#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
MMACHC	25974	broad.mit.edu	37	1	45965207	45965207	+	5'Flank	SNP	A	A	T			TCGA-61-1998-01A-01W-0722-08	TCGA-61-1998-10A-01W-0722-08	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0284efcd-e4b8-45b5-9c1e-6f3950ac4bf0	5a480357-2b29-4ce2-b257-a77186ce5fad	g.chr1:45965207A>T	ENST00000401061.4	+	0	0				CCDC163P_ENST00000502793.2_5'Flank|CCDC163P_ENST00000432082.1_Missense_Mutation_p.N25K|CCDC163P_ENST00000490551.3_Missense_Mutation_p.N25K|CCDC163P_ENST00000488405.2_Missense_Mutation_p.N25K	NM_015506.2	NP_056321.2	Q9Y4U1	MMAC_HUMAN	methylmalonic aciduria (cobalamin deficiency) cblC type, with homocystinuria						cobalamin biosynthetic process (GO:0009236)|cobalamin metabolic process (GO:0009235)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	cobalamin binding (GO:0031419)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	8	Acute lymphoblastic leukemia(166;0.155)				Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	CCCTCACCTTATTCCGGACCA	0.552																																																0			1											77.0	76.0	76.0					1																	45965207		1935	4147	6082	45737794	SO:0001631	upstream_gene_variant	126661				CCDS41324.1	1p34.1	2011-05-12			ENSG00000132763	ENSG00000132763			24525	protein-coding gene	gene with protein product		609831				16311595	Standard	NM_015506		Approved	DKFZP564I122, cblC	uc009vxv.3	Q9Y4U1	OTTHUMG00000007742		1.37:g.45965207A>T	Exception_encountered		45737794	Q5T157|Q9BRQ7	Missense_Mutation	SNP	ENST00000401061.4	37	CCDS41324.1	.	.	.	.	.	.	.	.	.	.	A	7.928	0.740130	0.15642	.	.	ENSG00000236624	ENST00000490551;ENST00000432082;ENST00000488405	.	.	.	5.27	1.56	0.23342	.	.	.	.	.	T	0.25269	0.0614	.	.	.	0.24235	N	0.995384	B;B	0.14012	0.009;0.009	B;B	0.08055	0.003;0.003	T	0.17992	-1.0351	7	0.37606	T	0.19	.	3.581	0.07952	0.5966:0.1969:0.2065:0.0	.	25;25	E9PLD6;F2Z3K3	.;.	K	25	.	ENSP00000431736:N25K	N	-	3	2	CCDC163P	45737794	1.000000	0.71417	0.999000	0.59377	0.097000	0.18754	1.667000	0.37471	0.434000	0.26340	-0.297000	0.09499	AAT		0.552	MMACHC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020864.2	NM_015506	
CYP4A22	284541	broad.mit.edu	37	1	47607866	47607866	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1998-01A-01W-0722-08	TCGA-61-1998-10A-01W-0722-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0284efcd-e4b8-45b5-9c1e-6f3950ac4bf0	5a480357-2b29-4ce2-b257-a77186ce5fad	g.chr1:47607866C>T	ENST00000371891.3	+	4	500	c.469C>T	c.(469-471)Cca>Tca	p.P157S	CYP4A22_ENST00000294337.3_Missense_Mutation_p.P157S|CYP4A22_ENST00000485117.1_3'UTR|CYP4A22-AS1_ENST00000444042.2_lincRNA|CYP4A22_ENST00000371890.3_Missense_Mutation_p.P157S	NM_001010969.2	NP_001010969.2	Q5TCH4	CP4AM_HUMAN	cytochrome P450, family 4, subfamily A, polypeptide 22	157						endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	alkane 1-monooxygenase activity (GO:0018685)|arachidonic acid omega-hydroxylase activity (GO:0052869)|heme binding (GO:0020037)|iron ion binding (GO:0005506)	p.P157S(1)		breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						CATCCTGAAGCCATACGTGGG	0.557																																					Pancreas(88;1240 1470 2099 14214 37557)											1	Substitution - Missense(1)	ovary(1)	1											122.0	100.0	107.0					1																	47607866		2203	4300	6503	47380453	SO:0001583	missense	284541				CCDS30707.1	1p33	2007-12-14			ENSG00000162365	ENSG00000162365		"""Cytochrome P450s"""	20575	protein-coding gene	gene with protein product		615341					Standard	XM_005270768		Approved		uc001cqv.1	Q5TCH4	OTTHUMG00000007845	ENST00000371891.3:c.469C>T	1.37:g.47607866C>T	ENSP00000360958:p.Pro157Ser		47380453	Q5TCH3|Q6JXK7|Q6JXK8|Q9NRM4	Missense_Mutation	SNP	ENST00000371891.3	37	CCDS30707.1	.	.	.	.	.	.	.	.	.	.	c	5.301	0.240847	0.10077	.	.	ENSG00000162365	ENST00000371890;ENST00000371891;ENST00000294337	T;T;T	0.66460	-0.21;-0.21;-0.21	1.7	0.722	0.18225	.	0.119600	0.56097	D	0.000022	T	0.56499	0.1989	L	0.42008	1.315	0.32003	N	0.60309	B;B	0.22276	0.007;0.067	B;B	0.34931	0.016;0.192	T	0.53872	-0.8377	10	0.45353	T	0.12	.	5.5165	0.16910	0.0:0.5949:0.2016:0.2036	.	157;157	Q5TCH5;Q5TCH4	.;CP4AM_HUMAN	S	157	ENSP00000360957:P157S;ENSP00000360958:P157S;ENSP00000294337:P157S	ENSP00000294337:P157S	P	+	1	0	CYP4A22	47380453	0.992000	0.36948	0.484000	0.27391	0.047000	0.14425	1.262000	0.32992	-0.386000	0.07821	-1.151000	0.01829	CCA		0.557	CYP4A22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021635.1	XM_208213	
ZNF644	84146	broad.mit.edu	37	1	91404919	91404919	+	Silent	SNP	T	T	A			TCGA-61-1998-01A-01W-0722-08	TCGA-61-1998-10A-01W-0722-08	T	T	A	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0284efcd-e4b8-45b5-9c1e-6f3950ac4bf0	5a480357-2b29-4ce2-b257-a77186ce5fad	g.chr1:91404919T>A	ENST00000370440.1	-	3	2209	c.1992A>T	c.(1990-1992)acA>acT	p.T664T	ZNF644_ENST00000347275.5_Intron|ZNF644_ENST00000361321.5_Intron|ZNF644_ENST00000467231.1_Intron|ZNF644_ENST00000337393.5_Silent_p.T664T			Q9H582	ZN644_HUMAN	zinc finger protein 644	664					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.T664T(1)		breast(4)|endometrium(2)|large_intestine(10)|lung(21)|ovary(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	47		all_lung(203;0.00206)|Lung NSC(277;0.0519)|Lung SC(238;0.101)		all cancers(265;0.00102)|Epithelial(280;0.00766)|KIRC - Kidney renal clear cell carcinoma(1967;0.147)|OV - Ovarian serous cystadenocarcinoma(397;0.173)		TTGATCCAAATGTTCGCTTCA	0.368																																																1	Substitution - coding silent(1)	ovary(1)	1											141.0	139.0	140.0					1																	91404919		2203	4300	6503	91177507	SO:0001819	synonymous_variant	84146			AB033047	CCDS731.1, CCDS732.1	1p22.2	2008-02-05			ENSG00000122482	ENSG00000122482			29222	protein-coding gene	gene with protein product		614159				10574462	Standard	NM_032186		Approved	KIAA1221, BM-005, MGC60165, MGC70410	uc001dnw.3	Q9H582	OTTHUMG00000010078	ENST00000370440.1:c.1992A>T	1.37:g.91404919T>A			91177507	A2RU71|Q2TAM0|Q5TCC0|Q6BEP7|Q6P446|Q6PI06|Q7LG67|Q9ULJ9	Silent	SNP	ENST00000370440.1	37	CCDS731.1																																																																																				0.368	ZNF644-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027846.2	NM_032186	
CRTC2	200186	broad.mit.edu	37	1	153925751	153925751	+	Nonsense_Mutation	SNP	G	G	A			TCGA-61-1998-01A-01W-0722-08	TCGA-61-1998-10A-01W-0722-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0284efcd-e4b8-45b5-9c1e-6f3950ac4bf0	5a480357-2b29-4ce2-b257-a77186ce5fad	g.chr1:153925751G>A	ENST00000368633.1	-	6	725	c.598C>T	c.(598-600)Cga>Tga	p.R200*	CRTC2_ENST00000368630.3_Intron|CRTC2_ENST00000476883.1_5'Flank	NM_181715.2	NP_859066.1	Q53ET0	CRTC2_HUMAN	CREB regulated transcription coactivator 2	200					gluconeogenesis (GO:0006094)|glucose homeostasis (GO:0042593)|histone H3-K9 acetylation (GO:0043970)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homotetramerization (GO:0051289)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	cAMP response element binding protein binding (GO:0008140)	p.R200*(1)		NS(1)|breast(1)|cervix(2)|endometrium(4)|large_intestine(5)|lung(8)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)	27	all_lung(78;3.05e-32)|Lung NSC(65;3.74e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			CCCCCACGTCGGCTGGGCAGG	0.488																																																1	Substitution - Nonsense(1)	ovary(1)	1											55.0	60.0	58.0					1																	153925751		2203	4300	6503	152192375	SO:0001587	stop_gained	200186			AY360172	CCDS30875.1	1q21.3	2008-02-05			ENSG00000160741	ENSG00000160741			27301	protein-coding gene	gene with protein product		608972				14506290, 14536081	Standard	NM_181715		Approved	TORC2	uc021pab.1	Q53ET0	OTTHUMG00000037156	ENST00000368633.1:c.598C>T	1.37:g.153925751G>A	ENSP00000357622:p.Arg200*		152192375	Q6UUV8|Q7Z3X7|Q8N332	Nonsense_Mutation	SNP	ENST00000368633.1	37	CCDS30875.1	.	.	.	.	.	.	.	.	.	.	G	22.6	4.307359	0.81247	.	.	ENSG00000160741	ENST00000368633	.	.	.	3.75	3.75	0.43078	.	0.099352	0.44483	D	0.000450	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.3333	11.2299	0.48905	0.0:0.0:1.0:0.0	.	.	.	.	X	200	.	ENSP00000357622:R200X	R	-	1	2	CRTC2	152192375	0.911000	0.30947	0.982000	0.44146	0.948000	0.59901	3.300000	0.51834	2.104000	0.64026	0.455000	0.32223	CGA		0.488	CRTC2-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090272.3	NM_181715	
ADAR	103	broad.mit.edu	37	1	154574163	154574163	+	Missense_Mutation	SNP	C	C	A			TCGA-61-1998-01A-01W-0722-08	TCGA-61-1998-10A-01W-0722-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0284efcd-e4b8-45b5-9c1e-6f3950ac4bf0	5a480357-2b29-4ce2-b257-a77186ce5fad	g.chr1:154574163C>A	ENST00000368474.4	-	2	1154	c.955G>T	c.(955-957)Gct>Tct	p.A319S	ADAR_ENST00000292205.5_Missense_Mutation_p.A362S|ADAR_ENST00000471068.1_5'Flank|ADAR_ENST00000368471.3_Missense_Mutation_p.A24S	NM_001111.4|NM_015840.3|NM_015841.3	NP_001102|NP_056655.2|NP_056656.2	P55265	DSRAD_HUMAN	adenosine deaminase, RNA-specific	319					adenosine to inosine editing (GO:0006382)|base conversion or substitution editing (GO:0016553)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|miRNA loading onto RISC involved in gene silencing by miRNA (GO:0035280)|mRNA modification (GO:0016556)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein kinase activity by regulation of protein phosphorylation (GO:0044387)|negative regulation of viral genome replication (GO:0045071)|positive regulation of viral genome replication (GO:0045070)|pre-miRNA processing (GO:0031054)|protein export from nucleus (GO:0006611)|protein import into nucleus (GO:0006606)|response to interferon-alpha (GO:0035455)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|supraspliceosomal complex (GO:0044530)	DNA binding (GO:0003677)|double-stranded RNA adenosine deaminase activity (GO:0003726)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.A319S(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|lung(20)|ovary(4)|prostate(2)|skin(2)	51	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.0997)		LUSC - Lung squamous cell carcinoma(543;0.185)	Colorectal(1306;0.115)		ATATTTTTAGCCAAATTCAGG	0.458																																																1	Substitution - Missense(1)	ovary(1)	1											75.0	75.0	75.0					1																	154574163		2203	4300	6503	152840787	SO:0001583	missense	103			BC038227	CCDS1071.1, CCDS30879.1	1q21.3	2012-03-22			ENSG00000160710	ENSG00000160710	3.5.4.-		225	protein-coding gene	gene with protein product		146920	"""interferon-induced protein 4"""	IFI4, G1P1		7972084	Standard	NM_001111		Approved	ADAR1	uc001ffh.3	P55265	OTTHUMG00000037261	ENST00000368474.4:c.955G>T	1.37:g.154574163C>A	ENSP00000357459:p.Ala319Ser		152840787	B1AQQ9|B1AQR0|D3DV76|O15223|O43859|O43860|Q9BYM3|Q9BYM4	Missense_Mutation	SNP	ENST00000368474.4	37	CCDS1071.1	.	.	.	.	.	.	.	.	.	.	C	24.7	4.561836	0.86335	.	.	ENSG00000160710	ENST00000292205;ENST00000368474;ENST00000368471;ENST00000529168	T;T;T;T	0.42131	0.98;0.98;0.98;0.98	4.45	4.45	0.53987	Winged helix-turn-helix transcription repressor DNA-binding (1);Double-stranded RNA-specific adenosine deaminase (DRADA) (3);	0.120167	0.56097	D	0.000034	T	0.51363	0.1670	L	0.58583	1.82	0.48901	D	0.999729	D;D;D	0.76494	0.998;0.998;0.999	D;D;D	0.83275	0.98;0.98;0.996	T	0.52961	-0.8505	10	0.59425	D	0.04	-15.007	13.3967	0.60858	0.0:0.8421:0.1579:0.0	.	319;319;319	P55265-3;P55265-2;P55265	.;.;DSRAD_HUMAN	S	362;319;24;314	ENSP00000292205:A362S;ENSP00000357459:A319S;ENSP00000357456:A24S;ENSP00000431794:A314S	ENSP00000292205:A362S	A	-	1	0	ADAR	152840787	1.000000	0.71417	0.907000	0.35723	0.989000	0.77384	5.068000	0.64364	2.450000	0.82876	0.491000	0.48974	GCT		0.458	ADAR-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000090691.2	NM_001111	
TDRD5	163589	broad.mit.edu	37	1	179659906	179659906	+	Missense_Mutation	SNP	G	G	A	rs570123255		TCGA-61-1998-01A-01W-0722-08	TCGA-61-1998-10A-01W-0722-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0284efcd-e4b8-45b5-9c1e-6f3950ac4bf0	5a480357-2b29-4ce2-b257-a77186ce5fad	g.chr1:179659906G>A	ENST00000367614.1	+	17	3133	c.2774G>A	c.(2773-2775)cGt>cAt	p.R925H	TDRD5_ENST00000294848.8_Missense_Mutation_p.R925H|TDRD5_ENST00000444136.1_Missense_Mutation_p.R979H	NM_001199091.1	NP_001186020.1	Q8NAT2	TDRD5_HUMAN	tudor domain containing 5	925					DNA methylation involved in gamete generation (GO:0043046)|P granule organization (GO:0030719)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|pi-body (GO:0071546)		p.R925H(2)		NS(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(44)|ovary(2)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)	77						AAAGACAAGCGTCAAGAATCT	0.418													G|||	1	0.000199681	0.0	0.0	5008	,	,		20527	0.0		0.0	False		,,,				2504	0.001															2	Substitution - Missense(2)	ovary(1)|central_nervous_system(1)	1											82.0	79.0	80.0					1																	179659906		2203	4300	6503	177926529	SO:0001583	missense	163589			AK092142	CCDS1332.1, CCDS55663.1	1q24.2	2013-01-23			ENSG00000162782	ENSG00000162782		"""Tudor domain containing"""	20614	protein-coding gene	gene with protein product							Standard	NM_001199085		Approved	FLJ34823, TUDOR3	uc010pnp.2	Q8NAT2	OTTHUMG00000035259	ENST00000367614.1:c.2774G>A	1.37:g.179659906G>A	ENSP00000356586:p.Arg925His		177926529	A1L4G5|B7ZLV0|Q5EBN4|Q5VTV0|Q6ZSK2	Missense_Mutation	SNP	ENST00000367614.1	37	CCDS1332.1	.	.	.	.	.	.	.	.	.	.	G	7.090	0.571962	0.13623	.	.	ENSG00000162782	ENST00000367614;ENST00000294848;ENST00000444136;ENST00000417329	T;T;T;T	0.29917	2.76;2.76;2.98;1.55	5.17	2.11	0.27256	.	0.965874	0.08577	N	0.925189	T	0.12178	0.0296	N	0.03608	-0.345	0.09310	N	1	P;B	0.35844	0.524;0.015	B;B	0.30855	0.121;0.001	T	0.10965	-1.0607	10	0.62326	D	0.03	-15.9539	4.4233	0.11492	0.2005:0.1872:0.6123:0.0	.	979;925	Q8NAT2-1;Q8NAT2	.;TDRD5_HUMAN	H	925;925;979;435	ENSP00000356586:R925H;ENSP00000294848:R925H;ENSP00000406052:R979H;ENSP00000410744:R435H	ENSP00000294848:R925H	R	+	2	0	TDRD5	177926529	0.007000	0.16637	0.080000	0.20451	0.272000	0.26649	0.730000	0.26043	1.302000	0.44855	0.655000	0.94253	CGT		0.418	TDRD5-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000085295.1	NM_173533	
GPR25	2848	broad.mit.edu	37	1	200843143	200843143	+	Silent	SNP	C	C	T			TCGA-61-1998-01A-01W-0722-08	TCGA-61-1998-10A-01W-0722-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0284efcd-e4b8-45b5-9c1e-6f3950ac4bf0	5a480357-2b29-4ce2-b257-a77186ce5fad	g.chr1:200843143C>T	ENST00000304244.2	+	1	1061	c.978C>T	c.(976-978)acC>acT	p.T326T		NM_005298.2	NP_005289.2	O00155	GPR25_HUMAN	G protein-coupled receptor 25	326					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)	p.T326T(1)		large_intestine(1)|lung(2)|ovary(1)|skin(1)	5						GCGGGCGCACCGGCCGCCTGG	0.706																																																1	Substitution - coding silent(1)	ovary(1)	1											15.0	16.0	16.0					1																	200843143		2167	4217	6384	199109766	SO:0001819	synonymous_variant	2848			U91939	CCDS1405.1	1q32.1	2012-08-21			ENSG00000170128	ENSG00000170128		"""GPCR / Class A : Orphans"""	4480	protein-coding gene	gene with protein product		602174				9020062	Standard	NM_005298		Approved		uc001gvn.2	O00155	OTTHUMG00000035788	ENST00000304244.2:c.978C>T	1.37:g.200843143C>T			199109766	A0AVJ5	Silent	SNP	ENST00000304244.2	37	CCDS1405.1																																																																																				0.706	GPR25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087056.1	NM_005298	
SIPA1L2	57568	broad.mit.edu	37	1	232650408	232650408	+	Silent	SNP	G	G	C			TCGA-61-1998-01A-01W-0722-08	TCGA-61-1998-10A-01W-0722-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0284efcd-e4b8-45b5-9c1e-6f3950ac4bf0	5a480357-2b29-4ce2-b257-a77186ce5fad	g.chr1:232650408G>C	ENST00000366630.1	-	2	1036	c.678C>G	c.(676-678)gtC>gtG	p.V226V	SIPA1L2_ENST00000262861.4_Silent_p.V226V			Q9P2F8	SI1L2_HUMAN	signal-induced proliferation-associated 1 like 2	226					regulation of small GTPase mediated signal transduction (GO:0051056)		GTPase activator activity (GO:0005096)	p.V226V(1)		NS(1)|breast(5)|central_nervous_system(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(49)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	103		all_cancers(173;0.00605)|Prostate(94;0.128)|all_epithelial(177;0.186)				ACCCAAAAGGGACCATTGCTT	0.468																																																1	Substitution - coding silent(1)	ovary(1)	1											99.0	98.0	98.0					1																	232650408		1880	4108	5988	230717031	SO:0001819	synonymous_variant	57568			AB037810	CCDS41474.1	1q42.2	2008-02-05			ENSG00000116991	ENSG00000116991			23800	protein-coding gene	gene with protein product		611609					Standard	NM_020808		Approved	KIAA1389	uc001hvg.3	Q9P2F8	OTTHUMG00000037820	ENST00000366630.1:c.678C>G	1.37:g.232650408G>C			230717031	Q2TV88|Q5VXR7|Q5VXR8|Q641Q4|Q8NA38|Q96DZ3|Q9H9F6	Silent	SNP	ENST00000366630.1	37	CCDS41474.1																																																																																				0.468	SIPA1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092318.1	XM_045839	
OR2L2	26246	broad.mit.edu	37	1	248201606	248201606	+	Missense_Mutation	SNP	T	T	A			TCGA-61-1998-01A-01W-0722-08	TCGA-61-1998-10A-01W-0722-08	T	T	A	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0284efcd-e4b8-45b5-9c1e-6f3950ac4bf0	5a480357-2b29-4ce2-b257-a77186ce5fad	g.chr1:248201606T>A	ENST00000366479.2	+	1	133	c.37T>A	c.(37-39)Tta>Ata	p.L13I	OR2L13_ENST00000366478.2_Intron	NM_001004686.2	NP_001004686.1	Q8NH16	OR2L2_HUMAN	olfactory receptor, family 2, subfamily L, member 2	13						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L13I(1)		NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(28)|ovary(1)|skin(4)|urinary_tract(1)	42	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0278)			TGATTTCATCTTATTGGGGCT	0.363																																																1	Substitution - Missense(1)	ovary(1)	1											133.0	128.0	130.0					1																	248201606		2203	4300	6503	246268229	SO:0001583	missense	26246			X64978	CCDS31103.1	1q44	2012-08-09			ENSG00000203663	ENSG00000203663		"""GPCR / Class A : Olfactory receptors"""	8266	protein-coding gene	gene with protein product				OR2L4P, OR2L12		1370859	Standard	NM_001004686		Approved	HTPCRH07, HSHTPCRH07	uc001idw.3	Q8NH16	OTTHUMG00000040214	ENST00000366479.2:c.37T>A	1.37:g.248201606T>A	ENSP00000355435:p.Leu13Ile		246268229	Q2M3T5	Missense_Mutation	SNP	ENST00000366479.2	37	CCDS31103.1	.	.	.	.	.	.	.	.	.	.	.	12.95	2.091426	0.36952	.	.	ENSG00000203663	ENST00000366479	T	0.00540	6.7	2.13	-0.717	0.11208	.	.	.	.	.	T	0.01730	0.0055	M	0.86864	2.845	0.09310	N	1	D	0.89917	1.0	D	0.79784	0.993	T	0.44544	-0.9321	9	0.72032	D	0.01	.	2.1238	0.03732	0.2439:0.3168:0.0:0.4393	.	13	Q8NH16	OR2L2_HUMAN	I	13	ENSP00000355435:L13I	ENSP00000355435:L13I	L	+	1	2	OR2L2	246268229	0.000000	0.05858	0.020000	0.16555	0.131000	0.20780	-2.292000	0.01146	-0.017000	0.14103	0.172000	0.16884	TTA		0.363	OR2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096871.1	NM_001004686	
GTPBP4	23560	broad.mit.edu	37	10	1046802	1046802	+	Silent	SNP	C	C	T			TCGA-61-1998-01A-01W-0722-08	TCGA-61-1998-10A-01W-0722-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0284efcd-e4b8-45b5-9c1e-6f3950ac4bf0	5a480357-2b29-4ce2-b257-a77186ce5fad	g.chr10:1046802C>T	ENST00000360803.4	+	7	922	c.840C>T	c.(838-840)atC>atT	p.I280I	GTPBP4_ENST00000491635.1_3'UTR|GTPBP4_ENST00000538293.1_Silent_p.I164I|GTPBP4_ENST00000545048.1_Silent_p.I233I	NM_012341.2	NP_036473.2	Q9BZE4	NOG1_HUMAN	GTP binding protein 4	280	OBG-type G. {ECO:0000255|PROSITE- ProRule:PRU01047}.				GTP catabolic process (GO:0006184)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of collagen binding (GO:0033342)|negative regulation of DNA replication (GO:0008156)|negative regulation of protein ubiquitination (GO:0031397)|osteoblast differentiation (GO:0001649)|protein stabilization (GO:0050821)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|ribosome biogenesis (GO:0042254)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)	p.I280I(1)		endometrium(2)|kidney(1)|large_intestine(3)|lung(11)|ovary(1)|prostate(2)|skin(1)	21		all_epithelial(10;0.107)|Colorectal(49;0.14)	OV - Ovarian serous cystadenocarcinoma(33;0.0814)	Epithelial(11;0.0513)|all cancers(11;0.135)|OV - Ovarian serous cystadenocarcinoma(14;0.173)		CTCTCTTCATCAACAAGGTGT	0.458																																																1	Substitution - coding silent(1)	ovary(1)	10											224.0	216.0	219.0					10																	1046802		2203	4300	6503	1036802	SO:0001819	synonymous_variant	23560			AK001548	CCDS31132.1	10p15-p14	2007-07-27			ENSG00000107937	ENSG00000107937			21535	protein-coding gene	gene with protein product	"""G protein-binding protein CRFG"", "" GTP-binding protein"""					11316846	Standard	NM_012341		Approved	CRFG, NGB, FLJ10690, FLJ10686, NOG1	uc001ift.3	Q9BZE4	OTTHUMG00000017538	ENST00000360803.4:c.840C>T	10.37:g.1046802C>T			1036802	B3KMC5|B4DY13|B7Z7A3|O95446|Q5T3R8|Q9NVJ8	Silent	SNP	ENST00000360803.4	37	CCDS31132.1																																																																																				0.458	GTPBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046412.1	NM_012341	
MAPK8	5599	broad.mit.edu	37	10	49628339	49628339	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1998-01A-01W-0722-08	TCGA-61-1998-10A-01W-0722-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0284efcd-e4b8-45b5-9c1e-6f3950ac4bf0	5a480357-2b29-4ce2-b257-a77186ce5fad	g.chr10:49628339C>T	ENST00000374189.1	+	6	773	c.592C>T	c.(592-594)Ctt>Ttt	p.L198F	MAPK8_ENST00000360332.3_Missense_Mutation_p.L198F|MAPK8_ENST00000374182.3_Missense_Mutation_p.L198F|MAPK8_ENST00000374174.1_Missense_Mutation_p.L198F|MAPK8_ENST00000395611.3_Missense_Mutation_p.L198F			P45983	MK08_HUMAN	mitogen-activated protein kinase 8	198	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to mechanical stimulus (GO:0071260)|cellular response to nitric oxide (GO:0071732)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|JNK cascade (GO:0007254)|JUN phosphorylation (GO:0007258)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein binding (GO:0032091)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification (GO:0001503)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of deacetylase activity (GO:0090045)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of gene expression (GO:0010628)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|programmed necrotic cell death (GO:0097300)|regulation of histone deacetylation (GO:0031063)|regulation of protein localization (GO:0032880)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|response to cadmium ion (GO:0046686)|response to stress (GO:0006950)|response to UV (GO:0009411)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|histone deacetylase binding (GO:0042826)|histone deacetylase regulator activity (GO:0035033)|JUN kinase activity (GO:0004705)|protein serine/threonine kinase activity (GO:0004674)	p.L198F(1)		breast(1)|central_nervous_system(3)|endometrium(4)|kidney(1)|large_intestine(6)|liver(3)|lung(11)|ovary(1)|skin(1)|stomach(1)|urinary_tract(2)	34		Ovarian(717;0.0221)|Lung SC(717;0.113)|all_neural(218;0.116)		Epithelial(53;3.46e-65)|Lung(62;0.125)		CGAGGTCATCCTTGGCATGGG	0.393																																																1	Substitution - Missense(1)	ovary(1)	10											141.0	132.0	135.0					10																	49628339		2203	4300	6503	49298345	SO:0001583	missense	5599			L26318	CCDS7223.1, CCDS7224.1, CCDS7225.1, CCDS7226.1, CCDS60527.1	10q11	2011-06-09			ENSG00000107643	ENSG00000107643	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinases"""	6881	protein-coding gene	gene with protein product	"""JUN N-terminal kinase"""	601158		PRKM8		8137421, 8654373	Standard	NM_002750		Approved	JNK, JNK1, SAPK1	uc001jgp.3	P45983	OTTHUMG00000018172	ENST00000374189.1:c.592C>T	10.37:g.49628339C>T	ENSP00000363304:p.Leu198Phe		49298345	B5BTZ5|B7ZLV4|D3DX88|D3DX92|Q15709|Q15712|Q15713|Q308M2	Missense_Mutation	SNP	ENST00000374189.1	37	CCDS7224.1	.	.	.	.	.	.	.	.	.	.	C	26.2	4.715018	0.89112	.	.	ENSG00000107643	ENST00000374189;ENST00000374182;ENST00000374179;ENST00000360332;ENST00000374176;ENST00000374174;ENST00000395611	T;T;T;T;T;T;T	0.67523	-0.27;-0.27;-0.27;-0.27;-0.27;-0.27;-0.27	5.38	4.48	0.54585	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.148370	0.46758	D	0.000261	T	0.69860	0.3158	M	0.62209	1.925	0.80722	D	1	P;B;B;B;B	0.36837	0.571;0.158;0.19;0.19;0.158	P;B;B;B;B	0.46479	0.518;0.187;0.284;0.284;0.259	T	0.68036	-0.5515	9	.	.	.	.	11.6095	0.51052	0.0:0.855:0.0:0.145	.	198;198;198;198;198	Q308M2;P45983-2;P45983;A1L4K2;P45983-3	.;.;MK08_HUMAN;.;.	F	198	ENSP00000363304:L198F;ENSP00000363297:L198F;ENSP00000363294:L198F;ENSP00000353483:L198F;ENSP00000363291:L198F;ENSP00000363289:L198F;ENSP00000378974:L198F	.	L	+	1	0	MAPK8	49298345	1.000000	0.71417	0.996000	0.52242	0.968000	0.65278	3.266000	0.51569	1.398000	0.46701	0.655000	0.94253	CTT		0.393	MAPK8-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047931.1		
CSTF2T	23283	broad.mit.edu	37	10	53458890	53458890	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1998-01A-01W-0722-08	TCGA-61-1998-10A-01W-0722-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0284efcd-e4b8-45b5-9c1e-6f3950ac4bf0	5a480357-2b29-4ce2-b257-a77186ce5fad	g.chr10:53458890C>T	ENST00000331173.4	-	1	465	c.420G>A	c.(418-420)atG>atA	p.M140I	PRKG1_ENST00000401604.2_Intron|PRKG1_ENST00000373980.4_Intron|PRKG1_ENST00000373985.1_Intron	NM_015235.2	NP_056050.1	Q9H0L4	CSTFT_HUMAN	cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa, tau variant	140					mRNA processing (GO:0006397)	intracellular (GO:0005622)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.M140I(1)		NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(6)|ovary(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	30				COAD - Colon adenocarcinoma(2;0.00736)|Colorectal(2;0.00898)|all cancers(4;0.0188)|GBM - Glioblastoma multiforme(4;0.0778)|Epithelial(53;0.122)		TCAGCTCAAACATCTGCTCCG	0.507																																																1	Substitution - Missense(1)	ovary(1)	10											142.0	138.0	140.0					10																	53458890		2203	4300	6503	53128896	SO:0001583	missense	23283			AB014589	CCDS7245.1	10q11	2013-02-12			ENSG00000177613	ENSG00000177613		"""RNA binding motif (RRM) containing"""	17086	protein-coding gene	gene with protein product		611968				12408968, 11113135	Standard	NM_015235		Approved	DKFZp434C1013, KIAA0689, CstF-64T	uc001jjp.3	Q9H0L4	OTTHUMG00000018246	ENST00000331173.4:c.420G>A	10.37:g.53458890C>T	ENSP00000332444:p.Met140Ile		53128896	B2RAR9|O75174|Q53HK6|Q7LGE8|Q8N6T1	Missense_Mutation	SNP	ENST00000331173.4	37	CCDS7245.1	.	.	.	.	.	.	.	.	.	.	C	22.7	4.329217	0.81690	.	.	ENSG00000177613	ENST00000331173	T	0.25250	1.81	4.99	4.99	0.66335	.	0.000000	0.85682	D	0.000000	T	0.54095	0.1837	M	0.85299	2.745	0.80722	D	1	D	0.59357	0.985	D	0.64877	0.93	T	0.59974	-0.7353	10	0.72032	D	0.01	-6.7129	16.1846	0.81942	0.0:1.0:0.0:0.0	.	140	Q9H0L4	CSTFT_HUMAN	I	140	ENSP00000332444:M140I	ENSP00000332444:M140I	M	-	3	0	CSTF2T	53128896	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.443000	0.66581	2.767000	0.95098	0.655000	0.94253	ATG		0.507	CSTF2T-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048097.1	NM_015235	
VCL	7414	broad.mit.edu	37	10	75857087	75857087	+	Missense_Mutation	SNP	A	A	T			TCGA-61-1998-01A-01W-0722-08	TCGA-61-1998-10A-01W-0722-08	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0284efcd-e4b8-45b5-9c1e-6f3950ac4bf0	5a480357-2b29-4ce2-b257-a77186ce5fad	g.chr10:75857087A>T	ENST00000211998.4	+	13	1963	c.1869A>T	c.(1867-1869)gaA>gaT	p.E623D	VCL_ENST00000372755.3_Missense_Mutation_p.E623D|VCL_ENST00000478896.2_Intron|VCL_ENST00000417648.2_Intron	NM_014000.2	NP_054706.1	P18206	VINC_HUMAN	vinculin	623	N-terminal globular head.				adherens junction assembly (GO:0034333)|apical junction assembly (GO:0043297)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)|epithelial cell-cell adhesion (GO:0090136)|lamellipodium assembly (GO:0030032)|morphogenesis of an epithelium (GO:0002009)|muscle contraction (GO:0006936)|negative regulation of cell migration (GO:0030336)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|protein localization to cell surface (GO:0034394)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cell-substrate junction (GO:0030055)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|vesicle (GO:0031982)	actin binding (GO:0003779)|alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)	p.E623D(1)	VCL/ALK(4)	breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	20	Prostate(51;0.0112)					CTAACAGGGAAGAGGTGGGTA	0.498																																																1	Substitution - Missense(1)	ovary(1)	10											89.0	86.0	87.0					10																	75857087		2203	4300	6503	75527093	SO:0001583	missense	7414			M33308	CCDS7340.1, CCDS7341.1	10q22.1-q23	2014-09-17			ENSG00000035403	ENSG00000035403			12665	protein-coding gene	gene with protein product	"""metavinculin"""	193065				1339348	Standard	NM_014000		Approved		uc001jwd.3	P18206	OTTHUMG00000018498	ENST00000211998.4:c.1869A>T	10.37:g.75857087A>T	ENSP00000211998:p.Glu623Asp		75527093	Q16450|Q5SWX2|Q7Z3B8|Q8IXU7	Missense_Mutation	SNP	ENST00000211998.4	37	CCDS7341.1	.	.	.	.	.	.	.	.	.	.	A	11.59	1.684785	0.29872	.	.	ENSG00000035403	ENST00000372755;ENST00000211998;ENST00000415462;ENST00000537043;ENST00000436396	T;T;T	0.62364	0.03;0.03;0.03	5.29	2.58	0.30949	.	0.233607	0.43919	D	0.000507	T	0.37839	0.1018	N	0.12471	0.22	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.0;0.0;0.001	T	0.12656	-1.0539	10	0.36615	T	0.2	.	6.0399	0.19728	0.6454:0.0:0.086:0.2687	.	550;623;623	F5H7T3;P18206-2;P18206	.;.;VINC_HUMAN	D	623;623;530;550;295	ENSP00000361841:E623D;ENSP00000211998:E623D;ENSP00000415489:E295D	ENSP00000211998:E623D	E	+	3	2	VCL	75527093	0.999000	0.42202	1.000000	0.80357	0.477000	0.33069	0.652000	0.24888	0.953000	0.37825	0.524000	0.50904	GAA		0.498	VCL-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_003373, NM_014000	
SEC23IP	11196	broad.mit.edu	37	10	121685734	121685734	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1998-01A-01W-0722-08	TCGA-61-1998-10A-01W-0722-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0284efcd-e4b8-45b5-9c1e-6f3950ac4bf0	5a480357-2b29-4ce2-b257-a77186ce5fad	g.chr10:121685734G>A	ENST00000369075.3	+	13	2380	c.2308G>A	c.(2308-2310)Gga>Aga	p.G770R	SEC23IP_ENST00000543134.1_Missense_Mutation_p.G559R	NM_007190.3	NP_009121.1	Q9Y6Y8	S23IP_HUMAN	SEC23 interacting protein	770					acrosome assembly (GO:0001675)|Golgi organization (GO:0007030)|intracellular protein transport (GO:0006886)|single fertilization (GO:0007338)	cis-Golgi network (GO:0005801)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum exit site (GO:0070971)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|perinuclear endoplasmic reticulum (GO:0097038)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.G770R(1)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(12)|ovary(3)|prostate(1)|stomach(3)|urinary_tract(1)	36		Lung NSC(174;0.109)|all_lung(145;0.142)|all_neural(114;0.234)		all cancers(201;0.00515)		AGTTGGCGCCGGACAGGTGAG	0.393																																																1	Substitution - Missense(1)	ovary(1)	10											135.0	139.0	138.0					10																	121685734		2203	4300	6503	121675724	SO:0001583	missense	11196			AB019435	CCDS7618.1	10q26.11-q26.12	2013-01-10			ENSG00000107651	ENSG00000107651		"""Sterile alpha motif (SAM) domain containing"""	17018	protein-coding gene	gene with protein product						10400679	Standard	NM_007190		Approved	p125	uc001leu.2	Q9Y6Y8	OTTHUMG00000019161	ENST00000369075.3:c.2308G>A	10.37:g.121685734G>A	ENSP00000358071:p.Gly770Arg		121675724	D3DRD2|Q8IXH5|Q9BUK5	Missense_Mutation	SNP	ENST00000369075.3	37	CCDS7618.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.109062	0.77096	.	.	ENSG00000107651	ENST00000369075;ENST00000543134	T;T	0.43688	0.94;1.09	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.65801	0.2726	M	0.68952	2.095	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.66272	-0.5965	10	0.66056	D	0.02	-20.9074	19.8472	0.96713	0.0:0.0:1.0:0.0	.	559;770	F5H0L8;Q9Y6Y8	.;S23IP_HUMAN	R	770;559	ENSP00000358071:G770R;ENSP00000438773:G559R	ENSP00000358071:G770R	G	+	1	0	SEC23IP	121675724	1.000000	0.71417	0.934000	0.37439	0.310000	0.27922	9.148000	0.94652	2.701000	0.92244	0.591000	0.81541	GGA		0.393	SEC23IP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050688.1		
MUC5B	727897	broad.mit.edu	37	11	1247994	1247994	+	Missense_Mutation	SNP	C	C	A			TCGA-61-1998-01A-01W-0722-08	TCGA-61-1998-10A-01W-0722-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0284efcd-e4b8-45b5-9c1e-6f3950ac4bf0	5a480357-2b29-4ce2-b257-a77186ce5fad	g.chr11:1247994C>A	ENST00000529681.1	+	4	407	c.349C>A	c.(349-351)Cag>Aag	p.Q117K	MUC5B_ENST00000447027.1_Missense_Mutation_p.Q117K	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	117	VWFD 1. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)		p.Q117K(1)		cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CTTCAACGTCCAGCTACGCCG	0.632																																																1	Substitution - Missense(1)	ovary(1)	11											36.0	39.0	38.0					11																	1247994		2121	4241	6362	1204570	SO:0001583	missense	727897			U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.349C>A	11.37:g.1247994C>A	ENSP00000436812:p.Gln117Lys		1204570	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	37	CCDS44515.2	.	.	.	.	.	.	.	.	.	.	C	7.099	0.573652	0.13623	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.58358	0.34;0.34	3.68	2.75	0.32379	von Willebrand factor, type D domain (3);	.	.	.	.	T	0.66771	0.2823	M	0.79475	2.455	0.33353	D	0.57129	B;P;D	0.57899	0.375;0.889;0.981	B;P;P	0.57425	0.251;0.736;0.82	T	0.77480	-0.2572	9	0.87932	D	0	.	12.263	0.54661	0.1713:0.8287:0.0:0.0	.	117;773;117	Q9HC84;A7Y9J9;E9PBJ0	MUC5B_HUMAN;.;.	K	117;117;117;150	ENSP00000436812:Q117K;ENSP00000415793:Q117K	ENSP00000343037:Q117K	Q	+	1	0	MUC5B	1204570	1.000000	0.71417	0.028000	0.17463	0.090000	0.18270	5.378000	0.66190	0.734000	0.32515	0.561000	0.74099	CAG		0.632	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
RIC3	79608	broad.mit.edu	37	11	8132397	8132397	+	Missense_Mutation	SNP	C	C	G			TCGA-61-1998-01A-01W-0722-08	TCGA-61-1998-10A-01W-0722-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0284efcd-e4b8-45b5-9c1e-6f3950ac4bf0	5a480357-2b29-4ce2-b257-a77186ce5fad	g.chr11:8132397C>G	ENST00000309737.6	-	6	957	c.958G>C	c.(958-960)Gct>Cct	p.A320P	RIC3_ENST00000425599.2_Missense_Mutation_p.A239P|RIC3_ENST00000539720.1_Missense_Mutation_p.A271P|RIC3_ENST00000343202.4_Missense_Mutation_p.A319P|RIC3_ENST00000335425.7_Missense_Mutation_p.A138P|RIC3_ENST00000396677.2_Missense_Mutation_p.A158P|RIC3_ENST00000530060.1_5'UTR			Q7Z5B4	RIC3_HUMAN	RIC3 acetylcholine receptor chaperone	320					cellular protein complex assembly (GO:0043623)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein folding (GO:0006457)|synaptic transmission, cholinergic (GO:0007271)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)		p.A319P(1)		breast(1)|endometrium(2)|large_intestine(2)|lung(9)|ovary(2)|pancreas(1)	17				Epithelial(150;2.89e-07)|BRCA - Breast invasive adenocarcinoma(625;0.204)		CTGAATCCAGCATTCTCTGCC	0.473																																																1	Substitution - Missense(1)	ovary(1)	11											140.0	128.0	132.0					11																	8132397		2201	4296	6497	8088973	SO:0001583	missense	79608				CCDS7788.1, CCDS44533.1, CCDS55741.1, CCDS55742.1	11p15.4	2013-08-05	2013-08-05		ENSG00000166405	ENSG00000166405			30338	protein-coding gene	gene with protein product		610509	"""resistance to inhibitors of cholinesterase 3 homolog (C. elegans)"""			12821669	Standard	NM_024557		Approved	FLJ11608, PRO1385, AYST720	uc001mgd.2	Q7Z5B4	OTTHUMG00000165694	ENST00000309737.6:c.958G>C	11.37:g.8132397C>G	ENSP00000308820:p.Ala320Pro		8088973	B0B1U0|B2RD25|D3DQU5|Q6UX78|Q7Z5B3|Q86T94|Q8TBJ9|Q9HAH8	Missense_Mutation	SNP	ENST00000309737.6	37	CCDS55742.1	.	.	.	.	.	.	.	.	.	.	C	16.84	3.234267	0.58886	.	.	ENSG00000166405	ENST00000396677;ENST00000335425;ENST00000343202;ENST00000309737;ENST00000539720;ENST00000425599	T;T;T;T	0.35605	1.34;1.34;1.35;1.3	5.96	1.46	0.22682	.	0.515676	0.20092	N	0.099436	T	0.50377	0.1612	M	0.67953	2.075	0.40134	D	0.976753	D;D;D;D;D	0.76494	0.989;0.996;0.999;0.999;0.966	P;P;D;D;P	0.66979	0.885;0.885;0.948;0.948;0.696	T	0.50021	-0.8876	10	0.72032	D	0.01	.	7.1573	0.25645	0.1235:0.63:0.0:0.2465	.	239;138;320;319;158	B0B1U0;Q7Z5B4-3;Q7Z5B4;Q7Z5B4-5;D3DQU6	.;.;RIC3_HUMAN;.;.	P	158;138;319;320;271;239	ENSP00000344904:A319P;ENSP00000308820:A320P;ENSP00000443871:A271P;ENSP00000395320:A239P	ENSP00000308820:A320P	A	-	1	0	RIC3	8088973	0.999000	0.42202	1.000000	0.80357	0.969000	0.65631	1.503000	0.35715	0.401000	0.25424	-0.142000	0.14014	GCT		0.473	RIC3-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000385900.1	NM_024557	
OR5T2	219464	broad.mit.edu	37	11	55999592	55999592	+	Missense_Mutation	SNP	G	G	T			TCGA-61-1998-01A-01W-0722-08	TCGA-61-1998-10A-01W-0722-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0284efcd-e4b8-45b5-9c1e-6f3950ac4bf0	5a480357-2b29-4ce2-b257-a77186ce5fad	g.chr11:55999592G>T	ENST00000313264.4	-	1	1145	c.1070C>A	c.(1069-1071)aCt>aAt	p.T357N		NM_001004746.1	NP_001004746.1	Q8NGG2	OR5T2_HUMAN	olfactory receptor, family 5, subfamily T, member 2	357						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T357N(1)		endometrium(6)|kidney(1)|large_intestine(5)|lung(22)|ovary(2)|prostate(1)|skin(1)|stomach(3)	41	Esophageal squamous(21;0.00448)					TTATTTTTTAGTATGAAAATA	0.328																																																1	Substitution - Missense(1)	ovary(1)	11											13.0	14.0	14.0					11																	55999592		2139	4215	6354	55756168	SO:0001583	missense	219464			AB065838	CCDS31523.1	11q11	2012-08-09			ENSG00000181718	ENSG00000181718		"""GPCR / Class A : Olfactory receptors"""	15296	protein-coding gene	gene with protein product							Standard	NM_001004746		Approved		uc010rjc.2	Q8NGG2	OTTHUMG00000166851	ENST00000313264.4:c.1070C>A	11.37:g.55999592G>T	ENSP00000323688:p.Thr357Asn		55756168	B9EGX5|Q6IFC8	Missense_Mutation	SNP	ENST00000313264.4	37	CCDS31523.1	.	.	.	.	.	.	.	.	.	.	G	2.772	-0.255558	0.05829	.	.	ENSG00000181718	ENST00000313264	T	0.00664	5.92	3.32	-4.66	0.03329	.	.	.	.	.	T	0.00440	0.0014	N	0.08118	0	0.09310	N	1	B	0.26400	0.148	B	0.17433	0.018	T	0.44050	-0.9353	9	0.30854	T	0.27	.	6.1779	0.20455	0.2693:0.3872:0.3435:0.0	.	357	Q8NGG2	OR5T2_HUMAN	N	357	ENSP00000323688:T357N	ENSP00000323688:T357N	T	-	2	0	OR5T2	55756168	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	-2.916000	0.00696	-1.143000	0.02866	-0.875000	0.02981	ACT		0.328	OR5T2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391598.1	NM_001004746	
SYT7	9066	broad.mit.edu	37	11	61291333	61291333	+	Silent	SNP	C	C	G			TCGA-61-1998-01A-01W-0722-08	TCGA-61-1998-10A-01W-0722-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0284efcd-e4b8-45b5-9c1e-6f3950ac4bf0	5a480357-2b29-4ce2-b257-a77186ce5fad	g.chr11:61291333C>G	ENST00000263846.4	-	7	1200	c.873G>C	c.(871-873)cgG>cgC	p.R291R	SYT7_ENST00000540831.1_5'Flank|SYT7_ENST00000540677.1_Silent_p.R366R|SYT7_ENST00000542670.1_Silent_p.R499R|SYT7_ENST00000542836.1_Silent_p.R335R|SYT7_ENST00000535826.1_Silent_p.R410R|SYT7_ENST00000539008.1_Silent_p.R574R	NM_004200.3	NP_004191.2	O43581	SYT7_HUMAN	synaptotagmin VII	291	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				exocytosis (GO:0006887)|plasma membrane repair (GO:0001778)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of insulin secretion (GO:0050796)	cell junction (GO:0030054)|dense core granule (GO:0031045)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|transporter activity (GO:0005215)	p.R291R(1)		kidney(2)|large_intestine(3)|lung(4)|ovary(3)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						CTTTGAGGTTCCGGGCTTTGA	0.612																																																1	Substitution - coding silent(1)	ovary(1)	11											321.0	305.0	310.0					11																	61291333		2202	4299	6501	61047909	SO:0001819	synonymous_variant	9066			AF038535	CCDS31577.1, CCDS58139.1, CCDS73298.1	11q12-q13.1	2013-01-21			ENSG00000011347	ENSG00000011347		"""Synaptotagmins"""	11514	protein-coding gene	gene with protein product		604146	"""prostate cancer associated protein 7"""	PCANAP7		9615227	Standard	NM_001252065		Approved	IPCA-7, SYT-VII, MGC150517	uc009ynr.3	O43581	OTTHUMG00000168199	ENST00000263846.4:c.873G>C	11.37:g.61291333C>G			61047909	F5GZU9|Q08AH6	Silent	SNP	ENST00000263846.4	37	CCDS31577.1																																																																																				0.612	SYT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398733.1	NM_004200	
FADS3	3995	broad.mit.edu	37	11	61643837	61643837	+	Missense_Mutation	SNP	G	G	T			TCGA-61-1998-01A-01W-0722-08	TCGA-61-1998-10A-01W-0722-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0284efcd-e4b8-45b5-9c1e-6f3950ac4bf0	5a480357-2b29-4ce2-b257-a77186ce5fad	g.chr11:61643837G>T	ENST00000278829.2	-	9	1226	c.1074C>A	c.(1072-1074)agC>agA	p.S358R	FADS3_ENST00000527697.1_Missense_Mutation_p.S234R|FADS3_ENST00000540820.1_3'UTR|FADS3_ENST00000525588.1_Missense_Mutation_p.S330R	NM_021727.3	NP_068373.1	Q9Y5Q0	FADS3_HUMAN	fatty acid desaturase 3	358					unsaturated fatty acid biosynthetic process (GO:0006636)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxidoreductase activity, acting on paired donors, with oxidation of a pair of donors resulting in the reduction of molecular oxygen to two molecules of water (GO:0016717)	p.S358R(1)		central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						CCACCTGAGAGCTGACCCAGT	0.652																																																1	Substitution - Missense(1)	ovary(1)	11											46.0	41.0	43.0					11																	61643837		2202	4299	6501	61400413	SO:0001583	missense	3995				CCDS8013.1	11q12-q13.1	2013-01-25			ENSG00000221968	ENSG00000221968	1.14.19.3	"""Fatty acid desaturases"""	3576	protein-coding gene	gene with protein product	"""delta-9-desaturase"""	606150		LLCDL3			Standard	NM_021727		Approved	CYB5RP	uc001nsm.3	Q9Y5Q0	OTTHUMG00000167500	ENST00000278829.2:c.1074C>A	11.37:g.61643837G>T	ENSP00000278829:p.Ser358Arg		61400413	O60426	Missense_Mutation	SNP	ENST00000278829.2	37	CCDS8013.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	9.209|9.209	1.030445|1.030445	0.19512|0.19512	.|.	.|.	ENSG00000221968|ENSG00000221968	ENST00000527379|ENST00000527697;ENST00000278829;ENST00000525588	.|T;T;T	.|0.17213	.|2.29;2.29;2.29	4.65|4.65	3.74|3.74	0.42951|0.42951	.|Fatty acid desaturase, type 1 (1);	.|.	.|.	.|.	.|.	T|T	0.20659|0.20659	0.0497|0.0497	L|L	0.46947|0.46947	1.48|1.48	0.80722|0.80722	D|D	1|1	.|P;B	.|0.35982	.|0.531;0.347	.|P;P	.|0.47941	.|0.562;0.481	T|T	0.05852|0.05852	-1.0860|-1.0860	5|9	.|0.33141	.|T	.|0.24	-4.0E-4|-4.0E-4	4.6867|4.6867	0.12760|0.12760	0.1828:0.0:0.6427:0.1745|0.1828:0.0:0.6427:0.1745	.|.	.|234;358	.|E9PKP8;Q9Y5Q0	.|.;FADS3_HUMAN	D|R	133|234;358;330	.|ENSP00000431533:S234R;ENSP00000278829:S358R;ENSP00000432206:S330R	.|ENSP00000278829:S358R	A|S	-|-	2|3	0|2	FADS3|FADS3	61400413|61400413	0.905000|0.905000	0.30787|0.30787	0.140000|0.140000	0.22221|0.22221	0.009000|0.009000	0.06853|0.06853	1.072000|1.072000	0.30678|0.30678	1.112000|1.112000	0.41740|0.41740	-0.140000|-0.140000	0.14226|0.14226	GCT|AGC		0.652	FADS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394836.1		
TMPO	7112	broad.mit.edu	37	12	98927521	98927521	+	Intron	SNP	G	G	T			TCGA-61-1998-01A-01W-0722-08	TCGA-61-1998-10A-01W-0722-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0284efcd-e4b8-45b5-9c1e-6f3950ac4bf0	5a480357-2b29-4ce2-b257-a77186ce5fad	g.chr12:98927521G>T	ENST00000556029.1	+	3	921				TMPO_ENST00000393053.2_Intron|TMPO_ENST00000261210.5_Intron|TMPO_ENST00000343315.5_Intron|TMPO_ENST00000266732.4_Nonsense_Mutation_p.E496*	NM_001032283.2	NP_001027454.1	P42167	LAP2B_HUMAN	thymopoietin							cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	DNA binding (GO:0003677)|lamin binding (GO:0005521)	p.E496*(2)		breast(2)|endometrium(1)|large_intestine(4)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						TCCCTTCCATGAATCTATTTT	0.413																																																2	Substitution - Nonsense(2)	ovary(1)|skin(1)	12											71.0	69.0	70.0					12																	98927521		2203	4300	6503	97451652	SO:0001627	intron_variant	7112				CCDS9064.1, CCDS31879.1, CCDS31880.1	12q22	2014-09-17			ENSG00000120802	ENSG00000120802			11875	protein-coding gene	gene with protein product	"""LEM domain containing 4"""	188380				7517549	Standard	NM_003276		Approved	TP, LAP2, LEMD4	uc001tfh.2	P42166	OTTHUMG00000170210	ENST00000556029.1:c.565+1905G>T	12.37:g.98927521G>T			97451652	A2T926|Q14861	Nonsense_Mutation	SNP	ENST00000556029.1	37	CCDS31879.1	.	.	.	.	.	.	.	.	.	.	G	37	6.545722	0.97654	.	.	ENSG00000120802	ENST00000266732	.	.	.	5.65	4.76	0.60689	.	0.233772	0.37623	N	0.002017	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.30854	T	0.27	-10.731	10.6226	0.45489	0.0883:0.0:0.9117:0.0	.	.	.	.	X	496	.	ENSP00000266732:E496X	E	+	1	0	TMPO	97451652	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.950000	0.49081	1.522000	0.49001	0.650000	0.86243	GAA		0.413	TMPO-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407973.2	NM_003276	
NOS1	4842	broad.mit.edu	37	12	117665296	117665296	+	Missense_Mutation	SNP	G	G	T			TCGA-61-1998-01A-01W-0722-08	TCGA-61-1998-10A-01W-0722-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0284efcd-e4b8-45b5-9c1e-6f3950ac4bf0	5a480357-2b29-4ce2-b257-a77186ce5fad	g.chr12:117665296G>T	ENST00000338101.4	-	23	3662	c.3658C>A	c.(3658-3660)Cca>Aca	p.P1220T	NOS1_ENST00000344089.3_3'UTR|NOS1_ENST00000317775.6_Missense_Mutation_p.P1186T			Q8WY41	NANO1_HUMAN	nitric oxide synthase 1 (neuronal)	0					cell migration (GO:0016477)|epithelial cell migration (GO:0010631)|negative regulation of translation (GO:0017148)	cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|translation repressor activity (GO:0030371)|zinc ion binding (GO:0008270)	p.P1186T(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(21)|lung(43)|ovary(3)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	117	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)		TACATGTCTGGGGAGGAGCTG	0.607																																					Esophageal Squamous(162;1748 2599 51982 52956)											1	Substitution - Missense(1)	ovary(1)	12											70.0	83.0	79.0					12																	117665296		2103	4222	6325	116149679	SO:0001583	missense	4842				CCDS41842.1, CCDS55890.1	12q24.22	2013-09-19			ENSG00000089250	ENSG00000089250	1.14.13.39		7872	protein-coding gene	gene with protein product		163731		NOS		1385308, 7682706	Standard	NM_001204213		Approved	nNOS	uc001twn.2	P29475	OTTHUMG00000137376	ENST00000338101.4:c.3658C>A	12.37:g.117665296G>T	ENSP00000337459:p.Pro1220Thr		116149679		Missense_Mutation	SNP	ENST00000338101.4	37	CCDS55890.1	.	.	.	.	.	.	.	.	.	.	G	27.7	4.858795	0.91433	.	.	ENSG00000089250	ENST00000397605;ENST00000317775;ENST00000541241;ENST00000338101	T;T	0.68331	-0.32;-0.32	4.95	4.95	0.65309	Riboflavin synthase-like beta-barrel (1);FAD-binding, type 1 (1);Ferredoxin reductase-type FAD-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.87018	0.6073	H	0.94306	3.52	0.80722	D	1	D	0.89917	1.0	D	0.76071	0.987	D	0.90591	0.4537	10	0.72032	D	0.01	-16.6131	18.3687	0.90400	0.0:0.0:1.0:0.0	.	1186	P29475	NOS1_HUMAN	T	1081;1186;1186;1220	ENSP00000320758:P1186T;ENSP00000337459:P1220T	ENSP00000320758:P1186T	P	-	1	0	NOS1	116149679	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.733000	0.84916	2.557000	0.86248	0.591000	0.81541	CCA		0.607	NOS1-002	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000268053.1		
LECT1	11061	broad.mit.edu	37	13	53277821	53277821	+	Missense_Mutation	SNP	G	G	C			TCGA-61-1998-01A-01W-0722-08	TCGA-61-1998-10A-01W-0722-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0284efcd-e4b8-45b5-9c1e-6f3950ac4bf0	5a480357-2b29-4ce2-b257-a77186ce5fad	g.chr13:53277821G>C	ENST00000377962.3	-	7	992	c.914C>G	c.(913-915)cCa>cGa	p.P305R	LECT1_ENST00000448904.2_Missense_Mutation_p.P304R			O75829	LECT1_HUMAN	leukocyte cell derived chemotaxin 1	305					cartilage development (GO:0051216)|endothelial cell morphogenesis (GO:0001886)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|proteoglycan metabolic process (GO:0006029)|skeletal system development (GO:0001501)	integral component of membrane (GO:0016021)|proteinaceous extracellular matrix (GO:0005578)		p.P305R(1)		NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|skin(1)|urinary_tract(1)	15		Lung NSC(96;0.00212)|Breast(56;0.00235)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;3.38e-08)		ATAAGGCCATGGGTAATAGCC	0.522																																																1	Substitution - Missense(1)	ovary(1)	13											72.0	73.0	72.0					13																	53277821		2203	4300	6503	52175822	SO:0001583	missense	11061			AB006000	CCDS9437.1, CCDS45051.1	13q14.3	2012-10-10			ENSG00000136110	ENSG00000136110		"""BRICHOS domain containing"""	17005	protein-coding gene	gene with protein product	"""BRICHOS domain containing 3"""	605147	"""multiple myeloma tumor suppressor 1"""	MYETS1		9731231, 10103018	Standard	XM_006719760		Approved	CHM-I, CHM1, chondromodulin, BRICD3	uc001vhf.2	O75829	OTTHUMG00000016980	ENST00000377962.3:c.914C>G	13.37:g.53277821G>C	ENSP00000367198:p.Pro305Arg		52175822	Q5TAM4|Q8TAY6|Q9UM18	Missense_Mutation	SNP	ENST00000377962.3	37	CCDS9437.1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.214631	0.79352	.	.	ENSG00000136110	ENST00000448904;ENST00000377962	T;T	0.36520	1.26;1.25	5.3	5.3	0.74995	.	0.108387	0.64402	D	0.000007	T	0.63920	0.2552	M	0.78637	2.42	0.58432	D	0.999994	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.972	T	0.67098	-0.5756	10	0.87932	D	0	.	19.1447	0.93459	0.0:0.0:1.0:0.0	.	304;305	O75829-2;O75829	.;LECT1_HUMAN	R	304;305	ENSP00000388576:P304R;ENSP00000367198:P305R	ENSP00000367198:P305R	P	-	2	0	LECT1	52175822	1.000000	0.71417	0.955000	0.39395	0.993000	0.82548	6.041000	0.70988	2.753000	0.94483	0.585000	0.79938	CCA		0.522	LECT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045110.3		
SLC10A2	6555	broad.mit.edu	37	13	103703609	103703609	+	Nonsense_Mutation	SNP	G	G	C	rs150229163		TCGA-61-1998-01A-01W-0722-08	TCGA-61-1998-10A-01W-0722-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0284efcd-e4b8-45b5-9c1e-6f3950ac4bf0	5a480357-2b29-4ce2-b257-a77186ce5fad	g.chr13:103703609G>C	ENST00000245312.3	-	4	1355	c.759C>G	c.(757-759)taC>taG	p.Y253*		NM_000452.2	NP_000443	Q12908	NTCP2_HUMAN	solute carrier family 10 (sodium/bile acid cotransporter), member 2	253					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|integral component of plasma membrane (GO:0005887)|microvillus (GO:0005902)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteasome complex (GO:0000502)	bile acid:sodium symporter activity (GO:0008508)	p.Y253*(1)		breast(1)|endometrium(2)|large_intestine(6)|lung(16)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34	all_neural(89;0.0662)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)				Aciclovir(DB00787)|Cyclosporine(DB00091)|Ursodeoxycholic acid(DB01586)|Valaciclovir(DB00577)	TGCCATACCTGTACCAGGGTA	0.428																																																1	Substitution - Nonsense(1)	ovary(1)	13											70.0	72.0	71.0					13																	103703609		2203	4300	6503	102501610	SO:0001587	stop_gained	6555			U10417	CCDS9506.1	13q33	2013-07-18	2013-07-18		ENSG00000125255	ENSG00000125255		"""Solute carriers"""	10906	protein-coding gene	gene with protein product		601295		ASBT, ISBT		8661017	Standard	NM_000452		Approved		uc001vpy.4	Q12908	OTTHUMG00000017313	ENST00000245312.3:c.759C>G	13.37:g.103703609G>C	ENSP00000245312:p.Tyr253*		102501610	A1L4F4|Q13839	Nonsense_Mutation	SNP	ENST00000245312.3	37	CCDS9506.1	.	.	.	.	.	.	.	.	.	.	G	39	7.407071	0.98265	.	.	ENSG00000125255	ENST00000245312	.	.	.	5.46	4.58	0.56647	.	0.574580	0.19974	N	0.101912	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	-14.0415	16.3048	0.82843	0.0:0.1319:0.8681:0.0	.	.	.	.	X	253	.	ENSP00000245312:Y253X	Y	-	3	2	SLC10A2	102501610	1.000000	0.71417	1.000000	0.80357	0.093000	0.18481	3.578000	0.53892	2.576000	0.86940	0.460000	0.39030	TAC		0.428	SLC10A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045716.1		
GMPR2	51292	broad.mit.edu	37	14	24706359	24706359	+	Splice_Site	SNP	G	G	C			TCGA-61-1998-01A-01W-0722-08	TCGA-61-1998-10A-01W-0722-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0284efcd-e4b8-45b5-9c1e-6f3950ac4bf0	5a480357-2b29-4ce2-b257-a77186ce5fad	g.chr14:24706359G>C	ENST00000355299.4	+	6	1008		c.e6+1		GMPR2_ENST00000559836.1_Splice_Site|GMPR2_ENST00000560517.1_Splice_Site|GMPR2_ENST00000399440.2_Splice_Site|GMPR2_ENST00000559104.1_Splice_Site|GMPR2_ENST00000420554.2_Splice_Site|GMPR2_ENST00000559910.1_Splice_Site|GMPR2_ENST00000557854.1_Splice_Site|GMPR2_ENST00000348719.7_Splice_Site|GMPR2_ENST00000456667.3_Splice_Site	NM_001002000.1	NP_001002000.1	Q9P2T1	GMPR2_HUMAN	guanosine monophosphate reductase 2						GMP metabolic process (GO:0046037)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|GMP reductase complex (GO:1902560)	GMP reductase activity (GO:0003920)|metal ion binding (GO:0046872)	p.?(1)		large_intestine(4)|lung(3)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	12				GBM - Glioblastoma multiforme(265;0.0181)		ATTGGGCCAGGTAAGCTGGTT	0.512																																																1	Unknown(1)	ovary(1)	14											115.0	117.0	116.0					14																	24706359		1995	4196	6191	23776199	SO:0001630	splice_region_variant	51292				CCDS41935.1, CCDS45087.1, CCDS61419.1, CCDS73624.1	14q11.2	2006-11-24							4377	protein-coding gene	gene with protein product		610781					Standard	XM_005267742		Approved		uc001wnw.3	Q9P2T1		ENST00000355299.4:c.547+1G>C	14.37:g.24706359G>C			23776199	D3DS66|Q567T0|Q6IAJ8|Q86T14	Splice_Site	SNP	ENST00000355299.4	37	CCDS41935.1	.	.	.	.	.	.	.	.	.	.	G	22.6	4.310005	0.81247	.	.	ENSG00000100938	ENST00000355299;ENST00000421944;ENST00000420554;ENST00000399440;ENST00000348719;ENST00000456667	.	.	.	5.37	5.37	0.77165	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.0474	0.89337	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	GMPR2	23776199	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	9.188000	0.94921	2.793000	0.96121	0.563000	0.77884	.		0.512	GMPR2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415821.2	NM_016576	Intron
L2HGDH	79944	broad.mit.edu	37	14	50769692	50769692	+	Missense_Mutation	SNP	C	C	G			TCGA-61-1998-01A-01W-0722-08	TCGA-61-1998-10A-01W-0722-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0284efcd-e4b8-45b5-9c1e-6f3950ac4bf0	5a480357-2b29-4ce2-b257-a77186ce5fad	g.chr14:50769692C>G	ENST00000267436.4	-	2	581	c.184G>C	c.(184-186)Gcc>Ccc	p.A62P	L2HGDH_ENST00000421284.3_Missense_Mutation_p.A62P|L2HGDH_ENST00000555423.1_Missense_Mutation_p.A62P|L2HGDH_ENST00000556393.1_5'UTR|L2HGDH_ENST00000555610.1_Missense_Mutation_p.A62P|L2HGDH_ENST00000261699.4_Missense_Mutation_p.A62P			Q9H9P8	L2HDH_HUMAN	L-2-hydroxyglutarate dehydrogenase	62					2-oxoglutarate metabolic process (GO:0006103)|cellular metabolic process (GO:0044237)|cellular protein metabolic process (GO:0044267)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|integral component of mitochondrial inner membrane (GO:0031305)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	2-hydroxyglutarate dehydrogenase activity (GO:0047545)	p.A62P(1)		kidney(1)|large_intestine(4)|lung(3)|ovary(2)	10	all_epithelial(31;0.000599)|Breast(41;0.0102)					CTGGCAGAGGCAAGCCCCACA	0.393																																																1	Substitution - Missense(1)	ovary(1)	14											123.0	123.0	123.0					14																	50769692		2203	4300	6503	49839442	SO:0001583	missense	79944				CCDS9698.1	14q22.1	2006-04-28	2005-05-25	2005-05-25	ENSG00000087299	ENSG00000087299	1.1.99.2		20499	protein-coding gene	gene with protein product	"""2-hydroxyglutarate dehydrogenase"""	609584	"""chromosome 14 open reading frame 160"""	C14orf160		16005139	Standard	NM_024884		Approved	FLJ12618	uc001wxu.3	Q9H9P8	OTTHUMG00000140289	ENST00000267436.4:c.184G>C	14.37:g.50769692C>G	ENSP00000267436:p.Ala62Pro		49839442	Q9BRR1	Missense_Mutation	SNP	ENST00000267436.4	37	CCDS9698.1	.	.	.	.	.	.	.	.	.	.	C	35	5.430251	0.96131	.	.	ENSG00000087299	ENST00000261699;ENST00000267436;ENST00000421284;ENST00000557131;ENST00000555423;ENST00000555610	D;D;D;D;D	0.83506	-1.73;-1.73;-1.73;-1.73;-1.73	5.35	5.35	0.76521	FAD dependent oxidoreductase (1);	0.000000	0.85682	D	0.000000	D	0.94978	0.8375	H	0.97940	4.11	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.81914	0.995;0.992	D	0.96243	0.9177	10	0.87932	D	0	-17.2031	19.9585	0.97232	0.0:1.0:0.0:0.0	.	62;62	C9JVN9;Q9H9P8	.;L2HDH_HUMAN	P	62	ENSP00000261699:A62P;ENSP00000267436:A62P;ENSP00000405559:A62P;ENSP00000450494:A62P;ENSP00000452483:A62P	ENSP00000261699:A62P	A	-	1	0	L2HGDH	49839442	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.365000	0.79537	2.894000	0.99253	0.655000	0.94253	GCC		0.393	L2HGDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276870.2	NM_024884	
POMT2	29954	broad.mit.edu	37	14	77762597	77762597	+	Silent	SNP	C	C	A			TCGA-61-1998-01A-01W-0722-08	TCGA-61-1998-10A-01W-0722-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0284efcd-e4b8-45b5-9c1e-6f3950ac4bf0	5a480357-2b29-4ce2-b257-a77186ce5fad	g.chr14:77762597C>A	ENST00000261534.4	-	9	1228	c.1026G>T	c.(1024-1026)gtG>gtT	p.V342V		NM_013382.5	NP_037514.2	Q9UKY4	POMT2_HUMAN	protein-O-mannosyltransferase 2	342	MIR 1. {ECO:0000255|PROSITE- ProRule:PRU00131}.					endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	dolichyl-phosphate-mannose-protein mannosyltransferase activity (GO:0004169)|metal ion binding (GO:0046872)	p.V342V(1)		breast(2)|endometrium(2)|large_intestine(1)|liver(1)|lung(5)|ovary(1)|prostate(1)|skin(1)	14			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0292)		TCACAGTGATCACAGAGCCGT	0.637																																																1	Substitution - coding silent(1)	ovary(1)	14											75.0	55.0	62.0					14																	77762597		2203	4300	6503	76832350	SO:0001819	synonymous_variant	29954			AF105020	CCDS9857.1	14q24	2014-09-17			ENSG00000009830	ENSG00000009830	2.4.1.109	"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"""	19743	protein-coding gene	gene with protein product		607439				11162531, 12460945	Standard	NM_013382		Approved	LGMD2N	uc001xti.2	Q9UKY4	OTTHUMG00000171556	ENST00000261534.4:c.1026G>T	14.37:g.77762597C>A			76832350	Q9NSG6|Q9P1W0|Q9P1W2	Silent	SNP	ENST00000261534.4	37	CCDS9857.1																																																																																				0.637	POMT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414155.1	NM_013382	
TTC7B	145567	broad.mit.edu	37	14	91084326	91084326	+	Silent	SNP	A	A	T			TCGA-61-1998-01A-01W-0722-08	TCGA-61-1998-10A-01W-0722-08	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0284efcd-e4b8-45b5-9c1e-6f3950ac4bf0	5a480357-2b29-4ce2-b257-a77186ce5fad	g.chr14:91084326A>T	ENST00000328459.6	-	16	1936	c.1815T>A	c.(1813-1815)acT>acA	p.T605T	TTC7B_ENST00000357056.2_Silent_p.T605T|TTC7B_ENST00000554654.1_5'UTR	NM_001010854.1	NP_001010854.1	Q86TV6	TTC7B_HUMAN	tetratricopeptide repeat domain 7B	605								p.T605T(1)		NS(1)|breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	36		Melanoma(154;0.222)				TGTGCTTACAAGTCAGCAGTG	0.552																																																1	Substitution - coding silent(1)	ovary(1)	14											131.0	123.0	125.0					14																	91084326		2203	4300	6503	90154079	SO:0001819	synonymous_variant	145567			BC035865	CCDS32140.1	14q32.12	2013-01-11	2004-06-02	2004-06-04		ENSG00000165914		"""Tetratricopeptide (TTC) repeat domain containing"""	19858	protein-coding gene	gene with protein product			"""tetratricopeptide repeat domain 7 like 1"""	TTC7L1			Standard	XM_005267367		Approved		uc001xyp.3	Q86TV6		ENST00000328459.6:c.1815T>A	14.37:g.91084326A>T			90154079	Q86U24|Q86VT3	Silent	SNP	ENST00000328459.6	37	CCDS32140.1																																																																																				0.552	TTC7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411364.2		
SERPINA4	5267	broad.mit.edu	37	14	95030122	95030122	+	Silent	SNP	C	C	A			TCGA-61-1998-01A-01W-0722-08	TCGA-61-1998-10A-01W-0722-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0284efcd-e4b8-45b5-9c1e-6f3950ac4bf0	5a480357-2b29-4ce2-b257-a77186ce5fad	g.chr14:95030122C>A	ENST00000557004.1	+	2	724	c.303C>A	c.(301-303)atC>atA	p.I101I	SERPINA4_ENST00000555095.1_Silent_p.I101I|SERPINA4_ENST00000298841.5_Silent_p.I101I|SERPINA5_ENST00000553780.1_Intron			P29622	KAIN_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 4	101					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.I101I(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(9)|lung(28)|ovary(3)|skin(1)|urinary_tract(1)	46				COAD - Colon adenocarcinoma(157;0.211)		GCAGCCAGATCCTTGAGGGCC	0.637																																																1	Substitution - coding silent(1)	ovary(1)	14											41.0	43.0	42.0					14																	95030122		2203	4300	6503	94099875	SO:0001819	synonymous_variant	5267			L19684	CCDS9927.1	14q32.13	2014-02-18	2005-08-18		ENSG00000100665	ENSG00000100665		"""Serine (or cysteine) peptidase inhibitors"""	8948	protein-coding gene	gene with protein product		147935	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 4"""	PI4		8227002, 24172014	Standard	NM_001289032		Approved	KST, KAL, KLST, kallistatin	uc001ydk.3	P29622	OTTHUMG00000170859	ENST00000557004.1:c.303C>A	14.37:g.95030122C>A			94099875	Q53XB5|Q86TR9|Q96BZ5	Silent	SNP	ENST00000557004.1	37	CCDS9927.1																																																																																				0.637	SERPINA4-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410718.1	NM_006215	
NPAP1	23742	broad.mit.edu	37	15	24921335	24921335	+	Missense_Mutation	SNP	G	G	T			TCGA-61-1998-01A-01W-0722-08	TCGA-61-1998-10A-01W-0722-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0284efcd-e4b8-45b5-9c1e-6f3950ac4bf0	5a480357-2b29-4ce2-b257-a77186ce5fad	g.chr15:24921335G>T	ENST00000329468.2	+	1	795	c.321G>T	c.(319-321)agG>agT	p.R107S		NM_018958.2	NP_061831.2	Q9NZP6	NPAP1_HUMAN	nuclear pore associated protein 1	107					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)		p.R107S(1)									ACCCCCCGAGGTTTGGACACC	0.677																																																1	Substitution - Missense(1)	ovary(1)	15											46.0	38.0	41.0					15																	24921335		2199	4293	6492	22472428	SO:0001583	missense	23742			AF179681	CCDS10015.1	15q11-q13	2012-07-19	2012-06-14	2012-06-14	ENSG00000185823	ENSG00000185823			1190	protein-coding gene	gene with protein product		610922	"""chromosome 15 open reading frame 2"""	C15orf2		10783265, 22694955	Standard	NM_018958		Approved		uc001ywo.3	Q9NZP6	OTTHUMG00000129179	ENST00000329468.2:c.321G>T	15.37:g.24921335G>T	ENSP00000333735:p.Arg107Ser		22472428		Missense_Mutation	SNP	ENST00000329468.2	37	CCDS10015.1	.	.	.	.	.	.	.	.	.	.	.	2.239	-0.374263	0.05034	.	.	ENSG00000185823	ENST00000329468	T	0.06218	3.33	2.45	0.414	0.16406	.	3.487680	0.01209	N	0.007796	T	0.06872	0.0175	N	0.22421	0.69	0.09310	N	1	P	0.47253	0.892	P	0.47251	0.542	T	0.19516	-1.0303	10	0.27785	T	0.31	.	3.5165	0.07727	0.1633:0.2682:0.5684:0.0	.	107	Q9NZP6	CO002_HUMAN	S	107	ENSP00000333735:R107S	ENSP00000333735:R107S	R	+	3	2	C15orf2	22472428	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.109000	0.10840	0.121000	0.18284	0.484000	0.47621	AGG		0.677	NPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251253.1	NM_018958	
RYR3	6263	broad.mit.edu	37	15	33895399	33895399	+	Silent	SNP	C	C	T			TCGA-61-1998-01A-01W-0722-08	TCGA-61-1998-10A-01W-0722-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0284efcd-e4b8-45b5-9c1e-6f3950ac4bf0	5a480357-2b29-4ce2-b257-a77186ce5fad	g.chr15:33895399C>T	ENST00000389232.4	+	18	2068	c.1998C>T	c.(1996-1998)atC>atT	p.I666I	RYR3_ENST00000415757.3_Silent_p.I666I	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	666	B30.2/SPRY 1. {ECO:0000255|PROSITE- ProRule:PRU00548}.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)	p.I666I(1)		NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		AGCTGATTATCGACCAGGTGG	0.567																																																1	Substitution - coding silent(1)	ovary(1)	15											135.0	141.0	139.0					15																	33895399		2004	4170	6174	31682691	SO:0001819	synonymous_variant	6263				CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.1998C>T	15.37:g.33895399C>T			31682691	O15175|Q15412	Silent	SNP	ENST00000389232.4	37	CCDS45210.1																																																																																				0.567	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1		
HEXA	3073	broad.mit.edu	37	15	72643496	72643496	+	Missense_Mutation	SNP	G	G	C			TCGA-61-1998-01A-01W-0722-08	TCGA-61-1998-10A-01W-0722-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0284efcd-e4b8-45b5-9c1e-6f3950ac4bf0	5a480357-2b29-4ce2-b257-a77186ce5fad	g.chr15:72643496G>C	ENST00000268097.5	-	6	1153	c.650C>G	c.(649-651)aCt>aGt	p.T217S	HEXA_ENST00000567159.1_Missense_Mutation_p.T217S|RP11-106M3.2_ENST00000379915.4_RNA|RP11-106M3.3_ENST00000570175.1_RNA|HEXA_ENST00000566304.1_Missense_Mutation_p.T228S|HEXA_ENST00000457859.2_Missense_Mutation_p.T25S|HEXA_ENST00000429918.2_Missense_Mutation_p.T44S	NM_000520.4	NP_000511.2	P06865	HEXA_HUMAN	hexosaminidase A (alpha polypeptide)	217					carbohydrate metabolic process (GO:0005975)|cell death (GO:0008219)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|glycosphingolipid metabolic process (GO:0006687)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)	beta-N-acetylhexosaminidase activity (GO:0004563)|protein heterodimerization activity (GO:0046982)	p.T217S(1)		breast(2)|cervix(1)|endometrium(3)|kidney(3)|lung(7)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	24						CTCTGGAAAAGTGAAGCTCTC	0.468																																																1	Substitution - Missense(1)	ovary(1)	15											162.0	130.0	141.0					15																	72643496		2199	4297	6496	70430550	SO:0001583	missense	3073			M13520	CCDS10243.1	15q24.1	2012-10-02			ENSG00000213614	ENSG00000213614	3.2.1.52		4878	protein-coding gene	gene with protein product	"""Tay Sachs disease"", ""GM2 gangliosidosis"""	606869				2952641, 3013851	Standard	NM_000520		Approved		uc002aun.4	P06865	OTTHUMG00000133445	ENST00000268097.5:c.650C>G	15.37:g.72643496G>C	ENSP00000268097:p.Thr217Ser		70430550	B4DKE7|E7ENH7|Q53HS8|Q6AI32	Missense_Mutation	SNP	ENST00000268097.5	37	CCDS10243.1	.	.	.	.	.	.	.	.	.	.	G	18.35	3.604435	0.66445	.	.	ENSG00000213614	ENST00000268097;ENST00000457859;ENST00000429918	D;D;D	0.95272	-3.66;-3.66;-3.66	5.78	4.83	0.62350	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);Glycoside hydrolase, family 20, catalytic core (1);	0.111773	0.64402	D	0.000014	D	0.89876	0.6842	N	0.21617	0.685	0.46044	D	0.998835	B;B;B;B;B	0.11235	0.0;0.004;0.0;0.0;0.001	B;B;B;B;B	0.25614	0.004;0.062;0.004;0.004;0.01	D	0.84979	0.0887	10	0.21540	T	0.41	-15.6742	16.2242	0.82283	0.0:0.0:0.8665:0.1335	.	44;228;44;97;217	E9PGL4;B4DVA7;B4DVL8;Q9BVJ8;P06865	.;.;.;.;HEXA_HUMAN	S	217;25;44	ENSP00000268097:T217S;ENSP00000398026:T25S;ENSP00000416187:T44S	ENSP00000268097:T217S	T	-	2	0	HEXA	70430550	1.000000	0.71417	0.916000	0.36221	0.999000	0.98932	5.560000	0.67332	2.706000	0.92434	0.655000	0.94253	ACT		0.468	HEXA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257317.2	NM_000520	
CNTNAP4	85445	broad.mit.edu	37	16	76486529	76486529	+	Missense_Mutation	SNP	G	G	A	rs570306162		TCGA-61-1998-01A-01W-0722-08	TCGA-61-1998-10A-01W-0722-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0284efcd-e4b8-45b5-9c1e-6f3950ac4bf0	5a480357-2b29-4ce2-b257-a77186ce5fad	g.chr16:76486529G>A	ENST00000476707.1	+	7	1344	c.1205G>A	c.(1204-1206)cGa>cAa	p.R402Q	CNTNAP4_ENST00000469589.1_3'UTR|CNTNAP4_ENST00000307431.8_Missense_Mutation_p.R398Q|CNTNAP4_ENST00000478060.1_Missense_Mutation_p.R326Q|CNTNAP4_ENST00000377504.4_Missense_Mutation_p.R350Q			Q9C0A0	CNTP4_HUMAN	contactin associated protein-like 4	399	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)|regulation of grooming behavior (GO:2000821)|regulation of synaptic transmission, dopaminergic (GO:0032225)|regulation of synaptic transmission, GABAergic (GO:0032228)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|presynaptic membrane (GO:0042734)		p.R374Q(1)		breast(4)|central_nervous_system(1)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(33)|ovary(2)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	64						TTTCAATTTCGAACTTGGAAT	0.463													G|||	1	0.000199681	0.0	0.0	5008	,	,		16483	0.0		0.001	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	16											99.0	98.0	99.0					16																	76486529		2198	4300	6498	75044030	SO:0001583	missense	85445			AB051550	CCDS10924.1, CCDS10924.2, CCDS73915.1	16q23.1	2008-02-05			ENSG00000152910	ENSG00000152910			18747	protein-coding gene	gene with protein product		610518				12093160	Standard	NM_033401		Approved	CASPR4, KIAA1763	uc010chb.1	Q9C0A0	OTTHUMG00000137617	ENST00000476707.1:c.1205G>A	16.37:g.76486529G>A	ENSP00000417628:p.Arg402Gln		75044030	E9PFZ6|Q86YZ7	Missense_Mutation	SNP	ENST00000476707.1	37		.	.	.	.	.	.	.	.	.	.	G	34	5.397475	0.96009	.	.	ENSG00000152910	ENST00000307431;ENST00000377504;ENST00000478060;ENST00000476707	D;D;D;D	0.83591	-1.74;-1.74;-1.74;-1.74	5.52	5.52	0.82312	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.000000	0.34435	N	0.003965	D	0.91788	0.7402	.	.	.	0.58432	D	0.999995	D;D;D;D	0.89917	1.0;0.998;1.0;0.996	D;D;D;D	0.78314	0.988;0.949;0.991;0.957	D	0.92081	0.5672	9	0.87932	D	0	.	19.6434	0.95767	0.0:0.0:1.0:0.0	.	326;402;374;399	E9PFZ6;E9PDN6;Q96M80;Q9C0A0	.;.;.;CNTP4_HUMAN	Q	398;350;326;402	ENSP00000306893:R398Q;ENSP00000439733:R350Q;ENSP00000418741:R326Q;ENSP00000417628:R402Q	ENSP00000306893:R398Q	R	+	2	0	CNTNAP4	75044030	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.240000	0.95396	2.880000	0.98712	0.655000	0.94253	CGA		0.463	CNTNAP4-005	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000348216.1	NM_033401	
TP53	7157	broad.mit.edu	37	17	7578204	7578204	+	Missense_Mutation	SNP	A	A	C			TCGA-61-1998-01A-01W-0722-08	TCGA-61-1998-10A-01W-0722-08	A	A	C	C	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0284efcd-e4b8-45b5-9c1e-6f3950ac4bf0	5a480357-2b29-4ce2-b257-a77186ce5fad	g.chr17:7578204A>C	ENST00000269305.4	-	6	834	c.645T>G	c.(643-645)agT>agG	p.S215R	TP53_ENST00000445888.2_Missense_Mutation_p.S215R|TP53_ENST00000420246.2_Missense_Mutation_p.S215R|TP53_ENST00000455263.2_Missense_Mutation_p.S215R|TP53_ENST00000413465.2_Missense_Mutation_p.S215R|TP53_ENST00000574684.1_Intron|TP53_ENST00000359597.4_Missense_Mutation_p.S215R	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	215	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		S -> C (in sporadic cancers; somatic mutation).|S -> G (in sporadic cancers; somatic mutation).|S -> I (in sporadic cancers; somatic mutation).|S -> K (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|S -> N (in sporadic cancers; somatic mutation).|S -> R (in sporadic cancers; somatic mutation).|S -> T (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.S215R(17)|p.0?(8)|p.?(5)|p.S215S(2)|p.H214fs*5(2)|p.V216fs*32(1)|p.V216fs*33(1)|p.S215fs*27(1)|p.S215del(1)|p.S215fs*29(1)|p.D208_V216delDRNTFRHSV(1)|p.V216fs*6(1)|p.T211_S215delTFRHS(1)|p.S83R(1)|p.D208fs*1(1)|p.S215fs*32(1)|p.S215fs*31(1)|p.S215_V216insX(1)|p.T211fs*28(1)|p.R213_S215>X(1)|p.D207_V216del10(1)|p.S215_V218>R(1)|p.S215_V218>M(1)|p.S122R(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCACCACCACACTATGTCGAA	0.532		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	53	Substitution - Missense(19)|Whole gene deletion(8)|Deletion - Frameshift(7)|Unknown(5)|Deletion - In frame(4)|Insertion - Frameshift(3)|Complex - deletion inframe(3)|Substitution - coding silent(2)|Insertion - In frame(1)|Complex - frameshift(1)	haematopoietic_and_lymphoid_tissue(9)|biliary_tract(5)|large_intestine(5)|bone(5)|breast(5)|stomach(4)|oesophagus(4)|ovary(4)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(2)|skin(2)|lung(2)|liver(1)|prostate(1)	17	GRCh37	CD941799	TP53	D							124.0	111.0	116.0					17																	7578204		2203	4300	6503	7518929	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.645T>G	17.37:g.7578204A>C	ENSP00000269305:p.Ser215Arg		7518929	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	A	20.2	3.954051	0.73902	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99855	-7.2;-7.2;-7.2;-7.2;-7.2;-7.2;-7.2;-7.2	5.28	-4.05	0.03998	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99806	0.9916	M	0.90705	3.14	0.58432	D	0.999995	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D	0.98563	1.0642	10	0.87932	D	0	-18.3023	12.3136	0.54942	0.7185:0.0:0.2815:0.0	.	176;215;215;122;215;215;215	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	R	215;215;215;215;215;215;204;122;83;122;83	ENSP00000410739:S215R;ENSP00000352610:S215R;ENSP00000269305:S215R;ENSP00000398846:S215R;ENSP00000391127:S215R;ENSP00000391478:S215R;ENSP00000425104:S83R;ENSP00000423862:S122R	ENSP00000269305:S215R	S	-	3	2	TP53	7518929	0.000000	0.05858	0.557000	0.28306	0.964000	0.63967	-1.515000	0.02252	-0.649000	0.05430	-0.468000	0.05107	AGT		0.532	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
KIAA0100	9703	broad.mit.edu	37	17	26940298	26940298	+	IGR	SNP	T	T	A			TCGA-61-1998-01A-01W-0722-08	TCGA-61-1998-10A-01W-0722-08	T	T	A	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0284efcd-e4b8-45b5-9c1e-6f3950ac4bf0	5a480357-2b29-4ce2-b257-a77186ce5fad	g.chr17:26940298T>A	ENST00000528896.2	-	0	7407				SGK494_ENST00000469832.3_5'UTR|RP11-192H23.4_ENST00000534850.1_Missense_Mutation_p.K130N|SPAG5-AS1_ENST00000424210.1_RNA|SGK494_ENST00000301037.5_Missense_Mutation_p.K130N|SPAG5-AS1_ENST00000414744.1_RNA|SPAG5-AS1_ENST00000554154.1_RNA|RP11-192H23.4_ENST00000577790.1_Intron	NM_014680.3	NP_055495.2	Q14667	K0100_HUMAN	KIAA0100							extracellular region (GO:0005576)		p.K169N(1)|p.K130N(1)		breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(23)|ovary(2)|prostate(2)|skin(6)|stomach(2)|urinary_tract(3)	68	Lung NSC(42;0.00431)					CAAATACAGCTTTCTGGGTGC	0.463											OREG0024279	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				2	Substitution - Missense(2)	ovary(2)	17											92.0	85.0	87.0					17																	26940298		2203	4300	6503	23964425	SO:0001628	intergenic_variant	124923			D43947	CCDS32595.1	17q11.2	2012-11-29			ENSG00000007202	ENSG00000007202			28960	protein-coding gene	gene with protein product	"""cancer/testis antigen 101"", ""breast cancer overexpressed gene 1"""	610664				16289875	Standard	NM_014680		Approved	DKFZp686M0843, MGC111488, BCOX1, CT101, BCOX	uc002hbu.3	Q14667	OTTHUMG00000166587		17.37:g.26940298T>A		790	23964425	A6NCX3|Q3SYN5|Q49A07|Q5H9T4|Q6WG74|Q6ZP51|Q96HH8	Missense_Mutation	SNP	ENST00000528896.2	37	CCDS32595.1	.	.	.	.	.	.	.	.	.	.	T	4.640	0.118943	0.08881	.	.	ENSG00000258472;ENSG00000167524;ENSG00000167524;ENSG00000167524;ENSG00000167524;ENSG00000167524	ENST00000531839;ENST00000378976;ENST00000481916;ENST00000301037;ENST00000534850;ENST00000530121	T;T;T;T;T	0.07216	3.21;3.21;3.21;3.21;3.21	4.98	-3.57	0.04612	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.449356	0.25332	N	0.031427	T	0.03053	0.0090	N	0.13327	0.33	0.20764	N	0.99985	B;B	0.09022	0.002;0.0	B;B	0.09377	0.004;0.004	T	0.30001	-0.9993	10	0.39692	T	0.17	0.0955	0.4335	0.00475	0.3731:0.2088:0.1261:0.292	.	130;130	E9PMD0;Q96LW2	.;SG494_HUMAN	N	130	ENSP00000431165:K130N;ENSP00000436369:K130N;ENSP00000301037:K130N;ENSP00000437573:K130N;ENSP00000434603:K130N	ENSP00000301037:K130N	K	-	3	2	AC005726.6;RP11-192H23.4	23964425	0.226000	0.23696	0.670000	0.29842	0.375000	0.29983	-0.080000	0.11339	-0.643000	0.05473	-0.378000	0.06908	AAA		0.463	KIAA0100-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390571.3	NM_014680	
EPN3	55040	broad.mit.edu	37	17	48618164	48618164	+	Silent	SNP	G	G	A	rs372785882		TCGA-61-1998-01A-01W-0722-08	TCGA-61-1998-10A-01W-0722-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0284efcd-e4b8-45b5-9c1e-6f3950ac4bf0	5a480357-2b29-4ce2-b257-a77186ce5fad	g.chr17:48618164G>A	ENST00000268933.3	+	7	1569	c.990G>A	c.(988-990)ccG>ccA	p.P330P	RP11-94C24.8_ENST00000513017.1_RNA|EPN3_ENST00000537145.1_Silent_p.P358P|EPN3_ENST00000541226.1_Missense_Mutation_p.R218Q	NM_017957.2	NP_060427.2	Q9H201	EPN3_HUMAN	epsin 3	330	5 X 3 AA repeats of [DE]-P-W.					clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	lipid binding (GO:0008289)	p.P330P(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(1)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	14	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;2.88e-09)			GTTTTAGGCCGAACACAGAGG	0.617													G|||	1	0.000199681	0.0	0.0014	5008	,	,		17531	0.0		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	17						G		1,4405	2.1+/-5.4	0,1,2202	57.0	57.0	57.0		990	-9.4	0.1	17		57	5,8595	3.7+/-12.6	0,5,4295	no	coding-synonymous	EPN3	NM_017957.2		0,6,6497	AA,AG,GG		0.0581,0.0227,0.0461		330/633	48618164	6,13000	2203	4300	6503	45973163	SO:0001819	synonymous_variant	55040			AF324241	CCDS11570.1	17q21.33	2008-07-18				ENSG00000049283			18235	protein-coding gene	gene with protein product		607264				10951261, 11359770	Standard	NM_017957		Approved	FLJ20778, MGC129899	uc002ira.4	Q9H201		ENST00000268933.3:c.990G>A	17.37:g.48618164G>A			45973163	A8K6J3|A8KAB2|Q9BVN6|Q9NWK2	Silent	SNP	ENST00000268933.3	37	CCDS11570.1	.	.	.	.	.	.	.	.	.	.	G	11.96	1.793303	0.31685	2.27E-4	5.81E-4	ENSG00000049283	ENST00000541226	T	0.42513	0.97	5.23	-9.35	0.00633	.	.	.	.	.	T	0.16471	0.0396	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.15723	-1.0427	6	0.17369	T	0.5	-4.0579	3.5155	0.07723	0.1656:0.3825:0.3562:0.0957	.	.	.	.	Q	218	ENSP00000440540:R218Q	ENSP00000440540:R218Q	R	+	2	0	EPN3	45973163	0.000000	0.05858	0.063000	0.19743	0.909000	0.53808	-1.911000	0.01583	-1.351000	0.02197	-0.377000	0.06932	CGA		0.617	EPN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367573.1	NM_017957	
HEATR6	63897	broad.mit.edu	37	17	58149580	58149580	+	Missense_Mutation	SNP	C	C	A			TCGA-61-1998-01A-01W-0722-08	TCGA-61-1998-10A-01W-0722-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0284efcd-e4b8-45b5-9c1e-6f3950ac4bf0	5a480357-2b29-4ce2-b257-a77186ce5fad	g.chr17:58149580C>A	ENST00000184956.6	-	5	711	c.695G>T	c.(694-696)tGc>tTc	p.C232F	HEATR6_ENST00000585976.1_Missense_Mutation_p.C232F	NM_022070.4	NP_071353.4	Q6AI08	HEAT6_HUMAN	HEAT repeat containing 6	232							poly(A) RNA binding (GO:0044822)	p.C232F(1)		NS(1)|breast(4)|endometrium(5)|kidney(2)|large_intestine(4)|lung(7)|ovary(2)|pancreas(1)|prostate(4)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	44	all_cancers(5;2.25e-13)|Breast(5;4.84e-25)|all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		BRCA - Breast invasive adenocarcinoma(1;5.93e-19)|Epithelial(12;7.59e-12)|all cancers(12;1.26e-10)			ACTTACCATGCAAAATGTGAT	0.388																																																1	Substitution - Missense(1)	ovary(1)	17											79.0	70.0	73.0					17																	58149580		2203	4300	6503	55504362	SO:0001583	missense	63897			BX640819	CCDS11623.1	17q23.2	2007-05-01				ENSG00000068097			24076	protein-coding gene	gene with protein product	"""amplified in breast cancer 1"""					12755490	Standard	NM_022070		Approved	ABC1, FLJ22087	uc002iyk.1	Q6AI08		ENST00000184956.6:c.695G>T	17.37:g.58149580C>A	ENSP00000184956:p.Cys232Phe		55504362	B3KXP3|Q6MZX1|Q6MZY2|Q8TDM9|Q9H6B3|Q9H6M7	Missense_Mutation	SNP	ENST00000184956.6	37	CCDS11623.1	.	.	.	.	.	.	.	.	.	.	C	22.5	4.303291	0.81136	.	.	ENSG00000068097	ENST00000184956;ENST00000393017	T	0.45276	0.9	5.19	5.19	0.71726	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.64735	0.2625	M	0.72118	2.19	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.85130	0.997;0.994	T	0.61063	-0.7138	10	0.37606	T	0.19	-12.5743	18.6504	0.91429	0.0:1.0:0.0:0.0	.	79;232	E7ESB9;Q6AI08	.;HEAT6_HUMAN	F	232;79	ENSP00000184956:C232F	ENSP00000184956:C232F	C	-	2	0	HEATR6	55504362	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.234000	0.72326	2.820000	0.97059	0.650000	0.86243	TGC		0.388	HEATR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449165.1	NM_022070	
SAP30BP	29115	broad.mit.edu	37	17	73698616	73698616	+	Silent	SNP	C	C	T	rs558970179		TCGA-61-1998-01A-01W-0722-08	TCGA-61-1998-10A-01W-0722-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0284efcd-e4b8-45b5-9c1e-6f3950ac4bf0	5a480357-2b29-4ce2-b257-a77186ce5fad	g.chr17:73698616C>T	ENST00000584667.1	+	6	710	c.453C>T	c.(451-453)taC>taT	p.Y151Y	SAP30BP_ENST00000355423.3_Silent_p.Y135Y|SAP30BP_ENST00000579864.1_3'UTR	NM_013260.6	NP_037392.1			SAP30 binding protein									p.Y151Y(1)		kidney(1)|large_intestine(2)|lung(12)|ovary(1)|prostate(1)	17	all_cancers(13;6.42e-08)		all cancers(21;4.25e-07)|Epithelial(20;9.57e-07)|Lung(188;0.132)|LUSC - Lung squamous cell carcinoma(166;0.154)			ATATGAACTACATTATCCAAA	0.438													C|||	1	0.000199681	0.0008	0.0	5008	,	,		20861	0.0		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	17											78.0	79.0	78.0					17																	73698616		2203	4300	6503	71210211	SO:0001819	synonymous_variant	29115			AY082382	CCDS11726.1	17q25.1	2006-01-05				ENSG00000161526			30785	protein-coding gene	gene with protein product		610218				15496587	Standard	NM_013260		Approved	HCNGP, HTRG, HTRP	uc002jpe.3	Q9UHR5		ENST00000584667.1:c.453C>T	17.37:g.73698616C>T			71210211		Silent	SNP	ENST00000584667.1	37	CCDS11726.1																																																																																				0.438	SAP30BP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448227.1	NM_013260	
EPG5	57724	broad.mit.edu	37	18	43438530	43438530	+	Splice_Site	SNP	C	C	A			TCGA-61-1998-01A-01W-0722-08	TCGA-61-1998-10A-01W-0722-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0284efcd-e4b8-45b5-9c1e-6f3950ac4bf0	5a480357-2b29-4ce2-b257-a77186ce5fad	g.chr18:43438530C>A	ENST00000282041.5	-	41	7261		c.e41+1		EPG5_ENST00000585906.1_Splice_Site	NM_020964.2	NP_066015.2	Q9HCE0	EPG5_HUMAN	ectopic P-granules autophagy protein 5 homolog (C. elegans)						autophagic vacuole maturation (GO:0097352)|autophagy (GO:0006914)|endocytic recycling (GO:0032456)			p.?(1)		NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(22)|lung(35)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	95						GGCCAACGTACCTTGGGTACA	0.423																																																1	Unknown(1)	ovary(1)	18											48.0	44.0	46.0					18																	43438530		1908	4131	6039	41692528	SO:0001630	splice_region_variant	57724			AK023817	CCDS11926.2	18q12.3	2011-03-02	2011-03-02	2011-03-02	ENSG00000152223	ENSG00000152223			29331	protein-coding gene	gene with protein product		615068	"""KIAA1632"""	KIAA1632		10997877, 20550938	Standard	XM_005258323		Approved	hEPG5	uc002lbm.3	Q9HCE0	OTTHUMG00000132626	ENST00000282041.5:c.7226+1G>T	18.37:g.43438530C>A			41692528	A2BDF3|Q9H8C8	Splice_Site	SNP	ENST00000282041.5	37	CCDS11926.2	.	.	.	.	.	.	.	.	.	.	C	19.66	3.868489	0.72065	.	.	ENSG00000152223	ENST00000282041;ENST00000540322;ENST00000308403	.	.	.	6.04	6.04	0.98038	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.5792	0.99380	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	EPG5	41692528	1.000000	0.71417	0.971000	0.41717	0.539000	0.34962	7.487000	0.81328	2.873000	0.98535	0.561000	0.74099	.		0.423	EPG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445081.1	NM_020964	Intron
TRIP10	9322	broad.mit.edu	37	19	6744700	6744700	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1998-01A-01W-0722-08	TCGA-61-1998-10A-01W-0722-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0284efcd-e4b8-45b5-9c1e-6f3950ac4bf0	5a480357-2b29-4ce2-b257-a77186ce5fad	g.chr19:6744700G>A	ENST00000313244.9	+	8	813	c.778G>A	c.(778-780)Gat>Aat	p.D260N	TRIP10_ENST00000596758.1_Missense_Mutation_p.D260N|TRIP10_ENST00000600428.1_Missense_Mutation_p.D152N|TRIP10_ENST00000313285.8_Missense_Mutation_p.D260N			Q15642	CIP4_HUMAN	thyroid hormone receptor interactor 10	260	F-BAR domain.				actin cytoskeleton organization (GO:0030036)|cell communication (GO:0007154)|endocytosis (GO:0006897)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|lipid binding (GO:0008289)	p.D260N(1)		NS(1)|breast(1)|endometrium(1)|large_intestine(1)|liver(2)|lung(7)|ovary(1)|prostate(1)|urinary_tract(1)	16						AAATGCTGTGGATCCCAAGAA	0.622																																																1	Substitution - Missense(1)	ovary(1)	19											127.0	115.0	119.0					19																	6744700		2203	4300	6503	6695700	SO:0001583	missense	9322			AB072596	CCDS12172.1, CCDS74271.1, CCDS74272.1	19p13.3	2008-02-05			ENSG00000125733	ENSG00000125733			12304	protein-coding gene	gene with protein product	"""Cdc42-interacting protein"""	604504	"""salt tolerator"""	STOT		7776974, 9210375, 11294612	Standard	XM_005259683		Approved	STP, HSTP, CIP4	uc002mfr.3	Q15642	OTTHUMG00000150255	ENST00000313244.9:c.778G>A	19.37:g.6744700G>A	ENSP00000320117:p.Asp260Asn		6695700	B2R8A6|B7WP22|D6W645|O15184|Q53G22|Q5TZN1|Q6FI24|Q8NFL1|Q8TCY1|Q8TDX3|Q96RJ1	Missense_Mutation	SNP	ENST00000313244.9	37		.	.	.	.	.	.	.	.	.	.	G	12.55	1.972526	0.34848	.	.	ENSG00000125733	ENST00000313285;ENST00000313244;ENST00000420690	T;T	0.52057	0.68;2.32	4.97	1.66	0.24008	.	0.216607	0.46758	N	0.000278	T	0.37625	0.1010	N	0.10874	0.06	0.35555	D	0.804224	B;D;B	0.58970	0.409;0.984;0.004	B;P;B	0.60473	0.173;0.875;0.003	T	0.38373	-0.9664	10	0.18710	T	0.47	-12.9655	7.4353	0.27152	0.2721:0.0:0.7279:0.0	.	260;260;260	G5E9U1;Q15642;Q15642-2	.;CIP4_HUMAN;.	N	260	ENSP00000320493:D260N;ENSP00000320117:D260N	ENSP00000320117:D260N	D	+	1	0	TRIP10	6695700	1.000000	0.71417	0.984000	0.44739	0.864000	0.49448	2.045000	0.41250	0.233000	0.21120	0.462000	0.41574	GAT		0.622	TRIP10-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000317129.2		
ZNF791	163049	broad.mit.edu	37	19	12738844	12738844	+	Missense_Mutation	SNP	A	A	C			TCGA-61-1998-01A-01W-0722-08	TCGA-61-1998-10A-01W-0722-08	A	A	C	C	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0284efcd-e4b8-45b5-9c1e-6f3950ac4bf0	5a480357-2b29-4ce2-b257-a77186ce5fad	g.chr19:12738844A>C	ENST00000343325.4	+	4	663	c.501A>C	c.(499-501)aaA>aaC	p.K167N	ZNF791_ENST00000540038.1_Missense_Mutation_p.K58N|ZNF490_ENST00000465656.1_Intron|ZNF791_ENST00000446165.1_3'UTR|AC010422.1_ENST00000408416.1_RNA|ZNF791_ENST00000458122.3_Missense_Mutation_p.K135N	NM_153358.2	NP_699189.2	Q3KP31	ZN791_HUMAN	zinc finger protein 791	167					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.K167N(1)		endometrium(3)|large_intestine(5)|lung(6)|ovary(2)|prostate(3)	19						AATGTGGAAAAACCTTCATAT	0.383																																																1	Substitution - Missense(1)	ovary(1)	19											60.0	60.0	60.0					19																	12738844		2203	4300	6503	12599844	SO:0001583	missense	163049			AK074877	CCDS12273.1	19p13.2-p13.13	2013-01-08			ENSG00000173875	ENSG00000173875		"""Zinc fingers, C2H2-type"", ""-"""	26895	protein-coding gene	gene with protein product							Standard	NM_153358		Approved	FLJ90396	uc002mua.2	Q3KP31	OTTHUMG00000156426	ENST00000343325.4:c.501A>C	19.37:g.12738844A>C	ENSP00000342974:p.Lys167Asn		12599844	B7Z586|Q8NC99	Missense_Mutation	SNP	ENST00000343325.4	37	CCDS12273.1	.	.	.	.	.	.	.	.	.	.	A	15.70	2.911369	0.52439	.	.	ENSG00000173875	ENST00000343325;ENST00000393303;ENST00000458122;ENST00000540038	T;T;T	0.07908	3.15;3.15;3.15	1.83	0.769	0.18492	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.29716	0.0742	M	0.91406	3.205	0.30052	N	0.811646	D	0.89917	1.0	D	0.87578	0.998	T	0.12016	-1.0564	9	0.87932	D	0	.	4.7119	0.12877	0.8022:0.0:0.1978:0.0	.	167	Q3KP31	ZN791_HUMAN	N	167;149;135;58	ENSP00000342974:K167N;ENSP00000441761:K135N;ENSP00000441038:K58N	ENSP00000342974:K167N	K	+	3	2	ZNF791	12599844	0.278000	0.24230	0.928000	0.36995	0.987000	0.75469	0.598000	0.24074	0.834000	0.34852	0.402000	0.26972	AAA		0.383	ZNF791-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344140.1	NM_153358	
LGALS13	29124	broad.mit.edu	37	19	40095962	40095962	+	Silent	SNP	C	C	T			TCGA-61-1998-01A-01W-0722-08	TCGA-61-1998-10A-01W-0722-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0284efcd-e4b8-45b5-9c1e-6f3950ac4bf0	5a480357-2b29-4ce2-b257-a77186ce5fad	g.chr19:40095962C>T	ENST00000221797.4	+	3	282	c.237C>T	c.(235-237)gaC>gaT	p.D79D		NM_013268.2	NP_037400.1	Q9UHV8	PP13_HUMAN	lectin, galactoside-binding, soluble, 13	79	Galectin. {ECO:0000255|PROSITE- ProRule:PRU00639}.				apoptotic process (GO:0006915)|phospholipid metabolic process (GO:0006644)		carbohydrate binding (GO:0030246)|lysophospholipase activity (GO:0004622)	p.D79D(1)		lung(5)|ovary(1)|urinary_tract(1)	7	all_cancers(60;1.77e-05)|all_lung(34;5.38e-08)|Lung NSC(34;6.37e-08)|Ovarian(47;0.116)		Epithelial(26;3.28e-26)|OV - Ovarian serous cystadenocarcinoma(5;7.31e-25)|all cancers(26;1.15e-23)|LUSC - Lung squamous cell carcinoma(53;0.00281)			AGACAACAGACTACGTGCCCT	0.493																																																1	Substitution - coding silent(1)	ovary(1)	19											234.0	173.0	194.0					19																	40095962		2203	4300	6503	44787802	SO:0001819	synonymous_variant	29124			AF117383	CCDS33024.1	19q13.2	2014-03-19	2008-07-25		ENSG00000105198	ENSG00000105198		"""Lectins, galactoside-binding"""	15449	protein-coding gene	gene with protein product	"""galectin 13"""	608717				6856484, 10527825	Standard	NM_013268		Approved	PP13, PLAC8	uc002omb.3	Q9UHV8	OTTHUMG00000183073	ENST00000221797.4:c.237C>T	19.37:g.40095962C>T			44787802	C5HZ15	Silent	SNP	ENST00000221797.4	37	CCDS33024.1																																																																																				0.493	LGALS13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464968.1	NM_013268	
CYP2A13	1553	broad.mit.edu	37	19	41594390	41594390	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1998-01A-01W-0722-08	TCGA-61-1998-10A-01W-0722-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0284efcd-e4b8-45b5-9c1e-6f3950ac4bf0	5a480357-2b29-4ce2-b257-a77186ce5fad	g.chr19:41594390G>A	ENST00000330436.3	+	1	14	c.14G>A	c.(13-15)gGg>gAg	p.G5E		NM_000766.4	NP_000757.2	Q16696	CP2AD_HUMAN	cytochrome P450, family 2, subfamily A, polypeptide 13	5					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)	p.G5E(1)		breast(3)|endometrium(6)|kidney(4)|large_intestine(8)|lung(13)|ovary(3)|prostate(3)|skin(2)	42					Methoxsalen(DB00553)|Nicotine(DB00184)|Testosterone(DB00624)	CTGGCCTCAGGGCTGCTTCTG	0.562																																																1	Substitution - Missense(1)	ovary(1)	19											64.0	53.0	56.0					19																	41594390		2203	4300	6503	46286230	SO:0001583	missense	1553			U22028	CCDS12571.1	19q13.2	2013-11-11	2003-01-14		ENSG00000197838	ENSG00000197838		"""Cytochrome P450s"""	2608	protein-coding gene	gene with protein product		608055	"""cytochrome P450, subfamily IIA (phenobarbital-inducible), polypeptide 13"""			7668294, 15128046	Standard	NM_000766		Approved	CPAD, CYP2A	uc002opt.4	Q16696	OTTHUMG00000182762	ENST00000330436.3:c.14G>A	19.37:g.41594390G>A	ENSP00000332679:p.Gly5Glu		46286230	Q53YR8|Q6R569|Q6R570|Q9H2X2	Missense_Mutation	SNP	ENST00000330436.3	37	CCDS12571.1	.	.	.	.	.	.	.	.	.	.	.	14.17	2.455093	0.43634	.	.	ENSG00000197838	ENST00000330436	T	0.68479	-0.33	3.3	3.3	0.37823	.	0.285165	0.29438	U	0.012142	T	0.74496	0.3724	M	0.68952	2.095	0.29049	N	0.884647	D	0.69078	0.997	P	0.59115	0.852	T	0.69771	-0.5055	10	0.41790	T	0.15	.	12.5425	0.56179	0.0:0.0:1.0:0.0	.	5	Q16696	CP2AD_HUMAN	E	5	ENSP00000332679:G5E	ENSP00000332679:G5E	G	+	2	0	CYP2A13	46286230	0.989000	0.36119	0.988000	0.46212	0.964000	0.63967	2.218000	0.42889	1.860000	0.53959	0.430000	0.28490	GGG		0.562	CYP2A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463505.1	NM_000766	
KLK2	3817	broad.mit.edu	37	19	51381738	51381738	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1998-01A-01W-0722-08	TCGA-61-1998-10A-01W-0722-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0284efcd-e4b8-45b5-9c1e-6f3950ac4bf0	5a480357-2b29-4ce2-b257-a77186ce5fad	g.chr19:51381738C>T	ENST00000325321.3	+	5	934	c.709C>T	c.(709-711)Cct>Tct	p.P237S	KLK2_ENST00000358049.4_3'UTR|KLK2_ENST00000391810.2_Missense_Mutation_p.P135S			P20151	KLK2_HUMAN	kallikrein-related peptidase 2	237	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase activity (GO:0004252)	p.P237S(1)	KLK2/ETV1(3)|KLK2/ETV4(2)	large_intestine(3)|lung(6)|ovary(1)|skin(1)	11		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00758)|GBM - Glioblastoma multiforme(134;0.00871)		ATGTGCCCTGCCTGAAAAGCC	0.562			T	ETV4	prostate																																		Dom	yes		19	19q13.41	3817	kallikrein-related peptidase 2		E	1	Substitution - Missense(1)	ovary(1)	19											203.0	193.0	196.0					19																	51381738		2203	4300	6503	56073550	SO:0001583	missense	3817			M18157	CCDS12808.1, CCDS42597.1, CCDS58675.1	19q13.33	2008-02-05	2006-10-27				3.4.21.35	"""Kallikreins"""	6363	protein-coding gene	gene with protein product		147960	"""kallikrein 2, prostatic"""			2468530, 16800724, 16800723	Standard	NM_005551		Approved		uc002ptv.3	P20151		ENST00000325321.3:c.709C>T	19.37:g.51381738C>T	ENSP00000313581:p.Pro237Ser		56073550	B4DU93|B4DUB0|F5H8L3|Q15946|Q9UJZ9	Missense_Mutation	SNP	ENST00000325321.3	37	CCDS12808.1	.	.	.	.	.	.	.	.	.	.	C	13.33	2.204203	0.38905	.	.	ENSG00000167751	ENST00000325321;ENST00000391810	D;D	0.88896	-2.44;-2.44	3.54	0.966	0.19667	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.676716	0.12259	N	0.484887	D	0.88603	0.6481	L	0.41124	1.26	0.09310	N	1	D;D	0.69078	0.997;0.963	P;P	0.60541	0.876;0.701	T	0.77897	-0.2416	10	0.59425	D	0.04	.	6.3015	0.21115	0.1954:0.4213:0.3833:0.0	.	220;237	B4DU77;P20151	.;KLK2_HUMAN	S	237;135	ENSP00000313581:P237S;ENSP00000375686:P135S	ENSP00000313581:P237S	P	+	1	0	KLK2	56073550	0.000000	0.05858	0.001000	0.08648	0.005000	0.04900	-0.385000	0.07379	0.544000	0.28883	0.563000	0.77884	CCT		0.562	KLK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464438.3	NM_005551.3	
PEG3	5178	broad.mit.edu	37	19	57326014	57326014	+	Missense_Mutation	SNP	C	C	A			TCGA-61-1998-01A-01W-0722-08	TCGA-61-1998-10A-01W-0722-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0284efcd-e4b8-45b5-9c1e-6f3950ac4bf0	5a480357-2b29-4ce2-b257-a77186ce5fad	g.chr19:57326014C>A	ENST00000326441.9	-	10	4159	c.3796G>T	c.(3796-3798)Ggc>Tgc	p.G1266C	ZIM2_ENST00000391708.3_Intron|ZIM2_ENST00000221722.5_Intron|ZIM2_ENST00000601070.1_Intron|ZIM2_ENST00000593711.1_Intron|ZIM2_ENST00000599935.1_Intron|PEG3_ENST00000598410.1_Missense_Mutation_p.G1142C|PEG3_ENST00000593695.1_Missense_Mutation_p.G1140C|PEG3_ENST00000423103.2_Missense_Mutation_p.G1266C	NM_006210.2	NP_006201.1	Q9GZU2	PEG3_HUMAN	paternally expressed 3	1266					apoptotic process (GO:0006915)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.G1266C(1)		NS(1)|biliary_tract(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(27)|lung(84)|ovary(8)|pancreas(5)|prostate(6)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)	170		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		AGGGCTAAGCCTGGAATGATA	0.468																																																1	Substitution - Missense(1)	ovary(1)	19											62.0	52.0	55.0					19																	57326014		2203	4300	6503	62017826	SO:0001583	missense	5178			AB006625	CCDS12948.1, CCDS58684.1, CCDS58685.1	19q13.4	2013-01-09				ENSG00000198300		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	8826	protein-coding gene	gene with protein product		601483				9149948	Standard	NM_006210		Approved	ZKSCAN22, KIAA0287, ZNF904, ZSCAN24	uc010etr.2	Q9GZU2		ENST00000326441.9:c.3796G>T	19.37:g.57326014C>A	ENSP00000326581:p.Gly1266Cys		62017826	A7E2B8|B4DIM4|C9JP50|P78418|Q5H9P9|Q7Z7H7|Q8TF75|Q9GZY2	Missense_Mutation	SNP	ENST00000326441.9	37	CCDS12948.1	.	.	.	.	.	.	.	.	.	.	C	14.01	2.406964	0.42715	.	.	ENSG00000198300	ENST00000326441;ENST00000423103	T;T	0.02787	4.16;4.16	4.11	1.98	0.26296	.	0.133319	0.35067	N	0.003467	T	0.05731	0.0150	L	0.27053	0.805	.	.	.	D;D;D	0.89917	0.997;1.0;1.0	P;D;D	0.77557	0.808;0.987;0.99	T	0.26985	-1.0087	9	0.51188	T	0.08	-14.2392	5.9521	0.19253	0.0:0.6799:0.0:0.3201	.	1142;1266;1201	A7E2B8;Q9GZU2;Q96Q96	.;PEG3_HUMAN;.	C	1266	ENSP00000326581:G1266C;ENSP00000403051:G1266C	ENSP00000326581:G1266C	G	-	1	0	ZIM2	62017826	0.000000	0.05858	0.019000	0.16419	0.995000	0.86356	-0.062000	0.11674	0.686000	0.31488	0.655000	0.94253	GGC		0.468	PEG3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416099.2		
DUXA	503835	broad.mit.edu	37	19	57670639	57670639	+	Missense_Mutation	SNP	A	A	C			TCGA-61-1998-01A-01W-0722-08	TCGA-61-1998-10A-01W-0722-08	A	A	C	C	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0284efcd-e4b8-45b5-9c1e-6f3950ac4bf0	5a480357-2b29-4ce2-b257-a77186ce5fad	g.chr19:57670639A>C	ENST00000554048.2	-	3	187	c.188T>G	c.(187-189)tTt>tGt	p.F63C		NM_001012729.1	NP_001012747.1	A6NLW8	DUXA_HUMAN	double homeobox A	63					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.F63C(1)		breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)	17		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0123)		TCGATTCTGAAACCAAATCTA	0.438																																																1	Substitution - Missense(1)	ovary(1)	19											72.0	67.0	69.0					19																	57670639		2203	4300	6503	62362451	SO:0001583	missense	503835				CCDS33126.1	19q13.43	2012-10-04			ENSG00000258873	ENSG00000258873		"""Homeoboxes / PRD class"""	32179	protein-coding gene	gene with protein product		611168					Standard	NM_001012729		Approved		uc002qoa.1	A6NLW8	OTTHUMG00000170714	ENST00000554048.2:c.188T>G	19.37:g.57670639A>C	ENSP00000452398:p.Phe63Cys		62362451		Missense_Mutation	SNP	ENST00000554048.2	37	CCDS33126.1	.	.	.	.	.	.	.	.	.	.	A	13.41	2.229214	0.39399	.	.	ENSG00000258873	ENST00000554048	D	0.99748	-6.62	2.54	2.54	0.30619	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.34268	N	0.004102	D	0.99736	0.9896	H	0.97315	3.98	0.34594	D	0.715779	D	0.76494	0.999	D	0.70487	0.969	D	0.97311	0.9937	10	0.87932	D	0	-14.1296	7.0071	0.24842	1.0:0.0:0.0:0.0	.	63	A6NLW8	DUXA_HUMAN	C	63	ENSP00000452398:F63C	ENSP00000365415:F63C	F	-	2	0	DUXA	62362451	1.000000	0.71417	1.000000	0.80357	0.652000	0.38707	2.087000	0.41653	1.424000	0.47217	0.459000	0.35465	TTT		0.438	DUXA-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410075.3	NM_001012729	
ZNF551	90233	broad.mit.edu	37	19	58199588	58199588	+	Missense_Mutation	SNP	G	G	T			TCGA-61-1998-01A-01W-0722-08	TCGA-61-1998-10A-01W-0722-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0284efcd-e4b8-45b5-9c1e-6f3950ac4bf0	5a480357-2b29-4ce2-b257-a77186ce5fad	g.chr19:58199588G>T	ENST00000282296.5	+	3	2130	c.1945G>T	c.(1945-1947)Ggg>Tgg	p.G649W	ZNF551_ENST00000356715.4_Missense_Mutation_p.G633W|ZNF551_ENST00000596085.1_Intron|AC003006.7_ENST00000599221.1_Intron|AC003006.7_ENST00000594684.1_Intron			Q7Z340	ZN551_HUMAN	zinc finger protein 551	649					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G633W(1)		endometrium(4)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)	15		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		CAGTGAATGTGGGAAATCCTT	0.428																																																1	Substitution - Missense(1)	ovary(1)	19											97.0	96.0	97.0					19																	58199588		2203	4300	6503	62891400	SO:0001583	missense	90233			BX538151	CCDS12959.1, CCDS12959.2	19q13.43	2013-09-20			ENSG00000204519	ENSG00000204519		"""Zinc fingers, C2H2-type"", ""-"""	25108	protein-coding gene	gene with protein product							Standard	NM_138347		Approved	DKFZp686H1038	uc002qpw.5	Q7Z340	OTTHUMG00000183470	ENST00000282296.5:c.1945G>T	19.37:g.58199588G>T	ENSP00000282296:p.Gly649Trp		62891400	B4DU22|P17034|Q8N246|Q9BRY1	Missense_Mutation	SNP	ENST00000282296.5	37	CCDS12959.2	.	.	.	.	.	.	.	.	.	.	G	18.16	3.562743	0.65538	.	.	ENSG00000204519	ENST00000356715;ENST00000282296	.	.	.	2.79	0.564	0.17302	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.75199	0.3817	M	0.94101	3.495	0.25453	N	0.987988	D	0.89917	1.0	D	0.97110	1.0	T	0.62412	-0.6860	8	0.72032	D	0.01	.	7.4611	0.27296	0.2324:0.0:0.7676:0.0	.	649	Q7Z340	ZN551_HUMAN	W	649;633	.	ENSP00000282296:G633W	G	+	1	0	ZNF551	62891400	0.772000	0.28567	0.000000	0.03702	0.944000	0.59088	1.368000	0.34216	0.082000	0.17018	-0.258000	0.10820	GGG		0.428	ZNF551-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466803.2	NM_138347	
FSHR	2492	broad.mit.edu	37	2	49190293	49190293	+	Missense_Mutation	SNP	A	A	T			TCGA-61-1998-01A-01W-0722-08	TCGA-61-1998-10A-01W-0722-08	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0284efcd-e4b8-45b5-9c1e-6f3950ac4bf0	5a480357-2b29-4ce2-b257-a77186ce5fad	g.chr2:49190293A>T	ENST00000406846.2	-	10	1786	c.1667T>A	c.(1666-1668)gTg>gAg	p.V556E	FSHR_ENST00000304421.4_Missense_Mutation_p.V530E|FSHR_ENST00000346173.3_Missense_Mutation_p.V494E|FSHR_ENST00000541117.1_Missense_Mutation_p.V292E	NM_000145.3	NP_000136.2	P23945	FSHR_HUMAN	follicle stimulating hormone receptor	556					female gamete generation (GO:0007292)|female gonad development (GO:0008585)|follicle-stimulating hormone signaling pathway (GO:0042699)|G-protein coupled receptor signaling pathway (GO:0007186)|gonad development (GO:0008406)|male gonad development (GO:0008584)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	follicle-stimulating hormone receptor activity (GO:0004963)	p.V556E(1)		NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(10)|liver(1)|lung(45)|ovary(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	73		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.181)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Choriogonadotropin alfa(DB00097)|Follitropin beta(DB00066)|Menotropins(DB00032)|Suramin(DB04786)|Urofollitropin(DB00094)	GGGGTTCCGCACTGTGAGGTA	0.532									Gonadal Dysgenesis, 46 XX																																							1	Substitution - Missense(1)	ovary(1)	2											119.0	97.0	105.0					2																	49190293		2203	4300	6503	49043797	SO:0001583	missense	2492	Familial Cancer Database			CCDS1843.1, CCDS1844.1, CCDS1844.2	2p21-p16	2014-09-17			ENSG00000170820	ENSG00000170820		"""GPCR / Class A : Gonadotropin and TSH receptors"""	3969	protein-coding gene	gene with protein product		136435		ODG1		8230163, 8855829	Standard	NM_000145		Approved	FSHRO, LGR1	uc002rww.3	P23945	OTTHUMG00000129259	ENST00000406846.2:c.1667T>A	2.37:g.49190293A>T	ENSP00000384708:p.Val556Glu		49043797	A8K947|G5CBS7|G5E967|J3KQ00|Q05AH0|Q16225|Q4QRJ3|Q4ZFZ2|Q53RW2	Missense_Mutation	SNP	ENST00000406846.2	37	CCDS1843.1	.	.	.	.	.	.	.	.	.	.	A	20.7	4.026121	0.75390	.	.	ENSG00000170820	ENST00000406846;ENST00000346173;ENST00000304421;ENST00000541117	T;T;T;T	0.42131	0.98;0.98;0.98;0.98	5.35	5.35	0.76521	GPCR, rhodopsin-like superfamily (1);	0.284833	0.32935	N	0.005480	T	0.73760	0.3628	H	0.94620	3.56	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.998;0.999	T	0.81831	-0.0752	9	.	.	.	.	14.958	0.71131	1.0:0.0:0.0:0.0	.	530;494;556	Q05AH0;G5E967;P23945	.;.;FSHR_HUMAN	E	556;494;530;292	ENSP00000384708:V556E;ENSP00000333908:V494E;ENSP00000306780:V530E;ENSP00000444172:V292E	.	V	-	2	0	FSHR	49043797	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.087000	0.94110	2.371000	0.80710	0.533000	0.62120	GTG		0.532	FSHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251367.2		
PLEKHM3	389072	broad.mit.edu	37	2	208842237	208842237	+	Nonsense_Mutation	SNP	C	C	T			TCGA-61-1998-01A-01W-0722-08	TCGA-61-1998-10A-01W-0722-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0284efcd-e4b8-45b5-9c1e-6f3950ac4bf0	5a480357-2b29-4ce2-b257-a77186ce5fad	g.chr2:208842237C>T	ENST00000427836.2	-	3	1173	c.684G>A	c.(682-684)tgG>tgA	p.W228*	PLEKHM3_ENST00000389247.4_Nonsense_Mutation_p.W228*|PLEKHM3_ENST00000457206.1_Nonsense_Mutation_p.W228*	NM_001080475.2	NP_001073944.1	Q6ZWE6	PKHM3_HUMAN	pleckstrin homology domain containing, family M, member 3	228	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				intracellular signal transduction (GO:0035556)		metal ion binding (GO:0046872)	p.W228*(1)		central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						AACAGCTTTGCCAGTAACTGT	0.418																																																1	Substitution - Nonsense(1)	ovary(1)	2											241.0	229.0	233.0					2																	208842237		1923	4120	6043	208550482	SO:0001587	stop_gained	389072			AK057612	CCDS42808.1	2q33.3	2013-01-10	2008-04-03	2008-04-03	ENSG00000178385	ENSG00000178385		"""Pleckstrin homology (PH) domain containing"""	34006	protein-coding gene	gene with protein product	"""differentiation associated protein"""		"""pleckstrin homology domain containing, family M, member 1-like"""	PLEKHM1L		19028694	Standard	NM_001080475		Approved	DAPR	uc002vcl.2	Q6ZWE6	OTTHUMG00000154781	ENST00000427836.2:c.684G>A	2.37:g.208842237C>T	ENSP00000417003:p.Trp228*		208550482	B9EKV2|Q8WW68	Nonsense_Mutation	SNP	ENST00000427836.2	37	CCDS42808.1	.	.	.	.	.	.	.	.	.	.	C	43	10.246887	0.99368	.	.	ENSG00000178385	ENST00000427836;ENST00000389247;ENST00000457206	.	.	.	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	20.4116	0.99017	0.0:1.0:0.0:0.0	.	.	.	.	X	228	.	ENSP00000373899:W228X	W	-	3	0	PLEKHM3	208550482	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.294000	0.78760	2.827000	0.97445	0.655000	0.94253	TGG		0.418	PLEKHM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337036.1	NM_001080475	
MX1	4599	broad.mit.edu	37	21	42830551	42830551	+	Missense_Mutation	SNP	C	C	A			TCGA-61-1998-01A-01W-0722-08	TCGA-61-1998-10A-01W-0722-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0284efcd-e4b8-45b5-9c1e-6f3950ac4bf0	5a480357-2b29-4ce2-b257-a77186ce5fad	g.chr21:42830551C>A	ENST00000398600.2	+	19	2880	c.1855C>A	c.(1855-1857)Ctc>Atc	p.L619I	MX1_ENST00000288383.6_Missense_Mutation_p.L596I|MX1_ENST00000398598.3_Missense_Mutation_p.L619I|MX1_ENST00000455164.2_Missense_Mutation_p.L619I	NM_001144925.1	NP_001138397.1	P20591	MX1_HUMAN	MX dynamin-like GTPase 1	619	GED. {ECO:0000255|PROSITE- ProRule:PRU00720}.|Stalk.				apoptotic process (GO:0006915)|cytokine-mediated signaling pathway (GO:0019221)|defense response (GO:0006952)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of viral genome replication (GO:0045071)|response to type I interferon (GO:0034340)|response to virus (GO:0009615)|signal transduction (GO:0007165)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.L619I(1)		breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(9)|lung(5)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	27		Prostate(19;3.18e-07)|all_epithelial(19;0.0277)				CATGCTGCAGCTCCTGCAGGA	0.602																																																1	Substitution - Missense(1)	ovary(1)	21											128.0	122.0	124.0					21																	42830551		2203	4300	6503	41752421	SO:0001583	missense	4599				CCDS13673.1, CCDS74796.1	21q22.3	2014-07-15	2014-07-15		ENSG00000157601	ENSG00000157601			7532	protein-coding gene	gene with protein product	"""interferon-inducible protein p78"""	147150	"""myxovirus (influenza) resistance 1, homolog of murine (interferon-inducible protein p78)"", ""myxovirus (influenza virus) resistance 1, interferon-inducible protein p78 (mouse)"""			17570575	Standard	XM_005260979		Approved	IFI-78K, MxA	uc010goq.3	P20591	OTTHUMG00000086755	ENST00000398600.2:c.1855C>A	21.37:g.42830551C>A	ENSP00000381601:p.Leu619Ile		41752421	B2RDA5|B3KU10|C9IYV7|C9J8D6|C9JN19|C9JN88|C9JUL1|C9JZS6|D3DSI8|Q86YP5|Q96CI3	Missense_Mutation	SNP	ENST00000398600.2	37	CCDS13673.1	.	.	.	.	.	.	.	.	.	.	C	19.96	3.922765	0.73213	.	.	ENSG00000157601	ENST00000398600;ENST00000398598;ENST00000455164;ENST00000288383	T;T;T;T	0.55588	0.51;0.51;0.51;0.51	4.7	4.7	0.59300	GTPase effector domain, GED (1);Dynamin GTPase effector (2);	0.074107	0.64402	D	0.000020	T	0.59783	0.2219	M	0.69823	2.125	0.45502	D	0.99846	P	0.41848	0.763	P	0.46850	0.529	T	0.62590	-0.6822	10	0.48119	T	0.1	-29.2525	13.8894	0.63729	0.0:1.0:0.0:0.0	.	619	P20591	MX1_HUMAN	I	619;619;619;596	ENSP00000381601:L619I;ENSP00000381599:L619I;ENSP00000410523:L619I;ENSP00000288383:L596I	ENSP00000288383:L596I	L	+	1	0	MX1	41752421	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	1.846000	0.39289	2.547000	0.85894	0.655000	0.94253	CTC		0.602	MX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195161.2		
SPECC1L	23384	broad.mit.edu	37	22	24718635	24718635	+	Missense_Mutation	SNP	G	G	C			TCGA-61-1998-01A-01W-0722-08	TCGA-61-1998-10A-01W-0722-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0284efcd-e4b8-45b5-9c1e-6f3950ac4bf0	5a480357-2b29-4ce2-b257-a77186ce5fad	g.chr22:24718635G>C	ENST00000314328.9	+	5	1972	c.1687G>C	c.(1687-1689)Gag>Cag	p.E563Q	SPECC1L_ENST00000541492.1_Missense_Mutation_p.E563Q|SPECC1L_ENST00000416735.1_Intron|SPECC1L_ENST00000437398.1_Missense_Mutation_p.E563Q|SPECC1L-ADORA2A_ENST00000358654.2_Missense_Mutation_p.E563Q	NM_001254733.1|NM_015330.3	NP_001241662.1|NP_056145	Q69YQ0	CYTSA_HUMAN	sperm antigen with calponin homology and coiled-coil domains 1-like	563					actin cytoskeleton organization (GO:0030036)|cell cycle (GO:0007049)|cell division (GO:0051301)|cell migration (GO:0016477)|negative regulation of actin filament depolymerization (GO:0030835)|negative regulation of microtubule depolymerization (GO:0007026)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|gap junction (GO:0005921)|microtubule organizing center (GO:0005815)		p.E563Q(1)		breast(1)|endometrium(1)|kidney(4)|large_intestine(7)|lung(6)|ovary(1)|prostate(1)|skin(3)|stomach(2)|urinary_tract(1)	27						AGCCACGTTAGAGGAATACAA	0.473																																																1	Substitution - Missense(1)	ovary(1)	22											58.0	57.0	57.0					22																	24718635		2203	4300	6503	23048635	SO:0001583	missense	23384			AK025531	CCDS33619.1, CCDS58797.1	22q11.23	2012-12-20	2010-09-17	2010-09-17	ENSG00000100014	ENSG00000100014			29022	protein-coding gene	gene with protein product	"""cytokinesis and spindle organization A"", ""cytospin A"""	614140	"""SPECC1-like"""			9205841	Standard	NM_001254733		Approved	KIAA0376, CYTSA	uc002zzv.4	Q69YQ0	OTTHUMG00000171450	ENST00000314328.9:c.1687G>C	22.37:g.24718635G>C	ENSP00000325785:p.Glu563Gln		23048635	B7Z758|F5H1H6|O15081	Missense_Mutation	SNP	ENST00000314328.9	37	CCDS33619.1	.	.	.	.	.	.	.	.	.	.	G	19.68	3.873066	0.72180	.	.	ENSG00000100014	ENST00000398280;ENST00000437398;ENST00000421374;ENST00000314328;ENST00000541492	T;T;T;T	0.62364	0.03;2.5;0.03;3.01	5.5	5.5	0.81552	.	0.208574	0.49305	D	0.000149	T	0.77157	0.4089	M	0.71036	2.16	0.58432	D	0.999998	D;B	0.63046	0.992;0.319	P;B	0.61397	0.888;0.127	T	0.78804	-0.2060	10	0.62326	D	0.03	-28.6628	18.3864	0.90468	0.0:0.0:1.0:0.0	.	563;563	F5H1H6;Q69YQ0	.;CYTSA_HUMAN	Q	591;563;563;563;563	ENSP00000393363:E563Q;ENSP00000405671:E563Q;ENSP00000325785:E563Q;ENSP00000439633:E563Q	ENSP00000325785:E563Q	E	+	1	0	SPECC1L	23048635	1.000000	0.71417	0.949000	0.38748	0.789000	0.44602	6.357000	0.73051	2.597000	0.87782	0.655000	0.94253	GAG		0.473	SPECC1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319986.2	NM_015330	
SLC9C1	285335	broad.mit.edu	37	3	111888085	111888085	+	Missense_Mutation	SNP	C	C	T	rs374547341		TCGA-61-1998-01A-01W-0722-08	TCGA-61-1998-10A-01W-0722-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0284efcd-e4b8-45b5-9c1e-6f3950ac4bf0	5a480357-2b29-4ce2-b257-a77186ce5fad	g.chr3:111888085C>T	ENST00000305815.5	-	24	3262	c.3010G>A	c.(3010-3012)Gct>Act	p.A1004T	SLC9C1_ENST00000487372.1_Missense_Mutation_p.A956T	NM_183061.1	NP_898884.1	Q4G0N8	SL9C1_HUMAN	solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1	1004					cell differentiation (GO:0030154)|ion transmembrane transport (GO:0034220)|multicellular organismal development (GO:0007275)|sodium ion transport (GO:0006814)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	solute:proton antiporter activity (GO:0015299)	p.A1004T(1)									GCTGTAATAGCGAGTCCAAGT	0.348																																																1	Substitution - Missense(1)	ovary(1)	3						C	THR/ALA	0,4406		0,0,2203	107.0	103.0	105.0		3010	1.0	0.6	3		105	1,8599	1.2+/-3.3	0,1,4299	no	missense	SLC9A10	NM_183061.1	58	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	1004/1178	111888085	1,13005	2203	4300	6503	113370775	SO:0001583	missense	285335			AK128084	CCDS33817.1	3q13	2013-05-22	2012-03-22	2012-03-22	ENSG00000172139	ENSG00000172139		"""Solute carriers"""	31401	protein-coding gene	gene with protein product	"""sperm-NHE"""	612738	"""solute carrier family 9, isoform 10"", ""solute carrier family 9, member 10"""	SLC9A10		12783626	Standard	NM_183061		Approved	NHE	uc003dyu.3	Q4G0N8	OTTHUMG00000159245	ENST00000305815.5:c.3010G>A	3.37:g.111888085C>T	ENSP00000306627:p.Ala1004Thr		113370775	Q6ZRP4|Q7RTP2	Missense_Mutation	SNP	ENST00000305815.5	37	CCDS33817.1	.	.	.	.	.	.	.	.	.	.	C	16.52	3.147062	0.57151	0.0	1.16E-4	ENSG00000172139	ENST00000305815;ENST00000487372	T;T	0.77358	-1.09;-1.09	5.83	1.0	0.19881	Cyclic nucleotide-binding-like (1);Cyclic nucleotide-binding domain (1);	0.821439	0.10954	N	0.615730	T	0.63046	0.2478	L	0.34521	1.04	0.19575	N	0.999967	P;P	0.44659	0.588;0.84	B;B	0.36030	0.216;0.17	T	0.50964	-0.8765	10	0.45353	T	0.12	4.47	8.6616	0.34097	0.3433:0.5616:0.0:0.0951	.	956;1004	Q4G0N8-2;Q4G0N8	.;S9A10_HUMAN	T	1004;956	ENSP00000306627:A1004T;ENSP00000420688:A956T	ENSP00000306627:A1004T	A	-	1	0	SLC9A10	113370775	0.876000	0.30132	0.630000	0.29268	0.834000	0.47266	0.078000	0.14761	0.244000	0.21351	0.603000	0.83216	GCT		0.348	SLC9C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354066.1	NM_183061	
RAPGEF6	51735	broad.mit.edu	37	5	130764612	130764612	+	Missense_Mutation	SNP	G	G	T			TCGA-61-1998-01A-01W-0722-08	TCGA-61-1998-10A-01W-0722-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0284efcd-e4b8-45b5-9c1e-6f3950ac4bf0	5a480357-2b29-4ce2-b257-a77186ce5fad	g.chr5:130764612G>T	ENST00000509018.1	-	27	4968	c.4763C>A	c.(4762-4764)gCa>gAa	p.A1588E	CTC-432M15.3_ENST00000514667.1_Missense_Mutation_p.A1638E|RAPGEF6_ENST00000296859.6_Missense_Mutation_p.A1596E|RAPGEF6_ENST00000307984.5_Intron|RAPGEF6_ENST00000507093.1_Intron	NM_001164386.1|NM_016340.5	NP_001157858.1|NP_057424.3	Q8TEU7	RPGF6_HUMAN	Rap guanine nucleotide exchange factor (GEF) 6	1588					positive regulation of GTPase activity (GO:0043547)|Ras protein signal transduction (GO:0007265)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	GTP-dependent protein binding (GO:0030742)|guanyl-nucleotide exchange factor activity (GO:0005085)|Ras GTPase binding (GO:0017016)	p.A1588E(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|skin(1)|stomach(1)	31			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0721)		TTCGCTATCTGCATCAGTCAC	0.408																																					Melanoma(168;435 1955 13113 13877 23213)											1	Substitution - Missense(1)	ovary(1)	5											121.0	115.0	117.0					5																	130764612		2203	4300	6503	130792511	SO:0001583	missense	51735			AF117947	CCDS34225.1, CCDS54897.1, CCDS54898.1, CCDS54899.1, CCDS54900.1	5q31.1	2008-02-05	2004-03-01	2004-03-02	ENSG00000158987	ENSG00000158987			20655	protein-coding gene	gene with protein product		610499	"""PDZ domain containing guanine nucleotide exchange factor (GEF) 2"""	PDZGEF2		11524421, 12095257	Standard	NM_016340		Approved	RA-GEF-2, PDZ-GEF2	uc010jdi.2	Q8TEU7	OTTHUMG00000162683	ENST00000509018.1:c.4763C>A	5.37:g.130764612G>T	ENSP00000421684:p.Ala1588Glu		130792511	A3KN82|A5PLL6|B7ZML2|E9PDV7|Q8NI21|Q8TEU6|Q96PC1	Missense_Mutation	SNP	ENST00000509018.1	37	CCDS34225.1	.	.	.	.	.	.	.	.	.	.	G	12.47	1.948111	0.34377	.	.	ENSG00000158987;ENSG00000158987;ENSG00000217128	ENST00000509018;ENST00000296859;ENST00000514667	T;T;T	0.23348	1.91;1.91;2.0	4.92	4.04	0.47022	.	0.326234	0.29972	N	0.010730	T	0.26846	0.0657	L	0.54323	1.7	0.80722	D	1	B;B;B	0.06786	0.0;0.001;0.0	B;B;B	0.06405	0.001;0.002;0.001	T	0.07443	-1.0772	10	0.59425	D	0.04	.	13.9149	0.63890	0.0:0.2905:0.7095:0.0	.	1596;1638;1588	B7ZML2;E9PCH4;Q8TEU7	.;.;RPGF6_HUMAN	E	1588;1596;1638	ENSP00000421684:A1588E;ENSP00000296859:A1596E;ENSP00000426948:A1638E	ENSP00000426948:A1638E	A	-	2	0	RAPGEF6;FNIP1	130792511	1.000000	0.71417	0.997000	0.53966	0.930000	0.56654	3.795000	0.55499	1.304000	0.44892	0.655000	0.94253	GCA		0.408	RAPGEF6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000370059.1	NM_016340	
PCDHGB7	56099	broad.mit.edu	37	5	140798423	140798423	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1998-01A-01W-0722-08	TCGA-61-1998-10A-01W-0722-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0284efcd-e4b8-45b5-9c1e-6f3950ac4bf0	5a480357-2b29-4ce2-b257-a77186ce5fad	g.chr5:140798423G>A	ENST00000398594.2	+	1	997	c.997G>A	c.(997-999)Gta>Ata	p.V333I	PCDHGA11_ENST00000398587.2_5'Flank|PCDHGA3_ENST00000253812.6_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA11_ENST00000518882.1_5'Flank|PCDHGA10_ENST00000398610.2_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB6_ENST00000520790.1_Intron	NM_018927.3	NP_061750.1	Q9Y5F8	PCDGJ_HUMAN	protocadherin gamma subfamily B, 7	333	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.V333I(1)		central_nervous_system(2)|endometrium(9)|kidney(6)|large_intestine(13)|lung(15)|ovary(4)|prostate(3)|stomach(1)|upper_aerodigestive_tract(3)	56			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACGGTGTAAAGTAATTGTAGA	0.403																																																1	Substitution - Missense(1)	ovary(1)	5											74.0	70.0	71.0					5																	140798423		1881	4107	5988	140778607	SO:0001583	missense	56099			AF152523	CCDS47293.1, CCDS75344.1	5q31	2010-01-26			ENSG00000254122	ENSG00000254122		"""Cadherins / Protocadherins : Clustered"""	8714	other	protocadherin	"""cadherin ME6"""	606304				10380929	Standard	NM_032101		Approved	ME6, PCDH-GAMMA-B7		Q9Y5F8	OTTHUMG00000164054	ENST00000398594.2:c.997G>A	5.37:g.140798423G>A	ENSP00000381594:p.Val333Ile		140778607	Q9UN63	Missense_Mutation	SNP	ENST00000398594.2	37	CCDS47293.1	.	.	.	.	.	.	.	.	.	.	g	4.959	0.178126	0.09443	.	.	ENSG00000254122	ENST00000398594	T	0.59906	0.23	5.57	1.71	0.24356	Cadherin (4);Cadherin-like (1);	0.324022	0.16289	U	0.220988	T	0.47266	0.1436	L	0.33710	1.025	0.22610	N	0.998934	B;B	0.23377	0.082;0.084	B;B	0.37508	0.252;0.094	T	0.43845	-0.9366	10	0.30078	T	0.28	.	6.4145	0.21710	0.2886:0.1206:0.5907:0.0	.	333;333	Q9Y5F8;Q9Y5F8-2	PCDGJ_HUMAN;.	I	333	ENSP00000381594:V333I	ENSP00000381594:V333I	V	+	1	0	PCDHGB7	140778607	0.749000	0.28305	1.000000	0.80357	0.325000	0.28411	0.272000	0.18644	0.286000	0.22352	0.462000	0.41574	GTA		0.403	PCDHGB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376973.1	NM_018927	
NUP153	9972	broad.mit.edu	37	6	17637764	17637764	+	Missense_Mutation	SNP	G	G	C			TCGA-61-1998-01A-01W-0722-08	TCGA-61-1998-10A-01W-0722-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0284efcd-e4b8-45b5-9c1e-6f3950ac4bf0	5a480357-2b29-4ce2-b257-a77186ce5fad	g.chr6:17637764G>C	ENST00000262077.2	-	16	2083	c.2084C>G	c.(2083-2085)aCt>aGt	p.T695S	NUP153_ENST00000537253.1_Missense_Mutation_p.T726S	NM_005124.2	NP_005115.2	P49790	NU153_HUMAN	nucleoporin 153kDa	695					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of RNA export from nucleus (GO:0046832)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral entry into host cell (GO:0046718)|viral penetration into host nucleus (GO:0075732)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|nucleocytoplasmic transporter activity (GO:0005487)|protein anchor (GO:0043495)|structural constituent of nuclear pore (GO:0017056)|transporter activity (GO:0005215)|zinc ion binding (GO:0008270)	p.T695S(1)		NS(2)|breast(6)|endometrium(4)|kidney(3)|large_intestine(7)|lung(23)|ovary(3)|skin(3)|urinary_tract(2)	53	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.125)	all cancers(50;0.0981)|Epithelial(50;0.112)			TTCAATTCCAGTCTGTTTAGC	0.413																																																1	Substitution - Missense(1)	ovary(1)	6											219.0	192.0	201.0					6																	17637764		2203	4300	6503	17745743	SO:0001583	missense	9972			Z25535	CCDS4541.1, CCDS64359.1, CCDS75407.1	6p22.3	2008-07-29	2002-08-29		ENSG00000124789	ENSG00000124789			8062	protein-coding gene	gene with protein product		603948	"""nucleoporin 153kD"""			8110839	Standard	NM_001278209		Approved	HNUP153	uc003ncd.2	P49790	OTTHUMG00000014312	ENST00000262077.2:c.2084C>G	6.37:g.17637764G>C	ENSP00000262077:p.Thr695Ser		17745743	B4DIK2|E7EPX5|F6QR24|Q4LE47|Q5T9I7|Q7Z743	Missense_Mutation	SNP	ENST00000262077.2	37	CCDS4541.1	.	.	.	.	.	.	.	.	.	.	G	11.02	1.516631	0.27123	.	.	ENSG00000124789	ENST00000262077;ENST00000430136;ENST00000537253	T;T	0.07216	3.22;3.21	6.11	5.19	0.71726	.	0.391146	0.21995	N	0.066092	T	0.02304	0.0071	L	0.29908	0.895	0.31814	N	0.626834	B;B;B	0.28055	0.199;0.011;0.026	B;B;B	0.33620	0.167;0.014;0.021	T	0.44483	-0.9325	10	0.12766	T	0.61	-11.9288	7.5501	0.27790	0.1372:0.1416:0.7212:0.0	.	726;675;695	F6QR24;Q4LE47;P49790	.;.;NU153_HUMAN	S	695;675;726	ENSP00000262077:T695S;ENSP00000444029:T726S	ENSP00000262077:T695S	T	-	2	0	NUP153	17745743	0.076000	0.21285	1.000000	0.80357	0.848000	0.48234	1.412000	0.34714	2.906000	0.99361	0.655000	0.94253	ACT		0.413	NUP153-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039953.1		
Unknown	0	broad.mit.edu	37	6	28243995	28243995	+	IGR	SNP	G	G	A			TCGA-61-1998-01A-01W-0722-08	TCGA-61-1998-10A-01W-0722-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0284efcd-e4b8-45b5-9c1e-6f3950ac4bf0	5a480357-2b29-4ce2-b257-a77186ce5fad	g.chr6:28243995G>A								NKAPL (15259 upstream) : PGBD1 (5318 downstream)																							GATTGAGAATGGGAAGCTTAT	0.393																																																0			6											72.0	68.0	69.0					6																	28243995		1838	4097	5935	28351974	SO:0001628	intergenic_variant	7741																															6.37:g.28243995G>A			28351974		Missense_Mutation	SNP		37																																																																																				0	0.393								
GPR115	221393	broad.mit.edu	37	6	47682262	47682262	+	Nonsense_Mutation	SNP	G	G	A			TCGA-61-1998-01A-01W-0722-08	TCGA-61-1998-10A-01W-0722-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0284efcd-e4b8-45b5-9c1e-6f3950ac4bf0	5a480357-2b29-4ce2-b257-a77186ce5fad	g.chr6:47682262G>A	ENST00000283303.2	+	6	1539	c.1281G>A	c.(1279-1281)tgG>tgA	p.W427*	RN7SKP116_ENST00000516902.1_RNA|GPR115_ENST00000327753.3_Nonsense_Mutation_p.W427*|GPR115_ENST00000371220.1_Nonsense_Mutation_p.W484*	NM_153838.3	NP_722580.3	Q8IZF3	GP115_HUMAN	G protein-coupled receptor 115	427					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.W427*(1)		NS(1)|breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(24)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	52						CCACAGTGTGGTCCCGGGTGG	0.488																																					GBM(22;431 510 9010 26644 32828)											1	Substitution - Nonsense(1)	ovary(1)	6											183.0	159.0	167.0					6																	47682262		2203	4300	6503	47790221	SO:0001587	stop_gained	221393			AK095395	CCDS4922.2	6p12.3	2014-08-08			ENSG00000153294	ENSG00000153294		"""-"", ""GPCR / Class B : Orphans"""	19011	protein-coding gene	gene with protein product		614268				12435584	Standard	NM_153838		Approved	FLJ38076, PGR18	uc003oza.1	Q8IZF3	OTTHUMG00000014800	ENST00000283303.2:c.1281G>A	6.37:g.47682262G>A	ENSP00000283303:p.Trp427*		47790221	B3KTD0|Q2PNZ0|Q5T5B5|Q5T5B6|Q86SN9|Q8IXE6	Nonsense_Mutation	SNP	ENST00000283303.2	37	CCDS4922.2	.	.	.	.	.	.	.	.	.	.	G	37	6.330668	0.97480	.	.	ENSG00000153294	ENST00000371220;ENST00000327753;ENST00000283303	.	.	.	5.45	5.45	0.79879	.	0.000000	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.894	18.6292	0.91354	0.0:0.0:1.0:0.0	.	.	.	.	X	484;427;427	.	ENSP00000283303:W427X	W	+	3	0	GPR115	47790221	1.000000	0.71417	1.000000	0.80357	0.361000	0.29550	9.778000	0.99011	2.721000	0.93114	0.655000	0.94253	TGG		0.488	GPR115-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040819.2	NM_153838	
ELMO1	9844	broad.mit.edu	37	7	37382282	37382282	+	Missense_Mutation	SNP	C	C	T	rs146510671		TCGA-61-1998-01A-01W-0722-08	TCGA-61-1998-10A-01W-0722-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0284efcd-e4b8-45b5-9c1e-6f3950ac4bf0	5a480357-2b29-4ce2-b257-a77186ce5fad	g.chr7:37382282C>T	ENST00000310758.4	-	2	660	c.13G>A	c.(13-15)Gcg>Acg	p.A5T	ELMO1_ENST00000442504.1_Missense_Mutation_p.A5T|ELMO1_ENST00000448602.1_Missense_Mutation_p.A5T	NM_001206480.1|NM_014800.10	NP_001193409.1|NP_055615.8	Q92556	ELMO1_HUMAN	engulfment and cell motility 1	5					actin cytoskeleton organization (GO:0030036)|apoptotic process (GO:0006915)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|phagocytosis, engulfment (GO:0006911)|Rac protein signal transduction (GO:0016601)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	SH3 domain binding (GO:0017124)	p.A5T(1)		breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(28)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	58						ACGATGTCCGCGGGTGGCGGC	0.502																																																1	Substitution - Missense(1)	ovary(1)	7						C	THR/ALA,THR/ALA,THR/ALA	2,4404	4.2+/-10.8	0,2,2201	116.0	121.0	119.0		13,13,13	4.0	0.0	7	dbSNP_134	119	0,8600		0,0,4300	no	missense,missense,missense	ELMO1	NM_001206480.1,NM_001206482.1,NM_014800.10	58,58,58	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	benign,benign,benign	5/728,5/728,5/728	37382282	2,13004	2203	4300	6503	37348807	SO:0001583	missense	9844			AF398885	CCDS5449.1, CCDS5450.1	7p14.1	2012-07-10	2006-01-20		ENSG00000155849	ENSG00000155849		"""Engulfment and cell motility proteins"""	16286	protein-coding gene	gene with protein product		606420	"""engulfment and cell motility 1 (ced-12 homolog, C. elegans)"""			11595183	Standard	NM_001039459		Approved	KIAA0281, CED12, ELMO-1, CED-12	uc003tfk.2	Q92556	OTTHUMG00000023701	ENST00000310758.4:c.13G>A	7.37:g.37382282C>T	ENSP00000312185:p.Ala5Thr		37348807	A4D1X6|Q29R79|Q6ZTJ0|Q96PB0|Q9H0I1	Missense_Mutation	SNP	ENST00000310758.4	37	CCDS5449.1	.	.	.	.	.	.	.	.	.	.	C	18.04	3.533964	0.64972	4.54E-4	0.0	ENSG00000155849	ENST00000310758;ENST00000442504;ENST00000448602;ENST00000455119;ENST00000455879;ENST00000453399;ENST00000445322	T;T;T;T;T;T;T	0.44881	2.53;2.53;2.53;1.53;1.52;0.94;0.91	4.94	4.03	0.46877	.	0.200167	0.41823	D	0.000804	T	0.27594	0.0678	N	0.19112	0.55	0.44323	D	0.997201	B	0.14012	0.009	B	0.14578	0.011	T	0.04635	-1.0937	10	0.25106	T	0.35	.	12.5184	0.56046	0.1731:0.8269:0.0:0.0	.	5	Q92556	ELMO1_HUMAN	T	5	ENSP00000312185:A5T;ENSP00000406952:A5T;ENSP00000394458:A5T;ENSP00000406610:A5T;ENSP00000416090:A5T;ENSP00000391734:A5T;ENSP00000397857:A5T	ENSP00000312185:A5T	A	-	1	0	ELMO1	37348807	0.961000	0.32948	0.033000	0.17914	0.945000	0.59286	2.373000	0.44266	1.166000	0.42689	0.655000	0.94253	GCG		0.502	ELMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219830.4	NM_130442	
ZMIZ2	83637	broad.mit.edu	37	7	44796130	44796130	+	Missense_Mutation	SNP	C	C	G			TCGA-61-1998-01A-01W-0722-08	TCGA-61-1998-10A-01W-0722-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0284efcd-e4b8-45b5-9c1e-6f3950ac4bf0	5a480357-2b29-4ce2-b257-a77186ce5fad	g.chr7:44796130C>G	ENST00000309315.4	+	3	280	c.157C>G	c.(157-159)Cag>Gag	p.Q53E	ZMIZ2_ENST00000433667.1_Missense_Mutation_p.Q53E|ZMIZ2_ENST00000441627.1_Missense_Mutation_p.Q53E|ZMIZ2_ENST00000413916.1_Missense_Mutation_p.Q53E|ZMIZ2_ENST00000265346.7_Missense_Mutation_p.Q53E	NM_031449.3	NP_113637.3	Q8NF64	ZMIZ2_HUMAN	zinc finger, MIZ-type containing 2	53	Gly-rich.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)|nuclear replication fork (GO:0043596)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|zinc ion binding (GO:0008270)	p.Q53E(1)		breast(3)|endometrium(2)|kidney(3)|large_intestine(6)|lung(10)|ovary(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35						CAACGCGACACAGAGCCAGGT	0.592																																					NSCLC(20;604 852 1948 16908 50522)											1	Substitution - Missense(1)	ovary(1)	7											69.0	73.0	71.0					7																	44796130		2133	4243	6376	44762655	SO:0001583	missense	83637			AK090415	CCDS43576.1, CCDS43577.1, CCDS75591.1	7p13	2009-11-06			ENSG00000122515	ENSG00000122515		"""Zinc fingers, MIZ-type"""	22229	protein-coding gene	gene with protein product		611196					Standard	XM_005249866		Approved	KIAA1886, hZIMP7, ZIMP7, DKFZp761I2123, NET27	uc003tlr.3	Q8NF64	OTTHUMG00000155817	ENST00000309315.4:c.157C>G	7.37:g.44796130C>G	ENSP00000311778:p.Gln53Glu		44762655	A4D2K7|D3DVL1|O94790|Q0VGB4|Q659A8|Q6JKL5|Q8WTX8|Q96Q01|Q9BQH7	Missense_Mutation	SNP	ENST00000309315.4	37	CCDS43576.1	.	.	.	.	.	.	.	.	.	.	C	18.18	3.566078	0.65651	.	.	ENSG00000122515	ENST00000413916;ENST00000457123;ENST00000309315;ENST00000441627;ENST00000433667;ENST00000265346;ENST00000414051	D;D;D;D;D;D	0.96885	-4.16;-4.16;-4.16;-4.16;-4.16;-4.16	4.34	4.34	0.51931	.	0.131249	0.32935	N	0.005475	D	0.95962	0.8685	M	0.62723	1.935	0.31237	N	0.695598	B;P;B	0.46656	0.288;0.882;0.185	B;P;B	0.47573	0.086;0.55;0.054	D	0.95822	0.8850	10	0.66056	D	0.02	-7.5575	15.7692	0.78152	0.0:1.0:0.0:0.0	.	53;53;53	Q8NF64-2;Q8NF64;Q8NF64-3	.;ZMIZ2_HUMAN;.	E	53	ENSP00000409648:Q53E;ENSP00000415501:Q53E;ENSP00000311778:Q53E;ENSP00000414723:Q53E;ENSP00000396601:Q53E;ENSP00000265346:Q53E	ENSP00000265346:Q53E	Q	+	1	0	ZMIZ2	44762655	0.974000	0.33945	0.822000	0.32727	0.844000	0.47949	2.284000	0.43478	2.251000	0.74343	0.467000	0.42956	CAG		0.592	ZMIZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341790.1	NM_031449	
STAG3	10734	broad.mit.edu	37	7	99786618	99786618	+	Missense_Mutation	SNP	C	C	A			TCGA-61-1998-01A-01W-0722-08	TCGA-61-1998-10A-01W-0722-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0284efcd-e4b8-45b5-9c1e-6f3950ac4bf0	5a480357-2b29-4ce2-b257-a77186ce5fad	g.chr7:99786618C>A	ENST00000426455.1	+	7	1101	c.694C>A	c.(694-696)Cgt>Agt	p.R232S	STAG3_ENST00000317296.5_Missense_Mutation_p.R232S|STAG3_ENST00000394018.2_Missense_Mutation_p.R174S	NM_001282716.1	NP_001269645.1	Q9UJ98	STAG3_HUMAN	stromal antigen 3	232					chromosome segregation (GO:0007059)|synaptonemal complex assembly (GO:0007130)	chromosome, centromeric region (GO:0000775)|extracellular space (GO:0005615)|lateral element (GO:0000800)|male germ cell nucleus (GO:0001673)|meiotic cohesin complex (GO:0030893)|nuclear meiotic cohesin complex (GO:0034991)|nucleolus (GO:0005730)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)|transverse filament (GO:0000802)		p.R232S(1)		breast(1)|central_nervous_system(2)|endometrium(6)|kidney(3)|large_intestine(11)|lung(30)|ovary(5)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	66	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					CCGCGCCTTCCGTCACACTAG	0.517																																																1	Substitution - Missense(1)	ovary(1)	7											90.0	89.0	89.0					7																	99786618		2203	4300	6503	99624554	SO:0001583	missense	10734			AJ007798	CCDS34703.1, CCDS64730.1, CCDS75642.1	7q22	2008-02-01			ENSG00000066923	ENSG00000066923			11356	protein-coding gene	gene with protein product		608489				10698974	Standard	XM_005250116		Approved		uc003utx.1	Q9UJ98	OTTHUMG00000155183	ENST00000426455.1:c.694C>A	7.37:g.99786618C>A	ENSP00000400359:p.Arg232Ser		99624554	A6H8Z1|B4DZ10|D6W5U8|H7BYK9|Q8NDP3	Missense_Mutation	SNP	ENST00000426455.1	37	CCDS34703.1	.	.	.	.	.	.	.	.	.	.	.	22.3	4.275914	0.80580	.	.	ENSG00000066923	ENST00000426455;ENST00000394018;ENST00000339784;ENST00000317296;ENST00000439782	T;T;T;T	0.69926	-0.44;-0.44;-0.44;-0.44	5.41	5.41	0.78517	STAG (1);	0.000000	0.48286	D	0.000189	D	0.84651	0.5519	M	0.88906	2.99	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.97110	0.989;1.0	D	0.86997	0.2114	10	0.87932	D	0	-12.1306	16.7269	0.85424	0.0:1.0:0.0:0.0	.	174;232	B4DZ10;Q9UJ98	.;STAG3_HUMAN	S	232;174;190;232;174	ENSP00000400359:R232S;ENSP00000377586:R174S;ENSP00000319318:R232S;ENSP00000397067:R174S	ENSP00000319318:R232S	R	+	1	0	STAG3	99624554	1.000000	0.71417	1.000000	0.80357	0.909000	0.53808	2.952000	0.49097	2.821000	0.97095	0.555000	0.69702	CGT		0.517	STAG3-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000338734.2	NM_012447	
GCC1	79571	broad.mit.edu	37	7	127222568	127222568	+	Missense_Mutation	SNP	C	C	A			TCGA-61-1998-01A-01W-0722-08	TCGA-61-1998-10A-01W-0722-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0284efcd-e4b8-45b5-9c1e-6f3950ac4bf0	5a480357-2b29-4ce2-b257-a77186ce5fad	g.chr7:127222568C>A	ENST00000321407.2	-	2	2252	c.1828G>T	c.(1828-1830)Gcc>Tcc	p.A610S	GCC1_ENST00000497650.1_5'Flank	NM_024523.5	NP_078799.2	Q96CN9	GCC1_HUMAN	GRIP and coiled-coil domain containing 1	610					protein targeting to Golgi (GO:0000042)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)		p.A610S(1)		breast(2)|endometrium(6)|kidney(4)|large_intestine(6)|lung(13)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	38						GAGGCCAAGGCCACAGAACGC	0.607																																																1	Substitution - Missense(1)	ovary(1)	7											69.0	67.0	68.0					7																	127222568		2203	4300	6503	127009804	SO:0001583	missense	79571			AF525417	CCDS5796.1	7q22.3	2004-03-05	2003-10-17		ENSG00000179562	ENSG00000179562			19095	protein-coding gene	gene with protein product		607418	"""golgi coiled-coil 1"""			10209125	Standard	NM_024523		Approved	FLJ22035, GCC88, GCC1P, MGC20706	uc003vma.3	Q96CN9	OTTHUMG00000023590	ENST00000321407.2:c.1828G>T	7.37:g.127222568C>A	ENSP00000318821:p.Ala610Ser		127009804	Q9H6N7	Missense_Mutation	SNP	ENST00000321407.2	37	CCDS5796.1	.	.	.	.	.	.	.	.	.	.	C	11.95	1.791405	0.31685	.	.	ENSG00000179562	ENST00000321407	T	0.10960	2.82	5.1	5.1	0.69264	.	0.296786	0.37623	N	0.002014	T	0.08537	0.0212	L	0.41236	1.265	0.37468	D	0.915505	P	0.47106	0.89	B	0.38378	0.272	T	0.21143	-1.0254	10	0.07990	T	0.79	-14.8502	14.3609	0.66771	0.0:1.0:0.0:0.0	.	610	Q96CN9	GCC1_HUMAN	S	610	ENSP00000318821:A610S	ENSP00000318821:A610S	A	-	1	0	GCC1	127009804	0.949000	0.32298	1.000000	0.80357	0.995000	0.86356	1.213000	0.32407	2.518000	0.84900	0.655000	0.94253	GCC		0.607	GCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059911.3	NM_024523	
RGS22	26166	broad.mit.edu	37	8	100999756	100999756	+	Missense_Mutation	SNP	C	C	A	rs182707509	byFrequency	TCGA-61-1998-01A-01W-0722-08	TCGA-61-1998-10A-01W-0722-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0284efcd-e4b8-45b5-9c1e-6f3950ac4bf0	5a480357-2b29-4ce2-b257-a77186ce5fad	g.chr8:100999756C>A	ENST00000360863.6	-	21	3304	c.3110G>T	c.(3109-3111)cGt>cTt	p.R1037L	RGS22_ENST00000523287.1_Missense_Mutation_p.R856L|RGS22_ENST00000523437.1_Missense_Mutation_p.R1025L	NM_015668.3	NP_056483.3	Q8NE09	RGS22_HUMAN	regulator of G-protein signaling 22	1037	RGS 2. {ECO:0000255|PROSITE- ProRule:PRU00171}.				positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)	p.R1037L(1)	RGS22/SYCP1(2)	breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(33)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	68			Epithelial(11;6.71e-08)|all cancers(13;4.19e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000469)|STAD - Stomach adenocarcinoma(118;0.169)			AGCCACAAAACGTTGAAATTG	0.358																																																1	Substitution - Missense(1)	ovary(1)	8											97.0	89.0	92.0					8																	100999756		1826	4082	5908	101068932	SO:0001583	missense	26166			AY009106	CCDS43758.1, CCDS69521.1, CCDS75775.1	8q22.2	2014-01-21	2007-08-14		ENSG00000132554	ENSG00000132554		"""Regulators of G-protein signaling"""	24499	protein-coding gene	gene with protein product		615650	"""regulator of G-protein signalling 22"""				Standard	XM_005250856		Approved	DKFZP434I092, PRTD-NY2, CT145	uc003yjb.1	Q8NE09	OTTHUMG00000164802	ENST00000360863.6:c.3110G>T	8.37:g.100999756C>A	ENSP00000354109:p.Arg1037Leu		101068932	A8K944|Q569L2|Q86Y71|Q9BYZ4|Q9UFN6	Missense_Mutation	SNP	ENST00000360863.6	37	CCDS43758.1	.	.	.	.	.	.	.	.	.	.	C	17.40	3.380137	0.61845	.	.	ENSG00000132554	ENST00000360863;ENST00000427793;ENST00000523287;ENST00000523437	T;T;T	0.01918	4.56;4.56;4.56	5.76	1.02	0.19986	Regulator of G protein signalling (3);Regulator of G protein signalling superfamily (1);	0.283837	0.33515	N	0.004831	T	0.05456	0.0144	L	0.56769	1.78	0.27924	N	0.938133	P;P;P	0.44946	0.846;0.846;0.815	P;P;B	0.50860	0.652;0.652;0.338	T	0.05716	-1.0868	10	0.72032	D	0.01	.	11.0112	0.47663	0.0:0.6475:0.0:0.3525	.	1025;1037;856	A8K944;Q8NE09;G3V112	.;RGS22_HUMAN;.	L	1037;1024;856;1025	ENSP00000354109:R1037L;ENSP00000429382:R856L;ENSP00000428212:R1025L	ENSP00000354109:R1037L	R	-	2	0	RGS22	101068932	0.990000	0.36364	0.424000	0.26647	0.936000	0.57629	0.858000	0.27845	-0.088000	0.12506	0.573000	0.79308	CGT		0.358	RGS22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000380365.1	NM_015668	
SYP	6855	broad.mit.edu	37	X	49049789	49049789	+	Missense_Mutation	SNP	C	C	G			TCGA-61-1998-01A-01W-0722-08	TCGA-61-1998-10A-01W-0722-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture			Illumina GAIIx	0284efcd-e4b8-45b5-9c1e-6f3950ac4bf0	5a480357-2b29-4ce2-b257-a77186ce5fad	g.chrX:49049789C>G	ENST00000263233.4	-	5	627	c.555G>C	c.(553-555)caG>caC	p.Q185H	SYP_ENST00000538567.1_Missense_Mutation_p.Q67H|SYP_ENST00000479808.1_Missense_Mutation_p.Q185H	NM_003179.2	NP_003170.1	P08247	SYPH_HUMAN	synaptophysin	185	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.				cellular response to organic substance (GO:0071310)|endocytosis (GO:0006897)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of opioid receptor signaling pathway (GO:2000474)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|synaptic vesicle maturation (GO:0016188)|synaptic vesicle membrane organization (GO:0048499)	cell junction (GO:0030054)|excitatory synapse (GO:0060076)|integral component of synaptic vesicle membrane (GO:0030285)|neuron projection (GO:0043005)|neuron projection terminus (GO:0044306)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)|protein complex (GO:0043234)|synaptic vesicle (GO:0008021)	cholesterol binding (GO:0015485)|protein self-association (GO:0043621)|transporter activity (GO:0005215)	p.Q185H(2)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(2)|lung(4)|ovary(1)|pancreas(1)	15		all_lung(315;0.00016)				TGTTCCCTGTCTGGCGGCAGA	0.572																																																2	Substitution - Missense(2)	ovary(2)	X											103.0	71.0	82.0					X																	49049789		2203	4300	6503	48936733	SO:0001583	missense	6855			X06389	CCDS14321.1	Xp11.23-p11.22	2014-02-19			ENSG00000102003	ENSG00000102003			11506	protein-coding gene	gene with protein product		313475				3120152, 19377476	Standard	NM_003179		Approved	MRX96	uc004dmz.1	P08247	OTTHUMG00000034557	ENST00000263233.4:c.555G>C	X.37:g.49049789C>G	ENSP00000263233:p.Gln185His		48936733	B2R7L6|B7Z359|Q6P2F7	Missense_Mutation	SNP	ENST00000263233.4	37	CCDS14321.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.95|13.95	2.390554|2.390554	0.42410|0.42410	.|.	.|.	ENSG00000102003|ENSG00000102003	ENST00000263233;ENST00000538567;ENST00000479808|ENST00000472598	T;T;T|.	0.70399|.	-0.48;-0.48;-0.48|.	5.11|5.11	5.11|5.11	0.69529|0.69529	Marvel (1);MARVEL-like domain (1);|.	0.278172|.	0.36665|.	N|.	0.002478|.	T|T	0.37404|0.37404	0.1002|0.1002	L|L	0.33245|0.33245	0.995|0.995	0.09310|0.09310	N|N	0.999995|0.999995	P|.	0.52692|.	0.955|.	P|.	0.49561|.	0.615|.	T|T	0.23261|0.23261	-1.0193|-1.0193	10|5	0.46703|.	T|.	0.11|.	-4.3796|-4.3796	10.3917|10.3917	0.44175|0.44175	0.0:0.905:0.0:0.095|0.0:0.905:0.0:0.095	.|.	185|.	P08247|.	SYPH_HUMAN|.	H|T	185;67;185|75	ENSP00000263233:Q185H;ENSP00000437456:Q67H;ENSP00000418169:Q185H|.	ENSP00000263233:Q185H|.	Q|R	-|-	3|2	2|0	SYP|SYP	48936733|48936733	0.827000|0.827000	0.29292|0.29292	0.926000|0.926000	0.36857|0.36857	0.979000|0.979000	0.70002|0.70002	1.499000|1.499000	0.35671|0.35671	2.358000|2.358000	0.79984|0.79984	0.600000|0.600000	0.82982|0.82982	CAG|AGA		0.572	SYP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083625.2	NM_003179	
ITIH6	347365	broad.mit.edu	37	X	54785126	54785126	+	Missense_Mutation	SNP	G	G	T			TCGA-61-1998-01A-01W-0722-08	TCGA-61-1998-10A-01W-0722-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0284efcd-e4b8-45b5-9c1e-6f3950ac4bf0	5a480357-2b29-4ce2-b257-a77186ce5fad	g.chrX:54785126G>T	ENST00000218436.6	-	8	1410	c.1381C>A	c.(1381-1383)Cag>Aag	p.Q461K		NM_198510.2	NP_940912.1	Q6UXX5	ITIH6_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 6	461	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.Q461K(1)									CCCTTCAGCTGTAGGGCCGCA	0.592																																																1	Substitution - Missense(1)	ovary(1)	X											46.0	41.0	43.0					X																	54785126		2203	4300	6503	54801851	SO:0001583	missense	347365			AY358170	CCDS14361.1	Xp11.22-p11.21	2011-10-26	2011-10-26	2011-10-26	ENSG00000102313	ENSG00000102313			28907	protein-coding gene	gene with protein product			"""inter-alpha (globulin) inhibitor H5-like"""	ITIH5L		12975309	Standard	NM_198510		Approved	UNQ6369	uc004dtj.2	Q6UXX5	OTTHUMG00000021634	ENST00000218436.6:c.1381C>A	X.37:g.54785126G>T	ENSP00000218436:p.Gln461Lys		54801851	A6NN03	Missense_Mutation	SNP	ENST00000218436.6	37	CCDS14361.1	.	.	.	.	.	.	.	.	.	.	G	13.23	2.176243	0.38413	.	.	ENSG00000102313	ENST00000218436	T	0.13196	2.61	3.66	3.66	0.41972	von Willebrand factor, type A (2);	0.000000	0.64402	U	0.000001	T	0.17704	0.0425	M	0.73372	2.23	0.40047	D	0.975726	B	0.13594	0.008	B	0.09377	0.004	T	0.04320	-1.0960	10	0.38643	T	0.18	.	13.6298	0.62189	0.0:0.0:1.0:0.0	.	461	Q6UXX5	ITH5L_HUMAN	K	461	ENSP00000218436:Q461K	ENSP00000218436:Q461K	Q	-	1	0	ITIH5L	54801851	1.000000	0.71417	0.020000	0.16555	0.007000	0.05969	6.143000	0.71756	1.402000	0.46780	0.597000	0.82753	CAG		0.592	ITIH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056814.2	NM_198510	
