+	Missense_Mutation	SNP	C	C	T			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr6:152826375C>T	ENST00000367255.5	-	9	1340	c.739G>A	c.(739-741)Gaa>Aaa	p.E247K	SYNE1_ENST00000413186.2_Missense_Mutation_p.E247K|SYNE1_ENST00000341594.5_Missense_Mutation_p.E247K|SYNE1_ENST00000466159.2_Missense_Mutation_p.E247K|SYNE1_ENST00000367248.3_Missense_Mutation_p.E254K|SYNE1_ENST00000265368.4_Missense_Mutation_p.E247K|SYNE1_ENST00000448038.1_Missense_Mutation_p.E254K|SYNE1_ENST00000423061.1_Missense_Mutation_p.E254K|SYNE1_ENST00000367253.4_Missense_Mutation_p.E247K	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	247	Actin-binding.|CH 2. {ECO:0000255|PROSITE- ProRule:PRU00044}.				cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		AGTTCTGTTTCGGCGATAGTG	0.433										HNSCC(10;0.0054)																																						0			6											141.0	129.0	133.0					6																	152826375		2203	4300	6503	152868068	SO:0001583	missense	23345			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.739G>A	6.37:g.152826375C>T	ENSP00000356224:p.Glu247Lys		152868068	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	superfamily_Calponin-homology domain CH-domain,HMMPfam_CH,PatternScan_ACTININ_1,HMMSmart_SM00033,PatternScan_ACTININ_2,superfamily_Spectrin repeat,HMMSmart_SM00150,HMMPfam_Spectrin,HMMPfam_KASH	p.E247K	ENST00000367255.5	37	c.739	CCDS5236.2	6	.	.	.	.	.	.	.	.	.	.	C	21.3	4.124421	0.77436	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000367253;ENST00000367248;ENST00000413186;ENST00000466159;ENST00000537750	D;D;D;D;D;D;D;D;D;D	0.95001	-3.58;-3.58;-3.58;-3.58;-3.58;-3.58;-3.58;-3.58;-3.58;-3.58	5.74	5.74	0.90152	Calponin homology domain (5);	0.000000	0.64402	D	0.000006	D	0.97623	0.9221	M	0.86651	2.83	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;0.97;1.0;1.0	D;D;P;D;D	0.79108	0.966;0.992;0.642;0.992;0.99	D	0.97825	1.0259	10	0.87932	D	0	.	19.994	0.97377	0.0:1.0:0.0:0.0	.	247;247;247;247;254	B3W695;Q8NF91;F5H4Q0;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.;.	K	247;254;247;254;247;247;254;247;247;247	ENSP00000356224:E247K;ENSP00000396024:E254K;ENSP00000265368:E247K;ENSP00000390975:E254K;ENSP00000341887:E247K;ENSP00000356222:E247K;ENSP00000356217:E254K;ENSP00000414510:E247K;ENSP00000446021:E247K;ENSP00000441264:E247K	ENSP00000265368:E247K	E	-	1	0	SYNE1	152868068	1.000000	0.71417	0.347000	0.25668	0.046000	0.14306	7.818000	0.86416	2.735000	0.93741	0.638000	0.83543	GAA	-	superfamily_Calponin-homology domain CH-domain,HMMPfam_CH,HMMSmart_SM00033		0.433	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	protein_coding	OTTHUMT00000334755.2	C	NM_182961		152868068	-1	no_errors	NM_182961	genbank	human	reviewed	54_36p	missense	SNP	0.984	T
OR6N1	128372	genome.wustl.edu	37	1	158736359	158736359	+	Silent	SNP	A	A	G			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr1:158736359A>G	ENST00000335094.2	-	1	133	c.114T>C	c.(112-114)acT>acC	p.T38T		NM_001005185.1	NP_001005185.1	Q8NGY5	OR6N1_HUMAN	olfactory receptor, family 6, subfamily N, member 1	38						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(22)|ovary(1)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	54	all_hematologic(112;0.0378)					TTCCCAACACAGTCATGAGGT	0.502																																																0			1											94.0	93.0	93.0					1																	158736359		2203	4300	6503	157002983	SO:0001819	synonymous_variant	128372			BK004199	CCDS30905.1	1q23.1	2012-08-09			ENSG00000197403	ENSG00000197403		"""GPCR / Class A : Olfactory receptors"""	15034	protein-coding gene	gene with protein product							Standard	NM_001005185		Approved		uc010piq.2	Q8NGY5	OTTHUMG00000022774	ENST00000335094.2:c.114T>C	1.37:g.158736359A>G			157002983	Q5VUU8|Q96R35	Silent	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.T38	ENST00000335094.2	37	c.114	CCDS30905.1	1																																																																																			-	superfamily_SSF81321		0.502	OR6N1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6N1	protein_coding	OTTHUMT00000059067.1	A	NM_001005185		157002983	-1	no_errors	NM_001005185	genbank	human	provisional	54_36p	silent	SNP	0.000	G
NR1I3	9970	genome.wustl.edu	37	1	161199716	161199716	+	Splice_Site	SNP	C	C	A			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr1:161199716C>A	ENST00000367982.4	-	9	1085	c.930G>T	c.(928-930)cgG>cgT	p.R310R	TOMM40L_ENST00000367987.1_3'UTR|NR1I3_ENST00000367981.3_Splice_Site_p.R282R|NR1I3_ENST00000442691.2_Intron|TOMM40L_ENST00000367988.3_3'UTR|NR1I3_ENST00000512372.1_Intron|NR1I3_ENST00000367985.3_Splice_Site_p.R272R|NR1I3_ENST00000511676.1_Splice_Site_p.R277R|NR1I3_ENST00000479324.1_5'UTR|NR1I3_ENST00000508387.1_3'UTR|NR1I3_ENST00000508740.1_Intron|MIR5187_ENST00000583479.1_RNA|NR1I3_ENST00000502985.1_3'UTR|NR1I3_ENST00000511944.1_Intron|NR1I3_ENST00000367983.4_Splice_Site_p.R306R|NR1I3_ENST00000428574.2_Intron|NR1I3_ENST00000504010.1_Splice_Site_p.R238R|NR1I3_ENST00000367984.4_Splice_Site_p.R267R|NR1I3_ENST00000515621.1_Splice_Site_p.R231R|NR1I3_ENST00000437437.2_Intron|TOMM40L_ENST00000474486.1_3'UTR|NR1I3_ENST00000412844.2_Intron|NR1I3_ENST00000367979.2_Splice_Site_p.R315R|NR1I3_ENST00000367980.2_Splice_Site_p.R315R|NR1I3_ENST00000511748.1_Intron|NR1I3_ENST00000505005.1_Intron			Q14994	NR1I3_HUMAN	nuclear receptor subfamily 1, group I, member 3	310					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	androgen receptor activity (GO:0004882)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|thyroid hormone receptor activity (GO:0004887)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|skin(1)	15	all_cancers(52;1.86e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00376)			CATACAGAAACCTTTGGAGGA	0.532																																																0			1											59.0	59.0	59.0					1																	161199716		2203	4300	6503	159466340	SO:0001630	splice_region_variant	9970			Z30425	CCDS1228.1, CCDS41427.1, CCDS41428.1, CCDS41429.1, CCDS41430.1, CCDS44260.1, CCDS44261.1, CCDS44262.1, CCDS53405.1, CCDS53406.1, CCDS53407.1, CCDS53408.1, CCDS53409.1, CCDS53410.1, CCDS53411.1	1q23.3	2013-01-16			ENSG00000143257	ENSG00000143257		"""Nuclear hormone receptors"""	7969	protein-coding gene	gene with protein product	"""constitutive androstane receptor"""	603881				8114692	Standard	NM_001077480		Approved	MB67, CAR1, CAR	uc001fzp.3	Q14994	OTTHUMG00000034347	ENST00000367982.4:c.930-1G>T	1.37:g.161199716C>A			159466340	E9PB75|E9PC13|E9PDU3|E9PGH6|E9PH10|E9PHC8|E9PHN4|F1D8Q0|F1D8Q1|Q0VAC9|Q4U0F0|Q5VTW5|Q5VTW6|Q6GZ68|Q6GZ76|Q6GZ77|Q6GZ78|Q6GZ79|Q6GZ82|Q6GZ83|Q6GZ84|Q6GZ85|Q6GZ87|Q6GZ89	Silent	SNP	HMMSmart_ZnF_C4,HMMPfam_zf-C4,superfamily_SSF57716,PatternScan_NUCLEAR_REC_DBD_1,superfamily_Str_ncl_receptor,HMMSmart_HOLI,HMMPfam_Hormone_recep	p.R315	ENST00000367982.4	37	c.945	CCDS41430.1	1																																																																																			-	superfamily_Str_ncl_receptor,HMMSmart_HOLI,HMMPfam_Hormone_recep		0.532	NR1I3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NR1I3	protein_coding	OTTHUMT00000083048.2	C		Silent	159466340	-1	no_errors	NM_001077482	genbank	human	reviewed	54_36p	silent	SNP	1.000	A
HMMR	3161	genome.wustl.edu	37	5	162910280	162910280	+	Silent	SNP	T	T	A			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr5:162910280T>A	ENST00000358715.3	+	15	1725	c.1689T>A	c.(1687-1689)gcT>gcA	p.A563A	RP11-80G7.1_ENST00000521666.1_RNA|HMMR_ENST00000393915.4_Silent_p.A564A|HMMR_ENST00000353866.3_Silent_p.A548A|RP11-80G7.1_ENST00000514724.2_RNA|HMMR_ENST00000432118.2_Silent_p.A477A			O75330	HMMR_HUMAN	hyaluronan-mediated motility receptor (RHAMM)	563					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|membrane (GO:0016020)|plasma membrane (GO:0005886)	hyaluronic acid binding (GO:0005540)			cervix(1)|kidney(3)|large_intestine(6)|lung(9)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	23	Renal(175;0.000281)	Medulloblastoma(196;0.00853)|all_neural(177;0.0408)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0296)|OV - Ovarian serous cystadenocarcinoma(192;0.0423)|Epithelial(171;0.0848)	Hyaluronan(DB08818)	GCAGAAAAGCTGAAAAAGAAA	0.303																																																0			5											41.0	45.0	44.0					5																	162910280		2184	4287	6471	162842858	SO:0001819	synonymous_variant	3161			U29343	CCDS4362.1, CCDS4363.1, CCDS47334.1, CCDS47335.1	5q34	2013-09-19			ENSG00000072571	ENSG00000072571		"""CD molecules"""	5012	protein-coding gene	gene with protein product		600936					Standard	NM_001142556		Approved	RHAMM, CD168	uc003lzh.3	O75330	OTTHUMG00000130381	ENST00000358715.3:c.1689T>A	5.37:g.162910280T>A			162842858	A8K3G2|B4E114|D3DQK9|D3DQL0|E9PCS0|Q32N02|Q92767	Silent	SNP	NULL	p.A563	ENST00000358715.3	37	c.1689	CCDS4362.1	5																																																																																			-	NULL		0.303	HMMR-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	HMMR	protein_coding	OTTHUMT00000252752.1	T	NM_012484		162842858	+1	no_errors	NM_012484	genbank	human	reviewed	54_36p	silent	SNP	0.913	A
SCN3A	6328	genome.wustl.edu	37	2	165984338	165984338	+	Missense_Mutation	SNP	C	C	G			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr2:165984338C>G	ENST00000360093.3	-	18	3687	c.3196G>C	c.(3196-3198)Gat>Cat	p.D1066H	SCN3A_ENST00000409101.3_Missense_Mutation_p.D1017H|SCN3A_ENST00000283254.7_Missense_Mutation_p.D1066H	NM_001081677.1	NP_001075146.1	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha subunit	1066					membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(19)|liver(2)|lung(47)|ovary(6)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(3)	120					Lacosamide(DB06218)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CCATTCCCATCTCTAAGATAA	0.363																																																0			2											132.0	124.0	127.0					2																	165984338		2203	4300	6503	165692584	SO:0001583	missense	6328			AF035685	CCDS33312.1, CCDS46440.1	2q24	2012-02-26	2007-01-23		ENSG00000153253	ENSG00000153253		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10590	protein-coding gene	gene with protein product		182391	"""sodium channel, voltage-gated, type III, alpha polypeptide"""			9589372, 16382098	Standard	NM_001081676		Approved	Nav1.3	uc002ucx.3	Q9NY46	OTTHUMG00000044171	ENST00000360093.3:c.3196G>C	2.37:g.165984338C>G	ENSP00000353206:p.Asp1066His		165692584	Q16142|Q53SX0|Q9BZB3|Q9C006|Q9NYK2|Q9P2J1|Q9UPD1|Q9Y6P4	Missense_Mutation	SNP	superfamily_SSF81324,HMMPfam_Ion_trans,HMMPfam_Na_trans_assoc,HMMSmart_IQ,HMMPfam_IQ	p.D1066H	ENST00000360093.3	37	c.3196		2	.	.	.	.	.	.	.	.	.	.	C	15.39	2.819308	0.50633	.	.	ENSG00000153253	ENST00000360093;ENST00000283254;ENST00000409101;ENST00000440431	D;D;D;D	0.83837	-1.77;-1.77;-1.77;-1.77	5.93	5.93	0.95920	Sodium ion transport-associated (1);	0.000000	0.64402	D	0.000005	D	0.91439	0.7298	M	0.82630	2.6	0.80722	D	1	P;D;D;D;P	0.57571	0.868;0.96;0.98;0.98;0.841	P;P;P;P;P	0.61658	0.892;0.776;0.668;0.668;0.473	D	0.91279	0.5050	10	0.59425	D	0.04	.	20.3437	0.98782	0.0:1.0:0.0:0.0	.	1066;1017;1017;1017;1066	Q9NY46;E7EUE6;Q9NY46-2;Q9NY46-4;Q9NY46-3	SCN3A_HUMAN;.;.;.;.	H	1066;1066;1017;1017	ENSP00000353206:D1066H;ENSP00000283254:D1066H;ENSP00000386726:D1017H;ENSP00000403348:D1017H	ENSP00000283254:D1066H	D	-	1	0	SCN3A	165692584	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.657000	0.46724	2.815000	0.96918	0.561000	0.74099	GAT	-	HMMPfam_Na_trans_assoc		0.363	SCN3A-201	KNOWN	basic|appris_candidate_longest	protein_coding	SCN3A	protein_coding		C	NM_006922		165692584	-1	no_errors	NM_006922	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
TTC21B	79809	genome.wustl.edu	37	2	166799728	166799728	+	Splice_Site	SNP	C	C	A			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr2:166799728C>A	ENST00000243344.7	-	5	690		c.e5+1		AC010127.5_ENST00000443032.1_RNA|AC010127.5_ENST00000440322.1_RNA	NM_024753.4	NP_079029.3	Q7Z4L5	TT21B_HUMAN	tetratricopeptide repeat domain 21B						forebrain dorsal/ventral pattern formation (GO:0021798)|intraciliary retrograde transport (GO:0035721)|intraciliary transport involved in cilium morphogenesis (GO:0035735)|protein localization to cilium (GO:0061512)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|smoothened signaling pathway (GO:0007224)|ventricular system development (GO:0021591)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intraciliary transport particle A (GO:0030991)|nuclear chromatin (GO:0000790)				breast(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(9)|lung(28)|ovary(2)|pancreas(2)|skin(2)|urinary_tract(1)	58						CTCCAACTCACCTTACCCAGC	0.328																																																0			2											123.0	116.0	118.0					2																	166799728		2203	4300	6503	166507974	SO:0001630	splice_region_variant	79809			AB082523	CCDS33315.1	2q24.3	2014-09-04			ENSG00000123607	ENSG00000123607		"""Tetratricopeptide (TTC) repeat domain containing"", ""Intraflagellar transport homologs"""	25660	protein-coding gene	gene with protein product		612014				12056414, 21258341	Standard	NM_024753		Approved	FLJ11457, JBTS11, NPHP12, IFT139, THM1	uc002udk.3	Q7Z4L5	OTTHUMG00000154083	ENST00000243344.7:c.552+1G>T	2.37:g.166799728C>A			166507974	A8MUZ3|Q3LIE4|Q53T84|Q6P4A1|Q6PIF5|Q8NCN3|Q96MA4|Q9HAK8	Splice_Site	SNP	-	e5+1	ENST00000243344.7	37	c.552+1	CCDS33315.1	2	.	.	.	.	.	.	.	.	.	.	C	22.9	4.346990	0.82022	.	.	ENSG00000123607	ENST00000243344	.	.	.	5.23	5.23	0.72850	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.8293	0.92132	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TTC21B	166507974	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	6.905000	0.75714	2.433000	0.82419	0.655000	0.94253	.	-	-		0.328	TTC21B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC21B	protein_coding	OTTHUMT00000333770.1	C	NM_024753	Intron	166507974	-1	no_errors	NM_024753	genbank	human	validated	54_36p	splice_site	SNP	1.000	A
DNM3	26052	genome.wustl.edu	37	1	172002357	172002357	+	Missense_Mutation	SNP	T	T	G			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr1:172002357T>G	ENST00000355305.5	+	6	958	c.801T>G	c.(799-801)caT>caG	p.H267Q	DNM3_ENST00000367731.1_Missense_Mutation_p.H267Q|DNM3_ENST00000520906.1_Missense_Mutation_p.H267Q|DNM3_ENST00000367733.2_Missense_Mutation_p.H267Q|DNM3_ENST00000358155.4_Missense_Mutation_p.H267Q			Q9UQ16	DYN3_HUMAN	dynamin 3	267	Dynamin-type G.				endocytosis (GO:0006897)|filopodium assembly (GO:0046847)|GTP catabolic process (GO:0006184)|synapse assembly (GO:0007416)	dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			NS(1)|breast(3)|endometrium(1)|kidney(1)|large_intestine(9)|lung(16)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	37						CTTACAGACATATCGCTGACC	0.443																																																0			1											54.0	57.0	56.0					1																	172002357		1915	4138	6053	170268980	SO:0001583	missense	26052			AL136712	CCDS44276.1, CCDS60356.1	1q24.1	2013-01-10			ENSG00000197959	ENSG00000197959		"""Pleckstrin homology (PH) domain containing"""	29125	protein-coding gene	gene with protein product	"""Dyna III"""	611445				10048485	Standard	NM_015569		Approved	KIAA0820	uc001gie.4	Q9UQ16	OTTHUMG00000034913	ENST00000355305.5:c.801T>G	1.37:g.172002357T>G	ENSP00000347457:p.His267Gln		170268980	A9Z1Y1|O14982|O95555|Q1MTM8|Q5W129|Q6P2G1|Q9H0P3|Q9H548|Q9NQ68|Q9NQN6	Missense_Mutation	SNP	HMMSmart_DYNc,superfamily_SSF52540,HMMPfam_Dynamin_N,PatternScan_DYNAMIN,HMMPfam_Dynamin_M,superfamily_SSF50729,HMMPfam_PH,HMMSmart_PH,HMMPfam_GED,HMMSmart_GED	p.H267Q	ENST00000355305.5	37	c.801		1	.	.	.	.	.	.	.	.	.	.	T	15.39	2.820766	0.50633	.	.	ENSG00000197959	ENST00000359070;ENST00000358155;ENST00000367733;ENST00000355305;ENST00000367731;ENST00000520906;ENST00000523513	T;T;T;T;T;T	0.72725	-0.68;-0.68;-0.68;-0.68;-0.68;-0.68	5.66	-4.21	0.03812	.	0.000000	0.85682	D	0.000000	T	0.74382	0.3709	M	0.79614	2.46	0.52099	D	0.999943	P;D;D;P	0.69078	0.594;0.995;0.997;0.517	B;P;D;B	0.67548	0.383;0.658;0.952;0.261	T	0.80745	-0.1245	10	0.72032	D	0.01	.	14.9035	0.70699	0.0:0.6396:0.0:0.3604	.	267;267;267;267	E5RHK8;Q9UQ16-2;Q9UQ16-3;Q6P2G1	.;.;.;.	Q	267;267;267;267;267;267;157	ENSP00000350876:H267Q;ENSP00000356707:H267Q;ENSP00000347457:H267Q;ENSP00000356705:H267Q;ENSP00000429701:H267Q;ENSP00000429416:H157Q	ENSP00000347457:H267Q	H	+	3	2	DNM3	170268980	0.966000	0.33281	0.966000	0.40874	0.206000	0.24218	0.156000	0.16382	-0.676000	0.05238	-0.912000	0.02778	CAT	-	superfamily_SSF52540,HMMPfam_Dynamin_M		0.443	DNM3-003	NOVEL	not_organism_supported|basic	protein_coding	DNM3	protein_coding	OTTHUMT00000084531.1	T	NM_015569		170268980	+1	no_errors	NM_015569	genbank	human	validated	54_36p	missense	SNP	1.000	G
GORASP2	26003	genome.wustl.edu	37	2	171811159	171811159	+	Splice_Site	SNP	G	G	C			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr2:171811159G>C	ENST00000234160.4	+	6	1381		c.e6-1		GORASP2_ENST00000452526.2_Splice_Site|GORASP2_ENST00000493692.1_Intron	NM_001201428.1|NM_015530.4	NP_001188357.1|NP_056345.3	Q9H8Y8	GORS2_HUMAN	golgi reassembly stacking protein 2, 55kDa						mitotic cell cycle (GO:0000278)|organelle organization (GO:0006996)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(3)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|skin(1)	14						TGTTTTTATAGCCTAGGATGT	0.398																																																0			2											96.0	93.0	94.0					2																	171811159		2203	4300	6503	171519405	SO:0001630	splice_region_variant	26003				CCDS33325.1	2q31.1	2012-09-20	2002-08-29		ENSG00000115806	ENSG00000115806			17500	protein-coding gene	gene with protein product		608693	"""golgi reassembly stacking protein 2, 55 kDa"""			10487747	Standard	NM_015530		Approved	GRASP55, GRS2, GOLPH6	uc002ugj.3	Q9H8Y8	OTTHUMG00000154072	ENST00000234160.4:c.567-1G>C	2.37:g.171811159G>C			171519405	B4DKT0|Q53TE3|Q96I74|Q96K84|Q9H946|Q9UFW4	Splice_Site	SNP	-	e6-1	ENST00000234160.4	37	c.567-1	CCDS33325.1	2	.	.	.	.	.	.	.	.	.	.	G	23.9	4.474159	0.84640	.	.	ENSG00000115806	ENST00000234160;ENST00000452526	.	.	.	5.84	5.84	0.93424	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.333	0.90277	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	GORASP2	171519405	1.000000	0.71417	0.998000	0.56505	0.986000	0.74619	9.572000	0.98179	2.762000	0.94881	0.551000	0.68910	.	-	-		0.398	GORASP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GORASP2	protein_coding	OTTHUMT00000333719.2	G		Intron	171519405	+1	no_errors	NM_015530	genbank	human	reviewed	54_36p	splice_site	SNP	1.000	C
GPRIN1	114787	genome.wustl.edu	37	5	176026542	176026542	+	Silent	SNP	G	G	A	rs531996464		TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr5:176026542G>A	ENST00000303991.4	-	2	471	c.294C>T	c.(292-294)tgC>tgT	p.C98C		NM_052899.2	NP_443131.2	Q7Z2K8	GRIN1_HUMAN	G protein regulated inducer of neurite outgrowth 1	98					neuron projection development (GO:0031175)	cell projection (GO:0042995)|plasma membrane (GO:0005886)				NS(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(3)|liver(1)|lung(15)|ovary(2)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	all_cancers(89;0.00263)|Renal(175;0.000269)|Lung NSC(126;0.00902)|all_lung(126;0.0142)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GGGGAGAGAAGCAGGTTGGGG	0.647													G|||	1	0.000199681	0.0008	0.0	5008	,	,		17251	0.0		0.0	False		,,,				2504	0.0															0			5											40.0	44.0	43.0					5																	176026542		2203	4300	6503	175959148	SO:0001819	synonymous_variant	114787			AB067480	CCDS4405.1	5q35.2	2008-02-05			ENSG00000169258	ENSG00000169258			24835	protein-coding gene	gene with protein product		611239				11572484	Standard	NM_052899		Approved	GRIN1, KIAA1893	uc003meo.1	Q7Z2K8	OTTHUMG00000130659	ENST00000303991.4:c.294C>T	5.37:g.176026542G>A			175959148	C9JM70|Q8ND74|Q96PZ4	Silent	SNP	NULL	p.C98	ENST00000303991.4	37	c.294	CCDS4405.1	5																																																																																			-	NULL		0.647	GPRIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPRIN1	protein_coding	OTTHUMT00000253149.1	G	NM_052899		175959148	-1	no_errors	NM_052899	genbank	human	validated	54_36p	silent	SNP	0.034	A
TSPAN17	26262	genome.wustl.edu	37	5	176083880	176083880	+	Silent	SNP	G	G	A			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr5:176083880G>A	ENST00000298564.10	+	4	635	c.486G>A	c.(484-486)ctG>ctA	p.L162L	TSPAN17_ENST00000310032.8_Intron|TSPAN17_ENST00000508164.1_Intron|TSPAN17_ENST00000405525.2_Intron|TSPAN17_ENST00000503045.1_Intron|TSPAN17_ENST00000515708.1_Intron			Q96FV3	TSN17_HUMAN	tetraspanin 17	247					establishment of protein localization to organelle (GO:0072594)|protein ubiquitination (GO:0016567)	integral component of membrane (GO:0016021)|ubiquitin ligase complex (GO:0000151)	enzyme binding (GO:0019899)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(4)|kidney(1)|large_intestine(2)|lung(5)|urinary_tract(1)	13	all_cancers(89;0.00141)|Renal(175;0.000269)|Lung NSC(126;0.00814)|all_lung(126;0.0133)	Medulloblastoma(196;0.00498)|all_neural(177;0.0212)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CCCCTCACCTGTCCTCTGTCT	0.637																																																0			5											76.0	70.0	72.0					5																	176083880		2203	4300	6503	176016486	SO:0001819	synonymous_variant	26262			AF174603	CCDS34298.1, CCDS47346.1, CCDS47346.2, CCDS54952.1	5q35.3	2013-02-14	2005-03-21	2005-03-21	ENSG00000048140	ENSG00000048140		"""Tetraspanins"""	13594	protein-coding gene	gene with protein product			"""F-box only protein 23, transmembrane 4 superfamily member 17"""	FBXO23, TM4SF17		10531035, 10531037	Standard	NM_012171		Approved	FBX23	uc003met.3	Q96FV3	OTTHUMG00000163230	ENST00000298564.10:c.486G>A	5.37:g.176083880G>A			176016486	Q6NXF7|Q96S98|Q9UKB9	Silent	SNP	HMMPfam_Tetraspannin	p.L162	ENST00000298564.10	37	c.486		5																																																																																			-	NULL		0.637	TSPAN17-009	PUTATIVE	basic	protein_coding	TSPAN17	protein_coding	OTTHUMT00000387012.1	G			176016486	+1	no_errors	ENST00000298564	ensembl	human	known	54_36p	silent	SNP	0.139	A
NSD1	64324	genome.wustl.edu	37	5	176715818	176715818	+	Splice_Site	SNP	A	A	C			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr5:176715818A>C	ENST00000439151.2	+	21	6196		c.e21-1		NSD1_ENST00000354179.4_Splice_Site|NSD1_ENST00000347982.4_Splice_Site|NSD1_ENST00000361032.4_Splice_Site	NM_022455.4	NP_071900.2	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1						gastrulation with mouth forming second (GO:0001702)|histone H3-K36 methylation (GO:0010452)|histone H4-K20 methylation (GO:0034770)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|estrogen receptor binding (GO:0030331)|histone methyltransferase activity (H3-K36 specific) (GO:0046975)|histone methyltransferase activity (H4-K20 specific) (GO:0042799)|retinoic acid receptor binding (GO:0042974)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(18)|lung(24)|ovary(2)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(3)	96	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)		TCTCTTATGCAGGCACTGAAC	0.368			T	NUP98	AML		Sotos Syndrome		Weaver syndrome;Sotos syndrome;Beckwith-Wiedemann syndrome	HNSCC(47;0.14)																													Dom	yes		5	5q35	64324	nuclear receptor binding SET domain protein 1	yes	L	0			5											124.0	123.0	123.0					5																	176715818		2203	4300	6503	176648424	SO:0001630	splice_region_variant	64324	Familial Cancer Database	Weaver-Smith syndrome;Cerebral Gigantism;BWS, Exomphalos-Macroglossia-Gigantism (EMG) syndrome, Wiedemann-Beckwith syndrome, WBS	AK026066	CCDS4412.1, CCDS4413.1	5q35	2014-09-17	2003-03-12		ENSG00000165671	ENSG00000165671		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	14234	protein-coding gene	gene with protein product		606681	"""Sotos syndrome"""	STO		9628876, 11896389	Standard	NM_022455		Approved	ARA267, FLJ22263, KMT3B	uc003mfr.4	Q96L73	OTTHUMG00000130846	ENST00000439151.2:c.6152-1A>C	5.37:g.176715818A>C			176648424	Q96PD8|Q96RN7	Splice_Site	SNP	-	e20-2	ENST00000439151.2	37	c.6152-2	CCDS4412.1	5	.	.	.	.	.	.	.	.	.	.	A	22.2	4.254874	0.80135	.	.	ENSG00000165671	ENST00000354179;ENST00000439151;ENST00000347982;ENST00000361032	.	.	.	5.64	5.64	0.86602	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.5422	0.76062	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	NSD1	176648424	1.000000	0.71417	0.997000	0.53966	0.986000	0.74619	9.268000	0.95675	2.145000	0.66743	0.533000	0.62120	.	-	-		0.368	NSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NSD1	protein_coding	OTTHUMT00000253412.2	A	NM_172349	Intron	176648424	+1	no_errors	NM_022455	genbank	human	reviewed	54_36p	splice_site	SNP	1.000	C
DBN1	1627	genome.wustl.edu	37	5	176899146	176899146	+	Intron	SNP	G	G	A	rs369476395		TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr5:176899146G>A	ENST00000309007.5	-	1	306				DBN1_ENST00000393565.1_Intron|DBN1_ENST00000292385.5_Silent_p.R22R	NM_004395.3	NP_004386	Q16643	DREB_HUMAN	drebrin 1						actin filament organization (GO:0007015)|cell communication by chemical coupling (GO:0010643)|cell communication by electrical coupling (GO:0010644)|maintenance of protein location in cell (GO:0032507)|neural precursor cell proliferation (GO:0061351)|regulation of dendrite development (GO:0050773)|regulation of neuronal synaptic plasticity (GO:0048168)	actin cytoskeleton (GO:0015629)|actomyosin (GO:0042641)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|gap junction (GO:0005921)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|profilin binding (GO:0005522)			breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(1)|lung(12)|ovary(1)|skin(2)	25	all_cancers(89;2.17e-05)|Renal(175;0.000269)|Lung NSC(126;0.0014)|all_lung(126;0.0025)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CTTGTCTCTCGCGTCCATCCC	0.657																																																0			5						G	,	2,4404	4.2+/-10.8	0,2,2201	53.0	50.0	51.0		,66	-4.9	0.4	5		51	0,8600		0,0,4300	no	intron,coding-synonymous	DBN1	NM_004395.3,NM_080881.2	,	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	,	,22/652	176899146	2,13004	2203	4300	6503	176831752	SO:0001627	intron_variant	1627				CCDS4420.1, CCDS4421.1	5q35.3	2008-02-05			ENSG00000113758	ENSG00000113758			2695	protein-coding gene	gene with protein product		126660		D0S117E		8216329	Standard	NM_004395		Approved		uc003mgy.2	Q16643	OTTHUMG00000130856	ENST00000309007.5:c.86+1290C>T	5.37:g.176899146G>A			176831752	A8MV58|B2RBG0|Q9UFZ5	Silent	SNP	HMMSmart_ADF,HMMPfam_Cofilin_ADF,superfamily_SSF55753	p.R22	ENST00000309007.5	37	c.66	CCDS4420.1	5																																																																																			-	HMMSmart_ADF,HMMPfam_Cofilin_ADF		0.657	DBN1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DBN1	protein_coding	OTTHUMT00000253429.2	G	NM_080881		176831752	-1	no_errors	NM_080881	genbank	human	reviewed	54_36p	silent	SNP	0.797	A
COL23A1	91522	genome.wustl.edu	37	5	177682004	177682004	+	Missense_Mutation	SNP	C	C	A			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr5:177682004C>A	ENST00000390654.3	-	16	1263	c.906G>T	c.(904-906)gaG>gaT	p.E302D	COL23A1_ENST00000407622.1_Missense_Mutation_p.A301S	NM_173465.3	NP_775736.2	Q86Y22	CONA1_HUMAN	collagen, type XXIII, alpha 1	302	Collagen-like 2.|Gly-rich.				collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(6)|ovary(1)|skin(2)|urinary_tract(1)	19	all_cancers(89;0.00188)|Renal(175;0.000159)|Lung NSC(126;0.00814)|all_lung(126;0.0129)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	OV - Ovarian serous cystadenocarcinoma(192;0.153)|all cancers(165;0.172)		TGTCTCCCTGCTCGCCCTTGA	0.537																																																0			5											196.0	195.0	195.0					5																	177682004		2034	4208	6242	177614610	SO:0001583	missense	91522			AL137461	CCDS4436.1	5q35.3	2013-01-16			ENSG00000050767	ENSG00000050767		"""Collagens"""	22990	protein-coding gene	gene with protein product		610043				12644459	Standard	NM_173465		Approved	DKFZp434K0621	uc021yiz.1	Q86Y22	OTTHUMG00000130890	ENST00000390654.3:c.906G>T	5.37:g.177682004C>A	ENSP00000375069:p.Glu302Asp		177614610	Q8IVR4|Q9NT93	Missense_Mutation	SNP	HMMPfam_Collagen	p.E302D	ENST00000390654.3	37	c.906	CCDS4436.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.39|13.39	2.222489|2.222489	0.39300|0.39300	.|.	.|.	ENSG00000050767|ENSG00000050767	ENST00000407622|ENST00000390654	D|T	0.90620|0.26518	-2.7|1.73	4.19|4.19	0.217|0.217	0.15264|0.15264	.|.	.|0.289830	.|0.28476	.|N	.|0.015204	T|T	0.19886|0.19886	0.0478|0.0478	L|L	0.47016|0.47016	1.485|1.485	0.09310|0.09310	N|N	0.999998|0.999998	.|B	.|0.32968	.|0.392	.|B	.|0.40982	.|0.345	T|T	0.17776|0.17776	-1.0358|-1.0358	7|10	0.18710|0.18710	T|T	0.47|0.47	-14.9006|-14.9006	3.1041|3.1041	0.06336|0.06336	0.189:0.4831:0.0:0.3278|0.189:0.4831:0.0:0.3278	.|.	.|302	.|Q86Y22	.|CONA1_HUMAN	S|D	301|302	ENSP00000385092:A301S|ENSP00000375069:E302D	ENSP00000385092:A301S|ENSP00000375069:E302D	A|E	-|-	1|3	0|2	COL23A1|COL23A1	177614610|177614610	0.934000|0.934000	0.31675|0.31675	0.976000|0.976000	0.42696|0.42696	0.842000|0.842000	0.47809|0.47809	-0.218000|-0.218000	0.09240|0.09240	-0.074000|-0.074000	0.12820|0.12820	-0.140000|-0.140000	0.14226|0.14226	GCA|GAG	-	HMMPfam_Collagen		0.537	COL23A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL23A1	protein_coding	OTTHUMT00000253475.1	C	NM_173465		177614610	-1	no_errors	NM_173465	genbank	human	validated	54_36p	missense	SNP	0.997	A
NR5A2	2494	genome.wustl.edu	37	1	200017451	200017451	+	Silent	SNP	T	T	C			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr1:200017451T>C	ENST00000367362.3	+	5	861	c.615T>C	c.(613-615)tcT>tcC	p.S205S	NR5A2_ENST00000236914.3_Silent_p.S159S|NR5A2_ENST00000544748.1_Silent_p.S133S	NM_001276464.1|NM_205860.1	NP_001263393.1|NP_995582.1	O00482	NR5A2_HUMAN	nuclear receptor subfamily 5, group A, member 2	205					bile acid metabolic process (GO:0008206)|cholesterol homeostasis (GO:0042632)|embryo development (GO:0009790)|endocrine pancreas development (GO:0031018)|gene expression (GO:0010467)|homeostatic process (GO:0042592)|intracellular receptor signaling pathway (GO:0030522)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of viral genome replication (GO:0045070)|regulation of cell proliferation (GO:0042127)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|phospholipid binding (GO:0005543)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(15)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	31	Prostate(682;0.19)					CTATGCCCTCTGACCTGACCA	0.502																																					Melanoma(179;1138 2773 15678 26136)											0			1											216.0	196.0	203.0					1																	200017451		2203	4300	6503	198284074	SO:0001819	synonymous_variant	2494			U93553	CCDS1400.1, CCDS1401.1, CCDS60383.1	1q32.11	2013-01-16			ENSG00000116833	ENSG00000116833		"""Nuclear hormone receptors"""	7984	protein-coding gene	gene with protein product	"""liver receptor homolog-1"""	604453		FTF		9858833, 7680097	Standard	NM_205860		Approved	FTZ-F1beta, hB1F, LRH-1, FTZ-F1, hB1F-2, B1F2	uc001gvb.4	O00482	OTTHUMG00000035635	ENST00000367362.3:c.615T>C	1.37:g.200017451T>C			198284074	B4E2P3|O95642|Q147U3	Silent	SNP	HMMSmart_SM00399,HMMPfam_zf-C4,superfamily_Glucocorticoid receptor-like (DNA-binding domain),PatternScan_NUCLEAR_REC_DBD_1,superfamily_Nuclear receptor ligand-binding domain,HMMSmart_SM00430,HMMPfam_Hormone_recep	p.S205	ENST00000367362.3	37	c.615	CCDS1401.1	1	.	.	.	.	.	.	.	.	.	.	T	8.485	0.860669	0.17178	.	.	ENSG00000116833	ENST00000367357	.	.	.	5.63	-11.3	0.00108	.	.	.	.	.	T	0.31358	0.0794	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.39722	-0.9600	4	.	.	.	.	1.8697	0.03206	0.1681:0.3234:0.2486:0.2599	.	.	.	.	P	126	.	.	L	+	2	0	NR5A2	198284074	0.000000	0.05858	0.253000	0.24343	0.992000	0.81027	-2.206000	0.01231	-2.277000	0.00677	-0.490000	0.04691	CTG	-	superfamily_Nuclear receptor ligand-binding domain		0.502	NR5A2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NR5A2	protein_coding	OTTHUMT00000086497.2	T			198284074	+1	no_errors	NM_205860	genbank	human	validated	54_36p	silent	SNP	0.962	C
KIF21B	23046	genome.wustl.edu	37	1	200950120	200950120	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr1:200950120G>A	ENST00000422435.2	-	29	4263	c.3947C>T	c.(3946-3948)gCc>gTc	p.A1316V	KIF21B_ENST00000332129.2_Missense_Mutation_p.A1303V|KIF21B_ENST00000461742.2_Missense_Mutation_p.A1316V|KIF21B_ENST00000360529.5_Missense_Mutation_p.A1303V	NM_001252100.1	NP_001239029.1	O75037	KI21B_HUMAN	kinesin family member 21B	1316					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(4)|large_intestine(8)|liver(1)|lung(27)|ovary(3)|pancreas(1)|prostate(5)|skin(8)|stomach(2)|urinary_tract(2)	83						CTCATCTGTGGCATCCAGGCA	0.587																																																0			1											103.0	85.0	91.0					1																	200950120		2203	4300	6503	199216743	SO:0001583	missense	23046			BC031927	CCDS30965.1, CCDS58054.1, CCDS58055.1, CCDS58056.1	1q32.1	2013-01-10			ENSG00000116852	ENSG00000116852		"""Kinesins"", ""WD repeat domain containing"""	29442	protein-coding gene	gene with protein product		608322				9455484	Standard	NM_001252100		Approved	DKFZP434J212, KIAA0449	uc001gvs.2	O75037	OTTHUMG00000035787	ENST00000422435.2:c.3947C>T	1.37:g.200950120G>A	ENSP00000411831:p.Ala1316Val		199216743	B2RP62|B7ZMI0|Q5T4J3	Missense_Mutation	SNP	HMMSmart_KISc,superfamily_SSF52540,HMMPfam_Kinesin,PatternScan_KINESIN_MOTOR_DOMAIN1,superfamily_WD40_like,superfamily_Prefoldin,HMMSmart_WD40,HMMPfam_WD40,PatternScan_WD_REPEATS_1	p.A1303V	ENST00000422435.2	37	c.3908	CCDS58056.1	1	.	.	.	.	.	.	.	.	.	.	G	26.0	4.697505	0.88830	.	.	ENSG00000116852	ENST00000332129;ENST00000360529;ENST00000461742;ENST00000422435;ENST00000539858	T;T;T;T	0.58940	0.3;0.3;0.3;0.3	5.69	5.69	0.88448	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.51873	0.1700	N	0.01267	-0.92	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;0.999;0.998	D;D;D;D	0.87578	0.996;0.998;0.996;0.994	T	0.66799	-0.5832	10	0.28530	T	0.3	.	19.7987	0.96497	0.0:0.0:1.0:0.0	.	1303;1316;1316;1303	B7ZMI0;B2RP62;O75037;O75037-2	.;.;KI21B_HUMAN;.	V	1303;1303;1316;1316;1316	ENSP00000328494:A1303V;ENSP00000353724:A1303V;ENSP00000433808:A1316V;ENSP00000411831:A1316V	ENSP00000328494:A1303V	A	-	2	0	KIF21B	199216743	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	9.458000	0.97634	2.700000	0.92200	0.585000	0.79938	GCC	-	superfamily_WD40_like,HMMSmart_WD40,HMMPfam_WD40		0.587	KIF21B-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIF21B	protein_coding	OTTHUMT00000382635.1	G	XM_371332		199216743	-1	no_errors	NM_017596	genbank	human	provisional	54_36p	missense	SNP	1.000	A
SATB2	23314	genome.wustl.edu	37	2	200137319	200137319	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr2:200137319G>A	ENST00000417098.1	-	11	2633	c.1817C>T	c.(1816-1818)cCg>cTg	p.P606L	SATB2_ENST00000457245.1_Missense_Mutation_p.P606L|SATB2_ENST00000443023.1_Missense_Mutation_p.P547L|SATB2_ENST00000428695.1_Missense_Mutation_p.P488L|SATB2_ENST00000260926.5_Missense_Mutation_p.P606L	NM_001172509.1	NP_001165980.1	Q9UPW6	SATB2_HUMAN	SATB homeobox 2	606					cartilage development (GO:0051216)|cellular response to organic substance (GO:0071310)|chromatin remodeling (GO:0006338)|embryonic pattern specification (GO:0009880)|embryonic skeletal system morphogenesis (GO:0048704)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|osteoblast development (GO:0002076)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(40)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						GTCTTCAGTCGGAGGAGGTGG	0.502																																					Colon(30;262 767 11040 24421 36230)											0			2											71.0	80.0	77.0					2																	200137319		2203	4300	6503	199845564	SO:0001583	missense	23314			AB028957	CCDS2327.1	2q33.1	2011-06-20	2007-02-15		ENSG00000119042	ENSG00000119042		"""Homeoboxes / CUT class"""	21637	protein-coding gene	gene with protein product		608148	"""SATB family member 2"""				Standard	NM_015265		Approved	KIAA1034, FLJ21474	uc002uva.2	Q9UPW6	OTTHUMG00000132767	ENST00000417098.1:c.1817C>T	2.37:g.200137319G>A	ENSP00000401112:p.Pro606Leu		199845564	A8K5Z8|Q3ZB87|Q4V763	Missense_Mutation	SNP	HMMPfam_CUT,HMMSmart_SM00389,superfamily_Homeodomain-like,HMMPfam_Homeobox	p.P606L	ENST00000417098.1	37	c.1817	CCDS2327.1	2	.	.	.	.	.	.	.	.	.	.	G	12.51	1.959927	0.34565	.	.	ENSG00000119042	ENST00000417098;ENST00000443023;ENST00000260926;ENST00000428695;ENST00000457245	T;T;T;T;T	0.45276	0.9;0.93;0.9;0.94;0.9	5.25	5.25	0.73442	.	0.269957	0.36444	N	0.002595	T	0.21550	0.0519	N	0.08118	0	0.47441	D	0.99942	P;B	0.35844	0.524;0.174	B;B	0.17722	0.019;0.004	T	0.09037	-1.0693	10	0.34782	T	0.22	-5.3416	16.7451	0.85470	0.0:0.0:1.0:0.0	.	488;606	Q3ZB87;Q9UPW6	.;SATB2_HUMAN	L	606;547;606;488;606	ENSP00000401112:P606L;ENSP00000388764:P547L;ENSP00000260926:P606L;ENSP00000388581:P488L;ENSP00000405420:P606L	ENSP00000260926:P606L	P	-	2	0	SATB2	199845564	1.000000	0.71417	0.963000	0.40424	0.916000	0.54674	3.013000	0.49582	2.620000	0.88729	0.644000	0.83932	CCG	-	NULL		0.502	SATB2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SATB2	protein_coding	OTTHUMT00000256140.1	G	NM_015265		199845564	-1	no_errors	NM_015265	genbank	human	validated	54_36p	missense	SNP	0.942	A
AOX1	316	genome.wustl.edu	37	2	201492122	201492122	+	Missense_Mutation	SNP	A	A	T			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr2:201492122A>T	ENST00000374700.2	+	20	2412	c.2171A>T	c.(2170-2172)gAa>gTa	p.E724V	AOX1_ENST00000485106.1_3'UTR	NM_001159.3	NP_001150.3	Q06278	AOXA_HUMAN	aldehyde oxidase 1	724					inflammatory response (GO:0006954)|reactive oxygen species metabolic process (GO:0072593)|small molecule metabolic process (GO:0044281)|vitamin B6 metabolic process (GO:0042816)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	2 iron, 2 sulfur cluster binding (GO:0051537)|aldehyde oxidase activity (GO:0004031)|electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|iron ion binding (GO:0005506)|molybdopterin cofactor binding (GO:0043546)|NAD binding (GO:0051287)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)|xanthine dehydrogenase activity (GO:0004854)			breast(5)|endometrium(3)|kidney(4)|large_intestine(13)|lung(38)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	81					Allopurinol(DB00437)|Aminocaproic Acid(DB00513)|Brimonidine(DB00484)|Famciclovir(DB00426)|Menadione(DB00170)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|Pyrazinamide(DB00339)|Raloxifene(DB00481)|Zaleplon(DB00962)|Zonisamide(DB00909)	AGGAAACTGGAATATGGAAAT	0.423																																																0			2											199.0	204.0	202.0					2																	201492122		2203	4300	6503	201200367	SO:0001583	missense	316			AF017060	CCDS33360.1	2q33	2008-05-20			ENSG00000138356	ENSG00000138356			553	protein-coding gene	gene with protein product		602841				7570184	Standard	NM_001159		Approved	AO, AOH1	uc002uvx.3	Q06278	OTTHUMG00000154536	ENST00000374700.2:c.2171A>T	2.37:g.201492122A>T	ENSP00000363832:p.Glu724Val		201200367	O14765|Q53RR8|Q53TV3|Q9BYF0|Q9UPG6	Missense_Mutation	SNP	superfamily_2Fe-2S ferredoxin-like,HMMPfam_Fer2,PatternScan_2FE2S_FER_1,HMMPfam_Fer2_2,superfamily_CO dehydrogenase ISP C-domain like,superfamily_FAD-binding domain,HMMPfam_FAD_binding_5,superfamily_CO dehydrogenase flavoprotein C-terminal domain-like,HMMPfam_CO_deh_flav_C,superfamily_CO dehydrogenase molybdoprotein N-domain-like,HMMPfam_Ald_Xan_dh_C,superfamily_Molybdenum cofactor-binding domain,HMMPfam_Ald_Xan_dh_C2,PatternScan_MOLYBDOPTERIN_EUK	p.E724V	ENST00000374700.2	37	c.2171	CCDS33360.1	2	.	.	.	.	.	.	.	.	.	.	A	13.62	2.290369	0.40494	.	.	ENSG00000138356	ENST00000374700	T	0.39056	1.1	4.87	4.87	0.63330	Aldehyde oxidase/xanthine dehydrogenase, molybdopterin binding (2);	0.177350	0.48767	D	0.000162	T	0.40862	0.1134	L	0.58925	1.835	0.54753	D	0.999984	B	0.34290	0.447	B	0.35727	0.209	T	0.40403	-0.9565	10	0.52906	T	0.07	-59.7893	11.5833	0.50904	0.851:0.1489:0.0:0.0	.	724	Q06278	ADO_HUMAN	V	724	ENSP00000363832:E724V	ENSP00000363832:E724V	E	+	2	0	AOX1	201200367	1.000000	0.71417	0.998000	0.56505	0.188000	0.23474	4.050000	0.57404	2.159000	0.67721	0.467000	0.42956	GAA	-	superfamily_Molybdenum cofactor-binding domain,HMMPfam_Ald_Xan_dh_C2		0.423	AOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AOX1	protein_coding	OTTHUMT00000335844.1	A	NM_001159		201200367	+1	no_errors	NM_001159	genbank	human	reviewed	54_36p	missense	SNP	0.998	T
CYP20A1	57404	genome.wustl.edu	37	2	204103807	204103807	+	Missense_Mutation	SNP	G	G	T			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr2:204103807G>T	ENST00000356079.4	+	1	145	c.22G>T	c.(22-24)Gcc>Tcc	p.A8S	CYP20A1_ENST00000461371.1_3'UTR|CYP20A1_ENST00000429815.2_Missense_Mutation_p.A8S	NM_177538.2	NP_803882.1	Q6UW02	CP20A_HUMAN	cytochrome P450, family 20, subfamily A, polypeptide 1	8						integral component of membrane (GO:0016021)|membrane (GO:0016020)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)			cervix(1)|large_intestine(2)|lung(6)|ovary(1)|skin(1)	11						CGCGATCTTCGCCGTTACCTT	0.652																																																0			2											124.0	101.0	108.0					2																	204103807		2203	4300	6503	203812052	SO:0001583	missense	57404			AK021770	CCDS2357.1	2q33	2008-02-05			ENSG00000119004	ENSG00000119004		"""Cytochrome P450s"""	20576	protein-coding gene	gene with protein product							Standard	NM_177538		Approved	CYP-M	uc002uzv.4	Q6UW02	OTTHUMG00000132854	ENST00000356079.4:c.22G>T	2.37:g.204103807G>T	ENSP00000348380:p.Ala8Ser		203812052	Q4ZG61|Q8N4Q8|Q8WWA9|Q9HC04	Missense_Mutation	SNP	superfamily_Cytochrome_P450,HMMPfam_p450	p.A8S	ENST00000356079.4	37	c.22	CCDS2357.1	2	.	.	.	.	.	.	.	.	.	.	G	24.6	4.553604	0.86231	.	.	ENSG00000119004	ENST00000356079;ENST00000421618;ENST00000429815;ENST00000443941	T;T;D	0.84146	-0.6;-0.68;-1.81	4.68	4.68	0.58851	.	0.113106	0.64402	D	0.000011	D	0.87641	0.6228	L	0.34521	1.04	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.65987	0.919;0.94	D	0.87162	0.2215	10	0.37606	T	0.19	-1.1869	17.5197	0.87783	0.0:0.0:1.0:0.0	.	8;8	E9PHG5;Q6UW02	.;CP20A_HUMAN	S	8	ENSP00000348380:A8S;ENSP00000407860:A8S;ENSP00000411341:A8S	ENSP00000348380:A8S	A	+	1	0	CYP20A1	203812052	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	7.494000	0.81503	2.282000	0.76494	0.462000	0.41574	GCC	-	NULL		0.652	CYP20A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP20A1	protein_coding	OTTHUMT00000256328.3	G	NM_020674		203812052	+1	no_errors	NM_177538	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
FCAMR	83953	genome.wustl.edu	37	1	207133038	207133038	+	Nonsense_Mutation	SNP	C	C	A			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr1:207133038C>A	ENST00000450945.2	-	6	780	c.757G>T	c.(757-759)Gga>Tga	p.G253*	FCAMR_ENST00000486178.1_5'UTR|FCAMR_ENST00000324852.4_Missense_Mutation_p.W520L|FCAMR_ENST00000400962.3_Nonsense_Mutation_p.G253*			Q8WWV6	FCAMR_HUMAN	Fc receptor, IgA, IgM, high affinity	399					immune system process (GO:0002376)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(2)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)|skin(1)|stomach(1)	11						CCTCCTTCTCCAGAGCTTCCT	0.537																																					Ovarian(199;1883 2142 16966 44409 45154)											0			1											130.0	125.0	126.0					1																	207133038		1568	3582	5150	205199661	SO:0001587	stop_gained	83953			AF354295	CCDS41460.1, CCDS53468.1	1q32.1	2013-01-14			ENSG00000162897	ENSG00000162897		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	24692	protein-coding gene	gene with protein product		605484				11779189	Standard	NM_001122979		Approved	FKSG87, FCA/MR, CD351	uc001hfa.4	Q8WWV6	OTTHUMG00000036579	ENST00000450945.2:c.757G>T	1.37:g.207133038C>A	ENSP00000392707:p.Gly253*		205199661	Q32M82|Q8WWV5|Q96SA2	Nonsense_Mutation	SNP	HMMPfam_V-set,superfamily_Immunoglobulin,HMMSmart_SM00409	p.G253*	ENST00000450945.2	37	c.757	CCDS41460.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	22.0|22.0	4.227443|4.227443	0.79576|0.79576	.|.	.|.	ENSG00000162897|ENSG00000162897	ENST00000400962;ENST00000450945|ENST00000324852	.|T	.|0.04862	.|3.54	4.17|4.17	-2.53|-2.53	0.06326|0.06326	.|.	.|.	.|.	.|.	.|.	.|T	.|0.04003	.|0.0112	.|.	.|.	.|.	0.21579|0.21579	N|N	0.999634|0.999634	.|B;B	.|0.02656	.|0.0;0.0	.|B;B	.|0.01281	.|0.0;0.0	.|T	.|0.41893	.|-0.9483	.|8	0.56958|0.36615	D|T	0.05|0.2	.|.	6.3537|6.3537	0.21390|0.21390	0.0:0.5972:0.149:0.2538|0.0:0.5972:0.149:0.2538	.|.	.|495;475	.|D2KTA8;Q8WWV6	.|.;FCAMR_HUMAN	X|L	253|520	.|ENSP00000316491:W520L	ENSP00000383746:G253X|ENSP00000316491:W520L	G|W	-|-	1|2	0|0	FCAMR|FCAMR	205199661|205199661	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.131000|0.131000	0.20780|0.20780	-1.161000|-1.161000	0.03144|0.03144	-0.448000|-0.448000	0.07128|0.07128	-0.176000|-0.176000	0.13171|0.13171	GGA|TGG	-	NULL		0.537	FCAMR-001	KNOWN	basic|CCDS	protein_coding	FCAMR	protein_coding	OTTHUMT00000088968.2	C	NM_032029		205199661	-1	no_errors	ENST00000400962	ensembl	human	known	54_36p	nonsense	SNP	0.000	A
PTPN14	5784	genome.wustl.edu	37	1	214656356	214656356	+	Intron	SNP	C	C	G			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr1:214656356C>G	ENST00000366956.5	-	2	41					NM_005401.4	NP_005392.2	Q15678	PTN14_HUMAN	protein tyrosine phosphatase, non-receptor type 14						lymphangiogenesis (GO:0001946)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of protein export from nucleus (GO:0046825)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)			NS(2)|breast(3)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(9)|liver(3)|lung(21)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	58				OV - Ovarian serous cystadenocarcinoma(81;0.00181)|all cancers(67;0.00194)|Epithelial(68;0.0157)|GBM - Glioblastoma multiforme(131;0.155)		ACCATTCCCCCCATACTATTT	0.383																																					Colon(92;557 1424 24372 34121 40073)											0			1																																								212722979	SO:0001627	intron_variant	643454			X82676	CCDS1514.1	1q32.2	2011-06-09			ENSG00000152104	ENSG00000152104		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9647	protein-coding gene	gene with protein product		603155				7733990	Standard	NM_005401		Approved	PEZ	uc001hkk.2	Q15678	OTTHUMG00000037039	ENST00000366956.5:c.154-18056G>C	1.37:g.214656356C>G			212722979	Q5VSI0	RNA	SNP	-	NULL	ENST00000366956.5	37	NULL	CCDS1514.1	1																																																																																			-	-		0.383	PTPN14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC643454	protein_coding	OTTHUMT00000089918.2	C	NM_005401		212722979	-1	pseudogene	XR_042294	genbank	human	model	54_36p	rna	SNP	1.000	G
USP37	57695	genome.wustl.edu	37	2	219319666	219319666	+	Missense_Mutation	SNP	C	C	T	rs61752208	byFrequency	TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr2:219319666C>T	ENST00000258399.3	-	26	3339	c.2927G>A	c.(2926-2928)cGt>cAt	p.R976H	USP37_ENST00000454775.1_Missense_Mutation_p.R976H|USP37_ENST00000418019.1_Missense_Mutation_p.R976H|USP37_ENST00000415516.1_Missense_Mutation_p.R882H	NM_020935.2	NP_065986	Q86T82	UBP37_HUMAN	ubiquitin specific peptidase 37	976					G1/S transition of mitotic cell cycle (GO:0000082)|mitotic nuclear division (GO:0007067)|protein deubiquitination (GO:0016579)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|protein kinase binding (GO:0019901)|ubiquitin-specific protease activity (GO:0004843)			NS(2)|breast(3)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(1)|lung(7)|ovary(2)|prostate(3)|skin(5)|stomach(1)	35		Renal(207;0.0915)		Epithelial(149;1.08e-06)|all cancers(144;0.000197)|LUSC - Lung squamous cell carcinoma(224;0.00375)|Lung(261;0.00487)		CAAGGCCTGACGGGTAGTCTT	0.458													C|||	16	0.00319489	0.0008	0.0014	5008	,	,		18769	0.0		0.0099	False		,,,				2504	0.0041															0			2						C	HIS/ARG	3,4403	6.2+/-15.9	0,3,2200	148.0	137.0	141.0		2927	3.8	0.3	2	dbSNP_129	141	58,8542	36.4+/-91.3	0,58,4242	yes	missense	USP37	NM_020935.2	29	0,61,6442	TT,TC,CC		0.6744,0.0681,0.469	probably-damaging	976/980	219319666	61,12945	2203	4300	6503	219027910	SO:0001583	missense	57695			AB046814	CCDS2418.1	2q35	2008-02-05	2005-08-08		ENSG00000135913	ENSG00000135913		"""Ubiquitin-specific peptidases"""	20063	protein-coding gene	gene with protein product			"""ubiquitin specific protease 37"""			12838346	Standard	NM_020935		Approved	KIAA1594	uc010fvs.1	Q86T82	OTTHUMG00000133113	ENST00000258399.3:c.2927G>A	2.37:g.219319666C>T	ENSP00000258399:p.Arg976His		219027910	A2RUQ8|B7ZM38|B7ZM41|E9PHL3|Q2KHT2|Q53S10|Q7Z3A5|Q9HCH8	Missense_Mutation	SNP	superfamily_Cysteine proteinases,HMMPfam_UCH,PatternScan_UCH_2_1,HMMSmart_SM00726,HMMPfam_UIM,PatternScan_UCH_2_2	p.R976H	ENST00000258399.3	37	c.2927	CCDS2418.1	2	7	0.003205128205128205	1	0.0020325203252032522	0	0.0	0	0.0	6	0.0079155672823219	C	15.76	2.927138	0.52759	6.81E-4	0.006744	ENSG00000135913	ENST00000258399;ENST00000454775;ENST00000415516;ENST00000418019	T;T;T;T	0.51071	0.79;0.79;0.72;0.79	5.61	3.83	0.44106	.	0.291939	0.33895	N	0.004459	T	0.29491	0.0735	N	0.14661	0.345	0.38925	D	0.957829	D;P	0.55172	0.97;0.902	P;B	0.48815	0.591;0.277	T	0.30736	-0.9968	10	0.52906	T	0.07	-5.8933	11.8735	0.52534	0.0:0.8616:0.0:0.1384	rs61752208	882;976	Q86T82-2;Q86T82	.;UBP37_HUMAN	H	976;976;882;976	ENSP00000258399:R976H;ENSP00000393662:R976H;ENSP00000400902:R882H;ENSP00000396585:R976H	ENSP00000258399:R976H	R	-	2	0	USP37	219027910	0.723000	0.28027	0.324000	0.25361	0.489000	0.33432	1.293000	0.33353	0.947000	0.37659	0.650000	0.86243	CGT	-	NULL		0.458	USP37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP37	protein_coding	OTTHUMT00000256779.3	C	NM_020935		219027910	-1	no_errors	NM_020935	genbank	human	validated	54_36p	missense	SNP	0.004	T
DOCK10	55619	genome.wustl.edu	37	2	225635022	225635022	+	Missense_Mutation	SNP	C	C	T			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr2:225635022C>T	ENST00000258390.7	-	55	6417	c.6350G>A	c.(6349-6351)cGc>cAc	p.R2117H	DOCK10_ENST00000409592.3_Missense_Mutation_p.R2111H	NM_014689.2	NP_055504.2	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10	2117	DHR-2.				regulation of cell migration (GO:0030334)|small GTPase mediated signal transduction (GO:0007264)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(10)|large_intestine(16)|lung(40)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	87		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		TTTGATGAGGCGCTCATTCAC	0.507																																																0			2											97.0	92.0	93.0					2																	225635022		2049	4209	6258	225343266	SO:0001583	missense	55619			AB014594	CCDS46528.1, CCDS74661.1	2q36.3	2013-01-10			ENSG00000135905	ENSG00000135905		"""Pleckstrin homology (PH) domain containing"""	23479	protein-coding gene	gene with protein product	"""zizimin3"""	611518				12432077	Standard	NM_014689		Approved	ZIZ3, KIAA0694	uc010fwz.1	Q96BY6	OTTHUMG00000153428	ENST00000258390.7:c.6350G>A	2.37:g.225635022C>T	ENSP00000258390:p.Arg2117His		225343266	B3FL70|O75178|Q9NW06|Q9NXI8	Missense_Mutation	SNP	superfamily_PH domain-like,HMMPfam_PH,HMMSmart_SM00233,HMMPfam_Ded_cyto	p.R2117H	ENST00000258390.7	37	c.6350	CCDS46528.1	2	.	.	.	.	.	.	.	.	.	.	C	24.7	4.557079	0.86231	.	.	ENSG00000135905	ENST00000409592;ENST00000258390;ENST00000373702	T;T	0.18174	2.23;2.23	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	T	0.45034	0.1322	M	0.76574	2.34	0.53688	D	0.999974	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.77557	0.98;0.98;0.99	T	0.44620	-0.9316	10	0.87932	D	0	.	18.8883	0.92388	0.0:1.0:0.0:0.0	.	2117;2111;779	Q96BY6;B3FL70;B4DEY4	DOC10_HUMAN;.;.	H	2111;2117;624	ENSP00000386694:R2111H;ENSP00000258390:R2117H	ENSP00000258390:R2117H	R	-	2	0	DOCK10	225343266	1.000000	0.71417	0.996000	0.52242	0.848000	0.48234	4.824000	0.62701	2.472000	0.83506	0.563000	0.77884	CGC	-	HMMPfam_Ded_cyto		0.507	DOCK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK10	protein_coding	OTTHUMT00000331246.1	C			225343266	-1	no_errors	NM_014689	genbank	human	validated	54_36p	missense	SNP	1.000	T
GNPAT	8443	genome.wustl.edu	37	1	231401898	231401898	+	Missense_Mutation	SNP	A	A	T	rs368688523		TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr1:231401898A>T	ENST00000366647.4	+	7	1080	c.911A>T	c.(910-912)aAa>aTa	p.K304I	GNPAT_ENST00000366646.3_Missense_Mutation_p.K243I	NM_014236.3	NP_055051.1	O15228	GNPAT_HUMAN	glyceronephosphate O-acyltransferase	304					cellular lipid metabolic process (GO:0044255)|cerebellum morphogenesis (GO:0021587)|ether lipid biosynthetic process (GO:0008611)|glycerophospholipid biosynthetic process (GO:0046474)|membrane organization (GO:0061024)|paranodal junction assembly (GO:0030913)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|response to drug (GO:0042493)|response to fatty acid (GO:0070542)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)|synapse assembly (GO:0007416)	membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	glycerone-phosphate O-acyltransferase activity (GO:0016287)|palmitoyl-CoA hydrolase activity (GO:0016290)|receptor binding (GO:0005102)			breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(3)|prostate(1)|skin(1)	23	Breast(184;0.0871)	all_cancers(173;0.2)|Prostate(94;0.183)				CCTAAACCAAAAGAGTCTACA	0.348																																																0			1											106.0	109.0	108.0					1																	231401898		2203	4300	6503	229468521	SO:0001583	missense	8443			AF043937	CCDS1592.1	1q42	2008-02-05			ENSG00000116906	ENSG00000116906	2.3.1.42		4416	protein-coding gene	gene with protein product		602744				9459311, 9536089	Standard	NM_014236		Approved	DHAPAT, DAPAT, DAP-AT	uc001hup.4	O15228	OTTHUMG00000038024	ENST00000366647.4:c.911A>T	1.37:g.231401898A>T	ENSP00000355607:p.Lys304Ile		229468521	B4DNM9|Q5TBH7|Q9BWC2	Missense_Mutation	SNP	HMMPfam_Acyltransferase,superfamily_SSF69593,HMMSmart_PlsC	p.K304I	ENST00000366647.4	37	c.911	CCDS1592.1	1	.	.	.	.	.	.	.	.	.	.	A	16.67	3.187236	0.57909	.	.	ENSG00000116906	ENST00000366647;ENST00000366646;ENST00000416000	T;T;T	0.53640	0.61;0.61;0.61	5.6	3.29	0.37713	.	0.048682	0.85682	D	0.000000	T	0.69949	0.3168	M	0.88906	2.99	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.80764	0.994;0.99	T	0.71724	-0.4506	10	0.87932	D	0	.	9.8239	0.40899	0.8608:0.0:0.1392:0.0	.	243;304	B4DNM9;O15228	.;GNPAT_HUMAN	I	304;243;294	ENSP00000355607:K304I;ENSP00000355606:K243I;ENSP00000411640:K294I	ENSP00000355606:K243I	K	+	2	0	GNPAT	229468521	1.000000	0.71417	0.941000	0.38009	0.452000	0.32318	5.996000	0.70639	0.417000	0.25871	0.377000	0.23210	AAA	-	superfamily_SSF69593		0.348	GNPAT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GNPAT	protein_coding	OTTHUMT00000092871.1	A			229468521	+1	no_errors	NM_014236	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
SIPA1L2	57568	genome.wustl.edu	37	1	232577078	232577078	+	Missense_Mutation	SNP	T	T	C			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr1:232577078T>C	ENST00000366630.1	-	13	3959	c.3601A>G	c.(3601-3603)Aaa>Gaa	p.K1201E	SIPA1L2_ENST00000308942.4_Missense_Mutation_p.K275E|SIPA1L2_ENST00000262861.4_Missense_Mutation_p.K1201E			Q9P2F8	SI1L2_HUMAN	signal-induced proliferation-associated 1 like 2	1201					regulation of small GTPase mediated signal transduction (GO:0051056)		GTPase activator activity (GO:0005096)			NS(1)|breast(5)|central_nervous_system(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(49)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	103		all_cancers(173;0.00605)|Prostate(94;0.128)|all_epithelial(177;0.186)				CTTCCATCTTTCTGCAGAGCT	0.448																																																0			1											306.0	314.0	311.0					1																	232577078		1845	4095	5940	230643701	SO:0001583	missense	57568			AB037810	CCDS41474.1	1q42.2	2008-02-05			ENSG00000116991	ENSG00000116991			23800	protein-coding gene	gene with protein product		611609					Standard	NM_020808		Approved	KIAA1389	uc001hvg.3	Q9P2F8	OTTHUMG00000037820	ENST00000366630.1:c.3601A>G	1.37:g.232577078T>C	ENSP00000355589:p.Lys1201Glu		230643701	Q2TV88|Q5VXR7|Q5VXR8|Q641Q4|Q8NA38|Q96DZ3|Q9H9F6	Missense_Mutation	SNP	superfamily_Rap/Ran-GAP (Pfam 02145),HMMPfam_Rap_GAP,superfamily_PDZ domain-like,HMMPfam_PDZ,HMMSmart_SM00228	p.K1201E	ENST00000366630.1	37	c.3601	CCDS41474.1	1	.	.	.	.	.	.	.	.	.	.	T	27.2	4.807767	0.90623	.	.	ENSG00000116991	ENST00000366630;ENST00000262861;ENST00000308942	T;T;T	0.42131	0.98;0.98;0.98	6.17	6.17	0.99709	.	0.278446	0.39341	N	0.001390	T	0.57548	0.2061	L	0.54323	1.7	0.50632	D	0.999888	D;D	0.61080	0.979;0.989	P;P	0.60789	0.525;0.879	T	0.54289	-0.8316	10	0.41790	T	0.15	-23.4289	16.8222	0.85835	0.0:0.0:0.0:1.0	.	1201;275	Q9P2F8;Q9P2F8-2	SI1L2_HUMAN;.	E	1201;1201;275	ENSP00000355589:K1201E;ENSP00000262861:K1201E;ENSP00000309102:K275E	ENSP00000262861:K1201E	K	-	1	0	SIPA1L2	230643701	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.851000	0.75425	2.371000	0.80710	0.533000	0.62120	AAA	-	NULL		0.448	SIPA1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIPA1L2	protein_coding	OTTHUMT00000092318.1	T	XM_045839		230643701	-1	no_errors	NM_020808	genbank	human	validated	54_36p	missense	SNP	1.000	C
USP40	55230	genome.wustl.edu	37	2	234433176	234433176	+	Missense_Mutation	SNP	C	C	A			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr2:234433176C>A	ENST00000427112.2	-	14	1875	c.1840G>T	c.(1840-1842)Gct>Tct	p.A614S	USP40_ENST00000251722.6_Missense_Mutation_p.A614S|USP40_ENST00000450966.1_Missense_Mutation_p.A626S			Q9NVE5	UBP40_HUMAN	ubiquitin specific peptidase 40	614					ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			breast(1)|endometrium(6)|kidney(5)|large_intestine(5)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	30		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0539)		Epithelial(121;1.71e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000407)|Lung(119;0.00277)|LUSC - Lung squamous cell carcinoma(224;0.00646)		TCCCCATCAGCAATTTCAGTT	0.378																																																0			2											88.0	82.0	84.0					2																	234433176		1860	4120	5980	234097915	SO:0001583	missense	55230			AK001647	CCDS46547.1	2q37.1	2005-08-08	2005-08-08		ENSG00000085982	ENSG00000085982		"""Ubiquitin-specific peptidases"""	20069	protein-coding gene	gene with protein product		610570	"""ubiquitin specific protease 40"""			12838346	Standard	NM_018218		Approved	FLJ10785	uc010zmr.2	Q9NVE5	OTTHUMG00000153199	ENST00000427112.2:c.1840G>T	2.37:g.234433176C>A	ENSP00000387898:p.Ala614Ser		234097915	Q6NX38|Q70EL0	Missense_Mutation	SNP	NULL	p.L545F	ENST00000427112.2	37	c.1635	CCDS46547.1	2	.	.	.	.	.	.	.	.	.	.	C	13.53	2.264834	0.40095	.	.	ENSG00000085982	ENST00000450966;ENST00000251722;ENST00000427112	T;T;T	0.42900	0.96;0.96;0.96	5.68	2.49	0.30216	.	1.212950	0.06066	N	0.659255	T	0.40886	0.1135	M	0.64997	1.995	0.09310	N	1	B;P	0.36959	0.44;0.575	B;B	0.36845	0.118;0.234	T	0.33292	-0.9874	10	0.42905	T	0.14	.	5.8739	0.18819	0.133:0.5625:0.0:0.3045	.	614;626	Q9NVE5;Q9NVE5-3	UBP40_HUMAN;.	S	626;614;614	ENSP00000415434:A626S;ENSP00000251722:A614S;ENSP00000387898:A614S	ENSP00000251722:A614S	A	-	1	0	USP40	234097915	0.001000	0.12720	0.494000	0.27515	0.982000	0.71751	0.333000	0.19768	0.759000	0.33084	0.563000	0.77884	GCT	-	NULL		0.378	USP40-017	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	USP40	protein_coding	OTTHUMT00000397235.1	C	XM_114294		234097915	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	NM_018218	genbank	human	validated	54_36p	missense	SNP	0.017	A
HEATR1	55127	genome.wustl.edu	37	1	236749544	236749544	+	Missense_Mutation	SNP	C	C	G	rs555144272		TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr1:236749544C>G	ENST00000366582.3	-	15	2038	c.1924G>C	c.(1924-1926)Gaa>Caa	p.E642Q	HEATR1_ENST00000366581.2_Missense_Mutation_p.E642Q	NM_018072.5	NP_060542.4	Q9H583	HEAT1_HUMAN	HEAT repeat containing 1	642					rRNA processing (GO:0006364)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(18)|lung(28)|ovary(3)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	87	Ovarian(103;0.0634)|Breast(184;0.133)	all_cancers(173;0.0255)|Prostate(94;0.175)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			TTTTTACCTTCTTCCCAGCCT	0.313																																																0			1											30.0	32.0	31.0					1																	236749544		2200	4297	6497	234816167	SO:0001583	missense	55127			BC065205	CCDS31066.1	1q43	2011-08-12			ENSG00000119285	ENSG00000119285			25517	protein-coding gene	gene with protein product	"""UTP10, small subunit (SSU) processome component, homolog (yeast)"""					17699751	Standard	NM_018072		Approved	FLJ10359, BAP28, UTP10	uc001hyd.2	Q9H583	OTTHUMG00000040061	ENST00000366582.3:c.1924G>C	1.37:g.236749544C>G	ENSP00000355541:p.Glu642Gln		234816167	Q5T3Q8|Q6P197|Q9NW23	Missense_Mutation	SNP	superfamily_ARM-type_fold,HMMPfam_HEAT,HMMPfam_BP28CT	p.E642Q	ENST00000366582.3	37	c.1924	CCDS31066.1	1	.	.	.	.	.	.	.	.	.	.	C	14.65	2.597966	0.46318	.	.	ENSG00000119285	ENST00000366582;ENST00000366581	T;T	0.54279	0.58;0.58	5.85	5.85	0.93711	Armadillo-type fold (1);	0.205916	0.50627	D	0.000108	T	0.56572	0.1994	M	0.66939	2.045	0.80722	D	1	B	0.29270	0.24	B	0.28465	0.09	T	0.56739	-0.7929	10	0.62326	D	0.03	.	20.1653	0.98150	0.0:1.0:0.0:0.0	.	642	Q9H583	HEAT1_HUMAN	Q	642	ENSP00000355541:E642Q;ENSP00000355540:E642Q	ENSP00000355540:E642Q	E	-	1	0	HEATR1	234816167	1.000000	0.71417	1.000000	0.80357	0.593000	0.36681	2.433000	0.44793	2.768000	0.95171	0.655000	0.94253	GAA	-	NULL		0.313	HEATR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEATR1	protein_coding	OTTHUMT00000096635.1	C	XM_375853		234816167	-1	no_errors	NM_018072	genbank	human	validated	54_36p	missense	SNP	1.000	G
PRR21	643905	genome.wustl.edu	37	2	240982126	240982126	+	Missense_Mutation	SNP	G	G	T			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr2:240982126G>T	ENST00000408934.1	-	1	273	c.274C>A	c.(274-276)Ctt>Att	p.L92I		NM_001080835.1	NP_001074304.1	Q8WXC7	PRR21_HUMAN	proline rich 21	92	Pro-rich.							p.S86fs*291(2)		NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(7)|ovary(2)|prostate(5)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)	29						CGTGGGTGAAGAGGCATGGAT	0.612																																																2	Deletion - Frameshift(2)	upper_aerodigestive_tract(2)	2											131.0	127.0	128.0					2																	240982126		2099	4174	6273	240630799	SO:0001583	missense	643905			AF453950	CCDS33417.1	2q37.3	2009-04-20			ENSG00000221961	ENSG00000221961			33866	protein-coding gene	gene with protein product							Standard	NM_001080835		Approved		uc010zod.2	Q8WXC7	OTTHUMG00000159174	ENST00000408934.1:c.274C>A	2.37:g.240982126G>T	ENSP00000386166:p.Leu92Ile		240630799		Missense_Mutation	SNP	NULL	p.L92I	ENST00000408934.1	37	c.274	CCDS33417.1	2	.	.	.	.	.	.	.	.	.	.	-	9.362	1.068302	0.20067	.	.	ENSG00000221961	ENST00000408934;ENST00000486799	T;T	0.12879	2.64;2.64	1.79	0.872	0.19113	.	.	.	.	.	T	0.07818	0.0196	N	0.08118	0	0.09310	N	1	P	0.50710	0.938	P	0.50754	0.649	T	0.10132	-1.0643	9	0.06494	T	0.89	.	6.074	0.19905	0.1849:0.0:0.8151:0.0	.	92	Q8WXC7	PRR21_HUMAN	I	92	ENSP00000386166:L92I;ENSP00000418240:L92I	ENSP00000386166:L92I	L	-	1	0	PRR21	240630799	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	-0.228000	0.09114	0.285000	0.22329	0.505000	0.49811	CTT	-	NULL		0.612	PRR21-201	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC643905	protein_coding		G	NM_001080835		240630799	-1	no_errors	NM_001080835	genbank	human	predicted	54_36p	missense	SNP	0.000	T
TP53	7157	genome.wustl.edu	37	17	7577599	7577600	+	Frame_Shift_Ins	INS	-	-	A			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	-	-					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr17:7577599_7577600insA	ENST00000269305.4	-	7	870_871	c.681_682insT	c.(679-684)tctgacfs	p.D228fs	TP53_ENST00000413465.2_Frame_Shift_Ins_p.D228fs|TP53_ENST00000359597.4_Frame_Shift_Ins_p.D228fs|TP53_ENST00000455263.2_Frame_Shift_Ins_p.D228fs|TP53_ENST00000420246.2_Frame_Shift_Ins_p.D228fs|TP53_ENST00000574684.1_5'UTR|TP53_ENST00000445888.2_Frame_Shift_Ins_p.D228fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	228	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		D -> A (in sporadic cancers; somatic mutation).|D -> E (in sporadic cancers; somatic mutation).|D -> G (in sporadic cancers; somatic mutation).|D -> H (in sporadic cancers; somatic mutation).|D -> N (in sporadic cancers; somatic mutation).|D -> P (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|D -> V (in sporadic cancers; somatic mutation).|D -> Y (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.D228N(6)|p.?(5)|p.S227S(3)|p.D228Y(2)|p.?fs(2)|p.V225_S227delVGS(2)|p.S227fs*1(1)|p.G226_D228delGSD(1)|p.D228fs*1(1)|p.V225fs*23(1)|p.D228fs*12(1)|p.D228fs*11(1)|p.S227_I232delSDCTTI(1)|p.D228H(1)|p.D228fs*19(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GTGGTACAGTCAGAGCCAACCT	0.525		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	37	Substitution - Missense(9)|Whole gene deletion(8)|Deletion - Frameshift(5)|Unknown(5)|Deletion - In frame(4)|Insertion - Frameshift(3)|Substitution - coding silent(3)	biliary_tract(5)|central_nervous_system(4)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(4)|breast(4)|bone(4)|oesophagus(2)|lung(2)|ovary(2)|liver(2)|upper_aerodigestive_tract(1)|stomach(1)|skin(1)|pancreas(1)	17																																								7518325	SO:0001589	frameshift_variant	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.682dupT	17.37:g.7577600_7577600dupA	ENSP00000269305:p.Asp228fs		7518324	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Ins	INS	HMMPfam_P53_TAD,HMMPfam_P53,superfamily_p53-like transcription factors,PatternScan_P53,HMMPfam_P53_tetramer,superfamily_p53 tetramerization domain	p.D227fs	ENST00000269305.4	37	c.682_681	CCDS11118.1	17																																																																																			-	HMMPfam_P53,superfamily_p53-like transcription factors		0.525	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	-	NM_000546		7518325	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	frame_shift_ins	INS	0.998:0.801	A
KCNJ11	3767	genome.wustl.edu	37	11	17408989	17408989	+	Frame_Shift_Del	DEL	A	A	-			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr11:17408989delA	ENST00000339994.4	-	1	1217	c.650delT	c.(649-651)atgfs	p.M217fs	KCNJ11_ENST00000526747.1_5'Flank|KCNJ11_ENST00000528731.1_Frame_Shift_Del_p.M130fs	NM_000525.3	NP_000516.3	Q14654	KCJ11_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 11	217					cellular response to glucose stimulus (GO:0071333)|cellular response to nicotine (GO:0071316)|cellular response to tumor necrosis factor (GO:0071356)|energy reserve metabolic process (GO:0006112)|glucose metabolic process (GO:0006006)|negative regulation of insulin secretion (GO:0046676)|neurological system process (GO:0050877)|positive regulation of cation channel activity (GO:2001259)|potassium ion import (GO:0010107)|potassium ion transmembrane transport (GO:0071805)|regulation of insulin secretion (GO:0050796)|regulation of membrane potential (GO:0042391)|response to ATP (GO:0033198)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ischemia (GO:0002931)|response to testosterone (GO:0033574)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	ATP-sensitive potassium channel complex (GO:0008282)|axolemma (GO:0030673)|cell body fiber (GO:0070852)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|mitochondrion (GO:0005739)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated potassium channel complex (GO:0008076)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|ATP-activated inward rectifier potassium channel activity (GO:0015272)|ion channel binding (GO:0044325)|potassium ion binding (GO:0030955)|voltage-gated potassium channel activity (GO:0005249)			endometrium(2)|large_intestine(2)|lung(6)|ovary(1)|prostate(3)|skin(2)	16				READ - Rectum adenocarcinoma(2;0.0276)|Colorectal(2;0.0633)	Diazoxide(DB01119)|Glimepiride(DB00222)|Glyburide(DB01016)|Ibutilide(DB00308)|Levosimendan(DB00922)|Thiamylal(DB01154)|Verapamil(DB00661)|Yohimbine(DB01392)	TACCACCTGCATGTGGATGGT	0.637											OREG0020810	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				0			11											78.0	58.0	65.0					11																	17408989		2200	4293	6493	17365565	SO:0001589	frameshift_variant	3767			D50582	CCDS31436.1, CCDS53606.1	11p15.1	2011-07-05						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6257	protein-coding gene	gene with protein product		600937				7502040, 16382105	Standard	NM_001166290		Approved	Kir6.2, BIR	uc001mna.3	Q14654		ENST00000339994.4:c.650delT	11.37:g.17408989delA	ENSP00000345708:p.Met217fs	717	17365565	B4DWI4|E9PNK0|Q2M1H7|Q58EX3|Q8IW96	Frame_Shift_Del	DEL	HMMPfam_IRK,superfamily_SSF81324,superfamily_Ig_E-set	p.M217fs	ENST00000339994.4	37	c.650	CCDS31436.1	11																																																																																			(deletion:cds_exon[17365042,17366214])	HMMPfam_IRK,superfamily_Ig_E-set		0.637	KCNJ11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNJ11	protein_coding	OTTHUMT00000387037.1	A	NM_000525		17365565	-1	no_errors	NM_000525	genbank	human	reviewed	54_36p	frame_shift_del	DEL	1.000	-
KRT13	3860	genome.wustl.edu	37	17	39659299	39659325	+	In_Frame_Del	DEL	CCATCTCCACGTTGACCTGGCCGACCA	CCATCTCCACGTTGACCTGGCCGACCA	-	rs147564962|rs140780704|rs375023751|rs150947773|rs200839212|rs369163489	byFrequency	TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	CCATCTCCACGTTGACCTGGCCGACCA	CCATCTCCACGTTGACCTGGCCGACCA					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr17:39659299_39659325delCCATCTCCACGTTGACCTGGCCGACCA	ENST00000246635.3	-	4	807_833	c.761_787delTGGTCGGCCAGGTCAACGTGGAGATGG	c.(760-789)gtggtcggccaggtcaacgtggagatggat>gat	p.VVGQVNVEM254del	KRT13_ENST00000587544.1_In_Frame_Del_p.VVGQVNVEM254del|KRT13_ENST00000336861.3_In_Frame_Del_p.VVGQVNVEM254del|KRT13_ENST00000587118.1_5'Flank|AC019349.5_ENST00000411759.1_RNA	NM_153490.2	NP_705694	P13646	K1C13_HUMAN	keratin 13	254	Linker 12.|Rod.				cellular response to retinoic acid (GO:0071300)|cytoskeleton organization (GO:0007010)|response to radiation (GO:0009314)|tongue morphogenesis (GO:0043587)	extracellular vesicular exosome (GO:0070062)|intermediate filament cytoskeleton (GO:0045111)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(10)|ovary(2)|pancreas(1)|prostate(2)|skin(4)|urinary_tract(1)	33		Breast(137;0.000286)				GGGGTGGCATCCATCTCCACGTTGACCTGGCCGACCACCTGGTTGCT	0.581																																																0			17																																								36912851	SO:0001651	inframe_deletion	3860				CCDS11396.1, CCDS11397.1	17q21.2	2013-06-20			ENSG00000171401	ENSG00000171401		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6415	protein-coding gene	gene with protein product	"""keratin, type I cytoskeletal 13"", ""cytokeratin 13"""	148065				16831889	Standard	NM_153490		Approved	K13, CK13, MGC3781, MGC161462	uc002hwu.1	P13646	OTTHUMG00000133434	ENST00000246635.3:c.761_787delTGGTCGGCCAGGTCAACGTGGAGATGG	17.37:g.39659299_39659325delCCATCTCCACGTTGACCTGGCCGACCA	ENSP00000246635:p.Val254_Met262del		36912825	Q53G54|Q6AZK5|Q8N240	In_Frame_Del	DEL	HMMPfam_Filament,superfamily_Prefoldin,PatternScan_IF	p.VVGQVNVEM254in_frame_del	ENST00000246635.3	37	c.787_761	CCDS11396.1	17																																																																																			(deletion:cds_exon[36912715,36912876])	HMMPfam_Filament,superfamily_Prefoldin		0.581	KRT13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KRT13	protein_coding	OTTHUMT00000257297.1	CCATCTCCACGTTGACCTGGCCGACCA	NM_153490		36912851	-1	no_errors	NM_153490	genbank	human	reviewed	54_36p	in_frame_del	DEL	1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:0.996:1.000:1.000:1.000:1.000:1.000:0.968:0.969:0.918:0.932:0.993:0.988:0.002:0.003:0.026:0.020:0.022	-
SHROOM4	57477	genome.wustl.edu	37	X	50351108	50351138	+	Frame_Shift_Del	DEL	AGTCCAGTGCTGGGTTCTCAAGGCAAGGATG	AGTCCAGTGCTGGGTTCTCAAGGCAAGGATG	-			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	AGTCCAGTGCTGGGTTCTCAAGGCAAGGATG	AGTCCAGTGCTGGGTTCTCAAGGCAAGGATG					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chrX:50351108_50351138delAGTCCAGTGCTGGGTTCTCAAGGCAAGGATG	ENST00000289292.7	-	6	3287_3317	c.3004_3034delCATCCTTGCCTTGAGAACCCAGCACTGGACT	c.(3004-3036)catccttgccttgagaacccagcactggacttgfs	p.HPCLENPALDL1002fs	SHROOM4_ENST00000376020.2_Frame_Shift_Del_p.HPCLENPALDL1002fs|SHROOM4_ENST00000460112.3_Frame_Shift_Del_p.HPCLENPALDL886fs			Q9ULL8	SHRM4_HUMAN	shroom family member 4	1002					actin cytoskeleton organization (GO:0030036)|actin filament organization (GO:0007015)|brain development (GO:0007420)|cognition (GO:0050890)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|myosin II complex (GO:0016460)|stress fiber (GO:0001725)	actin filament binding (GO:0051015)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(5)|large_intestine(6)|liver(1)|lung(20)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	52	Ovarian(276;0.236)					TAGCTTGACAAGTCCAGTGCTGGGTTCTCAAGGCAAGGATGGAAAGGGGTT	0.455																																																0			X																																								50367878	SO:0001589	frameshift_variant	57477			AB033028	CCDS35277.1	Xp11.22	2008-02-05			ENSG00000158352	ENSG00000158352			29215	protein-coding gene	gene with protein product		300579				10574462, 16615870	Standard	NR_027121		Approved	KIAA1202	uc004dpe.2	Q9ULL8	OTTHUMG00000021521	ENST00000289292.7:c.3004_3034delCATCCTTGCCTTGAGAACCCAGCACTGGACT	X.37:g.50351108_50351138delAGTCCAGTGCTGGGTTCTCAAGGCAAGGATG	ENSP00000289292:p.His1002fs		50367848	A7E2X9|D6RFW0|Q96LA0	Frame_Shift_Del	DEL	superfamily_PDZ domain-like,HMMSmart_SM00228,HMMPfam_ASD1,HMMPfam_ASD2	p.H1002fs	ENST00000289292.7	37	c.3034_3004	CCDS35277.1	X																																																																																			(deletion:cds_exon[50367121,50367924])	NULL		0.455	SHROOM4-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	SHROOM4	protein_coding	OTTHUMT00000056564.4	AGTCCAGTGCTGGGTTCTCAAGGCAAGGATG	NM_020717		50367878	-1	no_errors	NM_020717	genbank	human	reviewed	54_36p	frame_shift_del	DEL	0.998:0.988:0.989:0.986:0.978:0.981:0.995:0.993:0.994:0.998:0.998:0.999:0.997:1.000:1.000:1.000:1.000:1.000:1.000:0.997:0.953:0.935:0.929:0.924:0.913:0.854:0.864:0.798:0.746:0.827:0.886	-
PHF8	23133	genome.wustl.edu	37	X	54043170	54043189	+	Splice_Site	DEL	CTGGAGTAAAGAGATAGGTT	CTGGAGTAAAGAGATAGGTT	-			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	CTGGAGTAAAGAGATAGGTT	CTGGAGTAAAGAGATAGGTT					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chrX:54043170_54043189delCTGGAGTAAAGAGATAGGTT	ENST00000357988.5	-	6	921		c.e6-1		PHF8_ENST00000338154.6_Splice_Site|PHF8_ENST00000322659.8_Splice_Site|PHF8_ENST00000338946.6_Splice_Site	NM_001184896.1	NP_001171825.1	Q9UPP1	PHF8_HUMAN	PHD finger protein 8						brain development (GO:0007420)|G1/S transition of mitotic cell cycle (GO:0000082)|histone H3-K27 demethylation (GO:0071557)|histone H3-K36 demethylation (GO:0070544)|histone H3-K9 demethylation (GO:0033169)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of chromatin silencing at rDNA (GO:0061188)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone demethylase activity (GO:0032452)|histone demethylase activity (H3-K27 specific) (GO:0071558)|histone demethylase activity (H3-K36 specific) (GO:0051864)|histone demethylase activity (H3-K9 specific) (GO:0032454)|histone demethylase activity (H4-K20 specific) (GO:0035575)|iron ion binding (GO:0005506)|methylated histone binding (GO:0035064)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)	p.?(2)		endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(7)|lung(10)|ovary(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	40						TTGTCAGAACCTGGAGTAAAGAGATAGGTTCTGCACCAAG	0.473																																																2	Unknown(2)	kidney(2)	X																																								54059914	SO:0001630	splice_region_variant	23133			AB029034	CCDS14355.1, CCDS55418.1, CCDS55419.1, CCDS55420.1	Xp11.22	2013-01-28			ENSG00000172943	ENSG00000172943		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	20672	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1F"""	300560				10470851, 20023638, 20644565	Standard	NM_015107		Approved	ZNF422, KIAA1111, JHDM1F	uc004dsu.3	Q9UPP1	OTTHUMG00000021622	ENST00000357988.5:c.563-1AACCTATCTCTTTACTCCAG>-	X.37:g.54043170_54043189delCTGGAGTAAAGAGATAGGTT			54059895	B3KMV4|B7Z911|Q5H9U5|Q5JPR9|Q5JPS0|Q5JPS2|Q5JPS3|Q5VUJ4|Q7Z6D4|Q9HAH2	Splice_Site	DEL	-	e5-1	ENST00000357988.5	37	c.455-20_455-1	CCDS55420.1	X																																																																																			(deletion:intron[54059895,54060818])	-		0.473	PHF8-001	KNOWN	basic|CCDS	protein_coding	PHF8	protein_coding	OTTHUMT00000056784.2	CTGGAGTAAAGAGATAGGTT	NM_015107	Intron	54059914	-1	no_errors	NM_015107	genbank	human	validated	54_36p	splice_site_del	DEL	1.000:0.999:0.888:0.005:0.002:0.000:0.001:0.051:0.037:0.032:0.005:0.000:0.001:0.005:0.002:0.000:0.000:0.001:0.001:0.003	-
TSNAXIP1	55815	genome.wustl.edu	37	16	67857529	67857554	+	Splice_Site	DEL	CCTTACAGAGAGATCTTTGAGTTCTT	CCTTACAGAGAGATCTTTGAGTTCTT	-			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	CCTTACAGAGAGATCTTTGAGTTCTT	CCTTACAGAGAGATCTTTGAGTTCTT					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr16:67857529_67857554delCCTTACAGAGAGATCTTTGAGTTCTT	ENST00000388833.3	+	5	603_628	c.226_251delCCTTACAGAGAGATCTTTGAGTTCTT	c.(226-252)ccttacagagagatctttgagttcttc>c	p.PYREIFEFF76fs	TSNAXIP1_ENST00000561639.1_Splice_Site_p.PYREIFEFF130fs|TSNAXIP1_ENST00000415766.3_Intron|TSNAXIP1_ENST00000562321.1_Intron	NM_018430.2	NP_060900.2			translin-associated factor X interacting protein 1									p.E79*(1)		NS(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(8)|prostate(1)|soft_tissue(1)|urinary_tract(1)	22		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00432)|Epithelial(162;0.0192)|all cancers(182;0.125)		TTCTTGCCAGCCTTACAGAGAGATCTTTGAGTTCTTCATAGAGGAC	0.482																																																1	Substitution - Nonsense(1)	large_intestine(1)	16																																								66415055	SO:0001630	splice_region_variant	55815			AF132730	CCDS10846.2, CCDS73903.1, CCDS73904.1	16q22.2	2008-02-05			ENSG00000102904	ENSG00000102904			18586	protein-coding gene	gene with protein product		607720				12036294	Standard	XM_005256051		Approved	TXI1	uc002euj.3	Q2TAA8	OTTHUMG00000137545	ENST00000388833.3:c.226-1CCTTACAGAGAGATCTTTGAGTTCTT>-	16.37:g.67857529_67857554delCCTTACAGAGAGATCTTTGAGTTCTT			66415030		Frame_Shift_Del	DEL	NULL	p.P76fs	ENST00000388833.3	37	c.226_251	CCDS10846.2	16																																																																																			(deletion:cds_exon[66415030,66415123])	NULL		0.482	TSNAXIP1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	TSNAXIP1	protein_coding	OTTHUMT00000268876.2	CCTTACAGAGAGATCTTTGAGTTCTT	NM_018430	Frame_Shift_Del	66415055	+1	no_errors	NM_018430	genbank	human	validated	54_36p	frame_shift_del	DEL	1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:0.999:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000	-
TMEM132B	114795	genome.wustl.edu	37	12	125834354	125834370	+	Frame_Shift_Del	DEL	CAGACCTTGTTTTATGT	CAGACCTTGTTTTATGT	-			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	CAGACCTTGTTTTATGT	CAGACCTTGTTTTATGT					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr12:125834354_125834370delCAGACCTTGTTTTATGT	ENST00000299308.3	+	2	417_433	c.409_425delCAGACCTTGTTTTATGT	c.(409-426)cagaccttgttttatgtcfs	p.QTLFYV137fs	TMEM132B_ENST00000418253.2_3'UTR	NM_052907.2	NP_443139.2	Q14DG7	T132B_HUMAN	transmembrane protein 132B	137						integral component of membrane (GO:0016021)				NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(11)|liver(1)|lung(45)|ovary(5)|pancreas(1)|prostate(4)|skin(15)|upper_aerodigestive_tract(3)|urinary_tract(1)	107	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000423)|Epithelial(86;0.00394)|all cancers(50;0.0362)		ACCCAAAGTGCAGACCTTGTTTTATGTCACTGGCATG	0.493																																																0			12																																								124400323	SO:0001589	frameshift_variant	114795			AB067493	CCDS41859.1, CCDS66501.1	12q24.31	2006-03-02							29397	protein-coding gene	gene with protein product						11572484	Standard	NM_001286219		Approved	KIAA1906, KIAA1786	uc001uhe.1	Q14DG7		ENST00000299308.3:c.409_425delCAGACCTTGTTTTATGT	12.37:g.125834354_125834370delCAGACCTTGTTTTATGT	ENSP00000299308:p.Gln137fs		124400307	A2RRG8|Q8NA73|Q96JN9|Q96PY1	Frame_Shift_Del	DEL	NULL	p.Q137fs	ENST00000299308.3	37	c.409_425	CCDS41859.1	12																																																																																			(deletion:cds_exon[124399951,124400842])	NULL		0.493	TMEM132B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TMEM132B	protein_coding	OTTHUMT00000400043.1	CAGACCTTGTTTTATGT	NM_052907		124400323	+1	no_errors	NM_052907	genbank	human	provisional	54_36p	frame_shift_del	DEL	1.000:1.000:1.000:0.998:0.974:0.027:0.079:0.991:1.000:1.000:1.000:0.976:0.995:0.990:0.153:0.089:0.113	-
ITGA10	8515	genome.wustl.edu	37	1	145530984	145530984	+	Frame_Shift_Del	DEL	A	A	-			TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr1:145530984delA	ENST00000369304.3	+	7	891	c.716delA	c.(715-717)gagfs	p.E239fs	ITGA10_ENST00000481236.1_3'UTR|ITGA10_ENST00000539363.1_Frame_Shift_Del_p.E96fs|ITGA10_ENST00000538811.1_Frame_Shift_Del_p.E108fs	NM_003637.3	NP_003628.2	O75578	ITA10_HUMAN	integrin, alpha 10	239	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)	integrin alpha10-beta1 complex (GO:0034680)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(3)|kidney(5)|large_intestine(12)|lung(25)|ovary(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	59	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					AGTCGGCGGGAGGGACGAGAA	0.532																																																0			1											120.0	104.0	110.0					1																	145530984		2203	4300	6503	144242341	SO:0001589	frameshift_variant	8515			AF074015	CCDS72869.1	1q21.1	2010-03-23			ENSG00000143127	ENSG00000143127		"""Integrins"""	6135	protein-coding gene	gene with protein product		604042				9685391, 10702680	Standard	NM_003637		Approved		uc001eoa.3	O75578	OTTHUMG00000013751	ENST00000369304.3:c.716delA	1.37:g.145530984delA	ENSP00000358310:p.Glu239fs		144242341	B2RAM4|B2RTV5|Q6UXJ6|Q9UHZ8	Frame_Shift_Del	DEL	superfamily_Integrin alpha N-terminal domain,HMMSmart_SM00191,superfamily_vWA-like,HMMSmart_SM00327,HMMPfam_VWA,HMMPfam_FG-GAP,HMMPfam_Integrin_alpha2,superfamily_Integrin domains	p.E239fs	ENST00000369304.3	37	c.716	CCDS918.1	1																																																																																			(deletion:cds_exon[144242235,144242383])	superfamily_Integrin alpha N-terminal domain,superfamily_vWA-like,HMMSmart_SM00327,HMMPfam_VWA		0.532	ITGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGA10	protein_coding	OTTHUMT00000038537.2	A	NM_003637		144242341	+1	no_errors	NM_003637	genbank	human	reviewed	54_36p	frame_shift_del	DEL	1.000	-
IL10	3586	genome.wustl.edu	37	1	206942043	206942076	+	Splice_Site	DEL	TCATGGCTTTGTAGATGCCTTTCTCTTGGAGCTG	TCATGGCTTTGTAGATGCCTTTCTCTTGGAGCTG	-	rs146520891		TCGA-29-1691-01A-01W-0633-09	TCGA-29-1691-10A-01W-0633-09	TCATGGCTTTGTAGATGCCTTTCTCTTGGAGCTG	TCATGGCTTTGTAGATGCCTTTCTCTTGGAGCTG					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	65926e04-6720-4ac9-a5dd-06b0109b4d8d	a2bf02d4-c423-47a0-bd6b-7aef7bf12c88	g.chr1:206942043_206942076delTCATGGCTTTGTAGATGCCTTTCTCTTGGAGCTG	ENST00000423557.1	-	5	503_533	c.445_475delCAGCTCCAAGAGAAAGGCATCTACAAAGCCATGA	c.(445-477)cagctccaagagaaaggcatctacaaagccatg>tg	p.QLQEKGIYKAM149fs	IL10_ENST00000471071.1_5'UTR	NM_000572.2	NP_000563.1	P22301	IL10_HUMAN	interleukin 10	149					B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|branching involved in labyrinthine layer morphogenesis (GO:0060670)|cell-cell signaling (GO:0007267)|cellular response to estradiol stimulus (GO:0071392)|cellular response to lipopolysaccharide (GO:0071222)|cytoplasmic sequestering of NF-kappaB (GO:0007253)|defense response to bacterium (GO:0042742)|hemopoiesis (GO:0030097)|inflammatory response (GO:0006954)|leukocyte chemotaxis (GO:0030595)|negative regulation of apoptotic process (GO:0043066)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of chronic inflammatory response to antigenic stimulus (GO:0002875)|negative regulation of cytokine secretion involved in immune response (GO:0002740)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of interferon-alpha biosynthetic process (GO:0045355)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of membrane protein ectodomain proteolysis (GO:0051045)|negative regulation of MHC class II biosynthetic process (GO:0045347)|negative regulation of myeloid dendritic cell activation (GO:0030886)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of tumor necrosis factor biosynthetic process (GO:0042536)|negative regulation of tumor necrosis factor production (GO:0032720)|positive regulation of B cell apoptotic process (GO:0002904)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|receptor biosynthetic process (GO:0032800)|regulation of gene expression (GO:0010468)|regulation of isotype switching (GO:0045191)|regulation of sensory perception of pain (GO:0051930)|response to activity (GO:0014823)|response to carbon monoxide (GO:0034465)|response to drug (GO:0042493)|response to glucocorticoid (GO:0051384)|response to inactivity (GO:0014854)|response to insulin (GO:0032868)|response to molecule of bacterial origin (GO:0002237)|type 2 immune response (GO:0042092)	extracellular space (GO:0005615)	cytokine activity (GO:0005125)|growth factor activity (GO:0008083)|interleukin-10 receptor binding (GO:0005141)			endometrium(1)|large_intestine(6)|lung(4)|prostate(1)	12	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.211)			TCAAACTCACTCATGGCTTTGTAGATGCCTTTCTCTTGGAGCTGTGCAGAGAGA	0.444																																																0			1																																								205008699	SO:0001630	splice_region_variant	3586			M57627	CCDS1467.1	1q31-q32	2011-07-14			ENSG00000136634	ENSG00000136634		"""Interleukins and interleukin receptors"""	5962	protein-coding gene	gene with protein product	"""cytokine synthesis inhibitory factor"", ""T-cell growth inhibitory factor"""	124092				9162098	Standard	NM_000572		Approved	CSIF, TGIF, IL10A, IL-10	uc001hen.1	P22301	OTTHUMG00000036386	ENST00000423557.1:c.445-1CAGCTCCAAGAGAAAGGCATCTACAAAGCCATGA>-	1.37:g.206942043_206942076delTCATGGCTTTGTAGATGCCTTTCTCTTGGAGCTG			205008666		Frame_Shift_Del	DEL	HMMPfam_IL10,superfamily_4-helical cytokines,HMMSmart_SM00188,PatternScan_INTERLEUKIN_10	p.L149fs	ENST00000423557.1	37	c.475_445	CCDS1467.1	1																																																																																			(deletion:cds_exon[205008604,205008696], intron[205008697,205009796])	HMMPfam_IL10,superfamily_4-helical cytokines,HMMSmart_SM00188		0.444	IL10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL10	protein_coding	OTTHUMT00000088564.3	TCATGGCTTTGTAGATGCCTTTCTCTTGGAGCTG	NM_000572	Frame_Shift_Del	205008699	-1	no_errors	NM_000572	genbank	human	reviewed	54_36p	frame_shift_del	DEL	1.000:1.000:1.000:1.000:0.998:1.000:1.000:0.999:1.000:1.000:1.000:1.000:1.000:0.998:0.994:0.941:0.905:0.994:1.000:1.000:1.000:0.998:0.997:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000	-
