#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	SNP	G	G	A			TCGA-61-2611-02A-01W-1092-09	TCGA-61-2611-11A-01W-1092-09	G	G					Unknown	Invalid:failed_liftOver	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	204bf013-8fed-4f18-82b7-218cc1f0b8a6	c758d83a-3656-43a4-ba90-22fbb0e32c38	g.chrUnknown:0G>A								None (None upstream) : None (None downstream)																								0.0																																																0			MT																																								11779	SO:0001628	intergenic_variant	4538																															Unknown.37:g.0G>A			11779		Missense_Mutation	SNP	HMMPfam_Oxidored_q5_N,HMMPfam_Oxidored_q1	p.R340H		37	c.1019		MT																																																																																			-	HMMPfam_Oxidored_q1	0	0					MT-ND4			G			11779	+1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000361381	ensembl	human	known	54_36p	missense	SNP	NULL	A
FASTKD5	60493	genome.wustl.edu	37	20	3127461	3127461	+	Silent	SNP	C	C	T			TCGA-61-2611-02A-01W-1092-09	TCGA-61-2611-11A-01W-1092-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	204bf013-8fed-4f18-82b7-218cc1f0b8a6	c758d83a-3656-43a4-ba90-22fbb0e32c38	g.chr20:3127461C>T	ENST00000380266.3	-	2	2577	c.2256G>A	c.(2254-2256)ttG>ttA	p.L752L	UBOX5_ENST00000348031.2_Intron|UBOX5-AS1_ENST00000446537.1_RNA|UBOX5_ENST00000217173.2_Intron	NM_021826.4	NP_068598.1	Q7L8L6	FAKD5_HUMAN	FAST kinase domains 5	752	RAP. {ECO:0000255|PROSITE- ProRule:PRU00619}.				cellular respiration (GO:0045333)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)			breast(2)|endometrium(2)|large_intestine(2)|lung(8)|prostate(2)|skin(1)|urinary_tract(2)	19						GAAGAAACGCCAACTTTTCTA	0.478																																																0			20											121.0	119.0	119.0					20																	3127461		2203	4300	6503	3075461	SO:0001819	synonymous_variant	60493			BC007413	CCDS13048.1	20p13	2006-07-07			ENSG00000215251	ENSG00000215251			25790	protein-coding gene	gene with protein product		614272				11347906	Standard	NM_021826		Approved	FLJ13149	uc002whz.4	Q7L8L6	OTTHUMG00000031727	ENST00000380266.3:c.2256G>A	20.37:g.3127461C>T			3075461	Q96JN3|Q9H5D1|Q9H8Y3	Silent	SNP	HMMPfam_FAST_1,HMMPfam_FAST_2,HMMPfam_RAP	p.L752	ENST00000380266.3	37	c.2256	CCDS13048.1	20																																																																																			-	HMMPfam_RAP		0.478	FASTKD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FASTKD5	protein_coding	OTTHUMT00000077701.2	C	NM_021826		3075461	-1	no_errors	NM_021826	genbank	human	validated	54_36p	silent	SNP	0.989	T
RBFOX1	54715	genome.wustl.edu	37	16	7568219	7568219	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2611-02A-01W-1092-09	TCGA-61-2611-11A-01W-1092-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	204bf013-8fed-4f18-82b7-218cc1f0b8a6	c758d83a-3656-43a4-ba90-22fbb0e32c38	g.chr16:7568219C>T	ENST00000550418.1	+	5	1086	c.98C>T	c.(97-99)cCg>cTg	p.P33L	RBFOX1_ENST00000553186.1_Missense_Mutation_p.P33L|RBFOX1_ENST00000552089.1_Missense_Mutation_p.P69L|RBFOX1_ENST00000355637.4_Missense_Mutation_p.P53L|RBFOX1_ENST00000340209.4_Missense_Mutation_p.P38L|RBFOX1_ENST00000422070.4_Missense_Mutation_p.P76L|RBFOX1_ENST00000311745.5_Missense_Mutation_p.P53L|RBFOX1_ENST00000535565.2_Missense_Mutation_p.P69L|RBFOX1_ENST00000436368.2_Missense_Mutation_p.P53L|RBFOX1_ENST00000547338.1_Missense_Mutation_p.P33L|RBFOX1_ENST00000547372.1_Missense_Mutation_p.P76L	NM_018723.3	NP_061193.2	Q9NWB1	RFOX1_HUMAN	RNA binding protein, fox-1 homolog (C. elegans) 1	33					mRNA processing (GO:0006397)|neuromuscular process controlling balance (GO:0050885)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|RNA transport (GO:0050658)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	nucleotide binding (GO:0000166)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(11)|lung(17)|ovary(1)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)	55						TTTGCTCCCCCGCAGAACGGT	0.592																																					Ovarian(157;934 2567 15163 39509)											0			16											127.0	128.0	127.0					16																	7568219		2197	4300	6497	7508220	SO:0001583	missense	54715			AF107203	CCDS10531.1, CCDS10532.1, CCDS45405.1, CCDS55983.1, CCDS55984.1	16p13.3	2013-02-12			ENSG00000078328	ENSG00000078328		"""RNA binding motif (RRM) containing"""	18222	protein-coding gene	gene with protein product	"""ataxin 2-binding protein 1"", ""hexaribonucleotide binding protein 1"""	605104				10814712, 16260614	Standard	NM_018723		Approved	A2BP1, FOX-1, HRNBP1	uc002cyy.2	Q9NWB1	OTTHUMG00000129551	ENST00000550418.1:c.98C>T	16.37:g.7568219C>T	ENSP00000450031:p.Pro33Leu		7508220	Q7Z7I7|Q8TAE3|Q8TAF2|Q8WYB2|Q9NS20	Missense_Mutation	SNP	superfamily_SSF54928,HMMSmart_RRM,HMMPfam_RRM_1	p.P53L	ENST00000550418.1	37	c.158	CCDS55983.1	16	.	.	.	.	.	.	.	.	.	.	C	28.2	4.901870	0.92035	.	.	ENSG00000078328	ENST00000547605;ENST00000550418;ENST00000553186;ENST00000547372;ENST00000422070;ENST00000535565;ENST00000552089;ENST00000551752;ENST00000547338;ENST00000436368;ENST00000311745;ENST00000355637;ENST00000352951;ENST00000340209	T;T;T;T;T;T;T;T;T;T;T	0.38722	1.62;1.17;1.58;1.44;1.38;1.54;1.17;1.22;1.37;1.29;1.12	4.85	4.85	0.62838	.	0.000000	0.85682	D	0.000000	T	0.65091	0.2658	M	0.70275	2.135	0.80722	D	1	D;D;D;D;D;D;D;D;D	0.89917	0.993;0.999;1.0;1.0;0.999;0.997;1.0;0.999;1.0	P;D;P;D;D;P;D;D;D	0.76575	0.713;0.928;0.898;0.953;0.959;0.838;0.942;0.954;0.988	T	0.70117	-0.4960	10	0.87932	D	0	-6.1649	17.9952	0.89181	0.0:1.0:0.0:0.0	.	53;69;76;53;53;53;33;33;76	F8WAC5;F5H0M1;B7Z1U7;Q9NWB1-2;Q9NWB1-4;Q9NWB1-5;Q9NWB1-3;Q9NWB1;F8VZG9	.;.;.;.;.;.;.;RFOX1_HUMAN;.	L	33;33;33;76;76;69;69;33;33;53;53;53;53;38	ENSP00000450402:P33L;ENSP00000450031:P33L;ENSP00000447753:P33L;ENSP00000446842:P76L;ENSP00000391269:P76L;ENSP00000447281:P33L;ENSP00000447717:P33L;ENSP00000402745:P53L;ENSP00000309117:P53L;ENSP00000347855:P53L;ENSP00000344196:P38L	ENSP00000309117:P53L	P	+	2	0	RBFOX1	7508220	1.000000	0.71417	0.987000	0.45799	0.965000	0.64279	7.041000	0.76558	2.222000	0.72286	0.557000	0.71058	CCG	-	NULL		0.592	RBFOX1-003	KNOWN	basic|CCDS	protein_coding	A2BP1	protein_coding	OTTHUMT00000409492.2	C	NM_145891		7508220	+1	no_errors	NM_145891	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
TP53	7157	genome.wustl.edu	37	17	7577018	7577018	+	Splice_Site	SNP	C	C	G			TCGA-61-2611-02A-01W-1092-09	TCGA-61-2611-11A-01W-1092-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	204bf013-8fed-4f18-82b7-218cc1f0b8a6	c758d83a-3656-43a4-ba90-22fbb0e32c38	g.chr17:7577018C>G	ENST00000269305.4	-	8	1109		c.e8+1		TP53_ENST00000445888.2_Splice_Site|TP53_ENST00000420246.2_Splice_Site|TP53_ENST00000455263.2_Splice_Site|TP53_ENST00000359597.4_Splice_Site|TP53_ENST00000413465.2_Intron|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53						apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.?(28)|p.0?(8)|p.A307fs*34(1)|p.L308fs*31(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TGCTTGCTTACCTCGCTTAGT	0.562		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	38	Unknown(28)|Whole gene deletion(8)|Deletion - Frameshift(2)	lung(7)|breast(7)|bone(4)|upper_aerodigestive_tract(3)|central_nervous_system(3)|large_intestine(2)|stomach(2)|haematopoietic_and_lymphoid_tissue(2)|ovary(2)|biliary_tract(1)|endometrium(1)|urinary_tract(1)|skin(1)|oesophagus(1)|prostate(1)	17	GRCh37	CD920913	TP53	D							127.0	112.0	117.0					17																	7577018		2203	4300	6503	7517743	SO:0001630	splice_region_variant	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.919+1G>C	17.37:g.7577018C>G			7517743	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Splice_Site	SNP	-	e7+1	ENST00000269305.4	37	c.919+1	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	9.222	1.033661	0.19590	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	.	.	.	4.81	3.84	0.44239	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.038	0.36300	0.0:0.9:0.0:0.1	.	.	.	.	.	-1	.	.	.	-	.	.	TP53	7517743	1.000000	0.71417	0.939000	0.37840	0.223000	0.24884	4.456000	0.60081	1.259000	0.44117	0.561000	0.74099	.	-	-		0.562	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	C	NM_000546	Intron	7517743	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	splice_site	SNP	1.000	G
S1PR2	9294	genome.wustl.edu	37	19	10335250	10335250	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2611-02A-01W-1092-09	TCGA-61-2611-11A-01W-1092-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	204bf013-8fed-4f18-82b7-218cc1f0b8a6	c758d83a-3656-43a4-ba90-22fbb0e32c38	g.chr19:10335250G>A	ENST00000590320.1	-	2	442	c.332C>T	c.(331-333)tCt>tTt	p.S111F	CTD-2369P2.2_ENST00000317726.4_lincRNA	NM_004230.3	NP_004221.3	O95136	S1PR2_HUMAN	sphingosine-1-phosphate receptor 2	111					activation of MAPK activity (GO:0000187)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|positive regulation of cell proliferation (GO:0008284)|positive regulation of establishment of endothelial barrier (GO:1903142)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|G-protein coupled receptor binding (GO:0001664)|integrin binding (GO:0005178)|lipid binding (GO:0008289)|sphingosine-1-phosphate receptor activity (GO:0038036)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	15						GATGAAGGCAGAGCCCTCCCG	0.612																																					Pancreas(194;229 3020 15179 45747)											0			19											35.0	35.0	35.0					19																	10335250		2203	4300	6503	10196250	SO:0001583	missense	9294			AF034780	CCDS12229.1	19q13	2013-03-13	2008-04-30	2008-04-30	ENSG00000267534	ENSG00000267534		"""GPCR / Class A : Lysophospholipid receptors : Sphingosine 1-phosphate"""	3169	protein-coding gene	gene with protein product		605111	"""endothelial differentiation, sphingolipid G-protein-coupled receptor, 5"""	EDG5		8087418, 8878560	Standard	NM_004230		Approved	Gpcr13, H218, AGR16	uc002mnl.2	O95136	OTTHUMG00000180399	ENST00000590320.1:c.332C>T	19.37:g.10335250G>A	ENSP00000466933:p.Ser111Phe		10196250	Q86UN8	Missense_Mutation	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.S111F	ENST00000590320.1	37	c.332	CCDS12229.1	19	.	.	.	.	.	.	.	.	.	.	G	17.29	3.351482	0.61183	.	.	ENSG00000175898	ENST00000317726	.	.	.	5.46	5.46	0.80206	GPCR, rhodopsin-like superfamily (1);	0.065124	0.64402	D	0.000018	T	0.62208	0.2409	N	0.19112	0.55	0.51012	D	0.999902	D	0.67145	0.996	P	0.62014	0.897	T	0.66642	-0.5872	9	0.62326	D	0.03	.	18.0738	0.89421	0.0:0.0:1.0:0.0	.	111	O95136	S1PR2_HUMAN	F	111	.	ENSP00000322049:S111F	S	-	2	0	S1PR2	10196250	1.000000	0.71417	0.951000	0.38953	0.991000	0.79684	4.966000	0.63715	2.557000	0.86248	0.586000	0.80456	TCT	-	superfamily_SSF81321,HMMPfam_7tm_1		0.612	S1PR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	S1PR2	protein_coding	OTTHUMT00000451194.1	G	NM_004230		10196250	-1	no_errors	NM_004230	genbank	human	validated	54_36p	missense	SNP	0.990	A
USP47	55031	genome.wustl.edu	37	11	11924406	11924406	+	Splice_Site	SNP	G	G	T			TCGA-61-2611-02A-01W-1092-09	TCGA-61-2611-11A-01W-1092-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	204bf013-8fed-4f18-82b7-218cc1f0b8a6	c758d83a-3656-43a4-ba90-22fbb0e32c38	g.chr11:11924406G>T	ENST00000399455.2	+	7	918	c.798G>T	c.(796-798)gaG>gaT	p.E266D	USP47_ENST00000539466.1_5'UTR|USP47_ENST00000339865.5_Splice_Site_p.E178D|USP47_ENST00000527733.1_Splice_Site_p.E246D	NM_001282659.1	NP_001269588.1	Q96K76	UBP47_HUMAN	ubiquitin specific peptidase 47	266	USP.				base-excision repair (GO:0006284)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|monoubiquitinated protein deubiquitination (GO:0035520)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of G2/M transition of mitotic cell cycle (GO:0010972)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell growth (GO:0030307)|response to drug (GO:0042493)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)	ubiquitin-specific protease activity (GO:0004843)|WD40-repeat domain binding (GO:0071987)			breast(4)|endometrium(7)|kidney(2)|large_intestine(8)|liver(2)|lung(14)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	46				Epithelial(150;0.000339)		ATAGTAGTGAGGGTACTAATT	0.318																																																0			11											120.0	113.0	115.0					11																	11924406		1823	4078	5901	11880982	SO:0001630	splice_region_variant	55031			AK027362	CCDS41619.1, CCDS60725.1	11p15.2	2008-02-05	2005-08-08		ENSG00000170242	ENSG00000170242		"""Ubiquitin-specific peptidases"""	20076	protein-coding gene	gene with protein product		614460	"""Trf (TATA binding protein-related factor)-proximal homolog (Drosophila)"", ""ubiquitin specific protease 47"""			12838346	Standard	XM_005252997		Approved		uc001mjr.3	Q96K76	OTTHUMG00000165685	ENST00000399455.2:c.799+1G>T	11.37:g.11924406G>T			11880982	B3KXF5|E9PM46|Q658U0|Q86Y73|Q8TEP6|Q9BWI0|Q9NWN1	Missense_Mutation	SNP	superfamily_Cysteine proteinases,HMMPfam_UCH,PatternScan_UCH_2_1,PatternScan_UCH_2_2	p.E178D	ENST00000399455.2	37	c.534		11	.	.	.	.	.	.	.	.	.	.	G	15.31	2.794899	0.50208	.	.	ENSG00000170242	ENST00000339865;ENST00000527733;ENST00000399455;ENST00000535588	T;T;T	0.32023	1.47;1.47;1.47	5.43	3.55	0.40652	.	0.110596	0.64402	D	0.000003	T	0.23688	0.0573	N	0.13299	0.325	0.80722	D	1	P;P	0.36171	0.541;0.498	P;B	0.47786	0.557;0.421	T	0.05716	-1.0868	10	0.12766	T	0.61	.	9.3793	0.38304	0.2242:0.0:0.7758:0.0	.	246;178	E9PM46;Q96K76-2	.;.	D	178;246;266;266	ENSP00000339957:E178D;ENSP00000433146:E246D;ENSP00000382382:E266D	ENSP00000339957:E178D	E	+	3	2	USP47	11880982	1.000000	0.71417	1.000000	0.80357	0.424000	0.31475	2.852000	0.48310	1.285000	0.44548	-0.266000	0.10368	GAG	-	superfamily_Cysteine proteinases,HMMPfam_UCH		0.318	USP47-003	KNOWN	basic|appris_candidate_longest	protein_coding	USP47	protein_coding	OTTHUMT00000385853.2	G	NM_017944	Missense_Mutation	11880982	+1	no_errors	NM_017944	genbank	human	validated	54_36p	missense	SNP	1.000	T
ESF1	51575	genome.wustl.edu	37	20	13763271	13763271	+	Missense_Mutation	SNP	A	A	C			TCGA-61-2611-02A-01W-1092-09	TCGA-61-2611-11A-01W-1092-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	204bf013-8fed-4f18-82b7-218cc1f0b8a6	c758d83a-3656-43a4-ba90-22fbb0e32c38	g.chr20:13763271A>C	ENST00000202816.1	-	2	623	c.516T>G	c.(514-516)atT>atG	p.I172M	NDUFAF5_ENST00000378106.5_5'Flank|NDUFAF5_ENST00000463598.1_5'Flank	NM_001276380.1|NM_016649.3	NP_001263309.1|NP_057733.2	Q9H501	ESF1_HUMAN	ESF1, nucleolar pre-rRNA processing protein, homolog (S. cerevisiae)	172					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular space (GO:0005615)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(5)|large_intestine(8)|lung(11)|ovary(2)|skin(1)|stomach(1)	31						TATGTTGAACAATGTTTTTTT	0.323																																																0			20											47.0	47.0	47.0					20																	13763271		2201	4297	6498	13711271	SO:0001583	missense	51575				CCDS13117.1	20p12.1	2007-02-12	2006-11-13	2006-11-13	ENSG00000089048	ENSG00000089048			15898	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 6"""	C20orf6			Standard	NM_016649		Approved	bA526K24.1	uc002wok.2	Q9H501	OTTHUMG00000031906	ENST00000202816.1:c.516T>G	20.37:g.13763271A>C	ENSP00000202816:p.Ile172Met		13711271	Q86X92|Q9H9Q5|Q9HA35|Q9NX93|Q9P1S6	Missense_Mutation	SNP	NULL	p.I172M	ENST00000202816.1	37	c.516	CCDS13117.1	20	.	.	.	.	.	.	.	.	.	.	A	3.430	-0.116259	0.06881	.	.	ENSG00000089048	ENST00000202816	T	0.22539	1.95	4.6	0.56	0.17279	.	1.293100	0.04924	N	0.455528	T	0.13286	0.0322	N	0.24115	0.695	0.09310	N	1	P	0.34780	0.468	B	0.29353	0.101	T	0.27226	-1.0080	10	0.46703	T	0.11	.	5.7999	0.18408	0.5281:0.1792:0.2927:0.0	.	172	Q9H501	ESF1_HUMAN	M	172	ENSP00000202816:I172M	ENSP00000202816:I172M	I	-	3	3	ESF1	13711271	0.000000	0.05858	0.005000	0.12908	0.229000	0.25112	0.111000	0.15458	0.166000	0.19597	0.482000	0.46254	ATT	-	NULL		0.323	ESF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ESF1	protein_coding	OTTHUMT00000078049.1	A	NM_016649		13711271	-1	no_errors	NM_016649	genbank	human	provisional	54_36p	missense	SNP	0.000	C
CROCC	9696	genome.wustl.edu	37	1	17275337	17275337	+	Missense_Mutation	SNP	C	C	T	rs143866013	byFrequency	TCGA-61-2611-02A-01W-1092-09	TCGA-61-2611-11A-01W-1092-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	204bf013-8fed-4f18-82b7-218cc1f0b8a6	c758d83a-3656-43a4-ba90-22fbb0e32c38	g.chr1:17275337C>T	ENST00000375541.5	+	19	2821	c.2752C>T	c.(2752-2754)Cgg>Tgg	p.R918W	CROCC_ENST00000467938.1_Intron	NM_014675.3	NP_055490.3			ciliary rootlet coiled-coil, rootletin									p.R918W(2)		breast(3)|central_nervous_system(2)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(1)|lung(20)|ovary(3)|prostate(9)|skin(3)|urinary_tract(1)	62		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		TGAGGTGCAACGGCAGCTGGC	0.677																																																2	Substitution - Missense(2)	skin(2)	1											38.0	43.0	41.0					1																	17275337		2203	4298	6501	17147924	SO:0001583	missense	9696			AB007914	CCDS30616.1	1p36.13	2010-06-04	2009-03-04	2009-03-04	ENSG00000058453	ENSG00000058453			21299	protein-coding gene	gene with protein product	"""rootletin, ciliary rootlet protein"""	615776				12427867, 17971504	Standard	XM_006711056		Approved	rootletin, ROLT	uc001azt.2	Q5TZA2	OTTHUMG00000002200	ENST00000375541.5:c.2752C>T	1.37:g.17275337C>T	ENSP00000364691:p.Arg918Trp		17147924		Missense_Mutation	SNP	superfamily_Prefoldin	p.R918W	ENST00000375541.5	37	c.2752	CCDS30616.1	1	.	.	.	.	.	.	.	.	.	.	C	16.77	3.216169	0.58452	.	.	ENSG00000058453	ENST00000375541;ENST00000445545	T	0.23552	1.9	4.38	2.36	0.29203	.	.	.	.	.	T	0.39886	0.1095	L	0.50333	1.59	0.34311	D	0.68543	D;D	0.76494	0.999;0.999	D;D	0.63488	0.915;0.915	T	0.53143	-0.8480	9	0.72032	D	0.01	.	10.9364	0.47247	0.41:0.59:0.0:0.0	.	221;918	Q5TZA2-2;Q5TZA2	.;CROCC_HUMAN	W	918;799	ENSP00000364691:R918W	ENSP00000364691:R918W	R	+	1	2	CROCC	17147924	1.000000	0.71417	0.999000	0.59377	0.992000	0.81027	1.205000	0.32308	0.452000	0.26830	0.557000	0.71058	CGG	-	NULL		0.677	CROCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CROCC	protein_coding	OTTHUMT00000006249.2	C	NM_014675		17147924	+1	no_errors	NM_014675	genbank	human	validated	54_36p	missense	SNP	1.000	T
TMEM161A	54929	genome.wustl.edu	37	19	19244003	19244003	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2611-02A-01W-1092-09	TCGA-61-2611-11A-01W-1092-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	204bf013-8fed-4f18-82b7-218cc1f0b8a6	c758d83a-3656-43a4-ba90-22fbb0e32c38	g.chr19:19244003G>A	ENST00000162044.9	-	3	188	c.124C>T	c.(124-126)Cac>Tac	p.H42Y	TMEM161A_ENST00000592147.1_5'UTR|TMEM161A_ENST00000587583.2_Missense_Mutation_p.H42Y|TMEM161A_ENST00000450333.2_Missense_Mutation_p.H42Y	NM_017814.2	NP_060284.1	Q9NX61	T161A_HUMAN	transmembrane protein 161A	42					cellular response to oxidative stress (GO:0034599)|cellular response to UV (GO:0034644)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|positive regulation of DNA repair (GO:0045739)|response to retinoic acid (GO:0032526)	integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	15			OV - Ovarian serous cystadenocarcinoma(5;1.19e-05)|Epithelial(12;0.0011)			TCAGACGGGTGCTTGTATCGG	0.637																																																0			19											41.0	44.0	43.0					19																	19244003		2203	4300	6503	19105003	SO:0001583	missense	54929			BC005210	CCDS12393.1, CCDS58656.1	19p13.11	2008-02-05				ENSG00000064545			26020	protein-coding gene	gene with protein product						12975309	Standard	NM_017814		Approved	FLJ39645, FLJ20422	uc002nlg.4	Q9NX61		ENST00000162044.9:c.124C>T	19.37:g.19244003G>A	ENSP00000162044:p.His42Tyr		19105003	B3KUE0|G5E9M6|Q7L2Y1	Missense_Mutation	SNP	HMMPfam_Tmemb_161AB	p.H42Y	ENST00000162044.9	37	c.124	CCDS12393.1	19	.	.	.	.	.	.	.	.	.	.	G	14.35	2.508349	0.44660	.	.	ENSG00000064545	ENST00000450333;ENST00000162044	.	.	.	4.35	4.35	0.52113	.	0.102077	0.64402	D	0.000003	T	0.67571	0.2907	L	0.50333	1.59	0.80722	D	1	D;D;P	0.69078	0.996;0.997;0.954	D;D;P	0.81914	0.991;0.995;0.781	T	0.62459	-0.6850	9	0.16896	T	0.51	-14.8105	14.7363	0.69419	0.0:0.0:1.0:0.0	.	42;42;42	G5E9M6;B3KUE0;Q9NX61	.;.;T161A_HUMAN	Y	42	.	ENSP00000162044:H42Y	H	-	1	0	TMEM161A	19105003	1.000000	0.71417	0.978000	0.43139	0.043000	0.13939	8.589000	0.90817	2.140000	0.66376	0.563000	0.77884	CAC	-	HMMPfam_Tmemb_161AB		0.637	TMEM161A-004	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM161A	protein_coding	OTTHUMT00000460089.2	G	NM_017814		19105003	-1	no_errors	NM_017814	genbank	human	provisional	54_36p	missense	SNP	1.000	A
APOB	338	genome.wustl.edu	37	2	21229956	21229956	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2611-02A-01W-1092-09	TCGA-61-2611-11A-01W-1092-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	204bf013-8fed-4f18-82b7-218cc1f0b8a6	c758d83a-3656-43a4-ba90-22fbb0e32c38	g.chr2:21229956G>A	ENST00000233242.1	-	26	9911	c.9784C>T	c.(9784-9786)Cca>Tca	p.P3262S		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	3262					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ATGGTGAATGGAGACACTTCA	0.453																																																0			2											74.0	67.0	70.0					2																	21229956		2203	4300	6503	21083461	SO:0001583	missense	338			M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.9784C>T	2.37:g.21229956G>A	ENSP00000233242:p.Pro3262Ser		21083461	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	superfamily_Lipovitellin-phosvitin complex beta-sheet shell regions,HMMPfam_Vitellogenin_N,HMMSmart_SM00638,superfamily_Lipovitellin-phosvitin complex superhelical domain,HMMPfam_DUF1943,HMMPfam_DUF1081	p.P3262S	ENST00000233242.1	37	c.9784	CCDS1703.1	2	.	.	.	.	.	.	.	.	.	.	G	16.08	3.021652	0.54576	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	T	0.35421	1.31	4.71	4.71	0.59529	.	0.000000	0.53938	D	0.000060	T	0.60534	0.2276	M	0.80616	2.505	0.80722	D	1	P	0.49783	0.928	P	0.59825	0.864	T	0.67917	-0.5546	10	0.87932	D	0	.	17.6675	0.88207	0.0:0.0:1.0:0.0	.	3262	P04114	APOB_HUMAN	S	3262	ENSP00000233242:P3262S	ENSP00000233242:P3262S	P	-	1	0	APOB	21083461	1.000000	0.71417	0.942000	0.38095	0.977000	0.68977	1.682000	0.37628	2.169000	0.68431	0.563000	0.77884	CCA	-	NULL		0.453	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOB	protein_coding	OTTHUMT00000207571.1	G			21083461	-1	no_errors	NM_000384	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
SPECC1L	23384	genome.wustl.edu	37	22	24698170	24698170	+	5'UTR	SNP	T	T	G			TCGA-61-2611-02A-01W-1092-09	TCGA-61-2611-11A-01W-1092-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	204bf013-8fed-4f18-82b7-218cc1f0b8a6	c758d83a-3656-43a4-ba90-22fbb0e32c38	g.chr22:24698170T>G	ENST00000314328.9	+	0	256				SPECC1L_ENST00000416735.1_3'UTR|SPECC1L-ADORA2A_ENST00000358654.2_5'UTR|SPECC1L_ENST00000541492.1_5'UTR|SPECC1L_ENST00000437398.1_5'UTR	NM_001254733.1|NM_015330.3	NP_001241662.1|NP_056145	Q69YQ0	CYTSA_HUMAN	sperm antigen with calponin homology and coiled-coil domains 1-like						actin cytoskeleton organization (GO:0030036)|cell cycle (GO:0007049)|cell division (GO:0051301)|cell migration (GO:0016477)|negative regulation of actin filament depolymerization (GO:0030835)|negative regulation of microtubule depolymerization (GO:0007026)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|gap junction (GO:0005921)|microtubule organizing center (GO:0005815)				breast(1)|endometrium(1)|kidney(4)|large_intestine(7)|lung(6)|ovary(1)|prostate(1)|skin(3)|stomach(2)|urinary_tract(1)	27						CAGATTTGCTTGTAAATGCAT	0.398																																																0			22											41.0	38.0	39.0					22																	24698170		2203	4300	6503	23028170	SO:0001623	5_prime_UTR_variant	23384			AK025531	CCDS33619.1, CCDS58797.1	22q11.23	2012-12-20	2010-09-17	2010-09-17	ENSG00000100014	ENSG00000100014			29022	protein-coding gene	gene with protein product	"""cytokinesis and spindle organization A"", ""cytospin A"""	614140	"""SPECC1-like"""			9205841	Standard	NM_001254733		Approved	KIAA0376, CYTSA	uc002zzv.4	Q69YQ0	OTTHUMG00000171450	ENST00000314328.9:c.-30T>G	22.37:g.24698170T>G			23028170	B7Z758|F5H1H6|O15081	Missense_Mutation	SNP	NULL	p.C3G	ENST00000314328.9	37	c.7	CCDS33619.1	22	.	.	.	.	.	.	.	.	.	.	.	15.56	2.870873	0.51695	.	.	ENSG00000100014	ENST00000398280	.	.	.	5.3	2.85	0.33270	.	.	.	.	.	T	0.48502	0.1503	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.23797	-1.0178	5	0.16896	T	0.51	.	8.6714	0.34152	0.0:0.2018:0.0:0.7982	.	.	.	.	G	19	.	ENSP00000381328:C19G	C	+	1	0	SPECC1L	23028170	1.000000	0.71417	0.999000	0.59377	0.981000	0.71138	1.774000	0.38573	0.966000	0.38159	0.533000	0.62120	TGT	-	NULL		0.398	SPECC1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYTSA	protein_coding	OTTHUMT00000319986.2	T	NM_015330		23028170	+1	no_start_codon	ENST00000398280	ensembl	human	known	54_36p	missense	SNP	0.999	G
OSBPL3	26031	genome.wustl.edu	37	7	24892194	24892194	+	Nonsense_Mutation	SNP	G	G	A			TCGA-61-2611-02A-01W-1092-09	TCGA-61-2611-11A-01W-1092-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	204bf013-8fed-4f18-82b7-218cc1f0b8a6	c758d83a-3656-43a4-ba90-22fbb0e32c38	g.chr7:24892194G>A	ENST00000313367.2	-	11	1538	c.1087C>T	c.(1087-1089)Cag>Tag	p.Q363*	OSBPL3_ENST00000396429.1_Nonsense_Mutation_p.Q363*|OSBPL3_ENST00000409069.1_Nonsense_Mutation_p.Q332*|OSBPL3_ENST00000396431.1_Nonsense_Mutation_p.Q332*|OSBPL3_ENST00000352860.1_Nonsense_Mutation_p.Q332*|OSBPL3_ENST00000353930.1_Nonsense_Mutation_p.Q363*|OSBPL3_ENST00000431825.2_Nonsense_Mutation_p.Q332*	NM_015550.2	NP_056365.1	Q9H4L5	OSBL3_HUMAN	oxysterol binding protein-like 3	363					lipid transport (GO:0006869)	cytosol (GO:0005829)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)	cholesterol binding (GO:0015485)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(19)|prostate(1)|skin(3)|urinary_tract(1)	43						TCCATCAGCTGCTTCAGTTTC	0.453																																																0			7											101.0	83.0	89.0					7																	24892194		2203	4300	6503	24858719	SO:0001587	stop_gained	26031			AB014604	CCDS5390.1, CCDS5391.1, CCDS5392.1, CCDS47564.1	7p15.3	2013-01-10			ENSG00000070882	ENSG00000070882		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16370	protein-coding gene	gene with protein product		606732		OSBP3		9734811	Standard	XM_005249698		Approved	ORP-3, ORP3, KIAA0704	uc003sxf.3	Q9H4L5	OTTHUMG00000023277	ENST00000313367.2:c.1087C>T	7.37:g.24892194G>A	ENSP00000315410:p.Gln363*		24858719	A4D167|A4D168|A4D169|A4D170|A4D171|A4D172|B8ZZ79|B8ZZP0|O14591|O43357|O43358|Q8N702|Q8N703|Q8N704|Q8NFH0|Q8NFH1|Q8NI12|Q8NI13|Q9BZF4|Q9UED6	Nonsense_Mutation	SNP	superfamily_PH domain-like,HMMPfam_PH,HMMSmart_SM00233,HMMPfam_Oxysterol_BP,PatternScan_OSBP	p.Q363*	ENST00000313367.2	37	c.1087	CCDS5390.1	7	.	.	.	.	.	.	.	.	.	.	G	42	9.420892	0.99166	.	.	ENSG00000070882	ENST00000313367;ENST00000352860;ENST00000353930;ENST00000431825;ENST00000396431;ENST00000396429;ENST00000409069	.	.	.	5.16	5.16	0.70880	.	0.054457	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.29301	T	0.29	-16.1093	18.6679	0.91499	0.0:0.0:1.0:0.0	.	.	.	.	X	363;332;363;332;332;363;332	.	ENSP00000315410:Q363X	Q	-	1	0	OSBPL3	24858719	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.629000	0.83207	2.420000	0.82092	0.561000	0.74099	CAG	-	NULL		0.453	OSBPL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OSBPL3	protein_coding	OTTHUMT00000214085.2	G			24858719	-1	no_errors	NM_015550	genbank	human	reviewed	54_36p	nonsense	SNP	1.000	A
POM121L2	94026	genome.wustl.edu	37	6	27277246	27277246	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2611-02A-01W-1092-09	TCGA-61-2611-11A-01W-1092-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	204bf013-8fed-4f18-82b7-218cc1f0b8a6	c758d83a-3656-43a4-ba90-22fbb0e32c38	g.chr6:27277246C>T	ENST00000444565.1	-	1	2703	c.2704G>A	c.(2704-2706)Gag>Aag	p.E902K	POM121L2_ENST00000377451.2_Missense_Mutation_p.E838K	NM_033482.3	NP_258443.2	Q96KW2	P12L2_HUMAN	POM121 transmembrane nucleoporin-like 2	902										breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|skin(1)	7						ATCCCAGACTCATCACAGTCC	0.517																																																0			6											45.0	41.0	42.0					6																	27277246		692	1591	2283	27385225	SO:0001583	missense	94026			AL021808	CCDS59497.1	6p21.3	2012-03-13	2012-03-13		ENSG00000158553	ENSG00000158553			13973	protein-coding gene	gene with protein product			"""POM121 membrane glycoprotein-like 2 (rat)"", ""POM121 membrane glycoprotein-like 2"""				Standard	NM_033482		Approved	POM121-L	uc011dku.1	Q96KW2	OTTHUMG00000014475	ENST00000444565.1:c.2704G>A	6.37:g.27277246C>T	ENSP00000392726:p.Glu902Lys		27385225	C9J1I7	Missense_Mutation	SNP	NULL	p.E838K	ENST00000444565.1	37	c.2512	CCDS59497.1	6	.	.	.	.	.	.	.	.	.	.	C	12.88	2.071776	0.36566	.	.	ENSG00000158553	ENST00000377451;ENST00000444565	T;T	0.15372	2.44;2.43	3.95	3.95	0.45737	.	0.219833	0.22917	N	0.054072	T	0.14356	0.0347	L	0.46157	1.445	0.09310	N	1	D	0.89917	1.0	D	0.81914	0.995	T	0.05920	-1.0856	10	0.06494	T	0.89	.	11.7875	0.52051	0.0:1.0:0.0:0.0	.	902	C9J1I7	.	K	838;902	ENSP00000366671:E838K;ENSP00000392726:E902K	ENSP00000366671:E838K	E	-	1	0	POM121L2	27385225	0.224000	0.23674	0.092000	0.20876	0.315000	0.28087	2.783000	0.47766	2.499000	0.84300	0.305000	0.20034	GAG	-	NULL		0.517	POM121L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POM121L2	protein_coding	OTTHUMT00000040143.2	C	NM_033482		27385225	-1	no_errors	ENST00000377451	ensembl	human	known	54_36p	missense	SNP	0.003	T
DHX35	60625	genome.wustl.edu	37	20	37653992	37653992	+	Silent	SNP	G	G	A			TCGA-61-2611-02A-01W-1092-09	TCGA-61-2611-11A-01W-1092-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	204bf013-8fed-4f18-82b7-218cc1f0b8a6	c758d83a-3656-43a4-ba90-22fbb0e32c38	g.chr20:37653992G>A	ENST00000252011.3	+	18	1824	c.1791G>A	c.(1789-1791)aaG>aaA	p.K597K	DHX35_ENST00000373323.4_Silent_p.K566K|DHX35_ENST00000373325.2_Silent_p.K597K	NM_021931.3	NP_068750.2	Q9H5Z1	DHX35_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 35	597					mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(13)|ovary(1)|skin(2)|stomach(1)|urinary_tract(2)	40		Myeloproliferative disorder(115;0.00878)				TGCCCAGGAAGTCTAGTGAAG	0.478																																																0			20											163.0	171.0	168.0					20																	37653992		2203	4300	6503	37087406	SO:0001819	synonymous_variant	60625			AK026412	CCDS13310.1, CCDS54463.1	20q11.22-q12	2003-06-13	2003-06-13	2003-06-13	ENSG00000101452	ENSG00000101452		"""DEAH-boxes"""	15861	protein-coding gene	gene with protein product			"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 35"""	C20orf15, DDX35			Standard	NM_001190809		Approved	FLJ22759, KAIA0875	uc002xjh.3	Q9H5Z1	OTTHUMG00000032463	ENST00000252011.3:c.1791G>A	20.37:g.37653992G>A			37087406	A2RTX3|B4E0J0|F5GXM6|Q5THR0|Q9H4H7|Q9H6T6	Silent	SNP	HMMSmart_SM00487,superfamily_P-loop containing nucleoside triphosphate hydrolases,PatternScan_DEAH_ATP_HELICASE,HMMSmart_SM00490,HMMPfam_Helicase_C,HMMPfam_HA2,HMMPfam_DUF1605	p.K597	ENST00000252011.3	37	c.1791	CCDS13310.1	20																																																																																			-	HMMPfam_DUF1605		0.478	DHX35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHX35	protein_coding	OTTHUMT00000079212.2	G	NM_021931		37087406	+1	no_errors	NM_021931	genbank	human	reviewed	54_36p	silent	SNP	0.926	A
TSC22D1	8848	genome.wustl.edu	37	13	45147918	45147918	+	Missense_Mutation	SNP	C	C	A			TCGA-61-2611-02A-01W-1092-09	TCGA-61-2611-11A-01W-1092-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	204bf013-8fed-4f18-82b7-218cc1f0b8a6	c758d83a-3656-43a4-ba90-22fbb0e32c38	g.chr13:45147918C>A	ENST00000458659.2	-	1	2783	c.2293G>T	c.(2293-2295)Gtt>Ttt	p.V765F	TSC22D1_ENST00000501704.2_Intron|TSC22D1_ENST00000460842.1_5'Flank	NM_183422.3	NP_904358.2	Q15714	T22D1_HUMAN	TSC22 domain family, member 1	765	Gln-rich.				negative regulation of apoptotic process (GO:0043066)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell proliferation (GO:0008284)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		all_hematologic(4;8.74e-08)|Acute lymphoblastic leukemia(4;1.78e-07)|Lung NSC(96;2.21e-05)|Breast(139;0.000625)|Prostate(109;0.000947)|Hepatocellular(98;0.0202)|Lung SC(185;0.0262)		GBM - Glioblastoma multiforme(144;0.000522)|BRCA - Breast invasive adenocarcinoma(63;0.118)		GCAGGTGGAACCACTTGCGAA	0.478																																																0			13											83.0	82.0	82.0					13																	45147918		2203	4300	6503	44045918	SO:0001583	missense	8848			AJ222700	CCDS9392.1, CCDS31966.1, CCDS58291.1, CCDS73565.1	13q14	2008-02-05	2005-03-01	2005-03-03	ENSG00000102804	ENSG00000102804			16826	protein-coding gene	gene with protein product		607715	"""transforming growth factor beta 1 induced transcript 4"""	TGFB1I4		8651929, 9022669	Standard	NM_183422		Approved	TSC22, MGC17597	uc001uzn.4	Q15714	OTTHUMG00000016838	ENST00000458659.2:c.2293G>T	13.37:g.45147918C>A	ENSP00000397435:p.Val765Phe		44045918	B3KRL7|B9EGI0|O00666|Q6AHX5|Q6IBU1|Q8NCN1|Q96JS5	Missense_Mutation	SNP	PatternScan_TSC22,HMMPfam_TSC22	p.V765F	ENST00000458659.2	37	c.2293	CCDS31966.1	13	.	.	.	.	.	.	.	.	.	.	C	9.477	1.097180	0.20552	.	.	ENSG00000102804	ENST00000458659	D	0.85702	-2.02	4.47	3.54	0.40534	.	0.129817	0.34386	N	0.004020	T	0.73171	0.3553	L	0.29908	0.895	0.80722	D	1	B	0.29085	0.232	B	0.30179	0.112	T	0.64170	-0.6470	10	0.22109	T	0.4	.	6.2036	0.20590	0.1769:0.7184:0.0:0.1046	.	765	Q15714	T22D1_HUMAN	F	765	ENSP00000397435:V765F	ENSP00000397435:V765F	V	-	1	0	TSC22D1	44045918	1.000000	0.71417	1.000000	0.80357	0.706000	0.40770	1.840000	0.39230	1.093000	0.41377	0.462000	0.41574	GTT	-	NULL		0.478	TSC22D1-001	KNOWN	basic|CCDS	protein_coding	TSC22D1	protein_coding	OTTHUMT00000044743.2	C	NM_006022		44045918	-1	no_errors	NM_183422	genbank	human	validated	54_36p	missense	SNP	0.997	A
IPO13	9670	genome.wustl.edu	37	1	44424139	44424139	+	Missense_Mutation	SNP	C	C	G			TCGA-61-2611-02A-01W-1092-09	TCGA-61-2611-11A-01W-1092-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	204bf013-8fed-4f18-82b7-218cc1f0b8a6	c758d83a-3656-43a4-ba90-22fbb0e32c38	g.chr1:44424139C>G	ENST00000372343.3	+	10	2418	c.1756C>G	c.(1756-1758)Cag>Gag	p.Q586E		NM_014652.3	NP_055467.3	O94829	IPO13_HUMAN	importin 13	586					protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(6)|lung(13)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0821)				ACAGACAAGCCAGTGCATGTG	0.512																																																0			1											88.0	92.0	91.0					1																	44424139		2203	4300	6503	44196726	SO:0001583	missense	9670			AB018267	CCDS503.1	1p34.1	2008-02-05			ENSG00000117408	ENSG00000117408		"""Importins"""	16853	protein-coding gene	gene with protein product		610411				9872452, 11447110	Standard	NM_014652		Approved	IMP13, KIAA0724, RANBP13	uc001ckx.3	O94829	OTTHUMG00000008297	ENST00000372343.3:c.1756C>G	1.37:g.44424139C>G	ENSP00000361418:p.Gln586Glu		44196726	D3DPY4|Q5T4X3|Q7LC04|Q96HS3|Q9H8N3|Q9UFR1	Missense_Mutation	SNP	superfamily_ARM-type_fold,HMMPfam_IBN_N,HMMPfam_Xpo1	p.Q586E	ENST00000372343.3	37	c.1756	CCDS503.1	1	.	.	.	.	.	.	.	.	.	.	C	11.67	1.708084	0.30322	.	.	ENSG00000117408	ENST00000372343	T	0.66099	-0.19	5.81	5.81	0.92471	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.47544	0.1451	N	0.24115	0.695	0.80722	D	1	B	0.19817	0.039	B	0.12156	0.007	T	0.48328	-0.9045	10	0.02654	T	1	-19.9903	20.0817	0.97778	0.0:1.0:0.0:0.0	.	586	O94829	IPO13_HUMAN	E	586	ENSP00000361418:Q586E	ENSP00000361418:Q586E	Q	+	1	0	IPO13	44196726	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.385000	0.79763	2.743000	0.94032	0.650000	0.86243	CAG	-	superfamily_ARM-type_fold		0.512	IPO13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IPO13	protein_coding	OTTHUMT00000022846.1	C	NM_014652		44196726	+1	no_errors	NM_014652	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
BCAS1	8537	genome.wustl.edu	37	20	52645056	52645056	+	Missense_Mutation	SNP	G	G	C			TCGA-61-2611-02A-01W-1092-09	TCGA-61-2611-11A-01W-1092-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	204bf013-8fed-4f18-82b7-218cc1f0b8a6	c758d83a-3656-43a4-ba90-22fbb0e32c38	g.chr20:52645056G>C	ENST00000395961.3	-	4	764	c.598C>G	c.(598-600)Ctg>Gtg	p.L200V	BCAS1_ENST00000371435.2_Missense_Mutation_p.L200V|BCAS1_ENST00000411563.1_Missense_Mutation_p.L103V|BCAS1_ENST00000371440.3_Missense_Mutation_p.L200V	NM_003657.2	NP_003648.2	O75363	BCAS1_HUMAN	breast carcinoma amplified sequence 1	200						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(23)|ovary(2)|skin(2)|stomach(1)|urinary_tract(1)	37	Breast(2;9.53e-15)|Lung NSC(4;5.57e-06)|all_lung(4;1.44e-05)		STAD - Stomach adenocarcinoma(23;0.116)|Colorectal(105;0.198)			CCCTTGTCCAGCTTGAAGAAT	0.562																																																0			20											183.0	176.0	179.0					20																	52645056		2203	4300	6503	52078463	SO:0001583	missense	8537			AF041260	CCDS13444.1	20q13.2	2006-11-10			ENSG00000064787	ENSG00000064787			974	protein-coding gene	gene with protein product		602968				9671742	Standard	NM_003657		Approved	NABC1, AIBC1	uc002xws.2	O75363	OTTHUMG00000032772	ENST00000395961.3:c.598C>G	20.37:g.52645056G>C	ENSP00000379290:p.Leu200Val		52078463	A0AVG5|Q68CZ3	Missense_Mutation	SNP	NULL	p.L200V	ENST00000395961.3	37	c.598	CCDS13444.1	20	.	.	.	.	.	.	.	.	.	.	G	14.11	2.438491	0.43326	.	.	ENSG00000064787	ENST00000448484;ENST00000371440;ENST00000448710;ENST00000395961;ENST00000371435;ENST00000411563	T;T;T;T;T	0.08634	3.07;3.07;3.07;3.07;3.07	5.11	5.11	0.69529	.	0.000000	0.49916	D	0.000127	T	0.27832	0.0685	M	0.66939	2.045	0.42460	D	0.99278	D;D;D;D;D;D	0.89917	1.0;0.999;0.999;1.0;0.999;0.999	D;D;D;D;D;D	0.91635	0.999;0.996;0.996;0.998;0.997;0.997	T	0.00778	-1.1570	10	0.87932	D	0	-10.811	15.618	0.76784	0.0:0.0:1.0:0.0	.	103;200;200;200;200;200	B4E2C4;B2RCQ5;O75363-2;G3XAF7;A0AVG7;O75363	.;.;.;.;.;BCAS1_HUMAN	V	62;200;78;200;200;103	ENSP00000396361:L62V;ENSP00000360495:L200V;ENSP00000379290:L200V;ENSP00000360490:L200V;ENSP00000397442:L103V	ENSP00000360490:L200V	L	-	1	2	BCAS1	52078463	1.000000	0.71417	1.000000	0.80357	0.067000	0.16453	2.319000	0.43788	2.527000	0.85204	0.563000	0.77884	CTG	-	NULL		0.562	BCAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCAS1	protein_coding	OTTHUMT00000079766.2	G	NM_003657		52078463	-1	no_errors	NM_003657	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
FBXO9	26268	genome.wustl.edu	37	6	52957570	52957570	+	Nonsense_Mutation	SNP	G	G	T			TCGA-61-2611-02A-01W-1092-09	TCGA-61-2611-11A-01W-1092-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	204bf013-8fed-4f18-82b7-218cc1f0b8a6	c758d83a-3656-43a4-ba90-22fbb0e32c38	g.chr6:52957570G>T	ENST00000244426.6	+	8	1013	c.841G>T	c.(841-843)Gaa>Taa	p.E281*	RN7SL244P_ENST00000493405.2_RNA|FBXO9_ENST00000370939.3_Nonsense_Mutation_p.E237*|FBXO9_ENST00000323557.7_Nonsense_Mutation_p.E271*	NM_012347.4	NP_036479.1	Q9UK97	FBX9_HUMAN	F-box protein 9	281					fat cell differentiation (GO:0045444)|innate immune response (GO:0045087)|protein ubiquitination (GO:0016567)|regulation of TOR signaling (GO:0032006)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)	cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)			kidney(1)|large_intestine(4)|lung(1)|pancreas(2)|skin(1)	9	Lung NSC(77;0.103)					TCGTCAAGGGGAACAGTCTCT	0.338																																																0			6											83.0	73.0	76.0					6																	52957570		1820	4088	5908	53065529	SO:0001587	stop_gained	26268			AF155114	CCDS55022.1, CCDS55023.1, CCDS55024.1	6p12.3-p11.2	2004-06-15	2004-06-15		ENSG00000112146	ENSG00000112146		"""F-boxes /  ""other"""""	13588	protein-coding gene	gene with protein product		609091	"""F-box only protein 9"""			10531035, 10531037	Standard	NM_012347		Approved	FBX9, NY-REN-57	uc021zao.1	Q9UK97	OTTHUMG00000014869	ENST00000244426.6:c.841G>T	6.37:g.52957570G>T	ENSP00000244426:p.Glu281*		53065529	A6NFW3|B3KMM6|O75986|Q59EH8|Q6PKH7|Q9NT57|Q9Y593	Nonsense_Mutation	SNP	superfamily_F-box domain,HMMPfam_F-box	p.E281*	ENST00000244426.6	37	c.841	CCDS55023.1	6	.	.	.	.	.	.	.	.	.	.	G	40	8.074117	0.98640	.	.	ENSG00000112146	ENST00000370939;ENST00000323557;ENST00000244426	.	.	.	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.34782	T	0.22	-3.2742	19.8195	0.96586	0.0:0.0:1.0:0.0	.	.	.	.	X	237;271;281	.	ENSP00000244426:E281X	E	+	1	0	FBXO9	53065529	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.420000	0.97426	2.757000	0.94681	0.563000	0.77884	GAA	-	superfamily_F-box domain		0.338	FBXO9-002	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	FBXO9	protein_coding	OTTHUMT00000040950.3	G			53065529	+1	no_errors	ENST00000244426	ensembl	human	known	54_36p	nonsense	SNP	1.000	T
MED13	9969	genome.wustl.edu	37	17	60061714	60061714	+	Silent	SNP	G	G	C			TCGA-61-2611-02A-01W-1092-09	TCGA-61-2611-11A-01W-1092-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	204bf013-8fed-4f18-82b7-218cc1f0b8a6	c758d83a-3656-43a4-ba90-22fbb0e32c38	g.chr17:60061714G>C	ENST00000397786.2	-	15	2782	c.2706C>G	c.(2704-2706)gtC>gtG	p.V902V		NM_005121.2	NP_005112.2	Q9UHV7	MED13_HUMAN	mediator complex subunit 13	902					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(4)|central_nervous_system(1)|endometrium(10)|kidney(24)|large_intestine(15)|liver(1)|lung(20)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						CAGGCTTATAGACATAAGAAA	0.358																																																0			17											49.0	46.0	47.0					17																	60061714		1797	4063	5860	57416496	SO:0001819	synonymous_variant	9969			AB011165	CCDS42366.1	17q22-q23	2007-07-30	2007-07-30	2007-07-30		ENSG00000108510			22474	protein-coding gene	gene with protein product		603808	"""thyroid hormone receptor associated protein 1"""	THRAP1		1019863	Standard	NM_005121		Approved	KIAA0593, TRAP240	uc002izo.3	Q9UHV7		ENST00000397786.2:c.2706C>G	17.37:g.60061714G>C			57416496	B2RU05|O60334	Silent	SNP	HMMPfam_TRAP_240kDa	p.V902	ENST00000397786.2	37	c.2706	CCDS42366.1	17																																																																																			-	NULL		0.358	MED13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MED13	protein_coding	OTTHUMT00000445461.1	G	NM_005121		57416496	-1	no_errors	NM_005121	genbank	human	reviewed	54_36p	silent	SNP	0.991	C
EPN1	29924	genome.wustl.edu	37	19	56206253	56206253	+	Missense_Mutation	SNP	G	G	C			TCGA-61-2611-02A-01W-1092-09	TCGA-61-2611-11A-01W-1092-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	204bf013-8fed-4f18-82b7-218cc1f0b8a6	c758d83a-3656-43a4-ba90-22fbb0e32c38	g.chr19:56206253G>C	ENST00000270460.6	+	10	1737	c.1426G>C	c.(1426-1428)Ggg>Cgg	p.G476R	AC010525.6_ENST00000587937.1_lincRNA|EPN1_ENST00000411543.2_Missense_Mutation_p.G562R|EPN1_ENST00000085079.7_Missense_Mutation_p.G450R|AC010525.7_ENST00000589698.1_lincRNA|AC010525.4_ENST00000585559.1_RNA	NM_001130072.1	NP_001123544.1	Q9Y6I3	EPN1_HUMAN	epsin 1	476	Ala/Gly/Pro-rich.				embryonic organ development (GO:0048568)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|female pregnancy (GO:0007565)|in utero embryonic development (GO:0001701)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|Notch signaling pathway (GO:0007219)	coated pit (GO:0005905)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)			endometrium(5)|kidney(1)|large_intestine(2)|lung(8)|skin(1)	17		Colorectal(82;0.00244)|Ovarian(87;0.133)		GBM - Glioblastoma multiforme(193;0.112)		GTCATTCCTGGGGCCCAATGC	0.711																																																0			19											20.0	29.0	26.0					19																	56206253		2090	4201	6291	60898065	SO:0001583	missense	29924			AF073727	CCDS46198.1, CCDS46199.1, CCDS46200.1	19q13.42	2014-08-12			ENSG00000063245	ENSG00000063245			21604	protein-coding gene	gene with protein product		607262				9723620, 10557078	Standard	NM_001130072		Approved		uc002qlx.3	Q9Y6I3	OTTHUMG00000180911	ENST00000270460.6:c.1426G>C	19.37:g.56206253G>C	ENSP00000270460:p.Gly476Arg		60898065	Q86ST3|Q9HA18	Missense_Mutation	SNP	superfamily_ENTH_VHS,HMMPfam_ENTH,HMMSmart_ENTH,HMMPfam_UIM,HMMSmart_UIM	p.G450R	ENST00000270460.6	37	c.1348	CCDS46199.1	19	.	.	.	.	.	.	.	.	.	.	G	19.35	3.811727	0.70797	.	.	ENSG00000063245	ENST00000270460;ENST00000085079;ENST00000544375;ENST00000411543	T;T;T	0.71579	0.1;-0.41;-0.58	4.7	4.7	0.59300	.	0.113300	0.64402	D	0.000012	D	0.86058	0.5842	M	0.86502	2.82	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.83275	0.982;0.996;0.982;0.992	D	0.88563	0.3124	10	0.87932	D	0	-27.8749	16.9439	0.86225	0.0:0.0:1.0:0.0	.	436;562;476;450	B4DU91;Q9Y6I3-1;Q9Y6I3;Q9Y6I3-3	.;.;EPN1_HUMAN;.	R	476;450;436;562	ENSP00000270460:G476R;ENSP00000085079:G450R;ENSP00000406209:G562R	ENSP00000085079:G450R	G	+	1	0	EPN1	60898065	1.000000	0.71417	1.000000	0.80357	0.291000	0.27294	7.099000	0.76981	2.611000	0.88343	0.655000	0.94253	GGG	-	NULL		0.711	EPN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	EPN1	protein_coding	OTTHUMT00000453610.1	G	NM_013333		60898065	+1	no_errors	NM_013333	genbank	human	validated	54_36p	missense	SNP	1.000	C
LINC00174	285908	genome.wustl.edu	37	7	65842445	65842445	+	lincRNA	SNP	G	G	C			TCGA-61-2611-02A-01W-1092-09	TCGA-61-2611-11A-01W-1092-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	204bf013-8fed-4f18-82b7-218cc1f0b8a6	c758d83a-3656-43a4-ba90-22fbb0e32c38	g.chr7:65842445G>C	ENST00000421767.1	-	0	3287					NR_026873.1				long intergenic non-protein coding RNA 174																		GCCGCCAACAGGCAAGAACTG	0.692																																																0			7											17.0	18.0	18.0					7																	65842445		2200	4291	6491	65479880			285908			AK091213		7q11.21	2013-12-05	2013-12-05	2013-12-05	ENSG00000179406	ENSG00000179406		"""Long non-coding RNAs"""	27788	non-coding RNA	RNA, long non-coding			"""non-protein coding RNA 174"""	NCRNA00174			Standard	NR_026873		Approved		uc003tux.4		OTTHUMG00000156590		7.37:g.65842445G>C			65479880		Missense_Mutation	SNP	NULL	p.P51R	ENST00000421767.1	37	c.152		7																																																																																			-	NULL		0.692	LINC00174-001	KNOWN	basic	lincRNA	NCRNA00174	lincRNA	OTTHUMT00000344721.1	G	NR_026873		65479880	-1	no_errors	ENST00000324866	ensembl	human	known	54_36p	missense	SNP	0.465	C
HDAC8	55869	genome.wustl.edu	37	X	71791925	71791925	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2611-02A-01W-1092-09	TCGA-61-2611-11A-01W-1092-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	204bf013-8fed-4f18-82b7-218cc1f0b8a6	c758d83a-3656-43a4-ba90-22fbb0e32c38	g.chrX:71791925G>A	ENST00000373573.3	-	2	487	c.146C>T	c.(145-147)gCa>gTa	p.A49V	HDAC8_ENST00000373571.1_Missense_Mutation_p.A49V|HDAC8_ENST00000439122.2_Missense_Mutation_p.A49V|HDAC8_ENST00000373561.4_Missense_Mutation_p.A49V|HDAC8_ENST00000373583.1_Missense_Mutation_p.A49V|HDAC8_ENST00000373560.2_Missense_Mutation_p.A49V|HDAC8_ENST00000373554.1_Missense_Mutation_p.A49V|HDAC8_ENST00000373559.4_Missense_Mutation_p.A49V|HDAC8_ENST00000373589.4_Missense_Mutation_p.A49V|HDAC8_ENST00000478743.1_5'UTR|HDAC8_ENST00000373556.3_Missense_Mutation_p.A49V|HDAC8_ENST00000429103.2_5'UTR	NM_018486.2	NP_060956.1	Q9BY41	HDAC8_HUMAN	histone deacetylase 8	49	Histone deacetylase.				chromatin assembly or disassembly (GO:0006333)|chromatin modification (GO:0016568)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of cohesin localization to chromatin (GO:0071922)|sister chromatid cohesion (GO:0007062)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone deacetylase complex (GO:0000118)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)	histone deacetylase activity (GO:0004407)|metal ion binding (GO:0046872)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|transcription factor binding (GO:0008134)			breast(3)|cervix(1)|endometrium(1)|lung(4)|prostate(1)	10	Renal(35;0.156)				Vorinostat(DB02546)	CTTATGCAGTGCATATGCTTC	0.383																																																0			X											111.0	85.0	94.0					X																	71791925		2203	4300	6503	71708650	SO:0001583	missense	55869			AF230097	CCDS14420.1, CCDS55448.1, CCDS55449.1, CCDS55450.1, CCDS55451.1, CCDS55452.1	Xq13	2014-01-29	2002-09-02	2002-09-06	ENSG00000147099	ENSG00000147099			13315	protein-coding gene	gene with protein product		300269	"""histone deacetylase-like 1"", ""Wilson-Turner X-linked mental retardation syndrome"""	HDACL1, WTS, MRXS6		10756090, 10922473, 22889856	Standard	NM_001166448		Approved	RPD3	uc004eau.3	Q9BY41	OTTHUMG00000021814	ENST00000373573.3:c.146C>T	X.37:g.71791925G>A	ENSP00000362674:p.Ala49Val		71708650	A6ND12|A6ND61|A6NET3|A6NJR3|A8MQ62|B4DKN0|B4DV22|Q86VC8|Q9NP76|Q9NYH4	Missense_Mutation	SNP	superfamily_Arginase/deacetylase,HMMPfam_Hist_deacetyl	p.A49V	ENST00000373573.3	37	c.146	CCDS14420.1	X	.	.	.	.	.	.	.	.	.	.	G	14.80	2.644560	0.47258	.	.	ENSG00000147099	ENST00000373573;ENST00000373583;ENST00000373589;ENST00000373568;ENST00000415409;ENST00000373571;ENST00000439122;ENST00000373560;ENST00000373559;ENST00000373561;ENST00000421523;ENST00000373556;ENST00000373554	T;T;T;T;T;T;T;T;T;T;T;T	0.73897	-0.79;-0.79;-0.79;-0.79;-0.79;-0.79;-0.79;-0.79;-0.79;-0.79;-0.79;-0.79	4.32	4.32	0.51571	Histone deacetylase domain (2);	0.494462	0.21565	N	0.072519	T	0.61375	0.2342	N	0.19112	0.55	0.32629	N	0.522231	B;P;B;B	0.37176	0.157;0.586;0.003;0.0	B;B;B;B	0.39562	0.086;0.303;0.001;0.0	T	0.72779	-0.4190	10	0.87932	D	0	-6.8087	10.0275	0.42081	0.0:0.2024:0.7976:0.0	.	49;49;49;49	B4DH31;B4DKN0;B4DV22;Q9BY41	.;.;.;HDAC8_HUMAN	V	49;49;49;49;49;49;49;49;49;49;10;49;49	ENSP00000362674:A49V;ENSP00000362691:A49V;ENSP00000362669:A49V;ENSP00000396424:A49V;ENSP00000362672:A49V;ENSP00000414486:A49V;ENSP00000362661:A49V;ENSP00000362660:A49V;ENSP00000362662:A49V;ENSP00000398997:A10V;ENSP00000362657:A49V;ENSP00000362655:A49V	ENSP00000362655:A49V	A	-	2	0	HDAC8	71708650	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	3.144000	0.50616	2.083000	0.62718	0.422000	0.28245	GCA	-	superfamily_Arginase/deacetylase,HMMPfam_Hist_deacetyl		0.383	HDAC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HDAC8	protein_coding	OTTHUMT00000057193.2	G	NM_018486		71708650	-1	no_errors	NM_018486	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
MB21D1	115004	genome.wustl.edu	37	6	74135094	74135094	+	Silent	SNP	G	G	T			TCGA-61-2611-02A-01W-1092-09	TCGA-61-2611-11A-01W-1092-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	204bf013-8fed-4f18-82b7-218cc1f0b8a6	c758d83a-3656-43a4-ba90-22fbb0e32c38	g.chr6:74135094G>T	ENST00000370315.3	-	5	1519	c.1425C>A	c.(1423-1425)ctC>ctA	p.L475L	MB21D1_ENST00000370318.1_Intron	NM_138441.2	NP_612450.2	Q8N884	CGAS_HUMAN	Mab-21 domain containing 1	475					activation of innate immune response (GO:0002218)|cellular response to exogenous dsRNA (GO:0071360)|cyclic nucleotide biosynthetic process (GO:0009190)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of type I interferon production (GO:0032481)	cytosol (GO:0005829)	ATP binding (GO:0005524)|cyclic-GMP-AMP synthase activity (GO:0061501)|DNA binding (GO:0003677)|GTP binding (GO:0005525)|metal ion binding (GO:0046872)			central_nervous_system(1)|large_intestine(4)|lung(1)	6						TTTCTGTCCTGAGGCACTGAA	0.398																																																0			6											69.0	66.0	67.0					6																	74135094		2203	4300	6503	74191815	SO:0001819	synonymous_variant	115004			BC012928	CCDS4978.1	6q13	2011-02-23	2011-02-23	2011-02-23	ENSG00000164430	ENSG00000164430			21367	protein-coding gene	gene with protein product		613973	"""chromosome 6 open reading frame 150"""	C6orf150			Standard	NM_138441		Approved		uc003pgx.1	Q8N884	OTTHUMG00000015034	ENST00000370315.3:c.1425C>A	6.37:g.74135094G>T			74191815	L0L2J9|Q14CV6|Q32NC9|Q5SWL0|Q5SWL1|Q96E45	Silent	SNP	NULL	p.L475	ENST00000370315.3	37	c.1425	CCDS4978.1	6																																																																																			-	NULL		0.398	MB21D1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	C6orf150	protein_coding	OTTHUMT00000041221.5	G	NM_138441		74191815	-1	no_errors	NM_138441	genbank	human	validated	54_36p	silent	SNP	0.146	T
GPS1	2873	genome.wustl.edu	37	17	80012890	80012890	+	Intron	SNP	C	C	T			TCGA-61-2611-02A-01W-1092-09	TCGA-61-2611-11A-01W-1092-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	204bf013-8fed-4f18-82b7-218cc1f0b8a6	c758d83a-3656-43a4-ba90-22fbb0e32c38	g.chr17:80012890C>T	ENST00000306823.6	+	5	722				GPS1_ENST00000578552.1_Intron|GPS1_ENST00000320548.4_Intron|GPS1_ENST00000392358.2_Intron|GPS1_ENST00000355130.2_Intron			Q13098	CSN1_HUMAN	G protein pathway suppressor 1						cell cycle (GO:0007049)|cullin deneddylation (GO:0010388)|inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)	COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTPase inhibitor activity (GO:0005095)			breast(1)|central_nervous_system(1)|endometrium(3)|liver(1)|lung(4)|prostate(1)|skin(2)	13	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0211)			CCCCAGGATTCCTGACCACTG	0.607																																																0			17											52.0	52.0	52.0					17																	80012890		2202	4299	6501	77606179	SO:0001627	intron_variant	2873				CCDS11800.1, CCDS32774.1	17q25.3	2013-03-14				ENSG00000169727			4549	protein-coding gene	gene with protein product	"""COP9 signalosome subunit 1"""	601934				9535219	Standard	NM_212492		Approved	COPS1, CSN1	uc002kdl.1	Q13098		ENST00000306823.6:c.699+39C>T	17.37:g.80012890C>T			77606179	Q8NA10|Q9BWL1	Silent	SNP	HMMPfam_RPN7	p.F167	ENST00000306823.6	37	c.501	CCDS32774.1	17																																																																																			-	HMMPfam_RPN7		0.607	GPS1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GPS1	protein_coding	OTTHUMT00000442176.1	C	NM_212492		77606179	+1	no_start_codon	ENST00000392357	ensembl	human	known	54_36p	silent	SNP	0.002	T
PEX1	5189	genome.wustl.edu	37	7	92131394	92131394	+	Splice_Site	SNP	C	C	A			TCGA-61-2611-02A-01W-1092-09	TCGA-61-2611-11A-01W-1092-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	204bf013-8fed-4f18-82b7-218cc1f0b8a6	c758d83a-3656-43a4-ba90-22fbb0e32c38	g.chr7:92131394C>A	ENST00000248633.4	-	14	2322		c.e14-1		PEX1_ENST00000541751.1_Intron|PEX1_ENST00000438045.1_Splice_Site|PEX1_ENST00000428214.1_Splice_Site	NM_000466.2	NP_000457.1	O43933	PEX1_HUMAN	peroxisomal biogenesis factor 1						ATP catabolic process (GO:0006200)|microtubule-based peroxisome localization (GO:0060152)|peroxisome organization (GO:0007031)|protein import into peroxisome matrix (GO:0016558)|protein targeting to peroxisome (GO:0006625)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(6)|lung(17)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	41	all_cancers(62;9.35e-11)|all_epithelial(64;4.59e-10)|Breast(17;0.00201)|all_lung(186;0.0438)|Lung NSC(181;0.0592)	Breast(660;0.000932)|all_neural(109;0.00391)|Myeloproliferative disorder(862;0.0122)|Ovarian(593;0.023)|Medulloblastoma(109;0.123)	GBM - Glioblastoma multiforme(5;4.06e-06)|STAD - Stomach adenocarcinoma(4;4.51e-05)|all cancers(6;5.32e-05)|LUSC - Lung squamous cell carcinoma(200;0.225)|Lung(22;0.23)			ATCTTTGTTCCTAAAGAAAAA	0.294																																																0			7											95.0	105.0	102.0					7																	92131394		2203	4299	6502	91969330	SO:0001630	splice_region_variant	5189			AF026086	CCDS5627.1, CCDS64710.1	7q21.2	2010-04-21	2008-08-26		ENSG00000127980	ENSG00000127980		"""ATPases / AAA-type"""	8850	protein-coding gene	gene with protein product		602136	"""peroxisome biogenesis factor 1"", ""Zellweger syndrome 1"", ""Zellweger syndrome"""	ZWS1, ZWS		9398848	Standard	NM_001282677		Approved		uc003uly.3	O43933	OTTHUMG00000023926	ENST00000248633.4:c.2227-1G>T	7.37:g.92131394C>A			91969330	A4D1G3|A8KA90|B4DIM7|E9PE75|Q96S71|Q96S72|Q96S73|Q99994	Splice_Site	SNP	-	e14-1	ENST00000248633.4	37	c.2227-1	CCDS5627.1	7	.	.	.	.	.	.	.	.	.	.	C	18.91	3.724489	0.68959	.	.	ENSG00000127980	ENST00000438045;ENST00000248633;ENST00000428214	.	.	.	5.4	5.4	0.78164	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.3555	0.94410	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PEX1	91969330	1.000000	0.71417	1.000000	0.80357	0.873000	0.50193	6.536000	0.73842	2.813000	0.96785	0.561000	0.74099	.	-	-		0.294	PEX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PEX1	protein_coding	OTTHUMT00000254066.3	C	NM_000466	Intron	91969330	-1	no_errors	NM_000466	genbank	human	reviewed	54_36p	splice_site	SNP	0.998	A
DYNC1H1	1778	genome.wustl.edu	37	14	102508746	102508746	+	Missense_Mutation	SNP	C	C	G			TCGA-61-2611-02A-01W-1092-09	TCGA-61-2611-11A-01W-1092-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	204bf013-8fed-4f18-82b7-218cc1f0b8a6	c758d83a-3656-43a4-ba90-22fbb0e32c38	g.chr14:102508746C>G	ENST00000360184.4	+	68	12465	c.12301C>G	c.(12301-12303)Ctg>Gtg	p.L4101V	RP11-1017G21.4_ENST00000557551.1_RNA|RP11-1017G21.4_ENST00000557242.1_RNA|RP11-1017G21.4_ENST00000553701.1_RNA	NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	4101	AAA 6. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						GAATGTGCATCTGGCCCCAGG	0.562																																																0			14											86.0	75.0	79.0					14																	102508746		2203	4300	6503	101578499	SO:0001583	missense	1778			AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.12301C>G	14.37:g.102508746C>G	ENSP00000348965:p.Leu4101Val		101578499	B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Missense_Mutation	SNP	HMMPfam_DHC_N1,HMMPfam_DHC_N2,superfamily_SSF52540,HMMSmart_AAA,HMMPfam_AAA_5,HMMPfam_Dynein_heavy	p.L4101V	ENST00000360184.4	37	c.12301	CCDS9966.1	14	.	.	.	.	.	.	.	.	.	.	C	22.4	4.285062	0.80803	.	.	ENSG00000197102	ENST00000360184	T	0.30182	1.54	5.91	5.91	0.95273	Dynein heavy chain (1);	0.000000	0.64402	D	0.000001	T	0.64549	0.2608	H	0.94847	3.59	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.72724	-0.4207	10	0.87932	D	0	.	10.6321	0.45543	0.0:0.8583:0.0:0.1417	.	4101	Q14204	DYHC1_HUMAN	V	4101	ENSP00000348965:L4101V	ENSP00000348965:L4101V	L	+	1	2	DYNC1H1	101578499	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.360000	0.52299	2.808000	0.96608	0.655000	0.94253	CTG	-	HMMPfam_Dynein_heavy		0.562	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYNC1H1	protein_coding	OTTHUMT00000414574.1	C	NM_001376		101578499	+1	no_errors	NM_001376	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
TRPS1	7227	genome.wustl.edu	37	8	116616130	116616130	+	Missense_Mutation	SNP	T	T	G			TCGA-61-2611-02A-01W-1092-09	TCGA-61-2611-11A-01W-1092-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	204bf013-8fed-4f18-82b7-218cc1f0b8a6	c758d83a-3656-43a4-ba90-22fbb0e32c38	g.chr8:116616130T>G	ENST00000220888.5	-	3	2186	c.2027A>C	c.(2026-2028)cAa>cCa	p.Q676P	TRPS1_ENST00000395715.3_Missense_Mutation_p.Q689P|TRPS1_ENST00000519076.1_Missense_Mutation_p.Q430P|TRPS1_ENST00000519674.1_Missense_Mutation_p.Q676P|TRPS1_ENST00000520276.1_Missense_Mutation_p.Q680P			Q9UHF7	TRPS1_HUMAN	trichorhinophalangeal syndrome I	676	Mediates interaction with GLI3.				chondrocyte differentiation (GO:0002062)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|regulation of chondrocyte differentiation (GO:0032330)|regulation of histone deacetylation (GO:0031063)|skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(58)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	111	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)			TTCTTCCACTTGGGTAATAAA	0.433									Langer-Giedion syndrome																																							0			8											81.0	77.0	79.0					8																	116616130		1891	4108	5999	116685305	SO:0001583	missense	7227	Familial Cancer Database	Trichorhinophalangeal syndrome type 2, TRPS II	AF183810	CCDS6318.2, CCDS64957.1	8q23.3	2014-06-23			ENSG00000104447	ENSG00000104447		"""GATA zinc finger domain containing"", ""Zinc fingers, C2H2-type"""	12340	protein-coding gene	gene with protein product		604386				8530105, 10615131, 10647898	Standard	NM_001282903		Approved	LGCR	uc003yny.3	Q9UHF7	OTTHUMG00000142829	ENST00000220888.5:c.2027A>C	8.37:g.116616130T>G	ENSP00000220888:p.Gln676Pro		116685305	B4E1Z5|Q08AU2|Q9NWE1|Q9UHH6	Missense_Mutation	SNP	HMMSmart_ZnF_C2H2,superfamily_SSF57716,HMMSmart_ZnF_GATA,PatternScan_GATA_ZN_FINGER_1,HMMPfam_GATA,PatternScan_ZINC_FINGER_C2H2_1,HMMPfam_zf-C2H2	p.Q689P	ENST00000220888.5	37	c.2066		8	.	.	.	.	.	.	.	.	.	.	T	14.77	2.633754	0.47049	.	.	ENSG00000104447	ENST00000395715;ENST00000220888;ENST00000519076;ENST00000520276;ENST00000519674	T;T;T;T;T	0.11712	2.75;2.75;2.75;2.75;2.75	5.95	5.95	0.96441	Zinc finger, C2H2-like (1);	0.059479	0.64402	D	0.000002	T	0.08223	0.0205	L	0.27053	0.805	0.51233	D	0.999918	P;P;P	0.40731	0.728;0.608;0.728	B;B;B	0.28139	0.086;0.04;0.086	T	0.09862	-1.0655	10	0.87932	D	0	.	16.4069	0.83677	0.0:0.0:0.0:1.0	.	680;676;689	Q9UHF7-3;Q9UHF7;Q9UHF7-2	.;TRPS1_HUMAN;.	P	689;676;430;680;676	ENSP00000379065:Q689P;ENSP00000220888:Q676P;ENSP00000428910:Q430P;ENSP00000428680:Q680P;ENSP00000429174:Q676P	ENSP00000220888:Q676P	Q	-	2	0	TRPS1	116685305	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.628000	0.83189	2.272000	0.75746	0.460000	0.39030	CAA	-	HMMSmart_ZnF_C2H2		0.433	TRPS1-002	KNOWN	basic	protein_coding	TRPS1	protein_coding	OTTHUMT00000286436.3	T	NM_014112		116685305	-1	no_errors	NM_014112	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
MCAM	4162	genome.wustl.edu	37	11	119182854	119182854	+	Missense_Mutation	SNP	C	C	A			TCGA-61-2611-02A-01W-1092-09	TCGA-61-2611-11A-01W-1092-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	204bf013-8fed-4f18-82b7-218cc1f0b8a6	c758d83a-3656-43a4-ba90-22fbb0e32c38	g.chr11:119182854C>A	ENST00000264036.4	-	9	1065	c.1051G>T	c.(1051-1053)Gca>Tca	p.A351S	MCAM_ENST00000530144.2_5'Flank|MCAM_ENST00000392814.1_Missense_Mutation_p.A300S	NM_006500.2	NP_006491.2	P43121	MUC18_HUMAN	melanoma cell adhesion molecule	351	Ig-like C2-type 2.				anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|glomerular filtration (GO:0003094)|vascular wound healing (GO:0061042)	external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(2)|endometrium(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(3)|skin(1)	22		Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;3.78e-05)		TCAGGGGCTGCGGGACTCACT	0.622																																																0			11											47.0	48.0	48.0					11																	119182854		2199	4295	6494	118688064	SO:0001583	missense	4162			X68264	CCDS31690.1	11q23.3	2013-01-29				ENSG00000076706		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6934	protein-coding gene	gene with protein product	"""Gicerin"""	155735				2602381, 10702685	Standard	XM_005271552		Approved	MUC18, CD146	uc001pwf.3	P43121		ENST00000264036.4:c.1051G>T	11.37:g.119182854C>A	ENSP00000264036:p.Ala351Ser		118688064	O95812|Q59E86|Q6PHR3|Q6ZTR2	Missense_Mutation	SNP	HMMPfam_V-set,HMMSmart_SM00409,superfamily_Immunoglobulin,HMMPfam_C2-set_2,HMMSmart_SM00408,HMMPfam_ig	p.A351S	ENST00000264036.4	37	c.1051	CCDS31690.1	11	.	.	.	.	.	.	.	.	.	.	C	8.788	0.929822	0.18131	.	.	ENSG00000076706	ENST00000264036;ENST00000392814	T;T	0.14640	2.49;2.49	5.52	-2.56	0.06268	Immunoglobulin-like (1);	.	.	.	.	T	0.04815	0.0130	N	0.11789	0.175	0.09310	N	1	B	0.27498	0.18	B	0.27608	0.081	T	0.41716	-0.9493	9	0.09338	T	0.73	-0.016	1.3366	0.02146	0.1298:0.2117:0.2567:0.4019	.	351	P43121	MUC18_HUMAN	S	351;300	ENSP00000264036:A351S;ENSP00000376561:A300S	ENSP00000264036:A351S	A	-	1	0	MCAM	118688064	0.000000	0.05858	0.000000	0.03702	0.246000	0.25737	-1.000000	0.03693	-0.338000	0.08413	-1.121000	0.02013	GCA	-	superfamily_Immunoglobulin,HMMSmart_SM00409		0.622	MCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCAM	protein_coding	OTTHUMT00000388332.2	C			118688064	-1	no_errors	NM_006500	genbank	human	validated	54_36p	missense	SNP	0.000	A
PLA1A	51365	genome.wustl.edu	37	3	119347700	119347700	+	Missense_Mutation	SNP	C	C	G			TCGA-61-2611-02A-01W-1092-09	TCGA-61-2611-11A-01W-1092-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	204bf013-8fed-4f18-82b7-218cc1f0b8a6	c758d83a-3656-43a4-ba90-22fbb0e32c38	g.chr3:119347700C>G	ENST00000273371.4	+	10	1346	c.1274C>G	c.(1273-1275)cCt>cGt	p.P425R	PLA1A_ENST00000488919.1_Missense_Mutation_p.P252R|PLA1A_ENST00000494440.1_Missense_Mutation_p.P409R|PLA1A_ENST00000495992.1_Missense_Mutation_p.P409R	NM_015900.3	NP_056984.1	Q53H76	PLA1A_HUMAN	phospholipase A1 member A	425	Involved in the recognition of diacyl- phospholipids.				lipid catabolic process (GO:0016042)|lipid metabolic process (GO:0006629)|phosphatidylserine metabolic process (GO:0006658)	extracellular vesicular exosome (GO:0070062)	phosphatidylcholine 1-acylhydrolase activity (GO:0008970)			NS(1)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						GCCCTTTTGCCTGTCAATGAC	0.453																																																0			3											110.0	109.0	110.0					3																	119347700		2203	4300	6503	120830390	SO:0001583	missense	51365			AF035268	CCDS2991.1, CCDS56268.1, CCDS56269.1	3q13.13-q13.2	2002-11-28			ENSG00000144837	ENSG00000144837			17661	protein-coding gene	gene with protein product		607460				10196188	Standard	NM_015900		Approved	ps-PLA1	uc003ecu.3	Q53H76	OTTHUMG00000159425	ENST00000273371.4:c.1274C>G	3.37:g.119347700C>G	ENSP00000273371:p.Pro425Arg		120830390	B2R8V2|B4DXA2|O95991|Q86WX6|Q9UPD2	Missense_Mutation	SNP	superfamily_alpha/beta-Hydrolases,HMMPfam_Lipase,PatternScan_LIPASE_SER	p.P425R	ENST00000273371.4	37	c.1274	CCDS2991.1	3	.	.	.	.	.	.	.	.	.	.	C	14.50	2.552628	0.45487	.	.	ENSG00000144837	ENST00000273371;ENST00000488919;ENST00000495992;ENST00000494440	D;D;D;D	0.95554	-3.2;-3.74;-3.1;-3.26	5.39	5.39	0.77823	.	0.123692	0.56097	D	0.000037	D	0.95828	0.8642	L	0.36672	1.1	0.43579	D	0.995916	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.93950	0.7231	10	0.19147	T	0.46	-20.3177	16.0768	0.80974	0.0:1.0:0.0:0.0	.	409;425	Q53H76-3;Q53H76	.;PLA1A_HUMAN	R	425;252;409;409	ENSP00000273371:P425R;ENSP00000420625:P252R;ENSP00000417326:P409R;ENSP00000418793:P409R	ENSP00000273371:P425R	P	+	2	0	PLA1A	120830390	0.996000	0.38824	0.844000	0.33320	0.153000	0.21895	4.300000	0.59079	2.521000	0.84997	0.561000	0.74099	CCT	-	NULL		0.453	PLA1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLA1A	protein_coding	OTTHUMT00000355252.2	C			120830390	+1	no_errors	NM_015900	genbank	human	validated	54_36p	missense	SNP	0.342	G
VWA5A	4013	genome.wustl.edu	37	11	123993696	123993696	+	Missense_Mutation	SNP	G	G	C			TCGA-61-2611-02A-01W-1092-09	TCGA-61-2611-11A-01W-1092-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	204bf013-8fed-4f18-82b7-218cc1f0b8a6	c758d83a-3656-43a4-ba90-22fbb0e32c38	g.chr11:123993696G>C	ENST00000456829.2	+	8	1041	c.790G>C	c.(790-792)Gtg>Ctg	p.V264L	VWA5A_ENST00000361352.5_Missense_Mutation_p.V264L|VWA5A_ENST00000360334.4_Missense_Mutation_p.V264L|VWA5A_ENST00000392748.1_Missense_Mutation_p.V264L|VWA5A_ENST00000392744.4_Missense_Mutation_p.V280L|VWA5A_ENST00000449321.1_Missense_Mutation_p.V264L	NM_001130142.1	NP_001123614.1	O00534	VMA5A_HUMAN	von Willebrand factor A domain containing 5A	264										autonomic_ganglia(1)|breast(3)|endometrium(5)|kidney(2)|large_intestine(11)|lung(17)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	47						ATCTGCAATGGTGAGTTTCTA	0.428																																																0			11											78.0	78.0	78.0					11																	123993696		2201	4299	6500	123498906	SO:0001583	missense	4013			AF002672	CCDS8444.1, CCDS8445.1	11q24.1	2008-07-25	2008-07-25	2008-07-25	ENSG00000110002	ENSG00000110002			6658	protein-coding gene	gene with protein product		602929	"""loss of heterozygosity, 11, chromosomal region 2, gene A"""	LOH11CR2A		9417908, 14504409	Standard	NM_001130142		Approved	BCSC-1	uc001pzt.3	O00534	OTTHUMG00000165971	ENST00000456829.2:c.790G>C	11.37:g.123993696G>C	ENSP00000407726:p.Val264Leu		123498906	Q6UN19|Q6UN20|Q9BVF8	Splice_Site	SNP	-	e6+1	ENST00000456829.2	37	c.789+1	CCDS8444.1	11	.	.	.	.	.	.	.	.	.	.	G	9.778	1.174630	0.21704	.	.	ENSG00000110002	ENST00000456829;ENST00000360334;ENST00000392748;ENST00000524524;ENST00000530025;ENST00000361352;ENST00000449321;ENST00000392744	T;T;T;T;T;T	0.19105	4.0;2.17;4.0;2.53;2.53;2.53	5.96	4.09	0.47781	.	0.302543	0.33553	N	0.004800	T	0.12263	0.0298	L	0.35723	1.085	0.39594	D	0.969629	B;P	0.35507	0.079;0.506	B;B	0.36092	0.042;0.217	T	0.13124	-1.0521	10	0.02654	T	1	-26.4488	5.3045	0.15795	0.0766:0.1431:0.6321:0.1482	.	280;264	B4DHS6;O00534	.;VMA5A_HUMAN	L	264;264;264;264;264;264;264;280	ENSP00000407726:V264L;ENSP00000353485:V264L;ENSP00000376504:V264L;ENSP00000355070:V264L;ENSP00000404683:V264L;ENSP00000376501:V280L	ENSP00000353485:V264L	V	+	1	0	VWA5A	123498906	1.000000	0.71417	1.000000	0.80357	0.837000	0.47467	0.625000	0.24477	0.853000	0.35312	-0.169000	0.13324	GTG	-	-		0.428	VWA5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VWA5A	protein_coding	OTTHUMT00000387273.1	G	NM_014622		123498906	+1	no_stop_codon	ENST00000392744	ensembl	human	known	54_36p	splice_site	SNP	1.000	C
TBC1D31	93594	genome.wustl.edu	37	8	124162368	124162368	+	Splice_Site	SNP	A	A	T			TCGA-61-2611-02A-01W-1092-09	TCGA-61-2611-11A-01W-1092-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	204bf013-8fed-4f18-82b7-218cc1f0b8a6	c758d83a-3656-43a4-ba90-22fbb0e32c38	g.chr8:124162368A>T	ENST00000287380.1	+	21	3157	c.3067A>T	c.(3067-3069)Att>Ttt	p.I1023F	TBC1D31_ENST00000518805.1_Splice_Site_p.I577F|TBC1D31_ENST00000309336.3_Splice_Site_p.I958F|TBC1D31_ENST00000522420.1_Splice_Site_p.I918F|TBC1D31_ENST00000327098.5_Splice_Site_p.I927F|TBC1D31_ENST00000378080.2_3'UTR|TBC1D31_ENST00000521676.1_Splice_Site_p.I900F	NM_145647.3	NP_663622.2	Q96DN5	TBC31_HUMAN	TBC1 domain family, member 31	1023						centrosome (GO:0005813)	Rab GTPase activator activity (GO:0005097)										CTCAACACAGAGTAAGTTGAT	0.343																																																0			8											69.0	63.0	65.0					8																	124162368		2203	4300	6503	124231549	SO:0001630	splice_region_variant	93594			AK094612	CCDS6338.1, CCDS47916.1	8q24.13	2013-07-10	2013-07-10	2013-07-10	ENSG00000156787	ENSG00000156787		"""WD repeat domain containing"""	30888	protein-coding gene	gene with protein product			"""WD repeat domain 67"""	WDR67		12477932	Standard	NM_001145088		Approved	MGC21654, Gm85	uc003ypp.2	Q96DN5	OTTHUMG00000165081	ENST00000287380.1:c.3067+1A>T	8.37:g.124162368A>T			124231549	B7ZL19|Q2M2J9|Q3MIR6|Q8TBP9	Missense_Mutation	SNP	superfamily_WD40 repeat-like,HMMSmart_SM00320,HMMPfam_WD40,PatternScan_WD_REPEATS_1,superfamily_Ypt/Rab-GAP domain of gyp1p	p.I1023F	ENST00000287380.1	37	c.3067	CCDS6338.1	8	.	.	.	.	.	.	.	.	.	.	A	9.313	1.056068	0.19907	.	.	ENSG00000156787	ENST00000287380;ENST00000309336;ENST00000327098;ENST00000522420;ENST00000521676;ENST00000518805	T;T;T;T;T;T	0.74737	-0.17;-0.23;-0.26;-0.62;-0.87;0.98	4.41	-3.43	0.04810	.	0.804963	0.11187	N	0.590284	T	0.43055	0.1230	N	0.12182	0.205	0.80722	D	1	B;B;B;B	0.06786	0.0;0.001;0.0;0.0	B;B;B;B	0.04013	0.0;0.001;0.001;0.0	T	0.43956	-0.9359	10	0.06494	T	0.89	-0.078	2.0765	0.03625	0.3114:0.3943:0.1658:0.1285	.	927;958;918;1023	B7ZL19;Q96DN5-2;E7ERK7;Q96DN5	.;.;.;WDR67_HUMAN	F	1023;958;927;918;900;577	ENSP00000287380:I1023F;ENSP00000308358:I958F;ENSP00000312701:I927F;ENSP00000429334:I918F;ENSP00000430628:I900F;ENSP00000429494:I577F	ENSP00000287380:I1023F	I	+	1	0	WDR67	124231549	0.063000	0.20901	0.017000	0.16124	0.123000	0.20343	0.062000	0.14389	-0.665000	0.05317	-0.466000	0.05196	ATT	-	NULL		0.343	TBC1D31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR67	protein_coding	OTTHUMT00000381721.1	A	NM_145647	Missense_Mutation	124231549	+1	no_errors	NM_145647	genbank	human	validated	54_36p	missense	SNP	0.151	T
ANKRD50	57182	genome.wustl.edu	37	4	125591662	125591662	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2611-02A-01W-1092-09	TCGA-61-2611-11A-01W-1092-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	204bf013-8fed-4f18-82b7-218cc1f0b8a6	c758d83a-3656-43a4-ba90-22fbb0e32c38	g.chr4:125591662C>T	ENST00000504087.1	-	4	3807	c.2770G>A	c.(2770-2772)Ggg>Agg	p.G924R	ANKRD50_ENST00000515641.1_Missense_Mutation_p.G745R	NM_020337.2	NP_065070.1	Q9ULJ7	ANR50_HUMAN	ankyrin repeat domain 50	924										NS(1)|breast(3)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(14)|lung(18)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	55						TCCCTGTGCCCTTCTAATGCA	0.403																																																0			4											90.0	87.0	88.0					4																	125591662		2203	4300	6503	125811112	SO:0001583	missense	57182			AB033049	CCDS34060.1, CCDS54802.1	4q28.1	2013-01-10			ENSG00000151458	ENSG00000151458		"""Ankyrin repeat domain containing"""	29223	protein-coding gene	gene with protein product							Standard	NM_020337		Approved	KIAA1223	uc010inw.3	Q9ULJ7	OTTHUMG00000161398	ENST00000504087.1:c.2770G>A	4.37:g.125591662C>T	ENSP00000425658:p.Gly924Arg		125811112	A8K4V3|B4DHJ6|E9PDW0|Q6N064|Q6ZSE6	Missense_Mutation	SNP	superfamily_ANK,HMMPfam_Ank,HMMSmart_ANK	p.G924R	ENST00000504087.1	37	c.2770	CCDS34060.1	4	.	.	.	.	.	.	.	.	.	.	C	23.4	4.417632	0.83449	.	.	ENSG00000151458	ENST00000504087;ENST00000515641	T;T	0.74842	-0.88;-0.88	5.23	5.23	0.72850	Ankyrin repeat-containing domain (3);	0.000000	0.85682	D	0.000000	D	0.85225	0.5648	M	0.64567	1.98	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.86195	0.1615	10	0.87932	D	0	.	18.9964	0.92815	0.0:1.0:0.0:0.0	.	924	Q9ULJ7	ANR50_HUMAN	R	924;745	ENSP00000425658:G924R;ENSP00000425355:G745R	ENSP00000425658:G924R	G	-	1	0	ANKRD50	125811112	1.000000	0.71417	0.857000	0.33713	0.858000	0.48976	7.164000	0.77533	2.724000	0.93272	0.561000	0.74099	GGG	-	superfamily_ANK,HMMSmart_ANK,HMMPfam_Ank		0.403	ANKRD50-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD50	protein_coding	OTTHUMT00000364775.1	C	NM_020337		125811112	-1	no_errors	NM_020337	genbank	human	validated	54_36p	missense	SNP	0.998	T
EP400	57634	genome.wustl.edu	37	12	132502919	132502919	+	Silent	SNP	C	C	T			TCGA-61-2611-02A-01W-1092-09	TCGA-61-2611-11A-01W-1092-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	204bf013-8fed-4f18-82b7-218cc1f0b8a6	c758d83a-3656-43a4-ba90-22fbb0e32c38	g.chr12:132502919C>T	ENST00000333577.4	+	22	4492	c.4383C>T	c.(4381-4383)agC>agT	p.S1461S	EP400_ENST00000330386.6_Silent_p.S1425S|EP400_ENST00000332482.4_Silent_p.S1388S|EP400_ENST00000389562.2_Silent_p.S1424S|EP400_ENST00000389561.2_Silent_p.S1425S			Q96L91	EP400_HUMAN	E1A binding protein p400	1461					chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		TGAAGGCCAGCAGGTGCGTGC	0.582																																																0			12											35.0	38.0	37.0					12																	132502919		2203	4300	6503	131068872	SO:0001819	synonymous_variant	57634			U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.4383C>T	12.37:g.132502919C>T			131068872	O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Silent	SNP	HMMPfam_HSA,HMMSmart_HSA,superfamily_SSF52540,HMMSmart_DEXDc,HMMPfam_SNF2_N,HMMSmart_HELICc,HMMPfam_Helicase_C,superfamily_Homeodomain_like	p.S1424	ENST00000333577.4	37	c.4272		12																																																																																			-	NULL		0.582	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	EP400	protein_coding		C	NM_015409		131068872	+1	no_errors	NM_015409	genbank	human	validated	54_36p	silent	SNP	1.000	T
TTF1	7270	genome.wustl.edu	37	9	135277377	135277377	+	Missense_Mutation	SNP	T	T	G			TCGA-61-2611-02A-01W-1092-09	TCGA-61-2611-11A-01W-1092-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	204bf013-8fed-4f18-82b7-218cc1f0b8a6	c758d83a-3656-43a4-ba90-22fbb0e32c38	g.chr9:135277377T>G	ENST00000334270.2	-	2	871	c.832A>C	c.(832-834)Aaa>Caa	p.K278Q		NM_001205296.1|NM_007344.3	NP_001192225.1|NP_031370.2	Q15361	TTF1_HUMAN	transcription termination factor, RNA polymerase I	278	Poly-Lys.				chromatin remodeling (GO:0006338)|DNA-templated transcription, termination (GO:0006353)|gene expression (GO:0010467)|negative regulation of DNA replication (GO:0008156)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase I transcription (GO:0006363)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			endometrium(3)|kidney(1)|large_intestine(5)|lung(13)|ovary(2)|pancreas(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	30		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;4.25e-06)|Epithelial(140;9.09e-05)		TTCTTCTTTTTTTTCTTAGAC	0.473																																																0			9											89.0	92.0	91.0					9																	135277377		2203	4300	6503	134267198	SO:0001583	missense	7270			BC050734	CCDS6948.1, CCDS75925.1	9q34.3	2008-02-05			ENSG00000125482	ENSG00000125482			12397	protein-coding gene	gene with protein product		600777				7597036	Standard	NM_007344		Approved		uc004cbl.3	Q15361	OTTHUMG00000020836	ENST00000334270.2:c.832A>C	9.37:g.135277377T>G	ENSP00000333920:p.Lys278Gln		134267198	A1L160|Q4VXF3|Q58EY2|Q6P5T5	Missense_Mutation	SNP	HMMSmart_SANT,HMMPfam_Myb_DNA-binding	p.K278Q	ENST00000334270.2	37	c.832	CCDS6948.1	9	.	.	.	.	.	.	.	.	.	.	T	8.929	0.963002	0.18583	.	.	ENSG00000125482	ENST00000334270;ENST00000245588	T	0.12039	2.72	2.82	1.55	0.23275	.	.	.	.	.	T	0.09642	0.0237	L	0.36672	1.1	0.09310	N	1	B	0.25169	0.119	B	0.12156	0.007	T	0.32079	-0.9920	9	0.34782	T	0.22	.	5.8407	0.18633	0.0:0.0:0.274:0.726	.	278	Q15361	TTF1_HUMAN	Q	278	ENSP00000333920:K278Q	ENSP00000245588:K278Q	K	-	1	0	TTF1	134267198	0.997000	0.39634	0.004000	0.12327	0.005000	0.04900	1.597000	0.36729	0.086000	0.17137	0.383000	0.25322	AAA	-	NULL		0.473	TTF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTF1	protein_coding	OTTHUMT00000054784.2	T	NM_007344		134267198	-1	no_errors	NM_007344	genbank	human	validated	54_36p	missense	SNP	0.123	G
NHSL1	57224	genome.wustl.edu	37	6	138754802	138754802	+	Missense_Mutation	SNP	T	T	A			TCGA-61-2611-02A-01W-1092-09	TCGA-61-2611-11A-01W-1092-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	204bf013-8fed-4f18-82b7-218cc1f0b8a6	c758d83a-3656-43a4-ba90-22fbb0e32c38	g.chr6:138754802T>A	ENST00000427025.2	-	5	1320	c.692A>T	c.(691-693)cAa>cTa	p.Q231L	MIR3145_ENST00000580727.1_RNA|NHSL1_ENST00000343505.5_Missense_Mutation_p.Q227L	NM_020464.1	NP_065197.1	Q5SYE7	NHSL1_HUMAN	NHS-like 1	231										breast(2)|endometrium(4)|kidney(1)	7						AGCATCATCTTGGCCAGTGCC	0.488																																																0			6											28.0	24.0	25.0					6																	138754802		692	1591	2283	138796495	SO:0001583	missense	57224			AB037778	CCDS47487.1, CCDS55063.1	6q23.3	2009-02-18	2004-10-07	2004-10-07	ENSG00000135540	ENSG00000135540			21021	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 63"""	C6orf63			Standard	NM_001144060		Approved	bA43P8.1, KIAA1357	uc011edp.2	Q5SYE7	OTTHUMG00000016321	ENST00000427025.2:c.692A>T	6.37:g.138754802T>A	ENSP00000394546:p.Gln231Leu		138796495	Q3ZCS5|Q5SYE8|Q9P2J0	Missense_Mutation	SNP	NULL	p.Q231L	ENST00000427025.2	37	c.692	CCDS55063.1	6	.	.	.	.	.	.	.	.	.	.	T	9.124	1.009802	0.19277	.	.	ENSG00000135540	ENST00000427025;ENST00000343505;ENST00000342260	T;T	0.37915	1.17;1.61	5.54	4.39	0.52855	.	0.447185	0.26241	N	0.025509	T	0.25975	0.0633	L	0.48642	1.525	0.40870	D	0.983904	P;P	0.51933	0.949;0.949	P;P	0.48454	0.578;0.578	T	0.05835	-1.0861	10	0.72032	D	0.01	-3.919	11.3109	0.49364	0.0:0.0713:0.0:0.9287	.	227;231	E2QRJ1;Q5SYE7	.;NHSL1_HUMAN	L	231;227;169	ENSP00000394546:Q231L;ENSP00000344672:Q227L	ENSP00000344582:Q169L	Q	-	2	0	NHSL1	138796495	1.000000	0.71417	0.187000	0.23214	0.023000	0.10783	3.025000	0.49681	0.944000	0.37579	0.533000	0.62120	CAA	-	NULL		0.488	NHSL1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	NHSL1	protein_coding	OTTHUMT00000043700.2	T	XM_050421		138796495	-1	no_errors	ENST00000342260	ensembl	human	known	54_36p	missense	SNP	0.925	A
CACNA1B	774	genome.wustl.edu	37	9	141014730	141014730	+	Silent	SNP	G	G	A	rs187721569	byFrequency	TCGA-61-2611-02A-01W-1092-09	TCGA-61-2611-11A-01W-1092-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	204bf013-8fed-4f18-82b7-218cc1f0b8a6	c758d83a-3656-43a4-ba90-22fbb0e32c38	g.chr9:141014730G>A	ENST00000371372.1	+	45	6289	c.6144G>A	c.(6142-6144)tcG>tcA	p.S2048S	CACNA1B_ENST00000277551.2_Silent_p.S2048S|CACNA1B_ENST00000371363.1_Silent_p.S2046S|CACNA1B_ENST00000371355.4_Silent_p.S2049S|CACNA1B_ENST00000371357.1_Silent_p.S2047S|CACNA1B_ENST00000277549.5_Silent_p.S1242S	NM_000718.3|NM_001243812.1	NP_000709.1|NP_001230741.1	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type, alpha 1B subunit	2048					calcium ion import (GO:0070509)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|neurotransmitter secretion (GO:0007269)|regulation of blood pressure (GO:0008217)|regulation of calcium ion transport (GO:0051924)|regulation of heart contraction (GO:0008016)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transport (GO:0006810)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|protein C-terminus binding (GO:0008022)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(17)|lung(31)|ovary(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(2)	80	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)|Levetiracetam(DB01202)|Spironolactone(DB00421)|Verapamil(DB00661)	GCCAGGCGTCGTCGCACCACC	0.697													-|||	4	0.000798722	0.0	0.0043	5008	,	,		12089	0.0		0.001	False		,,,				2504	0.0															0			9						G		0,4250		0,0,2125	15.0	23.0	21.0		6144	-8.9	0.0	9		21	9,8443		0,9,4217	no	coding-synonymous	CACNA1B	NM_000718.3		0,9,6342	AA,AG,GG		0.1065,0.0,0.0709		2048/2340	141014730	9,12693	2125	4226	6351	140134551	SO:0001819	synonymous_variant	774			AB209467	CCDS59522.1, CCDS59523.1	9q34	2013-01-10	2007-02-16		ENSG00000148408	ENSG00000148408		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1389	protein-coding gene	gene with protein product		601012		CACNL1A5		8825650, 16382099	Standard	NM_000718		Approved	Cav2.2, CACNN	uc004cog.3	Q00975	OTTHUMG00000021002	ENST00000371372.1:c.6144G>A	9.37:g.141014730G>A			140134551	B1AQK5	Silent	SNP	superfamily_Voltage-gated potassium channels,HMMPfam_Ion_trans,HMMPfam_Ca_chan_IQ	p.S2048	ENST00000371372.1	37	c.6144	CCDS59522.1	9																																																																																			-	NULL		0.697	CACNA1B-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	CACNA1B	protein_coding	OTTHUMT00000055380.1	G	NM_000718		140134551	+1	no_errors	NM_000718	genbank	human	validated	54_36p	silent	SNP	0.014	A
PAXIP1	22976	genome.wustl.edu	37	7	154782742	154782742	+	Missense_Mutation	SNP	A	A	C			TCGA-61-2611-02A-01W-1092-09	TCGA-61-2611-11A-01W-1092-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	204bf013-8fed-4f18-82b7-218cc1f0b8a6	c758d83a-3656-43a4-ba90-22fbb0e32c38	g.chr7:154782742A>C	ENST00000404141.1	-	4	452	c.298T>G	c.(298-300)Ttt>Gtt	p.F100V	PAXIP1_ENST00000473219.1_5'UTR|PAXIP1_ENST00000397192.1_Missense_Mutation_p.F100V			Q6ZW49	PAXI1_HUMAN	PAX interacting (with transcription-activation domain) protein 1	100	BRCT 2. {ECO:0000255|PROSITE- ProRule:PRU00033}.|Interaction with PAGR1. {ECO:0000250}.				adipose tissue development (GO:0060612)|chorion development (GO:0060717)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|endothelial cell migration (GO:0043542)|histone H3-K4 methylation (GO:0051568)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K36 methylation (GO:0000416)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of isotype switching (GO:0045830)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|response to ionizing radiation (GO:0010212)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)				NS(1)|breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	33	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.0296)	UCEC - Uterine corpus endometrioid carcinoma (81;0.178)		GTGATTCCAAAAAAAATCTGA	0.328																																																0			7											48.0	45.0	46.0					7																	154782742		1817	4067	5884	154413675	SO:0001583	missense	22976			U80735	CCDS47753.1	7q36	2007-07-06	2005-04-05	2005-04-05	ENSG00000157212	ENSG00000157212			8624	protein-coding gene	gene with protein product		608254	"""PAX transcription activation domain interacting protein 1 like"""	PAXIP1L		9225980	Standard	XM_005249539		Approved	CAGF29, CAGF28, TNRC2, PTIP	uc022aqf.1	Q6ZW49	OTTHUMG00000151322	ENST00000404141.1:c.298T>G	7.37:g.154782742A>C	ENSP00000384048:p.Phe100Val		154413675	O15404|Q6N099|Q6ZWH9|Q7Z315|Q86UN0|Q8N4P9|Q96HP2	Missense_Mutation	SNP	superfamily_BRCT domain,HMMPfam_BRCT,HMMSmart_SM00292	p.F100V	ENST00000404141.1	37	c.298	CCDS47753.1	7	.	.	.	.	.	.	.	.	.	.	A	19.93	3.918012	0.73098	.	.	ENSG00000157212	ENST00000404141;ENST00000397192	T;T	0.11169	2.8;2.8	5.26	5.26	0.73747	BRCT (3);	0.169666	0.27759	U	0.017971	T	0.20901	0.0503	L	0.52126	1.63	0.51482	D	0.999921	P	0.48640	0.913	P	0.53490	0.727	T	0.00304	-1.1832	10	0.51188	T	0.08	-3.8598	14.0495	0.64727	1.0:0.0:0.0:0.0	.	100	Q6ZW49	PAXI1_HUMAN	V	100	ENSP00000384048:F100V;ENSP00000380376:F100V	ENSP00000380376:F100V	F	-	1	0	PAXIP1	154413675	1.000000	0.71417	0.999000	0.59377	0.893000	0.52053	8.193000	0.89719	2.113000	0.64589	0.454000	0.30748	TTT	-	HMMPfam_BRCT,superfamily_BRCT domain,HMMSmart_SM00292		0.328	PAXIP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	PAXIP1	protein_coding	OTTHUMT00000322223.1	A	NM_007349		154413675	-1	no_errors	NM_007349	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
OR6P1	128366	genome.wustl.edu	37	1	158533252	158533252	+	Missense_Mutation	SNP	G	G	T	rs187153877	byFrequency	TCGA-61-2611-02A-01W-1092-09	TCGA-61-2611-11A-01W-1092-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	204bf013-8fed-4f18-82b7-218cc1f0b8a6	c758d83a-3656-43a4-ba90-22fbb0e32c38	g.chr1:158533252G>T	ENST00000334632.1	-	1	142	c.143C>A	c.(142-144)aCa>aAa	p.T48K		NM_001160325.1	NP_001153797.1	Q8NGX9	OR6P1_HUMAN	olfactory receptor, family 6, subfamily P, member 1	48						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(4)|lung(1)	6						AAGCCATATTGTGAAGACAAT	0.473													G|||	3	0.000599042	0.0023	0.0	5008	,	,		22251	0.0		0.0	False		,,,				2504	0.0															0			1											51.0	59.0	57.0					1																	158533252		692	1591	2283	156799876	SO:0001583	missense	0			BK004193	CCDS53391.1	1q23.1	2012-08-09			ENSG00000186440	ENSG00000186440		"""GPCR / Class A : Olfactory receptors"""	15036	protein-coding gene	gene with protein product							Standard	NM_001160325		Approved		uc010pim.2	Q8NGX9	OTTHUMG00000019633	ENST00000334632.1:c.143C>A	1.37:g.158533252G>T	ENSP00000334721:p.Thr48Lys		156799876	Q6IFR9	Missense_Mutation	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.T48K	ENST00000334632.1	37	c.143	CCDS53391.1	1	4	0.0018315018315018315	4	0.008130081300813009	0	0.0	0	0.0	0	0.0	G	4.452	0.083671	0.08533	.	.	ENSG00000186440	ENST00000334632	T	0.03065	4.06	5.0	3.08	0.35506	GPCR, rhodopsin-like superfamily (1);	0.302856	0.23629	N	0.046144	T	0.02455	0.0075	M	0.86097	2.795	0.09310	N	1	B	0.27559	0.181	B	0.24155	0.051	T	0.32107	-0.9919	10	0.62326	D	0.03	.	7.6038	0.28091	0.2774:0.0:0.7226:0.0	.	48	Q8NGX9	OR6P1_HUMAN	K	48	ENSP00000334721:T48K	ENSP00000334721:T48K	T	-	2	0	OR6P1	156799876	0.000000	0.05858	0.003000	0.11579	0.005000	0.04900	0.378000	0.20569	0.654000	0.30846	0.591000	0.81541	ACA	-	superfamily_SSF81321,HMMPfam_7tm_1		0.473	OR6P1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6P1	protein_coding	OTTHUMT00000051848.1	G			156799876	-1	no_errors	ENST00000334632	ensembl	human	known	54_36p	missense	SNP	0.000	T
UBR3	130507	genome.wustl.edu	37	2	170785253	170785253	+	Missense_Mutation	SNP	A	A	T			TCGA-61-2611-02A-01W-1092-09	TCGA-61-2611-11A-01W-1092-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	204bf013-8fed-4f18-82b7-218cc1f0b8a6	c758d83a-3656-43a4-ba90-22fbb0e32c38	g.chr2:170785253A>T	ENST00000272793.5	+	18	2491	c.2441A>T	c.(2440-2442)aAt>aTt	p.N814I	UBR3_ENST00000418381.1_Missense_Mutation_p.N814I			Q6ZT12	UBR3_HUMAN	ubiquitin protein ligase E3 component n-recognin 3 (putative)	814					embryo development (GO:0009790)|in utero embryonic development (GO:0001701)|olfactory behavior (GO:0042048)|sensory perception of smell (GO:0007608)|suckling behavior (GO:0001967)|ubiquitin-dependent protein catabolic process (GO:0006511)	integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(9)|liver(1)|lung(8)|ovary(1)|prostate(3)|stomach(1)	33						GAAAATCCTAATCCCAAAAGT	0.348																																																0			2											122.0	102.0	108.0					2																	170785253		692	1591	2283	170493499	SO:0001583	missense	130507			AL834144	CCDS2238.2	2q31.1	2008-06-23	2008-06-23	2007-11-29	ENSG00000144357	ENSG00000144357		"""Ubiquitin protein ligase E3 component n-recognins"""	30467	protein-coding gene	gene with protein product		613831	"""zinc finger protein 650"""	ZNF650		17462990	Standard	NM_172070		Approved	KIAA2024, DKFZp434P117, FLJ37422	uc010zdi.2	Q6ZT12	OTTHUMG00000132229	ENST00000272793.5:c.2441A>T	2.37:g.170785253A>T	ENSP00000272793:p.Asn814Ile		170493499	B4DZR7|Q2KHN5|Q6ZR55|Q6ZSC2|Q8IVE7|Q8ND96	Missense_Mutation	SNP	HMMPfam_zf-UBR,HMMSmart_SM00396,superfamily_RING/U-box,HMMPfam_zf-C3HC4	p.N814I	ENST00000272793.5	37	c.2441		2	.	.	.	.	.	.	.	.	.	.	A	23.4	4.407061	0.83230	.	.	ENSG00000144357	ENST00000272793;ENST00000442603;ENST00000418381	T;T	0.40756	1.02;1.02	5.55	5.55	0.83447	.	.	.	.	.	T	0.49098	0.1537	N	0.24115	0.695	0.80722	D	1	D	0.71674	0.998	D	0.78314	0.991	T	0.42327	-0.9458	9	0.26408	T	0.33	.	14.8548	0.70329	1.0:0.0:0.0:0.0	.	814	Q6ZT12	UBR3_HUMAN	I	814	ENSP00000272793:N814I;ENSP00000396068:N814I	ENSP00000272793:N814I	N	+	2	0	UBR3	170493499	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.737000	0.91562	2.106000	0.64143	0.460000	0.39030	AAT	-	NULL		0.348	UBR3-001	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	UBR3	protein_coding	OTTHUMT00000255290.2	A	NM_172070		170493499	+1	no_errors	ENST00000272793	ensembl	human	known	54_36p	missense	SNP	1.000	T
CEP350	9857	genome.wustl.edu	37	1	180006063	180006063	+	Missense_Mutation	SNP	T	T	G			TCGA-61-2611-02A-01W-1092-09	TCGA-61-2611-11A-01W-1092-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	204bf013-8fed-4f18-82b7-218cc1f0b8a6	c758d83a-3656-43a4-ba90-22fbb0e32c38	g.chr1:180006063T>G	ENST00000367607.3	+	17	4367	c.3949T>G	c.(3949-3951)Tct>Gct	p.S1317A		NM_014810.4	NP_055625.4	Q5VT06	CE350_HUMAN	centrosomal protein 350kDa	1317					microtubule anchoring (GO:0034453)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	66						CCTTCCAGGTTCTAAGCGCTT	0.423																																																0			1											80.0	69.0	73.0					1																	180006063		2203	4300	6503	178272686	SO:0001583	missense	9857			AF287356	CCDS1336.1	1q25.2	2014-02-20			ENSG00000135837	ENSG00000135837			24238	protein-coding gene	gene with protein product	"""centrosome associated protein 350"""					16314388, 15615782	Standard	NM_014810		Approved	KIAA0480, CAP350	uc001gnt.3	Q5VT06	OTTHUMG00000035269	ENST00000367607.3:c.3949T>G	1.37:g.180006063T>G	ENSP00000356579:p.Ser1317Ala		178272686	O75068|Q8TDK3|Q8WY20	Missense_Mutation	SNP	superfamily_Cap-Gly domain,HMMPfam_CAP_GLY,PatternScan_CAP_GLY_1	p.S1316A	ENST00000367607.3	37	c.3946	CCDS1336.1	1	.	.	.	.	.	.	.	.	.	.	T	13.85	2.361049	0.41801	.	.	ENSG00000135837	ENST00000367607	T	0.57907	0.37	5.64	-3.12	0.05282	.	0.463445	0.18129	N	0.150793	T	0.22781	0.0550	N	0.14661	0.345	0.21499	N	0.999664	B;B	0.06786	0.001;0.001	B;B	0.06405	0.002;0.002	T	0.07654	-1.0761	9	.	.	.	.	1.2083	0.01899	0.1995:0.1301:0.2257:0.4447	.	1317;1317	E7EU22;Q5VT06	.;CE350_HUMAN	A	1317	ENSP00000356579:S1317A	.	S	+	1	0	CEP350	178272686	0.977000	0.34250	0.994000	0.49952	0.990000	0.78478	0.357000	0.20199	-0.143000	0.11334	0.397000	0.26171	TCT	-	NULL		0.423	CEP350-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP350	protein_coding	OTTHUMT00000085315.2	T	NM_014810		178272686	+1	no_errors	NM_014810	genbank	human	reviewed	54_36p	missense	SNP	0.954	G
TTN	7273	genome.wustl.edu	37	2	179631148	179631148	+	Silent	SNP	C	C	A			TCGA-61-2611-02A-01W-1092-09	TCGA-61-2611-11A-01W-1092-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	204bf013-8fed-4f18-82b7-218cc1f0b8a6	c758d83a-3656-43a4-ba90-22fbb0e32c38	g.chr2:179631148C>A	ENST00000591111.1	-	41	9887	c.9663G>T	c.(9661-9663)gtG>gtT	p.V3221V	TTN_ENST00000342992.6_Silent_p.V3221V|TTN_ENST00000342175.6_Silent_p.V3175V|TTN-AS1_ENST00000578746.1_RNA|TTN-AS1_ENST00000610005.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000359218.5_Silent_p.V3175V|TTN_ENST00000460472.2_Silent_p.V3175V|TTN_ENST00000360870.5_Silent_p.V3221V|TTN_ENST00000589042.1_Silent_p.V3221V			Q8WZ42	TITIN_HUMAN	titin	13551					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCCTTCCTGCCACAAAGGTGT	0.418																																																0			2											138.0	134.0	135.0					2																	179631148		2203	4300	6503	179339393	SO:0001819	synonymous_variant	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.9663G>T	2.37:g.179631148C>A			179339393	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	superfamily_SSF48726,HMMPfam_I-set,HMMSmart_IGc2,HMMSmart_IG,HMMPfam_Titin_Z,HMMPfam_ig,PatternScan_IG_MHC,PatternScan_THIOL_PROTEASE_HIS	p.V3221	ENST00000591111.1	37	c.9663		2																																																																																			-	superfamily_SSF48726,HMMPfam_I-set,HMMSmart_IG		0.418	TTN-019	PUTATIVE	basic	protein_coding	TTN	protein_coding	OTTHUMT00000460310.1	C	NM_133378		179339393	-1	no_errors	NM_133379	genbank	human	reviewed	54_36p	silent	SNP	0.996	A
ALG3	10195	genome.wustl.edu	37	3	183957289	183957289	+	IGR	SNP	C	C	A			TCGA-61-2611-02A-01W-1092-09	TCGA-61-2611-11A-01W-1092-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	204bf013-8fed-4f18-82b7-218cc1f0b8a6	c758d83a-3656-43a4-ba90-22fbb0e32c38	g.chr3:183957289C>A	ENST00000397676.3	-	0	1528				VWA5B2_ENST00000273794.5_Silent_p.P552P|EIF2B5_ENST00000444495.1_Intron|MIR1224_ENST00000408193.1_RNA|VWA5B2_ENST00000426955.2_Silent_p.P770P	NM_005787.5	NP_005778.1	Q92685	ALG3_HUMAN	ALG3, alpha-1,3- mannosyltransferase						cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|mannosylation (GO:0097502)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	alpha-1,3-mannosyltransferase activity (GO:0000033)|dol-P-Man:Man(5)GlcNAc(2)-PP-Dol alpha-1,3-mannosyltransferase activity (GO:0052925)			kidney(1)|large_intestine(1)|lung(6)|upper_aerodigestive_tract(1)	9	all_cancers(143;1.39e-10)|Ovarian(172;0.0339)		Epithelial(37;8.28e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			CCGGCCGACCCCGGAAACCCT	0.617																																																0			3											31.0	33.0	32.0					3																	183957289		692	1591	2283	185439983	SO:0001628	intergenic_variant	90113			BC002839	CCDS46967.1, CCDS46968.1	3q27.3	2013-02-26	2013-02-26		ENSG00000214160	ENSG00000214160	2.4.1.258	"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"""	23056	protein-coding gene	gene with protein product	"""carbohydrate deficient glycoprotein syndrome type IV"", ""dol-P-Man:Man(5)GlcNAc(2)-PP-Dol alpha-1,3-mannosyltransferase"", ""dol-P-Man dependent alpha-1,3- mannosyltransferase"""	608750	"""asparagine-linked glycosylation 3 homolog (yeast, alpha-1,3-mannosyltransferase)"", ""asparagine-linked glycosylation 3, alpha-1,3- mannosyltransferase homolog (S. cerevisiae)"""			1058125	Standard	NM_005787		Approved	NOT56L, Not56, CDGS4, D16Ertd36e	uc003fne.2	Q92685	OTTHUMG00000156823		3.37:g.183957289C>A			185439983	A8JZZ6|Q9BT71	Silent	SNP	superfamily_vWA-like	p.P530	ENST00000397676.3	37	c.1590	CCDS46968.1	3																																																																																			-	NULL		0.617	ALG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VWA5B2	protein_coding	OTTHUMT00000346033.1	C	NM_005787		185439983	+1	no_start_codon	ENST00000273794	ensembl	human	known	54_36p	silent	SNP	0.002	A
FSIP2	401024	genome.wustl.edu	37	2	186671503	186671503	+	Missense_Mutation	SNP	C	C	G			TCGA-61-2611-02A-01W-1092-09	TCGA-61-2611-11A-01W-1092-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	204bf013-8fed-4f18-82b7-218cc1f0b8a6	c758d83a-3656-43a4-ba90-22fbb0e32c38	g.chr2:186671503C>G	ENST00000424728.1	+	17	17470	c.17470C>G	c.(17470-17472)Ctc>Gtc	p.L5824V	FSIP2_ENST00000343098.5_Missense_Mutation_p.L5913V			Q5CZC0	FSIP2_HUMAN	fibrous sheath interacting protein 2	5824				L -> P (in Ref. 2; CAI46017). {ECO:0000305}.						NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(11)|lung(46)|pancreas(1)|urinary_tract(2)	69						TCAAGCCAAACTCTATGACAC	0.348																																																0			2											89.0	83.0	85.0					2																	186671503		1853	4090	5943	186379748	SO:0001583	missense	401024			AK092099	CCDS54426.1	2q32.1	2010-06-18			ENSG00000188738	ENSG00000188738			21675	protein-coding gene	gene with protein product		615796				14702039	Standard	NM_173651		Approved	FLJ34780	uc002upl.3	Q5CZC0	OTTHUMG00000153874	ENST00000424728.1:c.17470C>G	2.37:g.186671503C>G	ENSP00000401306:p.Leu5824Val		186379748	Q53TL3|Q53TN5|Q5HYH2|Q6ZTZ5|Q6ZU14|Q6ZU21	Missense_Mutation	SNP	NULL	p.L522V	ENST00000424728.1	37	c.1564		2	.	.	.	.	.	.	.	.	.	.	C	16.32	3.091018	0.55968	.	.	ENSG00000188738	ENST00000343098;ENST00000424728	T;T	0.63913	-0.07;-0.06	4.87	4.87	0.63330	.	.	.	.	.	T	0.61198	0.2328	L	0.36672	1.1	0.31689	N	0.642071	.	.	.	.	.	.	T	0.66548	-0.5896	7	0.45353	T	0.12	.	13.377	0.60745	0.0:1.0:0.0:0.0	.	.	.	.	V	5913;5824	ENSP00000344403:L5913V;ENSP00000401306:L5824V	ENSP00000344403:L5913V	L	+	1	0	FSIP2	186379748	0.992000	0.36948	0.992000	0.48379	0.744000	0.42396	3.643000	0.54374	2.515000	0.84797	0.591000	0.81541	CTC	-	NULL		0.348	FSIP2-001	KNOWN	basic	protein_coding	FLJ44048	protein_coding	OTTHUMT00000332778.3	C	NM_173651		186379748	+1	no_errors	NM_207482	genbank	human	validated	54_36p	missense	SNP	0.995	G
TFRC	7037	genome.wustl.edu	37	3	195782155	195782155	+	Nonsense_Mutation	SNP	A	A	T			TCGA-61-2611-02A-01W-1092-09	TCGA-61-2611-11A-01W-1092-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	204bf013-8fed-4f18-82b7-218cc1f0b8a6	c758d83a-3656-43a4-ba90-22fbb0e32c38	g.chr3:195782155A>T	ENST00000360110.4	-	17	1864	c.1695T>A	c.(1693-1695)taT>taA	p.Y565*	TFRC_ENST00000465288.1_5'Flank|TFRC_ENST00000540528.1_3'UTR|TFRC_ENST00000392396.3_Nonsense_Mutation_p.Y565*|TFRC_ENST00000535031.1_Nonsense_Mutation_p.Y283*|TFRC_ENST00000420415.1_Nonsense_Mutation_p.Y484*	NM_001128148.1	NP_001121620.1	P02786	TFR1_HUMAN	transferrin receptor	565					cellular iron ion homeostasis (GO:0006879)|iron ion import (GO:0097286)|osteoclast differentiation (GO:0030316)|positive regulation of bone resorption (GO:0045780)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|coated pit (GO:0005905)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)|vesicle (GO:0031982)	double-stranded RNA binding (GO:0003725)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|transferrin receptor activity (GO:0004998)			NS(1)|breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(10)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27	all_cancers(143;1.94e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;1.36e-24)|all cancers(36;3.34e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.17e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00233)	Gallium nitrate(DB05260)	TGGTACCCAAATAAGGATAAT	0.498			T	BCL6	NHL																																		Dom	yes		3	3q29	7037	"""transferrin receptor (p90, CD71)"""		L	0			3											93.0	85.0	88.0					3																	195782155		2203	4300	6503	197266552	SO:0001587	stop_gained	7037			X01060	CCDS3312.1	3q29	2013-09-19	2013-09-19		ENSG00000072274	ENSG00000072274		"""CD molecules"""	11763	protein-coding gene	gene with protein product		190010	"""transferrin receptor (p90, CD71)"""				Standard	NM_003234		Approved	CD71, TFR1, p90	uc003fwa.4	P02786	OTTHUMG00000155714	ENST00000360110.4:c.1695T>A	3.37:g.195782155A>T	ENSP00000353224:p.Tyr565*		197266552	D3DXB0|Q1HE24|Q59G55|Q9UCN0|Q9UCU5|Q9UDF9|Q9UK21	Nonsense_Mutation	SNP	superfamily_Zn-dependent exopeptidases,superfamily_Transferrin receptor ectodomain apical domain,HMMPfam_PA,superfamily_Transferrin receptor ectodomain C-terminal domain,HMMPfam_TFR_dimer	p.Y565*	ENST00000360110.4	37	c.1695	CCDS3312.1	3	.	.	.	.	.	.	.	.	.	.	A	24.8	4.566806	0.86439	.	.	ENSG00000072274	ENST00000360110;ENST00000420415;ENST00000392396;ENST00000535031	.	.	.	5.34	-1.96	0.07525	.	0.176200	0.51477	D	0.000082	.	.	.	.	.	.	0.20926	N	0.999826	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-14.3479	13.2613	0.60106	0.5808:0.0:0.4192:0.0	.	.	.	.	X	565;484;565;283	.	ENSP00000353224:Y565X	Y	-	3	2	TFRC	197266552	0.002000	0.14202	0.005000	0.12908	0.102000	0.19082	-0.196000	0.09532	-1.065000	0.03168	-1.843000	0.00578	TAT	-	superfamily_Zn-dependent exopeptidases		0.498	TFRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFRC	protein_coding	OTTHUMT00000341346.1	A			197266552	-1	no_errors	NM_003234	genbank	human	validated	54_36p	nonsense	SNP	0.772	T
CLK1	1195	genome.wustl.edu	37	2	201726575	201726575	+	Nonsense_Mutation	SNP	G	G	C			TCGA-61-2611-02A-01W-1092-09	TCGA-61-2611-11A-01W-1092-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	204bf013-8fed-4f18-82b7-218cc1f0b8a6	c758d83a-3656-43a4-ba90-22fbb0e32c38	g.chr2:201726575G>C	ENST00000321356.4	-	2	146	c.11C>G	c.(10-12)tCa>tGa	p.S4*	CLK1_ENST00000434813.2_Nonsense_Mutation_p.S46*|Y_RNA_ENST00000516950.1_RNA|CLK1_ENST00000492793.1_Intron	NM_004071.3	NP_004062.2	P49759	CLK1_HUMAN	CDC-like kinase 1	4					cell proliferation (GO:0008283)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|regulation of RNA splicing (GO:0043484)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)			NS(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(12)|ovary(1)|pancreas(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	33						AGTTCTCTTTGAGTGTCTCAT	0.413																																																0			2											106.0	94.0	98.0					2																	201726575		2203	4300	6503	201434820	SO:0001587	stop_gained	1195			L29219	CCDS2331.1, CCDS54427.1	2q33	2008-05-02			ENSG00000013441	ENSG00000013441		"""CDC-like kinases"""	2068	protein-coding gene	gene with protein product		601951				9856501	Standard	NM_004071		Approved		uc002uwe.2	P49759	OTTHUMG00000132784	ENST00000321356.4:c.11C>G	2.37:g.201726575G>C	ENSP00000326830:p.Ser4*		201434820	B4DFW7|Q0P694|Q8N5V8	Nonsense_Mutation	SNP	superfamily_Protein kinase-like (PK-like),HMMSmart_SM00219,HMMSmart_SM00220,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_ST	p.S4*	ENST00000321356.4	37	c.11	CCDS2331.1	2	.	.	.	.	.	.	.	.	.	.	G	34	5.303784	0.95601	.	.	ENSG00000013441	ENST00000321356;ENST00000357369;ENST00000434813	.	.	.	5.18	5.18	0.71444	.	0.161332	0.42821	D	0.000644	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	.	9.1451	0.36928	0.0798:0.1491:0.7711:0.0	.	.	.	.	X	4;4;46	.	ENSP00000326830:S4X	S	-	2	0	CLK1	201434820	0.996000	0.38824	1.000000	0.80357	0.990000	0.78478	2.266000	0.43320	2.565000	0.86533	0.573000	0.79308	TCA	-	NULL		0.413	CLK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLK1	protein_coding	OTTHUMT00000256192.2	G			201434820	-1	no_errors	NM_004071	genbank	human	reviewed	54_36p	nonsense	SNP	1.000	C
EGLN1	54583	genome.wustl.edu	37	1	231502175	231502175	+	Silent	SNP	G	G	A			TCGA-61-2611-02A-01W-1092-09	TCGA-61-2611-11A-01W-1092-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	204bf013-8fed-4f18-82b7-218cc1f0b8a6	c758d83a-3656-43a4-ba90-22fbb0e32c38	g.chr1:231502175G>A	ENST00000366641.3	-	5	4418	c.1263C>T	c.(1261-1263)gtC>gtT	p.V421V	EGLN1_ENST00000476717.1_5'UTR	NM_022051.2	NP_071334.1			egl-9 family hypoxia-inducible factor 1											breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)|urinary_tract(1)	16		Prostate(94;0.194)|Acute lymphoblastic leukemia(190;0.244)				CGTCTTTACCGACCGAATCTG	0.363																																																0			1											109.0	103.0	105.0					1																	231502175		2203	4300	6503	229568798	SO:0001819	synonymous_variant	54583			AJ310543	CCDS1595.1	1q42.1	2013-08-21	2013-08-21	2001-08-24	ENSG00000135766	ENSG00000135766		"""Zinc fingers, MYND-type"""	1232	protein-coding gene	gene with protein product	"""HIF prolyl hydroxylase 2"""	606425	"""EGL nine (C.elegans) homolog 1"", ""egl nine homolog 1 (C. elegans)"""	C1orf12		11056053	Standard	NM_022051		Approved	SM-20, PHD2, ZMYND6, HIFPH2	uc001huv.2	Q9GZT9	OTTHUMG00000038027	ENST00000366641.3:c.1263C>T	1.37:g.231502175G>A			229568798		Silent	SNP	HMMPfam_zf-MYND,PatternScan_ZF_MYND_1,HMMSmart_SM00702,HMMPfam_2OG-FeII_Oxy	p.V421	ENST00000366641.3	37	c.1263	CCDS1595.1	1																																																																																			-	NULL		0.363	EGLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EGLN1	protein_coding	OTTHUMT00000092879.1	G	NM_022051		229568798	-1	no_errors	NM_022051	genbank	human	provisional	54_36p	silent	SNP	0.713	A
ACKR3	57007	genome.wustl.edu	37	2	237490019	237490019	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2611-02A-01W-1092-09	TCGA-61-2611-11A-01W-1092-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	204bf013-8fed-4f18-82b7-218cc1f0b8a6	c758d83a-3656-43a4-ba90-22fbb0e32c38	g.chr2:237490019C>T	ENST00000272928.3	+	2	1221	c.911C>T	c.(910-912)tCg>tTg	p.S304L		NM_020311.2	NP_064707.1	P25106	ACKR3_HUMAN	atypical chemokine receptor 3	304					angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|receptor internalization (GO:0031623)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cell surface (GO:0009986)|coated pit (GO:0005905)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	C-X-C chemokine binding (GO:0019958)|C-X-C chemokine receptor activity (GO:0016494)|coreceptor activity (GO:0015026)|scavenger receptor activity (GO:0005044)										CAGTGCCTGTCGCTGGTGCAC	0.567																																																0			2											110.0	88.0	96.0					2																	237490019		2203	4300	6503	237154758	SO:0001583	missense	57007			BC008459	CCDS2516.1	2q37.3	2013-07-17	2013-07-16	2013-07-16	ENSG00000144476	ENSG00000144476		"""CD molecules"", ""GPCR / Class A : Chemokine receptors : Atypical"""	23692	protein-coding gene	gene with protein product		610376	"""chemokine orphan receptor 1"", ""chemokine (C-X-C motif) receptor 7"""	CMKOR1, CXCR7		16107333, 16148	Standard	NM_020311		Approved	RDC1, GPR159	uc002vwd.3	P25106	OTTHUMG00000133295	ENST00000272928.3:c.911C>T	2.37:g.237490019C>T	ENSP00000272928:p.Ser304Leu		237154758	A8K6J4|Q53RV4|Q8NE10|Q92938|Q92986	Missense_Mutation	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.S304L	ENST00000272928.3	37	c.911	CCDS2516.1	2	.	.	.	.	.	.	.	.	.	.	C	28.6	4.938367	0.92526	.	.	ENSG00000144476	ENST00000272928	T	0.37411	1.2	5.41	5.41	0.78517	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.68979	0.3060	M	0.89904	3.07	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.75110	-0.3433	9	.	.	.	.	19.2155	0.93776	0.0:1.0:0.0:0.0	.	304	P25106	CXCR7_HUMAN	L	304	ENSP00000272928:S304L	.	S	+	2	0	CXCR7	237154758	1.000000	0.71417	0.959000	0.39883	0.964000	0.63967	7.589000	0.82641	2.535000	0.85469	0.655000	0.94253	TCG	-	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1		0.567	ACKR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CXCR7	protein_coding	OTTHUMT00000257079.2	C	NM_020311		237154758	+1	no_errors	NM_020311	genbank	human	reviewed	54_36p	missense	SNP	0.999	T
