#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	SNP	T	T	C			TCGA-36-2545-01A-01D-1526-09	TCGA-36-2545-10A-01D-1526-09	T	T					Unknown	Invalid:failed_liftOver	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ff47cb75-3f83-4749-a21d-69bfa5eb6dbc	ee353276-9833-4604-a76f-c9f937999791	g.chrUnknown:0T>C								None (None upstream) : None (None downstream)																								0.0																																																0			MT																																								15542	SO:0001628	intergenic_variant	4519																															Unknown.37:g.0T>C			15542		Silent	SNP	superfamily_Transmembr_di-haem_cytochrome,HMMPfam_Cytochrom_B_N,HMMPfam_Cytochrom_B_C,superfamily_Cytochrome_b/b6_C	p.P265		37	c.795		MT																																																																																			-	HMMPfam_Cytochrom_B_C,superfamily_Cytochrome_b/b6_C	0	0					MT-CYB			T			15542	+1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000361789	ensembl	human	known	54_36p	silent	SNP	NULL	C
UNKL	64718	genome.wustl.edu	37	16	1449440	1449440	+	Silent	SNP	G	G	T			TCGA-36-2545-01A-01D-1526-09	TCGA-36-2545-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ff47cb75-3f83-4749-a21d-69bfa5eb6dbc	ee353276-9833-4604-a76f-c9f937999791	g.chr16:1449440G>T	ENST00000389221.4	-	5	668	c.669C>A	c.(667-669)ggC>ggA	p.G223G	UNKL_ENST00000508903.2_Silent_p.G223G|UNKL_ENST00000503648.1_5'Flank|UNKL_ENST00000301712.5_Silent_p.G223G|UNKL_ENST00000397462.1_Silent_p.G326G	NM_001193388.1	NP_001180317	Q9H9P5	UNKL_HUMAN	unkempt family zinc finger-like	223					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(1)|large_intestine(1)|lung(1)	4		Hepatocellular(780;0.0893)				GGCACGCATAGCCCTGGCGGC	0.657																																																0			16											35.0	30.0	32.0					16																	1449440		2193	4295	6488	1389441	SO:0001819	synonymous_variant	64718			BC011924	CCDS32359.1, CCDS53980.1, CCDS61787.1	16p13.3	2014-03-10	2013-10-17		ENSG00000059145	ENSG00000059145		"""Zinc fingers, CCCH-type domain containing"""	14184	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 28"", ""unkempt homolog (Drosophila)-like"""	C16orf28		20148946	Standard	NM_001193389		Approved	ZC3HDC5L, ZC3H5L, FLJ23360	uc031qup.1	Q9H9P5	OTTHUMG00000128553	ENST00000389221.4:c.669C>A	16.37:g.1449440G>T			1389441	B0QYN6|B1GXI8|Q96EV1|Q96RZ1|Q9BWL5|Q9H5K0|Q9UJJ8	Silent	SNP	HMMPfam_zf-CCCH,HMMSmart_ZnF_C3H1	p.G223	ENST00000389221.4	37	c.669	CCDS53981.1	16																																																																																			-	HMMSmart_ZnF_C3H1		0.657	UNKL-201	KNOWN	basic|CCDS	protein_coding	UNKL	protein_coding		G	NM_001037125		1389441	-1	no_errors	NM_001037125	genbank	human	validated	54_36p	silent	SNP	1.000	T
Unknown	0	genome.wustl.edu	37	6	1446413	1446413	+	IGR	SNP	C	C	T	rs74857467	byFrequency	TCGA-36-2545-01A-01D-1526-09	TCGA-36-2545-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ff47cb75-3f83-4749-a21d-69bfa5eb6dbc	ee353276-9833-4604-a76f-c9f937999791	g.chr6:1446413C>T								FOXF2 (50581 upstream) : RN7SL352P (61143 downstream)																							cgcccagggtcccatcatcag	0.562													C|||	32	0.00638978	0.0023	0.0072	5008	,	,		18325	0.0		0.0209	False		,,,				2504	0.0031															0			6																																								1391412	SO:0001628	intergenic_variant	0																															6.37:g.1446413C>T			1391412		Missense_Mutation	SNP	NULL	p.D89N		37	c.265		6																																																																																			-	NULL	0	0.562					LOC100133346			C			1391412	-1	no_start_codon:pseudogene:no_stop_codon	XM_001716166	genbank	human	model	54_36p	missense	SNP	0.000	T
ABCA3	21	genome.wustl.edu	37	16	2349517	2349517	+	Missense_Mutation	SNP	T	T	G			TCGA-36-2545-01A-01D-1526-09	TCGA-36-2545-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ff47cb75-3f83-4749-a21d-69bfa5eb6dbc	ee353276-9833-4604-a76f-c9f937999791	g.chr16:2349517T>G	ENST00000301732.5	-	14	2328	c.1628A>C	c.(1627-1629)aAt>aCt	p.N543T	ABCA3_ENST00000382381.3_Missense_Mutation_p.N485T	NM_001089.2	NP_001080.2	Q99758	ABCA3_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 3	543	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)	alveolar lamellar body (GO:0097208)|alveolar lamellar body membrane (GO:0097233)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(7)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(11)|liver(1)|lung(20)|ovary(7)|prostate(5)|skin(6)|upper_aerodigestive_tract(1)	70		Ovarian(90;0.17)			Imatinib(DB00619)	CCTGTCCTTATTTCCCACCCT	0.662																																																0			16											143.0	109.0	120.0					16																	2349517		2198	4300	6498	2289518	SO:0001583	missense	21			U78735	CCDS10466.1	16p13.3	2012-03-14			ENSG00000167972	ENSG00000167972		"""ATP binding cassette transporters / subfamily A"""	33	protein-coding gene	gene with protein product		601615		ABC3		8706931	Standard	NM_001089		Approved	ABC-C, EST111653, LBM180	uc002cpy.1	Q99758	OTTHUMG00000128845	ENST00000301732.5:c.1628A>C	16.37:g.2349517T>G	ENSP00000301732:p.Asn543Thr		2289518	B2RU09|Q54A95|Q6P5P9|Q92473	Missense_Mutation	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00382,HMMPfam_ABC_tran,PatternScan_ABC_TRANSPORTER_1	p.N543T	ENST00000301732.5	37	c.1628	CCDS10466.1	16	.	.	.	.	.	.	.	.	.	.	T	7.570	0.666585	0.14710	.	.	ENSG00000167972	ENST00000301732;ENST00000382381	D	0.90504	-2.68	5.78	-3.15	0.05233	ABC transporter-like (1);	0.547984	0.22298	N	0.061919	T	0.76118	0.3943	N	0.04746	-0.17	0.09310	N	1	B;B;B	0.27416	0.017;0.075;0.178	B;B;B	0.31442	0.019;0.045;0.13	T	0.65928	-0.6049	10	0.36615	T	0.2	.	8.5629	0.33523	0.0:0.4616:0.1213:0.4171	.	543;547;543	A7MBM9;Q4LE27;Q99758	.;.;ABCA3_HUMAN	T	543;547	ENSP00000301732:N543T	ENSP00000301732:N543T	N	-	2	0	ABCA3	2289518	0.986000	0.35501	0.000000	0.03702	0.001000	0.01503	1.063000	0.30567	-0.837000	0.04223	-0.321000	0.08615	AAT	-	superfamily_P-loop containing nucleoside triphosphate hydrolases		0.662	ABCA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA3	protein_coding	OTTHUMT00000250784.2	T	NM_001089		2289518	-1	no_errors	NM_001089	genbank	human	reviewed	54_36p	missense	SNP	0.036	G
FOXM1	2305	genome.wustl.edu	37	12	2973660	2973660	+	Splice_Site	SNP	C	C	G			TCGA-36-2545-01A-01D-1526-09	TCGA-36-2545-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ff47cb75-3f83-4749-a21d-69bfa5eb6dbc	ee353276-9833-4604-a76f-c9f937999791	g.chr12:2973660C>G	ENST00000359843.3	-	8	1160	c.1092G>C	c.(1090-1092)cgG>cgC	p.R364R	FOXM1_ENST00000361953.3_Splice_Site_p.R349R|FOXM1_ENST00000537018.1_5'Flank|FOXM1_ENST00000342628.2_Splice_Site_p.R364R	NM_021953.3	NP_068772.2	Q08050	FOXM1_HUMAN	forkhead box M1	364					cell cycle (GO:0007049)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|G2/M transition of mitotic cell cycle (GO:0000086)|liver development (GO:0001889)|mitotic cell cycle (GO:0000278)|negative regulation of cell aging (GO:0090344)|negative regulation of stress-activated MAPK cascade (GO:0032873)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)|positive regulation of double-strand break repair (GO:2000781)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell cycle (GO:0051726)|regulation of cell cycle arrest (GO:0071156)|regulation of cell growth (GO:0001558)|regulation of cell proliferation (GO:0042127)|regulation of Ras protein signal transduction (GO:0046578)|regulation of reactive oxygen species metabolic process (GO:2000377)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|protein kinase binding (GO:0019901)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(7)|lung(9)|prostate(1)|skin(1)|urinary_tract(3)	24			OV - Ovarian serous cystadenocarcinoma(31;0.000622)			TCATCTTCCGCCCTAGGAGGA	0.582																																																0			12											60.0	59.0	59.0					12																	2973660		2203	4300	6503	2843921	SO:0001630	splice_region_variant	2305			Y12773	CCDS8515.1, CCDS8516.1, CCDS8517.1	12p13	2007-09-18			ENSG00000111206	ENSG00000111206		"""Forkhead boxes"""	3818	protein-coding gene	gene with protein product	"""M-phase phosphoprotein 2"""	602341		FKHL16		9032290, 9441747	Standard	NM_202002		Approved	HFH-11, trident, HNF-3, INS-1, MPP2, MPHOSPH2, TGT3	uc001qlf.3	Q08050	OTTHUMG00000168118	ENST00000359843.3:c.1091-1G>C	12.37:g.2973660C>G			2843921	O43258|O43259|O43260|Q4ZGG7|Q9BRL2	Silent	SNP	"HMMSmart_SM00339,superfamily_""Winged helix"" DNA-binding domain,PatternScan_FORK_HEAD_1,HMMPfam_Fork_head,PatternScan_FORK_HEAD_2"	p.R364	ENST00000359843.3	37	c.1092	CCDS8515.1	12	.	.	.	.	.	.	.	.	.	.	C	8.385	0.838382	0.16891	.	.	ENSG00000111206	ENST00000535350	.	.	.	4.7	1.17	0.20885	.	.	.	.	.	T	0.52322	0.1727	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.41288	-0.9517	4	.	.	.	.	6.0845	0.19960	0.0:0.1922:0.5168:0.2911	.	.	.	.	P	90	.	.	A	-	1	0	FOXM1	2843921	0.999000	0.42202	1.000000	0.80357	0.545000	0.35147	0.616000	0.24344	0.412000	0.25729	-0.221000	0.12465	GCG	-	NULL		0.582	FOXM1-002	KNOWN	basic|CCDS	protein_coding	FOXM1	protein_coding	OTTHUMT00000398272.1	C	NM_021953	Silent	2843921	-1	no_errors	NM_202002	genbank	human	validated	54_36p	silent	SNP	0.998	G
SDK1	221935	genome.wustl.edu	37	7	4002369	4002369	+	Missense_Mutation	SNP	G	G	A	rs148919634		TCGA-36-2545-01A-01D-1526-09	TCGA-36-2545-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ff47cb75-3f83-4749-a21d-69bfa5eb6dbc	ee353276-9833-4604-a76f-c9f937999791	g.chr7:4002369G>A	ENST00000404826.2	+	9	1454	c.1315G>A	c.(1315-1317)Gcc>Acc	p.A439T	SDK1_ENST00000389531.3_Missense_Mutation_p.A439T	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	439	Ig-like C2-type 4.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		CAAAGTGCTCGCCAGCGGAGG	0.582													G|||	1	0.000199681	0.0008	0.0	5008	,	,		20289	0.0		0.0	False		,,,				2504	0.0															0			7						G	THR/ALA	4,4402	8.1+/-20.4	0,4,2199	48.0	44.0	45.0		1315	-10.7	0.0	7	dbSNP_134	45	0,8600		0,0,4300	yes	missense	SDK1	NM_152744.3	58	0,4,6499	AA,AG,GG		0.0,0.0908,0.0308	benign	439/2214	4002369	4,13002	2203	4300	6503	3968895	SO:0001583	missense	221935			AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.1315G>A	7.37:g.4002369G>A	ENSP00000385899:p.Ala439Thr		3968895	Q8TEN9|Q8TEP5|Q96N44	Missense_Mutation	SNP	superfamily_Immunoglobulin,HMMSmart_SM00409,HMMSmart_SM00408,HMMPfam_ig,HMMPfam_I-set,superfamily_Fibronectin type III,HMMSmart_SM00060,HMMPfam_fn3	p.A439T	ENST00000404826.2	37	c.1315	CCDS34590.1	7	.	.	.	.	.	.	.	.	.	.	G	2.215	-0.379694	0.05000	9.08E-4	0.0	ENSG00000146555	ENST00000404826;ENST00000389531	T;T	0.67698	-0.28;-0.28	5.34	-10.7	0.00240	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.537810	0.03722	N	0.251993	T	0.42854	0.1221	N	0.25332	0.735	0.09310	N	1	B	0.24368	0.102	B	0.14578	0.011	T	0.13255	-1.0516	10	0.13470	T	0.59	.	7.1979	0.25864	0.1217:0.354:0.3899:0.1344	.	439	Q7Z5N4	SDK1_HUMAN	T	439	ENSP00000385899:A439T;ENSP00000374182:A439T	ENSP00000374182:A439T	A	+	1	0	SDK1	3968895	0.000000	0.05858	0.000000	0.03702	0.578000	0.36192	-2.298000	0.01140	-2.963000	0.00289	-0.271000	0.10264	GCC	-	superfamily_Immunoglobulin,HMMPfam_I-set,HMMSmart_SM00409,HMMSmart_SM00408		0.582	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SDK1	protein_coding	OTTHUMT00000323702.1	G	NM_152744		3968895	+1	no_errors	NM_152744	genbank	human	validated	54_36p	missense	SNP	0.000	A
PLIN4	729359	genome.wustl.edu	37	19	4510723	4510723	+	Silent	SNP	G	G	A	rs78776990	byFrequency	TCGA-36-2545-01A-01D-1526-09	TCGA-36-2545-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ff47cb75-3f83-4749-a21d-69bfa5eb6dbc	ee353276-9833-4604-a76f-c9f937999791	g.chr19:4510723G>A	ENST00000301286.3	-	3	3206	c.3207C>T	c.(3205-3207)agC>agT	p.S1069S		NM_001080400.1	NP_001073869.1	Q96Q06	PLIN4_HUMAN	perilipin 4	1069						cytoplasm (GO:0005737)|lipid particle (GO:0005811)|plasma membrane (GO:0005886)				NS(2)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|skin(2)|soft_tissue(1)|stomach(2)	41						CCTCTTGGGGGCTCAGGGCAG	0.647													g|||	567	0.113219	0.0416	0.0865	5008	,	,		15958	0.0972		0.1372	False		,,,				2504	0.2209															0			19								234,3900		2,230,1835	30.0	35.0	34.0		3207	-2.5	0.0	19	dbSNP_131	34	1014,7384		64,886,3249	no	coding-synonymous	PLIN4	NM_001080400.1		66,1116,5084	AA,AG,GG		12.0743,5.6604,9.9585		1069/1358	4510723	1248,11284	2067	4199	6266	4461723	SO:0001819	synonymous_variant	729359			AB067468	CCDS45927.1	19p13.3	2009-10-06	2009-08-12	2009-08-12	ENSG00000167676	ENSG00000167676		"""Perilipins"""	29393	protein-coding gene	gene with protein product		613247	"""KIAA1881"""	KIAA1881		11572484, 19638644	Standard	NM_001080400		Approved	S3-12	uc002mar.1	Q96Q06	OTTHUMG00000167571	ENST00000301286.3:c.3207C>T	19.37:g.4510723G>A			4461723	A6NEI2	Silent	SNP	superfamily_Mannose-6-phosphate receptor binding protein 1 (Tip47) C-terminal domain	p.S1069	ENST00000301286.3	37	c.3207	CCDS45927.1	19																																																																																			-	NULL		0.647	PLIN4-001	NOVEL	basic|appris_principal|CCDS	protein_coding	KIAA1881	protein_coding	OTTHUMT00000395095.1	G	XM_170901		4461723	-1	no_errors	NM_001080400	genbank	human	provisional	54_36p	silent	SNP	0.000	A
ZNF232	7775	genome.wustl.edu	37	17	5009372	5009372	+	Missense_Mutation	SNP	C	C	T			TCGA-36-2545-01A-01D-1526-09	TCGA-36-2545-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ff47cb75-3f83-4749-a21d-69bfa5eb6dbc	ee353276-9833-4604-a76f-c9f937999791	g.chr17:5009372C>T	ENST00000250076.3	-	5	1736	c.1082G>A	c.(1081-1083)tGt>tAt	p.C361Y	ZNF232_ENST00000416429.2_3'UTR|ZNF232_ENST00000575898.1_Missense_Mutation_p.C352Y|ZNF232_ENST00000575538.1_5'Flank	NM_014519.2	NP_055334.2	Q9UNY5	ZN232_HUMAN	zinc finger protein 232	334					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(1)|large_intestine(2)|liver(1)|lung(4)|ovary(1)|prostate(2)	11						ACATTCATTACATTCGAAGGG	0.458																																																0			17											94.0	96.0	95.0					17																	5009372		2203	4300	6503	4950096	SO:0001583	missense	7775			AF080169	CCDS11068.1	17p13.2	2013-01-09			ENSG00000167840	ENSG00000167840		"""-"", ""Zinc fingers, C2H2-type"""	13026	protein-coding gene	gene with protein product						11311944	Standard	NM_014519		Approved	ZSCAN11	uc002gat.3	Q9UNY5	OTTHUMG00000099450	ENST00000250076.3:c.1082G>A	17.37:g.5009372C>T	ENSP00000250076:p.Cys361Tyr		4950096		Missense_Mutation	SNP	HMMPfam_SCAN,HMMSmart_SM00431,superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1	p.C361Y	ENST00000250076.3	37	c.1082	CCDS11068.1	17	.	.	.	.	.	.	.	.	.	.	C	15.55	2.867516	0.51588	.	.	ENSG00000167840	ENST00000250076	D	0.85088	-1.94	2.83	2.83	0.33086	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.93831	0.8027	H	0.95574	3.69	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.94718	0.7898	9	0.87932	D	0	.	11.8604	0.52463	0.0:1.0:0.0:0.0	.	334;325	Q9UNY5;Q9UNY5-2	ZN232_HUMAN;.	Y	361	ENSP00000250076:C361Y	ENSP00000250076:C361Y	C	-	2	0	ZNF232	4950096	0.888000	0.30383	0.033000	0.17914	0.641000	0.38312	2.837000	0.48191	1.878000	0.54408	0.655000	0.94253	TGT	-	superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1		0.458	ZNF232-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF232	protein_coding	OTTHUMT00000216915.1	C	NM_014519		4950096	-1	no_errors	NM_014519	genbank	human	validated	54_36p	missense	SNP	0.664	T
AKR1C1	1645	genome.wustl.edu	37	10	5005701	5005701	+	Missense_Mutation	SNP	G	G	C			TCGA-36-2545-01A-01D-1526-09	TCGA-36-2545-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ff47cb75-3f83-4749-a21d-69bfa5eb6dbc	ee353276-9833-4604-a76f-c9f937999791	g.chr10:5005701G>C	ENST00000380872.4	+	1	257	c.65G>C	c.(64-66)gGc>gCc	p.G22A	AKR1C1_ENST00000434459.2_Missense_Mutation_p.G22A|U8_ENST00000459095.1_RNA|AKR1C1_ENST00000380859.1_5'Flank|AKR1C1_ENST00000477661.1_3'UTR	NM_001353.5	NP_001344.2	Q04828	AK1C1_HUMAN	aldo-keto reductase family 1, member C1	22					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|cellular response to jasmonic acid stimulus (GO:0071395)|cholesterol homeostasis (GO:0042632)|daunorubicin metabolic process (GO:0044597)|digestion (GO:0007586)|doxorubicin metabolic process (GO:0044598)|epithelial cell differentiation (GO:0030855)|intestinal cholesterol absorption (GO:0030299)|oxidation-reduction process (GO:0055114)|phototransduction, visible light (GO:0007603)|progesterone metabolic process (GO:0042448)|protein homooligomerization (GO:0051260)|response to organophosphorus (GO:0046683)|retinal metabolic process (GO:0042574)|retinoid metabolic process (GO:0001523)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	17-alpha,20-alpha-dihydroxypregn-4-en-3-one dehydrogenase activity (GO:0047006)|alditol:NADP+ 1-oxidoreductase activity (GO:0004032)|aldo-keto reductase (NADP) activity (GO:0004033)|androsterone dehydrogenase (B-specific) activity (GO:0047042)|bile acid binding (GO:0032052)|carboxylic acid binding (GO:0031406)|indanol dehydrogenase activity (GO:0047718)|ketosteroid monooxygenase activity (GO:0047086)|oxidoreductase activity, acting on NAD(P)H, quinone or similar compound as acceptor (GO:0016655)|phenanthrene 9,10-monooxygenase activity (GO:0018636)|trans-1,2-dihydrobenzene-1,2-diol dehydrogenase activity (GO:0047115)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|lung(2)|ovary(3)|prostate(1)	13					Acetylsalicylic acid(DB00945)|Salicylic acid(DB00936)	CTGGGATTTGGCACCTATGCG	0.448																																					Colon(130;2054 2316 13360 15380)											0			10											139.0	123.0	129.0					10																	5005701		2203	4297	6500	4995701	SO:0001583	missense	1645			D26124	CCDS7061.1	10p15-p14	2012-12-04	2012-12-04		ENSG00000187134	ENSG00000187134	1.3.1.20, 1.1.1.149, 1.1.1.112	"""Aldo-keto reductases"""	384	protein-coding gene	gene with protein product	"""dihydrodiol dehydrogenase 1; 20-alpha (3-alpha)-hydroxysteroid dehydrogenase"""	600449	"""aldo-keto reductase family 1, member C1 (dihydrodiol dehydrogenase 1; 20-alpha (3-alpha)-hydroxysteroid dehydrogenase)"""	DDH1		8011662	Standard	NM_001353		Approved	DDH, MBAB, DD1, HAKRC		Q04828	OTTHUMG00000017580	ENST00000380872.4:c.65G>C	10.37:g.5005701G>C	ENSP00000370254:p.Gly22Ala		4995701	P52896|Q5SR15|Q7M4N2|Q9UCX2	Missense_Mutation	SNP	superfamily_Aldo/ket_red,HMMPfam_Aldo_ket_red,PatternScan_ALDOKETO_REDUCTASE_1,PatternScan_ALDOKETO_REDUCTASE_2,PatternScan_ALDOKETO_REDUCTASE_3	p.G22A	ENST00000380872.4	37	c.65	CCDS7061.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.77|17.77	3.471877|3.471877	0.63737|0.63737	.|.	.|.	ENSG00000187134|ENSG00000187134	ENST00000442997|ENST00000434459;ENST00000380872	.|D;D	.|0.95518	.|-3.73;-3.73	2.46|2.46	2.46|2.46	0.29980|0.29980	.|NADP-dependent oxidoreductase domain (3);	.|0.000000	.|0.64402	.|D	.|0.000020	D|D	0.97929|0.97929	0.9319|0.9319	H|H	0.95679|0.95679	3.705|3.705	0.40007|0.40007	D|D	0.975232|0.975232	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.91635	.|0.999;0.995;0.995	D|D	0.97610|0.97610	1.0129|1.0129	5|10	.|0.87932	.|D	.|0	.|.	8.4186|8.4186	0.32687|0.32687	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|22;22;22	.|B4E0M1;Q2XPP3;Q04828	.|.;.;AK1C1_HUMAN	P|A	21|22	.|ENSP00000412248:G22A;ENSP00000370254:G22A	.|ENSP00000370254:G22A	A|G	+|+	1|2	0|0	AKR1C1|AKR1C1	4995701|4995701	1.000000|1.000000	0.71417|0.71417	0.161000|0.161000	0.22692|0.22692	0.452000|0.452000	0.32318|0.32318	3.113000|3.113000	0.50376|0.50376	1.378000|1.378000	0.46305|0.46305	0.305000|0.305000	0.20034|0.20034	GCA|GGC	-	superfamily_Aldo/ket_red,HMMPfam_Aldo_ket_red		0.448	AKR1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKR1C1	protein_coding	OTTHUMT00000046523.2	G	NM_001353		4995701	+1	no_errors	NM_001353	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
ART4	420	genome.wustl.edu	37	12	14993570	14993570	+	Missense_Mutation	SNP	C	C	A			TCGA-36-2545-01A-01D-1526-09	TCGA-36-2545-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ff47cb75-3f83-4749-a21d-69bfa5eb6dbc	ee353276-9833-4604-a76f-c9f937999791	g.chr12:14993570C>A	ENST00000228936.4	-	2	1043	c.662G>T	c.(661-663)gGg>gTg	p.G221V	C12orf60_ENST00000527783.1_Intron|RP11-233G1.4_ENST00000444324.2_RNA	NM_021071.2	NP_066549.2	Q93070	NAR4_HUMAN	ADP-ribosyltransferase 4 (Dombrock blood group)	221					arginine metabolic process (GO:0006525)|protein ADP-ribosylation (GO:0006471)	anchored component of membrane (GO:0031225)|membrane (GO:0016020)|plasma membrane (GO:0005886)	NAD(P)+-protein-arginine ADP-ribosyltransferase activity (GO:0003956)			large_intestine(5)|liver(1)|lung(3)|prostate(1)|skin(2)|stomach(3)	15						TGTCTGGTTCCCAAACTCCTG	0.488																																																0			12											108.0	109.0	109.0					12																	14993570		2203	4300	6503	14884837	SO:0001583	missense	420			X95826	CCDS8668.1	12q13.2-q13.3	2014-07-18	2014-01-02	2006-01-12	ENSG00000111339	ENSG00000111339		"""CD molecules"", ""Blood group antigens"""	726	protein-coding gene	gene with protein product		110600	"""Dombrock blood group"", ""ADP-ribosyltransferase 4 (DO blood group)"", ""ADP-ribosyltransferase 4"""	DO		9119374	Standard	NM_021071		Approved	DOK1, CD297	uc001rcl.1	Q93070	OTTHUMG00000168738	ENST00000228936.4:c.662G>T	12.37:g.14993570C>A	ENSP00000228936:p.Gly221Val		14884837	Q9BZ50|Q9BZ51|Q9HB06	Missense_Mutation	SNP	superfamily_ADP-ribosylation,HMMPfam_ART,PatternScan_ART	p.G221V	ENST00000228936.4	37	c.662	CCDS8668.1	12	.	.	.	.	.	.	.	.	.	.	C	8.298	0.819287	0.16607	.	.	ENSG00000111339	ENST00000228936;ENST00000420600	T;T	0.10668	2.85;2.85	4.35	-0.841	0.10752	.	0.220269	0.47093	N	0.000259	T	0.16257	0.0391	M	0.85542	2.76	0.30011	N	0.815191	P;D	0.53745	0.898;0.962	P;P	0.47346	0.544;0.544	T	0.09840	-1.0656	10	0.72032	D	0.01	-9.6206	3.8585	0.08985	0.286:0.4579:0.0:0.2561	.	221;221	A8K6J7;Q93070	.;NAR4_HUMAN	V	221;204	ENSP00000228936:G221V;ENSP00000405689:G204V	ENSP00000228936:G221V	G	-	2	0	ART4	14884837	0.388000	0.25197	0.001000	0.08648	0.238000	0.25445	0.791000	0.26915	-0.148000	0.11234	0.563000	0.77884	GGG	-	superfamily_ADP-ribosylation,HMMPfam_ART		0.488	ART4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ART4	protein_coding	OTTHUMT00000400859.1	C	NM_021071		14884837	-1	no_errors	NM_021071	genbank	human	reviewed	54_36p	missense	SNP	0.001	A
Unknown	0	genome.wustl.edu	37	18	15254482	15254482	+	IGR	SNP	C	C	T			TCGA-36-2545-01A-01D-1526-09	TCGA-36-2545-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ff47cb75-3f83-4749-a21d-69bfa5eb6dbc	ee353276-9833-4604-a76f-c9f937999791	g.chr18:15254482C>T								RP11-454P7.3 (56754 upstream) : AP005901.1 (59072 downstream)																							TACCTGGATGCTGCTCAGCAG	0.413																																																0			18																																								15244482	SO:0001628	intergenic_variant	0																															18.37:g.15254482C>T			15244482		Missense_Mutation	SNP	superfamily_KRAB domain (Kruppel-associated box Pfam 01352),HMMPfam_KRAB,HMMSmart_SM00349,superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1	p.A23V		37	c.68		18																																																																																			-	superfamily_KRAB domain (Kruppel-associated box Pfam 01352),HMMPfam_KRAB,HMMSmart_SM00349	0	0.413					ENSG00000184624			C			15244482	+1	no_start_codon:no_stop_codon	ENST00000330020	ensembl	human	known	54_36p	missense	SNP	0.048	T
UPF1	5976	genome.wustl.edu	37	19	18967738	18967738	+	Missense_Mutation	SNP	C	C	T			TCGA-36-2545-01A-01D-1526-09	TCGA-36-2545-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ff47cb75-3f83-4749-a21d-69bfa5eb6dbc	ee353276-9833-4604-a76f-c9f937999791	g.chr19:18967738C>T	ENST00000599848.1	+	14	2119	c.1910C>T	c.(1909-1911)gCc>gTc	p.A637V	UPF1_ENST00000262803.5_Missense_Mutation_p.A626V			Q92900	RENT1_HUMAN	UPF1 regulator of nonsense transcripts homolog (yeast)	637					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|dosage compensation by inactivation of X chromosome (GO:0009048)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of translational termination (GO:0006449)|RNA metabolic process (GO:0016070)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|nucleus (GO:0005634)|supraspliceosomal complex (GO:0044530)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(11)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	40						CCGAGGCTGGCCAAGATGCAG	0.627																																																0			19											74.0	68.0	70.0					19																	18967738		2203	4300	6503	18828738	SO:0001583	missense	5976			AF074016	CCDS12386.1, CCDS74315.1	19p13.2-p13.11	2012-02-29	2006-02-07	2006-02-07	ENSG00000005007	ENSG00000005007			9962	protein-coding gene	gene with protein product	"""UP Frameshift 1"", ""smg-2 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	601430	"""regulator of nonsense transcripts 1"""	RENT1		8855285, 9064659	Standard	XM_005260015		Approved	HUPF1, KIAA0221, NORF1, pNORF1, smg-2	uc002nkf.3	Q92900		ENST00000599848.1:c.1910C>T	19.37:g.18967738C>T	ENSP00000470142:p.Ala637Val		18828738	O00239|O43343|Q86Z25|Q92842	Missense_Mutation	SNP	HMMPfam_UPF1_Zn_bind,superfamily_SSF52540,HMMPfam_ResIII	p.A626V	ENST00000599848.1	37	c.1877		19	.	.	.	.	.	.	.	.	.	.	C	18.06	3.540342	0.65085	.	.	ENSG00000005007	ENST00000262803	T	0.80393	-1.37	4.4	4.4	0.53042	Helicase/UvrB domain (1);	0.000000	0.85682	D	0.000000	T	0.78381	0.4274	M	0.64080	1.96	0.80722	D	1	B;B	0.22276	0.067;0.061	B;B	0.15484	0.013;0.013	T	0.77327	-0.2629	10	0.51188	T	0.08	-32.0353	15.9632	0.79948	0.0:1.0:0.0:0.0	.	637;626	Q92900;Q92900-2	RENT1_HUMAN;.	V	626	ENSP00000262803:A626V	ENSP00000262803:A626V	A	+	2	0	UPF1	18828738	1.000000	0.71417	0.990000	0.47175	0.640000	0.38277	7.265000	0.78442	2.006000	0.58801	0.491000	0.48974	GCC	-	superfamily_SSF52540		0.627	UPF1-002	KNOWN	basic	protein_coding	UPF1	protein_coding	OTTHUMT00000464684.1	C	NM_002911		18828738	+1	no_errors	NM_002911	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
AEBP2	121536	genome.wustl.edu	37	12	19610139	19610139	+	Intron	SNP	C	C	G			TCGA-36-2545-01A-01D-1526-09	TCGA-36-2545-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ff47cb75-3f83-4749-a21d-69bfa5eb6dbc	ee353276-9833-4604-a76f-c9f937999791	g.chr12:19610139C>G	ENST00000398864.3	+	2	697				AEBP2_ENST00000266508.9_Intron|AEBP2_ENST00000360995.4_Intron|AEBP2_ENST00000541908.1_Intron	NM_001114176.1	NP_001107648.1	Q6ZN18	AEBP2_HUMAN	AE binding protein 2						chromatin modification (GO:0016568)	ESC/E(Z) complex (GO:0035098)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|transcription corepressor activity (GO:0003714)			ovary(1)	1	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.00804)|Esophageal squamous(101;0.143)					TGTTTCACACCCAGTGTGTAA	0.443																																																0			12																																								19501406	SO:0001627	intron_variant	728672				CCDS44841.1, CCDS44842.1, CCDS58215.1	12p12.3	2012-10-02			ENSG00000139154	ENSG00000139154			24051	protein-coding gene	gene with protein product						10329662	Standard	NM_153207		Approved	MGC17922	uc001ref.2	Q6ZN18	OTTHUMG00000168906	ENST00000398864.3:c.672-5305C>G	12.37:g.19610139C>G			19501406	Q59FS5|Q6ZN62|Q96BG3	RNA	SNP	-	NULL	ENST00000398864.3	37	NULL	CCDS44841.1	12																																																																																			-	-		0.443	AEBP2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LOC728672	protein_coding	OTTHUMT00000401575.1	C	NM_153207		19501406	-1	pseudogene	XR_015580	genbank	human	model	54_36p	rna	SNP	1.000	G
METTL3	56339	genome.wustl.edu	37	14	21971365	21971365	+	Missense_Mutation	SNP	A	A	G			TCGA-36-2545-01A-01D-1526-09	TCGA-36-2545-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ff47cb75-3f83-4749-a21d-69bfa5eb6dbc	ee353276-9833-4604-a76f-c9f937999791	g.chr14:21971365A>G	ENST00000298717.4	-	3	825	c.674T>C	c.(673-675)aTa>aCa	p.I225T	METTL3_ENST00000538267.1_Nonstop_Mutation_p.*154Q	NM_019852.3	NP_062826.2	Q86U44	MTA70_HUMAN	methyltransferase like 3	225					circadian rhythm (GO:0007623)|gene expression (GO:0010467)|mRNA destabilization (GO:0061157)|mRNA methylation (GO:0080009)|mRNA processing (GO:0006397)|RNA methylation (GO:0001510)|stem cell maintenance (GO:0019827)	MIS complex (GO:0036396)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	mRNA (2'-O-methyladenosine-N6-)-methyltransferase activity (GO:0016422)|RNA binding (GO:0003723)	p.I225R(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(5)|pancreas(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	20	all_cancers(95;0.000628)		Epithelial(56;6.61e-06)	GBM - Glioblastoma multiforme(265;0.0146)		AAGGCTCTCTATCTCCAGATC	0.443																																																1	Substitution - Missense(1)	prostate(1)	14											182.0	174.0	177.0					14																	21971365		2203	4300	6503	21041205	SO:0001583	missense	56339			AF014837	CCDS32044.1	14q11.1	2012-06-12			ENSG00000165819	ENSG00000165819	2.1.1.62		17563	protein-coding gene	gene with protein product	"""N6-adenosine-methyltransferase 70 kDa subunit"""	612472					Standard	XM_006720206		Approved	Spo8, M6A, MT-A70	uc001wbc.3	Q86U44	OTTHUMG00000168825	ENST00000298717.4:c.674T>C	14.37:g.21971365A>G	ENSP00000298717:p.Ile225Thr		21041205	O14736|Q86V05|Q9HB32	Missense_Mutation	SNP	HMMPfam_MT-A70	p.I225T	ENST00000298717.4	37	c.674	CCDS32044.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	17.89|17.89	3.500879|3.500879	0.64298|0.64298	.|.	.|.	ENSG00000165819|ENSG00000165819	ENST00000298717|ENST00000538267	T|.	0.30448|.	1.53|.	5.36|5.36	5.36|5.36	0.76844|0.76844	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.59702|.	0.2213|.	M|M	0.69823|0.69823	2.125|2.125	0.18873|0.18873	N|N	0.999984|0.999984	D;D;P|.	0.76494|.	0.999;0.999;0.777|.	D;D;B|.	0.80764|.	0.991;0.994;0.391|.	T|.	0.55114|.	-0.8191|.	10|.	0.56958|.	D|.	0.05|.	-13.3899|-13.3899	14.4818|14.4818	0.67587|0.67587	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	225;225;225|.	B4E2F6;B4DTN4;Q86U44|.	.;.;MTA70_HUMAN|.	T|Q	225|154	ENSP00000298717:I225T|.	ENSP00000298717:I225T|.	I|X	-|-	2|1	0|0	METTL3|METTL3	21041205|21041205	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	8.024000|8.024000	0.88770|0.88770	2.257000|2.257000	0.74773|0.74773	0.460000|0.460000	0.39030|0.39030	ATA|TAG	-	NULL		0.443	METTL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	METTL3	protein_coding	OTTHUMT00000401227.1	A	NM_019852		21041205	-1	no_errors	NM_019852	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
CCAR2	57805	genome.wustl.edu	37	8	22475937	22475937	+	Missense_Mutation	SNP	T	T	G			TCGA-36-2545-01A-01D-1526-09	TCGA-36-2545-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ff47cb75-3f83-4749-a21d-69bfa5eb6dbc	ee353276-9833-4604-a76f-c9f937999791	g.chr8:22475937T>G	ENST00000308511.4	+	17	2398	c.2149T>G	c.(2149-2151)Tgt>Ggt	p.C717G	RP11-582J16.5_ENST00000521025.1_RNA|CCAR2_ENST00000389279.3_Missense_Mutation_p.C717G|CCAR2_ENST00000520861.1_Missense_Mutation_p.C392G|BIN3_ENST00000519335.1_5'Flank			Q8N163	CCAR2_HUMAN	cell cycle and apoptosis regulator 2	717	Interaction with NR1D1. {ECO:0000269|PubMed:23398316}.				cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|mRNA processing (GO:0006397)|negative regulation of catalytic activity (GO:0043086)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage checkpoint (GO:2000003)|regulation of circadian rhythm (GO:0042752)|regulation of DNA-templated transcription, elongation (GO:0032784)|regulation of protein stability (GO:0031647)|response to UV (GO:0009411)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|DBIRD complex (GO:0044609)|mitochondrial matrix (GO:0005759)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|poly(A) RNA binding (GO:0044822)|RNA polymerase II core binding (GO:0000993)										TGCCAACTGGTGTGGCTACTT	0.537																																																0			8											176.0	164.0	168.0					8																	22475937		2203	4300	6503	22531882	SO:0001583	missense	57805			AL834351	CCDS34863.1	8p22	2013-08-22	2013-08-22	2013-08-22		ENSG00000158941			23360	protein-coding gene	gene with protein product	"""deleted in breast cancer"""	607359	"""KIAA1967"""	KIAA1967		12370419	Standard	NM_021174		Approved	DBC-1, DBC1, NET35	uc003xci.3	Q8N163		ENST00000308511.4:c.2149T>G	8.37:g.22475937T>G	ENSP00000310670:p.Cys717Gly		22531882	A6NL03|B2RB79|D3DSR6|Q6P0Q9|Q8N3G7|Q8N8M1|Q8TF34|Q9H9Q9|Q9HD12|Q9NT55	Missense_Mutation	SNP	NULL	p.C717G	ENST00000308511.4	37	c.2149	CCDS34863.1	8	.	.	.	.	.	.	.	.	.	.	T	22.1	4.241658	0.79912	.	.	ENSG00000158941	ENST00000308511;ENST00000389279;ENST00000520861	T;T;T	0.00358	7.88;7.88;7.88	6.0	6.0	0.97389	.	0.141196	0.52532	D	0.000078	T	0.00666	0.0022	M	0.62723	1.935	0.48975	D	0.999737	D;D	0.76494	0.999;0.995	D;D	0.80764	0.994;0.979	D	0.84847	0.0811	10	0.39692	T	0.17	-11.1643	12.8965	0.58101	0.0:0.0:0.0:1.0	.	392;717	G3V119;Q8N163	.;K1967_HUMAN	G	717;717;392	ENSP00000310670:C717G;ENSP00000373930:C717G;ENSP00000429773:C392G	ENSP00000310670:C717G	C	+	1	0	KIAA1967	22531882	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.317000	0.72862	2.297000	0.77311	0.533000	0.62120	TGT	-	NULL		0.537	CCAR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1967	protein_coding	OTTHUMT00000375865.1	T	NM_021174		22531882	+1	no_errors	NM_021174	genbank	human	validated	54_36p	missense	SNP	1.000	G
ATP10A	57194	genome.wustl.edu	37	15	25925360	25925360	+	Silent	SNP	C	C	T			TCGA-36-2545-01A-01D-1526-09	TCGA-36-2545-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ff47cb75-3f83-4749-a21d-69bfa5eb6dbc	ee353276-9833-4604-a76f-c9f937999791	g.chr15:25925360C>T	ENST00000356865.6	-	20	3885	c.3774G>A	c.(3772-3774)ccG>ccA	p.P1258P		NM_024490.3	NP_077816.1	O60312	AT10A_HUMAN	ATPase, class V, type 10A	1258					ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|regulation of cell shape (GO:0008360)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|breast(2)|endometrium(8)|kidney(2)|large_intestine(33)|liver(1)|lung(41)|ovary(3)|pancreas(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	103		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		AAGGGTTGGACGGAGGATAGC	0.522																																																0			15											173.0	151.0	158.0					15																	25925360		2203	4300	6503	23476453	SO:0001819	synonymous_variant	57194			AB011138	CCDS32178.1	15q12	2010-04-20	2007-09-19		ENSG00000206190	ENSG00000206190		"""ATPases / P-type"""	13542	protein-coding gene	gene with protein product		605855	"""ATPase, Class V, type 10C"", ""ATPase, Class V, type 10A"""	ATP10C		11015572, 9628581	Standard	NM_024490		Approved	ATPVA, ATPVC, KIAA0566	uc010ayu.3	O60312		ENST00000356865.6:c.3774G>A	15.37:g.25925360C>T			23476453	Q4G0S9|Q969I4	Silent	SNP	HMMPfam_E1-E2_ATPase,superfamily_SSF81653,superfamily_SSF56784,PatternScan_ATPASE_E1_E2,superfamily_SSF81660,HMMPfam_Hydrolase_3	p.P1258	ENST00000356865.6	37	c.3774	CCDS32178.1	15																																																																																			-	NULL		0.522	ATP10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP10A	protein_coding	OTTHUMT00000414830.1	C	NM_024490		23476453	-1	no_errors	NM_024490	genbank	human	reviewed	54_36p	silent	SNP	0.993	T
GPLD1	2822	genome.wustl.edu	37	6	24429276	24429276	+	Missense_Mutation	SNP	C	C	G			TCGA-36-2545-01A-01D-1526-09	TCGA-36-2545-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ff47cb75-3f83-4749-a21d-69bfa5eb6dbc	ee353276-9833-4604-a76f-c9f937999791	g.chr6:24429276C>G	ENST00000230036.1	-	25	2617	c.2507G>C	c.(2506-2508)aGc>aCc	p.S836T		NM_001503.3	NP_001494.2	P80108	PHLD_HUMAN	glycosylphosphatidylinositol specific phospholipase D1	836					cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to calcium ion (GO:0071277)|cellular response to cholesterol (GO:0071397)|cellular response to drug (GO:0035690)|cellular response to insulin stimulus (GO:0032869)|cellular response to pH (GO:0071467)|cellular response to triglyceride (GO:0071401)|chondrocyte differentiation (GO:0002062)|complement receptor mediated signaling pathway (GO:0002430)|GPI anchor release (GO:0006507)|hematopoietic stem cell migration (GO:0035701)|hematopoietic stem cell migration to bone marrow (GO:0097241)|insulin receptor signaling pathway (GO:0008286)|negative regulation of cell proliferation (GO:0008285)|negative regulation of triglyceride catabolic process (GO:0010897)|ossification (GO:0001503)|phosphatidylcholine metabolic process (GO:0046470)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytolysis (GO:0045919)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of high-density lipoprotein particle clearance (GO:0010983)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of secretion (GO:0051047)|positive regulation of triglyceride biosynthetic process (GO:0010867)|regulation of cellular response to insulin stimulus (GO:1900076)|response to glucose (GO:0009749)|transepithelial transport (GO:0070633)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|proteinaceous extracellular matrix (GO:0005578)	glycosylphosphatidylinositol phospholipase D activity (GO:0004621)|phospholipase D activity (GO:0004630)|sodium channel regulator activity (GO:0017080)			breast(3)|endometrium(5)|kidney(1)|large_intestine(11)|lung(8)|ovary(2)|prostate(1)|urinary_tract(1)	32						TGAGCCAAGGCTATAGACGTG	0.502																																																0			6											100.0	90.0	93.0					6																	24429276		2203	4300	6503	24537255	SO:0001583	missense	2822			L11701	CCDS4553.1	6p22.1	2008-02-05			ENSG00000112293	ENSG00000112293			4459	protein-coding gene	gene with protein product		602515				11072085	Standard	NM_001503		Approved		uc003ned.2	P80108	OTTHUMG00000016104	ENST00000230036.1:c.2507G>C	6.37:g.24429276C>G	ENSP00000230036:p.Ser836Thr		24537255	Q15127|Q15128|Q2M2F2|Q5T3Y0|Q7Z6T8|Q8TCV0|Q8WW82|Q96ID6|Q9H167|Q9H4M1|Q9UJC9	Missense_Mutation	SNP	HMMSmart_SM00191,HMMPfam_FG-GAP,superfamily_Integrin alpha N-terminal domain	p.S836T	ENST00000230036.1	37	c.2507	CCDS4553.1	6	.	.	.	.	.	.	.	.	.	.	C	0.915	-0.717745	0.03182	.	.	ENSG00000112293	ENST00000230036	T	0.66099	-0.19	5.29	0.712	0.18167	.	0.738516	0.13394	N	0.391168	T	0.25269	0.0614	L	0.46157	1.445	0.09310	N	0.999996	B	0.13594	0.008	B	0.11329	0.006	T	0.16630	-1.0396	10	0.21540	T	0.41	-15.4083	3.8501	0.08951	0.0:0.3486:0.1879:0.4635	.	836	P80108	PHLD_HUMAN	T	836	ENSP00000230036:S836T	ENSP00000230036:S836T	S	-	2	0	GPLD1	24537255	0.394000	0.25246	0.071000	0.20095	0.065000	0.16274	0.025000	0.13577	0.232000	0.21100	-0.176000	0.13171	AGC	-	NULL		0.502	GPLD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPLD1	protein_coding	OTTHUMT00000043315.1	C	NM_001503		24537255	-1	no_errors	NM_001503	genbank	human	reviewed	54_36p	missense	SNP	0.011	G
APBB1IP	54518	genome.wustl.edu	37	10	26790054	26790054	+	Intron	SNP	A	A	T			TCGA-36-2545-01A-01D-1526-09	TCGA-36-2545-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ff47cb75-3f83-4749-a21d-69bfa5eb6dbc	ee353276-9833-4604-a76f-c9f937999791	g.chr10:26790054A>T	ENST00000376236.4	+	5	908				APBB1IP_ENST00000356785.4_Missense_Mutation_p.D156V	NM_019043.3	NP_061916.3	Q7Z5R6	AB1IP_HUMAN	amyloid beta (A4) precursor protein-binding, family B, member 1 interacting protein						blood coagulation (GO:0007596)|platelet activation (GO:0030168)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(27)|skin(7)|upper_aerodigestive_tract(1)	45						AGTATGTGGGACCAGAGATGG	0.478																																																0			10											133.0	119.0	124.0					10																	26790054		2203	4300	6503	26830060	SO:0001627	intron_variant	54518			AB085852	CCDS31167.1	10p12.1	2013-01-10			ENSG00000077420	ENSG00000077420		"""Pleckstrin homology (PH) domain containing"""	17379	protein-coding gene	gene with protein product	"""Rap1-GTP-interacting adaptor molecule"""	609036				9407065	Standard	NM_019043		Approved	INAG1, RIAM	uc001iss.3	Q7Z5R6	OTTHUMG00000017841	ENST00000376236.4:c.453+14A>T	10.37:g.26790054A>T			26830060	Q8IWS8|Q8IYL7|Q8IZZ7	Missense_Mutation	SNP	NULL	p.D156V	ENST00000376236.4	37	c.467	CCDS31167.1	10	.	.	.	.	.	.	.	.	.	.	A	6.114	0.389346	0.11581	.	.	ENSG00000077420	ENST00000356785	.	.	.	4.46	-0.655	0.11439	.	.	.	.	.	T	0.24812	0.0602	.	.	.	0.09310	N	1	B	0.26195	0.144	B	0.26969	0.075	T	0.24764	-1.0151	6	.	.	.	.	7.3036	0.26434	0.5669:0.0:0.4331:0.0	.	156	Q8IYL7	.	V	156	.	.	D	+	2	0	APBB1IP	26830060	0.000000	0.05858	0.001000	0.08648	0.010000	0.07245	-0.480000	0.06559	-0.113000	0.11958	-0.468000	0.05107	GAC	-	NULL		0.478	APBB1IP-003	KNOWN	basic|appris_principal|CCDS	protein_coding	APBB1IP	protein_coding	OTTHUMT00000047270.1	A	NM_019043		26830060	+1	no_errors	ENST00000356785	ensembl	human	known	54_36p	missense	SNP	0.000	T
IL21R	50615	genome.wustl.edu	37	16	27460570	27460570	+	Missense_Mutation	SNP	C	C	T	rs376045198		TCGA-36-2545-01A-01D-1526-09	TCGA-36-2545-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ff47cb75-3f83-4749-a21d-69bfa5eb6dbc	ee353276-9833-4604-a76f-c9f937999791	g.chr16:27460570C>T	ENST00000337929.3	+	9	2056	c.1583C>T	c.(1582-1584)cCg>cTg	p.P528L	IL21R_ENST00000395755.1_Missense_Mutation_p.P528L|IL21R_ENST00000564089.1_Missense_Mutation_p.P528L|IL21R-AS1_ENST00000563191.1_RNA|IL21R_ENST00000395754.4_Missense_Mutation_p.P528L	NM_181078.2	NP_851564.1	Q9HBE5	IL21R_HUMAN	interleukin 21 receptor	528					interleukin-21-mediated signaling pathway (GO:0038114)|natural killer cell activation (GO:0030101)	integral component of membrane (GO:0016021)	interleukin-21 receptor activity (GO:0001532)			breast(2)|large_intestine(3)|lung(1)|ovary(2)	8						GTCATTCCTCCGCCACTTTCG	0.657			T	BCL6	NHL																																		Dom	yes		16	16p11	50615	interleukin 21 receptor		L	0			16						C	LEU/PRO,LEU/PRO,LEU/PRO	1,3949		0,1,1974	31.0	30.0	30.0		1583,1583,1649	3.9	0.0	16		30	0,7968		0,0,3984	no	missense,missense,missense	IL21R	NM_021798.3,NM_181078.2,NM_181079.4	98,98,98	0,1,5958	TT,TC,CC		0.0,0.0253,0.0084	probably-damaging,probably-damaging,probably-damaging	528/539,528/539,550/561	27460570	1,11917	1975	3984	5959	27368071	SO:0001583	missense	50615			AF254067	CCDS10630.1	16p11	2014-09-17			ENSG00000103522	ENSG00000103522		"""Interleukins and interleukin receptors"", ""CD molecules"""	6006	protein-coding gene	gene with protein product		605383				11081504	Standard	NM_181078		Approved	CD360	uc002dos.2	Q9HBE5	OTTHUMG00000131675	ENST00000337929.3:c.1583C>T	16.37:g.27460570C>T	ENSP00000338010:p.Pro528Leu		27368071	A8K9E8|D3DWF7|Q96HZ1|Q9HB91	Missense_Mutation	SNP	superfamily_Fibronectin type III,PatternScan_HEMATOPO_REC_S_F1	p.P528L	ENST00000337929.3	37	c.1583	CCDS10630.1	16	.	.	.	.	.	.	.	.	.	.	C	16.85	3.235824	0.58886	2.53E-4	0.0	ENSG00000103522	ENST00000337929;ENST00000395755;ENST00000395754	T;T;T	0.38077	1.16;1.16;1.16	4.9	3.88	0.44766	.	0.238545	0.29868	N	0.010983	T	0.50309	0.1608	M	0.63428	1.95	0.09310	N	0.999996	D	0.71674	0.998	P	0.61477	0.889	T	0.37709	-0.9694	10	0.72032	D	0.01	-10.5296	10.3523	0.43943	0.0:0.8006:0.1994:0.0	.	528	Q9HBE5	IL21R_HUMAN	L	528	ENSP00000338010:P528L;ENSP00000379104:P528L;ENSP00000379103:P528L	ENSP00000338010:P528L	P	+	2	0	IL21R	27368071	0.032000	0.19561	0.008000	0.14137	0.013000	0.08279	2.552000	0.45828	2.271000	0.75665	0.561000	0.74099	CCG	-	NULL		0.657	IL21R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL21R	protein_coding	OTTHUMT00000254578.2	C	NM_181078		27368071	+1	no_errors	NM_021798	genbank	human	reviewed	54_36p	missense	SNP	0.010	T
MATN1	4146	genome.wustl.edu	37	1	31191762	31191762	+	Nonsense_Mutation	SNP	G	G	A			TCGA-36-2545-01A-01D-1526-09	TCGA-36-2545-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ff47cb75-3f83-4749-a21d-69bfa5eb6dbc	ee353276-9833-4604-a76f-c9f937999791	g.chr1:31191762G>A	ENST00000373765.4	-	3	519	c.484C>T	c.(484-486)Cag>Tag	p.Q162*	MATN1-AS1_ENST00000414532.2_RNA|MATN1-AS1_ENST00000454613.1_RNA|MATN1_ENST00000477320.1_5'UTR|MATN1-AS1_ENST00000414763.1_RNA	NM_002379.3	NP_002370.1	P21941	MATN1_HUMAN	matrilin 1, cartilage matrix protein	162	VWFA 1. {ECO:0000255|PROSITE- ProRule:PRU00219}.				extracellular matrix organization (GO:0030198)|growth plate cartilage chondrocyte morphogenesis (GO:0003429)|protein complex assembly (GO:0006461)|regulation of bone mineralization (GO:0030500)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)	12		Colorectal(325;0.00792)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)|Ovarian(437;0.0563)|Breast(348;0.0848)|Medulloblastoma(700;0.123)		Colorectal(126;1.29e-05)|COAD - Colon adenocarcinoma(152;0.000726)|STAD - Stomach adenocarcinoma(196;0.0183)|READ - Rectum adenocarcinoma(331;0.0649)		GACACGTCCTGCACGCTGTCC	0.721																																																0			1											12.0	12.0	12.0					1																	31191762		2186	4274	6460	30964349	SO:0001587	stop_gained	4146			M55675	CCDS336.1	1p35	2008-02-05			ENSG00000162510	ENSG00000162510			6907	protein-coding gene	gene with protein product		115437		CRTM, CMP		2246248, 9083061	Standard	NM_002379		Approved		uc001brz.3	P21941	OTTHUMG00000003705	ENST00000373765.4:c.484C>T	1.37:g.31191762G>A	ENSP00000362870:p.Gln162*		30964349	B2R7E3|Q5TBB9	Nonsense_Mutation	SNP	PatternScan_EGF_1,superfamily_SSF53300,HMMSmart_VWA,HMMPfam_VWA,superfamily_SSF57196,HMMSmart_EGF,HMMPfam_EGF,PatternScan_EGF_2,HMMPfam_Matrilin_ccoil	p.Q162*	ENST00000373765.4	37	c.484	CCDS336.1	1	.	.	.	.	.	.	.	.	.	.	G	37	6.410419	0.97546	.	.	ENSG00000162510	ENST00000373765	.	.	.	4.68	3.68	0.42216	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06625	T	0.88	-7.6911	12.1537	0.54064	0.0:0.0:0.6902:0.3098	.	.	.	.	X	162	.	ENSP00000362870:Q162X	Q	-	1	0	MATN1	30964349	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	3.189000	0.50965	2.135000	0.66039	0.491000	0.48974	CAG	-	superfamily_SSF53300,HMMSmart_VWA,HMMPfam_VWA		0.721	MATN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MATN1	protein_coding	OTTHUMT00000010458.1	G	NM_002379		30964349	-1	no_errors	NM_002379	genbank	human	reviewed	54_36p	nonsense	SNP	0.994	A
PRRC2A	7916	genome.wustl.edu	37	6	31602070	31602070	+	Missense_Mutation	SNP	G	G	C			TCGA-36-2545-01A-01D-1526-09	TCGA-36-2545-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ff47cb75-3f83-4749-a21d-69bfa5eb6dbc	ee353276-9833-4604-a76f-c9f937999791	g.chr6:31602070G>C	ENST00000376033.2	+	19	5011	c.4777G>C	c.(4777-4779)Ggc>Cgc	p.G1593R	PRRC2A_ENST00000376007.4_Missense_Mutation_p.G1593R	NM_004638.3	NP_004629.3	P48634	PRC2A_HUMAN	proline-rich coiled-coil 2A	1593	4 X 57 AA type A repeats.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(6)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|lung(19)|ovary(3)|pancreas(2)|prostate(4)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	70						TGAGGGCCCAGGCCCTCAGGC	0.527																																																0			6											219.0	285.0	262.0					6																	31602070		1511	2709	4220	31710049	SO:0001583	missense	7916			M31293	CCDS4708.1	6p21.3	2010-12-09	2010-12-09	2010-12-09	ENSG00000204469	ENSG00000204469			13918	protein-coding gene	gene with protein product		142580	"""HLA-B associated transcript 2"""	BAT2		2156268, 8499947	Standard	NM_080686		Approved	G2, D6S51E	uc003nvc.4	P48634	OTTHUMG00000031168	ENST00000376033.2:c.4777G>C	6.37:g.31602070G>C	ENSP00000365201:p.Gly1593Arg		31710049	B0UX77|B0UZE9|B0UZL3|O95875|Q05BK4|Q4LE37|Q5SQ29|Q5SQ30|Q5ST84|Q5STX6|Q5STX7|Q68DW9|Q6P9P7|Q6PIN1|Q8MGQ9|Q96QC6	Missense_Mutation	SNP	HMMPfam_BAT2_N	p.G1593R	ENST00000376033.2	37	c.4777	CCDS4708.1	6	.	.	.	.	.	.	.	.	.	.	G	11.67	1.706778	0.30232	.	.	ENSG00000204469	ENST00000424184;ENST00000435052;ENST00000376007;ENST00000376033;ENST00000376010	T;T	0.01685	4.69;4.69	5.31	3.39	0.38822	.	0.416065	0.23418	N	0.048391	T	0.00784	0.0026	N	0.22421	0.69	0.31039	N	0.716541	P	0.38195	0.622	B	0.41271	0.352	T	0.51100	-0.8748	10	0.87932	D	0	-6.9137	9.0427	0.36327	0.1884:0.0:0.8116:0.0	.	1593	P48634	PRC2A_HUMAN	R	1587;1576;1593;1593;818	ENSP00000365175:G1593R;ENSP00000365201:G1593R	ENSP00000365175:G1593R	G	+	1	0	PRRC2A	31710049	0.928000	0.31464	1.000000	0.80357	0.989000	0.77384	1.392000	0.34486	1.485000	0.48380	0.561000	0.74099	GGC	-	NULL		0.527	PRRC2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	BAT2	protein_coding	OTTHUMT00000259319.1	G	NM_080686		31710049	+1	no_errors	NM_080686	genbank	human	reviewed	54_36p	missense	SNP	0.973	C
PPARD	5467	genome.wustl.edu	37	6	35393750	35393750	+	Missense_Mutation	SNP	G	G	A	rs372497373		TCGA-36-2545-01A-01D-1526-09	TCGA-36-2545-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ff47cb75-3f83-4749-a21d-69bfa5eb6dbc	ee353276-9833-4604-a76f-c9f937999791	g.chr6:35393750G>A	ENST00000311565.4	+	9	1569	c.1220G>A	c.(1219-1221)cGg>cAg	p.R407Q	PPARD_ENST00000418635.2_Missense_Mutation_p.R309Q|PPARD_ENST00000540939.1_Missense_Mutation_p.R304Q|PPARD_ENST00000448077.2_Missense_Mutation_p.R368Q|PPARD_ENST00000360694.3_Missense_Mutation_p.R407Q	NM_001171818.1	NP_001165289.1	Q03181	PPARD_HUMAN	peroxisome proliferator-activated receptor delta	407	Ligand-binding.				adipose tissue development (GO:0060612)|anagen (GO:0042640)|apoptotic signaling pathway (GO:0097190)|axon ensheathment (GO:0008366)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cell-substrate adhesion (GO:0031589)|cellular response to hypoxia (GO:0071456)|cholesterol metabolic process (GO:0008203)|decidualization (GO:0046697)|embryo implantation (GO:0007566)|fatty acid beta-oxidation (GO:0006635)|fatty acid catabolic process (GO:0009062)|fatty acid transport (GO:0015908)|gene expression (GO:0010467)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glucose transport (GO:0015758)|heart development (GO:0007507)|intracellular receptor signaling pathway (GO:0030522)|keratinocyte migration (GO:0051546)|keratinocyte proliferation (GO:0043616)|lipid metabolic process (GO:0006629)|mRNA transcription (GO:0009299)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of collagen biosynthetic process (GO:0032966)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of inflammatory response (GO:0050728)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|phospholipid biosynthetic process (GO:0008654)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epidermis development (GO:0045684)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of insulin secretion (GO:0032024)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vasodilation (GO:0045909)|proteoglycan metabolic process (GO:0006029)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to activity (GO:0014823)|response to glucose (GO:0009749)|response to vitamin A (GO:0033189)|transcription initiation from RNA polymerase II promoter (GO:0006367)|vitamin A metabolic process (GO:0006776)|wound healing (GO:0042060)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|drug binding (GO:0008144)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|linoleic acid binding (GO:0070539)|lipid binding (GO:0008289)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(1)|endometrium(1)|large_intestine(4)|liver(2)|lung(9)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	23					Bezafibrate(DB01393)|Icosapent(DB00159)|Sulindac(DB00605)|Treprostinil(DB00374)	GCTGACCTGCGGCAACTGGTC	0.597																																																0			6											101.0	89.0	93.0					6																	35393750		2203	4300	6503	35501728	SO:0001583	missense	5467			L07592	CCDS4803.1, CCDS4804.1, CCDS54994.1, CCDS54995.1	6p21.2	2013-01-16	2006-10-17		ENSG00000112033	ENSG00000112033		"""Nuclear hormone receptors"""	9235	protein-coding gene	gene with protein product		600409	"""peroxisome proliferative activated receptor, delta"""			1333051	Standard	NM_177435		Approved	NUC1, NUCII, FAAR, NR1C2	uc003okm.3	Q03181	OTTHUMG00000014567	ENST00000311565.4:c.1220G>A	6.37:g.35393750G>A	ENSP00000310928:p.Arg407Gln		35501728	A8K6J6|B4E3V3|B6ZGS1|B7Z3W1|E9PE18|Q5D1P0|Q7Z5K0|Q9BUD4	Missense_Mutation	SNP	HMMSmart_SM00399,HMMPfam_zf-C4,superfamily_Glucocorticoid receptor-like (DNA-binding domain),PatternScan_NUCLEAR_REC_DBD_1,superfamily_Nuclear receptor ligand-binding domain,HMMSmart_SM00430,HMMPfam_Hormone_recep	p.R407Q	ENST00000311565.4	37	c.1220	CCDS4803.1	6	.	.	.	.	.	.	.	.	.	.	G	36	5.646574	0.96704	.	.	ENSG00000112033	ENST00000448077;ENST00000360694;ENST00000418635;ENST00000311565;ENST00000540939	D;D;D;D;D	0.84873	-1.91;-1.91;-1.91;-1.91;-1.91	5.05	5.05	0.67936	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.112610	0.64402	D	0.000009	D	0.94528	0.8238	H	0.96777	3.88	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.66351	0.943;0.943;0.943	D	0.96340	0.9250	10	0.87932	D	0	.	18.4266	0.90611	0.0:0.0:1.0:0.0	.	309;368;407	E9PE18;B7Z3W1;Q03181	.;.;PPARD_HUMAN	Q	368;407;309;407;304	ENSP00000414372:R368Q;ENSP00000353916:R407Q;ENSP00000413314:R309Q;ENSP00000310928:R407Q;ENSP00000443759:R304Q	ENSP00000310928:R407Q	R	+	2	0	PPARD	35501728	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.823000	0.99369	2.340000	0.79590	0.561000	0.74099	CGG	-	superfamily_Nuclear receptor ligand-binding domain,HMMSmart_SM00430,HMMPfam_Hormone_recep		0.597	PPARD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PPARD	protein_coding	OTTHUMT00000040288.1	G	NM_006238		35501728	+1	no_errors	NM_006238	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
CEP89	84902	genome.wustl.edu	37	19	33372864	33372864	+	Missense_Mutation	SNP	T	T	A			TCGA-36-2545-01A-01D-1526-09	TCGA-36-2545-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ff47cb75-3f83-4749-a21d-69bfa5eb6dbc	ee353276-9833-4604-a76f-c9f937999791	g.chr19:33372864T>A	ENST00000305768.5	-	18	2109	c.2021A>T	c.(2020-2022)gAg>gTg	p.E674V		NM_032816.3	NP_116205.3	Q96ST8	CEP89_HUMAN	centrosomal protein 89kDa	674					cilium assembly (GO:0042384)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary transition fiber (GO:0097539)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)				breast(2)|cervix(1)|endometrium(4)|large_intestine(4)|lung(15)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	35						CTCCTGCTGCTCCAGCAGACG	0.642																																																0			19											41.0	29.0	33.0					19																	33372864		2203	4300	6503	38064704	SO:0001583	missense	84902			AL832158	CCDS32987.1	19q13.11	2014-02-20	2011-05-06	2011-05-06		ENSG00000121289			25907	protein-coding gene	gene with protein product		615470	"""coiled-coil domain containing 123"""	CCDC123		16395595	Standard	NM_032816		Approved	FLJ14640	uc002nty.3	Q96ST8		ENST00000305768.5:c.2021A>T	19.37:g.33372864T>A	ENSP00000306105:p.Glu674Val		38064704	B9EGA6|Q8N5J8	Missense_Mutation	SNP	NULL	p.E674V	ENST00000305768.5	37	c.2021	CCDS32987.1	19	.	.	.	.	.	.	.	.	.	.	t	19.94	3.920637	0.73213	.	.	ENSG00000121289	ENST00000305768	D	0.88586	-2.4	5.64	5.64	0.86602	.	0.000000	0.64402	D	0.000003	D	0.93318	0.7870	M	0.66939	2.045	0.80722	D	1	D	0.76494	0.999	D	0.77557	0.99	D	0.93213	0.6602	10	0.48119	T	0.1	-16.3105	14.8341	0.70169	0.0:0.0:0.0:1.0	.	674	Q96ST8	CEP89_HUMAN	V	674	ENSP00000306105:E674V	ENSP00000306105:E674V	E	-	2	0	CEP89	38064704	1.000000	0.71417	0.973000	0.42090	0.845000	0.48019	5.620000	0.67736	2.155000	0.67459	0.454000	0.30748	GAG	-	NULL		0.642	CEP89-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCDC123	protein_coding	OTTHUMT00000451300.2	T	NM_032816		38064704	-1	no_errors	NM_032816	genbank	human	validated	54_36p	missense	SNP	0.998	A
BCOR	54880	genome.wustl.edu	37	X	39932444	39932444	+	Missense_Mutation	SNP	C	C	A			TCGA-36-2545-01A-01D-1526-09	TCGA-36-2545-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ff47cb75-3f83-4749-a21d-69bfa5eb6dbc	ee353276-9833-4604-a76f-c9f937999791	g.chrX:39932444C>A	ENST00000378444.4	-	4	2383	c.2155G>T	c.(2155-2157)Gcc>Tcc	p.A719S	BCOR_ENST00000378455.4_Missense_Mutation_p.A719S|BCOR_ENST00000397354.3_Missense_Mutation_p.A719S|BCOR_ENST00000342274.4_Missense_Mutation_p.A719S	NM_001123385.1	NP_001116857.1	Q6W2J9	BCOR_HUMAN	BCL6 corepressor	719					heart development (GO:0007507)|histone H2A monoubiquitination (GO:0035518)|negative regulation of bone mineralization (GO:0030502)|negative regulation of histone H3-K36 methylation (GO:0000415)|negative regulation of histone H3-K4 methylation (GO:0051572)|negative regulation of tooth mineralization (GO:0070171)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis (GO:0042476)|palate development (GO:0060021)|specification of axis polarity (GO:0065001)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	heat shock protein binding (GO:0031072)|histone deacetylase binding (GO:0042826)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(4)|central_nervous_system(11)|cervix(1)|endometrium(24)|eye(6)|haematopoietic_and_lymphoid_tissue(33)|kidney(2)|large_intestine(11)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	126						AACCCCAGGGCATCTTGGTAG	0.567			"""F, N, S, T"""	RARA	"""retinoblastoma, AML, APL(translocation)"""		oculo-facio-cardio-dental genetic																																Rec	yes		X	Xp11.4	54880	BCL6 corepressor	yes		0			X											51.0	50.0	50.0					X																	39932444		2202	4300	6502	39817388	SO:0001583	missense	54880			AF317391	CCDS14250.1, CCDS48092.1, CCDS48093.1	Xp11.4	2014-09-17	2010-06-10		ENSG00000183337	ENSG00000183337		"""Ankyrin repeat domain containing"""	20893	protein-coding gene	gene with protein product		300485	"""BCL6 co-repressor"""			10898795	Standard	NM_017745		Approved	FLJ20285, KIAA1575	uc004den.4	Q6W2J9	OTTHUMG00000024100	ENST00000378444.4:c.2155G>T	X.37:g.39932444C>A	ENSP00000367705:p.Ala719Ser		39817388	D3DWB3|D3DWB4|Q29RF6|Q6P4B6|Q7Z2K7|Q8TEB4|Q96DB3|Q9H232|Q9H233|Q9HCJ7|Q9NXF2	Missense_Mutation	SNP	superfamily_ANK,HMMSmart_ANK,HMMPfam_Ank	p.A719S	ENST00000378444.4	37	c.2155	CCDS48093.1	X	.	.	.	.	.	.	.	.	.	.	C	15.82	2.946500	0.53186	.	.	ENSG00000183337	ENST00000378455;ENST00000397354;ENST00000378444;ENST00000342274;ENST00000406200;ENST00000501455	T;T;T;T;T	0.15372	2.43;2.43;2.43;2.43;2.43	5.71	5.71	0.89125	.	.	.	.	.	T	0.23846	0.0577	N	0.14661	0.345	0.39456	D	0.967486	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.85130	0.997;0.972;0.993;0.972	T	0.09997	-1.0649	9	0.37606	T	0.19	-19.5567	12.2215	0.54437	0.0:0.9206:0.0:0.0794	.	719;719;719;719	Q6W2J9-3;Q6W2J9-4;Q6W2J9;Q6W2J9-2	.;.;BCOR_HUMAN;.	S	719;719;719;719;719;126	ENSP00000367716:A719S;ENSP00000380512:A719S;ENSP00000367705:A719S;ENSP00000345923:A719S;ENSP00000384485:A719S	ENSP00000345923:A719S	A	-	1	0	BCOR	39817388	1.000000	0.71417	0.993000	0.49108	0.991000	0.79684	4.581000	0.60949	2.385000	0.81259	0.513000	0.50165	GCC	-	NULL		0.567	BCOR-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BCOR	protein_coding	OTTHUMT00000060666.2	C	NM_017745		39817388	-1	no_errors	NM_017745	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
ZNF792	126375	genome.wustl.edu	37	19	35449623	35449623	+	Missense_Mutation	SNP	G	G	C			TCGA-36-2545-01A-01D-1526-09	TCGA-36-2545-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ff47cb75-3f83-4749-a21d-69bfa5eb6dbc	ee353276-9833-4604-a76f-c9f937999791	g.chr19:35449623G>C	ENST00000404801.1	-	4	1522	c.1136C>G	c.(1135-1137)tCc>tGc	p.S379C	ZNF792_ENST00000605484.1_Missense_Mutation_p.S312C	NM_175872.4	NP_787068.3	Q3KQV3	ZN792_HUMAN	zinc finger protein 792	379					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(5)	12	all_lung(56;4.18e-08)|Lung NSC(56;6.62e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)			AATGAGGTTGGAACGCTGGCT	0.473																																					GBM(1;7 183 21053 22581 22847)											0			19											48.0	43.0	45.0					19																	35449623		2203	4300	6503	40141463	SO:0001583	missense	126375			AK095770	CCDS12440.2	19q13.11	2013-01-08			ENSG00000180884	ENSG00000180884		"""Zinc fingers, C2H2-type"", ""-"""	24751	protein-coding gene	gene with protein product						8889548	Standard	NM_175872		Approved	FLJ38451	uc002nxh.1	Q3KQV3	OTTHUMG00000150339	ENST00000404801.1:c.1136C>G	19.37:g.35449623G>C	ENSP00000385099:p.Ser379Cys		40141463	B4E333|Q495L1|Q495L3|Q8N932	Missense_Mutation	SNP	superfamily_KRAB domain (Kruppel-associated box Pfam 01352),HMMPfam_KRAB,HMMSmart_SM00349,superfamily_C2H2 and C2HC zinc fingers,PatternScan_ZINC_FINGER_C2H2_1,HMMSmart_SM00355,HMMPfam_zf-C2H2	p.S379C	ENST00000404801.1	37	c.1136	CCDS12440.2	19	.	.	.	.	.	.	.	.	.	.	g	12.11	1.839196	0.32513	.	.	ENSG00000180884	ENST00000404801;ENST00000379189	T	0.19105	2.17	2.55	1.44	0.22558	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.37945	0.1022	M	0.71581	2.175	0.09310	N	1	D	0.76494	0.999	D	0.68192	0.956	T	0.10109	-1.0644	9	0.66056	D	0.02	.	4.8851	0.13699	0.0:0.2423:0.5099:0.2477	.	379	Q3KQV3	ZN792_HUMAN	C	379;139	ENSP00000385099:S379C	ENSP00000368487:S139C	S	-	2	0	ZNF792	40141463	0.132000	0.22450	0.041000	0.18516	0.915000	0.54546	2.473000	0.45145	0.589000	0.29677	0.563000	0.77884	TCC	-	superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1		0.473	ZNF792-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF792	protein_coding	OTTHUMT00000317673.1	G	NM_175872		40141463	-1	no_errors	NM_175872	genbank	human	validated	54_36p	missense	SNP	0.002	C
XRCC6	2547	genome.wustl.edu	37	22	42032774	42032774	+	Splice_Site	SNP	G	G	C			TCGA-36-2545-01A-01D-1526-09	TCGA-36-2545-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ff47cb75-3f83-4749-a21d-69bfa5eb6dbc	ee353276-9833-4604-a76f-c9f937999791	g.chr22:42032774G>C	ENST00000359308.4	+	4	1244	c.589G>C	c.(589-591)Ggc>Cgc	p.G197R	XRCC6_ENST00000405878.1_Splice_Site_p.G197R|XRCC6_ENST00000428575.2_Splice_Site_p.G64R|XRCC6_ENST00000402580.3_Splice_Site_p.G156R|XRCC6_ENST00000360079.3_Splice_Site_p.G197R|XRCC6_ENST00000405506.1_Splice_Site_p.G147R			P12956	XRCC6_HUMAN	X-ray repair complementing defective repair in Chinese hamster cells 6	197					brain development (GO:0007420)|cellular hyperosmotic salinity response (GO:0071475)|cellular response to X-ray (GO:0071481)|DNA duplex unwinding (GO:0032508)|DNA ligation (GO:0006266)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|establishment of integrated proviral latency (GO:0075713)|innate immune response (GO:0045087)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|telomere maintenance (GO:0000723)|transcription, DNA-templated (GO:0006351)|V(D)J recombination (GO:0033151)|viral process (GO:0016032)	cytosol (GO:0005829)|Ku70:Ku80 complex (GO:0043564)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nuclear telomere cap complex (GO:0000783)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	5'-deoxyribose-5-phosphate lyase activity (GO:0051575)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|telomeric DNA binding (GO:0042162)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(4)|liver(2)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	31						CCGAGATACAGGTGGGCATAT	0.458								Non-homologous end-joining																																								0			22											52.0	55.0	54.0					22																	42032774		2203	4300	6503	40362720	SO:0001630	splice_region_variant	2547			J04607	CCDS14021.1, CCDS74870.1, CCDS74871.1	22q13.2	2011-09-12	2008-07-31	2005-05-06	ENSG00000196419	ENSG00000196419			4055	protein-coding gene	gene with protein product	"""Ku autoantigen, 70kDa"""	152690	"""thyroid autoantigen 70kD (Ku antigen)"", ""thyroid autoantigen 70kDa (Ku antigen)"""	G22P1		9200330, 9223317	Standard	NM_001469		Approved	D22S731, D22S671, KU70, ML8	uc003bao.1	P12956	OTTHUMG00000151190	ENST00000359308.4:c.589+1G>C	22.37:g.42032774G>C			40362720	B1AHC8|Q6FG89|Q9UCQ2|Q9UCQ3	Missense_Mutation	SNP	superfamily_SSF53300,HMMPfam_Ku_N,superfamily_SPOC-like,HMMPfam_Ku,HMMSmart_Ku78,HMMPfam_Ku_C,superfamily_SSF68906,HMMPfam_SAP,HMMSmart_SAP	p.G197R	ENST00000359308.4	37	c.589	CCDS14021.1	22	.	.	.	.	.	.	.	.	.	.	G	19.37	3.815526	0.70912	.	.	ENSG00000196419	ENST00000360079;ENST00000402580;ENST00000428575;ENST00000359308;ENST00000405878;ENST00000402409;ENST00000405506	.	.	.	5.39	5.39	0.77823	Ku70/Ku80, N-terminal alpha/beta (1);	0.000000	0.85682	D	0.000000	D	0.85682	0.5753	M	0.90082	3.085	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;0.997;1.0;0.999	D	0.87581	0.2484	9	0.54805	T	0.06	-16.0192	19.1841	0.93635	0.0:0.0:1.0:0.0	.	147;197;156;197	B1AHC9;B1AHC7;B1AHC8;P12956	.;.;.;XRCC6_HUMAN	R	197;156;64;197;197;197;147	.	ENSP00000352257:G197R	G	+	1	0	XRCC6	40362720	1.000000	0.71417	0.997000	0.53966	0.228000	0.25075	9.476000	0.97823	2.537000	0.85549	0.655000	0.94253	GGC	-	superfamily_SSF53300,HMMPfam_Ku_N		0.458	XRCC6-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	XRCC6	protein_coding	OTTHUMT00000321688.1	G	NM_001469	Missense_Mutation	40362720	+1	no_errors	NM_001469	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
TGM7	116179	genome.wustl.edu	37	15	43584208	43584208	+	Missense_Mutation	SNP	A	A	C			TCGA-36-2545-01A-01D-1526-09	TCGA-36-2545-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ff47cb75-3f83-4749-a21d-69bfa5eb6dbc	ee353276-9833-4604-a76f-c9f937999791	g.chr15:43584208A>C	ENST00000452443.2	-	4	531	c.527T>G	c.(526-528)tTc>tGc	p.F176C		NM_052955.2	NP_443187.1	Q96PF1	TGM7_HUMAN	transglutaminase 7	176					peptide cross-linking (GO:0018149)		metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(16)|ovary(2)|prostate(4)|skin(1)	39		all_cancers(109;2.12e-14)|all_epithelial(112;1.99e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;9.14e-07)	L-Glutamine(DB00130)	GGAGGTGATGAATCTTTCATG	0.502																																																0			15											103.0	87.0	93.0					15																	43584208		2201	4299	6500	41371500	SO:0001583	missense	116179			AF363393	CCDS32213.1	15q15.2	2004-07-01				ENSG00000159495		"""Transglutaminases"""	30790	protein-coding gene	gene with protein product	"""transglutaminase Z"""	606776				11390390	Standard	NM_052955		Approved	TGMZ	uc001zrf.1	Q96PF1		ENST00000452443.2:c.527T>G	15.37:g.43584208A>C	ENSP00000389466:p.Phe176Cys		41371500		Missense_Mutation	SNP	superfamily_Ig_E-set,HMMPfam_Transglut_N,superfamily_SSF54001,HMMSmart_TGc,HMMPfam_Transglut_core,PatternScan_TRANSGLUTAMINASES,superfamily_Transglut_C,HMMPfam_Transglut_C	p.F176C	ENST00000452443.2	37	c.527	CCDS32213.1	15	.	.	.	.	.	.	.	.	.	.	A	14.45	2.540093	0.45176	.	.	ENSG00000159495	ENST00000452443	D	0.88741	-2.42	5.5	0.458	0.16670	.	0.443663	0.29046	N	0.013313	T	0.76227	0.3958	N	0.14661	0.345	0.09310	N	1	P	0.52463	0.953	P	0.46975	0.533	T	0.68232	-0.5463	10	0.36615	T	0.2	-7.311	0.8854	0.01243	0.4022:0.2652:0.189:0.1436	.	176	Q96PF1	TGM7_HUMAN	C	176	ENSP00000389466:F176C	ENSP00000389466:F176C	F	-	2	0	TGM7	41371500	0.007000	0.16637	0.374000	0.26016	0.969000	0.65631	0.465000	0.22004	0.482000	0.27582	0.533000	0.62120	TTC	-	superfamily_SSF54001		0.502	TGM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGM7	protein_coding	OTTHUMT00000432489.1	A	NM_052955		41371500	-1	no_errors	NM_052955	genbank	human	validated	54_36p	missense	SNP	0.007	C
PTPRF	5792	genome.wustl.edu	37	1	44069379	44069379	+	Silent	SNP	C	C	T			TCGA-36-2545-01A-01D-1526-09	TCGA-36-2545-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ff47cb75-3f83-4749-a21d-69bfa5eb6dbc	ee353276-9833-4604-a76f-c9f937999791	g.chr1:44069379C>T	ENST00000359947.4	+	16	2896	c.2556C>T	c.(2554-2556)ggC>ggT	p.G852G	PTPRF_ENST00000422171.2_Silent_p.G200G|PTPRF_ENST00000372413.3_Silent_p.G843G|PTPRF_ENST00000496447.1_3'UTR|PTPRF_ENST00000372414.3_Silent_p.G852G|PTPRF_ENST00000438120.1_Silent_p.G843G	NM_002840.3	NP_002831.2	P10586	PTPRF_HUMAN	protein tyrosine phosphatase, receptor type, F	852	Fibronectin type-III 6. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|negative regulation of receptor binding (GO:1900121)|peptidyl-tyrosine dephosphorylation (GO:0035335)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	heparin binding (GO:0008201)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(2)|breast(4)|central_nervous_system(3)|endometrium(9)|kidney(4)|large_intestine(11)|liver(1)|lung(24)|ovary(4)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)	72	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				AGCTGCTGGGCTACCGGCTGC	0.647																																																0			1											39.0	41.0	40.0					1																	44069379		2203	4299	6502	43841966	SO:0001819	synonymous_variant	5792			Y00815	CCDS489.2, CCDS490.2	1p34	2013-02-11			ENSG00000142949	ENSG00000142949		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9670	protein-coding gene	gene with protein product		179590		LAR		7558042	Standard	NM_130440		Approved		uc001cjr.3	P10586	OTTHUMG00000007501	ENST00000359947.4:c.2556C>T	1.37:g.44069379C>T			43841966	D3DPX6|D3DPX7|Q5T021|Q5T022|Q5W9G2|Q86WS0	Silent	SNP	superfamily_Immunoglobulin,HMMPfam_I-set,HMMSmart_SM00409,HMMSmart_SM00408,superfamily_Fibronectin type III,HMMSmart_SM00060,HMMPfam_fn3,superfamily_(Phosphotyrosine protein) phosphatases II,HMMSmart_SM00194,HMMPfam_Y_phosphatase,HMMSmart_SM00404,PatternScan_TYR_PHOSPHATASE_1	p.G852	ENST00000359947.4	37	c.2556	CCDS489.2	1	.	.	.	.	.	.	.	.	.	.	C	8.979	0.974809	0.18736	.	.	ENSG00000142949	ENST00000429895	.	.	.	5.03	5.03	0.67393	.	.	.	.	.	T	0.57725	0.2073	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.55724	-0.8096	4	.	.	.	.	7.7817	0.29068	0.1628:0.7487:0.0:0.0885	.	.	.	.	V	498	.	.	A	+	2	0	PTPRF	43841966	0.984000	0.35163	1.000000	0.80357	0.984000	0.73092	0.221000	0.17680	2.504000	0.84457	0.655000	0.94253	GCT	-	superfamily_Fibronectin type III,HMMSmart_SM00060,HMMPfam_fn3		0.647	PTPRF-001	KNOWN	basic|CCDS	protein_coding	PTPRF	protein_coding	OTTHUMT00000019710.1	C			43841966	+1	no_errors	NM_002840	genbank	human	reviewed	54_36p	silent	SNP	1.000	T
IPP	3652	genome.wustl.edu	37	1	46193309	46193309	+	Missense_Mutation	SNP	T	T	C			TCGA-36-2545-01A-01D-1526-09	TCGA-36-2545-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ff47cb75-3f83-4749-a21d-69bfa5eb6dbc	ee353276-9833-4604-a76f-c9f937999791	g.chr1:46193309T>C	ENST00000396478.3	-	5	1144	c.1042A>G	c.(1042-1044)Att>Gtt	p.I348V		NM_005897.2	NP_005888.1	Q9Y573	IPP_HUMAN	intracisternal A particle-promoted polypeptide	348						actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	actin binding (GO:0003779)			central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(6)|lung(5)|ovary(1)|stomach(2)	20	Acute lymphoblastic leukemia(166;0.155)					TTACCTCCAATAGCGTAGACC	0.373																																																0			1											121.0	116.0	118.0					1																	46193309		2203	4300	6503	45965896	SO:0001583	missense	3652			BC032544	CCDS30702.1, CCDS44132.1	1p34-p32	2013-01-30			ENSG00000197429	ENSG00000197429		"""Kelch-like"", ""BTB/POZ domain containing"""	6108	protein-coding gene	gene with protein product	"""kelch-like family member 27"""	147485				1905535, 8432546	Standard	NM_005897		Approved	KLHL27	uc001cou.3	Q9Y573	OTTHUMG00000008004	ENST00000396478.3:c.1042A>G	1.37:g.46193309T>C	ENSP00000379739:p.Ile348Val		45965896	A2A6V4|D3DQ11|Q8N5C3	Missense_Mutation	SNP	superfamily_POZ domain,HMMPfam_BTB,HMMSmart_SM00225,HMMPfam_BACK,superfamily_Galactose oxidase central domain,HMMPfam_Kelch_1,HMMSmart_SM00612	p.I348V	ENST00000396478.3	37	c.1042	CCDS30702.1	1	.	.	.	.	.	.	.	.	.	.	T	11.44	1.638281	0.29157	.	.	ENSG00000197429	ENST00000359942;ENST00000396478	D;D	0.82167	-1.58;-1.58	5.86	5.86	0.93980	Galactose oxidase, beta-propeller (1);	0.052577	0.85682	D	0.000000	T	0.73760	0.3628	N	0.21240	0.645	0.58432	D	0.999998	B;B	0.25235	0.015;0.121	B;B	0.33960	0.085;0.173	T	0.67643	-0.5618	10	0.02654	T	1	.	16.5602	0.84551	0.0:0.0:0.0:1.0	.	348;348	Q9Y573;A2A6V3	IPP_HUMAN;.	V	348	ENSP00000353024:I348V;ENSP00000379739:I348V	ENSP00000353024:I348V	I	-	1	0	IPP	45965896	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.702000	0.54800	2.367000	0.80283	0.528000	0.53228	ATT	-	superfamily_Galactose oxidase central domain,HMMPfam_Kelch_1,HMMSmart_SM00612		0.373	IPP-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	IPP	protein_coding	OTTHUMT00000021974.3	T	NM_005897		45965896	-1	no_errors	NM_005897	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
PTCHD4	442213	genome.wustl.edu	37	6	47846634	47846634	+	Missense_Mutation	SNP	A	A	G			TCGA-36-2545-01A-01D-1526-09	TCGA-36-2545-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ff47cb75-3f83-4749-a21d-69bfa5eb6dbc	ee353276-9833-4604-a76f-c9f937999791	g.chr6:47846634A>G	ENST00000339488.4	-	3	1979	c.1946T>C	c.(1945-1947)tTc>tCc	p.F649S		NM_001013732.3	NP_001013754.3	Q6ZW05	PTHD4_HUMAN	patched domain containing 4	649						integral component of membrane (GO:0016021)	hedgehog receptor activity (GO:0008158)										ATGGTCCATGAAGACAAAGGA	0.468																																																0			6											163.0	154.0	157.0					6																	47846634		2203	4300	6503	47954593	SO:0001583	missense	442213				CCDS34473.2	6p12.3	2012-02-06	2012-02-06	2012-02-06	ENSG00000244694	ENSG00000244694			21345	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 138"""	C6orf138			Standard	NM_001013732		Approved	dJ402H5.2, FLJ41841	uc011dwm.2	Q6ZW05	OTTHUMG00000150404	ENST00000339488.4:c.1946T>C	6.37:g.47846634A>G	ENSP00000341914:p.Phe649Ser		47954593	B0QZ29|B4DRK3|Q5T884	Missense_Mutation	SNP	HMMPfam_Patched,superfamily_SSF82866	p.F632S	ENST00000339488.4	37	c.1895	CCDS34473.2	6	.	.	.	.	.	.	.	.	.	.	A	17.59	3.426843	0.62733	.	.	ENSG00000244694	ENST00000339488	D	0.89050	-2.46	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	D	0.92244	0.7540	L	0.59436	1.845	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	D	0.93290	0.6667	10	0.87932	D	0	.	16.35	0.83199	1.0:0.0:0.0:0.0	.	649	Q6ZW05	CF138_HUMAN	S	649	ENSP00000341914:F649S	ENSP00000341914:F649S	F	-	2	0	C6orf138	47954593	1.000000	0.71417	0.998000	0.56505	0.985000	0.73830	6.982000	0.76173	2.270000	0.75569	0.528000	0.53228	TTC	-	HMMPfam_Patched,superfamily_SSF82866		0.468	PTCHD4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	C6orf138	protein_coding	OTTHUMT00000317987.2	A	NM_001013732		47954593	-1	no_errors	NM_001013732	genbank	human	validated	54_36p	missense	SNP	1.000	G
BRD1	23774	genome.wustl.edu	37	22	50216771	50216771	+	Missense_Mutation	SNP	T	T	A			TCGA-36-2545-01A-01D-1526-09	TCGA-36-2545-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ff47cb75-3f83-4749-a21d-69bfa5eb6dbc	ee353276-9833-4604-a76f-c9f937999791	g.chr22:50216771T>A	ENST00000216267.8	-	1	1681	c.1195A>T	c.(1195-1197)Aat>Tat	p.N399Y	BRD1_ENST00000542442.1_Missense_Mutation_p.N38Y|BRD1_ENST00000457780.2_Missense_Mutation_p.N399Y|BRD1_ENST00000342989.5_5'UTR|BRD1_ENST00000459821.1_5'UTR|BRD1_ENST00000404760.1_Missense_Mutation_p.N399Y|BRD1_ENST00000404034.1_Missense_Mutation_p.N399Y	NM_014577.1	NP_055392.1	O95696	BRD1_HUMAN	bromodomain containing 1	399					histone H3 acetylation (GO:0043966)	MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleus (GO:0005634)	histone binding (GO:0042393)|zinc ion binding (GO:0008270)			endometrium(6)|kidney(3)|large_intestine(5)|lung(17)|ovary(1)|pancreas(1)|prostate(3)|skin(1)	37		all_cancers(38;6.11e-10)|all_epithelial(38;8.06e-09)|all_lung(38;6.64e-05)|Lung NSC(38;0.0011)|Breast(42;0.00235)|Ovarian(80;0.0139)|Lung SC(80;0.164)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0369)|BRCA - Breast invasive adenocarcinoma(115;0.21)		CCGTAAATATTCAGAGGCCTC	0.532																																																0			22											119.0	142.0	134.0					22																	50216771		2203	4300	6503	48602775	SO:0001583	missense	23774			AF005067	CCDS14080.1	22q13.33	2008-07-01	2002-01-14		ENSG00000100425	ENSG00000100425			1102	protein-coding gene	gene with protein product	"""BR140-like"""	604589	"""bromodomain-containing 1"""			10591208, 10602503	Standard	NM_014577		Approved	BRL, BRPF2	uc003biv.3	O95696	OTTHUMG00000150288	ENST00000216267.8:c.1195A>T	22.37:g.50216771T>A	ENSP00000216267:p.Asn399Tyr		48602775	A6ZJA4	Missense_Mutation	SNP	HMMPfam_EPL1,superfamily_FYVE_PHD_ZnF,HMMSmart_PHD,HMMPfam_PHD,PatternScan_ZF_PHD_1,superfamily_Bromodomain,HMMSmart_BROMO,HMMPfam_Bromodomain,PatternScan_BROMODOMAIN_1,superfamily_SSF63748,HMMSmart_PWWP	p.N399Y	ENST00000216267.8	37	c.1195	CCDS14080.1	22	.	.	.	.	.	.	.	.	.	.	T	16.06	3.015035	0.54468	.	.	ENSG00000100425	ENST00000216267;ENST00000404034;ENST00000404760;ENST00000457780;ENST00000542442	T;T;T;T;T	0.28069	2.57;2.57;2.57;2.39;1.63	5.67	5.67	0.87782	.	0.177364	0.64402	D	0.000014	T	0.49508	0.1561	L	0.55481	1.735	0.44221	D	0.997056	D;D;D	0.69078	0.993;0.997;0.996	P;P;D	0.63597	0.825;0.825;0.916	T	0.48603	-0.9021	10	0.59425	D	0.04	.	15.8982	0.79350	0.0:0.0:0.0:1.0	.	399;399;399	Q86X06;O95696;O95696-2	.;BRD1_HUMAN;.	Y	399;399;399;399;38	ENSP00000216267:N399Y;ENSP00000384076:N399Y;ENSP00000385858:N399Y;ENSP00000410042:N399Y;ENSP00000437514:N38Y	ENSP00000216267:N399Y	N	-	1	0	BRD1	48602775	0.965000	0.33210	0.999000	0.59377	0.888000	0.51559	2.251000	0.43187	2.159000	0.67721	0.533000	0.62120	AAT	-	NULL		0.532	BRD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	BRD1	protein_coding	OTTHUMT00000317402.1	T	NM_014577		48602775	-1	no_errors	NM_014577	genbank	human	reviewed	54_36p	missense	SNP	0.995	A
SLC35A2	7355	genome.wustl.edu	37	X	48762607	48762607	+	Silent	SNP	C	C	A			TCGA-36-2545-01A-01D-1526-09	TCGA-36-2545-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ff47cb75-3f83-4749-a21d-69bfa5eb6dbc	ee353276-9833-4604-a76f-c9f937999791	g.chrX:48762607C>A	ENST00000247138.5	-	4	582	c.579G>T	c.(577-579)cgG>cgT	p.R193R	SLC35A2_ENST00000413561.2_Silent_p.R132R|SLC35A2_ENST00000445167.2_Intron|SLC35A2_ENST00000452555.2_Silent_p.R221R|SLC35A2_ENST00000376521.1_Silent_p.R193R|SLC35A2_ENST00000376529.3_Intron|SLC35A2_ENST00000376515.3_Intron	NM_005660.1	NP_005651.1	P78381	S35A2_HUMAN	solute carrier family 35 (UDP-galactose transporter), member A2	193					galactose metabolic process (GO:0006012)|transmembrane transport (GO:0055085)|UDP-galactose transport (GO:0015785)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	sugar:proton symporter activity (GO:0005351)|UDP-galactose transmembrane transporter activity (GO:0005459)			breast(1)|endometrium(4)|kidney(2)|large_intestine(1)|lung(5)|upper_aerodigestive_tract(2)	15						GATCCAGTGGCCGTGGGCCTC	0.642																																																0			X											10.0	11.0	11.0					X																	48762607		2179	4263	6442	48647551	SO:0001819	synonymous_variant	7355			D88146	CCDS14311.1, CCDS35247.1, CCDS43937.1, CCDS65253.1, CCDS65254.1, CCDS75973.1, CCDS75974.1, CCDS75975.1	Xp11.23-p11.22	2013-05-22			ENSG00000102100	ENSG00000102100		"""Solute carriers"""	11022	protein-coding gene	gene with protein product		314375	"""solute carrier family 35 (UDP-galactose transporter), member 2"""	UGALT		8128316	Standard	NM_001042498		Approved	UGAT, UGT, UGT1, UGT2, UGTL	uc004dlo.1	P78381	OTTHUMG00000024129	ENST00000247138.5:c.579G>T	X.37:g.48762607C>A			48647551	A8K2L9|A8K9V1|B4DE11|B4DPT2|E7EW45|Q8IV21|Q92553	Silent	SNP	superfamily_Multidrug resistance efflux transporter EmrE,HMMPfam_Nuc_sug_transp	p.R193	ENST00000247138.5	37	c.579	CCDS14311.1	X																																																																																			-	HMMPfam_Nuc_sug_transp		0.642	SLC35A2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC35A2	protein_coding	OTTHUMT00000060790.1	C	NM_005660		48647551	-1	no_errors	NM_005660	genbank	human	provisional	54_36p	silent	SNP	0.999	A
STAB1	23166	genome.wustl.edu	37	3	52548846	52548846	+	Splice_Site	SNP	G	G	T			TCGA-36-2545-01A-01D-1526-09	TCGA-36-2545-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ff47cb75-3f83-4749-a21d-69bfa5eb6dbc	ee353276-9833-4604-a76f-c9f937999791	g.chr3:52548846G>T	ENST00000321725.6	+	35	3883		c.e35+1			NM_015136.2	NP_055951.2	Q9NY15	STAB1_HUMAN	stabilin 1						cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|defense response to bacterium (GO:0042742)|inflammatory response (GO:0006954)|negative regulation of angiogenesis (GO:0016525)|oxidation-reduction process (GO:0055114)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronic acid binding (GO:0005540)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein receptor activity (GO:0005041)|protein disulfide oxidoreductase activity (GO:0015035)|scavenger receptor activity (GO:0005044)			breast(4)|central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(13)|liver(1)|lung(27)|ovary(1)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	76				BRCA - Breast invasive adenocarcinoma(193;1.73e-05)|Kidney(197;0.00182)|KIRC - Kidney renal clear cell carcinoma(197;0.00205)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)		GGCCCTGCGGGTGAGAGGCTG	0.682																																																0			3											32.0	37.0	35.0					3																	52548846		2203	4299	6502	52523886	SO:0001630	splice_region_variant	23166			AJ275213	CCDS33768.1	3p21.31	2008-07-18			ENSG00000010327	ENSG00000010327			18628	protein-coding gene	gene with protein product	"""MS-1 antigen"", ""fasciclin egf-like, laminin-type egf-like, and link domain-containing scavenger receptor-1"", ""common lymphatic endothelial and vascular endothelial receptor-1"""	608560				11829752, 12077138	Standard	XM_005264973		Approved	KIAA0246, STAB-1, FEEL-1, CLEVER-1, FELE-1, FEX1	uc003dej.3	Q9NY15	OTTHUMG00000158574	ENST00000321725.6:c.3807+1G>T	3.37:g.52548846G>T			52523886	A7E297|Q8IUH0|Q8IUH1|Q93072	Splice_Site	SNP	-	e35+1	ENST00000321725.6	37	c.3807+1	CCDS33768.1	3	.	.	.	.	.	.	.	.	.	.	G	22.7	4.320026	0.81469	.	.	ENSG00000010327	ENST00000321725	.	.	.	5.72	5.72	0.89469	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.3771	0.74615	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	STAB1	52523886	1.000000	0.71417	1.000000	0.80357	0.794000	0.44872	4.139000	0.58024	2.709000	0.92574	0.561000	0.74099	.	-	-		0.682	STAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAB1	protein_coding	OTTHUMT00000351380.2	G	NM_015136	Intron	52523886	+1	no_errors	NM_015136	genbank	human	reviewed	54_36p	splice_site	SNP	1.000	T
BRSK1	84446	genome.wustl.edu	37	19	55805403	55805403	+	Silent	SNP	C	C	T	rs373361295	byFrequency	TCGA-36-2545-01A-01D-1526-09	TCGA-36-2545-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ff47cb75-3f83-4749-a21d-69bfa5eb6dbc	ee353276-9833-4604-a76f-c9f937999791	g.chr19:55805403C>T	ENST00000309383.1	+	5	754	c.477C>T	c.(475-477)ccC>ccT	p.P159P	BRSK1_ENST00000590333.1_Silent_p.P175P|BRSK1_ENST00000585418.1_Silent_p.P159P	NM_032430.1	NP_115806.1	Q8TDC3	BRSK1_HUMAN	BR serine/threonine kinase 1	159	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axonogenesis (GO:0007409)|cellular response to DNA damage stimulus (GO:0006974)|centrosome duplication (GO:0051298)|establishment of cell polarity (GO:0030010)|G2 DNA damage checkpoint (GO:0031572)|neuron differentiation (GO:0030182)|neurotransmitter secretion (GO:0007269)|protein phosphorylation (GO:0006468)|response to UV (GO:0009411)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|gamma-tubulin binding (GO:0043015)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(15)|ovary(2)|prostate(2)|skin(6)|stomach(1)	48		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0474)		ACCTAAAGCCCGAGAACCTGC	0.602													C|||	2	0.000399361	0.0	0.0	5008	,	,		14059	0.002		0.0	False		,,,				2504	0.0															0			19						C		1,4405		0,1,2202	144.0	147.0	146.0		477	-9.6	0.4	19		146	0,8600		0,0,4300	no	coding-synonymous	BRSK1	NM_032430.1		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		159/779	55805403	1,13005	2203	4300	6503	60497215	SO:0001819	synonymous_variant	84446			AB058714	CCDS12921.1	19q13.4	2008-02-05				ENSG00000160469			18994	protein-coding gene	gene with protein product		609235				14976552	Standard	NM_032430		Approved	KIAA1811	uc002qkg.3	Q8TDC3		ENST00000309383.1:c.477C>T	19.37:g.55805403C>T			60497215	F1DG44|Q5J5B5|Q8NDD0|Q8NDR4|Q8TDC2|Q96AV4|Q96JL4	Silent	SNP	superfamily_Kinase_like,HMMSmart_S_TKc,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_ST	p.P159	ENST00000309383.1	37	c.477	CCDS12921.1	19																																																																																			-	superfamily_Kinase_like,HMMSmart_S_TKc,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ST		0.602	BRSK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRSK1	protein_coding	OTTHUMT00000452787.1	C	NM_032430		60497215	+1	no_errors	NM_032430	genbank	human	validated	54_36p	silent	SNP	0.532	T
TMEM258	746	genome.wustl.edu	37	11	61562915	61562915	+	5'Flank	SNP	G	G	T			TCGA-36-2545-01A-01D-1526-09	TCGA-36-2545-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ff47cb75-3f83-4749-a21d-69bfa5eb6dbc	ee353276-9833-4604-a76f-c9f937999791	g.chr11:61562915G>T	ENST00000537328.1	-	0	0				FEN1_ENST00000305885.2_Missense_Mutation_p.G28C|FADS2_ENST00000574708.1_Intron|TMEM258_ENST00000543510.1_5'Flank|MIR611_ENST00000384869.1_RNA	NM_014206.3	NP_055021.1	P61165	TM258_HUMAN	transmembrane protein 258							integral component of membrane (GO:0016021)											GAGCTACTTTGGCCGTAAGGT	0.532																																																0			11											78.0	70.0	73.0					11																	61562915		2202	4299	6501	61319491	SO:0001631	upstream_gene_variant	2237				CCDS8009.1	11q12.2	2012-12-03	2012-12-03	2012-12-03	ENSG00000134825	ENSG00000134825			1164	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 10"""	C11orf10		12427278	Standard	NM_014206		Approved		uc001nsf.3	P61165	OTTHUMG00000168172		11.37:g.61562915G>T	Exception_encountered		61319491	A8K6L8|Q9D953|Q9Y2Q7	Missense_Mutation	SNP	HMMPfam_XPG_N,HMMSmart_SM00485,superfamily_PIN domain-like,PatternScan_XPG_1,HMMSmart_SM00484,HMMPfam_XPG_I,PatternScan_XPG_2,superfamily_5' to 3' exonuclease C-terminal subdomain,HMMSmart_SM00279	p.G28C	ENST00000537328.1	37	c.82	CCDS8009.1	11	.	.	.	.	.	.	.	.	.	.	G	22.3	4.266835	0.80469	.	.	ENSG00000168496	ENST00000305885;ENST00000535723	T;T	0.58506	0.33;0.33	5.44	5.44	0.79542	XPG N-terminal (2);	0.000000	0.85682	D	0.000000	D	0.86418	0.5928	H	0.98314	4.2	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.91403	0.5145	10	0.87932	D	0	-25.2484	19.6661	0.95893	0.0:0.0:1.0:0.0	.	28	P39748	FEN1_HUMAN	C	28	ENSP00000305480:G28C;ENSP00000445692:G28C	ENSP00000305480:G28C	G	+	1	0	FEN1	61319491	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	9.478000	0.97927	2.724000	0.93272	0.561000	0.74099	GGC	-	HMMPfam_XPG_N,HMMSmart_SM00485,superfamily_PIN domain-like		0.532	TMEM258-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FEN1	protein_coding	OTTHUMT00000398577.1	G	NM_014206		61319491	+1	no_errors	NM_004111	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
EOGT	285203	genome.wustl.edu	37	3	69026887	69026887	+	Missense_Mutation	SNP	G	G	A	rs199832969		TCGA-36-2545-01A-01D-1526-09	TCGA-36-2545-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ff47cb75-3f83-4749-a21d-69bfa5eb6dbc	ee353276-9833-4604-a76f-c9f937999791	g.chr3:69026887G>A	ENST00000383701.3	-	18	2208	c.1466C>T	c.(1465-1467)cCg>cTg	p.P489L	EOGT_ENST00000540764.1_Missense_Mutation_p.P388L|EOGT_ENST00000295571.5_Missense_Mutation_p.P405L|EOGT_ENST00000540955.1_Missense_Mutation_p.P213L	NM_001278689.1	NP_001265618.1	Q5NDL2	EOGT_HUMAN	EGF domain-specific O-linked N-acetylglucosamine (GlcNAc) transferase	489					protein O-linked glycosylation (GO:0006493)	endoplasmic reticulum (GO:0005783)	protein N-acetylglucosaminyltransferase activity (GO:0016262)										GGTGAACTTCGGGTGCTCCCC	0.443																																																0			3											70.0	70.0	70.0					3																	69026887		2203	4300	6503	69109577	SO:0001583	missense	285203			AK091089	CCDS2908.1, CCDS63684.1	3p14.1	2013-10-11	2012-05-21	2012-05-21	ENSG00000163378	ENSG00000163378	2.4.1.255		28526	protein-coding gene	gene with protein product	"""AER61 glycosyltransferase"""	614789	"""chromosome 3 open reading frame 64"""	C3orf64		22310717	Standard	NM_001278689		Approved	AER61, FLJ33770	uc003dnk.3	Q5NDL2	OTTHUMG00000156279	ENST00000383701.3:c.1466C>T	3.37:g.69026887G>A	ENSP00000373206:p.Pro489Leu		69109577	A8K2U1|B4DFH5|L7X1M5|Q6MZY0|Q6P985|Q6ZTV0	Missense_Mutation	SNP	HMMPfam_DUF563,PatternScan_ER_TARGET	p.P405L	ENST00000383701.3	37	c.1214		3	.	.	.	.	.	.	.	.	.	.	G	16.76	3.213462	0.58452	.	.	ENSG00000163378	ENST00000383701;ENST00000295571;ENST00000540955;ENST00000540764	.	.	.	5.52	4.63	0.57726	.	0.094428	0.85682	D	0.000000	T	0.50360	0.1611	L	0.52364	1.645	0.80722	D	1	P;P	0.44429	0.694;0.835	B;B	0.38327	0.061;0.271	T	0.47649	-0.9101	9	0.23302	T	0.38	-9.8243	15.6493	0.77078	0.0:0.0:0.8616:0.1384	.	489;405	Q5NDL2;Q5NDL2-3	AER61_HUMAN;.	L	489;405;213;388	.	ENSP00000295571:P405L	P	-	2	0	C3orf64	69109577	1.000000	0.71417	0.859000	0.33776	0.967000	0.64934	7.873000	0.87193	1.319000	0.45190	0.591000	0.81541	CCG	-	NULL		0.443	EOGT-002	KNOWN	basic|appris_principal	protein_coding	C3orf64	protein_coding	OTTHUMT00000343722.1	G	NM_173654		69109577	-1	no_errors	NM_173654	genbank	human	provisional	54_36p	missense	SNP	1.000	A
ANKRD53	79998	genome.wustl.edu	37	2	71206928	71206928	+	Missense_Mutation	SNP	C	C	G			TCGA-36-2545-01A-01D-1526-09	TCGA-36-2545-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ff47cb75-3f83-4749-a21d-69bfa5eb6dbc	ee353276-9833-4604-a76f-c9f937999791	g.chr2:71206928C>G	ENST00000360589.3	+	3	589	c.555C>G	c.(553-555)gaC>gaG	p.D185E	ANKRD53_ENST00000272421.6_Missense_Mutation_p.D185E|ANKRD53_ENST00000441349.1_Missense_Mutation_p.D151E|ANKRD53_ENST00000457410.1_Missense_Mutation_p.D151E|AC007040.11_ENST00000606025.1_Intron	NM_001115116.1	NP_001108588.1	Q8N9V6	ANR53_HUMAN	ankyrin repeat domain 53	185										endometrium(2)|large_intestine(3)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	11						TCCACAGGGACAACACCACCG	0.597																																																0			2											159.0	107.0	125.0					2																	71206928		2203	4300	6503	71060436	SO:0001583	missense	79998			BC035234	CCDS1913.1, CCDS46321.1	2p13.3	2013-01-10			ENSG00000144031	ENSG00000144031		"""Ankyrin repeat domain containing"""	25691	protein-coding gene	gene with protein product							Standard	NM_024933		Approved	FLJ12056, FLJ36160	uc002shl.4	Q8N9V6	OTTHUMG00000129712	ENST00000360589.3:c.555C>G	2.37:g.71206928C>G	ENSP00000353796:p.Asp185Glu		71060436	Q8IYP8	Missense_Mutation	SNP	superfamily_ANK,HMMSmart_ANK,HMMPfam_Ank	p.D185E	ENST00000360589.3	37	c.555	CCDS46321.1	2	.	.	.	.	.	.	.	.	.	.	C	11.76	1.734047	0.30684	.	.	ENSG00000144031	ENST00000272421;ENST00000441349;ENST00000457410;ENST00000360589	T;T;T;T	0.71579	1.49;-0.58;1.49;1.49	4.88	2.91	0.33838	Ankyrin repeat-containing domain (4);	0.394290	0.23060	N	0.052392	T	0.47377	0.1442	N	0.12182	0.205	0.22666	N	0.998879	P;B;P	0.40398	0.716;0.316;0.607	B;B;B	0.35931	0.194;0.214;0.12	T	0.45454	-0.9260	10	0.72032	D	0.01	-25.3195	7.5905	0.28019	0.1887:0.6288:0.1825:0.0	.	151;185;185	C9JQK2;Q8N9V6;Q8N9V6-2	.;ANR53_HUMAN;.	E	185;151;151;185	ENSP00000272421:D185E;ENSP00000388883:D151E;ENSP00000407004:D151E;ENSP00000353796:D185E	ENSP00000272421:D185E	D	+	3	2	ANKRD53	71060436	0.999000	0.42202	0.823000	0.32752	0.034000	0.12701	1.053000	0.30442	1.171000	0.42768	0.650000	0.86243	GAC	-	superfamily_ANK,HMMSmart_ANK,HMMPfam_Ank		0.597	ANKRD53-004	PUTATIVE	basic|appris_candidate_longest|CCDS	protein_coding	ANKRD53	protein_coding	OTTHUMT00000330275.2	C	NM_024933		71060436	+1	no_errors	NM_024933	genbank	human	validated	54_36p	missense	SNP	0.736	G
MPHOSPH10	10199	genome.wustl.edu	37	2	71376573	71376573	+	Missense_Mutation	SNP	C	C	T			TCGA-36-2545-01A-01D-1526-09	TCGA-36-2545-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ff47cb75-3f83-4749-a21d-69bfa5eb6dbc	ee353276-9833-4604-a76f-c9f937999791	g.chr2:71376573C>T	ENST00000244230.2	+	10	2238	c.1886C>T	c.(1885-1887)tCc>tTc	p.S629F		NM_005791.2	NP_005782.1	O00566	MPP10_HUMAN	M-phase phosphoprotein 10 (U3 small nucleolar ribonucleoprotein)	629					negative regulation of phosphatase activity (GO:0010923)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|rRNA processing (GO:0006364)	chromosome (GO:0005694)|nucleolus (GO:0005730)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(2)|pancreas(2)|skin(2)|stomach(1)	26						GGCAAAGCTTCCTTCATAAAG	0.458																																																0			2											63.0	61.0	61.0					2																	71376573		2203	4300	6503	71230081	SO:0001583	missense	10199			X98494	CCDS1916.1	2p13.3	2014-06-12			ENSG00000124383	ENSG00000124383			7213	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 106"""	605503				8885239, 9450966	Standard	NM_005791		Approved	MPP10, MPP10P, CT90, PPP1R106	uc002sht.2	O00566	OTTHUMG00000129715	ENST00000244230.2:c.1886C>T	2.37:g.71376573C>T	ENSP00000244230:p.Ser629Phe		71230081	A0AVJ8	Missense_Mutation	SNP	HMMPfam_Mpp10	p.S629F	ENST00000244230.2	37	c.1886	CCDS1916.1	2	.	.	.	.	.	.	.	.	.	.	C	14.65	2.599243	0.46318	.	.	ENSG00000124383	ENST00000244230;ENST00000425650	T;T	0.10573	2.86;2.86	5.62	3.84	0.44239	.	0.442567	0.24065	N	0.041866	T	0.19167	0.0460	M	0.70275	2.135	0.09310	N	1	P	0.45212	0.853	P	0.49853	0.624	T	0.04870	-1.0921	10	0.46703	T	0.11	.	8.042	0.30527	0.0:0.7528:0.0:0.2472	.	629	O00566	MPP10_HUMAN	F	629;489	ENSP00000244230:S629F;ENSP00000393034:S489F	ENSP00000244230:S629F	S	+	2	0	MPHOSPH10	71230081	0.005000	0.15991	0.001000	0.08648	0.114000	0.19823	2.032000	0.41127	0.874000	0.35823	0.563000	0.77884	TCC	-	HMMPfam_Mpp10		0.458	MPHOSPH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MPHOSPH10	protein_coding	OTTHUMT00000251924.2	C	NM_005791		71230081	+1	no_errors	NM_005791	genbank	human	reviewed	54_36p	missense	SNP	0.006	T
ITGB4	3691	genome.wustl.edu	37	17	73723323	73723323	+	Missense_Mutation	SNP	G	G	A			TCGA-36-2545-01A-01D-1526-09	TCGA-36-2545-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ff47cb75-3f83-4749-a21d-69bfa5eb6dbc	ee353276-9833-4604-a76f-c9f937999791	g.chr17:73723323G>A	ENST00000200181.3	+	3	315	c.128G>A	c.(127-129)cGt>cAt	p.R43H	ITGB4_ENST00000584558.1_3'UTR|ITGB4_ENST00000450894.3_Missense_Mutation_p.R43H|ITGB4_ENST00000449880.2_Missense_Mutation_p.R43H|ITGB4_ENST00000579662.1_Missense_Mutation_p.R43H|ITGB4_ENST00000339591.3_Missense_Mutation_p.R43H	NM_000213.3	NP_000204.3	P16144	ITB4_HUMAN	integrin, beta 4	43	PSI.			R -> Y (in Ref. 11; AA sequence). {ECO:0000305}.	amelogenesis (GO:0097186)|autophagy (GO:0006914)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell motility (GO:0048870)|cell-matrix adhesion (GO:0007160)|digestive tract development (GO:0048565)|extracellular matrix organization (GO:0030198)|filopodium assembly (GO:0046847)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|mesodermal cell differentiation (GO:0048333)|nail development (GO:0035878)|renal system development (GO:0072001)|response to wounding (GO:0009611)|skin development (GO:0043588)	basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|hemidesmosome (GO:0030056)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor binding (GO:0001664)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|liver(1)|lung(25)|skin(1)|urinary_tract(1)	43	all_cancers(13;1.5e-07)		all cancers(21;8.32e-07)|Epithelial(20;1.92e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|Lung(188;0.132)|LUSC - Lung squamous cell carcinoma(166;0.154)			GAGTGTGTCCGTGTGGATAAG	0.592																																																0			17											87.0	69.0	75.0					17																	73723323		2203	4300	6503	71234918	SO:0001583	missense	3691				CCDS11727.1, CCDS32736.1, CCDS58599.1	17q25.1	2013-09-19			ENSG00000132470	ENSG00000132470		"""CD molecules"", ""Integrins"", ""Fibronectin type III domain containing"""	6158	protein-coding gene	gene with protein product		147557				2070796	Standard	XM_005257309		Approved	CD104	uc002jpg.3	P16144	OTTHUMG00000179814	ENST00000200181.3:c.128G>A	17.37:g.73723323G>A	ENSP00000200181:p.Arg43His		71234918	A0AVL6|O14690|O14691|O15339|O15340|O15341|Q0VF97|Q9UIQ4	Missense_Mutation	SNP	HMMSmart_SM00423,HMMPfam_Integrin_beta,HMMSmart_SM00187,superfamily_vWA-like,superfamily_Integrin domains,superfamily_EGF/Laminin,PatternScan_EGF_1,PatternScan_EGF_2,PatternScan_INTEGRIN_BETA,HMMPfam_EGF_2,superfamily_Integrin beta tail domain,HMMPfam_Integrin_B_tail,HMMPfam_Calx-beta,HMMSmart_SM00237,HMMSmart_SM00060,HMMPfam_fn3,superfamily_Fibronectin type III	p.R43H	ENST00000200181.3	37	c.128	CCDS11727.1	17	.	.	.	.	.	.	.	.	.	.	G	13.88	2.368807	0.42003	.	.	ENSG00000132470	ENST00000200181;ENST00000339591;ENST00000449880	D;D;D	0.92805	-3.11;-3.11;-3.11	5.36	5.36	0.76844	Integrin beta subunit, N-terminal (2);	0.155969	0.46758	D	0.000267	D	0.96119	0.8735	M	0.77820	2.39	0.58432	D	0.999998	D;D;D;D	0.89917	0.999;1.0;1.0;1.0	D;D;D;D	0.81914	0.962;0.981;0.989;0.995	D	0.96451	0.9334	10	0.87932	D	0	.	19.0937	0.93240	0.0:0.0:1.0:0.0	.	43;43;43;43	P16144-5;P16144-3;A0AVL6;P16144	.;.;.;ITB4_HUMAN	H	43	ENSP00000200181:R43H;ENSP00000344079:R43H;ENSP00000400217:R43H	ENSP00000200181:R43H	R	+	2	0	ITGB4	71234918	1.000000	0.71417	0.957000	0.39632	0.624000	0.37722	5.191000	0.65110	2.505000	0.84491	0.655000	0.94253	CGT	-	HMMSmart_SM00423,HMMPfam_Integrin_beta,HMMSmart_SM00187		0.592	ITGB4-001	KNOWN	basic|CCDS	protein_coding	ITGB4	protein_coding	OTTHUMT00000448334.1	G			71234918	+1	no_errors	NM_000213	genbank	human	reviewed	54_36p	missense	SNP	0.999	A
TRPM3	80036	genome.wustl.edu	37	9	73218366	73218366	+	Silent	SNP	C	C	T			TCGA-36-2545-01A-01D-1526-09	TCGA-36-2545-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ff47cb75-3f83-4749-a21d-69bfa5eb6dbc	ee353276-9833-4604-a76f-c9f937999791	g.chr9:73218366C>T	ENST00000377111.2	-	19	2895	c.2652G>A	c.(2650-2652)ctG>ctA	p.L884L	TRPM3_ENST00000396292.4_Silent_p.L756L|TRPM3_ENST00000358082.3_Silent_p.L746L|TRPM3_ENST00000357533.2_Silent_p.L888L|TRPM3_ENST00000423814.3_Silent_p.L911L|TRPM3_ENST00000377110.3_Silent_p.L884L|TRPM3_ENST00000377106.1_Silent_p.L756L|TRPM3_ENST00000396280.5_Silent_p.L733L|TRPM3_ENST00000377105.1_Silent_p.L743L|TRPM3_ENST00000360823.2_Silent_p.L746L|TRPM3_ENST00000396285.1_Silent_p.L731L|TRPM3_ENST00000408909.2_Silent_p.L743L	NM_001007471.2	NP_001007472.2	Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel, subfamily M, member 3	909					calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|sensory perception of temperature stimulus (GO:0050951)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)			NS(2)|breast(4)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(18)|liver(1)|lung(46)|ovary(3)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(1)	95						TGAAGAGCATCAGGTATCCGA	0.507																																																0			9											94.0	78.0	83.0					9																	73218366		2203	4300	6503	72408186	SO:0001819	synonymous_variant	80036			AB046836	CCDS6634.1, CCDS6635.1, CCDS6636.1, CCDS6637.1, CCDS43835.1, CCDS65064.1	9q21.11	2011-12-14			ENSG00000083067	ENSG00000083067		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17992	protein-coding gene	gene with protein product	"""melastatin 2"""	608961				16382100	Standard	NM_206946		Approved	KIAA1616, LTRPC3, GON-2	uc004aid.3	Q9HCF6	OTTHUMG00000019997	ENST00000377111.2:c.2652G>A	9.37:g.73218366C>T			72408186	A2A3F6|A9Z1Y7|Q5VW02|Q5VW03|Q5VW04|Q5W5T7|Q86SH0|Q86SH6|Q86UL0|Q86WK1|Q86WK2|Q86WK3|Q86WK4|Q86YZ9|Q86Z00|Q86Z01|Q9H0X2	Silent	SNP	HMMPfam_Ion_trans	p.L884	ENST00000377111.2	37	c.2652		9	.	.	.	.	.	.	.	.	.	.	C	9.333	1.060922	0.19987	.	.	ENSG00000083067	ENST00000396280	.	.	.	5.59	3.72	0.42706	.	.	.	.	.	T	0.58250	0.2109	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.55088	-0.8195	4	.	.	.	-13.0801	8.3037	0.32029	0.0:0.6175:0.2527:0.1299	.	.	.	.	N	733	.	.	D	-	1	0	TRPM3	72408186	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	2.136000	0.42121	1.340000	0.45581	-0.236000	0.12185	GAT	-	NULL		0.507	TRPM3-007	NOVEL	basic|exp_conf	protein_coding	TRPM3	protein_coding	OTTHUMT00000214157.5	C	NM_206945		72408186	-1	no_errors	NM_001007471	genbank	human	reviewed	54_36p	silent	SNP	1.000	T
ARHGEF17	9828	genome.wustl.edu	37	11	73078743	73078743	+	Missense_Mutation	SNP	G	G	C	rs146397383	byFrequency	TCGA-36-2545-01A-01D-1526-09	TCGA-36-2545-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ff47cb75-3f83-4749-a21d-69bfa5eb6dbc	ee353276-9833-4604-a76f-c9f937999791	g.chr11:73078743G>C	ENST00000263674.3	+	21	6460	c.6110G>C	c.(6109-6111)cGa>cCa	p.R2037P		NM_014786.3	NP_055601.2	Q96PE2	ARHGH_HUMAN	Rho guanine nucleotide exchange factor (GEF) 17	2037					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|skin(2)	32						GAGGACTTCCGACTCAGCAGT	0.637																																																0			11											104.0	99.0	101.0					11																	73078743		2200	4293	6493	72756391	SO:0001583	missense	9828			AF378754	CCDS8221.1	11q13.3	2011-11-16			ENSG00000110237	ENSG00000110237		"""Rho guanine nucleotide exchange factors"""	21726	protein-coding gene	gene with protein product	"""Rho-specific guanine-nucleotide exchange factor 164 kDa"", ""tumor endothelial marker 4"""					11559528, 12071859	Standard	NM_014786		Approved	TEM4, KIAA0337, p164-RhoGEF	uc001otu.3	Q96PE2	OTTHUMG00000167971	ENST00000263674.3:c.6110G>C	11.37:g.73078743G>C	ENSP00000263674:p.Arg2037Pro		72756391	B2RP20|Q86XU2|Q8N2S0|Q9Y4G3	Missense_Mutation	SNP	superfamily_DBL homology domain (DH-domain),HMMPfam_RhoGEF,HMMSmart_SM00325,superfamily_PH domain-like,superfamily_YVTN repeat-like/Quinoprotein amine dehydrogenase	p.R2037P	ENST00000263674.3	37	c.6110	CCDS8221.1	11	.	.	.	.	.	.	.	.	.	.	G	26.6	4.754752	0.89843	.	.	ENSG00000110237	ENST00000263674	T	0.69806	-0.43	5.57	5.57	0.84162	.	0.000000	0.64402	D	0.000001	D	0.83399	0.5246	M	0.84082	2.675	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.85599	0.1251	10	0.87932	D	0	-8.1433	17.0443	0.86498	0.0:0.0:1.0:0.0	.	2037	Q96PE2	ARHGH_HUMAN	P	2037	ENSP00000263674:R2037P	ENSP00000263674:R2037P	R	+	2	0	ARHGEF17	72756391	1.000000	0.71417	0.996000	0.52242	0.929000	0.56500	7.534000	0.82004	2.617000	0.88574	0.561000	0.74099	CGA	-	NULL		0.637	ARHGEF17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGEF17	protein_coding	OTTHUMT00000397365.1	G	NM_014786		72756391	+1	no_errors	NM_014786	genbank	human	validated	54_36p	missense	SNP	1.000	C
DCTN1	1639	genome.wustl.edu	37	2	74592301	74592301	+	Missense_Mutation	SNP	G	G	C	rs541856964		TCGA-36-2545-01A-01D-1526-09	TCGA-36-2545-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ff47cb75-3f83-4749-a21d-69bfa5eb6dbc	ee353276-9833-4604-a76f-c9f937999791	g.chr2:74592301G>C	ENST00000361874.3	-	26	3414	c.3097C>G	c.(3097-3099)Cta>Gta	p.L1033V	DCTN1_ENST00000407639.2_Missense_Mutation_p.L899V|DCTN1_ENST00000409567.3_Missense_Mutation_p.L1013V|DCTN1_ENST00000409868.1_Missense_Mutation_p.L1016V|DCTN1_ENST00000409240.1_Missense_Mutation_p.L996V|RP11-287D1.3_ENST00000451608.2_5'Flank|DCTN1_ENST00000495643.1_5'Flank|DCTN1_ENST00000409438.1_Missense_Mutation_p.L899V|DCTN1_ENST00000394003.3_Missense_Mutation_p.L1026V	NM_004082.4	NP_004073.2	Q14203	DCTN1_HUMAN	dynactin 1	1033					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|G2/M transition of mitotic cell cycle (GO:0000086)|melanosome transport (GO:0032402)|microtubule-based transport (GO:0010970)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|nervous system development (GO:0007399)	cell leading edge (GO:0031252)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dynactin complex (GO:0005869)|dynein complex (GO:0030286)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|spindle pole (GO:0000922)	motor activity (GO:0003774)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(20)|ovary(4)|prostate(1)|skin(3)	45						CGCTGCTTTAGTTCTGCCTTC	0.557																																																0			2											131.0	117.0	122.0					2																	74592301		2203	4300	6503	74445809	SO:0001583	missense	1639				CCDS1939.1, CCDS46341.1, CCDS46342.1, CCDS54368.1, CCDS54369.1	2p13	2014-09-17	2010-06-24		ENSG00000204843	ENSG00000204843			2711	protein-coding gene	gene with protein product	"""p150 glued homolog (Drosophila)"""	601143	"""dynactin 1 (p150, Glued (Drosophila) homolog)"""			1828535	Standard	NM_001190836		Approved		uc002skx.3	Q14203	OTTHUMG00000129963	ENST00000361874.3:c.3097C>G	2.37:g.74592301G>C	ENSP00000354791:p.Leu1033Val		74445809	A8MY36|B4DM45|E9PFS5|E9PGE1|G5E9H4|O95296|Q6IQ37|Q9BRM9|Q9UIU1|Q9UIU2	Missense_Mutation	SNP	superfamily_Cap-Gly domain,HMMPfam_CAP_GLY,PatternScan_CAP_GLY_1,superfamily_Spectrin repeat	p.L1033V	ENST00000361874.3	37	c.3097	CCDS1939.1	2	.	.	.	.	.	.	.	.	.	.	G	19.99	3.929462	0.73327	.	.	ENSG00000204843	ENST00000361874;ENST00000394003;ENST00000393999;ENST00000407639;ENST00000409438;ENST00000409240;ENST00000409868;ENST00000409567	T;T;T;T;T;T;T	0.78481	-1.06;-1.06;-1.18;-1.18;-1.06;-1.18;-1.06	5.03	4.13	0.48395	.	0.000000	0.34777	N	0.003681	D	0.85725	0.5763	M	0.71036	2.16	0.80722	D	1	D;D;D;D;D;D	0.89917	0.993;0.999;0.993;0.999;1.0;0.996	P;D;D;D;D;D	0.76575	0.837;0.975;0.952;0.988;0.969;0.978	D	0.86786	0.1982	10	0.72032	D	0.01	-4.1455	11.5734	0.50848	0.0908:0.0:0.9092:0.0	.	1013;996;1033;1026;899;899	E9PGE1;E9PFS5;Q14203;A8MY36;Q14203-2;G5E9H4	.;.;DCTN1_HUMAN;.;.;.	V	1033;1026;1016;899;899;996;1016;1013	ENSP00000354791:L1033V;ENSP00000377571:L1026V;ENSP00000384844:L899V;ENSP00000387270:L899V;ENSP00000386406:L996V;ENSP00000387327:L1016V;ENSP00000386843:L1013V	ENSP00000354791:L1033V	L	-	1	2	DCTN1	74445809	1.000000	0.71417	0.994000	0.49952	0.715000	0.41141	7.520000	0.81821	1.440000	0.47531	0.561000	0.74099	CTA	-	NULL		0.557	DCTN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DCTN1	protein_coding	OTTHUMT00000252227.3	G	NM_004082		74445809	-1	no_errors	NM_004082	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
Unknown	0	genome.wustl.edu	37	X	79816906	79816906	+	IGR	SNP	G	G	T			TCGA-36-2545-01A-01D-1526-09	TCGA-36-2545-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ff47cb75-3f83-4749-a21d-69bfa5eb6dbc	ee353276-9833-4604-a76f-c9f937999791	g.chrX:79816906G>T								FAM46D (116096 upstream) : BRWD3 (109446 downstream)																							TACCATTACGGCCTCCTGGGC	0.602																																																0			X																																								79703562	SO:0001628	intergenic_variant	727874																															X.37:g.79816906G>T			79703562		RNA	SNP	-	NULL		37	NULL		X																																																																																			-	-	0	0.602					LOC727874			G			79703562	+1	pseudogene	XR_042356	genbank	human	model	54_36p	rna	SNP	1.000	T
CNGB3	54714	genome.wustl.edu	37	8	87588261	87588261	+	Missense_Mutation	SNP	C	C	A			TCGA-36-2545-01A-01D-1526-09	TCGA-36-2545-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ff47cb75-3f83-4749-a21d-69bfa5eb6dbc	ee353276-9833-4604-a76f-c9f937999791	g.chr8:87588261C>A	ENST00000320005.5	-	18	2248	c.2201G>T	c.(2200-2202)gGa>gTa	p.G734V		NM_019098.4	NP_061971.3	Q9NQW8	CNGB3_HUMAN	cyclic nucleotide gated channel beta 3	734					cation transport (GO:0006812)|phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment (GO:0001750)|transmembrane transporter complex (GO:1902495)	cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(2)|endometrium(4)|kidney(6)|large_intestine(15)|lung(44)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	80						attttcttttcctttatcttc	0.358																																																0			8											168.0	173.0	171.0					8																	87588261		2203	4300	6503	87657377	SO:0001583	missense	54714			AF228520	CCDS6244.1	8q21.3	2013-01-23	2003-06-25		ENSG00000170289	ENSG00000170289		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2153	protein-coding gene	gene with protein product		605080	"""achromatopsia (rod monochromacy) 3"", ""achromatopsia (rod monochromacy) 1"""	ACHM3, ACHM1, RMCH		10888875, 10958649, 16382102	Standard	NM_019098		Approved		uc003ydx.3	Q9NQW8	OTTHUMG00000163738	ENST00000320005.5:c.2201G>T	8.37:g.87588261C>A	ENSP00000316605:p.Gly734Val		87657377	C9JA51|Q9NRE9	Missense_Mutation	SNP	superfamily_Voltage-gated potassium channels,HMMPfam_Ion_trans,superfamily_cAMP-binding domain-like,HMMSmart_SM00100,HMMPfam_cNMP_binding,PatternScan_CNMP_BINDING_1,PatternScan_CNMP_BINDING_2	p.G734V	ENST00000320005.5	37	c.2201	CCDS6244.1	8	.	.	.	.	.	.	.	.	.	.	C	0.819	-0.749328	0.03065	.	.	ENSG00000170289	ENST00000320005	T	0.61158	0.13	2.44	-3.15	0.05233	.	2.340680	0.01987	U	0.045256	T	0.39572	0.1083	N	0.19112	0.55	0.09310	N	1	B;B	0.24426	0.103;0.063	B;B	0.21546	0.035;0.016	T	0.12967	-1.0527	10	0.30854	T	0.27	.	5.6255	0.17480	0.0:0.4878:0.1488:0.3634	.	729;734	Q9NQW8-2;Q9NQW8	.;CNGB3_HUMAN	V	734	ENSP00000316605:G734V	ENSP00000316605:G734V	G	-	2	0	CNGB3	87657377	0.014000	0.17966	0.000000	0.03702	0.040000	0.13550	-0.628000	0.05515	-0.782000	0.04541	-1.595000	0.00837	GGA	-	NULL		0.358	CNGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNGB3	protein_coding	OTTHUMT00000375107.1	C	NM_019098		87657377	-1	no_errors	NM_019098	genbank	human	validated	54_36p	missense	SNP	0.006	A
ABCA4	24	genome.wustl.edu	37	1	94522196	94522196	+	Silent	SNP	G	G	T			TCGA-36-2545-01A-01D-1526-09	TCGA-36-2545-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ff47cb75-3f83-4749-a21d-69bfa5eb6dbc	ee353276-9833-4604-a76f-c9f937999791	g.chr1:94522196G>T	ENST00000370225.3	-	15	2429	c.2343C>A	c.(2341-2343)gcC>gcA	p.A781A	ABCA4_ENST00000535735.1_Intron	NM_000350.2	NP_000341.2	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 4	781					phospholipid transfer to membrane (GO:0006649)|photoreceptor cell maintenance (GO:0045494)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|phospholipid-translocating ATPase activity (GO:0004012)|transporter activity (GO:0005215)			NS(2)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(10)|large_intestine(25)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(10)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	147		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		GGTCCTGCCAGGCGAAGCACA	0.582																																																0			1											71.0	60.0	63.0					1																	94522196		2203	4300	6503	94294784	SO:0001819	synonymous_variant	24			U88667	CCDS747.1	1p22	2013-01-23			ENSG00000198691	ENSG00000198691		"""ATP binding cassette transporters / subfamily A"""	34	protein-coding gene	gene with protein product	"""Stargardt disease"""	601691	"""ATP-binding cassette transporter, retinal-specific"""	STGD1, ABCR, RP19, STGD		9490294	Standard	NM_000350		Approved	FFM, ARMD2, CORD3	uc001dqh.3	P78363	OTTHUMG00000010622	ENST00000370225.3:c.2343C>A	1.37:g.94522196G>T			94294784	O15112|O60438|O60915|Q0QD48|Q4LE31	Silent	SNP	superfamily_SSF52540,HMMSmart_AAA,HMMPfam_ABC_tran,PatternScan_ABC_TRANSPORTER_1	p.A781	ENST00000370225.3	37	c.2343	CCDS747.1	1																																																																																			-	NULL		0.582	ABCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA4	protein_coding	OTTHUMT00000029320.1	G	NM_000350		94294784	-1	no_errors	NM_000350	genbank	human	reviewed	54_36p	silent	SNP	0.999	T
TEKT4	150483	genome.wustl.edu	37	2	95541370	95541370	+	Missense_Mutation	SNP	C	C	T	rs112344899		TCGA-36-2545-01A-01D-1526-09	TCGA-36-2545-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ff47cb75-3f83-4749-a21d-69bfa5eb6dbc	ee353276-9833-4604-a76f-c9f937999791	g.chr2:95541370C>T	ENST00000295201.4	+	5	1111	c.974C>T	c.(973-975)gCg>gTg	p.A325V	AC097374.2_ENST00000568768.1_RNA	NM_144705.2	NP_653306.1	Q8WW24	TEKT4_HUMAN	tektin 4	325					cell projection organization (GO:0030030)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|motile cilium (GO:0031514)|nucleus (GO:0005634)				NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(15)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	28						CACAACGTGGCGGCACTGAAG	0.607													.|||	1	0.000199681	0.0	0.0	5008	,	,		20016	0.001		0.0	False		,,,				2504	0.0															0			2											194.0	161.0	172.0					2																	95541370		2203	4300	6503	94905097	SO:0001583	missense	150483			AK097438	CCDS2005.1	2q11.2	2008-02-05			ENSG00000163060	ENSG00000163060			31012	protein-coding gene	gene with protein product							Standard	XM_005263876		Approved	MGC27019	uc002stw.1	Q8WW24	OTTHUMG00000130396	ENST00000295201.4:c.974C>T	2.37:g.95541370C>T	ENSP00000295201:p.Ala325Val		94905097		Missense_Mutation	SNP	HMMPfam_Tektin	p.A325V	ENST00000295201.4	37	c.974	CCDS2005.1	2	2	9.157509157509158E-4	0	0.0	0	0.0	1	0.0017482517482517483	1	0.0013192612137203166	.	2.496	-0.316380	0.05422	.	.	ENSG00000163060	ENST00000295201	T	0.02579	4.24	2.47	0.0321	0.14174	.	0.390516	0.24975	N	0.034109	T	0.01800	0.0057	N	0.26162	0.8	0.09310	N	1	B	0.30439	0.279	B	0.20577	0.03	T	0.47761	-0.9092	10	0.33940	T	0.23	-16.8492	5.7335	0.18053	0.2129:0.5766:0.2105:0.0	.	325	Q8WW24	TEKT4_HUMAN	V	325	ENSP00000295201:A325V	ENSP00000295201:A325V	A	+	2	0	TEKT4	94905097	0.000000	0.05858	0.005000	0.12908	0.015000	0.08874	-0.696000	0.05104	0.323000	0.23307	0.465000	0.42564	GCG	-	HMMPfam_Tektin		0.607	TEKT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TEKT4	protein_coding	OTTHUMT00000252777.1	C	NM_144705		94905097	+1	no_errors	NM_144705	genbank	human	provisional	54_36p	missense	SNP	0.326	T
DYNC1H1	1778	genome.wustl.edu	37	14	102476663	102476663	+	Missense_Mutation	SNP	G	G	A			TCGA-36-2545-01A-01D-1526-09	TCGA-36-2545-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ff47cb75-3f83-4749-a21d-69bfa5eb6dbc	ee353276-9833-4604-a76f-c9f937999791	g.chr14:102476663G>A	ENST00000360184.4	+	31	6436	c.6272G>A	c.(6271-6273)cGg>cAg	p.R2091Q		NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	2091	AAA 1. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						TTCGGTCTTCGGGCTTTGAAG	0.428																																																0			14											93.0	97.0	96.0					14																	102476663		2203	4300	6503	101546416	SO:0001583	missense	1778			AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.6272G>A	14.37:g.102476663G>A	ENSP00000348965:p.Arg2091Gln		101546416	B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Missense_Mutation	SNP	HMMPfam_DHC_N1,HMMPfam_DHC_N2,superfamily_SSF52540,HMMSmart_AAA,HMMPfam_AAA_5,HMMPfam_Dynein_heavy	p.R2091Q	ENST00000360184.4	37	c.6272	CCDS9966.1	14	.	.	.	.	.	.	.	.	.	.	G	36	5.893712	0.97074	.	.	ENSG00000197102	ENST00000360184	T	0.67698	-0.28	5.61	5.61	0.85477	.	0.060705	0.64402	D	0.000003	D	0.89111	0.6622	H	0.97635	4.045	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.92532	0.6034	10	0.87932	D	0	.	19.6414	0.95758	0.0:0.0:1.0:0.0	.	2091	Q14204	DYHC1_HUMAN	Q	2091	ENSP00000348965:R2091Q	ENSP00000348965:R2091Q	R	+	2	0	DYNC1H1	101546416	1.000000	0.71417	0.991000	0.47740	0.989000	0.77384	9.807000	0.99171	2.655000	0.90218	0.650000	0.86243	CGG	-	superfamily_SSF52540		0.428	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYNC1H1	protein_coding	OTTHUMT00000414574.1	G	NM_001376		101546416	+1	no_errors	NM_001376	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
ARMCX5	64860	genome.wustl.edu	37	X	101857911	101857911	+	Missense_Mutation	SNP	T	T	C			TCGA-36-2545-01A-01D-1526-09	TCGA-36-2545-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ff47cb75-3f83-4749-a21d-69bfa5eb6dbc	ee353276-9833-4604-a76f-c9f937999791	g.chrX:101857911T>C	ENST00000604957.1	+	1	3464	c.842T>C	c.(841-843)aTc>aCc	p.I281T	ARMCX5_ENST00000246174.2_Missense_Mutation_p.I281T|ARMCX5_ENST00000541409.1_Missense_Mutation_p.I281T|ARMCX5_ENST00000372742.1_Missense_Mutation_p.I281T|RP4-769N13.6_ENST00000476910.2_RNA|RP4-769N13.7_ENST00000602441.1_RNA|ARMCX5_ENST00000537008.1_Missense_Mutation_p.I281T|ARMCX5_ENST00000536530.1_Missense_Mutation_p.I281T	NM_001168478.1	NP_001161950.1	Q6P1M9	ARMX5_HUMAN	armadillo repeat containing, X-linked 5	281										breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(7)|ovary(1)|upper_aerodigestive_tract(2)	22						TTAGCTGAGATCAAAAAACAG	0.453																																																0			X											87.0	81.0	83.0					X																	101857911		2203	4300	6503	101744567	SO:0001583	missense	64860				CCDS14500.1	Xq22.1-q22.3	2014-03-21			ENSG00000125962	ENSG00000125962		"""Armadillo repeat containing"""	25772	protein-coding gene	gene with protein product						16221301, 22569362	Standard	NM_022838		Approved	FLJ12969, GASP5	uc004ejh.3	Q6P1M9	OTTHUMG00000022062	ENST00000604957.1:c.842T>C	X.37:g.101857911T>C	ENSP00000474720:p.Ile281Thr		101744567	B3KU88|D3DX99|Q68DB4|Q9BVZ3|Q9H969	Missense_Mutation	SNP	PatternScan_CPSASE_2,HMMPfam_DUF634,superfamily_ARM repeat	p.I281T	ENST00000604957.1	37	c.842	CCDS14500.1	X	.	.	.	.	.	.	.	.	.	.	T	2.926	-0.222199	0.06061	.	.	ENSG00000125962	ENST00000246174;ENST00000537008;ENST00000541409;ENST00000536530;ENST00000372742	T;T;T;T;T	0.31769	1.48;1.48;1.48;1.48;1.48	3.9	2.74	0.32292	.	0.420575	0.17569	N	0.169529	T	0.15392	0.0371	L	0.27053	0.805	0.09310	N	1	P	0.37781	0.608	B	0.31869	0.137	T	0.11421	-1.0588	10	0.22109	T	0.4	-0.6149	5.1276	0.14894	0.0:0.1335:0.0:0.8665	.	281	Q6P1M9	ARMX5_HUMAN	T	281	ENSP00000246174:I281T;ENSP00000439001:I281T;ENSP00000446385:I281T;ENSP00000445851:I281T;ENSP00000361827:I281T	ENSP00000246174:I281T	I	+	2	0	ARMCX5	101744567	0.824000	0.29247	0.026000	0.17262	0.154000	0.21943	1.407000	0.34657	0.678000	0.31325	0.486000	0.48141	ATC	-	NULL		0.453	ARMCX5-013	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ARMCX5	protein_coding	OTTHUMT00000469659.1	T	NM_022838		101744567	+1	no_errors	NM_022838	genbank	human	provisional	54_36p	missense	SNP	0.343	C
SLC26A5	375611	genome.wustl.edu	37	7	103029841	103029841	+	Silent	SNP	G	G	A			TCGA-36-2545-01A-01D-1526-09	TCGA-36-2545-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ff47cb75-3f83-4749-a21d-69bfa5eb6dbc	ee353276-9833-4604-a76f-c9f937999791	g.chr7:103029841G>A	ENST00000306312.3	-	13	1603	c.1342C>T	c.(1342-1344)Ctg>Ttg	p.L448L	SLC26A5_ENST00000393730.1_Intron|SLC26A5_ENST00000339444.6_Silent_p.L448L|SLC26A5_ENST00000432958.2_Intron|SLC26A5_ENST00000393735.2_Silent_p.L448L|SLC26A5_ENST00000393727.1_Silent_p.L448L|SLC26A5_ENST00000356767.4_Intron|SLC26A5_ENST00000354356.4_5'UTR|SLC26A5_ENST00000393723.1_Intron|SLC26A5_ENST00000393729.1_Silent_p.L411L	NM_198999.2	NP_945350.1	P58743	S26A5_HUMAN	solute carrier family 26 (anion exchanger), member 5	448					regulation of cell shape (GO:0008360)|regulation of membrane potential (GO:0042391)|sensory perception of sound (GO:0007605)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)	secondary active sulfate transmembrane transporter activity (GO:0008271)			endometrium(5)|kidney(2)|large_intestine(9)|lung(15)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)	43						ATTCCCTTCAGGTTGACAATC	0.478																																																0			7											150.0	131.0	137.0					7																	103029841		2203	4300	6503	102817077	SO:0001819	synonymous_variant	375611			AC005064	CCDS5733.1, CCDS43630.1, CCDS55150.1, CCDS5732.1, CCDS43629.1	7q22	2013-07-18	2013-07-18	2005-09-13	ENSG00000170615	ENSG00000170615		"""Solute carriers"""	9359	protein-coding gene	gene with protein product	"""deafness, neurosensory, autosomal recessive, 61"""	604943	"""prestin (motor protein)"""	PRES		10821263	Standard	NM_206883		Approved	DFNB61	uc003vbz.3	P58743	OTTHUMG00000149911	ENST00000306312.3:c.1342C>T	7.37:g.103029841G>A			102817077	Q496J2|Q7Z7F3|Q86UF8|Q86UF9|Q86UG0	Silent	SNP	PatternScan_SLC26A,HMMPfam_Sulfate_transp,HMMPfam_STAS,superfamily_Anti-sigma factor antagonist SpoIIaa	p.L448	ENST00000306312.3	37	c.1342	CCDS5733.1	7																																																																																			-	HMMPfam_Sulfate_transp		0.478	SLC26A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC26A5	protein_coding	OTTHUMT00000313860.1	G	NM_198999		102817077	-1	no_errors	NM_198999	genbank	human	validated	54_36p	silent	SNP	1.000	A
SYCP1	6847	genome.wustl.edu	37	1	115420722	115420722	+	Missense_Mutation	SNP	T	T	A			TCGA-36-2545-01A-01D-1526-09	TCGA-36-2545-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ff47cb75-3f83-4749-a21d-69bfa5eb6dbc	ee353276-9833-4604-a76f-c9f937999791	g.chr1:115420722T>A	ENST00000369522.3	+	12	1049	c.809T>A	c.(808-810)cTa>cAa	p.L270Q	SYCP1_ENST00000369518.1_Missense_Mutation_p.L270Q	NM_001282541.1|NM_003176.2	NP_001269470.1|NP_003167.2	Q15431	SYCP1_HUMAN	synaptonemal complex protein 1	270					chiasma assembly (GO:0051026)|lateral element assembly (GO:0051878)|meiotic DNA repair synthesis (GO:0000711)|reciprocal meiotic recombination (GO:0007131)|regulation of protein localization (GO:0032880)|sperm chromatin condensation (GO:0035092)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)|male germ cell nucleus (GO:0001673)|transverse filament (GO:0000802)	DNA binding (GO:0003677)		RGS22/SYCP1(2)	NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(17)|lung(20)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	48	Lung SC(450;0.211)	all_cancers(81;8.65e-08)|all_epithelial(167;3.32e-07)|all_lung(203;6.55e-06)|Lung NSC(69;1.11e-05)|Acute lymphoblastic leukemia(138;0.221)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		taGGTATCACTACTATTGATC	0.239																																																0			1											23.0	27.0	26.0					1																	115420722		2122	4227	6349	115222245	SO:0001583	missense	6847			D67035	CCDS879.1, CCDS72840.1	1p13-p12	2009-03-12			ENSG00000198765	ENSG00000198765			11487	protein-coding gene	gene with protein product	"""cancer/testis antigen 8"""	602162				9560255	Standard	XM_005271154		Approved	HOM-TES-14, SCP1, CT8	uc001efr.3	Q15431	OTTHUMG00000012057	ENST00000369522.3:c.809T>A	1.37:g.115420722T>A	ENSP00000358535:p.Leu270Gln		115222245	O14963|Q5VXJ6	Missense_Mutation	SNP	HMMPfam_SCP-1	p.L270Q	ENST00000369522.3	37	c.809	CCDS879.1	1	.	.	.	.	.	.	.	.	.	.	T	15.43	2.831046	0.50845	.	.	ENSG00000198765	ENST00000369522;ENST00000536734;ENST00000455987;ENST00000369518	T;T;T	0.59224	0.28;0.28;0.28	4.59	3.42	0.39159	.	0.577780	0.15835	N	0.242307	T	0.45657	0.1353	M	0.65975	2.015	0.22996	N	0.998451	P;P	0.48640	0.913;0.913	P;P	0.55161	0.77;0.77	T	0.35025	-0.9805	10	0.13853	T	0.58	0.0023	7.8224	0.29294	0.1843:0.0:0.0:0.8157	.	270;270	B7ZLS9;Q15431	.;SYCP1_HUMAN	Q	270	ENSP00000358535:L270Q;ENSP00000410011:L270Q;ENSP00000358531:L270Q	ENSP00000358531:L270Q	L	+	2	0	SYCP1	115222245	0.813000	0.29090	0.904000	0.35570	0.824000	0.46624	1.357000	0.34090	0.673000	0.31224	0.460000	0.39030	CTA	-	HMMPfam_SCP-1		0.239	SYCP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYCP1	protein_coding	OTTHUMT00000033386.1	T	NM_003176		115222245	+1	no_errors	NM_003176	genbank	human	validated	54_36p	missense	SNP	0.316	A
ZNF80	7634	genome.wustl.edu	37	3	113950602	113950602	+	IGR	SNP	T	T	C			TCGA-36-2545-01A-01D-1526-09	TCGA-36-2545-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ff47cb75-3f83-4749-a21d-69bfa5eb6dbc	ee353276-9833-4604-a76f-c9f937999791	g.chr3:113950602T>C	ENST00000482457.2	-	0	2939				RP11-553L6.2_ENST00000493033.1_RNA|RP11-553L6.2_ENST00000481773.1_RNA	NM_007136.3	NP_009067.2	P51504	ZNF80_HUMAN	zinc finger protein 80						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(1)|large_intestine(9)|lung(15)|ovary(2)|prostate(2)|urinary_tract(2)	32		Lung NSC(201;0.0233)|all_neural(597;0.0837)				GGGCACGCTGTAACTCTTCCT	0.517																																					GBM(23;986 1114 21716)											0			3																																								115433292	SO:0001628	intergenic_variant	645180			X65233	CCDS2979.1	3q13.31	2013-01-08	2006-05-12		ENSG00000174255	ENSG00000174255		"""Zinc fingers, C2H2-type"""	13155	protein-coding gene	gene with protein product		194553	"""zinc finger protein 80 (pT17)"""			8478004	Standard	NM_007136		Approved	pT17	uc010hqo.3	P51504	OTTHUMG00000159332		3.37:g.113950602T>C			115433292	Q6NSW4|Q6NT14	RNA	SNP	-	NULL	ENST00000482457.2	37	NULL	CCDS2979.1	3																																																																																			-	-		0.517	ZNF80-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC645180	protein_coding	OTTHUMT00000354696.2	T	NM_007136		115433292	-1	pseudogene	XR_016740	genbank	human	model	54_36p	rna	SNP	0.990	C
SIK3	23387	genome.wustl.edu	37	11	116730119	116730119	+	Missense_Mutation	SNP	G	G	T			TCGA-36-2545-01A-01D-1526-09	TCGA-36-2545-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ff47cb75-3f83-4749-a21d-69bfa5eb6dbc	ee353276-9833-4604-a76f-c9f937999791	g.chr11:116730119G>T	ENST00000292055.4	-	19	2344	c.2309C>A	c.(2308-2310)tCc>tAc	p.S770Y	SIK3_ENST00000488337.1_5'UTR|SIK3_ENST00000446921.2_Missense_Mutation_p.S828Y|SIK3_ENST00000434315.2_Missense_Mutation_p.S669Y|SIK3_ENST00000375288.1_Missense_Mutation_p.S165Y|SIK3_ENST00000375300.1_Missense_Mutation_p.S828Y|SIK3_ENST00000542607.1_Missense_Mutation_p.S770Y	NM_025164.3	NP_079440.3	Q9Y2K2	SIK3_HUMAN	SIK family kinase 3	770	Gln-rich.				protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(18)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	57						GCGCCCACTGGAGCCTGCAGC	0.602											OREG0003491	type=REGULATORY REGION|Gene=AK022302|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																																				0			11											84.0	72.0	76.0					11																	116730119		2201	4296	6497	116235329	SO:0001583	missense	23387			AB023216	CCDS8379.1, CCDS60974.1, CCDS8379.2	11q23.3	2010-02-17			ENSG00000160584	ENSG00000160584			29165	protein-coding gene	gene with protein product		614776				10231032, 8889548	Standard	NM_025164		Approved	FLJ12240, L19, KIAA0999, QSK	uc001ppy.3	Q9Y2K2	OTTHUMG00000066628	ENST00000292055.4:c.2309C>A	11.37:g.116730119G>T	ENSP00000292055:p.Ser770Tyr	1475	116235329	A1A5A8|Q59FY2|Q5M9N1|Q6P3R6|Q8IYM8|Q9HA50	Missense_Mutation	SNP	superfamily_Protein kinase-like (PK-like),HMMSmart_SM00219,HMMSmart_SM00220,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_ST	p.S770Y	ENST00000292055.4	37	c.2309	CCDS8379.1	11	.	.	.	.	.	.	.	.	.	.	G	15.72	2.916062	0.52546	.	.	ENSG00000160584	ENST00000375300;ENST00000292055;ENST00000375288;ENST00000542607;ENST00000434315	T;T;T;T;T	0.72725	-0.64;-0.68;1.07;-0.65;-0.29	4.71	4.71	0.59529	.	0.857140	0.09494	U	0.794553	T	0.71745	0.3376	N	0.14661	0.345	0.19300	N	0.999972	D;P;D;D;P	0.67145	0.986;0.828;0.996;0.976;0.763	P;B;P;P;B	0.59703	0.814;0.34;0.862;0.656;0.421	T	0.67027	-0.5774	10	0.72032	D	0.01	.	15.6668	0.77236	0.0:0.0:1.0:0.0	.	770;770;669;770;165	Q9Y2K2-3;A1A5A8;A1A5A9;Q9Y2K2;Q9Y2K2-2	.;.;.;SIK3_HUMAN;.	Y	828;770;165;770;669	ENSP00000364449:S828Y;ENSP00000292055:S770Y;ENSP00000364437:S165Y;ENSP00000438108:S770Y;ENSP00000415873:S669Y	ENSP00000292055:S770Y	S	-	2	0	SIK3	116235329	0.862000	0.29867	0.143000	0.22291	0.569000	0.35902	4.553000	0.60753	2.527000	0.85204	0.561000	0.74099	TCC	-	NULL		0.602	SIK3-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	KIAA0999	protein_coding		G	NM_025164		116235329	-1	no_errors	NM_025164	genbank	human	validated	54_36p	missense	SNP	0.069	T
EXT1	2131	genome.wustl.edu	37	8	119122970	119122970	+	Missense_Mutation	SNP	A	A	T			TCGA-36-2545-01A-01D-1526-09	TCGA-36-2545-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ff47cb75-3f83-4749-a21d-69bfa5eb6dbc	ee353276-9833-4604-a76f-c9f937999791	g.chr8:119122970A>T	ENST00000378204.2	-	1	1122	c.316T>A	c.(316-318)Ttc>Atc	p.F106I		NM_000127.2	NP_000118.2	Q16394	EXT1_HUMAN	exostosin glycosyltransferase 1	106					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|cellular polysaccharide biosynthetic process (GO:0033692)|embryonic skeletal joint development (GO:0072498)|endoderm development (GO:0007492)|gastrulation (GO:0007369)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0015014)|mesoderm development (GO:0007498)|olfactory bulb development (GO:0021772)|ossification (GO:0001503)|protein glycosylation (GO:0006486)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity (GO:0050508)|glucuronosyltransferase activity (GO:0015020)|heparan sulfate N-acetylglucosaminyltransferase activity (GO:0042328)|N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase activity (GO:0050509)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|transferase activity, transferring glycosyl groups (GO:0016757)			breast(1)|endometrium(7)|kidney(1)|large_intestine(12)|lung(10)|ovary(3)|prostate(1)|stomach(1)|urinary_tract(2)	38	all_cancers(13;2.36e-26)|Lung NSC(37;5.02e-07)|Ovarian(258;0.0173)		STAD - Stomach adenocarcinoma(47;0.012)			CAAAGGGTGAAATCGAAGCAG	0.498			"""Mis, N, F, S"""			"""exostoses, osteosarcoma"""			Langer-Giedion syndrome;Hereditary Multiple Exostoses																													yes	Rec		Multiple Exostoses Type 1	8	8q24.11-q24.13	2131	multiple exostoses type 1 gene		M	0			8											82.0	81.0	82.0					8																	119122970		2203	4300	6503	119192151	SO:0001583	missense	2131	Familial Cancer Database	Trichorhinophalangeal syndrome type 2, TRPS II;HME, Hereditary Exostoses, Multiple Osteochondromatosis, Multiple Cartilaginous Exostoses	S79639	CCDS6324.1	8q24.11	2014-09-17	2013-03-01		ENSG00000182197	ENSG00000182197	2.4.1.224, 2.4.1.225	"""Exostosin glycosyltransferase family"""	3512	protein-coding gene	gene with protein product	"""Glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N- acetylglucosaminyltransferase"", ""N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase"""	608177	"""Langer-Giedion syndrome chromosome region"", ""exostoses (multiple) 1"", ""exostosin 1"""	LGCR, LGS			Standard	NM_000127		Approved	ttv	uc003yok.1	Q16394	OTTHUMG00000059718	ENST00000378204.2:c.316T>A	8.37:g.119122970A>T	ENSP00000367446:p.Phe106Ile		119192151	B2R7V2|Q9BVI9	Missense_Mutation	SNP	HMMPfam_Exostosin,superfamily_Nucleotide-diphospho-sugar transferases,HMMPfam_Glyco_transf_64	p.F106I	ENST00000378204.2	37	c.316	CCDS6324.1	8	.	.	.	.	.	.	.	.	.	.	A	13.31	2.199078	0.38806	.	.	ENSG00000182197	ENST00000378204	D	0.96168	-3.93	5.47	5.47	0.80525	.	0.110883	0.52532	D	0.000067	D	0.93926	0.8056	M	0.62723	1.935	0.48901	D	0.99972	B	0.26512	0.151	B	0.25291	0.059	D	0.92020	0.5625	10	0.37606	T	0.19	-1.0185	15.5438	0.76077	1.0:0.0:0.0:0.0	.	106	Q16394	EXT1_HUMAN	I	106	ENSP00000367446:F106I	ENSP00000367446:F106I	F	-	1	0	EXT1	119192151	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.411000	0.52672	2.068000	0.61886	0.379000	0.24179	TTC	-	NULL		0.498	EXT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EXT1	protein_coding	OTTHUMT00000132768.3	A	NM_000127		119192151	-1	no_errors	NM_000127	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
SORL1	6653	genome.wustl.edu	37	11	121429447	121429447	+	Silent	SNP	T	T	C			TCGA-36-2545-01A-01D-1526-09	TCGA-36-2545-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ff47cb75-3f83-4749-a21d-69bfa5eb6dbc	ee353276-9833-4604-a76f-c9f937999791	g.chr11:121429447T>C	ENST00000260197.7	+	20	2940	c.2811T>C	c.(2809-2811)gaT>gaC	p.D937D		NM_003105.5	NP_003096	Q92673	SORL_HUMAN	sortilin-related receptor, L(DLR class) A repeats containing	937					cell death (GO:0008219)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|negative regulation of aspartic-type endopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902960)|negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of metalloendopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902963)|negative regulation of neurofibrillary tangle assembly (GO:1902997)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron death (GO:1901215)|negative regulation of protein binding (GO:0032091)|negative regulation of protein oligomerization (GO:0032460)|negative regulation of tau-protein kinase activity (GO:1902948)|positive regulation of choline O-acetyltransferase activity (GO:1902771)|positive regulation of early endosome to recycling endosome transport (GO:1902955)|positive regulation of endocytic recycling (GO:2001137)|positive regulation of ER to Golgi vesicle-mediated transport (GO:1902953)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|positive regulation of protein localization to early endosome (GO:1902966)|post-Golgi vesicle-mediated transport (GO:0006892)|protein maturation (GO:0051604)|protein retention in Golgi apparatus (GO:0045053)|protein targeting (GO:0006605)|protein targeting to Golgi (GO:0000042)|protein targeting to lysosome (GO:0006622)|receptor-mediated endocytosis (GO:0006898)|regulation of smooth muscle cell migration (GO:0014910)|signal transduction (GO:0007165)	early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi cisterna (GO:0031985)|integral component of plasma membrane (GO:0005887)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|nuclear envelope lumen (GO:0005641)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)|beta-amyloid binding (GO:0001540)|low-density lipoprotein particle binding (GO:0030169)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(2)|lung(34)|ovary(5)|pancreas(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(2)	91		Breast(109;0.00119)|Medulloblastoma(222;0.0429)|all_neural(223;0.113)		BRCA - Breast invasive adenocarcinoma(274;3.34e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.108)		ACTGGACGGATGCCTACCTGG	0.547																																																0			11											223.0	180.0	195.0					11																	121429447		2203	4299	6502	120934657	SO:0001819	synonymous_variant	6653			Y08110	CCDS8436.1	11q23.2-q24.4	2014-06-05	2011-01-25		ENSG00000137642	ENSG00000137642		"""Fibronectin type III domain containing"""	11185	protein-coding gene	gene with protein product	"""LDLR relative with 11 ligand-binding repeats"""	602005	"""chromosome 11 open reading frame 32"", ""sortilin-related receptor, L(DLR class) A repeats-containing"""	C11orf32		9157966, 8940146	Standard	NM_003105		Approved	gp250, LR11, LRP9, SorLA, SorLA-1	uc001pxx.3	Q92673	OTTHUMG00000166057	ENST00000260197.7:c.2811T>C	11.37:g.121429447T>C			120934657	B2RNX7|Q92856	Silent	SNP	superfamily_Oligoxyloglucan reducing end-specific cellobiohydrolase,HMMSmart_SM00602,superfamily_YWTD domain,HMMSmart_SM00135,HMMPfam_Ldl_recept_b,PatternScan_EGF_2,superfamily_LDL receptor-like module,HMMPfam_Ldl_recept_a,HMMSmart_SM00192,PatternScan_LDLRA_1,PatternScan_COPPER_BLUE,superfamily_Fibronectin type III,HMMPfam_fn3,HMMSmart_SM00060	p.D937	ENST00000260197.7	37	c.2811	CCDS8436.1	11																																																																																			-	superfamily_YWTD domain,HMMSmart_SM00135,HMMPfam_Ldl_recept_b		0.547	SORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SORL1	protein_coding	OTTHUMT00000387626.2	T	NM_003105		120934657	+1	no_errors	NM_003105	genbank	human	reviewed	54_36p	silent	SNP	0.975	C
PHYHD1	254295	genome.wustl.edu	37	9	131703970	131703970	+	Missense_Mutation	SNP	C	C	A			TCGA-36-2545-01A-01D-1526-09	TCGA-36-2545-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ff47cb75-3f83-4749-a21d-69bfa5eb6dbc	ee353276-9833-4604-a76f-c9f937999791	g.chr9:131703970C>A	ENST00000372592.3	+	13	1787	c.854C>A	c.(853-855)cCc>cAc	p.P285H	PHYHD1_ENST00000421063.2_Missense_Mutation_p.P264H|PHYHD1_ENST00000487504.1_3'UTR|RP11-101E3.5_ENST00000482796.1_Intron|PHYHD1_ENST00000308941.5_Missense_Mutation_p.P278T|PHYHD1_ENST00000353176.5_Missense_Mutation_p.P264H	NM_001100876.1	NP_001094346.1	Q5SRE7	PHYD1_HUMAN	phytanoyl-CoA dioxygenase domain containing 1	285							dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(2)|large_intestine(3)|skin(1)|stomach(3)	10						GCTGAACTGCCCTTTCCCCAA	0.607																																																0			9											75.0	66.0	69.0					9																	131703970		2203	4300	6503	130743791	SO:0001583	missense	254295			BC051300	CCDS6914.1, CCDS43885.1, CCDS43886.1	9q34.13	2010-08-13			ENSG00000175287	ENSG00000175287			23396	protein-coding gene	gene with protein product						12477932	Standard	NM_174933		Approved	MGC16638	uc004bwp.2	Q5SRE7	OTTHUMG00000020764	ENST00000372592.3:c.854C>A	9.37:g.131703970C>A	ENSP00000361673:p.Pro285His		130743791	A6PWN9|A6PWP0|B3KT57|B4E3X8|Q5SRE9|Q5SRF0|Q7Z623|Q7Z7P9|Q96GM4	Missense_Mutation	SNP	HMMPfam_PhyH	p.P278T	ENST00000372592.3	37	c.832	CCDS43885.1	9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	25.4|25.4	4.630251|4.630251	0.87660|0.87660	.|.	.|.	ENSG00000175287|ENSG00000175287	ENST00000372592;ENST00000353176;ENST00000421063|ENST00000308941	D;D;D|.	0.90504|.	-2.68;-2.68;-2.68|.	5.4|5.4	5.4|5.4	0.78164|0.78164	.|.	0.055257|0.055257	0.85682|0.85682	D|D	0.000000|0.000000	T|T	0.72003|0.72003	0.3407|0.3407	.|.	.|.	.|.	0.58432|0.58432	D|D	0.999999|0.999999	D;D|P	0.89917|0.51933	1.0;1.0|0.949	D;D|P	0.87578|0.51701	0.998;0.982|0.677	T|T	0.75944|0.75944	-0.3139|-0.3139	9|8	0.56958|0.87932	D|D	0.05|0	-14.3713|-14.3713	18.1634|18.1634	0.89717|0.89717	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	264;285|278	Q5SRE7-2;Q5SRE7|Q5SRE7-3	.;PHYD1_HUMAN|.	H|T	285;264;264|278	ENSP00000361673:P285H;ENSP00000340945:P264H;ENSP00000409928:P264H|.	ENSP00000340945:P264H|ENSP00000309515:P278T	P|P	+|+	2|1	0|0	PHYHD1|PHYHD1	130743791|130743791	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.887000|0.887000	0.51463|0.51463	6.276000|6.276000	0.72601|0.72601	2.528000|2.528000	0.85240|0.85240	0.462000|0.462000	0.41574|0.41574	CCC|CCT	-	NULL		0.607	PHYHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHYHD1	protein_coding	OTTHUMT00000054506.2	C	NM_174933		130743791	+1	no_errors	NM_174933	genbank	human	validated	54_36p	missense	SNP	1.000	A
ZNF26	7574	genome.wustl.edu	37	12	133587975	133587975	+	Missense_Mutation	SNP	C	C	A			TCGA-36-2545-01A-01D-1526-09	TCGA-36-2545-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ff47cb75-3f83-4749-a21d-69bfa5eb6dbc	ee353276-9833-4604-a76f-c9f937999791	g.chr12:133587975C>A	ENST00000328654.5	+	4	1887	c.1510C>A	c.(1510-1512)Cac>Aac	p.H504N	ZNF26_ENST00000534834.1_Missense_Mutation_p.H484N	NM_019591.3	NP_062537.2	P17031	ZNF26_HUMAN	zinc finger protein 26	504					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(1)|large_intestine(7)|lung(2)|prostate(1)|skin(2)	13	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;1.24e-11)|all_epithelial(31;1.21e-08)|Lung NSC(355;0.000431)		OV - Ovarian serous cystadenocarcinoma(86;9.53e-09)|Epithelial(86;2.63e-07)|all cancers(50;1.14e-05)		TCAGAGAGTTCACACCGGAGA	0.423																																																0			12											1.0	1.0	1.0					12																	133587975		1	1	2	132098048	SO:0001583	missense	7574			X52351	CCDS31939.1	12q24.33	2013-01-08	2006-05-10		ENSG00000198393	ENSG00000198393		"""Zinc fingers, C2H2-type"", ""-"""	13053	protein-coding gene	gene with protein product		194537	"""zinc finger protein 26 (KOX 20)"""				Standard	NM_001256279		Approved	KOX20, FLJ20755	uc031qkj.1	P17031	OTTHUMG00000167936	ENST00000328654.5:c.1510C>A	12.37:g.133587975C>A	ENSP00000333725:p.His504Asn		132098048	Q86X57|Q9NWL3	Missense_Mutation	SNP	superfamily_KRAB domain (Kruppel-associated box Pfam 01352),HMMPfam_KRAB,HMMSmart_SM00349,superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,PatternScan_ZINC_FINGER_C2H2_1,HMMSmart_SM00355	p.H504N	ENST00000328654.5	37	c.1510	CCDS31939.1	12	.	.	.	.	.	.	.	.	.	.	C	17.88	3.497927	0.64186	.	.	ENSG00000198393	ENST00000328654;ENST00000534834	T;T	0.67345	-0.26;-0.26	3.89	3.89	0.44902	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.34828	N	0.003641	D	0.85762	0.5772	H	0.94582	3.555	0.33974	D	0.647192	D	0.71674	0.998	D	0.74023	0.982	D	0.92815	0.6267	9	.	.	.	.	15.1171	0.72410	0.0:1.0:0.0:0.0	.	504	P17031	ZNF26_HUMAN	N	504;484	ENSP00000333725:H504N;ENSP00000437420:H484N	.	H	+	1	0	ZNF26	132098048	0.997000	0.39634	0.993000	0.49108	0.750000	0.42670	3.850000	0.55918	2.147000	0.66899	0.585000	0.79938	CAC	-	superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1		0.423	ZNF26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF26	protein_coding	OTTHUMT00000397145.2	C	NM_019591		132098048	+1	no_errors	NM_019591	genbank	human	validated	54_36p	missense	SNP	0.851	A
ZNF449	203523	genome.wustl.edu	37	X	134494200	134494200	+	Silent	SNP	A	A	G			TCGA-36-2545-01A-01D-1526-09	TCGA-36-2545-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ff47cb75-3f83-4749-a21d-69bfa5eb6dbc	ee353276-9833-4604-a76f-c9f937999791	g.chrX:134494200A>G	ENST00000339249.4	+	5	896	c.756A>G	c.(754-756)ttA>ttG	p.L252L		NM_152695.5	NP_689908.3	Q6P9G9	ZN449_HUMAN	zinc finger protein 449	252					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)|prostate(1)|skin(1)	23	Acute lymphoblastic leukemia(192;6.56e-05)					TTGTAACTTTAGAGGGGAATG	0.368																																																0			X											56.0	59.0	58.0					X																	134494200		2184	4248	6432	134321866	SO:0001819	synonymous_variant	203523			AY280801	CCDS14649.1	Xq26.3	2013-01-09			ENSG00000173275	ENSG00000173275		"""-"", ""Zinc fingers, C2H2-type"""	21039	protein-coding gene	gene with protein product		300627					Standard	NM_152695		Approved	ZSCAN19, FLJ23614	uc004eys.3	Q6P9G9	OTTHUMG00000022478	ENST00000339249.4:c.756A>G	X.37:g.134494200A>G			134321866	Q5JRZ7|Q5JRZ8|Q6NZX2|Q8N3Q1|Q8TED7	Silent	SNP	HMMPfam_SCAN,HMMSmart_SM00431,superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1	p.L252	ENST00000339249.4	37	c.756	CCDS14649.1	X																																																																																			-	NULL		0.368	ZNF449-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF449	protein_coding	OTTHUMT00000058411.1	A	NM_152695		134321866	+1	no_errors	NM_152695	genbank	human	validated	54_36p	silent	SNP	0.004	G
CFAP46	54777	genome.wustl.edu	37	10	134660515	134660515	+	Missense_Mutation	SNP	G	G	T			TCGA-36-2545-01A-01D-1526-09	TCGA-36-2545-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ff47cb75-3f83-4749-a21d-69bfa5eb6dbc	ee353276-9833-4604-a76f-c9f937999791	g.chr10:134660515G>T	ENST00000368586.5	-	43	6288	c.6188C>A	c.(6187-6189)gCa>gAa	p.A2063E	TTC40_ENST00000263170.5_Missense_Mutation_p.A224E	NM_001200049.2	NP_001186978.2														breast(1)|endometrium(5)|lung(19)|urinary_tract(3)	28						GCTGGCGGCTGCTGCGACATC	0.642																																																0			10											35.0	36.0	36.0					10																	134660515		2198	4299	6497	134510505	SO:0001583	missense	54777																														ENST00000368586.5:c.6188C>A	10.37:g.134660515G>T	ENSP00000357575:p.Ala2063Glu		134510505		Missense_Mutation	SNP	NULL	p.A224E	ENST00000368586.5	37	c.671	CCDS58101.1	10	.	.	.	.	.	.	.	.	.	.	G	12.81	2.050136	0.36181	.	.	ENSG00000171811	ENST00000368586;ENST00000263170	T;T	0.12361	2.9;2.69	3.67	1.7	0.24286	.	0.432559	0.16951	U	0.192894	T	0.27205	0.0667	L	0.57536	1.79	0.09310	N	1	D	0.71674	0.998	P	0.62014	0.897	T	0.04664	-1.0935	10	0.66056	D	0.02	.	10.1876	0.43006	0.0:0.3943:0.6057:0.0	.	224	Q8IYW2	CJ092_HUMAN	E	2063;224	ENSP00000357575:A2063E;ENSP00000263170:A224E	ENSP00000263170:A224E	A	-	2	0	C10orf93	134510505	0.048000	0.20356	0.001000	0.08648	0.472000	0.32918	1.342000	0.33919	0.288000	0.22398	0.491000	0.48974	GCA	-	NULL		0.642	TTC40-001	PUTATIVE	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	C10orf92	protein_coding	OTTHUMT00000051095.3	G			134510505	-1	no_errors	ENST00000263170	ensembl	human	known	54_36p	missense	SNP	0.045	T
ZMYND19	116225	genome.wustl.edu	37	9	140481453	140481453	+	Missense_Mutation	SNP	G	G	A			TCGA-36-2545-01A-01D-1526-09	TCGA-36-2545-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ff47cb75-3f83-4749-a21d-69bfa5eb6dbc	ee353276-9833-4604-a76f-c9f937999791	g.chr9:140481453G>A	ENST00000298585.2	-	4	551	c.325C>T	c.(325-327)Cgg>Tgg	p.R109W	ZMYND19_ENST00000471957.1_5'Flank	NM_138462.2	NP_612471.1	Q96E35	ZMY19_HUMAN	zinc finger, MYND-type containing 19	109						cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|synapse (GO:0045202)	metal ion binding (GO:0046872)			endometrium(1)|large_intestine(2)|lung(5)|prostate(1)|skin(2)|soft_tissue(1)|urinary_tract(1)	13	all_cancers(76;0.106)			OV - Ovarian serous cystadenocarcinoma(145;0.000275)|Epithelial(140;0.00047)		GCCTTGGGCCGCCAGCCCCAC	0.672																																																0			9											49.0	47.0	48.0					9																	140481453		2203	4300	6503	139601274	SO:0001583	missense	116225			BC012948	CCDS7048.1	9q34.3	2008-02-05			ENSG00000165724	ENSG00000165724		"""Zinc fingers, MYND-type"""	21146	protein-coding gene	gene with protein product		611424					Standard	NM_138462		Approved	MIZIP	uc004cno.1	Q96E35	OTTHUMG00000020992	ENST00000298585.2:c.325C>T	9.37:g.140481453G>A	ENSP00000298585:p.Arg109Trp		139601274	Q5T366	Missense_Mutation	SNP	PatternScan_ZF_MYND_1,HMMPfam_zf-MYND	p.R109W	ENST00000298585.2	37	c.325	CCDS7048.1	9	.	.	.	.	.	.	.	.	.	.	G	20.2	3.949657	0.73787	.	.	ENSG00000165724	ENST00000298585	.	.	.	4.92	2.83	0.33086	.	0.153517	0.56097	D	0.000029	T	0.36110	0.0955	L	0.29908	0.895	0.47009	D	0.99928	D	0.60575	0.988	P	0.47346	0.544	T	0.20438	-1.0275	9	0.72032	D	0.01	-18.1096	5.2555	0.15544	0.1116:0.0:0.5585:0.3299	.	109	Q96E35	ZMY19_HUMAN	W	109	.	ENSP00000298585:R109W	R	-	1	2	ZMYND19	139601274	1.000000	0.71417	1.000000	0.80357	0.887000	0.51463	5.403000	0.66338	1.214000	0.43395	0.655000	0.94253	CGG	-	NULL		0.672	ZMYND19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZMYND19	protein_coding	OTTHUMT00000055356.1	G	NM_138462		139601274	-1	no_errors	NM_138462	genbank	human	validated	54_36p	missense	SNP	1.000	A
ASB10	136371	genome.wustl.edu	37	7	150884201	150884201	+	Missense_Mutation	SNP	G	G	C			TCGA-36-2545-01A-01D-1526-09	TCGA-36-2545-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ff47cb75-3f83-4749-a21d-69bfa5eb6dbc	ee353276-9833-4604-a76f-c9f937999791	g.chr7:150884201G>C	ENST00000420175.2	-	1	41	c.17C>G	c.(16-18)tCt>tGt	p.S6C	ASB10_ENST00000422024.1_Missense_Mutation_p.S51C|ASB10_ENST00000377867.3_Intron|ASB10_ENST00000275838.1_Missense_Mutation_p.S6C|ASB10_ENST00000434669.1_Missense_Mutation_p.S51C			Q8WXI3	ASB10_HUMAN	ankyrin repeat and SOCS box containing 10	6					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|endometrium(2)|lung(7)|skin(2)	12			OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CTCTTCTGGAGACCAACTCAT	0.592																																																0			7											25.0	20.0	22.0					7																	150884201		2203	4298	6501	150515134	SO:0001583	missense	136371			AK055536	CCDS5921.2, CCDS47749.1, CCDS47750.1, CCDS47749.2, CCDS47750.2	7q35	2014-02-04	2011-01-25		ENSG00000146926	ENSG00000146926		"""Ankyrin repeat domain containing"""	17185	protein-coding gene	gene with protein product		615054	"""ankyrin repeat and SOCS box-containing 10"", ""glaucoma 1, open angle, F (adult-onset)"""	GLC1F		22156576	Standard	NM_080871		Approved		uc003wjm.1	Q8WXI3	OTTHUMG00000157013	ENST00000420175.2:c.17C>G	7.37:g.150884201G>C	ENSP00000391137:p.Ser6Cys		150515134	A0AVH0|Q6ZUL6	Missense_Mutation	SNP	superfamily_ANK,HMMPfam_Ank,HMMSmart_ANK,HMMPfam_SOCS_box	p.S6C	ENST00000420175.2	37	c.17	CCDS47750.2	7	.	.	.	.	.	.	.	.	.	.	G	13.53	2.265570	0.40095	.	.	ENSG00000146926	ENST00000275838;ENST00000422024;ENST00000434669;ENST00000420175	T;T;T;T	0.70749	-0.45;-0.48;-0.51;-0.43	4.51	3.6	0.41247	.	.	.	.	.	T	0.55862	0.1947	N	0.24115	0.695	0.24421	N	0.994619	B;P	0.40000	0.214;0.698	B;B	0.37198	0.241;0.243	T	0.49643	-0.8918	9	0.72032	D	0.01	-4.7773	9.9816	0.41817	0.0:0.0:0.7974:0.2026	.	6;51	Q8WXI3;D5MNW9	ASB10_HUMAN;.	C	6;51;51;6	ENSP00000275838:S6C;ENSP00000401369:S51C;ENSP00000398247:S51C;ENSP00000391137:S6C	ENSP00000275838:S6C	S	-	2	0	ASB10	150515134	0.829000	0.29322	0.965000	0.40720	0.679000	0.39708	1.459000	0.35234	0.972000	0.38314	0.591000	0.81541	TCT	-	NULL		0.592	ASB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASB10	protein_coding	OTTHUMT00000347096.3	G	NM_080871		150515134	-1	no_errors	NM_080871	genbank	human	reviewed	54_36p	missense	SNP	0.996	C
IVL	3713	genome.wustl.edu	37	1	152882688	152882688	+	Missense_Mutation	SNP	G	G	C			TCGA-36-2545-01A-01D-1526-09	TCGA-36-2545-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ff47cb75-3f83-4749-a21d-69bfa5eb6dbc	ee353276-9833-4604-a76f-c9f937999791	g.chr1:152882688G>C	ENST00000368764.3	+	2	479	c.415G>C	c.(415-417)Gtc>Ctc	p.V139L	IVL_ENST00000392667.2_5'UTR			P07476	INVO_HUMAN	involucrin	139					isopeptide cross-linking via N6-(L-isoglutamyl)-L-lysine (GO:0018153)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|response to UV-B (GO:0010224)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)			breast(1)|endometrium(6)|kidney(1)|large_intestine(5)|lung(11)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	29	Lung NSC(65;3.97e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			TCAAGAGCTAGTCAAGAGAGA	0.507																																																0			1											62.0	66.0	65.0					1																	152882688		2203	4300	6503	151149312	SO:0001583	missense	3713			BC046391	CCDS1030.1	1q21	2008-02-05			ENSG00000163207	ENSG00000163207			6187	protein-coding gene	gene with protein product		147360				2873896	Standard	NM_005547		Approved		uc001fau.3	P07476	OTTHUMG00000012451	ENST00000368764.3:c.415G>C	1.37:g.152882688G>C	ENSP00000357753:p.Val139Leu		151149312	Q5T7P4	Missense_Mutation	SNP	PatternScan_INVOLUCRIN,HMMPfam_Involucrin_N,HMMPfam_Involucrin	p.V139L	ENST00000368764.3	37	c.415	CCDS1030.1	1	.	.	.	.	.	.	.	.	.	.	G	12.74	2.027636	0.35797	.	.	ENSG00000163207	ENST00000368764	T	0.09723	2.95	4.54	0.274	0.15654	.	.	.	.	.	T	0.01800	0.0057	N	0.14661	0.345	0.09310	N	0.999999	B	0.16603	0.018	B	0.13407	0.009	T	0.46952	-0.9154	9	0.27082	T	0.32	.	9.6956	0.40156	0.089:0.5269:0.3841:0.0	.	139	P07476	INVO_HUMAN	L	139	ENSP00000357753:V139L	ENSP00000357753:V139L	V	+	1	0	IVL	151149312	0.000000	0.05858	0.000000	0.03702	0.582000	0.36321	-0.618000	0.05578	-0.035000	0.13691	0.436000	0.28706	GTC	-	NULL		0.507	IVL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IVL	protein_coding	OTTHUMT00000034664.1	G	NM_005547		151149312	+1	no_errors	NM_005547	genbank	human	reviewed	54_36p	missense	SNP	0.000	C
HAUS7	55559	genome.wustl.edu	37	X	152720366	152720366	+	Intron	SNP	C	C	G			TCGA-36-2545-01A-01D-1526-09	TCGA-36-2545-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ff47cb75-3f83-4749-a21d-69bfa5eb6dbc	ee353276-9833-4604-a76f-c9f937999791	g.chrX:152720366C>G	ENST00000370211.4	-	9	1004				HAUS7_ENST00000421080.2_3'UTR|TREX2_ENST00000370232.1_Intron|TREX2_ENST00000338525.2_Intron|TREX2_ENST00000334497.2_Intron|TREX2_ENST00000330912.2_5'UTR|HAUS7_ENST00000370212.3_Missense_Mutation_p.G369A|HAUS7_ENST00000484394.1_5'UTR	NM_017518.7	NP_059988.3	Q99871	HAUS7_HUMAN	HAUS augmin-like complex, subunit 7						centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|HAUS complex (GO:0070652)|microtubule (GO:0005874)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	thioesterase binding (GO:0031996)			endometrium(1)|kidney(3)|large_intestine(1)|lung(10)|prostate(1)|skin(3)	19						ACAGGACCAGCCAGTCAGAGG	0.542																																																0			X											65.0	65.0	65.0					X																	152720366		2203	4300	6503	152373560	SO:0001627	intron_variant	55559			AF267739	CCDS35438.1	Xq28	2011-10-24	2009-04-20	2009-04-20		ENSG00000213397		"""HAUS augmin-like complex subunits"""	32979	protein-coding gene	gene with protein product	"""UCH37 interacting protein 1"", ""26S proteasome-associated UCH interacting protein 1"""	300540	"""UCHL5 interacting protein"""	UCHL5IP		11163772, 16395595, 19427217	Standard	NM_017518		Approved	UIP1	uc004fho.2	Q99871		ENST00000370211.4:c.961-400G>C	X.37:g.152720366C>G			152373560	B4DUH6|D3DWT9|Q96HS8|Q9NP54|Q9UFH9	Missense_Mutation	SNP	NULL	p.G369A	ENST00000370211.4	37	c.1106	CCDS35438.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.87|11.87	1.767033|1.767033	0.31320|0.31320	.|.	.|.	ENSG00000213397|ENSG00000213397	ENST00000435662|ENST00000370212	.|.	.|.	.|.	3.08|3.08	1.14|1.14	0.20703|0.20703	.|.	.|.	.|.	.|.	.|.	T|T	0.10035|0.10035	0.0246|0.0246	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	.|B	.|0.25441	.|0.126	.|B	.|0.19148	.|0.024	T|T	0.31998|0.31998	-0.9923|-0.9923	4|7	.|0.05833	.|T	.|0.94	.|.	3.4798|3.4798	0.07598|0.07598	0.0:0.5718:0.2589:0.1693|0.0:0.5718:0.2589:0.1693	.|.	.|369	.|Q99871-2	.|.	P|A	153|369	.|.	.|ENSP00000359231:G369A	A|G	-|-	1|2	0|0	HAUS7|HAUS7	152373560|152373560	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.000000|0.000000	0.00434|0.00434	0.068000|0.068000	0.14531|0.14531	0.167000|0.167000	0.19631|0.19631	-0.346000|-0.346000	0.07831|0.07831	GCT|GGC	-	NULL		0.542	HAUS7-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	UCHL5IP	protein_coding	OTTHUMT00000060963.2	C	NM_017518		152373560	-1	no_errors	NM_207107	genbank	human	reviewed	54_36p	missense	SNP	0.001	G
ARHGAP4	393	genome.wustl.edu	37	X	153173342	153173342	+	Silent	SNP	T	T	C			TCGA-36-2545-01A-01D-1526-09	TCGA-36-2545-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ff47cb75-3f83-4749-a21d-69bfa5eb6dbc	ee353276-9833-4604-a76f-c9f937999791	g.chrX:153173342T>C	ENST00000350060.5	-	22	2723	c.2682A>G	c.(2680-2682)ccA>ccG	p.P894P	ARHGAP4_ENST00000370016.1_Silent_p.P873P|ARHGAP4_ENST00000467421.1_5'Flank|ARHGAP4_ENST00000537206.1_Silent_p.P871P|ARHGAP4_ENST00000370028.3_Silent_p.P934P|ARHGAP4_ENST00000393721.1_Silent_p.P716P	NM_001666.4	NP_001657.3	P98171	RHG04_HUMAN	Rho GTPase activating protein 4	894					apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|negative regulation of axon extension (GO:0030517)|negative regulation of fibroblast migration (GO:0010764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of signal transduction (GO:0009967)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)	Rho GTPase activator activity (GO:0005100)|SH3/SH2 adaptor activity (GO:0005070)			central_nervous_system(2)|endometrium(2)|large_intestine(1)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	14	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					TGGTAGATGCTGGCCCAAGGC	0.647																																																0			X											51.0	55.0	54.0					X																	153173342		2202	4300	6502	152826536	SO:0001819	synonymous_variant	393			X78817	CCDS14736.1, CCDS55540.1	Xq28	2010-02-09			ENSG00000089820	ENSG00000089820		"""Rho GTPase activating proteins"""	674	protein-coding gene	gene with protein product	"""Rho-GAP hematopoietic protein C1"""	300023				8570618	Standard	NM_001666		Approved	KIAA0131, C1, p115, RhoGAP4, SrGAP4	uc004fjk.2	P98171	OTTHUMG00000024226	ENST00000350060.5:c.2682A>G	X.37:g.153173342T>C			152826536	Q14144|Q86UY3	Silent	SNP	HMMPfam_FCH,HMMSmart_FCH,superfamily_Rho_GAP,HMMSmart_RhoGAP,HMMPfam_RhoGAP,superfamily_SH3,HMMPfam_SH3_1,HMMSmart_SH3	p.P894	ENST00000350060.5	37	c.2682	CCDS14736.1	X																																																																																			-	NULL		0.647	ARHGAP4-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	ARHGAP4	protein_coding	OTTHUMT00000061119.1	T	NM_001666		152826536	-1	no_errors	NM_001666	genbank	human	validated	54_36p	silent	SNP	0.002	C
NTRK1	4914	genome.wustl.edu	37	1	156845442	156845442	+	Silent	SNP	A	A	G			TCGA-36-2545-01A-01D-1526-09	TCGA-36-2545-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ff47cb75-3f83-4749-a21d-69bfa5eb6dbc	ee353276-9833-4604-a76f-c9f937999791	g.chr1:156845442A>G	ENST00000524377.1	+	12	1526	c.1485A>G	c.(1483-1485)caA>caG	p.Q495Q	NTRK1_ENST00000368196.3_Silent_p.Q489Q|NTRK1_ENST00000392302.2_Silent_p.Q459Q|NTRK1_ENST00000358660.3_Silent_p.Q489Q	NM_002529.3	NP_002520.2	P04629	NTRK1_HUMAN	neurotrophic tyrosine kinase, receptor, type 1	495					activation of adenylate cyclase activity (GO:0007190)|activation of MAPKK activity (GO:0000186)|activation of phospholipase C activity (GO:0007202)|aging (GO:0007568)|axon guidance (GO:0007411)|axonogenesis involved in innervation (GO:0060385)|B cell differentiation (GO:0030183)|cellular response to nerve growth factor stimulus (GO:1990090)|cellular response to nicotine (GO:0071316)|circadian rhythm (GO:0007623)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|developmental programmed cell death (GO:0010623)|learning or memory (GO:0007611)|mechanoreceptor differentiation (GO:0042490)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory nerve development (GO:0021553)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of angiogenesis (GO:0045766)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of programmed cell death (GO:0043068)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|Ras protein signal transduction (GO:0007265)|response to activity (GO:0014823)|response to axon injury (GO:0048678)|response to drug (GO:0042493)|response to electrical stimulus (GO:0051602)|response to ethanol (GO:0045471)|response to hydrostatic pressure (GO:0051599)|response to nutrient levels (GO:0031667)|response to radiation (GO:0009314)|Sertoli cell development (GO:0060009)|small GTPase mediated signal transduction (GO:0007264)|sympathetic nervous system development (GO:0048485)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	axon (GO:0030424)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|early endosome (GO:0005769)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|nerve growth factor binding (GO:0048406)|nerve growth factor receptor activity (GO:0010465)|neurotrophin binding (GO:0043121)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(35)|ovary(8)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	74	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)				Amitriptyline(DB00321)|Imatinib(DB00619)|Regorafenib(DB08896)	AGAACCCACAATACTTCAGTG	0.577			T	"""TPM3, TPR, TFG"""	papillary thyroid					TSP Lung(10;0.080)																													Dom	yes		1	1q21-q22	4914	"""neurotrophic tyrosine kinase, receptor, type 1"""		E	0			1											97.0	77.0	84.0					1																	156845442		2203	4300	6503	155112066	SO:0001819	synonymous_variant	4914			Y09028	CCDS1161.1, CCDS30890.1, CCDS30891.1	1q21-q22	2014-09-17			ENSG00000198400	ENSG00000198400	2.7.10.1	"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	8031	protein-coding gene	gene with protein product	"""high affinity nerve growth factor receptor"""	191315				2869410	Standard	NM_001007792		Approved	TRK, TRKA, MTC	uc001fqh.1	P04629	OTTHUMG00000041304	ENST00000524377.1:c.1485A>G	1.37:g.156845442A>G			155112066	B2R6T5|B7ZM34|P08119|Q15655|Q15656|Q5D056|Q5VZS2|Q7Z5C3|Q9UIU7	Silent	SNP	superfamily_L domain-like,HMMSmart_SM00082,superfamily_Immunoglobulin,superfamily_Protein kinase-like (PK-like),HMMPfam_Pkinase_Tyr,HMMSmart_SM00219,HMMSmart_SM00220,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_TYR,PatternScan_RECEPTOR_TYR_KIN_II	p.Q495	ENST00000524377.1	37	c.1485	CCDS1161.1	1																																																																																			-	superfamily_Protein kinase-like (PK-like)		0.577	NTRK1-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NTRK1	protein_coding	OTTHUMT00000392279.1	A	NM_002529		155112066	+1	no_errors	NM_002529	genbank	human	reviewed	54_36p	silent	SNP	0.990	G
GOLIM4	27333	genome.wustl.edu	37	3	167766100	167766100	+	Missense_Mutation	SNP	C	C	G			TCGA-36-2545-01A-01D-1526-09	TCGA-36-2545-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ff47cb75-3f83-4749-a21d-69bfa5eb6dbc	ee353276-9833-4604-a76f-c9f937999791	g.chr3:167766100C>G	ENST00000470487.1	-	2	930	c.241G>C	c.(241-243)Gaa>Caa	p.E81Q	GOLIM4_ENST00000309027.4_Missense_Mutation_p.E81Q	NM_014498.3	NP_055313.1	O00461	GOLI4_HUMAN	golgi integral membrane protein 4	81	Endosome targeting.|Golgi targeting.				transport (GO:0006810)	cis-Golgi network (GO:0005801)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(5)|endometrium(2)|large_intestine(8)|lung(26)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47						TTTTTATGTTCAAGTCTTTCT	0.274																																																0			3											144.0	139.0	141.0					3																	167766100		2198	4296	6494	169248794	SO:0001583	missense	27333			U55853	CCDS3204.1	3q26	2007-07-30	2007-07-30	2007-07-30	ENSG00000173905	ENSG00000173905			15448	protein-coding gene	gene with protein product		606805	"""golgi phosphoprotein 4"""	GOLPH4		9201717, 15004235	Standard	NM_014498		Approved	GPP130, GIMPC, P138	uc003ffe.2	O00461	OTTHUMG00000158554	ENST00000470487.1:c.241G>C	3.37:g.167766100C>G	ENSP00000417354:p.Glu81Gln		169248794		Missense_Mutation	SNP	NULL	p.E81Q	ENST00000470487.1	37	c.241	CCDS3204.1	3	.	.	.	.	.	.	.	.	.	.	C	24.7	4.555778	0.86231	.	.	ENSG00000173905	ENST00000470487;ENST00000309027	.	.	.	5.19	5.19	0.71726	.	0.000000	0.85682	D	0.000000	D	0.82724	0.5099	M	0.79475	2.455	0.58432	D	0.999995	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.83567	0.0110	9	0.52906	T	0.07	-20.9023	19.1363	0.93429	0.0:1.0:0.0:0.0	.	81;81	F8W785;O00461	.;GOLI4_HUMAN	Q	81	.	ENSP00000309893:E81Q	E	-	1	0	GOLIM4	169248794	1.000000	0.71417	1.000000	0.80357	0.869000	0.49853	6.683000	0.74533	2.587000	0.87381	0.549000	0.68633	GAA	-	NULL		0.274	GOLIM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GOLIM4	protein_coding	OTTHUMT00000351278.2	C			169248794	-1	no_errors	NM_014498	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
RC3H1	149041	genome.wustl.edu	37	1	173962001	173962001	+	Missense_Mutation	SNP	G	G	C			TCGA-36-2545-01A-01D-1526-09	TCGA-36-2545-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ff47cb75-3f83-4749-a21d-69bfa5eb6dbc	ee353276-9833-4604-a76f-c9f937999791	g.chr1:173962001G>C	ENST00000367696.2	-	2	474	c.123C>G	c.(121-123)tgC>tgG	p.C41W	RC3H1_ENST00000258349.4_Missense_Mutation_p.C41W|RC3H1_ENST00000367694.2_Missense_Mutation_p.C41W			Q5TC82	RC3H1_HUMAN	ring finger and CCCH-type domains 1	41					B cell homeostasis (GO:0001782)|cytoplasmic mRNA processing body assembly (GO:0033962)|lymph node development (GO:0048535)|negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of germinal center formation (GO:0002635)|negative regulation of T-helper cell differentiation (GO:0045623)|nuclear-transcribed mRNA catabolic process (GO:0000956)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|posttranscriptional regulation of gene expression (GO:0010608)|protein ubiquitination (GO:0016567)|regulation of germinal center formation (GO:0002634)|regulation of mRNA stability (GO:0043488)|regulation of T cell receptor signaling pathway (GO:0050856)|spleen development (GO:0048536)|T cell homeostasis (GO:0043029)|T cell proliferation (GO:0042098)|T follicular helper cell differentiation (GO:0061470)	cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)	mRNA 3'-UTR binding (GO:0003730)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(20)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	50						GTTTATTCAGGCACATCTTGC	0.502																																																0			1											161.0	140.0	147.0					1																	173962001		2203	4300	6503	172228624	SO:0001583	missense	149041			AK093501	CCDS30940.1, CCDS72987.1	1q25.1	2013-01-18	2010-09-15		ENSG00000135870	ENSG00000135870		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, CCCH-type domain containing"""	29434	protein-coding gene	gene with protein product	"""KIAA2025 protein"""	609424	"""ring finger and CCCH-type zinc finger domains 1"""			15917799	Standard	XM_005244918		Approved	KIAA2025, roquin, RP5-1198E17.5, RNF198	uc001gju.4	Q5TC82	OTTHUMG00000037275	ENST00000367696.2:c.123C>G	1.37:g.173962001G>C	ENSP00000356669:p.Cys41Trp		172228624	B3KVK1|Q5W180|Q5W181|Q8IVE6|Q8N9V1	Missense_Mutation	SNP	superfamily_RING/U-box,HMMPfam_zf-C3HC4,HMMSmart_SM00184,PatternScan_ZF_RING_1,superfamily_CCCH zinc finger,HMMSmart_SM00356,HMMPfam_zf-CCCH	p.C41W	ENST00000367696.2	37	c.123	CCDS30940.1	1	.	.	.	.	.	.	.	.	.	.	G	22.7	4.324816	0.81580	.	.	ENSG00000135870	ENST00000367696;ENST00000258349;ENST00000367694	D;D;D	0.99680	-6.38;-6.38;-6.38	5.68	5.68	0.88126	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type, conserved site (1);Zinc finger, RING-type (2);Zinc finger, C3HC4 RING-type (1);	0.000000	0.85682	D	0.000000	D	0.99876	0.9941	H	0.98721	4.31	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;0.999;0.998;1.0	D	0.96452	0.9335	10	0.87932	D	0	-9.8157	19.7923	0.96464	0.0:0.0:1.0:0.0	.	41;41;41;41	B9EGU6;B7ZMB3;Q5TC82-2;Q5TC82	.;.;.;RC3H1_HUMAN	W	41	ENSP00000356669:C41W;ENSP00000258349:C41W;ENSP00000356667:C41W	ENSP00000258349:C41W	C	-	3	2	RC3H1	172228624	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.487000	0.81328	2.693000	0.91896	0.655000	0.94253	TGC	-	superfamily_RING/U-box,HMMPfam_zf-C3HC4,HMMSmart_SM00184,PatternScan_ZF_RING_1		0.502	RC3H1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	RC3H1	protein_coding	OTTHUMT00000090733.2	G	NM_172071		172228624	-1	no_errors	NM_172071	genbank	human	validated	54_36p	missense	SNP	1.000	C
TNN	63923	genome.wustl.edu	37	1	175063337	175063337	+	Missense_Mutation	SNP	G	G	C			TCGA-36-2545-01A-01D-1526-09	TCGA-36-2545-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ff47cb75-3f83-4749-a21d-69bfa5eb6dbc	ee353276-9833-4604-a76f-c9f937999791	g.chr1:175063337G>C	ENST00000239462.4	+	7	1649	c.1536G>C	c.(1534-1536)tgG>tgC	p.W512C		NM_022093.1	NP_071376.1	Q9UQP3	TENN_HUMAN	tenascin N	512	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axonogenesis (GO:0007409)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|liver(1)|lung(81)|ovary(5)|prostate(6)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	156		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		TCTACGTGTGGGCTGAAAGGG	0.552																																																0			1											93.0	73.0	80.0					1																	175063337		2203	4300	6503	173329960	SO:0001583	missense	63923			AK127044	CCDS30943.1	1q23-q24	2013-02-11			ENSG00000120332	ENSG00000120332		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	22942	protein-coding gene	gene with protein product							Standard	NM_022093		Approved		uc001gkl.1	Q9UQP3	OTTHUMG00000034882	ENST00000239462.4:c.1536G>C	1.37:g.175063337G>C	ENSP00000239462:p.Trp512Cys		173329960	B9EGP3|Q5R360	Missense_Mutation	SNP	PatternScan_EGF_1,HMMSmart_SM00181,HMMPfam_EGF_2,superfamily_EGF/Laminin,PatternScan_EGF_2,HMMPfam_fn3,HMMSmart_SM00060,superfamily_Fibronectin type III,HMMSmart_SM00186,HMMPfam_Fibrinogen_C,superfamily_Fibrinogen C-terminal domain-like,PatternScan_FIBRIN_AG_C_DOMAIN	p.W512C	ENST00000239462.4	37	c.1536	CCDS30943.1	1	.	.	.	.	.	.	.	.	.	.	G	17.03	3.284236	0.59867	.	.	ENSG00000120332	ENST00000239462;ENST00000539081	T	0.56611	0.45	5.12	5.12	0.69794	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.277119	0.31199	N	0.008077	T	0.76884	0.4050	M	0.90425	3.115	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.80764	0.994;0.994	T	0.79401	-0.1819	10	0.38643	T	0.18	.	16.3603	0.83259	0.0:0.0:1.0:0.0	.	512;512	B3KXB6;Q9UQP3	.;TENN_HUMAN	C	512	ENSP00000239462:W512C	ENSP00000239462:W512C	W	+	3	0	TNN	173329960	1.000000	0.71417	1.000000	0.80357	0.754000	0.42855	5.296000	0.65698	2.377000	0.81083	0.563000	0.77884	TGG	-	HMMPfam_fn3,HMMSmart_SM00060,superfamily_Fibronectin type III		0.552	TNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNN	protein_coding	OTTHUMT00000084422.1	G	XM_040527		173329960	+1	no_errors	NM_022093	genbank	human	validated	54_36p	missense	SNP	1.000	C
TOR3A	64222	genome.wustl.edu	37	1	179057054	179057054	+	Silent	SNP	G	G	A			TCGA-36-2545-01A-01D-1526-09	TCGA-36-2545-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ff47cb75-3f83-4749-a21d-69bfa5eb6dbc	ee353276-9833-4604-a76f-c9f937999791	g.chr1:179057054G>A	ENST00000367627.3	+	4	1400	c.648G>A	c.(646-648)ctG>ctA	p.L216L	TOR3A_ENST00000495145.1_3'UTR|TOR3A_ENST00000352445.6_Silent_p.L216L	NM_022371.3	NP_071766.2	Q9H497	TOR3A_HUMAN	torsin family 3, member A	216					ATP catabolic process (GO:0006200)|chaperone mediated protein folding requiring cofactor (GO:0051085)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			endometrium(1)|kidney(2)|large_intestine(4)|lung(4)|pancreas(1)|urinary_tract(1)	13						AGGAGCAGCTGATGAGCCAGA	0.622																																																0			1											37.0	40.0	39.0					1																	179057054		2203	4300	6503	177323677	SO:0001819	synonymous_variant	64222			BC001085	CCDS1329.1	1q25.2	2008-02-05	2003-04-02		ENSG00000186283	ENSG00000186283			11997	protein-coding gene	gene with protein product		607555	"""ATP-dependant interferon responsive"""	ADIR		10644435	Standard	NM_022371		Approved	FLJ22345, ADIR2	uc001gmd.3	Q9H497	OTTHUMG00000035077	ENST00000367627.3:c.648G>A	1.37:g.179057054G>A			177323677	B4DSY0|B7ZB65|Q5M7Y7|Q8WVA7|Q8WWM2|Q9H495|Q9H6E7	Silent	SNP	HMMPfam_Torsin,superfamily_P-loop containing nucleoside triphosphate hydrolases	p.L216	ENST00000367627.3	37	c.648	CCDS1329.1	1																																																																																			-	HMMPfam_Torsin,superfamily_P-loop containing nucleoside triphosphate hydrolases		0.622	TOR3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOR3A	protein_coding	OTTHUMT00000084927.1	G	NM_022371		177323677	+1	no_errors	NM_022371	genbank	human	validated	54_36p	silent	SNP	0.931	A
PDE11A	50940	genome.wustl.edu	37	2	178861991	178861991	+	Intron	SNP	G	G	A			TCGA-36-2545-01A-01D-1526-09	TCGA-36-2545-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ff47cb75-3f83-4749-a21d-69bfa5eb6dbc	ee353276-9833-4604-a76f-c9f937999791	g.chr2:178861991G>A	ENST00000286063.6	-	2	1389				AC011998.1_ENST00000457053.1_RNA|PDE11A_ENST00000358450.4_Intron	NM_016953.3	NP_058649.3	Q9HCR9	PDE11_HUMAN	phosphodiesterase 11A						blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|signal transduction (GO:0007165)	cytosol (GO:0005829)|perikaryon (GO:0043204)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|cyclic-nucleotide phosphodiesterase activity (GO:0004112)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(13)|lung(28)|ovary(4)|skin(3)|upper_aerodigestive_tract(3)	58			OV - Ovarian serous cystadenocarcinoma(117;0.00121)|Epithelial(96;0.00455)|all cancers(119;0.02)		Caffeine(DB00201)|Tadalafil(DB00820)	TTCCCTGAAGGCTCCTCTCAT	0.438									Primary Pigmented Nodular Adrenocortical Disease, Familial																																							0			2																																								178570237	SO:0001627	intron_variant	728664	Familial Cancer Database	iPPNAD, PPNAD1, incl. familial micronodular adrenocortical hyperplasia, PPNAD2	AJ251509	CCDS33334.1, CCDS42785.1, CCDS42786.1, CCDS46459.1	2q31.3	2010-06-22			ENSG00000128655	ENSG00000128655	3.1.4.17	"""Phosphodiesterases"""	8773	protein-coding gene	gene with protein product		604961				10725373	Standard	NM_001077196		Approved		uc002ulq.3	Q9HCR9	OTTHUMG00000154188	ENST00000286063.6:c.1071+17037C>T	2.37:g.178861991G>A			178570237	Q14CD1|Q53T16|Q96S76|Q9GZY7|Q9HB46|Q9NY45	RNA	SNP	-	NULL	ENST00000286063.6	37	NULL	CCDS33334.1	2																																																																																			-	-		0.438	PDE11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC728664	protein_coding	OTTHUMT00000334313.2	G			178570237	-1	pseudogene	XR_015711	genbank	human	model	54_36p	rna	SNP	0.994	A
METTL21A	151194	genome.wustl.edu	37	2	208477892	208477892	+	Missense_Mutation	SNP	G	G	A	rs374826319		TCGA-36-2545-01A-01D-1526-09	TCGA-36-2545-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ff47cb75-3f83-4749-a21d-69bfa5eb6dbc	ee353276-9833-4604-a76f-c9f937999791	g.chr2:208477892G>A	ENST00000411432.1	-	4	751	c.535C>T	c.(535-537)Cgg>Tgg	p.R179W	METTL21A_ENST00000477919.1_5'Flank|METTL21A_ENST00000425132.1_Intron|METTL21A_ENST00000426075.1_Missense_Mutation_p.R179W|METTL21A_ENST00000442521.1_Missense_Mutation_p.R179W|METTL21A_ENST00000432416.1_Intron|METTL21A_ENST00000458426.1_Intron|METTL21A_ENST00000448007.2_Missense_Mutation_p.R179W|METTL21A_ENST00000272839.3_Missense_Mutation_p.R197W|METTL21A_ENST00000406927.2_Missense_Mutation_p.R179W|METTL21A_ENST00000448823.2_3'UTR	NM_001127395.1	NP_001120867.1	Q8WXB1	MT21A_HUMAN	methyltransferase like 21A	179					peptidyl-lysine methylation (GO:0018022)|protein methylation (GO:0006479)	cytoplasm (GO:0005737)	ATPase binding (GO:0051117)|Hsp70 protein binding (GO:0030544)|protein-lysine N-methyltransferase activity (GO:0016279)			endometrium(2)|large_intestine(3)|lung(3)|ovary(1)|stomach(1)	10						TTGTTATCCCGTTCATAGCGA	0.388																																																0			2						G	TRP/ARG,TRP/ARG	4,4402	8.1+/-20.4	0,4,2199	150.0	150.0	150.0		535,535	5.3	1.0	2		150	0,8600		0,0,4300	no	missense,missense	METTL21A	NM_001127395.1,NM_145280.4	101,101	0,4,6499	AA,AG,GG		0.0,0.0908,0.0308	probably-damaging,probably-damaging	179/219,179/219	208477892	4,13002	2203	4300	6503	208186137	SO:0001583	missense	151194			AK093812, AF455817	CCDS2376.1	2q33.3	2013-09-30	2011-03-03	2011-03-03	ENSG00000144401	ENSG00000144401			30476	protein-coding gene	gene with protein product	"""Hepatocellular carcinoma-associated antigen 557b"", ""heat shock protein 70kDa lysine (K) methyltransferase"""	615257	"""family with sequence similarity 119, member A"""	FAM119A		23921388	Standard	NM_145280		Approved	LOC151194, HCA557b, HSPA-KMT	uc010fuk.1	Q8WXB1	OTTHUMG00000132934	ENST00000411432.1:c.535C>T	2.37:g.208477892G>A	ENSP00000415115:p.Arg179Trp		208186137	Q53RV0|Q8N1Z9|Q96GH6	Missense_Mutation	SNP	HMMPfam_Methyltransf_16,superfamily_S-adenosyl-L-methionine-dependent methyltransferases	p.R179W	ENST00000411432.1	37	c.535	CCDS2376.1	2	.	.	.	.	.	.	.	.	.	.	G	32	5.119134	0.94385	9.08E-4	0.0	ENSG00000144401	ENST00000411432;ENST00000448007;ENST00000272839;ENST00000406927;ENST00000426075;ENST00000442521	T;T;T;T;T;T	0.17528	2.27;2.27;2.27;2.27;2.27;2.27	5.26	5.26	0.73747	.	0.057480	0.64402	D	0.000001	T	0.51075	0.1653	M	0.88450	2.955	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.58736	-0.7584	10	0.72032	D	0.01	-18.0578	19.0594	0.93081	0.0:0.0:1.0:0.0	.	179	Q8WXB1	MT21A_HUMAN	W	179;179;197;179;179;179	ENSP00000415115:R179W;ENSP00000407622:R179W;ENSP00000272839:R197W;ENSP00000385481:R179W;ENSP00000403317:R179W;ENSP00000392062:R179W	ENSP00000272839:R197W	R	-	1	2	METTL21A	208186137	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.546000	0.82137	2.750000	0.94351	0.561000	0.74099	CGG	-	HMMPfam_Methyltransf_16,superfamily_S-adenosyl-L-methionine-dependent methyltransferases		0.388	METTL21A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM119A	protein_coding	OTTHUMT00000337044.1	G	NM_145280		208186137	-1	no_errors	NM_145280	genbank	human	validated	54_36p	missense	SNP	1.000	A
ARPC2	10109	genome.wustl.edu	37	2	219103497	219103497	+	Missense_Mutation	SNP	A	A	G			TCGA-36-2545-01A-01D-1526-09	TCGA-36-2545-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ff47cb75-3f83-4749-a21d-69bfa5eb6dbc	ee353276-9833-4604-a76f-c9f937999791	g.chr2:219103497A>G	ENST00000295685.10	+	5	640	c.379A>G	c.(379-381)Aaa>Gaa	p.K127E	ARPC2_ENST00000315717.5_Missense_Mutation_p.K127E|ARPC2_ENST00000477992.1_3'UTR	NM_005731.2	NP_005722.1	O15144	ARPC2_HUMAN	actin related protein 2/3 complex, subunit 2, 34kDa	127					Arp2/3 complex-mediated actin nucleation (GO:0034314)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|Arp2/3 protein complex (GO:0005885)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	structural constituent of cytoskeleton (GO:0005200)			cervix(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)	6		Renal(207;0.0474)		Epithelial(149;1.21e-06)|all cancers(144;0.000212)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0103)		TGTCTTTGAAAAATACTTCCA	0.418																																																0			2											114.0	112.0	113.0					2																	219103497		2203	4300	6503	218811742	SO:0001583	missense	10109			AF006085	CCDS2410.1	2q36.1	2011-07-06	2002-08-29		ENSG00000163466	ENSG00000163466		"""Actin related protein 2/3 complex subunits"""	705	protein-coding gene	gene with protein product		604224	"""actin related protein 2/3 complex, subunit 2 (34 kD)"""			9359840, 9230079	Standard	NM_005731		Approved	p34-Arc, ARC34	uc002vhd.4	O15144	OTTHUMG00000133618	ENST00000295685.10:c.379A>G	2.37:g.219103497A>G	ENSP00000295685:p.Lys127Glu		218811742	Q92801|Q9P1D4	Missense_Mutation	SNP	superfamily_Arp2/3 complex subunits,HMMPfam_P34-Arc	p.K127E	ENST00000295685.10	37	c.379	CCDS2410.1	2	.	.	.	.	.	.	.	.	.	.	A	24.8	4.574066	0.86542	.	.	ENSG00000163466	ENST00000315717;ENST00000295685	.	.	.	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	T	0.68568	0.3015	M	0.84511	2.7	0.80722	D	1	P	0.41131	0.739	B	0.39935	0.314	T	0.75294	-0.3368	9	0.62326	D	0.03	.	15.8062	0.78513	1.0:0.0:0.0:0.0	.	127	O15144	ARPC2_HUMAN	E	127	.	ENSP00000295685:K127E	K	+	1	0	ARPC2	218811742	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	9.139000	0.94554	2.317000	0.78254	0.460000	0.39030	AAA	-	HMMPfam_P34-Arc,superfamily_Arp2/3 complex subunits		0.418	ARPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARPC2	protein_coding	OTTHUMT00000256777.2	A	NM_005731		218811742	+1	no_errors	NM_005731	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
TUBB8P9	255208	genome.wustl.edu	37	1	227695250	227695250	+	IGR	SNP	G	G	C			TCGA-36-2545-01A-01D-1526-09	TCGA-36-2545-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	ff47cb75-3f83-4749-a21d-69bfa5eb6dbc	ee353276-9833-4604-a76f-c9f937999791	g.chr1:227695250G>C								CTD-2090I13.1 (76514 upstream) : RP11-275O4.3 (3046 downstream)																							CAGACACCGTGGTGGAGCCCT	0.478																																																0			1																																								225761873	SO:0001628	intergenic_variant	0																															1.37:g.227695250G>C			225761873		RNA	SNP	-	NULL		37	NULL		1																																																																																			-	-	0	0.478					ENSG00000221080			G			225761873	-1	no_errors	ENST00000408153	ensembl	human	novel	54_36p	rna	SNP	1.000	C
