#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	SNP	G	G	A			TCGA-29-1769-01A-01W-0639-09	TCGA-29-1769-10A-01W-0639-09	G	G					Unknown	Invalid:failed_liftOver	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	6e3821b5-a446-4b2d-9ede-6be24af88e5e	093609c2-c2b8-41d0-85ac-c69048b9b06b	g.chrUnknown:0G>A								None (None upstream) : None (None downstream)																								0.0																																																0			7																																								57375	SO:0001628	intergenic_variant	0																															Unknown.37:g.0G>A			57375		RNA	SNP	-	NULL		37	NULL		7																																																																																			-	-	0	0					LOC100133120			G			57375	+1	pseudogene	XR_037156	genbank	human	model	54_36p	rna	SNP	1.000	A
PXDN	7837	genome.wustl.edu	37	2	1670234	1670234	+	Missense_Mutation	SNP	G	G	C			TCGA-29-1769-01A-01W-0639-09	TCGA-29-1769-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	6e3821b5-a446-4b2d-9ede-6be24af88e5e	093609c2-c2b8-41d0-85ac-c69048b9b06b	g.chr2:1670234G>C	ENST00000252804.4	-	10	1093	c.1043C>G	c.(1042-1044)cCa>cGa	p.P348R	PXDN_ENST00000483018.1_5'UTR	NM_012293.1	NP_036425.1	Q92626	PXDN_HUMAN	peroxidasin homolog (Drosophila)	348	Ig-like C2-type 2.				extracellular matrix organization (GO:0030198)|hydrogen peroxide catabolic process (GO:0042744)|immune response (GO:0006955)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|oxidation-reduction process (GO:0055114)	endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|heme binding (GO:0020037)|interleukin-1 receptor antagonist activity (GO:0005152)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			breast(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(24)|lung(48)|ovary(3)|pancreas(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	112	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)		TGTATTCTGTGGCTGGATTAC	0.517																																																0			2											24.0	27.0	26.0					2																	1670234		1990	4155	6145	1649241	SO:0001583	missense	7837			AF200348	CCDS46221.1	2p25.3	2013-01-11			ENSG00000130508	ENSG00000130508		"""Immunoglobulin superfamily / I-set domain containing"""	14966	protein-coding gene	gene with protein product		605158				10441517, 9039502	Standard	XM_005264707		Approved	KIAA0230, PRG2, MG50, D2S448, D2S448E, PXN	uc002qxa.3	Q92626	OTTHUMG00000059697	ENST00000252804.4:c.1043C>G	2.37:g.1670234G>C	ENSP00000252804:p.Pro348Arg		1649241	A8QM65|D6W4Y0|Q4KMG2	Missense_Mutation	SNP	superfamily_L domain-like,HMMSmart_SM00369,HMMPfam_LRR_1,HMMSmart_SM00082,HMMPfam_LRRCT,superfamily_Immunoglobulin,HMMPfam_I-set,HMMSmart_SM00409,HMMSmart_SM00408,superfamily_Heme-dependent peroxidases,HMMPfam_An_peroxidase,HMMPfam_VWC,HMMSmart_SM00214,PatternScan_VWFC_1	p.P348R	ENST00000252804.4	37	c.1043	CCDS46221.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	27.4|27.4	4.824536|4.824536	0.90955|0.90955	.|.	.|.	ENSG00000130508|ENSG00000130508	ENST00000433670|ENST00000252804	.|T	.|0.35048	.|1.33	5.09|5.09	5.09|5.09	0.68999|0.68999	.|Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.|0.123056	.|0.56097	.|D	.|0.000032	T|T	0.72550|0.72550	0.3474|0.3474	H|H	0.96365|0.96365	3.81|3.81	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.85130	.|0.997;0.995	T|T	0.82645|0.82645	-0.0355|-0.0355	5|10	.|0.87932	.|D	.|0	-18.7789|-18.7789	16.6763|16.6763	0.85280|0.85280	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|348;348	.|Q92626-2;Q92626	.|.;PXDN_HUMAN	D|R	344|348	.|ENSP00000252804:P348R	.|ENSP00000252804:P348R	H|P	-|-	1|2	0|0	PXDN|PXDN	1649241|1649241	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	9.772000|9.772000	0.98984|0.98984	2.369000|2.369000	0.80426|0.80426	0.655000|0.655000	0.94253|0.94253	CAC|CCA	-	superfamily_Immunoglobulin,HMMPfam_I-set,HMMSmart_SM00409		0.517	PXDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PXDN	protein_coding	OTTHUMT00000322505.1	G	XM_056455		1649241	-1	no_errors	NM_012293	genbank	human	validated	54_36p	missense	SNP	0.999	C
ARRB2	409	genome.wustl.edu	37	17	4623693	4623693	+	Missense_Mutation	SNP	T	T	C			TCGA-29-1769-01A-01W-0639-09	TCGA-29-1769-10A-01W-0639-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	6e3821b5-a446-4b2d-9ede-6be24af88e5e	093609c2-c2b8-41d0-85ac-c69048b9b06b	g.chr17:4623693T>C	ENST00000269260.2	+	13	1240	c.1007T>C	c.(1006-1008)gTc>gCc	p.V336A	ARRB2_ENST00000381488.6_Missense_Mutation_p.V321A|ARRB2_ENST00000412477.3_Missense_Mutation_p.V357A|ARRB2_ENST00000574954.1_Missense_Mutation_p.V144A|ARRB2_ENST00000572457.1_Missense_Mutation_p.V144A|ARRB2_ENST00000571206.1_Missense_Mutation_p.V144A|ARRB2_ENST00000575877.1_Silent_p.C292C|ARRB2_ENST00000346341.2_Missense_Mutation_p.V321A	NM_001257328.1|NM_001257330.1|NM_004313.3	NP_001244257.1|NP_001244259.1|NP_004304.1	P32121	ARRB2_HUMAN	arrestin, beta 2	336	Interaction with TRAF6.				adult walking behavior (GO:0007628)|apoptotic DNA fragmentation (GO:0006309)|blood coagulation (GO:0007596)|brain development (GO:0007420)|cell chemotaxis (GO:0060326)|desensitization of G-protein coupled receptor protein signaling pathway by arrestin (GO:0002032)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|follicle-stimulating hormone signaling pathway (GO:0042699)|G-protein coupled receptor internalization (GO:0002031)|negative regulation of GTPase activity (GO:0034260)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of natural killer cell mediated cytotoxicity (GO:0045953)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of smooth muscle cell apoptotic process (GO:0034392)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|negative regulation of tumor necrosis factor production (GO:0032720)|Notch signaling pathway (GO:0007219)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of receptor internalization (GO:0002092)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of synaptic transmission, dopaminergic (GO:0032226)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein transport (GO:0015031)|protein ubiquitination (GO:0016567)|receptor internalization (GO:0031623)|regulation of androgen receptor signaling pathway (GO:0060765)|transcription from RNA polymerase II promoter (GO:0006366)|transforming growth factor beta receptor signaling pathway (GO:0007179)	basolateral plasma membrane (GO:0016323)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|endocytic vesicle (GO:0030139)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	angiotensin receptor binding (GO:0031701)|enzyme binding (GO:0019899)|G-protein coupled receptor binding (GO:0001664)|protein complex scaffold (GO:0032947)|receptor binding (GO:0005102)|ubiquitin protein ligase binding (GO:0031625)			large_intestine(1)|liver(2)|lung(3)|prostate(1)	7						CCCAGGGATGTCTCTGTGGAG	0.622																																																0			17											139.0	132.0	134.0					17																	4623693		2203	4300	6503	4570442	SO:0001583	missense	409				CCDS11050.1, CCDS11051.1, CCDS58504.1, CCDS58505.1, CCDS59276.1	17p13	2008-12-11			ENSG00000141480	ENSG00000141480			712	protein-coding gene	gene with protein product	"""arrestin 3"""	107941		ARR2		7695743	Standard	NM_001257329		Approved	BARR2, DKFZp686L0365	uc002fyl.3	P32121	OTTHUMG00000090759	ENST00000269260.2:c.1007T>C	17.37:g.4623693T>C	ENSP00000269260:p.Val336Ala		4570442	B4DLW0|B5B0C0|B7WPL3|D3DTK2|H0Y688|Q0Z8D3|Q2PP19|Q6ICT3|Q8N7Y2|Q9UEQ6	Missense_Mutation	SNP	superfamily_E set domains,HMMPfam_Arrestin_N,PatternScan_ARRESTINS,HMMPfam_Arrestin_C	p.V336A	ENST00000269260.2	37	c.1007	CCDS11050.1	17	.	.	.	.	.	.	.	.	.	.	T	20.8	4.044499	0.75732	.	.	ENSG00000141480	ENST00000381488;ENST00000269260;ENST00000346341;ENST00000412477	T;T	0.20598	2.06;2.06	4.57	4.57	0.56435	Immunoglobulin E-set (1);Arrestin, C-terminal (1);Arrestin-like, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.48943	0.1528	M	0.85542	2.76	0.58432	D	0.999999	B;D;D;D;D	0.89917	0.091;0.958;0.976;1.0;0.966	B;P;D;D;D	0.87578	0.158;0.789;0.915;0.998;0.925	T	0.54741	-0.8248	10	0.56958	D	0.05	-19.7381	12.1912	0.54273	0.0:0.0:0.0:1.0	.	357;321;336;321;336	B4DLW0;P32121-2;P32121-3;G5E980;P32121	.;.;.;.;ARRB2_HUMAN	A	336;336;321;337	ENSP00000269260:V336A;ENSP00000341895:V321A	ENSP00000269260:V336A	V	+	2	0	ARRB2	4570442	1.000000	0.71417	1.000000	0.80357	0.697000	0.40408	5.927000	0.70080	1.829000	0.53265	0.247000	0.18012	GTC	-	superfamily_E set domains,HMMPfam_Arrestin_C		0.622	ARRB2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ARRB2	protein_coding	OTTHUMT00000439552.1	T	NM_004313		4570442	+1	no_errors	NM_004313	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
APITD1	378708	genome.wustl.edu	37	1	10493956	10493956	+	Missense_Mutation	SNP	G	G	C	rs141209616		TCGA-29-1769-01A-01W-0639-09	TCGA-29-1769-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	6e3821b5-a446-4b2d-9ede-6be24af88e5e	093609c2-c2b8-41d0-85ac-c69048b9b06b	g.chr1:10493956G>C	ENST00000309048.3	+	2	184	c.109G>C	c.(109-111)Gac>Cac	p.D37H	APITD1_ENST00000462462.1_Intron|APITD1-CORT_ENST00000470413.2_Missense_Mutation_p.D37H|APITD1_ENST00000602787.1_Missense_Mutation_p.D37H|APITD1_ENST00000602296.1_Missense_Mutation_p.D37H|APITD1-CORT_ENST00000400900.2_Missense_Mutation_p.D37H|APITD1-CORT_ENST00000465026.1_Intron	NM_001270517.1|NM_199294.2	NP_001257446.1|NP_954988.1	Q8N2Z9	CENPS_HUMAN	apoptosis-inducing, TAF9-like domain 1	37					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|positive regulation of protein ubiquitination (GO:0031398)|replication fork processing (GO:0031297)|resolution of meiotic recombination intermediates (GO:0000712)	cytosol (GO:0005829)|FANCM-MHF complex (GO:0071821)|Fanconi anaemia nuclear complex (GO:0043240)|kinetochore (GO:0000776)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			kidney(1)|lung(1)|ovary(1)|stomach(1)	4	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.19e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.31e-07)|COAD - Colon adenocarcinoma(227;7.32e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000297)|Kidney(185;0.000747)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(132;0.0167)|READ - Rectum adenocarcinoma(331;0.0487)		AGTTGCATTGGACAAAGAGAT	0.483																																																0			1											145.0	137.0	140.0					1																	10493956		2203	4300	6503	10416543	SO:0001583	missense	378708			BC029430	CCDS114.1, CCDS115.1	1p36.22	2013-11-05			ENSG00000175279	ENSG00000175279			23163	protein-coding gene	gene with protein product	"""centromere protein S"""	609130				15328517, 16622420, 16622419	Standard	NR_036462		Approved	CENPS, CENP-S, MHF1, FAAP16		Q8N2Z9	OTTHUMG00000059085	ENST00000309048.3:c.109G>C	1.37:g.10493956G>C	ENSP00000308583:p.Asp37His		10416543	Q8NFE5|Q8NFG5	Missense_Mutation	SNP	superfamily_Histone-fold,HMMPfam_Somatostatin	p.D37H	ENST00000309048.3	37	c.109	CCDS115.1	1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.214591	0.79352	.	.	ENSG00000175279;ENSG00000175279;ENSG00000175279;ENSG00000251503;ENSG00000251503	ENST00000556104;ENST00000556817;ENST00000309048;ENST00000400900;ENST00000470413	.	.	.	6.07	5.14	0.70334	Histone-fold (1);	0.309310	0.33438	N	0.004919	T	0.74137	0.3677	L	0.55834	1.745	0.43313	D	0.995324	D;D	0.89917	0.998;1.0	D;D	0.71870	0.953;0.975	T	0.75396	-0.3332	9	0.51188	T	0.08	-17.3625	14.759	0.69590	0.071:0.0:0.929:0.0	.	37;37	Q8N2Z9-2;Q8N2Z9	.;CENPS_HUMAN	H	37	.	ENSP00000383692:D37H	D	+	1	0	APITD1-CORT;APITD1	10416543	1.000000	0.71417	0.875000	0.34327	0.985000	0.73830	4.673000	0.61604	1.546000	0.49388	0.655000	0.94253	GAC	-	superfamily_Histone-fold		0.483	APITD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APITD1	protein_coding	OTTHUMT00000130797.2	G	NM_199294		10416543	+1	no_errors	NM_198544	genbank	human	reviewed	54_36p	missense	SNP	0.969	C
PRB2	653247	genome.wustl.edu	37	12	11546281	11546281	+	Missense_Mutation	SNP	C	C	T			TCGA-29-1769-01A-01W-0639-09	TCGA-29-1769-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	6e3821b5-a446-4b2d-9ede-6be24af88e5e	093609c2-c2b8-41d0-85ac-c69048b9b06b	g.chr12:11546281C>T	ENST00000389362.4	-	3	766	c.731G>A	c.(730-732)gGa>gAa	p.G244E	PRB2_ENST00000545829.1_5'Flank|PRB1_ENST00000546254.1_Intron	NM_006248.3	NP_006239.3	P02812	PRB2_HUMAN	proline-rich protein BstNI subfamily 2	244	15 X 20 AA approximate tandem repeats of P-P-G-K-P-Q-G-P-P-P-Q-G-[GD]-[NKS]-[KSQ]- [PRS]-[QRS] [GPS]-[PSAR]-[PSR].					extracellular region (GO:0005576)				NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(14)|pancreas(1)|prostate(5)|skin(4)|stomach(2)|urinary_tract(1)	37		all_cancers(2;0.00558)|Acute lymphoblastic leukemia(2;3.94e-11)|all_hematologic(2;3.6e-09)	OV - Ovarian serous cystadenocarcinoma(49;0.185)			TGGGGGTGGTCCTTGTGGCTT	0.602																																																0			12											165.0	188.0	180.0					12																	11546281		2201	4293	6494	11437548	SO:0001583	missense	653247			K03208	CCDS41757.2	12p13.2	2012-10-02			ENSG00000121335	ENSG00000121335			9338	protein-coding gene	gene with protein product		168810				8554050	Standard	NM_006248		Approved	PRPPRB1, Ps, cP7	uc010shk.1	P02812	OTTHUMG00000156975	ENST00000389362.4:c.731G>A	12.37:g.11546281C>T	ENSP00000374013:p.Gly244Glu		11437548	O00599|P02811|P04281	Missense_Mutation	SNP	NULL	p.G223E	ENST00000389362.4	37	c.668	CCDS41757.2	12	.	.	.	.	.	.	.	.	.	.	.	5.489	0.275179	0.10403	.	.	ENSG00000121335	ENST00000389362	T	0.10382	2.88	1.4	1.4	0.22301	.	.	.	.	.	T	0.12561	0.0305	M	0.75615	2.305	0.09310	N	1	B	0.23540	0.087	B	0.14023	0.01	T	0.21314	-1.0249	9	0.52906	T	0.07	.	5.2685	0.15613	0.3362:0.6638:0.0:0.0	.	244	P02812	PRB2_HUMAN	E	244	ENSP00000374013:G244E	ENSP00000374013:G244E	G	-	2	0	PRB2	11437548	0.002000	0.14202	0.003000	0.11579	0.028000	0.11728	0.628000	0.24522	0.679000	0.31345	0.418000	0.28097	GGA	-	NULL		0.602	PRB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRB2	protein_coding	OTTHUMT00000346925.2	C	NM_006248		11437548	-1	no_errors	NM_006248	genbank	human	validated	54_36p	missense	SNP	0.002	T
VPS13D	55187	genome.wustl.edu	37	1	12409306	12409306	+	Silent	SNP	C	C	G			TCGA-29-1769-01A-01W-0639-09	TCGA-29-1769-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	6e3821b5-a446-4b2d-9ede-6be24af88e5e	093609c2-c2b8-41d0-85ac-c69048b9b06b	g.chr1:12409306C>G	ENST00000358136.3	+	46	9436	c.9306C>G	c.(9304-9306)ccC>ccG	p.P3102P	VPS13D_ENST00000356315.4_Silent_p.P3077P	NM_015378.2	NP_056193.2			vacuolar protein sorting 13 homolog D (S. cerevisiae)											NS(1)|breast(6)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(28)|lung(44)|ovary(5)|pancreas(1)|prostate(8)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(4)	130	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		AGGCCCGGCCCAAAGGATTGG	0.493																																																0			1											128.0	131.0	130.0					1																	12409306		2203	4300	6503	12331893	SO:0001819	synonymous_variant	55187			AJ608774	CCDS30588.1, CCDS30589.1	1p36.21	2008-02-05	2006-04-04		ENSG00000048707	ENSG00000048707			23595	protein-coding gene	gene with protein product		608877	"""vacuolar protein sorting 13D (yeast)"""				Standard	NM_015378		Approved	FLJ10619, KIAA0453	uc001atv.3	Q5THJ4	OTTHUMG00000013155	ENST00000358136.3:c.9306C>G	1.37:g.12409306C>G			12331893		Silent	SNP	superfamily_UBA-like,HMMPfam_UBA,HMMSmart_SM00165,HMMPfam_DUF1162	p.P3102	ENST00000358136.3	37	c.9306	CCDS30588.1	1	.	.	.	.	.	.	.	.	.	.	C	10.08	1.251426	0.22880	.	.	ENSG00000048707	ENST00000011700	T	0.66638	-0.22	5.88	1.82	0.25136	.	0.000000	0.85682	D	0.000000	T	0.68540	0.3012	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.66567	-0.5891	7	0.87932	D	0	.	5.3894	0.16236	0.3288:0.4825:0.0:0.1887	.	.	.	.	R	1924	ENSP00000011700:P1924R	ENSP00000011700:P1924R	P	+	2	0	VPS13D	12331893	0.928000	0.31464	1.000000	0.80357	0.997000	0.91878	0.032000	0.13732	0.402000	0.25451	0.655000	0.94253	CCA	-	NULL		0.493	VPS13D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13D	protein_coding	OTTHUMT00000036897.2	C	NM_015378		12331893	+1	no_errors	NM_015378	genbank	human	reviewed	54_36p	silent	SNP	0.986	G
TRPV2	51393	genome.wustl.edu	37	17	16336922	16336922	+	Missense_Mutation	SNP	A	A	T			TCGA-29-1769-01A-01W-0639-09	TCGA-29-1769-10A-01W-0639-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	6e3821b5-a446-4b2d-9ede-6be24af88e5e	093609c2-c2b8-41d0-85ac-c69048b9b06b	g.chr17:16336922A>T	ENST00000338560.7	+	13	2423	c.2024A>T	c.(2023-2025)tAt>tTt	p.Y675F	TRPV2_ENST00000577397.1_Missense_Mutation_p.Y245F	NM_016113.4	NP_057197.2	Q9Y5S1	TRPV2_HUMAN	transient receptor potential cation channel, subfamily V, member 2	675					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|positive regulation of axon extension (GO:0045773)|positive regulation of calcium ion import (GO:0090280)|response to heat (GO:0009408)|response to temperature stimulus (GO:0009266)|sensory perception (GO:0007600)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axonal growth cone (GO:0044295)|cell body (GO:0044297)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endomembrane system (GO:0012505)|growth cone membrane (GO:0032584)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)|ion channel activity (GO:0005216)|ion transmembrane transporter activity (GO:0015075)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|stomach(3)	28				UCEC - Uterine corpus endometrioid carcinoma (92;0.0837)		GAGAATGGCTATTGGTGGTGC	0.582																																																0			17											147.0	129.0	135.0					17																	16336922		2203	4300	6503	16277647	SO:0001583	missense	51393			AF129112	CCDS32576.1	17p11.2	2013-01-10			ENSG00000187688	ENSG00000187688		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	18082	protein-coding gene	gene with protein product		606676				10201375, 16382100	Standard	NM_016113		Approved	VRL, VRL-1, VRL1	uc002gpy.3	Q9Y5S1	OTTHUMG00000058989	ENST00000338560.7:c.2024A>T	17.37:g.16336922A>T	ENSP00000342222:p.Tyr675Phe		16277647	A6NML2|A8K0Z0|Q9Y670	Missense_Mutation	SNP	superfamily_ANK,HMMPfam_Ank,HMMSmart_ANK,HMMPfam_Ion_trans	p.Y675F	ENST00000338560.7	37	c.2024	CCDS32576.1	17	.	.	.	.	.	.	.	.	.	.	A	11.17	1.558479	0.27827	.	.	ENSG00000187688	ENST00000338560	D	0.89415	-2.51	5.79	5.79	0.91817	.	0.374704	0.30791	N	0.008872	T	0.76962	0.4061	N	0.10874	0.06	0.31501	N	0.664811	B	0.06786	0.001	B	0.10450	0.005	T	0.67658	-0.5614	10	0.07325	T	0.83	-34.4913	14.0861	0.64957	1.0:0.0:0.0:0.0	.	675	Q9Y5S1	TRPV2_HUMAN	F	675	ENSP00000342222:Y675F	ENSP00000342222:Y675F	Y	+	2	0	TRPV2	16277647	0.017000	0.18338	0.995000	0.50966	0.334000	0.28698	0.936000	0.28938	2.220000	0.72140	0.528000	0.53228	TAT	-	NULL		0.582	TRPV2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPV2	protein_coding	OTTHUMT00000130464.2	A	NM_016113		16277647	+1	no_errors	NM_016113	genbank	human	reviewed	54_36p	missense	SNP	0.617	T
SLC7A2	6542	genome.wustl.edu	37	8	17402079	17402079	+	Missense_Mutation	SNP	G	G	T			TCGA-29-1769-01A-01W-0639-09	TCGA-29-1769-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	6e3821b5-a446-4b2d-9ede-6be24af88e5e	093609c2-c2b8-41d0-85ac-c69048b9b06b	g.chr8:17402079G>T	ENST00000494857.1	+	4	714	c.496G>T	c.(496-498)Gat>Tat	p.D166Y	SLC7A2_ENST00000470360.1_Missense_Mutation_p.D206Y|SLC7A2_ENST00000004531.10_Missense_Mutation_p.D206Y|SLC7A2_ENST00000398090.3_Missense_Mutation_p.D206Y|SLC7A2_ENST00000522656.1_Missense_Mutation_p.D166Y	NM_001008539.3	NP_001008539.3	P52569	CTR2_HUMAN	solute carrier family 7 (cationic amino acid transporter, y+ system), member 2	166					amino acid transport (GO:0006865)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|macrophage activation (GO:0042116)|nitric oxide biosynthetic process (GO:0006809)|nitric oxide production involved in inflammatory response (GO:0002537)|regulation of inflammatory response (GO:0050727)|regulation of macrophage activation (GO:0043030)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	basic amino acid transmembrane transporter activity (GO:0015174)|high-affinity arginine transmembrane transporter activity (GO:0005289)|L-lysine transmembrane transporter activity (GO:0015189)|L-ornithine transmembrane transporter activity (GO:0000064)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(4)|lung(8)|ovary(2)|skin(1)|stomach(1)	25				Colorectal(111;0.0577)|COAD - Colon adenocarcinoma(73;0.216)	L-Lysine(DB00123)|L-Ornithine(DB00129)	AGAATATCCCGATTTTTTTGC	0.398																																																0			8											105.0	102.0	103.0					8																	17402079		2203	4300	6503	17446455	SO:0001583	missense	6542			D29990	CCDS6002.2, CCDS34852.1, CCDS55203.1	8p22	2013-05-22			ENSG00000003989	ENSG00000003989		"""Solute carriers"""	11060	protein-coding gene	gene with protein product		601872		ATRC2		8954799	Standard	NM_001164771		Approved	CAT-2, HCAT2	uc011kye.2	P52569	OTTHUMG00000130819	ENST00000494857.1:c.496G>T	8.37:g.17402079G>T	ENSP00000419140:p.Asp166Tyr		17446455	B7ZL54|O15291|O15292|Q14CQ6|Q6NSZ7|Q86TC6	Missense_Mutation	SNP	HMMPfam_AA_permease	p.D206Y	ENST00000494857.1	37	c.616	CCDS34852.1	8	.	.	.	.	.	.	.	.	.	.	G	23.1	4.374404	0.82573	.	.	ENSG00000003989	ENST00000494857;ENST00000522656;ENST00000470360;ENST00000004531;ENST00000398090	D;D;D;D;D	0.88277	-2.36;-2.36;-2.36;-2.36;-2.36	5.52	5.52	0.82312	Amino acid permease domain (1);	0.000000	0.85682	D	0.000000	D	0.96642	0.8904	H	0.96489	3.83	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	D	0.97394	0.9991	10	0.87932	D	0	.	19.8219	0.96602	0.0:0.0:1.0:0.0	.	206;206;166	P52569-3;P52569-2;P52569	.;.;CTR2_HUMAN	Y	166;166;206;206;206	ENSP00000419140:D166Y;ENSP00000430464:D166Y;ENSP00000419873:D206Y;ENSP00000004531:D206Y;ENSP00000381164:D206Y	ENSP00000004531:D206Y	D	+	1	0	SLC7A2	17446455	1.000000	0.71417	0.994000	0.49952	0.731000	0.41821	9.823000	0.99369	2.767000	0.95098	0.563000	0.77884	GAT	-	NULL		0.398	SLC7A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC7A2	protein_coding	OTTHUMT00000253367.3	G	NM_003046		17446455	+1	no_errors	NM_003046	genbank	human	validated	54_36p	missense	SNP	0.998	T
IGHV1OR15-9	390531	genome.wustl.edu	37	15	20169990	20169990	+	RNA	SNP	G	G	A			TCGA-29-1769-01A-01W-0639-09	TCGA-29-1769-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	6e3821b5-a446-4b2d-9ede-6be24af88e5e	093609c2-c2b8-41d0-85ac-c69048b9b06b	g.chr15:20169990G>A	ENST00000338912.5	-	0	281									immunoglobulin heavy variable 1/OR15-9 (non-functional)																		CTGTGCCCATGGATGTGTCCC	0.522																																																0			15											202.0	195.0	197.0					15																	20169990		2111	4232	6343	18430004			390531			L25542		15q11.1	2013-10-18	2008-08-22		ENSG00000188403	ENSG00000188403		"""Immunoglobulins / IGH orphons"""	5569	other	immunoglobulin gene			"""immunoglobulin heavy variable 1/OR15-9"", ""V-set and immunoglobulin domain containing 7"""	VSIG7		7959766	Standard	NG_032069		Approved	IGHV1/OR15-9, IGHV1OR159			OTTHUMG00000171652		15.37:g.20169990G>A			18430004		Silent	SNP	HMMPfam_V-set,superfamily_SSF48726,HMMSmart_IGv	p.S94	ENST00000338912.5	37	c.282		15																																																																																			-	HMMPfam_V-set,superfamily_SSF48726,HMMSmart_IGv		0.522	IGHV1OR15-9-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	VSIG7	IG_V_gene	OTTHUMT00000414646.4	G			18430004	-1	no_errors	ENST00000338912	ensembl	human	known	54_36p	silent	SNP	0.424	A
UEVLD	55293	genome.wustl.edu	37	11	18586529	18586529	+	Missense_Mutation	SNP	C	C	G			TCGA-29-1769-01A-01W-0639-09	TCGA-29-1769-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	6e3821b5-a446-4b2d-9ede-6be24af88e5e	093609c2-c2b8-41d0-85ac-c69048b9b06b	g.chr11:18586529C>G	ENST00000541984.1	-	4	284	c.222G>C	c.(220-222)tgG>tgC	p.W74C	UEVLD_ENST00000320750.6_Missense_Mutation_p.W152C|UEVLD_ENST00000396197.3_Missense_Mutation_p.W174C|UEVLD_ENST00000379387.4_Missense_Mutation_p.W152C|UEVLD_ENST00000300038.7_Missense_Mutation_p.W174C|UEVLD_ENST00000543987.1_Missense_Mutation_p.W174C|UEVLD_ENST00000540666.1_5'UTR|UEVLD_ENST00000535484.1_Missense_Mutation_p.W136C	NM_001261386.1	NP_001248315.1			UEV and lactate/malate dehyrogenase domains											endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	8						CATGATTTGCCCAGCTCTTTG	0.323																																																0			11											137.0	118.0	124.0					11																	18586529		2199	4293	6492	18543105	SO:0001583	missense	55293			AF503350	CCDS7843.1, CCDS41624.1, CCDS58122.1, CCDS58123.1, CCDS58124.1, CCDS58125.1, CCDS73266.1	11p15.1	2006-07-14			ENSG00000151116	ENSG00000151116			30866	protein-coding gene	gene with protein product		610985				12427560	Standard	NM_001040697		Approved	Attp, UEV3	uc001mot.4	Q8IX04	OTTHUMG00000167729	ENST00000541984.1:c.222G>C	11.37:g.18586529C>G	ENSP00000437538:p.Trp74Cys		18543105		Missense_Mutation	SNP	superfamily_UBC-like,HMMPfam_UEV,superfamily_NAD(P)-binding Rossmann-fold domains,HMMPfam_Ldh_1_N,superfamily_LDH C-terminal domain-like,HMMPfam_Ldh_1_C	p.W174C	ENST00000541984.1	37	c.522	CCDS58125.1	11	.	.	.	.	.	.	.	.	.	.	C	13.60	2.285844	0.40394	.	.	ENSG00000151116	ENST00000543987;ENST00000535484;ENST00000396197;ENST00000320750;ENST00000379387;ENST00000541984;ENST00000300038	D;D;T;D;T;T	0.82433	-1.61;-1.61;-0.75;-1.6;-0.74;-1.1	5.19	4.27	0.50696	NAD(P)-binding domain (1);	0.348836	0.33180	N	0.005197	T	0.79902	0.4526	L	0.47716	1.5	0.46631	D	0.999131	D;P;B;P;P	0.63046	0.992;0.761;0.001;0.846;0.556	P;B;B;B;B	0.49502	0.613;0.221;0.005;0.394;0.221	T	0.79155	-0.1920	10	0.51188	T	0.08	-4.4	6.7387	0.23422	0.1805:0.7249:0.0:0.0945	.	174;152;152;174;174	Q8IX04-5;B4DL43;Q8IX04-3;Q8IX04-2;Q8IX04	.;.;.;.;UEVLD_HUMAN	C	174;136;174;152;152;74;174	ENSP00000442974:W174C;ENSP00000441092:W136C;ENSP00000379500:W174C;ENSP00000323353:W152C;ENSP00000368697:W152C;ENSP00000437538:W74C	ENSP00000300038:W174C	W	-	3	0	UEVLD	18543105	0.974000	0.33945	1.000000	0.80357	0.971000	0.66376	1.468000	0.35332	1.474000	0.48178	0.650000	0.86243	TGG	-	superfamily_NAD(P)-binding Rossmann-fold domains		0.323	UEVLD-015	NOVEL	basic|exp_conf|CCDS	protein_coding	UEVLD	protein_coding	OTTHUMT00000395928.1	C	NM_018314		18543105	-1	no_errors	NM_001040697	genbank	human	validated	54_36p	missense	SNP	0.971	G
RIN2	54453	genome.wustl.edu	37	20	19956238	19956238	+	Silent	SNP	G	G	A			TCGA-29-1769-01A-01W-0639-09	TCGA-29-1769-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	6e3821b5-a446-4b2d-9ede-6be24af88e5e	093609c2-c2b8-41d0-85ac-c69048b9b06b	g.chr20:19956238G>A	ENST00000255006.6	+	8	1865	c.1716G>A	c.(1714-1716)cgG>cgA	p.R572R	RIN2_ENST00000484638.1_3'UTR|RIN2_ENST00000440354.2_Intron	NM_001242581.1|NM_018993.3	NP_001229510.1|NP_061866.1	Q8WYP3	RIN2_HUMAN	Ras and Rab interactor 2	523					endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of catalytic activity (GO:0050790)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	GTPase activator activity (GO:0005096)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|small GTPase regulator activity (GO:0005083)			autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|urinary_tract(2)	27						AGCTTTCCCGGGACAAATGCA	0.597																																																0			20											73.0	79.0	77.0					20																	19956238		2051	4198	6249	19904238	SO:0001819	synonymous_variant	54453			AB060339	CCDS56182.1	20p11.22	2008-07-30			ENSG00000132669	ENSG00000132669			18750	protein-coding gene	gene with protein product		610222				11733506, 1849280, 16423831	Standard	NM_018993		Approved	RASSF4	uc002wro.2	Q8WYP3	OTTHUMG00000031996	ENST00000255006.6:c.1716G>A	20.37:g.19956238G>A			19904238	Q00425|Q5TFT8|Q9BQL3|Q9H071	Silent	SNP	superfamily_SH2 domain,superfamily_VPS9 domain (Pfam 02204),HMMSmart_SM00167,HMMPfam_VPS9,HMMPfam_RA,HMMSmart_SM00314	p.R523	ENST00000255006.6	37	c.1569	CCDS56182.1	20																																																																																			-	NULL		0.597	RIN2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	RIN2	protein_coding	OTTHUMT00000078212.1	G			19904238	+1	no_errors	NM_018993	genbank	human	reviewed	54_36p	silent	SNP	1.000	A
DNAH11	8701	genome.wustl.edu	37	7	21639672	21639672	+	Missense_Mutation	SNP	A	A	G	rs374198643		TCGA-29-1769-01A-01W-0639-09	TCGA-29-1769-10A-01W-0639-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	6e3821b5-a446-4b2d-9ede-6be24af88e5e	093609c2-c2b8-41d0-85ac-c69048b9b06b	g.chr7:21639672A>G	ENST00000409508.3	+	15	2966	c.2935A>G	c.(2935-2937)Aat>Gat	p.N979D	DNAH11_ENST00000328843.6_Missense_Mutation_p.N979D	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	979	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						AATGTTATGCAATAGTTTTAG	0.368									Kartagener syndrome																																							0			7											61.0	58.0	59.0					7																	21639672		1847	4088	5935	21606197	SO:0001583	missense	8701	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.2935A>G	7.37:g.21639672A>G	ENSP00000475939:p.Asn979Asp		21606197	Q9UJ82	Missense_Mutation	SNP	HMMPfam_DHC_N1,HMMPfam_DHC_N2,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00382,PatternScan_THIOL_PROTEASE_HIS,HMMPfam_AAA_5,PatternScan_WD_REPEATS_1,HMMPfam_Dynein_heavy	p.N979D	ENST00000409508.3	37	c.2935		7	.	.	.	.	.	.	.	.	.	.	A	0.877	-0.730110	0.03135	.	.	ENSG00000105877	ENST00000328843	T	0.21031	2.03	5.72	0.731	0.18277	.	1.308160	0.04811	N	0.435146	T	0.09158	0.0226	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.26258	-1.0108	9	0.02654	T	1	.	9.1574	0.37000	0.5965:0.0:0.4035:0.0	.	979	Q96DT5	DYH11_HUMAN	D	979	ENSP00000330671:N979D	ENSP00000330671:N979D	N	+	1	0	DNAH11	21606197	0.000000	0.05858	0.000000	0.03702	0.974000	0.67602	0.987000	0.29603	-0.037000	0.13646	0.533000	0.62120	AAT	-	NULL		0.368	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	DNAH11	protein_coding	OTTHUMT00000326582.6	A	NM_003777		21606197	+1	no_errors	ENST00000328843	ensembl	human	known	54_36p	missense	SNP	0.000	G
CDCA7L	55536	genome.wustl.edu	37	7	21941865	21941865	+	3'UTR	SNP	T	T	A	rs544273866|rs374410108|rs60370798|rs386711147|rs577770757	byFrequency	TCGA-29-1769-01A-01W-0639-09	TCGA-29-1769-10A-01W-0639-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	6e3821b5-a446-4b2d-9ede-6be24af88e5e	093609c2-c2b8-41d0-85ac-c69048b9b06b	g.chr7:21941865T>A	ENST00000406877.3	-	0	1719				CDCA7L_ENST00000356195.5_3'UTR|CDCA7L_ENST00000373934.4_3'UTR|CDCA7L_ENST00000465490.1_5'Flank	NM_018719.4	NP_061189.2	Q96GN5	CDA7L_HUMAN	cell division cycle associated 7-like						positive regulation of cell proliferation (GO:0008284)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)				NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(8)|prostate(2)|skin(1)|urinary_tract(1)	29						AAAAAAATCTTTCTTAGGCAC	0.328														2406	0.480431	0.2617	0.4769	5008	,	,		17547	0.4603		0.7306	False		,,,				2504	0.5419															0			7											103.0	36.0	56.0					7																	21941865		692	1590	2282	21908390	SO:0001624	3_prime_UTR_variant	55536				CCDS5374.1, CCDS47558.1, CCDS47559.1	7p15.3	2007-04-27			ENSG00000164649	ENSG00000164649			30777	protein-coding gene	gene with protein product		609685				16829576	Standard	NM_018719		Approved	RAM2, R1, JPO2	uc010kuk.3	Q96GN5	OTTHUMG00000128429	ENST00000406877.3:c.*75A>T	7.37:g.21941865T>A			21908390	A4D141|A6NF50|B3KTR5|B4DUT3|C9K0Y1|Q6PIL4|Q86YT0|Q8IXN5|Q96C70|Q9H9A2|Q9NPV2	Splice_Site	SNP	-	e10+1	ENST00000406877.3	37	c.1365+1	CCDS5374.1	7																																																																																			-	-		0.328	CDCA7L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDCA7L	protein_coding	OTTHUMT00000250218.4	T	NM_018719		21908390	-1	no_errors	ENST00000373934	ensembl	human	known	54_36p	splice_site	SNP	0.003	A
TNRC6A	27327	genome.wustl.edu	37	16	24817970	24817970	+	Nonsense_Mutation	SNP	C	C	T			TCGA-29-1769-01A-01W-0639-09	TCGA-29-1769-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	6e3821b5-a446-4b2d-9ede-6be24af88e5e	093609c2-c2b8-41d0-85ac-c69048b9b06b	g.chr16:24817970C>T	ENST00000395799.3	+	17	4534	c.4405C>T	c.(4405-4407)Cag>Tag	p.Q1469*	TNRC6A_ENST00000315183.7_Nonsense_Mutation_p.Q1420*|CTD-2515A14.1_ENST00000568895.1_RNA|TNRC6A_ENST00000432286.2_5'Flank	NM_014494.2	NP_055309.2	Q8NDV7	TNR6A_HUMAN	trinucleotide repeat containing 6A	1469					cellular response to starvation (GO:0009267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|micro-ribonucleoprotein complex (GO:0035068)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(13)|kidney(5)|large_intestine(13)|liver(1)|lung(20)|ovary(3)|skin(2)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	64				GBM - Glioblastoma multiforme(48;0.0394)		GGTGAAGCAGCAGACTCCACC	0.483																																																0			16											142.0	123.0	129.0					16																	24817970		2197	4300	6497	24725471	SO:0001587	stop_gained	27327			U80739	CCDS10624.2	16p11.2	2009-09-22	2004-12-17	2004-12-17	ENSG00000090905	ENSG00000090905		"""Trinucleotide (CAG) repeat containing"""	11969	protein-coding gene	gene with protein product		610739	"""trinucleotide repeat containing 6"""	TNRC6		9225980	Standard	NM_014494		Approved	CAGH26, KIAA1460, GW182	uc002dmm.3	Q8NDV7	OTTHUMG00000096999	ENST00000395799.3:c.4405C>T	16.37:g.24817970C>T	ENSP00000379144:p.Gln1469*		24725471	C9JAR8|O15408|Q658L5|Q6NVB5|Q8NEZ0|Q8TBT8|Q8TCR0|Q9NV59|Q9P268	Nonsense_Mutation	SNP	PatternScan_TUBULIN_B_AUTOREG,HMMPfam_Ago_hook,superfamily_RNA-binding domain RBD	p.Q1469*	ENST00000395799.3	37	c.4405	CCDS10624.2	16	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	45|45	11.703484|11.703484	0.99593|0.99593	.|.	.|.	ENSG00000090905|ENSG00000090905	ENST00000450465|ENST00000315183;ENST00000395799	.|.	.|.	.|.	6.17|6.17	6.17|6.17	0.99709|0.99709	.|.	.|0.124624	.|0.56097	.|D	.|0.000040	T|.	0.57695|.	0.2071|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.46219|.	-0.9207|.	4|.	.|0.15952	.|T	.|0.53	0.5319|0.5319	15.581|15.581	0.76439|0.76439	0.1377:0.8623:0.0:0.0|0.1377:0.8623:0.0:0.0	.|.	.|.	.|.	.|.	V|X	359|1420;1469	.|.	.|ENSP00000326900:Q1420X	A|Q	+|+	2|1	0|0	TNRC6A|TNRC6A	24725471|24725471	1.000000|1.000000	0.71417|0.71417	0.990000|0.990000	0.47175|0.47175	0.998000|0.998000	0.95712|0.95712	3.274000|3.274000	0.51631|0.51631	2.941000|2.941000	0.99782|0.99782	0.655000|0.655000	0.94253|0.94253	GCA|CAG	-	NULL		0.483	TNRC6A-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	TNRC6A	protein_coding	OTTHUMT00000214081.1	C	NM_020847		24725471	+1	no_errors	NM_014494	genbank	human	reviewed	54_36p	nonsense	SNP	1.000	T
SLC30A2	7780	genome.wustl.edu	37	1	26368259	26368259	+	Missense_Mutation	SNP	A	A	C			TCGA-29-1769-01A-01W-0639-09	TCGA-29-1769-10A-01W-0639-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	6e3821b5-a446-4b2d-9ede-6be24af88e5e	093609c2-c2b8-41d0-85ac-c69048b9b06b	g.chr1:26368259A>C	ENST00000374278.3	-	5	839	c.623T>G	c.(622-624)gTc>gGc	p.V208G	SLC30A2_ENST00000374276.3_Missense_Mutation_p.V257G|SLC30A2_ENST00000498060.1_5'Flank	NM_032513.3	NP_115902.1	Q9BRI3	ZNT2_HUMAN	solute carrier family 30 (zinc transporter), member 2	208					positive regulation of sequestering of zinc ion (GO:0061090)|transmembrane transport (GO:0055085)|zinc ion transport (GO:0006829)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)	cation transmembrane transporter activity (GO:0008324)			cervix(1)|endometrium(2)|kidney(1)|lung(8)|stomach(1)	13		Colorectal(325;3.46e-05)|Lung NSC(340;6.18e-05)|all_lung(284;9.43e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0298)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;7.09e-26)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000728)|BRCA - Breast invasive adenocarcinoma(304;0.000969)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00614)|READ - Rectum adenocarcinoma(331;0.0649)		GATGGAGAAGACGAAGGTGCA	0.527																																																0			1											173.0	131.0	145.0					1																	26368259		2203	4300	6503	26240846	SO:0001583	missense	7780			AK023491	CCDS272.1, CCDS30644.1	1p35.3	2013-05-22			ENSG00000158014	ENSG00000158014		"""Solute carriers"""	11013	protein-coding gene	gene with protein product		609617		ZNT2			Standard	NM_001004434		Approved		uc001blg.1	Q9BRI3	OTTHUMG00000007508	ENST00000374278.3:c.623T>G	1.37:g.26368259A>C	ENSP00000363396:p.Val208Gly		26240846	Q71RC8	Missense_Mutation	SNP	HMMPfam_Cation_efflux	p.V257G	ENST00000374278.3	37	c.770	CCDS272.1	1	.	.	.	.	.	.	.	.	.	.	A	20.6	4.016339	0.75161	.	.	ENSG00000158014	ENST00000374278;ENST00000374276	T;T	0.64618	-0.11;-0.11	5.78	5.78	0.91487	.	0.652877	0.14131	N	0.339350	T	0.69450	0.3112	L	0.45285	1.41	0.49687	D	0.999817	B;P	0.35033	0.029;0.481	B;P	0.49192	0.062;0.602	T	0.69401	-0.5155	10	0.87932	D	0	-2.2255	15.0892	0.72180	1.0:0.0:0.0:0.0	.	208;257	Q9BRI3;Q9BRI3-2	ZNT2_HUMAN;.	G	208;257	ENSP00000363396:V208G;ENSP00000363394:V257G	ENSP00000363394:V257G	V	-	2	0	SLC30A2	26240846	1.000000	0.71417	0.995000	0.50966	0.882000	0.50991	9.191000	0.94940	2.201000	0.70794	0.459000	0.35465	GTC	-	HMMPfam_Cation_efflux		0.527	SLC30A2-001	KNOWN	basic|CCDS	protein_coding	SLC30A2	protein_coding	OTTHUMT00000019742.1	A	NM_032513		26240846	-1	no_errors	NM_001004434	genbank	human	validated	54_36p	missense	SNP	1.000	C
ASXL3	80816	genome.wustl.edu	37	18	31226240	31226240	+	Missense_Mutation	SNP	C	C	T			TCGA-29-1769-01A-01W-0639-09	TCGA-29-1769-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	6e3821b5-a446-4b2d-9ede-6be24af88e5e	093609c2-c2b8-41d0-85ac-c69048b9b06b	g.chr18:31226240C>T	ENST00000269197.5	+	4	278	c.278C>T	c.(277-279)aCg>aTg	p.T93M		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	93					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						GCAGATGGCACGTTGGATTTA	0.378																																																0			18											130.0	127.0	128.0					18																	31226240		1963	4161	6124	29480238	SO:0001583	missense	80816			AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.278C>T	18.37:g.31226240C>T	ENSP00000269197:p.Thr93Met		29480238	Q6ZMX6|Q96MU3|Q9UFC5	Missense_Mutation	SNP	NULL	p.T93M	ENST00000269197.5	37	c.278	CCDS45847.1	18	.	.	.	.	.	.	.	.	.	.	C	19.84	3.902154	0.72754	.	.	ENSG00000141431	ENST00000269197	T	0.15834	2.39	5.47	4.6	0.57074	.	.	.	.	.	T	0.15782	0.0380	L	0.36672	1.1	0.31758	N	0.633758	B	0.27351	0.176	B	0.18561	0.022	T	0.06862	-1.0803	9	0.66056	D	0.02	.	14.6633	0.68888	0.0:0.9294:0.0:0.0706	.	93	Q9C0F0	ASXL3_HUMAN	M	93	ENSP00000269197:T93M	ENSP00000269197:T93M	T	+	2	0	ASXL3	29480238	0.991000	0.36638	0.107000	0.21349	0.992000	0.81027	3.060000	0.49955	1.443000	0.47586	0.555000	0.69702	ACG	-	NULL		0.378	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ASXL3	protein_coding	OTTHUMT00000441865.2	C			29480238	+1	no_errors	NM_030632	genbank	human	validated	54_36p	missense	SNP	0.996	T
ROMO1	140823	genome.wustl.edu	37	20	34287667	34287667	+	Missense_Mutation	SNP	G	G	C			TCGA-29-1769-01A-01W-0639-09	TCGA-29-1769-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	6e3821b5-a446-4b2d-9ede-6be24af88e5e	093609c2-c2b8-41d0-85ac-c69048b9b06b	g.chr20:34287667G>C	ENST00000374078.1	+	2	293	c.113G>C	c.(112-114)gGc>gCc	p.G38A	ROMO1_ENST00000374072.1_Missense_Mutation_p.G38A|NFS1_ENST00000540053.1_5'Flank|NFS1_ENST00000397425.1_5'Flank|NFS1_ENST00000374085.1_5'Flank|NFS1_ENST00000374092.4_5'Flank|NFS1_ENST00000541387.1_5'Flank|ROMO1_ENST00000336695.4_Missense_Mutation_p.G38A|NFS1_ENST00000306750.3_5'Flank|ROMO1_ENST00000397416.1_Missense_Mutation_p.G38A|ROMO1_ENST00000374077.3_Missense_Mutation_p.G38A	NM_080748.2	NP_542786.1	P60602	ROMO1_HUMAN	reactive oxygen species modulator 1	38					cellular response to reactive oxygen species (GO:0034614)|defense response to bacterium (GO:0042742)|positive regulation of cell proliferation (GO:0008284)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|replicative cell aging (GO:0001302)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)				cervix(1)	1						GCGCTCTTCGGCACCTTTTCC	0.657											OREG0004048	type=REGULATORY REGION|Gene=NFS1|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																																				0			20											80.0	85.0	84.0					20																	34287667		2203	4300	6503	33751081	SO:0001583	missense	140823			AK000548	CCDS13264.1	20q11.22	2008-09-30	2008-09-30	2008-09-30	ENSG00000125995	ENSG00000125995			16185	protein-coding gene	gene with protein product	"""mitochondrial targeting GXXXG protein"""		"""chromosome 20 open reading frame 52"""	C20orf52		18313394, 17537404, 16842742	Standard	NM_080748		Approved	bA353C18.2, MTGMP	uc002xdy.3	P60602	OTTHUMG00000032360	ENST00000374078.1:c.113G>C	20.37:g.34287667G>C	ENSP00000363191:p.Gly38Ala	846	33751081	A7M872|E1P5R9|E9KL28|Q3MHD5|Q5QP16|Q9CQ98|Q9H1N2	Missense_Mutation	SNP	HMMPfam_Mit_gmP	p.G38A	ENST00000374078.1	37	c.113	CCDS13264.1	20	.	.	.	.	.	.	.	.	.	.	G	35	5.543105	0.96474	.	.	ENSG00000125995	ENST00000374078;ENST00000374077;ENST00000374072;ENST00000397416;ENST00000336695	T;T;T;T;T	0.68624	-0.34;-0.34;-0.34;-0.34;-0.34	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	T	0.75376	0.3841	.	.	.	0.80722	D	1	P	0.51240	0.943	P	0.51385	0.668	T	0.78137	-0.2321	9	0.66056	D	0.02	.	18.9826	0.92760	0.0:0.0:1.0:0.0	.	38	P60602	ROMO1_HUMAN	A	38	ENSP00000363191:G38A;ENSP00000363190:G38A;ENSP00000363185:G38A;ENSP00000380561:G38A;ENSP00000338293:G38A	ENSP00000338293:G38A	G	+	2	0	ROMO1	33751081	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	9.337000	0.96545	2.712000	0.92718	0.591000	0.81541	GGC	-	HMMPfam_Mit_gmP		0.657	ROMO1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ROMO1	protein_coding	OTTHUMT00000126404.1	G	NM_080748		33751081	+1	no_errors	NM_080748	genbank	human	validated	54_36p	missense	SNP	1.000	C
KCNK17	89822	genome.wustl.edu	37	6	39278756	39278756	+	Missense_Mutation	SNP	C	C	T	rs143146161	byFrequency	TCGA-29-1769-01A-01W-0639-09	TCGA-29-1769-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	6e3821b5-a446-4b2d-9ede-6be24af88e5e	093609c2-c2b8-41d0-85ac-c69048b9b06b	g.chr6:39278756C>T	ENST00000373231.4	-	2	497	c.265G>A	c.(265-267)Gcc>Acc	p.A89T	KCNK17_ENST00000453413.2_Missense_Mutation_p.A89T	NM_031460.3	NP_113648.2	Q96T54	KCNKH_HUMAN	potassium channel, subfamily K, member 17	89					potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			endometrium(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|skin(2)	14						AGGAGGCTGGCTCCGTTTTTG	0.562													C|||	8	0.00159744	0.0	0.0029	5008	,	,		12216	0.0		0.003	False		,,,				2504	0.0031															0			6						C	THR/ALA,THR/ALA	1,4405	2.1+/-5.4	0,1,2202	123.0	114.0	117.0		265,265	-1.4	0.0	6	dbSNP_134	117	9,8591	7.1+/-27.0	0,9,4291	yes	missense,missense	KCNK17	NM_001135111.1,NM_031460.3	58,58	0,10,6493	TT,TC,CC		0.1047,0.0227,0.0769	benign,benign	89/272,89/333	39278756	10,12996	2203	4300	6503	39386734	SO:0001583	missense	89822			AF358910	CCDS4842.1, CCDS47419.1	6p21	2012-03-07			ENSG00000124780	ENSG00000124780		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	14465	protein-coding gene	gene with protein product		607370				16382106	Standard	NM_031460		Approved	K2p17.1, TALK-2, TALK2, TASK4, TASK-4	uc003ooo.3	Q96T54	OTTHUMG00000014646	ENST00000373231.4:c.265G>A	6.37:g.39278756C>T	ENSP00000362328:p.Ala89Thr		39386734	E9PB46|Q5TCF4|Q8TAW4|Q9BXD1|Q9H592	Missense_Mutation	SNP	superfamily_SSF81324,HMMPfam_Ion_trans_2	p.A89T	ENST00000373231.4	37	c.265	CCDS4842.1	6	3	0.0013736263736263737	0	0.0	1	0.0027624309392265192	0	0.0	2	0.002638522427440633	C	9.351	1.065518	0.20067	2.27E-4	0.001047	ENSG00000124780	ENST00000373231;ENST00000453413	T;T	0.16897	2.31;2.68	5.42	-1.41	0.08941	.	0.718395	0.12155	N	0.494553	T	0.02494	0.0076	N	0.14661	0.345	0.09310	N	1	B;B	0.14012	0.009;0.009	B;B	0.18263	0.021;0.021	T	0.43015	-0.9417	10	0.62326	D	0.03	.	3.7895	0.08715	0.2717:0.2985:0.0:0.4298	.	89;89	E9PB46;Q96T54	.;KCNKH_HUMAN	T	89	ENSP00000362328:A89T;ENSP00000401271:A89T	ENSP00000362328:A89T	A	-	1	0	KCNK17	39386734	0.000000	0.05858	0.000000	0.03702	0.473000	0.32948	-0.836000	0.04382	-0.276000	0.09206	0.542000	0.68232	GCC	-	superfamily_SSF81324,HMMPfam_Ion_trans_2		0.562	KCNK17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNK17	protein_coding	OTTHUMT00000040453.2	C	NM_031460		39386734	-1	no_errors	NM_031460	genbank	human	reviewed	54_36p	missense	SNP	0.000	T
SETBP1	26040	genome.wustl.edu	37	18	42643139	42643139	+	Missense_Mutation	SNP	A	A	T			TCGA-29-1769-01A-01W-0639-09	TCGA-29-1769-10A-01W-0639-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	6e3821b5-a446-4b2d-9ede-6be24af88e5e	093609c2-c2b8-41d0-85ac-c69048b9b06b	g.chr18:42643139A>T	ENST00000282030.5	+	6	4563	c.4267A>T	c.(4267-4269)Acc>Tcc	p.T1423S		NM_015559.2	NP_056374.2	Q9Y6X0	SETBP_HUMAN	SET binding protein 1	1423						nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|endometrium(9)|kidney(9)|large_intestine(20)|lung(47)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	104				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		GATCCTGTCCACCAAGAAGAA	0.557									Schinzel-Giedion syndrome																																							0			18											55.0	52.0	53.0					18																	42643139		2203	4300	6503	40897137	SO:0001583	missense	26040	Familial Cancer Database	SGC, Schinzel-Giedion Midface Retraction syndrome	AB022660	CCDS11923.2, CCDS45859.1	18q21.1	2008-08-01			ENSG00000152217	ENSG00000152217			15573	protein-coding gene	gene with protein product		611060				11231286	Standard	NM_015559		Approved	SEB, KIAA0437	uc010dni.3	Q9Y6X0	OTTHUMG00000132613	ENST00000282030.5:c.4267A>T	18.37:g.42643139A>T	ENSP00000282030:p.Thr1423Ser		40897137	A6H8W5|Q6P6C3|Q9UEF3	Missense_Mutation	SNP	HMMPfam_AT_hook,HMMSmart_AT_hook	p.T1369S	ENST00000282030.5	37	c.4105	CCDS11923.2	18	.	.	.	.	.	.	.	.	.	.	A	24.8	4.566945	0.86439	.	.	ENSG00000152217	ENST00000282030	T	0.72942	-0.7	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	T	0.74023	0.3662	N	0.19112	0.55	0.38490	D	0.947948	D	0.67145	0.996	D	0.77557	0.99	T	0.79045	-0.1964	10	0.56958	D	0.05	.	15.1602	0.72778	1.0:0.0:0.0:0.0	.	1423	Q9Y6X0	SETBP_HUMAN	S	1423	ENSP00000282030:T1423S	ENSP00000282030:T1423S	T	+	1	0	SETBP1	40897137	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	5.760000	0.68793	2.113000	0.64589	0.460000	0.39030	ACC	-	NULL		0.557	SETBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETBP1	protein_coding	OTTHUMT00000255854.4	A	NM_001130110		40897137	+1	no_errors	NM_015559	genbank	human	validated	54_36p	missense	SNP	1.000	T
FOXP4	116113	genome.wustl.edu	37	6	41533624	41533624	+	Silent	SNP	G	G	C	rs114654485		TCGA-29-1769-01A-01W-0639-09	TCGA-29-1769-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	6e3821b5-a446-4b2d-9ede-6be24af88e5e	093609c2-c2b8-41d0-85ac-c69048b9b06b	g.chr6:41533624G>C	ENST00000307972.4	+	1	138	c.126G>C	c.(124-126)acG>acC	p.T42T	FOXP4_ENST00000373057.3_Silent_p.T42T|FOXP4_ENST00000373063.3_Silent_p.T42T|FOXP4_ENST00000409208.1_Silent_p.T42T|FOXP4_ENST00000373060.1_Silent_p.T42T			Q8IVH2	FOXP4_HUMAN	forkhead box P4	42					embryonic foregut morphogenesis (GO:0048617)|heart development (GO:0007507)|lung secretory cell differentiation (GO:0061140)|negative regulation of lung goblet cell differentiation (GO:1901250)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)	16	Ovarian(28;0.0327)|Colorectal(47;0.196)					CAAGTGGCACGGGCAGGGAAG	0.632																																																0			6											79.0	77.0	78.0					6																	41533624		2203	4300	6503	41641602	SO:0001819	synonymous_variant	116113			AB080747	CCDS4856.1, CCDS34447.1, CCDS34448.1	6p21.1	2008-02-05			ENSG00000137166	ENSG00000137166		"""Forkhead boxes"""	20842	protein-coding gene	gene with protein product		608924					Standard	XM_006714991		Approved	FLJ40908	uc003oql.3	Q8IVH2	OTTHUMG00000014679	ENST00000307972.4:c.126G>C	6.37:g.41533624G>C			41641602	Q5W098|Q7Z7F8|Q8IW55|Q96E19	Silent	SNP	"PatternScan_ZINC_FINGER_C2H2_1,HMMSmart_SM00339,superfamily_""Winged helix"" DNA-binding domain,HMMPfam_Fork_head,PatternScan_FORK_HEAD_2"	p.T42	ENST00000307972.4	37	c.126	CCDS34447.1	6																																																																																			-	NULL		0.632	FOXP4-002	KNOWN	basic|CCDS	protein_coding	FOXP4	protein_coding	OTTHUMT00000106767.1	G	NM_138457		41641602	+1	no_errors	NM_001012426	genbank	human	reviewed	54_36p	silent	SNP	0.238	C
B4GALNT2	124872	genome.wustl.edu	37	17	47246998	47246998	+	Missense_Mutation	SNP	A	A	T			TCGA-29-1769-01A-01W-0639-09	TCGA-29-1769-10A-01W-0639-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	6e3821b5-a446-4b2d-9ede-6be24af88e5e	093609c2-c2b8-41d0-85ac-c69048b9b06b	g.chr17:47246998A>T	ENST00000300404.2	+	11	1668	c.1609A>T	c.(1609-1611)Acc>Tcc	p.T537S	B4GALNT2_ENST00000393354.2_Missense_Mutation_p.T477S|RP11-708H21.4_ENST00000575159.1_lincRNA|B4GALNT2_ENST00000504681.1_Missense_Mutation_p.T451S	NM_153446.2	NP_703147.2	Q8NHY0	B4GN2_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 2	537					lipid glycosylation (GO:0030259)|negative regulation of cell-cell adhesion (GO:0022408)|protein glycosylation (GO:0006486)|UDP-N-acetylgalactosamine metabolic process (GO:0019276)|UDP-N-acetylglucosamine metabolic process (GO:0006047)	integral component of Golgi membrane (GO:0030173)|integral component of membrane (GO:0016021)	acetylgalactosaminyltransferase activity (GO:0008376)			endometrium(3)|large_intestine(6)|liver(2)|lung(8)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	24			all cancers(6;0.000316)			CCTAGAGAAGACCTACAATAC	0.547																																					GBM(124;244 1635 8663 18097 33175)											0			17											96.0	85.0	89.0					17																	47246998		2203	4300	6503	44601997	SO:0001583	missense	124872			AJ517770	CCDS11544.1, CCDS54139.1, CCDS54140.1	17q21.33	2013-02-22	2006-01-08	2006-01-08	ENSG00000167080	ENSG00000167080	2.4.1.-	"""Beta 4-glycosyltransferases"", ""Glycosyltransferase family 2 domain containing"""	24136	protein-coding gene	gene with protein product		111730	"""UDP-GalNAc:Neu5Acalpha2-3Galbeta-R beta1,4-N-acetylgalactosaminyltransferase"""	GALGT2		8782649, 12678917	Standard	NM_153446		Approved	Sda, Cad	uc002ion.2	Q8NHY0	OTTHUMG00000161307	ENST00000300404.2:c.1609A>T	17.37:g.47246998A>T	ENSP00000300404:p.Thr537Ser		44601997	B4DZE4|Q14CP1|Q86Y40	Missense_Mutation	SNP	superfamily_Nucleotide-diphospho-sugar transferases,HMMPfam_Glycos_transf_2	p.T537S	ENST00000300404.2	37	c.1609	CCDS11544.1	17	.	.	.	.	.	.	.	.	.	.	A	13.70	2.314743	0.40996	.	.	ENSG00000167080	ENST00000504681;ENST00000393354;ENST00000300404	T;T;T	0.21543	2.0;2.0;2.0	5.79	2.25	0.28309	.	1.144480	0.06412	N	0.720864	T	0.18215	0.0437	L	0.40543	1.245	0.09310	N	0.999999	B;B	0.16396	0.01;0.017	B;B	0.14578	0.011;0.006	T	0.36237	-0.9756	10	0.16896	T	0.51	2.2198	9.5147	0.39098	0.7849:0.0:0.2151:0.0	.	477;537	Q8NHY0-2;Q8NHY0	.;B4GN2_HUMAN	S	451;477;537	ENSP00000425510:T451S;ENSP00000377022:T477S;ENSP00000300404:T537S	ENSP00000300404:T537S	T	+	1	0	B4GALNT2	44601997	0.001000	0.12720	0.265000	0.24526	0.106000	0.19336	0.317000	0.19487	0.434000	0.26340	0.459000	0.35465	ACC	-	NULL		0.547	B4GALNT2-001	KNOWN	basic|CCDS	protein_coding	B4GALNT2	protein_coding	OTTHUMT00000364477.1	A	NM_153446		44601997	+1	no_errors	NM_153446	genbank	human	provisional	54_36p	missense	SNP	0.492	T
OGDH	4967	genome.wustl.edu	37	7	44736597	44736597	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1769-01A-01W-0639-09	TCGA-29-1769-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	6e3821b5-a446-4b2d-9ede-6be24af88e5e	093609c2-c2b8-41d0-85ac-c69048b9b06b	g.chr7:44736597G>A	ENST00000222673.5	+	15	2027	c.1985G>A	c.(1984-1986)gGc>gAc	p.G662D	OGDH_ENST00000449767.1_Missense_Mutation_p.G658D|OGDH_ENST00000439616.2_Missense_Mutation_p.G512D|OGDH_ENST00000444676.1_Missense_Mutation_p.G677D|OGDH_ENST00000543843.1_Missense_Mutation_p.G613D|OGDH_ENST00000447398.1_Missense_Mutation_p.G673D	NM_002541.3	NP_002532.2	Q02218	ODO1_HUMAN	oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide)	662					2-oxoglutarate metabolic process (GO:0006103)|cellular metabolic process (GO:0044237)|cellular nitrogen compound metabolic process (GO:0034641)|cerebellar cortex development (GO:0021695)|generation of precursor metabolites and energy (GO:0006091)|glycolytic process (GO:0006096)|hippocampus development (GO:0021766)|lysine catabolic process (GO:0006554)|NADH metabolic process (GO:0006734)|olfactory bulb mitral cell layer development (GO:0061034)|pyramidal neuron development (GO:0021860)|small molecule metabolic process (GO:0044281)|striatum development (GO:0021756)|succinyl-CoA metabolic process (GO:0006104)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)|thalamus development (GO:0021794)|tricarboxylic acid cycle (GO:0006099)	mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrion (GO:0005739)|oxoglutarate dehydrogenase complex (GO:0045252)	metal ion binding (GO:0046872)|oxoglutarate dehydrogenase (NAD+) activity (GO:0034602)|oxoglutarate dehydrogenase (succinyl-transferring) activity (GO:0004591)|thiamine pyrophosphate binding (GO:0030976)			breast(2)|endometrium(5)|kidney(2)|large_intestine(6)|lung(13)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	36					Valproic Acid(DB00313)	ATGGCGTTTGGCTCGCTCCTG	0.582																																																0			7											112.0	84.0	94.0					7																	44736597		2203	4300	6503	44703122	SO:0001583	missense	4967			D10523	CCDS34627.1, CCDS47580.1, CCDS55107.1	7p13-p11.2	2010-11-23			ENSG00000105953	ENSG00000105953	1.2.4.2		8124	protein-coding gene	gene with protein product		613022				8020988, 1542694	Standard	NM_002541		Approved	E1k	uc003tln.3	Q02218	OTTHUMG00000155304	ENST00000222673.5:c.1985G>A	7.37:g.44736597G>A	ENSP00000222673:p.Gly662Asp		44703122	B4E2U9|D3DVL0|E9PBM1|Q96DD3|Q9UDX0	Missense_Mutation	SNP	superfamily_SSF52518,HMMPfam_E1_dh,HMMPfam_Transket_pyr	p.G662D	ENST00000222673.5	37	c.1985	CCDS34627.1	7	.	.	.	.	.	.	.	.	.	.	G	31	5.076102	0.94000	.	.	ENSG00000105953	ENST00000439616;ENST00000449767;ENST00000447398;ENST00000444676;ENST00000222673;ENST00000543843	D;D;D;D;D;D	0.91237	-2.81;-2.81;-2.81;-2.81;-2.81;-2.81	5.13	5.13	0.70059	Transketolase-like, pyrimidine-binding domain (2);	0.049346	0.85682	D	0.000000	D	0.97259	0.9104	H	0.97587	4.035	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.999;0.999	D;D;D;D;D;D	0.83275	0.99;0.993;0.993;0.996;0.993;0.993	D	0.98525	1.0625	10	0.87932	D	0	-29.1455	18.3765	0.90437	0.0:0.0:1.0:0.0	.	457;512;658;673;564;662	B4E3E9;E9PFG7;E9PBM1;E9PDF2;A2VCT2;Q02218	.;.;.;.;.;ODO1_HUMAN	D	512;658;673;677;662;613	ENSP00000398576:G512D;ENSP00000392878:G658D;ENSP00000388183:G673D;ENSP00000414662:G677D;ENSP00000222673:G662D;ENSP00000443821:G613D	ENSP00000222673:G662D	G	+	2	0	OGDH	44703122	1.000000	0.71417	0.691000	0.30163	0.832000	0.47134	9.652000	0.98499	2.642000	0.89623	0.650000	0.86243	GGC	-	superfamily_SSF52518,HMMPfam_Transket_pyr		0.582	OGDH-001	KNOWN	basic|CCDS	protein_coding	OGDH	protein_coding	OTTHUMT00000339391.1	G			44703122	+1	no_errors	NM_002541	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
GPBP1L1	60313	genome.wustl.edu	37	1	46096212	46096212	+	Missense_Mutation	SNP	C	C	T			TCGA-29-1769-01A-01W-0639-09	TCGA-29-1769-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	6e3821b5-a446-4b2d-9ede-6be24af88e5e	093609c2-c2b8-41d0-85ac-c69048b9b06b	g.chr1:46096212C>T	ENST00000290795.3	-	10	2332	c.1111G>A	c.(1111-1113)Gcc>Acc	p.A371T	GPBP1L1_ENST00000479235.1_5'UTR|GPBP1L1_ENST00000355105.3_Missense_Mutation_p.A371T			Q9HC44	GPBL1_HUMAN	GC-rich promoter binding protein 1-like 1	371					positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)		GPBP1L1/MAST2_ENST00000361297(2)	breast(1)|endometrium(2)|large_intestine(4)|lung(10)|ovary(1)|skin(2)|stomach(1)	21	Acute lymphoblastic leukemia(166;0.155)					ACAGGGAGGGCAAGACCATTT	0.498																																																0			1											255.0	178.0	204.0					1																	46096212		2203	4300	6503	45868799	SO:0001583	missense	60313				CCDS528.1	1p34.1	2008-02-05			ENSG00000159592	ENSG00000159592			28843	protein-coding gene	gene with protein product						12477932	Standard	NM_021639		Approved	SP192	uc001coq.3	Q9HC44	OTTHUMG00000040990	ENST00000290795.3:c.1111G>A	1.37:g.46096212C>T	ENSP00000290795:p.Ala371Thr		45868799	D3DQ10|Q9H751	Missense_Mutation	SNP	NULL	p.A371T	ENST00000290795.3	37	c.1111	CCDS528.1	1	.	.	.	.	.	.	.	.	.	.	c	10.03	1.239488	0.22711	.	.	ENSG00000159592	ENST00000290795;ENST00000355105	T;T	0.22539	1.95;1.95	6.17	-4.56	0.03431	.	0.386952	0.31859	N	0.006956	T	0.04182	0.0116	N	0.02011	-0.69	0.18873	N	0.999988	B	0.02656	0.0	B	0.04013	0.001	T	0.31447	-0.9943	10	0.13853	T	0.58	-0.0752	1.6408	0.02752	0.4996:0.1186:0.153:0.2288	.	371	Q9HC44	GPBL1_HUMAN	T	371	ENSP00000290795:A371T;ENSP00000347224:A371T	ENSP00000290795:A371T	A	-	1	0	GPBP1L1	45868799	0.515000	0.26210	0.848000	0.33437	0.474000	0.32979	-0.272000	0.08560	-0.385000	0.07833	-0.701000	0.03672	GCC	-	NULL		0.498	GPBP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPBP1L1	protein_coding	OTTHUMT00000098375.1	C	NM_021639		45868799	-1	no_errors	NM_021639	genbank	human	validated	54_36p	missense	SNP	0.969	T
PIGF	5281	genome.wustl.edu	37	2	46839390	46839390	+	Nonsense_Mutation	SNP	C	C	T			TCGA-29-1769-01A-01W-0639-09	TCGA-29-1769-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	6e3821b5-a446-4b2d-9ede-6be24af88e5e	093609c2-c2b8-41d0-85ac-c69048b9b06b	g.chr2:46839390C>T	ENST00000281382.6	-	4	584	c.414G>A	c.(412-414)tgG>tgA	p.W138*	PIGF_ENST00000306465.4_Nonsense_Mutation_p.W138*|PIGF_ENST00000495933.1_5'UTR	NM_002643.3	NP_002634.1	Q07326	PIGF_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class F	138					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|GPI anchor biosynthetic process (GO:0006506)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	ethanolaminephosphotransferase activity (GO:0004307)			breast(1)|endometrium(1)|lung(1)|stomach(1)	4		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	LUSC - Lung squamous cell carcinoma(58;0.114)			ACACTCTTAGCCATGCTTTGA	0.284																																																0			2											24.0	20.0	22.0					2																	46839390		2156	4232	6388	46692894	SO:0001587	stop_gained	5281				CCDS1827.1, CCDS1828.1	2p21-p16	2013-02-26	2006-06-28		ENSG00000151665	ENSG00000151665		"""Phosphatidylinositol glycan anchor biosynthesis"""	8962	protein-coding gene	gene with protein product		600153	"""phosphatidylinositol glycan, class F"""			8575782, 8463218	Standard	NM_173074		Approved		uc002rvd.3	Q07326	OTTHUMG00000128816	ENST00000281382.6:c.414G>A	2.37:g.46839390C>T	ENSP00000281382:p.Trp138*		46692894	Q8WW20	Nonsense_Mutation	SNP	HMMPfam_PIG-F	p.W138*	ENST00000281382.6	37	c.414	CCDS1827.1	2	.	.	.	.	.	.	.	.	.	.	C	37	6.129205	0.97310	.	.	ENSG00000151665	ENST00000281382;ENST00000306465	.	.	.	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-4.8112	19.9893	0.97361	0.0:1.0:0.0:0.0	.	.	.	.	X	138	.	ENSP00000281382:W138X	W	-	3	0	PIGF	46692894	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	6.336000	0.72954	2.826000	0.97356	0.563000	0.77884	TGG	-	HMMPfam_PIG-F		0.284	PIGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIGF	protein_coding	OTTHUMT00000250749.2	C	NM_173074		46692894	-1	no_errors	NM_002643	genbank	human	reviewed	54_36p	nonsense	SNP	1.000	T
SCN8A	6334	genome.wustl.edu	37	12	52093464	52093464	+	Missense_Mutation	SNP	T	T	C			TCGA-29-1769-01A-01W-0639-09	TCGA-29-1769-10A-01W-0639-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	6e3821b5-a446-4b2d-9ede-6be24af88e5e	093609c2-c2b8-41d0-85ac-c69048b9b06b	g.chr12:52093464T>C	ENST00000354534.6	+	7	995	c.817T>C	c.(817-819)Ttc>Ctc	p.F273L	SCN8A_ENST00000550891.1_Missense_Mutation_p.F273L|SCN8A_ENST00000545061.1_Missense_Mutation_p.F273L	NM_001177984.2|NM_014191.3	NP_001171455.1|NP_055006.1	Q9UQD0	SCN8A_HUMAN	sodium channel, voltage gated, type VIII, alpha subunit	273				F -> I (in Ref. 3; ACM63162). {ECO:0000305}.	adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|membrane depolarization during action potential (GO:0086010)|muscle organ development (GO:0007517)|myelination (GO:0042552)|nervous system development (GO:0007399)|neuromuscular process (GO:0050905)|neuronal action potential (GO:0019228)|peripheral nervous system development (GO:0007422)|response to toxic substance (GO:0009636)|sensory perception of sound (GO:0007605)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	ATP binding (GO:0005524)|voltage-gated sodium channel activity (GO:0005248)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(19)|ovary(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55				BRCA - Breast invasive adenocarcinoma(357;0.181)	Valproic Acid(DB00313)	ACTGCAGCTGTTCATGGGGAA	0.453																																																0			12											110.0	106.0	107.0					12																	52093464		2086	4254	6340	50379731	SO:0001583	missense	6334			AB027567	CCDS44891.1, CCDS53794.1	12q13.1	2012-02-26	2007-01-23			ENSG00000196876		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10596	protein-coding gene	gene with protein product		600702	"""sodium channel, voltage gated, type VIII, alpha polypeptide"""	MED		7670495, 9828131, 16382098	Standard	NM_014191		Approved	Nav1.6, NaCh6, PN4, CerIII	uc001ryw.4	Q9UQD0		ENST00000354534.6:c.817T>C	12.37:g.52093464T>C	ENSP00000346534:p.Phe273Leu		50379731	B9VWG8|O95788|Q9NYX2|Q9UPB2	Missense_Mutation	SNP	superfamily_Voltage-gated potassium channels,HMMPfam_Ion_trans,HMMPfam_Na_trans_assoc,PatternScan_ODR_DC_2_1,HMMSmart_SM00015,HMMPfam_IQ	p.F273L	ENST00000354534.6	37	c.817	CCDS44891.1	12	.	.	.	.	.	.	.	.	.	.	T	32	5.168438	0.94768	.	.	ENSG00000196876	ENST00000550891;ENST00000354534;ENST00000545061;ENST00000355133;ENST00000357961;ENST00000551216	D;D;D;D;D	0.99089	-5.41;-5.41;-5.41;-5.41;-5.41	4.47	4.47	0.54385	Ion transport (1);	0.112355	0.64402	D	0.000009	D	0.99510	0.9825	H	0.97587	4.035	0.80722	D	1	P;D;D;P	0.58268	0.954;0.982;0.971;0.826	D;D;P;P	0.66979	0.943;0.948;0.776;0.473	D	0.97971	1.0343	10	0.87932	D	0	.	14.2323	0.65901	0.0:0.0:0.0:1.0	.	273;273;273;273	F8VWM7;Q9UQD0-3;F8VRN5;Q9UQD0	.;.;.;SCN8A_HUMAN	L	273;273;273;273;186;71	ENSP00000448415:F273L;ENSP00000346534:F273L;ENSP00000440360:F273L;ENSP00000347255:F273L;ENSP00000447567:F71L	ENSP00000346534:F273L	F	+	1	0	SCN8A	50379731	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.868000	0.87116	2.017000	0.59298	0.533000	0.62120	TTC	-	superfamily_Voltage-gated potassium channels,HMMPfam_Ion_trans		0.453	SCN8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN8A	protein_coding	OTTHUMT00000404372.3	T	NM_014191		50379731	+1	no_errors	NM_014191	genbank	human	validated	54_36p	missense	SNP	1.000	C
Unknown	0	genome.wustl.edu	37	1	50791982	50791982	+	IGR	SNP	G	G	T			TCGA-29-1769-01A-01W-0639-09	TCGA-29-1769-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	6e3821b5-a446-4b2d-9ede-6be24af88e5e	093609c2-c2b8-41d0-85ac-c69048b9b06b	g.chr1:50791982G>T								RP11-567C20.3 (103183 upstream) : DMRTA2 (91239 downstream)																							GATAAGAAGTGGATGCCCGTC	0.602																																																0			1																																								50564569	SO:0001628	intergenic_variant	343184																															1.37:g.50791982G>T			50564569		RNA	SNP	-	NULL		37	NULL		1																																																																																			-	-	0	0.602					LOC343184			G			50564569	+1	pseudogene	XR_016832	genbank	human	model	54_36p	rna	SNP	1.000	T
FAM120C	54954	genome.wustl.edu	37	X	54161319	54161319	+	Missense_Mutation	SNP	C	C	G			TCGA-29-1769-01A-01W-0639-09	TCGA-29-1769-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	6e3821b5-a446-4b2d-9ede-6be24af88e5e	093609c2-c2b8-41d0-85ac-c69048b9b06b	g.chrX:54161319C>G	ENST00000375180.2	-	7	1617	c.1561G>C	c.(1561-1563)Gac>Cac	p.D521H	FAM120C_ENST00000328235.4_Missense_Mutation_p.D521H	NM_017848.4	NP_060318.3	Q9NX05	F120C_HUMAN	family with sequence similarity 120C	521							poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	28						TGGGAAGAGTCTGGTCCCAAA	0.493																																																0			X											75.0	59.0	65.0					X																	54161319		2203	4300	6503	54178044	SO:0001583	missense	54954			AY150025	CCDS14356.1, CCDS55421.1, CCDS75987.1	Xp11.22	2011-04-13	2006-07-04	2006-07-04	ENSG00000184083	ENSG00000184083			16949	protein-coding gene	gene with protein product		300741	"""chromosome X open reading frame 17"""	CXorf17		14585507	Standard	XM_006724589		Approved	ORF34, FLJ20506	uc004dsz.4	Q9NX05	OTTHUMG00000021625	ENST00000375180.2:c.1561G>C	X.37:g.54161319C>G	ENSP00000364324:p.Asp521His		54178044	B2RMT7	Missense_Mutation	SNP	NULL	p.D521H	ENST00000375180.2	37	c.1561	CCDS14356.1	X	.	.	.	.	.	.	.	.	.	.	C	14.39	2.521028	0.44866	.	.	ENSG00000184083	ENST00000375180;ENST00000328235	T;T	0.45276	0.9;0.9	5.2	4.34	0.51931	.	0.231431	0.46442	D	0.000293	T	0.33818	0.0876	N	0.03608	-0.345	0.80722	D	1	D;P	0.60575	0.988;0.896	P;P	0.57244	0.816;0.537	T	0.37337	-0.9710	10	0.41790	T	0.15	-12.7224	12.3543	0.55165	0.0:0.9127:0.0:0.0873	.	521;521	F8W881;Q9NX05	.;F120C_HUMAN	H	521	ENSP00000364324:D521H;ENSP00000329896:D521H	ENSP00000329896:D521H	D	-	1	0	FAM120C	54178044	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	1.431000	0.34925	1.269000	0.44280	0.600000	0.82982	GAC	-	NULL		0.493	FAM120C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM120C	protein_coding	OTTHUMT00000056795.2	C	NM_017848		54178044	-1	no_errors	NM_017848	genbank	human	validated	54_36p	missense	SNP	0.999	G
CD37	951	genome.wustl.edu	37	19	49839021	49839021	+	Missense_Mutation	SNP	G	G	C			TCGA-29-1769-01A-01W-0639-09	TCGA-29-1769-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	6e3821b5-a446-4b2d-9ede-6be24af88e5e	093609c2-c2b8-41d0-85ac-c69048b9b06b	g.chr19:49839021G>C	ENST00000323906.4	+	2	261	c.120G>C	c.(118-120)aaG>aaC	p.K40N	CD37_ENST00000596426.1_3'UTR|CD37_ENST00000426897.2_5'UTR|CD37_ENST00000598095.1_5'UTR|CD37_ENST00000535669.2_Missense_Mutation_p.K40N|CTC-301O7.4_ENST00000358234.4_lincRNA	NM_001774.2	NP_001765.1	P11049	CD37_HUMAN	CD37 molecule	40					defense response to protozoan (GO:0042832)|negative regulation of cell proliferation (GO:0008285)|negative regulation of myeloid dendritic cell activation (GO:0030886)|positive regulation of immunoglobulin production (GO:0002639)|regulation of defense response to virus (GO:0050688)|regulation of humoral immune response (GO:0002920)	extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(1)|endometrium(1)|large_intestine(3)|lung(5)|upper_aerodigestive_tract(1)	11		all_lung(116;2.81e-06)|Lung NSC(112;5.89e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00088)|GBM - Glioblastoma multiforme(486;0.0443)		TCATTGACAAGACCAGCTTCG	0.627																																																0			19											181.0	183.0	182.0					19																	49839021		2203	4300	6503	54530833	SO:0001583	missense	951				CCDS12760.1, CCDS46139.1	19p13-q13.4	2013-02-14	2006-03-28			ENSG00000104894		"""CD molecules"", ""Tetraspanins"""	1666	protein-coding gene	gene with protein product		151523	"""CD37 antigen"""			8436422	Standard	XM_005259435		Approved	TSPAN26	uc002pnd.3	P11049		ENST00000323906.4:c.120G>C	19.37:g.49839021G>C	ENSP00000325708:p.Lys40Asn		54530833	B4DVC1|Q3KPF9	Missense_Mutation	SNP	HMMPfam_Tetraspannin,PatternScan_TM4_1,superfamily_Tetraspanin	p.K40N	ENST00000323906.4	37	c.120	CCDS12760.1	19	.	.	.	.	.	.	.	.	.	.	G	17.26	3.345311	0.61073	.	.	ENSG00000104894	ENST00000391859;ENST00000323906;ENST00000535669	T;T;T	0.25250	2.24;1.82;1.81	4.71	3.67	0.42095	.	0.102103	0.41823	D	0.000804	T	0.37571	0.1008	L	0.45228	1.405	0.80722	D	1	D;D	0.67145	0.996;0.996	D;D	0.67382	0.951;0.951	T	0.10613	-1.0622	10	0.59425	D	0.04	.	9.1967	0.37233	0.1025:0.0:0.8975:0.0	.	40;40	B7ZAN3;P11049	.;CD37_HUMAN	N	40	ENSP00000375732:K40N;ENSP00000325708:K40N;ENSP00000441037:K40N	ENSP00000325708:K40N	K	+	3	2	CD37	54530833	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	1.861000	0.39438	1.129000	0.42072	0.561000	0.74099	AAG	-	HMMPfam_Tetraspannin		0.627	CD37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD37	protein_coding	OTTHUMT00000465532.1	G			54530833	+1	no_errors	NM_001774	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
TCEA1	6917	genome.wustl.edu	37	8	54923033	54923033	+	Missense_Mutation	SNP	A	A	T			TCGA-29-1769-01A-01W-0639-09	TCGA-29-1769-10A-01W-0639-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	6e3821b5-a446-4b2d-9ede-6be24af88e5e	093609c2-c2b8-41d0-85ac-c69048b9b06b	g.chr8:54923033A>T	ENST00000521604.2	-	2	486	c.83T>A	c.(82-84)cTa>cAa	p.L28Q	TCEA1_ENST00000521086.2_5'UTR|TCEA1_ENST00000522635.1_Missense_Mutation_p.L28Q|TCEA1_ENST00000518784.1_Missense_Mutation_p.L28Q|TCEA1_ENST00000520534.1_Missense_Mutation_p.L28Q|TCEA1_ENST00000396401.3_Intron	NM_006756.2	NP_006747.1	P23193	TCEA1_HUMAN	transcription elongation factor A (SII), 1	28	TFIIS N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00649}.				DNA repair (GO:0006281)|erythrocyte differentiation (GO:0030218)|gene expression (GO:0010467)|nucleotide-excision repair (GO:0006289)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|regulation of DNA-templated transcription, elongation (GO:0032784)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|large_intestine(1)|lung(1)|skin(1)	4		Lung NSC(129;0.109)|all_epithelial(80;0.11)|all_lung(136;0.181)	OV - Ovarian serous cystadenocarcinoma(7;9.1e-07)|Epithelial(17;9.44e-05)|all cancers(17;0.000699)			AAGCTCCTTTAGCAAATCCAA	0.343			T	PLAG1	salivary adenoma																																		Dom	yes		8	8q11.2	6917	"""transcription elongation factor A (SII), 1"""		E	0			8											35.0	32.0	33.0					8																	54923033		1796	4064	5860	55085586	SO:0001583	missense	6917			X62585	CCDS47857.1, CCDS47858.1	8q11.2	2011-01-25			ENSG00000187735	ENSG00000187735		"""General transcription factors"""	11612	protein-coding gene	gene with protein product		601425		TCEA, GTF2S		8812434, 8112616	Standard	NM_006756		Approved	SII, TF2S, TFIIS	uc003xru.3	P23193	OTTHUMG00000164262	ENST00000521604.2:c.83T>A	8.37:g.54923033A>T	ENSP00000428426:p.Leu28Gln		55085586	A6NF25|A8K339|Q15563|Q6FG87	Missense_Mutation	SNP	superfamily_Conserved domain common to transcription factors TFIIS elongin A CRSP70,HMMPfam_TFIIS,HMMSmart_SM00509,superfamily_Elongation factor TFIIS domain 2,HMMPfam_TFIIS_M,HMMSmart_SM00510,superfamily_Zinc beta-ribbon,HMMPfam_TFIIS_C,HMMSmart_SM00440,PatternScan_ZF_TFIIS_1	p.L28Q	ENST00000521604.2	37	c.83	CCDS47858.1	8	.	.	.	.	.	.	.	.	.	.	A	14.79	2.641270	0.47153	.	.	ENSG00000187735	ENST00000521604;ENST00000522635;ENST00000520534;ENST00000518784;ENST00000519704	.	.	.	5.42	5.42	0.78866	Transcription factor IIS, N-terminal (4);Transcription elongation factor, TFIIS/CRSP70, N-terminal, sub-type (1);	0.088865	0.47093	U	0.000249	D	0.87645	0.6229	H	0.97635	4.045	0.58432	D	0.999995	P;D	0.89917	0.943;1.0	D;D	0.91635	0.944;0.999	D	0.91434	0.5168	9	0.87932	D	0	-1.142	12.9809	0.58564	1.0:0.0:0.0:0.0	.	28;28	B7Z4S1;P23193	.;TCEA1_HUMAN	Q	28	.	ENSP00000428868:L28Q	L	-	2	0	TCEA1	55085586	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.268000	0.72552	2.063000	0.61619	0.459000	0.35465	CTA	-	superfamily_Conserved domain common to transcription factors TFIIS elongin A CRSP70,HMMPfam_TFIIS,HMMSmart_SM00509		0.343	TCEA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TCEA1	protein_coding	OTTHUMT00000377975.2	A	NM_006756		55085586	-1	no_errors	NM_006756	genbank	human	validated	54_36p	missense	SNP	1.000	T
OR4C16	219428	genome.wustl.edu	37	11	55339962	55339962	+	Missense_Mutation	SNP	G	G	A	rs141382229	byFrequency	TCGA-29-1769-01A-01W-0639-09	TCGA-29-1769-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	6e3821b5-a446-4b2d-9ede-6be24af88e5e	093609c2-c2b8-41d0-85ac-c69048b9b06b	g.chr11:55339962G>A	ENST00000314634.3	+	1	359	c.359G>A	c.(358-360)cGc>cAc	p.R120H		NM_001004701.2	NP_001004701.2	Q8NGL9	OR4CG_HUMAN	olfactory receptor, family 4, subfamily C, member 16 (gene/pseudogene)	120						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(1)|lung(28)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	41		all_epithelial(135;0.0748)				GCTGTTGACCGCTATGTGGAC	0.512													g|||	3	0.000599042	0.0008	0.0014	5008	,	,		19430	0.0		0.0	False		,,,				2504	0.001															0			11						G	HIS/ARG	4,4398	8.1+/-20.4	0,4,2197	190.0	181.0	184.0		359	4.1	1.0	11	dbSNP_134	184	5,8587	4.3+/-15.6	0,5,4291	yes	missense	OR4C16	NM_001004701.2	29	0,9,6488	AA,AG,GG		0.0582,0.0909,0.0693	possibly-damaging	120/311	55339962	9,12985	2201	4296	6497	55096538	SO:0001583	missense	219428			AB065773	CCDS31502.1	11q11	2013-10-10	2013-10-10		ENSG00000181935	ENSG00000181935		"""GPCR / Class A : Olfactory receptors"""	15172	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily C, member 16"""				Standard	NM_001004701		Approved		uc010rih.2	Q8NGL9	OTTHUMG00000165198	ENST00000314634.3:c.359G>A	11.37:g.55339962G>A	ENSP00000324913:p.Arg120His		55096538	Q6IEV8	Missense_Mutation	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.R120H	ENST00000314634.3	37	c.359	CCDS31502.1	11	.	.	.	.	.	.	.	.	.	.	G	16.89	3.247781	0.59103	9.09E-4	5.82E-4	ENSG00000181935	ENST00000314634	T	0.77489	-1.1	4.98	4.07	0.47477	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000004	T	0.79936	0.4532	M	0.88906	2.99	0.33543	D	0.595121	B	0.19445	0.036	B	0.18561	0.022	T	0.83330	-0.0013	10	0.59425	D	0.04	.	11.2843	0.49214	0.0892:0.0:0.9108:0.0	.	120	Q8NGL9	OR4CG_HUMAN	H	120	ENSP00000324913:R120H	ENSP00000324913:R120H	R	+	2	0	OR4C16	55096538	0.994000	0.37717	1.000000	0.80357	0.958000	0.62258	3.443000	0.52907	1.331000	0.45412	0.549000	0.68633	CGC	-	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1		0.512	OR4C16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4C16	protein_coding	OTTHUMT00000382627.1	G	NM_001004701		55096538	+1	no_errors	NM_001004701	genbank	human	validated	54_36p	missense	SNP	1.000	A
ZNF473	25888	genome.wustl.edu	37	19	50548163	50548163	+	Missense_Mutation	SNP	G	G	C			TCGA-29-1769-01A-01W-0639-09	TCGA-29-1769-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	6e3821b5-a446-4b2d-9ede-6be24af88e5e	093609c2-c2b8-41d0-85ac-c69048b9b06b	g.chr19:50548163G>C	ENST00000595661.1	+	6	958	c.463G>C	c.(463-465)Gga>Cga	p.G155R	ZNF473_ENST00000391821.2_Missense_Mutation_p.G155R|CTD-2126E3.3_ENST00000599410.1_RNA|CTD-2126E3.3_ENST00000599914.1_RNA|ZNF473_ENST00000601364.1_Intron|ZNF473_ENST00000270617.3_Missense_Mutation_p.G155R|ZNF473_ENST00000445728.3_Missense_Mutation_p.G143R			Q8WTR7	ZN473_HUMAN	zinc finger protein 473	155					gene expression (GO:0010467)|histone mRNA 3'-end processing (GO:0006398)|histone mRNA metabolic process (GO:0008334)|mRNA 3'-end processing (GO:0031124)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	Cajal body (GO:0015030)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(9)|liver(2)|lung(12)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	37		all_neural(266;0.0459)|Ovarian(192;0.0728)		GBM - Glioblastoma multiforme(134;0.00111)|OV - Ovarian serous cystadenocarcinoma(262;0.0058)		ATTAAAGAGAGGACTCAGTCC	0.468																																																0			19											62.0	59.0	60.0					19																	50548163		2203	4300	6503	55239975	SO:0001583	missense	25888			AB032967	CCDS33077.1	19q13.33	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	23239	protein-coding gene	gene with protein product						11782445	Standard	NM_015428		Approved	KIAA1141, DKFZP434N043, HZFP100	uc002prn.3	Q8WTR7		ENST00000595661.1:c.463G>C	19.37:g.50548163G>C	ENSP00000472808:p.Gly155Arg		55239975	A8K8T7|Q9ULS9|Q9Y4Q7	Missense_Mutation	SNP	superfamily_KRAB domain (Kruppel-associated box Pfam 01352),HMMPfam_KRAB,HMMSmart_SM00349,superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1	p.G155R	ENST00000595661.1	37	c.463	CCDS33077.1	19	.	.	.	.	.	.	.	.	.	.	G	11.75	1.733103	0.30684	.	.	ENSG00000142528	ENST00000270617;ENST00000391821;ENST00000445728	T;T;T	0.10573	3.16;3.16;2.86	4.36	2.17	0.27698	.	1.138800	0.06669	N	0.765908	T	0.11793	0.0287	N	0.24115	0.695	0.09310	N	1	D	0.54047	0.964	P	0.53450	0.726	T	0.28933	-1.0028	10	0.22109	T	0.4	-3.2272	4.3067	0.10951	0.2012:0.1916:0.6071:0.0	.	155	Q8WTR7	ZN473_HUMAN	R	155;155;143	ENSP00000270617:G155R;ENSP00000375697:G155R;ENSP00000388961:G143R	ENSP00000270617:G155R	G	+	1	0	ZNF473	55239975	0.000000	0.05858	0.002000	0.10522	0.256000	0.26092	-0.138000	0.10374	0.745000	0.32763	0.655000	0.94253	GGA	-	NULL		0.468	ZNF473-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF473	protein_coding	OTTHUMT00000464833.1	G	XM_046390		55239975	+1	no_errors	NM_001006656	genbank	human	validated	54_36p	missense	SNP	0.001	C
MYBPC2	4606	genome.wustl.edu	37	19	50939881	50939881	+	Missense_Mutation	SNP	C	C	A			TCGA-29-1769-01A-01W-0639-09	TCGA-29-1769-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	6e3821b5-a446-4b2d-9ede-6be24af88e5e	093609c2-c2b8-41d0-85ac-c69048b9b06b	g.chr19:50939881C>A	ENST00000357701.5	+	5	404	c.353C>A	c.(352-354)aCc>aAc	p.T118N		NM_004533.3	NP_004524.3	Q14324	MYPC2_HUMAN	myosin binding protein C, fast type	118	Ig-like C2-type 1.				cell adhesion (GO:0007155)|muscle filament sliding (GO:0030049)	cytosol (GO:0005829)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)			breast(1)	1		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.0079)|GBM - Glioblastoma multiforme(134;0.0144)		CAGGTGTACACCGTGGAGCTG	0.597																																																0			19											76.0	75.0	75.0					19																	50939881		1995	4155	6150	55631693	SO:0001583	missense	4606				CCDS46152.1	19q13.33	2013-02-11	2001-11-28		ENSG00000086967	ENSG00000086967		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7550	protein-coding gene	gene with protein product	"""fast-type muscle myosin-binding-protein C"""	160793	"""myosin-binding protein C, fast-type"""			8375400	Standard	NM_004533		Approved	MYBPCF, MYBPC, MGC163408	uc002psf.2	Q14324		ENST00000357701.5:c.353C>A	19.37:g.50939881C>A	ENSP00000350332:p.Thr118Asn		55631693	A1L4G9	Missense_Mutation	SNP	superfamily_SSF48726,HMMSmart_IG,HMMPfam_I-set,superfamily_FN_III-like,HMMSmart_FN3,HMMPfam_fn3,HMMSmart_IGc2	p.T118N	ENST00000357701.5	37	c.353	CCDS46152.1	19	.	.	.	.	.	.	.	.	.	.	.	12.84	2.060010	0.36373	.	.	ENSG00000086967	ENST00000357701	T	0.67345	-0.26	3.77	1.58	0.23477	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	0.222778	0.19718	U	0.107644	T	0.58047	0.2095	L	0.52823	1.66	0.32909	D	0.514205	B	0.17465	0.022	B	0.31245	0.126	T	0.58216	-0.7675	10	0.30854	T	0.27	.	5.7532	0.18158	0.3419:0.5579:0.0:0.1002	.	118	Q14324	MYPC2_HUMAN	N	118	ENSP00000350332:T118N	ENSP00000350332:T118N	T	+	2	0	MYBPC2	55631693	0.460000	0.25776	0.975000	0.42487	0.880000	0.50808	0.993000	0.29680	0.922000	0.37019	0.450000	0.29827	ACC	-	superfamily_SSF48726,HMMSmart_IG		0.597	MYBPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYBPC2	protein_coding	OTTHUMT00000464751.1	C	NM_004533		55631693	+1	no_errors	NM_004533	genbank	human	validated	54_36p	missense	SNP	0.999	A
ERC2	26059	genome.wustl.edu	37	3	55733437	55733437	+	Missense_Mutation	SNP	T	T	G			TCGA-29-1769-01A-01W-0639-09	TCGA-29-1769-10A-01W-0639-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	6e3821b5-a446-4b2d-9ede-6be24af88e5e	093609c2-c2b8-41d0-85ac-c69048b9b06b	g.chr3:55733437T>G	ENST00000288221.6	-	16	3071	c.2816A>C	c.(2815-2817)cAa>cCa	p.Q939P		NM_015576.1	NP_056391.1	O15083	ERC2_HUMAN	ELKS/RAB6-interacting/CAST family member 2	939						cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|growth cone (GO:0030426)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)				breast(2)|endometrium(5)|large_intestine(6)|liver(1)|lung(14)|ovary(2)|urinary_tract(1)	31				KIRC - Kidney renal clear cell carcinoma(284;0.0667)|Kidney(284;0.0873)|OV - Ovarian serous cystadenocarcinoma(275;0.219)		ATTGGAATGTTGCGACCTCCC	0.458																																																0			3											227.0	237.0	234.0					3																	55733437		2050	4196	6246	55708477	SO:0001583	missense	26059			AB002376	CCDS46851.1	3p14.3	2006-08-14			ENSG00000187672	ENSG00000187672			31922	protein-coding gene	gene with protein product							Standard	NM_015576		Approved	CAST, CAST1, KIAA0378, SPBC110, Spc110, ELKSL	uc003dhr.1	O15083	OTTHUMG00000158390	ENST00000288221.6:c.2816A>C	3.37:g.55733437T>G	ENSP00000288221:p.Gln939Pro		55708477	Q2T9F6|Q86TK4	Missense_Mutation	SNP	HMMPfam_Cast,superfamily_Prefoldin	p.Q939P	ENST00000288221.6	37	c.2816	CCDS46851.1	3	.	.	.	.	.	.	.	.	.	.	T	12.31	1.899776	0.33535	.	.	ENSG00000187672	ENST00000288221	T	0.31510	1.49	5.66	5.66	0.87406	.	0.059343	0.64402	D	0.000002	T	0.18257	0.0438	N	0.08118	0	0.40294	D	0.978532	B	0.02656	0.0	B	0.01281	0.0	T	0.08289	-1.0729	10	0.25106	T	0.35	-21.6725	16.2026	0.82095	0.0:0.0:0.0:1.0	.	939	O15083	ERC2_HUMAN	P	939	ENSP00000288221:Q939P	ENSP00000288221:Q939P	Q	-	2	0	ERC2	55708477	1.000000	0.71417	0.993000	0.49108	0.996000	0.88848	3.078000	0.50096	2.285000	0.76669	0.533000	0.62120	CAA	-	NULL		0.458	ERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERC2	protein_coding	OTTHUMT00000350884.2	T	NM_015576		55708477	-1	no_errors	NM_015576	genbank	human	validated	54_36p	missense	SNP	0.998	G
NLRP7	199713	genome.wustl.edu	37	19	55445073	55445073	+	Missense_Mutation	SNP	T	T	C			TCGA-29-1769-01A-01W-0639-09	TCGA-29-1769-10A-01W-0639-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	6e3821b5-a446-4b2d-9ede-6be24af88e5e	093609c2-c2b8-41d0-85ac-c69048b9b06b	g.chr19:55445073T>C	ENST00000590030.1	-	7	2546	c.2506A>G	c.(2506-2508)Aag>Gag	p.K836E	NLRP7_ENST00000588756.1_Missense_Mutation_p.K836E|NLRP7_ENST00000340844.2_Missense_Mutation_p.K836E|NLRP7_ENST00000448121.2_Missense_Mutation_p.K808E|NLRP7_ENST00000446217.1_Missense_Mutation_p.K864E|NLRP7_ENST00000592784.1_Missense_Mutation_p.K836E|NLRP7_ENST00000328092.5_Missense_Mutation_p.K808E			Q8WX94	NALP7_HUMAN	NLR family, pyrin domain containing 7	836							ATP binding (GO:0005524)			autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(17)|liver(1)|lung(33)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	73				GBM - Glioblastoma multiforme(193;0.0325)		GCAAGGTCCTTGCAACTGGCT	0.478																																																0			19											103.0	97.0	99.0					19																	55445073		2203	4300	6503	60136885	SO:0001583	missense	199713			AF464765	CCDS12912.1, CCDS33109.1, CCDS46183.1	19q13.42	2008-02-05	2006-12-08	2006-12-08		ENSG00000167634		"""Nucleotide-binding domain and leucine rich repeat containing"""	22947	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 7"""	609661	"""NACHT, leucine rich repeat and PYD containing 7"""	NALP7		12563287, 12019269	Standard	NM_139176		Approved	PYPAF3, NOD12, PAN7, CLR19.4	uc002qii.4	Q8WX94		ENST00000590030.1:c.2506A>G	19.37:g.55445073T>C	ENSP00000465520:p.Lys836Glu		60136885	E9PE16|Q32MH8|Q7RTR1	Missense_Mutation	SNP	superfamily_DEATH_like,HMMPfam_PAAD_DAPIN,superfamily_SSF52540,HMMPfam_NACHT,superfamily_SSF52047	p.K808E	ENST00000590030.1	37	c.2422	CCDS33109.1	19	.	.	.	.	.	.	.	.	.	.	T	1.352	-0.591133	0.03799	.	.	ENSG00000167634	ENST00000328092;ENST00000448121;ENST00000340844;ENST00000446217;ENST00000399724	T;T;T;T	0.65364	-0.15;0.64;0.64;2.3	2.25	0.0821	0.14427	.	.	.	.	.	T	0.54319	0.1851	N	0.17922	0.545	0.09310	N	1	P;P;P;D	0.62365	0.489;0.951;0.788;0.991	B;P;P;D	0.64237	0.334;0.808;0.722;0.923	T	0.46762	-0.9168	9	0.13470	T	0.59	.	4.5286	0.11994	0.0:0.3265:0.0:0.6735	.	864;836;836;808	E7EPM2;Q32MH9;Q8WX94;Q8WX94-2	.;.;NALP7_HUMAN;.	E	836;808;836;864;603	ENSP00000329568:K836E;ENSP00000409137:K808E;ENSP00000339491:K836E;ENSP00000414273:K864E	ENSP00000329568:K836E	K	-	1	0	NLRP7	60136885	0.000000	0.05858	0.051000	0.19133	0.056000	0.15407	-1.147000	0.03188	-0.048000	0.13401	0.454000	0.30748	AAG	-	superfamily_SSF52047		0.478	NLRP7-003	KNOWN	basic|CCDS	protein_coding	NLRP7	protein_coding	OTTHUMT00000451396.1	T	NM_139176		60136885	-1	no_errors	NM_139176	genbank	human	reviewed	54_36p	missense	SNP	0.003	C
HSF4	3299	genome.wustl.edu	37	16	67201032	67201032	+	Missense_Mutation	SNP	G	G	T	rs199742128	byFrequency	TCGA-29-1769-01A-01W-0639-09	TCGA-29-1769-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	6e3821b5-a446-4b2d-9ede-6be24af88e5e	093609c2-c2b8-41d0-85ac-c69048b9b06b	g.chr16:67201032G>T	ENST00000521374.1	+	7	636	c.636G>T	c.(634-636)atG>atT	p.M212I	HSF4_ENST00000584272.1_Missense_Mutation_p.M212I|HSF4_ENST00000421453.1_Missense_Mutation_p.M212I|HSF4_ENST00000517867.1_3'UTR|HSF4_ENST00000264009.8_Missense_Mutation_p.M212I			Q9ULV5	HSF4_HUMAN	heat shock transcription factor 4	212					camera-type eye development (GO:0043010)|cell development (GO:0048468)|histone H3-K9 demethylation (GO:0033169)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homotrimerization (GO:0070207)|regulation of transcription, DNA-templated (GO:0006355)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	protein phosphatase binding (GO:0019903)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(3)|prostate(1)|skin(1)	12		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0143)|Epithelial(162;0.0335)|all cancers(182;0.184)		GGTCCCTGATGCTGGATGAGG	0.637																																																0			16						G	ILE/MET,ILE/MET	4,4178		0,4,2087	118.0	129.0	126.0		636,636	4.6	1.0	16		126	28,8420		1,26,4197	yes	missense,missense	HSF4	NM_001040667.2,NM_001538.3	10,10	1,30,6284	TT,TG,GG		0.3314,0.0956,0.2534	possibly-damaging,possibly-damaging	212/493,212/463	67201032	32,12598	2091	4224	6315	65758533	SO:0001583	missense	3299			D87673	CCDS42175.1, CCDS45510.1	16q21	2013-01-22			ENSG00000102878	ENSG00000102878			5227	protein-coding gene	gene with protein product		602438	"""cataract, Marner"""	CTM		8972228, 10488131, 12089525	Standard	NM_001538		Approved		uc002erl.2	Q9ULV5	OTTHUMG00000178325	ENST00000521374.1:c.636G>T	16.37:g.67201032G>T	ENSP00000430947:p.Met212Ile		65758533	Q99472|Q9ULV6	Missense_Mutation	SNP	"superfamily_""Winged helix"" DNA-binding domain,HMMSmart_SM00415,HMMPfam_HSF_DNA-bind,PatternScan_HSF_DOMAIN"	p.M212I	ENST00000521374.1	37	c.636	CCDS42175.1	16	.	.	.	.	.	.	.	.	.	.	G	14.80	2.642196	0.47153	9.56E-4	0.003314	ENSG00000102878	ENST00000421453;ENST00000264009;ENST00000517685;ENST00000521374;ENST00000517729	.	.	.	4.58	4.58	0.56647	.	0.042575	0.85682	D	0.000000	T	0.73984	0.3657	M	0.64567	1.98	0.49389	D	0.999789	P;P	0.50528	0.898;0.936	P;P	0.61201	0.626;0.885	T	0.76130	-0.3072	9	0.56958	D	0.05	-8.1501	14.9087	0.70740	0.0:0.0:1.0:0.0	.	212;212	Q9ULV5-2;Q9ULV5	.;HSF4_HUMAN	I	212;212;212;212;149	.	ENSP00000264009:M212I	M	+	3	0	HSF4	65758533	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.749000	0.62155	2.348000	0.79779	0.563000	0.77884	ATG	-	NULL		0.637	HSF4-006	KNOWN	basic|appris_principal|CCDS	protein_coding	HSF4	protein_coding	OTTHUMT00000375080.1	G	NM_001538		65758533	+1	no_errors	NM_001040667	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
LEPR	3953	genome.wustl.edu	37	1	66101914	66101914	+	Nonsense_Mutation	SNP	C	C	G			TCGA-29-1769-01A-01W-0639-09	TCGA-29-1769-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	6e3821b5-a446-4b2d-9ede-6be24af88e5e	093609c2-c2b8-41d0-85ac-c69048b9b06b	g.chr1:66101914C>G	ENST00000349533.6	+	20	2899	c.2714C>G	c.(2713-2715)tCa>tGa	p.S905*	LEPR_ENST00000406510.3_5'UTR	NM_002303.5	NP_002294.2	O15243	OBRG_HUMAN	leptin receptor	0					negative regulation of growth hormone receptor signaling pathway (GO:0060400)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of protein localization to cell surface (GO:2000009)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	receptor binding (GO:0005102)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(22)|skin(2)	36				OV - Ovarian serous cystadenocarcinoma(397;0.00722)|KIRC - Kidney renal clear cell carcinoma(1967;0.094)		CATACAGCATCAGTGACATGT	0.338																																																0			1											154.0	159.0	157.0					1																	66101914		2203	4300	6503	65874502	SO:0001587	stop_gained	3953			U43168	CCDS631.1, CCDS30740.1, CCDS30741.1, CCDS55604.1	1p31	2014-09-17			ENSG00000116678	ENSG00000116678		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6554	protein-coding gene	gene with protein product		601007				8548812, 8812446	Standard	NM_001003680		Approved	OBR, CD295	uc001dci.3	P48357	OTTHUMG00000009115	ENST00000349533.6:c.2714C>G	1.37:g.66101914C>G	ENSP00000330393:p.Ser905*		65874502	Q6FHL5	Nonsense_Mutation	SNP	superfamily_Fibronectin type III,HMMSmart_SM00060,HMMPfam_fn3,PatternScan_HEMATOPO_REC_S_F1,HMMPfam_Lep_receptor_Ig,PatternScan_HEMATOPO_REC_L_F2	p.S905*	ENST00000349533.6	37	c.2714	CCDS631.1	1	.	.	.	.	.	.	.	.	.	.	C	39	7.766022	0.98477	.	.	ENSG00000116678	ENST00000349533	.	.	.	5.79	5.79	0.91817	.	0.638552	0.15753	N	0.246323	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	-14.771	14.8226	0.70085	0.1439:0.8561:0.0:0.0	.	.	.	.	X	905	.	ENSP00000330393:S905X	S	+	2	0	LEPR	65874502	1.000000	0.71417	0.996000	0.52242	0.827000	0.46813	3.214000	0.51161	2.727000	0.93392	0.655000	0.94253	TCA	-	NULL		0.338	LEPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LEPR	protein_coding	OTTHUMT00000025275.1	C	NM_002303		65874502	+1	no_errors	NM_002303	genbank	human	validated	54_36p	nonsense	SNP	0.848	G
MYO5BP3	441442	genome.wustl.edu	37	9	68357833	68357833	+	IGR	SNP	C	C	T			TCGA-29-1769-01A-01W-0639-09	TCGA-29-1769-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	6e3821b5-a446-4b2d-9ede-6be24af88e5e	093609c2-c2b8-41d0-85ac-c69048b9b06b	g.chr9:68357833C>T								RP11-149F8.5 (17189 upstream) : RP11-764K9.1 (40044 downstream)																							GAAAGGCATTCATCTGGCAGA	0.502																																																0			9																																								67847653	SO:0001628	intergenic_variant	0																															9.37:g.68357833C>T			67847653		RNA	SNP	-	NULL		37	NULL		9																																																																																			-	-	0	0.502					LOC441442			C			67847653	-1	pseudogene	XR_037084	genbank	human	model	54_36p	rna	SNP	1.000	T
TPCN2	219931	genome.wustl.edu	37	11	68822261	68822261	+	Nonsense_Mutation	SNP	C	C	T			TCGA-29-1769-01A-01W-0639-09	TCGA-29-1769-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	6e3821b5-a446-4b2d-9ede-6be24af88e5e	093609c2-c2b8-41d0-85ac-c69048b9b06b	g.chr11:68822261C>T	ENST00000294309.3	+	3	348	c.247C>T	c.(247-249)Caa>Taa	p.Q83*	TPCN2_ENST00000542467.1_Nonsense_Mutation_p.Q83*	NM_139075.3	NP_620714.2	Q8NHX9	TPC2_HUMAN	two pore segment channel 2	83					calcium ion transport (GO:0006816)|cellular calcium ion homeostasis (GO:0006874)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|release of sequestered calcium ion into cytosol (GO:0051209)|smooth muscle contraction (GO:0006939)|transmembrane transport (GO:0055085)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|NAADP-sensitive calcium-release channel activity (GO:0072345)|protein kinase binding (GO:0019901)|voltage-gated calcium channel activity (GO:0005245)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(17)|prostate(2)|skin(1)|urinary_tract(1)	32			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			GAACGTATGCCAACGGTGAGA	0.597																																																0			11											114.0	77.0	89.0					11																	68822261		2200	4294	6494	68578837	SO:0001587	stop_gained	219931			AK023366	CCDS8189.1	11q13.1	2011-07-05			ENSG00000162341	ENSG00000162341		"""Voltage-gated ion channels / Two-pore channels"""	20820	protein-coding gene	gene with protein product		612163				16382101	Standard	NM_139075		Approved	TPC2	uc001oos.2	Q8NHX9	OTTHUMG00000167898	ENST00000294309.3:c.247C>T	11.37:g.68822261C>T	ENSP00000294309:p.Gln83*		68578837	Q9NT82	Nonsense_Mutation	SNP	superfamily_SSF81324,HMMPfam_Ion_trans	p.Q83*	ENST00000294309.3	37	c.247	CCDS8189.1	11	.	.	.	.	.	.	.	.	.	.	C	22.1	4.240729	0.79912	.	.	ENSG00000162341	ENST00000356782;ENST00000294309;ENST00000542467	.	.	.	4.65	4.65	0.58169	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.20046	T	0.44	-16.3536	17.4898	0.87700	0.0:1.0:0.0:0.0	.	.	.	.	X	13;83;83	.	ENSP00000294309:Q83X	Q	+	1	0	TPCN2	68578837	1.000000	0.71417	0.999000	0.59377	0.298000	0.27526	6.247000	0.72411	2.299000	0.77371	0.462000	0.41574	CAA	-	superfamily_SSF81324		0.597	TPCN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPCN2	protein_coding	OTTHUMT00000396878.2	C	NM_139075		68578837	+1	no_errors	NM_139075	genbank	human	validated	54_36p	nonsense	SNP	1.000	T
STOX1	219736	genome.wustl.edu	37	10	70645163	70645163	+	Missense_Mutation	SNP	G	G	T			TCGA-29-1769-01A-01W-0639-09	TCGA-29-1769-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	6e3821b5-a446-4b2d-9ede-6be24af88e5e	093609c2-c2b8-41d0-85ac-c69048b9b06b	g.chr10:70645163G>T	ENST00000298596.6	+	3	1694	c.1611G>T	c.(1609-1611)ttG>ttT	p.L537F	STOX1_ENST00000399162.2_Intron|STOX1_ENST00000399165.4_Intron|STOX1_ENST00000421961.2_Missense_Mutation_p.L427F|STOX1_ENST00000399169.4_Missense_Mutation_p.L537F	NM_152709.4	NP_689922.3	Q6ZVD7	STOX1_HUMAN	storkhead box 1	537						cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(5)|endometrium(2)|kidney(2)|large_intestine(5)|liver(2)|lung(8)|prostate(1)|skin(3)	28						CTAGGTCCTTGGATTCCTCAA	0.418																																																0			10											61.0	56.0	57.0					10																	70645163		1850	4090	5940	70315169	SO:0001583	missense	219736			AK057891	CCDS41535.1, CCDS44416.1, CCDS44417.1	10q22.1	2005-11-29	2005-04-04	2005-04-04	ENSG00000165730	ENSG00000165730			23508	protein-coding gene	gene with protein product		609397	"""chromosome 10 open reading frame 24"""	C10orf24			Standard	NM_152709		Approved	FLJ25162	uc001joq.3	Q6ZVD7	OTTHUMG00000018367	ENST00000298596.6:c.1611G>T	10.37:g.70645163G>T	ENSP00000298596:p.Leu537Phe		70315169	A2A3Q9|A5D6Y7|B0QZA4|B0QZA5|B0QZA6|Q4F8Q6|Q5I946|Q5I947|Q5I948|Q5VX38|Q5VX39|Q6ZRY3|Q96LR3|Q96LS0	Missense_Mutation	SNP	HMMPfam_Stork_head	p.L537F	ENST00000298596.6	37	c.1611	CCDS41535.1	10	.	.	.	.	.	.	.	.	.	.	G	11.03	1.518148	0.27211	.	.	ENSG00000165730	ENST00000399169;ENST00000298596;ENST00000421961	T;T;T	0.76709	-1.04;-1.04;-0.71	5.76	-2.06	0.07298	.	0.638908	0.14413	N	0.321176	T	0.71600	0.3359	L	0.59436	1.845	0.24630	N	0.993626	D	0.55605	0.972	P	0.51415	0.669	T	0.62243	-0.6895	10	0.19147	T	0.46	.	2.5689	0.04790	0.4031:0.108:0.3785:0.1105	.	537	Q6ZVD7	STOX1_HUMAN	F	537;537;427	ENSP00000382121:L537F;ENSP00000298596:L537F;ENSP00000394509:L427F	ENSP00000298596:L537F	L	+	3	2	STOX1	70315169	0.999000	0.42202	0.000000	0.03702	0.865000	0.49528	0.743000	0.26231	-0.747000	0.04759	0.591000	0.81541	TTG	-	NULL		0.418	STOX1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	STOX1	protein_coding	OTTHUMT00000276849.3	G	NM_152709		70315169	+1	no_errors	NM_152709	genbank	human	provisional	54_36p	missense	SNP	0.993	T
RPS3	6188	genome.wustl.edu	37	11	75111826	75111826	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1769-01A-01W-0639-09	TCGA-29-1769-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	6e3821b5-a446-4b2d-9ede-6be24af88e5e	093609c2-c2b8-41d0-85ac-c69048b9b06b	g.chr11:75111826G>A	ENST00000531188.1	+	2	181	c.119G>A	c.(118-120)cGa>cAa	p.R40Q	RPS3_ENST00000278572.6_Missense_Mutation_p.R40Q|SNORD15A_ENST00000384214.1_RNA|RPS3_ENST00000524851.1_Missense_Mutation_p.R40Q|RPS3_ENST00000530164.1_Missense_Mutation_p.R40Q|RPS3_ENST00000534440.1_Missense_Mutation_p.R40Q|RPS3_ENST00000526608.1_Missense_Mutation_p.R40Q|RPS3_ENST00000527446.1_Missense_Mutation_p.R40Q|RPS3_ENST00000529285.1_3'UTR	NM_001005.4|NM_001260506.1|NM_001260507.1	NP_000996.2|NP_001247435.1|NP_001247436.1	P23396	RS3_HUMAN	ribosomal protein S3	40	KH type-2. {ECO:0000255|PROSITE- ProRule:PRU00118}.				cellular protein metabolic process (GO:0044267)|cellular response to DNA damage stimulus (GO:0006974)|cytoplasmic translation (GO:0002181)|DNA catabolic process, endonucleolytic (GO:0000737)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|negative regulation of DNA repair (GO:0045738)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of DNA N-glycosylase activity (GO:1902546)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|ruffle membrane (GO:0032587)	damaged DNA binding (GO:0003684)|DNA-(apurinic or apyrimidinic site) lyase activity (GO:0003906)|enzyme binding (GO:0019899)|iron-sulfur cluster binding (GO:0051536)|mRNA binding (GO:0003729)|NF-kappaB binding (GO:0051059)|poly(A) RNA binding (GO:0044822)|protein kinase A binding (GO:0051018)|protein kinase binding (GO:0019901)|structural constituent of ribosome (GO:0003735)			endometrium(1)|kidney(1)|large_intestine(2)|lung(2)	6						GTTGAGGTGCGAGTTACACCA	0.418																																																0			11											102.0	96.0	98.0					11																	75111826		2200	4293	6493	74789474	SO:0001583	missense	6188				CCDS8236.1, CCDS58161.1	11q13.3-q13.5	2011-04-05				ENSG00000149273		"""S ribosomal proteins"""	10420	protein-coding gene	gene with protein product	"""IMR-90 ribosomal protein S3"", ""40S ribosomal protein S3"""	600454				1712897, 7789996	Standard	NM_001005		Approved	FLJ26283, FLJ27450, MGC87870, S3	uc031qcs.1	P23396		ENST00000531188.1:c.119G>A	11.37:g.75111826G>A	ENSP00000434643:p.Arg40Gln		74789474	B2R7N5|J3KN86|Q498B5|Q8NI95	Missense_Mutation	SNP	superfamily_Prokaryotic type KH domain (KH-domain type II),HMMPfam_KH_2,superfamily_Ribosomal protein S3 C-terminal domain,HMMPfam_Ribosomal_S3_C,PatternScan_RIBOSOMAL_S3	p.R40Q	ENST00000531188.1	37	c.119	CCDS8236.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.45|16.45	3.125576|3.125576	0.56721|0.56721	.|.	.|.	ENSG00000149273|ENSG00000149273	ENST00000525933|ENST00000531188;ENST00000530164;ENST00000530689;ENST00000278572;ENST00000534440;ENST00000527446;ENST00000526608;ENST00000527273;ENST00000524851	.|.	.|.	.|.	5.73|5.73	4.8|4.8	0.61643|0.61643	.|K homology domain-like, alpha/beta (1);K Homology, prokaryotic type (1);K Homology, type 2 (1);	.|0.174068	.|0.51477	.|N	.|0.000099	T|T	0.68787|0.68787	0.3039|0.3039	M|M	0.78285|0.78285	2.405|2.405	0.80722|0.80722	D|D	1|1	.|B	.|0.12630	.|0.006	.|B	.|0.21708	.|0.036	T|T	0.68500|0.68500	-0.5392|-0.5392	5|9	.|0.66056	.|D	.|0.02	-0.0253|-0.0253	13.7489|13.7489	0.62894|0.62894	0.0:0.0:0.8452:0.1548|0.0:0.0:0.8452:0.1548	.|.	.|40	.|P23396	.|RS3_HUMAN	K|Q	31|40	.|.	.|ENSP00000278572:R40Q	E|R	+|+	1|2	0|0	RPS3|RPS3	74789474|74789474	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.238000|0.238000	0.25445|0.25445	9.713000|9.713000	0.98740|0.98740	1.379000|1.379000	0.46325|0.46325	0.557000|0.557000	0.71058|0.71058	GAG|CGA	-	superfamily_Prokaryotic type KH domain (KH-domain type II)		0.418	RPS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPS3	protein_coding	OTTHUMT00000384158.2	G	NM_001005		74789474	+1	no_errors	NM_001005	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
ADAMTS18	170692	genome.wustl.edu	37	16	77465492	77465492	+	Silent	SNP	C	C	A			TCGA-29-1769-01A-01W-0639-09	TCGA-29-1769-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	6e3821b5-a446-4b2d-9ede-6be24af88e5e	093609c2-c2b8-41d0-85ac-c69048b9b06b	g.chr16:77465492C>A	ENST00000282849.5	-	3	613	c.195G>T	c.(193-195)acG>acT	p.T65T	ADAMTS18_ENST00000567121.1_5'UTR|RP11-449J10.1_ENST00000564358.1_RNA	NM_199355.2	NP_955387.1	Q8TE60	ATS18_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 18	65					eye development (GO:0001654)|negative regulation of platelet aggregation (GO:0090331)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(26)|lung(44)|ovary(2)|pancreas(1)|prostate(1)|skin(19)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	118						CTTCTACTGGCGTGACAAAGA	0.498																																																0			16											149.0	154.0	152.0					16																	77465492		2198	4300	6498	76022993	SO:0001819	synonymous_variant	170692			AJ311903	CCDS10926.1	16q23	2008-07-29	2005-08-19		ENSG00000140873	ENSG00000140873		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17110	protein-coding gene	gene with protein product		607512	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 18"""	ADAMTS21		11867212, 17546048	Standard	NM_199355		Approved		uc002ffc.4	Q8TE60	OTTHUMG00000137619	ENST00000282849.5:c.195G>T	16.37:g.77465492C>A			76022993	Q6P4R5|Q6ZWJ9	Silent	SNP	"HMMPfam_Pep_M12B_propep,superfamily_Metalloproteases (""zincins"") catalytic domain,HMMPfam_Reprolysin,superfamily_TSP-1 type 1 repeat,HMMSmart_SM00209,HMMPfam_TSP_1,HMMPfam_ADAM_spacer1,HMMPfam_PLAC"	p.T65	ENST00000282849.5	37	c.195	CCDS10926.1	16																																																																																			-	HMMPfam_Pep_M12B_propep		0.498	ADAMTS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS18	protein_coding	OTTHUMT00000269037.1	C			76022993	-1	no_errors	NM_199355	genbank	human	reviewed	54_36p	silent	SNP	0.995	A
KIF27	55582	genome.wustl.edu	37	9	86502046	86502046	+	Missense_Mutation	SNP	G	G	A	rs138059115	byFrequency	TCGA-29-1769-01A-01W-0639-09	TCGA-29-1769-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	6e3821b5-a446-4b2d-9ede-6be24af88e5e	093609c2-c2b8-41d0-85ac-c69048b9b06b	g.chr9:86502046G>A	ENST00000297814.2	-	9	2292	c.2149C>T	c.(2149-2151)Cgc>Tgc	p.R717C	KIF27_ENST00000334204.2_Missense_Mutation_p.R717C|KIF27_ENST00000413982.1_Missense_Mutation_p.R717C|KIF27_ENST00000376347.1_Missense_Mutation_p.R108C	NM_017576.1	NP_060046.1	Q86VH2	KIF27_HUMAN	kinesin family member 27	717					ATP catabolic process (GO:0006200)|cilium assembly (GO:0042384)|epithelial cilium movement (GO:0003351)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|smoothened signaling pathway (GO:0007224)|ventricular system development (GO:0021591)	cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(7)|lung(17)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	43						GTAAGTATGCGTTCTGAATTC	0.269													G|||	6	0.00119808	0.0023	0.0	5008	,	,		16847	0.0		0.003	False		,,,				2504	0.0															0			9						G	CYS/ARG	0,4404		0,0,2202	84.0	80.0	82.0		2149	2.4	1.0	9	dbSNP_134	82	3,8589	3.0+/-9.4	0,3,4293	no	missense	KIF27	NM_017576.1	180	0,3,6495	AA,AG,GG		0.0349,0.0,0.0231	benign	717/1402	86502046	3,12993	2202	4296	6498	85691866	SO:0001583	missense	55582			AY237536	CCDS6665.1, CCDS65071.1, CCDS65072.1	9q21.32	2008-03-03			ENSG00000165115	ENSG00000165115		"""Kinesins"""	18632	protein-coding gene	gene with protein product		611253					Standard	NM_017576		Approved	DKFZp434D0917	uc004ana.4	Q86VH2	OTTHUMG00000020109	ENST00000297814.2:c.2149C>T	9.37:g.86502046G>A	ENSP00000297814:p.Arg717Cys		85691866	B2RTR8|Q5T6W0|Q86VH0|Q86VH1|Q9UF54	Missense_Mutation	SNP	HMMSmart_SM00129,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMPfam_Kinesin,PatternScan_KINESIN_MOTOR_DOMAIN1	p.R717C	ENST00000297814.2	37	c.2149	CCDS6665.1	9	6	0.0027472527472527475	3	0.006097560975609756	0	0.0	0	0.0	3	0.00395778364116095	G	8.469	0.857057	0.17106	0.0	3.49E-4	ENSG00000165115	ENST00000297814;ENST00000413982;ENST00000334204;ENST00000376347	T;T;T;T	0.45668	0.89;0.89;0.89;0.89	4.27	2.36	0.29203	.	0.564317	0.14377	N	0.323407	T	0.16557	0.0398	N	0.14661	0.345	0.27360	N	0.955993	B;B;B	0.09022	0.002;0.002;0.0	B;B;B	0.06405	0.001;0.002;0.0	T	0.13845	-1.0494	10	0.54805	T	0.06	.	4.5892	0.12299	0.233:0.3377:0.4293:0.0	.	717;717;717	Q86VH2-3;Q86VH2-2;Q86VH2	.;.;KIF27_HUMAN	C	717;717;717;108	ENSP00000297814:R717C;ENSP00000401688:R717C;ENSP00000333928:R717C;ENSP00000365525:R108C	ENSP00000297814:R717C	R	-	1	0	KIF27	85691866	0.998000	0.40836	0.999000	0.59377	0.910000	0.53928	1.018000	0.30002	0.339000	0.23719	-0.680000	0.03767	CGC	-	NULL		0.269	KIF27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF27	protein_coding	OTTHUMT00000052861.1	G	NM_017576		85691866	-1	no_errors	NM_017576	genbank	human	provisional	54_36p	missense	SNP	0.432	A
CLCA4	22802	genome.wustl.edu	37	1	87045993	87045993	+	Missense_Mutation	SNP	G	G	C			TCGA-29-1769-01A-01W-0639-09	TCGA-29-1769-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	6e3821b5-a446-4b2d-9ede-6be24af88e5e	093609c2-c2b8-41d0-85ac-c69048b9b06b	g.chr1:87045993G>C	ENST00000370563.3	+	14	2767	c.2725G>C	c.(2725-2727)Gta>Cta	p.V909L	RP4-651E10.4_ENST00000456587.1_RNA	NM_012128.3	NP_036260.2	Q14CN2	CLCA4_HUMAN	chloride channel accessory 4	909					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	chloride channel activity (GO:0005254)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|liver(2)|lung(21)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	44		Lung NSC(277;0.238)		all cancers(265;0.0202)|Epithelial(280;0.0404)		TGGGTCTGTTGTAATTGTTAA	0.333																																																0			1											96.0	84.0	88.0					1																	87045993		1818	4064	5882	86818581	SO:0001583	missense	22802			AF127035	CCDS41355.1	1p31-p22	2012-02-26	2009-01-29		ENSG00000016602	ENSG00000016602			2018	protein-coding gene	gene with protein product			"""chloride channel, calcium activated, family member 4"", ""chloride channel regulator 4"""			10437792	Standard	NM_012128		Approved	CaCC2	uc009wcs.3	Q14CN2	OTTHUMG00000010260	ENST00000370563.3:c.2725G>C	1.37:g.87045993G>C	ENSP00000359594:p.Val909Leu		86818581	A8MQC9|B7Z1Q5|Q6UX81|Q9UNF7	Missense_Mutation	SNP	HMMPfam_CLCA_N,superfamily_SSF53300,HMMSmart_VWA,HMMPfam_VWA,HMMPfam_DUF1973	p.V909L	ENST00000370563.3	37	c.2725	CCDS41355.1	1	.	.	.	.	.	.	.	.	.	.	G	11.45	1.642031	0.29157	.	.	ENSG00000016602	ENST00000370563	T	0.03212	4.01	5.98	4.12	0.48240	.	0.335306	0.28031	N	0.016873	T	0.01254	0.0041	L	0.43923	1.385	0.09310	N	0.999991	B	0.30406	0.278	B	0.26517	0.07	T	0.45963	-0.9225	10	0.30078	T	0.28	-5.32	8.7894	0.34841	0.2459:0.0:0.754:0.0	.	909	Q14CN2	CLCA4_HUMAN	L	909	ENSP00000359594:V909L	ENSP00000359594:V909L	V	+	1	0	CLCA4	86818581	0.001000	0.12720	0.018000	0.16275	0.026000	0.11368	0.368000	0.20399	1.542000	0.49330	0.591000	0.81541	GTA	-	NULL		0.333	CLCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLCA4	protein_coding	OTTHUMT00000028292.1	G	NM_012128		86818581	+1	no_errors	NM_012128	genbank	human	reviewed	54_36p	missense	SNP	0.006	C
FAM35A	54537	genome.wustl.edu	37	10	88912061	88912061	+	Missense_Mutation	SNP	G	G	T			TCGA-29-1769-01A-01W-0639-09	TCGA-29-1769-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	6e3821b5-a446-4b2d-9ede-6be24af88e5e	093609c2-c2b8-41d0-85ac-c69048b9b06b	g.chr10:88912061G>T	ENST00000298784.1	+	3	1064	c.950G>T	c.(949-951)tGt>tTt	p.C317F	RN7SL733P_ENST00000582253.1_RNA|FAM35A_ENST00000298786.4_Missense_Mutation_p.C317F	NM_019054.2	NP_061927.2	Q86V20	FA35A_HUMAN	family with sequence similarity 35, member A	317										endometrium(2)|kidney(2)|large_intestine(5)|lung(1)|ovary(2)|prostate(2)|skin(2)	16						AGTCCTGTTTGTCCTAAAACA	0.368																																					Ovarian(175;703 2004 25460 32514 43441)											0			10											4.0	5.0	4.0					10																	88912061		1583	3358	4941	88902041	SO:0001583	missense	54537			BC051863	CCDS7383.1	10q23.2	2010-06-02			ENSG00000122376	ENSG00000122376			28773	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_019054		Approved	MGC5560, bA163M19.1, FAM35A1	uc001kei.4	Q86V20	OTTHUMG00000018669	ENST00000298784.1:c.950G>T	10.37:g.88912061G>T	ENSP00000298784:p.Cys317Phe		88902041	O95885|Q9H991	Missense_Mutation	SNP	NULL	p.C317F	ENST00000298784.1	37	c.950	CCDS7383.1	10	.	.	.	.	.	.	.	.	.	.	g	0.004	-2.249480	0.00268	.	.	ENSG00000122376	ENST00000298786;ENST00000298784;ENST00000358313	T;T;T	0.23147	1.92;1.92;1.92	4.09	-2.93	0.05598	.	0.363369	0.22473	N	0.059596	T	0.19565	0.0470	M	0.71581	2.175	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.24764	-1.0151	10	0.66056	D	0.02	-0.2041	0.9182	0.01309	0.2226:0.1184:0.2957:0.3632	.	317	Q86V20	FA35A_HUMAN	F	317	ENSP00000298786:C317F;ENSP00000298784:C317F;ENSP00000351064:C317F	ENSP00000298784:C317F	C	+	2	0	FAM35A	88902041	0.062000	0.20869	0.008000	0.14137	0.292000	0.27327	0.227000	0.17795	-0.949000	0.03663	-0.415000	0.06103	TGT	-	NULL		0.368	FAM35A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM35A	protein_coding	OTTHUMT00000049196.2	G	NM_019054		88902041	+1	no_errors	NM_019054	genbank	human	validated	54_36p	missense	SNP	0.155	T
GPR83	10888	genome.wustl.edu	37	11	94134396	94134396	+	Silent	SNP	C	C	T			TCGA-29-1769-01A-01W-0639-09	TCGA-29-1769-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	6e3821b5-a446-4b2d-9ede-6be24af88e5e	093609c2-c2b8-41d0-85ac-c69048b9b06b	g.chr11:94134396C>T	ENST00000243673.2	-	1	189	c.18G>A	c.(16-18)ttG>ttA	p.L6L	GPR83_ENST00000539203.2_Silent_p.L6L	NM_016540.3	NP_057624.3	Q9NYM4	GPR83_HUMAN	G protein-coupled receptor 83	6					response to glucocorticoid (GO:0051384)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide Y receptor activity (GO:0004983)			NS(1)|breast(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)	19		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				GACAGAGCAGCAAGAGGTGAG	0.746																																																0			11											19.0	20.0	20.0					11																	94134396		2197	4281	6478	93774044	SO:0001819	synonymous_variant	10888			AF236081	CCDS8297.1	11q21	2012-08-21	2003-07-30	2003-08-01	ENSG00000123901	ENSG00000123901		"""GPCR / Class A : Orphans"""	4523	protein-coding gene	gene with protein product		605569	"""G protein-coupled receptor 72"""	GPR72		10760605, 11060465	Standard	NM_016540		Approved		uc001pet.2	Q9NYM4	OTTHUMG00000167779	ENST00000243673.2:c.18G>A	11.37:g.94134396C>T			93774044	B0M0K5|Q6NWR4|Q9P1Y8	Silent	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.L6	ENST00000243673.2	37	c.18	CCDS8297.1	11																																																																																			-	NULL		0.746	GPR83-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR83	protein_coding	OTTHUMT00000396232.1	C	NM_016540		93774044	-1	no_errors	NM_016540	genbank	human	validated	54_36p	silent	SNP	0.568	T
RAP2A	5911	genome.wustl.edu	37	13	98086899	98086899	+	Missense_Mutation	SNP	G	G	C			TCGA-29-1769-01A-01W-0639-09	TCGA-29-1769-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	6e3821b5-a446-4b2d-9ede-6be24af88e5e	093609c2-c2b8-41d0-85ac-c69048b9b06b	g.chr13:98086899G>C	ENST00000245304.4	+	1	424	c.175G>C	c.(175-177)Gcg>Ccg	p.A59P		NM_021033.6	NP_066361.1	P10114	RAP2A_HUMAN	RAP2A, member of RAS oncogene family	59					actin cytoskeleton reorganization (GO:0031532)|cellular protein localization (GO:0034613)|establishment of protein localization (GO:0045184)|negative regulation of cell migration (GO:0030336)|positive regulation of protein autophosphorylation (GO:0031954)|Rap protein signal transduction (GO:0032486)|regulation of dendrite morphogenesis (GO:0048814)|regulation of JNK cascade (GO:0046328)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|recycling endosome (GO:0055037)|recycling endosome membrane (GO:0055038)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)	5	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.166)			CCTGGACACGGCGGGCACCGA	0.602																																																0			13											110.0	103.0	105.0					13																	98086899		2203	4300	6503	96884900	SO:0001583	missense	5911			AF205602	CCDS9485.1	13q34	2014-05-09			ENSG00000125249	ENSG00000125249			9861	protein-coding gene	gene with protein product		179540		RAP2			Standard	NM_021033		Approved	K-REV	uc001vnd.3	P10114	OTTHUMG00000017240	ENST00000245304.4:c.175G>C	13.37:g.98086899G>C	ENSP00000245304:p.Ala59Pro		96884900	B2RCJ1|Q5JSC1|Q5JSC2	Missense_Mutation	SNP	HMMSmart_SM00173,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00175,HMMPfam_Ras,HMMSmart_SM00174,HMMSmart_SM00176	p.A59P	ENST00000245304.4	37	c.175	CCDS9485.1	13	.	.	.	.	.	.	.	.	.	.	G	31	5.078873	0.94050	.	.	ENSG00000125249	ENST00000245304	D	0.88975	-2.45	3.05	3.05	0.35203	Small GTP-binding protein domain (1);	0.057614	0.64402	D	0.000002	D	0.95623	0.8577	H	0.94808	3.585	0.80722	D	1	D	0.76494	0.999	D	0.76575	0.988	D	0.96903	0.9661	10	0.87932	D	0	.	14.5937	0.68389	0.0:0.0:1.0:0.0	.	59	P10114	RAP2A_HUMAN	P	59	ENSP00000245304:A59P	ENSP00000245304:A59P	A	+	1	0	RAP2A	96884900	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.359000	0.79477	1.732000	0.51606	0.484000	0.47621	GCG	-	HMMSmart_SM00173,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00175,HMMPfam_Ras,HMMSmart_SM00174,HMMSmart_SM00176		0.602	RAP2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAP2A	protein_coding	OTTHUMT00000045528.4	G			96884900	+1	no_errors	NM_021033	genbank	human	validated	54_36p	missense	SNP	1.000	C
MTERF3	51001	genome.wustl.edu	37	8	97251755	97251755	+	Silent	SNP	T	T	C			TCGA-29-1769-01A-01W-0639-09	TCGA-29-1769-10A-01W-0639-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	6e3821b5-a446-4b2d-9ede-6be24af88e5e	093609c2-c2b8-41d0-85ac-c69048b9b06b	g.chr8:97251755T>C	ENST00000287025.3	-	8	1316	c.1218A>G	c.(1216-1218)tcA>tcG	p.S406S	KB-1043D8.6_ENST00000520575.1_RNA|MTERFD1_ENST00000524341.1_Silent_p.S162S|MTERFD1_ENST00000523821.1_3'UTR|MTERFD1_ENST00000522822.1_Silent_p.S285S	NM_015942.3	NP_057026.3	Q96E29	MTEF3_HUMAN		406					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)	transcription regulatory region DNA binding (GO:0044212)			endometrium(1)|kidney(1)|large_intestine(7)|lung(7)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	24	Breast(36;5.16e-05)					AGTCCTGTACTGATGCTTTGG	0.289																																																0			8											58.0	60.0	59.0					8																	97251755		2201	4297	6498	97320931	SO:0001819	synonymous_variant	51001																														ENST00000287025.3:c.1218A>G	8.37:g.97251755T>C			97320931	B3KMG6|G3V130|Q9Y301	Silent	SNP	HMMPfam_mTERF,HMMSmart_SM00733	p.S406	ENST00000287025.3	37	c.1218	CCDS6270.1	8																																																																																			-	NULL		0.289	MTERFD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MTERFD1	protein_coding	OTTHUMT00000379876.1	T			97320931	-1	no_errors	NM_015942	genbank	human	provisional	54_36p	silent	SNP	0.715	C
TMEM131	23505	genome.wustl.edu	37	2	98426216	98426216	+	Missense_Mutation	SNP	C	C	A			TCGA-29-1769-01A-01W-0639-09	TCGA-29-1769-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	6e3821b5-a446-4b2d-9ede-6be24af88e5e	093609c2-c2b8-41d0-85ac-c69048b9b06b	g.chr2:98426216C>A	ENST00000186436.5	-	19	2218	c.1990G>T	c.(1990-1992)Gct>Tct	p.A664S		NM_015348.1	NP_056163.1	Q92545	TM131_HUMAN	transmembrane protein 131	664						integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(4)|prostate(1)|skin(1)|stomach(1)	57						GCAATCACAGCCTTCACAGGG	0.408																																																0			2											68.0	67.0	67.0					2																	98426216		1943	4144	6087	97792648	SO:0001583	missense	23505			AK025852	CCDS46368.1	2q11.2	2006-04-12			ENSG00000075568	ENSG00000075568			30366	protein-coding gene	gene with protein product		615659				9039502, 10996388	Standard	NM_015348		Approved	CC28, YR-23, RW1, KIAA0257, PRO1048	uc002syh.4	Q92545	OTTHUMG00000153061	ENST00000186436.5:c.1990G>T	2.37:g.98426216C>A	ENSP00000186436:p.Ala664Ser		97792648		Missense_Mutation	SNP	NULL	p.A664S	ENST00000186436.5	37	c.1990	CCDS46368.1	2	.	.	.	.	.	.	.	.	.	.	C	29.9	5.046883	0.93740	.	.	ENSG00000075568	ENST00000186436	T	0.33865	1.39	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	T	0.59742	0.2216	M	0.64997	1.995	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.47328	-0.9126	10	0.28530	T	0.3	-16.5983	20.5541	0.99286	0.0:1.0:0.0:0.0	.	664	Q92545	TM131_HUMAN	S	664	ENSP00000186436:A664S	ENSP00000186436:A664S	A	-	1	0	TMEM131	97792648	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	7.371000	0.79600	2.864000	0.98301	0.551000	0.68910	GCT	-	NULL		0.408	TMEM131-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM131	protein_coding	OTTHUMT00000329285.2	C	XM_371542		97792648	-1	no_errors	NM_015348	genbank	human	validated	54_36p	missense	SNP	1.000	A
HABP4	22927	genome.wustl.edu	37	9	99227688	99227688	+	Silent	SNP	C	C	G			TCGA-29-1769-01A-01W-0639-09	TCGA-29-1769-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	6e3821b5-a446-4b2d-9ede-6be24af88e5e	093609c2-c2b8-41d0-85ac-c69048b9b06b	g.chr9:99227688C>G	ENST00000375249.4	+	3	657	c.582C>G	c.(580-582)ggC>ggG	p.G194G	HABP4_ENST00000375251.3_Intron	NM_014282.2	NP_055097.2			hyaluronan binding protein 4											NS(1)|cervix(2)|endometrium(1)|large_intestine(2)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	13		Acute lymphoblastic leukemia(62;0.0169)|all_hematologic(171;0.214)				GTATGCGCGGCAGAGGCAGAG	0.488																																																0			9											103.0	116.0	112.0					9																	99227688		2203	4300	6503	98267509	SO:0001819	synonymous_variant	22927			AF241831	CCDS6719.1	9q22.3-q31	2008-02-05			ENSG00000130956	ENSG00000130956			17062	protein-coding gene	gene with protein product						9523163, 10887182	Standard	XM_005251812		Approved	IHABP4, SERBP1L	uc010msg.3	Q5JVS0	OTTHUMG00000020298	ENST00000375249.4:c.582C>G	9.37:g.99227688C>G			98267509		Silent	SNP	HMMPfam_HABP4_PAI-RBP1	p.G194	ENST00000375249.4	37	c.582	CCDS6719.1	9																																																																																			-	NULL		0.488	HABP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HABP4	protein_coding	OTTHUMT00000053269.1	C	NM_014282		98267509	+1	no_errors	NM_014282	genbank	human	validated	54_36p	silent	SNP	0.998	G
OR5K3	403277	genome.wustl.edu	37	3	98110427	98110427	+	Silent	SNP	A	A	G			TCGA-29-1769-01A-01W-0639-09	TCGA-29-1769-10A-01W-0639-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	6e3821b5-a446-4b2d-9ede-6be24af88e5e	093609c2-c2b8-41d0-85ac-c69048b9b06b	g.chr3:98110427A>G	ENST00000383695.1	+	1	918	c.918A>G	c.(916-918)agA>agG	p.R306R	RP11-325B23.2_ENST00000508616.1_lincRNA	NM_001005516.1	NP_001005516.1	A6NET4	OR5K3_HUMAN	olfactory receptor, family 5, subfamily K, member 3	306						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(15)|prostate(1)|skin(1)|urinary_tract(1)	27						TGAAGAAGAGAAAATTTTGTC	0.269																																																0			3											33.0	38.0	36.0					3																	98110427		2108	4214	6322	99593117	SO:0001819	synonymous_variant	403277				CCDS33803.1	3q11.2	2013-09-23			ENSG00000206536	ENSG00000206536		"""GPCR / Class A : Olfactory receptors"""	31290	protein-coding gene	gene with protein product							Standard	NM_001005516		Approved		uc011bgw.2	A6NET4	OTTHUMG00000160077	ENST00000383695.1:c.918A>G	3.37:g.98110427A>G			99593117		Silent	SNP	PatternScan_G_PROTEIN_RECEP_F1_1,superfamily_SSF81321,HMMPfam_7tm_1	p.R306	ENST00000383695.1	37	c.918	CCDS33803.1	3																																																																																			-	superfamily_SSF81321		0.269	OR5K3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5K3	protein_coding	OTTHUMT00000359110.1	A			99593117	+1	no_errors	NM_001005516	genbank	human	provisional	54_36p	silent	SNP	0.000	G
MEPCE	56257	genome.wustl.edu	37	7	100028149	100028149	+	Missense_Mutation	SNP	C	C	T			TCGA-29-1769-01A-01W-0639-09	TCGA-29-1769-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	6e3821b5-a446-4b2d-9ede-6be24af88e5e	093609c2-c2b8-41d0-85ac-c69048b9b06b	g.chr7:100028149C>T	ENST00000310512.2	+	1	896	c.508C>T	c.(508-510)Cgc>Tgc	p.R170C	ZCWPW1_ENST00000398027.2_5'Flank|MEPCE_ENST00000414441.1_Intron|ZCWPW1_ENST00000324725.6_5'Flank|ZCWPW1_ENST00000360951.4_5'Flank	NM_019606.5	NP_062552.2	Q7L2J0	MEPCE_HUMAN	methylphosphate capping enzyme	170					negative regulation of chromatin binding (GO:0035562)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|RNA methylation (GO:0001510)|snRNA metabolic process (GO:0016073)|snRNA modification (GO:0040031)		poly(A) RNA binding (GO:0044822)|RNA methyltransferase activity (GO:0008173)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|liver(2)|lung(9)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	24	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					CTTCAAGAGGCGCAGGCGGGT	0.597																																																0			7											37.0	42.0	41.0					7																	100028149		2196	4281	6477	99866085	SO:0001583	missense	56257			AF264752	CCDS5693.1, CCDS55136.1	7q22.1	2008-02-04	2007-07-26	2007-07-26	ENSG00000146834	ENSG00000146834			20247	protein-coding gene	gene with protein product		611478	"""bin3, bicoid-interacting 3, homolog (Drosophila)"""	BCDIN3		12358911, 17643375	Standard	NM_019606		Approved	FLJ20257, MePCE	uc003uuw.3	Q7L2J0	OTTHUMG00000155255	ENST00000310512.2:c.508C>T	7.37:g.100028149C>T	ENSP00000308546:p.Arg170Cys		99866085	B3KP86|D6W5V7|Q9NPD4	Missense_Mutation	SNP	superfamily_SSF53335,HMMPfam_Bin3	p.R170C	ENST00000310512.2	37	c.508	CCDS5693.1	7	.	.	.	.	.	.	.	.	.	.	C	16.62	3.173169	0.57584	.	.	ENSG00000146834	ENST00000310512	.	.	.	4.58	4.58	0.56647	.	0.000000	0.85682	D	0.000000	T	0.73938	0.3651	L	0.52011	1.625	0.58432	D	0.999999	D	0.89917	1.0	D	0.83275	0.996	T	0.76798	-0.2826	9	0.87932	D	0	-13.6299	14.9172	0.70807	0.0:1.0:0.0:0.0	.	170	Q7L2J0	MEPCE_HUMAN	C	170	.	ENSP00000308546:R170C	R	+	1	0	MEPCE	99866085	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.715000	0.37971	2.389000	0.81357	0.561000	0.74099	CGC	-	NULL		0.597	MEPCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEPCE	protein_coding	OTTHUMT00000339135.1	C			99866085	+1	no_errors	NM_019606	genbank	human	provisional	54_36p	missense	SNP	1.000	T
UTP20	27340	genome.wustl.edu	37	12	101723196	101723196	+	Missense_Mutation	SNP	C	C	A			TCGA-29-1769-01A-01W-0639-09	TCGA-29-1769-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	6e3821b5-a446-4b2d-9ede-6be24af88e5e	093609c2-c2b8-41d0-85ac-c69048b9b06b	g.chr12:101723196C>A	ENST00000261637.4	+	27	3560	c.3386C>A	c.(3385-3387)aCc>aAc	p.T1129N		NM_014503.2	NP_055318.2	O75691	UTP20_HUMAN	UTP20, small subunit (SSU) processome component, homolog (yeast)	1129					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000480)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000447)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000472)|negative regulation of cell proliferation (GO:0008285)|rRNA processing (GO:0006364)	90S preribosome (GO:0030686)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|preribosome, small subunit precursor (GO:0030688)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			NS(3)|biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(26)|lung(30)|ovary(2)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	88						ATGACAGCAACCGTATCACAC	0.383																																																0			12											118.0	110.0	113.0					12																	101723196		2203	4300	6503	100247327	SO:0001583	missense	27340			AJ006778	CCDS9081.1	12q23	2006-02-11				ENSG00000120800			17897	protein-coding gene	gene with protein product	"""down regulated in metastasis"""	612822				9673349, 15590835, 12837249	Standard	NM_014503		Approved	DRIM	uc001tia.1	O75691	OTTHUMG00000170270	ENST00000261637.4:c.3386C>A	12.37:g.101723196C>A	ENSP00000261637:p.Thr1129Asn		100247327	Q9H3H4	Missense_Mutation	SNP	superfamily_ARM repeat,HMMPfam_DRIM	p.T1129N	ENST00000261637.4	37	c.3386	CCDS9081.1	12	.	.	.	.	.	.	.	.	.	.	C	9.842	1.191231	0.21954	.	.	ENSG00000120800	ENST00000261637	T	0.17370	2.28	5.6	4.71	0.59529	Armadillo-type fold (1);	0.345297	0.34828	N	0.003659	T	0.13798	0.0334	L	0.47716	1.5	0.09310	N	1	P	0.37914	0.611	B	0.31946	0.138	T	0.15607	-1.0431	10	0.23302	T	0.38	-5.1307	11.7395	0.51784	0.0:0.8462:0.0:0.1538	.	1129	O75691	UTP20_HUMAN	N	1129	ENSP00000261637:T1129N	ENSP00000261637:T1129N	T	+	2	0	UTP20	100247327	0.734000	0.28142	0.013000	0.15412	0.059000	0.15707	3.873000	0.56093	1.499000	0.48617	0.591000	0.81541	ACC	-	superfamily_ARM repeat		0.383	UTP20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UTP20	protein_coding	OTTHUMT00000408242.1	C	NM_014503		100247327	+1	no_errors	NM_014503	genbank	human	validated	54_36p	missense	SNP	0.086	A
NPAS2	4862	genome.wustl.edu	37	2	101604708	101604708	+	Silent	SNP	G	G	A			TCGA-29-1769-01A-01W-0639-09	TCGA-29-1769-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	6e3821b5-a446-4b2d-9ede-6be24af88e5e	093609c2-c2b8-41d0-85ac-c69048b9b06b	g.chr2:101604708G>A	ENST00000335681.5	+	17	2082	c.1797G>A	c.(1795-1797)ctG>ctA	p.L599L	NPAS2_ENST00000542504.1_Silent_p.L664L	NM_002518.3	NP_002509.2	Q99743	NPAS2_HUMAN	neuronal PAS domain protein 2	599					cellular lipid metabolic process (GO:0044255)|cellular response to DNA damage stimulus (GO:0006974)|central nervous system development (GO:0007417)|circadian regulation of gene expression (GO:0032922)|circadian sleep/wake cycle (GO:0042745)|locomotor rhythm (GO:0045475)|negative regulation of cell death (GO:0060548)|positive regulation of DNA repair (GO:0045739)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of response to DNA damage stimulus (GO:2001020)|response to redox state (GO:0051775)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter binding (GO:0001047)|DNA binding (GO:0003677)|Hsp90 protein binding (GO:0051879)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)	p.L599L(1)		cervix(1)|endometrium(3)|large_intestine(7)|lung(9)|ovary(3)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						GCCAGCACCTGCTCAGAGAAT	0.567																																																1	Substitution - coding silent(1)	lung(1)	2											50.0	55.0	54.0					2																	101604708		2200	4298	6498	100971140	SO:0001819	synonymous_variant	4862			U77970	CCDS2048.1	2q11.2	2013-05-21			ENSG00000170485	ENSG00000170485		"""Basic helix-loop-helix proteins"""	7895	protein-coding gene	gene with protein product		603347				9012850, 9079689	Standard	NM_002518		Approved	MOP4, PASD4, bHLHe9	uc002tap.1	Q99743	OTTHUMG00000130675	ENST00000335681.5:c.1797G>A	2.37:g.101604708G>A			100971140	Q4ZFV9|Q53SQ3|Q86V96|Q99629	Silent	SNP	superfamily_HLH_basic,HMMPfam_HLH,HMMSmart_HLH,HMMSmart_PAS,HMMPfam_PAS,superfamily_SSF55785,HMMPfam_PAS_3,HMMSmart_PAC	p.L599	ENST00000335681.5	37	c.1797	CCDS2048.1	2	.	.	.	.	.	.	.	.	.	.	G	10.42	1.346493	0.24426	.	.	ENSG00000170485	ENST00000433408	.	.	.	5.7	5.7	0.88788	.	.	.	.	.	T	0.65544	0.2701	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.63028	-0.6728	4	.	.	.	.	13.5145	0.61533	0.0803:0.0:0.9197:0.0	.	.	.	.	T	98	.	.	A	+	1	0	NPAS2	100971140	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	1.648000	0.37271	2.673000	0.90976	0.655000	0.94253	GCT	-	NULL		0.567	NPAS2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	NPAS2	protein_coding	OTTHUMT00000253168.3	G			100971140	+1	no_errors	NM_002518	genbank	human	reviewed	54_36p	silent	SNP	0.994	A
RELN	5649	genome.wustl.edu	37	7	103159825	103159825	+	Missense_Mutation	SNP	C	C	A			TCGA-29-1769-01A-01W-0639-09	TCGA-29-1769-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	6e3821b5-a446-4b2d-9ede-6be24af88e5e	093609c2-c2b8-41d0-85ac-c69048b9b06b	g.chr7:103159825C>A	ENST00000428762.1	-	49	7966	c.7807G>T	c.(7807-7809)Ggc>Tgc	p.G2603C	RELN_ENST00000424685.2_Missense_Mutation_p.G2603C|RELN_ENST00000343529.5_Missense_Mutation_p.G2603C	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	2603					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		CAGGTAATGCCTCCATTGACA	0.418																																					NSCLC(146;835 1944 15585 22231 52158)											0			7											154.0	128.0	137.0					7																	103159825		2203	4300	6503	102947061	SO:0001583	missense	5649				CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.7807G>T	7.37:g.103159825C>A	ENSP00000392423:p.Gly2603Cys		102947061	A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Missense_Mutation	SNP	HMMPfam_Reeler,superfamily_SSF57196,HMMSmart_EGF,HMMPfam_EGF_2,PatternScan_EGF_1,PatternScan_EGF_2,superfamily_Sialidase	p.G2603C	ENST00000428762.1	37	c.7807	CCDS47680.1	7	.	.	.	.	.	.	.	.	.	.	C	23.7	4.443977	0.83993	.	.	ENSG00000189056	ENST00000428762;ENST00000343529;ENST00000424685;ENST00000424828;ENST00000448171	D;D;D	0.84516	-1.86;-1.86;-1.86	5.87	4.99	0.66335	Neuraminidase (3);	0.000000	0.85682	D	0.000000	D	0.92296	0.7556	M	0.78344	2.41	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.93312	0.6685	10	0.87932	D	0	.	16.4923	0.84205	0.132:0.868:0.0:0.0	.	2603;2603	P78509-2;P78509	.;RELN_HUMAN	C	2603;2603;2603;120;2603	ENSP00000392423:G2603C;ENSP00000345694:G2603C;ENSP00000388446:G2603C	ENSP00000345694:G2603C	G	-	1	0	RELN	102947061	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.461000	0.80834	1.472000	0.48140	0.655000	0.94253	GGC	-	superfamily_Sialidase		0.418	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RELN	protein_coding	OTTHUMT00000348148.1	C	NM_005045		102947061	-1	no_errors	NM_005045	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
SORCS3	22986	genome.wustl.edu	37	10	106602561	106602561	+	Missense_Mutation	SNP	C	C	G	rs267602355		TCGA-29-1769-01A-01W-0639-09	TCGA-29-1769-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	6e3821b5-a446-4b2d-9ede-6be24af88e5e	093609c2-c2b8-41d0-85ac-c69048b9b06b	g.chr10:106602561C>G	ENST00000369701.3	+	2	866	c.639C>G	c.(637-639)atC>atG	p.I213M		NM_014978.1	NP_055793.1	Q9UPU3	SORC3_HUMAN	sortilin-related VPS10 domain containing receptor 3	213					learning (GO:0007612)|memory (GO:0007613)|neuropeptide signaling pathway (GO:0007218)|regulation of long term synaptic depression (GO:1900452)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal postsynaptic density (GO:0097481)	neuropeptide receptor activity (GO:0008188)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(19)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	131		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)		TCATACTTATCCTGACGAAGC	0.458																																					NSCLC(116;1497 1690 7108 13108 14106)											0			10											96.0	88.0	91.0					10																	106602561		2203	4300	6503	106592551	SO:0001583	missense	22986			AB028982	CCDS7558.1	10q23-q25	2006-04-12			ENSG00000156395	ENSG00000156395			16699	protein-coding gene	gene with protein product		606285				11499680	Standard	NM_014978		Approved	KIAA1059, SORCS	uc001kyi.1	Q9UPU3	OTTHUMG00000019011	ENST00000369701.3:c.639C>G	10.37:g.106602561C>G	ENSP00000358715:p.Ile213Met		106592551	Q5VXF9|Q9NQJ2	Missense_Mutation	SNP	superfamily_SSF110296,HMMSmart_VPS10,HMMPfam_PKD,superfamily_PKD	p.I213M	ENST00000369701.3	37	c.639	CCDS7558.1	10	.	.	.	.	.	.	.	.	.	.	C	15.20	2.762182	0.49468	.	.	ENSG00000156395	ENST00000369701	T	0.37411	1.2	5.78	3.68	0.42216	.	0.000000	0.85682	D	0.000000	T	0.23886	0.0578	N	0.20685	0.6	0.32614	N	0.524191	P	0.41710	0.76	P	0.45232	0.474	T	0.32188	-0.9916	10	0.62326	D	0.03	.	2.2606	0.04066	0.291:0.4831:0.0:0.2259	.	213	Q9UPU3	SORC3_HUMAN	M	213	ENSP00000358715:I213M	ENSP00000358715:I213M	I	+	3	3	SORCS3	106592551	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	2.258000	0.43249	1.422000	0.47177	-0.311000	0.09066	ATC	-	superfamily_SSF110296		0.458	SORCS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SORCS3	protein_coding	OTTHUMT00000050221.1	C	NM_014978		106592551	+1	no_errors	NM_014978	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
FRMPD3	84443	genome.wustl.edu	37	X	106844878	106844878	+	Silent	SNP	C	C	A			TCGA-29-1769-01A-01W-0639-09	TCGA-29-1769-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	6e3821b5-a446-4b2d-9ede-6be24af88e5e	093609c2-c2b8-41d0-85ac-c69048b9b06b	g.chrX:106844878C>A	ENST00000276185.4	+	16	3708	c.3708C>A	c.(3706-3708)ggC>ggA	p.G1236G				Q5JV73	FRPD3_HUMAN	FERM and PDZ domain containing 3	1236						cytoskeleton (GO:0005856)				breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(16)|ovary(2)|urinary_tract(1)	28						CCTCTGAAGGCCCTGCCAAAC	0.582																																																0			X											50.0	48.0	48.0					X																	106844878		876	1991	2867	106731534	SO:0001819	synonymous_variant	84443			AB058720	CCDS76006.1	Xq22	2008-02-05			ENSG00000147234	ENSG00000147234			29382	protein-coding gene	gene with protein product						11347906	Standard	NM_032428		Approved	RP5-1070B1.1, KIAA1817		Q5JV73	OTTHUMG00000022165	ENST00000276185.4:c.3708C>A	X.37:g.106844878C>A			106731534	Q96JK8	Silent	SNP	PatternScan_FERM_1,PatternScan_FERM_2,superfamily_PDZ,HMMPfam_PDZ,HMMSmart_PDZ,HMMSmart_B41,superfamily_FERM_3-hlx,HMMPfam_FERM_M	p.G1236	ENST00000276185.4	37	c.3708		X																																																																																			-	NULL		0.582	FRMPD3-201	KNOWN	basic|appris_principal	protein_coding	FRMPD3	protein_coding		C	XM_042978		106731534	+1	no_errors	XM_042978	genbank	human	model	54_36p	silent	SNP	0.350	A
ACACB	32	genome.wustl.edu	37	12	109660704	109660704	+	Missense_Mutation	SNP	C	C	G			TCGA-29-1769-01A-01W-0639-09	TCGA-29-1769-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	6e3821b5-a446-4b2d-9ede-6be24af88e5e	093609c2-c2b8-41d0-85ac-c69048b9b06b	g.chr12:109660704C>G	ENST00000338432.7	+	26	3898	c.3779C>G	c.(3778-3780)cCc>cGc	p.P1260R	ACACB_ENST00000377854.5_Missense_Mutation_p.P1190R|ACACB_ENST00000377848.3_Missense_Mutation_p.P1260R			O00763	ACACB_HUMAN	acetyl-CoA carboxylase beta	1260					acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|malonyl-CoA biosynthetic process (GO:2001295)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(9)|kidney(5)|large_intestine(20)|lung(40)|ovary(6)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95					Adenine(DB00173)|Biotin(DB00121)	CAGTTCTGCCCCGAGAACCTC	0.602																																																0			12											74.0	53.0	60.0					12																	109660704		2203	4300	6503	108145087	SO:0001583	missense	32			U89344	CCDS31898.1	12q24.1	2010-05-07	2010-04-30		ENSG00000076555	ENSG00000076555	6.4.1.2		85	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 2"""	601557	"""acetyl-Coenzyme A carboxylase beta"""			8670171	Standard	NM_001093		Approved	HACC275, ACC2, ACCB	uc001toc.3	O00763	OTTHUMG00000169250	ENST00000338432.7:c.3779C>G	12.37:g.109660704C>G	ENSP00000341044:p.Pro1260Arg		108145087	A6NK36|Q16852|Q1HEC1|Q6KE87|Q6KE89|Q6TY48	Missense_Mutation	SNP	HMMPfam_CPSase_L_chain,superfamily_PreATP-grasp domain,superfamily_Glutathione synthetase ATP-binding domain-like,HMMPfam_CPSase_L_D2,PatternScan_CPSASE_1,PatternScan_CPSASE_2,superfamily_Rudiment single hybrid motif,HMMPfam_Biotin_carb_C,superfamily_Single hybrid motif,HMMPfam_Biotin_lipoyl,HMMPfam_ACC_central,superfamily_ClpP/crotonase,HMMPfam_Carboxyl_trans	p.P1260R	ENST00000338432.7	37	c.3779	CCDS31898.1	12	.	.	.	.	.	.	.	.	.	.	C	23.5	4.424641	0.83667	.	.	ENSG00000076555	ENST00000338432;ENST00000377848;ENST00000377854;ENST00000390027	T;T;T	0.41400	1.0;1.0;1.0	5.19	5.19	0.71726	Acetyl-CoA carboxylase, central domain (1);	0.000000	0.85682	D	0.000000	T	0.66005	0.2746	M	0.80422	2.495	0.80722	D	1	D	0.71674	0.998	D	0.74023	0.982	T	0.62402	-0.6862	10	0.21540	T	0.41	.	19.1223	0.93367	0.0:1.0:0.0:0.0	.	1260	O00763	ACACB_HUMAN	R	1260;1260;1190;491	ENSP00000341044:P1260R;ENSP00000367079:P1260R;ENSP00000367085:P1190R	ENSP00000341044:P1260R	P	+	2	0	ACACB	108145087	1.000000	0.71417	0.959000	0.39883	0.961000	0.63080	4.921000	0.63397	2.590000	0.87494	0.650000	0.86243	CCC	-	HMMPfam_ACC_central		0.602	ACACB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACACB	protein_coding	OTTHUMT00000403077.1	C	NM_001093		108145087	+1	no_errors	NM_001093	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
PROZ	8858	genome.wustl.edu	37	13	113814408	113814408	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1769-01A-01W-0639-09	TCGA-29-1769-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	6e3821b5-a446-4b2d-9ede-6be24af88e5e	093609c2-c2b8-41d0-85ac-c69048b9b06b	g.chr13:113814408G>A	ENST00000375547.2	+	2	158	c.151G>A	c.(151-153)Gag>Aag	p.E51K	PROZ_ENST00000342783.4_Missense_Mutation_p.E73K	NM_003891.2	NP_003882.1	P22891	PROZ_HUMAN	protein Z, vitamin K-dependent plasma glycoprotein	51	Gla. {ECO:0000255|PROSITE- ProRule:PRU00463}.				blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|peptidyl-glutamic acid carboxylation (GO:0017187)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)	calcium ion binding (GO:0005509)|serine-type endopeptidase activity (GO:0004252)	p.E51K(1)		NS(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(4)|prostate(2)|skin(2)	16	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_lung(25;0.216)	all cancers(43;0.104)		Menadione(DB00170)	AGAACTCTTCGAGGGAAACTT	0.458																																																1	Substitution - Missense(1)	lung(1)	13											117.0	129.0	125.0					13																	113814408		2203	4300	6503	112862409	SO:0001583	missense	8858			M55670	CCDS9531.1, CCDS58300.1	13q34	2008-07-18			ENSG00000126231	ENSG00000126231			9460	protein-coding gene	gene with protein product		176895				2244898, 2403355	Standard	NM_001256134		Approved	PZ	uc010agr.2	P22891	OTTHUMG00000017376	ENST00000375547.2:c.151G>A	13.37:g.113814408G>A	ENSP00000364697:p.Glu51Lys		112862409	A6NMB4|Q15213|Q5JVF5|Q5JVF6	Missense_Mutation	SNP	HMMSmart_SM00069,superfamily_GLA-domain,HMMPfam_Gla,PatternScan_GLA_1,HMMSmart_SM00181,HMMPfam_EGF,HMMSmart_SM00179,PatternScan_ASX_HYDROXYL,PatternScan_EGF_1,PatternScan_EGF_2,superfamily_EGF/Laminin,superfamily_Trypsin-like serine proteases,HMMSmart_SM00020,HMMPfam_Trypsin	p.E51K	ENST00000375547.2	37	c.151	CCDS9531.1	13	.	.	.	.	.	.	.	.	.	.	G	0.097	-1.158379	0.01686	.	.	ENSG00000126231	ENST00000375547;ENST00000342783	D;D	0.98937	-5.25;-5.25	4.0	-1.59	0.08453	Gamma-carboxyglutamic acid-rich (GLA) domain (5);Coagulation factor, subgroup, Gla domain (1);	0.805233	0.11334	U	0.574710	D	0.93559	0.7944	N	0.04063	-0.285	0.09310	N	0.999995	B;B	0.31611	0.331;0.046	B;B	0.28849	0.095;0.036	D	0.87994	0.2751	10	0.87932	D	0	.	10.9535	0.47343	0.0943:0.5134:0.3923:0.0	.	73;51	P22891-2;P22891	.;PROZ_HUMAN	K	51;73	ENSP00000364697:E51K;ENSP00000344458:E73K	ENSP00000344458:E73K	E	+	1	0	PROZ	112862409	0.001000	0.12720	0.063000	0.19743	0.356000	0.29392	-0.615000	0.05597	-0.278000	0.09180	0.313000	0.20887	GAG	-	HMMSmart_SM00069,superfamily_GLA-domain,HMMPfam_Gla		0.458	PROZ-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PROZ	protein_coding	OTTHUMT00000045845.1	G	NM_003891		112862409	+1	no_errors	NM_003891	genbank	human	provisional	54_36p	missense	SNP	0.045	A
SIDT1	54847	genome.wustl.edu	37	3	113329868	113329868	+	Missense_Mutation	SNP	G	G	C			TCGA-29-1769-01A-01W-0639-09	TCGA-29-1769-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	6e3821b5-a446-4b2d-9ede-6be24af88e5e	093609c2-c2b8-41d0-85ac-c69048b9b06b	g.chr3:113329868G>C	ENST00000264852.4	+	18	2460	c.1734G>C	c.(1732-1734)atG>atC	p.M578I	SIDT1_ENST00000463226.1_3'UTR|SIDT1_ENST00000393830.3_Missense_Mutation_p.M578I	NM_017699.2	NP_060169.2	Q9NXL6	SIDT1_HUMAN	SID1 transmembrane family, member 1	578					dsRNA transport (GO:0033227)	integral component of membrane (GO:0016021)	RNA transmembrane transporter activity (GO:0051033)			breast(1)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(11)|liver(2)|lung(15)|ovary(3)|pancreas(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50						CCTCCTTCATGTACATGATCG	0.502																																																0			3											164.0	155.0	158.0					3																	113329868		2203	4300	6503	114812558	SO:0001583	missense	54847			AK000181	CCDS2974.1	3q13.31	2009-11-26			ENSG00000072858	ENSG00000072858			25967	protein-coding gene	gene with protein product		606816					Standard	NM_017699		Approved	FLJ20174, SID-1	uc003eak.3	Q9NXL6	OTTHUMG00000159299	ENST00000264852.4:c.1734G>C	3.37:g.113329868G>C	ENSP00000264852:p.Met578Ile		114812558	Q17RR4	Missense_Mutation	SNP	NULL	p.M578I	ENST00000264852.4	37	c.1734	CCDS2974.1	3	.	.	.	.	.	.	.	.	.	.	G	31	5.064324	0.93898	.	.	ENSG00000072858	ENST00000264852;ENST00000393830	T;T	0.25250	1.81;1.81	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.52661	0.1748	M	0.73430	2.235	0.80722	D	1	D;D	0.59767	0.983;0.986	P;D	0.66351	0.906;0.943	T	0.46456	-0.9190	10	0.45353	T	0.12	-27.822	20.0396	0.97574	0.0:0.0:1.0:0.0	.	578;578	Q9NXL6-2;Q9NXL6	.;SIDT1_HUMAN	I	578	ENSP00000264852:M578I;ENSP00000377416:M578I	ENSP00000264852:M578I	M	+	3	0	SIDT1	114812558	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.776000	0.99001	2.728000	0.93425	0.643000	0.83706	ATG	-	NULL		0.502	SIDT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIDT1	protein_coding	OTTHUMT00000317564.1	G	NM_017699		114812558	+1	no_errors	NM_017699	genbank	human	validated	54_36p	missense	SNP	1.000	C
RAD21	5885	genome.wustl.edu	37	8	117869599	117869599	+	Missense_Mutation	SNP	T	T	C			TCGA-29-1769-01A-01W-0639-09	TCGA-29-1769-10A-01W-0639-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	6e3821b5-a446-4b2d-9ede-6be24af88e5e	093609c2-c2b8-41d0-85ac-c69048b9b06b	g.chr8:117869599T>C	ENST00000297338.2	-	6	882	c.595A>G	c.(595-597)Acc>Gcc	p.T199A	RAD21_ENST00000523547.1_5'UTR	NM_006265.2	NP_006256.1	O60216	RAD21_HUMAN	RAD21 homolog (S. pombe)	199					apoptotic process (GO:0006915)|chromosome segregation (GO:0007059)|DNA recombination (GO:0006310)|double-strand break repair (GO:0006302)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|protein localization to chromatin (GO:0071168)|reciprocal meiotic recombination (GO:0007131)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin complex (GO:0008278)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear meiotic cohesin complex (GO:0034991)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(16)|ovary(1)|prostate(1)|skin(1)|stomach(1)	32	all_cancers(13;1.21e-21)|Lung NSC(37;0.000134)|Ovarian(258;0.0172)					AGATTGCTGGTGCTCTGTTCA	0.368																																																0			8											136.0	133.0	134.0					8																	117869599		2203	4300	6503	117938780	SO:0001583	missense	5885			BC050381	CCDS6321.1	8q24.11	2014-09-17	2001-11-28		ENSG00000164754	ENSG00000164754			9811	protein-coding gene	gene with protein product	"""sister chromatid cohesion 1"""	606462	"""RAD21 (S. pombe) homolog"""			8812457	Standard	NM_006265		Approved	KIAA0078, hHR21, SCC1	uc003yod.3	O60216	OTTHUMG00000164959	ENST00000297338.2:c.595A>G	8.37:g.117869599T>C	ENSP00000297338:p.Thr199Ala		117938780	A8K0E0|Q15001|Q99568	Missense_Mutation	SNP	HMMPfam_Rad21_Rec8_N,HMMPfam_Rad21_Rec8	p.T199A	ENST00000297338.2	37	c.595	CCDS6321.1	8	.	.	.	.	.	.	.	.	.	.	T	10.32	1.318593	0.23994	.	.	ENSG00000164754	ENST00000297338;ENST00000520992;ENST00000517485	T;T;T	0.51325	0.71;1.58;1.59	5.33	5.33	0.75918	.	0.147583	0.64402	D	0.000011	T	0.36580	0.0972	L	0.36672	1.1	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.20438	-1.0275	10	0.08381	T	0.77	-18.5544	15.6	0.76616	0.0:0.0:0.0:1.0	.	199	O60216	RAD21_HUMAN	A	199	ENSP00000297338:T199A;ENSP00000429342:T199A;ENSP00000427923:T199A	ENSP00000297338:T199A	T	-	1	0	RAD21	117938780	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.596000	0.67570	2.152000	0.67230	0.460000	0.39030	ACC	-	NULL		0.368	RAD21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAD21	protein_coding	OTTHUMT00000381184.1	T	NM_006265		117938780	-1	no_errors	NM_006265	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
TRIM32	22954	genome.wustl.edu	37	9	119460735	119460735	+	Silent	SNP	C	C	T			TCGA-29-1769-01A-01W-0639-09	TCGA-29-1769-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	6e3821b5-a446-4b2d-9ede-6be24af88e5e	093609c2-c2b8-41d0-85ac-c69048b9b06b	g.chr9:119460735C>T	ENST00000450136.1	+	2	875	c.714C>T	c.(712-714)cgC>cgT	p.R238R	ASTN2_ENST00000361209.2_Intron|ASTN2_ENST00000361477.3_Intron|ASTN2_ENST00000313400.4_Intron|ASTN2_ENST00000373996.3_Intron|TRIM32_ENST00000373983.2_Silent_p.R238R	NM_001099679.1|NM_012210.3	NP_001093149.1|NP_036342.2	Q13049	TRI32_HUMAN	tripartite motif containing 32	238					fat cell differentiation (GO:0045444)|innate immune response (GO:0045087)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell motility (GO:2000147)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neurogenesis (GO:0050769)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of proteolysis (GO:0045862)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of type I interferon production (GO:0032481)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of type I interferon production (GO:0032479)|response to tumor necrosis factor (GO:0034612)|response to UV (GO:0009411)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|striated muscle myosin thick filament (GO:0005863)	ligase activity (GO:0016874)|myosin binding (GO:0017022)|protein self-association (GO:0043621)|RNA binding (GO:0003723)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|translation initiation factor binding (GO:0031369)|ubiquitin binding (GO:0043130)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(5)|liver(1)|lung(6)|prostate(1)|skin(2)|urinary_tract(1)	26						CTGTGTCTCGCTGTGACTACT	0.532																																					Esophageal Squamous(92;212 1916 19711 26951)											0			9											74.0	63.0	67.0					9																	119460735		2203	4300	6503	118500556	SO:0001819	synonymous_variant	22954			U18543	CCDS6817.1	9q33.1	2014-09-17	2011-01-25		ENSG00000119401	ENSG00000119401		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16380	protein-coding gene	gene with protein product		602290	"""limb girdle muscular dystrophy 2H (autosomal recessive)"", ""tripartite motif-containing 32"""	LGMD2H		11331580, 7778269, 16606853	Standard	NM_001099679		Approved	HT2A, TATIP, BBS11	uc004bjx.2	Q13049	OTTHUMG00000021026	ENST00000450136.1:c.714C>T	9.37:g.119460735C>T			118500556	Q9NQP8	Silent	SNP	superfamily_SSF57850,HMMSmart_RING,HMMPfam_zf-C3HC4,PatternScan_ZF_RING_1,HMMSmart_BBOX,superfamily_SSF101898,HMMPfam_NHL	p.R238	ENST00000450136.1	37	c.714	CCDS6817.1	9																																																																																			-	NULL		0.532	TRIM32-201	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM32	protein_coding	OTTHUMT00000055466.2	C	NM_012210		118500556	+1	no_errors	NM_001099679	genbank	human	reviewed	54_36p	silent	SNP	1.000	T
ARHGAP31	57514	genome.wustl.edu	37	3	119133984	119133984	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1769-01A-01W-0639-09	TCGA-29-1769-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	6e3821b5-a446-4b2d-9ede-6be24af88e5e	093609c2-c2b8-41d0-85ac-c69048b9b06b	g.chr3:119133984G>A	ENST00000264245.4	+	12	3740	c.3208G>A	c.(3208-3210)Gag>Aag	p.E1070K		NM_020754.2	NP_065805.2	Q2M1Z3	RHG31_HUMAN	Rho GTPase activating protein 31	1070					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	GTPase activator activity (GO:0005096)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(3)|large_intestine(11)|lung(29)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	67						GAGCAGCAAGGAGAGTTCACC	0.582																																					Pancreas(7;176 297 5394 51128 51241)											0			3											163.0	179.0	173.0					3																	119133984		2141	4250	6391	120616674	SO:0001583	missense	57514				CCDS43135.1	3q13.33	2011-06-29			ENSG00000031081	ENSG00000031081		"""Rho GTPase activating proteins"""	29216	protein-coding gene	gene with protein product		610911				9786927, 12819203, 16519628	Standard	NM_020754		Approved	CDGAP	uc003ecj.4	Q2M1Z3	OTTHUMG00000159362	ENST00000264245.4:c.3208G>A	3.37:g.119133984G>A	ENSP00000264245:p.Glu1070Lys		120616674	Q9ULL6	Missense_Mutation	SNP	superfamily_GTPase activation domain GAP,HMMSmart_SM00324,HMMPfam_RhoGAP	p.E1070K	ENST00000264245.4	37	c.3208	CCDS43135.1	3	.	.	.	.	.	.	.	.	.	.	G	6.887	0.533148	0.13188	.	.	ENSG00000031081	ENST00000264245	T	0.08008	3.14	5.39	4.49	0.54785	.	0.337669	0.24978	N	0.034089	T	0.07503	0.0189	L	0.32530	0.975	0.09310	N	1	P	0.39665	0.682	B	0.35413	0.202	T	0.20472	-1.0274	10	0.42905	T	0.14	.	13.4681	0.61268	0.0:0.1566:0.8434:0.0	.	1070	Q2M1Z3	RHG31_HUMAN	K	1070	ENSP00000264245:E1070K	ENSP00000264245:E1070K	E	+	1	0	ARHGAP31	120616674	0.985000	0.35326	0.044000	0.18714	0.184000	0.23303	2.282000	0.43461	1.456000	0.47831	0.655000	0.94253	GAG	-	NULL		0.582	ARHGAP31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDGAP	protein_coding	OTTHUMT00000354942.2	G			120616674	+1	no_errors	NM_020754	genbank	human	reviewed	54_36p	missense	SNP	0.006	A
GOLGB1	2804	genome.wustl.edu	37	3	121414133	121414133	+	Missense_Mutation	SNP	T	T	A			TCGA-29-1769-01A-01W-0639-09	TCGA-29-1769-10A-01W-0639-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	6e3821b5-a446-4b2d-9ede-6be24af88e5e	093609c2-c2b8-41d0-85ac-c69048b9b06b	g.chr3:121414133T>A	ENST00000340645.5	-	13	5347	c.5222A>T	c.(5221-5223)aAg>aTg	p.K1741M	GOLGB1_ENST00000393667.3_Missense_Mutation_p.K1746M	NM_001256487.1|NM_001256488.1|NM_004487.4	NP_001243416.1|NP_001243417.1|NP_004478.3	Q14789	GOGB1_HUMAN	golgin B1	1741					Golgi organization (GO:0007030)	cis-Golgi network (GO:0005801)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(2)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(26)|liver(2)|lung(36)|ovary(7)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(13)	119				GBM - Glioblastoma multiforme(114;0.0989)		AGACTGAAACTTCTTAGAAAG	0.368																																																0			3											103.0	101.0	102.0					3																	121414133		2203	4300	6503	122896823	SO:0001583	missense	2804			X75304	CCDS3004.1, CCDS58847.1, CCDS74989.1	3q13	2010-02-12	2010-02-12	2007-07-27	ENSG00000173230	ENSG00000173230			4429	protein-coding gene	gene with protein product	"""macrogolgin"", ""golgi integral membrane protein 1"""	602500	"""golgi autoantigen, golgin subfamily b, macrogolgin (with transmembrane signal), 1"", ""golgin B1, golgi integral membrane protein"""			7691276, 15004235	Standard	NM_001256486		Approved	GCP, GCP372, giantin, GOLIM1	uc010hrc.4	Q14789	OTTHUMG00000159411	ENST00000340645.5:c.5222A>T	3.37:g.121414133T>A	ENSP00000341848:p.Lys1741Met		122896823	B2ZZ91|D3DN92|E7EP74|Q14398	Missense_Mutation	SNP	superfamily_Spectrin repeat,superfamily_Prefoldin,HMMSmart_SM00340	p.K1741M	ENST00000340645.5	37	c.5222	CCDS3004.1	3	.	.	.	.	.	.	.	.	.	.	T	7.111	0.576056	0.13623	.	.	ENSG00000173230	ENST00000340645;ENST00000393667	T;T	0.16597	2.34;2.33	5.62	5.62	0.85841	.	0.643000	0.14461	N	0.318166	T	0.14960	0.0361	N	0.14661	0.345	0.23537	N	0.997466	P;P;P;D	0.53885	0.904;0.904;0.904;0.963	B;B;B;P	0.46275	0.439;0.439;0.439;0.51	T	0.12451	-1.0547	10	0.49607	T	0.09	.	13.7743	0.63044	0.0:0.0:0.0:1.0	.	1666;1746;1746;1741	F1T0J2;E7EP74;B2ZZ91;Q14789	.;.;.;GOGB1_HUMAN	M	1741;1746	ENSP00000341848:K1741M;ENSP00000377275:K1746M	ENSP00000341848:K1741M	K	-	2	0	GOLGB1	122896823	0.948000	0.32251	0.171000	0.22900	0.463000	0.32649	4.651000	0.61447	2.123000	0.65237	0.460000	0.39030	AAG	-	HMMSmart_SM00340		0.368	GOLGB1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GOLGB1	protein_coding	OTTHUMT00000355159.1	T	NM_004487		122896823	-1	no_errors	NM_004487	genbank	human	validated	54_36p	missense	SNP	0.094	A
PARP14	54625	genome.wustl.edu	37	3	122418275	122418275	+	Missense_Mutation	SNP	A	A	G			TCGA-29-1769-01A-01W-0639-09	TCGA-29-1769-10A-01W-0639-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	6e3821b5-a446-4b2d-9ede-6be24af88e5e	093609c2-c2b8-41d0-85ac-c69048b9b06b	g.chr3:122418275A>G	ENST00000474629.2	+	6	1140	c.874A>G	c.(874-876)Aaa>Gaa	p.K292E		NM_017554.2	NP_060024.2	Q460N5	PAR14_HUMAN	poly (ADP-ribose) polymerase family, member 14	292					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	NAD+ ADP-ribosyltransferase activity (GO:0003950)			NS(2)|breast(5)|cervix(2)|endometrium(7)|kidney(5)|large_intestine(8)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	50				GBM - Glioblastoma multiforme(114;0.0531)		CGACTTCAATAAAATGCCACT	0.398																																																0			3											84.0	77.0	79.0					3																	122418275		1905	4124	6029	123900965	SO:0001583	missense	54625			AB033094	CCDS46894.1	3q21	2010-02-16			ENSG00000173193	ENSG00000173193		"""Poly (ADP-ribose) polymerases"""	29232	protein-coding gene	gene with protein product		610028				15273990	Standard	NM_017554		Approved	KIAA1268, pART8	uc003efq.4	Q460N5	OTTHUMG00000159552	ENST00000474629.2:c.874A>G	3.37:g.122418275A>G	ENSP00000418194:p.Lys292Glu		123900965	B4E2H0|Q460N4|Q8J027|Q9H9X9|Q9NV60|Q9ULF2	Missense_Mutation	SNP	superfamily_Macro domain-like,HMMSmart_SM00506,HMMPfam_Macro,superfamily_ADP-ribosylation,HMMPfam_PARP	p.K292E	ENST00000474629.2	37	c.874	CCDS46894.1	3	.	.	.	.	.	.	.	.	.	.	A	11.03	1.517543	0.27123	.	.	ENSG00000173193	ENST00000474629;ENST00000398162	T	0.72051	-0.62	5.46	3.0	0.34707	.	0.689370	0.13949	N	0.351661	T	0.51822	0.1697	L	0.34521	1.04	0.09310	N	1	B;P	0.38922	0.053;0.651	B;B	0.27887	0.053;0.084	T	0.40794	-0.9544	10	0.52906	T	0.07	.	6.8884	0.24216	0.6353:0.2893:0.0754:0.0	.	292;292	Q460N5-4;Q460N5	.;PAR14_HUMAN	E	292;211	ENSP00000418194:K292E	ENSP00000381228:K211E	K	+	1	0	PARP14	123900965	0.000000	0.05858	0.052000	0.19188	0.895000	0.52256	-0.100000	0.10990	0.463000	0.27118	0.533000	0.62120	AAA	-	NULL		0.398	PARP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARP14	protein_coding	OTTHUMT00000356173.2	A	NM_017554		123900965	+1	no_errors	NM_017554	genbank	human	validated	54_36p	missense	SNP	0.000	G
SWI5	375757	genome.wustl.edu	37	9	131048285	131048285	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1769-01A-01W-0639-09	TCGA-29-1769-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	6e3821b5-a446-4b2d-9ede-6be24af88e5e	093609c2-c2b8-41d0-85ac-c69048b9b06b	g.chr9:131048285G>A	ENST00000320188.5	+	4	616	c.616G>A	c.(616-618)Gtg>Atg	p.V206M	SWI5_ENST00000419867.2_Missense_Mutation_p.V141M|SWI5_ENST00000608796.1_Missense_Mutation_p.V141M|SWI5_ENST00000418976.1_Missense_Mutation_p.V101M|SWI5_ENST00000495313.1_Missense_Mutation_p.V110M	NM_001040011.1	NP_001035100.1	Q1ZZU3	SWI5_HUMAN	SWI5 recombination repair homolog (yeast)	206					cellular response to ionizing radiation (GO:0071479)|double-strand break repair via homologous recombination (GO:0000724)	nucleus (GO:0005634)|Swi5-Sfr1 complex (GO:0032798)											CATCAAGGATGTGGGGCAGAT	0.532																																																0			9											102.0	101.0	102.0					9																	131048285		2090	4231	6321	130088106	SO:0001583	missense	375757			BC029911	CCDS43883.1	9q34.13	2011-07-29	2011-07-29	2011-07-29	ENSG00000175854	ENSG00000175854			31412	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 119"""	C9orf119		21252223, 20976249	Standard	NM_001040011		Approved	bA395P17.9	uc004bup.3	Q1ZZU3	OTTHUMG00000020729	ENST00000320188.5:c.616G>A	9.37:g.131048285G>A	ENSP00000316609:p.Val206Met		130088106	Q5SYX7|Q5SYX8|Q8N2W6	Missense_Mutation	SNP	HMMPfam_Swi5	p.V206M	ENST00000320188.5	37	c.616	CCDS43883.1	9	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	17.88|17.88|17.88	3.497305|3.497305|3.497305	0.64186|0.64186|0.64186	.|.|.	.|.|.	ENSG00000175854|ENSG00000175854|ENSG00000175854	ENST00000418976|ENST00000495313;ENST00000372898|ENST00000320188	.|.|.	.|.|.	.|.|.	5.09|5.09|5.09	2.27|2.27|2.27	0.28462|0.28462|0.28462	.|.|.	.|.|0.513955	.|.|0.20516	.|.|N	.|.|0.090791	T|T|T	0.61362|0.61362|0.61362	0.2341|0.2341|0.2341	M|M|M	0.72118|0.72118|0.72118	2.19|2.19|2.19	0.26378|0.26378|0.26378	N|N|N	0.976786|0.976786|0.976786	.|.|D	.|.|0.64830	.|.|0.994	.|.|D	.|.|0.66497	.|.|0.944	T|T|T	0.53215|0.53215|0.53215	-0.8470|-0.8470|-0.8470	5|5|9	.|.|0.72032	.|.|D	.|.|0.01	.|.|.	8.1822|8.1822|8.1822	0.31317|0.31317|0.31317	0.2489:0.0:0.7511:0.0|0.2489:0.0:0.7511:0.0|0.2489:0.0:0.7511:0.0	.|.|.	.|.|206	.|.|Q1ZZU3	.|.|SWI5_HUMAN	Y|I|M	133|119;115|206	.|.|.	.|.|ENSP00000316609:V206M	C|M|V	+|+|+	2|3|1	0|0|0	SWI5|SWI5|SWI5	130088106|130088106|130088106	0.259000|0.259000|0.259000	0.24043|0.24043|0.24043	0.511000|0.511000|0.511000	0.27724|0.27724|0.27724	0.970000|0.970000|0.970000	0.65996|0.65996|0.65996	0.682000|0.682000|0.682000	0.25335|0.25335|0.25335	0.190000|0.190000|0.190000	0.20209|0.20209|0.20209	-0.339000|-0.339000|-0.339000	0.08088|0.08088|0.08088	TGT|ATG|GTG	-	HMMPfam_Swi5		0.532	SWI5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf119	protein_coding		G	NM_001040011		130088106	+1	no_errors	NM_001040011	genbank	human	validated	54_36p	missense	SNP	0.280	A
AKAP7	9465	genome.wustl.edu	37	6	131602806	131602806	+	Missense_Mutation	SNP	C	C	G			TCGA-29-1769-01A-01W-0639-09	TCGA-29-1769-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	6e3821b5-a446-4b2d-9ede-6be24af88e5e	093609c2-c2b8-41d0-85ac-c69048b9b06b	g.chr6:131602806C>G	ENST00000431975.2	+	8	1085	c.987C>G	c.(985-987)agC>agG	p.S329R	AKAP7_ENST00000342266.4_Missense_Mutation_p.S62R|AKAP7_ENST00000263050.3_Missense_Mutation_p.S65R|AKAP7_ENST00000541650.1_Intron|AKAP7_ENST00000368123.4_Missense_Mutation_p.S307R|AKAP7_ENST00000474850.2_Missense_Mutation_p.S85R|AKAP7_ENST00000537868.1_Intron	NM_016377.3	NP_057461.2	Q9P0M2	AKA7G_HUMAN	A kinase (PRKA) anchor protein 7	329	PKA-RII-alpha subunit binding domain. {ECO:0000250}.					cytosol (GO:0005829)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|nucleotide binding (GO:0000166)|protein kinase A binding (GO:0051018)			endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)|stomach(1)	13	Breast(56;0.152)			GBM - Glioblastoma multiforme(226;0.0184)|OV - Ovarian serous cystadenocarcinoma(155;0.0345)		GGGAGGGGAGCTCTGTGAAAA	0.532																																																0			6											43.0	48.0	46.0					6																	131602806		2203	4300	6503	131644499	SO:0001583	missense	9465			AF047715	CCDS5142.1, CCDS5143.1, CCDS5144.1, CCDS5142.2	6q23.2	2012-10-24			ENSG00000118507	ENSG00000118507		"""A-kinase anchor proteins"""	377	protein-coding gene	gene with protein product		604693				9545239	Standard	NM_016377		Approved	AKAP18, AKAP15	uc003qck.4	O43687	OTTHUMG00000015563	ENST00000431975.2:c.987C>G	6.37:g.131602806C>G	ENSP00000405252:p.Ser329Arg		131644499	B4DUC3|Q9HCZ8	Missense_Mutation	SNP	HMMPfam_AKAP7_NLS,superfamily_LigT-like,HMMPfam_AKAP7_RIRII_bdg	p.S307R	ENST00000431975.2	37	c.921	CCDS5142.2	6	.	.	.	.	.	.	.	.	.	.	C	14.29	2.491634	0.44249	.	.	ENSG00000118507	ENST00000431975;ENST00000368123;ENST00000263050;ENST00000342266;ENST00000474850	T;T	0.36699	1.24;1.25	5.97	5.1	0.69264	Protein kinase A anchor protein, RI-RII subunit-binding domain (1);	0.327256	0.34200	N	0.004175	T	0.12944	0.0314	L	0.27053	0.805	0.27143	N	0.961615	P;P;P	0.43477	0.782;0.782;0.808	B;B;B	0.39503	0.301;0.301;0.231	T	0.07501	-1.0769	10	0.66056	D	0.02	-33.1446	8.7185	0.34425	0.1515:0.7735:0.0:0.075	.	62;85;329	Q2TAJ5;O43687;Q9P0M2	.;AKA7A_HUMAN;AKA7G_HUMAN	R	329;307;65;62;85	ENSP00000405252:S329R;ENSP00000357105:S307R	ENSP00000263050:S65R	S	+	3	2	AKAP7	131644499	0.999000	0.42202	0.994000	0.49952	0.944000	0.59088	2.250000	0.43178	2.837000	0.97791	0.655000	0.94253	AGC	-	HMMPfam_AKAP7_RIRII_bdg		0.532	AKAP7-001	NOVEL	basic|appris_principal|CCDS	protein_coding	AKAP7	protein_coding	OTTHUMT00000042209.2	C	NM_004842		131644499	+1	no_errors	NM_016377	genbank	human	reviewed	54_36p	missense	SNP	0.961	G
BCLAF1	9774	genome.wustl.edu	37	6	136597138	136597138	+	Missense_Mutation	SNP	A	A	G			TCGA-29-1769-01A-01W-0639-09	TCGA-29-1769-10A-01W-0639-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	6e3821b5-a446-4b2d-9ede-6be24af88e5e	093609c2-c2b8-41d0-85ac-c69048b9b06b	g.chr6:136597138A>G	ENST00000531224.1	-	5	1777	c.1525T>C	c.(1525-1527)Ttt>Ctt	p.F509L	BCLAF1_ENST00000527536.1_Missense_Mutation_p.F509L|BCLAF1_ENST00000530767.1_Intron|BCLAF1_ENST00000527759.1_Missense_Mutation_p.F507L|BCLAF1_ENST00000392348.2_Missense_Mutation_p.F507L|BCLAF1_ENST00000353331.4_Missense_Mutation_p.F507L	NM_001077441.1|NM_014739.2	NP_001070909.1|NP_055554.1	Q9NYF8	BCLF1_HUMAN	BCL2-associated transcription factor 1	509					apoptotic process (GO:0006915)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA-templated transcription, initiation (GO:2000144)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of response to DNA damage stimulus (GO:2001022)|regulation of DNA-templated transcription in response to stress (GO:0043620)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|ovary(1)|skin(1)	9	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)		CTGTAATCAAAGAGGTCTTTG	0.398																																					Colon(142;1534 1789 5427 7063 28491)											0			6											213.0	223.0	220.0					6																	136597138		2202	4300	6502	136638831	SO:0001583	missense	9774			AF249273	CCDS5177.1, CCDS47485.1, CCDS47486.1, CCDS75525.1	6q22-q23	2007-03-02			ENSG00000029363	ENSG00000029363			16863	protein-coding gene	gene with protein product		612588				8724849, 10330179	Standard	NM_001077440		Approved	KIAA0164, BTF	uc003qgx.1	Q9NYF8	OTTHUMG00000033323	ENST00000531224.1:c.1525T>C	6.37:g.136597138A>G	ENSP00000435210:p.Phe509Leu		136638831	A2RU75|B7ZM58|E1P586|Q14673|Q86WU6|Q86WY0	Missense_Mutation	SNP	NULL	p.F509L	ENST00000531224.1	37	c.1525	CCDS5177.1	6	.	.	.	.	.	.	.	.	.	.	A	18.68	3.674917	0.67928	.	.	ENSG00000029363	ENST00000531224;ENST00000353331;ENST00000527536;ENST00000527759;ENST00000392348;ENST00000529826	T;T;T;T;T;T	0.14022	2.54;2.54;2.54;2.54;2.54;2.54	5.46	5.46	0.80206	.	0.000000	0.64402	D	0.000003	T	0.09862	0.0242	N	0.08118	0	0.80722	D	1	P;D;P	0.57257	0.955;0.979;0.955	P;P;P	0.61477	0.777;0.889;0.777	T	0.40175	-0.9577	10	0.38643	T	0.18	-9.8055	15.8878	0.79264	1.0:0.0:0.0:0.0	.	507;507;509	Q9NYF8-2;Q9NYF8-3;Q9NYF8	.;.;BCLF1_HUMAN	L	509;507;509;507;507;509	ENSP00000435210:F509L;ENSP00000229446:F507L;ENSP00000435441:F509L;ENSP00000434826:F507L;ENSP00000376159:F507L;ENSP00000431734:F509L	ENSP00000229446:F507L	F	-	1	0	BCLAF1	136638831	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.446000	0.80609	2.214000	0.71695	0.373000	0.22412	TTT	-	NULL		0.398	BCLAF1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BCLAF1	protein_coding	OTTHUMT00000042375.2	A	NM_014739		136638831	-1	no_errors	NM_014739	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
CLCN1	1180	genome.wustl.edu	37	7	143029909	143029909	+	Silent	SNP	G	G	A			TCGA-29-1769-01A-01W-0639-09	TCGA-29-1769-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	6e3821b5-a446-4b2d-9ede-6be24af88e5e	093609c2-c2b8-41d0-85ac-c69048b9b06b	g.chr7:143029909G>A	ENST00000343257.2	+	12	1431	c.1344G>A	c.(1342-1344)gtG>gtA	p.V448V		NM_000083.2	NP_000074	P35523	CLCN1_HUMAN	chloride channel, voltage-sensitive 1	448					chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|neuronal action potential propagation (GO:0019227)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	adenyl nucleotide binding (GO:0030554)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)			breast(4)|central_nervous_system(1)|endometrium(1)|large_intestine(11)|lung(26)|ovary(3)|prostate(2)|skin(7)|stomach(1)|upper_aerodigestive_tract(2)	58	Melanoma(164;0.205)					AGTCAGCTGTGTGGATTCACC	0.512																																																0			7											184.0	162.0	169.0					7																	143029909		2203	4300	6503	142740031	SO:0001819	synonymous_variant	1180			Z25884	CCDS5881.1	7q12	2012-09-26	2012-02-23		ENSG00000188037	ENSG00000188037		"""Ion channels / Chloride channels : Voltage-sensitive"""	2019	protein-coding gene	gene with protein product	"""Thomsen disease, autosomal dominant"""	118425	"""chloride channel 1, skeletal muscle"""			1379744	Standard	NM_000083		Approved	CLC1, ClC-1	uc003wcr.1	P35523	OTTHUMG00000152695	ENST00000343257.2:c.1344G>A	7.37:g.143029909G>A			142740031	A4D2H5|Q2M202	Silent	SNP	superfamily_Clc chloride channel,HMMPfam_Voltage_CLC,superfamily_CBS-domain,HMMPfam_CBS	p.V448	ENST00000343257.2	37	c.1344	CCDS5881.1	7																																																																																			-	superfamily_Clc chloride channel,HMMPfam_Voltage_CLC		0.512	CLCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLCN1	protein_coding	OTTHUMT00000327420.1	G	NM_000083		142740031	+1	no_errors	NM_000083	genbank	human	reviewed	54_36p	silent	SNP	0.995	A
FBXO38	81545	genome.wustl.edu	37	5	147785856	147785856	+	Missense_Mutation	SNP	C	C	A			TCGA-29-1769-01A-01W-0639-09	TCGA-29-1769-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	6e3821b5-a446-4b2d-9ede-6be24af88e5e	093609c2-c2b8-41d0-85ac-c69048b9b06b	g.chr5:147785856C>A	ENST00000340253.5	+	7	935	c.767C>A	c.(766-768)aCa>aAa	p.T256K	FBXO38_ENST00000513826.1_Missense_Mutation_p.T256K|FBXO38_ENST00000296701.6_Missense_Mutation_p.T256K|FBXO38_ENST00000394370.3_Missense_Mutation_p.T256K|FBXO38_ENST00000509699.2_3'UTR			Q6PIJ6	FBX38_HUMAN	F-box protein 38	256					cell death (GO:0008219)	cytoplasm (GO:0005737)|nucleus (GO:0005634)			ATG4C/FBXO38(2)	NS(1)|breast(2)|endometrium(7)|kidney(5)|large_intestine(9)|lung(15)|ovary(5)|prostate(2)|skin(2)|stomach(2)|urinary_tract(1)	51			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCTTTAGTAACAGGCTTAGCC	0.373																																																0			5											90.0	91.0	91.0					5																	147785856		2203	4300	6503	147766049	SO:0001583	missense	81545			BC005873	CCDS43384.1, CCDS64285.1	5q33.1	2008-02-05			ENSG00000145868	ENSG00000145868		"""F-boxes /  ""other"""""	28844	protein-coding gene	gene with protein product		608533				12477932	Standard	NM_030793		Approved	MOKA, SP329, FLJ13962, Fbx38	uc003lpg.2	Q6PIJ6	OTTHUMG00000129929	ENST00000340253.5:c.767C>A	5.37:g.147785856C>A	ENSP00000342023:p.Thr256Lys		147766049	Q6PK72|Q7Z2U0|Q86VN3|Q9BXY6|Q9H837|Q9HC40	Missense_Mutation	SNP	superfamily_F-box domain,HMMPfam_F-box,superfamily_RNI-like	p.T256K	ENST00000340253.5	37	c.767		5	.	.	.	.	.	.	.	.	.	.	C	29.6	5.024203	0.93462	.	.	ENSG00000145868	ENST00000340253;ENST00000296701;ENST00000394370;ENST00000513826	T;T;T;T	0.34472	2.32;1.36;2.32;1.36	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	T	0.51568	0.1682	L	0.32530	0.975	0.80722	D	1	D;D;D	0.76494	0.996;0.996;0.999	D;D;D	0.83275	0.922;0.922;0.996	T	0.51293	-0.8724	10	0.66056	D	0.02	-13.5855	18.2787	0.90092	0.0:1.0:0.0:0.0	.	256;256;256	Q6PIJ6-3;Q6PIJ6-2;Q6PIJ6	.;.;FBX38_HUMAN	K	256	ENSP00000342023:T256K;ENSP00000296701:T256K;ENSP00000377895:T256K;ENSP00000426410:T256K	ENSP00000296701:T256K	T	+	2	0	FBXO38	147766049	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.487000	0.81328	2.749000	0.94314	0.655000	0.94253	ACA	-	superfamily_RNI-like		0.373	FBXO38-002	KNOWN	basic|appris_principal	protein_coding	FBXO38	protein_coding	OTTHUMT00000252185.2	C	NM_030793		147766049	+1	no_errors	NM_205836	genbank	human	validated	54_36p	missense	SNP	1.000	A
CUL1	8454	genome.wustl.edu	37	7	148484102	148484102	+	Missense_Mutation	SNP	G	G	C			TCGA-29-1769-01A-01W-0639-09	TCGA-29-1769-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	6e3821b5-a446-4b2d-9ede-6be24af88e5e	093609c2-c2b8-41d0-85ac-c69048b9b06b	g.chr7:148484102G>C	ENST00000325222.4	+	13	1648	c.1369G>C	c.(1369-1371)Gaa>Caa	p.E457Q	CUL1_ENST00000602748.1_Missense_Mutation_p.E457Q|CUL1_ENST00000409469.1_Missense_Mutation_p.E457Q	NM_003592.2	NP_003583.2	Q13616	CUL1_HUMAN	cullin 1	457					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway (GO:0097193)|mitotic cell cycle (GO:0000278)|negative regulation of cell proliferation (GO:0008285)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein monoubiquitination (GO:0006513)|protein ubiquitination (GO:0016567)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|viral process (GO:0016032)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|SCF ubiquitin ligase complex (GO:0019005)				breast(2)|central_nervous_system(2)|endometrium(1)|kidney(5)|large_intestine(10)|liver(2)|lung(10)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	40	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00291)			CAAGTACATAGAAGACAAAGA	0.507																																																0			7											135.0	127.0	130.0					7																	148484102		2203	4300	6503	148115035	SO:0001583	missense	8454			U58087	CCDS34772.1	7q36.1	2011-05-24			ENSG00000055130	ENSG00000055130			2551	protein-coding gene	gene with protein product		603134				8681378	Standard	NM_003592		Approved		uc003wey.3	Q13616	OTTHUMG00000152776	ENST00000325222.4:c.1369G>C	7.37:g.148484102G>C	ENSP00000326804:p.Glu457Gln		148115035	D3DWG3|O60719|Q08AL6|Q8IYW1	Missense_Mutation	SNP	"superfamily_Cullin repeat,HMMPfam_Cullin,superfamily_Cullin homology domain,HMMSmart_SM00182,superfamily_""Winged helix"" DNA-binding domain,HMMPfam_Cullin_Nedd8,PatternScan_CULLIN_1"	p.E457Q	ENST00000325222.4	37	c.1369	CCDS34772.1	7	.	.	.	.	.	.	.	.	.	.	G	33	5.270010	0.95429	.	.	ENSG00000055130	ENST00000409469;ENST00000325222;ENST00000543583;ENST00000433865	T;T	0.75154	-0.91;-0.91	5.81	5.81	0.92471	Cullin, N-terminal (1);Cullin homology (3);	0.048140	0.85682	D	0.000000	T	0.82199	0.4985	L	0.48362	1.52	0.80722	D	1	B;D	0.89917	0.303;1.0	B;D	0.69654	0.055;0.965	T	0.76971	-0.2761	10	0.23891	T	0.37	-40.5521	20.0825	0.97783	0.0:0.0:1.0:0.0	.	384;457	E7EWR0;Q13616	.;CUL1_HUMAN	Q	457;457;415;384	ENSP00000387160:E457Q;ENSP00000326804:E457Q	ENSP00000326804:E457Q	E	+	1	0	CUL1	148115035	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	9.467000	0.97671	2.746000	0.94184	0.655000	0.94253	GAA	-	HMMPfam_Cullin,superfamily_Cullin homology domain,HMMSmart_SM00182		0.507	CUL1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CUL1	protein_coding	OTTHUMT00000467785.1	G	NM_003592		148115035	+1	no_errors	NM_003592	genbank	human	validated	54_36p	missense	SNP	1.000	C
SLC36A3	285641	genome.wustl.edu	37	5	150660715	150660715	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1769-01A-01W-0639-09	TCGA-29-1769-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	6e3821b5-a446-4b2d-9ede-6be24af88e5e	093609c2-c2b8-41d0-85ac-c69048b9b06b	g.chr5:150660715G>A	ENST00000335230.3	-	9	1415	c.1004C>T	c.(1003-1005)tCt>tTt	p.S335F	SLC36A3_ENST00000377713.3_Missense_Mutation_p.S376F	NM_181774.3	NP_861439.3	Q495N2	S36A3_HUMAN	solute carrier family 36, member 3	335						integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(6)|ovary(2)|skin(1)|stomach(2)|urinary_tract(2)	21		Medulloblastoma(196;0.109)|all_hematologic(541;0.243)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GATGCCGATAGAGTACATCAG	0.517																																																0			5											221.0	170.0	187.0					5																	150660715		2203	4300	6503	150640908	SO:0001583	missense	285641			AY162215	CCDS4314.1, CCDS47316.1	5q33.1	2013-07-17	2013-07-17		ENSG00000186334	ENSG00000186334		"""Solute carriers"""	19659	protein-coding gene	gene with protein product		608332				12809675	Standard	NM_181774		Approved	PAT3, TRAMD2, tramdorin2	uc003ltw.2	Q495N2	OTTHUMG00000130128	ENST00000335230.3:c.1004C>T	5.37:g.150660715G>A	ENSP00000334750:p.Ser335Phe		150640908	Q495N3|Q6ZMU7|Q6ZRU4|Q7Z6B4	Missense_Mutation	SNP	HMMPfam_Aa_trans	p.S335F	ENST00000335230.3	37	c.1004	CCDS4314.1	5	.	.	.	.	.	.	.	.	.	.	G	19.43	3.825711	0.71143	.	.	ENSG00000186334	ENST00000335230;ENST00000377713	T;T	0.02258	4.37;4.37	4.06	4.06	0.47325	.	0.114234	0.64402	D	0.000008	T	0.15392	0.0371	M	0.89601	3.045	0.58432	D	0.999999	D;P;D	0.61080	0.989;0.815;0.957	D;P;P	0.64776	0.929;0.619;0.875	T	0.03981	-1.0987	10	0.87932	D	0	-12.9579	16.7998	0.85611	0.0:0.0:1.0:0.0	.	376;335;320	Q495N2-3;Q495N2;Q495N2-2	.;S36A3_HUMAN;.	F	335;376	ENSP00000334750:S335F;ENSP00000366942:S376F	ENSP00000334750:S335F	S	-	2	0	SLC36A3	150640908	1.000000	0.71417	0.896000	0.35187	0.937000	0.57800	3.855000	0.55957	2.249000	0.74217	0.561000	0.74099	TCT	-	HMMPfam_Aa_trans		0.517	SLC36A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC36A3	protein_coding	OTTHUMT00000252436.1	G	NM_181774		150640908	-1	no_errors	NM_181774	genbank	human	validated	54_36p	missense	SNP	0.986	A
TTC21B	79809	genome.wustl.edu	37	2	166797588	166797588	+	Missense_Mutation	SNP	T	T	G			TCGA-29-1769-01A-01W-0639-09	TCGA-29-1769-10A-01W-0639-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	6e3821b5-a446-4b2d-9ede-6be24af88e5e	093609c2-c2b8-41d0-85ac-c69048b9b06b	g.chr2:166797588T>G	ENST00000243344.7	-	6	796	c.659A>C	c.(658-660)aAa>aCa	p.K220T	AC010127.5_ENST00000443032.1_RNA|AC010127.5_ENST00000440322.1_RNA	NM_024753.4	NP_079029.3	Q7Z4L5	TT21B_HUMAN	tetratricopeptide repeat domain 21B	220					forebrain dorsal/ventral pattern formation (GO:0021798)|intraciliary retrograde transport (GO:0035721)|intraciliary transport involved in cilium morphogenesis (GO:0035735)|protein localization to cilium (GO:0061512)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|smoothened signaling pathway (GO:0007224)|ventricular system development (GO:0021591)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intraciliary transport particle A (GO:0030991)|nuclear chromatin (GO:0000790)				breast(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(9)|lung(28)|ovary(2)|pancreas(2)|skin(2)|urinary_tract(1)	58						TAGTTGTAATTTCATTTTCTT	0.403																																																0			2											105.0	103.0	104.0					2																	166797588		2203	4300	6503	166505834	SO:0001583	missense	79809			AB082523	CCDS33315.1	2q24.3	2014-09-04			ENSG00000123607	ENSG00000123607		"""Tetratricopeptide (TTC) repeat domain containing"", ""Intraflagellar transport homologs"""	25660	protein-coding gene	gene with protein product		612014				12056414, 21258341	Standard	NM_024753		Approved	FLJ11457, JBTS11, NPHP12, IFT139, THM1	uc002udk.3	Q7Z4L5	OTTHUMG00000154083	ENST00000243344.7:c.659A>C	2.37:g.166797588T>G	ENSP00000243344:p.Lys220Thr		166505834	A8MUZ3|Q3LIE4|Q53T84|Q6P4A1|Q6PIF5|Q8NCN3|Q96MA4|Q9HAK8	Missense_Mutation	SNP	superfamily_TPR-like,HMMPfam_TPR_1,HMMSmart_SM00028	p.K220T	ENST00000243344.7	37	c.659	CCDS33315.1	2	.	.	.	.	.	.	.	.	.	.	T	24.7	4.560814	0.86335	.	.	ENSG00000123607	ENST00000243344	T	0.50813	0.73	5.38	5.38	0.77491	Tetratricopeptide-like helical (1);	0.044669	0.85682	D	0.000000	T	0.67813	0.2933	M	0.81802	2.56	0.80722	D	1	D;D	0.67145	0.996;0.985	P;P	0.61397	0.888;0.731	T	0.72833	-0.4173	10	0.62326	D	0.03	-25.1854	15.6847	0.77400	0.0:0.0:0.0:1.0	.	220;220	Q7Z4L5-2;Q7Z4L5	.;TT21B_HUMAN	T	220	ENSP00000243344:K220T	ENSP00000243344:K220T	K	-	2	0	TTC21B	166505834	1.000000	0.71417	0.997000	0.53966	0.959000	0.62525	6.249000	0.72427	2.165000	0.68154	0.528000	0.53228	AAA	-	superfamily_TPR-like		0.403	TTC21B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC21B	protein_coding	OTTHUMT00000333770.1	T	NM_024753		166505834	-1	no_errors	NM_024753	genbank	human	validated	54_36p	missense	SNP	1.000	G
TBP	6908	genome.wustl.edu	37	6	170871052	170871052	+	Silent	SNP	G	G	A	rs112083427|rs369312237	byFrequency	TCGA-29-1769-01A-01W-0639-09	TCGA-29-1769-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	6e3821b5-a446-4b2d-9ede-6be24af88e5e	093609c2-c2b8-41d0-85ac-c69048b9b06b	g.chr6:170871052G>A	ENST00000392092.2	+	3	507	c.228G>A	c.(226-228)caG>caA	p.Q76Q	TBP_ENST00000540980.1_Silent_p.Q56Q|TBP_ENST00000230354.6_Silent_p.Q76Q	NM_003194.4	NP_003185.1	P20226	TBP_HUMAN	TATA box binding protein	76	Poly-Gln.				cell death (GO:0008219)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|transcription factor TFIIA complex (GO:0005672)|transcription factor TFIID complex (GO:0005669)	repressing transcription factor binding (GO:0070491)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.Q76Q(4)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(1)	26		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		agcaacagcagcagcagcagc	0.572																																																4	Substitution - coding silent(4)	lung(3)|prostate(1)	6											14.0	19.0	17.0					6																	170871052		1952	3842	5794	170712977	SO:0001819	synonymous_variant	6908			M55654	CCDS5315.1, CCDS55077.1	6q27	2014-04-02			ENSG00000112592	ENSG00000112592		"""General transcription factors"""	11588	protein-coding gene	gene with protein product		600075		GTF2D1, SCA17		2194289, 11448935	Standard	NM_003194		Approved	TFIID	uc003qxu.3	P20226	OTTHUMG00000016084	ENST00000392092.2:c.228G>A	6.37:g.170871052G>A			170712977	B4E3B3|F5H869|Q16845|Q6IBM6|Q9UC02	Silent	SNP	superfamily_TFIID_C/glycos_N,HMMPfam_TBP,PatternScan_TFIID	p.Q76	ENST00000392092.2	37	c.228	CCDS5315.1	6																																																																																			-	NULL		0.572	TBP-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TBP	protein_coding	OTTHUMT00000043271.2	G	NM_003194		170712977	+1	no_errors	NM_003194	genbank	human	reviewed	54_36p	silent	SNP	0.973	A
GPR155	151556	genome.wustl.edu	37	2	175324626	175324626	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1769-01A-01W-0639-09	TCGA-29-1769-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	6e3821b5-a446-4b2d-9ede-6be24af88e5e	093609c2-c2b8-41d0-85ac-c69048b9b06b	g.chr2:175324626G>A	ENST00000392552.2	-	10	1989	c.1751C>T	c.(1750-1752)aCa>aTa	p.T584I	GPR155_ENST00000392551.2_Missense_Mutation_p.T584I|GPR155_ENST00000295500.4_Missense_Mutation_p.T584I	NM_001267051.1|NM_152529.6	NP_001253980.1|NP_689742.4	Q7Z3F1	GP155_HUMAN	G protein-coupled receptor 155	584					cognition (GO:0050890)|intracellular signal transduction (GO:0035556)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(2)|endometrium(5)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|stomach(2)|urinary_tract(2)	26						AATAGAGCTTGTAAAAAGTTC	0.398																																																0			2											69.0	68.0	68.0					2																	175324626		2203	4300	6503	175032872	SO:0001583	missense	151556			AY255528	CCDS2259.1, CCDS74605.1	2q31.1	2012-04-10			ENSG00000163328	ENSG00000163328			22951	protein-coding gene	gene with protein product						12679517	Standard	NM_001033045		Approved	DEPDC3, DEP.7, FLJ31819, PGR22	uc002uiu.4	Q7Z3F1	OTTHUMG00000132336	ENST00000392552.2:c.1751C>T	2.37:g.175324626G>A	ENSP00000376335:p.Thr584Ile		175032872	B2RCI2|D3DPE2|Q4G0Y6|Q53SJ3|Q53TA8|Q69YG8|Q86SP9|Q8N261|Q8N639|Q8N8K3|Q96MV6	Missense_Mutation	SNP	"HMMPfam_Mem_trans,superfamily_""Winged helix"" DNA-binding domain,HMMSmart_SM00049,HMMPfam_DEP"	p.T584I	ENST00000392552.2	37	c.1751	CCDS2259.1	2	.	.	.	.	.	.	.	.	.	.	G	12.84	2.058651	0.36277	.	.	ENSG00000163328	ENST00000392552;ENST00000510236;ENST00000392551;ENST00000295500	T;T;T	0.46819	0.86;0.86;0.86	5.89	5.01	0.66863	.	0.627413	0.18153	N	0.150022	T	0.36880	0.0983	L	0.36672	1.1	0.25928	N	0.983027	B;B	0.22983	0.078;0.055	B;B	0.18561	0.022;0.015	T	0.13202	-1.0518	10	0.35671	T	0.21	-2.9556	11.1109	0.48232	0.139:0.0:0.861:0.0	.	64;584	F5H464;Q7Z3F1	.;GP155_HUMAN	I	584;64;584;584	ENSP00000376335:T584I;ENSP00000376334:T584I;ENSP00000295500:T584I	ENSP00000295500:T584I	T	-	2	0	GPR155	175032872	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	4.443000	0.59994	2.793000	0.96121	0.561000	0.74099	ACA	-	NULL		0.398	GPR155-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR155	protein_coding	OTTHUMT00000255455.1	G	NM_152529		175032872	-1	no_errors	NM_001033045	genbank	human	validated	54_36p	missense	SNP	0.774	A
ABL2	27	genome.wustl.edu	37	1	179076961	179076961	+	Silent	SNP	C	C	T			TCGA-29-1769-01A-01W-0639-09	TCGA-29-1769-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	6e3821b5-a446-4b2d-9ede-6be24af88e5e	093609c2-c2b8-41d0-85ac-c69048b9b06b	g.chr1:179076961C>T	ENST00000502732.1	-	12	3644	c.3441G>A	c.(3439-3441)ctG>ctA	p.L1147L	ABL2_ENST00000408940.3_Silent_p.L1111L|ABL2_ENST00000367623.4_Silent_p.L1126L|ABL2_ENST00000512653.1_Silent_p.L1132L|ABL2_ENST00000511413.1_Silent_p.L1044L|ABL2_ENST00000504405.1_Silent_p.L1008L|ABL2_ENST00000344730.3_Silent_p.L1029L|ABL2_ENST00000507173.1_Silent_p.L1023L	NM_001168236.1|NM_001168237.1|NM_001168238.1|NM_007314.3	NP_001161708.1|NP_001161709.1|NP_001161710.1|NP_009298.1	P42684	ABL2_HUMAN	ABL proto-oncogene 2, non-receptor tyrosine kinase	1147	F-actin-binding. {ECO:0000250}.				actin filament bundle assembly (GO:0051017)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cellular protein modification process (GO:0006464)|cellular response to retinoic acid (GO:0071300)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of neuron projection development (GO:0010976)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of phospholipase C activity (GO:0010863)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of autophagy (GO:0010506)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of endocytosis (GO:0030100)|signal transduction (GO:0007165)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)	actin filament binding (GO:0051015)|actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)			breast(8)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	65					Adenosine triphosphate(DB00171)|Dasatinib(DB01254)	GTAGCTCCTGCAGGCTGAGTT	0.507			T	ETV6	AML																																		Dom	yes		1	1q24-q25	27	v-abl Abelson murine leukemia viral oncogene homolog 2		L	0			1											68.0	70.0	69.0					1																	179076961		2203	4300	6503	177343584	SO:0001819	synonymous_variant	27			M14904	CCDS30947.1, CCDS41441.1, CCDS44282.1, CCDS44283.1, CCDS41441.2, CCDS53435.1, CCDS53436.1, CCDS53437.1, CCDS53438.1	1q25.2	2014-06-26	2014-06-26		ENSG00000143322	ENSG00000143322		"""SH2 domain containing"""	77	protein-coding gene	gene with protein product	"""Abelson-related gene"""	164690	"""v-abl Abelson murine leukemia viral oncogene homolog 2 (arg, Abelson-related gene)"", ""v-abl Abelson murine leukemia viral oncogene homolog 2"", ""c-abl oncogene 2, non-receptor tyrosine kinase"""	ABLL		3787260	Standard	NM_001136001		Approved	ARG	uc001gmi.4	P42684	OTTHUMG00000035199	ENST00000502732.1:c.3441G>A	1.37:g.179076961C>T			177343584	A0M8X0|B7UEF2|B7UEF3|B7UEF4|B7UEF5|Q5T0X6|Q5W0C5|Q6NZY6|Q7Z301	Silent	SNP	superfamily_SH3-domain,HMMPfam_SH3_1,HMMSmart_SM00326,superfamily_SH2 domain,HMMSmart_SM00252,HMMPfam_SH2,superfamily_Protein kinase-like (PK-like),HMMPfam_Pkinase_Tyr,HMMSmart_SM00219,HMMSmart_SM00220,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_TYR,HMMPfam_F_actin_bind,HMMSmart_SM00808	p.L1147	ENST00000502732.1	37	c.3441	CCDS30947.1	1																																																																																			-	HMMPfam_F_actin_bind,HMMSmart_SM00808		0.507	ABL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ABL2	protein_coding	OTTHUMT00000085174.3	C	NM_005158		177343584	-1	no_errors	NM_007314	genbank	human	reviewed	54_36p	silent	SNP	1.000	T
PTGS2	5743	genome.wustl.edu	37	1	186643623	186643623	+	Silent	SNP	C	C	T			TCGA-29-1769-01A-01W-0639-09	TCGA-29-1769-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	6e3821b5-a446-4b2d-9ede-6be24af88e5e	093609c2-c2b8-41d0-85ac-c69048b9b06b	g.chr1:186643623C>T	ENST00000367468.5	-	10	1813	c.1677G>A	c.(1675-1677)aaG>aaA	p.K559K	PTGS2_ENST00000490885.2_5'UTR	NM_000963.2	NP_000954.1	P35354	PGH2_HUMAN	prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase)	559					anagen (GO:0042640)|angiogenesis (GO:0001525)|arachidonic acid metabolic process (GO:0019369)|bone mineralization (GO:0030282)|brown fat cell differentiation (GO:0050873)|cellular component movement (GO:0006928)|cellular response to ATP (GO:0071318)|cellular response to hypoxia (GO:0071456)|cellular response to mechanical stimulus (GO:0071260)|cellular response to UV (GO:0034644)|cyclooxygenase pathway (GO:0019371)|decidualization (GO:0046697)|embryo implantation (GO:0007566)|inflammatory response (GO:0006954)|learning (GO:0007612)|lipoxygenase pathway (GO:0019372)|maintenance of blood-brain barrier (GO:0035633)|memory (GO:0007613)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|negative regulation of smooth muscle contraction (GO:0045986)|negative regulation of synaptic transmission, dopaminergic (GO:0032227)|ovulation (GO:0030728)|positive regulation of apoptotic process (GO:0043065)|positive regulation of brown fat cell differentiation (GO:0090336)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|positive regulation of fever generation (GO:0031622)|positive regulation of fibroblast growth factor production (GO:0090271)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of platelet-derived growth factor production (GO:0090362)|positive regulation of prostaglandin biosynthetic process (GO:0031394)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of synaptic plasticity (GO:0031915)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transforming growth factor beta production (GO:0071636)|positive regulation of vasoconstriction (GO:0045907)|positive regulation vascular endothelial growth factor production (GO:0010575)|prostaglandin biosynthetic process (GO:0001516)|prostaglandin metabolic process (GO:0006693)|regulation of blood pressure (GO:0008217)|regulation of inflammatory response (GO:0050727)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to fatty acid (GO:0070542)|response to fructose (GO:0009750)|response to glucocorticoid (GO:0051384)|response to lipopolysaccharide (GO:0032496)|response to lithium ion (GO:0010226)|response to manganese ion (GO:0010042)|response to oxidative stress (GO:0006979)|response to tumor necrosis factor (GO:0034612)|response to vitamin D (GO:0033280)|sensory perception of pain (GO:0019233)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|neuron projection (GO:0043005)|nucleus (GO:0005634)|protein complex (GO:0043234)	arachidonate 15-lipoxygenase activity (GO:0050473)|enzyme binding (GO:0019899)|heme binding (GO:0020037)|lipid binding (GO:0008289)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)|prostaglandin-endoperoxide synthase activity (GO:0004666)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	27					Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Aldesleukin(DB00041)|Aminosalicylic Acid(DB00233)|Antipyrine(DB01435)|Antrafenine(DB01419)|Balsalazide(DB01014)|Bromfenac(DB00963)|Bumetanide(DB00887)|Carprofen(DB00821)|Celecoxib(DB00482)|Chlorphenesin(DB00856)|Cisplatin(DB00515)|Clodronate(DB00720)|Dapsone(DB00250)|Desmopressin(DB00035)|Diclofenac(DB00586)|Diflunisal(DB00861)|Dihomo-gamma-linolenic acid(DB00154)|Drospirenone(DB01395)|Etanercept(DB00005)|Etodolac(DB00749)|Etoposide(DB00773)|Etoricoxib(DB01628)|Fenoprofen(DB00573)|Flurbiprofen(DB00712)|Ginseng(DB01404)|Ibuprofen(DB01050)|Icosapent(DB00159)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Ketorolac(DB00465)|Lenalidomide(DB00480)|Lornoxicam(DB06725)|Lumiracoxib(DB01283)|Magnesium salicylate(DB01397)|Meclofenamic acid(DB00939)|Mefenamic acid(DB00784)|Meloxicam(DB00814)|Mesalazine(DB00244)|Nabumetone(DB00461)|Naproxen(DB00788)|Nepafenac(DB06802)|Niflumic Acid(DB04552)|Nonoxynol-9(DB06804)|Oxaprozin(DB00991)|Phenylbutazone(DB00812)|Piroxicam(DB00554)|Pomalidomide(DB08910)|Risedronate(DB00884)|Salicylate-sodium(DB01398)|Salicylic acid(DB00936)|Salsalate(DB01399)|Sulfasalazine(DB00795)|Sulindac(DB00605)|Suprofen(DB00870)|Tafluprost(DB08819)|Tenoxicam(DB00469)|Tetrahydrobiopterin(DB00360)|Thalidomide(DB01041)|Tiaprofenic acid(DB01600)|Tolmetin(DB00500)|Triamcinolone(DB00620)|Trisalicylate-choline(DB01401)	AGGGACAGCCCTTCACGTTAT	0.453																																																0			1											183.0	165.0	171.0					1																	186643623		2203	4300	6503	184910246	SO:0001819	synonymous_variant	5743			D28235	CCDS1371.1	1q25.2-q25.3	2008-02-05			ENSG00000073756	ENSG00000073756	1.14.99.1		9605	protein-coding gene	gene with protein product		600262				1380156	Standard	NM_000963		Approved	COX2	uc001gsb.3	P35354	OTTHUMG00000035473	ENST00000367468.5:c.1677G>A	1.37:g.186643623C>T			184910246	A8K802|Q16876	Silent	SNP	superfamily_EGF/Laminin,HMMPfam_EGF,superfamily_Heme-dependent peroxidases,HMMPfam_An_peroxidase	p.K559	ENST00000367468.5	37	c.1677	CCDS1371.1	1																																																																																			-	superfamily_Heme-dependent peroxidases,HMMPfam_An_peroxidase		0.453	PTGS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTGS2	protein_coding	OTTHUMT00000086157.2	C	NM_000963		184910246	-1	no_errors	NM_000963	genbank	human	reviewed	54_36p	silent	SNP	0.992	T
PAK2	5062	genome.wustl.edu	37	3	196529942	196529942	+	Missense_Mutation	SNP	G	G	C			TCGA-29-1769-01A-01W-0639-09	TCGA-29-1769-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	6e3821b5-a446-4b2d-9ede-6be24af88e5e	093609c2-c2b8-41d0-85ac-c69048b9b06b	g.chr3:196529942G>C	ENST00000327134.3	+	4	665	c.343G>C	c.(343-345)Gag>Cag	p.E115Q		NM_002577.4	NP_002568.2	Q13177	PAK2_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 2	115	Autoregulatory region. {ECO:0000250}.				apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in execution phase of apoptosis (GO:2001271)|negative regulation of protein kinase activity (GO:0006469)|peptidyl-serine phosphorylation (GO:0018105)|phosphorylation (GO:0016310)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein tyrosine kinase activity (GO:0061098)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of defense response to virus by virus (GO:0050690)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activator activity (GO:0030296)			breast(1)|cervix(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)	12	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;1.07e-23)|all cancers(36;6.38e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.5e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00405)		CACCAAACTAGAGCAAAAGAA	0.418																																																0			3											99.0	87.0	91.0					3																	196529942		2203	4300	6503	198014339	SO:0001583	missense	5062			U24153	CCDS3321.1	3q29	2008-06-17	2008-06-17			ENSG00000180370	2.7.11.1		8591	protein-coding gene	gene with protein product	"""S6/H4 kinase"""	605022	"""p21 (CDKN1A)-activated kinase 2"""			7744004, 7618083	Standard	NM_002577		Approved	PAK65, PAKgamma	uc003fwy.4	Q13177		ENST00000327134.3:c.343G>C	3.37:g.196529942G>C	ENSP00000314067:p.Glu115Gln		198014339	Q13154|Q6ISC3	Missense_Mutation	SNP	HMMPfam_PBD,HMMSmart_PBD,superfamily_Kinase_like,HMMSmart_S_TKc,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_ST	p.E115Q	ENST00000327134.3	37	c.343	CCDS3321.1	3	.	.	.	.	.	.	.	.	.	.	G	24.3	4.514879	0.85389	.	.	ENSG00000180370	ENST00000327134	D	0.87809	-2.3	5.51	4.64	0.57946	PAK-box/P21-Rho-binding (1);	0.046468	0.85682	D	0.000000	D	0.93223	0.7841	M	0.83118	2.625	0.80722	D	1	D	0.76494	0.999	D	0.79784	0.993	D	0.93676	0.6994	10	0.62326	D	0.03	.	13.3641	0.60674	0.0759:0.0:0.9241:0.0	.	115	Q13177	PAK2_HUMAN	Q	115	ENSP00000314067:E115Q	ENSP00000314067:E115Q	E	+	1	0	PAK2	198014339	1.000000	0.71417	0.973000	0.42090	0.998000	0.95712	9.430000	0.97488	1.335000	0.45486	0.563000	0.77884	GAG	-	HMMPfam_PBD		0.418	PAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAK2	protein_coding	OTTHUMT00000340548.1	G	NM_002577		198014339	+1	no_errors	NM_002577	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
CACNA1S	779	genome.wustl.edu	37	1	201010687	201010687	+	Missense_Mutation	SNP	C	C	G			TCGA-29-1769-01A-01W-0639-09	TCGA-29-1769-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	6e3821b5-a446-4b2d-9ede-6be24af88e5e	093609c2-c2b8-41d0-85ac-c69048b9b06b	g.chr1:201010687C>G	ENST00000362061.3	-	41	5305	c.5079G>C	c.(5077-5079)gaG>gaC	p.E1693D	RP11-168O16.2_ENST00000415359.1_RNA|CACNA1S_ENST00000367338.3_Missense_Mutation_p.E1674D	NM_000069.2	NP_000060.2	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type, alpha 1S subunit	1693					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport (GO:0006816)|endoplasmic reticulum organization (GO:0007029)|extraocular skeletal muscle development (GO:0002074)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|myoblast fusion (GO:0007520)|neuromuscular junction development (GO:0007528)|skeletal muscle adaptation (GO:0043501)|skeletal muscle fiber development (GO:0048741)|skeletal system development (GO:0001501)|striated muscle contraction (GO:0006941)	cytoplasm (GO:0005737)|I band (GO:0031674)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(19)|lung(37)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	102					Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	GCGTCTCTGTCTCTTCTGGGA	0.567																																																0			1											82.0	68.0	73.0					1																	201010687		2203	4300	6503	199277310	SO:0001583	missense	779			L33798	CCDS1407.1	1q32	2012-03-07			ENSG00000081248	ENSG00000081248		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1397	protein-coding gene	gene with protein product		114208		HOKPP, MHS5, CACNL1A3		7916735, 16382099	Standard	NM_000069		Approved	Cav1.1, hypoPP	uc001gvv.3	Q13698	OTTHUMG00000035784	ENST00000362061.3:c.5079G>C	1.37:g.201010687C>G	ENSP00000355192:p.Glu1693Asp		199277310	A4IF51|B1ALM2|Q12896|Q13934	Missense_Mutation	SNP	superfamily_SSF81324,HMMPfam_Ion_trans,HMMPfam_Ca_chan_IQ	p.E1693D	ENST00000362061.3	37	c.5079	CCDS1407.1	1	.	.	.	.	.	.	.	.	.	.	.	8.892	0.954292	0.18431	.	.	ENSG00000081248	ENST00000362061;ENST00000367338	D;D	0.96041	-3.89;-3.82	3.98	2.03	0.26663	.	7739.340000	0.00166	U	0.000000	D	0.90909	0.7143	L	0.29908	0.895	0.09310	N	1	B	0.19817	0.039	B	0.19148	0.024	T	0.79967	-0.1580	10	0.15499	T	0.54	.	5.1233	0.14871	0.0:0.6696:0.2143:0.1161	.	1693	Q13698	CAC1S_HUMAN	D	1693;1674	ENSP00000355192:E1693D;ENSP00000356307:E1674D	ENSP00000355192:E1693D	E	-	3	2	CACNA1S	199277310	0.005000	0.15991	0.003000	0.11579	0.070000	0.16714	0.119000	0.15626	0.603000	0.29913	0.462000	0.41574	GAG	-	NULL		0.567	CACNA1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNA1S	protein_coding	OTTHUMT00000087049.1	C	NM_000069		199277310	-1	no_errors	NM_000069	genbank	human	reviewed	54_36p	missense	SNP	0.007	G
MAP2	4133	genome.wustl.edu	37	2	210558691	210558691	+	Missense_Mutation	SNP	A	A	C			TCGA-29-1769-01A-01W-0639-09	TCGA-29-1769-10A-01W-0639-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	6e3821b5-a446-4b2d-9ede-6be24af88e5e	093609c2-c2b8-41d0-85ac-c69048b9b06b	g.chr2:210558691A>C	ENST00000360351.4	+	7	2303	c.1797A>C	c.(1795-1797)agA>agC	p.R599S	MAP2_ENST00000447185.1_Missense_Mutation_p.R595S|MAP2_ENST00000361559.4_Intron|MAP2_ENST00000199940.6_Intron|MAP2_ENST00000392194.1_Intron	NM_002374.3	NP_002365.3	P11137	MTAP2_HUMAN	microtubule-associated protein 2	599					axonogenesis (GO:0007409)|cellular response to organic substance (GO:0071310)|central nervous system neuron development (GO:0021954)|dendrite morphogenesis (GO:0048813)|microtubule bundle formation (GO:0001578)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|nuclear periphery (GO:0034399)	dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)			breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(36)|liver(2)|lung(42)|ovary(11)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	124		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Docetaxel(DB01248)|Estramustine(DB01196)|Paclitaxel(DB01229)	GTGACACTAGAGAAAGTGTCC	0.423																																					Pancreas(27;423 979 28787 29963)											0			2											85.0	81.0	82.0					2																	210558691		2203	4300	6503	210266936	SO:0001583	missense	4133				CCDS2384.1, CCDS2385.1, CCDS33369.1	2q34-q35	2008-05-27			ENSG00000078018	ENSG00000078018		"""A-kinase anchor proteins"""	6839	protein-coding gene	gene with protein product		157130				3103857, 7479905	Standard	XM_005246554		Approved	MAP2A, MAP2B, MAP2C	uc002vde.1	P11137	OTTHUMG00000132962	ENST00000360351.4:c.1797A>C	2.37:g.210558691A>C	ENSP00000353508:p.Arg599Ser		210266936	Q17S04|Q8IUX2|Q99975|Q99976	Missense_Mutation	SNP	HMMPfam_RII_binding_1,HMMPfam_MAP2_projctn,HMMPfam_Tubulin-binding,PatternScan_TAU_MAP	p.R599S	ENST00000360351.4	37	c.1797	CCDS2384.1	2	.	.	.	.	.	.	.	.	.	.	A	14.39	2.520505	0.44866	.	.	ENSG00000078018	ENST00000360351;ENST00000447185	T;T	0.26223	1.75;1.75	6.05	6.05	0.98169	MAP2/Tau projection (1);	0.089115	0.49916	D	0.000137	T	0.21387	0.0515	L	0.34521	1.04	0.38796	D	0.955094	B;B	0.22146	0.053;0.065	B;B	0.24701	0.032;0.055	T	0.06991	-1.0796	10	0.39692	T	0.17	-25.4175	11.6016	0.51006	0.9314:0.0:0.0686:0.0	.	595;599	P11137-3;P11137	.;MAP2_HUMAN	S	599;595	ENSP00000353508:R599S;ENSP00000392164:R595S	ENSP00000353508:R599S	R	+	3	2	MAP2	210266936	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.700000	0.47085	2.320000	0.78422	0.528000	0.53228	AGA	-	HMMPfam_MAP2_projctn		0.423	MAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAP2	protein_coding	OTTHUMT00000256521.2	A	NM_001039538		210266936	+1	no_errors	NM_002374	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
RYR2	6262	genome.wustl.edu	37	1	237951345	237951345	+	Missense_Mutation	SNP	G	G	C			TCGA-29-1769-01A-01W-0639-09	TCGA-29-1769-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	6e3821b5-a446-4b2d-9ede-6be24af88e5e	093609c2-c2b8-41d0-85ac-c69048b9b06b	g.chr1:237951345G>C	ENST00000366574.2	+	92	13703	c.13386G>C	c.(13384-13386)ttG>ttC	p.L4462F	RYR2_ENST00000360064.6_Missense_Mutation_p.L4468F|RYR2_ENST00000542537.1_Missense_Mutation_p.L4446F	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	4462					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			AACAAAAGTTGAGGCAGCTTC	0.398																																																0			1											87.0	96.0	93.0					1																	237951345		2095	4245	6340	236017968	SO:0001583	missense	6262			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.13386G>C	1.37:g.237951345G>C	ENSP00000355533:p.Leu4462Phe		236017968	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	HMMPfam_Ins145_P3_rec,HMMSmart_SM00472,HMMPfam_MIR,superfamily_MIR domain (Pfam 02815),HMMPfam_RYDR_ITPR,HMMPfam_SPRY,HMMSmart_SM00449,HMMPfam_RyR,HMMPfam_RIH_assoc,superfamily_EF-hand,HMMPfam_RR_TM4-6,HMMPfam_Ion_trans	p.L4462F	ENST00000366574.2	37	c.13386	CCDS55691.1	1	.	.	.	.	.	.	.	.	.	.	G	14.51	2.556059	0.45487	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.93426	-3.22;-3.22;-3.22	4.65	-3.1	0.05315	Ryanodine Receptor TM 4-6 (1);	0.140212	0.28011	U	0.016954	D	0.84683	0.5526	N	0.24115	0.695	0.31370	N	0.680257	B	0.28850	0.225	B	0.33521	0.165	T	0.75897	-0.3155	10	0.51188	T	0.08	.	5.5955	0.17325	0.3756:0.4562:0.1682:0.0	.	4462	Q92736	RYR2_HUMAN	F	4462;4468;4446	ENSP00000355533:L4462F;ENSP00000353174:L4468F;ENSP00000443798:L4446F	ENSP00000353174:L4468F	L	+	3	2	RYR2	236017968	0.034000	0.19679	0.033000	0.17914	0.849000	0.48306	0.197000	0.17197	-0.400000	0.07656	0.585000	0.79938	TTG	-	HMMPfam_RR_TM4-6		0.398	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	protein_coding	OTTHUMT00000095402.2	G	NM_001035		236017968	+1	no_errors	NM_001035	genbank	human	reviewed	54_36p	missense	SNP	0.151	C
