#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CAMTA1	23261	broad.mit.edu	37	1	7811267	7811267	+	Silent	SNP	T	T	A			TCGA-59-2351-01A-01W-0799-08	TCGA-59-2351-10A-01W-0800-08	T	T	A	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	930e9c43-af1e-47bc-8ee2-b3bd8a11bb8b	a31b2f09-d6d7-4ce2-a7b4-fd706c7a1c0f	g.chr1:7811267T>A	ENST00000303635.7	+	20	4905	c.4698T>A	c.(4696-4698)ctT>ctA	p.L1566L	CAMTA1_ENST00000476864.1_Silent_p.L130L|CAMTA1_ENST00000439411.2_Silent_p.L1552L	NM_015215.2	NP_056030.1	Q9Y6Y1	CMTA1_HUMAN	calmodulin binding transcription activator 1	1566	IQ 1. {ECO:0000255|PROSITE- ProRule:PRU00116}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.L1566L(1)		breast(5)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(11)|lung(29)|ovary(5)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	85	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		AGTACGCACTTTATAAAAAGA	0.493			T	WWTR1	epitheliod hemangioendothelioma																																		Dom	yes		1	1p36.31-p36.23	611501	calmodulin binding transcription activator 1		M	1	Substitution - coding silent(1)	ovary(1)	1											195.0	210.0	205.0					1																	7811267		2203	4300	6503	7733854	SO:0001819	synonymous_variant	23261			AB020640	CCDS30576.1, CCDS55574.1, CCDS55575.1	1p36.31-p36.23	2008-07-18			ENSG00000171735	ENSG00000171735			18806	protein-coding gene	gene with protein product		611501				11925432	Standard	NM_001195563		Approved	KIAA0833	uc001aoi.3	Q9Y6Y1	OTTHUMG00000001212	ENST00000303635.7:c.4698T>A	1.37:g.7811267T>A			7733854	A7MBM4|G3V3Z7|Q5VUE1|Q6V701|Q8WYI3|Q96S92	Silent	SNP	ENST00000303635.7	37	CCDS30576.1	.	.	.	.	.	.	.	.	.	.	T	10.71	1.426440	0.25726	.	.	ENSG00000171735	ENST00000495233;ENST00000490905	.	.	.	5.65	5.65	0.86999	.	.	.	.	.	T	0.72087	0.3417	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.71328	-0.4626	4	.	.	.	-7.3596	15.8787	0.79185	0.0:0.0:0.0:1.0	.	.	.	.	Y	530;132	.	.	F	+	2	0	CAMTA1	7733854	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.182000	0.58310	2.139000	0.66308	0.533000	0.62120	TTT		0.493	CAMTA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000003588.3	NM_015215	
C8B	732	broad.mit.edu	37	1	57415368	57415368	+	Missense_Mutation	SNP	G	G	C	rs150146785	byFrequency	TCGA-59-2351-01A-01W-0799-08	TCGA-59-2351-10A-01W-0800-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	930e9c43-af1e-47bc-8ee2-b3bd8a11bb8b	a31b2f09-d6d7-4ce2-a7b4-fd706c7a1c0f	g.chr1:57415368G>C	ENST00000371237.4	-	6	790	c.724C>G	c.(724-726)Cgc>Ggc	p.R242G	C8B_ENST00000535057.1_Missense_Mutation_p.R180G|C8B_ENST00000543257.1_Missense_Mutation_p.R190G	NM_000066.2	NP_000057	P07358	CO8B_HUMAN	complement component 8, beta polypeptide	242	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|membrane attack complex (GO:0005579)|vesicle (GO:0031982)		p.R242C(1)|p.R242G(1)		breast(2)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|liver(1)|lung(20)|ovary(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	52						GTGACATTGCGTTCAAAATCT	0.338																																																2	Substitution - Missense(2)	ovary(1)|kidney(1)	1											88.0	87.0	87.0					1																	57415368		2202	4299	6501	57187956	SO:0001583	missense	732			M16973	CCDS30730.1, CCDS60151.1, CCDS60152.1	1p32.2	2014-09-17			ENSG00000021852	ENSG00000021852		"""Complement system"""	1353	protein-coding gene	gene with protein product		120960					Standard	NM_000066		Approved		uc001cyp.3	P07358	OTTHUMG00000008305	ENST00000371237.4:c.724C>G	1.37:g.57415368G>C	ENSP00000360281:p.Arg242Gly		57187956	A1L4K7	Missense_Mutation	SNP	ENST00000371237.4	37	CCDS30730.1	.	.	.	.	.	.	.	.	.	.	G	8.844	0.942859	0.18281	.	.	ENSG00000021852	ENST00000371237;ENST00000543257;ENST00000535057	T;T;T	0.28255	1.78;1.79;1.62	5.19	3.19	0.36642	Membrane attack complex component/perforin (MACPF) domain (1);	1.053100	0.07284	N	0.871299	T	0.30603	0.0770	L	0.50333	1.59	0.09310	N	1	B;B;B	0.28082	0.151;0.151;0.2	B;B;B	0.25987	0.065;0.065;0.041	T	0.25950	-1.0117	10	0.52906	T	0.07	-0.8703	9.8148	0.40846	0.0801:0.0:0.7048:0.2151	.	190;180;242	F5H7G1;F5GY80;P07358	.;.;CO8B_HUMAN	G	242;190;180	ENSP00000360281:R242G;ENSP00000442548:R190G;ENSP00000440113:R180G	ENSP00000360281:R242G	R	-	1	0	C8B	57187956	0.009000	0.17119	0.125000	0.21846	0.376000	0.30014	-0.028000	0.12350	1.318000	0.45170	0.591000	0.81541	CGC		0.338	C8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022886.2		
ZZZ3	26009	broad.mit.edu	37	1	78041807	78041807	+	Silent	SNP	A	A	G			TCGA-59-2351-01A-01W-0799-08	TCGA-59-2351-10A-01W-0800-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	930e9c43-af1e-47bc-8ee2-b3bd8a11bb8b	a31b2f09-d6d7-4ce2-a7b4-fd706c7a1c0f	g.chr1:78041807A>G	ENST00000370801.3	-	12	2752	c.2277T>C	c.(2275-2277)gaT>gaC	p.D759D	ZZZ3_ENST00000476275.1_5'UTR|ZZZ3_ENST00000370798.1_Silent_p.D265D	NM_015534.4	NP_056349.1	Q8IYH5	ZZZ3_HUMAN	zinc finger, ZZ-type containing 3	759					chromatin organization (GO:0006325)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.D759D(1)		breast(2)|endometrium(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(1)|stomach(1)|urinary_tract(2)	39						ATCGGTCATCATCTTCATCCA	0.393																																																1	Substitution - coding silent(1)	ovary(1)	1											200.0	181.0	188.0					1																	78041807		2203	4300	6503	77814395	SO:0001819	synonymous_variant	26009			AL080063	CCDS677.1	1p31.1	2012-08-13			ENSG00000036549	ENSG00000036549		"""Zinc fingers, ZZ-type"""	24523	protein-coding gene	gene with protein product	"""ATAC component 1 homolog (Drosophila)"""					16428443, 21304275	Standard	NM_015534		Approved	DKFZP564I052, ATAC1	uc001dhq.3	Q8IYH5	OTTHUMG00000009652	ENST00000370801.3:c.2277T>C	1.37:g.78041807A>G			77814395	B7WPC6|Q6N004|Q6N070|Q8IYP0|Q8IYR1|Q8TEK4|Q9Y4U0	Silent	SNP	ENST00000370801.3	37	CCDS677.1																																																																																				0.393	ZZZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026615.1	NM_015534	
SORT1	6272	broad.mit.edu	37	1	109870143	109870143	+	Silent	SNP	G	G	A			TCGA-59-2351-01A-01W-0799-08	TCGA-59-2351-10A-01W-0800-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	930e9c43-af1e-47bc-8ee2-b3bd8a11bb8b	a31b2f09-d6d7-4ce2-a7b4-fd706c7a1c0f	g.chr1:109870143G>A	ENST00000256637.6	-	12	1510	c.1452C>T	c.(1450-1452)gcC>gcT	p.A484A	SORT1_ENST00000538502.1_Silent_p.A347A	NM_002959.5	NP_002950.3	Q99523	SORT_HUMAN	sortilin 1	484					endocytosis (GO:0006897)|endosome to lysosome transport (GO:0008333)|endosome transport via multivesicular body sorting pathway (GO:0032509)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose import (GO:0046323)|Golgi to endosome transport (GO:0006895)|multicellular organismal development (GO:0007275)|myotube differentiation (GO:0014902)|negative regulation of lipoprotein lipase activity (GO:0051005)|nerve growth factor signaling pathway (GO:0038180)|neuropeptide signaling pathway (GO:0007218)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification (GO:0001503)|plasma membrane to endosome transport (GO:0048227)|regulation of gene expression (GO:0010468)|response to insulin (GO:0032868)|vesicle organization (GO:0016050)	cell surface (GO:0009986)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasmic membrane-bounded vesicle (GO:0016023)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|trans-Golgi network transport vesicle (GO:0030140)	enzyme binding (GO:0019899)|nerve growth factor binding (GO:0048406)|nerve growth factor receptor activity (GO:0010465)|neurotensin receptor activity, non-G-protein coupled (GO:0030379)	p.A484A(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(9)|lung(5)|ovary(2)|prostate(1)|skin(1)	26		all_epithelial(167;4.69e-05)|all_lung(203;0.00016)|Lung NSC(277;0.000318)|Breast(1374;0.244)		Lung(183;0.0529)|Colorectal(144;0.142)|Epithelial(280;0.145)|Kidney(133;0.169)|all cancers(265;0.184)		CAATGCCTACGGCATTCGGCT	0.498																																																1	Substitution - coding silent(1)	ovary(1)	1											93.0	82.0	86.0					1																	109870143		2203	4300	6503	109671666	SO:0001819	synonymous_variant	6272			BC023542	CCDS798.1, CCDS55618.1	1p13.3	2008-05-14			ENSG00000134243	ENSG00000134243			11186	protein-coding gene	gene with protein product		602458					Standard	NM_002959		Approved	Gp95, NT3	uc001dxm.2	Q99523	OTTHUMG00000011999	ENST00000256637.6:c.1452C>T	1.37:g.109870143G>A			109671666	B4DWI3|C0JYZ0|Q8IZ49	Silent	SNP	ENST00000256637.6	37	CCDS798.1																																																																																				0.498	SORT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033179.1	NM_002959	
FLG2	388698	broad.mit.edu	37	1	152325862	152325862	+	Missense_Mutation	SNP	G	G	A			TCGA-59-2351-01A-01W-0799-08	TCGA-59-2351-10A-01W-0800-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	930e9c43-af1e-47bc-8ee2-b3bd8a11bb8b	a31b2f09-d6d7-4ce2-a7b4-fd706c7a1c0f	g.chr1:152325862G>A	ENST00000388718.5	-	3	4472	c.4400C>T	c.(4399-4401)aCt>aTt	p.T1467I	FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000445097.1_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	1467					establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.T1467I(1)		NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TCCATGAGTAGTTCCGTGTCT	0.507																																																1	Substitution - Missense(1)	ovary(1)	1											446.0	396.0	413.0					1																	152325862		2203	4300	6503	150592486	SO:0001583	missense	388698			AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.4400C>T	1.37:g.152325862G>A	ENSP00000373370:p.Thr1467Ile		150592486	Q9H4U1	Missense_Mutation	SNP	ENST00000388718.5	37	CCDS30861.1	.	.	.	.	.	.	.	.	.	.	G	9.469	1.095023	0.20471	.	.	ENSG00000143520	ENST00000388718	T	0.51817	0.69	2.59	1.65	0.23941	.	.	.	.	.	T	0.23014	0.0556	M	0.63843	1.955	0.09310	N	1	B	0.24721	0.11	B	0.27500	0.08	T	0.30504	-0.9976	9	0.49607	T	0.09	0.0011	5.4653	0.16639	0.1701:0.0:0.8299:0.0	.	1467	Q5D862	FILA2_HUMAN	I	1467	ENSP00000373370:T1467I	ENSP00000373370:T1467I	T	-	2	0	FLG2	150592486	0.000000	0.05858	0.000000	0.03702	0.085000	0.17905	-0.605000	0.05661	0.457000	0.26962	0.297000	0.19635	ACT		0.507	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034018.5	NM_001014342	
S100A2	6273	broad.mit.edu	37	1	153533949	153533949	+	Missense_Mutation	SNP	T	T	C			TCGA-59-2351-01A-01W-0799-08	TCGA-59-2351-10A-01W-0800-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	930e9c43-af1e-47bc-8ee2-b3bd8a11bb8b	a31b2f09-d6d7-4ce2-a7b4-fd706c7a1c0f	g.chr1:153533949T>C	ENST00000368708.3	-	3	632	c.260A>G	c.(259-261)aAt>aGt	p.N87S	S100A2_ENST00000368710.1_Missense_Mutation_p.N87S|S100A2_ENST00000497140.1_Missense_Mutation_p.N54S|S100A2_ENST00000368709.1_Missense_Mutation_p.N87S|S100A2_ENST00000368707.4_3'UTR|S100A2_ENST00000487430.2_Missense_Mutation_p.N87S	NM_005978.3	NP_005969.1	P29034	S10A2_HUMAN	S100 calcium binding protein A2	88					endothelial cell migration (GO:0043542)		calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)	p.N87S(1)		endometrium(1)|large_intestine(2)|lung(1)|ovary(1)	5	all_lung(78;5.98e-32)|Lung NSC(65;2.27e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.171)		Olopatadine(DB00768)	GAAGAAGTCATTGCACATGAC	0.537																																																1	Substitution - Missense(1)	ovary(1)	1											191.0	183.0	186.0					1																	153533949		2203	4300	6503	151800573	SO:0001583	missense	6273			BC002829	CCDS1044.1	1q21	2013-01-10	2001-11-28		ENSG00000196754	ENSG00000196754		"""S100 calcium binding proteins"", ""EF-hand domain containing"""	10492	protein-coding gene	gene with protein product		176993	"""S100 calcium-binding protein A2"""	S100L		8341667	Standard	NM_005978		Approved	CAN19	uc001fcb.3	P29034	OTTHUMG00000035031	ENST00000368708.3:c.260A>G	1.37:g.153533949T>C	ENSP00000357697:p.Asn87Ser		151800573	O00266|Q3KRB9|Q5RHS8|Q9BU83	Missense_Mutation	SNP	ENST00000368708.3	37	CCDS1044.1	.	.	.	.	.	.	.	.	.	.	T	12.80	2.045769	0.36085	.	.	ENSG00000196754	ENST00000368708;ENST00000368710;ENST00000368709;ENST00000368707	T;T;T	0.14144	2.53;2.53;2.53	4.79	3.63	0.41609	EF-hand-like domain (1);	0.140459	0.44688	D	0.000435	T	0.03434	0.0099	.	.	.	0.29297	N	0.868948	P	0.45768	0.866	B	0.34489	0.184	T	0.28964	-1.0027	9	0.66056	D	0.02	.	7.4649	0.27316	0.0:0.1048:0.0:0.8952	.	88	P29034	S10A2_HUMAN	S	87;87;87;128	ENSP00000357697:N87S;ENSP00000357699:N87S;ENSP00000357698:N87S	ENSP00000357696:N128S	N	-	2	0	S100A2	151800573	0.992000	0.36948	0.970000	0.41538	0.580000	0.36256	2.320000	0.43797	1.920000	0.55613	0.533000	0.62120	AAT		0.537	S100A2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084789.1	NM_005978	
ATP1A4	480	broad.mit.edu	37	1	160128842	160128842	+	Silent	SNP	G	G	A			TCGA-59-2351-01A-01W-0799-08	TCGA-59-2351-10A-01W-0800-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	930e9c43-af1e-47bc-8ee2-b3bd8a11bb8b	a31b2f09-d6d7-4ce2-a7b4-fd706c7a1c0f	g.chr1:160128842G>A	ENST00000368081.4	+	5	1047	c.576G>A	c.(574-576)gaG>gaA	p.E192E		NM_144699.3	NP_653300.2	Q13733	AT1A4_HUMAN	ATPase, Na+/K+ transporting, alpha 4 polypeptide	192					ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|fertilization (GO:0009566)|ion transmembrane transport (GO:0034220)|potassium ion transport (GO:0006813)|regulation of cellular pH (GO:0030641)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)	p.E192E(1)		breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(34)|ovary(2)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	75	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			ATGTACAAGAGGTGGTGTTGG	0.488																																																1	Substitution - coding silent(1)	ovary(1)	1											132.0	117.0	122.0					1																	160128842		2203	4300	6503	158395466	SO:0001819	synonymous_variant	480			BC028297	CCDS1197.1, CCDS44255.1	1q23.2	2012-10-22	2002-02-25		ENSG00000132681	ENSG00000132681		"""ATPases / P-type"""	14073	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-4"", ""sodium pump subunit alpha-4"", ""sodium-potassium ATPase catalytic subunit alpha-4"""	607321	"""ATPase, Na+/K+ transporting, alpha polypeptide-like 2"""	ATP1AL2		1981991, 3035563	Standard	NM_144699		Approved		uc001fve.4	Q13733	OTTHUMG00000031609	ENST00000368081.4:c.576G>A	1.37:g.160128842G>A			158395466	Q504T2|Q7Z4I9|Q8TBN8|Q8WXA7|Q8WXH7|Q8WY13	Silent	SNP	ENST00000368081.4	37	CCDS1197.1																																																																																				0.488	ATP1A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077415.1	NM_144699	
SCYL3	57147	broad.mit.edu	37	1	169823884	169823884	+	Missense_Mutation	SNP	C	C	T			TCGA-59-2351-01A-01W-0799-08	TCGA-59-2351-10A-01W-0800-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	930e9c43-af1e-47bc-8ee2-b3bd8a11bb8b	a31b2f09-d6d7-4ce2-a7b4-fd706c7a1c0f	g.chr1:169823884C>T	ENST00000367770.1	-	12	1743	c.1696G>A	c.(1696-1698)Gaa>Aaa	p.E566K	SCYL3_ENST00000367771.6_Missense_Mutation_p.E512K|SCYL3_ENST00000367772.4_Missense_Mutation_p.E566K			Q8IZE3	PACE1_HUMAN	SCY1-like 3 (S. cerevisiae)	566	Interaction with EZR.				cell migration (GO:0016477)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)	ATP binding (GO:0005524)|transferase activity, transferring phosphorus-containing groups (GO:0016772)	p.E512K(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(5)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	27	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					GATGACTCTTCCACATCCAAG	0.478																																																1	Substitution - Missense(1)	ovary(1)	1											116.0	116.0	116.0					1																	169823884		2203	4300	6503	168090508	SO:0001583	missense	57147			BC014662	CCDS1286.1, CCDS1287.1	1q24.2	2008-02-05			ENSG00000000457	ENSG00000000457			19285	protein-coding gene	gene with protein product	"""ezrin-binding partner PACE-1"""	608192				12651155	Standard	NM_020423		Approved	PACE-1, PACE1	uc001ggs.3	Q8IZE3	OTTHUMG00000035941	ENST00000367770.1:c.1696G>A	1.37:g.169823884C>T	ENSP00000356744:p.Glu566Lys		168090508	A8K8Z2|Q5THA6|Q5THA8|Q8IZN9|Q96C56|Q9UBK6	Missense_Mutation	SNP	ENST00000367770.1	37	CCDS1287.1	.	.	.	.	.	.	.	.	.	.	C	9.862	1.196570	0.22037	.	.	ENSG00000000457	ENST00000367772;ENST00000367771;ENST00000367770;ENST00000423670	T;T;T;T	0.15834	2.48;2.47;2.48;2.39	5.74	0.0455	0.14230	.	2.474260	0.01387	N	0.013127	T	0.04588	0.0125	L	0.60455	1.87	0.09310	N	1	B;B;B	0.14438	0.01;0.001;0.002	B;B;B	0.16722	0.016;0.002;0.004	T	0.25745	-1.0123	10	0.11794	T	0.64	-0.024	2.5486	0.04743	0.1174:0.3293:0.3435:0.2099	.	158;512;566	B4E2Y0;Q8IZE3-2;Q8IZE3	.;.;PACE1_HUMAN	K	566;512;566;512	ENSP00000356746:E566K;ENSP00000356745:E512K;ENSP00000356744:E566K;ENSP00000407993:E512K	ENSP00000356744:E566K	E	-	1	0	SCYL3	168090508	0.013000	0.17824	0.000000	0.03702	0.011000	0.07611	1.450000	0.35134	-0.249000	0.09569	-0.181000	0.13052	GAA		0.478	SCYL3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087550.4	NM_181093	
RGL1	23179	broad.mit.edu	37	1	183874041	183874041	+	Missense_Mutation	SNP	A	A	C			TCGA-59-2351-01A-01W-0799-08	TCGA-59-2351-10A-01W-0800-08	A	A	C	C	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	930e9c43-af1e-47bc-8ee2-b3bd8a11bb8b	a31b2f09-d6d7-4ce2-a7b4-fd706c7a1c0f	g.chr1:183874041A>C	ENST00000360851.3	+	13	1586	c.1408A>C	c.(1408-1410)Atg>Ctg	p.M470L	RGL1_ENST00000304685.4_Missense_Mutation_p.M505L|RGL1_ENST00000539189.1_Missense_Mutation_p.M441L|RGL1_ENST00000536277.1_Missense_Mutation_p.M468L			Q9NZL6	RGL1_HUMAN	ral guanine nucleotide dissociation stimulator-like 1	470	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				cellular lipid metabolic process (GO:0044255)|positive regulation of Ral GTPase activity (GO:0032852)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	Ral guanyl-nucleotide exchange factor activity (GO:0008321)	p.M505L(1)		breast(5)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(17)|ovary(4)|prostate(3)|stomach(1)	51						CAGCTATTGCATGACCCCAGA	0.453																																																1	Substitution - Missense(1)	ovary(1)	1											127.0	125.0	125.0					1																	183874041		2203	4300	6503	182140664	SO:0001583	missense	23179			AF186780	CCDS1359.1, CCDS72992.1	1q25.2	2008-02-05			ENSG00000143344	ENSG00000143344			30281	protein-coding gene	gene with protein product		605667				10760592, 10231032	Standard	XM_005245010		Approved	RGL	uc001gqm.3	Q9NZL6	OTTHUMG00000035328	ENST00000360851.3:c.1408A>C	1.37:g.183874041A>C	ENSP00000354097:p.Met470Leu		182140664	Q5SXQ2|Q5SXQ6|Q9HBY3|Q9HBY4|Q9NZL5|Q9UG43|Q9Y2G6	Missense_Mutation	SNP	ENST00000360851.3	37		.	.	.	.	.	.	.	.	.	.	A	1.352	-0.591034	0.03799	.	.	ENSG00000143344	ENST00000304685;ENST00000367531;ENST00000536277;ENST00000543395;ENST00000360851;ENST00000539189	T;T;T;T;T	0.23754	1.89;1.89;1.89;1.89;1.89	5.52	5.52	0.82312	Guanine-nucleotide dissociation stimulator CDC25 (3);Ras guanine nucleotide exchange factor, domain (1);	0.046816	0.85682	D	0.000000	T	0.04497	0.0123	N	0.00080	-2.225	0.46458	D	0.999059	B;B;B;B;B	0.06786	0.001;0.0;0.0;0.0;0.0	B;B;B;B;B	0.06405	0.002;0.001;0.0;0.0;0.001	T	0.36212	-0.9757	10	0.02654	T	1	.	10.5366	0.45007	0.8556:0.0:0.0:0.1444	.	441;468;275;470;505	F5H6U6;B7Z2W5;F5H3C3;Q9NZL6;Q5SXQ6	.;.;.;RGL1_HUMAN;.	L	505;505;468;275;470;441	ENSP00000303192:M505L;ENSP00000356501:M505L;ENSP00000438662:M468L;ENSP00000354097:M470L;ENSP00000437355:M441L	ENSP00000303192:M505L	M	+	1	0	RGL1	182140664	0.990000	0.36364	0.936000	0.37596	0.503000	0.33858	2.819000	0.48049	2.093000	0.63338	0.528000	0.53228	ATG		0.453	RGL1-002	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000085742.1	NM_015149	
HMCN1	83872	broad.mit.edu	37	1	186008099	186008099	+	Missense_Mutation	SNP	C	C	G			TCGA-59-2351-01A-01W-0799-08	TCGA-59-2351-10A-01W-0800-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	930e9c43-af1e-47bc-8ee2-b3bd8a11bb8b	a31b2f09-d6d7-4ce2-a7b4-fd706c7a1c0f	g.chr1:186008099C>G	ENST00000271588.4	+	38	6219	c.5990C>G	c.(5989-5991)gCt>gGt	p.A1997G	HMCN1_ENST00000367492.2_Missense_Mutation_p.A1997G	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	1997	Ig-like C2-type 17.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)	p.A1997G(1)		NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						ATCAACTCAGCTGGAGCTACA	0.418																																																1	Substitution - Missense(1)	ovary(1)	1											102.0	95.0	97.0					1																	186008099		2203	4300	6503	184274722	SO:0001583	missense	83872			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.5990C>G	1.37:g.186008099C>G	ENSP00000271588:p.Ala1997Gly		184274722	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	ENST00000271588.4	37	CCDS30956.1	.	.	.	.	.	.	.	.	.	.	C	32	5.128436	0.94473	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.68624	-0.34;-0.34	5.85	5.85	0.93711	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.81273	0.4788	M	0.68317	2.08	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	T	0.78003	-0.2374	10	0.36615	T	0.2	.	19.7585	0.96304	0.0:1.0:0.0:0.0	.	1997	Q96RW7	HMCN1_HUMAN	G	1997	ENSP00000271588:A1997G;ENSP00000356462:A1997G	ENSP00000271588:A1997G	A	+	2	0	HMCN1	184274722	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	5.413000	0.66399	2.773000	0.95371	0.655000	0.94253	GCT		0.418	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935	
CFH	3075	broad.mit.edu	37	1	196695952	196695952	+	Silent	SNP	C	C	A			TCGA-59-2351-01A-01W-0799-08	TCGA-59-2351-10A-01W-0800-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	930e9c43-af1e-47bc-8ee2-b3bd8a11bb8b	a31b2f09-d6d7-4ce2-a7b4-fd706c7a1c0f	g.chr1:196695952C>A	ENST00000367429.4	+	14	2358	c.2118C>A	c.(2116-2118)tcC>tcA	p.S706S		NM_000186.3	NP_000177.2	P08603	CFAH_HUMAN	complement factor H	706	Sushi 12. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heparan sulfate proteoglycan binding (GO:0043395)|heparin binding (GO:0008201)	p.S706S(1)		NS(3)|breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(24)|lung(33)|ovary(1)|prostate(5)|skin(9)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	101						AGCTTTCTTCCCCTCCTTATT	0.383																																																1	Substitution - coding silent(1)	ovary(1)	1											114.0	114.0	114.0					1																	196695952		2203	4300	6503	194962575	SO:0001819	synonymous_variant	3075			Y00716	CCDS1385.1	1q32	2014-09-17	2004-08-09	2004-08-12	ENSG00000000971	ENSG00000000971		"""Complement system"""	4883	protein-coding gene	gene with protein product	"""beta-1H"", ""H factor 2 (complement)"", ""age-related maculopathy susceptibility 1"""	134370	"""H factor 1 (complement)"""	HF, HF1, HF2		2889480, 2963625	Standard	NM_000186		Approved	HUS, FHL1, ARMS1, ARMD4	uc001gtj.4	P08603	OTTHUMG00000035607	ENST00000367429.4:c.2118C>A	1.37:g.196695952C>A			194962575	A5PL14|P78435|Q14570|Q2TAZ5|Q38G77|Q5TFM3|Q8N708|Q9NU86	Silent	SNP	ENST00000367429.4	37	CCDS1385.1																																																																																				0.383	CFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086412.2	NM_000186	
HEATR1	55127	broad.mit.edu	37	1	236748330	236748330	+	Missense_Mutation	SNP	C	C	T			TCGA-59-2351-01A-01W-0799-08	TCGA-59-2351-10A-01W-0800-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	930e9c43-af1e-47bc-8ee2-b3bd8a11bb8b	a31b2f09-d6d7-4ce2-a7b4-fd706c7a1c0f	g.chr1:236748330C>T	ENST00000366582.3	-	17	2350	c.2236G>A	c.(2236-2238)Gca>Aca	p.A746T	HEATR1_ENST00000366581.2_Missense_Mutation_p.A746T	NM_018072.5	NP_060542.4	Q9H583	HEAT1_HUMAN	HEAT repeat containing 1	746					rRNA processing (GO:0006364)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)	p.A746T(1)		NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(18)|lung(28)|ovary(3)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	87	Ovarian(103;0.0634)|Breast(184;0.133)	all_cancers(173;0.0255)|Prostate(94;0.175)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			CTTACCACTGCAGTAATGACA	0.383																																																1	Substitution - Missense(1)	ovary(1)	1											75.0	77.0	77.0					1																	236748330		2203	4300	6503	234814953	SO:0001583	missense	55127			BC065205	CCDS31066.1	1q43	2011-08-12			ENSG00000119285	ENSG00000119285			25517	protein-coding gene	gene with protein product	"""UTP10, small subunit (SSU) processome component, homolog (yeast)"""					17699751	Standard	NM_018072		Approved	FLJ10359, BAP28, UTP10	uc001hyd.2	Q9H583	OTTHUMG00000040061	ENST00000366582.3:c.2236G>A	1.37:g.236748330C>T	ENSP00000355541:p.Ala746Thr		234814953	Q5T3Q8|Q6P197|Q9NW23	Missense_Mutation	SNP	ENST00000366582.3	37	CCDS31066.1	.	.	.	.	.	.	.	.	.	.	C	12.54	1.967150	0.34754	.	.	ENSG00000119285	ENST00000366582;ENST00000366581	T;T	0.05258	3.49;3.47	5.93	1.48	0.22813	Armadillo-type fold (1);	0.573109	0.18996	N	0.125490	T	0.03390	0.0098	N	0.16307	0.4	0.18873	N	0.999982	B	0.02656	0.0	B	0.04013	0.001	T	0.46317	-0.9200	10	0.17369	T	0.5	.	6.5131	0.22232	0.1362:0.6266:0.0:0.2372	.	746	Q9H583	HEAT1_HUMAN	T	746	ENSP00000355541:A746T;ENSP00000355540:A746T	ENSP00000355540:A746T	A	-	1	0	HEATR1	234814953	0.506000	0.26139	0.249000	0.24280	0.133000	0.20885	0.431000	0.21444	0.396000	0.25283	-0.218000	0.12543	GCA		0.383	HEATR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096635.1	XM_375853	
FMN2	56776	broad.mit.edu	37	1	240370875	240370875	+	Silent	SNP	T	T	C	rs200259735		TCGA-59-2351-01A-01W-0799-08	TCGA-59-2351-10A-01W-0800-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	930e9c43-af1e-47bc-8ee2-b3bd8a11bb8b	a31b2f09-d6d7-4ce2-a7b4-fd706c7a1c0f	g.chr1:240370875T>C	ENST00000319653.9	+	5	2993	c.2763T>C	c.(2761-2763)ccT>ccC	p.P921P		NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	921	FH1.|Pro-rich.				cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)	p.P1064P(1)		NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			CGGGCATACCTCCTCCGCCGC	0.662																																																1	Substitution - coding silent(1)	ovary(1)	1											41.0	47.0	45.0					1																	240370875		2203	4300	6503	238437498	SO:0001819	synonymous_variant	56776			AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.2763T>C	1.37:g.240370875T>C			238437498	B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Silent	SNP	ENST00000319653.9	37	CCDS31069.2																																																																																				0.662	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096217.2	XM_371352	
DNA2	1763	broad.mit.edu	37	10	70225458	70225458	+	Missense_Mutation	SNP	G	G	C			TCGA-59-2351-01A-01W-0799-08	TCGA-59-2351-10A-01W-0800-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	930e9c43-af1e-47bc-8ee2-b3bd8a11bb8b	a31b2f09-d6d7-4ce2-a7b4-fd706c7a1c0f	g.chr10:70225458G>C	ENST00000358410.3	-	4	603	c.553C>G	c.(553-555)Caa>Gaa	p.Q185E	DNA2_ENST00000399179.2_Missense_Mutation_p.Q185E|DNA2_ENST00000399180.2_Missense_Mutation_p.Q271E	NM_001080449.2	NP_001073918.2	P51530	DNA2_HUMAN	DNA replication helicase/nuclease 2	185	Nuclease activity. {ECO:0000250}.				ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing (GO:0000729)|DNA duplex unwinding (GO:0032508)|DNA replication (GO:0006260)|DNA replication checkpoint (GO:0000076)|DNA replication, Okazaki fragment processing (GO:0033567)|DNA replication, removal of RNA primer (GO:0043137)|DNA strand elongation involved in DNA replication (GO:0006271)|mitochondrial DNA repair (GO:0043504)|mitochondrial DNA replication (GO:0006264)|mitotic cell cycle (GO:0000278)|positive regulation of DNA replication (GO:0045740)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	mitochondrial nucleoid (GO:0042645)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|5'-3' DNA helicase activity (GO:0043139)|5'-flap endonuclease activity (GO:0017108)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|nuclease activity (GO:0004518)|single-stranded DNA-dependent ATPase activity (GO:0043142)|site-specific endodeoxyribonuclease activity, specific for altered base (GO:0016890)	p.Q185E(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(7)|prostate(1)	20						TGAATTGTTTGAAAAGCAAGT	0.333																																																1	Substitution - Missense(1)	ovary(1)	10											59.0	56.0	57.0					10																	70225458		1802	4074	5876	69895464	SO:0001583	missense	1763			D42046	CCDS44415.1, CCDS44415.2	10q21.3-q22.1	2013-05-13	2013-05-13	2008-01-08	ENSG00000138346	ENSG00000138346			2939	protein-coding gene	gene with protein product		601810	"""DNA2 DNA replication helicase 2-like (yeast)"", ""DNA replication helicase 2 homolog (yeast)"""	DNA2L		8938459, 17032657, 23352259	Standard	NM_001080449		Approved	KIAA0083	uc031pvh.1	P51530	OTTHUMG00000018352	ENST00000358410.3:c.553C>G	10.37:g.70225458G>C	ENSP00000351185:p.Gln185Glu		69895464	Q2NKM1|Q5TC49|Q5TC50|Q6P455|Q6PI80|Q7Z6H9|Q8N346	Missense_Mutation	SNP	ENST00000358410.3	37		.	.	.	.	.	.	.	.	.	.	G	8.007	0.756578	0.15846	.	.	ENSG00000138346	ENST00000551118;ENST00000399180;ENST00000399179;ENST00000358410	D;D;D	0.93076	-2.67;-3.16;-2.66	5.8	3.91	0.45181	DNA replication factor Dna2 (1);	0.551044	0.19995	N	0.101462	D	0.83004	0.5160	N	0.13098	0.295	0.21527	N	0.999654	B;B	0.22746	0.041;0.074	B;B	0.23150	0.007;0.044	T	0.66677	-0.5863	10	0.02654	T	1	.	8.6156	0.33829	0.069:0.0:0.5399:0.3911	.	185;185	F8VR31;P51530	.;DNA2L_HUMAN	E	185;271;185;185	ENSP00000382133:Q271E;ENSP00000382132:Q185E;ENSP00000351185:Q185E	ENSP00000351185:Q185E	Q	-	1	0	DNA2	69895464	0.930000	0.31532	1.000000	0.80357	0.992000	0.81027	1.385000	0.34408	0.755000	0.32990	0.585000	0.79938	CAA		0.333	DNA2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000048334.2		
MICU1	10367	broad.mit.edu	37	10	74135575	74135575	+	Silent	SNP	C	C	G	rs545259526		TCGA-59-2351-01A-01W-0799-08	TCGA-59-2351-10A-01W-0800-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	930e9c43-af1e-47bc-8ee2-b3bd8a11bb8b	a31b2f09-d6d7-4ce2-a7b4-fd706c7a1c0f	g.chr10:74135575C>G	ENST00000361114.5	-	11	1332	c.1236G>C	c.(1234-1236)gtG>gtC	p.V412V	MICU1_ENST00000418483.2_Silent_p.V214V|MICU1_ENST00000398761.4_Silent_p.V414V|MICU1_ENST00000398763.4_Silent_p.V214V|MICU1_ENST00000401998.3_Silent_p.V412V	NM_001195518.1|NM_006077.3	NP_001182447.1|NP_006068.2	Q9BPX6	MICU1_HUMAN	mitochondrial calcium uptake 1	412	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				calcium ion import (GO:0070509)|calcium ion transmembrane import into mitochondrion (GO:0036444)|defense response (GO:0006952)|mitochondrial calcium ion homeostasis (GO:0051560)|mitochondrial calcium ion transport (GO:0006851)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)|protein homooligomerization (GO:0051260)	calcium channel complex (GO:0034704)|integral component of mitochondrial membrane (GO:0032592)|intracellular (GO:0005622)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|uniplex complex (GO:1990246)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)	p.V414V(1)									CCACATCACACACGTGGTCTG	0.532													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18160	0.0		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	10											75.0	76.0	76.0					10																	74135575		2092	4225	6317	73805581	SO:0001819	synonymous_variant	10367			Y17711	CCDS55714.1, CCDS55715.1	10q22.1	2013-01-10	2011-06-23	2011-06-23	ENSG00000107745	ENSG00000107745		"""EF-hand domain containing"""	1530	protein-coding gene	gene with protein product		605084	"""calcium binding atopy-related autoantigen 1"""	CBARA1		9806765, 20693986	Standard	NM_006077		Approved	CALC, EFHA3, FLJ12684	uc001jtb.2	Q9BPX6	OTTHUMG00000018437	ENST00000361114.5:c.1236G>C	10.37:g.74135575C>G			73805581	A8MV96|B3KN20|B4DJH9|B4DPI1|B5MBY3|D3YTJ3|O75785|Q9H9N6|Q9UFX0	Silent	SNP	ENST00000361114.5	37	CCDS55715.1																																																																																				0.532	MICU1-002	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048586.1	NM_006077	
LRIT2	340745	broad.mit.edu	37	10	85985240	85985240	+	Missense_Mutation	SNP	C	C	T			TCGA-59-2351-01A-01W-0799-08	TCGA-59-2351-10A-01W-0800-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	930e9c43-af1e-47bc-8ee2-b3bd8a11bb8b	a31b2f09-d6d7-4ce2-a7b4-fd706c7a1c0f	g.chr10:85985240C>T	ENST00000372113.4	-	1	42	c.37G>A	c.(37-39)Gtc>Atc	p.V13I	LRIT2_ENST00000538192.1_Missense_Mutation_p.V13I	NM_001017924.2	NP_001017924.1	A6NDA9	LRIT2_HUMAN	leucine-rich repeat, immunoglobulin-like and transmembrane domains 2	13						integral component of membrane (GO:0016021)		p.V13I(1)		central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(13)|ovary(3)|prostate(6)|urinary_tract(1)	32						TCCAGAAAGACCAGAACTAAC	0.468																																																1	Substitution - Missense(1)	ovary(1)	10											75.0	73.0	74.0					10																	85985240		2203	4300	6503	85975220	SO:0001583	missense	340745				CCDS31234.1, CCDS60581.1	10q23.2	2013-01-11	2007-06-19	2007-06-19	ENSG00000204033	ENSG00000204033		"""Immunoglobulin superfamily / I-set domain containing"""	23443	protein-coding gene	gene with protein product			"""leucine rich repeat containing 22"""	LRRC22			Standard	NM_001017924		Approved	AC022389.4	uc001kcy.3	A6NDA9	OTTHUMG00000018633	ENST00000372113.4:c.37G>A	10.37:g.85985240C>T	ENSP00000361185:p.Val13Ile		85975220	B7ZME6	Missense_Mutation	SNP	ENST00000372113.4	37	CCDS31234.1	.	.	.	.	.	.	.	.	.	.	C	2.715	-0.267931	0.05754	.	.	ENSG00000204033	ENST00000372113;ENST00000538192	T;T	0.61158	0.53;0.13	5.87	1.94	0.25998	.	0.471174	0.17748	N	0.163338	T	0.44561	0.1299	M	0.62723	1.935	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.06405	0.002;0.001	T	0.30149	-0.9988	10	0.18710	T	0.47	.	1.6407	0.02752	0.1319:0.4332:0.1286:0.3062	.	13;13	B7ZME6;A6NDA9	.;LRIT2_HUMAN	I	13	ENSP00000361185:V13I;ENSP00000438264:V13I	ENSP00000361185:V13I	V	-	1	0	LRIT2	85975220	0.000000	0.05858	0.008000	0.14137	0.024000	0.10985	-0.048000	0.11944	0.101000	0.17610	-0.794000	0.03295	GTC		0.468	LRIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049110.4	XM_291697	
SEC31B	25956	broad.mit.edu	37	10	102255224	102255224	+	Missense_Mutation	SNP	G	G	C			TCGA-59-2351-01A-01W-0799-08	TCGA-59-2351-10A-01W-0800-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	930e9c43-af1e-47bc-8ee2-b3bd8a11bb8b	a31b2f09-d6d7-4ce2-a7b4-fd706c7a1c0f	g.chr10:102255224G>C	ENST00000370345.3	-	19	2487	c.2390C>G	c.(2389-2391)cCc>cGc	p.P797R	SEC31B_ENST00000494350.1_5'Flank	NM_015490.3	NP_056305.1	Q9NQW1	SC31B_HUMAN	SEC31 homolog B (S. cerevisiae)	797					protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|vesicle coat (GO:0030120)		p.P797R(1)		NS(1)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(3)|lung(17)|ovary(1)|urinary_tract(1)	36		Colorectal(252;0.117)		Epithelial(162;2.36e-10)|all cancers(201;2.09e-08)		CCGGGGGAAGGGGAAAGGGGG	0.498																																																1	Substitution - Missense(1)	ovary(1)	10											67.0	62.0	64.0					10																	102255224		2203	4300	6503	102245214	SO:0001583	missense	25956			AF274863	CCDS7495.1	10q24.32	2013-01-10	2006-10-05	2006-09-07	ENSG00000075826	ENSG00000075826		"""WD repeat domain containing"""	23197	protein-coding gene	gene with protein product		610258	"""SEC31-like 2 (S. cerevisiae)"""	SEC31L2		16495487	Standard	NM_015490		Approved	SEC31B-1, DKFZP434M183	uc001krc.1	Q9NQW1	OTTHUMG00000019342	ENST00000370345.3:c.2390C>G	10.37:g.102255224G>C	ENSP00000359370:p.Pro797Arg		102245214	B7ZM75|Q6MZS3|Q86UF0|Q9Y4Q8	Missense_Mutation	SNP	ENST00000370345.3	37	CCDS7495.1	.	.	.	.	.	.	.	.	.	.	G	12.77	2.038415	0.35989	.	.	ENSG00000075826	ENST00000370345	T	0.57273	0.41	5.82	5.82	0.92795	.	0.277052	0.41500	D	0.000871	T	0.72479	0.3465	M	0.74881	2.28	0.80722	D	1	D;D	0.67145	0.996;0.992	D;D	0.71184	0.972;0.938	T	0.73100	-0.4089	10	0.54805	T	0.06	-15.8493	17.2565	0.87059	0.0:0.0:1.0:0.0	.	796;797	Q9NQW1-5;Q9NQW1	.;SC31B_HUMAN	R	797	ENSP00000359370:P797R	ENSP00000359370:P797R	P	-	2	0	SEC31B	102245214	1.000000	0.71417	0.569000	0.28460	0.079000	0.17450	5.241000	0.65384	2.757000	0.94681	0.561000	0.74099	CCC		0.498	SEC31B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051198.1	NM_015490	
DEPDC7	91614	broad.mit.edu	37	11	33054966	33054966	+	Missense_Mutation	SNP	C	C	A			TCGA-59-2351-01A-01W-0799-08	TCGA-59-2351-10A-01W-0800-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	930e9c43-af1e-47bc-8ee2-b3bd8a11bb8b	a31b2f09-d6d7-4ce2-a7b4-fd706c7a1c0f	g.chr11:33054966C>A	ENST00000241051.3	+	9	1593	c.1501C>A	c.(1501-1503)Cac>Aac	p.H501N	DEPDC7_ENST00000311388.3_Missense_Mutation_p.H492N	NM_001077242.1	NP_001070710.1	Q96QD5	DEPD7_HUMAN	DEP domain containing 7	501					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)		p.H492N(1)		endometrium(2)|large_intestine(4)|lung(8)|ovary(1)|skin(2)	17						CTATAAGTGTCACCCAGACAT	0.299																																																1	Substitution - Missense(1)	ovary(1)	11											82.0	81.0	81.0					11																	33054966		1796	4056	5852	33011542	SO:0001583	missense	91614				CCDS41632.1, CCDS41633.1	11p13	2006-03-24			ENSG00000121690	ENSG00000121690			29899	protein-coding gene	gene with protein product		612294				10568747	Standard	NM_001077242		Approved		uc001mub.3	Q96QD5	OTTHUMG00000166242	ENST00000241051.3:c.1501C>A	11.37:g.33054966C>A	ENSP00000241051:p.His501Asn		33011542	G5E941|Q8N602|Q8NCU9|Q9UGK5	Missense_Mutation	SNP	ENST00000241051.3	37	CCDS41632.1	.	.	.	.	.	.	.	.	.	.	C	11.60	1.688364	0.29962	.	.	ENSG00000121690	ENST00000241051;ENST00000311388	D;D	0.83250	-1.7;-1.7	5.25	5.25	0.73442	.	0.047246	0.85682	D	0.000000	T	0.78477	0.4289	L	0.56124	1.755	0.46149	D	0.998896	B;B	0.24043	0.096;0.002	B;B	0.27608	0.081;0.004	T	0.75340	-0.3352	10	0.49607	T	0.09	-4.3266	8.776	0.34762	0.2157:0.7083:0.0:0.076	.	492;501	G5E941;Q96QD5	.;DEPD7_HUMAN	N	501;492	ENSP00000241051:H501N;ENSP00000308971:H492N	ENSP00000241051:H501N	H	+	1	0	DEPDC7	33011542	1.000000	0.71417	1.000000	0.80357	0.782000	0.44232	4.732000	0.62029	2.605000	0.88082	0.557000	0.71058	CAC		0.299	DEPDC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388655.1	NM_139160	
GANAB	23193	broad.mit.edu	37	11	62398582	62398582	+	Nonsense_Mutation	SNP	G	G	C			TCGA-59-2351-01A-01W-0799-08	TCGA-59-2351-10A-01W-0800-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	930e9c43-af1e-47bc-8ee2-b3bd8a11bb8b	a31b2f09-d6d7-4ce2-a7b4-fd706c7a1c0f	g.chr11:62398582G>C	ENST00000356638.3	-	10	1086	c.1070C>G	c.(1069-1071)tCa>tGa	p.S357*	GANAB_ENST00000534422.1_5'Flank|GANAB_ENST00000540933.1_Nonsense_Mutation_p.S260*|GANAB_ENST00000534779.1_Nonsense_Mutation_p.S265*|GANAB_ENST00000346178.4_Nonsense_Mutation_p.S379*	NM_198334.1	NP_938148.1	Q14697	GANAB_HUMAN	glucosidase, alpha; neutral AB	357					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|glucosidase II complex (GO:0017177)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|glucan 1,3-alpha-glucosidase activity (GO:0033919)|poly(A) RNA binding (GO:0044822)	p.S357*(1)		central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(14)|ovary(3)|skin(2)|urinary_tract(3)	35					Miglitol(DB00491)	GCCAGTCTCTGACATCCAGCG	0.537																																					Melanoma(23;1005 1074 15747 18937)											1	Substitution - Nonsense(1)	ovary(1)	11											281.0	263.0	269.0					11																	62398582		2202	4299	6501	62155158	SO:0001587	stop_gained	23193			AF144074	CCDS8026.1, CCDS41656.1, CCDS60817.1, CCDS60818.1	11q12.3	2012-10-02			ENSG00000089597	ENSG00000089597	3.2.1.20		4138	protein-coding gene	gene with protein product		104160				10764838, 6342981	Standard	NM_198335		Approved	GluII, G2AN, KIAA0088	uc001nua.4	Q14697	OTTHUMG00000167696	ENST00000356638.3:c.1070C>G	11.37:g.62398582G>C	ENSP00000349053:p.Ser357*		62155158	A6NC20|Q8WTS9|Q9P0X0	Nonsense_Mutation	SNP	ENST00000356638.3	37	CCDS8026.1	.	.	.	.	.	.	.	.	.	.	G	37	6.527486	0.97637	.	.	ENSG00000089597	ENST00000346178;ENST00000356638;ENST00000534779;ENST00000540933	.	.	.	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-4.0538	16.4234	0.83790	0.0:0.0:1.0:0.0	.	.	.	.	X	379;357;265;260	.	ENSP00000340466:S379X	S	-	2	0	GANAB	62155158	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	9.541000	0.98083	2.750000	0.94351	0.563000	0.77884	TCA		0.537	GANAB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000395689.1	NM_198334	
GALNT8	26290	broad.mit.edu	37	12	4853717	4853717	+	Missense_Mutation	SNP	G	G	C			TCGA-59-2351-01A-01W-0799-08	TCGA-59-2351-10A-01W-0800-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	930e9c43-af1e-47bc-8ee2-b3bd8a11bb8b	a31b2f09-d6d7-4ce2-a7b4-fd706c7a1c0f	g.chr12:4853717G>C	ENST00000252318.2	+	4	1048	c.711G>C	c.(709-711)aaG>aaC	p.K237N	RP11-234B24.6_ENST00000544741.2_3'UTR	NM_017417.1	NP_059113.1	Q9NY28	GALT8_HUMAN	polypeptide N-acetylgalactosaminyltransferase 8	237	Catalytic subdomain A.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.K237N(1)		central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(13)|ovary(2)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(1)	35						AGAAGATTAAGCTTTACAACC	0.423																																					Colon(108;631 1558 7270 20097 39846)											1	Substitution - Missense(1)	ovary(1)	12											83.0	75.0	78.0					12																	4853717		2203	4300	6503	4723978	SO:0001583	missense	26290			AJ271385	CCDS8533.1	12p13.32	2014-03-13	2014-03-13		ENSG00000130035	ENSG00000130035	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4130	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 8"""	606250	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 8 (GalNAc-T8)"""			10767557	Standard	NM_017417		Approved	GALNAC-T8	uc001qne.1	Q9NY28	OTTHUMG00000166188	ENST00000252318.2:c.711G>C	12.37:g.4853717G>C	ENSP00000252318:p.Lys237Asn		4723978	B2RU02	Missense_Mutation	SNP	ENST00000252318.2	37	CCDS8533.1	.	.	.	.	.	.	.	.	.	.	G	14.16	2.451577	0.43531	.	.	ENSG00000130035	ENST00000252318	T	0.60672	0.17	4.5	-0.604	0.11626	Glycosyl transferase, family 2 (1);	1.396440	0.04518	N	0.384047	T	0.60444	0.2269	M	0.67953	2.075	0.09310	N	1	P	0.48998	0.918	P	0.46685	0.524	T	0.53585	-0.8418	10	0.49607	T	0.09	.	7.8153	0.29256	0.4796:0.0:0.5204:0.0	.	237	Q9NY28	GALT8_HUMAN	N	237	ENSP00000252318:K237N	ENSP00000252318:K237N	K	+	3	2	GALNT8	4723978	0.000000	0.05858	0.001000	0.08648	0.937000	0.57800	-0.409000	0.07160	-0.055000	0.13244	-0.439000	0.05793	AAG		0.423	GALNT8-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388277.2	NM_017417	
TAS2R8	50836	broad.mit.edu	37	12	10958714	10958714	+	Missense_Mutation	SNP	T	T	C			TCGA-59-2351-01A-01W-0799-08	TCGA-59-2351-10A-01W-0800-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	930e9c43-af1e-47bc-8ee2-b3bd8a11bb8b	a31b2f09-d6d7-4ce2-a7b4-fd706c7a1c0f	g.chr12:10958714T>C	ENST00000240615.2	-	1	1178	c.866A>G	c.(865-867)aAt>aGt	p.N289S		NM_023918.1	NP_076407.1	Q9NYW2	TA2R8_HUMAN	taste receptor, type 2, member 8	289					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)	p.N289S(1)		endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14						CAGTTTATTATTTAAAACAAT	0.333																																																1	Substitution - Missense(1)	ovary(1)	12											28.0	30.0	29.0					12																	10958714		2200	4292	6492	10849981	SO:0001583	missense	50836			AF227134	CCDS8632.1	12p13	2012-08-22			ENSG00000121314	ENSG00000121314		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14915	protein-coding gene	gene with protein product		604794				10761934, 10766242	Standard	NM_023918		Approved	T2R8, TRB5	uc010shh.2	Q9NYW2	OTTHUMG00000168506	ENST00000240615.2:c.866A>G	12.37:g.10958714T>C	ENSP00000240615:p.Asn289Ser		10849981	Q4KN29|Q645Y2	Missense_Mutation	SNP	ENST00000240615.2	37	CCDS8632.1	.	.	.	.	.	.	.	.	.	.	T	10.21	1.288821	0.23478	.	.	ENSG00000121314	ENST00000240615	T	0.39997	1.05	4.86	2.42	0.29668	.	0.084393	0.43919	U	0.000505	T	0.55226	0.1907	M	0.71871	2.18	0.09310	N	1	D	0.71674	0.998	D	0.67382	0.951	T	0.44574	-0.9319	10	0.59425	D	0.04	.	5.947	0.19223	0.0:0.0895:0.1663:0.7441	.	289	Q9NYW2	TA2R8_HUMAN	S	289	ENSP00000240615:N289S	ENSP00000240615:N289S	N	-	2	0	TAS2R8	10849981	0.097000	0.21791	0.010000	0.14722	0.006000	0.05464	0.581000	0.23819	0.327000	0.23409	-0.256000	0.11100	AAT		0.333	TAS2R8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399932.1		
PIK3C2G	5288	broad.mit.edu	37	12	18499747	18499747	+	Silent	SNP	C	C	T			TCGA-59-2351-01A-01W-0799-08	TCGA-59-2351-10A-01W-0800-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	930e9c43-af1e-47bc-8ee2-b3bd8a11bb8b	a31b2f09-d6d7-4ce2-a7b4-fd706c7a1c0f	g.chr12:18499747C>T	ENST00000266497.5	+	10	1640	c.1602C>T	c.(1600-1602)aaC>aaT	p.N534N	PIK3C2G_ENST00000538779.1_Silent_p.N534N|PIK3C2G_ENST00000535651.1_Silent_p.N534N|PIK3C2G_ENST00000433979.1_Silent_p.N534N			O75747	P3C2G_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 gamma	534	C2 PI3K-type. {ECO:0000255|PROSITE- ProRule:PRU00880}.				chemotaxis (GO:0006935)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol phosphate kinase activity (GO:0016307)	p.N534N(1)		breast(5)|central_nervous_system(6)|endometrium(2)|kidney(4)|large_intestine(8)|lung(31)|ovary(2)|prostate(1)|skin(2)|stomach(4)|upper_aerodigestive_tract(1)	66		Hepatocellular(102;0.194)				CAGCACACAACATTCCAGAAA	0.418																																																1	Substitution - coding silent(1)	ovary(1)	12											58.0	55.0	56.0					12																	18499747		1938	4133	6071	18391014	SO:0001819	synonymous_variant	5288			AJ000008	CCDS44839.1, CCDS73452.1	12p12	2012-07-13	2012-07-13		ENSG00000139144	ENSG00000139144	2.7.1.154		8973	protein-coding gene	gene with protein product		609001	"""phosphoinositide-3-kinase, class 2, gamma polypeptide"""			9878262	Standard	XM_005253393		Approved		uc001rdt.3	O75747	OTTHUMG00000168841	ENST00000266497.5:c.1602C>T	12.37:g.18499747C>T			18391014	A1L3U0	Silent	SNP	ENST00000266497.5	37	CCDS44839.1																																																																																				0.418	PIK3C2G-002	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401316.1	NM_004570	
KMT2D	8085	broad.mit.edu	37	12	49432061	49432061	+	Silent	SNP	G	G	A			TCGA-59-2351-01A-01W-0799-08	TCGA-59-2351-10A-01W-0800-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	930e9c43-af1e-47bc-8ee2-b3bd8a11bb8b	a31b2f09-d6d7-4ce2-a7b4-fd706c7a1c0f	g.chr12:49432061G>A	ENST00000301067.7	-	34	9077	c.9078C>T	c.(9076-9078)ggC>ggT	p.G3026G	KMT2D_ENST00000549743.1_5'Flank	NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	3026					chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.G2756G(1)									TTTCTAAGGTGCCAAGTTCAT	0.522																																																1	Substitution - coding silent(1)	ovary(1)	12											104.0	106.0	105.0					12																	49432061		2067	4206	6273	47718328	SO:0001819	synonymous_variant	8085			AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.9078C>T	12.37:g.49432061G>A			47718328	O14687	Silent	SNP	ENST00000301067.7	37	CCDS44873.1																																																																																				0.522	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2		
KRT6B	3854	broad.mit.edu	37	12	52843335	52843335	+	Missense_Mutation	SNP	C	C	G			TCGA-59-2351-01A-01W-0799-08	TCGA-59-2351-10A-01W-0800-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	930e9c43-af1e-47bc-8ee2-b3bd8a11bb8b	a31b2f09-d6d7-4ce2-a7b4-fd706c7a1c0f	g.chr12:52843335C>G	ENST00000252252.3	-	5	1042	c.995G>C	c.(994-996)aGc>aCc	p.S332T		NM_005555.3	NP_005546.2	P04259	K2C6B_HUMAN	keratin 6B	332	Linker 12.|Rod.				ectoderm development (GO:0007398)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural constituent of cytoskeleton (GO:0005200)	p.S332T(1)		NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(19)|ovary(4)|prostate(2)	40				BRCA - Breast invasive adenocarcinoma(357;0.083)		AGCGATGATGCTGTCCAGGTC	0.557																																																1	Substitution - Missense(1)	ovary(1)	12											184.0	163.0	170.0					12																	52843335		2203	4298	6501	51129602	SO:0001583	missense	3854			BC034535	CCDS8828.1	12q13.13	2013-01-16	2004-08-11		ENSG00000185479	ENSG00000185479		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6444	protein-coding gene	gene with protein product		148042	"""keratin-like 1 (a type II keratin sequence)"""	KRTL1		1713141, 16831889	Standard	NM_005555		Approved		uc001sak.3	P04259	OTTHUMG00000169593	ENST00000252252.3:c.995G>C	12.37:g.52843335C>G	ENSP00000252252:p.Ser332Thr		51129602	P48669	Missense_Mutation	SNP	ENST00000252252.3	37	CCDS8828.1	.	.	.	.	.	.	.	.	.	.	C	17.41	3.383254	0.61845	.	.	ENSG00000185479	ENST00000252252;ENST00000544607	T	0.75477	-0.94	3.05	3.05	0.35203	Filament (1);	0.000000	0.64402	D	0.000001	D	0.88366	0.6417	M	0.92970	3.365	0.36243	D	0.853416	D	0.76494	0.999	D	0.74348	0.983	D	0.93607	0.6935	10	0.72032	D	0.01	.	15.3938	0.74774	0.0:1.0:0.0:0.0	.	332	P04259	K2C6B_HUMAN	T	332;292	ENSP00000252252:S332T	ENSP00000252252:S332T	S	-	2	0	KRT6B	51129602	0.992000	0.36948	1.000000	0.80357	0.766000	0.43426	2.613000	0.46351	2.042000	0.60477	0.298000	0.19748	AGC		0.557	KRT6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404969.1	NM_005555	
TIMELESS	8914	broad.mit.edu	37	12	56817375	56817375	+	Silent	SNP	G	G	A			TCGA-59-2351-01A-01W-0799-08	TCGA-59-2351-10A-01W-0800-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	930e9c43-af1e-47bc-8ee2-b3bd8a11bb8b	a31b2f09-d6d7-4ce2-a7b4-fd706c7a1c0f	g.chr12:56817375G>A	ENST00000553532.1	-	17	2233	c.2083C>T	c.(2083-2085)Ctg>Ttg	p.L695L	TIMELESS_ENST00000229201.4_Silent_p.L694L|TIMELESS_ENST00000554616.1_Intron					timeless circadian clock									p.L695L(1)		NS(1)|breast(2)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(8)|lung(14)|ovary(7)|pancreas(2)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	49						CACCGTTTCAGGTAGTCCAGA	0.537																																																1	Substitution - coding silent(1)	ovary(1)	12											79.0	69.0	73.0					12																	56817375		2203	4300	6503	55103642	SO:0001819	synonymous_variant	8914			AF098162	CCDS8918.1	12q13.3	2012-12-14	2012-12-14		ENSG00000111602	ENSG00000111602			11813	protein-coding gene	gene with protein product	"""Tof1 homolog (S. cerevisiae)"", ""timeless circadian clock 1"""	603887	"""timeless (Drosophila) homolog"", ""timeless homolog (Drosophila)"""			9856465	Standard	NM_003920		Approved	hTIM, TIM, TIM1	uc001slf.2	Q9UNS1	OTTHUMG00000170600	ENST00000553532.1:c.2083C>T	12.37:g.56817375G>A			55103642		Silent	SNP	ENST00000553532.1	37	CCDS8918.1																																																																																				0.537	TIMELESS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000409771.1	NM_003920	
PPP1R12A	4659	broad.mit.edu	37	12	80199435	80199435	+	Missense_Mutation	SNP	G	G	C			TCGA-59-2351-01A-01W-0799-08	TCGA-59-2351-10A-01W-0800-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	930e9c43-af1e-47bc-8ee2-b3bd8a11bb8b	a31b2f09-d6d7-4ce2-a7b4-fd706c7a1c0f	g.chr12:80199435G>C	ENST00000450142.2	-	14	2203	c.1937C>G	c.(1936-1938)aCa>aGa	p.T646R	PPP1R12A_ENST00000550107.1_Missense_Mutation_p.T590R|PPP1R12A_ENST00000261207.5_Missense_Mutation_p.T646R|AC073569.1_ENST00000598624.1_Intron|PPP1R12A_ENST00000546369.1_Missense_Mutation_p.T559R|PPP1R12A_ENST00000437004.2_Missense_Mutation_p.T646R	NM_002480.2	NP_002471.1	O14974	MYPT1_HUMAN	protein phosphatase 1, regulatory subunit 12A	646	Ser/Thr-rich.				centrosome organization (GO:0051297)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of catalytic activity (GO:0043086)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein dephosphorylation (GO:0006470)|regulation of cell adhesion (GO:0030155)|regulation of myosin-light-chain-phosphatase activity (GO:0035507)|regulation of nucleocytoplasmic transport (GO:0046822)|signal transduction (GO:0007165)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|contractile fiber (GO:0043292)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|PTW/PP1 phosphatase complex (GO:0072357)	14-3-3 protein binding (GO:0071889)|enzyme inhibitor activity (GO:0004857)|phosphatase regulator activity (GO:0019208)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)	p.T646R(1)		breast(5)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(7)|liver(1)|lung(4)|ovary(2)|skin(1)	29						AGTCAGGGTTGTGGTAGAAGC	0.478																																																1	Substitution - Missense(1)	ovary(1)	12											112.0	113.0	112.0					12																	80199435		2105	4229	6334	78723566	SO:0001583	missense	4659			D87930	CCDS44947.1, CCDS44948.1, CCDS58259.1, CCDS58260.1	12q15-q21	2013-01-18	2011-10-04	2001-08-10	ENSG00000058272	ENSG00000058272		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	7618	protein-coding gene	gene with protein product	"""myosin phosphatase-targeting subunit 1"", ""myosin binding subunit"""	602021	"""protein phosphatase 1, regulatory (inhibitor) subunit 12A"""	MYPT1		9286714	Standard	NM_002480		Approved	MBS, M130	uc001syz.3	O14974	OTTHUMG00000170100	ENST00000450142.2:c.1937C>G	12.37:g.80199435G>C	ENSP00000389168:p.Thr646Arg		78723566	B4DZ09|F8VWB4|Q2NKL4|Q569H0|Q86WU3|Q8NFR6|Q9BYH0	Missense_Mutation	SNP	ENST00000450142.2	37	CCDS44947.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.51|18.51	3.640117|3.640117	0.67244|0.67244	.|.	.|.	ENSG00000058272|ENSG00000058272	ENST00000553081|ENST00000261207;ENST00000546189;ENST00000360825;ENST00000341878;ENST00000450142;ENST00000437004;ENST00000546369;ENST00000550107	.|T;T;T;T;T	.|0.40476	.|1.03;1.03;1.05;1.05;1.04	5.54|5.54	5.54|5.54	0.83059|0.83059	.|.	.|0.097634	.|0.64402	.|D	.|0.000001	T|T	0.63153|0.63153	0.2487|0.2487	M|M	0.63843|0.63843	1.955|1.955	0.58432|0.58432	D|D	0.999999|0.999999	.|P;D;P	.|0.69078	.|0.739;0.997;0.622	.|B;D;B	.|0.75484	.|0.354;0.986;0.193	T|T	0.57906|0.57906	-0.7730|-0.7730	5|10	.|0.33141	.|T	.|0.24	.|.	19.4766|19.4766	0.94991|0.94991	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|646;590;646	.|O14974-2;O14974-3;O14974	.|.;.;MYPT1_HUMAN	E|R	238|646;646;646;590;646;646;559;590	.|ENSP00000261207:T646R;ENSP00000389168:T646R;ENSP00000416769:T646R;ENSP00000449514:T559R;ENSP00000446855:T590R	.|ENSP00000261207:T646R	Q|T	-|-	1|2	0|0	PPP1R12A|PPP1R12A	78723566|78723566	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	7.575000|7.575000	0.82447|0.82447	2.585000|2.585000	0.87301|0.87301	0.591000|0.591000	0.81541|0.81541	CAA|ACA		0.478	PPP1R12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407254.2	NM_002480	
POC1B	282809	broad.mit.edu	37	12	89864231	89864231	+	Silent	SNP	C	C	T			TCGA-59-2351-01A-01W-0799-08	TCGA-59-2351-10A-01W-0800-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	930e9c43-af1e-47bc-8ee2-b3bd8a11bb8b	a31b2f09-d6d7-4ce2-a7b4-fd706c7a1c0f	g.chr12:89864231C>T	ENST00000313546.3	-	7	845	c.717G>A	c.(715-717)tcG>tcA	p.S239S	POC1B_ENST00000393179.4_Silent_p.S109S|POC1B_ENST00000541909.1_Silent_p.S109S|POC1B_ENST00000549035.1_Silent_p.S197S|POC1B_ENST00000378528.2_Intron|POC1B_ENST00000549504.1_Intron	NM_172240.2	NP_758440.1	Q8TC44	POC1B_HUMAN	POC1 centriolar protein B	239					cell proliferation (GO:0008283)|cilium assembly (GO:0042384)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|spindle pole (GO:0000922)		p.S239S(1)		endometrium(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|urinary_tract(1)	14						GATAGTTACCCGAAGGATGGA	0.378																																																1	Substitution - coding silent(1)	ovary(1)	12											138.0	130.0	132.0					12																	89864231		2203	4300	6503	88388362	SO:0001819	synonymous_variant	282809			AL832918	CCDS31869.1, CCDS55859.1	12q21.33	2014-05-02	2013-08-21	2010-03-26	ENSG00000139323	ENSG00000139323		"""WD repeat domain containing"""	30836	protein-coding gene	gene with protein product		614784	"""WD repeat domain 51B"", ""POC1 centriolar protein homolog B (Chlamydomonas)"""	WDR51B		19109428	Standard	NM_172240		Approved	TUWD12, FLJ14923		Q8TC44	OTTHUMG00000169944	ENST00000313546.3:c.717G>A	12.37:g.89864231C>T			88388362	G3V1X0	Silent	SNP	ENST00000313546.3	37	CCDS31869.1																																																																																				0.378	POC1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406637.1	NM_172240	
AMER2	219287	broad.mit.edu	37	13	25743819	25743819	+	Missense_Mutation	SNP	G	G	A			TCGA-59-2351-01A-01W-0799-08	TCGA-59-2351-10A-01W-0800-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	930e9c43-af1e-47bc-8ee2-b3bd8a11bb8b	a31b2f09-d6d7-4ce2-a7b4-fd706c7a1c0f	g.chr13:25743819G>A	ENST00000515384.1	-	1	2606	c.1939C>T	c.(1939-1941)Cgc>Tgc	p.R647C	AMER2_ENST00000357816.2_Missense_Mutation_p.R528C|AMER2_ENST00000381853.3_Missense_Mutation_p.R528C			Q8N7J2	AMER2_HUMAN	APC membrane recruitment protein 2	647					ectoderm development (GO:0007398)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|Wnt signaling pathway (GO:0016055)	plasma membrane (GO:0005886)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.R528C(1)									CTGACTCTGCGGACCAGCACT	0.582																																																1	Substitution - Missense(1)	ovary(1)	13											72.0	74.0	74.0					13																	25743819		2203	4300	6503	24641819	SO:0001583	missense	219287			AK055049	CCDS9312.1, CCDS53859.1	13q12.13	2013-10-11	2012-12-03	2012-12-03	ENSG00000165566	ENSG00000165566		"""-"""	26360	protein-coding gene	gene with protein product		614659	"""family with sequence similarity 123A"""	FAM123A		20843316	Standard	XM_005266279		Approved	FLJ25477	uc001uqb.3	Q8N7J2	OTTHUMG00000016602	ENST00000515384.1:c.1939C>T	13.37:g.25743819G>A	ENSP00000426528:p.Arg647Cys		24641819	Q5RL80|Q5VX56|Q8N593|Q96NN5	Missense_Mutation	SNP	ENST00000515384.1	37	CCDS53859.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.304684	0.81247	.	.	ENSG00000165566	ENST00000357816;ENST00000381853;ENST00000515384	T;T;T	0.36157	1.28;1.28;1.27	5.97	5.12	0.69794	.	0.000000	0.85682	D	0.000000	T	0.48132	0.1483	L	0.27053	0.805	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79108	0.987;0.992	T	0.53129	-0.8482	10	0.87932	D	0	-11.8384	15.7693	0.78152	0.0:0.0:0.8628:0.1372	.	647;528	Q8N7J2;Q8N7J2-2	F123A_HUMAN;.	C	528;528;647	ENSP00000350469:R528C;ENSP00000371277:R528C;ENSP00000426528:R647C	ENSP00000350469:R528C	R	-	1	0	FAM123A	24641819	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.149000	0.77396	1.520000	0.48965	0.655000	0.94253	CGC		0.582	AMER2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000370229.1	NM_152704	
LPAR6	10161	broad.mit.edu	37	13	48986113	48986113	+	Silent	SNP	T	T	G	rs199857507		TCGA-59-2351-01A-01W-0799-08	TCGA-59-2351-10A-01W-0800-08	T	T	G	G	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	930e9c43-af1e-47bc-8ee2-b3bd8a11bb8b	a31b2f09-d6d7-4ce2-a7b4-fd706c7a1c0f	g.chr13:48986113T>G	ENST00000378434.4	-	7	2071	c.447A>C	c.(445-447)gcA>gcC	p.A149A	LPAR6_ENST00000345941.2_Silent_p.A149A|RB1_ENST00000267163.4_Intron	NM_005767.5	NP_005758.2	P43657	LPAR6_HUMAN	lysophosphatidic acid receptor 6	149						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.0?(15)|p.?(4)|p.A149A(3)		NS(1)|endometrium(1)|large_intestine(4)|lung(1)|ovary(4)|prostate(1)|skin(1)|urinary_tract(1)	14						AAACGGCGGGTGCACTTCCTC	0.433																																																22	Whole gene deletion(15)|Unknown(4)|Substitution - coding silent(3)	bone(10)|breast(4)|ovary(3)|adrenal_gland(1)|eye(1)|soft_tissue(1)|haematopoietic_and_lymphoid_tissue(1)|endometrium(1)	13											29.0	31.0	31.0					13																	48986113		2202	4300	6502	47884114	SO:0001819	synonymous_variant	10161			AF000546	CCDS9410.1	13q14	2012-08-08	2009-06-23	2009-06-23	ENSG00000139679	ENSG00000139679		"""GPCR / Class A : Lysophospholipid receptors : Lysophosphatidic acid"""	15520	protein-coding gene	gene with protein product		609239	"""purinergic receptor P2Y, G-protein coupled, 5"""	P2RY5		11004484, 9755289, 19386608	Standard	NM_005767		Approved	P2Y5	uc010acu.3	P43657	OTTHUMG00000016895	ENST00000378434.4:c.447A>C	13.37:g.48986113T>G			47884114	A4FTW9|B3KVF2|F2YGU4|O15133|Q3KPF5|Q53FA0|Q5VW44|Q7Z3S0|Q7Z3S6	Silent	SNP	ENST00000378434.4	37	CCDS9410.1																																																																																				0.433	LPAR6-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276280.2	NM_005767	
RPGRIP1	57096	broad.mit.edu	37	14	21793543	21793543	+	Splice_Site	SNP	G	G	T			TCGA-59-2351-01A-01W-0799-08	TCGA-59-2351-10A-01W-0800-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	930e9c43-af1e-47bc-8ee2-b3bd8a11bb8b	a31b2f09-d6d7-4ce2-a7b4-fd706c7a1c0f	g.chr14:21793543G>T	ENST00000400017.2	+	15	2367		c.e15+1		RPGRIP1_ENST00000382933.4_Intron|RPGRIP1_ENST00000553500.1_Splice_Site|RPGRIP1_ENST00000556336.1_Intron|RPGRIP1_ENST00000206660.6_Splice_Site|RPGRIP1_ENST00000557771.1_Splice_Site|RPGRIP1_ENST00000307974.4_Splice_Site	NM_020366.3	NP_065099.3	Q96KN7	RPGR1_HUMAN	retinitis pigmentosa GTPase regulator interacting protein 1						eye photoreceptor cell development (GO:0042462)|response to stimulus (GO:0050896)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	axoneme (GO:0005930)|nonmotile primary cilium (GO:0031513)		p.?(1)		breast(3)|endometrium(2)|kidney(4)|large_intestine(11)|lung(10)|ovary(4)|pancreas(1)|prostate(3)|stomach(1)	39	all_cancers(95;0.0017)	all_cancers(140;0.0973)	Epithelial(56;6.24e-07)|all cancers(55;6.56e-06)	GBM - Glioblastoma multiforme(265;0.00888)		GGAAGAGGAGGTGAGAAAAAA	0.512																																																1	Unknown(1)	ovary(1)	14											24.0	25.0	25.0					14																	21793543		1906	4118	6024	20863383	SO:0001630	splice_region_variant	57096			AF227257	CCDS45080.1	14q11.2	2013-06-06			ENSG00000092200	ENSG00000092200			13436	protein-coding gene	gene with protein product		605446		RPGRIP		10958647, 10958648	Standard	NM_020366		Approved	RGI1, LCA6, CORD13	uc001wag.3	Q96KN7	OTTHUMG00000170758	ENST00000400017.2:c.2367+1G>T	14.37:g.21793543G>T			20863383	Q7Z2W6|Q8IXV5|Q96QA8|Q9HB94|Q9HB95|Q9HBK6|Q9NR40	Splice_Site	SNP	ENST00000400017.2	37	CCDS45080.1	.	.	.	.	.	.	.	.	.	.	G	14.97	2.693426	0.48202	.	.	ENSG00000092200	ENST00000557771;ENST00000400017;ENST00000206660;ENST00000555587;ENST00000307974	.	.	.	5.22	5.22	0.72569	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.3354	0.83059	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RPGRIP1	20863383	1.000000	0.71417	1.000000	0.80357	0.743000	0.42351	5.339000	0.65953	2.725000	0.93324	0.655000	0.94253	.		0.512	RPGRIP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410258.1	NM_020366	Intron
CDAN1	146059	broad.mit.edu	37	15	43017755	43017755	+	Missense_Mutation	SNP	G	G	A			TCGA-59-2351-01A-01W-0799-08	TCGA-59-2351-10A-01W-0800-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	930e9c43-af1e-47bc-8ee2-b3bd8a11bb8b	a31b2f09-d6d7-4ce2-a7b4-fd706c7a1c0f	g.chr15:43017755G>A	ENST00000356231.3	-	26	3405	c.3382C>T	c.(3382-3384)Ccg>Tcg	p.P1128S		NM_138477.2	NP_612486.2	Q8IWY9	CDAN1_HUMAN	codanin 1	1128					chromatin assembly (GO:0031497)|chromatin organization (GO:0006325)|negative regulation of DNA replication (GO:0008156)|protein localization (GO:0008104)	cytoplasm (GO:0005737)|endomembrane system (GO:0012505)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.P1128S(1)		endometrium(2)|kidney(4)|large_intestine(3)|lung(6)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(3)	24		all_cancers(109;5.4e-16)|all_epithelial(112;2.97e-14)|Lung NSC(122;1.75e-08)|all_lung(180;5.99e-08)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;2.49e-07)		AGCGGAACCGGCCCCTGAAAG	0.597																																																1	Substitution - Missense(1)	ovary(1)	15											48.0	50.0	49.0					15																	43017755		2203	4299	6502	40805047	SO:0001583	missense	146059			AF525398	CCDS32209.1	15q15.2	2012-04-25	2012-04-25			ENSG00000140326			1713	protein-coding gene	gene with protein product		607465	"""congenital dyserythropoietic anemia, type I"""			8634422, 12434312	Standard	XM_005254177		Approved	CDA-I, CDAI	uc001zql.3	Q8IWY9		ENST00000356231.3:c.3382C>T	15.37:g.43017755G>A	ENSP00000348564:p.Pro1128Ser		40805047	Q6NYD0|Q7Z7L5|Q969N3	Missense_Mutation	SNP	ENST00000356231.3	37	CCDS32209.1	.	.	.	.	.	.	.	.	.	.	G	14.42	2.530526	0.45073	.	.	ENSG00000140326	ENST00000356231;ENST00000267892	D	0.86030	-2.06	5.72	5.72	0.89469	.	0.311094	0.40818	N	0.001002	D	0.87553	0.6206	L	0.33485	1.01	0.38922	D	0.957767	P;D	0.89917	0.607;1.0	B;D	0.87578	0.12;0.998	D	0.86499	0.1802	10	0.33940	T	0.23	-2.1211	13.5953	0.61987	0.0:0.0:0.8445:0.1555	.	1128;1126	Q8IWY9;C9K0H8	CDAN1_HUMAN;.	S	1128;1126	ENSP00000348564:P1128S	ENSP00000267892:P1126S	P	-	1	0	CDAN1	40805047	1.000000	0.71417	0.986000	0.45419	0.760000	0.43138	3.512000	0.53407	2.699000	0.92147	0.563000	0.77884	CCG		0.597	CDAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000431103.1	XM_085300	
DMXL2	23312	broad.mit.edu	37	15	51828931	51828931	+	Missense_Mutation	SNP	C	C	G			TCGA-59-2351-01A-01W-0799-08	TCGA-59-2351-10A-01W-0800-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	930e9c43-af1e-47bc-8ee2-b3bd8a11bb8b	a31b2f09-d6d7-4ce2-a7b4-fd706c7a1c0f	g.chr15:51828931C>G	ENST00000251076.5	-	12	2033	c.1746G>C	c.(1744-1746)gaG>gaC	p.E582D	DMXL2_ENST00000449909.3_Missense_Mutation_p.E582D|DMXL2_ENST00000543779.2_Missense_Mutation_p.E582D	NM_001174116.1|NM_015263.3	NP_001167587.1|NP_056078.2	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2	582						cell junction (GO:0030054)|extracellular space (GO:0005615)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	Rab GTPase binding (GO:0017137)	p.E582D(1)		breast(4)|central_nervous_system(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(26)|liver(1)|lung(28)|ovary(7)|prostate(7)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	101				all cancers(107;0.00494)		CAGACATCCCCTCCTGGTGTA	0.443																																																1	Substitution - Missense(1)	ovary(1)	15											138.0	113.0	122.0					15																	51828931		2195	4293	6488	49616223	SO:0001583	missense	23312			AB020663	CCDS10141.1, CCDS53945.1, CCDS53946.1	15q21.2	2013-01-10			ENSG00000104093	ENSG00000104093		"""WD repeat domain containing"""	2938	protein-coding gene	gene with protein product	"""rabconnectin 3"""	612186					Standard	NM_001174116		Approved	RC3, KIAA0856	uc010ufy.2	Q8TDJ6	OTTHUMG00000131749	ENST00000251076.5:c.1746G>C	15.37:g.51828931C>G	ENSP00000251076:p.Glu582Asp		49616223	B2RTR3|B7ZMH3|F5GWF1|O94938	Missense_Mutation	SNP	ENST00000251076.5	37	CCDS10141.1	.	.	.	.	.	.	.	.	.	.	C	0.018	-1.480301	0.01027	.	.	ENSG00000104093	ENST00000251076;ENST00000543779;ENST00000449909	T;T;T	0.24151	2.02;2.02;1.87	5.42	-1.32	0.09201	.	0.681105	0.15437	N	0.262383	T	0.11707	0.0285	L	0.29908	0.895	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.30851	-0.9964	10	0.11182	T	0.66	.	2.2266	0.03986	0.2287:0.274:0.3626:0.1347	.	582;582;582	F5GWF1;B2RTR3;Q8TDJ6	.;.;DMXL2_HUMAN	D	582	ENSP00000251076:E582D;ENSP00000441858:E582D;ENSP00000400855:E582D	ENSP00000251076:E582D	E	-	3	2	DMXL2	49616223	0.000000	0.05858	0.001000	0.08648	0.013000	0.08279	-0.063000	0.11655	-0.270000	0.09285	-0.175000	0.13238	GAG		0.443	DMXL2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254671.2	NM_015263	
EDC3	80153	broad.mit.edu	37	15	74964117	74964117	+	Splice_Site	SNP	T	T	C			TCGA-59-2351-01A-01W-0799-08	TCGA-59-2351-10A-01W-0800-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	930e9c43-af1e-47bc-8ee2-b3bd8a11bb8b	a31b2f09-d6d7-4ce2-a7b4-fd706c7a1c0f	g.chr15:74964117T>C	ENST00000315127.4	-	3	346		c.e3-2		EDC3_ENST00000426797.3_Splice_Site|EDC3_ENST00000568176.1_Splice_Site	NM_001142444.1|NM_025083.3	NP_001135916.1|NP_079359.2	Q96F86	EDC3_HUMAN	enhancer of mRNA decapping 3						exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)	cytosol (GO:0005829)|membrane (GO:0016020)	identical protein binding (GO:0042802)|RNA binding (GO:0003723)	p.?(1)		breast(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	16						TCACCTGCCCTGAAATACACA	0.408																																																1	Unknown(1)	ovary(1)	15											55.0	60.0	58.0					15																	74964117		2197	4296	6493	72751170	SO:0001630	splice_region_variant	80153			BC011534	CCDS10267.1	15q24.1	2013-05-02	2013-05-02	2006-07-07	ENSG00000179151	ENSG00000179151			26114	protein-coding gene	gene with protein product		609842	"""yjeF domain containing (E.coli)"", ""LSM16 homolog (EDC3, S. cerevisiae)"", ""enhancer of mRNA decapping 3 homolog (S. cerevisiae)"""	YJDC, LSM16		15225602, 17533573, 22483619	Standard	NM_025083		Approved	FLJ21128, hYjeF_N2-15q23, YJEFN2	uc002aym.3	Q96F86	OTTHUMG00000142815	ENST00000315127.4:c.165-2A>G	15.37:g.74964117T>C			72751170	B3KPH0|D3DW61|Q9H797	Splice_Site	SNP	ENST00000315127.4	37	CCDS10267.1	.	.	.	.	.	.	.	.	.	.	T	17.55	3.417435	0.62622	.	.	ENSG00000179151	ENST00000315127;ENST00000426797	.	.	.	5.53	4.42	0.53409	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.4156	0.44320	0.0:0.0762:0.0:0.9238	.	.	.	.	.	-1	.	.	.	-	.	.	EDC3	72751170	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.667000	0.74451	0.934000	0.37316	0.528000	0.53228	.		0.408	EDC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286399.1	NM_025083	Intron
PEAK1	79834	broad.mit.edu	37	15	77472051	77472051	+	Missense_Mutation	SNP	C	C	T			TCGA-59-2351-01A-01W-0799-08	TCGA-59-2351-10A-01W-0800-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	930e9c43-af1e-47bc-8ee2-b3bd8a11bb8b	a31b2f09-d6d7-4ce2-a7b4-fd706c7a1c0f	g.chr15:77472051C>T	ENST00000560626.2	-	4	2693	c.2218G>A	c.(2218-2220)Gag>Aag	p.E740K	PEAK1_ENST00000558305.1_Missense_Mutation_p.E740K|PEAK1_ENST00000312493.4_Missense_Mutation_p.E740K			Q9H792	PEAK1_HUMAN	pseudopodium-enriched atypical kinase 1	740					cell migration (GO:0016477)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|substrate adhesion-dependent cell spreading (GO:0034446)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)	p.E740K(2)									GCCACAGGCTCTTGAGTGGCT	0.507																																																2	Substitution - Missense(2)	ovary(2)	15											94.0	90.0	91.0					15																	77472051		1957	4165	6122	75259106	SO:0001583	missense	79834				CCDS42062.1	15q24.3	2013-09-27			ENSG00000173517	ENSG00000173517			29431	protein-coding gene	gene with protein product		614248				16879967, 20534451	Standard	NM_024776		Approved	KIAA2002, sgk269		Q9H792	OTTHUMG00000172618	ENST00000560626.2:c.2218G>A	15.37:g.77472051C>T	ENSP00000452796:p.Glu740Lys		75259106	Q6ZS78|Q8NAZ4|Q8NCM3|Q8TEG7	Missense_Mutation	SNP	ENST00000560626.2	37	CCDS42062.1	.	.	.	.	.	.	.	.	.	.	C	17.72	3.459024	0.63401	.	.	ENSG00000173517	ENST00000312493	T	0.70516	-0.49	5.89	5.89	0.94794	.	0.269388	0.16374	U	0.217216	T	0.62221	0.2410	L	0.29908	0.895	0.43076	D	0.994726	B	0.17852	0.024	B	0.15484	0.013	T	0.57063	-0.7875	10	0.51188	T	0.08	-12.7065	15.7106	0.77623	0.0:0.864:0.136:0.0	.	740	Q9H792	PEAK1_HUMAN	K	740	ENSP00000309230:E740K	ENSP00000309230:E740K	E	-	1	0	AC087465.1	75259106	1.000000	0.71417	0.693000	0.30195	0.777000	0.43975	7.161000	0.77505	2.793000	0.96121	0.655000	0.94253	GAG		0.507	PEAK1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419483.3		
IQGAP1	8826	broad.mit.edu	37	15	91029272	91029272	+	Missense_Mutation	SNP	A	A	G			TCGA-59-2351-01A-01W-0799-08	TCGA-59-2351-10A-01W-0800-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	930e9c43-af1e-47bc-8ee2-b3bd8a11bb8b	a31b2f09-d6d7-4ce2-a7b4-fd706c7a1c0f	g.chr15:91029272A>G	ENST00000268182.5	+	31	4056	c.3932A>G	c.(3931-3933)gAt>gGt	p.D1311G	IQGAP1_ENST00000560738.1_Missense_Mutation_p.D739G	NM_003870.3	NP_003861.1	P46940	IQGA1_HUMAN	IQ motif containing GTPase activating protein 1	1311	C2.				cellular response to calcium ion (GO:0071277)|cellular response to epidermal growth factor stimulus (GO:0071364)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|glomerular visceral epithelial cell development (GO:0072015)|negative regulation of catalytic activity (GO:0043086)|negative regulation of dephosphorylation (GO:0035305)|neuron projection extension (GO:1990138)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|regulation of cytokine production (GO:0001817)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	actin filament (GO:0005884)|axon (GO:0030424)|cell junction (GO:0030054)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|extracellular vesicular exosome (GO:0070062)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|lateral plasma membrane (GO:0016328)|microtubule (GO:0005874)|midbody (GO:0030496)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|GTPase activator activity (GO:0005096)|GTPase inhibitor activity (GO:0005095)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|protein serine/threonine kinase activator activity (GO:0043539)|Ras GTPase activator activity (GO:0005099)	p.D1311G(1)		breast(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(14)|liver(1)|lung(18)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	59	Melanoma(11;0.00551)|Lung NSC(78;0.0237)|all_lung(78;0.0488)		BRCA - Breast invasive adenocarcinoma(143;0.0745)|KIRC - Kidney renal clear cell carcinoma(17;0.138)|Kidney(142;0.194)			CTCCTGTTGGATCACCAGGAT	0.507																																																1	Substitution - Missense(1)	ovary(1)	15											74.0	62.0	66.0					15																	91029272		2198	4298	6496	88830276	SO:0001583	missense	8826			D29640	CCDS10362.1	15q26.1	2008-07-18			ENSG00000140575	ENSG00000140575			6110	protein-coding gene	gene with protein product	"""RasGAP-like with IQ motifs"""	603379				8051149, 8670801	Standard	XM_005254984		Approved	p195, KIAA0051, SAR1, HUMORFA01	uc002bpl.1	P46940	OTTHUMG00000149832	ENST00000268182.5:c.3932A>G	15.37:g.91029272A>G	ENSP00000268182:p.Asp1311Gly		88830276	A7MBM3	Missense_Mutation	SNP	ENST00000268182.5	37	CCDS10362.1	.	.	.	.	.	.	.	.	.	.	A	29.7	5.027434	0.93518	.	.	ENSG00000140575	ENST00000268182	T	0.49720	0.77	5.46	5.46	0.80206	Rho GTPase activation protein (1);Ras GTPase-activating protein (1);	0.000000	0.85682	D	0.000000	T	0.50514	0.1620	L	0.47716	1.5	0.80722	D	1	P	0.49783	0.928	P	0.48738	0.588	T	0.52185	-0.8609	10	0.52906	T	0.07	-28.4834	14.6554	0.68828	1.0:0.0:0.0:0.0	.	1311	P46940	IQGA1_HUMAN	G	1311	ENSP00000268182:D1311G	ENSP00000268182:D1311G	D	+	2	0	IQGAP1	88830276	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	9.207000	0.95064	2.199000	0.70637	0.455000	0.32223	GAT		0.507	IQGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313493.1	NM_003870	
ERN2	10595	broad.mit.edu	37	16	23713839	23713839	+	Missense_Mutation	SNP	G	G	T			TCGA-59-2351-01A-01W-0799-08	TCGA-59-2351-10A-01W-0800-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	930e9c43-af1e-47bc-8ee2-b3bd8a11bb8b	a31b2f09-d6d7-4ce2-a7b4-fd706c7a1c0f	g.chr16:23713839G>T	ENST00000457008.2	-	10	991	c.953C>A	c.(952-954)gCc>gAc	p.A318D	ERN2_ENST00000256797.4_Missense_Mutation_p.A366D					endoplasmic reticulum to nucleus signaling 2									p.A318D(1)		large_intestine(2)|lung(2)|ovary(2)	6				GBM - Glioblastoma multiforme(48;0.0156)		ATCTGCGGGGGCCAGGGTCAG	0.587																																																1	Substitution - Missense(1)	ovary(1)	16											121.0	127.0	125.0					16																	23713839		2197	4300	6497	23621340	SO:0001583	missense	10595			AA527544	CCDS32407.1	16p12.2	2008-02-05	2007-08-14			ENSG00000134398			16942	protein-coding gene	gene with protein product		604034	"""ER to nucleus signalling 2"""			9755171, 11175748	Standard	NM_033266		Approved	IRE1b	uc002dma.4	Q76MJ5		ENST00000457008.2:c.953C>A	16.37:g.23713839G>T	ENSP00000413812:p.Ala318Asp		23621340		Missense_Mutation	SNP	ENST00000457008.2	37		.	.	.	.	.	.	.	.	.	.	G	27.4	4.826817	0.90955	.	.	ENSG00000134398	ENST00000256797;ENST00000457008	T;T	0.47869	0.83;0.83	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.65217	0.2670	M	0.61703	1.905	0.80722	D	1	P;D;D	0.89917	0.913;1.0;0.994	P;D;P	0.85130	0.536;0.997;0.891	T	0.56208	-0.8017	10	0.16420	T	0.52	.	17.8375	0.88704	0.0:0.0:1.0:0.0	.	318;318;318	Q76MJ5;E7ETG2;A5YM65	ERN2_HUMAN;.;.	D	366;318	ENSP00000256797:A366D;ENSP00000413812:A318D	ENSP00000256797:A366D	A	-	2	0	ERN2	23621340	1.000000	0.71417	0.996000	0.52242	0.981000	0.71138	8.556000	0.90697	2.821000	0.97095	0.555000	0.69702	GCC		0.587	ERN2-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000434886.1		
DNAH9	1770	broad.mit.edu	37	17	11872710	11872710	+	Missense_Mutation	SNP	C	C	T	rs9913494	byFrequency	TCGA-59-2351-01A-01W-0799-08	TCGA-59-2351-10A-01W-0800-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	930e9c43-af1e-47bc-8ee2-b3bd8a11bb8b	a31b2f09-d6d7-4ce2-a7b4-fd706c7a1c0f	g.chr17:11872710C>T	ENST00000262442.4	+	69	13395	c.13327C>T	c.(13327-13329)Cgc>Tgc	p.R4443C	DNAH9_ENST00000396001.2_3'UTR|DNAH9_ENST00000454412.2_Missense_Mutation_p.R4367C|RP11-1096G20.5_ENST00000580270.1_RNA|DNAH9_ENST00000608377.1_Missense_Mutation_p.R755C	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	4443			R -> C (in dbSNP:rs9913494).		cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)	p.R4443C(1)		NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		GCAGGACTGCCGCAGTGTCTA	0.517													C|||	8	0.00159744	0.0045	0.0029	5008	,	,		19202	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	17						C	CYS/ARG,CYS/ARG	24,4382	31.7+/-61.6	0,24,2179	106.0	90.0	95.0		13327,2263	3.0	0.3	17	dbSNP_119	95	2,8598	2.2+/-6.3	0,2,4298	yes	missense,missense	DNAH9	NM_001372.3,NM_004662.2	180,180	0,26,6477	TT,TC,CC		0.0233,0.5447,0.1999	benign,benign	4443/4487,755/799	11872710	26,12980	2203	4300	6503	11813435	SO:0001583	missense	1770			U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.13327C>T	17.37:g.11872710C>T	ENSP00000262442:p.Arg4443Cys		11813435	A2VCQ8|O15064|O95494|Q9NQ28	Missense_Mutation	SNP	ENST00000262442.4	37	CCDS11160.1	2	9.157509157509158E-4	2	0.0040650406504065045	0	0.0	0	0.0	0	0.0	C	15.92	2.975128	0.53720	0.005447	2.33E-4	ENSG00000007174	ENST00000262442;ENST00000454412;ENST00000413703;ENST00000396001	T;T;T	0.09255	3.0;3.0;3.0	4.99	3.0	0.34707	Dynein heavy chain (1);	0.173431	0.48767	D	0.000163	T	0.27169	0.0666	M	0.92923	3.36	0.28704	N	0.903934	D	0.76494	0.999	D	0.66716	0.946	T	0.22906	-1.0203	10	0.72032	D	0.01	.	6.8399	0.23957	0.14:0.7126:0.0:0.1474	rs9913494;rs52836710;rs9913494	4443	Q9NYC9	DYH9_HUMAN	C	4443;4367;2949;755	ENSP00000262442:R4443C;ENSP00000414874:R4367C;ENSP00000379323:R755C	ENSP00000262442:R4443C	R	+	1	0	DNAH9	11813435	0.003000	0.15002	0.274000	0.24659	0.914000	0.54420	0.681000	0.25320	0.686000	0.31488	-0.444000	0.05651	CGC		0.517	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252756.2	NM_001372	
CDK12	51755	broad.mit.edu	37	17	37673769	37673769	+	Missense_Mutation	SNP	A	A	G			TCGA-59-2351-01A-01W-0799-08	TCGA-59-2351-10A-01W-0800-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture			Illumina GAIIx	930e9c43-af1e-47bc-8ee2-b3bd8a11bb8b	a31b2f09-d6d7-4ce2-a7b4-fd706c7a1c0f	g.chr17:37673769A>G	ENST00000447079.4	+	10	2956	c.2923A>G	c.(2923-2925)Aag>Gag	p.K975E	CDK12_ENST00000430627.2_Missense_Mutation_p.K975E	NM_015083.1|NM_016507.2	NP_055898.1|NP_057591.2	Q9NYV4	CDK12_HUMAN	cyclin-dependent kinase 12	975	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				mRNA processing (GO:0006397)|phosphorylation of RNA polymerase II C-terminal domain (GO:0070816)|protein autophosphorylation (GO:0046777)|regulation of MAP kinase activity (GO:0043405)|RNA splicing (GO:0008380)	cyclin K-CDK12 complex (GO:0002944)|nuclear cyclin-dependent protein kinase holoenzyme complex (GO:0019908)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)	p.K975E(1)		NS(4)|breast(3)|endometrium(5)|kidney(4)|large_intestine(11)|lung(23)|ovary(11)|prostate(4)|skin(2)|urinary_tract(3)	70						CATGAAACCGAAGAAGCAATA	0.458			"""Mis, N, F"""		serous ovarian					TCGA Ovarian(9;0.13)																													Rec	yes		17	17q12	51755	cyclin-dependent kinase 12		E	1	Substitution - Missense(1)	ovary(1)	17											197.0	173.0	181.0					17																	37673769		2203	4300	6503	34927295	SO:0001583	missense	51755			AF227198	CCDS11337.1, CCDS45666.1	17q12	2011-10-25	2009-12-16	2009-12-16	ENSG00000167258	ENSG00000167258		"""Cyclin-dependent kinases"""	24224	protein-coding gene	gene with protein product	"""CDC2 related protein kinase 7"""	615514	"""Cdc2-related kinase, arginine/serine-rich"""	CRKRS		10048485, 11683387, 19884882	Standard	XM_005257456		Approved	CRK7, CRKR, KIAA0904	uc010cvv.3	Q9NYV4	OTTHUMG00000133214	ENST00000447079.4:c.2923A>G	17.37:g.37673769A>G	ENSP00000398880:p.Lys975Glu		34927295	A7E2B2|B4DYX4|B9EIQ6|O94978	Missense_Mutation	SNP	ENST00000447079.4	37	CCDS11337.1	.	.	.	.	.	.	.	.	.	.	A	22.0	4.225626	0.79576	.	.	ENSG00000167258	ENST00000430627;ENST00000447079	T;T	0.43294	0.95;0.95	5.19	5.19	0.71726	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.45606	D	0.000347	T	0.62245	0.2412	M	0.62016	1.91	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.998	D;D;D	0.83275	0.996;0.996;0.994	T	0.65776	-0.6086	10	0.72032	D	0.01	-11.5287	15.3521	0.74396	1.0:0.0:0.0:0.0	.	974;975;975	E7EUM9;Q9NYV4;Q9NYV4-2	.;CDK12_HUMAN;.	E	975	ENSP00000407720:K975E;ENSP00000398880:K975E	ENSP00000407720:K975E	K	+	1	0	CDK12	34927295	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.261000	0.95576	2.081000	0.62600	0.460000	0.39030	AAG		0.458	CDK12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256941.4	NM_016507	
SGCA	6442	broad.mit.edu	37	17	48247635	48247635	+	Silent	SNP	C	C	A			TCGA-59-2351-01A-01W-0799-08	TCGA-59-2351-10A-01W-0800-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	930e9c43-af1e-47bc-8ee2-b3bd8a11bb8b	a31b2f09-d6d7-4ce2-a7b4-fd706c7a1c0f	g.chr17:48247635C>A	ENST00000262018.3	+	7	915	c.879C>A	c.(877-879)acC>acA	p.T293T	SGCA_ENST00000344627.6_Intron|HILS1_ENST00000504307.1_RNA|SGCA_ENST00000543315.1_Intron|SGCA_ENST00000513942.1_Intron	NM_000023.2	NP_000014.1	Q16586	SGCA_HUMAN	sarcoglycan, alpha (50kDa dystrophin-associated glycoprotein)	293					muscle contraction (GO:0006936)|muscle organ development (GO:0007517)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|sarcoglycan complex (GO:0016012)|sarcolemma (GO:0042383)	calcium ion binding (GO:0005509)	p.T293T(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|lung(7)|ovary(2)|skin(1)	14						CTCTGGTCACCCTCCTGGTGC	0.637																																																1	Substitution - coding silent(1)	ovary(1)	17											124.0	106.0	112.0					17																	48247635		2203	4300	6503	45602634	SO:0001819	synonymous_variant	6442			L34355	CCDS32679.1, CCDS45729.1	17q21	2014-09-17	2002-08-29		ENSG00000108823	ENSG00000108823			10805	protein-coding gene	gene with protein product	"""50kD DAG"", ""Sarcoglycan, alpha (50kD dystrophin-associated glycoprotein; adhalin)"", ""adhalin (limb girdle muscular dystrophy 2D)"""	600119	"""sarcoglycan, alpha (50kD dystrophin-associated glycoprotein)"""	ADL		7937874	Standard	NM_000023		Approved	SCARMD1, LGMD2D, adhalin, DMDA2, A2	uc002iqi.3	Q16586	OTTHUMG00000162024	ENST00000262018.3:c.879C>A	17.37:g.48247635C>A			45602634	A6NEB8|A8K3K7|Q13710|Q13712	Silent	SNP	ENST00000262018.3	37	CCDS32679.1	.	.	.	.	.	.	.	.	.	.	C	10.49	1.363522	0.24684	.	.	ENSG00000108823	ENST00000504073	.	.	.	5.8	0.215	0.15253	.	.	.	.	.	T	0.40498	0.1119	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.23261	-1.0193	4	.	.	.	-27.7417	1.0293	0.01534	0.1376:0.3013:0.2681:0.293	.	.	.	.	T	66	.	.	P	+	1	0	SGCA	45602634	0.012000	0.17670	0.999000	0.59377	0.983000	0.72400	-0.193000	0.09573	0.063000	0.16370	0.655000	0.94253	CCT		0.637	SGCA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366841.1	NM_000023	
MAP2K6	5608	broad.mit.edu	37	17	67517194	67517194	+	Missense_Mutation	SNP	T	T	G			TCGA-59-2351-01A-01W-0799-08	TCGA-59-2351-10A-01W-0800-08	T	T	G	G	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	930e9c43-af1e-47bc-8ee2-b3bd8a11bb8b	a31b2f09-d6d7-4ce2-a7b4-fd706c7a1c0f	g.chr17:67517194T>G	ENST00000590474.1	+	7	775	c.488T>G	c.(487-489)gTa>gGa	p.V163G	MAP2K6_ENST00000589647.1_Missense_Mutation_p.V107G	NM_002758.3	NP_002749.2	P52564	MP2K6_HUMAN	mitogen-activated protein kinase kinase 6	163	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|apoptotic process (GO:0006915)|cardiac muscle contraction (GO:0060048)|cell cycle arrest (GO:0007050)|cellular response to sorbitol (GO:0072709)|DNA damage induced protein phosphorylation (GO:0006975)|innate immune response (GO:0045087)|muscle cell differentiation (GO:0042692)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of apoptotic process (GO:0043065)|positive regulation of muscle cell differentiation (GO:0051149)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)|response to ischemia (GO:0002931)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)	p.V163G(1)		central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|stomach(1)	20	Breast(10;6.05e-10)					TTGCAGATTGTAAAAGCATTA	0.343																																																1	Substitution - Missense(1)	ovary(1)	17											156.0	146.0	149.0					17																	67517194		2203	4300	6503	65028789	SO:0001583	missense	5608			U39064	CCDS11686.1	17q	2011-06-09						"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6846	protein-coding gene	gene with protein product	"""protein kinase, mitogen-activated, kinase 6 (MAP kinase kinase 6)"""	601254		PRKMK6		8621675	Standard	XM_005257515		Approved	MEK6, MKK6, SAPKK3, MAPKK6	uc002jij.3	P52564		ENST00000590474.1:c.488T>G	17.37:g.67517194T>G	ENSP00000468348:p.Val163Gly		65028789		Missense_Mutation	SNP	ENST00000590474.1	37	CCDS11686.1	.	.	.	.	.	.	.	.	.	.	T	24.5	4.536721	0.85812	.	.	ENSG00000108984	ENST00000359094	.	.	.	5.65	5.65	0.86999	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.75496	0.3857	L	0.58925	1.835	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.75059	-0.3451	8	.	.	.	-18.1181	15.0093	0.71539	0.0:0.0:0.0:1.0	.	163;163	P52564;A8K3Y2	MP2K6_HUMAN;.	G	163	.	.	V	+	2	0	MAP2K6	65028789	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.747000	0.85070	2.281000	0.76405	0.528000	0.53228	GTA		0.343	MAP2K6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450689.1	NM_002758	
FBN3	84467	broad.mit.edu	37	19	8145997	8145997	+	Missense_Mutation	SNP	T	T	C			TCGA-59-2351-01A-01W-0799-08	TCGA-59-2351-10A-01W-0800-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	930e9c43-af1e-47bc-8ee2-b3bd8a11bb8b	a31b2f09-d6d7-4ce2-a7b4-fd706c7a1c0f	g.chr19:8145997T>C	ENST00000600128.1	-	59	7757	c.7343A>G	c.(7342-7344)gAc>gGc	p.D2448G	FBN3_ENST00000270509.2_Missense_Mutation_p.D2448G|FBN3_ENST00000601739.1_Missense_Mutation_p.D2448G			Q75N90	FBN3_HUMAN	fibrillin 3	2448	EGF-like 40; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.					proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)	p.D2448G(1)		NS(1)|breast(9)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(15)|lung(53)|ovary(7)|pancreas(2)|prostate(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	132						GGTGCATTCGTCCAGGTCTGC	0.667																																																1	Substitution - Missense(1)	ovary(1)	19											83.0	74.0	77.0					19																	8145997		2203	4300	6503	8051997	SO:0001583	missense	84467				CCDS12196.1	19p13	2008-02-05							18794	protein-coding gene	gene with protein product		608529					Standard	NM_032447		Approved		uc002mjf.3	Q75N90		ENST00000600128.1:c.7343A>G	19.37:g.8145997T>C	ENSP00000470498:p.Asp2448Gly		8051997	Q75N91|Q75N92|Q75N93|Q86SJ5|Q96JP8	Missense_Mutation	SNP	ENST00000600128.1	37	CCDS12196.1	.	.	.	.	.	.	.	.	.	.	T	20.6	4.012025	0.75046	.	.	ENSG00000142449	ENST00000270509;ENST00000341066	D	0.95588	-3.75	4.12	4.12	0.48240	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.125429	0.51477	U	0.000088	D	0.98333	0.9447	H	0.96547	3.84	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.91635	0.999;0.999	D	0.99222	1.0879	10	0.72032	D	0.01	.	13.4113	0.60944	0.0:0.0:0.0:1.0	.	2448;554	Q75N90;Q6ZNB8	FBN3_HUMAN;.	G	2448;554	ENSP00000270509:D2448G	ENSP00000270509:D2448G	D	-	2	0	FBN3	8051997	1.000000	0.71417	1.000000	0.80357	0.816000	0.46133	7.642000	0.83385	1.633000	0.50488	0.247000	0.18012	GAC		0.667	FBN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461428.2	NM_032447	
MUC16	94025	broad.mit.edu	37	19	9086728	9086728	+	Nonsense_Mutation	SNP	G	G	C			TCGA-59-2351-01A-01W-0799-08	TCGA-59-2351-10A-01W-0800-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	930e9c43-af1e-47bc-8ee2-b3bd8a11bb8b	a31b2f09-d6d7-4ce2-a7b4-fd706c7a1c0f	g.chr19:9086728G>C	ENST00000397910.4	-	1	5290	c.5087C>G	c.(5086-5088)tCa>tGa	p.S1696*		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	1696	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.S1696*(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TCTTCCTAATGACTGGCTGAT	0.473																																																1	Substitution - Nonsense(1)	ovary(1)	19											147.0	137.0	140.0					19																	9086728		1969	4165	6134	8947728	SO:0001587	stop_gained	94025			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.5087C>G	19.37:g.9086728G>C	ENSP00000381008:p.Ser1696*		8947728	Q6ZQW5|Q96RK2	Nonsense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	44	10.718189	0.99456	.	.	ENSG00000181143	ENST00000397910	.	.	.	1.33	-2.65	0.06095	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	3.5546	0.07860	0.0:0.2319:0.3137:0.4544	.	.	.	.	X	1696	.	ENSP00000381008:S1696X	S	-	2	0	MUC16	8947728	0.000000	0.05858	0.000000	0.03702	0.171000	0.22731	-1.057000	0.03486	-1.198000	0.02669	0.313000	0.20887	TCA		0.473	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
COL5A3	50509	broad.mit.edu	37	19	10090669	10090669	+	Splice_Site	SNP	C	C	A			TCGA-59-2351-01A-01W-0799-08	TCGA-59-2351-10A-01W-0800-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	930e9c43-af1e-47bc-8ee2-b3bd8a11bb8b	a31b2f09-d6d7-4ce2-a7b4-fd706c7a1c0f	g.chr19:10090669C>A	ENST00000264828.3	-	36	2744		c.e36+1			NM_015719.3	NP_056534.2	P25940	CO5A3_HUMAN	collagen, type V, alpha 3						axon guidance (GO:0007411)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)	p.?(1)		NS(2)|breast(3)|central_nervous_system(2)|endometrium(11)|kidney(23)|large_intestine(12)|liver(2)|lung(35)|ovary(8)|prostate(5)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	116			Epithelial(33;7.11e-05)			ACCTCACTCACAGGGGGGCCC	0.602																																																1	Unknown(1)	ovary(1)	19											47.0	43.0	45.0					19																	10090669		2203	4300	6503	9951669	SO:0001630	splice_region_variant	50509			AF177941	CCDS12222.1	19p13.2	2013-01-16			ENSG00000080573	ENSG00000080573		"""Collagens"""	14864	protein-coding gene	gene with protein product		120216				10722718	Standard	NM_015719		Approved		uc002mmq.1	P25940	OTTHUMG00000150019	ENST00000264828.3:c.2658+1G>T	19.37:g.10090669C>A			9951669	Q9NZQ6	Splice_Site	SNP	ENST00000264828.3	37	CCDS12222.1	.	.	.	.	.	.	.	.	.	.	C	18.75	3.691617	0.68271	.	.	ENSG00000080573	ENST00000264828	.	.	.	4.5	4.5	0.54988	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.6968	0.69129	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	COL5A3	9951669	1.000000	0.71417	0.952000	0.39060	0.821000	0.46438	7.190000	0.77755	2.058000	0.61347	0.467000	0.42956	.		0.602	COL5A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315788.1	NM_015719	Intron
SLC44A2	57153	broad.mit.edu	37	19	10746124	10746124	+	Missense_Mutation	SNP	A	A	G			TCGA-59-2351-01A-01W-0799-08	TCGA-59-2351-10A-01W-0800-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	930e9c43-af1e-47bc-8ee2-b3bd8a11bb8b	a31b2f09-d6d7-4ce2-a7b4-fd706c7a1c0f	g.chr19:10746124A>G	ENST00000335757.5	+	14	1542	c.1166A>G	c.(1165-1167)aAc>aGc	p.N389S	SLC44A2_ENST00000407327.4_Missense_Mutation_p.N387S|SLC44A2_ENST00000586078.1_Missense_Mutation_p.N389S			Q8IWA5	CTL2_HUMAN	solute carrier family 44 (choline transporter), member 2	389					choline transport (GO:0015871)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	choline transmembrane transporter activity (GO:0015220)|signal transducer activity (GO:0004871)	p.N389S(1)		NS(1)|breast(3)|endometrium(5)|kidney(1)|large_intestine(7)|lung(4)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	27			Epithelial(33;8.7e-06)|all cancers(31;2.77e-05)		Choline(DB00122)	TCCACTTCCAACGAAGCGGTC	0.547																																																1	Substitution - Missense(1)	ovary(1)	19											140.0	143.0	142.0					19																	10746124		2203	4300	6503	10607124	SO:0001583	missense	57153			AF070636	CCDS12245.1, CCDS54216.1	19p13.2	2014-08-12	2013-07-17		ENSG00000129353	ENSG00000129353		"""Solute carriers"""	17292	protein-coding gene	gene with protein product		606106				10677542, 15715662	Standard	NM_001145056		Approved	CTL2	uc002mpf.3	Q8IWA5	OTTHUMG00000180585	ENST00000335757.5:c.1166A>G	19.37:g.10746124A>G	ENSP00000336888:p.Asn389Ser		10607124	B2RBB1|B3KNH3|B4DFJ0|F2Q9D7|Q658V1|Q658Z2|Q6PJV7|Q8N2F0|Q9NY68	Missense_Mutation	SNP	ENST00000335757.5	37	CCDS12245.1	.	.	.	.	.	.	.	.	.	.	A	13.77	2.336281	0.41398	.	.	ENSG00000129353	ENST00000407327;ENST00000335757;ENST00000380614	T;T	0.21031	2.03;2.03	4.31	4.31	0.51392	.	0.098520	0.64402	D	0.000001	T	0.19685	0.0473	L	0.35723	1.085	0.46185	D	0.998916	B;B;B	0.15473	0.01;0.013;0.01	B;B;B	0.25987	0.039;0.065;0.039	T	0.05068	-1.0908	10	0.66056	D	0.02	.	12.5643	0.56300	1.0:0.0:0.0:0.0	.	389;389;387	Q8IWA5-2;Q8IWA5;Q8IWA5-3	.;CTL2_HUMAN;.	S	387;389;389	ENSP00000385135:N387S;ENSP00000336888:N389S	ENSP00000336888:N389S	N	+	2	0	SLC44A2	10607124	1.000000	0.71417	0.985000	0.45067	0.791000	0.44710	4.691000	0.61738	1.806000	0.52798	0.374000	0.22700	AAC		0.547	SLC44A2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452045.1		
RYR1	6261	broad.mit.edu	37	19	39023345	39023345	+	Missense_Mutation	SNP	A	A	G			TCGA-59-2351-01A-01W-0799-08	TCGA-59-2351-10A-01W-0800-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	930e9c43-af1e-47bc-8ee2-b3bd8a11bb8b	a31b2f09-d6d7-4ce2-a7b4-fd706c7a1c0f	g.chr19:39023345A>G	ENST00000359596.3	+	78	11228	c.11228A>G	c.(11227-11229)gAa>gGa	p.E3743G	AC067969.2_ENST00000595853.1_RNA|RYR1_ENST00000360985.3_Missense_Mutation_p.E3743G|RYR1_ENST00000355481.4_Missense_Mutation_p.E3738G			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	3743					calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)	p.E3743G(1)		NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	GAGAACGGTGAAGCTGAAGAG	0.592																																																1	Substitution - Missense(1)	ovary(1)	19											114.0	110.0	111.0					19																	39023345		2203	4300	6503	43715185	SO:0001583	missense	6261			J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.11228A>G	19.37:g.39023345A>G	ENSP00000352608:p.Glu3743Gly		43715185	Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	ENST00000359596.3	37	CCDS33011.1	.	.	.	.	.	.	.	.	.	.	A	7.549	0.662359	0.14645	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985;ENST00000538206	D;D;D	0.97303	-4.28;-4.28;-4.33	5.37	4.36	0.52297	.	0.097231	0.39083	U	0.001476	D	0.92325	0.7565	N	0.22421	0.69	0.39292	D	0.964756	B;B;B	0.33171	0.4;0.264;0.172	B;B;B	0.33960	0.173;0.124;0.058	D	0.89052	0.3456	10	0.25106	T	0.35	.	9.3576	0.38175	0.9147:0.0:0.0853:0.0	.	3743;3738;3743	P21817-3;P21817-2;P21817	.;.;RYR1_HUMAN	G	3743;3738;3743;663	ENSP00000352608:E3743G;ENSP00000347667:E3738G;ENSP00000354254:E3743G	ENSP00000347667:E3738G	E	+	2	0	RYR1	43715185	0.741000	0.28217	0.039000	0.18376	0.039000	0.13416	2.269000	0.43346	0.886000	0.36113	0.533000	0.62120	GAA		0.592	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1		
TIMM50	92609	broad.mit.edu	37	19	39978811	39978811	+	Silent	SNP	C	C	G			TCGA-59-2351-01A-01W-0799-08	TCGA-59-2351-10A-01W-0800-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	930e9c43-af1e-47bc-8ee2-b3bd8a11bb8b	a31b2f09-d6d7-4ce2-a7b4-fd706c7a1c0f	g.chr19:39978811C>G	ENST00000607714.1	+	9	829	c.807C>G	c.(805-807)ggC>ggG	p.G269G	TIMM50_ENST00000599794.1_Silent_p.G73G|TIMM50_ENST00000314349.4_Silent_p.G372G|TIMM50_ENST00000544017.1_Silent_p.G156G			Q3ZCQ8	TIM50_HUMAN	translocase of inner mitochondrial membrane 50 homolog (S. cerevisiae)	269	FCP1 homology. {ECO:0000255|PROSITE- ProRule:PRU00336}.				cellular protein metabolic process (GO:0044267)|mitochondrial membrane organization (GO:0007006)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|protein targeting to mitochondrion (GO:0006626)|release of cytochrome c from mitochondria (GO:0001836)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial inner membrane presequence translocase complex (GO:0005744)|mitochondrion (GO:0005739)|nuclear speck (GO:0016607)	interleukin-2 receptor binding (GO:0005134)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|ribonucleoprotein complex binding (GO:0043021)|RNA binding (GO:0003723)	p.G372G(1)		NS(1)|endometrium(3)|large_intestine(5)|lung(3)|ovary(1)|prostate(1)	14	all_cancers(60;4.04e-06)|all_lung(34;1.77e-07)|Lung NSC(34;2.09e-07)|all_epithelial(25;1.13e-05)|Ovarian(47;0.159)		Epithelial(26;5.89e-26)|all cancers(26;1.96e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)			CCTGGGACGGCAACTCTGATG	0.592																																																1	Substitution - coding silent(1)	ovary(1)	19											203.0	204.0	203.0					19																	39978811		2203	4300	6503	44670651	SO:0001819	synonymous_variant	92609			BC009072	CCDS33023.1	19q13.2	2010-06-21	2006-04-04		ENSG00000105197	ENSG00000105197		"""Serine/threonine phosphatases / CTD aspartate-based phosphatases"""	23656	protein-coding gene	gene with protein product		607381	"""translocase of inner mitochondrial membrane 50 homolog (yeast)"""			12437925	Standard	NM_001001563		Approved	TIM50L	uc002olu.1	Q3ZCQ8		ENST00000607714.1:c.807C>G	19.37:g.39978811C>G			44670651	Q330K1|Q6QA00|Q96FJ5|Q96GY2|Q9H370	Silent	SNP	ENST00000607714.1	37																																																																																					0.592	TIMM50-021	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000470728.1	NM_001001563	
CIC	23152	broad.mit.edu	37	19	42793479	42793479	+	Missense_Mutation	SNP	G	G	C			TCGA-59-2351-01A-01W-0799-08	TCGA-59-2351-10A-01W-0800-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	930e9c43-af1e-47bc-8ee2-b3bd8a11bb8b	a31b2f09-d6d7-4ce2-a7b4-fd706c7a1c0f	g.chr19:42793479G>C	ENST00000575354.2	+	8	1321	c.1281G>C	c.(1279-1281)caG>caC	p.Q427H	CIC_ENST00000160740.3_Missense_Mutation_p.Q427H|CIC_ENST00000572681.2_Missense_Mutation_p.Q1336H	NM_015125.3	NP_055940.3	Q96RK0	CIC_HUMAN	capicua transcriptional repressor	427					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.Q427H(1)		autonomic_ganglia(1)|breast(5)|central_nervous_system(32)|endometrium(10)|kidney(2)|large_intestine(7)|lung(9)|ovary(7)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	82		Prostate(69;0.00682)				CTCGTTCTCAGCGTGCGGCCA	0.627			"""Mis, F, S"""		oligodendroglioma																																		Rec	yes		19	19q13.2	23152	capicua homolog		O	1	Substitution - Missense(1)	ovary(1)	19											50.0	45.0	47.0					19																	42793479		2203	4300	6503	47485319	SO:0001583	missense	23152			AB002304	CCDS12601.1	19q13.2	2013-03-15	2013-03-15		ENSG00000079432	ENSG00000079432			14214	protein-coding gene	gene with protein product		612082	"""capicua (Drosophila) homolog"", ""capicua homolog (Drosophila)"""			12393275, 15981098	Standard	NM_015125		Approved	KIAA0306	uc002otf.1	Q96RK0		ENST00000575354.2:c.1281G>C	19.37:g.42793479G>C	ENSP00000458663:p.Gln427His		47485319	Q7LGI1|Q9UEG5|Q9Y6T1	Missense_Mutation	SNP	ENST00000575354.2	37	CCDS12601.1	.	.	.	.	.	.	.	.	.	.	G	10.83	1.461610	0.26248	.	.	ENSG00000079432	ENST00000160740	.	.	.	4.59	2.46	0.29980	.	.	.	.	.	T	0.43942	0.1270	N	0.24115	0.695	0.37038	D	0.896981	D	0.61080	0.989	P	0.56916	0.809	T	0.50145	-0.8862	8	0.87932	D	0	-14.2648	6.7091	0.23266	0.2892:0.0:0.7108:0.0	.	427	Q96RK0	CIC_HUMAN	H	427	.	ENSP00000160740:Q427H	Q	+	3	2	CIC	47485319	1.000000	0.71417	1.000000	0.80357	0.849000	0.48306	2.460000	0.45031	0.679000	0.31345	-0.254000	0.11334	CAG		0.627	CIC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000438532.2		
CCDC8	83987	broad.mit.edu	37	19	46915211	46915211	+	Missense_Mutation	SNP	C	C	G			TCGA-59-2351-01A-01W-0799-08	TCGA-59-2351-10A-01W-0800-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	930e9c43-af1e-47bc-8ee2-b3bd8a11bb8b	a31b2f09-d6d7-4ce2-a7b4-fd706c7a1c0f	g.chr19:46915211C>G	ENST00000307522.3	-	1	1630	c.857G>C	c.(856-858)gGt>gCt	p.G286A		NM_032040.4	NP_114429.2	Q9H0W5	CCDC8_HUMAN	coiled-coil domain containing 8	286					microtubule cytoskeleton organization (GO:0000226)|negative regulation of phosphatase activity (GO:0010923)|regulation of mitosis (GO:0007088)	3M complex (GO:1990393)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)		p.G286A(1)		breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	23				OV - Ovarian serous cystadenocarcinoma(262;4.66e-05)|all cancers(93;0.000582)|Epithelial(262;0.00428)|GBM - Glioblastoma multiforme(486;0.0421)		TGCCCCCTGACCTGTGGGTGC	0.617																																																1	Substitution - Missense(1)	ovary(1)	19											75.0	74.0	74.0					19																	46915211		2203	4300	6503	51607051	SO:0001583	missense	83987			BC025243	CCDS12685.1	19q13.33	2012-04-17			ENSG00000169515	ENSG00000169515		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	25367	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 20"""	614145				11230166	Standard	NM_032040		Approved	DKFZp564K0322, 3M3, PPP1R20	uc002pep.3	Q9H0W5	OTTHUMG00000162348	ENST00000307522.3:c.857G>C	19.37:g.46915211C>G	ENSP00000303158:p.Gly286Ala		51607051	Q8TB26	Missense_Mutation	SNP	ENST00000307522.3	37	CCDS12685.1	.	.	.	.	.	.	.	.	.	.	C	0.824	-0.747763	0.03065	.	.	ENSG00000169515	ENST00000307522	T	0.08720	3.06	4.44	-8.4	0.00965	.	1.190450	0.06508	N	0.737468	T	0.02047	0.0064	N	0.02142	-0.665	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.46317	-0.9200	10	0.10111	T	0.7	1.6229	5.6542	0.17633	0.0839:0.1151:0.1598:0.6412	.	286	Q9H0W5	CCDC8_HUMAN	A	286	ENSP00000303158:G286A	ENSP00000303158:G286A	G	-	2	0	CCDC8	51607051	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.553000	0.06012	-0.890000	0.03945	-0.844000	0.03045	GGT		0.617	CCDC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368598.1	NM_032040	
ZSCAN5A	79149	broad.mit.edu	37	19	56734000	56734000	+	Silent	SNP	T	T	A			TCGA-59-2351-01A-01W-0799-08	TCGA-59-2351-10A-01W-0800-08	T	T	A	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	930e9c43-af1e-47bc-8ee2-b3bd8a11bb8b	a31b2f09-d6d7-4ce2-a7b4-fd706c7a1c0f	g.chr19:56734000T>A	ENST00000587340.1	-	6	1394	c.699A>T	c.(697-699)ccA>ccT	p.P233P	ZSCAN5A_ENST00000254165.3_Silent_p.P116P|ZSCAN5A_ENST00000587492.1_Silent_p.P87P|ZSCAN5A_ENST00000391713.1_Silent_p.P233P|ZSCAN5A_ENST00000592355.1_Silent_p.P233P			Q9BUG6	ZSA5A_HUMAN	zinc finger and SCAN domain containing 5A	233					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.P233P(1)		autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|liver(1)|lung(12)|ovary(1)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	37						ATGTCAGTCCTGGGTTCTCTT	0.527																																																1	Substitution - coding silent(1)	ovary(1)	19											211.0	183.0	193.0					19																	56734000		2203	4300	6503	61425812	SO:0001819	synonymous_variant	79149			AK098700	CCDS12941.1	19q13.43	2013-01-08	2008-06-10	2008-06-10	ENSG00000131848	ENSG00000131848		"""-"", ""Zinc fingers, C2H2-type"""	23710	protein-coding gene	gene with protein product			"""zinc finger protein 495"", ""zinc finger and SCAN domain containing 5"""	ZNF495, ZSCAN5			Standard	NM_024303		Approved	MGC4161	uc002qmq.3	Q9BUG6		ENST00000587340.1:c.699A>T	19.37:g.56734000T>A			61425812	B4DX98|Q49A73|Q53F04|Q8N7B3	Silent	SNP	ENST00000587340.1	37	CCDS12941.1																																																																																				0.527	ZSCAN5A-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458110.1	NM_024303	
KCNS3	3790	broad.mit.edu	37	2	18112771	18112771	+	Missense_Mutation	SNP	C	C	G			TCGA-59-2351-01A-01W-0799-08	TCGA-59-2351-10A-01W-0800-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	930e9c43-af1e-47bc-8ee2-b3bd8a11bb8b	a31b2f09-d6d7-4ce2-a7b4-fd706c7a1c0f	g.chr2:18112771C>G	ENST00000403915.1	+	3	947	c.496C>G	c.(496-498)Cag>Gag	p.Q166E	KCNS3_ENST00000465292.1_Intron|KCNS3_ENST00000304101.4_Missense_Mutation_p.Q166E	NM_001282428.1	NP_001269357.1	Q9BQ31	KCNS3_HUMAN	potassium voltage-gated channel, delayed-rectifier, subfamily S, member 3	166					energy reserve metabolic process (GO:0006112)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel regulator activity (GO:0015459)	p.Q166E(1)		endometrium(5)|kidney(1)|large_intestine(7)|lung(11)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					GCGATTTGGTCAGCTCCGGAA	0.502																																																1	Substitution - Missense(1)	ovary(1)	2											63.0	68.0	66.0					2																	18112771		2203	4300	6503	17976252	SO:0001583	missense	3790			AF043472	CCDS1692.1	2p24	2011-07-05			ENSG00000170745	ENSG00000170745		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6302	protein-coding gene	gene with protein product		603888				10484328, 16382104	Standard	NM_002252		Approved	Kv9.3	uc002rcw.3	Q9BQ31	OTTHUMG00000044150	ENST00000403915.1:c.496C>G	2.37:g.18112771C>G	ENSP00000385968:p.Gln166Glu		17976252	D6W520|O43651|Q4ZFY1|Q96B56	Missense_Mutation	SNP	ENST00000403915.1	37	CCDS1692.1	.	.	.	.	.	.	.	.	.	.	C	0	-2.815397	0.00073	.	.	ENSG00000170745	ENST00000403915;ENST00000304101	D;D	0.96651	-4.08;-4.08	5.88	2.94	0.34122	.	0.272597	0.39909	N	0.001235	T	0.79263	0.4416	N	0.00462	-1.47	0.22305	N	0.999213	B	0.02656	0.0	B	0.01281	0.0	T	0.74450	-0.3661	10	0.02654	T	1	.	4.3702	0.11244	0.126:0.459:0.3281:0.0869	.	166	Q9BQ31	KCNS3_HUMAN	E	166	ENSP00000385968:Q166E;ENSP00000305824:Q166E	ENSP00000305824:Q166E	Q	+	1	0	KCNS3	17976252	1.000000	0.71417	0.564000	0.28396	0.015000	0.08874	4.063000	0.57499	1.500000	0.48636	-0.136000	0.14681	CAG		0.502	KCNS3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323808.1	NM_002252	
ERCC3	2071	broad.mit.edu	37	2	128046408	128046408	+	Silent	SNP	G	G	A			TCGA-59-2351-01A-01W-0799-08	TCGA-59-2351-10A-01W-0800-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	930e9c43-af1e-47bc-8ee2-b3bd8a11bb8b	a31b2f09-d6d7-4ce2-a7b4-fd706c7a1c0f	g.chr2:128046408G>A	ENST00000285398.2	-	7	949	c.855C>T	c.(853-855)atC>atT	p.I285I	ERCC3_ENST00000493187.2_Silent_p.I221I	NM_000122.1	NP_000113.1	P19447	ERCC3_HUMAN	excision repair cross-complementation group 3	285					7-methylguanosine mRNA capping (GO:0006370)|apoptotic process (GO:0006915)|DNA repair (GO:0006281)|DNA topological change (GO:0006265)|gene expression (GO:0010467)|hair cell differentiation (GO:0035315)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA duplex unwinding (GO:0000717)|nucleotide-excision repair, DNA incision (GO:0033683)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|protein localization (GO:0008104)|regulation of mitotic cell cycle phase transition (GO:1901990)|response to hypoxia (GO:0001666)|response to oxidative stress (GO:0006979)|response to UV (GO:0009411)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)|viral process (GO:0016032)	holo TFIIH complex (GO:0005675)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	3'-5' DNA helicase activity (GO:0043138)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATPase activity (GO:0016887)|damaged DNA binding (GO:0003684)|dATP binding (GO:0032564)|DNA binding (GO:0003677)|GTP binding (GO:0005525)|peptide binding (GO:0042277)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)|transcription factor binding (GO:0008134)	p.I285I(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(12)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	31	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.073)		ACTCCAGGTGGATGCAACGTT	0.438			"""Mis, S"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																													yes	Rec		Xeroderma pigmentosum (B)	2	2q21	2071	"""excision repair cross-complementing rodent repair deficiency, complementation group 3 (xeroderma pigmentosum group B complementing)"""		E	1	Substitution - coding silent(1)	ovary(1)	2											155.0	159.0	157.0					2																	128046408		2203	4300	6503	127762878	SO:0001819	synonymous_variant	2071	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	M31899	CCDS2144.1	2q21	2014-09-17	2014-03-07		ENSG00000163161	ENSG00000163161		"""General transcription factors"", ""General transcription factor IIH complex subunits"""	3435	protein-coding gene	gene with protein product	"""xeroderma pigmentosum group B complementing"""	133510	"""excision repair cross-complementing rodent repair deficiency, complementation group 3"""			8202161	Standard	NM_000122		Approved	XPB, BTF2, RAD25, TFIIH, GTF2H	uc002toh.1	P19447	OTTHUMG00000131530	ENST00000285398.2:c.855C>T	2.37:g.128046408G>A			127762878	Q53QM0	Silent	SNP	ENST00000285398.2	37	CCDS2144.1	.	.	.	.	.	.	.	.	.	.	G	6.277	0.419221	0.11870	.	.	ENSG00000163161	ENST00000456257	.	.	.	5.5	2.75	0.32379	.	.	.	.	.	T	0.53286	0.1787	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.42172	-0.9467	4	.	.	.	-27.0873	4.9387	0.13954	0.2876:0.0:0.5763:0.1361	.	.	.	.	F	135	.	.	S	-	2	0	ERCC3	127762878	1.000000	0.71417	1.000000	0.80357	0.580000	0.36256	1.694000	0.37752	0.303000	0.22785	-0.768000	0.03414	TCC		0.438	ERCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331028.1	NM_000122	
LRP2	4036	broad.mit.edu	37	2	170034471	170034471	+	Missense_Mutation	SNP	G	G	T			TCGA-59-2351-01A-01W-0799-08	TCGA-59-2351-10A-01W-0800-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	930e9c43-af1e-47bc-8ee2-b3bd8a11bb8b	a31b2f09-d6d7-4ce2-a7b4-fd706c7a1c0f	g.chr2:170034471G>T	ENST00000263816.3	-	53	10520	c.10235C>A	c.(10234-10236)gCt>gAt	p.A3412D	LRP2_ENST00000461418.1_5'UTR	NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	3412					cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)	p.A3412D(1)		biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	AATGGTAATAGCGAAAGGGTG	0.433																																																1	Substitution - Missense(1)	ovary(1)	2											182.0	157.0	165.0					2																	170034471		2203	4300	6503	169742717	SO:0001583	missense	4036				CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.10235C>A	2.37:g.170034471G>T	ENSP00000263816:p.Ala3412Asp		169742717	O00711|Q16215	Missense_Mutation	SNP	ENST00000263816.3	37	CCDS2232.1	.	.	.	.	.	.	.	.	.	.	G	23.8	4.457461	0.84317	.	.	ENSG00000081479	ENST00000263816;ENST00000536293	D	0.96491	-4.03	5.67	4.78	0.61160	Six-bladed beta-propeller, TolB-like (1);Growth factor, receptor (1);	0.000000	0.85682	D	0.000000	D	0.97688	0.9242	M	0.69185	2.1	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98198	1.0466	10	0.62326	D	0.03	.	16.6992	0.85344	0.0:0.1295:0.8705:0.0	.	3412	P98164	LRP2_HUMAN	D	3412;107	ENSP00000263816:A3412D	ENSP00000263816:A3412D	A	-	2	0	LRP2	169742717	1.000000	0.71417	0.894000	0.35097	0.650000	0.38633	6.745000	0.74860	1.362000	0.46000	0.650000	0.86243	GCT		0.433	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525	
TTN	7273	broad.mit.edu	37	2	179393799	179393799	+	Missense_Mutation	SNP	T	T	G			TCGA-59-2351-01A-01W-0799-08	TCGA-59-2351-10A-01W-0800-08	T	T	G	G	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	930e9c43-af1e-47bc-8ee2-b3bd8a11bb8b	a31b2f09-d6d7-4ce2-a7b4-fd706c7a1c0f	g.chr2:179393799T>G	ENST00000591111.1	-	310	101980	c.101756A>C	c.(101755-101757)aAg>aCg	p.K33919T	TTN-AS1_ENST00000588716.1_RNA|TTN-AS1_ENST00000589391.1_RNA|TTN-AS1_ENST00000592161.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000590040.1_RNA|TTN-AS1_ENST00000592836.1_RNA|TTN-AS1_ENST00000587568.1_RNA|TTN-AS1_ENST00000588257.1_RNA|TTN-AS1_ENST00000588804.1_RNA|TTN-AS1_ENST00000587576.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.K26687T|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.K35560T|TTN_ENST00000342992.6_Missense_Mutation_p.K32992T|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000591867.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000589355.1_RNA|TTN-AS1_ENST00000587944.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000450692.2_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.K26620T|TTN-AS1_ENST00000589434.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.K26495T|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000589842.1_RNA|TTN-AS1_ENST00000591466.1_RNA|TTN-AS1_ENST00000442329.2_RNA|TTN-AS1_ENST00000585487.1_RNA|TTN-AS1_ENST00000585625.1_RNA|TTN-AS1_ENST00000431259.2_RNA|TTN-AS1_ENST00000592182.1_RNA|TTN-AS1_ENST00000604571.1_RNA|TTN-AS1_ENST00000588244.1_RNA|TTN-AS1_ENST00000585358.1_RNA			Q8WZ42	TITIN_HUMAN	titin	33919					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.K32990T(1)|p.K26495T(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GAGGGCTAACTTTTCTTGAGA	0.403																																																2	Substitution - Missense(2)	ovary(2)	2											89.0	82.0	85.0					2																	179393799		1822	4077	5899	179102045	SO:0001583	missense	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.101756A>C	2.37:g.179393799T>G	ENSP00000465570:p.Lys33919Thr		179102045	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	T	14.02	2.410602	0.42715	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.65178	-0.14;0.26;0.23;0.22	5.54	4.37	0.52481	Ribonuclease H-like (1);	.	.	.	.	T	0.46054	0.1373	N	0.17082	0.46	0.23685	N	0.997111	B;B;B;B;B	0.06786	0.0;0.0;0.0;0.0;0.001	B;B;B;B;B	0.08055	0.001;0.001;0.001;0.001;0.003	T	0.41716	-0.9493	9	0.87932	D	0	.	9.3908	0.38372	0.0:0.0:0.1883:0.8117	.	26495;26620;26687;33919;32992	D3DPF9;E7EQE6;E7ET18;Q8WZ42;A6NKB1	.;.;.;TITIN_HUMAN;.	T	32992;26495;26687;26620;26492	ENSP00000343764:K32992T;ENSP00000434586:K26495T;ENSP00000340554:K26687T;ENSP00000352154:K26620T	ENSP00000340554:K26687T	K	-	2	0	TTN	179102045	0.996000	0.38824	0.972000	0.41901	0.881000	0.50899	2.665000	0.46791	0.917000	0.36895	0.533000	0.62120	AAG		0.403	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
SIRPG	55423	broad.mit.edu	37	20	1617038	1617038	+	Missense_Mutation	SNP	A	A	G			TCGA-59-2351-01A-01W-0799-08	TCGA-59-2351-10A-01W-0800-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	930e9c43-af1e-47bc-8ee2-b3bd8a11bb8b	a31b2f09-d6d7-4ce2-a7b4-fd706c7a1c0f	g.chr20:1617038A>G	ENST00000303415.3	-	3	608	c.544T>C	c.(544-546)Tgg>Cgg	p.W182R	RP11-77C3.3_ENST00000456177.1_RNA|SIRPG_ENST00000381580.1_Missense_Mutation_p.W149R|SIRPG_ENST00000216927.4_Missense_Mutation_p.W182R|RP11-77C3.3_ENST00000437384.1_RNA|SIRPG_ENST00000381583.2_Missense_Mutation_p.W182R|SIRPG_ENST00000344103.4_Intron	NM_018556.3	NP_061026.2	Q9P1W8	SIRPG_HUMAN	signal-regulatory protein gamma	182	Ig-like C1-type 1.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of T cell activation (GO:0050870)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.W182R(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|stomach(1)	27						TTTTTGAACCATTTCAGGGTG	0.567																																																1	Substitution - Missense(1)	ovary(1)	20											176.0	157.0	164.0					20																	1617038		2203	4300	6503	1565038	SO:0001583	missense	55423			AB042624	CCDS13020.2, CCDS13021.2, CCDS33434.1	20p13	2013-01-11	2006-02-03	2006-02-03	ENSG00000089012	ENSG00000089012		"""Signal-regulatory proteins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C1-set domain containing"""	15757	protein-coding gene	gene with protein product		605466	"""signal-regulatory protein beta 2"""	SIRPB2		11185750, 16339511	Standard	XM_005260749		Approved	bA77C3.1, SIRP-B2, SIRPgamma, CD172g	uc002wfm.1	Q9P1W8	OTTHUMG00000031680	ENST00000303415.3:c.544T>C	20.37:g.1617038A>G	ENSP00000305529:p.Trp182Arg		1565038	B1AKP6|Q5D051|Q5JV25|Q5MKL4|Q8WWA5|Q9NQK8	Missense_Mutation	SNP	ENST00000303415.3	37	CCDS13020.2	.	.	.	.	.	.	.	.	.	.	.	14.95	2.687849	0.48097	.	.	ENSG00000089012	ENST00000381580;ENST00000303415;ENST00000381583;ENST00000216927	T;T;T;T	0.04551	3.6;3.6;3.6;3.6	2.09	2.09	0.27110	Immunoglobulin-like (1);Immunoglobulin C1-set (2);Immunoglobulin-like fold (1);	0.000000	0.56097	D	0.000034	T	0.26048	0.0635	H	0.96333	3.805	0.39250	D	0.964015	D;D	0.89917	0.999;1.0	D;D	0.77557	0.983;0.99	T	0.06320	-1.0833	10	0.87932	D	0	.	6.0565	0.19815	1.0:0.0:0.0:0.0	.	182;182	Q9P1W8-4;Q9P1W8	.;SIRPG_HUMAN	R	149;182;182;182	ENSP00000370992:W149R;ENSP00000305529:W182R;ENSP00000370995:W182R;ENSP00000216927:W182R	ENSP00000216927:W182R	W	-	1	0	SIRPG	1565038	0.987000	0.35691	0.859000	0.33776	0.385000	0.30292	3.631000	0.54280	0.948000	0.37687	0.332000	0.21555	TGG		0.567	SIRPG-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077566.2	NM_018556	
ZPLD1	131368	broad.mit.edu	37	3	102187907	102187907	+	Silent	SNP	G	G	A			TCGA-59-2351-01A-01W-0799-08	TCGA-59-2351-10A-01W-0800-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	930e9c43-af1e-47bc-8ee2-b3bd8a11bb8b	a31b2f09-d6d7-4ce2-a7b4-fd706c7a1c0f	g.chr3:102187907G>A	ENST00000491959.1	+	15	1743	c.861G>A	c.(859-861)caG>caA	p.Q287Q	ZPLD1_ENST00000306176.1_Silent_p.Q303Q|ZPLD1_ENST00000466937.1_Silent_p.Q287Q			Q8TCW7	ZPLD1_HUMAN	zona pellucida-like domain containing 1	287	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.					integral component of membrane (GO:0016021)		p.Q303Q(1)		central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(18)|ovary(2)|skin(3)	35						ACAAGAATCAGAAAATGTCCA	0.478																																																1	Substitution - coding silent(1)	ovary(1)	3											127.0	123.0	124.0					3																	102187907		2203	4300	6503	103670597	SO:0001819	synonymous_variant	131368			AY090780	CCDS2947.1	3q12.3	2009-03-25			ENSG00000170044	ENSG00000170044			27022	protein-coding gene	gene with protein product		615915				18632209	Standard	NM_175056		Approved		uc003dvt.1	Q8TCW7	OTTHUMG00000159229	ENST00000491959.1:c.861G>A	3.37:g.102187907G>A			103670597	Q49AS1|Q8WU36	Silent	SNP	ENST00000491959.1	37																																																																																					0.478	ZPLD1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000353984.1	NM_175056	
MYLK	4638	broad.mit.edu	37	3	123451760	123451760	+	Nonsense_Mutation	SNP	C	C	T			TCGA-59-2351-01A-01W-0799-08	TCGA-59-2351-10A-01W-0800-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	930e9c43-af1e-47bc-8ee2-b3bd8a11bb8b	a31b2f09-d6d7-4ce2-a7b4-fd706c7a1c0f	g.chr3:123451760C>T	ENST00000475616.1	-	8	1498	c.1499G>A	c.(1498-1500)tGg>tAg	p.W500*	MYLK_ENST00000360304.3_Nonsense_Mutation_p.W500*|MYLK_ENST00000346322.5_Intron|MYLK_ENST00000360772.3_Nonsense_Mutation_p.W500*|MYLK_ENST00000359169.1_Nonsense_Mutation_p.W500*			Q15746	MYLK_HUMAN	myosin light chain kinase	500	Ig-like C2-type 3.				actin filament organization (GO:0007015)|aorta smooth muscle tissue morphogenesis (GO:0060414)|bleb assembly (GO:0032060)|cellular hypotonic response (GO:0071476)|muscle contraction (GO:0006936)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cell migration (GO:0030335)|positive regulation of wound healing (GO:0090303)|protein phosphorylation (GO:0006468)|smooth muscle contraction (GO:0006939)|tonic smooth muscle contraction (GO:0014820)	cell-cell junction (GO:0005911)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|metal ion binding (GO:0046872)|myosin light chain kinase activity (GO:0004687)	p.W500*(1)		NS(2)|breast(4)|central_nervous_system(1)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(37)|ovary(7)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	113		Lung NSC(201;0.0496)		GBM - Glioblastoma multiforme(114;0.0736)		TTGGAGGGTCCAGCTACAGGA	0.572																																																1	Substitution - Nonsense(1)	ovary(1)	3											73.0	58.0	63.0					3																	123451760		2203	4300	6503	124934450	SO:0001587	stop_gained	4638			X85337	CCDS3023.1, CCDS43141.1, CCDS46896.1, CCDS46897.1, CCDS58849.1	3q21	2013-02-11	2008-01-23		ENSG00000065534	ENSG00000065534	2.7.11.18	"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7590	protein-coding gene	gene with protein product	"""smooth muscle myosin light chain kinase"""	600922	"""myosin, light polypeptide kinase"""			8575746	Standard	NM_053026		Approved	MLCK, smMLCK, MYLK1, MLCK1	uc003ego.3	Q15746	OTTHUMG00000141304	ENST00000475616.1:c.1499G>A	3.37:g.123451760C>T	ENSP00000418335:p.Trp500*		124934450	B4DUE3|D3DN97|O95796|O95797|O95798|O95799|Q14844|Q16794|Q17S15|Q3ZCP9|Q5MY99|Q5MYA0|Q6P2N0|Q7Z4J0|Q9C0L5|Q9UBG5|Q9UBY6|Q9UIT9	Nonsense_Mutation	SNP	ENST00000475616.1	37	CCDS46896.1	.	.	.	.	.	.	.	.	.	.	C	42	9.731948	0.99249	.	.	ENSG00000065534	ENST00000360772;ENST00000360304;ENST00000359169;ENST00000475616	.	.	.	5.2	5.2	0.72013	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.48119	T	0.1	.	17.6554	0.88176	0.0:1.0:0.0:0.0	.	.	.	.	X	500	.	ENSP00000352088:W500X	W	-	2	0	MYLK	124934450	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.504000	0.66968	2.710000	0.92621	0.591000	0.81541	TGG		0.572	MYLK-004	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356464.1	NM_053025	
KALRN	8997	broad.mit.edu	37	3	124436217	124436217	+	Silent	SNP	A	A	T	rs142823302		TCGA-59-2351-01A-01W-0799-08	TCGA-59-2351-10A-01W-0800-08	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	930e9c43-af1e-47bc-8ee2-b3bd8a11bb8b	a31b2f09-d6d7-4ce2-a7b4-fd706c7a1c0f	g.chr3:124436217A>T	ENST00000291478.5	+	26	3472	c.3309A>T	c.(3307-3309)gcA>gcT	p.A1103A	KALRN_ENST00000360013.3_Silent_p.A2800A|KALRN_ENST00000428018.2_Silent_p.A1071A	NM_007064.3	NP_008995.2	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase	2799					apoptotic signaling pathway (GO:0097190)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|protein phosphorylation (GO:0006468)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.A1103A(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(21)|lung(28)|ovary(4)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	83						GCAGGGTTGCACATTTGGACA	0.488																																																1	Substitution - coding silent(1)	ovary(1)	3											70.0	66.0	68.0					3																	124436217		2203	4300	6503	125918907	SO:0001819	synonymous_variant	8997			U94190	CCDS3027.1, CCDS3028.1	3q21.2	2013-02-11	2005-03-11	2005-03-12	ENSG00000160145	ENSG00000160145		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	4814	protein-coding gene	gene with protein product	"""serine/threonine kinase with Dbl and pleckstrin homology domains"""	604605	"""huntingtin-associated protein interacting protein (duo)"""	HAPIP		9285789, 10023074	Standard	NM_001024660		Approved	duo, Hs.8004, TRAD, DUET, Kalirin, ARHGEF24	uc003ehd.3	O60229	OTTHUMG00000125545	ENST00000291478.5:c.3309A>T	3.37:g.124436217A>T			125918907	A8MSI4|C9JQ37|Q6ZN45|Q8TBQ5|Q9NSZ4|Q9Y2A5	Silent	SNP	ENST00000291478.5	37	CCDS3028.1	.	.	.	.	.	.	.	.	.	.	A	10.17	1.276200	0.23307	.	.	ENSG00000160145	ENST00000354186	.	.	.	4.87	-8.62	0.00881	.	.	.	.	.	T	0.34337	0.0894	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.44205	-0.9343	4	.	.	.	.	2.0032	0.03471	0.1606:0.4014:0.1632:0.2748	.	.	.	.	L	2769	.	.	H	+	2	0	KALRN	125918907	0.150000	0.22732	0.929000	0.37066	0.987000	0.75469	-0.428000	0.06991	-1.092000	0.03062	0.460000	0.39030	CAC		0.488	KALRN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000246891.5	NM_003947	
EIF2B5	8893	broad.mit.edu	37	3	183861929	183861929	+	Missense_Mutation	SNP	C	C	T	rs541227484		TCGA-59-2351-01A-01W-0799-08	TCGA-59-2351-10A-01W-0800-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	930e9c43-af1e-47bc-8ee2-b3bd8a11bb8b	a31b2f09-d6d7-4ce2-a7b4-fd706c7a1c0f	g.chr3:183861929C>T	ENST00000273783.3	+	14	2034	c.1912C>T	c.(1912-1914)Cgc>Tgc	p.R638C	EIF2B5_ENST00000444495.1_Missense_Mutation_p.R638C	NM_003907.2	NP_003898.2	Q13144	EI2BE_HUMAN	eukaryotic translation initiation factor 2B, subunit 5 epsilon, 82kDa	638	W2. {ECO:0000255|PROSITE- ProRule:PRU00695}.				astrocyte development (GO:0014002)|astrocyte differentiation (GO:0048708)|cellular protein metabolic process (GO:0044267)|cellular response to drug (GO:0035690)|gene expression (GO:0010467)|myelination (GO:0042552)|negative regulation of translational initiation in response to stress (GO:0032057)|oligodendrocyte development (GO:0014003)|ovarian follicle development (GO:0001541)|positive regulation of GTPase activity (GO:0043547)|positive regulation of translational initiation (GO:0045948)|response to endoplasmic reticulum stress (GO:0034976)|response to glucose (GO:0009749)|response to heat (GO:0009408)|response to peptide hormone (GO:0043434)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation initiation factor 2B complex (GO:0005851)|nucleus (GO:0005634)	guanyl-nucleotide exchange factor activity (GO:0005085)|translation initiation factor activity (GO:0003743)|translation initiation factor binding (GO:0031369)	p.R638C(1)		cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(9)|ovary(5)|urinary_tract(1)	27	all_cancers(143;7.59e-11)|Ovarian(172;0.0303)		Epithelial(37;7.06e-36)|OV - Ovarian serous cystadenocarcinoma(80;3.11e-22)			CTACATAAAGCGCGCAGCCGA	0.473																																																1	Substitution - Missense(1)	ovary(1)	3											158.0	162.0	160.0					3																	183861929		2203	4300	6503	185344623	SO:0001583	missense	8893			U23028	CCDS3252.1	3q27.3	2006-07-18	2002-08-29		ENSG00000145191	ENSG00000145191			3261	protein-coding gene	gene with protein product		603945	"""eukaryotic translation initiation factor 2B, subunit 5 (epsilon, 82kD)"""			8688466	Standard	NM_003907		Approved	EIF2Bepsilon, EIF-2B	uc003fmp.3	Q13144	OTTHUMG00000156840	ENST00000273783.3:c.1912C>T	3.37:g.183861929C>T	ENSP00000273783:p.Arg638Cys		185344623	Q541Z1|Q96D04	Missense_Mutation	SNP	ENST00000273783.3	37	CCDS3252.1	.	.	.	.	.	.	.	.	.	.	c	17.43	3.387119	0.61956	.	.	ENSG00000145191	ENST00000273783;ENST00000444495	T;T	0.80824	-1.42;-1.42	5.83	5.83	0.93111	eIF4-gamma/eIF5/eIF2-epsilon (2);Armadillo-type fold (1);MIF4-like, type 1/2/3 (1);	0.000000	0.85682	D	0.000000	D	0.89455	0.6720	M	0.80028	2.48	0.80722	D	1	D;D	0.89917	1.0;1.0	P;P	0.60415	0.874;0.873	D	0.89429	0.3715	10	0.56958	D	0.05	.	20.1218	0.97964	0.0:1.0:0.0:0.0	.	638;638	E9PC74;Q13144	.;EI2BE_HUMAN	C	638	ENSP00000273783:R638C;ENSP00000409142:R638C	ENSP00000273783:R638C	R	+	1	0	EIF2B5	185344623	1.000000	0.71417	1.000000	0.80357	0.362000	0.29581	4.124000	0.57924	2.763000	0.94921	0.561000	0.74099	CGC		0.473	EIF2B5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346168.1		
EIF4G1	1981	broad.mit.edu	37	3	184041297	184041297	+	Silent	SNP	A	A	G			TCGA-59-2351-01A-01W-0799-08	TCGA-59-2351-10A-01W-0800-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	930e9c43-af1e-47bc-8ee2-b3bd8a11bb8b	a31b2f09-d6d7-4ce2-a7b4-fd706c7a1c0f	g.chr3:184041297A>G	ENST00000346169.2	+	15	2461	c.2190A>G	c.(2188-2190)gcA>gcG	p.A730A	EIF4G1_ENST00000382330.3_Silent_p.A737A|EIF2B5_ENST00000444495.1_Intron|EIF4G1_ENST00000411531.1_Silent_p.A691A|EIF4G1_ENST00000319274.6_Silent_p.A730A|EIF4G1_ENST00000435046.2_Silent_p.A534A|EIF4G1_ENST00000427845.1_Silent_p.A644A|EIF4G1_ENST00000441154.1_Silent_p.A567A|EIF4G1_ENST00000350481.5_Silent_p.A566A|EIF4G1_ENST00000424196.1_Silent_p.A737A|EIF4G1_ENST00000392537.2_Silent_p.A643A|EIF4G1_ENST00000434061.2_Silent_p.A535A|EIF4G1_ENST00000414031.1_Silent_p.A690A|EIF4G1_ENST00000342981.4_Silent_p.A731A|EIF4G1_ENST00000352767.3_Silent_p.A737A|SNORD66_ENST00000390856.1_RNA	NM_198241.2	NP_937884	Q04637	IF4G1_HUMAN	eukaryotic translation initiation factor 4 gamma, 1	730	MIF4G. {ECO:0000255|PROSITE- ProRule:PRU00698}.|eIF3/EIF4A-binding.				cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|insulin receptor signaling pathway (GO:0008286)|lung development (GO:0030324)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of translational initiation (GO:0006446)|response to ethanol (GO:0045471)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)	p.A730A(1)		central_nervous_system(1)|cervix(2)|endometrium(3)|kidney(5)|large_intestine(14)|lung(41)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	75	all_cancers(143;1.06e-10)|Ovarian(172;0.0339)		Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			TGAACAAAGCAGAGAAAGCCT	0.547																																																1	Substitution - coding silent(1)	ovary(1)	3											103.0	109.0	107.0					3																	184041297		2203	4300	6503	185523991	SO:0001819	synonymous_variant	1981			D12686	CCDS3259.1, CCDS3260.1, CCDS3261.1, CCDS46970.1, CCDS46970.2, CCDS54687.1, CCDS54688.1	3q27.1	2013-09-19			ENSG00000114867	ENSG00000114867		"""Parkinson disease"""	3296	protein-coding gene	gene with protein product		600495		EIF4G, EIF4F		1429670, 9372926, 21907011	Standard	NM_182917		Approved	p220, PARK18	uc010hxy.3	Q04637	OTTHUMG00000156784	ENST00000346169.2:c.2190A>G	3.37:g.184041297A>G			185523991	D3DNT2|D3DNT4|D3DNT5|E9PFM1|G5E9S1|O43177|O95066|Q5HYG0|Q6ZN21|Q8N102	Silent	SNP	ENST00000346169.2	37	CCDS3259.1																																																																																				0.547	EIF4G1-007	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000345733.1	NM_182917	
TP63	8626	broad.mit.edu	37	3	189585724	189585724	+	Missense_Mutation	SNP	A	A	C			TCGA-59-2351-01A-01W-0799-08	TCGA-59-2351-10A-01W-0800-08	A	A	C	C	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	930e9c43-af1e-47bc-8ee2-b3bd8a11bb8b	a31b2f09-d6d7-4ce2-a7b4-fd706c7a1c0f	g.chr3:189585724A>C	ENST00000264731.3	+	7	1074	c.985A>C	c.(985-987)Acc>Ccc	p.T329P	TP63_ENST00000392463.2_Missense_Mutation_p.T235P|TP63_ENST00000354600.5_Missense_Mutation_p.T235P|TP63_ENST00000437221.1_Missense_Mutation_p.T235P|TP63_ENST00000449992.1_Missense_Mutation_p.T150P|TP63_ENST00000320472.5_Missense_Mutation_p.T329P|TP63_ENST00000392460.3_Missense_Mutation_p.T329P|TP63_ENST00000440651.2_Missense_Mutation_p.T329P|TP63_ENST00000392461.3_Missense_Mutation_p.T235P|TP63_ENST00000456148.1_Missense_Mutation_p.T235P|TP63_ENST00000382063.4_Missense_Mutation_p.T244P|TP63_ENST00000418709.2_Missense_Mutation_p.T329P	NM_001114978.1|NM_003722.4	NP_001108450.1|NP_003713.3	Q9H3D4	P63_HUMAN	tumor protein p63	329					apoptotic process (GO:0006915)|cell aging (GO:0007569)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|chromatin remodeling (GO:0006338)|cloacal septation (GO:0060197)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|ectoderm and mesoderm interaction (GO:0007499)|embryonic limb morphogenesis (GO:0030326)|epidermal cell division (GO:0010481)|epithelial cell development (GO:0002064)|establishment of planar polarity (GO:0001736)|establishment of skin barrier (GO:0061436)|female genitalia morphogenesis (GO:0048807)|hair follicle morphogenesis (GO:0031069)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|keratinocyte differentiation (GO:0030216)|keratinocyte proliferation (GO:0043616)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organismal aging (GO:0010259)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular senescence (GO:2000773)|negative regulation of keratinocyte differentiation (GO:0045617)|negative regulation of mesoderm development (GO:2000381)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|odontogenesis of dentin-containing tooth (GO:0042475)|polarized epithelial cell differentiation (GO:0030859)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell cycle G1/S phase transition (GO:1902808)|positive regulation of fibroblast apoptotic process (GO:2000271)|positive regulation of keratinocyte proliferation (GO:0010838)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|post-anal tail morphogenesis (GO:0036342)|prostatic bud formation (GO:0060513)|protein homotetramerization (GO:0051289)|proximal/distal pattern formation (GO:0009954)|regulation of epidermal cell division (GO:0010482)|regulation of neuron apoptotic process (GO:0043523)|response to gamma radiation (GO:0010332)|response to X-ray (GO:0010165)|skeletal system development (GO:0001501)|smooth muscle tissue development (GO:0048745)|squamous basal epithelial stem cell differentiation involved in prostate gland acinus development (GO:0060529)|sympathetic nervous system development (GO:0048485)|urinary bladder development (GO:0060157)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|p53 binding (GO:0002039)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding transcription factor activity (GO:0000989)|transcription regulatory region DNA binding (GO:0044212)|WW domain binding (GO:0050699)	p.T329P(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(5)|large_intestine(12)|lung(15)|ovary(2)|skin(9)|upper_aerodigestive_tract(6)	61	all_cancers(143;3.35e-10)|Ovarian(172;0.0925)		Lung(62;3.33e-05)	GBM - Glioblastoma multiforme(93;0.0227)		TACTCTGGAAACCAGAGAGTA	0.403										HNSCC(45;0.13)																																						1	Substitution - Missense(1)	ovary(1)	3											76.0	70.0	72.0					3																	189585724		2203	4300	6503	191068418	SO:0001583	missense	8626			AB010153	CCDS3293.1, CCDS46976.1, CCDS46977.1, CCDS46978.1, CCDS46979.1, CCDS46980.1	3q27-q29	2014-09-17			ENSG00000073282	ENSG00000073282			15979	protein-coding gene	gene with protein product		603273	"""tumor protein p73-like"", ""tumor protein p53-like"", ""tumor protein p53-competing protein"""	TP73L, TP53L, TP53CP		9774969, 9662378, 11181441, 11181451	Standard	NM_003722		Approved	p51, SHFM4, EEC3, p63, p73L, OFC8, KET, p73H, NBP, p53CP	uc003fry.2	Q9H3D4	OTTHUMG00000156313	ENST00000264731.3:c.985A>C	3.37:g.189585724A>C	ENSP00000264731:p.Thr329Pro		191068418	O75080|O75195|O75922|O76078|Q6VEG2|Q6VEG3|Q6VEG4|Q6VFJ1|Q6VFJ2|Q6VFJ3|Q6VH20|Q7LDI3|Q7LDI4|Q7LDI5|Q96KR0|Q9H3D2|Q9H3D3|Q9H3P8|Q9NPH7|Q9P1B4|Q9P1B5|Q9P1B6|Q9P1B7|Q9UBV9|Q9UE10|Q9UP26|Q9UP27|Q9UP28|Q9UP74	Missense_Mutation	SNP	ENST00000264731.3	37	CCDS3293.1	.	.	.	.	.	.	.	.	.	.	A	21.6	4.180462	0.78677	.	.	ENSG00000073282	ENST00000264731;ENST00000418709;ENST00000320472;ENST00000392460;ENST00000440651;ENST00000382063;ENST00000354600;ENST00000437221;ENST00000392463;ENST00000392461;ENST00000449992;ENST00000456148	D;D;D;D;D;D;D;D;D;D;D;D	0.99773	-6.66;-6.66;-6.66;-6.66;-6.66;-6.66;-6.66;-6.66;-6.66;-6.66;-6.72;-6.66	5.61	4.44	0.53790	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99622	0.9862	M	0.75615	2.305	0.80722	D	1	D;P;D;D;D;D;D;D;D;D	0.71674	0.994;0.951;0.997;0.963;0.994;0.987;0.97;0.982;0.998;0.963	D;P;D;D;D;D;D;D;D;D	0.76071	0.959;0.899;0.977;0.919;0.959;0.919;0.951;0.94;0.987;0.919	D	0.97698	1.0183	9	.	.	.	-3.4352	11.1089	0.48221	0.9262:0.0:0.0738:0.0	.	150;329;329;235;235;235;235;329;329;329	Q9H3D4-10;Q9H3D4-7;Q9H3D4-11;Q9H3D4-4;Q9H3D4-2;Q9H3D4-6;C9D7C9;Q9H3D4-3;Q9H3D4;Q9H3D4-5	.;.;.;.;.;.;.;.;P63_HUMAN;.	P	329;329;329;329;329;244;235;235;235;235;150;235	ENSP00000264731:T329P;ENSP00000407144:T329P;ENSP00000317510:T329P;ENSP00000376253:T329P;ENSP00000394337:T329P;ENSP00000371495:T244P;ENSP00000346614:T235P;ENSP00000392488:T235P;ENSP00000376256:T235P;ENSP00000376254:T235P;ENSP00000387839:T150P;ENSP00000389485:T235P	.	T	+	1	0	TP63	191068418	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.014000	0.64029	2.143000	0.66587	0.533000	0.62120	ACC		0.403	TP63-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000343865.1	NM_003722	
PROM1	8842	broad.mit.edu	37	4	15987617	15987617	+	Missense_Mutation	SNP	T	T	C			TCGA-59-2351-01A-01W-0799-08	TCGA-59-2351-10A-01W-0800-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	930e9c43-af1e-47bc-8ee2-b3bd8a11bb8b	a31b2f09-d6d7-4ce2-a7b4-fd706c7a1c0f	g.chr4:15987617T>C	ENST00000510224.1	-	21	2422	c.2174A>G	c.(2173-2175)aAc>aGc	p.N725S	PROM1_ENST00000540805.1_Missense_Mutation_p.N725S|PROM1_ENST00000447510.2_Missense_Mutation_p.N725S|PROM1_ENST00000539194.1_Missense_Mutation_p.N725S|PROM1_ENST00000508167.1_Missense_Mutation_p.N716S|PROM1_ENST00000505450.1_Missense_Mutation_p.N716S|PROM1_ENST00000543373.1_Missense_Mutation_p.N716S			O43490	PROM1_HUMAN	prominin 1	725					camera-type eye photoreceptor cell differentiation (GO:0060219)|glomerular parietal epithelial cell differentiation (GO:0072139)|glomerular visceral epithelial cell differentiation (GO:0072112)|photoreceptor cell maintenance (GO:0045494)|positive regulation of nephron tubule epithelial cell differentiation (GO:2000768)|retina layer formation (GO:0010842)|retina morphogenesis in camera-type eye (GO:0060042)	apical plasma membrane (GO:0016324)|brush border (GO:0005903)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|photoreceptor outer segment (GO:0001750)|photoreceptor outer segment membrane (GO:0042622)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|vesicle (GO:0031982)	actinin binding (GO:0042805)|cadherin binding (GO:0045296)	p.N724S(1)		breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(4)|liver(1)|lung(11)|ovary(3)|pancreas(1)|upper_aerodigestive_tract(2)	35						TGTGATGAAGTTCTGAGCAAA	0.368																																																1	Substitution - Missense(1)	ovary(1)	4											65.0	58.0	60.0					4																	15987617		1857	4094	5951	15596715	SO:0001583	missense	8842			AF027208	CCDS47029.1, CCDS54746.1, CCDS54747.1, CCDS54748.1	4p15	2013-06-06	2001-11-28	2003-03-28	ENSG00000007062	ENSG00000007062		"""CD molecules"""	9454	protein-coding gene	gene with protein product		604365	"""prominin (mouse)-like 1"", ""macular dystrophy, retinal 2"", ""Stargardt disease 4 (autosomal dominant)"""	PROML1, MCDR2, STGD4		11467842	Standard	NM_006017		Approved	AC133, CD133, RP41, CORD12	uc003goo.2	O43490	OTTHUMG00000160180	ENST00000510224.1:c.2174A>G	4.37:g.15987617T>C	ENSP00000426809:p.Asn725Ser		15596715	Q6SV49|Q6SV50|Q6SV51|Q6SV52|Q6SV53|Q96EN6	Missense_Mutation	SNP	ENST00000510224.1	37	CCDS47029.1	.	.	.	.	.	.	.	.	.	.	T	8.769	0.925539	0.18056	.	.	ENSG00000007062	ENST00000447510;ENST00000540805;ENST00000539194;ENST00000505450;ENST00000508167;ENST00000510224;ENST00000543373	T;T;T;T;T;T;T	0.42513	0.97;0.97;0.97;0.97;0.97;0.97;0.97	5.14	-3.82	0.04281	.	1.241300	0.05129	N	0.492223	T	0.21674	0.0522	L	0.29908	0.895	0.09310	N	1	B;B;B;B;B;B	0.29341	0.203;0.203;0.203;0.203;0.138;0.242	B;B;B;B;B;B	0.25987	0.061;0.061;0.039;0.061;0.033;0.065	T	0.14420	-1.0473	10	0.07482	T	0.82	-23.8439	2.6564	0.05013	0.2952:0.0645:0.1783:0.4619	.	716;725;716;725;716;725	O43490-5;O43490-6;O43490-4;O43490-7;O43490-2;O43490	.;.;.;.;.;PROM1_HUMAN	S	725;725;725;716;716;725;716	ENSP00000415481:N725S;ENSP00000438045:N725S;ENSP00000443620:N725S;ENSP00000426090:N716S;ENSP00000427346:N716S;ENSP00000426809:N725S;ENSP00000445526:N716S	ENSP00000415481:N725S	N	-	2	0	PROM1	15596715	0.002000	0.14202	0.022000	0.16811	0.045000	0.14185	-0.035000	0.12205	-0.211000	0.10124	-0.321000	0.08615	AAC		0.368	PROM1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000359595.2	NM_006017	
FAT1	2195	broad.mit.edu	37	4	187525561	187525561	+	Missense_Mutation	SNP	C	C	A			TCGA-59-2351-01A-01W-0799-08	TCGA-59-2351-10A-01W-0800-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	930e9c43-af1e-47bc-8ee2-b3bd8a11bb8b	a31b2f09-d6d7-4ce2-a7b4-fd706c7a1c0f	g.chr4:187525561C>A	ENST00000441802.2	-	18	10727	c.10518G>T	c.(10516-10518)aaG>aaT	p.K3506N		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	3506	Cadherin 32. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.K3506N(1)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						GATCTTTCTCCTTCCTCTTGA	0.448										HNSCC(5;0.00058)																											Colon(197;1040 2055 4143 4984 49344)											1	Substitution - Missense(1)	ovary(1)	4											114.0	111.0	112.0					4																	187525561		1933	4134	6067	187762555	SO:0001583	missense	2195			X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.10518G>T	4.37:g.187525561C>A	ENSP00000406229:p.Lys3506Asn		187762555		Missense_Mutation	SNP	ENST00000441802.2	37	CCDS47177.1	.	.	.	.	.	.	.	.	.	.	C	6.717	0.500925	0.12822	.	.	ENSG00000083857	ENST00000441802;ENST00000260147	T	0.52057	0.68	5.74	-1.06	0.10002	Cadherin (4);Cadherin-like (1);	0.098319	0.64402	N	0.000002	T	0.33440	0.0863	L	0.42245	1.32	0.37618	D	0.921209	B	0.17038	0.02	B	0.21708	0.036	T	0.05869	-1.0859	10	0.42905	T	0.14	.	6.1215	0.20155	0.0:0.2823:0.1229:0.5948	.	3506	Q14517	FAT1_HUMAN	N	3506;3508	ENSP00000406229:K3506N	ENSP00000260147:K3508N	K	-	3	2	FAT1	187762555	0.974000	0.33945	0.547000	0.28179	0.005000	0.04900	0.649000	0.24843	-0.383000	0.07858	-0.471000	0.05019	AAG		0.448	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360209.3	NM_005245	
FYB	2533	broad.mit.edu	37	5	39134990	39134990	+	Nonsense_Mutation	SNP	C	C	A			TCGA-59-2351-01A-01W-0799-08	TCGA-59-2351-10A-01W-0800-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	930e9c43-af1e-47bc-8ee2-b3bd8a11bb8b	a31b2f09-d6d7-4ce2-a7b4-fd706c7a1c0f	g.chr5:39134990C>A	ENST00000351578.6	-	8	1832	c.1642G>T	c.(1642-1644)Gga>Tga	p.G548*	FYB_ENST00000540520.1_Nonsense_Mutation_p.G558*|FYB_ENST00000515010.1_Nonsense_Mutation_p.G548*|FYB_ENST00000505428.1_Nonsense_Mutation_p.G548*|FYB_ENST00000512982.1_Nonsense_Mutation_p.G548*	NM_199335.3	NP_955367.1	O15117	FYB_HUMAN	FYN binding protein	548	SH3.				immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|NLS-bearing protein import into nucleus (GO:0006607)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|T cell receptor signaling pathway (GO:0050852)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|nucleus (GO:0005634)	receptor binding (GO:0005102)	p.G548*(1)|p.G548R(1)		endometrium(2)|kidney(4)|large_intestine(6)|liver(1)|lung(29)|ovary(2)|upper_aerodigestive_tract(1)	45	all_lung(31;0.000343)		Epithelial(62;0.235)			AACCATTTTCCTTCTGGGTTG	0.413																																																2	Substitution - Missense(1)|Substitution - Nonsense(1)	ovary(1)|kidney(1)	5											184.0	173.0	177.0					5																	39134990		1894	4137	6031	39170747	SO:0001587	stop_gained	2533			U93049	CCDS47200.1, CCDS54848.1	5p13.1	2012-05-04	2010-05-04		ENSG00000082074	ENSG00000082074			4036	protein-coding gene	gene with protein product		602731	"""FYN-binding protein (FYB-120/130)"""			9115214, 9207119	Standard	NM_001465		Approved	SLAP-130, FYB-120/130	uc011cpl.2	O15117	OTTHUMG00000162071	ENST00000351578.6:c.1642G>T	5.37:g.39134990C>A	ENSP00000316460:p.Gly548*		39170747	A8K2Y8|B4DLN2|E9PBV9|O00359|Q9NZI9	Nonsense_Mutation	SNP	ENST00000351578.6	37	CCDS47200.1	.	.	.	.	.	.	.	.	.	.	C	39	7.737060	0.98462	.	.	ENSG00000082074	ENST00000351578;ENST00000515010;ENST00000512982;ENST00000505428;ENST00000540520;ENST00000542542	.	.	.	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-18.7922	20.3465	0.98790	0.0:1.0:0.0:0.0	.	.	.	.	X	548;548;548;548;558;548	.	ENSP00000316460:G548X	G	-	1	0	FYB	39170747	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.270000	0.72563	2.798000	0.96311	0.655000	0.94253	GGA		0.413	FYB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000367098.1	NM_001465	
MCTP1	79772	broad.mit.edu	37	5	94244963	94244963	+	Missense_Mutation	SNP	T	T	G			TCGA-59-2351-01A-01W-0799-08	TCGA-59-2351-10A-01W-0800-08	T	T	G	G	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	930e9c43-af1e-47bc-8ee2-b3bd8a11bb8b	a31b2f09-d6d7-4ce2-a7b4-fd706c7a1c0f	g.chr5:94244963T>G	ENST00000515393.1	-	10	1644	c.1645A>C	c.(1645-1647)Att>Ctt	p.I549L	MCTP1_ENST00000505078.1_Missense_Mutation_p.I65L|MCTP1_ENST00000429576.2_Missense_Mutation_p.I282L|MCTP1_ENST00000312216.8_Missense_Mutation_p.I328L|MCTP1_ENST00000505208.1_Missense_Mutation_p.I328L	NM_024717.4	NP_078993.4	Q6DN14	MCTP1_HUMAN	multiple C2 domains, transmembrane 1	549	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				calcium-mediated signaling (GO:0019722)	integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)	p.I549L(1)		breast(1)|endometrium(3)|large_intestine(13)|liver(2)|lung(13)|ovary(2)|skin(4)|stomach(2)|urinary_tract(1)	41		all_cancers(142;1.68e-05)|all_epithelial(76;1.51e-07)|all_lung(232;0.0167)|Lung NSC(167;0.0207)|Ovarian(225;0.0218)|Colorectal(57;0.207)		all cancers(79;9.1e-17)		AACCTGCCAATGAAATCATCC	0.358																																																1	Substitution - Missense(1)	ovary(1)	5											82.0	77.0	79.0					5																	94244963		2203	4300	6503	94270719	SO:0001583	missense	79772				CCDS34203.1, CCDS47247.1, CCDS75275.1	5q15	2008-02-05			ENSG00000175471	ENSG00000175471			26183	protein-coding gene	gene with protein product						15528213	Standard	XM_005272082		Approved	FLJ22344	uc003kkx.2	Q6DN14	OTTHUMG00000162742	ENST00000515393.1:c.1645A>C	5.37:g.94244963T>G	ENSP00000424126:p.Ile549Leu		94270719	Q6DN13|Q8N2W1|Q8NBA2|Q96LX0|Q9H6E8	Missense_Mutation	SNP	ENST00000515393.1	37	CCDS34203.1	.	.	.	.	.	.	.	.	.	.	T	7.833	0.720329	0.15372	.	.	ENSG00000175471	ENST00000515393;ENST00000429576;ENST00000505078;ENST00000312216;ENST00000508509;ENST00000512425;ENST00000505208;ENST00000506568	T;T;T;T;T;T;T;T	0.68903	-0.36;-0.36;-0.36;-0.36;-0.36;-0.36;-0.36;-0.36	5.68	5.68	0.88126	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.093490	0.64402	D	0.000001	T	0.51346	0.1669	N	0.21097	0.63	0.58432	D	0.999999	B;B;B	0.18968	0.032;0.015;0.004	B;B;B	0.26614	0.071;0.015;0.013	T	0.48681	-0.9014	10	0.02654	T	1	-14.5208	15.9332	0.79683	0.0:0.0:0.0:1.0	.	549;282;328	Q6DN14;Q6DN14-3;Q6DN14-2	MCTP1_HUMAN;.;.	L	549;282;65;328;269;210;328;150	ENSP00000424126:I549L;ENSP00000391639:I282L;ENSP00000426417:I65L;ENSP00000308957:I328L;ENSP00000423410:I269L;ENSP00000431075:I210L;ENSP00000426438:I328L;ENSP00000426294:I150L	ENSP00000308957:I328L	I	-	1	0	MCTP1	94270719	1.000000	0.71417	1.000000	0.80357	0.768000	0.43524	7.698000	0.84413	2.164000	0.68074	0.477000	0.44152	ATT		0.358	MCTP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000370280.3	NM_024717	
ADAMTS19	171019	broad.mit.edu	37	5	129072908	129072908	+	Missense_Mutation	SNP	T	T	A			TCGA-59-2351-01A-01W-0799-08	TCGA-59-2351-10A-01W-0800-08	T	T	A	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	930e9c43-af1e-47bc-8ee2-b3bd8a11bb8b	a31b2f09-d6d7-4ce2-a7b4-fd706c7a1c0f	g.chr5:129072908T>A	ENST00000274487.4	+	23	3766	c.3621T>A	c.(3619-3621)agT>agA	p.S1207R	CTC-575N7.1_ENST00000503616.1_RNA	NM_133638.3	NP_598377.3	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 19	1207						proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.S1207R(1)		NS(1)|breast(4)|endometrium(10)|kidney(9)|large_intestine(14)|lung(34)|ovary(6)|pancreas(1)|prostate(6)|skin(6)	91		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		AGCAGAAGAGTTGACCTCTAG	0.438																																																1	Substitution - Missense(1)	ovary(1)	5											60.0	51.0	54.0					5																	129072908		2203	4300	6503	129100807	SO:0001583	missense	171019			AJ311904	CCDS4146.1	5q23.3	2009-04-27	2005-08-19		ENSG00000145808	ENSG00000145808		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17111	protein-coding gene	gene with protein product		607513	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 19"""			11867212	Standard	NM_133638		Approved		uc003kvb.1	Q8TE59	OTTHUMG00000128990	ENST00000274487.4:c.3621T>A	5.37:g.129072908T>A	ENSP00000274487:p.Ser1207Arg		129100807		Missense_Mutation	SNP	ENST00000274487.4	37	CCDS4146.1	.	.	.	.	.	.	.	.	.	.	T	13.52	2.260727	0.39995	.	.	ENSG00000145808	ENST00000274487	T	0.67698	-0.28	3.99	0.35	0.16037	.	0.077421	0.52532	D	0.000068	T	0.53384	0.1793	N	0.19112	0.55	0.37924	D	0.931784	P	0.47762	0.9	P	0.49451	0.611	T	0.50841	-0.8780	9	.	.	.	.	9.1002	0.36664	0.0:0.3127:0.0:0.6873	.	1207	Q8TE59	ATS19_HUMAN	R	1207	ENSP00000274487:S1207R	.	S	+	3	2	ADAMTS19	129100807	1.000000	0.71417	1.000000	0.80357	0.608000	0.37181	1.419000	0.34793	0.064000	0.16427	-0.385000	0.06624	AGT		0.438	ADAMTS19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250979.2	NM_133638	
UNC5CL	222643	broad.mit.edu	37	6	41002798	41002798	+	Missense_Mutation	SNP	T	T	C			TCGA-59-2351-01A-01W-0799-08	TCGA-59-2351-10A-01W-0800-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	930e9c43-af1e-47bc-8ee2-b3bd8a11bb8b	a31b2f09-d6d7-4ce2-a7b4-fd706c7a1c0f	g.chr6:41002798T>C	ENST00000373164.1	-	1	76	c.16A>G	c.(16-18)Agt>Ggt	p.S6G	UNC5CL_ENST00000244565.3_Missense_Mutation_p.S6G|UNC5CL_ENST00000470102.1_5'Flank			Q8IV45	UN5CL_HUMAN	unc-5 homolog C (C. elegans)-like	6					positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of JNK cascade (GO:0046330)|proteolysis (GO:0006508)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	peptidase activity (GO:0008233)	p.S6G(1)		endometrium(1)|kidney(3)|large_intestine(3)|lung(3)|ovary(2)|upper_aerodigestive_tract(1)	13	Ovarian(28;0.0418)|Colorectal(47;0.196)					TGGAATGAACTCTCCTGGGGG	0.602																																																1	Substitution - Missense(1)	ovary(1)	6											56.0	50.0	52.0					6																	41002798		2203	4300	6503	41110776	SO:0001583	missense	222643			BC035284	CCDS4847.1	6p21.1	2013-10-15			ENSG00000124602	ENSG00000124602			21203	protein-coding gene	gene with protein product	"""ZU5 and death domain containing"""					14769797	Standard	NM_173561		Approved	MGC34763, ZUD	uc003opi.3	Q8IV45	OTTHUMG00000014665	ENST00000373164.1:c.16A>G	6.37:g.41002798T>C	ENSP00000362258:p.Ser6Gly		41110776	Q5TGU1	Missense_Mutation	SNP	ENST00000373164.1	37	CCDS4847.1	.	.	.	.	.	.	.	.	.	.	T	10.04	1.241201	0.22711	.	.	ENSG00000124602	ENST00000244565;ENST00000373164	T;T	0.18016	2.24;2.24	4.49	1.98	0.26296	.	0.480260	0.19429	N	0.114481	T	0.03564	0.0102	L	0.29908	0.895	0.25397	N	0.988475	B	0.02656	0.0	B	0.01281	0.0	T	0.37731	-0.9693	10	0.87932	D	0	-1.2047	3.9386	0.09316	0.1822:0.101:0.0:0.7168	.	6	Q8IV45	UN5CL_HUMAN	G	6	ENSP00000244565:S6G;ENSP00000362258:S6G	ENSP00000244565:S6G	S	-	1	0	UNC5CL	41110776	0.257000	0.24022	0.660000	0.29694	0.436000	0.31835	0.687000	0.25407	0.236000	0.21180	0.460000	0.39030	AGT		0.602	UNC5CL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040491.1	NM_173561	
TREM2	54209	broad.mit.edu	37	6	41126710	41126710	+	Missense_Mutation	SNP	G	G	A			TCGA-59-2351-01A-01W-0799-08	TCGA-59-2351-10A-01W-0800-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	930e9c43-af1e-47bc-8ee2-b3bd8a11bb8b	a31b2f09-d6d7-4ce2-a7b4-fd706c7a1c0f	g.chr6:41126710G>A	ENST00000373113.3	-	4	670	c.577C>T	c.(577-579)Ctc>Ttc	p.L193F	TREM2_ENST00000338469.3_Intron|TREM2_ENST00000373122.4_Missense_Mutation_p.P206L	NM_018965.2	NP_061838.1	Q9NZC2	TREM2_HUMAN	triggering receptor expressed on myeloid cells 2	193					axon guidance (GO:0007411)|dendritic cell differentiation (GO:0097028)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|positive regulation of antigen processing and presentation of peptide antigen via MHC class II (GO:0002588)|positive regulation of C-C chemokine receptor CCR7 signaling pathway (GO:1903082)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of CD40 signaling pathway (GO:2000350)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein localization to plasma membrane (GO:1903078)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	lipopolysaccharide binding (GO:0001530)|receptor activity (GO:0004872)|scaffold protein binding (GO:0097110)	p.L193F(1)		breast(1)|endometrium(2)|large_intestine(4)|lung(2)|ovary(1)|pancreas(1)	11	Ovarian(28;0.0418)|Colorectal(47;0.196)					GCAGCCCAGAGGGCGCTGGCT	0.577																																																1	Substitution - Missense(1)	ovary(1)	6											60.0	64.0	62.0					6																	41126710		2203	4300	6503	41234688	SO:0001583	missense	54209			AF213457	CCDS4852.1, CCDS64422.1	6p21.1	2014-09-17	2002-08-15		ENSG00000095970	ENSG00000095970		"""Immunoglobulin superfamily / V-set domain containing"""	17761	protein-coding gene	gene with protein product		605086	"""triggering receptor expressed on myeloid cells 2a"""			10799849, 12080485	Standard	NM_001271821		Approved	TREM-2, Trem2a, Trem2b, Trem2c	uc003opy.3	Q9NZC2	OTTHUMG00000014671	ENST00000373113.3:c.577C>T	6.37:g.41126710G>A	ENSP00000362205:p.Leu193Phe		41234688	Q8N5H8|Q8WYN6	Missense_Mutation	SNP	ENST00000373113.3	37	CCDS4852.1	.	.	.	.	.	.	.	.	.	.	G	12.22	1.873876	0.33069	.	.	ENSG00000095970	ENST00000373113	T	0.58940	0.3	4.92	4.04	0.47022	.	0.133205	0.34725	N	0.003724	T	0.38108	0.1028	L	0.59436	1.845	0.80722	D	1	B	0.22080	0.064	B	0.20767	0.031	T	0.48614	-0.9020	10	0.66056	D	0.02	-19.6982	10.7408	0.46152	0.0:0.0:0.8097:0.1902	.	193	Q9NZC2	TREM2_HUMAN	F	193	ENSP00000362205:L193F	ENSP00000362205:L193F	L	-	1	0	TREM2	41234688	0.996000	0.38824	0.959000	0.39883	0.486000	0.33341	2.546000	0.45778	1.418000	0.47098	0.643000	0.83706	CTC		0.577	TREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040499.1	NM_018965	
MDN1	23195	broad.mit.edu	37	6	90418252	90418252	+	Missense_Mutation	SNP	C	C	G	rs377084929		TCGA-59-2351-01A-01W-0799-08	TCGA-59-2351-10A-01W-0800-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	930e9c43-af1e-47bc-8ee2-b3bd8a11bb8b	a31b2f09-d6d7-4ce2-a7b4-fd706c7a1c0f	g.chr6:90418252C>G	ENST00000369393.3	-	51	7976	c.7861G>C	c.(7861-7863)Gac>Cac	p.D2621H	MDN1_ENST00000428876.1_Missense_Mutation_p.D2621H			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	2621					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)	p.D2621H(1)		NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		AAGAGCTGGTCAGGCTGGTCC	0.473																																																1	Substitution - Missense(1)	ovary(1)	6											164.0	164.0	164.0					6																	90418252		2203	4300	6503	90474973	SO:0001583	missense	23195			AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.7861G>C	6.37:g.90418252C>G	ENSP00000358400:p.Asp2621His		90474973	O15019|Q5T794	Missense_Mutation	SNP	ENST00000369393.3	37	CCDS5024.1	.	.	.	.	.	.	.	.	.	.	C	12.70	2.017216	0.35606	.	.	ENSG00000112159	ENST00000369393;ENST00000428876	T;T	0.03580	3.88;3.88	5.11	2.23	0.28157	.	0.915974	0.09485	N	0.795864	T	0.00906	0.0030	N	0.14661	0.345	0.28126	N	0.930386	P	0.45283	0.855	B	0.38500	0.275	T	0.50583	-0.8811	10	0.62326	D	0.03	.	7.4566	0.27270	0.0:0.7184:0.1352:0.1464	.	2621	Q9NU22	MDN1_HUMAN	H	2621	ENSP00000358400:D2621H;ENSP00000413970:D2621H	ENSP00000358400:D2621H	D	-	1	0	MDN1	90474973	0.950000	0.32346	0.248000	0.24265	0.622000	0.37654	0.844000	0.27654	0.228000	0.21019	0.655000	0.94253	GAC		0.473	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041514.2		
REV3L	5980	broad.mit.edu	37	6	111737566	111737566	+	Missense_Mutation	SNP	G	G	C	rs533806331		TCGA-59-2351-01A-01W-0799-08	TCGA-59-2351-10A-01W-0800-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	930e9c43-af1e-47bc-8ee2-b3bd8a11bb8b	a31b2f09-d6d7-4ce2-a7b4-fd706c7a1c0f	g.chr6:111737566G>C	ENST00000358835.3	-	3	703	c.249C>G	c.(247-249)atC>atG	p.I83M	REV3L_ENST00000368802.3_Missense_Mutation_p.I83M|REV3L_ENST00000435970.1_Missense_Mutation_p.I5M|REV3L_ENST00000368805.1_Missense_Mutation_p.I83M			O60673	DPOLZ_HUMAN	REV3-like, polymerase (DNA directed), zeta, catalytic subunit	83					DNA-dependent DNA replication (GO:0006261)|translesion synthesis (GO:0019985)	chromosome (GO:0005694)|nucleus (GO:0005634)|zeta DNA polymerase complex (GO:0016035)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)	p.I5M(1)		NS(2)|breast(1)|endometrium(6)|kidney(7)|large_intestine(30)|lung(25)|ovary(3)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	88		all_cancers(87;7.57e-06)|Acute lymphoblastic leukemia(125;2.46e-08)|all_hematologic(75;1.08e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.0314)|Epithelial(106;0.057)|all cancers(137;0.0663)		GTGCTCTGTCGATACTGAATG	0.403								DNA polymerases (catalytic subunits)																																								1	Substitution - Missense(1)	ovary(1)	6											105.0	92.0	96.0					6																	111737566		2203	4300	6503	111844259	SO:0001583	missense	5980			AF058701	CCDS5091.2, CCDS69177.1	6q22	2012-05-18	2012-05-18		ENSG00000009413	ENSG00000009413		"""DNA polymerases"""	9968	protein-coding gene	gene with protein product	"""polymerase, DNA, zeta"""	602776	"""REV3 (yeast homolog)-like, catalytic subunit of DNA polymerase zeta"", ""REV3-like, catalytic subunit of DNA polymerase zeta (yeast)"""			9618506, 9925914	Standard	NM_001286431		Approved	POLZ, REV3	uc003puy.4	O60673	OTTHUMG00000016318	ENST00000358835.3:c.249C>G	6.37:g.111737566G>C	ENSP00000351697:p.Ile83Met		111844259	O43214|Q5TC33	Missense_Mutation	SNP	ENST00000358835.3	37	CCDS5091.2	.	.	.	.	.	.	.	.	.	.	G	18.68	3.675469	0.67928	.	.	ENSG00000009413	ENST00000368802;ENST00000368805;ENST00000358835;ENST00000435970	T;T;T;T	0.02787	4.67;4.67;4.67;4.16	5.31	3.42	0.39159	DNA-directed DNA polymerase, family B, exonuclease domain (1);Ribonuclease H-like (1);	0.046817	0.85682	D	0.000000	T	0.08133	0.0203	M	0.89904	3.07	0.34424	D	0.697822	D	0.89917	1.0	D	0.97110	1.0	T	0.01578	-1.1320	10	0.66056	D	0.02	-3.2284	2.312	0.04188	0.2425:0.0:0.4871:0.2704	.	83	O60673	DPOLZ_HUMAN	M	83;83;83;5	ENSP00000357792:I83M;ENSP00000357795:I83M;ENSP00000351697:I83M;ENSP00000402003:I5M	ENSP00000351697:I83M	I	-	3	3	REV3L	111844259	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.430000	0.52807	2.636000	0.89361	0.655000	0.94253	ATC		0.403	REV3L-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043695.1	NM_002912	
FBXL18	80028	broad.mit.edu	37	7	5540703	5540703	+	Silent	SNP	C	C	T			TCGA-59-2351-01A-01W-0799-08	TCGA-59-2351-10A-01W-0800-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	930e9c43-af1e-47bc-8ee2-b3bd8a11bb8b	a31b2f09-d6d7-4ce2-a7b4-fd706c7a1c0f	g.chr7:5540703C>T	ENST00000382368.3	-	3	1320	c.1197G>A	c.(1195-1197)gaG>gaA	p.E399E	FBXL18_ENST00000453700.3_Silent_p.E399E	NM_024963.4	NP_079239.3	Q96ME1	FXL18_HUMAN	F-box and leucine-rich repeat protein 18	399								p.E399E(1)	FBXL18/RNF216(2)	central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(10)|ovary(3)	21		Ovarian(82;0.0607)		UCEC - Uterine corpus endometrioid carcinoma (126;0.181)|OV - Ovarian serous cystadenocarcinoma(56;3.64e-13)		GGCCCAGGCCCTCCGAGCTGT	0.711																																																1	Substitution - coding silent(1)	ovary(1)	7											16.0	22.0	20.0					7																	5540703		2186	4282	6468	5507229	SO:0001819	synonymous_variant	80028			AK057042	CCDS43546.1	7p22.2	2011-06-09			ENSG00000155034	ENSG00000155034		"""F-boxes / Leucine-rich repeats"""	21874	protein-coding gene	gene with protein product		609084					Standard	NM_024963		Approved	FLJ11467, Fbl18	uc003son.4	Q96ME1	OTTHUMG00000151832	ENST00000382368.3:c.1197G>A	7.37:g.5540703C>T			5507229	Q9BR90|Q9BTC7|Q9HAK7	Silent	SNP	ENST00000382368.3	37	CCDS43546.1	.	.	.	.	.	.	.	.	.	.	C	3.329	-0.137064	0.06711	.	.	ENSG00000155034	ENST00000458142	.	.	.	5.25	1.06	0.20224	.	.	.	.	.	T	0.54013	0.1832	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.43572	-0.9383	4	.	.	.	.	7.0381	0.25004	0.0:0.4765:0.3184:0.2051	.	.	.	.	K	283	.	.	R	-	2	0	FBXL18	5507229	0.959000	0.32827	0.983000	0.44433	0.749000	0.42624	0.091000	0.15046	0.220000	0.20860	-0.237000	0.12165	AGG		0.711	FBXL18-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324093.1	NM_024963	
GRB10	2887	broad.mit.edu	37	7	50742219	50742219	+	Silent	SNP	A	A	G	rs200846366	byFrequency	TCGA-59-2351-01A-01W-0799-08	TCGA-59-2351-10A-01W-0800-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	930e9c43-af1e-47bc-8ee2-b3bd8a11bb8b	a31b2f09-d6d7-4ce2-a7b4-fd706c7a1c0f	g.chr7:50742219A>G	ENST00000401949.1	-	6	745	c.276T>C	c.(274-276)gcT>gcC	p.A92A	GRB10_ENST00000398810.2_Silent_p.A34A|GRB10_ENST00000402497.1_Silent_p.A34A|GRB10_ENST00000335866.3_Silent_p.A34A|GRB10_ENST00000357271.5_Silent_p.A92A|GRB10_ENST00000402578.1_Silent_p.A34A|GRB10_ENST00000403097.1_Silent_p.A86A|GRB10_ENST00000439599.1_Silent_p.A86A|GRB10_ENST00000407526.1_Silent_p.A34A|GRB10_ENST00000398812.2_Silent_p.A92A|GRB10_ENST00000406641.1_Silent_p.A34A			Q13322	GRB10_HUMAN	growth factor receptor-bound protein 10	92					insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|negative regulation of glucose import (GO:0046325)|negative regulation of glycogen biosynthetic process (GO:0045719)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of phosphorylation (GO:0042326)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of phosphorylation (GO:0042327)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|response to insulin (GO:0032868)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	insulin receptor binding (GO:0005158)|SH3/SH2 adaptor activity (GO:0005070)	p.A92A(1)		NS(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(19)|ovary(3)|skin(3)|upper_aerodigestive_tract(2)	41	Glioma(55;0.08)|all_neural(89;0.245)					GAGGGCCTGAAGCCCGAGGCT	0.657									Russell-Silver syndrome				A|||	4	0.000798722	0.0	0.0058	5008	,	,		18184	0.0		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	7											40.0	47.0	45.0					7																	50742219		2066	4211	6277	50709713	SO:0001819	synonymous_variant	2887	Familial Cancer Database	Silver-Russell Dwarfism, Silver-Russell syndrome, SRS, Russel-Silver Dwarfism		CCDS43582.1, CCDS43583.1, CCDS47586.1	7p12.2	2013-02-14			ENSG00000106070	ENSG00000106070		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	4564	protein-coding gene	gene with protein product		601523					Standard	NM_005311		Approved		uc003tpi.2	Q13322	OTTHUMG00000150622	ENST00000401949.1:c.276T>C	7.37:g.50742219A>G			50709713	A4D258|A7VJ95|A8K0E6|D3DVM9|O00427|O00701|O75222|Q92606|Q92907|Q92948	Silent	SNP	ENST00000401949.1	37	CCDS43582.1																																																																																				0.657	GRB10-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319157.1		
AZGP1	563	broad.mit.edu	37	7	99565930	99565930	+	Missense_Mutation	SNP	C	C	G	rs145427176		TCGA-59-2351-01A-01W-0799-08	TCGA-59-2351-10A-01W-0800-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	930e9c43-af1e-47bc-8ee2-b3bd8a11bb8b	a31b2f09-d6d7-4ce2-a7b4-fd706c7a1c0f	g.chr7:99565930C>G	ENST00000292401.4	-	3	597	c.461G>C	c.(460-462)tGg>tCg	p.W154S	AZGP1_ENST00000411734.1_Missense_Mutation_p.W151S|AZGP1_ENST00000483612.1_5'Flank	NM_001185.3	NP_001176.1	P25311	ZA2G_HUMAN	alpha-2-glycoprotein 1, zinc-binding	154					antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell adhesion (GO:0007155)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|protein transmembrane transport (GO:0071806)|retina homeostasis (GO:0001895)|RNA phosphodiester bond hydrolysis (GO:0090501)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|MHC class I protein complex (GO:0042612)|nucleus (GO:0005634)	glycoprotein binding (GO:0001948)|peptide antigen binding (GO:0042605)|protein transmembrane transporter activity (GO:0008320)|ribonuclease activity (GO:0004540)	p.W154S(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|stomach(1)	16	Esophageal squamous(72;0.0166)|Lung NSC(181;0.0211)|all_lung(186;0.0323)					GAAGGGGACCCAGGCTGGGAT	0.507																																																1	Substitution - Missense(1)	ovary(1)	7											131.0	139.0	136.0					7																	99565930		2203	4300	6503	99403866	SO:0001583	missense	563			BC005306	CCDS5680.1	7q22.1	2013-01-11	2006-11-07		ENSG00000160862	ENSG00000160862		"""Immunoglobulin superfamily / C1-set domain containing"""	910	protein-coding gene	gene with protein product		194460	"""alpha-2-glycoprotein 1, zinc"""			2049092	Standard	NM_001185		Approved	ZA2G, ZAG	uc003ush.3	P25311	OTTHUMG00000023066	ENST00000292401.4:c.461G>C	7.37:g.99565930C>G	ENSP00000292401:p.Trp154Ser		99403866	D6W5T8|O60386|Q5XKQ4|Q8N4N0	Missense_Mutation	SNP	ENST00000292401.4	37	CCDS5680.1	.	.	.	.	.	.	.	.	.	.	C	10.66	1.412941	0.25465	.	.	ENSG00000160862	ENST00000292401;ENST00000411734	T;T	0.01215	5.16;5.16	2.76	2.76	0.32466	MHC class I, alpha chain, alpha1/alpha2 (1);MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);	0.000000	0.30538	U	0.009404	T	0.10208	0.0250	H	0.98048	4.135	0.58432	D	0.999992	D	0.89917	1.0	D	0.97110	1.0	T	0.00081	-1.2107	10	0.87932	D	0	.	6.2038	0.20591	0.0:0.8439:0.0:0.1561	.	154	P25311	ZA2G_HUMAN	S	154;151	ENSP00000292401:W154S;ENSP00000396093:W151S	ENSP00000292401:W154S	W	-	2	0	AZGP1	99403866	1.000000	0.71417	0.764000	0.31436	0.078000	0.17371	2.671000	0.46842	1.464000	0.47987	0.313000	0.20887	TGG		0.507	AZGP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059387.4	NM_001185	
TMEM209	84928	broad.mit.edu	37	7	129832614	129832614	+	Missense_Mutation	SNP	C	C	T			TCGA-59-2351-01A-01W-0799-08	TCGA-59-2351-10A-01W-0800-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	930e9c43-af1e-47bc-8ee2-b3bd8a11bb8b	a31b2f09-d6d7-4ce2-a7b4-fd706c7a1c0f	g.chr7:129832614C>T	ENST00000397622.2	-	6	745	c.623G>A	c.(622-624)gGa>gAa	p.G208E	RP11-775D22.3_ENST00000483283.1_RNA|TMEM209_ENST00000336804.8_Missense_Mutation_p.G207E|TMEM209_ENST00000462753.1_Missense_Mutation_p.G207E|TMEM209_ENST00000473456.1_Missense_Mutation_p.G208E	NM_032842.3	NP_116231.2	Q96SK2	TM209_HUMAN	transmembrane protein 209	208	Ser-rich.					integral component of membrane (GO:0016021)		p.G207E(1)		NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(6)|ovary(2)|skin(1)	12	Melanoma(18;0.0435)					CTCCACTGGTCCAACAGTGGT	0.428																																																1	Substitution - Missense(1)	ovary(1)	7											94.0	95.0	95.0					7																	129832614		1892	4114	6006	129619850	SO:0001583	missense	84928				CCDS47712.1, CCDS75661.1	7q32.2	2008-02-26			ENSG00000146842	ENSG00000146842			21898	protein-coding gene	gene with protein product						12958361	Standard	NM_032842		Approved	FLJ14803, NET31	uc003vpn.2	Q96SK2	OTTHUMG00000157653	ENST00000397622.2:c.623G>A	7.37:g.129832614C>T	ENSP00000380747:p.Gly208Glu		129619850	A4D1L1|Q49A50|Q6PF00|Q8NCH3|Q96SL6	Missense_Mutation	SNP	ENST00000397622.2	37	CCDS47712.1	.	.	.	.	.	.	.	.	.	.	C	18.60	3.659068	0.67586	.	.	ENSG00000146842	ENST00000397622;ENST00000462753;ENST00000473456;ENST00000336804	T;T;T;T	0.29142	1.58;1.58;1.58;1.58	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	T	0.56062	0.1960	M	0.68317	2.08	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.49409	-0.8943	10	0.42905	T	0.14	-18.6113	19.1047	0.93290	0.0:1.0:0.0:0.0	.	208;208	Q96SK2-3;Q96SK2	.;TM209_HUMAN	E	208;207;208;207	ENSP00000380747:G208E;ENSP00000419697:G207E;ENSP00000417258:G208E;ENSP00000338388:G207E	ENSP00000338388:G207E	G	-	2	0	TMEM209	129619850	1.000000	0.71417	0.921000	0.36526	0.170000	0.22686	6.993000	0.76245	2.835000	0.97688	0.591000	0.81541	GGA		0.428	TMEM209-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000349339.1	NM_032842	
ATAD2	29028	broad.mit.edu	37	8	124349876	124349876	+	Missense_Mutation	SNP	C	C	G			TCGA-59-2351-01A-01W-0799-08	TCGA-59-2351-10A-01W-0800-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	930e9c43-af1e-47bc-8ee2-b3bd8a11bb8b	a31b2f09-d6d7-4ce2-a7b4-fd706c7a1c0f	g.chr8:124349876C>G	ENST00000287394.5	-	21	3147	c.3040G>C	c.(3040-3042)Gac>Cac	p.D1014H	ATAD2_ENST00000521903.1_Missense_Mutation_p.D332H	NM_014109.3	NP_054828.2	Q6PL18	ATAD2_HUMAN	ATPase family, AAA domain containing 2	1014	Bromo. {ECO:0000255|PROSITE- ProRule:PRU00035}.				ATP catabolic process (GO:0006200)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.D1014H(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(12)|lung(16)|ovary(3)|prostate(3)|skin(1)|urinary_tract(2)	48	Lung NSC(37;1.25e-09)|Ovarian(258;0.00838)		STAD - Stomach adenocarcinoma(47;0.00288)			TCATCAGGGTCAACAGGCTTA	0.363																																																1	Substitution - Missense(1)	ovary(1)	8											130.0	119.0	123.0					8																	124349876		2203	4300	6503	124419057	SO:0001583	missense	29028			BC019909	CCDS6343.1	8q24.13	2014-01-21		2007-02-08	ENSG00000156802	ENSG00000156802		"""ATPases / AAA-type"""	30123	protein-coding gene	gene with protein product		611941				12477932	Standard	NM_014109		Approved	PRO2000, DKFZp667N1320, MGC5254, MGC29843, CT137	uc003yqh.4	Q6PL18	OTTHUMG00000165090	ENST00000287394.5:c.3040G>C	8.37:g.124349876C>G	ENSP00000287394:p.Asp1014His		124419057	Q14CR1|Q658P2|Q68CQ0|Q6PJV6|Q8N890|Q9UHS5	Missense_Mutation	SNP	ENST00000287394.5	37	CCDS6343.1	.	.	.	.	.	.	.	.	.	.	C	25.4	4.638400	0.87760	.	.	ENSG00000156802	ENST00000287394;ENST00000521903	T;T	0.25912	1.77;1.77	5.58	5.58	0.84498	Bromodomain (6);	0.089605	0.85682	D	0.000000	T	0.68641	0.3023	H	0.98111	4.15	0.80722	D	1	D	0.89917	1.0	D	0.74023	0.982	T	0.79011	-0.1977	10	0.48119	T	0.1	-17.5357	19.9414	0.97163	0.0:1.0:0.0:0.0	.	1014	Q6PL18	ATAD2_HUMAN	H	1014;332	ENSP00000287394:D1014H;ENSP00000429213:D332H	ENSP00000287394:D1014H	D	-	1	0	ATAD2	124419057	1.000000	0.71417	1.000000	0.80357	0.868000	0.49771	7.711000	0.84669	2.779000	0.95612	0.650000	0.86243	GAC		0.363	ATAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381766.2	NM_014109	
AIFM1	9131	broad.mit.edu	37	X	129281494	129281494	+	Missense_Mutation	SNP	G	G	T			TCGA-59-2351-01A-01W-0799-08	TCGA-59-2351-10A-01W-0800-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	930e9c43-af1e-47bc-8ee2-b3bd8a11bb8b	a31b2f09-d6d7-4ce2-a7b4-fd706c7a1c0f	g.chrX:129281494G>T	ENST00000287295.3	-	5	809	c.579C>A	c.(577-579)ttC>ttA	p.F193L	AIFM1_ENST00000535724.1_Missense_Mutation_p.F106L|AIFM1_ENST00000319908.3_Missense_Mutation_p.F189L|AIFM1_ENST00000346424.2_Intron	NM_001130847.3|NM_004208.3	NP_001124319.1|NP_004199.1	O95831	AIFM1_HUMAN	apoptosis-inducing factor, mitochondrion-associated, 1	193	FAD-dependent oxidoreductase. {ECO:0000250}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|cell redox homeostasis (GO:0045454)|chromosome condensation (GO:0030261)|DNA catabolic process (GO:0006308)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|mitochondrial respiratory chain complex I assembly (GO:0032981)|neuron apoptotic process (GO:0051402)|neuron differentiation (GO:0030182)|positive regulation of apoptotic process (GO:0043065)|regulation of apoptotic DNA fragmentation (GO:1902510)	cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|electron carrier activity (GO:0009055)|FAD binding (GO:0071949)|NAD(P)H oxidase activity (GO:0016174)|oxidoreductase activity, acting on NAD(P)H (GO:0016651)	p.F193L(1)|p.F189L(1)		central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(4)|liver(2)|lung(8)|ovary(4)|prostate(2)|urinary_tract(1)	30					Flavin adenine dinucleotide(DB03147)	TCCACTGTTTGAATCGCAGTG	0.418																																																2	Substitution - Missense(2)	ovary(2)	X											147.0	128.0	134.0					X																	129281494		2203	4300	6503	129109175	SO:0001583	missense	9131			AF100928	CCDS14618.1, CCDS14619.1, CCDS48167.1	Xq26.1	2014-01-30	2006-11-16	2006-11-16	ENSG00000156709	ENSG00000156709			8768	protein-coding gene	gene with protein product		300169	"""programmed cell death 8 (apoptosis-inducing factor)"", ""neuropathy, axonal, motor-sensory with deafness and mental retardation (Cowchock syndrome)"""	PDCD8, NAMSD		9989411, 23217327	Standard	NM_004208		Approved	AIF, CMTX4	uc004evg.3	O95831	OTTHUMG00000022392	ENST00000287295.3:c.579C>A	X.37:g.129281494G>T	ENSP00000287295:p.Phe193Leu		129109175	A4QPB4|B1ALN1|B2RB08|D3DTE9|Q1L6K4|Q1L6K6|Q2QKE4|Q5JUZ7|Q6I9X6|Q9Y3I3|Q9Y3I4	Missense_Mutation	SNP	ENST00000287295.3	37	CCDS14618.1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.937308	0.73557	.	.	ENSG00000156709	ENST00000319908;ENST00000535724;ENST00000287295	T;T;T	0.81330	-1.48;-1.48;-1.48	4.84	4.84	0.62591	Pyridine nucleotide-disulphide oxidoreductase, FAD/NAD(P)-binding domain (1);	0.044089	0.85682	D	0.000000	D	0.88724	0.6514	M	0.81802	2.56	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.997;0.988;0.998	D	0.89613	0.3843	10	0.72032	D	0.01	-8.7587	10.7977	0.46470	0.0886:0.0:0.9114:0.0	.	193;189;193	Q1L6K6;O95831-3;O95831	.;.;AIFM1_HUMAN	L	189;106;193	ENSP00000315122:F189L;ENSP00000446113:F106L;ENSP00000287295:F193L	ENSP00000287295:F193L	F	-	3	2	AIFM1	129109175	1.000000	0.71417	0.995000	0.50966	0.685000	0.39939	4.379000	0.59575	2.234000	0.73211	0.544000	0.68410	TTC		0.418	AIFM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058247.2		
TP53	7157	broad.mit.edu	37	17	7578510	7578510	+	Frame_Shift_Del	DEL	G	G	-			TCGA-59-2351-01A-01W-0799-08	TCGA-59-2351-10A-01W-0800-08	G	G	-	-	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina_Capture			Illumina GAIIx	930e9c43-af1e-47bc-8ee2-b3bd8a11bb8b	a31b2f09-d6d7-4ce2-a7b4-fd706c7a1c0f	g.chr17:7578510delG	ENST00000269305.4	-	5	609	c.420delC	c.(418-420)accfs	p.T140fs	TP53_ENST00000445888.2_Frame_Shift_Del_p.T140fs|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Frame_Shift_Del_p.T140fs|TP53_ENST00000420246.2_Frame_Shift_Del_p.T140fs|TP53_ENST00000413465.2_Frame_Shift_Del_p.T140fs|TP53_ENST00000455263.2_Frame_Shift_Del_p.T140fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	140	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		T -> A (in sporadic cancers; somatic mutation).|T -> I (in sporadic cancers; somatic mutation).|T -> N (in a sporadic cancer; somatic mutation).|T -> P (in a sporadic cancer; somatic mutation).|T -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.T140T(6)|p.A138_P142delAKTCP(4)|p.K139_T140delKT(3)|p.N131fs*27(2)|p.C141fs*8(2)|p.K139_C141>N(1)|p.L137_W146del10(1)|p.K46_T47delKT(1)|p.A6_P10delAKTCP(1)|p.K7_T8delKT(1)|p.K139fs*4(1)|p.A45_P49delAKTCP(1)|p.C141fs*29(1)|p.T140fs*28(1)|p.A138_V143delAKTCPV(1)|p.K139fs*29(1)|p.T140I(1)|p.C141fs*34(1)|p.C141fs*30(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCACAGGGCAGGTCTTGGCCA	0.562		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	39	Deletion - In frame(13)|Whole gene deletion(8)|Substitution - coding silent(6)|Deletion - Frameshift(5)|Insertion - Frameshift(4)|Complex - frameshift(1)|Complex - deletion inframe(1)|Substitution - Missense(1)	ovary(10)|NS(5)|central_nervous_system(4)|breast(4)|bone(4)|haematopoietic_and_lymphoid_tissue(3)|testis(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)|lung(1)|eye(1)|liver(1)	17											56.0	55.0	56.0					17																	7578510		2203	4300	6503	7519235	SO:0001589	frameshift_variant	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.420delC	17.37:g.7578510delG	ENSP00000269305:p.Thr140fs		7519235	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	ENST00000269305.4	37	CCDS11118.1																																																																																				0.562	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
