#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
MRPS15	64960	broad.mit.edu	37	1	36921912	36921912	+	Missense_Mutation	SNP	C	C	T	rs80215530	byFrequency	TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chr1:36921912C>T	ENST00000373116.5	-	7	673	c.512G>A	c.(511-513)cGt>cAt	p.R171H	MRPS15_ENST00000488606.1_5'UTR	NM_031280.3	NP_112570.2	P82914	RT15_HUMAN	mitochondrial ribosomal protein S15	171					translation (GO:0006412)	mitochondrial small ribosomal subunit (GO:0005763)|mitochondrion (GO:0005739)|nuclear membrane (GO:0031965)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)	p.R171H(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|ovary(1)	14		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				GTTGGTGTTACGGAGGTTTTT	0.453																																																1	Substitution - Missense(1)	ovary(1)	1											94.0	89.0	90.0					1																	36921912		2203	4300	6503	36694499	SO:0001583	missense	64960			AB049946	CCDS411.1	1p34.3	2012-09-13			ENSG00000116898	ENSG00000116898		"""Mitochondrial ribosomal proteins / small subunits"""	14504	protein-coding gene	gene with protein product		611979					Standard	NM_031280		Approved	FLJ11564	uc001cas.2	P82914	OTTHUMG00000008042	ENST00000373116.5:c.512G>A	1.37:g.36921912C>T	ENSP00000362208:p.Arg171His		36694499	B2RD82|Q9H2K1	Missense_Mutation	SNP	ENST00000373116.5	37	CCDS411.1	.	.	.	.	.	.	.	.	.	.	C	35	5.528685	0.96446	.	.	ENSG00000116898	ENST00000373116	.	.	.	6.06	6.06	0.98353	S15/NS1, RNA-binding (2);	0.000000	0.85682	D	0.000000	D	0.87661	0.6233	H	0.94345	3.525	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.89987	0.4105	9	0.87932	D	0	-26.9014	19.1847	0.93639	0.0:1.0:0.0:0.0	.	171	P82914	RT15_HUMAN	H	171	.	ENSP00000362208:R171H	R	-	2	0	MRPS15	36694499	1.000000	0.71417	0.970000	0.41538	0.995000	0.86356	7.113000	0.77095	2.882000	0.98803	0.655000	0.94253	CGT		0.453	MRPS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022052.2	NM_031280	
GBP6	163351	broad.mit.edu	37	1	89835207	89835207	+	Missense_Mutation	SNP	C	C	A			TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chr1:89835207C>A	ENST00000370456.4	+	3	386	c.293C>A	c.(292-294)aCc>aAc	p.T98N	GBP6_ENST00000535065.1_Intron	NM_198460.2	NP_940862.2	Q6ZN66	GBP6_HUMAN	guanylate binding protein family, member 6	98	GB1/RHD3-type G.|GTPase domain (Globular). {ECO:0000250}.				cellular response to interferon-gamma (GO:0071346)|defense response to bacterium (GO:0042742)|immune response (GO:0006955)	extracellular vesicular exosome (GO:0070062)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.T98N(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	42		Lung NSC(277;0.0908)		all cancers(265;0.0108)|Epithelial(280;0.0398)		CTTCTGGACACCGAAGGTCTG	0.507																																																1	Substitution - Missense(1)	ovary(1)	1											83.0	76.0	79.0					1																	89835207		2203	4300	6503	89607795	SO:0001583	missense	163351			BX537949	CCDS723.1	1p22	2008-02-05			ENSG00000183347	ENSG00000183347			25395	protein-coding gene	gene with protein product		612467					Standard	NM_198460		Approved	DKFZp686G0786	uc001dnf.2	Q6ZN66	OTTHUMG00000010123	ENST00000370456.4:c.293C>A	1.37:g.89835207C>A	ENSP00000359485:p.Thr98Asn		89607795	A2RRM3|Q6ZN86|Q7Z3F0	Missense_Mutation	SNP	ENST00000370456.4	37	CCDS723.1	.	.	.	.	.	.	.	.	.	.	C	15.84	2.951841	0.53293	.	.	ENSG00000183347	ENST00000544311;ENST00000370456	T	0.76709	-1.04	4.55	3.63	0.41609	Guanylate-binding protein, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.90445	0.7008	H	0.98786	4.33	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.91861	0.5499	10	0.87932	D	0	-20.3496	10.193	0.43039	0.0:0.9006:0.0:0.0994	.	98	Q6ZN66	GBP6_HUMAN	N	69;98	ENSP00000359485:T98N	ENSP00000359485:T98N	T	+	2	0	GBP6	89607795	0.996000	0.38824	0.780000	0.31762	0.388000	0.30384	3.865000	0.56033	0.910000	0.36722	0.585000	0.79938	ACC		0.507	GBP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028001.1	NM_198460	
ABCA4	24	broad.mit.edu	37	1	94495051	94495051	+	Missense_Mutation	SNP	T	T	A			TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	T	T	A	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chr1:94495051T>A	ENST00000370225.3	-	30	4575	c.4489A>T	c.(4489-4491)Acc>Tcc	p.T1497S		NM_000350.2	NP_000341.2	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 4	1497					phospholipid transfer to membrane (GO:0006649)|photoreceptor cell maintenance (GO:0045494)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|phospholipid-translocating ATPase activity (GO:0004012)|transporter activity (GO:0005215)	p.T1497S(1)		NS(2)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(10)|large_intestine(25)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(10)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	147		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		GGCAGCATGGTGAGCTTCTCC	0.632																																																1	Substitution - Missense(1)	ovary(1)	1											62.0	41.0	48.0					1																	94495051		2203	4300	6503	94267639	SO:0001583	missense	24			U88667	CCDS747.1	1p22	2013-01-23			ENSG00000198691	ENSG00000198691		"""ATP binding cassette transporters / subfamily A"""	34	protein-coding gene	gene with protein product	"""Stargardt disease"""	601691	"""ATP-binding cassette transporter, retinal-specific"""	STGD1, ABCR, RP19, STGD		9490294	Standard	NM_000350		Approved	FFM, ARMD2, CORD3	uc001dqh.3	P78363	OTTHUMG00000010622	ENST00000370225.3:c.4489A>T	1.37:g.94495051T>A	ENSP00000359245:p.Thr1497Ser		94267639	O15112|O60438|O60915|Q0QD48|Q4LE31	Missense_Mutation	SNP	ENST00000370225.3	37	CCDS747.1	.	.	.	.	.	.	.	.	.	.	T	17.25	3.342868	0.61073	.	.	ENSG00000198691	ENST00000546054;ENST00000370225	D	0.94537	-3.45	5.24	5.24	0.73138	.	0.159989	0.53938	D	0.000045	D	0.89298	0.6675	L	0.50333	1.59	0.80722	D	1	B	0.22746	0.074	B	0.23574	0.047	D	0.87145	0.2205	10	0.38643	T	0.18	.	15.3612	0.74475	0.0:0.0:0.0:1.0	.	1497	P78363	ABCA4_HUMAN	S	289;1497	ENSP00000359245:T1497S	ENSP00000359245:T1497S	T	-	1	0	ABCA4	94267639	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.990000	0.70595	2.212000	0.71576	0.529000	0.55759	ACC		0.632	ABCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029320.1	NM_000350	
PLPPR4	9890	broad.mit.edu	37	1	99767345	99767345	+	Missense_Mutation	SNP	T	T	A			TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	T	T	A	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chr1:99767345T>A	ENST00000370185.3	+	6	1355	c.858T>A	c.(856-858)ttT>ttA	p.F286L	LPPR4_ENST00000457765.1_Intron|LPPR4_ENST00000370184.1_Missense_Mutation_p.F128L	NM_014839.4	NP_055654.2	Q7Z2D5	LPPR4_HUMAN		286					axonogenesis (GO:0007409)|inner ear development (GO:0048839)|phospholipid dephosphorylation (GO:0046839)	integral component of plasma membrane (GO:0005887)	lipid phosphatase activity (GO:0042577)|phosphatidate phosphatase activity (GO:0008195)	p.F286L(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(39)|ovary(3)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	72		all_epithelial(167;3.54e-06)|all_lung(203;0.00139)|Lung NSC(277;0.00202)		Epithelial(280;0.0736)|all cancers(265;0.0975)|COAD - Colon adenocarcinoma(174;0.142)|Lung(183;0.201)|Colorectal(170;0.22)		TCTTCACATTTATCATCTGTG	0.383																																																1	Substitution - Missense(1)	ovary(1)	1											139.0	134.0	136.0					1																	99767345		2203	4300	6503	99539933	SO:0001583	missense	9890																														ENST00000370185.3:c.858T>A	1.37:g.99767345T>A	ENSP00000359204:p.Phe286Leu		99539933	E7EPS1|O75043|Q5T9R9|Q86XQ5|Q8N3F1|Q96MP0	Missense_Mutation	SNP	ENST00000370185.3	37	CCDS757.1	.	.	.	.	.	.	.	.	.	.	T	13.53	2.265256	0.40095	.	.	ENSG00000117600	ENST00000370185;ENST00000263178;ENST00000370184	T;T	0.72942	-0.7;-0.7	4.92	1.36	0.22044	Phosphatidic acid phosphatase/chloroperoxidase, N-terminal (1);	0.356680	0.32106	N	0.006572	T	0.46639	0.1403	N	0.13003	0.285	0.80722	D	1	P	0.51791	0.948	P	0.60068	0.868	T	0.41805	-0.9488	10	0.13470	T	0.59	-19.4954	8.4354	0.32784	0.0:0.3098:0.0:0.6902	.	286	Q7Z2D5	LPPR4_HUMAN	L	286;286;128	ENSP00000359204:F286L;ENSP00000359203:F128L	ENSP00000263178:F286L	F	+	3	2	RP4-788L13.1	99539933	0.987000	0.35691	0.998000	0.56505	0.996000	0.88848	0.174000	0.16743	-0.015000	0.14150	0.402000	0.26972	TTT		0.383	LPPR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029670.2		
AMIGO1	57463	broad.mit.edu	37	1	110050740	110050740	+	Silent	SNP	C	C	T			TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chr1:110050740C>T	ENST00000369864.4	-	2	1144	c.795G>A	c.(793-795)ctG>ctA	p.L265L	AMIGO1_ENST00000369862.1_Silent_p.L265L					adhesion molecule with Ig-like domain 1									p.L265L(1)		autonomic_ganglia(1)|breast(2)|endometrium(1)|large_intestine(6)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		all_epithelial(167;2.83e-05)|all_lung(203;0.00016)|Lung NSC(277;0.000318)|Breast(1374;0.244)		Colorectal(144;0.0129)|Lung(183;0.0182)|Epithelial(280;0.046)|all cancers(265;0.0492)|READ - Rectum adenocarcinoma(129;0.0689)|LUSC - Lung squamous cell carcinoma(189;0.227)		TGAGGAAACTCAGGTTGAAGA	0.522																																																1	Substitution - coding silent(1)	ovary(1)	1											101.0	103.0	103.0					1																	110050740		2203	4300	6503	109852263	SO:0001819	synonymous_variant	57463				CCDS30795.1	1p13.3	2013-01-11			ENSG00000181754	ENSG00000181754		"""Immunoglobulin superfamily / V-set domain containing"""	20824	protein-coding gene	gene with protein product	"""amphoterin-induced gene and open reading frame"""	615689				12629050	Standard	NM_020703		Approved	AMIGO, KIAA1163	uc001dxx.4	Q86WK6	OTTHUMG00000011653	ENST00000369864.4:c.795G>A	1.37:g.110050740C>T			109852263		Silent	SNP	ENST00000369864.4	37	CCDS30795.1																																																																																				0.522	AMIGO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032247.1	NM_020703	
RBM15	64783	broad.mit.edu	37	1	110883320	110883320	+	Silent	SNP	A	A	G			TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chr1:110883320A>G	ENST00000369784.3	+	1	2193	c.1293A>G	c.(1291-1293)aaA>aaG	p.K431K	RP5-1074L1.1_ENST00000449169.1_RNA|RBM15_ENST00000602849.1_Silent_p.K431K|RBM15_ENST00000487146.2_Silent_p.K431K	NM_022768.4	NP_073605.4	Q96T37	RBM15_HUMAN	RNA binding motif protein 15	431	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				negative regulation of myeloid cell differentiation (GO:0045638)|patterning of blood vessels (GO:0001569)|placenta blood vessel development (GO:0060674)|positive regulation of transcription of Notch receptor target (GO:0007221)|spleen development (GO:0048536)|ventricular septum morphogenesis (GO:0060412)|viral process (GO:0016032)	membrane (GO:0016020)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.K431R(1)		ovary(3)	3		all_cancers(81;2.89e-06)|all_epithelial(167;2.96e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)|Breast(1374;0.0634)		BRCA - Breast invasive adenocarcinoma(282;0.000224)|Epithelial(280;0.000476)|Kidney(133;0.000539)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|all cancers(265;0.00144)|Lung(183;0.0238)|Colorectal(144;0.103)|LUSC - Lung squamous cell carcinoma(189;0.135)		ACCGGGCCAAATTAGCAATGT	0.463			T	MKL1	acute megakaryocytic leukemia																																		Dom	yes		1	1p13	64783	RNA binding motif protein 15		L	1	Substitution - Missense(1)	ovary(1)	1											48.0	55.0	52.0					1																	110883320		2203	4300	6503	110684843	SO:0001819	synonymous_variant	64783			AF368063	CCDS822.1, CCDS59198.1	1p13	2013-02-12			ENSG00000162775	ENSG00000162775		"""RNA binding motif (RRM) containing"""	14959	protein-coding gene	gene with protein product	"""one twenty-two"""	606077				11431691, 11344311	Standard	NM_001201545		Approved	OTT, OTT1	uc001dzl.1	Q96T37	OTTHUMG00000011284	ENST00000369784.3:c.1293A>G	1.37:g.110883320A>G			110684843	A1A693|Q3ZB86|Q4V760|Q5D058|Q5T613|Q86VW9|Q96PE4|Q96SC5|Q96SC6|Q96SC9|Q96SD0|Q96T38|Q9BRA5|Q9H6R8|Q9H9Y0	Silent	SNP	ENST00000369784.3	37	CCDS822.1																																																																																				0.463	RBM15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000031114.2	NM_022768	
CTTNBP2NL	55917	broad.mit.edu	37	1	112997102	112997102	+	Missense_Mutation	SNP	G	G	T			TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chr1:112997102G>T	ENST00000271277.6	+	5	587	c.362G>T	c.(361-363)cGg>cTg	p.R121L		NM_018704.2	NP_061174.1	Q9P2B4	CT2NL_HUMAN	CTTNBP2 N-terminal like	121					negative regulation of transmembrane transport (GO:0034763)|negative regulation of transporter activity (GO:0032410)|protein dephosphorylation (GO:0006470)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	protein phosphatase 2A binding (GO:0051721)	p.R121L(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	29		all_cancers(81;0.00064)|all_epithelial(167;0.000415)|all_lung(203;0.00045)|Lung NSC(69;0.000705)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		GAAAGGCAGCGGCATGCACAG	0.383																																																1	Substitution - Missense(1)	ovary(1)	1											119.0	113.0	115.0					1																	112997102		2203	4300	6503	112798625	SO:0001583	missense	55917			AB037854	CCDS845.1	1p13.2	2008-02-05			ENSG00000143079	ENSG00000143079			25330	protein-coding gene	gene with protein product		615100				10718198	Standard	NM_018704		Approved	DKFZp547A023	uc001ebx.3	Q9P2B4	OTTHUMG00000011154	ENST00000271277.6:c.362G>T	1.37:g.112997102G>T	ENSP00000271277:p.Arg121Leu		112798625	B3KMS5|Q96B40	Missense_Mutation	SNP	ENST00000271277.6	37	CCDS845.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.062708	0.76187	.	.	ENSG00000143079	ENST00000271277;ENST00000441739	T;T	0.43294	0.95;0.95	6.04	6.04	0.98038	Cortactin-binding protein-2, N-terminal (1);	0.039177	0.85682	D	0.000000	T	0.44808	0.1311	N	0.25647	0.755	0.54753	D	0.999986	D	0.67145	0.996	D	0.68192	0.956	T	0.19582	-1.0301	10	0.36615	T	0.2	-30.0464	20.1899	0.98228	0.0:0.0:1.0:0.0	.	121	Q9P2B4	CT2NL_HUMAN	L	121	ENSP00000271277:R121L;ENSP00000390976:R121L	ENSP00000271277:R121L	R	+	2	0	CTTNBP2NL	112798625	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.608000	0.67654	2.873000	0.98535	0.563000	0.77884	CGG		0.383	CTTNBP2NL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030686.1	NM_018704	
TCHH	7062	broad.mit.edu	37	1	152084052	152084052	+	Silent	SNP	C	C	T	rs374409875		TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chr1:152084052C>T	ENST00000368804.1	-	2	1640	c.1641G>A	c.(1639-1641)gaG>gaA	p.E547E		NM_007113.2	NP_009044.2	Q07283	TRHY_HUMAN	trichohyalin	547	9 X 28 AA approximate tandem repeats.				keratinization (GO:0031424)	cytoskeleton (GO:0005856)	calcium ion binding (GO:0005509)	p.E547E(1)		NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(20)|kidney(9)|large_intestine(16)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(4)	105	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TCAGCAGCTGCTCGCGCCTCT	0.662																																																1	Substitution - coding silent(1)	ovary(1)	1								0,4070		0,0,2035	77.0	84.0	81.0		1641	0.7	0.0	1		81	2,8382		0,2,4190	no	coding-synonymous	TCHH	NM_007113.2		0,2,6225	TT,TC,CC		0.0239,0.0,0.0161		547/1944	152084052	2,12452	2035	4192	6227	150350676	SO:0001819	synonymous_variant	7062			L09190	CCDS41396.1	1q21-q23	2013-01-10		2006-01-27	ENSG00000159450	ENSG00000159450		"""EF-hand domain containing"""	11791	protein-coding gene	gene with protein product		190370		THH		1431214	Standard	NM_007113		Approved		uc001ezp.3	Q07283	OTTHUMG00000013066	ENST00000368804.1:c.1641G>A	1.37:g.152084052C>T			150350676	Q5VUI3	Silent	SNP	ENST00000368804.1	37	CCDS41396.1																																																																																				0.662	TCHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036671.2	NM_007113	
GON4L	54856	broad.mit.edu	37	1	155743001	155743001	+	Splice_Site	SNP	G	G	A			TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chr1:155743001G>A	ENST00000368331.1	-	18	2399	c.2351C>T	c.(2350-2352)gCg>gTg	p.A784V	GON4L_ENST00000437809.1_Splice_Site_p.A784V|GON4L_ENST00000361040.5_Splice_Site_p.A784V|GON4L_ENST00000471341.1_5'UTR|GON4L_ENST00000271883.5_Splice_Site_p.A784V	NM_001282858.1|NM_001282860.1	NP_001269787.1|NP_001269789.1	Q3T8J9	GON4L_HUMAN	gon-4-like (C. elegans)	784					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.A784V(1)		NS(2)|breast(4)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	45	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					AAATTCATTCGCTATAAGAAA	0.408																																																1	Substitution - Missense(1)	ovary(1)	1											68.0	67.0	67.0					1																	155743001		2203	4300	6503	154009625	SO:0001630	splice_region_variant	54856			AB046826	CCDS1121.1, CCDS44242.1, CCDS60296.1	1q22	2013-10-31	2006-11-08	2006-02-16	ENSG00000116580	ENSG00000116580			25973	protein-coding gene	gene with protein product		610393	"""gon-4 homolog (C.elegans)"""	GON4		16545939, 21454521	Standard	XM_005245283		Approved	FLJ20203, GON-4	uc001fly.1	Q3T8J9	OTTHUMG00000014106	ENST00000368331.1:c.2351-1C>T	1.37:g.155743001G>A			154009625	B7ZBL4|Q14C93|Q3T8J8|Q5VYZ5|Q5W0D5|Q6AWA6|Q6P1Q6|Q7Z3L3|Q8IY79|Q9BQI1|Q9HCG6	Missense_Mutation	SNP	ENST00000368331.1	37		.	.	.	.	.	.	.	.	.	.	G	16.38	3.108043	0.56291	.	.	ENSG00000116580	ENST00000437809;ENST00000368331;ENST00000271883;ENST00000539959;ENST00000361040	T;T;T;T	0.12672	2.86;2.86;2.86;2.66	5.12	2.03	0.26663	.	0.236963	0.35320	N	0.003295	T	0.03136	0.0092	L	0.47716	1.5	0.34525	D	0.708553	P;B;B	0.38992	0.653;0.203;0.305	B;B;B	0.29176	0.099;0.046;0.099	T	0.35549	-0.9784	10	0.52906	T	0.07	.	2.7795	0.05357	0.161:0.1451:0.5442:0.1497	.	784;784;784	Q3T8J9-2;Q3T8J9;Q3T8J9-3	.;GON4L_HUMAN;.	V	784	ENSP00000396117:A784V;ENSP00000357315:A784V;ENSP00000271883:A784V;ENSP00000354322:A784V	ENSP00000271883:A784V	A	-	2	0	GON4L	154009625	0.992000	0.36948	0.558000	0.28319	0.639000	0.38242	2.266000	0.43320	0.719000	0.32188	0.491000	0.48974	GCG		0.408	GON4L-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_032292	Missense_Mutation
SELE	6401	broad.mit.edu	37	1	169701925	169701925	+	Silent	SNP	T	T	A			TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	T	T	A	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chr1:169701925T>A	ENST00000333360.7	-	3	391	c.252A>T	c.(250-252)gtA>gtT	p.V84V	SELE_ENST00000367775.1_Silent_p.V84V|C1orf112_ENST00000498289.1_Intron|SELE_ENST00000367779.4_Silent_p.V84V|SELE_ENST00000367782.4_Silent_p.V84V|SELE_ENST00000367781.4_Silent_p.V84V|SELE_ENST00000367776.1_Silent_p.V84V|SELE_ENST00000367777.1_Silent_p.V84V|SELE_ENST00000367780.4_Silent_p.V84V|SELE_ENST00000367774.1_Silent_p.V84V	NM_000450.2	NP_000441.2	P16581	LYAM2_HUMAN	selectin E	84	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				actin filament-based process (GO:0030029)|activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|heterophilic cell-cell adhesion (GO:0007157)|inflammatory response (GO:0006954)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte migration involved in inflammatory response (GO:0002523)|leukocyte tethering or rolling (GO:0050901)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of receptor internalization (GO:0002092)|regulation of inflammatory response (GO:0050727)|response to interleukin-1 (GO:0070555)|response to lipopolysaccharide (GO:0032496)|response to tumor necrosis factor (GO:0034612)	caveola (GO:0005901)|coated pit (GO:0005905)|cortical cytoskeleton (GO:0030863)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	oligosaccharide binding (GO:0070492)|phospholipase binding (GO:0043274)|sialic acid binding (GO:0033691)|transmembrane signaling receptor activity (GO:0004888)	p.V84V(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(12)|ovary(3)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	32	all_hematologic(923;0.208)				Carvedilol(DB01136)	TCTGGGTTCCTACCCAGACCC	0.428																																																1	Substitution - coding silent(1)	ovary(1)	1											83.0	79.0	80.0					1																	169701925		2203	4300	6503	167968549	SO:0001819	synonymous_variant	6401			M30640	CCDS1283.1	1q22-q25	2008-07-31	2008-07-31		ENSG00000007908	ENSG00000007908		"""CD molecules"""	10718	protein-coding gene	gene with protein product		131210	"""endothelial adhesion molecule 1"""	ELAM1, ELAM		1375831	Standard	NM_000450		Approved	ESEL, CD62E	uc001ggm.4	P16581	OTTHUMG00000034851	ENST00000333360.7:c.252A>T	1.37:g.169701925T>A			167968549	A2RRD6|P16111	Silent	SNP	ENST00000333360.7	37	CCDS1283.1																																																																																				0.428	SELE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084333.1	NM_000450	
ZBTB41	360023	broad.mit.edu	37	1	197169101	197169101	+	Missense_Mutation	SNP	A	A	C			TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	A	A	C	C	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chr1:197169101A>C	ENST00000367405.4	-	1	571	c.503T>G	c.(502-504)aTa>aGa	p.I168R	ZBTB41_ENST00000467322.1_5'UTR|CRB1_ENST00000535699.1_5'Flank	NM_194314.2	NP_919290.2	Q5SVQ8	ZBT41_HUMAN	zinc finger and BTB domain containing 41	168					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.I168R(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(11)|lung(11)|ovary(1)|skin(3)|upper_aerodigestive_tract(2)	40						CACTGCATCTATAATGTCCAA	0.318																																																1	Substitution - Missense(1)	ovary(1)	1											40.0	39.0	39.0					1																	197169101		2203	4299	6502	195435724	SO:0001583	missense	360023				CCDS30960.1	1q31.3	2013-01-08			ENSG00000177888	ENSG00000177888		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	24819	protein-coding gene	gene with protein product							Standard	NM_194314		Approved	FRBZ1, FLJ36199, DKFZp686C06120, ZNF924	uc001gtx.1	Q5SVQ8	OTTHUMG00000036275	ENST00000367405.4:c.503T>G	1.37:g.197169101A>C	ENSP00000356375:p.Ile168Arg		195435724	A2RUA8|Q6MZT8|Q6ZR25|Q7Z4T1|Q8IZ99	Missense_Mutation	SNP	ENST00000367405.4	37	CCDS30960.1	.	.	.	.	.	.	.	.	.	.	A	15.69	2.908920	0.52439	.	.	ENSG00000177888	ENST00000367405	T	0.66099	-0.19	4.96	3.83	0.44106	BTB/POZ-like (1);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.48286	D	0.000199	T	0.41858	0.1177	N	0.04090	-0.28	0.58432	D	0.999999	P	0.44946	0.846	B	0.43445	0.42	T	0.49011	-0.8983	10	0.87932	D	0	.	10.3445	0.43899	0.9221:0.0:0.0779:0.0	.	168	Q5SVQ8	ZBT41_HUMAN	R	168	ENSP00000356375:I168R	ENSP00000356375:I168R	I	-	2	0	ZBTB41	195435724	1.000000	0.71417	0.989000	0.46669	0.816000	0.46133	8.957000	0.93082	0.732000	0.32470	0.254000	0.18369	ATA		0.318	ZBTB41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088249.2	NM_194314	
ATP2B4	493	broad.mit.edu	37	1	203708819	203708819	+	Missense_Mutation	SNP	A	A	T			TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chr1:203708819A>T	ENST00000357681.5	+	21	4578	c.3455A>T	c.(3454-3456)gAg>gTg	p.E1152V	ATP2B4_ENST00000367218.3_3'UTR|ATP2B4_ENST00000391954.2_3'UTR|ATP2B4_ENST00000367219.3_3'UTR|ATP2B4_ENST00000341360.2_3'UTR	NM_001684.4	NP_001675.3	P23634	AT2B4_HUMAN	ATPase, Ca++ transporting, plasma membrane 4	1188					blood coagulation (GO:0007596)|calcium ion homeostasis (GO:0055074)|calcium ion import across plasma membrane (GO:0098703)|calcium ion transmembrane transport (GO:0070588)|cellular calcium ion homeostasis (GO:0006874)|cellular response to epinephrine stimulus (GO:0071872)|ion transmembrane transport (GO:0034220)|negative regulation of adrenergic receptor signaling pathway involved in heart process (GO:1901205)|negative regulation of arginine catabolic process (GO:1900082)|negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of cardiac muscle hypertrophy in response to stress (GO:1903243)|negative regulation of citrulline biosynthetic process (GO:1903249)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of nitric oxide mediated signal transduction (GO:0010751)|negative regulation of nitric-oxide synthase activity (GO:0051001)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of the force of heart contraction (GO:0098736)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to hydrostatic pressure (GO:0051599)|transmembrane transport (GO:0055085)	caveola (GO:0005901)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|nitric-oxide synthase binding (GO:0050998)|protein phosphatase 2B binding (GO:0030346)|scaffold protein binding (GO:0097110)	p.E1152V(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(10)|lung(20)|ovary(2)|prostate(6)|skin(1)|stomach(1)|urinary_tract(3)	56	all_cancers(21;0.071)|all_epithelial(62;0.228)		BRCA - Breast invasive adenocarcinoma(75;0.109)			GATGAGGAAGAGGAGGAAAAT	0.498																																																1	Substitution - Missense(1)	ovary(1)	1											123.0	110.0	114.0					1																	203708819		2203	4300	6503	201975442	SO:0001583	missense	493			M25874	CCDS1440.1, CCDS30977.1	1q32.1	2010-04-20	2005-05-26		ENSG00000058668	ENSG00000058668	3.6.3.8	"""ATPases / P-type"""	817	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 4"""	108732	"""matrix-remodelling associated 1"""	ATP2B2, MXRA1		1674727	Standard	NM_001001396		Approved	PMCA4	uc001gzw.3	P23634	OTTHUMG00000035906	ENST00000357681.5:c.3455A>T	1.37:g.203708819A>T	ENSP00000350310:p.Glu1152Val		201975442	B1APW5|B1APW6|Q13450|Q13452|Q13455|Q16817|Q7Z3S1	Missense_Mutation	SNP	ENST00000357681.5	37	CCDS1440.1	.	.	.	.	.	.	.	.	.	.	A	16.34	3.096159	0.56075	.	.	ENSG00000058668	ENST00000357681	T	0.79653	-1.29	5.46	5.46	0.80206	.	1.166840	0.06393	N	0.717426	T	0.78604	0.4309	L	0.38175	1.15	0.80722	D	1	B	0.27853	0.191	B	0.29942	0.109	T	0.63202	-0.6690	10	0.72032	D	0.01	-11.0127	15.1947	0.73078	1.0:0.0:0.0:0.0	.	1152	P23634-6	.	V	1152	ENSP00000350310:E1152V	ENSP00000350310:E1152V	E	+	2	0	ATP2B4	201975442	1.000000	0.71417	0.966000	0.40874	0.400000	0.30750	2.550000	0.45811	2.077000	0.62373	0.533000	0.62120	GAG		0.498	ATP2B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087462.1	NM_001001396	
PIGR	5284	broad.mit.edu	37	1	207106486	207106486	+	Missense_Mutation	SNP	C	C	A			TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chr1:207106486C>A	ENST00000356495.4	-	7	1914	c.1731G>T	c.(1729-1731)aaG>aaT	p.K577N	PIGR_ENST00000487208.1_5'Flank	NM_002644.3	NP_002635.2	P01833	PIGR_HUMAN	polymeric immunoglobulin receptor	577					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc receptor signaling pathway (GO:0038093)|immunoglobulin transcytosis in epithelial cells mediated by polymeric immunoglobulin receptor (GO:0002415)|receptor clustering (GO:0043113)|retina homeostasis (GO:0001895)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	polymeric immunoglobulin receptor activity (GO:0001792)	p.K577N(1)		central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(7)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						CAGCGTCTGCCTTCGCTAGGC	0.547																																																1	Substitution - Missense(1)	ovary(1)	1											61.0	61.0	61.0					1																	207106486		2203	4300	6503	205173109	SO:0001583	missense	5284				CCDS1474.1	1q31-q41	2013-01-11			ENSG00000162896	ENSG00000162896		"""Immunoglobulin superfamily / V-set domain containing"""	8968	protein-coding gene	gene with protein product		173880					Standard	NM_002644		Approved		uc001hez.3	P01833	OTTHUMG00000036581	ENST00000356495.4:c.1731G>T	1.37:g.207106486C>A	ENSP00000348888:p.Lys577Asn		205173109	Q68D81|Q8IZY7	Missense_Mutation	SNP	ENST00000356495.4	37	CCDS1474.1	.	.	.	.	.	.	.	.	.	.	C	1.444	-0.566738	0.03910	.	.	ENSG00000162896	ENST00000356495	T	0.16196	2.36	3.88	-7.77	0.01227	.	1.704540	0.02662	N	0.107613	T	0.07593	0.0191	N	0.19112	0.55	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.30238	-0.9985	10	0.14656	T	0.56	-12.108	1.072	0.01623	0.1599:0.3221:0.237:0.281	.	577	P01833	PIGR_HUMAN	N	577	ENSP00000348888:K577N	ENSP00000348888:K577N	K	-	3	2	PIGR	205173109	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-2.936000	0.00685	-2.694000	0.00402	-1.191000	0.01696	AAG		0.547	PIGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088975.1	NM_002644	
ARHGAP21	57584	broad.mit.edu	37	10	24911660	24911660	+	Splice_Site	SNP	A	A	T			TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chr10:24911660A>T	ENST00000396432.2	-	8	1012		c.e8+1		ARHGAP21_ENST00000320481.6_Splice_Site	NM_020824.3	NP_065875.3	Q5T5U3	RHG21_HUMAN	Rho GTPase activating protein 21						establishment of Golgi localization (GO:0051683)|Golgi organization (GO:0007030)|maintenance of Golgi location (GO:0051684)|organelle transport along microtubule (GO:0072384)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)	p.?(1)		NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(17)|lung(21)|ovary(7)|pancreas(1)|prostate(5)|skin(2)|stomach(2)|urinary_tract(1)	78						TGCATTTCTTACCAGTGCTGT	0.328																																																1	Unknown(1)	ovary(1)	10											92.0	90.0	91.0					10																	24911660		2203	4300	6503	24951666	SO:0001630	splice_region_variant	57584			AF480466	CCDS7144.2	10p12.31	2013-01-10			ENSG00000107863	ENSG00000107863		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	23725	protein-coding gene	gene with protein product		609870				12056806	Standard	NM_020824		Approved	KIAA1424, ARHGAP10	uc001isb.2	Q5T5U3	OTTHUMG00000017825	ENST00000396432.2:c.525+1T>A	10.37:g.24911660A>T			24951666	Q0VF98|Q7Z3P7|Q8N3A2|Q8NI19|Q8TBV5|Q9P2C3	Splice_Site	SNP	ENST00000396432.2	37	CCDS7144.2	.	.	.	.	.	.	.	.	.	.	A	20.7	4.028021	0.75390	.	.	ENSG00000107863	ENST00000396432;ENST00000446003	.	.	.	5.72	5.72	0.89469	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.2962	0.82776	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ARHGAP21	24951666	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.443000	0.90320	2.304000	0.77564	0.528000	0.53228	.		0.328	ARHGAP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047229.4	NM_020824	Intron
SHOC2	8036	broad.mit.edu	37	10	112724807	112724807	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chr10:112724807C>T	ENST00000369452.4	+	2	1036	c.691C>T	c.(691-693)Cct>Tct	p.P231S	SHOC2_ENST00000265277.5_Missense_Mutation_p.P231S|SHOC2_ENST00000489390.1_Intron	NM_007373.3	NP_031399.2	Q9UQ13	SHOC2_HUMAN	soc-2 suppressor of clear homolog (C. elegans)	231					fibroblast growth factor receptor signaling pathway (GO:0008543)|positive regulation of Ras protein signal transduction (GO:0046579)|Ras protein signal transduction (GO:0007265)|regulation of catalytic activity (GO:0050790)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein phosphatase type 1 complex (GO:0000164)	protein phosphatase binding (GO:0019903)|protein phosphatase regulator activity (GO:0019888)	p.P231S(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(4)|ovary(1)|skin(2)	17				Epithelial(162;0.000796)|all cancers(201;0.011)|BRCA - Breast invasive adenocarcinoma(275;0.126)		TAAACAACTACCTGCTGAAAT	0.323																																																1	Substitution - Missense(1)	ovary(1)	10											55.0	56.0	56.0					10																	112724807		2202	4300	6502	112714797	SO:0001583	missense	8036			AB020669	CCDS7568.1, CCDS58095.1	10q25	2014-09-17	2001-11-28		ENSG00000108061	ENSG00000108061			15454	protein-coding gene	gene with protein product		602775	"""soc-2 (suppressor of clear, C.elegans) homolog"""			9618511, 9674433, 10783161	Standard	NM_007373		Approved	KIAA0862, SOC2, SUR-8, SOC-2, SUR8	uc001kzl.4	Q9UQ13	OTTHUMG00000019047	ENST00000369452.4:c.691C>T	10.37:g.112724807C>T	ENSP00000358464:p.Pro231Ser		112714797	A8K9W8|B3KR23|O76063|Q5VZS8|Q5VZS9	Missense_Mutation	SNP	ENST00000369452.4	37	CCDS7568.1	.	.	.	.	.	.	.	.	.	.	C	18.76	3.692553	0.68271	.	.	ENSG00000108061	ENST00000265277;ENST00000369452;ENST00000451838	T;T;D	0.85484	1.65;1.62;-1.99	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	D	0.94268	0.8159	M	0.91406	3.205	0.80722	D	1	D;D	0.67145	0.996;0.99	D;P	0.78314	0.991;0.788	D	0.95063	0.8197	10	0.87932	D	0	.	19.4783	0.94998	0.0:1.0:0.0:0.0	.	231;231	Q9UQ13-2;Q9UQ13	.;SHOC2_HUMAN	S	231;231;67	ENSP00000265277:P231S;ENSP00000358464:P231S;ENSP00000408275:P67S	ENSP00000265277:P231S	P	+	1	0	SHOC2	112714797	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.089000	0.71384	2.606000	0.88127	0.561000	0.74099	CCT		0.323	SHOC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050355.1	NM_007373	
OR4C13	283092	broad.mit.edu	37	11	49974323	49974323	+	Missense_Mutation	SNP	G	G	T			TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chr11:49974323G>T	ENST00000555099.1	+	1	381	c.349G>T	c.(349-351)Gcc>Tcc	p.A117S		NM_001001955.2	NP_001001955.2	Q8NGP0	OR4CD_HUMAN	olfactory receptor, family 4, subfamily C, member 13	117						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A117S(1)		autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(24)|ovary(2)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	43						TACTGTAATGGCCTATGACCA	0.443																																																1	Substitution - Missense(1)	ovary(1)	11											114.0	106.0	109.0					11																	49974323		2201	4296	6497	49930899	SO:0001583	missense	283092			AB065750	CCDS31495.1	11p11.12	2012-10-03			ENSG00000258817	ENSG00000258817		"""GPCR / Class A : Olfactory receptors"""	15169	protein-coding gene	gene with protein product							Standard	NM_001001955		Approved		uc010rhz.2	Q8NGP0	OTTHUMG00000166686	ENST00000555099.1:c.349G>T	11.37:g.49974323G>T	ENSP00000452277:p.Ala117Ser		49930899	A6NJJ3|B9EH30|Q6IF48|Q96R68	Missense_Mutation	SNP	ENST00000555099.1	37	CCDS31495.1	.	.	.	.	.	.	.	.	.	.	.	14.39	2.519665	0.44866	.	.	ENSG00000258817	ENST00000555099	T	0.39787	1.06	2.95	2.95	0.34219	GPCR, rhodopsin-like superfamily (1);	0.000000	0.46442	D	0.000281	T	0.59595	0.2205	M	0.71296	2.17	0.40018	D	0.97537	D	0.76494	0.999	D	0.77557	0.99	T	0.62987	-0.6737	9	.	.	.	.	11.6719	0.51406	0.0:0.0:1.0:0.0	.	117	Q8NGP0	OR4CD_HUMAN	S	117	ENSP00000452277:A117S	.	A	+	1	0	OR4C13	49930899	1.000000	0.71417	0.999000	0.59377	0.056000	0.15407	7.068000	0.76748	1.646000	0.50622	0.195000	0.17529	GCC		0.443	OR4C13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391103.1	NM_001001955	
AHNAK	79026	broad.mit.edu	37	11	62284754	62284754	+	Missense_Mutation	SNP	A	A	G			TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chr11:62284754A>G	ENST00000378024.4	-	5	17409	c.17135T>C	c.(17134-17136)aTc>aCc	p.I5712T	AHNAK_ENST00000525875.1_5'UTR|AHNAK_ENST00000257247.7_Intron|AHNAK_ENST00000530124.1_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	5712					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)	p.I5712T(1)		NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				GGGCATTTTGATCTTGGACTT	0.478																																																1	Substitution - Missense(1)	ovary(1)	11											79.0	82.0	81.0					11																	62284754		2201	4299	6500	62041330	SO:0001583	missense	79026			M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.17135T>C	11.37:g.62284754A>G	ENSP00000367263:p.Ile5712Thr		62041330	A1A586	Missense_Mutation	SNP	ENST00000378024.4	37	CCDS31584.1	.	.	.	.	.	.	.	.	.	.	A	16.52	3.147615	0.57151	.	.	ENSG00000124942	ENST00000378024	T	0.01092	5.35	4.77	4.77	0.60923	.	.	.	.	.	T	0.05960	0.0155	M	0.71036	2.16	0.42751	D	0.99377	D	0.61697	0.99	D	0.71184	0.972	T	0.12734	-1.0536	9	0.66056	D	0.02	.	14.0042	0.64453	1.0:0.0:0.0:0.0	.	5712	Q09666	AHNK_HUMAN	T	5712	ENSP00000367263:I5712T	ENSP00000367263:I5712T	I	-	2	0	AHNAK	62041330	0.998000	0.40836	0.998000	0.56505	0.896000	0.52359	5.945000	0.70226	1.793000	0.52555	0.448000	0.29417	ATC		0.478	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395572.1	NM_024060	
GDF3	9573	broad.mit.edu	37	12	7848321	7848321	+	Missense_Mutation	SNP	G	G	T			TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chr12:7848321G>T	ENST00000329913.3	-	1	51	c.4C>A	c.(4-6)Ctt>Att	p.L2I		NM_020634.1	NP_065685.1	Q9NR23	GDF3_HUMAN	growth differentiation factor 3	2					endoderm development (GO:0007492)|eye development (GO:0001654)|formation of anatomical boundary (GO:0048859)|growth (GO:0040007)|in utero embryonic development (GO:0001701)|mesoderm development (GO:0007498)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of epidermal cell differentiation (GO:0045605)|notochord development (GO:0030903)|primitive streak formation (GO:0090009)|regulation of cell fate commitment (GO:0010453)|response to dietary excess (GO:0002021)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|somite rostral/caudal axis specification (GO:0032525)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	protein kinase binding (GO:0019901)	p.L2I(1)		breast(2)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	28						AAGAAACGAAGCATGGCCTCT	0.473																																																1	Substitution - Missense(1)	ovary(1)	12											32.0	31.0	31.0					12																	7848321		2203	4300	6503	7739588	SO:0001583	missense	9573			AF263538	CCDS8581.1	12p13.1	2014-01-30			ENSG00000184344	ENSG00000184344		"""Endogenous ligands"""	4218	protein-coding gene	gene with protein product		606522				9467948	Standard	NM_020634		Approved		uc001qte.3	Q9NR23	OTTHUMG00000168433	ENST00000329913.3:c.4C>A	12.37:g.7848321G>T	ENSP00000331745:p.Leu2Ile		7739588	Q8NEJ4	Missense_Mutation	SNP	ENST00000329913.3	37	CCDS8581.1	.	.	.	.	.	.	.	.	.	.	G	12.25	1.881083	0.33255	.	.	ENSG00000184344	ENST00000329913	D	0.81821	-1.54	4.28	-0.082	0.13700	.	2.774190	0.03707	U	0.249593	T	0.58595	0.2133	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.43523	-0.9386	10	0.16896	T	0.51	.	1.5612	0.02595	0.1993:0.1474:0.4588:0.1945	.	2	Q9NR23	GDF3_HUMAN	I	2	ENSP00000331745:L2I	ENSP00000331745:L2I	L	-	1	0	GDF3	7739588	0.049000	0.20398	0.500000	0.27589	0.005000	0.04900	0.076000	0.14712	-0.010000	0.14271	-1.129000	0.01985	CTT		0.473	GDF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399717.1		
PKP2	5318	broad.mit.edu	37	12	33031177	33031177	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chr12:33031177G>A	ENST00000070846.6	-	3	661	c.637C>T	c.(637-639)Cac>Tac	p.H213Y	PKP2_ENST00000340811.4_Missense_Mutation_p.H213Y	NM_004572.3	NP_004563.2	Q99959	PKP2_HUMAN	plakophilin 2	213					adherens junction maintenance (GO:0034334)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell action potential (GO:0086001)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cell-cell signaling involved in cardiac conduction (GO:0086019)|desmosome assembly (GO:0002159)|gap junction assembly (GO:0016264)|heart development (GO:0007507)|intermediate filament bundle assembly (GO:0045110)|lipid homeostasis (GO:0055088)|maintenance of organ identity (GO:0048496)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|positive regulation of sodium ion transport (GO:0010765)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of tight junction assembly (GO:2000810)|single organismal cell-cell adhesion (GO:0016337)|ventricular cardiac muscle cell action potential (GO:0086005)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	adherens junction (GO:0005912)|cell junction (GO:0030054)|cell-cell junction (GO:0005911)|desmosome (GO:0030057)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intermediate filament binding (GO:0019215)|ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|protein kinase C binding (GO:0005080)|sodium channel regulator activity (GO:0017080)	p.H213Y(1)		NS(1)|breast(2)|endometrium(1)|kidney(9)|large_intestine(8)|lung(21)|ovary(1)|pancreas(2)|prostate(2)|skin(2)|urinary_tract(1)	50	Lung NSC(5;9.35e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)					GTGTCAAAGTGGCGCTGCCTG	0.617																																																1	Substitution - Missense(1)	ovary(1)	12											137.0	116.0	123.0					12																	33031177		2203	4300	6503	32922444	SO:0001583	missense	5318			X97675	CCDS8731.1, CCDS31771.1	12p11	2014-09-17				ENSG00000057294		"""Armadillo repeat containing"""	9024	protein-coding gene	gene with protein product		602861				8922383	Standard	NM_001005242		Approved		uc001rlj.4	Q99959	OTTHUMG00000169500	ENST00000070846.6:c.637C>T	12.37:g.33031177G>A	ENSP00000070846:p.His213Tyr		32922444	A0AV37|B8QFA1|B8QGS6|B8QGS7|D3DUW9|Q4VC01|Q99960	Missense_Mutation	SNP	ENST00000070846.6	37	CCDS8731.1	.	.	.	.	.	.	.	.	.	.	G	1.264	-0.615049	0.03663	.	.	ENSG00000057294	ENST00000340811;ENST00000070846;ENST00000537278	T;T	0.80033	-1.33;-1.27	5.07	2.21	0.28008	.	1.263180	0.05337	N	0.529390	T	0.59169	0.2174	N	0.12182	0.205	0.09310	N	1	B;B;B	0.06786	0.001;0.0;0.001	B;B;B	0.04013	0.001;0.001;0.001	T	0.54098	-0.8344	10	0.02654	T	1	-1.4444	3.6028	0.08031	0.3034:0.0:0.5177:0.1789	.	213;213;213	Q99959-2;A0AV37;Q99959	.;.;PKP2_HUMAN	Y	213	ENSP00000342800:H213Y;ENSP00000070846:H213Y	ENSP00000070846:H213Y	H	-	1	0	PKP2	32922444	0.977000	0.34250	0.938000	0.37757	0.980000	0.70556	0.774000	0.26675	1.138000	0.42230	0.650000	0.86243	CAC		0.617	PKP2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000404449.1	NM_004572	
LRRK2	120892	broad.mit.edu	37	12	40696669	40696669	+	Missense_Mutation	SNP	T	T	C			TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chr12:40696669T>C	ENST00000298910.7	+	26	3633	c.3575T>C	c.(3574-3576)aTt>aCt	p.I1192T	LRRK2_ENST00000343742.2_Missense_Mutation_p.I1192T	NM_198578.3	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	1192					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|autophagy (GO:0006914)|cellular protein localization (GO:0034613)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|endocytosis (GO:0006897)|exploration behavior (GO:0035640)|GTP catabolic process (GO:0006184)|intracellular distribution of mitochondria (GO:0048312)|intracellular signal transduction (GO:0035556)|locomotory exploration behavior (GO:0035641)|MAPK cascade (GO:0000165)|negative regulation of GTPase activity (GO:0034260)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of late endosome to lysosome transport (GO:1902823)|negative regulation of peroxidase activity (GO:2000469)|negative regulation of protein binding (GO:0032091)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein processing (GO:0010955)|negative regulation of protein processing involved in protein targeting to mitochondrion (GO:1903217)|negative regulation of protein targeting to mitochondrion (GO:1903215)|negative regulation of thioredoxin peroxidase activity by peptidyl-threonine phosphorylation (GO:1903125)|neuromuscular junction development (GO:0007528)|neuron death (GO:0070997)|neuron projection morphogenesis (GO:0048812)|olfactory bulb development (GO:0021772)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of autophagy (GO:0010508)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of programmed cell death (GO:0043068)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein autoubiquitination (GO:1902499)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of kidney size (GO:0035564)|regulation of locomotion (GO:0040012)|regulation of membrane potential (GO:0042391)|regulation of mitochondrial depolarization (GO:0051900)|regulation of neuroblast proliferation (GO:1902692)|regulation of neuron death (GO:1901214)|regulation of neuron maturation (GO:0014041)|regulation of protein kinase A signaling (GO:0010738)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of synaptic vesicle exocytosis (GO:2000300)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic side of mitochondrial outer membrane (GO:0032473)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)|ATP binding (GO:0005524)|clathrin binding (GO:0030276)|glycoprotein binding (GO:0001948)|GTP binding (GO:0005525)|GTP-dependent protein kinase activity (GO:0034211)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|MAP kinase kinase activity (GO:0004708)|peroxidase inhibitor activity (GO:0036479)|protein homodimerization activity (GO:0042803)|protein kinase A binding (GO:0051018)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|tubulin binding (GO:0015631)	p.I1192T(2)		NS(3)|biliary_tract(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(23)|large_intestine(31)|lung(55)|ovary(15)|pancreas(2)|prostate(4)|skin(4)|stomach(9)|upper_aerodigestive_tract(7)|urinary_tract(2)	181	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				CCAGAAGCAATTTTAAATCTT	0.299																																																2	Substitution - Missense(2)	ovary(2)	12											73.0	84.0	80.0					12																	40696669		2201	4282	6483	38982936	SO:0001583	missense	120892			AK026776	CCDS31774.1	12q12	2011-07-21			ENSG00000188906	ENSG00000188906		"""Parkinson disease"""	18618	protein-coding gene	gene with protein product		609007	"""Parkinson disease (autosomal dominant) 8"""	PARK8		15541308	Standard	NM_198578		Approved	ROCO2, DKFZp434H2111, FLJ45829, RIPK7	uc001rmg.4	Q5S007	OTTHUMG00000059742	ENST00000298910.7:c.3575T>C	12.37:g.40696669T>C	ENSP00000298910:p.Ile1192Thr		38982936	A6NJU2|Q6ZS50|Q8NCX9	Missense_Mutation	SNP	ENST00000298910.7	37	CCDS31774.1	.	.	.	.	.	.	.	.	.	.	T	19.06	3.754795	0.69648	.	.	ENSG00000188906	ENST00000343742;ENST00000298910	T;T	0.56941	0.43;1.7	4.91	4.91	0.64330	.	0.055473	0.64402	D	0.000001	T	0.80325	0.4602	H	0.96943	3.91	0.51012	D	0.999904	D;D;D	0.89917	0.999;1.0;0.999	D;D;D	0.69307	0.919;0.963;0.919	D	0.85603	0.1253	10	0.41790	T	0.15	.	14.8678	0.70430	0.0:0.0:0.0:1.0	.	1192;1192;1192	Q17RV3;E9PC85;Q5S007	.;.;LRRK2_HUMAN	T	1192	ENSP00000341930:I1192T;ENSP00000298910:I1192T	ENSP00000298910:I1192T	I	+	2	0	LRRK2	38982936	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	6.524000	0.73791	1.981000	0.57761	0.533000	0.62120	ATT		0.299	LRRK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277179.1	XM_058513	
SHMT2	6472	broad.mit.edu	37	12	57627397	57627397	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chr12:57627397C>T	ENST00000328923.3	+	9	1527	c.1075C>T	c.(1075-1077)Cgg>Tgg	p.R359W	SHMT2_ENST00000449049.3_Missense_Mutation_p.R338W|SHMT2_ENST00000393827.4_Missense_Mutation_p.R263W|SHMT2_ENST00000553474.1_Missense_Mutation_p.R338W|SHMT2_ENST00000557487.1_Missense_Mutation_p.R349W|SHMT2_ENST00000414700.3_Missense_Mutation_p.R338W	NM_001166356.1|NM_005412.5	NP_001159828.1|NP_005403.2	P34897	GLYM_HUMAN	serine hydroxymethyltransferase 2 (mitochondrial)	359					glycine biosynthetic process from serine (GO:0019264)|L-serine biosynthetic process (GO:0006564)|one-carbon metabolic process (GO:0006730)|positive regulation of cell proliferation (GO:0008284)|protein homotetramerization (GO:0051289)|tetrahydrofolate interconversion (GO:0035999)	extracellular vesicular exosome (GO:0070062)|microtubule cytoskeleton (GO:0015630)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	amino acid binding (GO:0016597)|chromatin binding (GO:0003682)|glycine hydroxymethyltransferase activity (GO:0004372)|L-allo-threonine aldolase activity (GO:0008732)|pyridoxal phosphate binding (GO:0030170)	p.R359W(1)		breast(1)|central_nervous_system(1)|large_intestine(4)|liver(2)|lung(3)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	15					Glycine(DB00145)|Tetrahydrofolic acid(DB00116)	GAAGAATGCTCGGGCCATGGC	0.607																																					Esophageal Squamous(150;1369 2416 49071 49364)											1	Substitution - Missense(1)	ovary(1)	12											81.0	70.0	74.0					12																	57627397		2203	4300	6503	55913664	SO:0001583	missense	6472			AK223555	CCDS8934.1, CCDS53805.1, CCDS55837.1	12q12-q14	2006-03-27				ENSG00000182199	2.1.2.1		10852	protein-coding gene	gene with protein product		138450		SHMT		8999870	Standard	NM_005412		Approved		uc001snf.2	P34897		ENST00000328923.3:c.1075C>T	12.37:g.57627397C>T	ENSP00000333667:p.Arg359Trp		55913664	B7Z9F1|E7EQ19|E7EU43|O00740|Q8N1A5	Missense_Mutation	SNP	ENST00000328923.3	37	CCDS8934.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.20|19.20	3.780862|3.780862	0.70222|0.70222	.|.	.|.	ENSG00000182199|ENSG00000182199	ENST00000328923;ENST00000557487;ENST00000555634;ENST00000414700;ENST00000553474;ENST00000449049;ENST00000393827|ENST00000557529	T;T;T;T;T;T;T|.	0.49720|.	0.77;0.77;0.77;0.77;0.77;0.77;0.77|.	4.32|4.32	3.43|3.43	0.39272|0.39272	Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (1);Pyridoxal phosphate-dependent transferase, major domain (1);|.	0.341285|.	0.29515|.	N|.	0.011926|.	T|T	0.61615|0.61615	0.2361|0.2361	M|M	0.77103|0.77103	2.36|2.36	0.32725|0.32725	N|N	0.5098|0.5098	D;D;D;D;D|.	0.76494|.	0.998;0.97;0.999;0.998;0.97|.	P;P;P;P;P|.	0.61940|.	0.896;0.567;0.896;0.896;0.498|.	T|T	0.69472|0.69472	-0.5136|-0.5136	10|5	0.87932|.	D|.	0|.	-15.0817|-15.0817	8.5351|8.5351	0.33357|0.33357	0.0:0.8933:0.0:0.1067|0.0:0.8933:0.0:0.1067	.|.	368;349;263;290;359|.	B4DWA7;Q8N1A5;B4DLV4;B4DP88;P34897|.	.;.;.;.;GLYM_HUMAN|.	W|L	359;349;198;338;338;338;263|158	ENSP00000333667:R359W;ENSP00000452315:R349W;ENSP00000450930:R198W;ENSP00000406881:R338W;ENSP00000452419:R338W;ENSP00000413770:R338W;ENSP00000377413:R263W|.	ENSP00000333667:R359W|.	R|S	+|+	1|2	2|0	SHMT2|SHMT2	55913664|55913664	0.922000|0.922000	0.31269|0.31269	0.987000|0.987000	0.45799|0.45799	0.996000|0.996000	0.88848|0.88848	2.703000|2.703000	0.47110|0.47110	1.182000|1.182000	0.42928|0.42928	0.561000|0.561000	0.74099|0.74099	CGG|TCG		0.607	SHMT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412525.2	NM_005412	
TMTC2	160335	broad.mit.edu	37	12	83359496	83359496	+	Missense_Mutation	SNP	G	G	T			TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chr12:83359496G>T	ENST00000321196.3	+	6	2549	c.1842G>T	c.(1840-1842)aaG>aaT	p.K614N	TMTC2_ENST00000549919.1_Missense_Mutation_p.K608N|TMTC2_ENST00000548305.1_Missense_Mutation_p.K614N	NM_152588.1	NP_689801.1	Q8N394	TMTC2_HUMAN	transmembrane and tetratricopeptide repeat containing 2	614					calcium ion homeostasis (GO:0055074)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)		p.K614N(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(7)|lung(13)|ovary(2)|skin(1)|urinary_tract(1)	39						ACCTAGGAAAGCTGTATCATG	0.478																																																1	Substitution - Missense(1)	ovary(1)	12											123.0	116.0	118.0					12																	83359496		2203	4299	6502	81883627	SO:0001583	missense	160335			AK074634	CCDS9025.1	12q21.31	2014-06-09			ENSG00000179104	ENSG00000179104		"""Tetratricopeptide (TTC) repeat domain containing"""	25440	protein-coding gene	gene with protein product		615856				24764305	Standard	NM_152588		Approved	DKFZp762A217	uc001szt.3	Q8N394	OTTHUMG00000169736	ENST00000321196.3:c.1842G>T	12.37:g.83359496G>T	ENSP00000322300:p.Lys614Asn		81883627	B2RCU7|Q8N2K8	Missense_Mutation	SNP	ENST00000321196.3	37	CCDS9025.1	.	.	.	.	.	.	.	.	.	.	G	13.14	2.149420	0.37923	.	.	ENSG00000179104	ENST00000321196;ENST00000548305;ENST00000549919;ENST00000546590	D;D;D	0.93488	-3.23;-3.23;-3.23	5.07	-3.12	0.05282	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	D	0.85159	0.5633	N	0.01219	-0.95	0.53005	D	0.999964	D;D;D	0.69078	0.997;0.964;0.993	D;P;P	0.65874	0.939;0.775;0.865	T	0.79806	-0.1648	10	0.13853	T	0.58	-17.7458	11.2962	0.49280	0.5395:0.0:0.4605:0.0	.	614;369;614	Q8N394;F8VRQ2;F8VSH2	TMTC2_HUMAN;.;.	N	614;614;608;369	ENSP00000322300:K614N;ENSP00000448292:K614N;ENSP00000447609:K608N	ENSP00000322300:K614N	K	+	3	2	TMTC2	81883627	0.895000	0.30542	0.921000	0.36526	0.646000	0.38490	0.145000	0.16157	-0.498000	0.06632	-0.482000	0.04802	AAG		0.478	TMTC2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405663.1	NM_152588	
SCYL2	55681	broad.mit.edu	37	12	100720404	100720404	+	Missense_Mutation	SNP	G	G	A	rs199548769		TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chr12:100720404G>A	ENST00000360820.2	+	12	1951	c.1514G>A	c.(1513-1515)cGt>cAt	p.R505H		NM_017988.4	NP_060458.3	Q6P3W7	SCYL2_HUMAN	SCY1-like 2 (S. cerevisiae)	505					endosome to lysosome transport (GO:0008333)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of clathrin-mediated endocytosis (GO:2000370)|positive regulation of receptor internalization (GO:0002092)|receptor internalization involved in canonical Wnt signaling pathway (GO:2000286)	cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|receptor binding (GO:0005102)	p.R509H(1)		central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(4)|lung(15)|ovary(2)|skin(1)	41						TAATAGGTTCGTGTAAATTCA	0.279																																																1	Substitution - Missense(1)	ovary(1)	12											95.0	91.0	93.0					12																	100720404		2203	4299	6502	99244535	SO:0001583	missense	55681			AB037781	CCDS9076.1	12q23.1	2005-01-20				ENSG00000136021			19286	protein-coding gene	gene with protein product						10718198	Standard	NM_017988		Approved	KIAA1360	uc001thn.3	Q6P3W7	OTTHUMG00000170319	ENST00000360820.2:c.1514G>A	12.37:g.100720404G>A	ENSP00000354061:p.Arg505His		99244535	A8KAB5|Q96EF4|Q96ST4|Q9H7V5|Q9NVH3|Q9P2I7	Missense_Mutation	SNP	ENST00000360820.2	37	CCDS9076.1	.	.	.	.	.	.	.	.	.	.	G	34	5.323184	0.95708	.	.	ENSG00000136021	ENST00000549687;ENST00000360820	T;T	0.55052	0.54;0.54	5.38	5.38	0.77491	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.76976	0.4063	M	0.86178	2.8	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	T	0.80420	-0.1390	10	0.87932	D	0	.	19.497	0.95077	0.0:0.0:1.0:0.0	.	505	Q6P3W7	SCYL2_HUMAN	H	505	ENSP00000448366:R505H;ENSP00000354061:R505H	ENSP00000354061:R505H	R	+	2	0	SCYL2	99244535	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.672000	0.98629	2.677000	0.91161	0.563000	0.77884	CGT		0.279	SCYL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408493.2	NM_017988	
SSH1	54434	broad.mit.edu	37	12	109205075	109205075	+	Missense_Mutation	SNP	C	C	T	rs563965184		TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chr12:109205075C>T	ENST00000326495.5	-	6	524	c.431G>A	c.(430-432)cGa>cAa	p.R144Q	SSH1_ENST00000326470.5_Missense_Mutation_p.R155Q|SSH1_ENST00000551165.1_Missense_Mutation_p.R144Q|SSH1_ENST00000546812.1_5'UTR|SSH1_ENST00000360239.3_5'UTR	NM_018984.3	NP_061857.3	Q8WYL5	SSH1_HUMAN	slingshot protein phosphatase 1	144					actin cytoskeleton organization (GO:0030036)|cell morphogenesis (GO:0000902)|cellular response to ATP (GO:0071318)|protein dephosphorylation (GO:0006470)|regulation of actin polymerization or depolymerization (GO:0008064)|regulation of axonogenesis (GO:0050770)|regulation of cellular protein metabolic process (GO:0032268)|regulation of lamellipodium assembly (GO:0010591)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|DNA binding (GO:0003677)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.R144Q(1)		breast(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(8)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						GCTCCACAGTCGGAGAACCAT	0.498													C|||	1	0.000199681	0.0	0.0	5008	,	,		23865	0.0		0.0	False		,,,				2504	0.001															1	Substitution - Missense(1)	ovary(1)	12											173.0	142.0	152.0					12																	109205075		2203	4300	6503	107729204	SO:0001583	missense	54434			BC062341	CCDS9121.1, CCDS53825.1, CCDS55882.1	12q24.12	2013-03-05	2013-03-05			ENSG00000084112		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Slingshots"""	30579	protein-coding gene	gene with protein product		606778	"""slingshot homolog 1 (Drosophila)"""			10718198, 11832213	Standard	NM_018984		Approved	KIAA1298	uc001tnm.3	Q8WYL5	OTTHUMG00000169371	ENST00000326495.5:c.431G>A	12.37:g.109205075C>T	ENSP00000315713:p.Arg144Gln		107729204	Q6P6C0|Q8N9A7|Q8WYL3|Q8WYL4|Q9P2P8	Missense_Mutation	SNP	ENST00000326495.5	37	CCDS9121.1	.	.	.	.	.	.	.	.	.	.	C	23.7	4.450825	0.84209	.	.	ENSG00000084112	ENST00000326495;ENST00000551165;ENST00000326470;ENST00000546697	T;T;T;T	0.77358	0.51;0.51;0.51;-1.09	5.2	5.2	0.72013	.	0.117279	0.64402	D	0.000015	T	0.67031	0.2850	N	0.14661	0.345	0.80722	D	1	P;P;P	0.52577	0.883;0.928;0.954	B;P;B	0.46917	0.334;0.531;0.426	T	0.71708	-0.4511	10	0.62326	D	0.03	-12.0542	11.5568	0.50752	0.0:0.9183:0.0:0.0817	.	155;144;144	Q8WYL5-5;Q8WYL5-2;Q8WYL5	.;.;SSH1_HUMAN	Q	144;144;155;128	ENSP00000315713:R144Q;ENSP00000448824:R144Q;ENSP00000326107:R155Q;ENSP00000446652:R128Q	ENSP00000326107:R155Q	R	-	2	0	SSH1	107729204	1.000000	0.71417	0.764000	0.31436	0.822000	0.46500	3.584000	0.53936	2.577000	0.86979	0.655000	0.94253	CGA		0.498	SSH1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000403724.1	NM_018984	
TBX3	6926	broad.mit.edu	37	12	115120927	115120927	+	Missense_Mutation	SNP	C	C	A			TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chr12:115120927C>A	ENST00000257566.3	-	1	468	c.79G>T	c.(79-81)Gac>Tac	p.D27Y	TBX3_ENST00000349155.2_Missense_Mutation_p.D27Y	NM_016569.3	NP_057653.3	O15119	TBX3_HUMAN	T-box 3	27					anterior/posterior axis specification, embryo (GO:0008595)|atrioventricular bundle cell differentiation (GO:0003167)|blood vessel development (GO:0001568)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cardiac muscle cell fate commitment (GO:0060923)|cell aging (GO:0007569)|cellular senescence (GO:0090398)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|female genitalia development (GO:0030540)|follicle-stimulating hormone secretion (GO:0046884)|forelimb morphogenesis (GO:0035136)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|limbic system development (GO:0021761)|luteinizing hormone secretion (GO:0032275)|male genitalia development (GO:0030539)|mammary gland development (GO:0030879)|mammary placode formation (GO:0060596)|mesoderm morphogenesis (GO:0048332)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|organ morphogenesis (GO:0009887)|outflow tract morphogenesis (GO:0003151)|palate development (GO:0060021)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|sinoatrial node cell development (GO:0060931)|skeletal system development (GO:0001501)|specification of organ position (GO:0010159)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|ventricular septum morphogenesis (GO:0060412)	nucleus (GO:0005634)	RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.D27Y(1)		breast(5)|endometrium(1)|kidney(1)|large_intestine(6)|lung(21)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	Medulloblastoma(191;0.163)|all_neural(191;0.178)			BRCA - Breast invasive adenocarcinoma(302;0.0574)		ATGGCGAAGTCCGGCGCCCGG	0.701											OREG0022153	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	12											31.0	33.0	32.0					12																	115120927		2138	4234	6372	113605310	SO:0001583	missense	6926			BC025258	CCDS9175.1, CCDS9176.1	12q24.21	2013-09-05	2008-07-31		ENSG00000135111	ENSG00000135111		"""T-boxes"""	11602	protein-coding gene	gene with protein product		601621	"""ulnar mammary syndrome"""	UMS		8988164	Standard	NM_005996		Approved	TBX3-ISO, XHL	uc001tvt.1	O15119	OTTHUMG00000169586	ENST00000257566.3:c.79G>T	12.37:g.115120927C>A	ENSP00000257566:p.Asp27Tyr	1463	113605310	Q8TB20|Q9UKF8	Missense_Mutation	SNP	ENST00000257566.3	37	CCDS9176.1	.	.	.	.	.	.	.	.	.	.	C	26.4	4.737065	0.89482	.	.	ENSG00000135111	ENST00000349155;ENST00000257566;ENST00000361100	D;D	0.91124	-2.76;-2.79	4.93	4.93	0.64822	.	0.047616	0.85682	D	0.000000	D	0.94716	0.8295	M	0.66297	2.02	0.80722	D	1	P;D;D	0.89917	0.894;1.0;0.999	B;D;D	0.75484	0.446;0.986;0.915	D	0.95327	0.8426	10	0.87932	D	0	.	18.1546	0.89687	0.0:1.0:0.0:0.0	.	27;27;27	B4E3A6;O15119-2;O15119	.;.;TBX3_HUMAN	Y	27	ENSP00000257567:D27Y;ENSP00000257566:D27Y	ENSP00000257566:D27Y	D	-	1	0	TBX3	113605310	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	7.263000	0.78421	2.301000	0.77427	0.655000	0.94253	GAC		0.701	TBX3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000404947.2	NM_016569, NM_005996	
NBEA	26960	broad.mit.edu	37	13	35770278	35770278	+	Silent	SNP	T	T	C			TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chr13:35770278T>C	ENST00000400445.3	+	31	5739	c.5205T>C	c.(5203-5205)atT>atC	p.I1735I	NBEA_ENST00000379939.2_Silent_p.I1732I|NBEA_ENST00000540320.1_Silent_p.I1735I|NBEA_ENST00000310336.4_Silent_p.I1735I	NM_015678.4	NP_056493.3	Q8NFP9	NBEA_HUMAN	neurobeachin	1735					protein localization (GO:0008104)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)		p.I1735I(1)		NS(1)|breast(1)|endometrium(14)|kidney(4)|large_intestine(29)|lung(40)|ovary(9)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	108		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		TATCTAGCATTAGTCAAACCA	0.418																																																1	Substitution - coding silent(1)	ovary(1)	13											86.0	83.0	84.0					13																	35770278		1889	4148	6037	34668278	SO:0001819	synonymous_variant	26960			AF467288	CCDS45026.1, CCDS55894.1	13q13	2014-09-17			ENSG00000172915	ENSG00000172915		"""A-kinase anchor proteins"", ""WD repeat domain containing"""	7648	protein-coding gene	gene with protein product		604889				10501977	Standard	NM_015678		Approved	KIAA1544, BCL8B, FLJ10197	uc021ric.1	Q8NFP9	OTTHUMG00000016724	ENST00000400445.3:c.5205T>C	13.37:g.35770278T>C			34668278	B7Z2H9|Q5T320|Q9HCM8|Q9NSU1|Q9NW98|Q9Y6J1	Silent	SNP	ENST00000400445.3	37	CCDS45026.1																																																																																				0.418	NBEA-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_015678	
LRFN5	145581	broad.mit.edu	37	14	42361139	42361139	+	Missense_Mutation	SNP	C	C	T	rs369488450		TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chr14:42361139C>T	ENST00000298119.4	+	4	3261	c.2072C>T	c.(2071-2073)aCg>aTg	p.T691M	LRFN5_ENST00000554171.1_Intron|LRFN5_ENST00000554120.1_Intron	NM_152447.3	NP_689660.2	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III domain containing 5	691						integral component of membrane (GO:0016021)		p.T691M(1)|p.T691K(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(67)|ovary(5)|pancreas(3)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(2)	120			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)		GAGGGGCCCACGTCTAAAAGA	0.468										HNSCC(30;0.082)																																						2	Substitution - Missense(2)	ovary(1)|lung(1)	14											54.0	51.0	52.0					14																	42361139		2203	4300	6503	41430889	SO:0001583	missense	145581			AK055365	CCDS9678.1	14q21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000165379	ENSG00000165379		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	20360	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 8"""	612811	"""chromosome 14 open reading frame 146"""	C14orf146		16828986	Standard	NM_152447		Approved	FIGLER8, SALM5	uc001wvm.3	Q96NI6	OTTHUMG00000140261	ENST00000298119.4:c.2072C>T	14.37:g.42361139C>T	ENSP00000298119:p.Thr691Met		41430889	B3KU78|Q86XL2	Missense_Mutation	SNP	ENST00000298119.4	37	CCDS9678.1	.	.	.	.	.	.	.	.	.	.	C	7.256	0.604267	0.14002	.	.	ENSG00000165379	ENST00000298119	T	0.46819	0.86	5.69	3.86	0.44501	.	0.586689	0.16082	N	0.230480	T	0.24699	0.0599	N	0.08118	0	0.25603	N	0.986578	B	0.10296	0.003	B	0.04013	0.001	T	0.10590	-1.0623	10	0.30854	T	0.27	.	6.8618	0.24072	0.0:0.7381:0.0:0.2619	.	691	Q96NI6	LRFN5_HUMAN	M	691	ENSP00000298119:T691M	ENSP00000298119:T691M	T	+	2	0	LRFN5	41430889	0.023000	0.18921	0.858000	0.33744	0.535000	0.34838	1.837000	0.39201	1.413000	0.46997	0.650000	0.86243	ACG		0.468	LRFN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276786.1	NM_152447	
RYR3	6263	broad.mit.edu	37	15	33988678	33988678	+	Missense_Mutation	SNP	G	G	T			TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chr15:33988678G>T	ENST00000389232.4	+	39	6190	c.6120G>T	c.(6118-6120)atG>atT	p.M2040I	RYR3_ENST00000415757.3_Missense_Mutation_p.M2040I	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	2040	4 X approximate repeats.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)	p.M2040I(1)		NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		AGTTGCTCATGATCAATGGGC	0.512																																																1	Substitution - Missense(1)	ovary(1)	15											100.0	105.0	103.0					15																	33988678		2076	4217	6293	31775970	SO:0001583	missense	6263				CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.6120G>T	15.37:g.33988678G>T	ENSP00000373884:p.Met2040Ile		31775970	O15175|Q15412	Missense_Mutation	SNP	ENST00000389232.4	37	CCDS45210.1	.	.	.	.	.	.	.	.	.	.	G	24.9	4.583937	0.86748	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	T;T	0.63417	-0.04;0.22	4.84	4.84	0.62591	Intracellular calcium-release channel (1);	0.000000	0.85682	D	0.000000	T	0.73048	0.3537	L	0.41824	1.3	0.80722	D	1	B;D	0.71674	0.119;0.998	B;D	0.85130	0.097;0.997	T	0.73672	-0.3909	10	0.51188	T	0.08	.	18.4937	0.90856	0.0:0.0:1.0:0.0	.	2040;2040	Q15413-2;Q15413	.;RYR3_HUMAN	I	2040	ENSP00000373884:M2040I;ENSP00000399610:M2040I	ENSP00000354735:M2040I	M	+	3	0	RYR3	31775970	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	9.601000	0.98297	2.670000	0.90874	0.650000	0.86243	ATG		0.512	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1		
EHD4	30844	broad.mit.edu	37	15	42192955	42192955	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chr15:42192955G>A	ENST00000220325.4	-	6	1597	c.1514C>T	c.(1513-1515)gCg>gTg	p.A505V	RP11-23P13.6_ENST00000564432.2_RNA	NM_139265.3	NP_644670.1	Q9H223	EHD4_HUMAN	EH-domain containing 4	505	EF-hand. {ECO:0000255|PROSITE- ProRule:PRU00448}.|EH. {ECO:0000255|PROSITE- ProRule:PRU00077}.				cellular response to growth factor stimulus (GO:0071363)|endocytic recycling (GO:0032456)|pinocytosis (GO:0006907)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|protein homooligomerization (GO:0051260)|regulation of endocytosis (GO:0030100)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|nucleic acid binding (GO:0003676)	p.A505V(1)		NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(7)|ovary(2)|stomach(1)|urinary_tract(1)	20		all_cancers(109;2.54e-12)|all_epithelial(112;6.59e-11)|Lung NSC(122;2.17e-07)|all_lung(180;8.79e-07)|Melanoma(134;0.091)		OV - Ovarian serous cystadenocarcinoma(18;1.6e-19)|GBM - Glioblastoma multiforme(94;3.77e-06)|COAD - Colon adenocarcinoma(120;0.0474)|Colorectal(105;0.0538)		CTTGGCCAGCGCGAACTCCTC	0.642																																																1	Substitution - Missense(1)	ovary(1)	15											59.0	52.0	54.0					15																	42192955		2203	4299	6502	39980247	SO:0001583	missense	30844			AF181265	CCDS10081.1	15q11.1	2013-01-10			ENSG00000103966	ENSG00000103966		"""EF-hand domain containing"""	3245	protein-coding gene	gene with protein product		605892		PAST4		10673336, 11533061	Standard	NM_139265		Approved		uc001zot.3	Q9H223	OTTHUMG00000130370	ENST00000220325.4:c.1514C>T	15.37:g.42192955G>A	ENSP00000220325:p.Ala505Val		39980247	Q9HAR1|Q9NZN2	Missense_Mutation	SNP	ENST00000220325.4	37	CCDS10081.1	.	.	.	.	.	.	.	.	.	.	G	32	5.145275	0.94603	.	.	ENSG00000103966	ENST00000220325	T	0.28255	1.62	4.83	4.83	0.62350	EPS15 homology (EH) (2);EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	T	0.39279	0.1072	M	0.76838	2.35	0.80722	D	1	D	0.60575	0.988	B	0.42282	0.382	T	0.48536	-0.9027	10	0.40728	T	0.16	-10.6941	18.2861	0.90114	0.0:0.0:1.0:0.0	.	505	Q9H223	EHD4_HUMAN	V	505	ENSP00000220325:A505V	ENSP00000220325:A505V	A	-	2	0	EHD4	39980247	1.000000	0.71417	0.880000	0.34516	0.833000	0.47200	9.792000	0.99085	2.394000	0.81467	0.543000	0.68304	GCG		0.642	EHD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252737.2	NM_139265	
CORO2B	10391	broad.mit.edu	37	15	69011074	69011074	+	Missense_Mutation	SNP	C	C	G	rs143009182		TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chr15:69011074C>G	ENST00000566799.1	+	9	1034	c.1005C>G	c.(1003-1005)tgC>tgG	p.C335W	CORO2B_ENST00000540068.1_Missense_Mutation_p.C330W|CORO2B_ENST00000261861.5_Missense_Mutation_p.C330W|CORO2B_ENST00000543950.1_Missense_Mutation_p.C330W			Q9UQ03	COR2B_HUMAN	coronin, actin binding protein, 2B	335					actin cytoskeleton organization (GO:0030036)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|membrane (GO:0016020)	actin binding (GO:0003779)|actin filament binding (GO:0051015)	p.C335W(1)		kidney(3)|large_intestine(13)|lung(11)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	36						TGTCAGCCTGCGAGGTGTTCC	0.612																																																1	Substitution - Missense(1)	ovary(1)	15											88.0	65.0	73.0					15																	69011074		2200	4298	6498	66798128	SO:0001583	missense	10391			AB010098	CCDS53952.1, CCDS10229.2	15q22.31	2013-01-10	2001-11-28		ENSG00000103647	ENSG00000103647		"""Coronins"", ""WD repeat domain containing"""	2256	protein-coding gene	gene with protein product	"""clipin C"", ""coronin, actin-binding, 2B"""	605002	"""coronin, actin-binding protein, 2B"""			10224093, 10231032	Standard	NM_001190456		Approved	ClipinC, KIAA0925	uc021spj.1	Q9UQ03	OTTHUMG00000133288	ENST00000566799.1:c.1005C>G	15.37:g.69011074C>G	ENSP00000454783:p.Cys335Trp		66798128	A8K0W3|O94767|Q8TAN1	Missense_Mutation	SNP	ENST00000566799.1	37	CCDS10229.2	.	.	.	.	.	.	.	.	.	.	C	16.75	3.210130	0.58343	.	.	ENSG00000103647	ENST00000261861;ENST00000540068;ENST00000543950	T;T	0.35421	1.31;1.31	5.34	1.96	0.26148	Domain of unknown function DUF1900 (1);	0.043362	0.85682	D	0.000000	T	0.66548	0.2800	H	0.95982	3.75	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.69386	-0.5159	10	0.87932	D	0	-25.5521	7.5336	0.27697	0.0:0.5855:0.0:0.4145	.	335	Q9UQ03	COR2B_HUMAN	W	335;330;330	ENSP00000446250:C330W;ENSP00000443819:C330W	ENSP00000261861:C335W	C	+	3	2	CORO2B	66798128	0.036000	0.19791	1.000000	0.80357	0.995000	0.86356	-0.869000	0.04232	0.646000	0.30693	0.460000	0.39030	TGC		0.612	CORO2B-203	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_006091	
POLG	5428	broad.mit.edu	37	15	89865200	89865200	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chr15:89865200C>T	ENST00000268124.5	-	15	2806	c.2473G>A	c.(2473-2475)Gtg>Atg	p.V825M	POLG_ENST00000442287.2_Missense_Mutation_p.V825M	NM_001126131.1|NM_002693.2	NP_001119603.1|NP_002684.1	P54098	DPOG1_HUMAN	polymerase (DNA directed), gamma	825					aging (GO:0007568)|base-excision repair, gap-filling (GO:0006287)|cell death (GO:0008219)|DNA metabolic process (GO:0006259)|DNA-dependent DNA replication (GO:0006261)|mitochondrial DNA replication (GO:0006264)	extracellular vesicular exosome (GO:0070062)|gamma DNA polymerase complex (GO:0005760)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|exonuclease activity (GO:0004527)|protease binding (GO:0002020)	p.V825M(1)		breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(3)|urinary_tract(2)	33	Lung NSC(78;0.0472)|all_lung(78;0.089)		STAD - Stomach adenocarcinoma(125;0.165)			TACCTGATCACAGCACGGGGC	0.567								DNA polymerases (catalytic subunits)																													Colon(73;648 1203 11348 18386 27782)											1	Substitution - Missense(1)	ovary(1)	15											123.0	104.0	111.0					15																	89865200		2200	4299	6499	87666204	SO:0001583	missense	5428			X98093	CCDS10350.1	15q24	2014-09-17			ENSG00000140521	ENSG00000140521		"""DNA polymerases"""	9179	protein-coding gene	gene with protein product		174763				9465903	Standard	NM_002693		Approved	POLG1, POLGA	uc002bnr.4	P54098	OTTHUMG00000149646	ENST00000268124.5:c.2473G>A	15.37:g.89865200C>T	ENSP00000268124:p.Val825Met		87666204	Q8NFM2|Q92515	Missense_Mutation	SNP	ENST00000268124.5	37	CCDS10350.1	.	.	.	.	.	.	.	.	.	.	C	23.7	4.448899	0.84101	.	.	ENSG00000140521	ENST00000268124;ENST00000442287	D;D	0.96992	-4.2;-4.2	5.37	5.37	0.77165	DNA-directed DNA polymerase, family A, palm domain (1);	0.116470	0.64402	D	0.000016	D	0.97639	0.9226	M	0.77103	2.36	0.58432	D	0.999999	D	0.76494	0.999	D	0.71414	0.973	D	0.97722	1.0197	10	0.62326	D	0.03	-26.845	12.4538	0.55691	0.0:0.9231:0.0:0.0769	.	825	P54098	DPOG1_HUMAN	M	825	ENSP00000268124:V825M;ENSP00000399851:V825M	ENSP00000268124:V825M	V	-	1	0	POLG	87666204	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	5.370000	0.66144	2.529000	0.85273	0.561000	0.74099	GTG		0.567	POLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000312854.2	NM_002693	
SYNM	23336	broad.mit.edu	37	15	99653864	99653864	+	Silent	SNP	C	C	T			TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chr15:99653864C>T	ENST00000560674.1	+	2	490	c.21C>T	c.(19-21)gaC>gaT	p.D7D	SYNM_ENST00000328642.7_Silent_p.D292D|SYNM_ENST00000336292.6_Silent_p.D292D|SYNM_ENST00000561323.1_3'UTR			O15061	SYNEM_HUMAN	synemin, intermediate filament protein	293	Head.				intermediate filament cytoskeleton organization (GO:0045104)	adherens junction (GO:0005912)|costamere (GO:0043034)|intermediate filament (GO:0005882)|membrane (GO:0016020)|neurofilament cytoskeleton (GO:0060053)	intermediate filament binding (GO:0019215)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)	p.D292D(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(8)|lung(6)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	29						GGCTGCGGGACTATCAGGACC	0.552																																					Pancreas(125;1071 1762 21750 40003 40381)											1	Substitution - coding silent(1)	ovary(1)	15											44.0	50.0	48.0					15																	99653864		2170	4270	6440	97471387	SO:0001819	synonymous_variant	23336			AK026420	CCDS73786.1, CCDS73787.1	15q26.3	2014-09-17	2008-09-19	2008-09-19	ENSG00000182253	ENSG00000182253		"""A-kinase anchor proteins"", ""Intermediate filaments type IV"""	24466	protein-coding gene	gene with protein product	"""synemin alpha"", ""synemin beta"""	606087	"""desmuslin"""	DMN		11737198, 11454237	Standard	NM_145728		Approved	KIAA0353, SYN	uc002bup.3	O15061		ENST00000560674.1:c.21C>T	15.37:g.99653864C>T			97471387	A7E2Y2|Q2TBJ4|Q5NJJ9|Q8TE61|Q8TE62	Silent	SNP	ENST00000560674.1	37																																																																																					0.552	SYNM-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000415698.2	NM_145728	
POLR3E	55718	broad.mit.edu	37	16	22327994	22327994	+	Missense_Mutation	SNP	G	G	C			TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chr16:22327994G>C	ENST00000299853.5	+	10	882	c.715G>C	c.(715-717)Gtc>Ctc	p.V239L	POLR3E_ENST00000564209.1_Missense_Mutation_p.V239L|POLR3E_ENST00000418581.2_Missense_Mutation_p.V203L|POLR3E_ENST00000359210.4_Missense_Mutation_p.V239L	NM_001258033.1|NM_001258035.1|NM_018119.3	NP_001244962.1|NP_001244964.1|NP_060589.1	Q9NVU0	RPC5_HUMAN	polymerase (RNA) III (DNA directed) polypeptide E (80kD)	239					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)	centrosome (GO:0005813)|cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA-directed RNA polymerase activity (GO:0003899)	p.V239L(1)		central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27				GBM - Glioblastoma multiforme(48;0.012)		CACGGAGCTCGTCAAGTCACC	0.642																																																1	Substitution - Missense(1)	ovary(1)	16											51.0	45.0	47.0					16																	22327994		2197	4300	6497	22235495	SO:0001583	missense	55718			AY092085	CCDS10605.1, CCDS58432.1, CCDS58433.1, CCDS58434.1, CCDS73845.1	16p12	2013-01-21			ENSG00000058600	ENSG00000058600		"""RNA polymerase subunits"""	30347	protein-coding gene	gene with protein product						10819331, 10521666	Standard	NM_018119		Approved	RPC5, SIN, FLJ10509	uc002dkk.4	Q9NVU0	OTTHUMG00000094779	ENST00000299853.5:c.715G>C	16.37:g.22327994G>C	ENSP00000299853:p.Val239Leu		22235495	B4DL24|B4DUP6|H3BT11|Q9BWF7|Q9H8W8|Q9H907|Q9P276	Missense_Mutation	SNP	ENST00000299853.5	37	CCDS10605.1	.	.	.	.	.	.	.	.	.	.	G	11.67	1.708677	0.30322	.	.	ENSG00000058600	ENST00000299853;ENST00000359210;ENST00000418581	T;T;T	0.42513	0.97;0.97;0.97	5.23	-1.06	0.10002	.	0.382752	0.28470	N	0.015227	T	0.32645	0.0836	L	0.44542	1.39	0.35085	D	0.763782	B;B;B;B;B;B	0.25169	0.119;0.062;0.036;0.023;0.036;0.079	B;B;B;B;B;B	0.30105	0.111;0.07;0.07;0.026;0.07;0.076	T	0.33137	-0.9880	10	0.56958	D	0.05	-11.1641	9.6214	0.39723	0.7842:0.0:0.2158:0.0	.	183;203;239;239;239;239	B4DDR0;B4DL24;B4DUP6;Q9NVU0-2;Q9NVU0;Q9NVU0-3	.;.;.;.;RPC5_HUMAN;.	L	239;239;203	ENSP00000299853:V239L;ENSP00000352140:V239L;ENSP00000399254:V203L	ENSP00000299853:V239L	V	+	1	0	POLR3E	22235495	0.899000	0.30636	0.301000	0.25044	0.919000	0.55068	1.514000	0.35834	-0.055000	0.13244	0.563000	0.77884	GTC		0.642	POLR3E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211590.1	NM_018119	
PER1	5187	broad.mit.edu	37	17	8049358	8049358	+	Silent	SNP	C	C	A			TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chr17:8049358C>A	ENST00000317276.4	-	17	2373	c.2136G>T	c.(2134-2136)gcG>gcT	p.A712A	PER1_ENST00000578089.1_5'UTR|PER1_ENST00000581082.1_Silent_p.A692A|PER1_ENST00000354903.5_Silent_p.A696A	NM_002616.2	NP_002607.2	O15534	PER1_HUMAN	period circadian clock 1	712	Required for phosphorylation by CSNK1E. {ECO:0000250}.				circadian regulation of gene expression (GO:0032922)|circadian regulation of translation (GO:0097167)|circadian rhythm (GO:0007623)|entrainment of circadian clock (GO:0009649)|entrainment of circadian clock by photoperiod (GO:0043153)|histone H3 acetylation (GO:0043966)|histone H3 deacetylation (GO:0070932)|histone H4 acetylation (GO:0043967)|negative regulation of glucocorticoid receptor signaling pathway (GO:2000323)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|posttranscriptional regulation of gene expression (GO:0010608)|regulation of circadian rhythm (GO:0042752)|regulation of cytokine production involved in inflammatory response (GO:1900015)|regulation of hair cycle (GO:0042634)|regulation of p38MAPK cascade (GO:1900744)|regulation of sodium ion transport (GO:0002028)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|E-box binding (GO:0070888)|kinase binding (GO:0019900)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|signal transducer activity (GO:0004871)|transcription factor binding transcription factor activity (GO:0000989)|ubiquitin protein ligase binding (GO:0031625)	p.A712A(1)		breast(4)|central_nervous_system(1)|endometrium(2)|kidney(7)|large_intestine(3)|lung(15)|ovary(4)|pancreas(1)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	47						CCACACTCTCCGCCTTATTGG	0.647			T	ETV6	"""AML, CMML"""			Other conserved DNA damage response genes																															Dom	yes		17	17p13.1-17p12	5187	period homolog 1 (Drosophila)		L	1	Substitution - coding silent(1)	ovary(1)	17											71.0	64.0	66.0					17																	8049358		2203	4300	6503	7990083	SO:0001819	synonymous_variant	5187			AB002107	CCDS11131.1	17p13.1	2012-12-13	2012-12-13			ENSG00000179094			8845	protein-coding gene	gene with protein product		602260	"""period (Drosophila) homolog 1"", ""period homolog 1 (Drosophila)"""	PER		9323128	Standard	NM_002616		Approved	RIGUI	uc002gkd.3	O15534		ENST00000317276.4:c.2136G>T	17.37:g.8049358C>A			7990083	B2RPA8|B4DI49|D3DTR3	Silent	SNP	ENST00000317276.4	37	CCDS11131.1																																																																																				0.647	PER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441481.2		
MYO15A	51168	broad.mit.edu	37	17	18063311	18063311	+	Silent	SNP	A	A	C			TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	A	A	C	C	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chr17:18063311A>C	ENST00000205890.5	+	56	9704	c.9366A>C	c.(9364-9366)acA>acC	p.T3122T	MYO15A_ENST00000418233.3_Silent_p.T386T|MYO15A_ENST00000451725.2_Silent_p.T14T	NM_016239.3	NP_057323.3	Q9UKN7	MYO15_HUMAN	myosin XVA	3122	MyTH4 2. {ECO:0000255|PROSITE- ProRule:PRU00359}.|Tail.				inner ear morphogenesis (GO:0042472)|locomotory behavior (GO:0007626)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|stereocilium (GO:0032420)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.T3122T(1)		breast(5)|central_nervous_system(2)|endometrium(17)|kidney(3)|large_intestine(16)|lung(27)|ovary(3)|pancreas(1)|prostate(6)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	99	all_neural(463;0.228)					AGCAGATCACAGACAATACCA	0.552																																																1	Substitution - coding silent(1)	ovary(1)	17											111.0	113.0	112.0					17																	18063311		2120	4235	6355	18004036	SO:0001819	synonymous_variant	51168			AF144094	CCDS42271.1	17p11.2	2011-09-27			ENSG00000091536	ENSG00000091536		"""Myosins / Myosin superfamily : Class XV"""	7594	protein-coding gene	gene with protein product		602666		DFNB3, MYO15		9603736	Standard	NM_016239		Approved		uc021trl.1	Q9UKN7	OTTHUMG00000059390	ENST00000205890.5:c.9366A>C	17.37:g.18063311A>C			18004036	B4DFC7	Silent	SNP	ENST00000205890.5	37	CCDS42271.1																																																																																				0.552	MYO15A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132048.1	NM_016239	
RHBDL3	162494	broad.mit.edu	37	17	30632388	30632388	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chr17:30632388G>A	ENST00000269051.4	+	7	824	c.810G>A	c.(808-810)atG>atA	p.M270I	RHBDL3_ENST00000536287.1_Missense_Mutation_p.M172I|RHBDL3_ENST00000538145.1_Missense_Mutation_p.M262I	NM_138328.2	NP_612201.1	P58872	RHBL3_HUMAN	rhomboid, veinlet-like 3 (Drosophila)	270						integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|serine-type endopeptidase activity (GO:0004252)	p.M270I(1)		breast(1)|endometrium(1)|large_intestine(5)|lung(5)|ovary(1)|prostate(2)|skin(1)	16		Breast(31;0.116)|Ovarian(249;0.182)				TGGCTGACATGACCGCTCCAG	0.582																																																1	Substitution - Missense(1)	ovary(1)	17											171.0	137.0	148.0					17																	30632388		2203	4300	6503	27656501	SO:0001583	missense	162494			AJ313480	CCDS32613.1	17q11.2	2013-01-10				ENSG00000141314		"""EF-hand domain containing"""	16502	protein-coding gene	gene with protein product			"""rhomboid, veinlet-like 4 (Drosophila)"""	RHBDL4		11900977	Standard	XM_006721733		Approved	VRHO	uc002hhe.1	P58872		ENST00000269051.4:c.810G>A	17.37:g.30632388G>A	ENSP00000269051:p.Met270Ile		27656501	A6NMH1|Q495Y4|Q495Y5|Q495Y6	Missense_Mutation	SNP	ENST00000269051.4	37	CCDS32613.1	.	.	.	.	.	.	.	.	.	.	G	29.7	5.032515	0.93575	.	.	ENSG00000141314	ENST00000269051;ENST00000538145;ENST00000536287	T;T;T	0.11277	2.79;2.79;2.79	6.02	6.02	0.97574	Peptidase S54, rhomboid domain (1);	0.000000	0.85682	D	0.000000	T	0.21427	0.0516	N	0.19112	0.55	0.80722	D	1	D;D	0.57571	0.98;0.98	D;D	0.75020	0.985;0.985	T	0.01185	-1.1425	10	0.51188	T	0.08	.	18.3103	0.90197	0.0:0.0:1.0:0.0	.	262;270	Q495Y5;P58872	.;RHBL3_HUMAN	I	270;262;172	ENSP00000269051:M270I;ENSP00000442092:M262I;ENSP00000466508:M172I	ENSP00000269051:M270I	M	+	3	0	RHBDL3	27656501	1.000000	0.71417	1.000000	0.80357	0.900000	0.52787	8.600000	0.90860	2.857000	0.98124	0.650000	0.86243	ATG		0.582	RHBDL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000447120.1	NM_138328	
SLFN13	146857	broad.mit.edu	37	17	33770904	33770904	+	Nonsense_Mutation	SNP	G	G	A			TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chr17:33770904G>A	ENST00000285013.6	-	4	1377	c.1102C>T	c.(1102-1104)Cag>Tag	p.Q368*	SLFN13_ENST00000533791.1_Nonsense_Mutation_p.Q368*|SLFN13_ENST00000534689.1_Nonsense_Mutation_p.Q50*|SLFN13_ENST00000542635.1_Nonsense_Mutation_p.Q368*|SLFN13_ENST00000360502.2_Nonsense_Mutation_p.Q50*|SLFN13_ENST00000526861.1_Nonsense_Mutation_p.Q368*	NM_144682.5	NP_653283.3	Q68D06	SLN13_HUMAN	schlafen family member 13	368						intracellular (GO:0005622)	ATP binding (GO:0005524)	p.Q368*(2)		NS(1)|breast(1)|endometrium(1)|large_intestine(10)|lung(8)|ovary(3)|pancreas(1)|prostate(5)|stomach(1)	31				UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)		AGACTCAACTGAGACTCAAAG	0.388																																																2	Substitution - Nonsense(2)	ovary(1)|lung(1)	17											85.0	81.0	82.0					17																	33770904		2203	4300	6503	30795017	SO:0001587	stop_gained	146857			AL832726	CCDS32620.1	17q12	2006-04-05				ENSG00000154760			26481	protein-coding gene	gene with protein product		614957				9846487	Standard	NM_144682		Approved	FLJ31952	uc002hjl.2	Q68D06		ENST00000285013.6:c.1102C>T	17.37:g.33770904G>A	ENSP00000285013:p.Gln368*		30795017	E1P645|Q658M1|Q6ZS51|Q96A81	Nonsense_Mutation	SNP	ENST00000285013.6	37	CCDS32620.1	.	.	.	.	.	.	.	.	.	.	g	38	6.735089	0.97801	.	.	ENSG00000154760	ENST00000285013;ENST00000360502;ENST00000526861;ENST00000542635;ENST00000534689;ENST00000532210	.	.	.	3.4	3.4	0.38934	.	0.000000	0.43260	D	0.000589	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.20519	T	0.43	.	10.4397	0.44457	0.0:0.0:1.0:0.0	.	.	.	.	X	368;50;368;368;50;37	.	ENSP00000285013:Q368X	Q	-	1	0	SLFN13	30795017	0.040000	0.19996	0.987000	0.45799	0.106000	0.19336	2.747000	0.47475	1.878000	0.54408	0.514000	0.50259	CAG		0.388	SLFN13-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381883.1	NM_144682	
CARD14	79092	broad.mit.edu	37	17	78172297	78172297	+	Silent	SNP	C	C	T	rs143677083		TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chr17:78172297C>T	ENST00000573882.1	+	15	2294	c.1758C>T	c.(1756-1758)atC>atT	p.I586I	CARD14_ENST00000573754.1_3'UTR|CARD14_ENST00000344227.2_Silent_p.I586I|CARD14_ENST00000392434.2_Silent_p.I349I|RP11-334C17.5_ENST00000570309.1_RNA|CARD14_ENST00000570421.1_Silent_p.I586I			Q9BXL6	CAR14_HUMAN	caspase recruitment domain family, member 14	586	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				activation of NF-kappaB-inducing kinase activity (GO:0007250)|apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein phosphorylation (GO:0001934)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	CARD domain binding (GO:0050700)	p.I586I(1)		NS(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(11)|ovary(5)|prostate(1)|skin(1)	23	all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.017)|BRCA - Breast invasive adenocarcinoma(99;0.0908)			TCAGCGTCATCGGCGGGAACC	0.682													C|||	1	0.000199681	0.0008	0.0	5008	,	,		15993	0.0		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	17						C	,	0,4406		0,0,2203	58.0	57.0	58.0		1758,1047	-4.9	0.1	17	dbSNP_134	58	1,8595	1.2+/-3.3	0,1,4297	no	coding-synonymous,coding-synonymous	CARD14	NM_024110.3,NM_052819.2	,	0,1,6500	TT,TC,CC		0.0116,0.0,0.0077	,	586/1005,349/435	78172297	1,13001	2203	4298	6501	75786892	SO:0001819	synonymous_variant	79092			AF322642	CCDS11768.1, CCDS58605.1	17q25.3	2014-09-04			ENSG00000141527	ENSG00000141527			16446	protein-coding gene	gene with protein product		607211	"""psoriasis susceptibility 2"""	PSORS2		11278692, 11356195, 22521418	Standard	NM_052819		Approved	CARMA2, BIMP2	uc031res.1	Q9BXL6	OTTHUMG00000177549	ENST00000573882.1:c.1758C>T	17.37:g.78172297C>T			75786892	B8QQJ3|Q9BVB5	Silent	SNP	ENST00000573882.1	37	CCDS11768.1																																																																																				0.682	CARD14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437507.1		
ONECUT2	9480	broad.mit.edu	37	18	55143752	55143752	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chr18:55143752C>T	ENST00000491143.2	+	2	1344	c.1312C>T	c.(1312-1314)Cgc>Tgc	p.R438C		NM_004852.2	NP_004843.2	O95948	ONEC2_HUMAN	one cut homeobox 2	438					cell fate commitment (GO:0045165)|cilium assembly (GO:0042384)|endocrine pancreas development (GO:0031018)|epithelial cell development (GO:0002064)|liver development (GO:0001889)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|organ morphogenesis (GO:0009887)|peripheral nervous system neuron development (GO:0048935)|positive regulation of cell migration (GO:0030335)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell-matrix adhesion (GO:0001952)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.R438C(1)		breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|lung(4)|ovary(2)|skin(1)	15		Colorectal(73;0.234)		READ - Rectum adenocarcinoma(59;0.227)|Colorectal(16;0.245)		TGACCTCCAACGCCGAACACT	0.522																																																1	Substitution - Missense(1)	ovary(1)	18											59.0	65.0	63.0					18																	55143752		2048	4204	6252	53294750	SO:0001583	missense	9480			Y18198	CCDS42440.1	18q21.31	2012-03-09	2007-07-16		ENSG00000119547	ENSG00000119547		"""Homeoboxes / CUT class"""	8139	protein-coding gene	gene with protein product		604894	"""one cut domain, family member 2"""			9915796	Standard	NM_004852		Approved	OC-2	uc002lgo.3	O95948	OTTHUMG00000159776	ENST00000491143.2:c.1312C>T	18.37:g.55143752C>T	ENSP00000419185:p.Arg438Cys		53294750		Missense_Mutation	SNP	ENST00000491143.2	37	CCDS42440.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	23.0|23.0	4.367422|4.367422	0.82463|0.82463	.|.	.|.	ENSG00000119547|ENSG00000119547	ENST00000491143;ENST00000262095|ENST00000481727	.|.	.|.	.|.	6.02|6.02	6.02|6.02	0.97574|0.97574	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.83880|0.83880	0.5350|0.5350	M|M	0.90814|0.90814	3.15|3.15	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.85130|.	0.997|.	D|D	0.86205|0.86205	0.1621|0.1621	9|5	0.87932|.	D|.	0|.	-20.6886|-20.6886	14.919|14.919	0.70822|0.70822	0.1432:0.8568:0.0:0.0|0.1432:0.8568:0.0:0.0	.|.	438|.	O95948|.	ONEC2_HUMAN|.	C|M	419;438|66	.|.	ENSP00000262095:R438C|.	R|T	+|+	1|2	0|0	ONECUT2|ONECUT2	53294750|53294750	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	7.487000|7.487000	0.81328|0.81328	2.857000|2.857000	0.98124|0.98124	0.650000|0.650000	0.86243|0.86243	CGC|ACG		0.522	ONECUT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357264.3		
SERPINB4	6318	broad.mit.edu	37	18	61310657	61310657	+	Missense_Mutation	SNP	T	T	G			TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	T	T	G	G	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chr18:61310657T>G	ENST00000341074.5	-	2	270	c.155A>C	c.(154-156)cAa>cCa	p.Q52P	SERPINB4_ENST00000356424.6_Missense_Mutation_p.Q52P	NM_002974.2	NP_002965.1	P48594	SPB4_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 4	52					negative regulation of endopeptidase activity (GO:0010951)|negative regulation of peptidase activity (GO:0010466)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	enzyme binding (GO:0019899)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.Q52P(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(22)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	42						CTTGCTAATTTGTTGTGCAGT	0.438																																																1	Substitution - Missense(1)	ovary(1)	18											297.0	260.0	273.0					18																	61310657		2203	4300	6503	59461637	SO:0001583	missense	6318			X89015	CCDS11986.1	18q21.33	2014-02-18	2005-08-18		ENSG00000206073	ENSG00000206073		"""Serine (or cysteine) peptidase inhibitors"""	10570	protein-coding gene	gene with protein product	"""squamous cell carcinoma antigen 2"""	600518	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 4"""	SCCA2		7724531, 14630915, 24172014	Standard	NM_175041		Approved	PI11, LEUPIN, SCCA-2, SCCA1		P48594	OTTHUMG00000060405	ENST00000341074.5:c.155A>C	18.37:g.61310657T>G	ENSP00000343445:p.Gln52Pro		59461637	A8K847	Missense_Mutation	SNP	ENST00000341074.5	37	CCDS11986.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	15.59|15.59	2.878976|2.878976	0.51801|0.51801	.|.	.|.	ENSG00000206073|ENSG00000206073	ENST00000413673|ENST00000341074;ENST00000356424;ENST00000436264	.|D;D;D	.|0.85955	.|-2.05;-2.05;-2.05	3.83|3.83	3.83|3.83	0.44106|0.44106	.|Serpin domain (3);	.|0.379952	.|0.19193	.|N	.|0.120385	D|D	0.94417|0.94417	0.8204|0.8204	H|H	0.96633|0.96633	3.855|3.855	0.09310|0.09310	N|N	1|1	.|D;D	.|0.63880	.|0.993;0.99	.|D;D	.|0.72338	.|0.977;0.953	D|D	0.87699|0.87699	0.2559|0.2559	5|10	.|0.87932	.|D	.|0	.|.	12.27|12.27	0.54700|0.54700	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|52;52	.|P48594;Q9BYF7	.|SPB4_HUMAN;.	Q|P	54|52	.|ENSP00000343445:Q52P;ENSP00000348795:Q52P;ENSP00000399796:Q52P	.|ENSP00000343445:Q52P	K|Q	-|-	1|2	0|0	SERPINB4|SERPINB4	59461637|59461637	0.991000|0.991000	0.36638|0.36638	0.002000|0.002000	0.10522|0.10522	0.004000|0.004000	0.04260|0.04260	6.322000|6.322000	0.72886|0.72886	1.728000|1.728000	0.51552|0.51552	0.416000|0.416000	0.27883|0.27883	AAA|CAA		0.438	SERPINB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133794.2	NM_175041	
MUC16	94025	broad.mit.edu	37	19	9077660	9077660	+	Silent	SNP	C	C	A			TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chr19:9077660C>A	ENST00000397910.4	-	3	9989	c.9786G>T	c.(9784-9786)ctG>ctT	p.L3262L		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	3263	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.L3262L(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TTCCTGTGGGCAGGTGAGAGA	0.547																																																1	Substitution - coding silent(1)	ovary(1)	19											118.0	122.0	121.0					19																	9077660		2138	4231	6369	8938660	SO:0001819	synonymous_variant	94025			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.9786G>T	19.37:g.9077660C>A			8938660	Q6ZQW5|Q96RK2	Silent	SNP	ENST00000397910.4	37	CCDS54212.1																																																																																				0.547	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
ZNF208	7757	broad.mit.edu	37	19	22154440	22154440	+	Missense_Mutation	SNP	C	C	A			TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chr19:22154440C>A	ENST00000397126.4	-	4	3544	c.3396G>T	c.(3394-3396)aaG>aaT	p.K1132N	ZNF208_ENST00000601773.1_Intron|ZNF208_ENST00000599916.1_Intron	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	1132					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.K1004N(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				TATGAATTACCTTATGTTTAG	0.363																																																1	Substitution - Missense(1)	ovary(1)	19											50.0	53.0	52.0					19																	22154440		2100	4234	6334	21946280	SO:0001583	missense	7757			BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.3396G>T	19.37:g.22154440C>A	ENSP00000380315:p.Lys1132Asn		21946280		Missense_Mutation	SNP	ENST00000397126.4	37	CCDS54240.1	.	.	.	.	.	.	.	.	.	.	C	11.71	1.720251	0.30503	.	.	ENSG00000160321	ENST00000397126;ENST00000428290	T	0.07567	3.18	2.59	-0.0714	0.13743	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.06188	0.0160	.	.	.	0.09310	N	1	P	0.39216	0.664	B	0.36030	0.216	T	0.32348	-0.9910	8	0.62326	D	0.03	.	4.4047	0.11404	0.0:0.5664:0.1866:0.247	.	1004	O43345	ZN208_HUMAN	N	1132;1004	ENSP00000380315:K1132N	ENSP00000380315:K1132N	K	-	3	2	ZNF208	21946280	.	.	0.001000	0.08648	0.142000	0.21351	.	.	0.120000	0.18254	0.297000	0.19635	AAG		0.363	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464302.1	NM_007153	
PEPD	5184	broad.mit.edu	37	19	33980958	33980958	+	Silent	SNP	G	G	A	rs375023206		TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chr19:33980958G>A	ENST00000244137.7	-	6	480	c.447C>T	c.(445-447)ggC>ggT	p.G149G	PEPD_ENST00000397032.4_Silent_p.G149G|PEPD_ENST00000436370.3_Silent_p.G85G	NM_000285.3	NP_000276.2	P12955	PEPD_HUMAN	peptidase D	149					cellular amino acid metabolic process (GO:0006520)|collagen catabolic process (GO:0030574)|proteolysis (GO:0006508)	extracellular vesicular exosome (GO:0070062)	aminopeptidase activity (GO:0004177)|dipeptidase activity (GO:0016805)|manganese ion binding (GO:0030145)|metallocarboxypeptidase activity (GO:0004181)	p.G149G(1)		endometrium(3)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)	17	Esophageal squamous(110;0.137)					CCGTGTTGACGCCACGCTGGG	0.652													G|||	1	0.000199681	0.0	0.0	5008	,	,		15201	0.0		0.0	False		,,,				2504	0.001															1	Substitution - coding silent(1)	ovary(1)	19						G	,,	2,4210		0,2,2104	30.0	35.0	33.0		447,447,255	-5.7	0.8	19		33	1,8425		0,1,4212	no	coding-synonymous,coding-synonymous,coding-synonymous	PEPD	NM_000285.3,NM_001166056.1,NM_001166057.1	,,	0,3,6316	AA,AG,GG		0.0119,0.0475,0.0237	,,	149/494,149/453,85/430	33980958	3,12635	2106	4213	6319	38672798	SO:0001819	synonymous_variant	5184			BC015027	CCDS42544.1, CCDS54244.1, CCDS54245.1	19q13.11	2008-02-05				ENSG00000124299	3.4.13.9		8840	protein-coding gene	gene with protein product	"""prolidase"""	613230				2925654, 1972707	Standard	NM_000285		Approved		uc002nur.4	P12955		ENST00000244137.7:c.447C>T	19.37:g.33980958G>A			38672798	A8K3Z1|A8K416|A8K696|A8MX47|B4DDB7|B4DGJ1|E9PCE8|Q8TBN9|Q9BT75	Silent	SNP	ENST00000244137.7	37	CCDS42544.1																																																																																				0.652	PEPD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451432.3	NM_000285	
ZNF527	84503	broad.mit.edu	37	19	37879811	37879811	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chr19:37879811C>T	ENST00000436120.2	+	5	967	c.860C>T	c.(859-861)tCa>tTa	p.S287L	ZNF527_ENST00000587349.1_Intron	NM_032453.1	NP_115829.1	Q8NB42	ZN527_HUMAN	zinc finger protein 527	287				S -> P (in Ref. 1; BAG62727). {ECO:0000305}.	regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S287L(1)		NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	33			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			AGCTGTTACTCATTCTTTACT	0.393																																																1	Substitution - Missense(1)	ovary(1)	19											120.0	112.0	114.0					19																	37879811		2040	4207	6247	42571651	SO:0001583	missense	84503			AB058732, AK091585	CCDS42559.1	19q13.1	2013-01-08			ENSG00000189164	ENSG00000189164		"""Zinc fingers, C2H2-type"", ""-"""	29385	protein-coding gene	gene with protein product						11347906	Standard	NM_032453		Approved	KIAA1829	uc010efk.1	Q8NB42	OTTHUMG00000048173	ENST00000436120.2:c.860C>T	19.37:g.37879811C>T	ENSP00000390179:p.Ser287Leu		42571651	B4DVL5	Missense_Mutation	SNP	ENST00000436120.2	37	CCDS42559.1	.	.	.	.	.	.	.	.	.	.	C	15.36	2.811746	0.50527	.	.	ENSG00000189164	ENST00000356178;ENST00000317566;ENST00000436120	.	.	.	4.19	4.19	0.49359	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.331298	0.17133	N	0.185763	T	0.67183	0.2866	M	0.87038	2.855	0.35201	D	0.774264	B;B	0.30634	0.19;0.288	B;B	0.32533	0.07;0.147	T	0.77827	-0.2443	9	0.66056	D	0.02	.	11.3209	0.49421	0.1827:0.8173:0.0:0.0	.	287;255	Q8NB42;Q8NB42-2	ZN527_HUMAN;.	L	287;255;235	.	ENSP00000325231:S255L	S	+	2	0	ZNF527	42571651	0.004000	0.15560	0.012000	0.15200	0.883000	0.51084	1.144000	0.31565	2.171000	0.68590	0.655000	0.94253	TCA		0.393	ZNF527-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458434.1	NM_032453	
SLC8A2	6543	broad.mit.edu	37	19	47935623	47935623	+	Silent	SNP	C	C	T			TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chr19:47935623C>T	ENST00000236877.6	-	9	2585	c.2190G>A	c.(2188-2190)acG>acA	p.T730T	SLC8A2_ENST00000542837.1_Silent_p.T486T|SLC8A2_ENST00000539381.1_Silent_p.T193T|SLC8A2_ENST00000601757.1_5'Flank	NM_015063.2	NP_055878.1	Q9UPR5	NAC2_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 2	730					blood coagulation (GO:0007596)|cell communication (GO:0007154)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium:sodium antiporter activity (GO:0005432)	p.T730T(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(10)|ovary(2)|prostate(2)|skin(5)|stomach(1)	31		all_cancers(25;3.05e-07)|all_lung(116;4.19e-06)|Lung NSC(112;7.16e-06)|all_epithelial(76;7.65e-06)|all_neural(266;0.0652)|Ovarian(192;0.086)|Breast(70;0.173)		OV - Ovarian serous cystadenocarcinoma(262;0.000501)|all cancers(93;0.00058)|Epithelial(262;0.0181)|GBM - Glioblastoma multiforme(486;0.0457)		TCCAGAACACCGTCAGGAAGT	0.652																																																1	Substitution - coding silent(1)	ovary(1)	19											103.0	90.0	95.0					19																	47935623		2203	4300	6503	52627435	SO:0001819	synonymous_variant	6543			AB029010	CCDS33065.1	19q13.32	2013-07-15	2008-09-02		ENSG00000118160	ENSG00000118160		"""Solute carriers"""	11069	protein-coding gene	gene with protein product		601901				8021246	Standard	NM_015063		Approved	NCX2, KIAA1087	uc002pgx.3	Q9UPR5	OTTHUMG00000183529	ENST00000236877.6:c.2190G>A	19.37:g.47935623C>T			52627435	B4DYQ9	Silent	SNP	ENST00000236877.6	37	CCDS33065.1																																																																																				0.652	SLC8A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466997.1		
CLEC4F	165530	broad.mit.edu	37	2	71043345	71043345	+	Missense_Mutation	SNP	T	T	C			TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chr2:71043345T>C	ENST00000272367.2	-	4	1244	c.1168A>G	c.(1168-1170)Ata>Gta	p.I390V	CLEC4F_ENST00000426626.1_Missense_Mutation_p.I390V	NM_001258027.1|NM_173535.2	NP_001244956.1|NP_775806.2	Q8N1N0	CLC4F_HUMAN	C-type lectin domain family 4, member F	390					endocytosis (GO:0006897)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)	p.I390V(1)		endometrium(1)|large_intestine(5)|lung(18)|ovary(5)|prostate(5)|skin(1)|upper_aerodigestive_tract(2)	37						AGGGTCTGTATCTCTCTGCTG	0.428																																					Colon(107;10 2157 6841 26035)											1	Substitution - Missense(1)	ovary(1)	2											131.0	129.0	130.0					2																	71043345		2203	4300	6503	70896853	SO:0001583	missense	165530			AK096429	CCDS1910.1	2p13.3	2008-02-05	2005-02-09	2005-02-11	ENSG00000152672	ENSG00000152672		"""C-type lectin domain containing"""	25357	protein-coding gene	gene with protein product			"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 13"""	CLECSF13		8889548, 1846367	Standard	NM_001258027		Approved	FLJ39110, KCLR	uc002shf.3	Q8N1N0	OTTHUMG00000129713	ENST00000272367.2:c.1168A>G	2.37:g.71043345T>C	ENSP00000272367:p.Ile390Val		70896853	A4QPA5	Missense_Mutation	SNP	ENST00000272367.2	37	CCDS1910.1	.	.	.	.	.	.	.	.	.	.	T	3.745	-0.052700	0.07362	.	.	ENSG00000152672	ENST00000272367;ENST00000426626	T;T	0.80994	-1.44;-1.44	3.88	2.68	0.31781	.	0.462024	0.18337	N	0.144311	T	0.74756	0.3758	M	0.71036	2.16	0.09310	N	1	B;B	0.34200	0.441;0.441	B;B	0.31946	0.138;0.138	T	0.65261	-0.6211	10	0.42905	T	0.14	.	6.3064	0.21141	0.2319:0.0:0.0:0.7681	.	390;390	B7ZMM1;Q8N1N0	.;CLC4F_HUMAN	V	390	ENSP00000272367:I390V;ENSP00000390581:I390V	ENSP00000272367:I390V	I	-	1	0	CLEC4F	70896853	0.172000	0.23043	0.131000	0.22000	0.041000	0.13682	-0.018000	0.12568	0.797000	0.33971	0.383000	0.25322	ATA		0.428	CLEC4F-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251922.1	NM_173535	
POLR1A	25885	broad.mit.edu	37	2	86258453	86258453	+	Splice_Site	SNP	C	C	T			TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chr2:86258453C>T	ENST00000263857.6	-	30	4956	c.4578G>A	c.(4576-4578)caG>caA	p.Q1526Q	POLR1A_ENST00000409681.1_Intron			O95602	RPA1_HUMAN	polymerase (RNA) I polypeptide A, 194kDa	1526					gene expression (GO:0010467)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase I complex (GO:0005736)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|zinc ion binding (GO:0008270)	p.Q1526Q(1)		NS(1)|breast(4)|cervix(2)|endometrium(8)|kidney(3)|large_intestine(12)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	63						CCACACTGACCTGGCACCACA	0.657																																																1	Substitution - coding silent(1)	ovary(1)	2											66.0	71.0	70.0					2																	86258453		2103	4216	6319	86111964	SO:0001630	splice_region_variant	25885			AK025568	CCDS42706.1	2p11.2	2013-01-21			ENSG00000068654	ENSG00000068654		"""RNA polymerase subunits"""	17264	protein-coding gene	gene with protein product						9236775	Standard	NM_015425		Approved	DKFZP586M0122, FLJ21915, RPO1-4, RPA1	uc002sqs.3	O95602	OTTHUMG00000153165	ENST00000263857.6:c.4578+1G>A	2.37:g.86258453C>T			86111964	B7Z7T0|D6W5M0|Q0VG05|Q9UEH0|Q9UFT9	Silent	SNP	ENST00000263857.6	37	CCDS42706.1																																																																																				0.657	POLR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329830.2	NM_015425	Silent
IL36B	27177	broad.mit.edu	37	2	113783780	113783780	+	Silent	SNP	C	C	T			TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chr2:113783780C>T	ENST00000259213.4	-	5	398	c.291G>A	c.(289-291)aaG>aaA	p.K97K		NM_014438.3	NP_055253.2	Q9NZH7	IL36B_HUMAN	interleukin 36, beta	97					immune response (GO:0006955)|inflammatory response (GO:0006954)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of T cell differentiation (GO:0045582)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	interleukin-1 receptor binding (GO:0005149)	p.K97K(1)		kidney(1)|ovary(1)|pancreas(1)	3						agcaagtgtccttccctatgt	0.463																																																1	Substitution - coding silent(1)	ovary(1)	2											163.0	139.0	147.0					2																	113783780		2203	4300	6503	113500251	SO:0001819	synonymous_variant	27177			AF201833	CCDS2109.1, CCDS2110.1	2q14	2011-07-14	2011-06-06	2011-06-06	ENSG00000136696	ENSG00000136696		"""Interleukins and interleukin receptors"""	15564	protein-coding gene	gene with protein product		605508	"""interleukin 1 family, member 8 (eta)"""	IL1F8		10625660, 10512743, 16646978	Standard	NM_173178		Approved	FIL1, IL-1H2, IL-1F8, FILI-(ETA), IL1-ETA, IL1H2, MGC126880, MGC126882	uc002tiq.1	Q9NZH7	OTTHUMG00000131338	ENST00000259213.4:c.291G>A	2.37:g.113783780C>T			113500251	Q3MIH0|Q53SR6|Q7RTZ7|Q9UHA5	Silent	SNP	ENST00000259213.4	37	CCDS2109.1																																																																																				0.463	IL36B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254110.1	NM_014438	
SCN1A	6323	broad.mit.edu	37	2	166848032	166848032	+	Missense_Mutation	SNP	G	G	C			TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chr2:166848032G>C	ENST00000303395.4	-	26	5752	c.5753C>G	c.(5752-5754)tCt>tGt	p.S1918C	AC010127.3_ENST00000595647.1_RNA|SCN1A_ENST00000375405.3_Missense_Mutation_p.S1907C|AC010127.3_ENST00000597623.1_RNA|SCN1A_ENST00000423058.2_Missense_Mutation_p.S1918C|SCN1A_ENST00000409050.1_Missense_Mutation_p.S1890C			P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha subunit	1918	IQ.				adult walking behavior (GO:0007628)|membrane depolarization during action potential (GO:0086010)|neuromuscular process controlling posture (GO:0050884)|neuronal action potential (GO:0019228)|neuronal action potential propagation (GO:0019227)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|intercalated disc (GO:0014704)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	voltage-gated sodium channel activity (GO:0005248)	p.S1907C(1)		NS(4)|breast(5)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(33)|lung(87)|ovary(7)|pancreas(1)|prostate(9)|skin(23)|upper_aerodigestive_tract(2)|urinary_tract(1)	200					Dronedarone(DB04855)|Nitrazepam(DB01595)|Permethrin(DB04930)|Phenacemide(DB01121)|Phenazopyridine(DB01438)|Phenytoin(DB00252)|Topiramate(DB00273)|Valproic Acid(DB00313)|Zonisamide(DB00909)	AATGACAGCAGATACTTCCTC	0.408																																																1	Substitution - Missense(1)	ovary(1)	2											103.0	98.0	100.0					2																	166848032		2203	4300	6503	166556278	SO:0001583	missense	6323			AB093548	CCDS33316.1, CCDS54413.1, CCDS54414.1	2q24.3	2014-09-17	2007-01-23		ENSG00000144285	ENSG00000144285		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10585	protein-coding gene	gene with protein product		182389	"""febrile convulsions 3"""	SCN1, FEB3		8062593, 16382098, 11823106	Standard	NM_006920		Approved	Nav1.1, GEFSP2, HBSCI, NAC1, SMEI	uc021vsb.1	P35498	OTTHUMG00000044173	ENST00000303395.4:c.5753C>G	2.37:g.166848032G>C	ENSP00000303540:p.Ser1918Cys		166556278	E9PG49|Q16172|Q585T7|Q8IUJ6|Q96LA3|Q9C008	Missense_Mutation	SNP	ENST00000303395.4	37	CCDS54413.1	.	.	.	.	.	.	.	.	.	.	G	14.63	2.593600	0.46214	.	.	ENSG00000144285	ENST00000423058;ENST00000303395;ENST00000375405;ENST00000409050	D;D;D;D	0.96554	-4.05;-4.05;-4.01;-4.0	5.76	5.76	0.90799	.	0.000000	0.64402	D	0.000008	D	0.97148	0.9068	L	0.41961	1.31	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.96142	0.9101	10	0.32370	T	0.25	.	19.9787	0.97318	0.0:0.0:1.0:0.0	.	1907	P35498-2	.	C	1918;1918;1907;1890	ENSP00000407030:S1918C;ENSP00000303540:S1918C;ENSP00000364554:S1907C;ENSP00000386312:S1890C	ENSP00000303540:S1918C	S	-	2	0	SCN1A	166556278	1.000000	0.71417	0.999000	0.59377	0.982000	0.71751	9.810000	0.99221	2.719000	0.93026	0.555000	0.69702	TCT		0.408	SCN1A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102661.1	NM_006920	
TTN	7273	broad.mit.edu	37	2	179453904	179453904	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chr2:179453904C>T	ENST00000591111.1	-	254	57849	c.57625G>A	c.(57625-57627)Gct>Act	p.A19209T	TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.A11785T|TTN-AS1_ENST00000590743.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000589234.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.A11910T|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.A11977T|TTN_ENST00000589042.1_Missense_Mutation_p.A20850T|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.A18282T|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000589907.1_RNA			Q8WZ42	TITIN_HUMAN	titin	19209	Ig-like 108.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.A18280T(1)|p.A11785T(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AAACTGCCAGCCGTGTTAGTT	0.418																																																2	Substitution - Missense(2)	ovary(2)	2											104.0	103.0	103.0					2																	179453904		1899	4122	6021	179162150	SO:0001583	missense	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.57625G>A	2.37:g.179453904C>T	ENSP00000465570:p.Ala19209Thr		179162150	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	C	16.28	3.079314	0.55753	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.67865	-0.29;-0.29;-0.29;-0.29	6.02	6.02	0.97574	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Fibronectin, type III (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.77791	0.4183	M	0.71581	2.175	0.80722	D	1	P;P;P;P	0.49783	0.928;0.928;0.928;0.928	P;P;P;P	0.51974	0.686;0.686;0.686;0.686	T	0.78899	-0.2022	9	0.87932	D	0	.	20.5373	0.99239	0.0:1.0:0.0:0.0	.	11785;11910;11977;19209	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	T	18282;11785;11977;11910;11783	ENSP00000343764:A18282T;ENSP00000434586:A11785T;ENSP00000340554:A11977T;ENSP00000352154:A11910T	ENSP00000340554:A11977T	A	-	1	0	TTN	179162150	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.770000	0.85390	2.857000	0.98124	0.650000	0.86243	GCT		0.418	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
CCDC141	285025	broad.mit.edu	37	2	179702422	179702422	+	Missense_Mutation	SNP	T	T	G			TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	T	T	G	G	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chr2:179702422T>G	ENST00000420890.2	-	23	3641	c.3524A>C	c.(3523-3525)gAg>gCg	p.E1175A	CCDC141_ENST00000295723.5_Missense_Mutation_p.E600A|CCDC141_ENST00000480419.1_5'UTR	NM_173648.3	NP_775919.3	Q6ZP82	CC141_HUMAN	coiled-coil domain containing 141	1175								p.E600A(1)		NS(2)|breast(1)|endometrium(5)|kidney(1)|large_intestine(17)|lung(37)|ovary(8)|pancreas(2)|skin(4)|upper_aerodigestive_tract(1)	78			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.0531)|all cancers(119;0.147)			TGGTAGTCGCTCTTCCCCTGT	0.488																																																1	Substitution - Missense(1)	ovary(1)	2											86.0	86.0	86.0					2																	179702422		2203	4300	6503	179410667	SO:0001583	missense	285025			AK096821		2q31.2	2013-01-14			ENSG00000163492	ENSG00000163492		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	26821	protein-coding gene	gene with protein product	"""coiled-coil protein associated with myosin II and DISC1"""					20956536	Standard	NM_173648		Approved	FLJ39502, CAMDI	uc002une.2	Q6ZP82	OTTHUMG00000132578	ENST00000420890.2:c.3524A>C	2.37:g.179702422T>G	ENSP00000395995:p.Glu1175Ala		179410667	H7C0P1|J3KNW6|Q8N8H3	Missense_Mutation	SNP	ENST00000420890.2	37		.	.	.	.	.	.	.	.	.	.	T	10.92	1.488302	0.26686	.	.	ENSG00000163492	ENST00000420890;ENST00000343876;ENST00000295723	T;T;T	0.44083	0.93;1.55;1.55	5.57	2.09	0.27110	.	0.878367	0.09682	N	0.769606	T	0.23094	0.0558	N	0.14661	0.345	0.09310	N	0.999999	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.001	T	0.20505	-1.0273	10	0.35671	T	0.21	-0.1564	4.0998	0.10009	0.0:0.2058:0.3565:0.4376	.	600;600	Q6ZP82;Q6ZP82-2	CC141_HUMAN;.	A	1175;619;600	ENSP00000395995:E1175A;ENSP00000344627:E619A;ENSP00000295723:E600A	ENSP00000295723:E600A	E	-	2	0	CCDC141	179410667	0.002000	0.14202	0.008000	0.14137	0.024000	0.10985	0.921000	0.28718	0.454000	0.26884	0.454000	0.30748	GAG		0.488	CCDC141-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_173648	
SLC4A3	6508	broad.mit.edu	37	2	220497051	220497051	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chr2:220497051G>A	ENST00000358055.3	+	8	1540	c.1028G>A	c.(1027-1029)cGc>cAc	p.R343H	SLC4A3_ENST00000273063.6_Missense_Mutation_p.R370H|SLC4A3_ENST00000497589.1_3'UTR|SLC4A3_ENST00000317151.3_Missense_Mutation_p.R343H|SLC4A3_ENST00000373762.3_Missense_Mutation_p.R370H|SLC4A3_ENST00000373760.2_Missense_Mutation_p.R343H			P48751	B3A3_HUMAN	solute carrier family 4 (anion exchanger), member 3	343				R -> P (in Ref. 2; AAB05850). {ECO:0000305}.	bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|regulation of intracellular pH (GO:0051453)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)	p.R370H(1)		breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)	51		Renal(207;0.0183)		Epithelial(149;2.53e-07)|all cancers(144;5.57e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GAGACGGCCCGCTGGATCAAG	0.667																																																1	Substitution - Missense(1)	ovary(1)	2											42.0	46.0	44.0					2																	220497051		2203	4300	6503	220205295	SO:0001583	missense	6508				CCDS2445.1, CCDS2446.1	2q35	2013-07-19	2013-07-19		ENSG00000114923	ENSG00000114923		"""Solute carriers"""	11029	protein-coding gene	gene with protein product	"""Anion exchanger 3, neuronal"""	106195	"""solute carrier family 4, anion exchanger, member 3"""			8001971	Standard	NM_005070		Approved	AE3, SLC2C	uc002vmo.4	P48751	OTTHUMG00000059238	ENST00000358055.3:c.1028G>A	2.37:g.220497051G>A	ENSP00000350756:p.Arg343His		220205295	A6H8L2|A8K1Q9|B7ZVX6|B9EGD1|Q6YIQ9	Missense_Mutation	SNP	ENST00000358055.3	37	CCDS2445.1	.	.	.	.	.	.	.	.	.	.	G	34	5.316308	0.95655	.	.	ENSG00000114923	ENST00000358055;ENST00000373760;ENST00000273063;ENST00000373762;ENST00000317151;ENST00000413743	D;D;D;D;D;D	0.85773	-2.03;-2.03;-2.03;-2.03;-2.03;-2.03	3.85	3.85	0.44370	Bicarbonate transporter, cytoplasmic (1);Phosphotransferase/anion transporter (1);	0.000000	0.85682	D	0.000000	D	0.90133	0.6917	M	0.80332	2.49	0.80722	D	1	D;D	0.55605	0.972;0.963	P;P	0.54664	0.754;0.758	D	0.91481	0.5204	10	0.52906	T	0.07	.	16.3106	0.82869	0.0:0.0:1.0:0.0	.	343;370	P48751;P48751-3	B3A3_HUMAN;.	H	343;343;370;370;343;145	ENSP00000350756:R343H;ENSP00000362865:R343H;ENSP00000273063:R370H;ENSP00000362867:R370H;ENSP00000314006:R343H;ENSP00000414722:R145H	ENSP00000273063:R370H	R	+	2	0	SLC4A3	220205295	1.000000	0.71417	0.997000	0.53966	0.998000	0.95712	9.595000	0.98260	2.126000	0.65437	0.561000	0.74099	CGC		0.667	SLC4A3-009	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316472.1	NM_005070	
ACSL3	2181	broad.mit.edu	37	2	223799373	223799373	+	Missense_Mutation	SNP	T	T	C			TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chr2:223799373T>C	ENST00000357430.3	+	16	2504	c.1973T>C	c.(1972-1974)gTa>gCa	p.V658A	AC013476.1_ENST00000582868.1_RNA|ACSL3_ENST00000392066.3_Missense_Mutation_p.V658A	NM_004457.3	NP_004448.2	O95573	ACSL3_HUMAN	acyl-CoA synthetase long-chain family member 3	658					brain development (GO:0007420)|fatty acid biosynthetic process (GO:0006633)|long-chain fatty acid import (GO:0044539)|positive regulation of Golgi to plasma membrane protein transport (GO:0042998)|positive regulation of phosphatidylcholine biosynthetic process (GO:2001247)|positive regulation of secretion (GO:0051047)|response to nutrient (GO:0007584)|response to organic cyclic compound (GO:0014070)|very-low-density lipoprotein particle assembly (GO:0034379)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|perinuclear region of cytoplasm (GO:0048471)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)	p.V658A(1)		cervix(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(5)|ovary(2)|prostate(1)|skin(2)	22		Renal(207;0.0183)		Epithelial(121;1.28e-10)|all cancers(144;8.06e-08)|Lung(261;0.00834)|LUSC - Lung squamous cell carcinoma(224;0.00864)	Icosapent(DB00159)	GAAAATGAGGTACTTAAAGTG	0.403			T	ETV1	prostate																																		Dom	yes		2	2q36	2181	acyl-CoA synthetase long-chain family member 3		E	1	Substitution - Missense(1)	ovary(1)	2											142.0	128.0	133.0					2																	223799373		2203	4300	6503	223507617	SO:0001583	missense	2181			D89053	CCDS2455.1	2q34-q35	2008-02-05	2004-02-19	2004-02-20	ENSG00000123983	ENSG00000123983		"""Acyl-CoA synthetase family"""	3570	protein-coding gene	gene with protein product		602371	"""fatty-acid-Coenzyme A ligase, long-chain 3"""	FACL3			Standard	NM_004457		Approved	ACS3, PRO2194	uc002vnj.3	O95573	OTTHUMG00000133160	ENST00000357430.3:c.1973T>C	2.37:g.223799373T>C	ENSP00000350012:p.Val658Ala		223507617	Q60I92|Q8IUM9	Missense_Mutation	SNP	ENST00000357430.3	37	CCDS2455.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	30|30	5.057065|5.057065	0.93846|0.93846	.|.	.|.	ENSG00000123983|ENSG00000123983	ENST00000357430;ENST00000392066|ENST00000407441	T;T|.	0.26810|.	1.71;1.71|.	5.59|5.59	5.59|5.59	0.84812|0.84812	.|.	0.058642|.	0.64402|.	D|.	0.000002|.	T|T	0.78387|0.78387	0.4275|0.4275	M|M	0.84326|0.84326	2.69|2.69	0.80722|0.80722	D|D	1|1	D|.	0.57571|.	0.98|.	P|.	0.59595|.	0.86|.	T|T	0.80623|0.80623	-0.1300|-0.1300	10|5	0.87932|.	D|.	0|.	-19.9059|-19.9059	15.7762|15.7762	0.78220|0.78220	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	658|.	O95573|.	ACSL3_HUMAN|.	A|H	658|159	ENSP00000350012:V658A;ENSP00000375918:V658A|.	ENSP00000350012:V658A|.	V|Y	+|+	2|1	0|0	ACSL3|ACSL3	223507617|223507617	1.000000|1.000000	0.71417|0.71417	0.972000|0.972000	0.41901|0.41901	0.986000|0.986000	0.74619|0.74619	8.040000|8.040000	0.89188|0.89188	2.128000|2.128000	0.65567|0.65567	0.533000|0.533000	0.62120|0.62120	GTA|TAC		0.403	ACSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256862.2	NM_004457	
RBM39	9584	broad.mit.edu	37	20	34309749	34309749	+	Silent	SNP	A	A	G			TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chr20:34309749A>G	ENST00000253363.6	-	9	761	c.738T>C	c.(736-738)agT>agC	p.S246S	RBM39_ENST00000528062.3_Silent_p.S224S|RBM39_ENST00000407261.4_Silent_p.S89S|RBM39_ENST00000361162.6_Silent_p.S246S			Q14498	RBM39_HUMAN	RNA binding motif protein 39	246					mRNA processing (GO:0006397)|regulation of transcription, DNA-templated (GO:0006355)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	microtubule cytoskeleton (GO:0015630)|microtubule organizing center (GO:0005815)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.S246S(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(6)|lung(6)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35	all_epithelial(2;0.00295)|Lung NSC(9;0.00453)|Breast(12;0.00544)|all_lung(11;0.00676)					TAGGTCCAGCACTTCCCTTTT	0.413																																																1	Substitution - coding silent(1)	ovary(1)	20											184.0	164.0	171.0					20																	34309749		2203	4300	6503	33773163	SO:0001819	synonymous_variant	9584			L10910	CCDS13265.1, CCDS13266.1, CCDS56186.1	20q11.22	2014-07-03	2006-07-11	2006-07-11	ENSG00000131051	ENSG00000131051		"""RNA binding motif (RRM) containing"""	15923	protein-coding gene	gene with protein product	"""coactivator of activating protein-1 and estrogen receptors"", ""functional spliceosome-associated protein 59"""	604739	"""RNA-binding region (RNP1, RRM) containing 2"""	RNPC2		8227358, 15694343, 21551269	Standard	NM_184234		Approved	CC1.3, HCC1, CAPER, fSAP59, CAPERalpha	uc002xeb.3	Q14498	OTTHUMG00000032358	ENST00000253363.6:c.738T>C	20.37:g.34309749A>G			33773163	A2RRD3|A5D8W2|B0BLV3|E1P5S0|E1P5S1|Q14499	Silent	SNP	ENST00000253363.6	37	CCDS13266.1	.	.	.	.	.	.	.	.	.	.	A	10.44	1.350601	0.24512	.	.	ENSG00000131051	ENST00000448303	.	.	.	5.22	4.1	0.47936	.	.	.	.	.	T	0.62490	0.2432	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.59423	-0.7457	4	.	.	.	.	11.4642	0.50227	0.9282:0.0:0.0718:0.0	.	.	.	.	R	119	.	.	C	-	1	0	RBM39	33773163	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.329000	0.33770	0.913000	0.36797	0.529000	0.55759	TGC		0.413	RBM39-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000078931.2	NM_184237	
TOX2	84969	broad.mit.edu	37	20	42574641	42574641	+	Missense_Mutation	SNP	C	C	A			TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chr20:42574641C>A	ENST00000358131.5	+	1	297	c.89C>A	c.(88-90)gCa>gAa	p.A30E	TOX2_ENST00000423191.2_Intron|TOX2_ENST00000341197.4_Intron|TOX2_ENST00000372999.1_Intron	NM_001098798.1	NP_001092268.1	Q96NM4	TOX2_HUMAN	TOX high mobility group box family member 2	30					female gonad development (GO:0008585)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to gonadotropin (GO:0034698)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.A30E(1)		NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|skin(2)	26		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.00189)			CTTCTACTTGCAAGACACTGG	0.602																																																1	Substitution - Missense(1)	ovary(1)	20											45.0	45.0	45.0					20																	42574641		2013	4177	6190	42008055	SO:0001583	missense	84969			BC007636	CCDS13324.1, CCDS42875.1, CCDS46603.1	20q13.12	2007-03-20	2007-03-20	2007-03-20					16095	protein-coding gene	gene with protein product	"""granulosa cell HMG box 1"""	611163	"""chromosome 20 open reading frame 100"""	C20orf100		14764631	Standard	NM_001098796		Approved	dJ1108D11.2, GCX-1	uc010ggo.3	Q96NM4		ENST00000358131.5:c.89C>A	20.37:g.42574641C>A	ENSP00000350849:p.Ala30Glu		42008055	A8K1J1|E1P5X0|G3XAC7|Q5TE33|Q5TE34|Q5TE35|Q96IC9|Q9BQN5	Missense_Mutation	SNP	ENST00000358131.5	37	CCDS42875.1	.	.	.	.	.	.	.	.	.	.	C	12.89	2.072936	0.36566	.	.	ENSG00000124191	ENST00000358131	T	0.15603	2.41	4.44	2.42	0.29668	.	1.586020	0.04451	N	0.372622	T	0.09024	0.0223	N	0.08118	0	0.45883	D	0.998735	B	0.23058	0.079	B	0.18263	0.021	T	0.37033	-0.9723	10	0.02654	T	1	.	10.8982	0.47036	0.0:0.6305:0.3695:0.0	.	30	Q96NM4	TOX2_HUMAN	E	30	ENSP00000350849:A30E	ENSP00000350849:A30E	A	+	2	0	TOX2	42008055	0.026000	0.19158	0.883000	0.34634	0.815000	0.46073	0.021000	0.13489	0.565000	0.29255	0.313000	0.20887	GCA		0.602	TOX2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000079329.2		
ZFP64	55734	broad.mit.edu	37	20	50769706	50769706	+	Missense_Mutation	SNP	G	G	T			TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chr20:50769706G>T	ENST00000216923.4	-	6	1374	c.1025C>A	c.(1024-1026)cCt>cAt	p.P342H	ZFP64_ENST00000371518.2_Intron|ZFP64_ENST00000361387.2_Intron|ZFP64_ENST00000371515.4_Missense_Mutation_p.P340H|ZFP64_ENST00000346617.4_Missense_Mutation_p.P288H|ZFP64_ENST00000477786.1_Intron	NM_018197.2|NM_199426.1	NP_060667.2|NP_955458.1	Q9NPA5	ZF64A_HUMAN	ZFP64 zinc finger protein	342					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.P342H(1)		breast(2)|endometrium(5)|large_intestine(8)|lung(11)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	33						GCACTTCTCAGGATGCTCCGA	0.592																																																1	Substitution - Missense(1)	ovary(1)	20											121.0	111.0	114.0					20																	50769706		2203	4300	6503	50203113	SO:0001583	missense	55734			AK001596	CCDS13439.1, CCDS13440.1, CCDS13441.1, CCDS13442.1	20q13.11-q13.13	2013-01-08	2012-11-27		ENSG00000020256	ENSG00000020256		"""Zinc fingers, C2H2-type"""	15940	protein-coding gene	gene with protein product			"""zinc finger protein 338"", ""zinc finger protein 64 homolog (mouse)"", ""zinc finger protein 64"""	ZNF338		9034307	Standard	NM_199427		Approved	FLJ10734, dJ831D17.1, FLJ12628, dJ548G19.1	uc002xwl.3	Q9NPA5	OTTHUMG00000032756	ENST00000216923.4:c.1025C>A	20.37:g.50769706G>T	ENSP00000216923:p.Pro342His		50203113	Q9NTS7|Q9NVH4	Missense_Mutation	SNP	ENST00000216923.4	37	CCDS13440.1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.392339	0.83011	.	.	ENSG00000020256	ENST00000216923;ENST00000346617;ENST00000371515;ENST00000546083;ENST00000371516	T;T;T	0.20881	2.04;2.04;2.04	5.79	5.79	0.91817	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.64402	D	0.000014	T	0.53706	0.1813	M	0.84773	2.715	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.999	D;P;D	0.70487	0.969;0.903;0.91	T	0.58335	-0.7654	10	0.87932	D	0	-25.5076	20.0381	0.97570	0.0:0.0:1.0:0.0	.	288;340;342	Q9NPA5-2;Q5JWM1;Q9NPA5	.;.;ZF64A_HUMAN	H	342;288;340;184;495	ENSP00000216923:P342H;ENSP00000344615:P288H;ENSP00000360570:P340H	ENSP00000216923:P342H	P	-	2	0	ZFP64	50203113	1.000000	0.71417	0.998000	0.56505	0.870000	0.49936	9.623000	0.98386	2.740000	0.93945	0.609000	0.83330	CCT		0.592	ZFP64-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000079744.1	NM_018197	
TSHZ2	128553	broad.mit.edu	37	20	51872658	51872658	+	Missense_Mutation	SNP	G	G	T	rs371016440		TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chr20:51872658G>T	ENST00000371497.5	+	2	3548	c.2661G>T	c.(2659-2661)aaG>aaT	p.K887N	RP4-678D15.1_ENST00000606932.1_RNA|TSHZ2_ENST00000329613.6_Missense_Mutation_p.K884N|TSHZ2_ENST00000603338.2_Missense_Mutation_p.K884N	NM_001193421.1|NM_173485.5	NP_001180350.1|NP_775756.3	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	887					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.K887N(1)		NS(2)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(16)|lung(38)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	84			STAD - Stomach adenocarcinoma(23;0.1)			AAATCTCTAAGTTTACGGGAC	0.488																																																1	Substitution - Missense(1)	ovary(1)	20											86.0	84.0	84.0					20																	51872658		2203	4300	6503	51306065	SO:0001583	missense	128553			AF230201	CCDS33490.1, CCDS54474.1	20q13.2	2013-11-20	2007-07-16	2006-03-14	ENSG00000182463	ENSG00000182463		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	13010	protein-coding gene	gene with protein product		614118	"""chromosome 20 open reading frame 17"", ""zinc finger protein 218"", ""teashirt family zinc finger 2"""	C20orf17, ZNF218		9671742	Standard	NM_173485		Approved	ZABC2, OVC10-2, TSH2	uc021wex.1	Q9NRE2	OTTHUMG00000033058	ENST00000371497.5:c.2661G>T	20.37:g.51872658G>T	ENSP00000360552:p.Lys887Asn		51306065	B7Z7W1|J3KNQ0|Q4VXM4|Q6N003|Q8N260	Missense_Mutation	SNP	ENST00000371497.5	37	CCDS33490.1	.	.	.	.	.	.	.	.	.	.	G	17.37	3.372999	0.61624	.	.	ENSG00000182463	ENST00000371497;ENST00000329613;ENST00000450262	T;T	0.19669	2.13;2.13	5.8	5.8	0.92144	Homeobox (1);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	T	0.35038	0.0918	L	0.39898	1.24	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.04333	-1.0959	10	0.72032	D	0.01	-0.3631	10.1311	0.42680	0.1525:0.0:0.8475:0.0	.	887	Q9NRE2	TSH2_HUMAN	N	887;884;413	ENSP00000360552:K887N;ENSP00000333114:K884N	ENSP00000333114:K884N	K	+	3	2	TSHZ2	51306065	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.363000	0.59473	2.732000	0.93576	0.643000	0.83706	AAG		0.488	TSHZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080398.6	NM_173485	
SLC4A7	9497	broad.mit.edu	37	3	27439813	27439813	+	Missense_Mutation	SNP	C	C	G			TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chr3:27439813C>G	ENST00000295736.5	-	17	2502	c.2432G>C	c.(2431-2433)gGg>gCg	p.G811A	SLC4A7_ENST00000388777.4_Missense_Mutation_p.G361A|SLC4A7_ENST00000437179.1_Missense_Mutation_p.G692A|SLC4A7_ENST00000445684.1_Missense_Mutation_p.G807A|SLC4A7_ENST00000425128.2_3'UTR|SLC4A7_ENST00000440156.1_Missense_Mutation_p.G807A|SLC4A7_ENST00000455077.1_Missense_Mutation_p.G692A|SLC4A7_ENST00000446700.1_Missense_Mutation_p.G803A|SLC4A7_ENST00000454389.1_Missense_Mutation_p.G820A|SLC4A7_ENST00000428386.1_Missense_Mutation_p.G687A|SLC4A7_ENST00000435667.2_Missense_Mutation_p.G696A	NM_003615.4	NP_003606.3	Q9Y6M7	S4A7_HUMAN	solute carrier family 4, sodium bicarbonate cotransporter, member 7	811					auditory receptor cell development (GO:0060117)|bicarbonate transport (GO:0015701)|cochlear nucleus development (GO:0021747)|ion transport (GO:0006811)|retina vasculature morphogenesis in camera-type eye (GO:0061299)|retinal cell programmed cell death (GO:0046666)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|sodium:bicarbonate symporter activity (GO:0008510)	p.G811A(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(12)|lung(9)|ovary(4)|skin(1)	38					Sodium bicarbonate(DB01390)	ACAAGCTGACCCCAAGAATAC	0.368																																																1	Substitution - Missense(1)	ovary(1)	3											111.0	112.0	112.0					3																	27439813		2203	4300	6503	27414817	SO:0001583	missense	9497			AB012130	CCDS33721.1, CCDS58819.1, CCDS58820.1	3p24.1	2013-05-22			ENSG00000033867	ENSG00000033867		"""Solute carriers"""	11033	protein-coding gene	gene with protein product		603353		SLC4A6		10198178, 9610397	Standard	NM_003615		Approved	NBC3, SBC2	uc003cdv.4	Q9Y6M7	OTTHUMG00000155679	ENST00000295736.5:c.2432G>C	3.37:g.27439813C>G	ENSP00000295736:p.Gly811Ala		27414817	A6NIA8|B2CI53|B5M449|B5M451|B5M452|B5M453|B6DY52|B6DY53|C9JST9|D3K174|D3K175|O60350|Q6AHZ9|Q9HC88|Q9UIB9	Missense_Mutation	SNP	ENST00000295736.5	37	CCDS33721.1	.	.	.	.	.	.	.	.	.	.	C	28.1	4.887502	0.91814	.	.	ENSG00000033867	ENST00000419036;ENST00000295736;ENST00000428386;ENST00000454389;ENST00000440156;ENST00000437179;ENST00000446700;ENST00000455077;ENST00000445684;ENST00000435667;ENST00000388777;ENST00000428179	T;T;T;T;T;T;T;T;T;T;T;T	0.79352	-1.26;-1.26;-1.26;-1.26;-1.26;-1.26;-1.26;-1.26;-1.26;-1.26;-1.26;-1.26	5.71	5.71	0.89125	Bicarbonate transporter, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.90539	0.7035	M	0.89163	3.01	0.80722	D	1	D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D	0.91494	0.5214	10	0.72032	D	0.01	.	19.8545	0.96752	0.0:1.0:0.0:0.0	.	807;692;803;807;820;361;687;811;692	E9PFN4;B5M452;E9PGC1;B5M453;E9PDL9;F8W7E6;Q9Y6M7-2;Q9Y6M7;B2CI53	.;.;.;.;.;.;.;S4A7_HUMAN;.	A	362;811;687;820;807;692;803;692;807;696;361;707	ENSP00000411031:G362A;ENSP00000295736:G811A;ENSP00000416368:G687A;ENSP00000390394:G820A;ENSP00000414797:G807A;ENSP00000394252:G692A;ENSP00000406605:G803A;ENSP00000407382:G692A;ENSP00000406804:G807A;ENSP00000395336:G696A;ENSP00000373429:G361A;ENSP00000388703:G707A	ENSP00000295736:G811A	G	-	2	0	SLC4A7	27414817	1.000000	0.71417	0.970000	0.41538	0.704000	0.40688	7.818000	0.86416	2.695000	0.91970	0.563000	0.77884	GGG		0.368	SLC4A7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000341230.2	NM_003615	
ZNF589	51385	broad.mit.edu	37	3	48310200	48310200	+	Missense_Mutation	SNP	G	G	T			TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chr3:48310200G>T	ENST00000354698.3	+	4	1091	c.1019G>T	c.(1018-1020)gGc>gTc	p.G340V	ZNF589_ENST00000412564.1_Intron|ZNF589_ENST00000427617.2_Intron|ZNF589_ENST00000440261.2_Intron	NM_016089.2	NP_057173.2	Q86UQ0	ZN589_HUMAN	zinc finger protein 589	340					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G340V(1)		large_intestine(1)|lung(1)|ovary(1)|skin(1)	4				BRCA - Breast invasive adenocarcinoma(193;0.000649)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		TGTGGGCGAGGCTTTCGTGAA	0.498																																					Colon(9;319 328 25374 27611 50948)											1	Substitution - Missense(1)	ovary(1)	3											88.0	95.0	93.0					3																	48310200		2153	4280	6433	48285204	SO:0001583	missense	51385			AF114816	CCDS43085.1	3p21	2013-01-08			ENSG00000164048	ENSG00000164048		"""Zinc fingers, C2H2-type"", ""-"""	16747	protein-coding gene	gene with protein product						10029171	Standard	NM_016089		Approved	SZF1	uc003csl.4	Q86UQ0	OTTHUMG00000156833	ENST00000354698.3:c.1019G>T	3.37:g.48310200G>T	ENSP00000346729:p.Gly340Val		48285204	Q86UC9|Q9BRI6|Q9BRY3|Q9Y611|Q9Y612	Missense_Mutation	SNP	ENST00000354698.3	37	CCDS43085.1	.	.	.	.	.	.	.	.	.	.	G	11.24	1.578968	0.28180	.	.	ENSG00000164048	ENST00000354698;ENST00000296437	T	0.17054	2.3	1.07	1.07	0.20283	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.10852	0.0265	L	0.28014	0.82	0.21967	N	0.999448	P;B	0.37141	0.584;0.068	B;B	0.37304	0.234;0.246	T	0.24905	-1.0147	9	0.72032	D	0.01	.	3.3292	0.07077	0.2736:0.0:0.7264:0.0	.	337;340	Q86UQ0-2;Q86UQ0	.;ZN589_HUMAN	V	340;337	ENSP00000346729:G340V	ENSP00000296437:G337V	G	+	2	0	ZNF589	48285204	0.000000	0.05858	0.010000	0.14722	0.041000	0.13682	-0.003000	0.12901	0.903000	0.36546	0.313000	0.20887	GGC		0.498	ZNF589-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346124.1	NM_016089	
RYK	6259	broad.mit.edu	37	3	133907756	133907756	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chr3:133907756G>A	ENST00000427044.2	-	10	1070	c.460C>T	c.(460-462)Cgt>Tgt	p.R154C	RYK_ENST00000296084.4_Missense_Mutation_p.R344C			P34925	RYK_HUMAN	receptor-like tyrosine kinase	340	WIF. {ECO:0000255|PROSITE- ProRule:PRU00222}.				axon guidance (GO:0007411)|corpus callosum development (GO:0022038)|neuron differentiation (GO:0030182)|neuron projection development (GO:0031175)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of MAPK cascade (GO:0043410)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)	p.R340C(1)		lung(1)|ovary(3)	4						TGGAAAATACGCCCAAAAGTA	0.264																																																1	Substitution - Missense(1)	ovary(1)	3											64.0	60.0	61.0					3																	133907756		1795	4061	5856	135390446	SO:0001583	missense	6259			S59184	CCDS75016.1	3q22.1	2012-02-28	2012-02-28		ENSG00000163785	ENSG00000163785	2.7.10.1		10481	protein-coding gene	gene with protein product		600524	"""JTK5A protein tyrosine kinase"", ""RYK receptor-like tyrosine kinase"""	JTK5A		8386829	Standard	NM_001005861		Approved	D3S3195, RYK1, JTK5	uc003eqc.1	P34925	OTTHUMG00000159750	ENST00000427044.2:c.460C>T	3.37:g.133907756G>A	ENSP00000399527:p.Arg154Cys		135390446	Q04696	Missense_Mutation	SNP	ENST00000427044.2	37		.	.	.	.	.	.	.	.	.	.	G	14.99	2.700749	0.48307	.	.	ENSG00000163785	ENST00000296084;ENST00000427044	D;D	0.83250	-1.7;-1.7	5.35	4.48	0.54585	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.052199	0.85682	D	0.000000	T	0.81254	0.4784	M	0.73598	2.24	0.80722	D	1	B;B	0.14012	0.009;0.008	B;B	0.12837	0.008;0.004	T	0.79169	-0.1914	10	0.87932	D	0	-5.0345	9.4484	0.38712	0.0725:0.0:0.7858:0.1417	.	340;343	P34925;P34925-2	RYK_HUMAN;.	C	344;154	ENSP00000296084:R344C;ENSP00000399527:R154C	ENSP00000296084:R344C	R	-	1	0	RYK	135390446	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.073000	0.76784	1.380000	0.46344	0.650000	0.86243	CGT		0.264	RYK-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001005861	
ATP11B	23200	broad.mit.edu	37	3	182602567	182602567	+	Missense_Mutation	SNP	G	G	T	rs371088881		TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chr3:182602567G>T	ENST00000323116.5	+	22	2796	c.2536G>T	c.(2536-2538)Gct>Tct	p.A846S		NM_014616.2	NP_055431.1	Q9Y2G3	AT11B_HUMAN	ATPase, class VI, type 11B	846					aminophospholipid transport (GO:0015917)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear inner membrane (GO:0005637)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|ion transmembrane transporter activity (GO:0015075)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.A846S(1)		breast(3)|cervix(2)|endometrium(2)|kidney(4)|large_intestine(6)|liver(2)|lung(14)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|urinary_tract(1)	41	all_cancers(143;9.04e-15)|Ovarian(172;0.0355)		all cancers(12;1.2e-42)|Epithelial(37;2.77e-36)|LUSC - Lung squamous cell carcinoma(7;7.58e-24)|Lung(8;4.66e-22)|OV - Ovarian serous cystadenocarcinoma(80;2.35e-20)			AGGAAGACAGGCTGCAAGAAA	0.323																																																1	Substitution - Missense(1)	ovary(1)	3						G	SER/ALA	0,4406		0,0,2203	127.0	137.0	134.0		2536	5.7	1.0	3		134	1,8599	1.2+/-3.3	0,1,4299	no	missense	ATP11B	NM_014616.1	99	0,1,6502	TT,TG,GG		0.0116,0.0,0.0077	probably-damaging	846/1178	182602567	1,13005	2203	4300	6503	184085261	SO:0001583	missense	23200			AF156548	CCDS33896.1	3q27	2010-04-20	2007-09-19		ENSG00000058063	ENSG00000058063		"""ATPases / P-type"""	13553	protein-coding gene	gene with protein product		605869	"""ATPase, Class VI, type 11B"""			10231032, 11015572	Standard	NM_014616		Approved	ATPIF, ATPIR, KIAA0956	uc003flb.3	Q9Y2G3	OTTHUMG00000158295	ENST00000323116.5:c.2536G>T	3.37:g.182602567G>T	ENSP00000321195:p.Ala846Ser		184085261	Q96FN1|Q9UKK7	Missense_Mutation	SNP	ENST00000323116.5	37	CCDS33896.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.1|20.1	3.932805|3.932805	0.73442|0.73442	0.0|0.0	1.16E-4|1.16E-4	ENSG00000058063|ENSG00000058063	ENST00000323116;ENST00000482070|ENST00000498086	T;T|.	0.73047|.	0.23;-0.71|.	5.72|5.72	5.72|5.72	0.89469|0.89469	HAD-like domain (2);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.91734|0.91734	0.7386|0.7386	H|H	0.99357|0.99357	4.53|4.53	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.91635|.	0.994;0.999|.	D|D	0.94810|0.94810	0.7978|0.7978	10|5	0.87932|.	D|.	0|.	.|.	19.8628|19.8628	0.96789|0.96789	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	420;846|.	B3KSJ2;Q9Y2G3|.	.;AT11B_HUMAN|.	S|S	846;81|646	ENSP00000321195:A846S;ENSP00000417124:A81S|.	ENSP00000321195:A846S|.	A|R	+|+	1|3	0|2	ATP11B|ATP11B	184085261|184085261	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	9.409000|9.409000	0.97331|0.97331	2.692000|2.692000	0.91855|0.91855	0.585000|0.585000	0.79938|0.79938	GCT|AGG		0.323	ATP11B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350598.1	NM_014616	
HTR3C	170572	broad.mit.edu	37	3	183774067	183774067	+	Missense_Mutation	SNP	G	G	A	rs142791028	byFrequency	TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chr3:183774067G>A	ENST00000318351.1	+	4	416	c.382G>A	c.(382-384)Gtg>Atg	p.V128M		NM_130770.2	NP_570126.2	Q8WXA8	5HT3C_HUMAN	5-hydroxytryptamine (serotonin) receptor 3C, ionotropic	128			V -> M (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	extracellular ligand-gated ion channel activity (GO:0005230)	p.V128M(2)		central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(14)|ovary(1)|prostate(1)|skin(2)|stomach(2)	32	all_cancers(143;2.33e-10)|Ovarian(172;0.0303)		Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;3.11e-22)		Ergoloid mesylate(DB01049)	CATCTTCATCGTGGAATCGTG	0.502													G|||	3	0.000599042	0.0	0.0	5008	,	,		20225	0.0		0.0	False		,,,				2504	0.0031															2	Substitution - Missense(2)	large_intestine(1)|ovary(1)	3						A	MET/VAL	0,4406		0,0,2203	124.0	124.0	124.0		382	-9.5	0.0	3	dbSNP_134	124	1,8599		0,1,4299	no	missense	HTR3C	NM_130770.2	21	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	128/448	183774067	1,13005	2203	4300	6503	185256761	SO:0001583	missense	170572			AF459285	CCDS3250.1	3q27	2012-05-22	2012-02-03		ENSG00000178084	ENSG00000178084		"""5-HT (serotonin) receptors"", ""Ligand-gated ion channels / 5-HT (serotonin) receptors, ionotropic"""	24003	protein-coding gene	gene with protein product		610121	"""5-hydroxytryptamine (serotonin) receptor 3, family member C"""			12801637, 15157181	Standard	NM_130770		Approved		uc003fmk.3	Q8WXA8	OTTHUMG00000156862	ENST00000318351.1:c.382G>A	3.37:g.183774067G>A	ENSP00000322617:p.Val128Met		185256761	A2RRR5	Missense_Mutation	SNP	ENST00000318351.1	37	CCDS3250.1	.	.	.	.	.	.	.	.	.	.	.	1.525	-0.545931	0.04024	0.0	1.16E-4	ENSG00000178084	ENST00000318351	T	0.78816	-1.21	4.77	-9.53	0.00575	Neurotransmitter-gated ion-channel ligand-binding (3);	1.553000	0.03787	N	0.262280	T	0.68311	0.2987	L	0.47716	1.5	0.09310	N	1	B	0.22800	0.075	B	0.21546	0.035	T	0.60449	-0.7261	10	0.56958	D	0.05	0.0272	9.0502	0.36372	0.1972:0.0697:0.5854:0.1477	.	128	Q8WXA8	5HT3C_HUMAN	M	128	ENSP00000322617:V128M	ENSP00000322617:V128M	V	+	1	0	HTR3C	185256761	0.000000	0.05858	0.001000	0.08648	0.701000	0.40568	-3.898000	0.00339	-4.514000	0.00045	-3.767000	0.00021	GTG		0.502	HTR3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346296.1	NM_130770	
BCL6	604	broad.mit.edu	37	3	187447315	187447315	+	Missense_Mutation	SNP	T	T	A			TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	T	T	A	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chr3:187447315T>A	ENST00000406870.2	-	5	1244	c.878A>T	c.(877-879)tAc>tTc	p.Y293F	RP11-211G3.3_ENST00000437407.1_Intron|BCL6_ENST00000450123.2_Missense_Mutation_p.Y293F|RP11-211G3.3_ENST00000449623.1_Intron|BCL6_ENST00000232014.4_Missense_Mutation_p.Y293F	NM_001706.4	NP_001697.2	P41182	BCL6_HUMAN	B-cell CLL/lymphoma 6	293					actin cytoskeleton organization (GO:0030036)|B cell differentiation (GO:0030183)|cell morphogenesis (GO:0000902)|cellular response to DNA damage stimulus (GO:0006974)|erythrocyte development (GO:0048821)|germinal center formation (GO:0002467)|inflammatory response (GO:0006954)|negative regulation of B cell apoptotic process (GO:0002903)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of isotype switching to IgE isotypes (GO:0048294)|negative regulation of mast cell cytokine production (GO:0032764)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of T-helper 2 cell differentiation (GO:0045629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of apoptotic process (GO:0043065)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cellular component movement (GO:0051272)|protein import into nucleus, translocation (GO:0000060)|regulation of germinal center formation (GO:0002634)|regulation of immune response (GO:0050776)|regulation of inflammatory response (GO:0050727)|regulation of memory T cell differentiation (GO:0043380)|regulation of Rho GTPase activity (GO:0032319)|Rho protein signal transduction (GO:0007266)|spermatogenesis (GO:0007283)|type 2 immune response (GO:0042092)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|metal ion binding (GO:0046872)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Y293F(1)		central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(9)|lung(10)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	40	all_cancers(143;9.45e-12)|Ovarian(172;0.0418)		OV - Ovarian serous cystadenocarcinoma(80;1.76e-18)	GBM - Glioblastoma multiforme(93;0.0141)		ACAAGGGAAGTAGGGGGCATT	0.562			"""T, Mis"""	"""IG loci, ZNFN1A1, LCP1, PIM1, TFRC, CIITA, NACA, HSPCB, HSPCA, HIST1H4I, IL21R,  POU2AF1, ARHH, EIF4A2, SFRS3"""	"""NHL, CLL"""																																		Dom	yes		3	3q27	604	B-cell CLL/lymphoma 6		L	1	Substitution - Missense(1)	ovary(1)	3											80.0	89.0	86.0					3																	187447315		2203	4300	6503	188930009	SO:0001583	missense	604				CCDS3289.1, CCDS46975.1	3q27	2013-01-09	2008-08-01		ENSG00000113916	ENSG00000113916		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	1001	protein-coding gene	gene with protein product		109565	"""zinc finger protein 51"""	ZNF51			Standard	NM_001130845		Approved	ZBTB27, LAZ3, BCL5, BCL6A	uc003frq.2	P41182	OTTHUMG00000156441	ENST00000406870.2:c.878A>T	3.37:g.187447315T>A	ENSP00000384371:p.Tyr293Phe		188930009	A7E241|B8PSA7|D3DNV5	Missense_Mutation	SNP	ENST00000406870.2	37	CCDS3289.1	.	.	.	.	.	.	.	.	.	.	T	6.530	0.466066	0.12402	.	.	ENSG00000113916	ENST00000406870;ENST00000232014;ENST00000450123	T;T;T	0.07567	3.18;3.18;3.19	5.34	5.34	0.76211	.	0.361425	0.32161	N	0.006492	T	0.05135	0.0137	N	0.16478	0.41	0.37763	D	0.926387	B;B	0.12013	0.001;0.005	B;B	0.11329	0.002;0.006	T	0.38308	-0.9667	10	0.11794	T	0.64	.	10.103	0.42517	0.1494:0.0:0.0:0.8506	.	293;293	B8PSA7;P41182	.;BCL6_HUMAN	F	293	ENSP00000384371:Y293F;ENSP00000232014:Y293F;ENSP00000413122:Y293F	ENSP00000232014:Y293F	Y	-	2	0	BCL6	188930009	1.000000	0.71417	0.993000	0.49108	0.534000	0.34807	1.089000	0.30890	2.148000	0.66965	0.379000	0.24179	TAC		0.562	BCL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344202.1	NM_138931	
FRAS1	80144	broad.mit.edu	37	4	79387503	79387503	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chr4:79387503G>A	ENST00000264895.6	+	50	7611	c.7171G>A	c.(7171-7173)Ggc>Agc	p.G2391S		NM_025074.6	NP_079350.5	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1	2391					cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)	p.G2391S(3)|p.G2392S(1)		breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						CAGCCATGACGGCAGTAACTC	0.527																																																4	Substitution - Missense(4)	central_nervous_system(3)|ovary(1)	4											78.0	80.0	79.0					4																	79387503		2128	4237	6365	79606527	SO:0001583	missense	80144			AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000264895.6:c.7171G>A	4.37:g.79387503G>A	ENSP00000264895:p.Gly2391Ser		79606527	A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Missense_Mutation	SNP	ENST00000264895.6	37	CCDS54771.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.35|15.35	2.806409|2.806409	0.50421|0.50421	.|.	.|.	ENSG00000138759|ENSG00000138759	ENST00000264895|ENST00000512123	T|.	0.26223|.	1.75|.	5.53|5.53	4.69|4.69	0.59074|0.59074	.|.	0.297141|.	0.36665|.	N|.	0.002479|.	T|T	0.75693|0.75693	0.3884|0.3884	M|M	0.76002|0.76002	2.32|2.32	0.80722|0.80722	D|D	1|1	P|.	0.45902|.	0.868|.	B|.	0.35655|.	0.207|.	T|T	0.75399|0.75399	-0.3331|-0.3331	10|5	0.62326|.	D|.	0.03|.	.|.	17.8279|17.8279	0.88671|0.88671	0.0652:0.0:0.9348:0.0|0.0652:0.0:0.9348:0.0	.|.	2391|.	E9PHH6|.	.|.	S|Q	2391|619	ENSP00000264895:G2391S|.	ENSP00000264895:G2391S|.	G|R	+|+	1|2	0|0	FRAS1|FRAS1	79606527|79606527	1.000000|1.000000	0.71417|0.71417	0.916000|0.916000	0.36221|0.36221	0.715000|0.715000	0.41141|0.41141	7.713000|7.713000	0.84693|0.84693	0.830000|0.830000	0.34757|0.34757	-1.128000|-1.128000	0.01989|0.01989	GGC|CGG		0.527	FRAS1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
MTTP	4547	broad.mit.edu	37	4	100527921	100527921	+	Missense_Mutation	SNP	A	A	G			TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chr4:100527921A>G	ENST00000265517.5	+	11	1564	c.1361A>G	c.(1360-1362)aAg>aGg	p.K454R	RP11-766F14.1_ENST00000508578.1_RNA|MTTP_ENST00000457717.1_Missense_Mutation_p.K454R|MTTP_ENST00000511045.1_Missense_Mutation_p.K481R			P55157	MTP_HUMAN	microsomal triglyceride transfer protein	454	Vitellogenin. {ECO:0000255|PROSITE- ProRule:PRU00557}.				cholesterol homeostasis (GO:0042632)|lipid metabolic process (GO:0006629)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|protein lipidation (GO:0006497)|response to calcium ion (GO:0051592)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|membrane-bounded vesicle (GO:0031988)|microvillus membrane (GO:0031528)|receptor complex (GO:0043235)|rough endoplasmic reticulum (GO:0005791)	lipid binding (GO:0008289)|lipid transporter activity (GO:0005319)	p.K454R(1)		breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(14)|lung(19)|ovary(4)|prostate(5)|skin(1)|urinary_tract(1)	57				OV - Ovarian serous cystadenocarcinoma(123;6.04e-09)	Hesperetin(DB01094)|Lomitapide(DB08827)	GTGGAAGCTAAGAAGTTAATC	0.433																																																1	Substitution - Missense(1)	ovary(1)	4											80.0	86.0	84.0					4																	100527921		2203	4300	6503	100746944	SO:0001583	missense	4547				CCDS3651.1, CCDS75169.1	4q24	2008-02-05	2005-11-04	2005-11-04	ENSG00000138823	ENSG00000138823			7467	protein-coding gene	gene with protein product		157147	"""microsomal triglyceride transfer protein (large polypeptide, 88kD)"", ""microsomal triglyceride transfer protein (large polypeptide, 88kDa)"""	MTP		8111381	Standard	XM_005263025		Approved	ABL	uc003hvc.4	P55157	OTTHUMG00000131023	ENST00000265517.5:c.1361A>G	4.37:g.100527921A>G	ENSP00000265517:p.Lys454Arg		100746944	A8K428|Q08AM4|Q6P5T3	Missense_Mutation	SNP	ENST00000265517.5	37	CCDS3651.1	.	.	.	.	.	.	.	.	.	.	A	16.10	3.027950	0.54790	.	.	ENSG00000138823	ENST00000511045;ENST00000457717;ENST00000265517;ENST00000538053	T;T;T	0.39997	1.05;1.05;1.05	5.51	5.51	0.81932	Lipid transport protein, N-terminal (3);Vitellinogen, superhelical (2);	0.000000	0.85682	D	0.000000	T	0.47746	0.1462	M	0.66506	2.035	0.50632	D	0.999888	P;P	0.40731	0.728;0.698	P;B	0.45099	0.469;0.191	T	0.39820	-0.9595	10	0.15952	T	0.53	-15.4203	15.6261	0.76859	1.0:0.0:0.0:0.0	.	481;454	E9PBP6;P55157	.;MTP_HUMAN	R	481;454;454;454	ENSP00000427679:K481R;ENSP00000400821:K454R;ENSP00000265517:K454R	ENSP00000265517:K454R	K	+	2	0	MTTP	100746944	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.394000	0.79862	2.083000	0.62718	0.533000	0.62120	AAG		0.433	MTTP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253662.3		
WDR17	116966	broad.mit.edu	37	4	177089798	177089798	+	Splice_Site	SNP	G	G	T			TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chr4:177089798G>T	ENST00000280190.4	+	25	3239		c.e25-1		WDR17_ENST00000508596.1_Intron|WDR17_ENST00000393643.2_Splice_Site|WDR17_ENST00000507824.2_Intron			Q8IZU2	WDR17_HUMAN	WD repeat domain 17									p.?(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(18)|lung(46)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	92		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.21e-20)|Epithelial(43;9.71e-18)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-09)|GBM - Glioblastoma multiforme(59;0.000295)|STAD - Stomach adenocarcinoma(60;0.000703)|LUSC - Lung squamous cell carcinoma(193;0.0232)		CCTCAATGAAGTGTCCCCTTT	0.323																																																1	Unknown(1)	ovary(1)	4											123.0	117.0	119.0					4																	177089798		2203	4300	6503	177326792	SO:0001630	splice_region_variant	116966			AF492460	CCDS3825.1, CCDS43284.1, CCDS43284.2	4q34	2013-01-09			ENSG00000150627	ENSG00000150627		"""WD repeat domain containing"""	16661	protein-coding gene	gene with protein product		609005				12401215	Standard	NM_170710		Approved		uc003iuj.3	Q8IZU2	OTTHUMG00000160791	ENST00000280190.4:c.3084-1G>T	4.37:g.177089798G>T			177326792	E7EQX0|Q0QD35	Splice_Site	SNP	ENST00000280190.4	37	CCDS3825.1	.	.	.	.	.	.	.	.	.	.	G	2.482	-0.319447	0.05386	.	.	ENSG00000150627	ENST00000393643;ENST00000280190;ENST00000507824	.	.	.	4.55	-2.29	0.06805	.	.	.	.	.	.	.	.	.	.	.	0.19300	N	0.999973	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.5913	0.00728	0.3231:0.1253:0.2987:0.2529	.	.	.	.	.	-1	.	.	.	+	.	.	WDR17	177326792	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.362000	0.07602	-0.113000	0.11958	-0.282000	0.10007	.		0.323	WDR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362334.2		Intron
ICE1	23379	broad.mit.edu	37	5	5464525	5464525	+	Missense_Mutation	SNP	C	C	G			TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chr5:5464525C>G	ENST00000296564.7	+	13	5300	c.5078C>G	c.(5077-5079)cCt>cGt	p.P1693R		NM_015325.2	NP_056140.1	Q9Y2F5	ICE1_HUMAN		1693	Pro-rich.				positive regulation of intracellular protein transport (GO:0090316)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	protein homodimerization activity (GO:0042803)	p.P1693R(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)	35						CGTGCCTCTCCTCCAGATCCT	0.607																																																1	Substitution - Missense(1)	ovary(1)	5											105.0	109.0	108.0					5																	5464525		2081	4212	6293	5517525	SO:0001583	missense	23379																														ENST00000296564.7:c.5078C>G	5.37:g.5464525C>G	ENSP00000296564:p.Pro1693Arg		5517525	Q68DE1|Q6ZT40|Q7L587|Q7Z3A9|Q9NTH9	Missense_Mutation	SNP	ENST00000296564.7	37	CCDS47187.1	.	.	.	.	.	.	.	.	.	.	C	14.42	2.530979	0.45073	.	.	ENSG00000164151	ENST00000296564	T	0.12879	2.64	5.05	4.18	0.49190	.	.	.	.	.	T	0.30070	0.0753	L	0.54323	1.7	0.09310	N	0.999995	D	0.76494	0.999	D	0.69479	0.964	T	0.05099	-1.0906	9	0.52906	T	0.07	-8.9272	11.2962	0.49280	0.0:0.9102:0.0:0.0898	.	1693	Q9Y2F5	K0947_HUMAN	R	1693	ENSP00000296564:P1693R	ENSP00000296564:P1693R	P	+	2	0	KIAA0947	5517525	0.907000	0.30839	0.019000	0.16419	0.015000	0.08874	4.035000	0.57297	1.126000	0.42016	0.460000	0.39030	CCT		0.607	KIAA0947-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365575.1		
SLC45A2	51151	broad.mit.edu	37	5	33954474	33954474	+	Missense_Mutation	SNP	T	T	A	rs143509333		TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	T	T	A	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chr5:33954474T>A	ENST00000296589.4	-	4	1170	c.1024A>T	c.(1024-1026)Atg>Ttg	p.M342L	SLC45A2_ENST00000382102.3_Missense_Mutation_p.M342L|SLC45A2_ENST00000345083.5_Missense_Mutation_p.M234L|SLC45A2_ENST00000509381.1_Missense_Mutation_p.H233L|SLC45A2_ENST00000342059.3_Missense_Mutation_p.M283L	NM_016180.3	NP_057264	Q9UMX9	S45A2_HUMAN	solute carrier family 45, member 2	342					developmental pigmentation (GO:0048066)|melanin biosynthetic process (GO:0042438)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)		p.M342L(1)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(25)|ovary(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	48						ACCTGGCCCATGAAATCTGTG	0.478																																					Ovarian(31;380 859 8490 22203 49048)											1	Substitution - Missense(1)	ovary(1)	5											170.0	128.0	142.0					5																	33954474		2203	4300	6503	33990231	SO:0001583	missense	51151			AF172849	CCDS3901.1, CCDS43308.1, CCDS75232.1	5p13.3	2013-08-06	2005-10-06	2005-10-06	ENSG00000164175	ENSG00000164175		"""Solute carriers"""	16472	protein-coding gene	gene with protein product		606202	"""membrane associated transporter"""	MATP		11916009, 11574907	Standard	NM_001012509		Approved	AIM-1, OCA4	uc003jid.3	Q9UMX9	OTTHUMG00000090719	ENST00000296589.4:c.1024A>T	5.37:g.33954474T>A	ENSP00000296589:p.Met342Leu		33990231	Q6P2P0|Q9BTM3	Missense_Mutation	SNP	ENST00000296589.4	37	CCDS3901.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	25.9|25.9	4.685389|4.685389	0.88639|0.88639	.|.	.|.	ENSG00000164175|ENSG00000164175	ENST00000509381|ENST00000296589;ENST00000342059;ENST00000382102;ENST00000510600;ENST00000345083	.|T;T;T;T;T	.|0.81247	.|-1.47;-1.47;-1.47;-1.47;-1.47	6.08|6.08	4.92|4.92	0.64577|0.64577	.|Major facilitator superfamily domain, general substrate transporter (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.89670|0.89670	0.6782|0.6782	M|M	0.88450|0.88450	2.955|2.955	0.30399|0.30399	N|N	0.780223|0.780223	P|D;P	0.39282|0.63046	0.666|0.992;0.616	B|D;P	0.35859|0.63793	0.212|0.918;0.579	D|D	0.88588|0.88588	0.3141|0.3141	7|10	.|0.66056	.|D	.|0.02	-31.156|-31.156	12.0888|12.0888	0.53713|0.53713	0.0:0.0666:0.0:0.9334|0.0:0.0666:0.0:0.9334	.|.	233|342;342	D6RGY6|Q9UMX9-4;Q9UMX9	.|.;S45A2_HUMAN	L|L	233|342;283;342;167;234	.|ENSP00000296589:M342L;ENSP00000341014:M283L;ENSP00000371534:M342L;ENSP00000424010:M167L;ENSP00000340444:M234L	.|ENSP00000296589:M342L	H|M	-|-	2|1	0|0	SLC45A2|SLC45A2	33990231|33990231	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	5.885000|5.885000	0.69736|0.69736	1.131000|1.131000	0.42111|0.42111	0.533000|0.533000	0.62120|0.62120	CAT|ATG		0.478	SLC45A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207443.2	NM_016180	
VCAN	1462	broad.mit.edu	37	5	82836875	82836875	+	Missense_Mutation	SNP	G	G	A	rs59948995		TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chr5:82836875G>A	ENST00000265077.3	+	8	8618	c.8053G>A	c.(8053-8055)Gtt>Att	p.V2685I	VCAN-AS1_ENST00000512090.1_RNA|VCAN_ENST00000513016.1_3'UTR|VCAN_ENST00000512590.2_Intron|VCAN_ENST00000502527.2_Intron|VCAN_ENST00000342785.4_Intron|VCAN-AS1_ENST00000513899.1_RNA|VCAN_ENST00000343200.5_Missense_Mutation_p.V1698I	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	2685	GAG-beta.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)	p.V2685I(1)		NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	AGAATTAGACGTTTTACTTCC	0.438													g|||	1	0.000199681	0.0	0.0	5008	,	,		21572	0.001		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	5											126.0	118.0	121.0					5																	82836875		2203	4299	6502	82872631	SO:0001583	missense	1462			X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.8053G>A	5.37:g.82836875G>A	ENSP00000265077:p.Val2685Ile		82872631	P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Missense_Mutation	SNP	ENST00000265077.3	37	CCDS4060.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	g	0.006	-2.053883	0.00390	.	.	ENSG00000038427	ENST00000265077;ENST00000343200	T;T	0.28255	1.62;1.62	6.17	-4.28	0.03732	.	1.004860	0.08000	N	0.988684	T	0.07638	0.0192	N	0.01705	-0.755	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.31223	-0.9951	10	0.07644	T	0.81	.	2.2566	0.04057	0.3658:0.215:0.3138:0.1054	rs59948995	1698;2685	P13611-2;P13611	.;CSPG2_HUMAN	I	2685;1698	ENSP00000265077:V2685I;ENSP00000340062:V1698I	ENSP00000265077:V2685I	V	+	1	0	VCAN	82872631	0.013000	0.17824	0.001000	0.08648	0.012000	0.07955	0.101000	0.15251	-0.617000	0.05664	-1.254000	0.01491	GTT		0.438	VCAN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254092.3	NM_004385	
IMPG1	3617	broad.mit.edu	37	6	76728498	76728498	+	Silent	SNP	C	C	T			TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chr6:76728498C>T	ENST00000369950.3	-	7	933	c.744G>A	c.(742-744)aaG>aaA	p.K248K	IMPG1_ENST00000369963.3_3'UTR	NM_001282368.1|NM_001563.2	NP_001269297.1|NP_001554.2			interphotoreceptor matrix proteoglycan 1									p.K248K(1)		breast(5)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(8)|lung(27)|ovary(2)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	63		Acute lymphoblastic leukemia(125;0.0418)|all_hematologic(105;0.222)				CGAGCTCTGCCTTGAACTTCT	0.493																																					Pancreas(37;839 1141 2599 26037)											1	Substitution - coding silent(1)	ovary(1)	6											124.0	114.0	118.0					6																	76728498		2203	4300	6503	76785218	SO:0001819	synonymous_variant	3617			AF017776	CCDS4985.1, CCDS75483.1	6q14.2-q15	2008-02-05	2004-05-25		ENSG00000112706	ENSG00000112706			6055	protein-coding gene	gene with protein product		602870	"""sialoprotein associated with cones and rods"""	SPACR			Standard	NM_001282368		Approved	IPM150, GP147	uc003pik.1	Q17R60	OTTHUMG00000015063	ENST00000369950.3:c.744G>A	6.37:g.76728498C>T			76785218		Silent	SNP	ENST00000369950.3	37	CCDS4985.1																																																																																				0.493	IMPG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041288.1	NM_001563	
ZBTB24	9841	broad.mit.edu	37	6	109796641	109796641	+	Missense_Mutation	SNP	C	C	A			TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chr6:109796641C>A	ENST00000230122.3	-	5	1416	c.1249G>T	c.(1249-1251)Gat>Tat	p.D417Y		NM_001164313.1|NM_014797.2	NP_001157785.1|NP_055612.2	O43167	ZBT24_HUMAN	zinc finger and BTB domain containing 24	417					hematopoietic progenitor cell differentiation (GO:0002244)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.D417Y(1)		breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(9)|ovary(1)|pancreas(1)|skin(1)|stomach(1)	22		all_cancers(87;0.000189)|Acute lymphoblastic leukemia(125;3.07e-08)|all_hematologic(75;3.33e-06)|all_epithelial(87;0.00686)|Lung SC(18;0.0743)|Colorectal(196;0.101)|all_lung(197;0.149)		Epithelial(106;0.0154)|all cancers(137;0.0216)|OV - Ovarian serous cystadenocarcinoma(136;0.0242)|BRCA - Breast invasive adenocarcinoma(108;0.059)		TGAGACACATCCATGAATTTG	0.458																																																1	Substitution - Missense(1)	ovary(1)	6											225.0	183.0	197.0					6																	109796641		2203	4300	6503	109903334	SO:0001583	missense	9841			AB007901	CCDS34509.1	6q21	2014-09-17	2004-04-15	2004-04-16	ENSG00000112365	ENSG00000112365		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	21143	protein-coding gene	gene with protein product	"""POZ (BTB) and AT hook containing zinc finger 2"""	614064	"""zinc finger protein 450"""	ZNF450		9455477	Standard	NM_014797		Approved	KIAA0441, BIF1, PATZ2	uc003ptl.1	O43167	OTTHUMG00000015349	ENST00000230122.3:c.1249G>T	6.37:g.109796641C>A	ENSP00000230122:p.Asp417Tyr		109903334	Q17RC6|Q5TED5|Q8N455	Missense_Mutation	SNP	ENST00000230122.3	37	CCDS34509.1	.	.	.	.	.	.	.	.	.	.	C	29.5	5.008483	0.93346	.	.	ENSG00000112365	ENST00000230122	T	0.06449	3.3	6.17	6.17	0.99709	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.09686	0.0238	N	0.25031	0.7	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.46091	-0.9216	10	0.24483	T	0.36	-33.7729	20.8794	0.99867	0.0:1.0:0.0:0.0	.	417	O43167	ZBT24_HUMAN	Y	417	ENSP00000230122:D417Y	ENSP00000230122:D417Y	D	-	1	0	ZBTB24	109903334	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.336000	0.79245	2.941000	0.99782	0.655000	0.94253	GAT		0.458	ZBTB24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041758.1	NM_014797	
LAMA2	3908	broad.mit.edu	37	6	129641721	129641721	+	Missense_Mutation	SNP	G	G	T	rs573563174		TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chr6:129641721G>T	ENST00000421865.2	+	28	4146	c.4097G>T	c.(4096-4098)cGt>cTt	p.R1366L		NM_000426.3|NM_001079823.1	NP_000417|NP_001073291.1	P24043	LAMA2_HUMAN	laminin, alpha 2	1366	Laminin IV type A 2. {ECO:0000255|PROSITE-ProRule:PRU00458}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|myelination in peripheral nervous system (GO:0022011)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|sarcolemma (GO:0042383)	structural molecule activity (GO:0005198)	p.R1366L(1)		NS(2)|biliary_tract(2)|breast(10)|central_nervous_system(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(35)|lung(84)|ovary(10)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(2)	194				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		GAACAAGGACGTGGAACAACA	0.433													G|||	1	0.000199681	0.0	0.0	5008	,	,		18728	0.001		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	6											184.0	170.0	175.0					6																	129641721		2203	4300	6503	129683414	SO:0001583	missense	3908			Z26653	CCDS5138.1	6q22-q23	2014-09-17	2008-08-01		ENSG00000196569	ENSG00000196569		"""Laminins"""	6482	protein-coding gene	gene with protein product	"""merosin"", ""congenital muscular dystrophy"""	156225		LAMM		2185464, 8294519	Standard	NM_000426		Approved		uc003qbn.3	P24043	OTTHUMG00000015545	ENST00000421865.2:c.4097G>T	6.37:g.129641721G>T	ENSP00000400365:p.Arg1366Leu		129683414	Q14736|Q5VUM2|Q93022	Missense_Mutation	SNP	ENST00000421865.2	37	CCDS5138.1	.	.	.	.	.	.	.	.	.	.	G	7.576	0.667717	0.14710	.	.	ENSG00000196569	ENST00000358023;ENST00000354729;ENST00000421865	T	0.35236	1.32	5.27	-7.19	0.01500	Laminin B type IV (2);	1.618200	0.02661	N	0.107553	T	0.08088	0.0202	L	0.29908	0.895	0.09310	N	1	B;B	0.19331	0.035;0.035	B;B	0.22386	0.039;0.039	T	0.17198	-1.0377	10	0.33141	T	0.24	.	4.9748	0.14135	0.429:0.3284:0.1699:0.0727	.	1366;1366	A6NF00;P24043	.;LAMA2_HUMAN	L	1366	ENSP00000400365:R1366L	ENSP00000346769:R1366L	R	+	2	0	LAMA2	129683414	0.000000	0.05858	0.002000	0.10522	0.123000	0.20343	-3.091000	0.00609	-1.132000	0.02907	-0.251000	0.11542	CGT		0.433	LAMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042180.1		
AKAP9	10142	broad.mit.edu	37	7	91712945	91712945	+	Silent	SNP	G	G	A			TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chr7:91712945G>A	ENST00000359028.2	+	34	8883	c.8658G>A	c.(8656-8658)gtG>gtA	p.V2886V	AKAP9_ENST00000358100.2_Silent_p.V2886V|AKAP9_ENST00000356239.3_Silent_p.V2874V			Q99996	AKAP9_HUMAN	A kinase (PRKA) anchor protein 9	2886					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|Sertoli cell development (GO:0060009)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|synaptic transmission (GO:0007268)|transport (GO:0006810)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|pericentriolar material (GO:0000242)|voltage-gated potassium channel complex (GO:0008076)	ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|receptor binding (GO:0005102)	p.V2886V(1)|p.V2874V(1)		NS(1)|autonomic_ganglia(2)|breast(14)|central_nervous_system(3)|cervix(1)|endometrium(13)|kidney(12)|large_intestine(35)|lung(49)|ovary(8)|prostate(6)|skin(8)|stomach(1)|urinary_tract(2)	155	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			TGAAGGCAGTGATACAGTGTC	0.323			T	BRAF	papillary thyroid																																		Dom	yes		7	7q21-q22	10142	A kinase (PRKA) anchor protein (yotiao) 9		E	2	Substitution - coding silent(2)	ovary(2)	7											48.0	50.0	49.0					7																	91712945		2203	4300	6503	91550881	SO:0001819	synonymous_variant	10142			AF091711	CCDS5622.1	7q21-q22	2014-09-17	2013-09-25		ENSG00000127914	ENSG00000127914		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	379	protein-coding gene	gene with protein product	"""A-kinase anchoring protein 450"", ""AKAP9-BRAF fusion protein"", ""AKAP120-like protein"", ""centrosome- and golgi-localized protein kinase N-associated protein"", ""protein kinase A anchoring protein 9"", ""A-kinase anchor protein, 350kDa"", ""protein phosphatase 1, regulatory subunit 45"", ""yotiao"""	604001				9482789, 10390370, 24475373	Standard	NM_147185		Approved	KIAA0803, AKAP350, AKAP450, CG-NAP, YOTIAO, HYPERION, PRKA9, MU-RMS-40.16A, PPP1R45, LQT11	uc003ulg.3	Q99996	OTTHUMG00000131127	ENST00000359028.2:c.8658G>A	7.37:g.91712945G>A			91550881	A4D1F0|A4D1F2|A4D1F4|O14869|O43355|O94895|Q75N20|Q9UQH3|Q9UQQ4|Q9Y6B8|Q9Y6Y2	Silent	SNP	ENST00000359028.2	37																																																																																					0.323	AKAP9-202	KNOWN	basic	protein_coding	protein_coding		NM_005751	
CBLL1	79872	broad.mit.edu	37	7	107398982	107398982	+	Nonsense_Mutation	SNP	C	C	T			TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chr7:107398982C>T	ENST00000440859.3	+	6	1302	c.835C>T	c.(835-837)Cag>Tag	p.Q279*	CBLL1_ENST00000415884.2_3'UTR|CBLL1_ENST00000222597.2_Nonsense_Mutation_p.Q278*	NM_001284291.1|NM_024814.2	NP_001271220.1|NP_079090.2	Q75N03	HAKAI_HUMAN	Cbl proto-oncogene-like 1, E3 ubiquitin protein ligase	279	Pro-rich.				negative regulation of cell adhesion (GO:0007162)|positive regulation of cell migration (GO:0030335)|positive regulation of endocytosis (GO:0045807)|protein ubiquitination (GO:0016567)|single organismal cell-cell adhesion (GO:0016337)	ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.Q279*(1)		endometrium(2)|large_intestine(2)|lung(9)|ovary(2)|prostate(3)|skin(3)	21						ATCGGTCAGTCAGGAAACCTT	0.473																																																1	Substitution - Nonsense(1)	ovary(1)	7											82.0	81.0	81.0					7																	107398982		2203	4300	6503	107186218	SO:0001587	stop_gained	79872			AK026762	CCDS5747.1, CCDS64754.1	7q22.3	2013-07-09	2013-07-09		ENSG00000105879	ENSG00000105879		"""RING-type (C3HC4) zinc fingers"""	21225	protein-coding gene	gene with protein product	"""Casitas B-lineage lymphoma-like"""	606872	"""Cas-Br-M (murine) ecotropic retroviral transforming sequence-like 1"""			11836526, 11944035	Standard	NM_001284291		Approved	HAKAI, FLJ23109, RNF188	uc003veq.3	Q75N03	OTTHUMG00000154809	ENST00000440859.3:c.835C>T	7.37:g.107398982C>T	ENSP00000401277:p.Gln279*		107186218	B7ZM03|Q8TAJ4|Q9H5S6	Nonsense_Mutation	SNP	ENST00000440859.3	37	CCDS5747.1	.	.	.	.	.	.	.	.	.	.	C	18.18	3.565595	0.65651	.	.	ENSG00000105879	ENST00000440859;ENST00000535365;ENST00000222597;ENST00000420796	.	.	.	5.01	5.01	0.66863	.	0.065942	0.64402	D	0.000007	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.12103	T	0.63	-1.371	18.6833	0.91554	0.0:1.0:0.0:0.0	.	.	.	.	X	279;158;278;229	.	ENSP00000222597:Q278X	Q	+	1	0	CBLL1	107186218	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.798000	0.75155	2.498000	0.84270	0.491000	0.48974	CAG		0.473	CBLL1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337156.2	NM_024814	
PLXNA4	91584	broad.mit.edu	37	7	131825466	131825466	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chr7:131825466G>A	ENST00000359827.3	-	30	6292	c.5330C>T	c.(5329-5331)aCc>aTc	p.T1777I	PLXNA4_ENST00000321063.4_Missense_Mutation_p.T1777I			Q9HCM2	PLXA4_HUMAN	plexin A4	1777					anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)	p.T1777I(1)		NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						GTCCATGAAGGTCTGAGCCAC	0.542																																																1	Substitution - Missense(1)	ovary(1)	7											122.0	127.0	125.0					7																	131825466		2203	4300	6503	131476006	SO:0001583	missense	91584			AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.5330C>T	7.37:g.131825466G>A	ENSP00000352882:p.Thr1777Ile		131476006	A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Missense_Mutation	SNP	ENST00000359827.3	37	CCDS43646.1	.	.	.	.	.	.	.	.	.	.	G	29.6	5.018292	0.93404	.	.	ENSG00000221866	ENST00000321063;ENST00000359827	T;T	0.16457	2.34;2.34	5.11	5.11	0.69529	Plexin, cytoplasmic RasGAP domain (1);Rho GTPase activation protein (1);	0.050321	0.85682	D	0.000000	T	0.53769	0.1817	M	0.92833	3.35	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.66791	-0.5834	10	0.72032	D	0.01	.	18.5342	0.91004	0.0:0.0:1.0:0.0	.	1777	Q9HCM2	PLXA4_HUMAN	I	1777	ENSP00000323194:T1777I;ENSP00000352882:T1777I	ENSP00000323194:T1777I	T	-	2	0	PLXNA4	131476006	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.809000	0.99208	2.367000	0.80283	0.591000	0.81541	ACC		0.542	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338422.2	NM_181775	
NUDCD1	84955	broad.mit.edu	37	8	110293378	110293378	+	Missense_Mutation	SNP	T	T	A			TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	T	T	A	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chr8:110293378T>A	ENST00000239690.4	-	6	1221	c.847A>T	c.(847-849)Act>Tct	p.T283S	NUDCD1_ENST00000427660.2_Missense_Mutation_p.T254S	NM_032869.3	NP_116258.2			NudC domain containing 1									p.T283S(1)		breast(1)|kidney(1)|large_intestine(4)|lung(15)|ovary(1)|prostate(2)|skin(1)	25	all_neural(195;0.219)		OV - Ovarian serous cystadenocarcinoma(57;1.56e-12)			TCATCTTCAGTCTGTTGCCAG	0.353																																																1	Substitution - Missense(1)	ovary(1)	8											110.0	99.0	103.0					8																	110293378		2203	4300	6503	110362554	SO:0001583	missense	84955			AF283302	CCDS6312.1, CCDS47910.1	8q23	2005-02-07			ENSG00000120526	ENSG00000120526			24306	protein-coding gene	gene with protein product		606109				11416219	Standard	NM_032869		Approved	CML66, FLJ14991	uc003ynb.4	Q96RS6	OTTHUMG00000164931	ENST00000239690.4:c.847A>T	8.37:g.110293378T>A	ENSP00000239690:p.Thr283Ser		110362554		Missense_Mutation	SNP	ENST00000239690.4	37	CCDS6312.1	.	.	.	.	.	.	.	.	.	.	T	17.35	3.367010	0.61513	.	.	ENSG00000120526	ENST00000239690;ENST00000427660	T;T	0.78003	-1.14;-1.14	5.25	5.25	0.73442	CS-like domain (1);CS domain (1);HSP20-like chaperone (1);	0.048354	0.85682	N	0.000000	T	0.76744	0.4030	L	0.39566	1.225	0.46542	D	0.999092	B;B;B	0.31893	0.321;0.345;0.086	B;B;B	0.43360	0.369;0.417;0.067	T	0.74518	-0.3639	10	0.33940	T	0.23	-5.8411	14.3419	0.66633	0.0:0.0:0.0:1.0	.	196;283;254	Q96RS6-3;Q96RS6;Q96RS6-2	.;NUDC1_HUMAN;.	S	283;254	ENSP00000239690:T283S;ENSP00000410707:T254S	ENSP00000239690:T283S	T	-	1	0	NUDCD1	110362554	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	5.800000	0.69108	1.980000	0.57719	0.528000	0.53228	ACT		0.353	NUDCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380996.1	NM_032869	
CYP11B1	1584	broad.mit.edu	37	8	143960518	143960518	+	Missense_Mutation	SNP	G	G	T			TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chr8:143960518G>T	ENST00000292427.4	-	2	357	c.325C>A	c.(325-327)Cac>Aac	p.H109N	CYP11B1_ENST00000377675.3_Missense_Mutation_p.H154N|CYP11B1_ENST00000517471.1_Missense_Mutation_p.H109N	NM_000497.3	NP_000488.3	P15538	C11B1_HUMAN	cytochrome P450, family 11, subfamily B, polypeptide 1	109					aldosterone biosynthetic process (GO:0032342)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|glucocorticoid biosynthetic process (GO:0006704)|glucose homeostasis (GO:0042593)|immune response (GO:0006955)|mineralocorticoid biosynthetic process (GO:0006705)|regulation of blood pressure (GO:0008217)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid 11-beta-monooxygenase activity (GO:0004507)	p.H109N(1)		central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(10)|lung(36)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	67	all_cancers(97;4.74e-11)|all_epithelial(106;2.06e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Cimetidine(DB00501)|Clotrimazole(DB00257)|Etomidate(DB00292)|Fluconazole(DB00196)|Hydrocortisone(DB00741)|Ketoconazole(DB01026)|Metoclopramide(DB01233)|Metyrapone(DB01011)|Miconazole(DB01110)|Mitotane(DB00648)|Phenytoin(DB00252)|Spironolactone(DB00421)	CTCATCCTGTGGGGATGCAGG	0.612									Familial Hyperaldosteronism type I																																							1	Substitution - Missense(1)	ovary(1)	8											204.0	147.0	166.0					8																	143960518		2203	4300	6503	143957520	SO:0001583	missense	1584	Familial Cancer Database	Dexamethasone Sensitive Aldosteronism, FH-I	D16153	CCDS6392.1, CCDS34953.1	8q21-q22	2013-06-19	2003-01-14		ENSG00000160882	ENSG00000160882	1.14.15.4	"""Cytochrome P450s"""	2591	protein-coding gene	gene with protein product	"""steroid 11-beta-monooxygenase"""	610613	"""cytochrome P450, subfamily XIB (steroid 11-beta-hydroxylase), polypeptide 1"""	CYP11B		1303253	Standard	XM_005250807		Approved	P450C11, FHI, CPN1	uc003yxi.3	P15538	OTTHUMG00000164637	ENST00000292427.4:c.325C>A	8.37:g.143960518G>T	ENSP00000292427:p.His109Asn		143957520	Q14095|Q4VAQ8|Q4VAQ9|Q9UML2	Missense_Mutation	SNP	ENST00000292427.4	37	CCDS6392.1	.	.	.	.	.	.	.	.	.	.	G	9.750	1.167300	0.21621	.	.	ENSG00000160882	ENST00000292427;ENST00000517471;ENST00000377675	T;T;T	0.74106	-0.25;-0.25;-0.81	3.55	-4.21	0.03812	.	1.324690	0.05515	N	0.561121	T	0.54255	0.1847	N	0.17474	0.49	0.09310	N	1	B;B;B	0.20164	0.024;0.042;0.022	B;B;B	0.32022	0.039;0.139;0.068	T	0.40001	-0.9586	10	0.15952	T	0.53	.	3.0777	0.06252	0.3385:0.0:0.3575:0.304	.	154;109;109	Q4VAR0;Q4VAQ9;P15538	.;.;C11B1_HUMAN	N	109;109;154	ENSP00000292427:H109N;ENSP00000428043:H109N;ENSP00000366903:H154N	ENSP00000292427:H109N	H	-	1	0	CYP11B1	143957520	0.000000	0.05858	0.000000	0.03702	0.064000	0.16182	-0.512000	0.06313	-1.295000	0.02357	0.484000	0.47621	CAC		0.612	CYP11B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379475.2		
IFNA13	3447	broad.mit.edu	37	9	21367973	21367973	+	Missense_Mutation	SNP	C	C	A			TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chr9:21367973C>A	ENST00000449498.1	-	1	102	c.37G>T	c.(37-39)Gtg>Ttg	p.V13L		NM_006900.3	NP_008831.3	P01562	IFNA1_HUMAN	interferon, alpha 13	12					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|natural killer cell activation involved in immune response (GO:0002323)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to exogenous dsRNA (GO:0043330)|T cell activation involved in immune response (GO:0002286)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|type I interferon receptor binding (GO:0005132)	p.V12L(1)		breast(2)|large_intestine(2)|lung(1)|ovary(2)|prostate(1)|skin(1)	9				Lung(24;7.66e-27)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.0173)		CTGAGCACCACCAGGGCCATC	0.542																																																1	Substitution - Missense(1)	ovary(1)	9											85.0	93.0	90.0					9																	21367973		2202	4300	6502	21357973	SO:0001583	missense	3447				CCDS6505.2	9p22	2010-12-10			ENSG00000233816	ENSG00000233816		"""Interferons"""	5419	protein-coding gene	gene with protein product		147578				1385305	Standard	NM_006900		Approved		uc003zpa.2	P01562	OTTHUMG00000019675	ENST00000449498.1:c.37G>T	9.37:g.21367973C>A	ENSP00000394494:p.Val13Leu		21357973	D4Q9M8|Q14605|Q2M1L8|Q52LB8|Q5VYQ2|Q7M4Q1|Q8WZ68|Q9UMJ3	Missense_Mutation	SNP	ENST00000449498.1	37	CCDS6505.2	.	.	.	.	.	.	.	.	.	.	C	8.025	0.760569	0.15914	.	.	ENSG00000233816	ENST00000449498	T	0.03242	4.0	2.56	0.344	0.16006	.	0.851240	0.09947	N	0.735178	T	0.04363	0.0120	L	0.53617	1.68	0.09310	N	1	B	0.12630	0.006	B	0.15870	0.014	T	0.41574	-0.9501	10	0.38643	T	0.18	.	4.782	0.13206	0.0:0.3971:0.4564:0.1465	.	13	E9PB07	.	L	13	ENSP00000394494:V13L	ENSP00000394494:V13L	V	-	1	0	IFNA13	21357973	0.000000	0.05858	0.003000	0.11579	0.143000	0.21401	-0.404000	0.07205	-0.057000	0.13199	0.313000	0.20887	GTG		0.542	IFNA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051904.2	NM_006900	
GBA2	57704	broad.mit.edu	37	9	35751705	35751705	+	5'Flank	SNP	T	T	C			TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chr9:35751705T>C	ENST00000378103.3	-	0	0				GBA2_ENST00000378094.4_5'Flank|GBA2_ENST00000545786.1_5'Flank|RGP1_ENST00000378078.4_Missense_Mutation_p.V239A|RGP1_ENST00000456972.2_Missense_Mutation_p.V279A|MSMP_ENST00000414286.1_5'Flank	NM_020944.2	NP_065995.1	Q9HCG7	GBA2_HUMAN	glucosidase, beta (bile acid) 2						bile acid metabolic process (GO:0008206)|cell death (GO:0008219)|central nervous system neuron development (GO:0021954)|glucosylceramide catabolic process (GO:0006680)|glycoside catabolic process (GO:0016139)|glycosphingolipid metabolic process (GO:0006687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|smooth endoplasmic reticulum (GO:0005790)	beta-glucosidase activity (GO:0008422)|glucosylceramidase activity (GO:0004348)	p.V279A(1)		NS(1)|kidney(3)|large_intestine(5)|lung(5)|ovary(4)|skin(3)	21	all_epithelial(49;0.167)		Lung(28;0.00416)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			GGCGAGGACGTGGTGGGGACC	0.512																																																1	Substitution - Missense(1)	ovary(1)	9											104.0	104.0	104.0					9																	35751705		1972	4147	6119	35741705	SO:0001631	upstream_gene_variant	9827			AJ309567	CCDS6589.1	9p13.2	2013-09-11			ENSG00000070610	ENSG00000070610			18986	protein-coding gene	gene with protein product	"""bile acid beta-glucosidase"", ""non-lysosomal glucosylceramidase"""	609471	"""spastic paraplegia 46 (autosomal recessive)"""	SPG46		11489889, 23332916, 23332917	Standard	NM_020944		Approved	KIAA1605, AD035, DKFZp762K054	uc003zxw.3	Q9HCG7	OTTHUMG00000021024		9.37:g.35751705T>C	Exception_encountered		35741705	D3DRP2|Q5TCV6|Q96A51|Q96LY1|Q96SJ2|Q9H2L8	Missense_Mutation	SNP	ENST00000378103.3	37	CCDS6589.1	.	.	.	.	.	.	.	.	.	.	T	21.9	4.220951	0.79464	.	.	ENSG00000107185	ENST00000456972;ENST00000378078	.	.	.	5.58	5.58	0.84498	.	0.112106	0.64402	D	0.000009	T	0.74997	0.3790	M	0.70595	2.14	0.54753	D	0.999986	P;P	0.43578	0.811;0.811	P;P	0.56042	0.79;0.79	T	0.76785	-0.2831	9	0.56958	D	0.05	-5.0839	14.9494	0.71060	0.0:0.0:0.0:1.0	.	239;239	Q92546;A8K0K1	RGP1_HUMAN;.	A	279;239	.	ENSP00000367318:V239A	V	+	2	0	RGP1	35741705	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.859000	0.75467	2.132000	0.65825	0.454000	0.30748	GTG		0.512	GBA2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000055456.1	NM_020944	
FRMPD1	22844	broad.mit.edu	37	9	37733549	37733549	+	Missense_Mutation	SNP	A	A	G			TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chr9:37733549A>G	ENST00000539465.1	+	11	1668	c.1075A>G	c.(1075-1077)Agc>Ggc	p.S359G	FRMPD1_ENST00000377765.3_Missense_Mutation_p.S359G|FRMPD1_ENST00000536622.1_Missense_Mutation_p.S181G|FRMPD1_ENST00000541302.1_Missense_Mutation_p.S228G|RP11-613M10.9_ENST00000540557.1_Intron			Q5SYB0	FRPD1_HUMAN	FERM and PDZ domain containing 1	359	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.					cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)		p.S359G(1)		NS(3)|breast(2)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(22)|lung(34)|ovary(5)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	93				GBM - Glioblastoma multiforme(29;0.00655)		GAAAGCCATTAGCTTCCACAT	0.468																																																1	Substitution - Missense(1)	ovary(1)	9											85.0	84.0	84.0					9																	37733549		2203	4300	6503	37723549	SO:0001583	missense	22844			AB023184	CCDS6612.1	9p13.1	2008-02-05			ENSG00000070601	ENSG00000070601			29159	protein-coding gene	gene with protein product						10231032	Standard	NM_014907		Approved	KIAA0967, FRMD2	uc004aag.1	Q5SYB0	OTTHUMG00000019927	ENST00000539465.1:c.1075A>G	9.37:g.37733549A>G	ENSP00000444411:p.Ser359Gly		37723549	B4DZC8|B7Z807|D3DRQ3|Q14C73|Q5HY96|Q9Y2H3	Missense_Mutation	SNP	ENST00000539465.1	37	CCDS6612.1	.	.	.	.	.	.	.	.	.	.	A	14.81	2.647318	0.47258	.	.	ENSG00000070601	ENST00000377765;ENST00000539465;ENST00000536622;ENST00000541302	T;T;T;T	0.79352	-1.26;-1.26;-1.26;-1.26	5.64	5.64	0.86602	Band 4.1 domain (1);FERM central domain (2);FERM domain (1);	0.134911	0.64402	D	0.000002	T	0.79370	0.4434	L	0.52905	1.665	0.54753	D	0.999986	B;P	0.37612	0.077;0.602	B;P	0.45343	0.093;0.477	T	0.80795	-0.1223	10	0.62326	D	0.03	-11.9237	13.8044	0.63220	1.0:0.0:0.0:0.0	.	228;359	B4DZC8;Q5SYB0	.;FRPD1_HUMAN	G	359;359;181;228	ENSP00000366995:S359G;ENSP00000444411:S359G;ENSP00000437762:S181G;ENSP00000444804:S228G	ENSP00000366995:S359G	S	+	1	0	FRMPD1	37723549	1.000000	0.71417	0.994000	0.49952	0.993000	0.82548	3.984000	0.56923	2.153000	0.67306	0.533000	0.62120	AGC		0.468	FRMPD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402969.1	NM_014907	
CEP78	84131	broad.mit.edu	37	9	80881399	80881399	+	Silent	SNP	C	C	T			TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chr9:80881399C>T	ENST00000424347.2	+	15	2128	c.1839C>T	c.(1837-1839)ctC>ctT	p.L613L	CEP78_ENST00000376597.4_Silent_p.L630L|CEP78_ENST00000415759.2_Silent_p.L614L|CEP78_ENST00000277082.5_Silent_p.L613L|CEP78_ENST00000376598.2_Silent_p.L629L			Q5JTW2	CEP78_HUMAN	centrosomal protein 78kDa	613					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytosol (GO:0005829)		p.L613L(1)		breast(1)|cervix(1)|endometrium(5)|large_intestine(7)|lung(4)|ovary(1)|stomach(1)|urinary_tract(1)	21						CTTTGCCTCTCGACTCCTTTC	0.428																																																1	Substitution - coding silent(1)	ovary(1)	9											59.0	58.0	59.0					9																	80881399		1865	4091	5956	80071219	SO:0001819	synonymous_variant	84131			BC058931	CCDS47984.1, CCDS47985.1	9q21.2	2014-02-20	2005-12-01	2005-12-01	ENSG00000148019	ENSG00000148019			25740	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 81"""	C9orf81		14654843	Standard	NM_001098802		Approved	FLJ12643	uc004aky.4	Q5JTW2	OTTHUMG00000020062	ENST00000424347.2:c.1839C>T	9.37:g.80881399C>T			80071219	A1A4S8|E9PHX5|Q5BJE3|Q5JTW0|Q5JTW1|Q9H9N3	Silent	SNP	ENST00000424347.2	37																																																																																					0.428	CEP78-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000052766.2	XM_095991	
SPTAN1	6709	broad.mit.edu	37	9	131329147	131329147	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chr9:131329147C>T	ENST00000372731.4	+	2	238	c.128C>T	c.(127-129)tCc>tTc	p.S43F	SPTAN1_ENST00000358161.5_Missense_Mutation_p.S43F|SPTAN1_ENST00000372739.3_Missense_Mutation_p.S43F	NM_001195532.1|NM_003127.3	NP_001182461.1|NP_003118.2	Q13813	SPTN1_HUMAN	spectrin, alpha, non-erythrocytic 1	43					actin filament capping (GO:0051693)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cuticular plate (GO:0032437)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intracellular membrane-bounded organelle (GO:0043231)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|spectrin (GO:0008091)|vesicle (GO:0031982)|Z disc (GO:0030018)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)	p.S43F(1)		NS(2)|breast(8)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(21)|liver(1)|lung(25)|ovary(5)|pancreas(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	87						CTGGAAGATTCCTATCGATTC	0.473																																					NSCLC(120;833 1744 2558 35612 37579)											1	Substitution - Missense(1)	ovary(1)	9											94.0	93.0	94.0					9																	131329147		2203	4300	6503	130368968	SO:0001583	missense	6709			M19725	CCDS6905.1, CCDS48036.1, CCDS75914.1	9q34.11	2013-01-10	2012-06-15		ENSG00000197694	ENSG00000197694		"""EF-hand domain containing"""	11273	protein-coding gene	gene with protein product	"""alpha-fodrin"""	182810				3336352	Standard	NM_003127		Approved		uc004bvm.4	Q13813	OTTHUMG00000020754	ENST00000372731.4:c.128C>T	9.37:g.131329147C>T	ENSP00000361816:p.Ser43Phe		130368968	Q13186|Q15324|Q16606|Q59EF1|Q5VXV5|Q5VXV6|Q7Z6M5|Q9P0V0	Missense_Mutation	SNP	ENST00000372731.4	37	CCDS6905.1	.	.	.	.	.	.	.	.	.	.	C	27.7	4.856658	0.91433	.	.	ENSG00000197694	ENST00000358161;ENST00000372731;ENST00000372739;ENST00000372719	T;T;T	0.36699	1.24;1.24;1.24	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	T	0.65375	0.2685	M	0.82517	2.595	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;0.968;1.0	D;D;D;P;D	0.77557	0.99;0.99;0.976;0.804;0.98	T	0.69427	-0.5148	10	0.87932	D	0	.	18.775	0.91908	0.0:1.0:0.0:0.0	.	43;43;43;43;43	A6NG51;B4DTV8;Q13813-3;Q13813-2;Q13813	.;.;.;.;SPTA2_HUMAN	F	43	ENSP00000350882:S43F;ENSP00000361816:S43F;ENSP00000361824:S43F	ENSP00000350882:S43F	S	+	2	0	SPTAN1	130368968	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.400000	0.79949	2.742000	0.94016	0.655000	0.94253	TCC		0.473	SPTAN1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054472.1	NM_003127	
ADAMTS13	11093	broad.mit.edu	37	9	136303450	136303450	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chr9:136303450C>T	ENST00000371929.3	+	14	2113	c.1669C>T	c.(1669-1671)Cca>Tca	p.P557S	ADAMTS13_ENST00000356589.2_Missense_Mutation_p.P526S|ADAMTS13_ENST00000485925.1_Intron|ADAMTS13_ENST00000355699.2_Missense_Mutation_p.P557S|ADAMTS13_ENST00000536611.1_Missense_Mutation_p.P229S|ADAMTS13_ENST00000371916.1_3'UTR	NM_139025.3|NM_139027.3	NP_620594.1|NP_620596.2	Q76LX8	ATS13_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 13	557	Spacer.				cell-matrix adhesion (GO:0007160)|glycoprotein metabolic process (GO:0009100)|integrin-mediated signaling pathway (GO:0007229)|peptide catabolic process (GO:0043171)|platelet activation (GO:0030168)|protein processing (GO:0016485)|proteolysis (GO:0006508)|response to interferon-gamma (GO:0034341)|response to interleukin-4 (GO:0070670)|response to tumor necrosis factor (GO:0034612)	cell surface (GO:0009986)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.P557S(1)		central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(13)|ovary(2)|prostate(3)|skin(4)	36				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)		CACGTGCAGCCCACGGAAGGG	0.627																																																1	Substitution - Missense(1)	ovary(1)	9											119.0	101.0	107.0					9																	136303450		2203	4300	6503	135293271	SO:0001583	missense	11093			AJ011374	CCDS6970.1, CCDS6971.1, CCDS6972.1	9q34	2008-07-21	2005-08-19	2001-09-21	ENSG00000160323	ENSG00000160323		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	1366	protein-coding gene	gene with protein product		604134	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 13"""	C9orf8		11557746, 11535495	Standard	NM_139025		Approved	VWFCP, TTP, vWF-CP, FLJ42993, MGC118899, MGC118900, DKFZp434C2322	uc004cdv.4	Q76LX8	OTTHUMG00000020876	ENST00000371929.3:c.1669C>T	9.37:g.136303450C>T	ENSP00000360997:p.Pro557Ser		135293271	Q6UY16|Q710F6|Q711T8|Q96L37|Q9H0G3|Q9UGQ1	Missense_Mutation	SNP	ENST00000371929.3	37	CCDS6970.1	.	.	.	.	.	.	.	.	.	.	C	1.598	-0.527326	0.04141	.	.	ENSG00000160323	ENST00000371929;ENST00000355699;ENST00000356589;ENST00000536611	T;T;T;T	0.67171	-0.21;-0.25;-0.23;0.2	4.8	1.63	0.23807	.	.	.	.	.	T	0.40222	0.1108	N	0.20401	0.57	0.09310	N	1	B;B;B	0.21225	0.023;0.053;0.051	B;B;B	0.10450	0.003;0.005;0.005	T	0.22277	-1.0221	9	0.07990	T	0.79	.	1.7734	0.03016	0.2969:0.3438:0.2507:0.1086	.	557;526;557	Q76LX8;Q76LX8-3;Q76LX8-2	ATS13_HUMAN;.;.	S	557;557;526;229	ENSP00000360997:P557S;ENSP00000347927:P557S;ENSP00000348997:P526S;ENSP00000444504:P229S	ENSP00000347927:P557S	P	+	1	0	ADAMTS13	135293271	0.000000	0.05858	0.107000	0.21349	0.739000	0.42172	-0.710000	0.05024	0.961000	0.38030	0.561000	0.74099	CCA		0.627	ADAMTS13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000054920.1	NM_139025	
UBA1	7317	broad.mit.edu	37	X	47065672	47065672	+	Silent	SNP	C	C	G			TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chrX:47065672C>G	ENST00000335972.6	+	16	1950	c.1767C>G	c.(1765-1767)gtC>gtG	p.V589V	INE1_ENST00000456273.1_RNA|UBA1_ENST00000490869.1_3'UTR|UBA1_ENST00000377269.3_5'Flank|UBA1_ENST00000377351.4_Silent_p.V589V	NM_003334.3	NP_003325.2	P22314	UBA1_HUMAN	ubiquitin-like modifier activating enzyme 1	589	2 approximate repeats.				cell death (GO:0008219)|cellular response to DNA damage stimulus (GO:0006974)|modification-dependent protein catabolic process (GO:0019941)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|ubiquitin activating enzyme activity (GO:0004839)|ubiquitin-protein transferase activity (GO:0004842)	p.V589V(1)		breast(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						GCCGCTGTGTCTACTACCGGA	0.562																																																1	Substitution - coding silent(1)	ovary(1)	X											56.0	35.0	42.0					X																	47065672		2203	4299	6502	46950616	SO:0001819	synonymous_variant	7317			AF258566	CCDS14275.1	Xp11.23	2014-08-13	2007-11-30	2007-11-30	ENSG00000130985	ENSG00000130985	6.3.2.19	"""Ubiquitin-like modifier activating enzymes"""	12469	protein-coding gene	gene with protein product	"""UBA1, ubiquitin-activating enzyme E1 homolog (yeast)"", ""POC20 centriolar protein homolog (Chlamydomonas)"""	314370	"""ubiquitin-activating enzyme E1 (A1S9T and BN75 temperature sensitivity complementing)"", ""ubiquitin-activating enzyme E1"""	A1S9T, GXP1, UBE1		1845793	Standard	NM_153280		Approved	UBE1X, POC20, CFAP124	uc004dhj.4	P22314	OTTHUMG00000021436	ENST00000335972.6:c.1767C>G	X.37:g.47065672C>G			46950616	Q5JRR8|Q96E13	Silent	SNP	ENST00000335972.6	37	CCDS14275.1																																																																																				0.562	UBA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056389.1	NM_003334	
ARMCX3	51566	broad.mit.edu	37	X	100880256	100880256	+	Missense_Mutation	SNP	C	C	G			TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chrX:100880256C>G	ENST00000341189.4	+	5	1153	c.287C>G	c.(286-288)gCc>gGc	p.A96G	ARMCX3_ENST00000471229.2_Missense_Mutation_p.A96G|ARMCX3_ENST00000537169.1_Missense_Mutation_p.A96G|ARMCX3-AS1_ENST00000454228.1_RNA|RP4-545K15.5_ENST00000564612.1_RNA	NM_016607.3	NP_057691.1	Q9UH62	ARMX3_HUMAN	armadillo repeat containing, X-linked 3	96					cellular protein localization (GO:0034613)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	integral component of mitochondrial outer membrane (GO:0031307)		p.A96G(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(2)	11						agggcaagggccagggctaCC	0.547																																																1	Substitution - Missense(1)	ovary(1)	X											59.0	58.0	58.0					X																	100880256		2202	4300	6502	100766912	SO:0001583	missense	51566			AY359079	CCDS14489.1	Xq22.1	2014-03-21			ENSG00000102401	ENSG00000102401		"""Armadillo repeat containing"""	24065	protein-coding gene	gene with protein product		300364				11162520, 11042152, 19304657, 16221301, 22569362	Standard	NM_016607		Approved	ALEX3, GASP6	uc004eia.1	Q9UH62	OTTHUMG00000022035	ENST00000341189.4:c.287C>G	X.37:g.100880256C>G	ENSP00000340672:p.Ala96Gly		100766912	Q53HC6|Q7LCF5|Q9NPE4	Missense_Mutation	SNP	ENST00000341189.4	37	CCDS14489.1	.	.	.	.	.	.	.	.	.	.	C	7.989	0.752978	0.15778	.	.	ENSG00000102401	ENST00000341189;ENST00000537169	T;T	0.21543	2.0;2.0	3.98	3.98	0.46160	.	0.527792	0.18411	N	0.142045	T	0.09158	0.0226	N	0.08118	0	0.29676	N	0.842061	D	0.53885	0.963	B	0.37989	0.262	T	0.04650	-1.0936	9	.	.	.	-4.8817	10.5278	0.44958	0.0:1.0:0.0:0.0	.	96	Q9UH62	ARMX3_HUMAN	G	96	ENSP00000340672:A96G;ENSP00000439032:A96G	.	A	+	2	0	ARMCX3	100766912	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	3.018000	0.49625	2.244000	0.73946	0.594000	0.82650	GCC		0.547	ARMCX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057568.2	NM_016607	
PHF6	84295	broad.mit.edu	37	X	133549045	133549045	+	Splice_Site	SNP	G	G	C			TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chrX:133549045G>C	ENST00000332070.3	+	8	931		c.e8-1		PHF6_ENST00000416404.2_Splice_Site|PHF6_ENST00000370803.3_Splice_Site|PHF6_ENST00000394292.1_Splice_Site|PHF6_ENST00000370800.4_Splice_Site|PHF6_ENST00000370799.1_Splice_Site	NM_032458.2	NP_115834.1	Q8IWS0	PHF6_HUMAN	PHD finger protein 6						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone binding (GO:0042393)|histone deacetylase binding (GO:0042826)|phosphoprotein binding (GO:0051219)|poly(A) RNA binding (GO:0044822)|ribonucleoprotein complex binding (GO:0043021)|scaffold protein binding (GO:0097110)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)	p.?(2)		cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(88)|kidney(2)|large_intestine(1)|liver(1)|lung(6)|ovary(1)|skin(1)|urinary_tract(1)	103	Acute lymphoblastic leukemia(192;0.000127)					TTCTTCTCTAGTTGTTTTCTT	0.323			"""F, N, Splice, Mis"""		ETP ALL																																Colon(100;666 1493 6344 21231 35807)		Rec	yes		X	Xq26.3	84295	PHD finger protein 6		L	2	Unknown(2)	ovary(1)|haematopoietic_and_lymphoid_tissue(1)	X											34.0	34.0	34.0					X																	133549045		2202	4295	6497	133376711	SO:0001630	splice_region_variant	84295			AB058726	CCDS14639.1, CCDS14640.1	Xq26	2014-09-17			ENSG00000156531	ENSG00000156531		"""Zinc fingers, PHD-type"""	18145	protein-coding gene	gene with protein product	"""centromere protein 31"""	300414	"""Borjeson-Forssman-Lehmann syndrome"""	BFLS, BORJ		12415272, 15466013	Standard	NM_032335		Approved	KIAA1823, MGC14797, CENP-31	uc004exk.3	Q8IWS0	OTTHUMG00000022453	ENST00000332070.3:c.730-1G>C	X.37:g.133549045G>C			133376711	A8K230|B4E0G4|D3DTG3|E9PC97|Q5JRC7|Q5JRC8|Q96JK3|Q9BRU0	Splice_Site	SNP	ENST00000332070.3	37	CCDS14639.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.108429	0.77096	.	.	ENSG00000156531	ENST00000370803;ENST00000332070;ENST00000394292;ENST00000370799;ENST00000416404;ENST00000370800	.	.	.	5.42	5.42	0.78866	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.4048	0.87470	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PHF6	133376711	1.000000	0.71417	0.998000	0.56505	0.957000	0.61999	9.420000	0.97426	2.410000	0.81850	0.594000	0.82650	.		0.323	PHF6-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000058367.1	NM_032458	Intron
TKTL1	8277	broad.mit.edu	37	X	153524340	153524340	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2012-01A-01W-0722-08	TCGA-61-2012-11A-01W-0722-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	06baadc5-c314-4f1c-a297-1e83c83b2ac6	6c3d5efc-f530-4461-8a41-e9881f21d812	g.chrX:153524340G>A	ENST00000369915.3	+	1	317	c.128G>A	c.(127-129)aGc>aAc	p.S43N	TEX28_ENST00000369926.1_5'Flank|TKTL1_ENST00000217905.7_5'UTR	NM_001145933.1|NM_012253.3	NP_001139405.1|NP_036385.3	P51854	TKTL1_HUMAN	transketolase-like 1	43					glucose catabolic process (GO:0006007)|thiamine metabolic process (GO:0006772)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|transketolase activity (GO:0004802)	p.S43N(1)		NS(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(5)|prostate(1)|skin(1)|urinary_tract(2)	34	all_cancers(53;5.05e-16)|all_epithelial(53;1.82e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					TGCTCCACGAGCTCCGGGTAA	0.622																																																1	Substitution - Missense(1)	ovary(1)	X											127.0	107.0	114.0					X																	153524340		2203	4300	6503	153177534	SO:0001583	missense	8277			X91817	CCDS35448.1, CCDS55541.1	Xq28	2008-02-05			ENSG00000007350	ENSG00000007350			11835	protein-coding gene	gene with protein product		300044				8838793	Standard	NM_012253		Approved	TKR, TKT2	uc004fkg.3	P51854	OTTHUMG00000022707	ENST00000369915.3:c.128G>A	X.37:g.153524340G>A	ENSP00000358931:p.Ser43Asn		153177534	A8K896|Q5TYJ8|Q5TYJ9|Q8TC75	Missense_Mutation	SNP	ENST00000369915.3	37	CCDS35448.1	.	.	.	.	.	.	.	.	.	.	G	8.722	0.914655	0.17907	.	.	ENSG00000007350	ENST00000369915	T	0.18810	2.19	4.46	0.875	0.19130	Transketolase, N-terminal (1);	0.232989	0.40908	D	0.000997	T	0.05181	0.0138	N	0.01228	-0.945	0.09310	N	0.999999	B;B	0.11235	0.004;0.004	B;B	0.13407	0.009;0.009	T	0.35425	-0.9789	10	0.18710	T	0.47	-8.7439	3.7084	0.08410	0.2782:0.476:0.2458:0.0	.	43;43	B7Z7I0;P51854	.;TKTL1_HUMAN	N	43	ENSP00000358931:S43N	ENSP00000358931:S43N	S	+	2	0	TKTL1	153177534	0.080000	0.21391	0.001000	0.08648	0.021000	0.10359	1.583000	0.36579	0.242000	0.21303	0.529000	0.55759	AGC		0.622	TKTL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058923.1	NM_012253	
