#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	SNP	G	G	A			TCGA-36-2548-01A-01D-1526-09	TCGA-36-2548-10A-01D-1526-09	G	G					Unknown	Invalid:failed_liftOver	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f0526795-f4e2-4362-8fd8-58f5b9fc6ee7	4f689ff8-b0ef-4495-af25-6f460f515b4f	g.chrUnknown:0G>A								None (None upstream) : None (None downstream)																								0.0																																																0			MT																																								8866	SO:0001628	intergenic_variant	4508																															Unknown.37:g.0G>A			8866		Silent	SNP	HMMPfam_ATP-synt_A,superfamily_ATPase_F0_A,PatternScan_ATPASE_A	p.V113		37	c.339		MT																																																																																			-	HMMPfam_ATP-synt_A,superfamily_ATPase_F0_A	0	0					MT-ATP6			G			8866	+1	no_errors	ENST00000361899	ensembl	human	known	54_36p	silent	SNP	NULL	A
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	SNP	G	G	A			TCGA-36-2548-01A-01D-1526-09	TCGA-36-2548-10A-01D-1526-09	G	G					Unknown	Invalid:failed_liftOver	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f0526795-f4e2-4362-8fd8-58f5b9fc6ee7	4f689ff8-b0ef-4495-af25-6f460f515b4f	g.chrUnknown:0G>A								None (None upstream) : None (None downstream)																								0.0																																																0			MT																																								10099	SO:0001628	intergenic_variant	4537																															Unknown.37:g.0G>A			10099		Missense_Mutation	SNP	HMMPfam_Oxidored_q4	p.A14T		37	c.40		MT																																																																																			-	HMMPfam_Oxidored_q4	0	0					MT-ND3			G			10099	+1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000361227	ensembl	human	known	54_36p	missense	SNP	NULL	A
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	SNP	T	T	C			TCGA-36-2548-01A-01D-1526-09	TCGA-36-2548-10A-01D-1526-09	T	T					Unknown	Invalid:failed_liftOver	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f0526795-f4e2-4362-8fd8-58f5b9fc6ee7	4f689ff8-b0ef-4495-af25-6f460f515b4f	g.chrUnknown:0T>C								None (None upstream) : None (None downstream)																								0.0																																																0			MT																																								10316	SO:0001628	intergenic_variant	4537																															Unknown.37:g.0T>C			10316		Missense_Mutation	SNP	HMMPfam_Oxidored_q4	p.L86P		37	c.257		MT																																																																																			-	HMMPfam_Oxidored_q4	0	0					MT-ND3			T			10316	+1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000361227	ensembl	human	known	54_36p	missense	SNP	NULL	C
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	SNP	G	G	A			TCGA-36-2548-01A-01D-1526-09	TCGA-36-2548-10A-01D-1526-09	G	G					Unknown	Invalid:failed_liftOver	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f0526795-f4e2-4362-8fd8-58f5b9fc6ee7	4f689ff8-b0ef-4495-af25-6f460f515b4f	g.chrUnknown:0G>A								None (None upstream) : None (None downstream)																								0.0																																																0			MT																																								11915	SO:0001628	intergenic_variant	4538																															Unknown.37:g.0G>A			11915		Silent	SNP	HMMPfam_Oxidored_q5_N,HMMPfam_Oxidored_q1	p.T385		37	c.1155		MT																																																																																			-	HMMPfam_Oxidored_q1	0	0					MT-ND4			G			11915	+1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000361381	ensembl	human	known	54_36p	silent	SNP	NULL	A
MYOM2	9172	genome.wustl.edu	37	8	2000387	2000387	+	Missense_Mutation	SNP	G	G	T			TCGA-36-2548-01A-01D-1526-09	TCGA-36-2548-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f0526795-f4e2-4362-8fd8-58f5b9fc6ee7	4f689ff8-b0ef-4495-af25-6f460f515b4f	g.chr8:2000387G>T	ENST00000262113.4	+	3	360	c.219G>T	c.(217-219)aaG>aaT	p.K73N	MYOM2_ENST00000523438.1_Intron	NM_003970.2	NP_003961.2	P54296	MYOM2_HUMAN	myomesin 2	73					muscle contraction (GO:0006936)	M band (GO:0031430)|mitochondrion (GO:0005739)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)			autonomic_ganglia(2)|breast(4)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(11)|kidney(2)|large_intestine(17)|lung(39)|ovary(5)|prostate(1)|skin(10)|upper_aerodigestive_tract(3)	104		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)		TCTGTGCGAAGCGAGTGAGCA	0.602																																																0			8											111.0	97.0	101.0					8																	2000387		2203	4300	6503	1987794	SO:0001583	missense	9172				CCDS5957.1	8p23.3	2014-06-06	2012-10-17		ENSG00000036448	ENSG00000036448		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7614	protein-coding gene	gene with protein product		603509	"""myomesin (M-protein) 2 (165kD)"", ""myomesin (M-protein) 2, 165kDa"""				Standard	XM_006716237		Approved		uc003wpx.4	P54296	OTTHUMG00000129175	ENST00000262113.4:c.219G>T	8.37:g.2000387G>T	ENSP00000262113:p.Lys73Asn		1987794	Q7Z3Y2	Missense_Mutation	SNP	superfamily_SSF48726,HMMPfam_I-set,HMMSmart_IG,superfamily_FN_III-like,HMMSmart_FN3,HMMPfam_fn3,HMMPfam_ig,HMMSmart_IGc2	p.K73N	ENST00000262113.4	37	c.219	CCDS5957.1	8	.	.	.	.	.	.	.	.	.	.	G	3.333	-0.136262	0.06711	.	.	ENSG00000036448	ENST00000262113	T	0.52295	0.67	4.71	0.416	0.16416	.	0.071226	0.56097	D	0.000031	T	0.37156	0.0993	M	0.62723	1.935	0.09310	N	1	B	0.32245	0.361	B	0.29440	0.102	T	0.19549	-1.0302	10	0.24483	T	0.36	.	7.9486	0.30001	0.5084:0.0:0.4916:0.0	.	73	P54296	MYOM2_HUMAN	N	73	ENSP00000262113:K73N	ENSP00000262113:K73N	K	+	3	2	MYOM2	1987794	1.000000	0.71417	0.010000	0.14722	0.006000	0.05464	0.871000	0.28023	-0.068000	0.12953	-0.768000	0.03414	AAG	-	NULL		0.602	MYOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYOM2	protein_coding	OTTHUMT00000251249.1	G	NM_003970		1987794	+1	no_errors	NM_003970	genbank	human	validated	54_36p	missense	SNP	0.002	T
TMC2	117532	genome.wustl.edu	37	20	2597941	2597941	+	Missense_Mutation	SNP	G	G	A			TCGA-36-2548-01A-01D-1526-09	TCGA-36-2548-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f0526795-f4e2-4362-8fd8-58f5b9fc6ee7	4f689ff8-b0ef-4495-af25-6f460f515b4f	g.chr20:2597941G>A	ENST00000358864.1	+	16	2179	c.2164G>A	c.(2164-2166)Gac>Aac	p.D722N	TMC2_ENST00000496948.1_3'UTR	NM_080751.2	NP_542789.2	Q8TDI7	TMC2_HUMAN	transmembrane channel-like 2	722					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|vestibular reflex (GO:0060005)	integral component of membrane (GO:0016021)|stereocilium bundle tip (GO:0032426)	voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(3)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(14)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35						ACCCTCCTTTGACTGCGGGCC	0.627																																																0			20											97.0	71.0	80.0					20																	2597941		2203	4300	6503	2545941	SO:0001583	missense	117532			AF417580	CCDS13029.2	20p13	2010-08-05	2003-02-23		ENSG00000149488	ENSG00000149488			16527	protein-coding gene	gene with protein product		606707	"""transmembrane, cochlear expressed, 2"""	C20orf145		11850618, 12906855	Standard	XM_005260660		Approved	dJ686C3.3	uc002wgf.1	Q8TDI7	OTTHUMG00000031698	ENST00000358864.1:c.2164G>A	20.37:g.2597941G>A	ENSP00000351732:p.Asp722Asn		2545941	Q5JXT0|Q5JXT1|Q6UWW4|Q6ZS41|Q8N9F3|Q9BYN2|Q9BYN3|Q9BYN4|Q9BYN5	Missense_Mutation	SNP	HMMPfam_TMC	p.D722N	ENST00000358864.1	37	c.2164	CCDS13029.2	20	.	.	.	.	.	.	.	.	.	.	G	20.3	3.958924	0.74016	.	.	ENSG00000149488	ENST00000358864	T	0.64260	-0.09	5.31	5.31	0.75309	.	0.088260	0.85682	D	0.000000	T	0.70369	0.3216	L	0.41710	1.295	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	T	0.63152	-0.6701	10	0.15499	T	0.54	-28.2476	16.8463	0.85981	0.0:0.0:1.0:0.0	.	722	Q8TDI7	TMC2_HUMAN	N	722	ENSP00000351732:D722N	ENSP00000351732:D722N	D	+	1	0	TMC2	2545941	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.864000	0.99589	2.632000	0.89209	0.650000	0.86243	GAC	-	NULL		0.627	TMC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMC2	protein_coding	OTTHUMT00000077601.2	G			2545941	+1	no_errors	NM_080751	genbank	human	validated	54_36p	missense	SNP	1.000	A
TP53	7157	genome.wustl.edu	37	17	7578370	7578370	+	Splice_Site	SNP	C	C	A			TCGA-36-2548-01A-01D-1526-09	TCGA-36-2548-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f0526795-f4e2-4362-8fd8-58f5b9fc6ee7	4f689ff8-b0ef-4495-af25-6f460f515b4f	g.chr17:7578370C>A	ENST00000269305.4	-	5	749		c.e5+1		TP53_ENST00000455263.2_Splice_Site|TP53_ENST00000420246.2_Splice_Site|TP53_ENST00000574684.1_Splice_Site|TP53_ENST00000413465.2_Splice_Site|TP53_ENST00000359597.4_Splice_Site|TP53_ENST00000445888.2_Splice_Site	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53						apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.?(54)|p.0?(8)|p.G187fs*16(2)|p.D186_P191delDGLAPP(1)|p.L188fs*19(1)|p.G187_L188delGL(1)|p.G187fs*22(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CAGCTGCTCACCATCGCTATC	0.632		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	68	Unknown(54)|Whole gene deletion(8)|Deletion - Frameshift(3)|Deletion - In frame(2)|Insertion - Frameshift(1)	lung(12)|breast(9)|oesophagus(7)|ovary(7)|liver(7)|urinary_tract(5)|NS(5)|haematopoietic_and_lymphoid_tissue(4)|bone(4)|upper_aerodigestive_tract(2)|large_intestine(2)|central_nervous_system(2)|stomach(1)|soft_tissue(1)	17											48.0	46.0	47.0					17																	7578370		2203	4300	6503	7519095	SO:0001630	splice_region_variant	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.559+1G>T	17.37:g.7578370C>A			7519095	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Splice_Site	SNP	-	e4+1	ENST00000269305.4	37	c.559+1	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	11.69	1.713974	0.30413	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	.	.	.	4.7	3.7	0.42460	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.0738	0.59075	0.0:0.8363:0.1637:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TP53	7519095	1.000000	0.71417	0.967000	0.41034	0.201000	0.24016	3.085000	0.50151	1.248000	0.43934	0.655000	0.94253	.	-	-		0.632	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	C	NM_000546	Intron	7519095	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	splice_site	SNP	0.998	A
MYH2	4620	genome.wustl.edu	37	17	10432950	10432950	+	Silent	SNP	C	C	T	rs145796634	byFrequency	TCGA-36-2548-01A-01D-1526-09	TCGA-36-2548-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f0526795-f4e2-4362-8fd8-58f5b9fc6ee7	4f689ff8-b0ef-4495-af25-6f460f515b4f	g.chr17:10432950C>T	ENST00000245503.5	-	24	3432	c.3048G>A	c.(3046-3048)ctG>ctA	p.L1016L	MYH2_ENST00000532183.2_Intron|RP11-799N11.1_ENST00000399342.2_RNA|MYH2_ENST00000397183.2_Silent_p.L1016L|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_017534.5	NP_060004.3	Q9UKX2	MYH2_HUMAN	myosin, heavy chain 2, skeletal muscle, adult	1016					Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|plasma membrane repair (GO:0001778)|response to activity (GO:0014823)	A band (GO:0031672)|actomyosin contractile ring (GO:0005826)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|protein complex (GO:0043234)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(99)|ovary(6)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(4)	176						CCTCTGCCTGCAGGTCATCCA	0.483													c|||	10	0.00199681	0.003	0.0072	5008	,	,		19493	0.0		0.001	False		,,,				2504	0.0															0			17						C	,	6,4400	11.4+/-27.6	0,6,2197	162.0	156.0	158.0		3048,3048	2.0	1.0	17	dbSNP_134	158	4,8584	3.7+/-12.6	0,4,4290	no	coding-synonymous,coding-synonymous	MYH2	NM_001100112.1,NM_017534.5	,	0,10,6487	TT,TC,CC		0.0466,0.1362,0.077	,	1016/1942,1016/1942	10432950	10,12984	2203	4294	6497	10373675	SO:0001819	synonymous_variant	4620				CCDS11156.1	17p13.1	2014-02-04	2006-09-29		ENSG00000125414	ENSG00000125414		"""Myosins / Myosin superfamily : Class II"""	7572	protein-coding gene	gene with protein product		160740	"""myosin, heavy polypeptide 2, skeletal muscle, adult"", ""inclusion body myopathy 3, autosomal dominant"""	IBM3		7545970, 11889243	Standard	NM_001100112		Approved	MYH2A, MYHSA2, MyHC-IIa, MYHas8, MyHC-2A	uc010coi.3	Q9UKX2	OTTHUMG00000130363	ENST00000245503.5:c.3048G>A	17.37:g.10432950C>T			10373675	A0AVL4|Q14322|Q16229|Q567P6|Q86T56	Silent	SNP	HMMPfam_Myosin_N,superfamily_SSF52540,HMMSmart_MYSc,HMMPfam_Myosin_head,HMMSmart_IQ,HMMPfam_IQ,HMMPfam_Myosin_tail_1	p.L1016	ENST00000245503.5	37	c.3048	CCDS11156.1	17																																																																																			-	NULL		0.483	MYH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH2	protein_coding	OTTHUMT00000252726.3	C	NM_017534		10373675	-1	no_errors	NM_001100112	genbank	human	validated	54_36p	silent	SNP	0.999	T
TEAD1	7003	genome.wustl.edu	37	11	12785801	12785801	+	Missense_Mutation	SNP	G	G	A	rs377174338		TCGA-36-2548-01A-01D-1526-09	TCGA-36-2548-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f0526795-f4e2-4362-8fd8-58f5b9fc6ee7	4f689ff8-b0ef-4495-af25-6f460f515b4f	g.chr11:12785801G>A	ENST00000527575.1	+	2	135	c.22G>A	c.(22-24)Ggc>Agc	p.G8S	TEAD1_ENST00000361905.4_5'UTR|TEAD1_ENST00000361985.2_Missense_Mutation_p.G8S|TEAD1_ENST00000527636.1_Missense_Mutation_p.G8S|TEAD1_ENST00000334310.6_5'UTR			P28347	TEAD1_HUMAN	TEA domain family member 1 (SV40 transcriptional enhancer factor)	8					gene expression (GO:0010467)|hippo signaling (GO:0035329)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(9)	17				Epithelial(150;0.00223)|BRCA - Breast invasive adenocarcinoma(625;0.236)		CAGCTGGAGCGGCAGTGAGAG	0.498																																																0			11						G	SER/GLY	1,4399	2.1+/-5.4	0,1,2199	66.0	73.0	71.0		22	5.8	1.0	11		71	0,8588		0,0,4294	no	missense	TEAD1	NM_021961.5	56	0,1,6493	AA,AG,GG		0.0,0.0227,0.0077		8/427	12785801	1,12987	2200	4294	6494	12742377	SO:0001583	missense	7003			X84839	CCDS7810.1, CCDS7810.2	11p15.4	2008-11-12				ENSG00000187079			11714	protein-coding gene	gene with protein product		189967	"""atrophia areata, peripapillary chorioretinal degeneration"""	TCF13, AA		1851669, 9889009, 15016762	Standard	NM_021961		Approved	TEF-1	uc021qdx.1	P28347		ENST00000527575.1:c.22G>A	11.37:g.12785801G>A	ENSP00000435977:p.Gly8Ser		12742377	A4FUP2|E7EV65	Missense_Mutation	SNP	HMMPfam_TEA,HMMSmart_SM00426,PatternScan_TEA_1	p.G8S	ENST00000527575.1	37	c.22		11	.	.	.	.	.	.	.	.	.	.	G	16.67	3.186768	0.57909	2.27E-4	0.0	ENSG00000187079	ENST00000527636;ENST00000527376;ENST00000527575;ENST00000361985	T;T;T;T	0.62941	0.57;1.64;-0.01;0.57	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	T	0.56411	0.1983	N	0.12746	0.255	0.80722	D	1	.	.	.	.	.	.	T	0.54470	-0.8289	8	0.30078	T	0.28	.	19.6863	0.95981	0.0:0.0:1.0:0.0	.	.	.	.	S	8	ENSP00000435233:G8S;ENSP00000432587:G8S;ENSP00000435977:G8S;ENSP00000354588:G8S	ENSP00000354588:G8S	G	+	1	0	TEAD1	12742377	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.876000	0.87215	2.746000	0.94184	0.591000	0.81541	GGC	-	HMMPfam_TEA		0.498	TEAD1-002	NOVEL	basic	protein_coding	TEAD1	protein_coding	OTTHUMT00000386888.1	G	NM_021961		12742377	+1	no_start_codon	ENST00000334310	ensembl	human	known	54_36p	missense	SNP	1.000	A
TEKT3	64518	genome.wustl.edu	37	17	15234710	15234710	+	Missense_Mutation	SNP	C	C	T	rs141313239	byFrequency	TCGA-36-2548-01A-01D-1526-09	TCGA-36-2548-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f0526795-f4e2-4362-8fd8-58f5b9fc6ee7	4f689ff8-b0ef-4495-af25-6f460f515b4f	g.chr17:15234710C>T	ENST00000395930.1	-	3	379	c.193G>A	c.(193-195)Gtg>Atg	p.V65M	TEKT3_ENST00000338696.2_Missense_Mutation_p.V65M	NM_031898.2	NP_114104.1	Q9BXF9	TEKT3_HUMAN	tektin 3	65					cilium morphogenesis (GO:0060271)|regulation of fertilization (GO:0080154)|sperm motility (GO:0030317)	acrosomal membrane (GO:0002080)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleus (GO:0005634)|sperm flagellum (GO:0036126)				endometrium(1)|kidney(3)|large_intestine(5)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	23				UCEC - Uterine corpus endometrioid carcinoma (92;0.0877)		TACGGGGCCACGCTTGGGGAA	0.522													C|||	3	0.000599042	0.0015	0.0014	5008	,	,		16499	0.0		0.0	False		,,,				2504	0.0															0			17						C	MET/VAL	7,4399	12.9+/-30.5	0,7,2196	136.0	128.0	131.0		193	3.2	0.5	17	dbSNP_134	131	0,8600		0,0,4300	yes	missense	TEKT3	NM_031898.2	21	0,7,6496	TT,TC,CC		0.0,0.1589,0.0538	benign	65/491	15234710	7,12999	2203	4300	6503	15175435	SO:0001583	missense	64518			AF334676	CCDS11169.1	17p12	2011-05-23			ENSG00000125409	ENSG00000125409			14293	protein-coding gene	gene with protein product		612683				11381029, 14735490	Standard	NM_031898		Approved	FLJ32828	uc002gon.3	Q9BXF9	OTTHUMG00000058965	ENST00000395930.1:c.193G>A	17.37:g.15234710C>T	ENSP00000379263:p.Val65Met		15175435	B2RAS7|D3DTT0|Q8N5R5|Q96M48	Missense_Mutation	SNP	HMMPfam_Tektin	p.V65M	ENST00000395930.1	37	c.193	CCDS11169.1	17	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	4.829	0.154096	0.09185	0.001589	0.0	ENSG00000125409	ENST00000395930;ENST00000338696;ENST00000536146;ENST00000539316;ENST00000543896	T;T;T;T;T	0.43294	4.13;4.13;1.55;1.55;0.95	5.4	3.2	0.36748	.	0.237076	0.37530	N	0.002059	T	0.21062	0.0507	N	0.12182	0.205	0.20975	N	0.999818	B	0.17038	0.02	B	0.09377	0.004	T	0.13388	-1.0511	10	0.33141	T	0.24	-3.2424	5.8796	0.18848	0.7076:0.1479:0.1445:0.0	.	65	Q9BXF9	TEKT3_HUMAN	M	65	ENSP00000379263:V65M;ENSP00000343995:V65M;ENSP00000446111:V65M;ENSP00000439713:V65M;ENSP00000444180:V65M	ENSP00000343995:V65M	V	-	1	0	TEKT3	15175435	0.965000	0.33210	0.467000	0.27180	0.079000	0.17450	2.028000	0.41088	0.454000	0.26884	-0.262000	0.10625	GTG	-	NULL		0.522	TEKT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TEKT3	protein_coding	OTTHUMT00000130385.2	C	NM_031898		15175435	-1	no_errors	NM_031898	genbank	human	reviewed	54_36p	missense	SNP	0.509	T
SPEN	23013	genome.wustl.edu	37	1	16258718	16258718	+	Missense_Mutation	SNP	C	C	T			TCGA-36-2548-01A-01D-1526-09	TCGA-36-2548-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f0526795-f4e2-4362-8fd8-58f5b9fc6ee7	4f689ff8-b0ef-4495-af25-6f460f515b4f	g.chr1:16258718C>T	ENST00000375759.3	+	11	6187	c.5983C>T	c.(5983-5985)Ccc>Tcc	p.P1995S		NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	1995					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)			NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		TGGTGGTGGACCCCAAGGGAA	0.562																																																0			1											28.0	29.0	29.0					1																	16258718		2201	4294	6495	16131305	SO:0001583	missense	23013				CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.5983C>T	1.37:g.16258718C>T	ENSP00000364912:p.Pro1995Ser		16131305	Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Missense_Mutation	SNP	superfamily_SSF54928,HMMSmart_RRM,HMMPfam_RRM_1,superfamily_SPOC-like,HMMPfam_SPOC	p.P1995S	ENST00000375759.3	37	c.5983	CCDS164.1	1	.	.	.	.	.	.	.	.	.	.	C	1.200	-0.632657	0.03584	.	.	ENSG00000065526	ENST00000375759	T	0.09538	2.97	4.84	4.84	0.62591	.	.	.	.	.	T	0.10508	0.0257	L	0.47716	1.5	0.09310	N	1	B	0.20887	0.049	B	0.16722	0.016	T	0.30563	-0.9974	9	0.09843	T	0.71	-0.3109	12.7447	0.57276	0.0:0.92:0.0:0.08	.	1995	Q96T58	MINT_HUMAN	S	1995	ENSP00000364912:P1995S	ENSP00000364912:P1995S	P	+	1	0	SPEN	16131305	0.001000	0.12720	0.004000	0.12327	0.164000	0.22412	1.253000	0.32886	2.394000	0.81467	0.462000	0.41574	CCC	-	NULL		0.562	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPEN	protein_coding	OTTHUMT00000025993.1	C	NM_015001		16131305	+1	no_errors	NM_015001	genbank	human	reviewed	54_36p	missense	SNP	0.003	T
PPM1F	9647	genome.wustl.edu	37	22	22277487	22277487	+	Missense_Mutation	SNP	G	G	A			TCGA-36-2548-01A-01D-1526-09	TCGA-36-2548-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f0526795-f4e2-4362-8fd8-58f5b9fc6ee7	4f689ff8-b0ef-4495-af25-6f460f515b4f	g.chr22:22277487G>A	ENST00000263212.5	-	8	1448	c.1343C>T	c.(1342-1344)aCc>aTc	p.T448I	PPM1F_ENST00000538191.1_Missense_Mutation_p.T344I|PPM1F_ENST00000407142.1_Missense_Mutation_p.T280I	NM_014634.3	NP_055449.1	P49593	PPM1F_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1F	448					cellular response to drug (GO:0035690)|histone dephosphorylation (GO:0016576)|intrinsic apoptotic signaling pathway (GO:0097193)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein kinase activity by regulation of protein phosphorylation (GO:0044387)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-threonine dephosphorylation (GO:0035970)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of chemotaxis (GO:0050921)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of gene expression (GO:0010628)|positive regulation of growth (GO:0045927)|positive regulation of stress fiber assembly (GO:0051496)	cytosol (GO:0005829)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)	calmodulin-dependent protein phosphatase activity (GO:0033192)|metal ion binding (GO:0046872)|phosphatase activity (GO:0016791)|protein serine/threonine phosphatase activity (GO:0004722)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(1)|ovary(2)|upper_aerodigestive_tract(1)	12	Colorectal(54;0.105)			READ - Rectum adenocarcinoma(21;0.155)		TGGAGCCTGGGTCTCAGGTTC	0.637																																																0			22											67.0	76.0	73.0					22																	22277487		2203	4300	6503	20607487	SO:0001583	missense	9647			D13640	CCDS13796.1	22q11.22	2012-04-17	2010-03-05		ENSG00000100034	ENSG00000100034	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	19388	protein-coding gene	gene with protein product	"""partner of PIX 2"", ""Ca(2+)/calmodulin-dependent protein kinase phosphatase"""		"""protein phosphatase 1F (PP2C domain containing)"""			11864573, 11559703	Standard	NM_014634		Approved	FEM-2, KIAA0015, POPX2, CaMKPase, CAMKP	uc002zvp.2	P49593	OTTHUMG00000150835	ENST00000263212.5:c.1343C>T	22.37:g.22277487G>A	ENSP00000263212:p.Thr448Ile		20607487	A8K6G3|B7Z2C3|Q96PM2	Missense_Mutation	SNP	superfamily_PP2C-related,HMMSmart_PP2Cc,HMMPfam_PP2C,HMMSmart_PP2C_SIG,PatternScan_PP2C	p.T448I	ENST00000263212.5	37	c.1343	CCDS13796.1	22	.	.	.	.	.	.	.	.	.	.	G	8.153	0.787851	0.16258	.	.	ENSG00000100034	ENST00000263212;ENST00000407142;ENST00000406981;ENST00000538191	T;T;T	0.16897	2.55;2.31;2.55	4.71	-0.853	0.10709	.	1.986030	0.02054	N	0.050243	T	0.09335	0.0230	N	0.14661	0.345	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.002	T	0.24548	-1.0157	10	0.27785	T	0.31	-18.1755	2.1795	0.03871	0.1294:0.135:0.4245:0.3111	.	344;448	B7Z2C3;P49593	.;PPM1F_HUMAN	I	448;280;280;344	ENSP00000263212:T448I;ENSP00000384930:T280I;ENSP00000439915:T344I	ENSP00000263212:T448I	T	-	2	0	PPM1F	20607487	0.782000	0.28689	0.018000	0.16275	0.030000	0.12068	0.575000	0.23729	0.303000	0.22785	0.655000	0.94253	ACC	-	NULL		0.637	PPM1F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPM1F	protein_coding	OTTHUMT00000320267.2	G	NM_014634		20607487	-1	no_errors	NM_014634	genbank	human	reviewed	54_36p	missense	SNP	0.039	A
ARMC4	55130	genome.wustl.edu	37	10	28229687	28229687	+	Silent	SNP	C	C	T			TCGA-36-2548-01A-01D-1526-09	TCGA-36-2548-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f0526795-f4e2-4362-8fd8-58f5b9fc6ee7	4f689ff8-b0ef-4495-af25-6f460f515b4f	g.chr10:28229687C>T	ENST00000305242.5	-	13	1883	c.1791G>A	c.(1789-1791)tcG>tcA	p.S597S	ARMC4_ENST00000545014.1_Silent_p.S122S|ARMC4_ENST00000537576.1_Silent_p.S289S	NM_018076.2	NP_060546.2	Q5T2S8	ARMC4_HUMAN	armadillo repeat containing 4	597					cell projection organization (GO:0030030)|cilium movement (GO:0003341)|left/right axis specification (GO:0070986)|outer dynein arm assembly (GO:0036158)|ventricular system development (GO:0021591)	axoneme (GO:0005930)|ciliary base (GO:0097546)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)				NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(17)|liver(1)|lung(17)|ovary(5)|prostate(3)|skin(8)|stomach(2)|urinary_tract(3)	75						CATACAGACTCGATTGGGCAG	0.443																																																0			10											93.0	89.0	90.0					10																	28229687		2203	4300	6503	28269693	SO:0001819	synonymous_variant	55130			AL136859	CCDS7157.1	10p12.1-p11.23	2014-02-03			ENSG00000169126	ENSG00000169126		"""Armadillo repeat containing"""	25583	protein-coding gene	gene with protein product		615408				11230166	Standard	XM_005252485		Approved	FLJ10817, FLJ10376, DKFZP434P1735, CILD23	uc001itz.3	Q5T2S8	OTTHUMG00000017867	ENST00000305242.5:c.1791G>A	10.37:g.28229687C>T			28269693	A8K906|B7Z7I1|Q9H0C0	Silent	SNP	superfamily_ARM repeat,HMMSmart_SM00185,HMMPfam_Arm	p.S597	ENST00000305242.5	37	c.1791	CCDS7157.1	10																																																																																			-	superfamily_ARM repeat,HMMSmart_SM00185		0.443	ARMC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARMC4	protein_coding	OTTHUMT00000047339.1	C	NM_018076		28269693	-1	no_errors	NM_018076	genbank	human	validated	54_36p	silent	SNP	0.000	T
RNF185	91445	genome.wustl.edu	37	22	31600476	31600476	+	Splice_Site	SNP	T	T	A			TCGA-36-2548-01A-01D-1526-09	TCGA-36-2548-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f0526795-f4e2-4362-8fd8-58f5b9fc6ee7	4f689ff8-b0ef-4495-af25-6f460f515b4f	g.chr22:31600476T>A	ENST00000326132.6	+	7	642	c.483T>A	c.(481-483)gcT>gcA	p.A161A	RNF185_ENST00000266252.7_Splice_Site_p.A105A|RNF185-AS1_ENST00000526089.1_RNA|RNF185_ENST00000426256.2_Splice_Site_p.A99A	NM_152267.3	NP_689480.2	Q96GF1	RN185_HUMAN	ring finger protein 185	161					autophagy (GO:0006914)|protein ubiquitination (GO:0016567)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|large_intestine(1)|lung(3)|skin(1)	6						TCTCTCCAGCTGTCCCTGGGA	0.502																																																0			22											151.0	127.0	135.0					22																	31600476		2203	4300	6503	29930476	SO:0001630	splice_region_variant	91445				CCDS13890.1, CCDS46689.1	22q12.2	2013-01-09			ENSG00000138942	ENSG00000138942		"""RING-type (C3HC4) zinc fingers"""	26783	protein-coding gene	gene with protein product	"""hypothetical protein FLJ38628"""					12477932	Standard	NM_152267		Approved	FLJ38628	uc003akb.3	Q96GF1	OTTHUMG00000151253	ENST00000326132.6:c.482-1T>A	22.37:g.31600476T>A			29930476	A8K5C1|A9X3T8|Q8N900	Silent	SNP	superfamily_RING/U-box,HMMSmart_SM00184,HMMPfam_zf-C3HC4,PatternScan_ZF_RING_1	p.A161	ENST00000326132.6	37	c.483	CCDS13890.1	22																																																																																			-	NULL		0.502	RNF185-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF185	protein_coding	OTTHUMT00000321927.2	T	NM_152267	Silent	29930476	+1	no_errors	NM_152267	genbank	human	validated	54_36p	silent	SNP	0.998	A
USPL1	10208	genome.wustl.edu	37	13	31205140	31205140	+	Missense_Mutation	SNP	G	G	A			TCGA-36-2548-01A-01D-1526-09	TCGA-36-2548-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f0526795-f4e2-4362-8fd8-58f5b9fc6ee7	4f689ff8-b0ef-4495-af25-6f460f515b4f	g.chr13:31205140G>A	ENST00000255304.4	+	4	739	c.397G>A	c.(397-399)Ggt>Agt	p.G133S	USPL1_ENST00000465952.1_3'UTR	NM_005800.4	NP_005791.3	Q5W0Q7	USPL1_HUMAN	ubiquitin specific peptidase like 1	133					Cajal body organization (GO:0030576)|cell proliferation (GO:0008283)|protein desumoylation (GO:0016926)	Cajal body (GO:0015030)|extracellular space (GO:0005615)	SUMO binding (GO:0032183)|SUMO-specific isopeptidase activity (GO:0070140)			breast(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(15)|pancreas(3)|skin(3)	34		Lung SC(185;0.0257)|Breast(139;0.203)		all cancers(112;0.0306)|Epithelial(112;0.131)|OV - Ovarian serous cystadenocarcinoma(117;0.134)		TGCTATTGACGGTGGAAAAGT	0.368																																					Ovarian(60;318 1180 1554 28110 31601)											0			13											63.0	65.0	64.0					13																	31205140		2203	4300	6503	30103140	SO:0001583	missense	10208			X59131	CCDS9336.1	13q12-q14	2012-11-14	2005-11-24	2005-11-24	ENSG00000132952	ENSG00000132952			20294	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 22"""	C13orf22		22878415	Standard	NM_005800		Approved	bA121O19.1, D13S106E	uc001utc.2	Q5W0Q7	OTTHUMG00000016675	ENST00000255304.4:c.397G>A	13.37:g.31205140G>A	ENSP00000255304:p.Gly133Ser		30103140	Q14109|Q6AI45|Q8IY30|Q8IYE8	Missense_Mutation	SNP	NULL	p.G133S	ENST00000255304.4	37	c.397	CCDS9336.1	13	.	.	.	.	.	.	.	.	.	.	G	5.571	0.290166	0.10567	.	.	ENSG00000132952	ENST00000255304	T	0.05786	3.39	6.07	1.3	0.21679	.	0.646675	0.16465	N	0.213223	T	0.02688	0.0081	N	0.05574	-0.02	0.09310	N	1	B	0.21606	0.058	B	0.16722	0.016	T	0.45789	-0.9237	10	0.02654	T	1	-5.8986	10.2814	0.43541	0.3518:0.0:0.6482:0.0	.	133	Q5W0Q7	USPL1_HUMAN	S	133	ENSP00000255304:G133S	ENSP00000255304:G133S	G	+	1	0	USPL1	30103140	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.506000	0.22658	0.275000	0.22094	-0.137000	0.14449	GGT	-	NULL		0.368	USPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USPL1	protein_coding	OTTHUMT00000044369.1	G	NM_005800		30103140	+1	no_errors	NM_005800	genbank	human	validated	54_36p	missense	SNP	0.001	A
CSMD2	114784	genome.wustl.edu	37	1	33990501	33990501	+	Silent	SNP	G	G	A			TCGA-36-2548-01A-01D-1526-09	TCGA-36-2548-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f0526795-f4e2-4362-8fd8-58f5b9fc6ee7	4f689ff8-b0ef-4495-af25-6f460f515b4f	g.chr1:33990501G>A	ENST00000373381.4	-	66	10553	c.10377C>T	c.(10375-10377)ggC>ggT	p.G3459G		NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	3315						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				GCAGCTCCACGCCACTGTGGT	0.562																																																0			1											134.0	108.0	116.0					1																	33990501		2203	4300	6503	33763088	SO:0001819	synonymous_variant	114784			AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373381.4:c.10377C>T	1.37:g.33990501G>A			33763088	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Silent	SNP	superfamily_Spermadhesin CUB domain,HMMPfam_CUB,HMMSmart_SM00042,superfamily_Complement control module/SCR domain,HMMPfam_Sushi,HMMSmart_SM00032,PatternScan_GLYCOSYL_HYDROL_F10,PatternScan_IG_MHC	p.G3315	ENST00000373381.4	37	c.9945		1																																																																																			-	NULL		0.562	CSMD2-201	KNOWN	basic|appris_principal	protein_coding	CSMD2	protein_coding		G	NM_052896		33763088	-1	no_errors	NM_052896	genbank	human	validated	54_36p	silent	SNP	0.452	A
APIP	51074	genome.wustl.edu	37	11	34912168	34912168	+	Intron	SNP	T	T	A			TCGA-36-2548-01A-01D-1526-09	TCGA-36-2548-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f0526795-f4e2-4362-8fd8-58f5b9fc6ee7	4f689ff8-b0ef-4495-af25-6f460f515b4f	g.chr11:34912168T>A	ENST00000395787.3	-	3	373				APIP_ENST00000527830.1_Intron|APIP_ENST00000278359.5_Intron	NM_015957.2	NP_057041.2			APAF1 interacting protein											kidney(2)|lung(1)|skin(1)	4	all_epithelial(35;0.161)	all_hematologic(20;0.107)	STAD - Stomach adenocarcinoma(6;0.000425)			AAGTTTGCAGTCCAATCATGC	0.358																																																0			11											85.0	75.0	78.0					11																	34912168		692	1590	2282	34868744	SO:0001627	intron_variant	51074			AF132963	CCDS7895.1	11p13	2014-05-12				ENSG00000149089	4.2.1.109		17581	protein-coding gene	gene with protein product	"""methylthioribulose-1-phosphate dehydratase"""	612491				10810093, 15262985, 24367089	Standard	NM_015957		Approved	CGI-29, Mmrp19, APIP2	uc001mvs.2	Q96GX9		ENST00000395787.3:c.159-69A>T	11.37:g.34912168T>A			34868744		Silent	SNP	superfamily_AraD-like aldolase/epimerase,HMMPfam_Aldolase_II	p.G3	ENST00000395787.3	37	c.9	CCDS7895.1	11																																																																																			-	NULL		0.358	APIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APIP	protein_coding	OTTHUMT00000389864.1	T	NM_015957		34868744	-1	no_errors	ENST00000395786	ensembl	human	known	54_36p	silent	SNP	0.005	A
KRT10	3858	genome.wustl.edu	37	17	38978560	38978560	+	Missense_Mutation	SNP	C	C	G			TCGA-36-2548-01A-01D-1526-09	TCGA-36-2548-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f0526795-f4e2-4362-8fd8-58f5b9fc6ee7	4f689ff8-b0ef-4495-af25-6f460f515b4f	g.chr17:38978560C>G	ENST00000269576.5	-	1	287	c.278G>C	c.(277-279)aGc>aCc	p.S93T	TMEM99_ENST00000496847.1_Intron|TMEM99_ENST00000301665.3_Intron	NM_000421.3	NP_000412	P13645	K1C10_HUMAN	keratin 10	93	Gly-rich.|Head.				cellular response to calcium ion (GO:0071277)|keratinocyte differentiation (GO:0030216)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of epidermis (GO:0030280)			NS(2)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)	11		Breast(137;0.000301)				CCCACCAAAGCTGCTACTTCC	0.592																																																0			17											92.0	98.0	96.0					17																	38978560		2203	4300	6503	36232086	SO:0001583	missense	3858			J04029	CCDS11377.1	17q21.2	2013-06-20	2008-08-01		ENSG00000186395	ENSG00000186395		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6413	protein-coding gene	gene with protein product	"""cytokeratin 10"", ""epidermolytic hyperkeratosis"""	148080	"""keratosis palmaris et plantaris"""	KPP		2461420, 16831889	Standard	NM_000421		Approved	K10, CK10	uc002hvi.3	P13645	OTTHUMG00000133368	ENST00000269576.5:c.278G>C	17.37:g.38978560C>G	ENSP00000269576:p.Ser93Thr		36232086	Q14664|Q8N175	Missense_Mutation	SNP	HMMPfam_Filament,superfamily_Prefoldin,PatternScan_IF	p.S93T	ENST00000269576.5	37	c.278	CCDS11377.1	17	.	.	.	.	.	.	.	.	.	.	C	9.963	1.223418	0.22457	.	.	ENSG00000186395	ENST00000269576	D	0.82255	-1.59	5.52	3.5	0.40072	.	0.167634	0.28946	N	0.013638	T	0.71953	0.3401	L	0.29908	0.895	0.80722	D	1	P	0.38922	0.651	B	0.35859	0.212	T	0.66316	-0.5954	10	0.26408	T	0.33	.	12.707	0.57065	0.1304:0.7443:0.1253:0.0	.	93	P13645	K1C10_HUMAN	T	93	ENSP00000269576:S93T	ENSP00000269576:S93T	S	-	2	0	KRT10	36232086	0.790000	0.28787	0.798000	0.32154	0.136000	0.21042	1.993000	0.40747	0.675000	0.31264	0.603000	0.83216	AGC	-	NULL		0.592	KRT10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT10	protein_coding	OTTHUMT00000257875.1	C	NM_000421		36232086	-1	no_errors	NM_000421	genbank	human	reviewed	54_36p	missense	SNP	0.492	G
CSF3R	1441	genome.wustl.edu	37	1	36938155	36938155	+	Missense_Mutation	SNP	C	C	T			TCGA-36-2548-01A-01D-1526-09	TCGA-36-2548-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f0526795-f4e2-4362-8fd8-58f5b9fc6ee7	4f689ff8-b0ef-4495-af25-6f460f515b4f	g.chr1:36938155C>T	ENST00000373106.1	-	7	1353	c.806G>A	c.(805-807)cGc>cAc	p.R269H	CSF3R_ENST00000331941.5_Missense_Mutation_p.R269H|CSF3R_ENST00000418048.2_Missense_Mutation_p.R269H|CSF3R_ENST00000487540.2_5'Flank|CSF3R_ENST00000338937.5_Missense_Mutation_p.R269H|CSF3R_ENST00000373104.1_Missense_Mutation_p.R269H|CSF3R_ENST00000361632.4_Missense_Mutation_p.R269H|CSF3R_ENST00000373103.1_Missense_Mutation_p.R269H|CSF3R_ENST00000440588.2_Missense_Mutation_p.R269H	NM_000760.3	NP_000751.1	Q99062	CSF3R_HUMAN	colony stimulating factor 3 receptor (granulocyte)	269	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|defense response (GO:0006952)|neutrophil chemotaxis (GO:0030593)|odontogenesis of dentin-containing tooth (GO:0042475)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	cytokine receptor activity (GO:0004896)|receptor activity (GO:0004872)			central_nervous_system(3)|endometrium(2)|kidney(3)|large_intestine(9)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)			Filgrastim(DB00099)|Pegfilgrastim(DB00019)	CGGCTTGTGGCGCAGCTCACA	0.672																																																0			1											36.0	37.0	36.0					1																	36938155		2196	4285	6481	36710742	SO:0001583	missense	1441			M59820	CCDS412.1, CCDS413.1, CCDS414.1	1p35-p34.3	2014-09-17			ENSG00000119535	ENSG00000119535		"""CD molecules"", ""Fibronectin type III domain containing"""	2439	protein-coding gene	gene with protein product		138971		CD114		1371413	Standard	NM_000760		Approved	GCSFR	uc001cax.2	Q99062	OTTHUMG00000008010	ENST00000373106.1:c.806G>A	1.37:g.36938155C>T	ENSP00000362198:p.Arg269His		36710742		Missense_Mutation	SNP	HMMPfam_Lep_receptor_Ig,superfamily_FN_III-like,HMMSmart_FN3,PatternScan_HEMATOPO_REC_L_F2,HMMPfam_fn3	p.R269H	ENST00000373106.1	37	c.806	CCDS413.1	1	.	.	.	.	.	.	.	.	.	.	C	14.99	2.700057	0.48307	.	.	ENSG00000119535	ENST00000373106;ENST00000373104;ENST00000373103;ENST00000361632;ENST00000331941;ENST00000418048;ENST00000338937;ENST00000440588	T;T;T;T;T;T;T;T	0.56776	0.44;0.44;0.44;0.44;0.44;0.44;0.44;0.44	4.88	3.94	0.45596	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.555420	0.19006	N	0.125202	T	0.70150	0.3191	M	0.81802	2.56	0.42207	D	0.991793	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.85130	0.983;0.993;0.976;0.997	T	0.72293	-0.4336	10	0.62326	D	0.03	-26.8968	9.0552	0.36401	0.0:0.8292:0.0:0.1708	.	269;269;269;269	E1B6W6;Q99062-3;Q99062;Q99062-4	.;.;CSF3R_HUMAN;.	H	269	ENSP00000362198:R269H;ENSP00000362196:R269H;ENSP00000362195:R269H;ENSP00000355406:R269H;ENSP00000332180:R269H;ENSP00000401588:R269H;ENSP00000345013:R269H;ENSP00000397568:R269H	ENSP00000332180:R269H	R	-	2	0	CSF3R	36710742	1.000000	0.71417	0.999000	0.59377	0.087000	0.18053	1.432000	0.34936	2.531000	0.85337	0.655000	0.94253	CGC	-	superfamily_FN_III-like,HMMSmart_FN3		0.672	CSF3R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSF3R	protein_coding	OTTHUMT00000021997.2	C	NM_156039		36710742	-1	no_errors	NM_156039	genbank	human	reviewed	54_36p	missense	SNP	0.998	T
FREM2	341640	genome.wustl.edu	37	13	39265898	39265898	+	Missense_Mutation	SNP	G	G	A			TCGA-36-2548-01A-01D-1526-09	TCGA-36-2548-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f0526795-f4e2-4362-8fd8-58f5b9fc6ee7	4f689ff8-b0ef-4495-af25-6f460f515b4f	g.chr13:39265898G>A	ENST00000280481.7	+	1	4633	c.4417G>A	c.(4417-4419)Gat>Aat	p.D1473N		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	1473					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		GGAATGCACGGATCAGCCTGG	0.473																																																0			13											98.0	79.0	85.0					13																	39265898		2203	4300	6503	38163898	SO:0001583	missense	341640			BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.4417G>A	13.37:g.39265898G>A	ENSP00000280481:p.Asp1473Asn		38163898	Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Missense_Mutation	SNP	HMMSmart_SM00237,HMMPfam_Calx-beta	p.D1473N	ENST00000280481.7	37	c.4417	CCDS31960.1	13	.	.	.	.	.	.	.	.	.	.	G	20.0	3.929743	0.73327	.	.	ENSG00000150893	ENST00000280481	T	0.26518	1.73	5.81	5.81	0.92471	.	0.046369	0.85682	D	0.000000	T	0.44477	0.1295	L	0.42245	1.32	0.80722	D	1	D	0.65815	0.995	D	0.64410	0.925	T	0.06917	-1.0800	10	0.42905	T	0.14	.	20.0825	0.97783	0.0:0.0:1.0:0.0	.	1473	Q5SZK8	FREM2_HUMAN	N	1473	ENSP00000280481:D1473N	ENSP00000280481:D1473N	D	+	1	0	FREM2	38163898	1.000000	0.71417	0.811000	0.32455	0.773000	0.43773	9.864000	0.99589	2.746000	0.94184	0.655000	0.94253	GAT	-	NULL		0.473	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FREM2	protein_coding	OTTHUMT00000044599.2	G	NM_207361		38163898	+1	no_errors	NM_207361	genbank	human	reviewed	54_36p	missense	SNP	0.997	A
PHF8	23133	genome.wustl.edu	37	X	53989292	53989292	+	Missense_Mutation	SNP	G	G	T			TCGA-36-2548-01A-01D-1526-09	TCGA-36-2548-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f0526795-f4e2-4362-8fd8-58f5b9fc6ee7	4f689ff8-b0ef-4495-af25-6f460f515b4f	g.chrX:53989292G>T	ENST00000357988.5	-	19	2990	c.2632C>A	c.(2632-2634)Cca>Aca	p.P878T	PHF8_ENST00000322659.8_Missense_Mutation_p.P825T|PHF8_ENST00000338154.6_Missense_Mutation_p.P842T|PHF8_ENST00000338946.6_Missense_Mutation_p.P741T	NM_001184896.1	NP_001171825.1	Q9UPP1	PHF8_HUMAN	PHD finger protein 8	878					brain development (GO:0007420)|G1/S transition of mitotic cell cycle (GO:0000082)|histone H3-K27 demethylation (GO:0071557)|histone H3-K36 demethylation (GO:0070544)|histone H3-K9 demethylation (GO:0033169)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of chromatin silencing at rDNA (GO:0061188)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone demethylase activity (GO:0032452)|histone demethylase activity (H3-K27 specific) (GO:0071558)|histone demethylase activity (H3-K36 specific) (GO:0051864)|histone demethylase activity (H3-K9 specific) (GO:0032454)|histone demethylase activity (H4-K20 specific) (GO:0035575)|iron ion binding (GO:0005506)|methylated histone binding (GO:0035064)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)			endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(7)|lung(10)|ovary(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	40						GGACTCCATGGAGCATCATCT	0.423																																																0			X											184.0	155.0	165.0					X																	53989292		2203	4300	6503	54006017	SO:0001583	missense	23133			AB029034	CCDS14355.1, CCDS55418.1, CCDS55419.1, CCDS55420.1	Xp11.22	2013-01-28			ENSG00000172943	ENSG00000172943		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	20672	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1F"""	300560				10470851, 20023638, 20644565	Standard	NM_015107		Approved	ZNF422, KIAA1111, JHDM1F	uc004dsu.3	Q9UPP1	OTTHUMG00000021622	ENST00000357988.5:c.2632C>A	X.37:g.53989292G>T	ENSP00000350676:p.Pro878Thr		54006017	B3KMV4|B7Z911|Q5H9U5|Q5JPR9|Q5JPS0|Q5JPS2|Q5JPS3|Q5VUJ4|Q7Z6D4|Q9HAH2	Missense_Mutation	SNP	superfamily_FYVE/PHD zinc finger,HMMSmart_SM00249,HMMPfam_PHD,PatternScan_EGF_2,PatternScan_ZF_PHD_1,superfamily_Clavaminate synthase-like,HMMSmart_SM00558,HMMPfam_JmjC	p.P842T	ENST00000357988.5	37	c.2524	CCDS55420.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.2|20.2	3.957817|3.957817	0.73902|0.73902	.|.	.|.	ENSG00000172943|ENSG00000172943	ENST00000357988;ENST00000338154;ENST00000338946;ENST00000396277;ENST00000322659|ENST00000443302	T;T;T;T|.	0.60040|.	0.22;0.22;0.22;0.22|.	5.47|5.47	5.47|5.47	0.80525|0.80525	.|.	0.062950|.	0.64402|.	D|.	0.000005|.	T|T	0.71333|0.71333	0.3327|0.3327	L|L	0.58510|0.58510	1.815|1.815	0.41185|0.41185	D|D	0.986264|0.986264	D;D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0;1.0|.	D;D;D;D;D|.	0.97110|.	1.0;0.998;0.994;0.996;0.996|.	T|T	0.70238|0.70238	-0.4927|-0.4927	10|5	0.87932|.	D|.	0|.	-9.9101|-9.9101	17.0575|17.0575	0.86539|0.86539	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	364;842;741;777;878|.	B3KMV4;Q9UPP1-2;B7Z911;Q9UPP1-3;Q9UPP1|.	.;.;.;.;PHF8_HUMAN|.	T|Y	878;842;741;771;825|605	ENSP00000350676:P878T;ENSP00000338868:P842T;ENSP00000340051:P741T;ENSP00000319473:P825T|.	ENSP00000319473:P825T|.	P|S	-|-	1|2	0|0	PHF8|PHF8	54006017|54006017	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.973000|0.973000	0.67179|0.67179	6.531000|6.531000	0.73820|0.73820	2.291000|2.291000	0.77112|0.77112	0.431000|0.431000	0.28591|0.28591	CCA|TCC	-	NULL		0.423	PHF8-001	KNOWN	basic|CCDS	protein_coding	PHF8	protein_coding	OTTHUMT00000056784.2	G	NM_015107		54006017	-1	no_errors	NM_015107	genbank	human	validated	54_36p	missense	SNP	1.000	T
GYS1	2997	genome.wustl.edu	37	19	49472860	49472860	+	Silent	SNP	C	C	A			TCGA-36-2548-01A-01D-1526-09	TCGA-36-2548-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f0526795-f4e2-4362-8fd8-58f5b9fc6ee7	4f689ff8-b0ef-4495-af25-6f460f515b4f	g.chr19:49472860C>A	ENST00000323798.3	-	16	2095	c.1899G>T	c.(1897-1899)ggG>ggT	p.G633G	GYS1_ENST00000263276.6_Silent_p.G569G|GYS1_ENST00000544287.1_Silent_p.G266G|GYS1_ENST00000541188.1_Silent_p.G553G	NM_002103.4	NP_002094.2	P13807	GYS1_HUMAN	glycogen synthase 1 (muscle)	633					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|heart development (GO:0007507)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|inclusion body (GO:0016234)|membrane (GO:0016020)	glucose binding (GO:0005536)|glycogen (starch) synthase activity (GO:0004373)|glycogen synthase activity, transferring glucose-1-phosphate (GO:0061547)|protein kinase binding (GO:0019901)			breast(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(5)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;8.64e-05)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000164)|all cancers(93;0.000226)|GBM - Glioblastoma multiforme(486;0.00561)|Epithelial(262;0.0286)		GGTAGCGGTACCCCTGGGCCT	0.672																																																0			19											26.0	16.0	19.0					19																	49472860		2099	4145	6244	54164672	SO:0001819	synonymous_variant	2997				CCDS12747.1, CCDS54292.1	19q13.3	2013-02-22			ENSG00000104812	ENSG00000104812	2.4.1.11	"""Glycosyltransferase group 1 domain containing"""	4706	protein-coding gene	gene with protein product		138570		GYS			Standard	NM_002103		Approved	GSY	uc002plp.3	P13807	OTTHUMG00000150723	ENST00000323798.3:c.1899G>T	19.37:g.49472860C>A			54164672	Q9BTT9	Silent	SNP	HMMPfam_Glycogen_syn,superfamily_SSF53756	p.G633	ENST00000323798.3	37	c.1899	CCDS12747.1	19																																																																																			-	HMMPfam_Glycogen_syn		0.672	GYS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GYS1	protein_coding	OTTHUMT00000319791.1	C	NM_002103		54164672	-1	no_errors	NM_002103	genbank	human	provisional	54_36p	silent	SNP	0.998	A
POLR2C	5432	genome.wustl.edu	37	16	57504969	57504969	+	Missense_Mutation	SNP	C	C	G			TCGA-36-2548-01A-01D-1526-09	TCGA-36-2548-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f0526795-f4e2-4362-8fd8-58f5b9fc6ee7	4f689ff8-b0ef-4495-af25-6f460f515b4f	g.chr16:57504969C>G	ENST00000219252.5	+	9	1104	c.766C>G	c.(766-768)Ctg>Gtg	p.L256V		NM_032940.2	NP_116558.1	P19387	RPB3_HUMAN	polymerase (RNA) II (DNA directed) polypeptide C, 33kDa	256					7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of viral transcription (GO:0050434)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, core complex (GO:0005665)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(2)|upper_aerodigestive_tract(1)	10						GAAGAAGAAACTGAGTGATTT	0.458																																																0			16											119.0	109.0	113.0					16																	57504969		2198	4300	6498	56062470	SO:0001583	missense	5432				CCDS10782.1	16q13-q21	2013-01-21	2002-08-29		ENSG00000102978	ENSG00000102978		"""RNA polymerase subunits"""	9189	protein-coding gene	gene with protein product	"""RNA polymerase II subunit 3"""	180663	"""polymerase (RNA) II (DNA directed) polypeptide C (33kD)"""			8034326	Standard	NM_032940		Approved	RPB3	uc002elt.1	P19387	OTTHUMG00000133464	ENST00000219252.5:c.766C>G	16.37:g.57504969C>G	ENSP00000219252:p.Leu256Val		56062470	O15161	Missense_Mutation	SNP	superfamily_RBP11-like subunits of RNA polymerase,HMMPfam_RNA_pol_L,HMMSmart_SM00662,PatternScan_RNA_POL_D_30KD,superfamily_Insert subdomain of RNA polymerase alpha subunit,HMMPfam_RNA_pol_A_bac,PatternScan_EF_HAND_1	p.L256V	ENST00000219252.5	37	c.766	CCDS10782.1	16	.	.	.	.	.	.	.	.	.	.	C	19.06	3.753679	0.69648	.	.	ENSG00000102978	ENST00000219252	D	0.85556	-2.0	5.59	3.3	0.37823	DNA-directed RNA polymerase, RpoA/D/Rpb3-type (1);DNA-directed RNA polymerase, dimerisation (1);DNA-directed RNA polymerase, RBP11-like (1);	0.067596	0.64402	D	0.000012	D	0.91140	0.7210	M	0.79805	2.47	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.90193	0.4251	10	0.36615	T	0.2	.	12.0057	0.53257	0.0:0.7889:0.0:0.2111	.	256	P19387	RPB3_HUMAN	V	256	ENSP00000219252:L256V	ENSP00000219252:L256V	L	+	1	2	POLR2C	56062470	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	1.479000	0.35453	1.360000	0.45960	0.655000	0.94253	CTG	-	superfamily_RBP11-like subunits of RNA polymerase,HMMPfam_RNA_pol_L,HMMSmart_SM00662		0.458	POLR2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR2C	protein_coding	OTTHUMT00000257340.3	C	NM_032940		56062470	+1	no_errors	NM_032940	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
KLK8	11202	genome.wustl.edu	37	19	51503501	51503501	+	Missense_Mutation	SNP	G	G	A			TCGA-36-2548-01A-01D-1526-09	TCGA-36-2548-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f0526795-f4e2-4362-8fd8-58f5b9fc6ee7	4f689ff8-b0ef-4495-af25-6f460f515b4f	g.chr19:51503501G>A	ENST00000600767.1	-	5	733	c.244C>T	c.(244-246)Cgc>Tgc	p.R82C	KLK8_ENST00000593490.1_Intron|KLK8_ENST00000291726.7_Missense_Mutation_p.R82C|KLK8_ENST00000347619.4_Intron|KLK8_ENST00000320838.5_Intron|KLK8_ENST00000598195.1_5'Flank|CTB-147C22.9_ENST00000594512.1_RNA|KLK8_ENST00000391806.2_Missense_Mutation_p.R127C			O60259	KLK8_HUMAN	kallikrein-related peptidase 8	82	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cell death (GO:0008219)|keratinocyte proliferation (GO:0043616)|memory (GO:0007613)|negative regulation of axon regeneration (GO:0048681)|negative regulation of myelination (GO:0031642)|neuron projection morphogenesis (GO:0048812)|regulation of synapse organization (GO:0050807)|response to wounding (GO:0009611)|synapse organization (GO:0050808)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	serine-type endopeptidase activity (GO:0004252)	p.R127C(1)		central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(8)|prostate(1)	15		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.0033)|GBM - Glioblastoma multiforme(134;0.00888)		TCTCCCAGGCGTACTGTGTAT	0.562																																																1	Substitution - Missense(1)	prostate(1)	19											171.0	173.0	173.0					19																	51503501		2203	4300	6503	56195313	SO:0001583	missense	11202			AB008390	CCDS12813.1, CCDS12814.1, CCDS12815.1, CCDS42600.1, CCDS74433.1	19q13	2011-09-07	2006-10-27			ENSG00000129455		"""Kallikreins"", ""Serine peptidases / Serine peptidases"""	6369	protein-coding gene	gene with protein product		605644	"""kallikrein 8 (neuropsin/ovasin)"""	PRSS19		10102990, 9714609, 16800724, 16800723	Standard	NM_144505		Approved	HNP, TADG14, neuropsin, ovasin	uc002pur.1	O60259		ENST00000600767.1:c.244C>T	19.37:g.51503501G>A	ENSP00000472016:p.Arg82Cys		56195313	Q5V9X1|Q5V9X2|Q8IW69|Q9HCB3|Q9NR68|Q9NR69|Q9UIL9|Q9UQ47	Missense_Mutation	SNP	superfamily_Pept_Ser_Cys,HMMSmart_Tryp_SPc,HMMPfam_Trypsin,PatternScan_TRYPSIN_HIS,PatternScan_TRYPSIN_SER	p.R127C	ENST00000600767.1	37	c.379	CCDS12813.1	19	.	.	.	.	.	.	.	.	.	.	G	15.53	2.861739	0.51482	.	.	ENSG00000129455	ENST00000391806;ENST00000291726	D;D	0.89810	-2.57;-2.57	5.02	5.02	0.67125	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.49305	D	0.000142	D	0.93363	0.7884	M	0.70108	2.13	0.80722	D	1	D;D	0.89917	0.968;1.0	P;D	0.76071	0.507;0.987	D	0.93651	0.6973	10	0.72032	D	0.01	.	13.707	0.62646	0.0:0.0:1.0:0.0	.	82;127	O60259;O60259-2	KLK8_HUMAN;.	C	127;82	ENSP00000375682:R127C;ENSP00000291726:R82C	ENSP00000291726:R82C	R	-	1	0	KLK8	56195313	0.993000	0.37304	0.722000	0.30670	0.413000	0.31143	4.125000	0.57931	2.592000	0.87571	0.655000	0.94253	CGC	-	superfamily_Pept_Ser_Cys,HMMSmart_Tryp_SPc,HMMPfam_Trypsin		0.562	KLK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLK8	protein_coding	OTTHUMT00000465032.2	G	NM_007196		56195313	-1	no_errors	NM_144505	genbank	human	reviewed	54_36p	missense	SNP	0.995	A
RNF111	54778	genome.wustl.edu	37	15	59344631	59344631	+	Splice_Site	SNP	G	G	T			TCGA-36-2548-01A-01D-1526-09	TCGA-36-2548-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f0526795-f4e2-4362-8fd8-58f5b9fc6ee7	4f689ff8-b0ef-4495-af25-6f460f515b4f	g.chr15:59344631G>T	ENST00000557998.1	+	3	1294		c.e3+1		RNF111_ENST00000348370.4_Splice_Site|RNF111_ENST00000561186.1_Splice_Site|RNF111_ENST00000559209.1_Splice_Site|RNF111_ENST00000434298.1_Splice_Site	NM_001270530.1	NP_001257459.1	Q6ZNA4	RN111_HUMAN	ring finger protein 111						gene expression (GO:0010467)|pattern specification process (GO:0007389)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|protein polyubiquitination (GO:0000209)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent SMAD protein catabolic process (GO:0030579)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	ligase activity (GO:0016874)|SUMO polymer binding (GO:0032184)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(11)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35				all cancers(107;0.194)		AAAGCTATCGGTGAGATTTTA	0.303																																					NSCLC(72;983 1365 10746 34387 47081)											0			15											82.0	75.0	77.0					15																	59344631		2192	4291	6483	57131923	SO:0001630	splice_region_variant	54778			AL157474	CCDS10169.1, CCDS58365.1, CCDS58366.1	15q21	2013-01-09			ENSG00000157450	ENSG00000157450		"""RING-type (C3HC4) zinc fingers"""	17384	protein-coding gene	gene with protein product		605840				11298452	Standard	NM_017610		Approved	ARK, Arkadia, FLJ38008, DKFZP761D081	uc002aft.4	Q6ZNA4	OTTHUMG00000132716	ENST00000557998.1:c.1007+1G>T	15.37:g.59344631G>T			57131923	C9JUS4|H0YN55|Q6P9A4|Q6ZMU2|Q7L428|Q7Z346|Q8N1P9|Q8WUA3|Q9NSR1	Splice_Site	SNP	-	e2+1	ENST00000557998.1	37	c.1007+1	CCDS58366.1	15	.	.	.	.	.	.	.	.	.	.	G	23.4	4.409548	0.83340	.	.	ENSG00000157450	ENST00000348370;ENST00000434298	.	.	.	5.47	5.47	0.80525	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.3248	0.94258	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RNF111	57131923	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	8.748000	0.91615	2.554000	0.86153	0.514000	0.50259	.	-	-		0.303	RNF111-003	KNOWN	basic|CCDS	protein_coding	RNF111	protein_coding	OTTHUMT00000416012.1	G	NM_017610	Intron	57131923	+1	no_errors	NM_017610	genbank	human	reviewed	54_36p	splice_site	SNP	1.000	T
MIR7162	102466227	genome.wustl.edu	37	15	62544849	62544849	+	IGR	SNP	A	A	G	rs554871780		TCGA-36-2548-01A-01D-1526-09	TCGA-36-2548-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f0526795-f4e2-4362-8fd8-58f5b9fc6ee7	4f689ff8-b0ef-4495-af25-6f460f515b4f	g.chr15:62544849A>G								hsa-mir-7162 (3855 upstream) : RP11-299H22.5 (10593 downstream)																							GAAGTTCCTCAGAAACAACGC	0.522																																																0			15																																								60332141	SO:0001628	intergenic_variant	255180																															15.37:g.62544849A>G			60332141		RNA	SNP	-	NULL		37	NULL		15																																																																																			-	-	0	0.522					FLJ38723			A			60332141	-1	no_errors	XR_041381	genbank	human	model	54_36p	rna	SNP	0.947	G
TMEM109	79073	genome.wustl.edu	37	11	60687260	60687260	+	Missense_Mutation	SNP	T	T	G			TCGA-36-2548-01A-01D-1526-09	TCGA-36-2548-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f0526795-f4e2-4362-8fd8-58f5b9fc6ee7	4f689ff8-b0ef-4495-af25-6f460f515b4f	g.chr11:60687260T>G	ENST00000227525.3	+	2	498	c.95T>G	c.(94-96)tTg>tGg	p.L32W	TMEM109_ENST00000536171.1_Missense_Mutation_p.L32W|RP11-881M11.4_ENST00000543907.1_RNA	NM_024092.2	NP_076997.1	Q9BVC6	TM109_HUMAN	transmembrane protein 109	32					cellular response to gamma radiation (GO:0071480)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|negative regulation of cell death (GO:0060548)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)				central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(1)|ovary(1)|skin(1)	8						CACTCAGCATTGGCCCAGTCC	0.552																																																0			11											161.0	134.0	143.0					11																	60687260		2203	4299	6502	60443836	SO:0001583	missense	79073				CCDS7996.1	11q12.2	2005-12-22				ENSG00000110108			28771	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_024092		Approved	MGC5508	uc001nqg.3	Q9BVC6		ENST00000227525.3:c.95T>G	11.37:g.60687260T>G	ENSP00000227525:p.Leu32Trp		60443836		Missense_Mutation	SNP	NULL	p.L32W	ENST00000227525.3	37	c.95	CCDS7996.1	11	.	.	.	.	.	.	.	.	.	.	T	13.25	2.181654	0.38511	.	.	ENSG00000110108	ENST00000227525;ENST00000446886;ENST00000536171	.	.	.	5.34	-0.712	0.11226	.	1.013530	0.07927	N	0.976861	T	0.34919	0.0914	L	0.39898	1.24	0.09310	N	1	P	0.50156	0.932	P	0.49421	0.61	T	0.31138	-0.9954	9	0.66056	D	0.02	0.3433	5.9665	0.19328	0.0:0.4117:0.1795:0.4088	.	32	Q9BVC6	TM109_HUMAN	W	32	.	ENSP00000227525:L32W	L	+	2	0	TMEM109	60443836	0.000000	0.05858	0.000000	0.03702	0.367000	0.29736	-0.301000	0.08232	-0.042000	0.13535	-0.468000	0.05107	TTG	-	NULL		0.552	TMEM109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM109	protein_coding	OTTHUMT00000396343.1	T	NM_024092		60443836	+1	no_errors	NM_024092	genbank	human	validated	54_36p	missense	SNP	0.000	G
ZNF530	348327	genome.wustl.edu	37	19	58117973	58117973	+	Silent	SNP	T	T	C			TCGA-36-2548-01A-01D-1526-09	TCGA-36-2548-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f0526795-f4e2-4362-8fd8-58f5b9fc6ee7	4f689ff8-b0ef-4495-af25-6f460f515b4f	g.chr19:58117973T>C	ENST00000332854.6	+	3	1300	c.1080T>C	c.(1078-1080)ttT>ttC	p.F360F	ZNF530_ENST00000597864.1_Intron	NM_020880.3	NP_065931.3	Q6P9A1	ZN530_HUMAN	zinc finger protein 530	360					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(6)|skin(1)	20		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0443)|Breast(46;0.0848)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		GAAAATCCTTTAGCCATAGCA	0.448																																																0			19											106.0	101.0	103.0					19																	58117973		2203	4300	6503	62809785	SO:0001819	synonymous_variant	348327			AK096831	CCDS12955.1	19q13.43	2013-01-08				ENSG00000183647		"""Zinc fingers, C2H2-type"", ""-"""	29297	protein-coding gene	gene with protein product						10819331	Standard	NM_020880		Approved	KIAA1508	uc002qpk.2	Q6P9A1		ENST00000332854.6:c.1080T>C	19.37:g.58117973T>C			62809785	O43340|Q9P220	Silent	SNP	superfamily_Krueppel-associated_box,HMMPfam_KRAB,HMMSmart_KRAB,superfamily_SSF57667,HMMPfam_zf-C2H2,HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1	p.F360	ENST00000332854.6	37	c.1080	CCDS12955.1	19																																																																																			-	superfamily_SSF57667,HMMPfam_zf-C2H2,HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1		0.448	ZNF530-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF530	protein_coding	OTTHUMT00000466797.1	T	NM_020880		62809785	+1	no_errors	NM_020880	genbank	human	validated	54_36p	silent	SNP	0.656	C
ABCA9	10350	genome.wustl.edu	37	17	67024708	67024708	+	Missense_Mutation	SNP	T	T	C			TCGA-36-2548-01A-01D-1526-09	TCGA-36-2548-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f0526795-f4e2-4362-8fd8-58f5b9fc6ee7	4f689ff8-b0ef-4495-af25-6f460f515b4f	g.chr17:67024708T>C	ENST00000340001.4	-	12	1794	c.1583A>G	c.(1582-1584)aAc>aGc	p.N528S	ABCA9_ENST00000453985.2_Missense_Mutation_p.N528S|ABCA9_ENST00000370732.2_Missense_Mutation_p.N528S	NM_080283.3	NP_525022.2	Q8IUA7	ABCA9_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 9	528	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			NS(2)|breast(4)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(21)|lung(35)|ovary(4)|prostate(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	91	Breast(10;1.47e-12)					ACTAAGTATGTTTAACAGGGT	0.383																																																0			17											116.0	108.0	111.0					17																	67024708		2203	4300	6503	64536303	SO:0001583	missense	10350			AF423307	CCDS11681.1	17q24	2012-03-14			ENSG00000154258	ENSG00000154258		"""ATP binding cassette transporters / subfamily A"""	39	protein-coding gene	gene with protein product		612507					Standard	XM_005256934		Approved	EST640918	uc002jhu.3	Q8IUA7	OTTHUMG00000140371	ENST00000340001.4:c.1583A>G	17.37:g.67024708T>C	ENSP00000342216:p.Asn528Ser		64536303	Q6P655|Q8N2S4|Q8WWZ5|Q96MD8	Missense_Mutation	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00382,HMMPfam_ABC_tran	p.N528S	ENST00000340001.4	37	c.1583	CCDS11681.1	17	.	.	.	.	.	.	.	.	.	.	T	18.49	3.635208	0.67130	.	.	ENSG00000154258	ENST00000340001;ENST00000453985;ENST00000370732;ENST00000453749	T;T	0.39787	1.06;1.06	5.13	5.13	0.70059	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.130764	0.33290	N	0.005061	T	0.42381	0.1200	N	0.15975	0.35	0.32671	N	0.516849	P;P	0.52061	0.939;0.95	P;P	0.59546	0.721;0.859	T	0.51872	-0.8650	10	0.31617	T	0.26	.	14.0374	0.64654	0.0:0.0:0.0:1.0	.	528;528	Q8IUA7-3;Q8IUA7	.;ABCA9_HUMAN	S	528;511;528;523	ENSP00000342216:N528S;ENSP00000359767:N528S	ENSP00000342216:N528S	N	-	2	0	ABCA9	64536303	1.000000	0.71417	0.029000	0.17559	0.901000	0.52897	7.120000	0.77153	2.061000	0.61500	0.482000	0.46254	AAC	-	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00382,HMMPfam_ABC_tran		0.383	ABCA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA9	protein_coding	OTTHUMT00000277072.2	T	NM_172386		64536303	-1	no_errors	NM_080283	genbank	human	reviewed	54_36p	missense	SNP	0.972	C
SGTB	54557	genome.wustl.edu	37	5	64966090	64966090	+	Missense_Mutation	SNP	C	C	T			TCGA-36-2548-01A-01D-1526-09	TCGA-36-2548-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f0526795-f4e2-4362-8fd8-58f5b9fc6ee7	4f689ff8-b0ef-4495-af25-6f460f515b4f	g.chr5:64966090C>T	ENST00000381007.4	-	11	1133	c.898G>A	c.(898-900)Gct>Act	p.A300T		NM_019072.2	NP_061945.1	Q96EQ0	SGTB_HUMAN	small glutamine-rich tetratricopeptide repeat (TPR)-containing, beta	300										large_intestine(3)|lung(3)|skin(3)	9		Lung NSC(167;3.24e-06)|Prostate(74;0.0138)|Ovarian(174;0.0545)|Breast(144;0.174)|Colorectal(97;0.234)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0657)|Lung(70;0.00487)		TGCTCTTCAGCGCTGCTGCTG	0.458																																																0			5											159.0	151.0	153.0					5																	64966090		2203	4300	6503	65001846	SO:0001583	missense	54557			AK096321	CCDS3988.1	5q12.3	2013-01-10			ENSG00000197860	ENSG00000197860		"""Tetratricopeptide (TTC) repeat domain containing"""	23567	protein-coding gene	gene with protein product						12477932	Standard	XM_005248548		Approved	Sgt2, FLJ39002	uc003jud.3	Q96EQ0	OTTHUMG00000097801	ENST00000381007.4:c.898G>A	5.37:g.64966090C>T	ENSP00000370395:p.Ala300Thr		65001846		Missense_Mutation	SNP	superfamily_SSF48452,HMMPfam_TPR_1,HMMSmart_TPR	p.A300T	ENST00000381007.4	37	c.898	CCDS3988.1	5	.	.	.	.	.	.	.	.	.	.	C	10.87	1.473292	0.26423	.	.	ENSG00000197860	ENST00000381007	T	0.60548	0.18	5.64	-4.93	0.03066	.	0.561068	0.19431	N	0.114436	T	0.25382	0.0617	N	0.03324	-0.35	0.35896	D	0.830001	B	0.06786	0.001	B	0.01281	0.0	T	0.28138	-1.0053	10	0.10111	T	0.7	-3.2663	12.7727	0.57429	0.0:0.4162:0.0:0.5838	.	300	Q96EQ0	SGTB_HUMAN	T	300	ENSP00000370395:A300T	ENSP00000370395:A300T	A	-	1	0	SGTB	65001846	0.960000	0.32886	0.015000	0.15790	0.996000	0.88848	0.720000	0.25896	-0.959000	0.03618	-0.300000	0.09419	GCT	-	NULL		0.458	SGTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SGTB	protein_coding	OTTHUMT00000215057.2	C	NM_019072		65001846	-1	no_errors	NM_019072	genbank	human	validated	54_36p	missense	SNP	0.997	T
CTNNA3	29119	genome.wustl.edu	37	10	67829111	67829111	+	Missense_Mutation	SNP	G	G	T			TCGA-36-2548-01A-01D-1526-09	TCGA-36-2548-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f0526795-f4e2-4362-8fd8-58f5b9fc6ee7	4f689ff8-b0ef-4495-af25-6f460f515b4f	g.chr10:67829111G>T	ENST00000433211.2	-	15	2288	c.2114C>A	c.(2113-2115)gCc>gAc	p.A705D	CTNNA3_ENST00000373735.1_5'UTR|CTNNA3_ENST00000373744.4_Missense_Mutation_p.A705D	NM_013266.2	NP_037398.2			catenin (cadherin-associated protein), alpha 3											breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|liver(1)|lung(50)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|stomach(1)|urinary_tract(1)	95						CATGTTCTTGGCCAGAACAAT	0.368																																																0			10											263.0	225.0	238.0					10																	67829111		2203	4300	6503	67499117	SO:0001583	missense	29119			AF091606	CCDS7269.1	10q21	2006-11-24			ENSG00000183230	ENSG00000183230			2511	protein-coding gene	gene with protein product		607667				12596047, 11590244	Standard	XM_005269717		Approved	VR22, MGC26194	uc001jmw.2	Q9UI47	OTTHUMG00000018334	ENST00000433211.2:c.2114C>A	10.37:g.67829111G>T	ENSP00000389714:p.Ala705Asp		67499117		Missense_Mutation	SNP	HMMPfam_Vinculin,superfamily_alpha-catenin/vinculin	p.A705D	ENST00000433211.2	37	c.2114	CCDS7269.1	10	.	.	.	.	.	.	.	.	.	.	G	26.3	4.720009	0.89205	.	.	ENSG00000183230	ENST00000433211;ENST00000373744;ENST00000373735	T;T;T	0.70986	-0.53;-0.53;-0.53	5.29	5.29	0.74685	.	0.000000	0.53938	D	0.000056	D	0.86602	0.5972	M	0.90252	3.1	0.80722	D	1	D	0.76494	0.999	D	0.70487	0.969	D	0.89382	0.3682	10	0.87932	D	0	-9.2287	16.4194	0.83753	0.0:0.0:1.0:0.0	.	705	Q9UI47	CTNA3_HUMAN	D	705;705;44	ENSP00000389714:A705D;ENSP00000362849:A705D;ENSP00000362840:A44D	ENSP00000362840:A44D	A	-	2	0	CTNNA3	67499117	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.492000	0.97957	2.483000	0.83821	0.591000	0.81541	GCC	-	HMMPfam_Vinculin,superfamily_alpha-catenin/vinculin		0.368	CTNNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTNNA3	protein_coding	OTTHUMT00000048282.2	G	NM_013266		67499117	-1	no_errors	NM_013266	genbank	human	validated	54_36p	missense	SNP	1.000	T
MYO5BP3	441442	genome.wustl.edu	37	9	68357375	68357375	+	IGR	SNP	G	G	A	rs113072271		TCGA-36-2548-01A-01D-1526-09	TCGA-36-2548-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f0526795-f4e2-4362-8fd8-58f5b9fc6ee7	4f689ff8-b0ef-4495-af25-6f460f515b4f	g.chr9:68357375G>A								RP11-149F8.5 (16731 upstream) : RP11-764K9.1 (40502 downstream)																							CATGTGCTTGGCATCTAATAG	0.428																																																0			9																																								67847195	SO:0001628	intergenic_variant	0																															9.37:g.68357375G>A			67847195		RNA	SNP	-	NULL		37	NULL		9																																																																																			-	-	0	0.428					LOC441442			G			67847195	-1	pseudogene	XR_037084	genbank	human	model	54_36p	rna	SNP	0.998	A
NEO1	4756	genome.wustl.edu	37	15	73408959	73408959	+	Missense_Mutation	SNP	T	T	C			TCGA-36-2548-01A-01D-1526-09	TCGA-36-2548-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f0526795-f4e2-4362-8fd8-58f5b9fc6ee7	4f689ff8-b0ef-4495-af25-6f460f515b4f	g.chr15:73408959T>C	ENST00000339362.5	+	3	656	c.209T>C	c.(208-210)gTt>gCt	p.V70A	NEO1_ENST00000261908.6_Missense_Mutation_p.V70A|NEO1_ENST00000558964.1_Missense_Mutation_p.V70A|NEO1_ENST00000560262.1_Missense_Mutation_p.V70A			Q92859	NEO1_HUMAN	neogenin 1	70	Ig-like C2-type 1.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|iron ion homeostasis (GO:0055072)|muscle cell differentiation (GO:0042692)|myoblast fusion (GO:0007520)|positive regulation of muscle cell differentiation (GO:0051149)|regulation of transcription, DNA-templated (GO:0006355)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(9)|lung(26)|pancreas(2)|prostate(1)|skin(3)|urinary_tract(2)	57						GGCTCTTCTGTTATATTAAAC	0.373																																																0			15											74.0	79.0	77.0					15																	73408959		2198	4297	6495	71196012	SO:0001583	missense	4756			U61262	CCDS10247.1, CCDS53957.1, CCDS58378.1	15q22.3-q23	2014-06-20	2010-06-24		ENSG00000067141	ENSG00000067141		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7754	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 2"""	601907	"""neogenin (chicken) homolog 1"""			9121761	Standard	NM_002499		Approved	NGN, HsT17534, IGDCC2, NTN1R2	uc002avm.4	Q92859	OTTHUMG00000133509	ENST00000339362.5:c.209T>C	15.37:g.73408959T>C	ENSP00000341198:p.Val70Ala		71196012	B7ZKM9|B7ZKN0|O00340|Q17RX1	Missense_Mutation	SNP	PatternScan_TONB_DEPENDENT_REC_1,HMMPfam_I-set,superfamily_Immunoglobulin,HMMSmart_SM00409,HMMSmart_SM00408,superfamily_Fibronectin type III,HMMSmart_SM00060,HMMPfam_fn3,HMMPfam_Neogenin_C	p.V70A	ENST00000339362.5	37	c.209	CCDS10247.1	15	.	.	.	.	.	.	.	.	.	.	T	12.70	2.016497	0.35606	.	.	ENSG00000067141	ENST00000339362;ENST00000261908	T;T	0.16457	2.34;2.34	5.93	4.81	0.61882	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.110223	0.64402	D	0.000008	T	0.10937	0.0267	N	0.21373	0.66	0.53005	D	0.999967	B;B;B	0.16396	0.011;0.017;0.012	B;B;B	0.28139	0.044;0.058;0.086	T	0.13683	-1.0500	10	0.10902	T	0.67	-10.767	7.9061	0.29763	0.0:0.0681:0.1389:0.7929	.	70;70;70	B7ZKM9;B7ZKN0;Q92859	.;.;NEO1_HUMAN	A	70	ENSP00000341198:V70A;ENSP00000261908:V70A	ENSP00000261908:V70A	V	+	2	0	NEO1	71196012	0.998000	0.40836	0.961000	0.40146	0.975000	0.68041	3.022000	0.49659	1.058000	0.40530	0.482000	0.46254	GTT	-	HMMPfam_I-set,superfamily_Immunoglobulin,HMMSmart_SM00409,HMMSmart_SM00408		0.373	NEO1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NEO1	protein_coding	OTTHUMT00000257472.2	T	NM_002499		71196012	+1	no_errors	NM_002499	genbank	human	validated	54_36p	missense	SNP	0.989	C
DBF4	10926	genome.wustl.edu	37	7	87514430	87514430	+	Missense_Mutation	SNP	C	C	A			TCGA-36-2548-01A-01D-1526-09	TCGA-36-2548-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f0526795-f4e2-4362-8fd8-58f5b9fc6ee7	4f689ff8-b0ef-4495-af25-6f460f515b4f	g.chr7:87514430C>A	ENST00000265728.1	+	3	860	c.356C>A	c.(355-357)cCt>cAt	p.P119H		NM_006716.3	NP_006707.1	Q9UBU7	DBF4A_HUMAN	DBF4 zinc finger	119	BRCT 1.				DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|positive regulation of catalytic activity (GO:0043085)	nucleoplasm (GO:0005654)	enzyme activator activity (GO:0008047)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(1)|large_intestine(6)|lung(13)|ovary(1)|skin(3)	28	Esophageal squamous(14;0.00202)	Breast(660;0.0334)				ACCACTTCACCTCATCCCAGC	0.408																																																0			7											79.0	76.0	77.0					7																	87514430		2203	4300	6503	87352366	SO:0001583	missense	10926			AF160876	CCDS5611.1	7q21.3	2014-02-17	2014-02-17		ENSG00000006634	ENSG00000006634		"""Zinc fingers, DBF-type"""	17364	protein-coding gene	gene with protein product	"""activator of S phase kinase"", ""chiffon homolog (Drosophila)"", ""zinc finger, DBF-type containing 1"", ""DBF4 zinc finger A"""	604281	"""DBF4 homolog (S. cerevisiae)"""			10373557, 10517317	Standard	NM_006716		Approved	ASK, chif, ZDBF1, DBF4A	uc003ujf.1	Q9UBU7	OTTHUMG00000131034	ENST00000265728.1:c.356C>A	7.37:g.87514430C>A	ENSP00000265728:p.Pro119His		87352366	A4D1D8|A8K954|O75226|Q75MS6|Q75N01|Q9Y2M6	Missense_Mutation	SNP	HMMPfam_zf-DBF,HMMSmart_SM00586	p.P119H	ENST00000265728.1	37	c.356	CCDS5611.1	7	.	.	.	.	.	.	.	.	.	.	C	23.5	4.419810	0.83559	.	.	ENSG00000006634	ENST00000265728	T	0.12039	2.72	5.43	5.43	0.79202	BRCT (1);	0.228496	0.41097	D	0.000946	T	0.37320	0.0999	M	0.62723	1.935	0.51767	D	0.999932	D	0.89917	1.0	D	0.77557	0.99	T	0.03555	-1.1025	10	0.54805	T	0.06	-12.9515	19.2432	0.93891	0.0:1.0:0.0:0.0	.	119	Q9UBU7	DBF4A_HUMAN	H	119	ENSP00000265728:P119H	ENSP00000265728:P119H	P	+	2	0	DBF4	87352366	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.429000	0.59901	2.550000	0.86006	0.591000	0.81541	CCT	-	NULL		0.408	DBF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DBF4	protein_coding	OTTHUMT00000253678.1	C	NM_006716		87352366	+1	no_errors	NM_006716	genbank	human	validated	54_36p	missense	SNP	1.000	A
ANKRD11	29123	genome.wustl.edu	37	16	89346163	89346163	+	Missense_Mutation	SNP	G	G	A	rs76793093	byFrequency	TCGA-36-2548-01A-01D-1526-09	TCGA-36-2548-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f0526795-f4e2-4362-8fd8-58f5b9fc6ee7	4f689ff8-b0ef-4495-af25-6f460f515b4f	g.chr16:89346163G>A	ENST00000301030.4	-	9	7247	c.6787C>T	c.(6787-6789)Ccc>Tcc	p.P2263S	ANKRD11_ENST00000378330.2_Missense_Mutation_p.P2263S	NM_001256183.1|NM_013275.5	NP_001243112.1|NP_037407.4	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11	2263	Pro-rich.				bone development (GO:0060348)|face morphogenesis (GO:0060325)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|odontogenesis of dentin-containing tooth (GO:0042475)|skeletal system morphogenesis (GO:0048705)|tissue homeostasis (GO:0001894)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|central_nervous_system(3)|endometrium(17)|kidney(2)|large_intestine(18)|lung(20)|ovary(6)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	83		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		GCGGCGGGGGGGCCTTCAGCC	0.746													G|||	152	0.0303514	0.0008	0.0245	5008	,	,		8789	0.0744		0.0507	False		,,,				2504	0.0082															0			16						G	SER/PRO	14,2982		0,14,1484	2.0	3.0	2.0		6787	1.3	0.0	16	dbSNP_131	2	121,6295		0,121,3087	no	missense	ANKRD11	NM_013275.4	74	0,135,4571	AA,AG,GG		1.8859,0.4673,1.4343	probably-damaging	2263/2664	89346163	135,9277	1498	3208	4706	87873664	SO:0001583	missense	29123			AY373756	CCDS32513.1	16q24.3	2013-01-10				ENSG00000167522		"""Ankyrin repeat domain containing"""	21316	protein-coding gene	gene with protein product		611192				11483580	Standard	NM_001256182		Approved	LZ16, T13	uc002fnc.2	Q6UB99		ENST00000301030.4:c.6787C>T	16.37:g.89346163G>A	ENSP00000301030:p.Pro2263Ser		87873664	Q6NTG1|Q6QMF8	Missense_Mutation	SNP	superfamily_Ankyrin repeat,HMMSmart_SM00248,HMMPfam_Ank	p.P2263S	ENST00000301030.4	37	c.6787	CCDS32513.1	16	90	0.04120879120879121	0	0.0	6	0.016574585635359115	36	0.06293706293706294	48	0.0633245382585752	g	12.09	1.833606	0.32421	0.004673	0.018859	ENSG00000167522	ENST00000301030;ENST00000378330	T;T	0.35789	1.29;1.29	4.96	1.28	0.21552	.	1.399020	0.04740	N	0.422636	T	0.01870	0.0059	N	0.12182	0.205	0.09310	N	0.999999	B	0.09022	0.002	B	0.04013	0.001	T	0.14282	-1.0478	10	0.13853	T	0.58	.	2.8329	0.05505	0.2569:0.1312:0.4795:0.1325	.	2263	Q6UB99	ANR11_HUMAN	S	2263	ENSP00000301030:P2263S;ENSP00000367581:P2263S	ENSP00000301030:P2263S	P	-	1	0	ANKRD11	87873664	0.006000	0.16342	0.000000	0.03702	0.000000	0.00434	0.923000	0.28757	0.141000	0.18875	-1.568000	0.00874	CCC	-	NULL		0.746	ANKRD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD11	protein_coding	OTTHUMT00000430462.3	G	NM_013275		87873664	-1	no_errors	NM_013275	genbank	human	validated	54_36p	missense	SNP	0.000	A
CATSPERB	79820	genome.wustl.edu	37	14	92076841	92076841	+	Missense_Mutation	SNP	G	G	C			TCGA-36-2548-01A-01D-1526-09	TCGA-36-2548-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f0526795-f4e2-4362-8fd8-58f5b9fc6ee7	4f689ff8-b0ef-4495-af25-6f460f515b4f	g.chr14:92076841G>C	ENST00000256343.3	-	21	2737	c.2581C>G	c.(2581-2583)Ctc>Gtc	p.L861V		NM_024764.2	NP_079040.2	Q9H7T0	CTSRB_HUMAN	catsper channel auxiliary subunit beta	861					cell differentiation (GO:0030154)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|cilium (GO:0005929)|plasma membrane (GO:0005886)				NS(1)|breast(4)|central_nervous_system(1)|kidney(3)|large_intestine(15)|liver(1)|lung(12)|ovary(2)|pancreas(1)|prostate(3)|skin(9)|urinary_tract(2)	54		all_cancers(154;0.0663)|all_epithelial(191;0.236)				GTTTTGATGAGGTTAAAACCC	0.363																																																0			14											64.0	65.0	65.0					14																	92076841		2203	4300	6503	91146594	SO:0001583	missense	79820			AK024360	CCDS32142.1	14q32.12	2012-02-22	2012-02-22	2007-10-18	ENSG00000133962	ENSG00000133962			20500	protein-coding gene	gene with protein product		611169	"""chromosome 14 open reading frame 161"", ""cation channel, sperm-associated, beta"""	C14orf161		17478420	Standard	NM_024764		Approved	FLJ14298	uc001xzs.1	Q9H7T0	OTTHUMG00000171118	ENST00000256343.3:c.2581C>G	14.37:g.92076841G>C	ENSP00000256343:p.Leu861Val		91146594	A0AV51	Missense_Mutation	SNP	NULL	p.L861V	ENST00000256343.3	37	c.2581	CCDS32142.1	14	.	.	.	.	.	.	.	.	.	.	G	13.25	2.180744	0.38511	.	.	ENSG00000133962	ENST00000256343	T	0.46819	0.86	5.75	-1.11	0.09840	.	0.730389	0.12239	N	0.486673	T	0.36908	0.0984	L	0.34521	1.04	0.09310	N	0.999999	B	0.33171	0.4	B	0.30855	0.121	T	0.14839	-1.0458	10	0.51188	T	0.08	-2.8086	16.1716	0.81820	0.0:0.0:0.7301:0.2699	.	861	Q9H7T0	CTSRB_HUMAN	V	861	ENSP00000256343:L861V	ENSP00000256343:L861V	L	-	1	0	CATSPERB	91146594	0.009000	0.17119	0.834000	0.33040	0.562000	0.35680	-0.445000	0.06845	-0.431000	0.07307	0.563000	0.77884	CTC	-	NULL		0.363	CATSPERB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CATSPERB	protein_coding	OTTHUMT00000411769.1	G	NM_024764		91146594	-1	no_errors	NM_024764	genbank	human	validated	54_36p	missense	SNP	0.701	C
GATAD1	57798	genome.wustl.edu	37	7	92078169	92078169	+	Missense_Mutation	SNP	G	G	A			TCGA-36-2548-01A-01D-1526-09	TCGA-36-2548-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f0526795-f4e2-4362-8fd8-58f5b9fc6ee7	4f689ff8-b0ef-4495-af25-6f460f515b4f	g.chr7:92078169G>A	ENST00000287957.3	+	2	630	c.353G>A	c.(352-354)aGa>aAa	p.R118K		NM_021167.4	NP_066990.3	Q8WUU5	GATD1_HUMAN	GATA zinc finger domain containing 1	118						nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|lung(3)	6	all_cancers(62;1.63e-10)|all_epithelial(64;8.33e-10)|Breast(17;0.00311)|all_lung(186;0.0498)|Lung NSC(181;0.0676)		STAD - Stomach adenocarcinoma(171;4.51e-05)|GBM - Glioblastoma multiforme(5;8.83e-05)|all cancers(6;0.000136)|Lung(22;0.123)|Epithelial(20;0.179)|LUSC - Lung squamous cell carcinoma(200;0.225)			AAAGGGAGAAGACATATATTT	0.408																																																0			7											67.0	73.0	71.0					7																	92078169		2203	4300	6503	91916105	SO:0001583	missense	57798				CCDS5625.1	7q21-q22	2014-09-17			ENSG00000157259	ENSG00000157259		"""GATA zinc finger domain containing"""	29941	protein-coding gene	gene with protein product	"""ocular development associated gene"""	614518				12062807	Standard	NM_021167		Approved	ODAG, RG083M05.2, FLJ22489	uc003ulx.2	Q8WUU5	OTTHUMG00000131201	ENST00000287957.3:c.353G>A	7.37:g.92078169G>A	ENSP00000287957:p.Arg118Lys		91916105	B2RE37|D6W5Q5|Q8N5Y5|Q99995|Q9H689	Missense_Mutation	SNP	superfamily_Glucocorticoid receptor-like (DNA-binding domain),HMMPfam_GATA	p.R118K	ENST00000287957.3	37	c.353	CCDS5625.1	7	.	.	.	.	.	.	.	.	.	.	G	31	5.090686	0.94149	.	.	ENSG00000157259	ENST00000287957	T	0.62788	-0.0	5.58	4.7	0.59300	.	0.000000	0.85682	D	0.000000	T	0.65852	0.2731	M	0.82823	2.61	0.80722	D	1	B	0.29766	0.256	B	0.27076	0.076	T	0.69928	-0.5012	10	0.87932	D	0	-9.8871	14.6806	0.69015	0.0698:0.0:0.9302:0.0	.	118	Q8WUU5	GATD1_HUMAN	K	118	ENSP00000287957:R118K	ENSP00000287957:R118K	R	+	2	0	GATAD1	91916105	1.000000	0.71417	1.000000	0.80357	0.586000	0.36452	9.213000	0.95133	1.510000	0.48803	0.460000	0.39030	AGA	-	NULL		0.408	GATAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GATAD1	protein_coding	OTTHUMT00000253929.2	G	NM_021167		91916105	+1	no_errors	NM_021167	genbank	human	validated	54_36p	missense	SNP	1.000	A
CNGA3	1261	genome.wustl.edu	37	2	99013338	99013338	+	Missense_Mutation	SNP	C	C	T			TCGA-36-2548-01A-01D-1526-09	TCGA-36-2548-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f0526795-f4e2-4362-8fd8-58f5b9fc6ee7	4f689ff8-b0ef-4495-af25-6f460f515b4f	g.chr2:99013338C>T	ENST00000272602.2	+	7	1744	c.1705C>T	c.(1705-1707)Cgc>Tgc	p.R569C	CNGA3_ENST00000393504.1_Missense_Mutation_p.R569C|CNGA3_ENST00000409937.1_Missense_Mutation_p.R573C|CNGA3_ENST00000436404.2_Missense_Mutation_p.R551C			Q16281	CNGA3_HUMAN	cyclic nucleotide gated channel alpha 3	569			R -> H (in ACHM2). {ECO:0000269|PubMed:11536077, ECO:0000269|PubMed:14757870}.		cation transport (GO:0006812)|phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|response to cAMP (GO:0051591)|response to corticosteroid (GO:0031960)|response to magnesium ion (GO:0032026)|retinal cone cell development (GO:0046549)|signal transduction (GO:0007165)|transport (GO:0006810)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|perikaryon (GO:0043204)|photoreceptor outer segment membrane (GO:0042622)|transmembrane transporter complex (GO:1902495)	cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|ligand-gated ion channel activity (GO:0015276)|voltage-gated potassium channel activity (GO:0005249)	p.R569C(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(10)|lung(17)|ovary(5)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)	49						GGCCAACATCCGCAGCATTGG	0.587																																																1	Substitution - Missense(1)	skin(1)	2											116.0	112.0	114.0					2																	99013338		2203	4300	6503	98379770	SO:0001583	missense	1261			S76069	CCDS2034.1, CCDS42719.1	2q11.2	2013-01-08			ENSG00000144191	ENSG00000144191		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2150	protein-coding gene	gene with protein product		600053		CNCG3, ACHM2		7532814, 9517456, 16382102	Standard	NM_001298		Approved	CCNC1, CCNCa, CNG3	uc002syt.3	Q16281	OTTHUMG00000130561	ENST00000272602.2:c.1705C>T	2.37:g.99013338C>T	ENSP00000272602:p.Arg569Cys		98379770	E9PF93|Q4VAP7|Q53RD2|Q6ZNA7|Q9UP64	Missense_Mutation	SNP	superfamily_SSF81324,HMMPfam_Ion_trans,superfamily_cNMP_binding,HMMSmart_cNMP,HMMPfam_cNMP_binding,PatternScan_CNMP_BINDING_1,PatternScan_CNMP_BINDING_2	p.R569C	ENST00000272602.2	37	c.1705	CCDS2034.1	2	.	.	.	.	.	.	.	.	.	.	C	15.15	2.747295	0.49257	.	.	ENSG00000144191	ENST00000393504;ENST00000436404;ENST00000272602;ENST00000409937	D;D;D;D	0.97186	-4.28;-4.28;-4.28;-4.28	5.42	1.68	0.24146	Cyclic nucleotide-binding, conserved site (1);Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (3);	0.000000	0.85682	D	0.000000	D	0.98811	0.9599	H	0.97051	3.93	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.997	D;D;D	0.76575	0.988;0.988;0.952	D	0.99078	1.0836	10	0.87932	D	0	.	12.8538	0.57873	0.5467:0.4533:0.0:0.0	.	573;551;569	E9PF93;Q4VAP7;Q16281	.;.;CNGA3_HUMAN	C	569;551;569;573	ENSP00000377140:R569C;ENSP00000410070:R551C;ENSP00000272602:R569C;ENSP00000386761:R573C	ENSP00000272602:R569C	R	+	1	0	CNGA3	98379770	0.748000	0.28294	1.000000	0.80357	0.724000	0.41520	0.341000	0.19909	0.128000	0.18479	-0.457000	0.05445	CGC	-	superfamily_cNMP_binding,HMMSmart_cNMP,HMMPfam_cNMP_binding,PatternScan_CNMP_BINDING_2		0.587	CNGA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CNGA3	protein_coding	OTTHUMT00000252986.1	C	NM_001298		98379770	+1	no_errors	NM_001298	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
UTP20	27340	genome.wustl.edu	37	12	101723078	101723078	+	Missense_Mutation	SNP	C	C	T			TCGA-36-2548-01A-01D-1526-09	TCGA-36-2548-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f0526795-f4e2-4362-8fd8-58f5b9fc6ee7	4f689ff8-b0ef-4495-af25-6f460f515b4f	g.chr12:101723078C>T	ENST00000261637.4	+	27	3442	c.3268C>T	c.(3268-3270)Cct>Tct	p.P1090S		NM_014503.2	NP_055318.2	O75691	UTP20_HUMAN	UTP20, small subunit (SSU) processome component, homolog (yeast)	1090					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000480)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000447)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000472)|negative regulation of cell proliferation (GO:0008285)|rRNA processing (GO:0006364)	90S preribosome (GO:0030686)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|preribosome, small subunit precursor (GO:0030688)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			NS(3)|biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(26)|lung(30)|ovary(2)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	88						TAAAGTTCTTCCTTTAGGTCG	0.413																																																0			12											157.0	137.0	144.0					12																	101723078		2203	4300	6503	100247209	SO:0001583	missense	27340			AJ006778	CCDS9081.1	12q23	2006-02-11				ENSG00000120800			17897	protein-coding gene	gene with protein product	"""down regulated in metastasis"""	612822				9673349, 15590835, 12837249	Standard	NM_014503		Approved	DRIM	uc001tia.1	O75691	OTTHUMG00000170270	ENST00000261637.4:c.3268C>T	12.37:g.101723078C>T	ENSP00000261637:p.Pro1090Ser		100247209	Q9H3H4	Missense_Mutation	SNP	superfamily_ARM repeat,HMMPfam_DRIM	p.P1090S	ENST00000261637.4	37	c.3268	CCDS9081.1	12	.	.	.	.	.	.	.	.	.	.	C	33	5.237788	0.95240	.	.	ENSG00000120800	ENST00000261637	T	0.21191	2.02	5.6	5.6	0.85130	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.45155	0.1328	M	0.70275	2.135	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.21586	-1.0241	10	0.09084	T	0.74	-19.463	19.9737	0.97296	0.0:1.0:0.0:0.0	.	1090	O75691	UTP20_HUMAN	S	1090	ENSP00000261637:P1090S	ENSP00000261637:P1090S	P	+	1	0	UTP20	100247209	1.000000	0.71417	1.000000	0.80357	0.886000	0.51366	7.556000	0.82233	2.793000	0.96121	0.591000	0.81541	CCT	-	superfamily_ARM repeat		0.413	UTP20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UTP20	protein_coding	OTTHUMT00000408242.1	C	NM_014503		100247209	+1	no_errors	NM_014503	genbank	human	validated	54_36p	missense	SNP	1.000	T
TRPC5	7224	genome.wustl.edu	37	X	111078157	111078157	+	Missense_Mutation	SNP	G	G	T			TCGA-36-2548-01A-01D-1526-09	TCGA-36-2548-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f0526795-f4e2-4362-8fd8-58f5b9fc6ee7	4f689ff8-b0ef-4495-af25-6f460f515b4f	g.chrX:111078157G>T	ENST00000262839.2	-	7	2806	c.1888C>A	c.(1888-1890)Ctt>Att	p.L630I		NM_012471.2	NP_036603.1	Q9UL62	TRPC5_HUMAN	transient receptor potential cation channel, subfamily C, member 5	630					axon guidance (GO:0007411)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|nervous system development (GO:0007399)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			biliary_tract(1)|breast(4)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(38)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						ACGGCAATAAGCTGATAGGAG	0.443																																																0			X											223.0	173.0	190.0					X																	111078157		2203	4300	6503	110964813	SO:0001583	missense	7224			AF054568	CCDS14561.1	Xq23	2014-06-13			ENSG00000072315	ENSG00000072315		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12337	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 159"""	300334				10493832, 16382100	Standard	NM_012471		Approved	PPP1R159	uc004epl.1	Q9UL62	OTTHUMG00000022212	ENST00000262839.2:c.1888C>A	X.37:g.111078157G>T	ENSP00000262839:p.Leu630Ile		110964813	B2RP53|O75233|Q5JXY8|Q9Y514	Missense_Mutation	SNP	superfamily_Ankyrin repeat,HMMPfam_Ank,HMMSmart_SM00248,HMMPfam_TRP_2,HMMPfam_Ion_trans,PatternScan_RIBOSOMAL_S2_1	p.L630I	ENST00000262839.2	37	c.1888	CCDS14561.1	X	.	.	.	.	.	.	.	.	.	.	G	23.5	4.427860	0.83667	.	.	ENSG00000072315	ENST00000262839	D	0.81908	-1.55	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	T	0.81103	0.4753	L	0.35644	1.08	0.80722	D	1	P;P	0.51449	0.749;0.945	B;P	0.48304	0.334;0.573	T	0.77635	-0.2514	10	0.18276	T	0.48	-2.7452	18.7427	0.91780	0.0:0.0:1.0:0.0	.	631;630	Q59G51;Q9UL62	.;TRPC5_HUMAN	I	630	ENSP00000262839:L630I	ENSP00000262839:L630I	L	-	1	0	TRPC5	110964813	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.487000	0.73633	2.371000	0.80710	0.544000	0.68410	CTT	-	NULL		0.443	TRPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPC5	protein_coding	OTTHUMT00000057945.1	G	NM_012471		110964813	-1	no_errors	NM_012471	genbank	human	validated	54_36p	missense	SNP	1.000	T
SLC35F5	80255	genome.wustl.edu	37	2	114476795	114476795	+	Missense_Mutation	SNP	C	C	T			TCGA-36-2548-01A-01D-1526-09	TCGA-36-2548-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f0526795-f4e2-4362-8fd8-58f5b9fc6ee7	4f689ff8-b0ef-4495-af25-6f460f515b4f	g.chr2:114476795C>T	ENST00000245680.2	-	14	1845	c.1432G>A	c.(1432-1434)Gat>Aat	p.D478N	SLC35F5_ENST00000470204.2_5'UTR|MIR4782_ENST00000577987.1_RNA	NM_025181.2	NP_079457.2	Q8WV83	S35F5_HUMAN	solute carrier family 35, member F5	478					transport (GO:0006810)	integral component of membrane (GO:0016021)				endometrium(1)|kidney(4)|large_intestine(2)|lung(7)|ovary(2)|prostate(3)|skin(1)	20						ATCACAGGATCCCAATTATTA	0.308																																																0			2											65.0	66.0	66.0					2																	114476795		2203	4300	6503	114193265	SO:0001583	missense	80255			AF529364	CCDS2119.1	2q14.1	2013-05-22			ENSG00000115084	ENSG00000115084		"""Solute carriers"""	23617	protein-coding gene	gene with protein product							Standard	XM_005263799		Approved	FLJ22004	uc002tku.1	Q8WV83	OTTHUMG00000131361	ENST00000245680.2:c.1432G>A	2.37:g.114476795C>T	ENSP00000245680:p.Asp478Asn		114193265	Q9H6P8|Q9H7D8	Missense_Mutation	SNP	superfamily_Multidrug resistance efflux transporter EmrE,HMMPfam_DUF6	p.D478N	ENST00000245680.2	37	c.1432	CCDS2119.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	25.1|25.1	4.598918|4.598918	0.87055|0.87055	.|.	.|.	ENSG00000115084|ENSG00000115084	ENST00000245680;ENST00000409106|ENST00000447673	T;T|.	0.56611|.	0.45;0.46|.	5.59|5.59	5.59|5.59	0.84812|0.84812	.|.	0.064019|.	0.64402|.	D|.	0.000007|.	T|T	0.72244|0.72244	0.3436|0.3436	L|L	0.55213|0.55213	1.73|1.73	0.80722|0.80722	D|D	1|1	D|.	0.63880|.	0.993|.	D|.	0.74674|.	0.984|.	T|T	0.68432|0.68432	-0.5410|-0.5410	10|5	0.52906|.	T|.	0.07|.	-17.0205|-17.0205	19.592|19.592	0.95518|0.95518	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	478|.	Q8WV83|.	S35F5_HUMAN|.	N|E	478;472|240	ENSP00000245680:D478N;ENSP00000386754:D472N|.	ENSP00000245680:D478N|.	D|G	-|-	1|2	0|0	SLC35F5|SLC35F5	114193265|114193265	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.601000|7.601000	0.82783|0.82783	2.628000|2.628000	0.89032|0.89032	0.655000|0.655000	0.94253|0.94253	GAT|GGA	-	NULL		0.308	SLC35F5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC35F5	protein_coding	OTTHUMT00000254150.1	C	NM_025181		114193265	-1	no_errors	NM_025181	genbank	human	provisional	54_36p	missense	SNP	1.000	T
CD3G	917	genome.wustl.edu	37	11	118220583	118220583	+	Nonsense_Mutation	SNP	A	A	T	rs570768621|rs199676861	byFrequency	TCGA-36-2548-01A-01D-1526-09	TCGA-36-2548-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f0526795-f4e2-4362-8fd8-58f5b9fc6ee7	4f689ff8-b0ef-4495-af25-6f460f515b4f	g.chr11:118220583A>T	ENST00000532917.1	+	3	273	c.205A>T	c.(205-207)Aaa>Taa	p.K69*	CD3G_ENST00000392883.2_Nonsense_Mutation_p.K9*|CD3G_ENST00000532903.1_3'UTR	NM_000073.2	NP_000064.1	P09693	CD3G_HUMAN	CD3g molecule, gamma (CD3-TCR complex)	69	Ig-like.				cell surface receptor signaling pathway (GO:0007166)|establishment or maintenance of cell polarity (GO:0007163)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|protein complex assembly (GO:0006461)|protein transport (GO:0015031)|regulation of immune response (GO:0050776)|regulation of lymphocyte apoptotic process (GO:0070228)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	alpha-beta T cell receptor complex (GO:0042105)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|T cell receptor complex (GO:0042101)	protein heterodimerization activity (GO:0046982)|receptor signaling complex scaffold activity (GO:0030159)|T cell receptor binding (GO:0042608)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|kidney(1)|large_intestine(2)|skin(1)	6	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.04e-05)	Muromonab(DB00075)	AACTGAAGATAAAAAAAAATG	0.403																																																0			11	GRCh37	CM983819	CD3G	M							100.0	97.0	98.0					11																	118220583		2200	4296	6496	117725793	SO:0001587	stop_gained	917			X60491	CCDS8395.1	11q23	2014-09-17	2006-03-28		ENSG00000160654	ENSG00000160654		"""CD molecules"""	1675	protein-coding gene	gene with protein product		186740	"""CD3g antigen, gamma polypeptide (TiT3 complex)"""				Standard	NM_000073		Approved		uc001psu.2	P09693	OTTHUMG00000166971	ENST00000532917.1:c.205A>T	11.37:g.118220583A>T	ENSP00000431445:p.Lys69*		117725793	Q2HIZ6	Nonsense_Mutation	SNP	superfamily_Immunoglobulin,HMMSmart_SM00408,HMMPfam_ITAM,HMMSmart_SM00077	p.K69*	ENST00000532917.1	37	c.205	CCDS8395.1	11	.	.	.	.	.	.	.	.	.	.	A	9.764	1.170945	0.21621	.	.	ENSG00000160654	ENST00000392883;ENST00000532917	.	.	.	5.94	-2.1	0.07210	.	1.346410	0.04360	N	0.357210	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.4066	0.21668	0.4952:0.1334:0.3714:0.0	.	.	.	.	X	9;69	.	ENSP00000376621:K9X	K	+	1	0	CD3G	117725793	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.104000	0.10923	-0.651000	0.05415	-0.429000	0.05907	AAA	-	superfamily_Immunoglobulin,HMMSmart_SM00408		0.403	CD3G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD3G	protein_coding	OTTHUMT00000392135.1	A	NM_000073		117725793	+1	no_errors	NM_000073	genbank	human	reviewed	54_36p	nonsense	SNP	0.000	T
MAN1A2	10905	genome.wustl.edu	37	1	118039453	118039453	+	Silent	SNP	G	G	T	rs111250977		TCGA-36-2548-01A-01D-1526-09	TCGA-36-2548-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f0526795-f4e2-4362-8fd8-58f5b9fc6ee7	4f689ff8-b0ef-4495-af25-6f460f515b4f	g.chr1:118039453G>T	ENST00000356554.3	+	10	2088	c.1353G>T	c.(1351-1353)ggG>ggT	p.G451G		NM_006699.3	NP_006690.1	O60476	MA1A2_HUMAN	mannosidase, alpha, class 1A, member 2	451					cellular protein metabolic process (GO:0044267)|lung alveolus development (GO:0048286)|N-glycan processing (GO:0006491)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|respiratory gaseous exchange (GO:0007585)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleolus (GO:0005730)	calcium ion binding (GO:0005509)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(17)|ovary(1)|skin(1)|urinary_tract(1)	27	Lung SC(450;0.225)	all_cancers(81;7.9e-06)|all_epithelial(167;7.39e-07)|all_lung(203;2.84e-06)|Lung NSC(69;1.99e-05)		Lung(183;0.0688)|Kidney(133;0.114)|LUSC - Lung squamous cell carcinoma(189;0.223)|KIRC - Kidney renal clear cell carcinoma(1967;0.237)|Colorectal(144;0.243)		GGAAGAATGGGCACTTGGAAA	0.398																																					Ovarian(33;199 881 8228 13687 31538)											0			1											104.0	107.0	106.0					1																	118039453		2203	4299	6502	117840976	SO:0001819	synonymous_variant	10905			AF027156	CCDS895.1	1p13	2008-02-05			ENSG00000198162	ENSG00000198162			6822	protein-coding gene	gene with protein product		604345				9592125	Standard	NM_006699		Approved	MAN1B	uc001ehd.1	O60476	OTTHUMG00000012149	ENST00000356554.3:c.1353G>T	1.37:g.118039453G>T			117840976	Q9H510	Silent	SNP	superfamily_Glyco_hydro_47,HMMPfam_Glyco_hydro_47	p.G451	ENST00000356554.3	37	c.1353	CCDS895.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.17|10.17	1.276475|1.276475	0.23307|0.23307	.|.	.|.	ENSG00000198162|ENSG00000198162	ENST00000421535|ENST00000449370	.|.	.|.	.|.	5.59|5.59	-8.01|-8.01	0.01122|0.01122	.|.	.|0.091717	.|0.85682	.|D	.|0.000000	T|T	0.36468|0.36468	0.0968|0.0968	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.51411|0.51411	-0.8709|-0.8709	4|6	.|0.54805	.|T	.|0.06	-16.5774|-16.5774	4.2172|4.2172	0.10540|0.10540	0.5316:0.2493:0.1208:0.0982|0.5316:0.2493:0.1208:0.0982	.|.	.|.	.|.	.|.	S|V	18|184	.|.	.|ENSP00000412706:G184V	A|G	+|+	1|2	0|0	MAN1A2|MAN1A2	117840976|117840976	0.058000|0.058000	0.20735|0.20735	0.876000|0.876000	0.34364|0.34364	0.996000|0.996000	0.88848|0.88848	-0.573000|-0.573000	0.05874|0.05874	-1.170000|-1.170000	0.02769|0.02769	0.557000|0.557000	0.71058|0.71058	GCA|GGC	-	superfamily_Glyco_hydro_47,HMMPfam_Glyco_hydro_47		0.398	MAN1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAN1A2	protein_coding	OTTHUMT00000033593.1	G	NM_006699		117840976	+1	no_errors	NM_006699	genbank	human	validated	54_36p	silent	SNP	0.508	T
HPD	3242	genome.wustl.edu	37	12	122281734	122281734	+	Missense_Mutation	SNP	C	C	T	rs140144597	byFrequency	TCGA-36-2548-01A-01D-1526-09	TCGA-36-2548-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f0526795-f4e2-4362-8fd8-58f5b9fc6ee7	4f689ff8-b0ef-4495-af25-6f460f515b4f	g.chr12:122281734C>T	ENST00000289004.4	-	12	871	c.836G>A	c.(835-837)cGc>cAc	p.R279H	HPD_ENST00000543163.1_Missense_Mutation_p.R240H	NM_002150.2	NP_002141	P32754	HPPD_HUMAN	4-hydroxyphenylpyruvate dioxygenase	279					cellular nitrogen compound metabolic process (GO:0034641)|L-phenylalanine catabolic process (GO:0006559)|small molecule metabolic process (GO:0044281)|tyrosine catabolic process (GO:0006572)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	4-hydroxyphenylpyruvate dioxygenase activity (GO:0003868)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|kidney(1)|large_intestine(6)|lung(8)|urinary_tract(1)	18	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000105)|Epithelial(86;0.000352)|BRCA - Breast invasive adenocarcinoma(302;0.225)	Nitisinone(DB00348)	TCTCAAGTGGCGAATCTGTTT	0.537													C|||	2	0.000399361	0.0	0.0	5008	,	,		16832	0.0		0.001	False		,,,				2504	0.001															0			12						C	HIS/ARG,HIS/ARG	0,4406		0,0,2203	114.0	107.0	109.0		719,836	2.3	1.0	12	dbSNP_134	109	3,8597	3.0+/-9.4	0,3,4297	yes	missense,missense	HPD	NM_001171993.1,NM_002150.2	29,29	0,3,6500	TT,TC,CC		0.0349,0.0,0.0231	possibly-damaging,possibly-damaging	240/355,279/394	122281734	3,13003	2203	4300	6503	120766117	SO:0001583	missense	3242			BC014790	CCDS9224.1, CCDS53839.1	12q24.31	2013-09-19			ENSG00000158104	ENSG00000158104	1.13.11.27		5147	protein-coding gene	gene with protein product	"""glyoxalase domain containing 3"""	609695		PPD			Standard	NM_001171993		Approved	4-HPPD, 4HPPD, GLOD3	uc001ubj.3	P32754	OTTHUMG00000169081	ENST00000289004.4:c.836G>A	12.37:g.122281734C>T	ENSP00000289004:p.Arg279His		120766117	A8K461|B3KQ63|Q13234	Missense_Mutation	SNP	superfamily_Glyoxalase/Bleomycin resistance protein/Dihydroxybiphenyl dioxygenase,HMMPfam_Glyoxalase	p.R279H	ENST00000289004.4	37	c.836	CCDS9224.1	12	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	12.07	1.826537	0.32329	0.0	3.49E-4	ENSG00000158104	ENST00000289004;ENST00000545969;ENST00000543163	T;T	0.64803	-0.12;-0.12	4.32	2.32	0.28847	Glyoxalase/fosfomycin resistance/dioxygenase (1);	0.558450	0.19279	N	0.118206	T	0.64605	0.2613	M	0.82517	2.595	0.36281	D	0.855792	P	0.40083	0.702	B	0.39617	0.305	T	0.74559	-0.3625	10	0.48119	T	0.1	-25.6894	12.6809	0.56922	0.0:0.4062:0.5938:0.0	.	279	P32754	HPPD_HUMAN	H	279;276;240	ENSP00000289004:R279H;ENSP00000441677:R240H	ENSP00000289004:R279H	R	-	2	0	HPD	120766117	0.999000	0.42202	0.992000	0.48379	0.502000	0.33828	1.786000	0.38694	1.003000	0.39130	0.511000	0.50034	CGC	-	superfamily_Glyoxalase/Bleomycin resistance protein/Dihydroxybiphenyl dioxygenase,HMMPfam_Glyoxalase		0.537	HPD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HPD	protein_coding	OTTHUMT00000402184.1	C	NM_002150		120766117	-1	no_errors	NM_002150	genbank	human	validated	54_36p	missense	SNP	0.994	T
PTPRZ1	5803	genome.wustl.edu	37	7	121668653	121668653	+	Missense_Mutation	SNP	C	C	G			TCGA-36-2548-01A-01D-1526-09	TCGA-36-2548-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f0526795-f4e2-4362-8fd8-58f5b9fc6ee7	4f689ff8-b0ef-4495-af25-6f460f515b4f	g.chr7:121668653C>G	ENST00000393386.2	+	14	5447	c.5036C>G	c.(5035-5037)cCt>cGt	p.P1679R	PTPRZ1_ENST00000449182.1_Missense_Mutation_p.P819R	NM_001206838.1|NM_002851.2	NP_001193767.1|NP_002842.2	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type, Z polypeptide 1	1679					axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|hematopoietic progenitor cell differentiation (GO:0002244)|learning or memory (GO:0007611)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of oligodendrocyte progenitor proliferation (GO:0070445)	integral component of plasma membrane (GO:0005887)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(12)|large_intestine(17)|liver(1)|lung(42)|ovary(4)|prostate(5)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	106						AGTACATCCCCTAGAGTTATA	0.378																																																0			7											188.0	158.0	168.0					7																	121668653		2203	4300	6503	121455889	SO:0001583	missense	5803			M93426	CCDS34740.1, CCDS56505.1	7q31.3	2013-02-11			ENSG00000106278	ENSG00000106278		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9685	protein-coding gene	gene with protein product		176891		PTPZ, PTPRZ		7736789, 8387522	Standard	NM_001206838		Approved	PTP18, RPTPB, phosphacan	uc003vjy.3	P23471	OTTHUMG00000157057	ENST00000393386.2:c.5036C>G	7.37:g.121668653C>G	ENSP00000377047:p.Pro1679Arg		121455889	A4D0W5|C9JFM0|O76043|Q9UDR6	Missense_Mutation	SNP	superfamily_Carbonic anhydrase,HMMPfam_Carb_anhydrase,superfamily_Fibronectin type III,HMMSmart_SM00060,HMMPfam_fn3,superfamily_(Phosphotyrosine protein) phosphatases II,HMMSmart_SM00194,HMMPfam_Y_phosphatase,HMMSmart_SM00404,PatternScan_TYR_PHOSPHATASE_1	p.P1679R	ENST00000393386.2	37	c.5036	CCDS34740.1	7	.	.	.	.	.	.	.	.	.	.	C	21.6	4.169655	0.78452	.	.	ENSG00000106278	ENST00000393386;ENST00000449182	T;D	0.81499	0.84;-1.5	5.8	4.92	0.64577	.	0.088114	0.49916	D	0.000137	D	0.85678	0.5752	L	0.43923	1.385	0.50632	D	0.999888	D;D;D	0.76494	0.959;0.964;0.999	P;P;D	0.73708	0.79;0.573;0.981	D	0.87192	0.2235	10	0.87932	D	0	.	14.8788	0.70516	0.0:0.9313:0.0:0.0687	.	818;819;1679	P23471-2;C9JFM0;P23471	.;.;PTPRZ_HUMAN	R	1679;819	ENSP00000377047:P1679R;ENSP00000410000:P819R	ENSP00000377047:P1679R	P	+	2	0	PTPRZ1	121455889	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	7.373000	0.79623	1.464000	0.47987	0.650000	0.86243	CCT	-	NULL		0.378	PTPRZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRZ1	protein_coding	OTTHUMT00000347288.1	C	NM_002851		121455889	+1	no_errors	NM_002851	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
TTC16	158248	genome.wustl.edu	37	9	130489348	130489348	+	Missense_Mutation	SNP	G	G	C			TCGA-36-2548-01A-01D-1526-09	TCGA-36-2548-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f0526795-f4e2-4362-8fd8-58f5b9fc6ee7	4f689ff8-b0ef-4495-af25-6f460f515b4f	g.chr9:130489348G>C	ENST00000373289.3	+	11	1605	c.1525G>C	c.(1525-1527)Gtg>Ctg	p.V509L	PTRH1_ENST00000429848.1_5'Flank|TTC16_ENST00000489226.1_3'UTR|PTRH1_ENST00000419060.1_5'Flank	NM_144965.1	NP_659402.1	Q8NEE8	TTC16_HUMAN	tetratricopeptide repeat domain 16	509										central_nervous_system(2)|endometrium(3)|lung(7)|ovary(3)|pancreas(2)|prostate(4)|skin(1)	22						GGAGCAGATGGTGGAGGGCAG	0.662																																																0			9											26.0	28.0	27.0					9																	130489348		2201	4295	6496	129529169	SO:0001583	missense	158248			AK057342	CCDS6875.1	9q34.13	2013-01-10			ENSG00000167094	ENSG00000167094		"""Tetratricopeptide (TTC) repeat domain containing"""	26536	protein-coding gene	gene with protein product						12477932	Standard	NM_144965		Approved	FLJ32780	uc004brq.1	Q8NEE8	OTTHUMG00000020711	ENST00000373289.3:c.1525G>C	9.37:g.130489348G>C	ENSP00000362386:p.Val509Leu		129529169	B4DYG4|B5ME24|Q5JU66|Q96M72	Missense_Mutation	SNP	superfamily_SSF48452,HMMPfam_TPR_1,HMMSmart_TPR	p.V509L	ENST00000373289.3	37	c.1525	CCDS6875.1	9	.	.	.	.	.	.	.	.	.	.	G	9.350	1.065279	0.20067	.	.	ENSG00000167094	ENST00000373289;ENST00000373288	T	0.17213	2.29	5.9	-11.8	0.00035	.	2.636200	0.00935	N	0.002773	T	0.08670	0.0215	N	0.17474	0.49	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.08055	0.003;0.003	T	0.12734	-1.0536	10	0.35671	T	0.21	0.4256	7.767	0.28986	0.4377:0.4096:0.0794:0.0732	.	496;509	B4DZ42;Q8NEE8	.;TTC16_HUMAN	L	509;287	ENSP00000362386:V509L	ENSP00000362385:V287L	V	+	1	0	TTC16	129529169	0.000000	0.05858	0.000000	0.03702	0.034000	0.12701	-3.807000	0.00361	-3.505000	0.00150	-0.266000	0.10368	GTG	-	NULL		0.662	TTC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC16	protein_coding	OTTHUMT00000054224.1	G	NM_144965		129529169	+1	no_errors	NM_144965	genbank	human	provisional	54_36p	missense	SNP	0.000	C
PTPN18	26469	genome.wustl.edu	37	2	131117022	131117022	+	Missense_Mutation	SNP	C	C	A			TCGA-36-2548-01A-01D-1526-09	TCGA-36-2548-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f0526795-f4e2-4362-8fd8-58f5b9fc6ee7	4f689ff8-b0ef-4495-af25-6f460f515b4f	g.chr2:131117022C>A	ENST00000175756.5	+	4	433	c.332C>A	c.(331-333)aCc>aAc	p.T111N	PTPN18_ENST00000420717.1_3'UTR|PTPN18_ENST00000347849.3_Intron	NM_014369.3	NP_055184.2	Q99952	PTN18_HUMAN	protein tyrosine phosphatase, non-receptor type 18 (brain-derived)	111	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)			endometrium(1)|kidney(3)|large_intestine(2)|lung(5)|ovary(3)|prostate(1)	15	Colorectal(110;0.1)					TTGCCTCACACCCTGCTAGAC	0.607																																																0			2											98.0	89.0	92.0					2																	131117022		2203	4300	6503	130833492	SO:0001583	missense	26469			X79568	CCDS2161.1, CCDS46410.1	2q21	2011-06-09			ENSG00000072135	ENSG00000072135		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9649	protein-coding gene	gene with protein product		606587				8950995	Standard	NM_014369		Approved	BDP1	uc002trc.3	Q99952	OTTHUMG00000131630	ENST00000175756.5:c.332C>A	2.37:g.131117022C>A	ENSP00000175756:p.Thr111Asn		130833492	B4E1E6|Q53P42	Missense_Mutation	SNP	HMMSmart_PTPc,superfamily_SSF52799,HMMPfam_Y_phosphatase,PatternScan_TYR_PHOSPHATASE_1	p.T111N	ENST00000175756.5	37	c.332	CCDS2161.1	2	.	.	.	.	.	.	.	.	.	.	C	20.6	4.021308	0.75275	.	.	ENSG00000072135	ENST00000175756;ENST00000409022	D	0.89552	-2.53	4.46	3.57	0.40892	Protein-tyrosine phosphatase, receptor/non-receptor type (4);	0.000000	0.35179	N	0.003381	D	0.95692	0.8599	H	0.96111	3.77	0.58432	D	0.999992	D;D	0.76494	0.994;0.999	D;D	0.77557	0.924;0.99	D	0.95870	0.8890	10	0.87932	D	0	.	11.0822	0.48066	0.0:0.8115:0.1885:0.0	.	111;111	E7EMB8;Q99952	.;PTN18_HUMAN	N	111	ENSP00000175756:T111N	ENSP00000175756:T111N	T	+	2	0	PTPN18	130833492	0.992000	0.36948	0.942000	0.38095	0.989000	0.77384	3.286000	0.51724	1.182000	0.42928	0.655000	0.94253	ACC	-	HMMSmart_PTPc,superfamily_SSF52799,HMMPfam_Y_phosphatase		0.607	PTPN18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPN18	protein_coding	OTTHUMT00000254523.2	C			130833492	+1	no_errors	NM_014369	genbank	human	reviewed	54_36p	missense	SNP	0.912	A
SLITRK4	139065	genome.wustl.edu	37	X	142718596	142718596	+	Missense_Mutation	SNP	T	T	C			TCGA-36-2548-01A-01D-1526-09	TCGA-36-2548-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f0526795-f4e2-4362-8fd8-58f5b9fc6ee7	4f689ff8-b0ef-4495-af25-6f460f515b4f	g.chrX:142718596T>C	ENST00000381779.4	-	2	554	c.329A>G	c.(328-330)aAg>aGg	p.K110R	SLITRK4_ENST00000338017.4_Missense_Mutation_p.K110R|SLITRK4_ENST00000356928.1_Missense_Mutation_p.K110R	NM_001184749.2|NM_001184750.1|NM_173078.4	NP_001171678.1|NP_001171679.1|NP_775101.1	Q8IW52	SLIK4_HUMAN	SLIT and NTRK-like family, member 4	110						integral component of membrane (GO:0016021)				autonomic_ganglia(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(11)|lung(27)|ovary(2)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	60	Acute lymphoblastic leukemia(192;6.56e-05)					GTGCAACTGCTTTAATGCACT	0.413																																																0			X											69.0	66.0	67.0					X																	142718596		2203	4300	6503	142546262	SO:0001583	missense	139065			BC040986	CCDS14679.1	Xq27.3	2004-06-23			ENSG00000179542	ENSG00000179542			23502	protein-coding gene	gene with protein product		300562				14557068	Standard	NM_001184749		Approved	DKFZp547M2010	uc004fby.3	Q8IW52	OTTHUMG00000022580	ENST00000381779.4:c.329A>G	X.37:g.142718596T>C	ENSP00000371198:p.Lys110Arg		142546262	Q5JXG3|Q8TCM8|Q96DL3	Missense_Mutation	SNP	superfamily_L domain-like,HMMSmart_SM00369,HMMPfam_LRR_1,HMMSmart_SM00365,HMMSmart_SM00082,HMMPfam_LRRNT	p.K110R	ENST00000381779.4	37	c.329	CCDS14679.1	X	.	.	.	.	.	.	.	.	.	.	T	13.91	2.377998	0.42105	.	.	ENSG00000179542	ENST00000381779;ENST00000356928;ENST00000338017	T;T;T	0.54479	0.57;0.57;0.57	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	T	0.51568	0.1682	L	0.42245	1.32	0.58432	D	0.999994	P	0.49696	0.927	P	0.48089	0.566	T	0.47598	-0.9105	10	0.29301	T	0.29	-12.2729	13.5168	0.61545	0.0:0.0:0.0:1.0	.	110	Q8IW52	SLIK4_HUMAN	R	110	ENSP00000371198:K110R;ENSP00000349400:K110R;ENSP00000336627:K110R	ENSP00000336627:K110R	K	-	2	0	SLITRK4	142546262	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.289000	0.72696	1.876000	0.54355	0.486000	0.48141	AAG	-	superfamily_L domain-like,HMMSmart_SM00369		0.413	SLITRK4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SLITRK4	protein_coding	OTTHUMT00000058617.1	T	NM_173078		142546262	-1	no_errors	NM_173078	genbank	human	validated	54_36p	missense	SNP	1.000	C
MFSD3	113655	genome.wustl.edu	37	8	145735156	145735156	+	Missense_Mutation	SNP	C	C	T			TCGA-36-2548-01A-01D-1526-09	TCGA-36-2548-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f0526795-f4e2-4362-8fd8-58f5b9fc6ee7	4f689ff8-b0ef-4495-af25-6f460f515b4f	g.chr8:145735156C>T	ENST00000301327.4	+	1	700	c.440C>T	c.(439-441)gCc>gTc	p.A147V	RECQL4_ENST00000532237.1_5'Flank|CTD-2517M22.17_ENST00000580385.1_RNA	NM_138431.1	NP_612440.1	Q96ES6	MFSD3_HUMAN	major facilitator superfamily domain containing 3	147	Leu-rich.				transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)				central_nervous_system(2)|endometrium(1)|kidney(1)|lung(4)	8	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)			AAGCTGGGGGCCGCGCTAGCT	0.706											OREG0019059	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				0			8											8.0	8.0	8.0					8																	145735156		2114	4182	6296	145705964	SO:0001583	missense	113655				CCDS6431.1	8q24.3	2005-11-17			ENSG00000167700	ENSG00000167700			25157	protein-coding gene	gene with protein product							Standard	NM_138431		Approved		uc003zdi.1	Q96ES6	OTTHUMG00000165177	ENST00000301327.4:c.440C>T	8.37:g.145735156C>T	ENSP00000301327:p.Ala147Val	1696	145705964		Missense_Mutation	SNP	superfamily_MFS_gen_substrate_transporter,HMMPfam_MFS_1	p.A147V	ENST00000301327.4	37	c.440	CCDS6431.1	8	.	.	.	.	.	.	.	.	.	.	C	16.53	3.147747	0.57151	.	.	ENSG00000167700	ENST00000301327	T	0.58060	0.36	5.02	5.02	0.67125	Major facilitator superfamily domain, general substrate transporter (1);	0.265930	0.37393	N	0.002118	T	0.57330	0.2046	L	0.52011	1.625	0.23693	N	0.997096	P	0.47253	0.892	P	0.51055	0.657	T	0.51395	-0.8711	10	0.25106	T	0.35	-25.0729	16.1659	0.81754	0.0:1.0:0.0:0.0	.	147	Q96ES6	MFSD3_HUMAN	V	147	ENSP00000301327:A147V	ENSP00000301327:A147V	A	+	2	0	MFSD3	145705964	0.994000	0.37717	0.049000	0.19019	0.141000	0.21300	6.842000	0.75379	2.484000	0.83849	0.561000	0.74099	GCC	-	superfamily_MFS_gen_substrate_transporter,HMMPfam_MFS_1		0.706	MFSD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MFSD3	protein_coding	OTTHUMT00000382478.2	C	NM_138431		145705964	+1	no_errors	NM_138431	genbank	human	provisional	54_36p	missense	SNP	0.252	T
NPY5R	4889	genome.wustl.edu	37	4	164272349	164272349	+	Silent	SNP	C	C	T			TCGA-36-2548-01A-01D-1526-09	TCGA-36-2548-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f0526795-f4e2-4362-8fd8-58f5b9fc6ee7	4f689ff8-b0ef-4495-af25-6f460f515b4f	g.chr4:164272349C>T	ENST00000515560.1	+	4	2446	c.924C>T	c.(922-924)caC>caT	p.H308H	NPY5R_ENST00000506953.1_Silent_p.H308H|NPY5R_ENST00000338566.3_Silent_p.H308H			Q15761	NPY5R_HUMAN	neuropeptide Y receptor Y5	308					cardiac left ventricle morphogenesis (GO:0003214)|eating behavior (GO:0042755)|G-protein coupled receptor signaling pathway (GO:0007186)|generation of ovulation cycle rhythm (GO:0060112)|negative regulation of apoptotic process (GO:0043066)|negative regulation of glutamate secretion (GO:0014050)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|neuropeptide signaling pathway (GO:0007218)|outflow tract morphogenesis (GO:0003151)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of smooth muscle cell proliferation (GO:0048661)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neuropeptide Y receptor activity (GO:0004983)|pancreatic polypeptide receptor activity (GO:0001602)|peptide YY receptor activity (GO:0001601)			NS(2)|biliary_tract(1)|breast(1)|endometrium(3)|large_intestine(4)|lung(26)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	42	all_hematologic(180;0.166)	Prostate(90;0.109)				AAGAGAACCACTCCAGAATAC	0.408																																					Melanoma(139;1287 1774 9781 19750 25599)											0			4											82.0	85.0	84.0					4																	164272349		2203	4300	6503	164491799	SO:0001819	synonymous_variant	4889			BC042416	CCDS3804.1	4q31-q32	2012-08-08				ENSG00000164129		"""GPCR / Class A : Neuropeptide receptors : Y"""	7958	protein-coding gene	gene with protein product		602001				8700207, 9417917	Standard	NM_006174		Approved	NPYR5	uc003iqn.3	Q15761		ENST00000515560.1:c.924C>T	4.37:g.164272349C>T			164491799	Q6GTR7|Q92916	Silent	SNP	PatternScan_G_PROTEIN_RECEP_F1_1,superfamily_SSF81321,HMMPfam_7tm_1	p.H308	ENST00000515560.1	37	c.924	CCDS3804.1	4																																																																																			-	superfamily_SSF81321,HMMPfam_7tm_1		0.408	NPY5R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPY5R	protein_coding	OTTHUMT00000364633.1	C	NM_006174		164491799	+1	no_errors	NM_006174	genbank	human	provisional	54_36p	silent	SNP	0.000	T
KIF21B	23046	genome.wustl.edu	37	1	200978545	200978545	+	Missense_Mutation	SNP	G	G	A			TCGA-36-2548-01A-01D-1526-09	TCGA-36-2548-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f0526795-f4e2-4362-8fd8-58f5b9fc6ee7	4f689ff8-b0ef-4495-af25-6f460f515b4f	g.chr1:200978545G>A	ENST00000422435.2	-	2	429	c.113C>T	c.(112-114)cCc>cTc	p.P38L	KIF21B_ENST00000360529.5_Missense_Mutation_p.P38L|KIF21B_ENST00000332129.2_Missense_Mutation_p.P38L|KIF21B_ENST00000461742.2_Missense_Mutation_p.P38L	NM_001252100.1	NP_001239029.1	O75037	KI21B_HUMAN	kinesin family member 21B	38	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(4)|large_intestine(8)|liver(1)|lung(27)|ovary(3)|pancreas(1)|prostate(5)|skin(8)|stomach(2)|urinary_tract(2)	83						CAGGACCTGGGGCTCTCCCGG	0.572																																																0			1											100.0	100.0	100.0					1																	200978545		2203	4300	6503	199245168	SO:0001583	missense	23046			BC031927	CCDS30965.1, CCDS58054.1, CCDS58055.1, CCDS58056.1	1q32.1	2013-01-10			ENSG00000116852	ENSG00000116852		"""Kinesins"", ""WD repeat domain containing"""	29442	protein-coding gene	gene with protein product		608322				9455484	Standard	NM_001252100		Approved	DKFZP434J212, KIAA0449	uc001gvs.2	O75037	OTTHUMG00000035787	ENST00000422435.2:c.113C>T	1.37:g.200978545G>A	ENSP00000411831:p.Pro38Leu		199245168	B2RP62|B7ZMI0|Q5T4J3	Missense_Mutation	SNP	HMMSmart_KISc,superfamily_SSF52540,HMMPfam_Kinesin,PatternScan_KINESIN_MOTOR_DOMAIN1,superfamily_WD40_like,superfamily_Prefoldin,HMMSmart_WD40,HMMPfam_WD40,PatternScan_WD_REPEATS_1	p.P38L	ENST00000422435.2	37	c.113	CCDS58056.1	1	.	.	.	.	.	.	.	.	.	.	G	24.1	4.499259	0.85069	.	.	ENSG00000116852	ENST00000332129;ENST00000360529;ENST00000461742;ENST00000422435;ENST00000539858	T;T;T;T	0.74632	-0.86;-0.86;-0.86;-0.86	4.75	3.83	0.44106	Kinesin, motor domain (4);	0.000000	0.85682	D	0.000000	T	0.82199	0.4985	L	0.56199	1.76	0.80722	D	1	D;D;B;D	0.89917	1.0;1.0;0.0;1.0	D;D;B;D	0.91635	0.999;0.999;0.004;0.999	D	0.83734	0.0200	10	0.87932	D	0	.	12.8576	0.57894	0.0788:0.0:0.9212:0.0	.	38;38;38;38	B7ZMI0;B2RP62;O75037;O75037-2	.;.;KI21B_HUMAN;.	L	38	ENSP00000328494:P38L;ENSP00000353724:P38L;ENSP00000433808:P38L;ENSP00000411831:P38L	ENSP00000328494:P38L	P	-	2	0	KIF21B	199245168	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	9.567000	0.98161	1.215000	0.43411	0.655000	0.94253	CCC	-	HMMSmart_KISc,superfamily_SSF52540,HMMPfam_Kinesin		0.572	KIF21B-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIF21B	protein_coding	OTTHUMT00000382635.1	G	XM_371332		199245168	-1	no_errors	NM_017596	genbank	human	provisional	54_36p	missense	SNP	1.000	A
EXOC8	149371	genome.wustl.edu	37	1	231472153	231472153	+	Missense_Mutation	SNP	G	G	A			TCGA-36-2548-01A-01D-1526-09	TCGA-36-2548-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	f0526795-f4e2-4362-8fd8-58f5b9fc6ee7	4f689ff8-b0ef-4495-af25-6f460f515b4f	g.chr1:231472153G>A	ENST00000360394.2	-	1	1425	c.1339C>T	c.(1339-1341)Cgc>Tgc	p.R447C	EXOC8_ENST00000366645.1_Missense_Mutation_p.R443C|SPRTN_ENST00000008440.9_5'Flank|SPRTN_ENST00000391858.4_5'Flank|SPRTN_ENST00000295050.7_5'Flank	NM_175876.3	NP_787072.2	Q8IYI6	EXOC8_HUMAN	exocyst complex component 8	447					cellular protein localization (GO:0034613)|cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|membrane organization (GO:0061024)|protein transport (GO:0015031)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|exocyst (GO:0000145)|membrane (GO:0016020)|plasma membrane (GO:0005886)				cervix(2)|endometrium(1)|large_intestine(2)|liver(1)|lung(5)|prostate(1)|skin(1)|stomach(1)	14	Breast(184;0.0871)	all_cancers(173;0.151)|Prostate(94;0.183)				CCTTCGATGCGAAGCTGACGA	0.488																																																0			1											55.0	54.0	54.0					1																	231472153		2203	4300	6503	229538776	SO:0001583	missense	149371			AL117352	CCDS1593.1	1q42.2	2013-01-22			ENSG00000116903	ENSG00000116903			24659	protein-coding gene	gene with protein product		615283				12477932	Standard	NM_175876		Approved	SEC84, EXO84, Exo84p	uc001huq.3	Q8IYI6	OTTHUMG00000038025	ENST00000360394.2:c.1339C>T	1.37:g.231472153G>A	ENSP00000353564:p.Arg447Cys		229538776	B3KU33|Q5TE82	Missense_Mutation	SNP	HMMPfam_Vps51,superfamily_PH domain-like,HMMPfam_PH,HMMSmart_SM00233	p.R447C	ENST00000360394.2	37	c.1339	CCDS1593.1	1	.	.	.	.	.	.	.	.	.	.	G	17.67	3.447219	0.63178	.	.	ENSG00000116903	ENST00000360394;ENST00000366645	T;T	0.79845	-1.31;-1.31	5.97	5.05	0.67936	Cullin repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.88036	0.6329	M	0.65975	2.015	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	D	0.88557	0.3120	10	0.54805	T	0.06	-18.7128	14.4165	0.67153	0.0:0.0:0.7327:0.2673	.	447	Q8IYI6	EXOC8_HUMAN	C	447;443	ENSP00000353564:R447C;ENSP00000355605:R443C	ENSP00000353564:R447C	R	-	1	0	EXOC8	229538776	1.000000	0.71417	0.964000	0.40570	0.835000	0.47333	6.633000	0.74286	1.510000	0.48803	0.655000	0.94253	CGC	-	NULL		0.488	EXOC8-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EXOC8	protein_coding		G	NM_175876		229538776	-1	no_errors	NM_175876	genbank	human	validated	54_36p	missense	SNP	1.000	A
