#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
NME4	4833	genome.wustl.edu	37	16	449124	449124	+	Splice_Site	SNP	G	G	A			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr16:449124G>A	ENST00000219479.2	+	2	239		c.e2+1		DECR2_ENST00000397710.1_5'Flank|DECR2_ENST00000424398.2_5'Flank|NME4_ENST00000450036.1_Splice_Site|DECR2_ENST00000219481.5_5'Flank|NME4_ENST00000397722.1_Splice_Site|NME4_ENST00000382940.4_Splice_Site	NM_005009.2	NP_005000.1	O00746	NDKM_HUMAN	NME/NM23 nucleoside diphosphate kinase 4						CTP biosynthetic process (GO:0006241)|GTP biosynthetic process (GO:0006183)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleoside metabolic process (GO:0009116)|small molecule metabolic process (GO:0044281)|UTP biosynthetic process (GO:0006228)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|nucleoside diphosphate kinase activity (GO:0004550)			NS(1)|lung(1)|stomach(1)|urinary_tract(1)	4		Hepatocellular(16;0.00015)				GATGCTGCAGGTAGTGGGACT	0.662																																																0			16											49.0	50.0	49.0					16																	449124		2200	4298	6498	389125	SO:0001630	splice_region_variant	4833			Y07604	CCDS10408.1, CCDS66886.1, CCDS73797.1	16p13.3	2013-04-29	2012-05-18		ENSG00000103202	ENSG00000103202			7852	protein-coding gene	gene with protein product		601818	"""non-metastatic cells 4, protein expressed in"""			9099850, 19852809	Standard	NM_005009		Approved	nm23-H4, NM23H4, NDPKD	uc002cgz.3	O00746	OTTHUMG00000047995	ENST00000219479.2:c.225+1G>A	16.37:g.449124G>A			389125	A2IDD0|Q5U0M9	Splice_Site	SNP	-	e2+1	ENST00000219479.2	37	c.225+1	CCDS10408.1	16	.	.	.	.	.	.	.	.	.	.	G	15.67	2.900880	0.52227	.	.	ENSG00000103202	ENST00000397722;ENST00000454619;ENST00000219479;ENST00000382940;ENST00000433358;ENST00000450036	.	.	.	4.34	4.34	0.51931	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.5831	0.76462	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	NME4	389125	1.000000	0.71417	0.998000	0.56505	0.877000	0.50540	8.742000	0.91588	2.235000	0.73313	0.462000	0.41574	.	-	-		0.662	NME4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NME4	protein_coding	OTTHUMT00000109256.2	G	NM_005009	Intron	389125	+1	no_errors	NM_005009	genbank	human	validated	54_36p	splice_site	SNP	1.000	A
UBXN6	80700	genome.wustl.edu	37	19	4452483	4452483	+	Nonsense_Mutation	SNP	C	C	A			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr19:4452483C>A	ENST00000301281.6	-	4	443	c.319G>T	c.(319-321)Gag>Tag	p.E107*	UBXN6_ENST00000394765.3_Nonsense_Mutation_p.E54*|CTB-50L17.9_ENST00000592034.1_RNA	NM_025241.2	NP_079517.1	Q9BZV1	UBXN6_HUMAN	UBX domain protein 6	107						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)				NS(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|skin(1)	12						TCTCTGGGCTCAGATACCTGG	0.657																																																0			19											53.0	47.0	49.0					19																	4452483		2203	4300	6503	4403483	SO:0001587	stop_gained	80700			AF272893	CCDS12129.1, CCDS54201.1	19p13	2008-07-25	2008-07-25	2008-07-25		ENSG00000167671		"""UBX domain containing"""	14928	protein-coding gene	gene with protein product		611946	"""UBX domain-containing 1"", ""UBX domain containing 1"""	UBXD1		11342112	Standard	NM_025241		Approved	UBXDC2	uc002man.2	Q9BZV1		ENST00000301281.6:c.319G>T	19.37:g.4452483C>A	ENSP00000301281:p.Glu107*		4403483	D6W626|Q96AH1|Q96IK9|Q9BZV0	Nonsense_Mutation	SNP	HMMPfam_PUB,HMMSmart_SM00580,superfamily_Ubiquitin-like,HMMSmart_SM00166,HMMPfam_UBX	p.E107*	ENST00000301281.6	37	c.319	CCDS12129.1	19	.	.	.	.	.	.	.	.	.	.	C	19.56	3.850133	0.71719	.	.	ENSG00000167671	ENST00000301281;ENST00000394765	.	.	.	4.79	1.47	0.22746	.	0.654660	0.15544	N	0.256796	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.28530	T	0.3	-29.485	5.0423	0.14465	0.0:0.4824:0.3318:0.1857	.	.	.	.	X	107;54	.	ENSP00000301281:E107X	E	-	1	0	UBXN6	4403483	0.017000	0.18338	0.012000	0.15200	0.014000	0.08584	1.438000	0.35002	0.453000	0.26858	-0.458000	0.05436	GAG	-	NULL		0.657	UBXN6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	UBXN6	protein_coding	OTTHUMT00000458447.3	C	NM_025241		4403483	-1	no_errors	NM_025241	genbank	human	provisional	54_36p	nonsense	SNP	0.200	A
STS	412	genome.wustl.edu	37	X	7268262	7268262	+	Missense_Mutation	SNP	A	A	G			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chrX:7268262A>G	ENST00000217961.4	+	10	1932	c.1712A>G	c.(1711-1713)cAg>cGg	p.Q571R		NM_000351.4	NP_000342.2	P08842	STS_HUMAN	steroid sulfatase (microsomal), isozyme S	571					cellular protein metabolic process (GO:0044267)|epidermis development (GO:0008544)|female pregnancy (GO:0007565)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|steroid catabolic process (GO:0006706)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|steryl-sulfatase activity (GO:0004773)|sulfuric ester hydrolase activity (GO:0008484)			NS(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(10)|prostate(2)|skin(1)	27		Colorectal(8;0.0136)|Medulloblastoma(8;0.184)			Norelgestromin(DB06713)	CTGTCTTGCCAGTGTGATAGA	0.542									Ichthyosis																																							0			X											32.0	29.0	30.0					X																	7268262		2203	4299	6502	7278262	SO:0001583	missense	412	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	M16505	CCDS14127.1	Xp22.32	2013-06-10	2007-07-19		ENSG00000101846	ENSG00000101846	3.1.6.2	"""Arylsulfatase family"""	11425	protein-coding gene	gene with protein product	"""arylsulfatase C"""	300747	"""steroid sulfatase (microsomal), arylsulfatase C, isozyme S"""	ARSC1			Standard	NM_000351		Approved	ARSC	uc004cry.4	P08842	OTTHUMG00000021102	ENST00000217961.4:c.1712A>G	X.37:g.7268262A>G	ENSP00000217961:p.Gln571Arg		7278262	B2RA47	Missense_Mutation	SNP	superfamily_Alkaline_phosphatase_core,HMMPfam_Sulfatase,PatternScan_SULFATASE_1,PatternScan_SULFATASE_2	p.Q571R	ENST00000217961.4	37	c.1712	CCDS14127.1	X	.	.	.	.	.	.	.	.	.	.	A	1.015	-0.686524	0.03328	.	.	ENSG00000101846	ENST00000217961	D	0.89050	-2.46	4.11	0.249	0.15531	Alkaline-phosphatase-like, core domain (1);	0.735396	0.12710	N	0.445604	T	0.81069	0.4746	L	0.39898	1.24	0.23487	N	0.997576	B	0.02656	0.0	B	0.04013	0.001	T	0.62835	-0.6770	10	0.23302	T	0.38	.	7.3802	0.26851	0.7141:0.0:0.2859:0.0	.	571	P08842	STS_HUMAN	R	571	ENSP00000217961:Q571R	ENSP00000217961:Q571R	Q	+	2	0	STS	7278262	0.989000	0.36119	0.056000	0.19401	0.034000	0.12701	1.817000	0.39002	-0.341000	0.08376	0.486000	0.48141	CAG	-	superfamily_Alkaline_phosphatase_core		0.542	STS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STS	protein_coding	OTTHUMT00000055686.1	A	NM_000351		7278262	+1	no_errors	NM_000351	genbank	human	reviewed	54_36p	missense	SNP	0.940	G
CD163L1	283316	genome.wustl.edu	37	12	7585182	7585182	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr12:7585182G>A	ENST00000313599.3	-	4	653	c.596C>T	c.(595-597)cCa>cTa	p.P199L	CD163L1_ENST00000416109.2_Missense_Mutation_p.P209L|CD163L1_ENST00000396630.1_Missense_Mutation_p.P199L			Q9NR16	C163B_HUMAN	CD163 molecule-like 1	199	SRCR 2. {ECO:0000255|PROSITE- ProRule:PRU00196}.					extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)			breast(5)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(18)|lung(37)|ovary(8)|prostate(3)|skin(6)|stomach(1)|urinary_tract(4)	96						AAAAGAAGATGGACATCCTAG	0.478																																																0			12											113.0	100.0	105.0					12																	7585182		2203	4300	6503	7476449	SO:0001583	missense	283316			AF264014	CCDS8577.1, CCDS73434.1	12p13.31	2006-03-28	2006-03-28			ENSG00000177675			30375	protein-coding gene	gene with protein product		606079	"""CD163 antigen-like 1"""			11124526, 11086079	Standard	XM_005253348		Approved	M160, CD163B	uc001qsy.3	Q9NR16		ENST00000313599.3:c.596C>T	12.37:g.7585182G>A	ENSP00000315945:p.Pro199Leu		7476449	B4E0G7|C9JHR7|E7EVK4|Q2M3B7|Q6UWC2	Missense_Mutation	SNP	superfamily_SRCR-like,HMMSmart_SM00202,HMMPfam_SRCR,PatternScan_SRCR_1	p.P199L	ENST00000313599.3	37	c.596	CCDS8577.1	12	.	.	.	.	.	.	.	.	.	.	G	16.36	3.100183	0.56183	.	.	ENSG00000177675	ENST00000313599;ENST00000416109;ENST00000396630	T;T;T	0.29917	1.55;1.55;1.55	2.22	1.32	0.21799	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	.	.	.	.	T	0.26919	0.0659	L	0.53780	1.695	0.32315	N	0.563175	B;B	0.34349	0.45;0.45	B;B	0.34301	0.179;0.179	T	0.36040	-0.9764	9	0.66056	D	0.02	.	6.9789	0.24692	0.1544:0.0:0.8456:0.0	.	209;199	E7EVK4;Q9NR16	.;C163B_HUMAN	L	199;209;199	ENSP00000315945:P199L;ENSP00000393474:P209L;ENSP00000379871:P199L	ENSP00000315945:P199L	P	-	2	0	CD163L1	7476449	0.356000	0.24930	0.124000	0.21820	0.730000	0.41778	0.838000	0.27572	0.481000	0.27557	0.563000	0.77884	CCA	-	superfamily_SRCR-like,HMMSmart_SM00202,HMMPfam_SRCR		0.478	CD163L1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CD163L1	protein_coding	OTTHUMT00000399329.1	G	NM_174941		7476449	-1	no_errors	NM_174941	genbank	human	reviewed	54_36p	missense	SNP	0.784	A
TP53	7157	genome.wustl.edu	37	17	7577114	7577114	+	Missense_Mutation	SNP	C	C	G			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr17:7577114C>G	ENST00000269305.4	-	8	1013	c.824G>C	c.(823-825)tGt>tCt	p.C275S	TP53_ENST00000413465.2_Intron|TP53_ENST00000455263.2_Missense_Mutation_p.C275S|TP53_ENST00000359597.4_Missense_Mutation_p.C275S|TP53_ENST00000420246.2_Missense_Mutation_p.C275S|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Missense_Mutation_p.C275S	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	275	Interaction with AXIN1. {ECO:0000250}.|Interaction with DNA.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		C -> F (in sporadic cancers; somatic mutation).|C -> G (in sporadic cancers; somatic mutation).|C -> R (in sporadic cancers; somatic mutation).|C -> S (in sporadic cancers; somatic mutation).|C -> W (in sporadic cancers; somatic mutation).|C -> Y (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:7887414}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.C275Y(53)|p.C275F(37)|p.0?(8)|p.C275fs*70(3)|p.?(2)|p.C275S(2)|p.C275fs*20(1)|p.L265_K305del41(1)|p.R273_C275delRVC(1)|p.F270_D281del12(1)|p.V274_P278del(1)|p.A276fs*29(1)|p.S269fs*21(1)|p.C275fs*67(1)|p.V272_K292del21(1)|p.C275_R283delCACPGRDRR(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AGGACAGGCACAAACACGCAC	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	115	Substitution - Missense(92)|Whole gene deletion(8)|Deletion - Frameshift(7)|Deletion - In frame(6)|Unknown(2)	lung(14)|large_intestine(13)|breast(13)|upper_aerodigestive_tract(12)|central_nervous_system(10)|haematopoietic_and_lymphoid_tissue(10)|ovary(7)|urinary_tract(6)|stomach(5)|oesophagus(5)|bone(5)|liver(5)|skin(3)|pancreas(2)|NS(2)|prostate(2)|biliary_tract(1)	17	GRCh37	CM076568|CM951234	TP53	M							71.0	61.0	64.0					17																	7577114		2203	4300	6503	7517839	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.824G>C	17.37:g.7577114C>G	ENSP00000269305:p.Cys275Ser		7517839	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	HMMPfam_P53_TAD,HMMPfam_P53,superfamily_p53-like transcription factors,PatternScan_P53,HMMPfam_P53_tetramer,superfamily_p53 tetramerization domain	p.C275S	ENST00000269305.4	37	c.824	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	26.7	4.759306	0.89932	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99869	-7.34;-7.34;-7.34;-7.34;-7.34;-7.34	4.92	4.92	0.64577	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99883	0.9944	M	0.92738	3.34	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.999;0.999	D;D;D;D	0.91635	0.991;0.999;0.987;0.987	D	0.96317	0.9233	10	0.87932	D	0	-17.2181	15.662	0.77193	0.0:1.0:0.0:0.0	.	275;275;275;275	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	S	275;275;275;275;275;264;143	ENSP00000352610:C275S;ENSP00000269305:C275S;ENSP00000398846:C275S;ENSP00000391127:C275S;ENSP00000391478:C275S;ENSP00000425104:C143S	ENSP00000269305:C275S	C	-	2	0	TP53	7517839	1.000000	0.71417	0.999000	0.59377	0.904000	0.53231	7.587000	0.82613	2.556000	0.86216	0.462000	0.41574	TGT	-	HMMPfam_P53,superfamily_p53-like transcription factors		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	C	NM_000546		7517839	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
APOBEC1	339	genome.wustl.edu	37	12	7805355	7805355	+	Missense_Mutation	SNP	C	C	T	rs144382507	byFrequency	TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr12:7805355C>T	ENST00000229304.4	-	3	141	c.121G>A	c.(121-123)Gaa>Aaa	p.E41K		NM_001644.3	NP_001635.2	P41238	ABEC1_HUMAN	apolipoprotein B mRNA editing enzyme, catalytic polypeptide 1	41					cellular response to insulin stimulus (GO:0032869)|cytidine deamination (GO:0009972)|cytidine to uridine editing (GO:0016554)|defense response to virus (GO:0051607)|DNA demethylation (GO:0080111)|gene expression (GO:0010467)|lipid metabolic process (GO:0006629)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein transport (GO:0042953)|mRNA modification (GO:0016556)|mRNA processing (GO:0006397)|mRNA stabilization (GO:0048255)|negative regulation of methylation-dependent chromatin silencing (GO:0090310)|regulation of cell proliferation (GO:0042127)|response to calcium ion (GO:0051592)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to gamma radiation (GO:0010332)|response to osmotic stress (GO:0006970)|response to zinc ion (GO:0010043)|RNA processing (GO:0006396)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	AU-rich element binding (GO:0017091)|cytidine deaminase activity (GO:0004126)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.E41K(1)		kidney(2)|large_intestine(2)|lung(10)|prostate(1)|skin(1)|stomach(1)	17						CACTTGATTTCGTAGAGCAGA	0.448																																					Pancreas(135;929 1826 4531 10527 41012)											1	Substitution - Missense(1)	large_intestine(1)	12											41.0	43.0	43.0					12																	7805355		2203	4299	6502	7696622	SO:0001583	missense	339			U72891	CCDS8579.1	12p13.1	2007-02-01			ENSG00000111701	ENSG00000111701		"""Apolipoprotein B mRNA editing enzymes"""	604	protein-coding gene	gene with protein product		600130					Standard	XM_005253355		Approved	BEDP, CDAR1, APOBEC-1, HEPR	uc001qtb.3	P41238	OTTHUMG00000141288	ENST00000229304.4:c.121G>A	12.37:g.7805355C>T	ENSP00000229304:p.Glu41Lys		7696622	Q9UE64|Q9UM71	Missense_Mutation	SNP	HMMPfam_APOBEC_N,superfamily_Cytidine_deaminase-like,PatternScan_CYT_DCMP_DEAMINASES,HMMPfam_APOBEC_C	p.E41K	ENST00000229304.4	37	c.121	CCDS8579.1	12	.	.	.	.	.	.	.	.	.	.	C	19.65	3.868103	0.72065	.	.	ENSG00000111701	ENST00000229304	T	0.66280	-0.2	4.48	4.48	0.54585	APOBEC-like, N-terminal (1);	0.000000	0.56097	D	0.000025	T	0.78780	0.4337	M	0.82056	2.57	0.35064	D	0.761806	D	0.89917	1.0	D	0.91635	0.999	D	0.86200	0.1618	10	0.87932	D	0	-19.9258	13.0361	0.58873	0.0:1.0:0.0:0.0	.	41	P41238	ABEC1_HUMAN	K	41	ENSP00000229304:E41K	ENSP00000229304:E41K	E	-	1	0	APOBEC1	7696622	1.000000	0.71417	0.982000	0.44146	0.541000	0.35023	3.725000	0.54970	2.224000	0.72417	0.462000	0.41574	GAA	-	HMMPfam_APOBEC_N		0.448	APOBEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOBEC1	protein_coding	OTTHUMT00000280523.1	C	NM_001644		7696622	-1	no_errors	NM_001644	genbank	human	reviewed	54_36p	missense	SNP	0.642	T
ERI1	90459	genome.wustl.edu	37	8	8875875	8875875	+	Missense_Mutation	SNP	G	G	T			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr8:8875875G>T	ENST00000523898.1	+	6	1330	c.651G>T	c.(649-651)aaG>aaT	p.K217N	ERI1_ENST00000520332.1_3'UTR|ERI1_ENST00000250263.7_Missense_Mutation_p.K217N|ERI1_ENST00000519292.1_Missense_Mutation_p.K217N			Q8IV48	ERI1_HUMAN	exoribonuclease 1	217	Exonuclease.				gene silencing by RNA (GO:0031047)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|rRNA 3'-end processing (GO:0031125)	cytoplasm (GO:0005737)|histone pre-mRNA 3'end processing complex (GO:0071204)|nucleolus (GO:0005730)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|histone pre-mRNA stem-loop binding (GO:0071207)|metal ion binding (GO:0046872)|ribosome binding (GO:0043022)|rRNA binding (GO:0019843)			NS(1)|endometrium(2)|large_intestine(1)|lung(6)|prostate(1)	11						TGAAATTGAAGGAATTAGGAA	0.289																																																0			8											53.0	56.0	55.0					8																	8875875		2203	4299	6502	8913285	SO:0001583	missense	90459			BC035279	CCDS5972.1	8p23.1	2008-12-16	2008-12-16	2008-12-16	ENSG00000104626	ENSG00000104626		"""Enhanced RNAi three prime mRNA exonucleases"""	23994	protein-coding gene	gene with protein product	"""exoribonuclease 1"", ""enhanced RNAi three prime mRNA exonuclease homolog 1 (C.elegans)"""	608739	"""three prime histone mRNA exonuclease 1"""	THEX1		14536070	Standard	NM_153332		Approved	3'HEXO	uc003wsk.2	Q8IV48	OTTHUMG00000129328	ENST00000523898.1:c.651G>T	8.37:g.8875875G>T	ENSP00000429615:p.Lys217Asn		8913285	A8K4U7|Q9NSX3	Missense_Mutation	SNP	HMMPfam_SAP,HMMSmart_SAP,superfamily_RNaseH_fold,HMMSmart_EXOIII,HMMPfam_Exonuc_X-T	p.K217N	ENST00000523898.1	37	c.651	CCDS5972.1	8	.	.	.	.	.	.	.	.	.	.	G	16.86	3.238140	0.58886	.	.	ENSG00000104626	ENST00000523898;ENST00000250263;ENST00000519292	T;T;T	0.22336	1.96;1.96;1.96	5.83	2.71	0.32032	Exonuclease (1);Exonuclease, RNase T/DNA polymerase III (1);Ribonuclease H-like (1);	0.094526	0.64402	D	0.000001	T	0.14442	0.0349	L	0.31120	0.905	0.48901	D	0.999729	B	0.29805	0.257	B	0.32211	0.142	T	0.09357	-1.0678	10	0.27082	T	0.32	-9.5325	9.0792	0.36540	0.3585:0.0:0.6415:0.0	.	217	Q8IV48	ERI1_HUMAN	N	217	ENSP00000429615:K217N;ENSP00000250263:K217N;ENSP00000430190:K217N	ENSP00000250263:K217N	K	+	3	2	ERI1	8913285	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	1.334000	0.33827	0.615000	0.30124	0.561000	0.74099	AAG	-	superfamily_RNaseH_fold,HMMSmart_EXOIII,HMMPfam_Exonuc_X-T		0.289	ERI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERI1	protein_coding	OTTHUMT00000251471.2	G	NM_153332		8913285	+1	no_errors	NM_153332	genbank	human	validated	54_36p	missense	SNP	1.000	T
RNA5-8SP6	100873336	genome.wustl.edu	37	Y	10037825	10037825	+	RNA	SNP	T	T	C			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chrY:10037825T>C	ENST00000515896.1	+	0	62									RNA, 5.8S ribosomal pseudogene 6																		GCTGTGAGAATTAATGTGAAT	0.517																																																0			Y																																								10647825			0					Yp11.2	2012-08-07	2012-08-07	2012-08-07	ENSG00000251705	ENSG00000251705			41960	pseudogene	RNA, pseudogene			"""RNA, 5.8S ribosomal 6"""	RN5-8S6			Standard	NG_033474		Approved						Y.37:g.10037825T>C			10647825		Missense_Mutation	SNP	NULL	p.I7T	ENST00000515896.1	37	c.20		Y																																																																																			-	NULL		0.517	RNA5-8SP6-201	KNOWN	basic	rRNA	LOC100132755	rRNA		T			10647825	+1	no_errors	XM_001713806	genbank	human	model	54_36p	missense	SNP	1.000	C
CARM1	10498	genome.wustl.edu	37	19	11022931	11022931	+	Missense_Mutation	SNP	C	C	G			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr19:11022931C>G	ENST00000327064.4	+	5	820	c.630C>G	c.(628-630)atC>atG	p.I210M	CARM1_ENST00000344150.4_Missense_Mutation_p.I210M	NM_199141.1	NP_954592.1	Q86X55	CARM1_HUMAN	coactivator-associated arginine methyltransferase 1	210	SAM-dependent MTase PRMT-type. {ECO:0000255|PROSITE-ProRule:PRU01015}.				cellular lipid metabolic process (GO:0044255)|endochondral bone morphogenesis (GO:0060350)|histone H3-R17 methylation (GO:0034971)|histone H3-R2 methylation (GO:0034970)|histone methylation (GO:0016571)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of protein binding (GO:0032091)|pathogenesis (GO:0009405)|peptidyl-arginine methylation, to asymmetrical-dimethyl arginine (GO:0019919)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fat cell differentiation (GO:0045600)|regulation of growth plate cartilage chondrocyte proliferation (GO:0003420)|regulation of intracellular estrogen receptor signaling pathway (GO:0033146)|regulation of transcription, DNA-templated (GO:0006355)|response to cAMP (GO:0051591)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	beta-catenin binding (GO:0008013)|histone methyltransferase activity (GO:0042054)|histone methyltransferase activity (H3-R17 specific) (GO:0035642)|histone-arginine N-methyltransferase activity (GO:0008469)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|lysine-acetylated histone binding (GO:0070577)|protein methyltransferase activity (GO:0008276)|protein-arginine N-methyltransferase activity (GO:0016274)|protein-arginine omega-N asymmetric methyltransferase activity (GO:0035242)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(4)|urinary_tract(1)	13						CACGGAAAATCTACGCGGTGG	0.642																																																0			19											247.0	207.0	221.0					19																	11022931		2203	4300	6503	10883931	SO:0001583	missense	10498			AF055027	CCDS12250.1	19p13.2	2010-10-11			ENSG00000142453	ENSG00000142453		"""Protein arginine methyltransferases"""	23393	protein-coding gene	gene with protein product		603934				10381882, 11724789	Standard	NM_199141		Approved	PRMT4	uc002mpz.3	Q86X55		ENST00000327064.4:c.630C>G	19.37:g.11022931C>G	ENSP00000325690:p.Ile210Met		10883931	A6NN38	Missense_Mutation	SNP	superfamily_SSF53335,HMMPfam_PrmA	p.I210M	ENST00000327064.4	37	c.630	CCDS12250.1	19	.	.	.	.	.	.	.	.	.	.	C	16.78	3.218055	0.58560	.	.	ENSG00000142453	ENST00000327064;ENST00000344150	T;T	0.26067	1.76;1.76	5.35	4.31	0.51392	.	0.064498	0.64402	D	0.000010	T	0.34308	0.0893	L	0.60455	1.87	0.38430	D	0.946419	P	0.35208	0.49	P	0.46389	0.515	T	0.31475	-0.9942	10	0.87932	D	0	-4.6263	8.0556	0.30604	0.0:0.7522:0.1605:0.0873	.	210	Q86X55	CARM1_HUMAN	M	210	ENSP00000325690:I210M;ENSP00000340934:I210M	ENSP00000325690:I210M	I	+	3	3	CARM1	10883931	1.000000	0.71417	0.980000	0.43619	0.938000	0.57974	0.780000	0.26760	1.227000	0.43598	0.655000	0.94253	ATC	-	superfamily_SSF53335,HMMPfam_PrmA		0.642	CARM1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CARM1	protein_coding	OTTHUMT00000452625.1	C	XM_032719		10883931	+1	no_errors	NM_199141	genbank	human	validated	54_36p	missense	SNP	1.000	G
CARM1	10498	genome.wustl.edu	37	19	11030271	11030271	+	Splice_Site	SNP	G	G	A			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr19:11030271G>A	ENST00000327064.4	+	9	1211	c.1021G>A	c.(1021-1023)Gac>Aac	p.D341N	CARM1_ENST00000344150.4_Splice_Site_p.D341N	NM_199141.1	NP_954592.1	Q86X55	CARM1_HUMAN	coactivator-associated arginine methyltransferase 1	341	SAM-dependent MTase PRMT-type. {ECO:0000255|PROSITE-ProRule:PRU01015}.				cellular lipid metabolic process (GO:0044255)|endochondral bone morphogenesis (GO:0060350)|histone H3-R17 methylation (GO:0034971)|histone H3-R2 methylation (GO:0034970)|histone methylation (GO:0016571)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of protein binding (GO:0032091)|pathogenesis (GO:0009405)|peptidyl-arginine methylation, to asymmetrical-dimethyl arginine (GO:0019919)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fat cell differentiation (GO:0045600)|regulation of growth plate cartilage chondrocyte proliferation (GO:0003420)|regulation of intracellular estrogen receptor signaling pathway (GO:0033146)|regulation of transcription, DNA-templated (GO:0006355)|response to cAMP (GO:0051591)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	beta-catenin binding (GO:0008013)|histone methyltransferase activity (GO:0042054)|histone methyltransferase activity (H3-R17 specific) (GO:0035642)|histone-arginine N-methyltransferase activity (GO:0008469)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|lysine-acetylated histone binding (GO:0070577)|protein methyltransferase activity (GO:0008276)|protein-arginine N-methyltransferase activity (GO:0016274)|protein-arginine omega-N asymmetric methyltransferase activity (GO:0035242)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(4)|urinary_tract(1)	13						TCTCTCCCAGGACACATTTGA	0.582																																																0			19											93.0	75.0	81.0					19																	11030271		2203	4300	6503	10891271	SO:0001630	splice_region_variant	10498			AF055027	CCDS12250.1	19p13.2	2010-10-11			ENSG00000142453	ENSG00000142453		"""Protein arginine methyltransferases"""	23393	protein-coding gene	gene with protein product		603934				10381882, 11724789	Standard	NM_199141		Approved	PRMT4	uc002mpz.3	Q86X55		ENST00000327064.4:c.1021-1G>A	19.37:g.11030271G>A			10891271	A6NN38	Missense_Mutation	SNP	HMMPfam_PrmA,superfamily_SSF53335	p.D341N	ENST00000327064.4	37	c.1021	CCDS12250.1	19	.	.	.	.	.	.	.	.	.	.	G	32	5.133547	0.94517	.	.	ENSG00000142453	ENST00000327064;ENST00000344150	T;T	0.22945	1.93;1.93	4.47	4.47	0.54385	.	0.000000	0.85682	D	0.000000	T	0.57681	0.2070	M	0.88377	2.95	0.80722	D	1	D;B	0.89917	1.0;0.356	D;B	0.83275	0.996;0.344	T	0.65981	-0.6036	9	.	.	.	-8.2903	16.4257	0.83814	0.0:0.0:1.0:0.0	.	341;341	Q86X55-1;Q86X55	.;CARM1_HUMAN	N	341	ENSP00000325690:D341N;ENSP00000340934:D341N	.	D	+	1	0	CARM1	10891271	1.000000	0.71417	1.000000	0.80357	0.893000	0.52053	8.968000	0.93407	2.469000	0.83416	0.563000	0.77884	GAC	-	superfamily_SSF53335		0.582	CARM1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CARM1	protein_coding	OTTHUMT00000452625.1	G	XM_032719	Missense_Mutation	10891271	+1	no_errors	NM_199141	genbank	human	validated	54_36p	missense	SNP	1.000	A
PTCHD2	57540	genome.wustl.edu	37	1	11561473	11561473	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr1:11561473G>A	ENST00000294484.6	+	2	562	c.424G>A	c.(424-426)Gac>Aac	p.D142N	PTCHD2_ENST00000389575.3_Missense_Mutation_p.D142N	NM_020780.1	NP_065831.1	Q9P2K9	PTHD2_HUMAN	patched domain containing 2	142					cholesterol homeostasis (GO:0042632)|regulation of lipid transport (GO:0032368)|smoothened signaling pathway (GO:0007224)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)	hedgehog receptor activity (GO:0008158)			NS(3)|breast(2)|endometrium(9)|kidney(4)|large_intestine(5)|lung(34)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	76	Ovarian(185;0.249)	Lung NSC(185;4.16e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.13e-07)|COAD - Colon adenocarcinoma(227;4.83e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000325)|Kidney(185;0.000877)|KIRC - Kidney renal clear cell carcinoma(229;0.00273)|STAD - Stomach adenocarcinoma(313;0.00766)|READ - Rectum adenocarcinoma(331;0.0549)		CGATTTGGCCGACTTCACCTC	0.637																																																0			1											31.0	33.0	32.0					1																	11561473		2022	4166	6188	11484060	SO:0001583	missense	57540			AB037758	CCDS41247.1	1p36.22	2010-02-17			ENSG00000204624	ENSG00000204624			29251	protein-coding gene	gene with protein product		611251				15738394	Standard	NM_020780		Approved	KIAA1337, DISP3	uc001ash.4	Q9P2K9	OTTHUMG00000002074	ENST00000294484.6:c.424G>A	1.37:g.11561473G>A	ENSP00000294484:p.Asp142Asn		11484060	Q5VTU9|Q9UJD6	Missense_Mutation	SNP	HMMPfam_Patched,superfamily_Multidrug efflux transporter AcrB transmembrane domain	p.D142N	ENST00000294484.6	37	c.424	CCDS41247.1	1	.	.	.	.	.	.	.	.	.	.	G	16.96	3.266257	0.59540	.	.	ENSG00000204624	ENST00000294484;ENST00000389575	T;T	0.59772	0.24;0.24	5.77	5.77	0.91146	.	0.157146	0.53938	D	0.000044	T	0.49508	0.1561	L	0.29908	0.895	0.45378	D	0.998367	B	0.23990	0.095	B	0.12837	0.008	T	0.45279	-0.9272	10	0.66056	D	0.02	-32.2065	18.9865	0.92773	0.0:0.0:1.0:0.0	.	142	Q9P2K9	PTHD2_HUMAN	N	142	ENSP00000294484:D142N;ENSP00000374226:D142N	ENSP00000294484:D142N	D	+	1	0	PTCHD2	11484060	1.000000	0.71417	0.963000	0.40424	0.893000	0.52053	5.285000	0.65633	2.724000	0.93272	0.561000	0.74099	GAC	-	NULL		0.637	PTCHD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PTCHD2	protein_coding	OTTHUMT00000005770.2	G	XM_052561		11484060	+1	no_errors	NM_020780	genbank	human	validated	54_36p	missense	SNP	0.938	A
DNAH5	1767	genome.wustl.edu	37	5	13923470	13923470	+	Silent	SNP	G	G	A			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr5:13923470G>A	ENST00000265104.4	-	4	461	c.357C>T	c.(355-357)aaC>aaT	p.N119N		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	119	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					GAGCCACATCGTTTCCCTCGG	0.453									Kartagener syndrome																																							0			5											209.0	197.0	201.0					5																	13923470		2203	4300	6503	13976470	SO:0001819	synonymous_variant	1767	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.357C>T	5.37:g.13923470G>A			13976470	Q92860|Q96L74|Q9H5S7|Q9HCG9	Silent	SNP	HMMPfam_DHC_N1,superfamily_Spectrin,HMMPfam_DHC_N2,superfamily_SSF52540,HMMSmart_AAA,HMMPfam_AAA_5,HMMPfam_Dynein_heavy	p.N119	ENST00000265104.4	37	c.357	CCDS3882.1	5																																																																																			-	NULL		0.453	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH5	protein_coding	OTTHUMT00000207057.2	G	NM_001369		13976470	-1	no_errors	NM_001369	genbank	human	validated	54_36p	silent	SNP	0.938	A
TRIO	7204	genome.wustl.edu	37	5	14369614	14369614	+	Missense_Mutation	SNP	G	G	C			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr5:14369614G>C	ENST00000344204.4	+	18	3222	c.3198G>C	c.(3196-3198)caG>caC	p.Q1066H	TRIO_ENST00000509967.2_Missense_Mutation_p.Q1017H|TRIO_ENST00000537187.1_Missense_Mutation_p.Q1066H	NM_007118.2	NP_009049.2	O75962	TRIO_HUMAN	trio Rho guanine nucleotide exchange factor	1066					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cytosol (GO:0005829)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(2)|breast(6)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(21)|lung(34)|ovary(4)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	118	Lung NSC(4;0.000742)					ACCTGGAGCAGAAGGAGGCAT	0.607																																																0			5											92.0	86.0	88.0					5																	14369614		2203	4300	6503	14422614	SO:0001583	missense	7204			AF091395	CCDS3883.1	5p14-p15.1	2013-01-11	2012-07-12		ENSG00000038382	ENSG00000038382		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"""	12303	protein-coding gene	gene with protein product		601893	"""triple functional domain (PTPRF interacting)"""			8643598	Standard	NM_007118		Approved	ARHGEF23	uc003jff.3	O75962	OTTHUMG00000131057	ENST00000344204.4:c.3198G>C	5.37:g.14369614G>C	ENSP00000339299:p.Gln1066His		14422614	D3DTD1|Q13458|Q59EQ7|Q6PJC9|Q6ZN05|Q8IWK8	Missense_Mutation	SNP	superfamily_CRAL/TRIO domain,HMMSmart_SM00516,HMMPfam_Spectrin,HMMSmart_SM00150,superfamily_Spectrin repeat,superfamily_DBL homology domain (DH-domain),HMMPfam_RhoGEF,HMMSmart_SM00325,superfamily_PH domain-like,HMMPfam_PH,HMMSmart_SM00233,superfamily_SH3-domain,HMMPfam_SH3_1,HMMSmart_SM00326,superfamily_Immunoglobulin,HMMPfam_I-set,HMMSmart_SM00409,HMMSmart_SM00408,superfamily_Protein kinase-like (PK-like),HMMSmart_SM00219,HMMSmart_SM00220,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ST	p.Q1066H	ENST00000344204.4	37	c.3198	CCDS3883.1	5	.	.	.	.	.	.	.	.	.	.	G	13.95	2.390848	0.42410	.	.	ENSG00000038382	ENST00000344204;ENST00000537187;ENST00000509967;ENST00000513206	T;T;T	0.44482	0.92;0.92;0.92	5.83	-6.01	0.02199	.	0.000000	0.85682	D	0.000000	T	0.58609	0.2134	M	0.78637	2.42	0.48236	D	0.999615	D;D;D	0.76494	0.991;0.999;0.996	D;D;D	0.75484	0.937;0.972;0.986	T	0.67296	-0.5706	10	0.66056	D	0.02	.	15.4702	0.75434	0.6146:0.0:0.3854:0.0	.	1017;1066;1066	F5H228;O75962-5;O75962	.;.;TRIO_HUMAN	H	1066;1066;1017;753	ENSP00000339299:Q1066H;ENSP00000446348:Q1066H;ENSP00000445592:Q1017H	ENSP00000339299:Q1066H	Q	+	3	2	TRIO	14422614	0.996000	0.38824	0.543000	0.28128	0.617000	0.37484	0.396000	0.20867	-1.044000	0.03254	-0.253000	0.11424	CAG	-	NULL		0.607	TRIO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIO	protein_coding	OTTHUMT00000253711.2	G	NM_007118		14422614	+1	no_errors	NM_007118	genbank	human	validated	54_36p	missense	SNP	1.000	C
NRIP1	8204	genome.wustl.edu	37	21	16337429	16337429	+	Missense_Mutation	SNP	G	G	C			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr21:16337429G>C	ENST00000400202.1	-	3	3797	c.3085C>G	c.(3085-3087)Ctt>Gtt	p.L1029V	AF127577.10_ENST00000446301.1_RNA|NRIP1_ENST00000400199.1_Missense_Mutation_p.L1029V|NRIP1_ENST00000318948.4_Missense_Mutation_p.L1029V			P48552	NRIP1_HUMAN	nuclear receptor interacting protein 1	1029	Interaction with ZNF366.				androgen receptor signaling pathway (GO:0030521)|lipid storage (GO:0019915)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|ovarian follicle rupture (GO:0001543)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|estrogen receptor binding (GO:0030331)|glucocorticoid receptor binding (GO:0035259)|nuclear hormone receptor binding (GO:0035257)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			cervix(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(6)|lung(13)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	39				Epithelial(23;1.19e-05)|all cancers(11;4.64e-05)|COAD - Colon adenocarcinoma(22;0.000232)|Colorectal(24;0.0006)|OV - Ovarian serous cystadenocarcinoma(11;0.00418)|Lung(58;0.199)|LUSC - Lung squamous cell carcinoma(23;0.24)		CCATTCAAAAGCCCAGATTCT	0.463																																																0			21											55.0	54.0	54.0					21																	16337429		2202	4299	6501	15259300	SO:0001583	missense	8204			X84373	CCDS13568.1	21q11.2	2008-07-31			ENSG00000180530	ENSG00000180530			8001	protein-coding gene	gene with protein product	"""receptor interacting protein 140"", ""nuclear factor RIP140"""	602490				7641693, 9521594	Standard	NM_003489		Approved	RIP140	uc002yjx.2	P48552	OTTHUMG00000074323	ENST00000400202.1:c.3085C>G	21.37:g.16337429G>C	ENSP00000383063:p.Leu1029Val		15259300	Q8IWE8	Missense_Mutation	SNP	NULL	p.L1029V	ENST00000400202.1	37	c.3085	CCDS13568.1	21	.	.	.	.	.	.	.	.	.	.	G	10.94	1.493738	0.26774	.	.	ENSG00000180530	ENST00000400199;ENST00000400202;ENST00000318948	T;T;T	0.08458	3.09;3.09;3.09	5.61	4.73	0.59995	.	1.283300	0.05379	N	0.536851	T	0.09905	0.0243	N	0.22421	0.69	0.29804	N	0.832156	B	0.19200	0.034	B	0.24394	0.053	T	0.34453	-0.9828	10	0.35671	T	0.21	-30.4213	14.83	0.70139	0.0691:0.0:0.9309:0.0	.	1029	P48552	NRIP1_HUMAN	V	1029	ENSP00000383060:L1029V;ENSP00000383063:L1029V;ENSP00000327213:L1029V	ENSP00000327213:L1029V	L	-	1	0	NRIP1	15259300	0.896000	0.30565	0.917000	0.36280	0.958000	0.62258	1.928000	0.40104	1.500000	0.48636	0.655000	0.94253	CTT	-	NULL		0.463	NRIP1-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	NRIP1	protein_coding	OTTHUMT00000157926.1	G	NM_003489		15259300	-1	no_errors	NM_003489	genbank	human	reviewed	54_36p	missense	SNP	0.724	C
RPS6KA3	6197	genome.wustl.edu	37	X	20185833	20185833	+	Silent	SNP	T	T	C			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chrX:20185833T>C	ENST00000379565.3	-	17	1683	c.1476A>G	c.(1474-1476)gtA>gtG	p.V492V	RPS6KA3_ENST00000540702.1_Silent_p.V463V|RPS6KA3_ENST00000544447.1_Silent_p.V464V|RPS6KA3_ENST00000379548.4_Silent_p.V462V|RPS6KA3_ENST00000479809.1_5'UTR	NM_004586.2	NP_004577.1	P51812	KS6A3_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 3	492	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|cell cycle (GO:0007049)|central nervous system development (GO:0007417)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell growth (GO:0030307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of DNA-templated transcription in response to stress (GO:0043620)|regulation of translation in response to stress (GO:0043555)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(4)|central_nervous_system(4)|endometrium(3)|kidney(2)|large_intestine(5)|liver(14)|lung(7)|ovary(1)|stomach(1)	41					Acetylsalicylic acid(DB00945)	TAAGTTCTGTTACTACATACA	0.303																																																0			X											146.0	155.0	152.0					X																	20185833		2203	4300	6503	20095754	SO:0001819	synonymous_variant	6197			U08316	CCDS14197.1	Xp22.2-p22.1	2013-06-03	2002-08-29		ENSG00000177189	ENSG00000177189			10432	protein-coding gene	gene with protein product		300075	"""ribosomal protein S6 kinase, 90kD, polypeptide 3"", ""mental retardation, X-linked 19"", ""Coffin-Lowry syndrome"""	MRX19, CLS		8141249, 11896450, 16879200	Standard	XM_005274573		Approved	RSK, RSK2, HU-3	uc004czu.3	P51812	OTTHUMG00000021231	ENST00000379565.3:c.1476A>G	X.37:g.20185833T>C			20095754	B2R9V4|Q4VAP3|Q59H26|Q5JPK8|Q7Z3Z7	Silent	SNP	superfamily_Kinase_like,HMMSmart_S_TKc,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_ST,HMMSmart_S_TK_X,HMMPfam_Pkinase_C	p.V492	ENST00000379565.3	37	c.1476	CCDS14197.1	X																																																																																			-	superfamily_Kinase_like,HMMSmart_S_TKc,HMMPfam_Pkinase		0.303	RPS6KA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RPS6KA3	protein_coding	OTTHUMT00000056011.3	T	NM_004586		20095754	-1	no_errors	NM_004586	genbank	human	reviewed	54_36p	silent	SNP	1.000	C
MBOAT1	154141	genome.wustl.edu	37	6	20151417	20151417	+	Splice_Site	SNP	T	T	A			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr6:20151417T>A	ENST00000324607.7	-	3	486	c.322A>T	c.(322-324)Aga>Tga	p.R108*	MBOAT1_ENST00000536798.1_Splice_Site_p.R108*|MBOAT1_ENST00000541730.1_5'UTR	NM_001080480.1	NP_001073949.1	Q6ZNC8	MBOA1_HUMAN	membrane bound O-acyltransferase domain containing 1	108					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	transferase activity, transferring acyl groups other than amino-acyl groups (GO:0016747)			breast(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(5)	20	all_cancers(95;0.244)|Breast(50;0.0379)|Ovarian(93;0.0473)|all_epithelial(95;0.109)		OV - Ovarian serous cystadenocarcinoma(7;0.00392)|all cancers(50;0.0117)|Epithelial(50;0.0454)			GTATCTTACCTGTGAATATTG	0.368																																																0			6											133.0	118.0	124.0					6																	20151417		2203	4300	6503	20259396	SO:0001630	splice_region_variant	154141			AK093994	CCDS34346.1	6p22.3	2013-10-11	2006-06-29	2006-06-29	ENSG00000172197	ENSG00000172197			21579	protein-coding gene	gene with protein product	"""lysophosphatidylethanolamine acyltransferase 1"""	611732	"""O-acyltransferase (membrane bound) domain containing 1"""	OACT1		18287005	Standard	NM_001080480		Approved	MGC44669, dJ434O11.1, LPEAT1	uc003ncx.2	Q6ZNC8	OTTHUMG00000014334	ENST00000324607.7:c.323+1A>T	6.37:g.20151417T>A			20259396	A9EDQ5|B4DL59|B4E3J4|Q86XC2|Q8N9R5	Nonsense_Mutation	SNP	HMMPfam_MBOAT	p.R108*	ENST00000324607.7	37	c.322	CCDS34346.1	6	.	.	.	.	.	.	.	.	.	.	T	37	6.584333	0.97684	.	.	ENSG00000172197	ENST00000324607;ENST00000536798	.	.	.	5.69	5.69	0.88448	.	0.100367	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.24483	T	0.36	-8.9093	14.9263	0.70881	0.0:0.0:0.0:1.0	.	.	.	.	X	108	.	ENSP00000324944:R108X	R	-	1	2	MBOAT1	20259396	1.000000	0.71417	1.000000	0.80357	0.635000	0.38103	5.093000	0.64517	2.150000	0.67090	0.528000	0.53228	AGA	-	NULL		0.368	MBOAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MBOAT1	protein_coding	OTTHUMT00000039980.1	T		Nonsense_Mutation	20259396	-1	no_errors	NM_001080480	genbank	human	provisional	54_36p	nonsense	SNP	1.000	A
RSPH14	27156	genome.wustl.edu	37	22	23476296	23476296	+	Missense_Mutation	SNP	A	A	G			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr22:23476296A>G	ENST00000216036.4	-	4	534	c.338T>C	c.(337-339)cTg>cCg	p.L113P	AC000029.1_ENST00000408142.1_RNA|Metazoa_SRP_ENST00000606537.1_RNA	NM_014433.2	NP_055248.1	Q9UHP6	RTDR1_HUMAN		113										breast(1)|endometrium(3)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	18	all_hematologic(9;0.0197)|Acute lymphoblastic leukemia(84;0.181)			READ - Rectum adenocarcinoma(21;0.175)		CAGGAAGGACAGGGCAAGGAC	0.562																																																0			22											144.0	106.0	119.0					22																	23476296		2203	4300	6503	21806296	SO:0001583	missense	27156																														ENST00000216036.4:c.338T>C	22.37:g.23476296A>G	ENSP00000216036:p.Leu113Pro		21806296		Missense_Mutation	SNP	superfamily_ARM-type_fold,HMMPfam_Arm	p.L113P	ENST00000216036.4	37	c.338	CCDS13803.1	22	.	.	.	.	.	.	.	.	.	.	A	16.88	3.245674	0.59103	.	.	ENSG00000100218	ENST00000216036	T	0.50813	0.73	5.09	5.09	0.68999	Armadillo-like helical (1);Armadillo-type fold (1);	0.422934	0.23758	N	0.044847	T	0.69324	0.3098	M	0.79475	2.455	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.998	T	0.73808	-0.3866	10	0.87932	D	0	-16.0757	14.7615	0.69610	1.0:0.0:0.0:0.0	.	134;113	B7Z5X4;Q9UHP6	.;RTDR1_HUMAN	P	113	ENSP00000216036:L113P	ENSP00000216036:L113P	L	-	2	0	RTDR1	21806296	1.000000	0.71417	0.992000	0.48379	0.263000	0.26337	5.450000	0.66626	2.222000	0.72286	0.533000	0.62120	CTG	-	superfamily_ARM-type_fold		0.562	RTDR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RTDR1	protein_coding	OTTHUMT00000319049.1	A			21806296	-1	no_errors	NM_014433	genbank	human	reviewed	54_36p	missense	SNP	0.992	G
ELAVL2	1993	genome.wustl.edu	37	9	23692735	23692735	+	Silent	SNP	T	T	A			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr9:23692735T>A	ENST00000397312.2	-	7	1174	c.900A>T	c.(898-900)ggA>ggT	p.G300G	ELAVL2_ENST00000223951.6_Silent_p.G287G|ELAVL2_ENST00000544538.1_Silent_p.G300G|ELAVL2_ENST00000380117.1_Silent_p.G300G|ELAVL2_ENST00000380110.4_Silent_p.G330G	NM_004432.3	NP_004423.2	Q12926	ELAV2_HUMAN	ELAV like neuron-specific RNA binding protein 2	300	RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.				regulation of transcription, DNA-templated (GO:0006355)		mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(20)|ovary(2)|skin(1)|stomach(1)|urinary_tract(1)	39				GBM - Glioblastoma multiforme(1;2.18e-156)|Lung(42;2.15e-28)|LUSC - Lung squamous cell carcinoma(38;1.02e-19)		TGGTGACAGCTCCAAAAGGCC	0.468																																																0			9											145.0	128.0	133.0					9																	23692735		2203	4300	6503	23682735	SO:0001819	synonymous_variant	1993			BC030692	CCDS6515.1, CCDS55298.1	9p21	2013-10-03	2013-10-03		ENSG00000107105	ENSG00000107105		"""RNA binding motif (RRM) containing"""	3313	protein-coding gene	gene with protein product	"""Hu antigen B"""	601673	"""ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2"", ""ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B)"""			8812435	Standard	NM_004432		Approved	HuB, HEL-N1	uc003zpu.3	Q12926	OTTHUMG00000019700	ENST00000397312.2:c.900A>T	9.37:g.23692735T>A			23682735	D3DRK3|Q13235|Q59G15|Q8NEM4|Q9H1Q8	Silent	SNP	superfamily_RNA-binding domain RBD,HMMSmart_SM00360,HMMPfam_RRM_1	p.G300	ENST00000397312.2	37	c.900	CCDS6515.1	9																																																																																			-	superfamily_RNA-binding domain RBD,HMMSmart_SM00360,HMMPfam_RRM_1		0.468	ELAVL2-201	KNOWN	basic|CCDS	protein_coding	ELAVL2	protein_coding	OTTHUMT00000051943.2	T	NM_004432		23682735	-1	no_errors	NM_004432	genbank	human	validated	54_36p	silent	SNP	1.000	A
CASC1	55259	genome.wustl.edu	37	12	25300038	25300038	+	Splice_Site	SNP	G	G	C			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr12:25300038G>C	ENST00000320267.9	-	7	649	c.568C>G	c.(568-570)Caa>Gaa	p.Q190E	CASC1_ENST00000354189.5_Splice_Site_p.Q254E|CASC1_ENST00000395987.3_Splice_Site_p.Q196E|CASC1_ENST00000395990.2_Splice_Site_p.Q150E|CASC1_ENST00000557684.1_5'UTR|CASC1_ENST00000545133.1_Splice_Site_p.Q131E|CASC1_ENST00000537577.1_Splice_Site_p.Q78E	NM_001082973.1	NP_001076442	Q6TDU7	CASC1_HUMAN	cancer susceptibility candidate 1	190										breast(3)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|liver(1)|lung(3)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	31	Acute lymphoblastic leukemia(6;0.00112)|all_hematologic(7;0.00152)|Melanoma(3;0.0301)|Colorectal(261;0.11)		OV - Ovarian serous cystadenocarcinoma(3;7.42e-20)|Epithelial(3;7.58e-16)|all cancers(3;1.07e-13)			GTACTAGCTTGCTGTAAGAGA	0.343																																																0			12											132.0	127.0	129.0					12																	25300038		2203	4300	6503	25191305	SO:0001630	splice_region_variant	55259			AK093102	CCDS31759.2, CCDS41762.1, CCDS41763.1, CCDS55810.1, CCDS55811.1	12p12.1	2012-04-17			ENSG00000118307	ENSG00000118307		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	29599	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 54"""					14583591	Standard	NM_018272		Approved	LAS1, FLJ10921, PPP1R54	uc001rgk.3	Q6TDU7	OTTHUMG00000150195	ENST00000320267.9:c.568-1C>G	12.37:g.25300038G>C			25191305	B4DNP2|F5H6T6|Q17RL2|Q4G171|Q5U5K5|Q9NV50	Missense_Mutation	SNP	NULL	p.Q196E	ENST00000320267.9	37	c.586	CCDS41762.1	12	.	.	.	.	.	.	.	.	.	.	G	3.774	-0.046959	0.07407	.	.	ENSG00000118307	ENST00000354189;ENST00000395987;ENST00000320267;ENST00000395990;ENST00000537577;ENST00000395992;ENST00000545133	T;T;T;T;T;T	0.31510	1.49;1.49;1.49;1.49;1.49;1.49	5.43	3.49	0.39957	.	0.892392	0.09942	N	0.735862	T	0.24431	0.0592	L	0.48362	1.52	0.26836	N	0.968489	B;B;B;B;B	0.20887	0.004;0.004;0.049;0.002;0.004	B;B;B;B;B	0.20184	0.009;0.016;0.028;0.007;0.016	T	0.33497	-0.9866	10	0.07644	T	0.81	-9.7637	8.9353	0.35695	0.0:0.161:0.6722:0.1668	.	78;131;254;190;196	F5H555;F5H6T6;Q6TDU7-3;Q6TDU7;F8W8F9	.;.;.;CASC1_HUMAN;.	E	254;196;190;150;78;196;131	ENSP00000346126:Q254E;ENSP00000379310:Q196E;ENSP00000313141:Q190E;ENSP00000379313:Q150E;ENSP00000444715:Q78E;ENSP00000437373:Q131E	ENSP00000313141:Q190E	Q	-	1	0	CASC1	25191305	0.999000	0.42202	0.999000	0.59377	0.940000	0.58332	0.807000	0.27140	1.250000	0.43966	0.573000	0.79308	CAA	-	NULL		0.343	CASC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CASC1	protein_coding	OTTHUMT00000316761.1	G	NM_018272	Missense_Mutation	25191305	-1	no_errors	NM_018272	genbank	human	validated	54_36p	missense	SNP	1.000	C
HIST1H1C	3006	genome.wustl.edu	37	6	26056537	26056537	+	Silent	SNP	C	C	T			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr6:26056537C>T	ENST00000343677.2	-	1	162	c.120G>A	c.(118-120)gtG>gtA	p.V40V		NM_005319.3	NP_005310.1	P16403	H12_HUMAN	histone cluster 1, H1c	40	H15. {ECO:0000255|PROSITE- ProRule:PRU00837}.				nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)	nuclear euchromatin (GO:0005719)|nucleosome (GO:0000786)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(1)|large_intestine(1)|lung(8)|ovary(4)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)	34						TGAGCTCTGACACCGGGGGAC	0.627																																																0			6											48.0	56.0	53.0					6																	26056537		2203	4300	6503	26164516	SO:0001819	synonymous_variant	3006			X57129	CCDS4577.1	6p21.3	2012-10-02	2006-10-11	2003-02-21	ENSG00000187837	ENSG00000187837		"""Histones / Replication-dependent"""	4716	protein-coding gene	gene with protein product		142710	"""H1 histone family, member 2"", ""histone 1, H1c"""	H1F2		2759094, 12408966	Standard	NM_005319		Approved	H1.2, H1s-1, H1c	uc003nfw.3	P16403	OTTHUMG00000016140	ENST00000343677.2:c.120G>A	6.37:g.26056537C>T			26164516	A8K4I2	Silent	SNP	"HMMSmart_SM00526,superfamily_""Winged helix"" DNA-binding domain,HMMPfam_Linker_histone"	p.V40	ENST00000343677.2	37	c.120	CCDS4577.1	6																																																																																			-	"HMMSmart_SM00526,superfamily_""Winged helix"" DNA-binding domain,HMMPfam_Linker_histone"		0.627	HIST1H1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H1C	protein_coding	OTTHUMT00000043372.1	C	NM_005319		26164516	-1	no_errors	NM_005319	genbank	human	reviewed	54_36p	silent	SNP	1.000	T
HOXA2	3199	genome.wustl.edu	37	7	27141071	27141071	+	Silent	SNP	G	G	A			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr7:27141071G>A	ENST00000222718.5	-	2	715	c.405C>T	c.(403-405)atC>atT	p.I135I	HOTAIRM1_ENST00000429611.3_RNA|HOTAIRM1_ENST00000593300.1_RNA|HOTAIRM1_ENST00000428939.3_RNA|HOTAIRM1_ENST00000434063.3_RNA|HOTAIRM1_ENST00000425358.2_RNA	NM_006735.3	NP_006726.1	O43364	HXA2_HUMAN	homeobox A2	135					anterior/posterior pattern specification (GO:0009952)|brain segmentation (GO:0035284)|cell fate determination (GO:0001709)|dorsal/ventral pattern formation (GO:0009953)|embryonic viscerocranium morphogenesis (GO:0048703)|middle ear morphogenesis (GO:0042474)|motor neuron axon guidance (GO:0008045)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|osteoblast development (GO:0002076)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|rhombomere 2 development (GO:0021568)|rhombomere 3 morphogenesis (GO:0021658)|segment specification (GO:0007379)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|cervix(1)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|skin(1)	22						TGCCATCGGCGATTTCCAGGG	0.512																																																0			7											21.0	23.0	22.0					7																	27141071		2164	4249	6413	27107596	SO:0001819	synonymous_variant	3199				CCDS5403.1	7p15.2	2011-06-20	2005-12-22		ENSG00000105996	ENSG00000105996		"""Homeoboxes / ANTP class : HOXL subclass"""	5103	protein-coding gene	gene with protein product		604685	"""homeo box A2"""	HOX1K		1358459	Standard	NM_006735		Approved		uc003syh.3	O43364	OTTHUMG00000023208	ENST00000222718.5:c.405C>T	7.37:g.27141071G>A			27107596	A1L4K3|B2RMW3	Silent	SNP	PatternScan_ANTENNAPEDIA,superfamily_Homeodomain_like,HMMSmart_HOX,HMMPfam_Homeobox,PatternScan_HOMEOBOX_1	p.I135	ENST00000222718.5	37	c.405	CCDS5403.1	7																																																																																			-	superfamily_Homeodomain_like		0.512	HOXA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOXA2	protein_coding	OTTHUMT00000358508.2	G			27107596	-1	no_errors	NM_006735	genbank	human	reviewed	54_36p	silent	SNP	0.994	A
LIG3	3980	genome.wustl.edu	37	17	33328331	33328331	+	Missense_Mutation	SNP	C	C	A			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr17:33328331C>A	ENST00000378526.4	+	17	2520	c.2387C>A	c.(2386-2388)aCa>aAa	p.T796K	LIG3_ENST00000262327.5_Missense_Mutation_p.T796K	NM_013975.3	NP_039269.2	P49916	DNLI3_HUMAN	ligase III, DNA, ATP-dependent	796					base-excision repair (GO:0006284)|base-excision repair, DNA ligation (GO:0006288)|DNA biosynthetic process (GO:0071897)|DNA repair (GO:0006281)|double-strand break repair via nonhomologous end joining (GO:0006303)|lagging strand elongation (GO:0006273)|mitochondrial DNA repair (GO:0043504)|negative regulation of DNA recombination (GO:0045910)|nucleotide-excision repair (GO:0006289)|reciprocal meiotic recombination (GO:0007131)|spermatogenesis (GO:0007283)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA ligase (ATP) activity (GO:0003910)|DNA ligase activity (GO:0003909)|zinc ion binding (GO:0008270)			endometrium(4)|large_intestine(8)|lung(9)|ovary(3)|pancreas(2)|prostate(1)|skin(3)|stomach(1)	31		Ovarian(249;0.17)			Bleomycin(DB00290)	GAGGCTCATACAGCTGACGGG	0.522								Other BER factors																																								0			17											91.0	83.0	85.0					17																	33328331		2203	4300	6503	30352444	SO:0001583	missense	3980				CCDS11284.2, CCDS11285.2	17q11.2-q12	2008-10-29			ENSG00000005156	ENSG00000005156			6600	protein-coding gene	gene with protein product		600940	"""ligase II, DNA, ATP-dependent"""	LIG2		7760816	Standard	NM_002311		Approved		uc002hik.2	P49916	OTTHUMG00000128519	ENST00000378526.4:c.2387C>A	17.37:g.33328331C>A	ENSP00000367787:p.Thr796Lys		30352444	Q16714|Q6NVK3	Missense_Mutation	SNP	superfamily_Glucocorticoid receptor-like (DNA-binding domain),HMMPfam_zf-PARP,PatternScan_PARP_ZN_FINGER_1,HMMPfam_DNA_ligase_A_N,superfamily_DNA ligase/mRNA capping enzyme catalytic domain,HMMPfam_DNA_ligase_A_M,PatternScan_DNA_LIGASE_A1,PatternScan_DNA_LIGASE_A2,HMMPfam_DNA_ligase_A_C,superfamily_BRCT domain,HMMSmart_SM00292	p.T796K	ENST00000378526.4	37	c.2387	CCDS11284.2	17	.	.	.	.	.	.	.	.	.	.	C	34	5.299389	0.95574	.	.	ENSG00000005156	ENST00000378526;ENST00000262327	T;T	0.63580	-0.05;-0.05	5.97	5.97	0.96955	DNA ligase, ATP-dependent, C-terminal (1);Nucleic acid-binding, OB-fold-like (1);Nucleic acid-binding, OB-fold (1);	0.091723	0.85682	D	0.000000	T	0.72890	0.3517	L	0.43646	1.37	0.58432	D	0.999992	D;D	0.65815	0.995;0.995	D;D	0.70935	0.971;0.971	T	0.65348	-0.6190	10	0.23302	T	0.38	-13.567	19.4162	0.94700	0.0:1.0:0.0:0.0	.	796;796	P49916;E5KLB6	DNLI3_HUMAN;.	K	796	ENSP00000367787:T796K;ENSP00000262327:T796K	ENSP00000262327:T796K	T	+	2	0	LIG3	30352444	1.000000	0.71417	0.390000	0.26220	0.980000	0.70556	7.276000	0.78559	2.837000	0.97791	0.655000	0.94253	ACA	-	NULL		0.522	LIG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIG3	protein_coding	OTTHUMT00000250330.3	C	NM_013975		30352444	+1	no_errors	NM_013975	genbank	human	reviewed	54_36p	missense	SNP	0.996	A
PRRC2A	7916	genome.wustl.edu	37	6	31593305	31593305	+	Missense_Mutation	SNP	C	C	G			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr6:31593305C>G	ENST00000376033.2	+	7	910	c.676C>G	c.(676-678)Cat>Gat	p.H226D	PRRC2A_ENST00000376007.4_Missense_Mutation_p.H226D|SNORA38_ENST00000363946.1_RNA|PRRC2A_ENST00000469577.1_3'UTR	NM_004638.3	NP_004629.3	P48634	PRC2A_HUMAN	proline-rich coiled-coil 2A	226	4 X 57 AA type A repeats.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(6)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|lung(19)|ovary(3)|pancreas(2)|prostate(4)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	70						CTCCAAACTTCATCATGGTCA	0.567																																																0			6											76.0	79.0	78.0					6																	31593305		2203	4300	6503	31701284	SO:0001583	missense	7916			M31293	CCDS4708.1	6p21.3	2010-12-09	2010-12-09	2010-12-09	ENSG00000204469	ENSG00000204469			13918	protein-coding gene	gene with protein product		142580	"""HLA-B associated transcript 2"""	BAT2		2156268, 8499947	Standard	NM_080686		Approved	G2, D6S51E	uc003nvc.4	P48634	OTTHUMG00000031168	ENST00000376033.2:c.676C>G	6.37:g.31593305C>G	ENSP00000365201:p.His226Asp		31701284	B0UX77|B0UZE9|B0UZL3|O95875|Q05BK4|Q4LE37|Q5SQ29|Q5SQ30|Q5ST84|Q5STX6|Q5STX7|Q68DW9|Q6P9P7|Q6PIN1|Q8MGQ9|Q96QC6	Missense_Mutation	SNP	HMMPfam_BAT2_N	p.H226D	ENST00000376033.2	37	c.676	CCDS4708.1	6	.	.	.	.	.	.	.	.	.	.	C	11.87	1.768102	0.31320	.	.	ENSG00000204469	ENST00000424184;ENST00000435052;ENST00000376007;ENST00000376033	T;T	0.01495	4.83;4.83	5.06	5.06	0.68205	.	0.114750	0.39834	N	0.001244	T	0.00724	0.0024	N	0.11560	0.145	0.34547	D	0.710871	B	0.19583	0.037	B	0.20767	0.031	T	0.56535	-0.7963	10	0.87932	D	0	-4.588	15.9558	0.79886	0.0:1.0:0.0:0.0	.	226	P48634	PRC2A_HUMAN	D	226	ENSP00000365175:H226D;ENSP00000365201:H226D	ENSP00000365175:H226D	H	+	1	0	PRRC2A	31701284	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.861000	0.39438	2.628000	0.89032	0.655000	0.94253	CAT	-	NULL		0.567	PRRC2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	BAT2	protein_coding	OTTHUMT00000259319.1	C	NM_080686		31701284	+1	no_errors	NM_080686	genbank	human	reviewed	54_36p	missense	SNP	0.875	G
DMD	1756	genome.wustl.edu	37	X	32224361	32224361	+	Intron	SNP	G	G	T			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chrX:32224361G>T	ENST00000357033.4	-	44	6645				DMD_ENST00000378677.2_Intron	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin						cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				AGTAGCTGGGGAGGAAGATAC	0.488																																																0			X																																								32134282	SO:0001627	intron_variant	0			AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.6438+10671C>A	X.37:g.32224361G>T			32134282	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	RNA	SNP	-	NULL	ENST00000357033.4	37	NULL	CCDS14233.1	X																																																																																			-	-		0.488	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC100130233	protein_coding	OTTHUMT00000056182.2	G	NM_004006		32134282	+1	pseudogene	XR_038856	genbank	human	model	54_36p	rna	SNP	0.994	T
TADA2A	6871	genome.wustl.edu	37	17	35836996	35836996	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr17:35836996C>T	ENST00000394395.2	+	16	1414	c.1241C>T	c.(1240-1242)gCg>gTg	p.A414V	TADA2A_ENST00000225396.6_Missense_Mutation_p.A414V	NM_001166105.1	NP_001159577.1	O75478	TAD2A_HUMAN	transcriptional adaptor 2A	414	SWIRM. {ECO:0000255|PROSITE- ProRule:PRU00247}.				chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|transcription from RNA polymerase II promoter (GO:0006366)	chromosome (GO:0005694)|nucleus (GO:0005634)|PCAF complex (GO:0000125)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)|zinc ion binding (GO:0008270)			breast(4)|cervix(1)|endometrium(1)|kidney(2)|lung(3)|prostate(1)|skin(1)	13						TTAAGACTGGCGCAGGCAAGA	0.443																																																0			17											176.0	179.0	178.0					17																	35836996		2203	4300	6503	32911109	SO:0001583	missense	6871			AK022767	CCDS11319.1, CCDS45656.1	17q12-q21	2014-04-10	2009-10-02	2009-10-02	ENSG00000108264	ENSG00000276234			11531	protein-coding gene	gene with protein product		602276	"""transcriptional adaptor 2 (ADA2 homolog, yeast)-like"""	TADA2L		8552087	Standard	XM_006722043		Approved	ADA2, hADA2, ADA2A	uc002hnt.3	O75478	OTTHUMG00000188469	ENST00000394395.2:c.1241C>T	17.37:g.35836996C>T	ENSP00000377918:p.Ala414Val		32911109	A8MVD0|B3KMU9|Q9BVJ0|Q9UCW2|Q9UP49	Missense_Mutation	SNP	superfamily_Homeodomain-like,HMMSmart_SM00717,HMMPfam_Myb_DNA-binding,HMMPfam_SWIRM	p.A414V	ENST00000394395.2	37	c.1241	CCDS11319.1	17	.	.	.	.	.	.	.	.	.	.	C	36	5.608831	0.96637	.	.	ENSG00000108264	ENST00000394395;ENST00000428846;ENST00000225396	T;T	0.44881	0.91;0.91	5.93	5.93	0.95920	Homeodomain-like (1);SWIRM (2);	0.000000	0.85682	D	0.000000	T	0.69842	0.3156	M	0.84511	2.7	0.80722	D	1	D	0.76494	0.999	D	0.74674	0.984	T	0.68447	-0.5406	10	0.39692	T	0.17	-12.528	20.3398	0.98759	0.0:1.0:0.0:0.0	.	414	O75478	TAD2A_HUMAN	V	414;313;414	ENSP00000377918:A414V;ENSP00000225396:A414V	ENSP00000225396:A414V	A	+	2	0	TADA2A	32911109	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	7.629000	0.83207	2.811000	0.96726	0.557000	0.71058	GCG	-	HMMPfam_SWIRM		0.443	TADA2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TADA2L	protein_coding	OTTHUMT00000256677.3	C	NM_001488		32911109	+1	no_errors	NM_001488	genbank	human	reviewed	54_36p	missense	SNP	0.999	T
HNF1B	6928	genome.wustl.edu	37	17	36059179	36059179	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr17:36059179G>A	ENST00000225893.4	-	8	1917	c.1556C>T	c.(1555-1557)cCc>cTc	p.P519L	HNF1B_ENST00000561193.1_Missense_Mutation_p.P493L|HNF1B_ENST00000427275.2_Intron|HNF1B_ENST00000560016.1_Intron	NM_000458.2|NM_001165923.1	NP_000449.1|NP_001159395.1	P35680	HNF1B_HUMAN	HNF1 homeobox B	519					anterior/posterior pattern specification (GO:0009952)|branching morphogenesis of an epithelial tube (GO:0048754)|embryonic digestive tract morphogenesis (GO:0048557)|endocrine pancreas development (GO:0031018)|endodermal cell fate specification (GO:0001714)|epithelial cell proliferation (GO:0050673)|genitalia development (GO:0048806)|hepatoblast differentiation (GO:0061017)|hindbrain development (GO:0030902)|inner cell mass cell differentiation (GO:0001826)|insulin secretion (GO:0030073)|kidney development (GO:0001822)|mesonephric duct formation (GO:0072181)|negative regulation of mesenchymal cell apoptotic process involved in mesonephric nephron morphogenesis (GO:0061296)|negative regulation of mesenchymal cell apoptotic process involved in metanephros development (GO:1900212)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephric nephron tubule development (GO:0039020)|pronephros development (GO:0048793)|regulation of branch elongation involved in ureteric bud branching (GO:0072095)|regulation of endodermal cell fate specification (GO:0042663)|regulation of pronephros size (GO:0035565)|regulation of Wnt signaling pathway (GO:0030111)|response to glucose (GO:0009749)|ureteric bud elongation (GO:0060677)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|protein homodimerization activity (GO:0042803)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(6)|kidney(3)|large_intestine(2)|liver(1)|lung(3)|ovary(3)|prostate(1)|skin(2)	28		Breast(25;0.00765)|Ovarian(249;0.15)	STAD - Stomach adenocarcinoma(1;0.0142)			ATACTGGGGGGGTTCCTGCTT	0.512																																					Colon(71;102 1179 9001 27917 43397)											0			17											104.0	93.0	97.0					17																	36059179		2203	4300	6503	33133292	SO:0001583	missense	6928			BC017714	CCDS11324.1, CCDS58538.1	17q12	2014-05-06	2007-08-24	2007-08-24	ENSG00000108753	ENSG00000275410		"""Homeoboxes / HNF class"""	11630	protein-coding gene	gene with protein product		189907	"""transcription factor 2, hepatic; LF-B3; variant hepatic nuclear factor"""	TCF2		1677179, 10484768	Standard	NM_000458		Approved	LFB3, VHNF1, HNF1beta, MODY5	uc002hok.4	P35680	OTTHUMG00000188478	ENST00000225893.4:c.1556C>T	17.37:g.36059179G>A	ENSP00000225893:p.Pro519Leu		33133292	B4DKM3|E0YMJ9	Missense_Mutation	SNP	superfamily_Dimerization cofactor of HNF-1 alpha,HMMPfam_HNF-1_N,superfamily_lambda repressor-like DNA-binding domains,superfamily_Homeodomain-like,HMMSmart_SM00389,HMMPfam_Homeobox,PatternScan_HOMEOBOX_1,HMMPfam_HNF-1B_C	p.P519L	ENST00000225893.4	37	c.1556	CCDS11324.1	17	.	.	.	.	.	.	.	.	.	.	G	23.0	4.356842	0.82243	.	.	ENSG00000108753	ENST00000225893;ENST00000539087	D	0.96992	-4.2	5.87	5.87	0.94306	Hepatocyte nuclear factor 1, beta isoform, C-terminal (1);	0.049561	0.85682	D	0.000000	D	0.96956	0.9006	L	0.53249	1.67	0.80722	D	1	P;D	0.63880	0.786;0.993	P;P	0.58620	0.588;0.842	D	0.95546	0.8616	10	0.32370	T	0.25	.	19.5705	0.95413	0.0:0.0:1.0:0.0	.	493;519	E0YMJ6;P35680	.;HNF1B_HUMAN	L	519;407	ENSP00000225893:P519L	ENSP00000225893:P519L	P	-	2	0	HNF1B	33133292	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.725000	0.74752	2.941000	0.99782	0.655000	0.94253	CCC	-	HMMPfam_HNF-1B_C		0.512	HNF1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HNF1B	protein_coding	OTTHUMT00000256807.3	G	NM_000458		33133292	-1	no_errors	NM_000458	genbank	human	validated	54_36p	missense	SNP	1.000	A
KIAA0319L	79932	genome.wustl.edu	37	1	35972212	35972212	+	Splice_Site	SNP	C	C	A			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr1:35972212C>A	ENST00000325722.3	-	3	901		c.e3+1			NM_024874.4	NP_079150.3	Q8IZA0	K319L_HUMAN	KIAA0319-like							cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(12)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|urinary_tract(1)	34		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				AGCATGCTTACCTCTGCAGAG	0.443																																																0			1											148.0	137.0	141.0					1																	35972212		2203	4300	6503	35744799	SO:0001630	splice_region_variant	79932			AY163234	CCDS390.1	1p34.3	2008-10-24			ENSG00000142687	ENSG00000142687			30071	protein-coding gene	gene with protein product		613535				11347906	Standard	NM_024874		Approved	KIAA1837	uc001byx.3	Q8IZA0	OTTHUMG00000004370	ENST00000325722.3:c.666+1G>T	1.37:g.35972212C>A			35744799	B1AN13|D3DPR8|O95010|Q6PJJ7|Q7L1C9|Q8N2B3|Q8NDA0|Q8WY39|Q8WYZ5|Q96IC3|Q96JJ0|Q9BUW6|Q9H7V0	Splice_Site	SNP	-	e2+1	ENST00000325722.3	37	c.666+1	CCDS390.1	1	.	.	.	.	.	.	.	.	.	.	C	17.56	3.419847	0.62622	.	.	ENSG00000142687	ENST00000325722;ENST00000426982;ENST00000440579;ENST00000431916;ENST00000373258;ENST00000469892	.	.	.	5.63	5.63	0.86233	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.5403	0.76039	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	KIAA0319L	35744799	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	4.075000	0.57584	2.798000	0.96311	0.655000	0.94253	.	-	-		0.443	KIAA0319L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0319L	protein_coding	OTTHUMT00000012684.2	C	NM_024874	Intron	35744799	-1	no_errors	NM_024874	genbank	human	reviewed	54_36p	splice_site	SNP	1.000	A
C5orf42	65250	genome.wustl.edu	37	5	37183676	37183676	+	Missense_Mutation	SNP	G	G	T			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr5:37183676G>T	ENST00000508244.1	-	25	4700	c.4607C>A	c.(4606-4608)cCt>cAt	p.P1536H	C5orf42_ENST00000425232.2_Missense_Mutation_p.P1536H|C5orf42_ENST00000274258.7_Missense_Mutation_p.P417H			Q9H799	CE042_HUMAN	chromosome 5 open reading frame 42	1536						integral component of membrane (GO:0016021)				breast(5)|endometrium(3)|kidney(8)|large_intestine(24)|lung(28)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	79	all_lung(31;0.000616)		COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)			ACCTATTACAGGAAGTGTATT	0.308																																																0			5											56.0	54.0	55.0					5																	37183676		2202	4300	6502	37219433	SO:0001583	missense	65250				CCDS34146.1, CCDS34146.2	5p13.2	2014-01-28			ENSG00000197603	ENSG00000197603			25801	protein-coding gene	gene with protein product		614571				22264561	Standard	NM_023073		Approved	FLJ13231, JBTS17	uc011cpa.1	Q9H799	OTTHUMG00000160492	ENST00000508244.1:c.4607C>A	5.37:g.37183676G>T	ENSP00000421690:p.Pro1536His		37219433	A8MUB7|B7ZLV7|Q4G174|Q6DK46|Q8N8L4|Q9H5T1|Q9H8T9	Missense_Mutation	SNP	NULL	p.P417H	ENST00000508244.1	37	c.1250	CCDS34146.2	5	.	.	.	.	.	.	.	.	.	.	G	25.1	4.606614	0.87157	.	.	ENSG00000197603	ENST00000508244;ENST00000425232;ENST00000274258;ENST00000514429;ENST00000388739	T;T;T;T	0.74421	-0.84;-0.84;-0.84;-0.84	5.6	4.72	0.59763	.	0.000000	0.44285	D	0.000466	T	0.73760	0.3628	N	0.24115	0.695	0.44117	D	0.996894	D;P	0.56287	0.975;0.951	P;P	0.55011	0.766;0.503	T	0.77907	-0.2412	10	0.72032	D	0.01	.	15.8037	0.78477	0.0:0.0:0.8628:0.1372	.	1536;417	E9PH94;Q9H799	.;CE042_HUMAN	H	1536;1536;417;584;417	ENSP00000421690:P1536H;ENSP00000389014:P1536H;ENSP00000274258:P417H;ENSP00000424223:P584H	ENSP00000274258:P417H	P	-	2	0	C5orf42	37219433	1.000000	0.71417	0.987000	0.45799	0.993000	0.82548	8.317000	0.89987	1.332000	0.45431	0.655000	0.94253	CCT	-	NULL		0.308	C5orf42-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	C5orf42	protein_coding	OTTHUMT00000360806.1	G	NM_023073		37219433	-1	no_errors	NM_023073	genbank	human	predicted	54_36p	missense	SNP	1.000	T
BRCA1	672	genome.wustl.edu	37	17	41246127	41246127	+	Nonsense_Mutation	SNP	A	A	C	rs80357490		TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr17:41246127A>C	ENST00000357654.3	-	10	1539	c.1421T>G	c.(1420-1422)tTa>tGa	p.L474*	BRCA1_ENST00000471181.2_Nonsense_Mutation_p.L474*|BRCA1_ENST00000586385.1_Intron|BRCA1_ENST00000491747.2_Intron|BRCA1_ENST00000493795.1_Nonsense_Mutation_p.L427*|BRCA1_ENST00000591534.1_Intron|BRCA1_ENST00000354071.3_Nonsense_Mutation_p.L474*|BRCA1_ENST00000351666.3_Intron|BRCA1_ENST00000352993.3_Intron|BRCA1_ENST00000346315.3_Nonsense_Mutation_p.L474*|BRCA1_ENST00000591849.1_Intron|BRCA1_ENST00000309486.4_Nonsense_Mutation_p.L178*|BRCA1_ENST00000468300.1_Intron	NM_007294.3	NP_009225.1	P38398	BRCA1_HUMAN	breast cancer 1, early onset	474					androgen receptor signaling pathway (GO:0030521)|apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to indole-3-methanol (GO:0071681)|cellular response to tumor necrosis factor (GO:0071356)|chromosome segregation (GO:0007059)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|fatty acid biosynthetic process (GO:0006633)|G2 DNA damage checkpoint (GO:0031572)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of centriole replication (GO:0046600)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of DNA repair (GO:0045739)|positive regulation of gene expression (GO:0010628)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K9 acetylation (GO:2000617)|positive regulation of histone H4-K16 acetylation (GO:2000620)|positive regulation of histone H4-K20 methylation (GO:0070512)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation vascular endothelial growth factor production (GO:0010575)|postreplication repair (GO:0006301)|protein autoubiquitination (GO:0051865)|protein K6-linked ubiquitination (GO:0085020)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to estrogen (GO:0043627)|response to ionizing radiation (GO:0010212)	BRCA1-A complex (GO:0070531)|BRCA1-BARD1 complex (GO:0031436)|chromosome (GO:0005694)|cytoplasm (GO:0005737)|gamma-tubulin ring complex (GO:0008274)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ribonucleoprotein complex (GO:0030529)|ubiquitin ligase complex (GO:0000151)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|RNA binding (GO:0003723)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(30)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(28)|ovary(36)|skin(2)|stomach(4)|urinary_tract(2)	120		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)		TACATGGCTTAAGTTGGGGAG	0.363			"""D, Mis, N, F, S"""		ovarian	"""breast, ovarian"""		Homologous recombination	Hereditary Breast-Ovarian Cancer, BRCA1 type	TCGA Ovarian(2;0.000030)																												yes	Rec	yes	Hereditary breast/ovarian cancer	17	17q21	672	familial breast/ovarian cancer gene 1		E	0			17	GRCh37	CM021505	BRCA1	M	rs80357490						128.0	127.0	127.0					17																	41246127		2203	4300	6503	38499653	SO:0001587	stop_gained	672	Familial Cancer Database		U14680	CCDS11453.1, CCDS11454.1, CCDS11455.1, CCDS11456.1, CCDS11459.1, CCDS11455.2, CCDS11456.2, CCDS11459.2, CCDS11454.2	17q21.31	2014-09-17			ENSG00000012048	ENSG00000012048		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1100	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 1"", ""protein phosphatase 1, regulatory subunit 53"""	113705				1676470	Standard	NM_007300		Approved	RNF53, BRCC1, PPP1R53	uc002ict.3	P38398	OTTHUMG00000157426	ENST00000357654.3:c.1421T>G	17.37:g.41246127A>C	ENSP00000350283:p.Leu474*		38499653	O15129|Q1RMC1|Q3LRJ0|Q3LRJ6|Q6IN79|Q7KYU9	Nonsense_Mutation	SNP	superfamily_RING/U-box,HMMSmart_SM00184,HMMPfam_zf-C3HC4,PatternScan_ZF_RING_1,HMMPfam_BRCT,HMMSmart_SM00292,superfamily_BRCT domain	p.L474*	ENST00000357654.3	37	c.1421	CCDS11453.1	17	.	.	.	.	.	.	.	.	.	.	A	9.027	0.986385	0.18889	.	.	ENSG00000012048	ENST00000357654;ENST00000412061;ENST00000354071;ENST00000346315;ENST00000309486;ENST00000471181;ENST00000493795;ENST00000470026;ENST00000477152	.	.	.	4.44	3.36	0.38483	.	0.506969	0.16702	N	0.203087	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	0.1175	4.8722	0.13639	0.7479:0.0:0.0888:0.1634	.	.	.	.	X	474;474;474;474;178;474;427;474;448	.	ENSP00000310938:L178X	L	-	2	0	BRCA1	38499653	0.233000	0.23772	0.230000	0.23976	0.179000	0.23085	1.814000	0.38972	0.851000	0.35264	0.379000	0.24179	TTA	-	NULL		0.363	BRCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRCA1	protein_coding	OTTHUMT00000348798.2	A	NM_007294		38499653	-1	no_errors	NM_007294	genbank	human	reviewed	54_36p	nonsense	SNP	0.000	C
MPP2	4355	genome.wustl.edu	37	17	41959847	41959847	+	Silent	SNP	C	C	T			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr17:41959847C>T	ENST00000461854.1	-	7	643	c.558G>A	c.(556-558)ctG>ctA	p.L186L	MPP2_ENST00000523501.1_Silent_p.L151L|MPP2_ENST00000377184.3_Silent_p.L179L|MPP2_ENST00000536246.1_Silent_p.L151L|MPP2_ENST00000473246.1_5'UTR|MPP2_ENST00000518766.1_Silent_p.L207L|MPP2_ENST00000269095.4_Silent_p.L162L|MPP2_ENST00000520305.1_Silent_p.L23L			Q14168	MPP2_HUMAN	membrane protein, palmitoylated 2 (MAGUK p55 subfamily member 2)	186	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				nucleotide phosphorylation (GO:0046939)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	guanylate kinase activity (GO:0004385)			breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|liver(1)|lung(4)|ovary(1)|prostate(7)|skin(1)|upper_aerodigestive_tract(1)	29		Breast(137;0.00314)		BRCA - Breast invasive adenocarcinoma(366;0.12)		GCGCGATCACCAGCTCGCCGC	0.582																																																0			17											56.0	56.0	56.0					17																	41959847		2203	4300	6503	39315373	SO:0001819	synonymous_variant	4355				CCDS11471.1, CCDS62206.1, CCDS62207.1, CCDS62208.1, CCDS62209.1, CCDS62210.1	17q12-q21	2008-07-18			ENSG00000108852	ENSG00000108852			7220	protein-coding gene	gene with protein product	"""MAGUK p55 subfamily member 2"", ""discs large, homolog 2"""	600723		DLG2		7590743	Standard	NM_001278370		Approved	DKFZp761D0712	uc002ieo.1	Q14168	OTTHUMG00000133840	ENST00000461854.1:c.558G>A	17.37:g.41959847C>T			39315373	B4DGE9|B4DRJ0|B7Z3G8|E7EV80|E7EV91|E7EX01|Q53ES9|Q5CZB9|Q9BQJ2	Silent	SNP	HMMSmart_SM00569,HMMPfam_L27,superfamily_PDZ domain-like,HMMPfam_PDZ,HMMSmart_SM00228,superfamily_SH3-domain,HMMSmart_SM00326,HMMPfam_SH3_2,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00072,PatternScan_GUANYLATE_KINASE_1,HMMPfam_Guanylate_kin	p.L162	ENST00000461854.1	37	c.486		17																																																																																			-	superfamily_PDZ domain-like,HMMPfam_PDZ,HMMSmart_SM00228		0.582	MPP2-003	KNOWN	non_canonical_polymorphism|basic	protein_coding	MPP2	protein_coding	OTTHUMT00000258388.2	C	NM_005374		39315373	-1	no_errors	NM_005374	genbank	human	reviewed	54_36p	silent	SNP	1.000	T
ITGA2B	3674	genome.wustl.edu	37	17	42456063	42456063	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr17:42456063C>T	ENST00000262407.5	-	19	1925	c.1894G>A	c.(1894-1896)Gac>Aac	p.D632N	ITGA2B_ENST00000353281.4_Missense_Mutation_p.D632N	NM_000419.3	NP_000410.2	P08514	ITA2B_HUMAN	integrin, alpha 2b (platelet glycoprotein IIb of IIb/IIIa complex, antigen CD41)	632					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of leukocyte migration (GO:0002687)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|platelet alpha granule membrane (GO:0031092)	extracellular matrix binding (GO:0050840)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)			biliary_tract(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(8)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.191)	Abciximab(DB00054)|Tirofiban(DB00775)	TCCCCACAGTCCAGGACGATT	0.562																																																0			17											73.0	50.0	57.0					17																	42456063		2189	4279	6468	39811589	SO:0001583	missense	3674				CCDS32665.1	17q21.32	2014-09-17	2006-02-22			ENSG00000005961		"""CD molecules"", ""Integrins"""	6138	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 93"""	607759	"""integrin, alpha 2b (platelet glycoprotein IIb of IIb/IIIa complex, antigen CD41B)"""	GP2B			Standard	NM_000419		Approved	CD41B, CD41, PPP1R93	uc002igt.1	P08514		ENST00000262407.5:c.1894G>A	17.37:g.42456063C>T	ENSP00000262407:p.Asp632Asn		39811589	B2RCY8|O95366|Q14443|Q17R67	Missense_Mutation	SNP	superfamily_Integrin alpha N-terminal domain,HMMSmart_SM00191,HMMPfam_FG-GAP,HMMPfam_Integrin_alpha2,superfamily_Integrin domains,PatternScan_INTEGRIN_ALPHA,HMMPfam_Integrin_alpha	p.D632N	ENST00000262407.5	37	c.1894	CCDS32665.1	17	.	.	.	.	.	.	.	.	.	.	C	11.27	1.588228	0.28357	.	.	ENSG00000005961	ENST00000262407;ENST00000353281	T;T	0.49720	0.77;0.77	4.68	3.71	0.42584	Integrin alpha-2 (1);	0.000000	0.35936	U	0.002889	T	0.49423	0.1556	M	0.81179	2.53	0.80722	D	1	P;P	0.42620	0.567;0.785	B;B	0.40444	0.293;0.329	T	0.54009	-0.8357	10	0.46703	T	0.11	.	10.3732	0.44066	0.0:0.9036:0.0:0.0964	.	230;632	Q59FA8;P08514	.;ITA2B_HUMAN	N	632	ENSP00000262407:D632N;ENSP00000340536:D632N	ENSP00000262407:D632N	D	-	1	0	ITGA2B	39811589	1.000000	0.71417	1.000000	0.80357	0.018000	0.09664	4.771000	0.62318	1.187000	0.43000	0.591000	0.81541	GAC	-	HMMPfam_Integrin_alpha2,superfamily_Integrin domains		0.562	ITGA2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGA2B	protein_coding	OTTHUMT00000439823.1	C			39811589	-1	no_errors	NM_000419	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
HNF4A	3172	genome.wustl.edu	37	20	43034734	43034734	+	Missense_Mutation	SNP	C	C	G			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr20:43034734C>G	ENST00000316099.4	+	2	241	c.152C>G	c.(151-153)cCc>cGc	p.P51R	HNF4A_ENST00000609795.1_Missense_Mutation_p.P29R|MIR3646_ENST00000578301.1_RNA|HNF4A_ENST00000443598.2_Missense_Mutation_p.P51R|HNF4A_ENST00000316673.4_Missense_Mutation_p.P29R|HNF4A_ENST00000415691.2_Missense_Mutation_p.P51R|HNF4A_ENST00000457232.1_Missense_Mutation_p.P29R	NM_000457.4|NM_001258355.1|NM_178849.2	NP_000448.3|NP_001245284.1|NP_849180.1	P41235	HNF4A_HUMAN	hepatocyte nuclear factor 4, alpha	51					blood coagulation (GO:0007596)|endocrine pancreas development (GO:0031018)|gene expression (GO:0010467)|glucose homeostasis (GO:0042593)|lipid homeostasis (GO:0055088)|lipid metabolic process (GO:0006629)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|ornithine metabolic process (GO:0006591)|phospholipid homeostasis (GO:0055091)|positive regulation of cholesterol homeostasis (GO:2000189)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gastrulation (GO:0010470)|regulation of growth hormone receptor signaling pathway (GO:0060398)|regulation of insulin secretion (GO:0050796)|regulation of lipid metabolic process (GO:0019216)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to glucose (GO:0009749)|sex differentiation (GO:0007548)|signal transduction involved in regulation of gene expression (GO:0023019)|SMAD protein signal transduction (GO:0060395)|transcription initiation from RNA polymerase II promoter (GO:0006367)|triglyceride homeostasis (GO:0070328)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|fatty acid binding (GO:0005504)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			endometrium(4)|large_intestine(7)|lung(17)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(2)	34		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)			CTCAACGCGCCCAACAGCCTG	0.622																																					Colon(79;2 1269 8820 14841 52347)											0			20											137.0	136.0	136.0					20																	43034734		2203	4300	6503	42468148	SO:0001583	missense	3172			X76930	CCDS13330.1, CCDS13331.1, CCDS42876.1, CCDS46604.1, CCDS46605.1, CCDS68131.1, CCDS74728.1	20q13.12	2014-09-17			ENSG00000101076	ENSG00000101076		"""Nuclear hormone receptors"""	5024	protein-coding gene	gene with protein product		600281		TCF14, MODY, MODY1		7926813, 9048927	Standard	NM_001030003		Approved	NR2A1, HNF4	uc010zwo.1	P41235	OTTHUMG00000032531	ENST00000316099.4:c.152C>G	20.37:g.43034734C>G	ENSP00000312987:p.Pro51Arg		42468148	A5JW41|B2RPP8|O00659|O00723|Q14540|Q5QPB8|Q6B4V5|Q6B4V6|Q6B4V7|Q92653|Q92654|Q92655|Q99864|Q9NQH0	Missense_Mutation	SNP	HMMSmart_SM00399,HMMPfam_zf-C4,superfamily_Glucocorticoid receptor-like (DNA-binding domain),PatternScan_NUCLEAR_REC_DBD_1,superfamily_Nuclear receptor ligand-binding domain,HMMSmart_SM00430,HMMPfam_Hormone_recep	p.P51R	ENST00000316099.4	37	c.152	CCDS13330.1	20	.	.	.	.	.	.	.	.	.	.	c	17.88	3.498104	0.64186	.	.	ENSG00000101076	ENST00000316673;ENST00000457232;ENST00000316099;ENST00000443598;ENST00000338692;ENST00000415691	D;D;D;D;D	0.93307	-3.17;-3.16;-3.14;-3.2;-3.12	5.17	5.17	0.71159	.	0.771995	0.12775	N	0.440156	D	0.87617	0.6222	N	0.14661	0.345	0.32263	N	0.569876	B;B;B;B;B;B;P	0.36909	0.19;0.105;0.105;0.419;0.286;0.409;0.573	B;B;B;B;B;B;B	0.38327	0.058;0.042;0.042;0.189;0.14;0.271;0.142	D	0.88007	0.2760	10	0.44086	T	0.13	.	12.1226	0.53900	0.0:0.9217:0.0:0.0783	.	44;51;51;51;29;29;29	Q5QPB7;P41235;F1D8S2;P41235-3;F1D8T0;P41235-6;P41235-7	.;HNF4A_HUMAN;.;.;.;.;.	R	29;29;51;51;81;51	ENSP00000315180:P29R;ENSP00000396216:P29R;ENSP00000312987:P51R;ENSP00000410911:P51R;ENSP00000412111:P51R	ENSP00000312987:P51R	P	+	2	0	HNF4A	42468148	1.000000	0.71417	0.994000	0.49952	0.994000	0.84299	5.629000	0.67798	2.414000	0.81942	0.645000	0.84053	CCC	-	NULL		0.622	HNF4A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HNF4A	protein_coding	OTTHUMT00000079363.3	C			42468148	+1	no_errors	NM_000457	genbank	human	reviewed	54_36p	missense	SNP	0.993	G
MAP4K1	11184	genome.wustl.edu	37	19	39101704	39101704	+	Missense_Mutation	SNP	G	G	T			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr19:39101704G>T	ENST00000591517.1	-	11	825	c.797C>A	c.(796-798)aCc>aAc	p.T266N	MAP4K1_ENST00000589002.1_Intron|MAP4K1_ENST00000396857.2_Missense_Mutation_p.T266N|MAP4K1_ENST00000589130.1_Missense_Mutation_p.T262N|MAP4K1_ENST00000586296.1_Missense_Mutation_p.T266N|MAP4K1_ENST00000423454.2_Intron	NM_007181.4	NP_009112.1	Q92918	M4K1_HUMAN	mitogen-activated protein kinase kinase kinase kinase 1	266	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of JUN kinase activity (GO:0007257)|activation of MAPKKK activity (GO:0000185)|cell proliferation (GO:0008283)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|response to stress (GO:0006950)	membrane (GO:0016020)	ATP binding (GO:0005524)|MAP kinase kinase kinase kinase activity (GO:0008349)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(24)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(1)	44	all_cancers(60;6.42e-06)|Ovarian(47;0.103)		Lung(45;0.000751)|LUSC - Lung squamous cell carcinoma(53;0.00272)			GAGCATCTTGGTGGCGCTGGG	0.537																																																0			19											111.0	125.0	120.0					19																	39101704		1990	4168	6158	43793544	SO:0001583	missense	11184			U66464	CCDS42564.1, CCDS59385.1	19q13.1-q13.4	2011-06-09				ENSG00000104814	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinase kinase kinase kinases"""	6863	protein-coding gene	gene with protein product	"""hematopoietic progenitor kinase 1"""	601983				8824585	Standard	NM_001042600		Approved	HPK1	uc002oix.1	Q92918		ENST00000591517.1:c.797C>A	19.37:g.39101704G>T	ENSP00000465039:p.Thr266Asn		43793544		Missense_Mutation	SNP	PatternScan_PROTEIN_KINASE_ST,superfamily_Kinase_like,HMMSmart_S_TKc,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ATP,HMMSmart_CNH,HMMPfam_CNH	p.T266N	ENST00000591517.1	37	c.797	CCDS59385.1	19	.	.	.	.	.	.	.	.	.	.	.	13.81	2.348652	0.41599	.	.	ENSG00000104814	ENST00000396857;ENST00000221409	T	0.65178	-0.14	4.27	3.24	0.37175	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.404731	0.24191	N	0.040704	T	0.54431	0.1858	L	0.41492	1.28	0.80722	D	1	P;P	0.42584	0.531;0.784	B;B	0.42522	0.201;0.39	T	0.57991	-0.7715	10	0.72032	D	0.01	.	10.83	0.46654	0.0944:0.0:0.9055:0.0	.	266;266	Q92918-2;Q92918	.;M4K1_HUMAN	N	266	ENSP00000380066:T266N	ENSP00000221409:T266N	T	-	2	0	MAP4K1	43793544	0.989000	0.36119	1.000000	0.80357	0.942000	0.58702	1.933000	0.40153	1.015000	0.39444	0.555000	0.69702	ACC	-	superfamily_Kinase_like,HMMSmart_S_TKc,HMMPfam_Pkinase		0.537	MAP4K1-002	KNOWN	basic|CCDS	protein_coding	MAP4K1	protein_coding	OTTHUMT00000453390.1	G	NM_001042600		43793544	-1	no_errors	NM_007181	genbank	human	validated	54_36p	missense	SNP	0.988	T
ANO6	196527	genome.wustl.edu	37	12	45814883	45814883	+	Missense_Mutation	SNP	G	G	T			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr12:45814883G>T	ENST00000320560.8	+	18	2449	c.2247G>T	c.(2245-2247)atG>atT	p.M749I	ANO6_ENST00000425752.2_Missense_Mutation_p.M749I|ANO6_ENST00000423947.3_Missense_Mutation_p.M770I|ANO6_ENST00000441606.2_Missense_Mutation_p.M731I|ANO6_ENST00000435642.1_Missense_Mutation_p.M749I|ANO6_ENST00000426898.2_3'UTR	NM_001025356.2	NP_001020527.2	Q4KMQ2	ANO6_HUMAN	anoctamin 6	749					activation of blood coagulation via clotting cascade (GO:0002543)|blood coagulation (GO:0007596)|bone mineralization involved in bone maturation (GO:0035630)|calcium activated galactosylceramide scrambling (GO:0061591)|calcium activated phosphatidylcholine scrambling (GO:0061590)|calcium activated phosphatidylserine scrambling (GO:0061589)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|dendritic cell chemotaxis (GO:0002407)|ion transmembrane transport (GO:0034220)|phosphatidylserine exposure on blood platelet (GO:0097045)|phospholipid scrambling (GO:0017121)|positive regulation of endothelial cell apoptotic process (GO:2000353)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)	cell surface (GO:0009986)|chloride channel complex (GO:0034707)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|intracellular calcium activated chloride channel activity (GO:0005229)|phospholipid scramblase activity (GO:0017128)|voltage-gated chloride channel activity (GO:0005247)|voltage-gated ion channel activity (GO:0005244)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(23)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	46						CGTCGGACATGATCCCCCGCC	0.473																																																0			12											189.0	161.0	170.0					12																	45814883		2203	4300	6503	44101150	SO:0001583	missense	196527			AL832340	CCDS31782.1, CCDS44865.1, CCDS44866.1, CCDS55819.1	12q12-q13.11	2014-09-17	2008-08-28	2008-08-28				"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	25240	protein-coding gene	gene with protein product		608663	"""transmembrane protein 16F"""	TMEM16F		15067359, 24692353	Standard	NM_001025356		Approved	DKFZp313M0720	uc010slf.2	Q4KMQ2	OTTHUMG00000169564	ENST00000320560.8:c.2247G>T	12.37:g.45814883G>T	ENSP00000320087:p.Met749Ile		44101150	A6NNM6|B9EGG0|E7ENK4|E9PB30|E9PCT2|Q8N3Q2	Missense_Mutation	SNP	HMMPfam_DUF590	p.M749I	ENST00000320560.8	37	c.2247	CCDS31782.1	12	.	.	.	.	.	.	.	.	.	.	G	15.55	2.866079	0.51588	.	.	ENSG00000177119	ENST00000425752;ENST00000423947;ENST00000435642;ENST00000320560;ENST00000441606	T;T;T;T;T	0.69435	-0.4;-0.27;-0.4;-0.27;-0.26	5.05	5.05	0.67936	.	0.000000	0.85682	D	0.000000	T	0.65801	0.2726	L	0.49571	1.57	0.80722	D	1	B;B;P;B	0.35684	0.029;0.001;0.515;0.003	B;B;B;B	0.38378	0.057;0.007;0.272;0.014	T	0.65615	-0.6125	10	0.40728	T	0.16	.	19.2834	0.94061	0.0:0.0:1.0:0.0	.	731;770;749;749	E9PB30;B9EGG0;E9PCT2;Q4KMQ2	.;.;.;ANO6_HUMAN	I	749;770;749;749;731	ENSP00000391417:M749I;ENSP00000409126:M770I;ENSP00000413840:M749I;ENSP00000320087:M749I;ENSP00000413137:M731I	ENSP00000320087:M749I	M	+	3	0	ANO6	44101150	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.585000	0.74062	2.717000	0.92951	0.650000	0.86243	ATG	-	HMMPfam_DUF590		0.473	ANO6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ANO6	protein_coding	OTTHUMT00000404822.1	G	XM_113743		44101150	+1	no_errors	NM_001025356	genbank	human	validated	54_36p	missense	SNP	1.000	T
C21orf2	755	genome.wustl.edu	37	21	45751873	45751873	+	Missense_Mutation	SNP	C	C	T	rs144430869		TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr21:45751873C>T	ENST00000339818.4	-	5	605	c.398G>A	c.(397-399)cGt>cAt	p.R133H	AP001062.8_ENST00000422357.1_RNA|C21orf2_ENST00000325223.7_Missense_Mutation_p.R133H|AP001062.7_ENST00000448927.1_RNA|C21orf2_ENST00000496321.1_5'UTR|C21orf2_ENST00000397956.3_Missense_Mutation_p.R133H	NM_001271440.1|NM_004928.2	NP_001258369.1|NP_004919.1	O43822	CU002_HUMAN	chromosome 21 open reading frame 2	133	LRRCT.				cilium morphogenesis (GO:0060271)|cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)|smoothened signaling pathway (GO:0007224)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				endometrium(2)	2				Colorectal(79;0.0806)		ACTCAGTGCACGGGACAGCTC	0.627																																																0			21						C	HIS/ARG	0,4406		0,0,2203	81.0	63.0	69.0		398	2.5	0.8	21	dbSNP_134	69	1,8599	1.2+/-3.3	0,1,4299	yes	missense	C21orf2	NM_004928.2	29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	133/257	45751873	1,13005	2203	4300	6503	44576301	SO:0001583	missense	755			Y11392	CCDS13709.1, CCDS59444.1, CCDS59445.1	21q22.3	2014-03-24			ENSG00000160226	ENSG00000160226			1260	protein-coding gene	gene with protein product	"""nuclear encoded mitochondrial protein"", ""leucine rich repeat containing 76"""	603191				9465297	Standard	NM_004928		Approved	YF5, A2, LRRC76	uc002zeq.2	O43822	OTTHUMG00000086909	ENST00000339818.4:c.398G>A	21.37:g.45751873C>T	ENSP00000344566:p.Arg133His		44576301	A8MPS9|O14993|Q8N5X6|Q99837|Q99838	Missense_Mutation	SNP	superfamily_Outer arm dynein light chain 1,HMMSmart_SM00446	p.R133H	ENST00000339818.4	37	c.398	CCDS13709.1	21	.	.	.	.	.	.	.	.	.	.	C	12.31	1.900279	0.33535	0.0	1.16E-4	ENSG00000160226	ENST00000339818;ENST00000380160;ENST00000397956;ENST00000325223	T;T;T	0.35421	1.61;1.31;1.64	4.72	2.47	0.30058	.	0.210225	0.40908	D	0.000983	T	0.22085	0.0532	L	0.51422	1.61	0.35542	D	0.803101	B;P;B;P	0.47545	0.324;0.897;0.217;0.672	B;B;B;B	0.32624	0.042;0.149;0.019;0.071	T	0.28870	-1.0030	10	0.44086	T	0.13	-16.1799	4.8398	0.13485	0.0:0.6388:0.0:0.3612	.	133;133;133;92	G5E952;Q8N5X6;O43822;O43822-2	.;.;CU002_HUMAN;.	H	133;169;133;133	ENSP00000344566:R133H;ENSP00000381047:R133H;ENSP00000317302:R133H	ENSP00000317302:R133H	R	-	2	0	C21orf2	44576301	0.411000	0.25384	0.814000	0.32528	0.125000	0.20455	1.094000	0.30951	1.117000	0.41842	0.655000	0.94253	CGT	-	superfamily_Outer arm dynein light chain 1		0.627	C21orf2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C21orf2	protein_coding	OTTHUMT00000195799.1	C	NM_004928		44576301	-1	no_errors	NM_004928	genbank	human	validated	54_36p	missense	SNP	0.924	T
RAMP3	10268	genome.wustl.edu	37	7	45222905	45222905	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr7:45222905C>T	ENST00000242249.4	+	3	379	c.341C>T	c.(340-342)cCc>cTc	p.P114L	RAMP3_ENST00000481345.1_Missense_Mutation_p.P114L|RAMP3_ENST00000496212.1_Missense_Mutation_p.P114L	NM_005856.2	NP_005847.1	O60896	RAMP3_HUMAN	receptor (G protein-coupled) activity modifying protein 3	114					calcium ion transport (GO:0006816)|cellular response to estradiol stimulus (GO:0071392)|G-protein coupled receptor signaling pathway involved in heart process (GO:0086103)|intracellular protein transport (GO:0006886)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of receptor recycling (GO:0001921)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|receptor internalization (GO:0031623)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	coreceptor activity (GO:0015026)|protein transporter activity (GO:0008565)|receptor activity (GO:0004872)			breast(1)|endometrium(1)|large_intestine(4)|lung(4)|stomach(1)	11					Pramlintide(DB01278)	TTGGAGGACCCCCCAGACGAG	0.632																																																0			7											114.0	111.0	112.0					7																	45222905		2203	4300	6503	45189430	SO:0001583	missense	10268			AJ001016	CCDS5503.1	7p13-p12	2006-11-21	2006-11-21		ENSG00000122679	ENSG00000122679		"""Receptor (G protein-coupled) activity modifying proteins"""	9845	protein-coding gene	gene with protein product		605155	"""receptor activity modifying protein 3"", ""receptor (calcitonin) activity modifying protein 3"""				Standard	NM_005856		Approved		uc003tnb.3	O60896	OTTHUMG00000023729	ENST00000242249.4:c.341C>T	7.37:g.45222905C>T	ENSP00000242249:p.Pro114Leu		45189430	Q7Z2Y1	Missense_Mutation	SNP	HMMPfam_RAMP	p.P114L	ENST00000242249.4	37	c.341	CCDS5503.1	7	.	.	.	.	.	.	.	.	.	.	C	17.05	3.290433	0.59976	.	.	ENSG00000122679	ENST00000242249;ENST00000481345;ENST00000496212	T;T;T	0.57436	0.4;0.4;0.4	4.37	4.37	0.52481	.	0.000000	0.85682	D	0.000000	T	0.75975	0.3923	M	0.89414	3.03	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.81890	-0.0725	10	0.87932	D	0	-31.6697	14.3953	0.67007	0.0:1.0:0.0:0.0	.	114	O60896	RAMP3_HUMAN	L	114	ENSP00000242249:P114L;ENSP00000419012:P114L;ENSP00000418460:P114L	ENSP00000242249:P114L	P	+	2	0	RAMP3	45189430	1.000000	0.71417	0.984000	0.44739	0.037000	0.13140	4.987000	0.63857	1.955000	0.56771	0.655000	0.94253	CCC	-	HMMPfam_RAMP		0.632	RAMP3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	RAMP3	protein_coding	OTTHUMT00000251343.1	C	NM_005856		45189430	+1	no_errors	NM_005856	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
MRO	83876	genome.wustl.edu	37	18	48331562	48331562	+	Missense_Mutation	SNP	T	T	G			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr18:48331562T>G	ENST00000428869.2	-	6	649	c.391A>C	c.(391-393)Ata>Cta	p.I131L	MRO_ENST00000436348.2_Missense_Mutation_p.I145L|MRO_ENST00000256425.2_Missense_Mutation_p.I131L|MRO_ENST00000431965.2_Missense_Mutation_p.I145L|MRO_ENST00000587291.1_5'UTR|MRO_ENST00000398439.3_Missense_Mutation_p.I131L|MRO_ENST00000588444.1_Missense_Mutation_p.I131L			Q9BYG7	MSTRO_HUMAN	maestro	131						nucleolus (GO:0005730)				breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|prostate(2)|skin(2)	10		Colorectal(6;0.0596)		Colorectal(21;0.082)		GTGATATCTATGAAGAAGGAA	0.408																																																0			18											122.0	111.0	115.0					18																	48331562		2203	4300	6503	46585560	SO:0001583	missense	83876			AK054702	CCDS11947.1, CCDS45867.1, CCDS45868.1, CCDS45869.1	18q21	2012-12-19	2004-06-15		ENSG00000134042	ENSG00000134042		"""maestro heat-like repeat containing"""	24121	protein-coding gene	gene with protein product	"""B29 protein"", ""beside the Ma29 deletion"""	608080	"""chromosome 18 open reading frame 3"""	C18orf3		11401430	Standard	NM_031939		Approved	B29, FLJ30140	uc010dpa.3	Q9BYG7	OTTHUMG00000132692	ENST00000428869.2:c.391A>C	18.37:g.48331562T>G	ENSP00000409509:p.Ile131Leu		46585560	B7Z2I5|B7Z3B2|E9PAT5|E9PBI3|K7EKJ8|Q8N6K5	Missense_Mutation	SNP	superfamily_ARM repeat	p.I131L	ENST00000428869.2	37	c.391	CCDS11947.1	18	.	.	.	.	.	.	.	.	.	.	T	12.20	1.866282	0.32977	.	.	ENSG00000134042	ENST00000436348;ENST00000431965;ENST00000428869;ENST00000398439;ENST00000256425	T;T;T;T;T	0.63580	-0.05;2.21;1.49;1.49;1.49	5.71	-4.35	0.03656	Armadillo-like helical (1);Armadillo-type fold (1);	0.977251	0.08384	N	0.954057	T	0.51295	0.1666	L	0.59912	1.85	0.30890	N	0.730444	B;P;B;B	0.35656	0.193;0.514;0.128;0.02	B;B;B;B	0.32724	0.09;0.151;0.067;0.03	T	0.48948	-0.8989	10	0.12430	T	0.62	-25.0257	12.8589	0.57901	0.0:0.5898:0.0:0.4102	.	131;145;145;131	E9PFU2;E9PBI3;E9PAT5;Q9BYG7	.;.;.;MSTRO_HUMAN	L	145;145;131;131;131	ENSP00000397900:I145L;ENSP00000392614:I145L;ENSP00000409509:I131L;ENSP00000381465:I131L;ENSP00000256425:I131L	ENSP00000256425:I131L	I	-	1	0	MRO	46585560	0.116000	0.22171	0.721000	0.30653	0.519000	0.34347	-0.683000	0.05179	-1.091000	0.03065	0.455000	0.32223	ATA	-	superfamily_ARM repeat		0.408	MRO-003	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	MRO	protein_coding	OTTHUMT00000449478.2	T	NM_031939		46585560	-1	no_errors	NM_031939	genbank	human	reviewed	54_36p	missense	SNP	0.959	G
GPR111	222611	genome.wustl.edu	37	6	47649659	47649659	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr6:47649659G>A	ENST00000296862.1	+	6	1364	c.1364G>A	c.(1363-1365)gGc>gAc	p.G455D	GPR111_ENST00000507065.1_Missense_Mutation_p.G387D|GPR111_ENST00000398742.2_Missense_Mutation_p.G387D			Q8IZF7	GP111_HUMAN	G protein-coupled receptor 111	455					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|liver(2)|lung(15)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	29						GTAGGCCTGGGCATTTCTATT	0.423																																																0			6											165.0	151.0	155.0					6																	47649659		1954	4137	6091	47757618	SO:0001583	missense	222611			AB065684		6p12.3	2014-08-08			ENSG00000164393	ENSG00000164393		"""-"", ""GPCR / Class B : Orphans"""	18991	protein-coding gene	gene with protein product						12435584	Standard	NM_153839		Approved	hGPCR35, PGR20	uc003oyy.3	Q8IZF7	OTTHUMG00000046168	ENST00000296862.1:c.1364G>A	6.37:g.47649659G>A	ENSP00000296862:p.Gly455Asp		47757618	Q2PNZ1|Q86SL6|Q8NGU5|Q8TDT5	Missense_Mutation	SNP	HMMPfam_GPS,HMMPfam_7tm_2	p.G387D	ENST00000296862.1	37	c.1160		6	.	.	.	.	.	.	.	.	.	.	G	15.57	2.873515	0.51695	.	.	ENSG00000164393	ENST00000507065;ENST00000296862;ENST00000398742	T;T;T	0.46819	0.86;0.86;0.86	5.43	5.43	0.79202	GPCR, family 2-like (1);	0.000000	0.64402	D	0.000005	T	0.66752	0.2821	M	0.86864	2.845	0.43043	D	0.994638	D;D	0.89917	1.0;1.0	D;D	0.85130	0.993;0.997	T	0.72308	-0.4332	10	0.62326	D	0.03	.	13.8962	0.63773	0.0:0.1525:0.8475:0.0	.	387;455	Q8IZF7-2;Q8IZF7	.;GP111_HUMAN	D	387;455;387	ENSP00000422934:G387D;ENSP00000296862:G455D;ENSP00000381727:G387D	ENSP00000296862:G455D	G	+	2	0	GPR111	47757618	1.000000	0.71417	1.000000	0.80357	0.402000	0.30811	5.214000	0.65236	2.544000	0.85801	0.591000	0.81541	GGC	-	NULL		0.423	GPR111-001	KNOWN	basic	protein_coding	GPR111	protein_coding	OTTHUMT00000106423.2	G	NM_153839		47757618	+1	no_errors	NM_153839	genbank	human	validated	54_36p	missense	SNP	1.000	A
NOD2	64127	genome.wustl.edu	37	16	50733758	50733758	+	Missense_Mutation	SNP	C	C	A			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr16:50733758C>A	ENST00000300589.2	+	2	538	c.433C>A	c.(433-435)Ctc>Atc	p.L145I	NOD2_ENST00000526417.2_3'UTR	NM_022162.1	NP_071445.1	Q9HC29	NOD2_HUMAN	nucleotide-binding oligomerization domain containing 2	145	CARD 2. {ECO:0000255|PROSITE- ProRule:PRU00046}.				activation of MAPK activity (GO:0000187)|activation of MAPK activity involved in innate immune response (GO:0035419)|cellular response to muramyl dipeptide (GO:0071225)|cellular response to peptidoglycan (GO:0071224)|cytokine production involved in immune response (GO:0002367)|defense response (GO:0006952)|defense response to bacterium (GO:0042742)|defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|detection of biotic stimulus (GO:0009595)|detection of muramyl dipeptide (GO:0032498)|immunoglobulin production involved in immunoglobulin mediated immune response (GO:0002381)|innate immune response (GO:0045087)|innate immune response in mucosa (GO:0002227)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|macrophage inflammatory protein-1 alpha production (GO:0071608)|maintenance of gastrointestinal epithelium (GO:0030277)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of inflammatory response to antigenic stimulus (GO:0002862)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of interleukin-18 production (GO:0032701)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of macrophage apoptotic process (GO:2000110)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of T cell mediated immunity (GO:0002710)|negative regulation of toll-like receptor 2 signaling pathway (GO:0034136)|negative regulation of tumor necrosis factor production (GO:0032720)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070431)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of B cell activation (GO:0050871)|positive regulation of biosynthetic process of antibacterial peptides active against Gram-positive bacteria (GO:0006965)|positive regulation of dendritic cell antigen processing and presentation (GO:0002606)|positive regulation of dendritic cell cytokine production (GO:0002732)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gamma-delta T cell activation (GO:0046645)|positive regulation of humoral immune response mediated by circulating immunoglobulin (GO:0002925)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JNK cascade (GO:0046330)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of prostaglandin-E synthase activity (GO:2000363)|positive regulation of prostaglandin-endoperoxide synthase activity (GO:0060585)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of stress-activated MAPK cascade (GO:0032874)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type 2 immune response (GO:0002830)|protein oligomerization (GO:0051259)|regulation of inflammatory response (GO:0050727)|regulation of neutrophil chemotaxis (GO:0090022)|response to exogenous dsRNA (GO:0043330)|response to lipopolysaccharide (GO:0032496)|response to muramyl dipeptide (GO:0032495)|response to nutrient (GO:0007584)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|vesicle (GO:0031982)	ATP binding (GO:0005524)|CARD domain binding (GO:0050700)|enzyme binding (GO:0019899)|muramyl dipeptide binding (GO:0032500)|peptidoglycan binding (GO:0042834)|protein kinase binding (GO:0019901)			cervix(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(30)|ovary(3)|skin(3)	52		all_cancers(37;0.0156)				TGTCAGGAGGCTCCACAGCCA	0.617																																																0			16											55.0	53.0	54.0					16																	50733758		2198	4300	6498	49291259	SO:0001583	missense	64127			AF178930	CCDS10746.1	16q12	2014-09-17	2006-12-08	2006-12-08	ENSG00000167207	ENSG00000167207		"""Nucleotide-binding domain and leucine rich repeat containing"""	5331	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 2"", ""NOD-like receptor C2"", ""NLR family, CARD domain containing 2"""	605956	"""caspase recruitment domain family, member 15"""	IBD1, CARD15		7809109, 8587604	Standard	XM_005256084		Approved	BLAU, CD, PSORAS1, CLR16.3, NLRC2	uc002egm.1	Q9HC29	OTTHUMG00000133171	ENST00000300589.2:c.433C>A	16.37:g.50733758C>A	ENSP00000300589:p.Leu145Ile		49291259	E2JEQ6|Q96RH5|Q96RH6|Q96RH8	Missense_Mutation	SNP	HMMPfam_CARD,superfamily_DEATH domain,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMPfam_NACHT,superfamily_RNI-like,HMMSmart_SM00368,HMMPfam_LRR_1	p.L145I	ENST00000300589.2	37	c.433	CCDS10746.1	16	.	.	.	.	.	.	.	.	.	.	C	13.01	2.110607	0.37242	.	.	ENSG00000167207	ENST00000526417;ENST00000531674;ENST00000300589	T;T	0.26373	2.16;1.74	5.29	4.28	0.50868	DEATH-like (2);Caspase Recruitment (2);	0.148500	0.30392	N	0.009726	T	0.18800	0.0451	L	0.43152	1.355	0.42933	D	0.994324	B	0.32409	0.37	B	0.30316	0.114	T	0.03597	-1.1021	10	0.20046	T	0.44	.	9.4899	0.38953	0.2644:0.7356:0.0:0.0	.	145	Q9HC29	NOD2_HUMAN	I	118;118;145	ENSP00000431681:L118I;ENSP00000300589:L145I	ENSP00000300589:L145I	L	+	1	0	NOD2	49291259	1.000000	0.71417	1.000000	0.80357	0.487000	0.33371	1.605000	0.36815	2.482000	0.83794	0.591000	0.81541	CTC	-	superfamily_DEATH domain,HMMPfam_CARD		0.617	NOD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOD2	protein_coding	OTTHUMT00000256876.2	C	NM_022162		49291259	+1	no_errors	NM_022162	genbank	human	reviewed	54_36p	missense	SNP	0.993	A
C10orf71	118461	genome.wustl.edu	37	10	50532784	50532784	+	Missense_Mutation	SNP	T	T	A			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr10:50532784T>A	ENST00000374144.3	+	3	2482	c.2194T>A	c.(2194-2196)Tct>Act	p.S732T	C10orf71_ENST00000323868.4_Intron			Q711Q0	CJ071_HUMAN	chromosome 10 open reading frame 71	732										endometrium(1)	1						CAGCACCAGCTCTTCAGATCA	0.498																																																0			10											66.0	55.0	58.0					10																	50532784		692	1591	2283	50202790	SO:0001583	missense	118461			AL833265	CCDS44387.1	10q11.23	2012-05-31			ENSG00000177354	ENSG00000177354			26973	protein-coding gene	gene with protein product							Standard	NM_001135196		Approved	FLJ45913	uc021pqa.2	Q711Q0	OTTHUMG00000018190	ENST00000374144.3:c.2194T>A	10.37:g.50532784T>A	ENSP00000363259:p.Ser732Thr		50202790	A0AVL8	Missense_Mutation	SNP	PatternScan_SUGAR_TRANSPORT_1	p.S732T	ENST00000374144.3	37	c.2194	CCDS44387.1	10	.	.	.	.	.	.	.	.	.	.	T	25.5	4.645412	0.87859	.	.	ENSG00000177354	ENST00000374144	T	0.13538	2.58	5.64	5.64	0.86602	.	0.000000	0.34178	U	0.004200	T	0.20251	0.0487	L	0.34521	1.04	0.80722	D	1	.	.	.	.	.	.	T	0.00807	-1.1558	8	0.62326	D	0.03	.	14.4225	0.67193	0.0:0.0:0.0:1.0	.	.	.	.	T	732	ENSP00000363259:S732T	ENSP00000363259:S732T	S	+	1	0	C10orf71	50202790	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.172000	0.65003	2.160000	0.67779	0.482000	0.46254	TCT	-	NULL		0.498	C10orf71-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C10orf71	protein_coding	OTTHUMT00000047984.2	T	NM_199459		50202790	+1	no_errors	ENST00000374144	ensembl	human	known	54_36p	missense	SNP	1.000	A
Unknown	0	genome.wustl.edu	37	15	53229211	53229211	+	IGR	SNP	C	C	T			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr15:53229211C>T								RP11-209K10.2 (132072 upstream) : RP11-209E8.1 (179350 downstream)																							GAATGTTTTACGATGCATCGT	0.348																																																0			15																																								51016503	SO:0001628	intergenic_variant	645693																															15.37:g.53229211C>T			51016503		RNA	SNP	-	NULL		37	NULL		15																																																																																			-	-	0	0.348					LOC645693			C			51016503	-1	pseudogene	XR_017498	genbank	human	model	54_36p	rna	SNP	1.000	T
MC3R	4159	genome.wustl.edu	37	20	54824818	54824818	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr20:54824818C>T	ENST00000243911.2	+	1	1031	c.919C>T	c.(919-921)Cgc>Tgc	p.R307C		NM_019888.3	NP_063941.3	P41968	MC3R_HUMAN	melanocortin 3 receptor	307					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|homoiothermy (GO:0042309)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cAMP biosynthetic process (GO:0030819)|regulation of blood pressure (GO:0008217)|regulation of heart rate (GO:0002027)|sodium ion homeostasis (GO:0055078)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	melanocortin receptor activity (GO:0004977)|melanocyte-stimulating hormone receptor activity (GO:0004980)|neuropeptide binding (GO:0042923)|peptide hormone binding (GO:0017046)	p.R344C(1)		breast(2)|endometrium(1)|kidney(3)|large_intestine(3)|lung(13)|ovary(3)|skin(1)	26			Colorectal(105;0.202)			CCTGGAATTGCGCAACACCTT	0.517																																																1	Substitution - Missense(1)	breast(1)	20											171.0	162.0	165.0					20																	54824818		2203	4300	6503	54258225	SO:0001583	missense	4159				CCDS13449.2	20q13.2-q13.3	2012-08-10			ENSG00000124089	ENSG00000124089		"""GPCR / Class A : Melanocortin receptors"""	6931	protein-coding gene	gene with protein product		155540				8463333	Standard	NM_019888		Approved	MC3	uc002xxb.2	P41968	OTTHUMG00000032785	ENST00000243911.2:c.919C>T	20.37:g.54824818C>T	ENSP00000243911:p.Arg307Cys		54258225	Q4KN27|Q9H517	Missense_Mutation	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.R344C	ENST00000243911.2	37	c.1030	CCDS13449.2	20	.	.	.	.	.	.	.	.	.	.	C	12.54	1.967174	0.34754	.	.	ENSG00000124089	ENST00000243911	T	0.58358	0.34	5.09	3.06	0.35304	.	0.000000	0.64402	D	0.000014	T	0.80989	0.4730	H	0.97440	4.005	0.54753	D	0.999986	D	0.89917	1.0	D	0.83275	0.996	D	0.85842	0.1398	10	0.87932	D	0	.	13.1951	0.59734	0.4134:0.5866:0.0:0.0	.	344	P41968	MC3R_HUMAN	C	307	ENSP00000243911:R307C	ENSP00000243911:R307C	R	+	1	0	MC3R	54258225	1.000000	0.71417	0.993000	0.49108	0.191000	0.23601	2.103000	0.41806	0.477000	0.27464	0.555000	0.69702	CGC	-	superfamily_SSF81321		0.517	MC3R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MC3R	protein_coding	OTTHUMT00000079786.2	C			54258225	+1	no_errors	NM_019888	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
DST	667	genome.wustl.edu	37	6	56483870	56483870	+	Silent	SNP	C	C	T	rs370912424		TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr6:56483870C>T	ENST00000370765.6	-	23	5069	c.4962G>A	c.(4960-4962)gcG>gcA	p.A1654A	DST_ENST00000370769.4_Intron|DST_ENST00000421834.2_Intron|DST_ENST00000370754.5_Intron|DST_ENST00000244364.6_Intron|DST_ENST00000446842.2_Intron|DST_ENST00000370788.2_Intron|DST_ENST00000361203.3_Intron|DST_ENST00000312431.6_Intron	NM_001723.5	NP_001714.1	Q03001	DYST_HUMAN	dystonin	3724					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			TTTGACTTTTCGCCAGGTCTT	0.353													C|||	1	0.000199681	0.0	0.0	5008	,	,		19699	0.0		0.0	False		,,,				2504	0.001															0			6						C	,	0,4406		0,0,2203	117.0	127.0	123.0		4962,	1.3	1.0	6		123	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,intron	DST	NM_001723.5,NM_015548.4	,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,	1654/2650,	56483870	1,13005	2203	4300	6503	56591829	SO:0001819	synonymous_variant	667			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000370765.6:c.4962G>A	6.37:g.56483870C>T			56591829	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Silent	SNP	HMMSmart_SPEC,superfamily_Spectrin,HMMPfam_Spectrin,superfamily_SSF75399,HMMSmart_PLEC,HMMPfam_Plectin	p.A1654	ENST00000370765.6	37	c.4962	CCDS4959.1	6																																																																																			-	NULL		0.353	DST-010	KNOWN	basic|CCDS	protein_coding	DST	protein_coding	OTTHUMT00000041027.2	C	NM_001723		56591829	-1	no_errors	NM_001723	genbank	human	reviewed	54_36p	silent	SNP	0.752	T
VPS13C	54832	genome.wustl.edu	37	15	62257013	62257013	+	Silent	SNP	G	G	A	rs573291312		TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr15:62257013G>A	ENST00000261517.5	-	31	3172	c.3099C>T	c.(3097-3099)gtC>gtT	p.V1033V	VPS13C_ENST00000395898.3_Silent_p.V990V|VPS13C_ENST00000395896.4_Silent_p.V1033V|VPS13C_ENST00000249837.3_Silent_p.V990V	NM_020821.2	NP_065872.1			vacuolar protein sorting 13 homolog C (S. cerevisiae)											NS(3)|breast(4)|endometrium(4)|kidney(9)|large_intestine(26)|lung(46)|ovary(5)|prostate(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	117						TAATAGAAGCGACAAGAGCTT	0.323													G|||	1	0.000199681	0.0008	0.0	5008	,	,		17367	0.0		0.0	False		,,,				2504	0.0															0			15											88.0	92.0	90.0					15																	62257013		2203	4299	6502	60044305	SO:0001819	synonymous_variant	54832			AJ608770	CCDS10180.1, CCDS32257.1, CCDS45272.1, CCDS58367.1	15q21.3	2009-07-09	2006-04-04		ENSG00000129003	ENSG00000129003			23594	protein-coding gene	gene with protein product		608879	"""vacuolar protein sorting 13C (yeast)"""				Standard	NM_018080		Approved	FLJ20136, FLJ10381, KIAA1421	uc002agz.3	Q709C8	OTTHUMG00000132801	ENST00000261517.5:c.3099C>T	15.37:g.62257013G>A			60044305		Silent	SNP	HMMPfam_DUF1162	p.V1033	ENST00000261517.5	37	c.3099	CCDS32257.1	15																																																																																			-	NULL		0.323	VPS13C-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13C	protein_coding	OTTHUMT00000415997.1	G	NM_017684		60044305	-1	no_errors	NM_020821	genbank	human	validated	54_36p	silent	SNP	0.996	A
C1orf87	127795	genome.wustl.edu	37	1	60476083	60476083	+	Missense_Mutation	SNP	C	C	A			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr1:60476083C>A	ENST00000371201.3	-	9	1280	c.1173G>T	c.(1171-1173)ttG>ttT	p.L391F	C1orf87_ENST00000450089.2_Missense_Mutation_p.L162F|C1orf87_ENST00000486478.1_5'Flank|C1orf87_ENST00000395552.1_5'Flank	NM_152377.2	NP_689590.1	Q8N0U7	CA087_HUMAN	chromosome 1 open reading frame 87	391							calcium ion binding (GO:0005509)			breast(2)|endometrium(2)|large_intestine(6)|lung(19)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	33						AATCAGATAACAAATCAGAAG	0.388																																					NSCLC(75;811 1386 4923 13371 51772)											0			1											127.0	126.0	126.0					1																	60476083		2203	4300	6503	60248671	SO:0001583	missense	127795			AK124828	CCDS614.1	1p32.1	2014-04-03			ENSG00000162598	ENSG00000162598			28547	protein-coding gene	gene with protein product	"""carcinoma-related EF-hand protein"""					12477932	Standard	NM_152377		Approved	MGC34837, CREF	uc001czs.2	Q8N0U7	OTTHUMG00000008992	ENST00000371201.3:c.1173G>T	1.37:g.60476083C>A	ENSP00000360244:p.Leu391Phe		60248671	Q6ZU07|Q8IVS0	Missense_Mutation	SNP	superfamily_EF-hand	p.L391F	ENST00000371201.3	37	c.1173	CCDS614.1	1	.	.	.	.	.	.	.	.	.	.	C	8.807	0.934368	0.18206	.	.	ENSG00000162598	ENST00000371201;ENST00000450089	T	0.20332	2.08	4.86	-0.342	0.12635	.	0.459040	0.18474	N	0.140133	T	0.17280	0.0415	L	0.59436	1.845	0.09310	N	1	B	0.22683	0.073	B	0.25884	0.064	T	0.20042	-1.0287	10	0.52906	T	0.07	-1.7869	3.6192	0.08089	0.1676:0.462:0.0:0.3704	.	391	Q8N0U7	CA087_HUMAN	F	391;162	ENSP00000360244:L391F	ENSP00000360244:L391F	L	-	3	2	C1orf87	60248671	0.001000	0.12720	0.005000	0.12908	0.421000	0.31385	0.278000	0.18753	-0.129000	0.11620	0.650000	0.86243	TTG	-	NULL		0.388	C1orf87-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf87	protein_coding	OTTHUMT00000024943.1	C	NM_152377		60248671	-1	no_errors	NM_152377	genbank	human	predicted	54_36p	missense	SNP	0.018	A
CD5	921	genome.wustl.edu	37	11	60889153	60889153	+	Silent	SNP	C	C	A			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr11:60889153C>A	ENST00000347785.3	+	6	1042	c.876C>A	c.(874-876)cgC>cgA	p.R292R		NM_014207.3	NP_055022.2	P06127	CD5_HUMAN	CD5 molecule	292	SRCR 3. {ECO:0000255|PROSITE- ProRule:PRU00196}.				apoptotic signaling pathway (GO:0097190)|cell proliferation (GO:0008283)|cell recognition (GO:0008037)|T cell costimulation (GO:0031295)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|scavenger receptor activity (GO:0005044)|transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(1)|large_intestine(4)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		all_lung(304;5.94e-05)|Lung NSC(402;7.26e-05)		BRCA - Breast invasive adenocarcinoma(625;0.000946)|Lung(977;0.0086)|LUSC - Lung squamous cell carcinoma(625;0.0528)		TGGAGGTGCGCCAGGGGGCTC	0.652																																																0			11											49.0	44.0	46.0					11																	60889153		2203	4299	6502	60645729	SO:0001819	synonymous_variant	921			X04391	CCDS8000.1	11q13	2008-07-18	2006-03-28		ENSG00000110448	ENSG00000110448		"""CD molecules"""	1685	protein-coding gene	gene with protein product		153340	"""CD5 antigen (p56-62)"""	LEU1		1711157	Standard	NM_014207		Approved	T1	uc009ynk.3	P06127	OTTHUMG00000167825	ENST00000347785.3:c.876C>A	11.37:g.60889153C>A			60645729	A0N0P4|A8K9I3	Silent	SNP	superfamily_SRCR-like,HMMSmart_SM00202,HMMPfam_SRCR	p.R292	ENST00000347785.3	37	c.876	CCDS8000.1	11																																																																																			-	superfamily_SRCR-like,HMMSmart_SM00202,HMMPfam_SRCR		0.652	CD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD5	protein_coding	OTTHUMT00000396465.2	C	NM_014207		60645729	+1	no_errors	NM_014207	genbank	human	validated	54_36p	silent	SNP	0.706	A
NLRP5	126206	genome.wustl.edu	37	19	56565058	56565058	+	Silent	SNP	C	C	T			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr19:56565058C>T	ENST00000390649.3	+	13	3183	c.3183C>T	c.(3181-3183)atC>atT	p.I1061I		NM_153447.4	NP_703148.4	P59047	NALP5_HUMAN	NLR family, pyrin domain containing 5	1061					cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|embryo implantation (GO:0007566)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|neuron death (GO:0070997)|organ morphogenesis (GO:0009887)|regulation of protein stability (GO:0031647)|regulation of RNA stability (GO:0043487)	apical cortex (GO:0045179)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|protein complex (GO:0043234)	ATP binding (GO:0005524)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|ovary(5)|skin(2)|stomach(4)|upper_aerodigestive_tract(2)	25		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		CCTGTGTGATCTCGAGGAGCA	0.572																																																0			19											83.0	84.0	84.0					19																	56565058		2097	4218	6315	61256870	SO:0001819	synonymous_variant	126206			AY154460	CCDS12938.1	19q13.43	2008-10-30	2006-12-08	2006-12-08	ENSG00000171487	ENSG00000171487		"""Nucleotide-binding domain and leucine rich repeat containing"""	21269	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 5"""	609658	"""NACHT, leucine rich repeat and PYD containing 5"""	NALP5		12563287, 11925379	Standard	NM_153447		Approved	PYPAF8, MATER, PAN11, CLR19.8	uc002qmj.3	P59047	OTTHUMG00000149887	ENST00000390649.3:c.3183C>T	19.37:g.56565058C>T			61256870	A8MTY4|Q86W29	Silent	SNP	superfamily_DEATH domain,HMMPfam_PAAD_DAPIN,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMPfam_NACHT,superfamily_RNI-like,HMMSmart_SM00368	p.I1042	ENST00000390649.3	37	c.3126	CCDS12938.1	19																																																																																			-	superfamily_RNI-like,HMMSmart_SM00368		0.572	NLRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP5	protein_coding	OTTHUMT00000313735.1	C	NM_153447		61256870	+1	no_errors	NM_153447	genbank	human	reviewed	54_36p	silent	SNP	0.006	T
USP34	9736	genome.wustl.edu	37	2	61633157	61633157	+	Nonsense_Mutation	SNP	G	G	A	rs372597990		TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr2:61633157G>A	ENST00000398571.2	-	3	314	c.238C>T	c.(238-240)Cag>Tag	p.Q80*		NM_014709.3	NP_055524.3	Q70CQ2	UBP34_HUMAN	ubiquitin specific peptidase 34	80					positive regulation of canonical Wnt signaling pathway (GO:0090263)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)		cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			autonomic_ganglia(1)|breast(14)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(52)|ovary(8)|prostate(10)|skin(6)|urinary_tract(2)	138			Epithelial(17;0.229)			TTACAAAGCTGGTCCCGGAGC	0.378																																																0			2											143.0	128.0	132.0					2																	61633157		1869	4113	5982	61486661	SO:0001587	stop_gained	9736			AB011142	CCDS42686.1	2p16.1-p15	2005-08-08	2005-08-08		ENSG00000115464	ENSG00000115464		"""Ubiquitin-specific peptidases"""	20066	protein-coding gene	gene with protein product		615295	"""ubiquitin specific protease 34"""			12838346	Standard	NM_014709		Approved	KIAA0570, KIAA0729	uc002sbe.3	Q70CQ2	OTTHUMG00000152265	ENST00000398571.2:c.238C>T	2.37:g.61633157G>A	ENSP00000381577:p.Gln80*		61486661	A8MWD0|B3KWU9|O60316|O94834|Q3B777|Q6P6C9|Q7L8P6|Q8N3T9|Q8TBW2|Q9UGA1	Nonsense_Mutation	SNP	superfamily_Cysteine proteinases,HMMPfam_UCH,PatternScan_UCH_2_1,PatternScan_UCH_2_2	p.Q80*	ENST00000398571.2	37	c.238	CCDS42686.1	2	.	.	.	.	.	.	.	.	.	.	G	36	5.625825	0.96671	.	.	ENSG00000115464	ENST00000398571	.	.	.	6.07	6.07	0.98685	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	20.6593	0.99626	0.0:0.0:1.0:0.0	.	.	.	.	X	80	.	ENSP00000381577:Q80X	Q	-	1	0	USP34	61486661	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.350000	0.79385	2.885000	0.99019	0.655000	0.94253	CAG	-	NULL		0.378	USP34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP34	protein_coding	OTTHUMT00000325650.4	G			61486661	-1	no_errors	NM_014709	genbank	human	validated	54_36p	nonsense	SNP	1.000	A
HERC1	8925	genome.wustl.edu	37	15	64045211	64045211	+	Missense_Mutation	SNP	A	A	C			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr15:64045211A>C	ENST00000443617.2	-	8	1935	c.1848T>G	c.(1846-1848)atT>atG	p.I616M		NM_003922.3	NP_003913.3	Q15751	HERC1_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 1	616					cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of autophagy (GO:0010507)|neuromuscular process controlling balance (GO:0050885)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|transport (GO:0006810)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(3)|breast(9)|central_nervous_system(4)|endometrium(23)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(22)|liver(1)|lung(36)|ovary(7)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	132						AAACTTTGCGAATGAACATTC	0.373																																																0			15											99.0	95.0	96.0					15																	64045211		1861	4097	5958	61832264	SO:0001583	missense	8925			U50078	CCDS45277.1	15q22	2013-01-10	2012-02-23			ENSG00000103657		"""WD repeat domain containing"""	4867	protein-coding gene	gene with protein product		605109	"""hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1"""			8861955, 9233772	Standard	NM_003922		Approved	p532, p619	uc002amp.3	Q15751		ENST00000443617.2:c.1848T>G	15.37:g.64045211A>C	ENSP00000390158:p.Ile616Met		61832264	Q8IW65	Missense_Mutation	SNP	superfamily_RCC1/BLIP-II,HMMPfam_RCC1,PatternScan_RCC1_2,HMMSmart_SM00449,HMMPfam_SPRY,PatternScan_PHOSPHOPANTETHEINE,HMMSmart_SM00320,HMMPfam_WD40,superfamily_WD40 repeat-like,PatternScan_WD_REPEATS_1,PatternScan_ARGINASE_2,superfamily_Hect E3 ligase catalytic domain,HMMSmart_SM00119,HMMPfam_HECT	p.I616M	ENST00000443617.2	37	c.1848	CCDS45277.1	15	.	.	.	.	.	.	.	.	.	.	A	18.79	3.698756	0.68501	.	.	ENSG00000103657	ENST00000443617	D	0.86694	-2.16	5.41	3.06	0.35304	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.067685	0.56097	U	0.000024	D	0.87509	0.6195	M	0.77712	2.385	0.40184	D	0.977322	B;P	0.36438	0.41;0.553	B;P	0.44921	0.362;0.464	D	0.83833	0.0253	10	0.49607	T	0.09	.	5.4805	0.16721	0.7293:0.0:0.1413:0.1294	.	616;616	C9JUT5;Q15751	.;HERC1_HUMAN	M	616	ENSP00000390158:I616M	ENSP00000390158:I616M	I	-	3	3	HERC1	61832264	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.902000	0.48703	0.428000	0.26173	0.528000	0.53228	ATT	-	superfamily_RCC1/BLIP-II		0.373	HERC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HERC1	protein_coding	OTTHUMT00000418523.1	A	NM_003922		61832264	-1	no_errors	NM_003922	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
L1TD1	54596	genome.wustl.edu	37	1	62676583	62676583	+	Missense_Mutation	SNP	T	T	G			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr1:62676583T>G	ENST00000498273.1	+	4	2432	c.2137T>G	c.(2137-2139)Tat>Gat	p.Y713D	Y_RNA_ENST00000363304.1_RNA	NM_001164835.1|NM_019079.4	NP_001158307.1|NP_061952.3	Q5T7N2	LITD1_HUMAN	LINE-1 type transposase domain containing 1	713										breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	35						aaaggagagttatgagaatag	0.348																																																0			1											30.0	32.0	31.0					1																	62676583		1646	2925	4571	62449171	SO:0001583	missense	54596			BC060808	CCDS619.1	1p31.3	2009-01-12			ENSG00000240563	ENSG00000240563			25595	protein-coding gene	gene with protein product						12477932	Standard	NM_001164835		Approved	FLJ10884, ECAT11	uc001dae.4	Q5T7N2	OTTHUMG00000008914	ENST00000498273.1:c.2137T>G	1.37:g.62676583T>G	ENSP00000419901:p.Tyr713Asp		62449171	Q8NDA1|Q9NUV8|Q9NV78	Missense_Mutation	SNP	HMMPfam_Transposase_22	p.Y713D	ENST00000498273.1	37	c.2137	CCDS619.1	1	.	.	.	.	.	.	.	.	.	.	T	8.559	0.877337	0.17395	.	.	ENSG00000240563	ENST00000498273	T	0.12984	2.63	2.86	-3.2	0.05156	.	.	.	.	.	T	0.04861	0.0131	N	0.08118	0	0.09310	N	1	B	0.20550	0.046	B	0.06405	0.002	T	0.36720	-0.9736	9	0.34782	T	0.22	.	1.8501	0.03167	0.256:0.4601:0.1294:0.1545	.	713	Q5T7N2	LITD1_HUMAN	D	713	ENSP00000419901:Y713D	ENSP00000419901:Y713D	Y	+	1	0	L1TD1	62449171	0.000000	0.05858	0.000000	0.03702	0.031000	0.12232	-0.704000	0.05058	-0.571000	0.06014	-0.947000	0.02670	TAT	-	HMMPfam_Transposase_22		0.348	L1TD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	L1TD1	protein_coding	OTTHUMT00000024688.1	T	NM_019079		62449171	+1	no_errors	NM_019079	genbank	human	validated	54_36p	missense	SNP	0.000	G
L1TD1	54596	genome.wustl.edu	37	1	62676992	62676992	+	Missense_Mutation	SNP	A	A	G			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr1:62676992A>G	ENST00000498273.1	+	4	2841	c.2546A>G	c.(2545-2547)tAt>tGt	p.Y849C	Y_RNA_ENST00000363304.1_RNA	NM_001164835.1|NM_019079.4	NP_001158307.1|NP_061952.3	Q5T7N2	LITD1_HUMAN	LINE-1 type transposase domain containing 1	849										breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	35						tttagagattatgttttgcat	0.378																																																0			1											35.0	36.0	36.0					1																	62676992		2197	4297	6494	62449580	SO:0001583	missense	54596			BC060808	CCDS619.1	1p31.3	2009-01-12			ENSG00000240563	ENSG00000240563			25595	protein-coding gene	gene with protein product						12477932	Standard	NM_001164835		Approved	FLJ10884, ECAT11	uc001dae.4	Q5T7N2	OTTHUMG00000008914	ENST00000498273.1:c.2546A>G	1.37:g.62676992A>G	ENSP00000419901:p.Tyr849Cys		62449580	Q8NDA1|Q9NUV8|Q9NV78	Missense_Mutation	SNP	HMMPfam_Transposase_22	p.Y849C	ENST00000498273.1	37	c.2546	CCDS619.1	1	.	.	.	.	.	.	.	.	.	.	A	8.224	0.803065	0.16397	.	.	ENSG00000240563	ENST00000498273	T	0.21361	2.01	2.67	1.5	0.22942	.	.	.	.	.	T	0.28134	0.0694	L	0.29908	0.895	0.09310	N	1	D	0.62365	0.991	D	0.74674	0.984	T	0.08827	-1.0703	9	0.87932	D	0	.	4.805	0.13316	0.2974:0.0:0.0:0.7026	.	849	Q5T7N2	LITD1_HUMAN	C	849	ENSP00000419901:Y849C	ENSP00000419901:Y849C	Y	+	2	0	L1TD1	62449580	0.010000	0.17322	0.005000	0.12908	0.094000	0.18550	0.336000	0.19823	0.444000	0.26612	0.254000	0.18369	TAT	-	HMMPfam_Transposase_22		0.378	L1TD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	L1TD1	protein_coding	OTTHUMT00000024688.1	A	NM_019079		62449580	+1	no_errors	NM_019079	genbank	human	validated	54_36p	missense	SNP	0.001	G
CDH11	1009	genome.wustl.edu	37	16	65005544	65005544	+	Missense_Mutation	SNP	A	A	C			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr16:65005544A>C	ENST00000268603.4	-	11	2195	c.1580T>G	c.(1579-1581)tTt>tGt	p.F527C	CDH11_ENST00000566827.1_Missense_Mutation_p.F401C|CDH11_ENST00000394156.3_Missense_Mutation_p.F527C	NM_001797.2	NP_001788.2	P55287	CAD11_HUMAN	cadherin 11, type 2, OB-cadherin (osteoblast)	527	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|corticospinal tract morphogenesis (GO:0021957)|homophilic cell adhesion (GO:0007156)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(19)|lung(40)|ovary(3)|prostate(3)|skin(2)|urinary_tract(2)	88		Ovarian(137;0.0973)		OV - Ovarian serous cystadenocarcinoma(108;0.205)		GCTGAAGATAAATCTTGGTCC	0.423			T	USP6	aneurysmal bone cysts					TSP Lung(24;0.17)																													Dom	yes		16	16q22.1	1009	"""cadherin 11, type 2, OB-cadherin (osteoblast)"""		M	0			16											133.0	125.0	128.0					16																	65005544		2203	4300	6503	63563045	SO:0001583	missense	1009			D21255	CCDS10803.1	16q21	2010-01-26			ENSG00000140937	ENSG00000140937		"""Cadherins / Major cadherins"""	1750	protein-coding gene	gene with protein product	"""OB-Cadherin"""	600023				9615235	Standard	NM_001797		Approved	OB, CAD11	uc002eoi.3	P55287	OTTHUMG00000137494	ENST00000268603.4:c.1580T>G	16.37:g.65005544A>C	ENSP00000268603:p.Phe527Cys		63563045	A8K5D6|A8MZC8|B7WP28|Q15065|Q15066|Q9UQ93|Q9UQ94	Missense_Mutation	SNP	superfamily_Cadherin-like,HMMPfam_Cadherin,HMMSmart_SM00112,PatternScan_CADHERIN_1,HMMPfam_Cadherin_C	p.F527C	ENST00000268603.4	37	c.1580	CCDS10803.1	16	.	.	.	.	.	.	.	.	.	.	A	21.7	4.182129	0.78677	.	.	ENSG00000140937	ENST00000268603;ENST00000394156;ENST00000538390	T;T	0.62639	2.04;0.01	5.88	5.88	0.94601	Cadherin (3);Cadherin-like (1);	0.000000	0.85682	D	0.000000	D	0.85265	0.5657	H	0.95043	3.615	0.80722	D	1	D;D	0.89917	1.0;0.987	D;P	0.87578	0.998;0.75	D	0.89600	0.3834	10	0.87932	D	0	.	15.4635	0.75381	1.0:0.0:0.0:0.0	.	527;527	P55287-2;P55287	.;CAD11_HUMAN	C	527;527;510	ENSP00000268603:F527C;ENSP00000377711:F527C	ENSP00000268603:F527C	F	-	2	0	CDH11	63563045	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.896000	0.92521	2.250000	0.74265	0.533000	0.62120	TTT	-	superfamily_Cadherin-like,HMMPfam_Cadherin,HMMSmart_SM00112		0.423	CDH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH11	protein_coding	OTTHUMT00000268755.1	A	NM_033664		63563045	-1	no_errors	NM_001797	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
KCTD19	146212	genome.wustl.edu	37	16	67354661	67354661	+	Nonsense_Mutation	SNP	G	G	C			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr16:67354661G>C	ENST00000304372.5	-	2	186	c.131C>G	c.(130-132)tCa>tGa	p.S44*	RN7SKP118_ENST00000364331.1_RNA|KCTD19_ENST00000562860.1_5'UTR	NM_001100915.1	NP_001094385.1	Q17RG1	KCD19_HUMAN	potassium channel tetramerization domain containing 19	44	BTB 1.				protein homooligomerization (GO:0051260)					endometrium(3)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(3)	23		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0311)|Epithelial(162;0.0906)		GGTCAAGGCTGAAGCCTCTTT	0.488																																																0			16											92.0	89.0	90.0					16																	67354661		1912	4126	6038	65912162	SO:0001587	stop_gained	146212			AK097481	CCDS42179.1	16q22.1	2013-06-20	2013-06-20			ENSG00000168676			24753	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 19"""				Standard	NM_001100915		Approved	FLJ40162	uc002esu.2	Q17RG1		ENST00000304372.5:c.131C>G	16.37:g.67354661G>C	ENSP00000305702:p.Ser44*		65912162	B4DZ49|Q8N804	Nonsense_Mutation	SNP	superfamily_BTB/POZ_fold,HMMPfam_K_tetra	p.S44*	ENST00000304372.5	37	c.131	CCDS42179.1	16	.	.	.	.	.	.	.	.	.	.	G	27.4	4.831342	0.91036	.	.	ENSG00000168676	ENST00000304372	.	.	.	6.08	4.06	0.47325	.	0.407531	0.21013	N	0.081646	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	-2.0406	9.0387	0.36305	0.1822:0.0:0.8178:0.0	.	.	.	.	X	44	.	ENSP00000305702:S44X	S	-	2	0	KCTD19	65912162	1.000000	0.71417	0.942000	0.38095	0.994000	0.84299	2.918000	0.48829	0.811000	0.34303	0.591000	0.81541	TCA	-	superfamily_BTB/POZ_fold,HMMPfam_K_tetra		0.488	KCTD19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCTD19	protein_coding	OTTHUMT00000422061.1	G	XM_085367		65912162	-1	no_errors	NM_001100915	genbank	human	provisional	54_36p	nonsense	SNP	0.508	C
LRIG1	26018	genome.wustl.edu	37	3	66431106	66431106	+	Missense_Mutation	SNP	C	C	A	rs375774171		TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr3:66431106C>A	ENST00000273261.3	-	18	3474	c.2950G>T	c.(2950-2952)Gcc>Tcc	p.A984S	LRIG1_ENST00000496559.2_5'UTR|LRIG1_ENST00000383703.3_Missense_Mutation_p.A961S|SLC25A26_ENST00000536651.1_3'UTR	NM_015541.2	NP_056356.2	Q96JA1	LRIG1_HUMAN	leucine-rich repeats and immunoglobulin-like domains 1	984					innervation (GO:0060384)|otolith morphogenesis (GO:0032474)|sensory perception of sound (GO:0007605)	integral component of membrane (GO:0016021)				NS(2)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|prostate(1)|skin(4)|stomach(4)|urinary_tract(1)	42		Lung NSC(201;0.0101)		BRCA - Breast invasive adenocarcinoma(55;0.00047)		GACCCAGCGGCAGTCCTGCTG	0.597																																																0			3											96.0	101.0	99.0					3																	66431106		2203	4300	6503	66513796	SO:0001583	missense	26018			AB050468	CCDS33783.1	3p14	2013-01-14			ENSG00000144749	ENSG00000144749		"""Immunoglobulin superfamily / I-set domain containing"""	17360	protein-coding gene	gene with protein product	"""ortholog of mouse integral membrane glycoprotein LIG-1"", ""leucine-rich repeat protein LRIG1"""	608868				11414704, 12234026	Standard	NM_015541		Approved	LIG-1, DKFZP586O1624, LIG1	uc003dmx.3	Q96JA1	OTTHUMG00000158727	ENST00000273261.3:c.2950G>T	3.37:g.66431106C>A	ENSP00000273261:p.Ala984Ser		66513796	Q6IQ51|Q96CF9|Q9BYB8|Q9UFI4	Missense_Mutation	SNP	HMMPfam_LRRNT,HMMSmart_SM00013,superfamily_L domain-like,HMMSmart_SM00369,HMMPfam_LRR_1,HMMSmart_SM00365,HMMSmart_SM00082,HMMPfam_LRRCT,HMMPfam_I-set,superfamily_Immunoglobulin,HMMSmart_SM00409,HMMSmart_SM00408	p.A984S	ENST00000273261.3	37	c.2950	CCDS33783.1	3	.	.	.	.	.	.	.	.	.	.	C	6.071	0.381347	0.11466	.	.	ENSG00000144749	ENST00000273261;ENST00000383703;ENST00000383702	T;T	0.63913	-0.07;-0.05	5.64	-3.43	0.04810	.	2.258740	0.01906	N	0.039501	T	0.37073	0.0990	N	0.19112	0.55	0.09310	N	1	B;B;B	0.12013	0.004;0.005;0.001	B;B;B	0.08055	0.003;0.003;0.001	T	0.25328	-1.0135	10	0.05959	T	0.93	.	1.8218	0.03112	0.1883:0.4015:0.2098:0.2004	.	961;984;984	Q96JA1-2;Q5XWD3;Q96JA1	.;.;LRIG1_HUMAN	S	984;961;887	ENSP00000273261:A984S;ENSP00000373208:A961S	ENSP00000273261:A984S	A	-	1	0	LRIG1	66513796	0.000000	0.05858	0.000000	0.03702	0.049000	0.14656	-0.413000	0.07123	-0.501000	0.06605	0.650000	0.86243	GCC	-	NULL		0.597	LRIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRIG1	protein_coding	OTTHUMT00000351930.1	C	NM_015541		66513796	-1	no_errors	NM_015541	genbank	human	validated	54_36p	missense	SNP	0.000	A
TANGO6	79613	genome.wustl.edu	37	16	68961577	68961577	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr16:68961577G>A	ENST00000261778.1	+	13	2246	c.2234G>A	c.(2233-2235)cGc>cAc	p.R745H	RP11-521L9.1_ENST00000562790.1_lincRNA	NM_024562.1	NP_078838.1	Q9C0B7	TNG6_HUMAN	transport and golgi organization 6 homolog (Drosophila)	745						integral component of membrane (GO:0016021)											GTTGATCTCCGCATCACCATC	0.488																																																0			16											156.0	155.0	155.0					16																	68961577		2059	4228	6287	67519078	SO:0001583	missense	79613				CCDS45516.1	16q22.1	2012-12-13	2012-12-13	2012-12-13	ENSG00000103047	ENSG00000103047			25749	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 7"""	TMCO7		11214970	Standard	NM_024562		Approved	FLJ12688, KIAA1746	uc002ewi.4	Q9C0B7	OTTHUMG00000176743	ENST00000261778.1:c.2234G>A	16.37:g.68961577G>A	ENSP00000261778:p.Arg745His		67519078	Q569F9|Q9H9K1	Missense_Mutation	SNP	superfamily_ARM repeat,HMMPfam_DUF2435,HMMPfam_HEAT,HMMPfam_DUF2411	p.R745H	ENST00000261778.1	37	c.2234	CCDS45516.1	16	.	.	.	.	.	.	.	.	.	.	G	32	5.146787	0.94603	.	.	ENSG00000103047	ENST00000261778	T	0.64991	-0.13	5.37	5.37	0.77165	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.76528	0.4000	M	0.72894	2.215	0.58432	D	0.999996	D	0.89917	1.0	D	0.69142	0.962	T	0.71497	-0.4575	10	0.15952	T	0.53	-2.2007	18.6945	0.91596	0.0:0.0:1.0:0.0	.	745	Q9C0B7	TMCO7_HUMAN	H	745	ENSP00000261778:R745H	ENSP00000261778:R745H	R	+	2	0	TMCO7	67519078	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	4.219000	0.58561	2.512000	0.84698	0.655000	0.94253	CGC	-	superfamily_ARM repeat,HMMPfam_DUF2435		0.488	TANGO6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMCO7	protein_coding	OTTHUMT00000433471.2	G	XM_928235.2		67519078	+1	no_errors	NM_024562	genbank	human	validated	54_36p	missense	SNP	1.000	A
PPP6R3	55291	genome.wustl.edu	37	11	68367848	68367848	+	Missense_Mutation	SNP	C	C	G			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr11:68367848C>G	ENST00000393800.2	+	20	2332	c.2078C>G	c.(2077-2079)aCa>aGa	p.T693R	PPP6R3_ENST00000393799.2_Missense_Mutation_p.T693R|PPP6R3_ENST00000393801.3_Missense_Mutation_p.T693R|PPP6R3_ENST00000527403.2_Missense_Mutation_p.T658R|PPP6R3_ENST00000529710.1_Missense_Mutation_p.T613R|PPP6R3_ENST00000534534.1_Missense_Mutation_p.T461R|PPP6R3_ENST00000524904.1_Missense_Mutation_p.T687R|PPP6R3_ENST00000265636.5_Missense_Mutation_p.T613R|PPP6R3_ENST00000265637.4_Missense_Mutation_p.T647R|PPP6R3_ENST00000524845.1_Missense_Mutation_p.T664R	NM_001164161.1|NM_001164162.1|NM_001164163.1	NP_001157633.1|NP_001157634.1|NP_001157635.1	Q5H9R7	PP6R3_HUMAN	protein phosphatase 6, regulatory subunit 3	693					regulation of phosphoprotein phosphatase activity (GO:0043666)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein phosphatase binding (GO:0019903)			breast(2)|endometrium(6)|kidney(3)|large_intestine(10)|liver(2)|lung(9)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37						CCAATGGAAACAACCCACGGT	0.473																																																0			11											115.0	111.0	112.0					11																	68367848		2200	4294	6494	68124424	SO:0001583	missense	55291			AF264779	CCDS8182.1, CCDS53671.1, CCDS53672.1, CCDS53673.1, CCDS53674.1, CCDS53675.1	11q13	2012-04-17	2010-06-28	2010-06-28	ENSG00000110075	ENSG00000110075		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"""	1173	protein-coding gene	gene with protein product	"""sporulation-induced transcript 4-associated protein"""	610879	"""chromosome 11 open reading frame 23"", ""SAPS domain family, member 3"""	C11orf23, SAPS3		11401438, 16769727	Standard	NM_018312		Approved	SAPLa, DKFZp781E2374, DKFZp781O2362, DKFZp781E17107, SAP190, SAPL, PP6R3, FLJ11058, FLJ43065, KIAA1558, MGC125711, MGC125712	uc001onv.3	Q5H9R7		ENST00000393800.2:c.2078C>G	11.37:g.68367848C>G	ENSP00000377389:p.Thr693Arg		68124424	Q3B7I1|Q3I4Y0|Q3KR35|Q68CR3|Q7L4R8|Q8N3B2|Q96MB2|Q9H2K5|Q9H2K6|Q9HCL4|Q9NUY3	Missense_Mutation	SNP	HMMPfam_SAPS	p.T613R	ENST00000393800.2	37	c.1838	CCDS53672.1	11	.	.	.	.	.	.	.	.	.	.	C	16.19	3.051764	0.55218	.	.	ENSG00000110075	ENST00000393799;ENST00000393800;ENST00000534534;ENST00000524845;ENST00000265637;ENST00000524904;ENST00000393801;ENST00000265636;ENST00000529710;ENST00000527403;ENST00000534190	T;T;T;T;T;T;T;T;T;T;T	0.54675	0.56;0.56;0.56;0.56;0.56;0.56;0.56;0.56;0.56;0.56;0.56	5.45	5.45	0.79879	.	0.050331	0.85682	D	0.000000	T	0.63379	0.2506	L	0.29908	0.895	0.58432	D	0.999999	D;P;D;D;D;D;D;D	0.89917	1.0;0.745;0.981;0.997;0.981;0.968;1.0;0.981	D;B;P;D;P;P;D;P	0.91635	0.999;0.224;0.872;0.931;0.872;0.749;0.999;0.817	T	0.60840	-0.7183	10	0.35671	T	0.21	.	19.3058	0.94163	0.0:1.0:0.0:0.0	.	376;461;613;664;687;693;693;613	B4DYU6;E9PQP7;Q5H9R7-3;Q5H9R7-6;Q5H9R7-2;Q5H9R7;Q5H9R7-5;Q5H9R7-4	.;.;.;.;.;PP6R3_HUMAN;.;.	R	693;693;461;664;647;687;693;613;613;658;400	ENSP00000377388:T693R;ENSP00000377389:T693R;ENSP00000434429:T461R;ENSP00000431415:T664R;ENSP00000265637:T647R;ENSP00000433058:T687R;ENSP00000377390:T693R;ENSP00000265636:T613R;ENSP00000437329:T613R;ENSP00000433565:T658R;ENSP00000436209:T400R	ENSP00000265636:T613R	T	+	2	0	PPP6R3	68124424	1.000000	0.71417	0.918000	0.36340	0.084000	0.17831	5.628000	0.67791	2.558000	0.86282	0.655000	0.94253	ACA	-	NULL		0.473	PPP6R3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SAPS3	protein_coding	OTTHUMT00000395275.1	C	NM_018312		68124424	+1	no_errors	NM_018312	genbank	human	validated	54_36p	missense	SNP	0.973	G
HYDIN	54768	genome.wustl.edu	37	16	70926290	70926290	+	Missense_Mutation	SNP	C	C	T	rs375151457		TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr16:70926290C>T	ENST00000393567.2	-	56	9541	c.9391G>A	c.(9391-9393)Gag>Aag	p.E3131K		NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	3131					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				GGCTGGTGCTCAATCTTCACT	0.483																																																0			16											74.0	85.0	81.0					16																	70926290		1859	4089	5948	69483791	SO:0001583	missense	54768			AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.9391G>A	16.37:g.70926290C>T	ENSP00000377197:p.Glu3131Lys		69483791	A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	superfamily_PapD-like,superfamily_P-loop containing nucleoside triphosphate hydrolases	p.E3130K	ENST00000393567.2	37	c.9388	CCDS59269.1	16	.	.	.	.	.	.	.	.	.	.	C	6.272	0.418378	0.11870	.	.	ENSG00000157423	ENST00000393567;ENST00000316490	T	0.00730	5.77	4.85	4.85	0.62838	.	0.488214	0.14653	U	0.306497	T	0.00580	0.0019	N	0.12502	0.225	0.22675	N	0.998866	B	0.19935	0.04	B	0.25405	0.06	T	0.43798	-0.9369	10	0.02654	T	1	.	10.7514	0.46211	0.0:0.9089:0.0:0.0911	.	3130	F8WD23	.	K	3131;3130	ENSP00000377197:E3131K	ENSP00000313052:E3130K	E	-	1	0	HYDIN	69483791	0.751000	0.28327	0.691000	0.30163	0.794000	0.44872	2.894000	0.48640	2.244000	0.73946	0.430000	0.28490	GAG	-	NULL		0.483	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	HYDIN	protein_coding	OTTHUMT00000398624.3	C			69483791	-1	no_errors	NM_032821	genbank	human	validated	54_36p	missense	SNP	0.039	T
ST6GALNAC1	55808	genome.wustl.edu	37	17	74625437	74625437	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr17:74625437G>A	ENST00000156626.7	-	2	687	c.488C>T	c.(487-489)aCg>aTg	p.T163M	ST6GALNAC1_ENST00000590878.1_5'UTR	NM_018414.3	NP_060884.1	Q9NSC7	SIA7A_HUMAN	ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 1	163					oligosaccharide biosynthetic process (GO:0009312)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	alpha-N-acetylgalactosaminide alpha-2,6-sialyltransferase activity (GO:0001665)|sialyltransferase activity (GO:0008373)			breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(11)|prostate(1)|upper_aerodigestive_tract(1)	22						TCCTTGGGTCGTCTTTGTGTC	0.577																																																0			17											183.0	161.0	169.0					17																	74625437		2203	4300	6503	72137032	SO:0001583	missense	55808			Y11339	CCDS11748.1	17q25.3	2013-03-01	2005-02-07	2005-02-07	ENSG00000070526	ENSG00000070526		"""Sialyltransferases"""	23614	protein-coding gene	gene with protein product		610138	"""sialyltransferase 7 ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltransferase) A"""	SIAT7A			Standard	NM_001289107		Approved	ST6GalNAcI	uc002jsh.3	Q9NSC7	OTTHUMG00000180369	ENST00000156626.7:c.488C>T	17.37:g.74625437G>A	ENSP00000156626:p.Thr163Met		72137032	Q6UW90|Q9NSC6	Missense_Mutation	SNP	HMMPfam_Glyco_transf_29	p.T163M	ENST00000156626.7	37	c.488	CCDS11748.1	17	.	.	.	.	.	.	.	.	.	.	G	4.683	0.126979	0.08931	.	.	ENSG00000070526	ENST00000156626;ENST00000359088	T;T	0.23754	1.91;1.89	3.53	-2.1	0.07210	.	1.598150	0.03343	N	0.194990	T	0.10252	0.0251	N	0.11201	0.11	0.09310	N	1	B	0.31752	0.338	B	0.14023	0.01	T	0.10019	-1.0648	10	0.30854	T	0.27	-1.8425	1.7992	0.03068	0.4498:0.1351:0.2776:0.1375	.	163	Q9NSC7	SIA7A_HUMAN	M	163	ENSP00000156626:T163M;ENSP00000351991:T163M	ENSP00000156626:T163M	T	-	2	0	ST6GALNAC1	72137032	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.563000	0.05943	-0.358000	0.08162	-0.658000	0.03865	ACG	-	NULL		0.577	ST6GALNAC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ST6GALNAC1	protein_coding	OTTHUMT00000450974.1	G	NM_018414		72137032	-1	no_errors	NM_018414	genbank	human	validated	54_36p	missense	SNP	0.001	A
GLG1	2734	genome.wustl.edu	37	16	74502931	74502931	+	Silent	SNP	G	G	A			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr16:74502931G>A	ENST00000422840.2	-	17	2348	c.2349C>T	c.(2347-2349)acC>acT	p.T783T	GLG1_ENST00000205061.5_Silent_p.T783T|GLG1_ENST00000447066.2_Silent_p.T772T	NM_001145667.1	NP_001139139.1	Q92896	GSLG1_HUMAN	golgi glycoprotein 1	783					blood coagulation (GO:0007596)|bone morphogenesis (GO:0060349)|leukocyte migration (GO:0050900)|negative regulation of protein processing (GO:0010955)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|regulation of chondrocyte differentiation (GO:0032330)	extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			breast(2)|cervix(2)|endometrium(6)|kidney(8)|large_intestine(6)|lung(28)|ovary(3)|prostate(1)|skin(1)	57						CATTGCGCACGGTCGTGCTCA	0.622																																																0			16											63.0	55.0	58.0					16																	74502931		2198	4300	6498	73060432	SO:0001819	synonymous_variant	2734				CCDS32485.1, CCDS45526.1, CCDS45527.1	16q22-q23	2010-02-12	2010-02-12			ENSG00000090863			4316	protein-coding gene	gene with protein product		600753	"""golgi apparatus protein 1"""			8530051, 7531823	Standard	NM_012201		Approved	MG-160, ESL-1, CFR-1	uc002fcx.3	Q92896		ENST00000422840.2:c.2349C>T	16.37:g.74502931G>A			73060432	B7Z8Y4|D3DUJ7|Q13221|Q6P9D1	Silent	SNP	HMMPfam_Cys_rich_FGFR	p.T783	ENST00000422840.2	37	c.2349	CCDS45527.1	16																																																																																			-	HMMPfam_Cys_rich_FGFR		0.622	GLG1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	GLG1	protein_coding	OTTHUMT00000435750.1	G	NM_012201		73060432	-1	no_errors	NM_012201	genbank	human	validated	54_36p	silent	SNP	0.300	A
Unknown	0	genome.wustl.edu	37	12	77054454	77054454	+	IGR	SNP	T	T	C			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr12:77054454T>C								RP11-20E24.1 (45243 upstream) : ZDHHC17 (102913 downstream)																							AGAGAATTAATGTGCGTATTG	0.398																																																0			12																																								75578585	SO:0001628	intergenic_variant	653079																															12.37:g.77054454T>C			75578585		RNA	SNP	-	NULL		37	NULL		12																																																																																			-	-	0	0.398					LOC653079			T			75578585	+1	pseudogene	XR_016115	genbank	human	model	54_36p	rna	SNP	1.000	C
ZDHHC17	23390	genome.wustl.edu	37	12	77244680	77244680	+	Missense_Mutation	SNP	T	T	C			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr12:77244680T>C	ENST00000426126.2	+	17	2463	c.1814T>C	c.(1813-1815)cTc>cCc	p.L605P	ZDHHC17_ENST00000334822.5_Missense_Mutation_p.L605P	NM_015336.2	NP_056151.2	Q8IUH5	ZDH17_HUMAN	zinc finger, DHHC-type containing 17	605					lipoprotein transport (GO:0042953)|magnesium ion transport (GO:0015693)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein palmitoylation (GO:0018345)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi-associated vesicle membrane (GO:0030660)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	identical protein binding (GO:0042802)|magnesium ion transmembrane transporter activity (GO:0015095)|palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|signal transducer activity (GO:0004871)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|large_intestine(3)|liver(2)|lung(14)	23						TGCTGTGGCCTCTTTCGTCCT	0.413																																																0			12											153.0	153.0	153.0					12																	77244680		1914	4125	6039	75768811	SO:0001583	missense	23390			AB023163	CCDS44946.1	12q21.2	2013-01-10				ENSG00000186908		"""Zinc fingers, DHHC-type"", ""Ankyrin repeat domain containing"""	18412	protein-coding gene	gene with protein product		607799				9700202, 18794299	Standard	NM_015336		Approved	HIP14, HYPH, KIAA0946	uc001syk.1	Q8IUH5	OTTHUMG00000169917	ENST00000426126.2:c.1814T>C	12.37:g.77244680T>C	ENSP00000403397:p.Leu605Pro		75768811	B4DR39|O75407|Q7Z2I0|Q86W89|Q86YK0|Q9P088|Q9UPZ8	Missense_Mutation	SNP	superfamily_Ankyrin repeat,HMMSmart_SM00248,HMMPfam_Ank,HMMPfam_zf-DHHC	p.L605P	ENST00000426126.2	37	c.1814	CCDS44946.1	12	.	.	.	.	.	.	.	.	.	.	T	17.22	3.334148	0.60853	.	.	ENSG00000186908	ENST00000426126;ENST00000334822	T;T	0.36340	1.26;1.26	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	T	0.57533	0.2060	M	0.62723	1.935	0.80722	D	1	D	0.76494	0.999	D	0.72982	0.979	T	0.61412	-0.7068	10	0.87932	D	0	-7.5927	15.3882	0.74718	0.0:0.0:0.0:1.0	.	605	Q8IUH5	ZDH17_HUMAN	P	605	ENSP00000403397:L605P;ENSP00000334868:L605P	ENSP00000334868:L605P	L	+	2	0	ZDHHC17	75768811	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.841000	0.86834	2.044000	0.60594	0.460000	0.39030	CTC	-	NULL		0.413	ZDHHC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDHHC17	protein_coding	OTTHUMT00000406555.1	T	NM_015336		75768811	+1	no_errors	NM_015336	genbank	human	validated	54_36p	missense	SNP	1.000	C
NAA11	84779	genome.wustl.edu	37	4	80246487	80246487	+	Missense_Mutation	SNP	C	C	T	rs529712269		TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr4:80246487C>T	ENST00000286794.4	-	1	717	c.545G>A	c.(544-546)gGc>gAc	p.G182D	NAA11_ENST00000513733.1_5'UTR	NM_032693.2	NP_116082.1	Q9BSU3	NAA11_HUMAN	N(alpha)-acetyltransferase 11, NatA catalytic subunit	182					N-terminal protein amino acid acetylation (GO:0006474)	NatA complex (GO:0031415)|nucleus (GO:0005634)	peptide alpha-N-acetyltransferase activity (GO:0004596)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(4)|lung(9)|ovary(1)|pancreas(1)|skin(2)	23						AAGTGTGCTGCCCTGGGTCTC	0.557													C|||	1	0.000199681	0.0	0.0	5008	,	,		19716	0.0		0.0	False		,,,				2504	0.001															0			4											53.0	54.0	54.0					4																	80246487		1953	4147	6100	80465511	SO:0001583	missense	84779				CCDS47084.1	4q21.23	2010-05-07	2010-01-14	2010-01-14		ENSG00000156269	2.3.1.88	"""N(alpha)-acetyltransferase subunits"""	28125	protein-coding gene	gene with protein product			"""ARD1 homolog B (S. cerevisiae)"""	ARD1B		16638120, 19660095	Standard	NM_032693		Approved	ARD2, hARD2	uc003hlt.4	Q9BSU3		ENST00000286794.4:c.545G>A	4.37:g.80246487C>T	ENSP00000286794:p.Gly182Asp		80465511	Q66K19|Q6P479	Missense_Mutation	SNP	superfamily_Acyl_CoA_acyltransferase,HMMPfam_Acetyltransf_1	p.G182D	ENST00000286794.4	37	c.545	CCDS47084.1	4	.	.	.	.	.	.	.	.	.	.	C	10.82	1.458200	0.26161	.	.	ENSG00000156269	ENST00000286794	T	0.56776	0.44	4.97	2.3	0.28687	.	0.505914	0.19557	N	0.111437	T	0.26085	0.0636	N	0.03608	-0.345	0.09310	N	1	B	0.17268	0.021	B	0.12156	0.007	T	0.16600	-1.0397	10	0.30854	T	0.27	-6.7378	8.8622	0.35265	0.0:0.7491:0.0:0.2509	.	182	Q9BSU3	NAA11_HUMAN	D	182	ENSP00000286794:G182D	ENSP00000286794:G182D	G	-	2	0	NAA11	80465511	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-0.223000	0.09177	0.372000	0.24591	0.655000	0.94253	GGC	-	NULL		0.557	NAA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARD1B	protein_coding	OTTHUMT00000362922.1	C			80465511	-1	no_errors	NM_032693	genbank	human	validated	54_36p	missense	SNP	0.000	T
SEMA3E	9723	genome.wustl.edu	37	7	83029431	83029431	+	Missense_Mutation	SNP	T	T	A			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr7:83029431T>A	ENST00000307792.3	-	11	1746	c.1279A>T	c.(1279-1281)Aca>Tca	p.T427S	SEMA3E_ENST00000427262.1_Missense_Mutation_p.T367S	NM_012431.2	NP_036563.1	O15041	SEM3E_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3E	427	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell-matrix adhesion (GO:0001953)|patterning of blood vessels (GO:0001569)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of cell shape (GO:0008360)|semaphorin-plexin signaling pathway (GO:0071526)|sprouting angiogenesis (GO:0002040)|synapse organization (GO:0050808)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(19)|ovary(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)	51		Medulloblastoma(109;0.109)				TTTCCATCTGTTTTTACCAAT	0.413																																																0			7											216.0	192.0	200.0					7																	83029431		2203	4300	6503	82867367	SO:0001583	missense	9723			AB002329	CCDS34674.1, CCDS55121.1	7q21.11	2013-01-11			ENSG00000170381	ENSG00000170381		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10727	protein-coding gene	gene with protein product	"""M-sema H"""	608166		SEMAH		9205841, 9515811	Standard	NM_012431		Approved	M-SemaK, KIAA0331, coll-5	uc003uhy.2	O15041	OTTHUMG00000154693	ENST00000307792.3:c.1279A>T	7.37:g.83029431T>A	ENSP00000303212:p.Thr427Ser		82867367	B4E1P1|Q75M94|Q75M97	Missense_Mutation	SNP	superfamily_Sema,HMMPfam_Sema,HMMSmart_Sema,HMMSmart_PSI,superfamily_Plexin-like_fold,superfamily_SSF48726,HMMSmart_IG,HMMPfam_ig	p.T427S	ENST00000307792.3	37	c.1279	CCDS34674.1	7	.	.	.	.	.	.	.	.	.	.	T	20.3	3.972549	0.74246	.	.	ENSG00000170381	ENST00000307792;ENST00000427262;ENST00000541514	T;T	0.10668	2.85;2.85	5.53	5.53	0.82687	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.000000	0.85682	D	0.000000	T	0.25005	0.0607	M	0.62723	1.935	0.43756	D	0.99626	P	0.42375	0.778	P	0.58577	0.841	T	0.00885	-1.1527	10	0.35671	T	0.21	.	10.077	0.42366	0.0:0.0748:0.0:0.9252	.	427	O15041	SEM3E_HUMAN	S	427;367;427	ENSP00000303212:T427S;ENSP00000405052:T367S	ENSP00000303212:T427S	T	-	1	0	SEMA3E	82867367	1.000000	0.71417	0.984000	0.44739	0.993000	0.82548	3.438000	0.52871	2.092000	0.63282	0.482000	0.46254	ACA	-	superfamily_Sema,HMMPfam_Sema,HMMSmart_Sema		0.413	SEMA3E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA3E	protein_coding	OTTHUMT00000336606.1	T	NM_012431		82867367	-1	no_errors	NM_012431	genbank	human	provisional	54_36p	missense	SNP	0.944	A
DNAH6	1768	genome.wustl.edu	37	2	84800678	84800678	+	Missense_Mutation	SNP	C	C	A			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr2:84800678C>A	ENST00000237449.6	+	11	1899	c.1891C>A	c.(1891-1893)Ctt>Att	p.L631I	DNAH6_ENST00000398278.2_Missense_Mutation_p.L631I|DNAH6_ENST00000389394.3_Missense_Mutation_p.L631I			Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy chain 6	631	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(9)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	57						AAATGAAAGTCTTGATTTACA	0.343																																																0			2											96.0	105.0	102.0					2																	84800678		2203	4300	6503	84654189	SO:0001583	missense	284944			U61736	CCDS46348.1	2p11.2	2011-05-24	2006-09-04		ENSG00000115423	ENSG00000115423		"""Axonemal dyneins"""	2951	protein-coding gene	gene with protein product		603336	"""dynein, axonemal, heavy polypeptide 6"", ""dynein heavy chain-like 1"""	DNHL1		8812413	Standard	NM_001370		Approved	Dnahc6, HL-2, FLJ37357	uc010fgb.3	Q9C0G6	OTTHUMG00000128957	ENST00000237449.6:c.1891C>A	2.37:g.84800678C>A	ENSP00000237449:p.Leu631Ile		84654189	A0PJN9|B5MEE0|B7ZL99|O95493|Q53QZ1|Q53TE5|Q8N1W6|Q92861|Q96BL6|Q9H030|Q9H5E1	Missense_Mutation	SNP	HMMPfam_DHC_N2,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00382,HMMPfam_AAA_5,HMMPfam_Dynein_heavy	p.L631I	ENST00000237449.6	37	c.1891	CCDS46348.1	2	.	.	.	.	.	.	.	.	.	.	C	12.96	2.093227	0.36952	.	.	ENSG00000115423	ENST00000389394;ENST00000398278;ENST00000237449	T;T;T	0.24350	1.86;1.98;1.86	4.95	4.95	0.65309	.	0.000000	0.43919	D	0.000501	T	0.28962	0.0719	L	0.58101	1.795	0.27645	N	0.947595	B;P	0.51537	0.052;0.946	B;P	0.46253	0.05;0.509	T	0.17561	-1.0365	10	0.31617	T	0.26	.	10.5983	0.45352	0.0:0.9094:0.0:0.0906	.	631;210	Q9C0G6;Q9C0G6-3	DYH6_HUMAN;.	I	631	ENSP00000374045:L631I;ENSP00000381326:L631I;ENSP00000237449:L631I	ENSP00000237449:L631I	L	+	1	0	DNAH6	84654189	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.082000	0.41605	2.272000	0.75746	0.491000	0.48974	CTT	-	NULL		0.343	DNAH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNHL1	protein_coding	OTTHUMT00000328537.2	C	NM_001370		84654189	+1	no_errors	ENST00000237449	ensembl	human	known	54_36p	missense	SNP	1.000	A
PICALM	8301	genome.wustl.edu	37	11	85685847	85685847	+	Missense_Mutation	SNP	T	T	A			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr11:85685847T>A	ENST00000393346.3	-	19	1996	c.1848A>T	c.(1846-1848)caA>caT	p.Q616H	PICALM_ENST00000532317.1_Missense_Mutation_p.Q574H|PICALM_ENST00000528398.1_Missense_Mutation_p.Q515H|PICALM_ENST00000526033.1_Missense_Mutation_p.Q609H|PICALM_ENST00000356360.5_Missense_Mutation_p.Q596H			Q13492	PICAL_HUMAN	phosphatidylinositol binding clathrin assembly protein	616					axonogenesis (GO:0007409)|cargo loading into vesicle (GO:0035459)|cell proliferation (GO:0008283)|clathrin coat assembly (GO:0048268)|clathrin-mediated endocytosis (GO:0072583)|dendrite morphogenesis (GO:0048813)|endosomal transport (GO:0016197)|hemopoiesis (GO:0030097)|iron ion homeostasis (GO:0055072)|iron ion import into cell (GO:0097459)|negative regulation of gene expression (GO:0010629)|negative regulation of metalloendopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902963)|negative regulation of receptor-mediated endocytosis (GO:0048261)|positive regulation of aspartic-type endopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902961)|positive regulation of beta-amyloid formation (GO:1902004)|positive regulation of neuron death (GO:1901216)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|receptor internalization (GO:0031623)|receptor-mediated endocytosis (GO:0006898)|regulation of aspartic-type endopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902959)|regulation of endocytosis (GO:0030100)|regulation of protein localization (GO:0032880)|synaptic vesicle maturation (GO:0016188)|vesicle-mediated transport (GO:0016192)	clathrin coat (GO:0030118)|coated pit (GO:0005905)|cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|neurofibrillary tangle (GO:0097418)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|vesicle (GO:0031982)	1-phosphatidylinositol binding (GO:0005545)|clathrin adaptor activity (GO:0035615)|clathrin binding (GO:0030276)|clathrin heavy chain binding (GO:0032050)			endometrium(1)|kidney(2)|large_intestine(2)|liver(1)|lung(10)|ovary(1)|skin(1)|urinary_tract(1)	19		Acute lymphoblastic leukemia(157;7.42e-07)|all_hematologic(158;0.00092)				CACTTCCCATTTGTGGAGGCT	0.418			T	"""MLLT10, MLL"""	"""TALL, AML, """																																		Dom	yes		11	11q14	8301	phosphatidylinositol binding clathrin assembly protein (CALM)		L	0			11											186.0	159.0	168.0					11																	85685847		2203	4299	6502	85363495	SO:0001583	missense	8301			BC048259	CCDS8272.1, CCDS31653.1, CCDS55783.1, CCDS55784.1	11q14	2008-02-01			ENSG00000073921	ENSG00000073921			15514	protein-coding gene	gene with protein product		603025				8643484	Standard	NM_001206947		Approved	CALM, CLTH	uc001pbm.3	Q13492	OTTHUMG00000166981	ENST00000393346.3:c.1848A>T	11.37:g.85685847T>A	ENSP00000377015:p.Gln616His		85363495	B4DTM3|E9PN05|F8VPG7|O60700|Q4LE54|Q6GMQ6|Q86XZ9	Missense_Mutation	SNP	superfamily_ENTH/VHS domain,HMMPfam_ANTH,HMMSmart_SM00273,superfamily_GAT-like domain	p.Q616H	ENST00000393346.3	37	c.1848	CCDS8272.1	11	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	T|T|T	14.91|14.91|14.91	2.675690|2.675690|2.675690	0.47781|0.47781|0.47781	.|.|.	.|.|.	ENSG00000073921|ENSG00000073921|ENSG00000073921	ENST00000530692|ENST00000529760;ENST00000532603;ENST00000526961|ENST00000532317;ENST00000526033;ENST00000447890;ENST00000393346;ENST00000528398;ENST00000356360	.|.|T;T;T;T;T	.|.|0.55234	.|.|0.53;0.53;0.53;0.53;0.53	5.87|5.87|5.87	0.564|0.564|0.564	0.17302|0.17302|0.17302	.|.|.	.|.|0.056455	.|.|0.64402	.|.|D	.|.|0.000001	T|T|T	0.65637|0.65637|0.65637	0.2710|0.2710|0.2710	M|M|M	0.70275|0.70275|0.70275	2.135|2.135|2.135	0.42561|0.42561|0.42561	D|D|D	0.993149|0.993149|0.993149	.|.|B;D;B;B;B;B	.|.|0.65815	.|.|0.001;0.995;0.054;0.024;0.009;0.151	.|.|B;D;B;B;B;B	.|.|0.77004	.|.|0.002;0.989;0.039;0.029;0.006;0.066	T|T|T	0.63629|0.63629|0.63629	-0.6594|-0.6594|-0.6594	5|5|9	.|.|.	.|.|.	.|.|.	-5.6115|-5.6115|-5.6115	9.7342|9.7342|9.7342	0.40377|0.40377|0.40377	0.0:0.4043:0.0:0.5957|0.0:0.4043:0.0:0.5957|0.0:0.4043:0.0:0.5957	.|.|.	.|.|515;201;624;609;616;574	.|.|E9PN05;B4DLM1;A8MX97;F8VPG7;Q13492;Q13492-3	.|.|.;.;.;.;PICAL_HUMAN;.	I|Y|H	153|272;98;228|574;609;616;616;515;596	.|.|ENSP00000436958:Q574H;ENSP00000433846:Q609H;ENSP00000377015:Q616H;ENSP00000434884:Q515H;ENSP00000348718:Q596H	.|.|.	K|N|Q	-|-|-	2|1|3	0|0|2	PICALM|PICALM|PICALM	85363495|85363495|85363495	0.988000|0.988000|0.988000	0.35896|0.35896|0.35896	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.969000|0.969000|0.969000	0.65631|0.65631|0.65631	0.140000|0.140000|0.140000	0.16056|0.16056|0.16056	0.209000|0.209000|0.209000	0.20645|0.20645|0.20645	0.533000|0.533000|0.533000	0.62120|0.62120|0.62120	AAA|AAT|CAA	-	NULL		0.418	PICALM-005	KNOWN	basic|appris_principal|CCDS	protein_coding	PICALM	protein_coding	OTTHUMT00000392224.1	T	NM_007166		85363495	-1	no_errors	NM_007166	genbank	human	validated	54_36p	missense	SNP	0.998	A
RGR	5995	genome.wustl.edu	37	10	86012656	86012656	+	Silent	SNP	C	C	T			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr10:86012656C>T	ENST00000359452.4	+	4	452	c.414C>T	c.(412-414)ttC>ttT	p.F138F	RGR_ENST00000358110.5_Silent_p.F134F	NM_001012720.1|NM_002921.3	NP_001012738.1|NP_002912.2	P47804	RGR_HUMAN	retinal G protein coupled receptor	134					chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|phototransduction (GO:0007602)|protein-chromophore linkage (GO:0018298)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)	chemokine receptor activity (GO:0004950)|G-protein coupled receptor activity (GO:0004930)|photoreceptor activity (GO:0009881)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|stomach(1)	17						TGGTGCTCTTCGTGTGGCTGT	0.587																																					NSCLC(15;204 545 5889 6385 32445)											0			10											147.0	110.0	122.0					10																	86012656		2203	4300	6503	86002636	SO:0001819	synonymous_variant	5995			BC011349	CCDS7374.1, CCDS41543.1	10q23	2013-02-14			ENSG00000148604	ENSG00000148604		"""GPCR / Class A : Opsin receptors"""	9990	protein-coding gene	gene with protein product	"""RGR-opsin"""	600342				8641686	Standard	NM_002921		Approved	RP44	uc001kdd.1	P47804	OTTHUMG00000018636	ENST00000359452.4:c.414C>T	10.37:g.86012656C>T			86002636	A6NKK7|Q96FC5	Silent	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1,PatternScan_OPSIN	p.F138	ENST00000359452.4	37	c.414	CCDS7374.1	10																																																																																			-	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1		0.587	RGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGR	protein_coding	OTTHUMT00000049116.1	C	NM_002921		86002636	+1	no_errors	NM_002921	genbank	human	reviewed	54_36p	silent	SNP	0.721	T
RGPD1	400966	genome.wustl.edu	37	2	87157234	87157234	+	Intron	SNP	G	G	A	rs533992672		TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr2:87157234G>A	ENST00000559485.1	+	1	64				RGPD1_ENST00000398193.3_Intron|RGPD1_ENST00000409776.2_Intron	NM_001024457.3	NP_001019628.3	P0DJD0	RGPD1_HUMAN	RANBP2-like and GRIP domain containing 1						protein targeting to Golgi (GO:0000042)					breast(1)|endometrium(1)|lung(1)	3						TACCGGAGTCGCCAGTTAAAC	0.637													G|||	1	0.000199681	0.0008	0.0	5008	,	,		13508	0.0		0.0	False		,,,				2504	0.0															0			2																																								87010745	SO:0001627	intron_variant	729843				CCDS46358.1, CCDS46358.2	2p11.2	2013-09-24			ENSG00000187627	ENSG00000187627		"""Tetratricopeptide (TTC) repeat domain containing"""	32414	protein-coding gene	gene with protein product		612704				15710750, 15815621	Standard	NM_001024457		Approved	RGP1	uc021vkh.1	P0DJD0	OTTHUMG00000153248	ENST00000559485.1:c.48+12433G>A	2.37:g.87157234G>A			87010745	P0C839|Q68DN6|Q6V1X0	RNA	SNP	-	NULL	ENST00000559485.1	37	NULL	CCDS46358.2	2																																																																																			-	-		0.637	RGPD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LOC729843	protein_coding	OTTHUMT00000330684.4	G	NM_001024457		87010745	-1	pseudogene	XR_016056	genbank	human	model	54_36p	rna	SNP	1.000	A
KCNK10	54207	genome.wustl.edu	37	14	88654417	88654417	+	Missense_Mutation	SNP	T	T	C			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr14:88654417T>C	ENST00000340700.5	-	6	1341	c.890A>G	c.(889-891)aAg>aGg	p.K297R	KCNK10_ENST00000319231.5_Missense_Mutation_p.K302R|KCNK10_ENST00000312350.5_Missense_Mutation_p.K302R	NM_021161.4	NP_066984.1	P57789	KCNKA_HUMAN	potassium channel, subfamily K, member 10	297					signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transport (GO:0006810)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(3)|pancreas(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	47						CACTAGGGGCTTATACCACTC	0.443																																																0			14											160.0	154.0	156.0					14																	88654417		2203	4300	6503	87724170	SO:0001583	missense	54207			AF279890	CCDS9880.1, CCDS9881.1, CCDS9882.1	14q31	2014-06-12						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6273	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 97"""	605873				10880510, 16382106	Standard	NM_021161		Approved	K2p10.1, TREK-2, TREK2, PPP1R97	uc001xwn.3	P57789		ENST00000340700.5:c.890A>G	14.37:g.88654417T>C	ENSP00000343104:p.Lys297Arg		87724170	B2R8T4|B2RCT3|B5TJL4|Q6B014|Q8TDK7|Q8TDK8|Q9HB59	Missense_Mutation	SNP	superfamily_Voltage-gated potassium channels,HMMPfam_Ion_trans_2	p.K302R	ENST00000340700.5	37	c.905	CCDS9880.1	14	.	.	.	.	.	.	.	.	.	.	T	15.58	2.874266	0.51695	.	.	ENSG00000100433	ENST00000340700;ENST00000312350;ENST00000319231	T;T;T	0.26518	1.73;1.73;1.73	5.52	5.52	0.82312	Ion transport 2 (1);	0.043589	0.85682	D	0.000000	T	0.21921	0.0528	L	0.28776	0.89	0.58432	D	0.999998	B;P;B	0.37141	0.337;0.584;0.055	B;B;B	0.41036	0.261;0.346;0.05	T	0.03212	-1.1060	10	0.10377	T	0.69	.	15.1125	0.72368	0.0:0.0:0.0:1.0	.	297;302;302	P57789;B2R8T4;Q6B014	KCNKA_HUMAN;.;.	R	297;302;302	ENSP00000343104:K297R;ENSP00000310568:K302R;ENSP00000312811:K302R	ENSP00000310568:K302R	K	-	2	0	KCNK10	87724170	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.193000	0.72075	2.225000	0.72522	0.459000	0.35465	AAG	-	superfamily_Voltage-gated potassium channels,HMMPfam_Ion_trans_2		0.443	KCNK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNK10	protein_coding	OTTHUMT00000410167.1	T	NM_021161		87724170	-1	no_errors	NM_138317	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
NPAS2	4862	genome.wustl.edu	37	2	101521219	101521219	+	Start_Codon_SNP	SNP	G	G	C			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr2:101521219G>C	ENST00000335681.5	+	2	288	c.3G>C	c.(1-3)atG>atC	p.M1I	NPAS2_ENST00000542504.1_Missense_Mutation_p.M66I	NM_002518.3	NP_002509.2	Q99743	NPAS2_HUMAN	neuronal PAS domain protein 2	1	Sufficient for heterodimer formation with ARNTL/BMAL1, E-box binding and for the effect of NADPH. {ECO:0000250|UniProtKB:P97460}.				cellular lipid metabolic process (GO:0044255)|cellular response to DNA damage stimulus (GO:0006974)|central nervous system development (GO:0007417)|circadian regulation of gene expression (GO:0032922)|circadian sleep/wake cycle (GO:0042745)|locomotor rhythm (GO:0045475)|negative regulation of cell death (GO:0060548)|positive regulation of DNA repair (GO:0045739)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of response to DNA damage stimulus (GO:2001020)|response to redox state (GO:0051775)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter binding (GO:0001047)|DNA binding (GO:0003677)|Hsp90 protein binding (GO:0051879)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			cervix(1)|endometrium(3)|large_intestine(7)|lung(9)|ovary(3)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						AAAATCTAATGGATGAAGATG	0.418																																																0			2											42.0	49.0	47.0					2																	101521219		2203	4300	6503	100887651	SO:0001582	initiator_codon_variant	4862			U77970	CCDS2048.1	2q11.2	2013-05-21			ENSG00000170485	ENSG00000170485		"""Basic helix-loop-helix proteins"""	7895	protein-coding gene	gene with protein product		603347				9012850, 9079689	Standard	NM_002518		Approved	MOP4, PASD4, bHLHe9	uc002tap.1	Q99743	OTTHUMG00000130675	ENST00000335681.5:c.3G>C	2.37:g.101521219G>C	ENSP00000338283:p.Met1Ile		100887651	Q4ZFV9|Q53SQ3|Q86V96|Q99629	Missense_Mutation	SNP	superfamily_HLH_basic,HMMPfam_HLH,HMMSmart_HLH,HMMSmart_PAS,HMMPfam_PAS,superfamily_SSF55785,HMMPfam_PAS_3,HMMSmart_PAC	p.M1I	ENST00000335681.5	37	c.3	CCDS2048.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.54|14.54	2.565697|2.565697	0.45694|0.45694	.|.	.|.	ENSG00000170485|ENSG00000170485	ENST00000335681;ENST00000542504|ENST00000427413	T;T|.	0.09630|.	2.96;3.29|.	5.17|5.17	5.17|5.17	0.71159|0.71159	.|.	0.141389|.	0.64402|.	D|.	0.000008|.	T|T	0.69396|0.69396	0.3106|0.3106	.|.	.|.	.|.	0.41441|0.41441	D|D	0.987927|0.987927	B;B|.	0.27765|.	0.03;0.188|.	B;B|.	0.25614|.	0.036;0.062|.	T|T	0.67818|0.67818	-0.5572|-0.5572	9|4	0.62326|.	D|.	0.03|.	.|.	14.0344|14.0344	0.64636|0.64636	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	66;1|.	F5H027;Q99743|.	.;NPAS2_HUMAN|.	I|S	1;66|67	ENSP00000338283:M1I;ENSP00000438428:M66I|.	ENSP00000338283:M1I|.	M|W	+|+	3|2	0|0	NPAS2|NPAS2	100887651|100887651	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.986000|0.986000	0.74619|0.74619	5.196000|5.196000	0.65136|0.65136	2.680000|2.680000	0.91292|0.91292	0.591000|0.591000	0.81541|0.81541	ATG|TGG	-	NULL		0.418	NPAS2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	NPAS2	protein_coding	OTTHUMT00000253168.3	G		Missense_Mutation	100887651	+1	no_errors	NM_002518	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
TBC1D8	11138	genome.wustl.edu	37	2	101652492	101652492	+	Missense_Mutation	SNP	G	G	T			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr2:101652492G>T	ENST00000376840.4	-	9	1545	c.1546C>A	c.(1546-1548)Ctt>Att	p.L516I	TBC1D8_ENST00000409318.1_Missense_Mutation_p.L531I			O95759	TBCD8_HUMAN	TBC1 domain family, member 8 (with GRAM domain)	516	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.				blood circulation (GO:0008015)|positive regulation of cell proliferation (GO:0008284)	membrane (GO:0016020)	calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)			breast(1)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(2)|lung(12)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	32						GAGAAGAGAAGCCAGAGTCTC	0.512																																																0			2											89.0	93.0	92.0					2																	101652492		2017	4184	6201	101018924	SO:0001583	missense	11138			AB024057	CCDS46375.1	2q12.1	2011-11-30			ENSG00000204634	ENSG00000204634			17791	protein-coding gene	gene with protein product	"""BUB2-like protein 1"", ""vascular Rab-GAP/TBC-containing protein"""					10373574	Standard	NM_001102426		Approved	HBLP1, VRP, AD3	uc010fiv.3	O95759	OTTHUMG00000153040	ENST00000376840.4:c.1546C>A	2.37:g.101652492G>T	ENSP00000366036:p.Leu516Ile		101018924	A6NDL4|A8K9W1|B9A6K4|Q53SQ4|Q9UQ32	Missense_Mutation	SNP	HMMPfam_GRAM,HMMSmart_SM00568,superfamily_Ypt/Rab-GAP domain of gyp1p,HMMPfam_TBC,HMMSmart_SM00164,superfamily_EF-hand	p.L516I	ENST00000376840.4	37	c.1546	CCDS46375.1	2	.	.	.	.	.	.	.	.	.	.	G	13.16	2.152883	0.38021	.	.	ENSG00000204634	ENST00000376840;ENST00000409318	T;T	0.11712	2.75;2.75	5.0	5.0	0.66597	Rab-GAP/TBC domain (4);	0.000000	0.52532	D	0.000063	T	0.29783	0.0744	M	0.77103	2.36	0.49582	D	0.999802	P;P	0.40660	0.726;0.484	P;B	0.51297	0.665;0.381	T	0.02075	-1.1218	10	0.56958	D	0.05	-27.6616	18.6504	0.91429	0.0:0.0:1.0:0.0	.	531;516	B7Z6L4;O95759	.;TBCD8_HUMAN	I	516;531	ENSP00000366036:L516I;ENSP00000386856:L531I	ENSP00000366036:L516I	L	-	1	0	TBC1D8	101018924	1.000000	0.71417	0.996000	0.52242	0.071000	0.16799	4.401000	0.59716	2.462000	0.83206	0.655000	0.94253	CTT	-	superfamily_Ypt/Rab-GAP domain of gyp1p,HMMPfam_TBC,HMMSmart_SM00164		0.512	TBC1D8-011	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D8	protein_coding	OTTHUMT00000376092.1	G	NM_007063		101018924	-1	no_errors	NM_001102426	genbank	human	validated	54_36p	missense	SNP	1.000	T
PAH	5053	genome.wustl.edu	37	12	103249098	103249098	+	Silent	SNP	G	G	A			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr12:103249098G>A	ENST00000553106.1	-	6	994	c.522C>T	c.(520-522)atC>atT	p.I174I	PAH_ENST00000551988.1_5'UTR|PAH_ENST00000307000.2_Silent_p.I169I	NM_000277.1	NP_000268.1	P00439	PH4H_HUMAN	phenylalanine hydroxylase	174			I -> T (in PKU; haplotype 1).|I -> V (in PKU).		catecholamine biosynthetic process (GO:0042423)|cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|L-phenylalanine catabolic process (GO:0006559)|neurotransmitter biosynthetic process (GO:0042136)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	amino acid binding (GO:0016597)|iron ion binding (GO:0005506)|phenylalanine 4-monooxygenase activity (GO:0004505)			endometrium(1)|kidney(3)|large_intestine(5)|lung(10)|ovary(5)|skin(2)|urinary_tract(1)	27					Droxidopa(DB06262)|Epinephrine(DB00668)|L-Phenylalanine(DB00120)|Norepinephrine(DB00368)|Tetrahydrobiopterin(DB00360)	CCACTCGAGGGATGGGCTGCC	0.502																																																0			12											67.0	63.0	64.0					12																	103249098		2203	4300	6503	101773228	SO:0001819	synonymous_variant	5053			U49897	CCDS9092.1	12q22-q24.2	2010-04-27				ENSG00000171759	1.14.16.1		8582	protein-coding gene	gene with protein product	"""phenylalanine 4-monooxygenase"""	612349				2063869	Standard	NM_000277		Approved	PH	uc001tjq.1	P00439		ENST00000553106.1:c.522C>T	12.37:g.103249098G>A			101773228	Q16717|Q8TC14	Silent	SNP	superfamily_SSF55021,HMMPfam_ACT,superfamily_Aaa_hydroxylase,HMMPfam_Biopterin_H,PatternScan_BIOPTERIN_HYDROXYL	p.I174	ENST00000553106.1	37	c.522	CCDS9092.1	12																																																																																			-	superfamily_Aaa_hydroxylase,HMMPfam_Biopterin_H		0.502	PAH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAH	protein_coding	OTTHUMT00000406692.1	G			101773228	-1	no_errors	NM_000277	genbank	human	reviewed	54_36p	silent	SNP	0.993	A
SENP7	57337	genome.wustl.edu	37	3	101177799	101177799	+	Splice_Site	SNP	C	C	T			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr3:101177799C>T	ENST00000394095.2	-	4	337	c.284G>A	c.(283-285)aGg>aAg	p.R95K	SENP7_ENST00000314261.7_Splice_Site_p.R95K|SENP7_ENST00000348610.3_Splice_Site_p.R62K|SENP7_ENST00000394094.2_Splice_Site_p.R95K|Y_RNA_ENST00000364684.1_RNA|SENP7_ENST00000358203.3_Splice_Site_p.R62K|SENP7_ENST00000394091.1_Splice_Site_p.R62K	NM_001282802.1|NM_020654.3	NP_001269731.1|NP_065705.3	Q9BQF6	SENP7_HUMAN	SUMO1/sentrin specific peptidase 7	95						intracellular (GO:0005622)|nucleus (GO:0005634)	cysteine-type peptidase activity (GO:0008234)			breast(2)|endometrium(1)|kidney(1)|large_intestine(16)|lung(15)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44						CATATCTTACCTTTCTGGTGA	0.368																																																0			3											229.0	215.0	220.0					3																	101177799		2203	4300	6503	102660489	SO:0001630	splice_region_variant	57337				CCDS2941.2, CCDS43121.1, CCDS63704.1, CCDS63705.1, CCDS63706.1	3q12	2008-02-05	2005-08-17		ENSG00000138468	ENSG00000138468			30402	protein-coding gene	gene with protein product		612846	"""SUMO1/sentrin specific protease 7"""			11214970, 11230166	Standard	NM_001282802		Approved		uc003dut.3	Q9BQF6	OTTHUMG00000149927	ENST00000394095.2:c.284+1G>A	3.37:g.101177799C>T			102660489	A1L3A5|A8MW39|B7WNW8|Q7Z3F4|Q96PS5|Q9C0F6|Q9HBT5	Missense_Mutation	SNP	superfamily_Cysteine proteinases,HMMPfam_Peptidase_C48	p.R95K	ENST00000394095.2	37	c.284	CCDS2941.2	3	.	.	.	.	.	.	.	.	.	.	C	19.87	3.907036	0.72868	.	.	ENSG00000138468	ENST00000394095;ENST00000394094;ENST00000314261;ENST00000394091;ENST00000358203;ENST00000348610	T;T;T;T;T;T	0.55930	1.29;0.49;0.8;1.21;1.21;1.32	4.64	4.64	0.57946	.	0.599257	0.15845	N	0.241814	T	0.57844	0.2081	N	0.24115	0.695	0.24078	N	0.995954	P;D;D;D	0.89917	0.935;1.0;0.998;0.999	B;D;D;D	0.83275	0.435;0.996;0.99;0.991	T	0.49390	-0.8945	9	.	.	.	-9.407	12.8935	0.58084	0.0:1.0:0.0:0.0	.	62;95;62;95	Q9BQF6-4;Q9BQF6-5;Q9BQF6-2;Q9BQF6	.;.;.;SENP7_HUMAN	K	95;95;95;62;62;62	ENSP00000377655:R95K;ENSP00000377654:R95K;ENSP00000313624:R95K;ENSP00000377651:R62K;ENSP00000350936:R62K;ENSP00000342159:R62K	.	R	-	2	0	SENP7	102660489	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	3.296000	0.51802	2.399000	0.81585	0.655000	0.94253	AGG	-	NULL		0.368	SENP7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SENP7	protein_coding	OTTHUMT00000313957.2	C	NM_020654	Missense_Mutation	102660489	-1	no_errors	NM_020654	genbank	human	validated	54_36p	missense	SNP	1.000	T
MGEA5	10724	genome.wustl.edu	37	10	103563611	103563611	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr10:103563611C>T	ENST00000361464.3	-	7	1312	c.917G>A	c.(916-918)cGg>cAg	p.R306Q	MGEA5_ENST00000439817.1_Missense_Mutation_p.R306Q|MGEA5_ENST00000370094.3_Missense_Mutation_p.R306Q|MGEA5_ENST00000357797.5_Missense_Mutation_p.R306Q	NM_012215.3	NP_036347.1	O60502	OGA_HUMAN	meningioma expressed antigen 5 (hyaluronidase)	306					aging (GO:0007568)|dATP metabolic process (GO:0046060)|glycoprotein catabolic process (GO:0006516)|N-acetylglucosamine metabolic process (GO:0006044)|necrotic cell death (GO:0070265)|negative regulation of cardiac muscle adaptation (GO:0010616)|negative regulation of protein glycosylation (GO:0060051)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of cell killing (GO:0031343)|positive regulation of DNA metabolic process (GO:0051054)|positive regulation of glucose import (GO:0046326)|positive regulation of growth hormone secretion (GO:0060124)|positive regulation of insulin secretion (GO:0032024)|positive regulation of mitochondrial depolarization (GO:0051901)|positive regulation of protein complex disassembly (GO:0043243)|positive regulation of proteolysis (GO:0045862)|protein targeting to membrane (GO:0006612)|response to steroid hormone (GO:0048545)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|hyalurononglucosaminidase activity (GO:0004415)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(11)|ovary(2)|skin(1)|urinary_tract(1)	23		Colorectal(252;0.207)		Epithelial(162;4.67e-09)|all cancers(201;2.54e-07)		TCCTTTTAACCGTGGGATGAG	0.433																																																0			10											204.0	190.0	195.0					10																	103563611		2203	4300	6503	103553601	SO:0001583	missense	10724			AF036144	CCDS7520.1, CCDS44471.1	10q24.1-q24.3	2008-08-01			ENSG00000198408	ENSG00000198408			7056	protein-coding gene	gene with protein product	"""nuclear cytoplasmic O-GlcNAcase and acetyltransferase"""	604039				9811929, 16356930	Standard	NM_012215		Approved	MEA5, NCOAT, OGA	uc001ktv.2	O60502	OTTHUMG00000018939	ENST00000361464.3:c.917G>A	10.37:g.103563611C>T	ENSP00000354850:p.Arg306Gln		103553601	B7WPB9|D3DR79|E9PGF9|O75166|Q86WV0|Q8IV98|Q9BVA5|Q9HAR0	Missense_Mutation	SNP	HMMPfam_NAGidase,superfamily_Acyl-CoA N-acyltransferases (Nat)	p.R306Q	ENST00000361464.3	37	c.917	CCDS7520.1	10	.	.	.	.	.	.	.	.	.	.	C	32	5.106256	0.94292	.	.	ENSG00000198408	ENST00000439817;ENST00000361464;ENST00000357797;ENST00000370094;ENST00000429860	T;T;T;T	0.30448	1.54;1.54;1.55;1.53	5.82	5.82	0.92795	Glycoside hydrolase, superfamily (1);	0.000000	0.85682	D	0.000000	T	0.19327	0.0464	N	0.05510	-0.035	0.80722	D	1	P;P;P;P	0.43519	0.809;0.63;0.63;0.68	B;B;B;B	0.38842	0.283;0.186;0.186;0.283	T	0.04961	-1.0915	10	0.24483	T	0.36	-12.0432	20.0991	0.97865	0.0:1.0:0.0:0.0	.	306;306;306;306	E9PGF9;O60502-2;O60502-3;O60502	.;.;.;NCOAT_HUMAN	Q	306;306;306;306;221	ENSP00000409973:R306Q;ENSP00000354850:R306Q;ENSP00000350445:R306Q;ENSP00000359112:R306Q	ENSP00000350445:R306Q	R	-	2	0	MGEA5	103553601	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	6.019000	0.70818	2.752000	0.94435	0.655000	0.94253	CGG	-	HMMPfam_NAGidase		0.433	MGEA5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	MGEA5	protein_coding	OTTHUMT00000049987.1	C	NM_012215		103553601	-1	no_errors	NM_012215	genbank	human	validated	54_36p	missense	SNP	1.000	T
IGHD	3495	genome.wustl.edu	37	14	106307554	106307554	+	RNA	SNP	G	G	A	rs573593009	byFrequency	TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr14:106307554G>A	ENST00000390556.2	-	0	483							P01880	IGHD_HUMAN	immunoglobulin heavy constant delta						immune response (GO:0006955)	blood microparticle (GO:0072562)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)										GGTGTGGCTCGGACACTCTGC	0.652													G|||	10	0.00199681	0.0	0.0	5008	,	,		11000	0.0		0.0	False		,,,				2504	0.0102															0			14											35.0	37.0	36.0					14																	106307554		2029	4175	6204	105378599			0			K02875		14q32.33	2012-03-09			ENSG00000211898	ENSG00000211898		"""Immunoglobulins / IGH locus"""	5480	other	immunoglobulin gene	"""immunoglobulin delta"", ""constant region of heavy chain of IgD"""	147170				3922054	Standard	NG_001019		Approved	FLJ00382, FLJ46727, MGC29633	uc001ysj.3	P01880	OTTHUMG00000152538		14.37:g.106307554G>A			105378599	Q6P4I8|Q8WU38	Nonsense_Mutation	SNP	superfamily_Immunoglobulin,HMMPfam_C1-set,HMMSmart_SM00407,PatternScan_IG_MHC,HMMPfam_ig	p.R162*	ENST00000390556.2	37	c.484		14																																																																																			-	NULL		0.652	IGHD-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal	IG_C_gene	IGHD	IG_C_gene	OTTHUMT00000326652.1	G	NG_001019		105378599	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000390556	ensembl	human	known	54_36p	nonsense	SNP	0.009	A
CAPN6	827	genome.wustl.edu	37	X	110494210	110494210	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chrX:110494210C>T	ENST00000324068.1	-	8	1260	c.1093G>A	c.(1093-1095)Gat>Aat	p.D365N	CAPN6_ENST00000541758.1_Missense_Mutation_p.D110N	NM_014289.3	NP_055104.2	Q9Y6Q1	CAN6_HUMAN	calpain 6	365	Domain III.				microtubule bundle formation (GO:0001578)|proteolysis (GO:0006508)|regulation of cytoskeleton organization (GO:0051493)	perinuclear region of cytoplasm (GO:0048471)|spindle microtubule (GO:0005876)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|microtubule binding (GO:0008017)			cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(25)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)	47						ATCAGGGGATCATCATCCACA	0.473																																																0			X											306.0	269.0	282.0					X																	110494210		2203	4300	6503	110380866	SO:0001583	missense	827			AF029232	CCDS14555.1	Xq23	2008-07-29			ENSG00000077274	ENSG00000077274			1483	protein-coding gene	gene with protein product		300146				9503024, 9339374	Standard	NM_014289		Approved	CAPNX, CalpM, CANPX	uc004epc.2	Q9Y6Q1	OTTHUMG00000022203	ENST00000324068.1:c.1093G>A	X.37:g.110494210C>T	ENSP00000317214:p.Asp365Asn		110380866	D3DUY7|Q9UEQ1|Q9UJA8	Missense_Mutation	SNP	PatternScan_THIOL_PROTEASE_CYS,PatternScan_THIOL_PROTEASE_HIS,PatternScan_THIOL_PROTEASE_ASN,superfamily_SSF54001,HMMSmart_CysPc,HMMPfam_Peptidase_C2,HMMPfam_Calpain_III,HMMSmart_calpain_III,superfamily_Peptidase_C2,superfamily_C2_CaLB,HMMSmart_C2,HMMPfam_C2	p.D365N	ENST00000324068.1	37	c.1093	CCDS14555.1	X	.	.	.	.	.	.	.	.	.	.	C	29.3	4.995347	0.93167	.	.	ENSG00000077274	ENST00000324068;ENST00000541758	D;D	0.88509	-2.39;-2.15	5.95	5.95	0.96441	Peptidase C2, calpain, large subunit, domain III (2);Peptidase C2, calpain, domain III (1);	0.347798	0.28730	N	0.014340	D	0.88862	0.6552	L	0.43152	1.355	0.58432	D	0.999999	P	0.40282	0.711	P	0.45343	0.477	D	0.87298	0.2303	10	0.36615	T	0.2	.	19.2764	0.94032	0.0:1.0:0.0:0.0	.	365	Q9Y6Q1	CAN6_HUMAN	N	365;110	ENSP00000317214:D365N;ENSP00000441736:D110N	ENSP00000317214:D365N	D	-	1	0	CAPN6	110380866	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.468000	0.80943	2.504000	0.84457	0.600000	0.82982	GAT	-	HMMPfam_Calpain_III,HMMSmart_calpain_III,superfamily_Peptidase_C2		0.473	CAPN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAPN6	protein_coding	OTTHUMT00000057922.1	C			110380866	-1	no_errors	NM_014289	genbank	human	reviewed	54_36p	missense	SNP	0.992	T
TOX4P1	285412	genome.wustl.edu	37	4	113377644	113377644	+	IGR	SNP	G	G	C			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr4:113377644G>C								ALPK1 (13882 upstream) : NEUROG2 (57027 downstream)																							GGTTGGTGTTGAGGATTTCTG	0.488																																																0			4																																								113597093	SO:0001628	intergenic_variant	285412																															4.37:g.113377644G>C			113597093		RNA	SNP	-	NULL		37	NULL		4																																																																																			-	-	0	0.488					LOC285412			G			113597093	+1	pseudogene	XR_017405	genbank	human	model	54_36p	rna	SNP	1.000	C
ANK2	287	genome.wustl.edu	37	4	114253132	114253132	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr4:114253132C>T	ENST00000357077.4	+	28	3183	c.3130C>T	c.(3130-3132)Ctt>Ttt	p.L1044F	ANK2_ENST00000506722.1_Missense_Mutation_p.L1035F|ANK2_ENST00000394537.3_Missense_Mutation_p.L1044F|ANK2_ENST00000509550.1_Intron|ANK2_ENST00000264366.6_Intron	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	1044	Interaction with SPTBN1.|ZU5 1. {ECO:0000255|PROSITE- ProRule:PRU00485}.				atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		ACTCAGTAAACTTCACCTGCC	0.517																																																0			4											128.0	139.0	135.0					4																	114253132		2203	4300	6503	114472581	SO:0001583	missense	287			M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.3130C>T	4.37:g.114253132C>T	ENSP00000349588:p.Leu1044Phe		114472581	Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	superfamily_ANK,HMMSmart_ANK,HMMPfam_Ank,HMMPfam_ZU5,PatternScan_ALDEHYDE_DEHYDR_GLU,superfamily_DEATH_like,HMMSmart_DEATH,HMMPfam_Death	p.L1044F	ENST00000357077.4	37	c.3130	CCDS3702.1	4	.	.	.	.	.	.	.	.	.	.	C	17.07	3.294334	0.60086	.	.	ENSG00000145362	ENST00000503271;ENST00000506722;ENST00000504454;ENST00000394537;ENST00000357077;ENST00000343056	T;T;T;T;T	0.44482	0.92;0.92;0.92;0.92;0.92	5.62	4.78	0.61160	.	0.658399	0.11693	N	0.538689	T	0.41003	0.1140	N	0.08118	0	0.80722	D	1	B;D;B;B	0.64830	0.419;0.994;0.419;0.137	B;P;B;B	0.57101	0.16;0.813;0.16;0.068	T	0.43048	-0.9415	10	0.59425	D	0.04	.	14.2715	0.66154	0.0:0.9287:0.0:0.0713	.	1044;1044;1035;1035	Q01484-2;Q01484-4;Q01484-5;F8WEF9	.;.;.;.	F	1023;1035;1059;1044;1044;1035	ENSP00000423799:L1023F;ENSP00000421067:L1035F;ENSP00000424722:L1059F;ENSP00000378044:L1044F;ENSP00000349588:L1044F	ENSP00000340561:L1035F	L	+	1	0	ANK2	114472581	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	1.375000	0.46248	0.655000	0.94253	CTT	-	HMMPfam_ZU5		0.517	ANK2-001	KNOWN	basic|CCDS	protein_coding	ANK2	protein_coding	OTTHUMT00000256422.2	C	NM_001148		114472581	+1	no_errors	NM_001148	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
PARP9	83666	genome.wustl.edu	37	3	122247249	122247249	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr3:122247249G>A	ENST00000360356.2	-	11	2754	c.2527C>T	c.(2527-2529)Cct>Tct	p.P843S	PARP9_ENST00000477522.2_Missense_Mutation_p.P808S|PARP9_ENST00000471785.1_Missense_Mutation_p.P808S|PARP9_ENST00000492382.1_Missense_Mutation_p.P388S	NM_001146102.1|NM_031458.2	NP_001139574.1|NP_113646.2	Q8IXQ6	PARP9_HUMAN	poly (ADP-ribose) polymerase family, member 9	843	PARP catalytic. {ECO:0000255|PROSITE- ProRule:PRU00397}.				cell migration (GO:0016477)|double-strand break repair (GO:0006302)|regulation of response to interferon-gamma (GO:0060330)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	NAD+ ADP-ribosyltransferase activity (GO:0003950)			endometrium(3)|kidney(2)|large_intestine(9)|liver(1)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(3)	34				GBM - Glioblastoma multiforme(114;0.0519)		CCCCTCCAAGGATGCTGTGCA	0.458																																																0			3											131.0	117.0	122.0					3																	122247249		2203	4300	6503	123729939	SO:0001583	missense	83666			AF307339	CCDS3014.1, CCDS54633.1, CCDS54634.1	3q13-q21	2010-02-16			ENSG00000138496	ENSG00000138496		"""Poly (ADP-ribose) polymerases"""	24118	protein-coding gene	gene with protein product		612065				11110709	Standard	NM_031458		Approved	BAL, BAL1	uc003efi.3	Q8IXQ6	OTTHUMG00000159522	ENST00000360356.2:c.2527C>T	3.37:g.122247249G>A	ENSP00000353512:p.Pro843Ser		123729939	A8KA94|B2R8S9|E9PFM7|Q8TCP3|Q9BZL8|Q9BZL9	Missense_Mutation	SNP	superfamily_Macro domain-like,HMMSmart_SM00506,HMMPfam_Macro,superfamily_ADP-ribosylation,HMMPfam_PARP	p.P843S	ENST00000360356.2	37	c.2527	CCDS3014.1	3	.	.	.	.	.	.	.	.	.	.	G	0.278	-0.988535	0.02162	.	.	ENSG00000138496	ENST00000360356;ENST00000492382;ENST00000477522;ENST00000471785;ENST00000452457	T;T;T;T	0.08896	3.37;3.04;3.23;3.23	4.79	-2.23	0.06930	Poly(ADP-ribose) polymerase, catalytic domain (1);	1.412040	0.04466	N	0.375247	T	0.02012	0.0063	N	0.01267	-0.92	0.09310	N	1	B;B;B	0.13145	0.004;0.007;0.007	B;B;B	0.15484	0.006;0.007;0.013	T	0.35475	-0.9787	10	0.02654	T	1	.	1.1007	0.01683	0.2676:0.2753:0.3165:0.1407	.	843;388;808	Q8IXQ6;G5E9U8;Q8IXQ6-2	PARP9_HUMAN;.;.	S	843;388;808;808;766	ENSP00000353512:P843S;ENSP00000417664:P388S;ENSP00000419506:P808S;ENSP00000419001:P808S	ENSP00000353512:P843S	P	-	1	0	PARP9	123729939	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.843000	0.04350	-0.563000	0.06078	0.655000	0.94253	CCT	-	NULL		0.458	PARP9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PARP9	protein_coding	OTTHUMT00000355957.1	G	NM_031458		123729939	-1	no_errors	NM_031458	genbank	human	provisional	54_36p	missense	SNP	0.000	A
OR8B12	219858	genome.wustl.edu	37	11	124412873	124412873	+	Missense_Mutation	SNP	G	G	T			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr11:124412873G>T	ENST00000306842.2	-	1	702	c.678C>A	c.(676-678)caC>caA	p.H226Q		NM_001005195.1	NP_001005195.1	Q8NGG6	OR8BC_HUMAN	olfactory receptor, family 8, subfamily B, member 12	226						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	31		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0213)		TAGAACTGTTGTGTAGAATGC	0.428																																																0			11											84.0	75.0	78.0					11																	124412873		2201	4299	6500	123918083	SO:0001583	missense	219858				CCDS31711.1	11q24.2	2013-09-24			ENSG00000170953	ENSG00000170953		"""GPCR / Class A : Olfactory receptors"""	15307	protein-coding gene	gene with protein product							Standard	NM_001005195		Approved		uc010sam.2	Q8NGG6	OTTHUMG00000165922	ENST00000306842.2:c.678C>A	11.37:g.124412873G>T	ENSP00000307159:p.His226Gln		123918083	B2RNF6|Q6IEW8|Q96RC7	Missense_Mutation	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.H226Q	ENST00000306842.2	37	c.678	CCDS31711.1	11	.	.	.	.	.	.	.	.	.	.	G	1.570	-0.534315	0.04082	.	.	ENSG00000170953	ENST00000306842	T	0.00044	8.83	3.89	-0.546	0.11840	GPCR, rhodopsin-like superfamily (1);	0.487586	0.19272	N	0.118368	T	0.00073	0.0002	N	0.16602	0.42	0.09310	N	1	B	0.21520	0.057	B	0.27715	0.082	T	0.30822	-0.9965	10	0.39692	T	0.17	.	0.8589	0.01189	0.3277:0.2943:0.2285:0.1496	.	226	Q8NGG6	OR8BC_HUMAN	Q	226	ENSP00000307159:H226Q	ENSP00000307159:H226Q	H	-	3	2	OR8B12	123918083	0.000000	0.05858	0.005000	0.12908	0.367000	0.29736	-0.998000	0.03701	-0.081000	0.12662	-0.142000	0.14014	CAC	-	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1		0.428	OR8B12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8B12	protein_coding	OTTHUMT00000387061.1	G			123918083	-1	no_errors	NM_001005195	genbank	human	provisional	54_36p	missense	SNP	0.000	T
FAM102A	399665	genome.wustl.edu	37	9	130710666	130710666	+	Nonsense_Mutation	SNP	C	C	A			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr9:130710666C>A	ENST00000373095.1	-	5	817	c.442G>T	c.(442-444)Gga>Tga	p.G148*	FAM102A_ENST00000300434.3_Intron|FAM102A_ENST00000373084.4_Nonsense_Mutation_p.G6*	NM_001035254.2	NP_001030331.1	Q5T9C2	F102A_HUMAN	family with sequence similarity 102, member A	148										breast(1)|cervix(1)|large_intestine(3)|lung(1)|ovary(4)	10						CAGGGATCTCCAGAGAGCAGG	0.642																																																0			9											114.0	101.0	106.0					9																	130710666		2203	4300	6503	129750487	SO:0001587	stop_gained	399665				CCDS6888.1, CCDS35150.1	9q34.11	2012-11-05	2005-11-17	2005-11-17	ENSG00000167106	ENSG00000167106			31419	protein-coding gene	gene with protein product	"""sym-3 homolog A (C. elegans)"""	610891	"""chromosome 9 open reading frame 132"""	C9orf132			Standard	NM_001035254		Approved	Eeig1, bA203J24.7, SYM-3A	uc004bsx.2	Q5T9C2	OTTHUMG00000020720	ENST00000373095.1:c.442G>T	9.37:g.130710666C>A	ENSP00000362187:p.Gly148*		129750487	A2A329|Q8TEL4	Nonsense_Mutation	SNP	HMMPfam_Eeig1	p.G148*	ENST00000373095.1	37	c.442	CCDS35150.1	9	.	.	.	.	.	.	.	.	.	.	C	41	8.710433	0.98925	.	.	ENSG00000167106	ENST00000373095;ENST00000373084	.	.	.	4.75	4.75	0.60458	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-5.9857	16.3282	0.82996	0.0:1.0:0.0:0.0	.	.	.	.	X	148;6	.	ENSP00000362176:G6X	G	-	1	0	FAM102A	129750487	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.708000	0.84633	2.189000	0.69895	0.563000	0.77884	GGA	-	HMMPfam_Eeig1		0.642	FAM102A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM102A	protein_coding	OTTHUMT00000054298.2	C			129750487	-1	no_errors	NM_001035254	genbank	human	validated	54_36p	nonsense	SNP	1.000	A
GPR148	344561	genome.wustl.edu	37	2	131487271	131487271	+	Missense_Mutation	SNP	C	C	G			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr2:131487271C>G	ENST00000309926.4	+	1	629	c.547C>G	c.(547-549)Ctt>Gtt	p.L183V		NM_207364.2	NP_997247.2	Q8TDV2	GP148_HUMAN	G protein-coupled receptor 148	183						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(15)|skin(3)|upper_aerodigestive_tract(1)	27	Colorectal(110;0.1)					CCCCACATTCCTTATTTGGCT	0.597																																																0			2											69.0	66.0	67.0					2																	131487271		2203	4300	6503	131203741	SO:0001583	missense	344561			AY255532	CCDS2163.1	2q21.2	2012-08-21			ENSG00000173302	ENSG00000173302		"""GPCR / Class A : Orphans"""	23623	protein-coding gene	gene with protein product						12679517	Standard	NM_207364		Approved	PGR6	uc002trv.2	Q8TDV2	OTTHUMG00000131655	ENST00000309926.4:c.547C>G	2.37:g.131487271C>G	ENSP00000308908:p.Leu183Val		131203741	Q2M369|Q86SP7|Q86U87	Missense_Mutation	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1	p.L183V	ENST00000309926.4	37	c.547	CCDS2163.1	2	.	.	.	.	.	.	.	.	.	.	.	5.242	0.230071	0.09969	.	.	ENSG00000173302	ENST00000309926	T	0.37752	1.18	2.86	1.92	0.25849	GPCR, rhodopsin-like superfamily (1);	0.000000	0.47852	U	0.000206	T	0.24044	0.0582	N	0.08118	0	0.09310	N	1	P	0.38551	0.636	P	0.47827	0.558	T	0.12400	-1.0549	10	0.32370	T	0.25	-9.6221	7.7295	0.28779	0.4483:0.5517:0.0:0.0	.	183	Q8TDV2	GP148_HUMAN	V	183	ENSP00000308908:L183V	ENSP00000308908:L183V	L	+	1	0	GPR148	131203741	0.007000	0.16637	0.055000	0.19348	0.032000	0.12392	0.246000	0.18160	0.456000	0.26937	0.462000	0.41574	CTT	-	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1		0.597	GPR148-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR148	protein_coding	OTTHUMT00000254552.3	C	XM_293092		131203741	+1	no_errors	NM_207364	genbank	human	provisional	54_36p	missense	SNP	0.001	G
COL6A6	131873	genome.wustl.edu	37	3	130290150	130290150	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr3:130290150G>A	ENST00000358511.6	+	6	2921	c.2890G>A	c.(2890-2892)Gac>Aac	p.D964N	COL6A6_ENST00000453409.2_Missense_Mutation_p.D964N	NM_001102608.1	NP_001096078.1	A6NMZ7	CO6A6_HUMAN	collagen, type VI, alpha 6	964	Nonhelical region.|VWFA 5. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(30)|lung(57)|ovary(8)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	134						AGGATCAAGCGACAAGTACTT	0.502																																																0			3											48.0	46.0	47.0					3																	130290150		1968	4160	6128	131772840	SO:0001583	missense	131873			AL713792	CCDS46911.1	3q22.1	2013-01-16			ENSG00000206384	ENSG00000206384		"""Collagens"""	27023	protein-coding gene	gene with protein product							Standard	NM_001102608		Approved		uc010htl.3	A6NMZ7	OTTHUMG00000159653	ENST00000358511.6:c.2890G>A	3.37:g.130290150G>A	ENSP00000351310:p.Asp964Asn		131772840	A7DZQ0|A7DZQ1|A7DZQ2|Q69YT0	Missense_Mutation	SNP	HMMSmart_SM00327,superfamily_vWA-like,HMMPfam_VWA,HMMPfam_Collagen	p.D964N	ENST00000358511.6	37	c.2890	CCDS46911.1	3	.	.	.	.	.	.	.	.	.	.	G	14.87	2.665569	0.47677	.	.	ENSG00000206384	ENST00000358511;ENST00000453409	T;T	0.78126	-1.15;-1.15	4.82	4.82	0.62117	von Willebrand factor, type A (3);	0.197907	0.35378	N	0.003253	T	0.81226	0.4778	L	0.45051	1.395	0.33048	D	0.53237	D	0.76494	0.999	D	0.66979	0.948	T	0.81852	-0.0742	10	0.25106	T	0.35	.	12.7395	0.57243	0.0828:0.0:0.9171:0.0	.	964	A6NMZ7	CO6A6_HUMAN	N	964	ENSP00000351310:D964N;ENSP00000399236:D964N	ENSP00000351310:D964N	D	+	1	0	COL6A6	131772840	0.998000	0.40836	0.937000	0.37676	0.833000	0.47200	3.424000	0.52764	2.403000	0.81681	0.561000	0.74099	GAC	-	superfamily_vWA-like,HMMSmart_SM00327,HMMPfam_VWA		0.502	COL6A6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	COL6A6	protein_coding	OTTHUMT00000356705.5	G	NM_001102608		131772840	+1	no_errors	NM_001102608	genbank	human	provisional	54_36p	missense	SNP	0.753	A
NUDT16	131870	genome.wustl.edu	37	3	131102092	131102092	+	Silent	SNP	C	C	T			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr3:131102092C>T	ENST00000521288.1	+	3	526	c.495C>T	c.(493-495)ggC>ggT	p.G165G	NUDT16_ENST00000537561.1_Silent_p.G119G|NUDT16_ENST00000359850.3_Silent_p.G132G|RP11-933H2.4_ENST00000502521.1_RNA|NUDT16_ENST00000502852.1_3'UTR			Q96DE0	NUD16_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 16	165	Nudix hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00794}.				adenosine to inosine editing (GO:0006382)|dephosphorylation (GO:0016311)|dITP catabolic process (GO:0035863)|IDP catabolic process (GO:0046709)|mRNA catabolic process (GO:0006402)|negative regulation of rRNA processing (GO:2000233)|nucleobase-containing small molecule catabolic process (GO:0034656)|nucleobase-containing small molecule metabolic process (GO:0055086)|positive regulation of cell cycle process (GO:0090068)|positive regulation of cell proliferation (GO:0008284)|positive regulation of double-strand break repair (GO:2000781)|proteolysis (GO:0006508)|small molecule metabolic process (GO:0044281)|snoRNA catabolic process (GO:0016077)|XDP catabolic process (GO:1901639)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	cobalt ion binding (GO:0050897)|dIDP diphosphatase activity (GO:0097383)|dITP diphosphatase activity (GO:0035870)|GTP binding (GO:0005525)|inosine-diphosphatase activity (GO:0090450)|ITP binding (GO:1901641)|m7G(5')pppN diphosphatase activity (GO:0050072)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|metalloexopeptidase activity (GO:0008235)|mRNA binding (GO:0003729)|nucleotide phosphatase activity, acting on free nucleotides (GO:0098519)|protein homodimerization activity (GO:0042803)|snoRNA binding (GO:0030515)|XTP binding (GO:1901640)			large_intestine(1)|lung(6)	7						CCTTTATTGGCTCTGCGCGGG	0.557																																																0			3											123.0	109.0	114.0					3																	131102092		2203	4300	6503	132584782	SO:0001819	synonymous_variant	0			AK055827	CCDS3070.1, CCDS3070.2, CCDS54640.1, CCDS54641.1	3q21.3	2005-01-25						"""Nudix motif containing"""	26442	protein-coding gene	gene with protein product						12477932	Standard	NM_152395		Approved	FLJ31265	uc021xec.1	Q96DE0		ENST00000521288.1:c.495C>T	3.37:g.131102092C>T			132584782	B4E3B4|E9PED4|F5GYJ1|Q96N82	Missense_Mutation	SNP	NULL	p.A30T	ENST00000521288.1	37	c.88	CCDS3070.2	3																																																																																			-	NULL		0.557	NUDT16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC100133263	protein_coding	OTTHUMT00000356537.9	C	NM_152395		132584782	-1	no_errors	XM_001717995	genbank	human	model	54_36p	missense	SNP	0.008	T
ATP11C	286410	genome.wustl.edu	37	X	138908964	138908964	+	Missense_Mutation	SNP	G	G	C			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chrX:138908964G>C	ENST00000327569.3	-	2	153	c.55C>G	c.(55-57)Cga>Gga	p.R19G	ATP11C_ENST00000370543.1_Missense_Mutation_p.R19G|ATP11C_ENST00000359686.2_Missense_Mutation_p.R19G|ATP11C_ENST00000370557.1_Missense_Mutation_p.R16G|ATP11C_ENST00000361648.2_Missense_Mutation_p.R19G	NM_173694.4	NP_775965	Q8NB49	AT11C_HUMAN	ATPase, class VI, type 11C	19					ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|positive regulation of B cell differentiation (GO:0045579)|pre-B cell differentiation (GO:0002329)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(2)|central_nervous_system(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(31)|ovary(5)|prostate(1)|skin(3)	75	Acute lymphoblastic leukemia(192;0.000127)					GTGCCAACTCGTTTCTCTTCT	0.398																																																0			X											125.0	104.0	111.0					X																	138908964		2203	4300	6503	138736630	SO:0001583	missense	286410			AJ580094	CCDS14668.1, CCDS35410.1	Xq27.1	2011-06-09	2007-09-19		ENSG00000101974	ENSG00000101974		"""ATPases / P-type"""	13554	protein-coding gene	gene with protein product		300516	"""ATPase, Class VI, type 11C"""			11015572	Standard	NM_173694		Approved	ATPIG, ATPIQ	uc004faz.3	Q8NB49	OTTHUMG00000022538	ENST00000327569.3:c.55C>G	X.37:g.138908964G>C	ENSP00000332756:p.Arg19Gly		138736630	Q5JT69|Q5JT70|Q5JT71|Q5JT72|Q5JT73|Q6ZND5|Q6ZU50|Q6ZUP7|Q70IJ9|Q70IK0|Q8WX24	Missense_Mutation	SNP	HMMPfam_E1-E2_ATPase,superfamily_Calcium ATPase transduction domain A,superfamily_HAD-like,PatternScan_ATPASE_E1_E2,superfamily_Metal cation-transporting ATPase ATP-binding domain N	p.R19G	ENST00000327569.3	37	c.55	CCDS14668.1	X	.	.	.	.	.	.	.	.	.	.	G	16.56	3.157321	0.57259	.	.	ENSG00000101974	ENST00000370557;ENST00000361648;ENST00000327569;ENST00000370543;ENST00000359686	T;T;T;T;T	0.54279	0.58;0.58;0.58;0.58;0.58	4.93	4.05	0.47172	.	0.071820	0.56097	D	0.000032	T	0.53722	0.1814	L	0.28504	0.86	0.46823	D	0.999214	D;P	0.60160	0.987;0.89	P;P	0.61397	0.888;0.496	T	0.46048	-0.9219	10	0.23302	T	0.38	.	11.3068	0.49340	0.0:0.0:0.8051:0.1949	.	19;19	Q8NB49-3;Q8NB49	.;AT11C_HUMAN	G	16;19;19;19;19	ENSP00000359588:R16G;ENSP00000355165:R19G;ENSP00000332756:R19G;ENSP00000359574:R19G;ENSP00000352715:R19G	ENSP00000332756:R19G	R	-	1	2	ATP11C	138736630	0.989000	0.36119	1.000000	0.80357	0.997000	0.91878	1.678000	0.37586	1.156000	0.42514	0.544000	0.68410	CGA	-	NULL		0.398	ATP11C-008	KNOWN	basic|CCDS	protein_coding	ATP11C	protein_coding	OTTHUMT00000354945.1	G	NM_173694		138736630	-1	no_errors	NM_173694	genbank	human	validated	54_36p	missense	SNP	0.988	C
CEP70	80321	genome.wustl.edu	37	3	138227333	138227333	+	Missense_Mutation	SNP	T	T	G			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr3:138227333T>G	ENST00000264982.3	-	12	1264	c.998A>C	c.(997-999)gAg>gCg	p.E333A	CEP70_ENST00000481834.1_Missense_Mutation_p.E333A|CEP70_ENST00000484888.1_Missense_Mutation_p.E333A|CEP70_ENST00000542237.1_Missense_Mutation_p.E313A|CEP70_ENST00000489254.1_Missense_Mutation_p.E181A	NM_024491.2	NP_077817.2	Q8NHQ1	CEP70_HUMAN	centrosomal protein 70kDa	333					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(6)|skin(3)	24						TTTGCTGGGCTCATCTTTCTT	0.348																																																0			3											246.0	252.0	250.0					3																	138227333		2203	4300	6503	139710023	SO:0001583	missense	80321			AF202146	CCDS3102.1, CCDS75022.1, CCDS75023.1, CCDS75024.1	3q22.3	2014-02-20			ENSG00000114107	ENSG00000114107			29972	protein-coding gene	gene with protein product		614310				14654843	Standard	XM_005247802		Approved	BITE, FLJ13036	uc003esl.3	Q8NHQ1	OTTHUMG00000159891	ENST00000264982.3:c.998A>C	3.37:g.138227333T>G	ENSP00000264982:p.Glu333Ala		139710023	B7Z5I8|B7Z7E8|D3DNE9|F5GZX8|Q96B31|Q9H2C3|Q9H2Z1|Q9H940	Missense_Mutation	SNP	NULL	p.E333A	ENST00000264982.3	37	c.998	CCDS3102.1	3	.	.	.	.	.	.	.	.	.	.	T	13.52	2.263046	0.39995	.	.	ENSG00000114107	ENST00000264982;ENST00000542237;ENST00000489254;ENST00000484888;ENST00000474781;ENST00000481834	T;T;T;T;T;T	0.48836	1.38;1.39;0.8;1.38;1.38;1.37	5.24	4.05	0.47172	.	0.360490	0.29861	N	0.011010	T	0.43389	0.1245	L	0.60455	1.87	0.26704	N	0.971117	P;P;B;P	0.40731	0.728;0.59;0.063;0.59	B;B;B;B	0.43445	0.42;0.35;0.02;0.35	T	0.24190	-1.0167	10	0.15952	T	0.53	-1.4412	8.1529	0.31152	0.1783:0.0:0.0:0.8217	.	181;313;333;333	B7Z2D2;F5GZX8;Q8NHQ1-2;Q8NHQ1	.;.;.;CEP70_HUMAN	A	333;313;181;333;315;333	ENSP00000264982:E333A;ENSP00000444128:E313A;ENSP00000417821:E181A;ENSP00000419231:E333A;ENSP00000419833:E315A;ENSP00000417465:E333A	ENSP00000264982:E333A	E	-	2	0	CEP70	139710023	0.970000	0.33590	0.216000	0.23742	0.889000	0.51656	2.057000	0.41365	0.961000	0.38030	0.533000	0.62120	GAG	-	NULL		0.348	CEP70-001	KNOWN	basic|CCDS	protein_coding	CEP70	protein_coding	OTTHUMT00000358001.1	T	NM_024491		139710023	-1	no_errors	NM_024491	genbank	human	validated	54_36p	missense	SNP	0.609	G
PCDHGA6	56109	genome.wustl.edu	37	5	140755569	140755569	+	Missense_Mutation	SNP	A	A	G			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr5:140755569A>G	ENST00000517434.1	+	1	1919	c.1919A>G	c.(1918-1920)cAg>cGg	p.Q640R	PCDHGB2_ENST00000522605.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron	NM_018919.2|NM_032086.1	NP_061742.1|NP_114475.1	Q9Y5G7	PCDG6_HUMAN	protocadherin gamma subfamily A, 6	640	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|large_intestine(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCGCTCAAGCAGAGCCTAGTG	0.701																																																0			5											40.0	50.0	47.0					5																	140755569		2202	4298	6500	140735753	SO:0001583	missense	56109			AF152513	CCDS54926.1, CCDS75335.1	5q31	2010-01-26				ENSG00000253731		"""Cadherins / Protocadherins : Clustered"""	8704	other	protocadherin		606293				10380929	Standard	NM_018919		Approved	PCDH-GAMMA-A6		Q9Y5G7		ENST00000517434.1:c.1919A>G	5.37:g.140755569A>G	ENSP00000429601:p.Gln640Arg		140735753	A6H8K7|B2RN55|Q9Y5D1	Missense_Mutation	SNP	superfamily_Cadherin-like,HMMPfam_Cadherin_2,HMMSmart_SM00112,PatternScan_CADHERIN_1,HMMPfam_Cadherin	p.Q640R	ENST00000517434.1	37	c.1919	CCDS54926.1	5	.	.	.	.	.	.	.	.	.	.	.	17.01	3.279581	0.59758	.	.	ENSG00000253731	ENST00000517434	T	0.52754	0.65	4.87	3.71	0.42584	Cadherin (4);Cadherin-like (1);	0.000000	0.30036	U	0.010562	T	0.66509	0.2796	M	0.84585	2.705	0.22629	N	0.998912	D;D	0.65815	0.995;0.988	D;D	0.67548	0.949;0.952	T	0.59139	-0.7510	10	0.87932	D	0	.	7.8759	0.29592	0.7892:0.1374:0.0734:0.0	.	640;640	Q9Y5G7-2;Q9Y5G7	.;PCDG6_HUMAN	R	640	ENSP00000429601:Q640R	ENSP00000429601:Q640R	Q	+	2	0	PCDHGA6	140735753	0.992000	0.36948	1.000000	0.80357	0.984000	0.73092	4.161000	0.58170	0.989000	0.38761	0.460000	0.39030	CAG	-	superfamily_Cadherin-like,HMMPfam_Cadherin,HMMSmart_SM00112		0.701	PCDHGA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA6	protein_coding	OTTHUMT00000374743.1	A	NM_018919		140735753	+1	no_errors	NM_018919	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
RP6-206I17.1	0	genome.wustl.edu	37	1	143744064	143744064	+	lincRNA	SNP	G	G	C	rs188779600	byFrequency	TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr1:143744064G>C	ENST00000445753.1	-	0	210																											TCCCGCGTTCGTTGCAGCAGC	0.667													g|||	35	0.00698882	0.0008	0.013	5008	,	,		11347	0.0		0.0189	False		,,,				2504	0.0061															0			1																																								142535587			727820																															1.37:g.143744064G>C			142535587		RNA	SNP	-	NULL	ENST00000445753.1	37	NULL		1																																																																																			-	-		0.667	RP6-206I17.1-001	KNOWN	basic	lincRNA	LOC727820	lincRNA	OTTHUMT00000037956.1	G			142535587	-1	no_errors	XR_041980	genbank	human	model	54_36p	rna	SNP	0.002	C
CNGA2	1260	genome.wustl.edu	37	X	150912849	150912849	+	Missense_Mutation	SNP	C	C	A			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chrX:150912849C>A	ENST00000329903.4	+	6	1907	c.1874C>A	c.(1873-1875)gCc>gAc	p.A625D		NM_005140.1	NP_005131.1	Q16280	CNGA2_HUMAN	cyclic nucleotide gated channel alpha 2	625					phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|sensory perception of smell (GO:0007608)	integral component of plasma membrane (GO:0005887)	cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)			breast(4)|endometrium(4)|large_intestine(5)|lung(34)|prostate(2)	49	Acute lymphoblastic leukemia(192;6.56e-05)					TACACGGGGGCCCAGCAGAAG	0.547																																																0			X											113.0	95.0	101.0					X																	150912849		2203	4300	6503	150663505	SO:0001583	missense	1260			S76067	CCDS14701.1	Xq27	2011-07-05			ENSG00000183862	ENSG00000183862		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2149	protein-coding gene	gene with protein product		300338		CNCA1, CNCA		7532814, 16382102	Standard	NM_005140		Approved	CNG2, OCNC1, OCNCa, OCNCALPHA, OCNCalpha, FLJ46312	uc004fey.1	Q16280	OTTHUMG00000024173	ENST00000329903.4:c.1874C>A	X.37:g.150912849C>A	ENSP00000328478:p.Ala625Asp		150663505	A0AVD0	Missense_Mutation	SNP	superfamily_SSF81324,HMMPfam_Ion_trans,superfamily_cNMP_binding,HMMSmart_cNMP,HMMPfam_cNMP_binding,PatternScan_CNMP_BINDING_1,PatternScan_CNMP_BINDING_2	p.A625D	ENST00000329903.4	37	c.1874	CCDS14701.1	X	.	.	.	.	.	.	.	.	.	.	C	16.05	3.011794	0.54468	.	.	ENSG00000183862	ENST00000329903	D	0.97352	-4.35	5.47	5.47	0.80525	.	0.052830	0.85682	D	0.000000	D	0.96386	0.8821	M	0.65498	2.005	0.46336	D	0.998998	P	0.50272	0.933	P	0.44860	0.462	D	0.96687	0.9508	10	0.66056	D	0.02	.	15.561	0.76244	0.0:1.0:0.0:0.0	.	625	Q16280	CNGA2_HUMAN	D	625	ENSP00000328478:A625D	ENSP00000328478:A625D	A	+	2	0	CNGA2	150663505	1.000000	0.71417	0.993000	0.49108	0.856000	0.48823	7.487000	0.81328	2.269000	0.75478	0.600000	0.82982	GCC	-	NULL		0.547	CNGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNGA2	protein_coding	OTTHUMT00000060888.1	C	NM_005140		150663505	+1	no_errors	NM_005140	genbank	human	validated	54_36p	missense	SNP	1.000	A
PLCH1	23007	genome.wustl.edu	37	3	155271943	155271943	+	Missense_Mutation	SNP	T	T	C			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr3:155271943T>C	ENST00000340059.7	-	8	1075	c.1076A>G	c.(1075-1077)cAt>cGt	p.H359R	PLCH1_ENST00000447496.2_Missense_Mutation_p.H359R|PLCH1_ENST00000460012.1_Missense_Mutation_p.H341R|PLCH1_ENST00000414191.1_Missense_Mutation_p.H341R|PLCH1_ENST00000334686.6_Missense_Mutation_p.H341R|PLCH1_ENST00000494598.1_Missense_Mutation_p.H359R	NM_001130960.1	NP_001124432.1	Q4KWH8	PLCH1_HUMAN	phospholipase C, eta 1	359	PI-PLC X-box. {ECO:0000255|PROSITE- ProRule:PRU00270}.				inositol phosphate metabolic process (GO:0043647)|lipid catabolic process (GO:0016042)|phosphatidylinositol-mediated signaling (GO:0048015)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase C activity (GO:0050429)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)			NS(3)|breast(3)|endometrium(9)|kidney(4)|large_intestine(20)|lung(45)|ovary(2)|prostate(5)|skin(8)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	107			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			AGTGTAACCATGATGTACTAC	0.403																																																0			3											143.0	130.0	135.0					3																	155271943		2203	4300	6503	156754637	SO:0001583	missense	23007			AB028992	CCDS33881.1, CCDS46939.1, CCDS46940.1	3q25	2013-01-10	2006-03-16	2006-03-16	ENSG00000114805	ENSG00000114805	3.1.4.11	"""EF-hand domain containing"""	29185	protein-coding gene	gene with protein product		612835	"""phospholipase C-like 3"""	PLCL3		15702972	Standard	NM_014996		Approved	KIAA1069, MGC117152, DKFZp434C1372, PLCeta1	uc021xge.1	Q4KWH8	OTTHUMG00000158477	ENST00000340059.7:c.1076A>G	3.37:g.155271943T>C	ENSP00000345988:p.His359Arg		156754637	Q29RV9|Q4KWH9|Q68CN0|Q86XK4|Q9H9U2|Q9UPT3	Missense_Mutation	SNP	superfamily_SSF50729,HMMPfam_PH,HMMSmart_PH,HMMSmart_EFh,HMMPfam_efhand,PatternScan_EF_HAND_1,superfamily_SSF47473,HMMPfam_efhand_like,HMMSmart_PLCXc,HMMPfam_PI-PLC-X,superfamily_PLC-like_Pdiesterase_TIM-brl,HMMPfam_PI-PLC-Y,HMMSmart_PLCYc,superfamily_C2_CaLB,HMMSmart_C2,HMMPfam_C2	p.H341R	ENST00000340059.7	37	c.1022	CCDS46939.1	3	.	.	.	.	.	.	.	.	.	.	T	23.1	4.377315	0.82682	.	.	ENSG00000114805	ENST00000494598;ENST00000460012;ENST00000447496;ENST00000340059;ENST00000334686;ENST00000414191	T;T;T;T;T;T	0.75589	-0.95;-0.95;-0.95;-0.95;-0.95;-0.95	5.75	5.75	0.90469	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);Phospholipase C, phosphatidylinositol-specific , X domain (3);	0.000000	0.85682	D	0.000000	D	0.90376	0.6988	H	0.95365	3.66	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.93161	0.6558	10	0.87932	D	0	.	16.0681	0.80903	0.0:0.0:0.0:1.0	.	341;359;359	Q4KWH8-2;Q4KWH8;Q4KWH8-3	.;PLCH1_HUMAN;.	R	359;341;359;359;341;341	ENSP00000419100:H359R;ENSP00000417502:H341R;ENSP00000402759:H359R;ENSP00000345988:H359R;ENSP00000335469:H341R;ENSP00000412977:H341R	ENSP00000335469:H341R	H	-	2	0	PLCH1	156754637	1.000000	0.71417	0.958000	0.39756	0.897000	0.52465	7.878000	0.87231	2.188000	0.69820	0.528000	0.53228	CAT	-	HMMSmart_PLCXc,HMMPfam_PI-PLC-X,superfamily_PLC-like_Pdiesterase_TIM-brl		0.403	PLCH1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PLCH1	protein_coding	OTTHUMT00000351125.1	T	NM_014996		156754637	-1	no_errors	NM_014996	genbank	human	validated	54_36p	missense	SNP	1.000	C
F5	2153	genome.wustl.edu	37	1	169511801	169511801	+	Missense_Mutation	SNP	C	C	A			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr1:169511801C>A	ENST00000367797.3	-	13	2728	c.2527G>T	c.(2527-2529)Gat>Tat	p.D843Y	F5_ENST00000367796.3_Missense_Mutation_p.D848Y	NM_000130.4	NP_000121	P12259	FA5_HUMAN	coagulation factor V (proaccelerin, labile factor)	843	B.				blood circulation (GO:0008015)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	copper ion binding (GO:0005507)			NS(1)|breast(4)|central_nervous_system(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(55)|ovary(3)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(1)	128	all_hematologic(923;0.208)				ART-123(DB05777)|Drotrecogin alfa(DB00055)	CCTGTGACATCTGGCTGTAGA	0.458																																																0			1											169.0	163.0	165.0					1																	169511801		2203	4300	6503	167778425	SO:0001583	missense	2153			M14335	CCDS1281.1	1q23	2012-10-02			ENSG00000198734	ENSG00000198734			3542	protein-coding gene	gene with protein product		612309					Standard	NM_000130		Approved		uc001ggg.1	P12259	OTTHUMG00000034595	ENST00000367797.3:c.2527G>T	1.37:g.169511801C>A	ENSP00000356771:p.Asp843Tyr		167778425	A8K6E8|Q14285|Q2EHR5|Q5R346|Q5R347|Q6UPU6|Q8WWQ6	Missense_Mutation	SNP	superfamily_Cupredoxins,HMMPfam_Cu-oxidase_3,PatternScan_MULTICOPPER_OXIDASE1,HMMPfam_LSPR,superfamily_Galactose-binding domain-like,HMMSmart_SM00231,HMMPfam_F5_F8_type_C,PatternScan_FA58C_1,PatternScan_FA58C_2	p.D843Y	ENST00000367797.3	37	c.2527	CCDS1281.1	1	.	.	.	.	.	.	.	.	.	.	C	16.00	2.999503	0.54147	.	.	ENSG00000198734	ENST00000367797;ENST00000367796	T;T	0.21734	1.99;1.99	5.97	-0.935	0.10423	.	1.175370	0.05851	N	0.621279	T	0.04770	0.0129	L	0.39898	1.24	0.09310	N	1	B	0.30406	0.278	B	0.21360	0.034	T	0.39375	-0.9617	10	0.66056	D	0.02	-0.1212	2.003	0.03471	0.1242:0.3499:0.1217:0.4042	.	843	P12259	FA5_HUMAN	Y	843;848	ENSP00000356771:D843Y;ENSP00000356770:D848Y	ENSP00000356770:D848Y	D	-	1	0	F5	167778425	0.000000	0.05858	0.001000	0.08648	0.173000	0.22820	-0.196000	0.09532	-0.157000	0.11059	0.585000	0.79938	GAT	-	NULL		0.458	F5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	F5	protein_coding	OTTHUMT00000083712.1	C	NM_000130		167778425	-1	no_errors	NM_000130	genbank	human	reviewed	54_36p	missense	SNP	0.001	A
THBS2	7058	genome.wustl.edu	37	6	169625424	169625424	+	Silent	SNP	G	G	A			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr6:169625424G>A	ENST00000366787.3	-	18	2838	c.2589C>T	c.(2587-2589)gaC>gaT	p.D863D	THBS2_ENST00000488355.1_5'Flank|XXyac-YX65C7_A.2_ENST00000444188.1_RNA	NM_003247.2	NP_003238.2	P35442	TSP2_HUMAN	thrombospondin 2	863					cell adhesion (GO:0007155)|negative regulation of angiogenesis (GO:0016525)|positive regulation of synapse assembly (GO:0051965)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|platelet alpha granule (GO:0031091)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			NS(3)|biliary_tract(1)|endometrium(8)|kidney(3)|large_intestine(23)|liver(1)|lung(56)|ovary(6)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	111		Breast(66;1.78e-05)|Ovarian(120;0.0728)|Esophageal squamous(34;0.247)		OV - Ovarian serous cystadenocarcinoma(33;1.85e-21)|BRCA - Breast invasive adenocarcinoma(81;1.43e-06)|GBM - Glioblastoma multiforme(31;0.000379)		cgtcatctatgtcctcgttgt	0.582																																					Esophageal Squamous(91;219 1934 18562 44706)											0			6											232.0	186.0	202.0					6																	169625424		2193	4295	6488	169367349	SO:0001819	synonymous_variant	7058				CCDS34574.1	6q27	2008-07-28			ENSG00000186340	ENSG00000186340			11786	protein-coding gene	gene with protein product		188061				18455130	Standard	NM_003247		Approved	TSP2	uc003qwt.3	P35442	OTTHUMG00000045408	ENST00000366787.3:c.2589C>T	6.37:g.169625424G>A			169367349	A6H8N1|A7E232|Q5RI52	Silent	SNP	PatternScan_EGF_1,HMMSmart_TSPN,superfamily_ConA_like_lec_gl,HMMPfam_VWC,HMMSmart_VWC,PatternScan_VWFC_1,superfamily_TSP1,HMMSmart_TSP1,HMMPfam_TSP_1,superfamily_SSF57196,HMMSmart_EGF,HMMPfam_EGF_CA,HMMPfam_EGF,PatternScan_EGF_2,superfamily_SSF103647,HMMPfam_TSP_3,HMMPfam_TSP_C	p.D863	ENST00000366787.3	37	c.2589	CCDS34574.1	6																																																																																			-	superfamily_SSF103647,HMMPfam_TSP_3		0.582	THBS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THBS2	protein_coding	OTTHUMT00000105439.1	G	NM_003247		169367349	-1	no_errors	NM_003247	genbank	human	reviewed	54_36p	silent	SNP	1.000	A
TNR	7143	genome.wustl.edu	37	1	175292508	175292508	+	Missense_Mutation	SNP	C	C	G			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr1:175292508C>G	ENST00000367674.2	-	23	4770	c.4062G>C	c.(4060-4062)caG>caC	p.Q1354H	RP3-518E13.2_ENST00000569593.1_RNA|TNR_ENST00000263525.2_Missense_Mutation_p.Q1354H			Q92752	TENR_HUMAN	tenascin R	1354					associative learning (GO:0008306)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|negative regulation of axon extension involved in regeneration (GO:0048692)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of synaptic transmission (GO:0050805)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transmission of nerve impulse (GO:0051971)|synapse organization (GO:0050808)|telencephalon cell migration (GO:0022029)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)				NS(3)|breast(7)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|lung(98)|ovary(4)|pancreas(5)|prostate(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	177	Renal(580;0.146)					ACTGTAAGGACTGCCGTTTTC	0.468																																																0			1											145.0	131.0	136.0					1																	175292508		2203	4300	6503	173559131	SO:0001583	missense	7143			X98085	CCDS1318.1	1q24	2013-02-11	2012-07-12		ENSG00000116147	ENSG00000116147		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11953	protein-coding gene	gene with protein product	"""restrictin"", ""janusin"""	601995				8626505, 8940128	Standard	NM_003285		Approved		uc009wwu.1	Q92752	OTTHUMG00000034876	ENST00000367674.2:c.4062G>C	1.37:g.175292508C>G	ENSP00000356646:p.Gln1354His		173559131	C9J563|Q15568|Q5R3G0	Missense_Mutation	SNP	PatternScan_EGF_1,PatternScan_EGF_2,HMMSmart_SM00181,HMMPfam_EGF_2,superfamily_EGF/Laminin,HMMPfam_fn3,HMMSmart_SM00060,superfamily_Fibronectin type III,HMMSmart_SM00186,HMMPfam_Fibrinogen_C,superfamily_Fibrinogen C-terminal domain-like	p.Q1354H	ENST00000367674.2	37	c.4062	CCDS1318.1	1	.	.	.	.	.	.	.	.	.	.	C	10.14	1.267469	0.23136	.	.	ENSG00000116147	ENST00000367674;ENST00000263525;ENST00000367673	T;T	0.26223	1.75;1.75	5.37	3.48	0.39840	.	0.064020	0.64402	D	0.000010	T	0.17577	0.0422	N	0.22421	0.69	0.23776	N	0.996873	B	0.10296	0.003	B	0.04013	0.001	T	0.20042	-1.0287	10	0.87932	D	0	.	10.7215	0.46042	0.0:0.8417:0.0:0.1583	.	1354	Q92752	TENR_HUMAN	H	1354;1354;1264	ENSP00000356646:Q1354H;ENSP00000263525:Q1354H	ENSP00000263525:Q1354H	Q	-	3	2	TNR	173559131	1.000000	0.71417	0.997000	0.53966	0.200000	0.23975	1.651000	0.37302	0.626000	0.30322	0.561000	0.74099	CAG	-	NULL		0.468	TNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNR	protein_coding	OTTHUMT00000084414.4	C	NM_003285		173559131	-1	no_errors	NM_003285	genbank	human	validated	54_36p	missense	SNP	1.000	G
NMNAT2	23057	genome.wustl.edu	37	1	183253881	183253881	+	Missense_Mutation	SNP	A	A	G			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr1:183253881A>G	ENST00000287713.6	-	6	827	c.493T>C	c.(493-495)Tgt>Cgt	p.C165R	NMNAT2_ENST00000294868.4_Missense_Mutation_p.C160R|NMNAT2_ENST00000473046.1_5'UTR	NM_015039.3	NP_055854.1	Q9BZQ4	NMNA2_HUMAN	nicotinamide nucleotide adenylyltransferase 2	165					NAD biosynthetic process (GO:0009435)|NAD metabolic process (GO:0019674)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|late endosome (GO:0005770)|synapse (GO:0045202)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|nicotinamide-nucleotide adenylyltransferase activity (GO:0000309)|nicotinate-nucleotide adenylyltransferase activity (GO:0004515)			endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(2)|lung(7)|skin(2)	18						GGGCGGACACAGCAGATCCGG	0.537																																																0			1											56.0	58.0	58.0					1																	183253881		2203	4300	6503	181520504	SO:0001583	missense	23057			AF288395	CCDS1353.1, CCDS1354.1	1q25	2008-02-05	2003-04-30	2003-05-02	ENSG00000157064	ENSG00000157064			16789	protein-coding gene	gene with protein product		608701	"""chromosome 1 open reading frame 15"""	C1orf15		11318611, 12359228	Standard	NM_015039		Approved	KIAA0479, PNAT2	uc001gqc.2	Q9BZQ4	OTTHUMG00000035519	ENST00000287713.6:c.493T>C	1.37:g.183253881A>G	ENSP00000287713:p.Cys165Arg		181520504	O75067|Q5T1Q3|Q8WU99|Q96QW1	Missense_Mutation	SNP	superfamily_Nucleotidylyl transferase,HMMPfam_CTP_transf_2	p.C165R	ENST00000287713.6	37	c.493	CCDS1353.1	1	.	.	.	.	.	.	.	.	.	.	A	15.33	2.802023	0.50315	.	.	ENSG00000157064	ENST00000287713;ENST00000294868	D;D	0.98028	-4.67;-4.58	5.32	4.18	0.49190	Cytidylyltransferase (1);	0.105820	0.64402	D	0.000003	D	0.97514	0.9186	L	0.47716	1.5	0.80722	D	1	D;D;D	0.76494	0.999;0.995;0.994	D;P;P	0.77004	0.989;0.829;0.808	D	0.95643	0.8700	10	0.21014	T	0.42	-6.5026	12.1299	0.53936	0.8564:0.1435:0.0:0.0	.	165;165;160	A8K5S5;Q9BZQ4;Q9BZQ4-2	.;NMNA2_HUMAN;.	R	165;160	ENSP00000287713:C165R;ENSP00000294868:C160R	ENSP00000287713:C165R	C	-	1	0	NMNAT2	181520504	1.000000	0.71417	0.998000	0.56505	0.897000	0.52465	8.375000	0.90135	0.849000	0.35215	0.459000	0.35465	TGT	-	superfamily_Nucleotidylyl transferase,HMMPfam_CTP_transf_2		0.537	NMNAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NMNAT2	protein_coding	OTTHUMT00000086255.1	A			181520504	-1	no_errors	NM_015039	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
TROVE2	6738	genome.wustl.edu	37	1	193038630	193038630	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr1:193038630G>A	ENST00000367446.3	+	2	656	c.446G>A	c.(445-447)cGg>cAg	p.R149Q	TROVE2_ENST00000416058.2_5'UTR|TROVE2_ENST00000367443.1_Missense_Mutation_p.R149Q|TROVE2_ENST00000367445.3_Missense_Mutation_p.R149Q|TROVE2_ENST00000460715.2_Intron|TROVE2_ENST00000367441.1_Missense_Mutation_p.R149Q|TROVE2_ENST00000367444.3_Missense_Mutation_p.R149Q|TROVE2_ENST00000400968.2_Missense_Mutation_p.R149Q|TROVE2_ENST00000432079.1_Intron	NM_004600.5	NP_004591.2	P10155	RO60_HUMAN	TROVE domain family, member 2	149	RNA-binding. {ECO:0000250}.|TROVE. {ECO:0000255|PROSITE- ProRule:PRU00343}.				cilium morphogenesis (GO:0060271)|immune system development (GO:0002520)|response to UV (GO:0009411)|smoothened signaling pathway (GO:0007224)|transcription from RNA polymerase III promoter (GO:0006383)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	metal ion binding (GO:0046872)|RNA binding (GO:0003723)|U2 snRNA binding (GO:0030620)			biliary_tract(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(7)|prostate(2)|urinary_tract(1)	21						CGTGCCCTCCGGAAGGCTATA	0.448																																																0			1											96.0	92.0	93.0					1																	193038630		1939	4141	6080	191305253	SO:0001583	missense	6738			BC036658	CCDS41449.1, CCDS1379.1, CCDS41450.1, CCDS41450.2, CCDS53451.1	1q31	2014-08-06	2005-06-14	2005-06-14	ENSG00000116747	ENSG00000116747			11313	protein-coding gene	gene with protein product		600063	"""Sjogren syndrome antigen A2 (60kDa, ribonucleoprotein autoantigen SS-A/Ro)"""	SSA2		8188321	Standard	NM_001042369		Approved	Ro60	uc001gss.3	P10155	OTTHUMG00000035675	ENST00000367446.3:c.446G>A	1.37:g.193038630G>A	ENSP00000356416:p.Arg149Gln		191305253	B2RBB9|Q5LJ98|Q5LJ99|Q5LJA0|Q86WL3|Q86WL4|Q92787|Q9H1W6	Missense_Mutation	SNP	HMMPfam_TROVE	p.R149Q	ENST00000367446.3	37	c.446	CCDS1379.1	1	.	.	.	.	.	.	.	.	.	.	G	33	5.246553	0.95305	.	.	ENSG00000116747	ENST00000400968;ENST00000367446;ENST00000367443;ENST00000367445;ENST00000367444;ENST00000367441;ENST00000512587	T;T;T;T;T;T;T	0.22945	1.93;1.93;1.93;1.93;1.93;1.93;1.93	5.75	5.75	0.90469	TROVE (2);	0.000000	0.85682	D	0.000000	T	0.53094	0.1775	M	0.69823	2.125	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.968;0.968;0.956;0.999	T	0.43972	-0.9358	10	0.41790	T	0.15	-3.3768	19.9522	0.97203	0.0:0.0:1.0:0.0	.	149;149;149;149	Q5LJ99;Q5LJ98;Q5LJA0;P10155	.;.;.;RO60_HUMAN	Q	149;149;149;149;149;149;90	ENSP00000383752:R149Q;ENSP00000356416:R149Q;ENSP00000356413:R149Q;ENSP00000356415:R149Q;ENSP00000356414:R149Q;ENSP00000356411:R149Q;ENSP00000424612:R90Q	ENSP00000356411:R149Q	R	+	2	0	TROVE2	191305253	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.272000	0.95707	2.725000	0.93324	0.655000	0.94253	CGG	-	HMMPfam_TROVE		0.448	TROVE2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TROVE2	protein_coding	OTTHUMT00000086688.1	G	NM_004600		191305253	+1	no_errors	NM_004600	genbank	human	validated	54_36p	missense	SNP	1.000	A
IPO9	55705	genome.wustl.edu	37	1	201842038	201842038	+	Nonsense_Mutation	SNP	G	G	T			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr1:201842038G>T	ENST00000361565.4	+	20	2728	c.2659G>T	c.(2659-2661)Gag>Tag	p.E887*		NM_018085.4	NP_060555.2	Q96P70	IPO9_HUMAN	importin 9	887					protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	histone binding (GO:0042393)|protein transporter activity (GO:0008565)			cervix(1)|endometrium(5)|kidney(4)|large_intestine(5)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	38						GAAGGGAGAGGAGATCTACAG	0.532																																																0			1											105.0	96.0	99.0					1																	201842038		2203	4300	6503	200108661	SO:0001587	stop_gained	55705			AF410465	CCDS1415.1	1q31.3	2008-02-05			ENSG00000198700	ENSG00000198700		"""Importins"""	19425	protein-coding gene	gene with protein product						11823430, 10574461	Standard	NM_018085		Approved	Imp9, FLJ10402	uc001gwz.3	Q96P70	OTTHUMG00000035805	ENST00000361565.4:c.2659G>T	1.37:g.201842038G>T	ENSP00000354742:p.Glu887*		200108661	B1ASV5|Q8N1Y1|Q8N3I2|Q8NCG9|Q96SU6|Q9NW01|Q9P0A8|Q9ULM8	Nonsense_Mutation	SNP	superfamily_ARM repeat,HMMPfam_IBN_N	p.E887*	ENST00000361565.4	37	c.2659	CCDS1415.1	1	.	.	.	.	.	.	.	.	.	.	G	40	8.253709	0.98727	.	.	ENSG00000198700	ENST00000361565	.	.	.	5.23	5.23	0.72850	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07030	T	0.85	-13.9111	16.6861	0.85306	0.0:0.0:1.0:0.0	.	.	.	.	X	887	.	ENSP00000354742:E887X	E	+	1	0	IPO9	200108661	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.225000	0.95219	2.605000	0.88082	0.655000	0.94253	GAG	-	superfamily_ARM repeat		0.532	IPO9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IPO9	protein_coding	OTTHUMT00000087088.1	G	NM_018085		200108661	+1	no_errors	NM_018085	genbank	human	validated	54_36p	nonsense	SNP	1.000	T
ATIC	471	genome.wustl.edu	37	2	216200784	216200784	+	Silent	SNP	A	A	G			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr2:216200784A>G	ENST00000236959.9	+	11	1361	c.1035A>G	c.(1033-1035)ggA>ggG	p.G345G	ATIC_ENST00000435675.1_Silent_p.G344G|ATIC_ENST00000540518.1_Silent_p.G286G	NM_004044.6	NP_004035.2	P31939	PUR9_HUMAN	5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase	345					'de novo' IMP biosynthetic process (GO:0006189)|brainstem development (GO:0003360)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|dihydrofolate metabolic process (GO:0046452)|nucleobase-containing compound metabolic process (GO:0006139)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleoside metabolic process (GO:0009116)|organ regeneration (GO:0031100)|purine nucleobase metabolic process (GO:0006144)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|response to inorganic substance (GO:0010035)|small molecule metabolic process (GO:0044281)|tetrahydrofolate biosynthetic process (GO:0046654)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)	IMP cyclohydrolase activity (GO:0003937)|phosphoribosylaminoimidazolecarboxamide formyltransferase activity (GO:0004643)|protein homodimerization activity (GO:0042803)		ATIC/ALK(24)	large_intestine(2)|lung(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	8		Renal(323;0.229)		Epithelial(149;2.02e-06)|all cancers(144;0.000316)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.0097)	Methotrexate(DB00563)|Pemetrexed(DB00642)|Tetrahydrofolic acid(DB00116)	TTGCCCCAGGATATGAAGAAG	0.318			T	ALK	ALCL																																		Dom	yes		2	2q35	471	5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase		L	0			2											102.0	105.0	104.0					2																	216200784		2203	4300	6503	215909029	SO:0001819	synonymous_variant	471				CCDS2398.1	2q35	2010-04-27			ENSG00000138363	ENSG00000138363	2.1.2.3, 3.5.4.10		794	protein-coding gene	gene with protein product	"""phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase"""	601731				8567683, 9378707	Standard	NM_004044		Approved	PURH, AICARFT, IMPCHASE	uc002vex.4	P31939	OTTHUMG00000133023	ENST00000236959.9:c.1035A>G	2.37:g.216200784A>G			215909029	A8K202|E9PBU3|Q13856|Q53S28	Silent	SNP	superfamily_SSF52335,HMMPfam_MGS,HMMPfam_AICARFT_IMPCHas,HMMSmart_AICARFT_IMPCHas,superfamily_AICARFT_IMPCHas_formly	p.G345	ENST00000236959.9	37	c.1035	CCDS2398.1	2	.	.	.	.	.	.	.	.	.	.	A	10.50	1.368401	0.24771	.	.	ENSG00000138363	ENST00000446622;ENST00000426233	.	.	.	5.61	-1.15	0.09709	.	.	.	.	.	T	0.50973	0.1647	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.41627	-0.9498	4	.	.	.	-18.9346	6.1477	0.20294	0.3716:0.3611:0.2673:0.0	.	.	.	.	V	39;14	.	.	I	+	1	0	ATIC	215909029	0.734000	0.28142	0.998000	0.56505	0.998000	0.95712	-0.116000	0.10724	-0.108000	0.12066	0.533000	0.62120	ATA	-	HMMPfam_AICARFT_IMPCHas,HMMSmart_AICARFT_IMPCHas,superfamily_AICARFT_IMPCHas_formly		0.318	ATIC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATIC	protein_coding	OTTHUMT00000256610.1	A	NM_004044		215909029	+1	no_errors	NM_004044	genbank	human	validated	54_36p	silent	SNP	0.953	G
IRF2BP2	359948	genome.wustl.edu	37	1	234743405	234743405	+	Silent	SNP	C	C	T			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr1:234743405C>T	ENST00000366609.3	-	2	1272	c.1242G>A	c.(1240-1242)ccG>ccA	p.P414P	IRF2BP2_ENST00000491430.1_5'UTR|IRF2BP2_ENST00000366610.3_Silent_p.P398P|RP4-781K5.2_ENST00000436039.1_RNA	NM_182972.2	NP_892017.2	Q7Z5L9	I2BP2_HUMAN	interferon regulatory factor 2 binding protein 2	414					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	11	Ovarian(103;0.0303)	all_cancers(173;0.0236)|Prostate(94;0.0115)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)|Epithelial(3;6.2e-05)			CCGCTTCAGGCGGTGTGGTCC	0.582																																																0			1											92.0	98.0	96.0					1																	234743405		2203	4300	6503	232810028	SO:0001819	synonymous_variant	359948			AY278023	CCDS1602.1, CCDS41475.1	1q42.3	2008-02-05			ENSG00000168264	ENSG00000168264			21729	protein-coding gene	gene with protein product		615332				12799427	Standard	NM_182972		Approved	IRF-2BP2	uc001hwg.3	Q7Z5L9	OTTHUMG00000037981	ENST00000366609.3:c.1242G>A	1.37:g.234743405C>T			232810028	B1AM35|B1AM36|Q6P083|Q7Z5L8|Q8N351|Q8WUH8	Silent	SNP	NULL	p.P414	ENST00000366609.3	37	c.1242	CCDS1602.1	1																																																																																			-	NULL		0.582	IRF2BP2-002	NOVEL	basic|CCDS	protein_coding	IRF2BP2	protein_coding	OTTHUMT00000092705.1	C	NM_182972		232810028	-1	no_errors	NM_182972	genbank	human	reviewed	54_36p	silent	SNP	1.000	T
C1orf101	257044	genome.wustl.edu	37	1	244747184	244747184	+	Silent	SNP	T	T	G			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr1:244747184T>G	ENST00000366534.4	+	13	2082	c.2028T>G	c.(2026-2028)ctT>ctG	p.L676L	C1orf101_ENST00000473875.1_3'UTR|C1orf101_ENST00000366533.4_Silent_p.L676L|C1orf101_ENST00000366531.3_Silent_p.L525L	NM_001130957.1	NP_001124429.1	Q5SY80	CA101_HUMAN	chromosome 1 open reading frame 101	676						CatSper complex (GO:0036128)				NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(2)|urinary_tract(3)	36	all_cancers(71;2.99e-05)|all_epithelial(71;0.00015)|all_neural(11;0.0269)|Breast(184;0.0654)|Glioma(6;0.0724)|Ovarian(71;0.0761)|all_lung(81;0.0874)|Lung NSC(105;0.121)		all cancers(7;1.22e-05)|OV - Ovarian serous cystadenocarcinoma(106;0.001)|GBM - Glioblastoma multiforme(7;0.0154)			ACACGGGTCTTGTGCTGGTTC	0.428																																																0			1											94.0	76.0	82.0					1																	244747184		2203	4300	6503	242813807	SO:0001819	synonymous_variant	257044			BC032859	CCDS1625.1, CCDS44340.1, CCDS55693.1	1q44	2012-12-20			ENSG00000179397	ENSG00000179397			28491	protein-coding gene	gene with protein product						12477932	Standard	NM_173807		Approved	MGC33370	uc001iam.3	Q5SY80	OTTHUMG00000040103	ENST00000366534.4:c.2028T>G	1.37:g.244747184T>G			242813807	B4DZR4|B7Z7X5|E9PEA3|Q8IYZ6	Silent	SNP	NULL	p.L676	ENST00000366534.4	37	c.2028	CCDS44340.1	1																																																																																			-	NULL		0.428	C1orf101-001	NOVEL	basic|appris_principal|CCDS	protein_coding	C1orf101	protein_coding	OTTHUMT00000096701.1	T	NM_173807		242813807	+1	no_errors	NM_173807	genbank	human	validated	54_36p	silent	SNP	0.000	G
CLEC12B	387837	genome.wustl.edu	37	12	10168309	10168325	+	Splice_Site	DEL	TGTTCCCTCTCCATCCT	TGTTCCCTCTCCATCCT	-			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	TGTTCCCTCTCCATCCT	TGTTCCCTCTCCATCCT					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr12:10168309_10168325delTGTTCCCTCTCCATCCT	ENST00000338896.5	+	5	791_807	c.663_679delTGTTCCCTCTCCATCCT	c.(661-681)tctgttccctctccatcctta>tcta	p.VPSPSL222fs	CLEC12B_ENST00000396502.1_Frame_Shift_Del_p.VPSPSL222fs|CLEC1B_ENST00000428126.2_5'Flank|RP11-133L14.5_ENST00000544225.1_RNA	NM_001129998.1	NP_001123470.1	Q2HXU8	CL12B_HUMAN	C-type lectin domain family 12, member B	222	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			central_nervous_system(2)|large_intestine(2)|lung(5)	9						AAGATGGCTCTGTTCCCTCTCCATCCTTGTACGTCTC	0.401																																																0			12																																								10059592	SO:0001630	splice_region_variant	387837			AK128243	CCDS8610.1, CCDS44830.1	12p13.2	2010-08-17			ENSG00000256660	ENSG00000256660		"""C-type lectin domain containing"""	31966	protein-coding gene	gene with protein product						17562706	Standard	NM_205852		Approved		uc001qwz.2	Q2HXU8	OTTHUMG00000168397	ENST00000338896.5:c.680+1TGTTCCCTCTCCATCCT>-	12.37:g.10168309_10168325delTGTTCCCTCTCCATCCT			10059576	Q6UWF2|Q6ZRG0	Frame_Shift_Del	DEL	superfamily_C-type_lectin_fold,HMMSmart_CLECT,HMMPfam_Lectin_C	p.P223fs	ENST00000338896.5	37	c.663_679	CCDS44830.1	12																																																																																			(deletion:cds_exon[10059478,10059612])	superfamily_C-type_lectin_fold,HMMSmart_CLECT		0.401	CLEC12B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLEC12B	protein_coding	OTTHUMT00000399554.2	TGTTCCCTCTCCATCCT	NM_205852	Frame_Shift_Del	10059592	+1	no_errors	NM_205852	genbank	human	validated	54_36p	frame_shift_del	DEL	0.006:0.000:0.003:0.015:0.638:0.697:0.763:0.881:0.931:0.933:0.913:0.851:0.670:0.661:0.663:0.701:0.712	-
LRRC75A	388341	genome.wustl.edu	37	17	16343363	16343366	+	IGR	DEL	TCAC	TCAC	-			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	TCAC	TCAC					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr17:16343363_16343366delTCAC	ENST00000409083.3	-	0	2656				C17orf76-AS1_ENST00000584141.1_RNA|C17orf76-AS1_ENST00000475947.2_RNA|RP11-138I1.3_ENST00000585048.1_lincRNA|C17orf76-AS1_ENST00000584177.1_RNA|C17orf76-AS1_ENST00000470491.2_RNA|C17orf76-AS1_ENST00000475953.1_RNA|C17orf76-AS1_ENST00000487066.1_RNA|C17orf76-AS1_ENST00000391079.1_RNA|C17orf76-AS1_ENST00000478103.2_RNA|C17orf76-AS1_ENST00000578380.2_RNA|C17orf76-AS1_ENST00000484836.1_RNA|C17orf76-AS1_ENST00000583400.2_RNA|C17orf76-AS1_ENST00000582911.1_RNA|C17orf76-AS1_ENST00000581913.1_RNA|C17orf76-AS1_ENST00000481898.1_RNA|C17orf76-AS1_ENST00000483140.1_RNA|C17orf76-AS1_ENST00000384229.1_RNA|C17orf76-AS1_ENST00000365172.1_RNA|C17orf76-AS1_ENST00000460249.1_RNA|C17orf76-AS1_ENST00000580180.1_RNA|C17orf76-AS1_ENST00000491009.1_RNA|C17orf76-AS1_ENST00000584926.1_RNA|C17orf76-AS1_ENST00000477249.2_RNA|C17orf76-AS1_ENST00000492250.1_RNA|C17orf76-AS1_ENST00000581718.1_RNA|C17orf76-AS1_ENST00000580770.1_RNA|C17orf76-AS1_ENST00000472367.1_RNA|C17orf76-AS1_ENST00000481027.1_RNA|C17orf76-AS1_ENST00000480811.1_RNA|C17orf76-AS1_ENST00000579473.1_RNA	NM_207387.3	NP_997270.2														lung(1)	1						TCTGATGAAATCACTAATAGGAAG	0.475																																																0			17																																								16284091	SO:0001628	intergenic_variant	26800																															17.37:g.16343363_16343366delTCAC			16284088		RNA	DEL	-	NULL	ENST00000409083.3	37	NULL	CCDS11178.2	17																																																																																			(deletion:rna[16284075,16284145])	-		0.475	FAM211A-001	NOVEL	basic|exp_conf|CCDS	protein_coding	SNORD49A	protein_coding	OTTHUMT00000130461.2	TCAC			16284091	+1	no_errors	NR_002744	genbank	human	provisional	54_36p	rna	DEL	0.002:0.002:0.002:0.005	-
GTF3C1	2975	genome.wustl.edu	37	16	27487836	27487851	+	Frame_Shift_Del	DEL	TGAAGCACCAGAAAGT	TGAAGCACCAGAAAGT	-			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	TGAAGCACCAGAAAGT	TGAAGCACCAGAAAGT					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr16:27487836_27487851delTGAAGCACCAGAAAGT	ENST00000356183.4	-	29	4289_4304	c.4274_4289delACTTTCTGGTGCTTCA	c.(4273-4290)cactttctggtgcttcagfs	p.HFLVLQ1425fs	GTF3C1_ENST00000561623.1_Frame_Shift_Del_p.HFLVLQ1425fs	NM_001520.3	NP_001511.2	Q12789	TF3C1_HUMAN	general transcription factor IIIC, polypeptide 1, alpha 220kDa	1425					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|rRNA transcription (GO:0009303)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription (GO:0009304)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)			breast(2)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|liver(3)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	80						GATCAGGTTCTGAAGCACCAGAAAGTGGATGTCATC	0.56																																																0			16																																								27395352	SO:0001589	frameshift_variant	2975			U06485	CCDS32414.1, CCDS66988.1	16p12	2010-03-23	2002-08-29			ENSG00000077235		"""General transcription factors"""	4664	protein-coding gene	gene with protein product		603246	"""general transcription factor IIIC, polypeptide 1 (alpha subunit, 220kD )"""			8164661, 8127861	Standard	NM_001520		Approved	TFIIIC220	uc002dov.2	Q12789		ENST00000356183.4:c.4274_4289delACTTTCTGGTGCTTCA	16.37:g.27487836_27487851delTGAAGCACCAGAAAGT	ENSP00000348510:p.His1425fs		27395337	B2RP21|Q12838|Q6DKN9|Q9Y4W9	Frame_Shift_Del	DEL	HMMPfam_B-block_TFIIIC	p.H1425fs	ENST00000356183.4	37	c.4289_4274	CCDS32414.1	16																																																																																			(deletion:cds_exon[27395273,27395366])	NULL		0.560	GTF3C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTF3C1	protein_coding	OTTHUMT00000433856.1	TGAAGCACCAGAAAGT	NM_001520		27395352	-1	no_errors	NM_001520	genbank	human	validated	54_36p	frame_shift_del	DEL	0.998:0.919:0.873:0.995:0.996:0.995:1.000:1.000:1.000:1.000:0.998:0.983:0.992:0.996:0.999:1.000	-
KCNJ15	3772	genome.wustl.edu	37	21	39619445	39619448	+	IGR	DEL	TGGA	TGGA	-	rs531244861|rs71857816|rs536556382|rs112430846|rs10579917	byFrequency	TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	TGGA	TGGA					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr21:39619445_39619448delTGGA								AP001434.2 (9322 upstream) : KCNJ15 (9214 downstream)																							gatgcataggtggatggatggatg	0.422														896	0.178914	0.3593	0.1657	5008	,	,		37672	0.0685		0.169	False		,,,				2504	0.0685															0			21																																								38541318	SO:0001628	intergenic_variant	441964																															21.37:g.39619453_39619456delTGGA			38541315		Frame_Shift_Del	DEL	NULL	p.S225fs		37	c.676_673		21																																																																																			(deletion:cds_exon[38540755,38541438])	NULL	0	0.422					LOC441964			TGGA			38541318	-1	no_errors	XM_497783	genbank	human	model	54_36p	frame_shift_del	DEL	0.001:0.001:0.001:0.001	-
CDK17	5128	genome.wustl.edu	37	12	96688862	96688874	+	Frame_Shift_Del	DEL	GCAATATGCCAAA	GCAATATGCCAAA	-	rs528370481	byFrequency	TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	GCAATATGCCAAA	GCAATATGCCAAA					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr12:96688862_96688874delGCAATATGCCAAA	ENST00000261211.3	-	10	1503_1515	c.900_912delTTTGGCATATTGC	c.(898-912)ggtttggcatattgcfs	p.GLAYC300fs	CDK17_ENST00000553042.1_5'UTR|CDK17_ENST00000542666.1_Frame_Shift_Del_p.GLAYC247fs|CDK17_ENST00000543119.2_Frame_Shift_Del_p.GLAYC300fs	NM_001170464.2|NM_002595.4	NP_001163935.1|NP_002586.2	Q00537	CDK17_HUMAN	cyclin-dependent kinase 17	300	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				protein phosphorylation (GO:0006468)		ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)	p.L301F(1)		breast(1)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(6)|lung(11)|ovary(4)|prostate(2)|skin(1)	37						TTCTTCTATGGCAATATGCCAAACCACGTAGAA	0.343																																																1	Substitution - Missense(1)	kidney(1)	12																																								95213005	SO:0001589	frameshift_variant	5128				CCDS9061.1, CCDS53819.1	12q23.1	2011-11-08	2009-12-16	2009-12-16		ENSG00000059758		"""Cyclin-dependent kinases"""	8750	protein-coding gene	gene with protein product		603440	"""PCTAIRE protein kinase 2"""	PCTK2		9370357, 19884882	Standard	NM_001170464		Approved	PCTAIRE2	uc009ztk.3	Q00537		ENST00000261211.3:c.900_912delTTTGGCATATTGC	12.37:g.96688862_96688874delGCAATATGCCAAA	ENSP00000261211:p.Gly300fs		95212993	A8K1U6|B2RCQ2|Q8NEB8	Frame_Shift_Del	DEL	superfamily_Protein kinase-like (PK-like),HMMSmart_SM00219,HMMSmart_SM00220,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_ST	p.L301fs	ENST00000261211.3	37	c.912_900	CCDS9061.1	12																																																																																			(deletion:cds_exon[95212908,95213031])	superfamily_Protein kinase-like (PK-like),HMMSmart_SM00219,HMMSmart_SM00220,HMMPfam_Pkinase		0.343	CDK17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCTK2	protein_coding	OTTHUMT00000408751.1	GCAATATGCCAAA	NM_002595		95213005	-1	no_errors	NM_002595	genbank	human	reviewed	54_36p	frame_shift_del	DEL	1.000:1.000:1.000:1.000:1.000:1.000:0.990:1.000:1.000:1.000:1.000:1.000:0.999	-
LOC101927209	101927209	genome.wustl.edu	37	1	142713590	142713590	+	lincRNA	DEL	C	C	-			TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr1:142713590delC	ENST00000610091.1	-	0	2068																											TTGTTGCTTTCTTCTTCCTTC	0.373																																																0			1																																								141655113			375010																															1.37:g.142713590delC			141655113		RNA	DEL	-	NULL	ENST00000610091.1	37	NULL		1																																																																																			(deletion:rna[141654484,141655403])	-		0.373	RP11-417J8.6-001	KNOWN	basic	lincRNA	LOC375010	lincRNA	OTTHUMT00000037265.2	C			141655113	-1	pseudogene	XR_041271	genbank	human	model	54_36p	rna	DEL	0.085	-
SLC51A	200931	genome.wustl.edu	37	3	195954558	195954580	+	Frame_Shift_Del	DEL	TGGTCTCTGGATCCCTCGTTCCC	TGGTCTCTGGATCCCTCGTTCCC	-	rs371651472|rs144779175		TCGA-61-1914-01A-01W-0639-09	TCGA-61-1914-11A-01W-0640-09	TGGTCTCTGGATCCCTCGTTCCC	TGGTCTCTGGATCCCTCGTTCCC					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	41e59680-da3c-45d9-8a36-59596743d03a	75201ee4-2590-4b96-8bcf-e9e82aa0457d	g.chr3:195954558_195954580delTGGTCTCTGGATCCCTCGTTCCC	ENST00000296327.5	+	4	521_543	c.312_334delTGGTCTCTGGATCCCTCGTTCCC	c.(310-336)tttggtctctggatccctcgttccctgfs	p.GLWIPRSL105fs		NM_152672.5	NP_689885.4	Q86UW1	OSTA_HUMAN	solute carrier family 51, alpha subunit	105					bile acid and bile salt transport (GO:0015721)|transport (GO:0006810)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|transporter activity (GO:0005215)	p.I108I(1)|p.W107*(1)|p.R110H(1)								Conjugated Estrogens(DB00286)|Digoxin(DB00390)|Dinoprostone(DB00917)	TGTGCTGCTTTGGTCTCTGGATCCCTCGTTCCCTGGTGCTGGT	0.641																																																3	Substitution - Nonsense(1)|Substitution - Missense(1)|Substitution - coding silent(1)	large_intestine(1)|lung(1)|kidney(1)	3																																								197438977	SO:0001589	frameshift_variant	200931				CCDS3314.1	3q29	2013-05-22			ENSG00000163959	ENSG00000163959		"""Solute carriers"""	29955	protein-coding gene	gene with protein product	"""organic solute transporter, alpha subunit"""	612084				12719432, 20538072	Standard	NM_152672		Approved	OSTalpha	uc003fwd.3	Q86UW1	OTTHUMG00000155684	ENST00000296327.5:c.312_334delTGGTCTCTGGATCCCTCGTTCCC	3.37:g.195954558_195954580delTGGTCTCTGGATCCCTCGTTCCC	ENSP00000296327:p.Gly105fs		197438955	Q6ZMC7	Frame_Shift_Del	DEL	NULL	p.L106fs	ENST00000296327.5	37	c.312_334	CCDS3314.1	3																																																																																			(deletion:cds_exon[197438932,197439005])	NULL		0.641	SLC51A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OSTalpha	protein_coding	OTTHUMT00000341253.1	TGGTCTCTGGATCCCTCGTTCCC	NM_152672		197438977	+1	no_errors	NM_152672	genbank	human	validated	54_36p	frame_shift_del	DEL	1.000:1.000:1.000:0.990:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:0.995:0.996:0.989:0.868:0.872:0.860:0.515:0.599:0.884:0.900:0.882	-
