#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ZDHHC6	64429	hgsc.bcm.edu	37	10	114200336	114200336	+	Missense_Mutation	SNP	C	C	T			TCGA-AF-2691-01A-01W-0831-10	TCGA-AF-2691-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	0a041965-3054-4091-9dae-8b6b40cc7a03	0dc37a16-724e-44fe-a593-b1efde8ccf36	g.chr10:114200336C>T	ENST00000369405.3	-	5	1060	c.637G>A	c.(637-639)Gct>Act	p.A213T	ZDHHC6_ENST00000369404.3_Missense_Mutation_p.A209T	NM_022494.1	NP_071939.1	Q9H6R6	ZDHC6_HUMAN	zinc finger, DHHC-type containing 6	213					protein palmitoylation (GO:0018345)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)	p.A213T(1)		endometrium(4)|kidney(1)|large_intestine(2)|lung(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	14		Colorectal(252;0.198)		Epithelial(162;0.0291)|all cancers(201;0.117)		GTTCCTAAAGCTAATCCCAAG	0.438																																					p.A213T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G637A	10						.						158.0	145.0	149.0					10																	114200336		2203	4300	6503	114190326	SO:0001583	missense	64429	exon5			AK025605	CCDS7574.1	10q26.11	2008-05-02			ENSG00000023041	ENSG00000023041		"""Zinc fingers, DHHC-type"""	19160	protein-coding gene	gene with protein product							Standard	NM_022494		Approved	ZNF376, FLJ21952	uc001kzv.3	Q9H6R6	OTTHUMG00000019062	ENST00000369405.3:c.637G>A	10.37:g.114200336C>T	ENSP00000358413:p.Ala213Thr		114190326	NM_022494	D3DRB6|Q53G45|Q96IV7|Q9H605	Missense_Mutation	SNP	ENST00000369405.3	37	CCDS7574.1	.	.	.	.	.	.	.	.	.	.	C	36	5.749561	0.96890	.	.	ENSG00000023041	ENST00000369405;ENST00000369404	T;T	0.25414	1.8;1.8	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	T	0.41259	0.1151	L	0.28608	0.87	0.80722	D	1	D;D	0.76494	0.995;0.999	D;D	0.70935	0.922;0.971	T	0.03981	-1.0987	10	0.34782	T	0.22	-7.9332	20.3065	0.98633	0.0:1.0:0.0:0.0	.	209;213	Q9H6R6-2;Q9H6R6	.;ZDHC6_HUMAN	T	213;209	ENSP00000358413:A213T;ENSP00000358412:A209T	ENSP00000358412:A209T	A	-	1	0	ZDHHC6	114190326	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.786000	0.85741	2.809000	0.96659	0.650000	0.86243	GCT		0.438	ZDHHC6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050393.1	NM_022494	
MPP7	143098	hgsc.bcm.edu	37	10	28343023	28343023	+	Missense_Mutation	SNP	A	A	T			TCGA-AF-2691-01A-01W-0831-10	TCGA-AF-2691-10A-01W-0831-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	0a041965-3054-4091-9dae-8b6b40cc7a03	0dc37a16-724e-44fe-a593-b1efde8ccf36	g.chr10:28343023A>T	ENST00000375732.1	-	17	1961	c.1702T>A	c.(1702-1704)Tgg>Agg	p.W568R	MPP7_ENST00000540098.1_Missense_Mutation_p.W568R|MPP7_ENST00000375719.3_Missense_Mutation_p.W568R|MPP7_ENST00000337532.5_Missense_Mutation_p.W568R			Q5T2T1	MPP7_HUMAN	membrane protein, palmitoylated 7 (MAGUK p55 subfamily member 7)	568					establishment of cell polarity (GO:0030010)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of signal transduction (GO:0009967)|protein localization to adherens junction (GO:0071896)|tight junction assembly (GO:0070830)	adherens junction (GO:0005912)|cell junction (GO:0030054)|mitochondrion (GO:0005739)|MPP7-DLG1-LIN7 complex (GO:0097025)|tight junction (GO:0005923)	protein complex scaffold (GO:0032947)|protein domain specific binding (GO:0019904)|protein heterodimerization activity (GO:0046982)|signaling adaptor activity (GO:0035591)	p.W568R(1)		autonomic_ganglia(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|skin(1)|stomach(1)	22						ACTGGCACCCAATGGGTCTCT	0.338																																					p.W568R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1702A	10						.						82.0	82.0	82.0					10																	28343023		2203	4300	6503	28383029	SO:0001583	missense	143098	exon19			BC038105	CCDS7158.1	10p12.1	2004-01-15			ENSG00000150054	ENSG00000150054			26542	protein-coding gene	gene with protein product		610973				14719143	Standard	NM_173496		Approved	FLJ32798	uc001iua.1	Q5T2T1	OTTHUMG00000017868	ENST00000375732.1:c.1702T>A	10.37:g.28343023A>T	ENSP00000364884:p.Trp568Arg		28383029	NM_173496	B2RCC9|B4DWL9|B5MDZ3|D3DRW3|Q5T2T0|Q8IY28	Missense_Mutation	SNP	ENST00000375732.1	37	CCDS7158.1	.	.	.	.	.	.	.	.	.	.	A	22.5	4.302382	0.81136	.	.	ENSG00000150054	ENST00000375732;ENST00000337532;ENST00000540098;ENST00000375719	T;T;T;T	0.24908	1.83;1.83;1.83;1.83	5.36	5.36	0.76844	.	0.059758	0.64402	D	0.000001	T	0.59197	0.2176	M	0.90595	3.13	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.69109	-0.5232	10	0.87932	D	0	.	15.3574	0.74437	1.0:0.0:0.0:0.0	.	568	Q5T2T1	MPP7_HUMAN	R	568	ENSP00000364884:W568R;ENSP00000337907:W568R;ENSP00000438693:W568R;ENSP00000364871:W568R	ENSP00000337907:W568R	W	-	1	0	MPP7	28383029	1.000000	0.71417	0.973000	0.42090	0.964000	0.63967	9.339000	0.96797	2.022000	0.59522	0.482000	0.46254	TGG		0.338	MPP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047345.1	NM_173496	
RET	5979	hgsc.bcm.edu	37	10	43597793	43597793	+	Missense_Mutation	SNP	G	G	A	rs76397662	byFrequency	TCGA-AF-2691-01A-01W-0831-10	TCGA-AF-2691-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	0a041965-3054-4091-9dae-8b6b40cc7a03	0dc37a16-724e-44fe-a593-b1efde8ccf36	g.chr10:43597793G>A	ENST00000355710.3	+	3	573	c.341G>A	c.(340-342)cGc>cAc	p.R114H	RET_ENST00000340058.5_Missense_Mutation_p.R114H	NM_020975.4	NP_066124.1	P07949	RET_HUMAN	ret proto-oncogene	114			R -> C (in HSCR1). {ECO:0000269|PubMed:22174939}.|R -> H (in CCHS and HSCR1). {ECO:0000269|PubMed:12086152, ECO:0000269|PubMed:14566559, ECO:0000269|PubMed:22174939}.		activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to retinoic acid (GO:0071300)|embryonic epithelial tube formation (GO:0001838)|enteric nervous system development (GO:0048484)|homophilic cell adhesion (GO:0007156)|innervation (GO:0060384)|lymphocyte migration into lymphoid organs (GO:0097021)|MAPK cascade (GO:0000165)|membrane protein proteolysis (GO:0033619)|neural crest cell migration (GO:0001755)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|peptidyl-tyrosine phosphorylation (GO:0018108)|Peyer's patch morphogenesis (GO:0061146)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cell migration (GO:0030335)|positive regulation of cell size (GO:0045793)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of metanephric glomerulus development (GO:0072300)|positive regulation of neuron maturation (GO:0014042)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription, DNA-templated (GO:0045893)|posterior midgut development (GO:0007497)|protein phosphorylation (GO:0006468)|regulation of axonogenesis (GO:0050770)|regulation of cell adhesion (GO:0030155)|response to drug (GO:0042493)|response to pain (GO:0048265)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|ureter maturation (GO:0035799)|ureteric bud development (GO:0001657)	endosome membrane (GO:0010008)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|protein tyrosine kinase activity (GO:0004713)|receptor activity (GO:0004872)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.R114H(1)	CCDC6/RET(4)|KIF5B/RET(79)	NS(2)|adrenal_gland(26)|breast(5)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(14)|lung(27)|ovary(5)|prostate(3)|skin(1)|thyroid(504)|upper_aerodigestive_tract(1)|urinary_tract(1)	607		Ovarian(717;0.0423)			Cabozantinib(DB08875)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)	TCTGCAGACCGCGGCTTTCCC	0.627		1	"""T, Mis, N, F"""	"""H4, PRKAR1A, NCOA4, PCM1, GOLGA5, TRIM33, KTN1, TRIM27, HOOK3, KIF5B, CCDC6"""	"""medullary thyroid,  papillary thyroid, pheochromocytoma, NSCLC"""	"""medullary thyroid,  papillary thyroid, pheochromocytoma"""	Hirschsprung disease		Multiple Endocrine Neoplasia, type 2B;Multiple Endocrine Neoplasia, type 2A;Familial Medullary Thyroid Carcinoma				G|||	7	0.00139776	0.0	0.0	5008	,	,		20443	0.006		0.0	False		,,,				2504	0.001				p.R114H	Melanoma(102;360 522 3376 9752 9881 14372 17251 18341 20876 24662 34807 43144 48149)	yes	Dom	yes	Multiple endocrine neoplasia 2A/2B	10	10q11.2	5979	ret proto-oncogene	yes	"""E, O"""	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G341A	10	GRCh37	CM023441	RET	M	rs76397662	.						103.0	92.0	96.0					10																	43597793		2203	4300	6503	42917799	SO:0001583	missense	5979	exon3	Familial Cancer Database	MEN2B, Wagenmann-Froboese s.;MEN2A, Sipple disease, incl MEN2C;FMTC	BC004257	CCDS7200.1, CCDS53525.1	10q11.2	2014-09-17	2007-02-16		ENSG00000165731	ENSG00000165731		"""Cadherins / Cadherin-related"""	9967	protein-coding gene	gene with protein product	"""cadherin-related family member 16"""	164761	"""multiple endocrine neoplasia and medullary thyroid carcinoma 1"", ""Hirschsprung disease 1"""	HSCR1, MEN2A, MTC1, MEN2B		2687772, 1611909	Standard	NM_020975		Approved	PTC, CDHF12, RET51, CDHR16	uc001jal.3	P07949	OTTHUMG00000018024	ENST00000355710.3:c.341G>A	10.37:g.43597793G>A	ENSP00000347942:p.Arg114His		42917799	NM_020975	A8K6Z2|Q15250|Q9BTB0|Q9H4A2	Missense_Mutation	SNP	ENST00000355710.3	37	CCDS7200.1	4	0.0018315018315018315	0	0.0	0	0.0	4	0.006993006993006993	0	0.0	G	8.828	0.939278	0.18281	.	.	ENSG00000165731	ENST00000355710;ENST00000340058;ENST00000535749	T;T	0.78707	-1.08;-1.2	4.82	4.82	0.62117	.	0.581302	0.19338	N	0.116724	T	0.52175	0.1718	N	0.08118	0	0.24599	A	0.00621181	B;B	0.13145	0.001;0.007	B;B	0.06405	0.0;0.002	T	0.64032	-0.6502	9	0.45353	T	0.12	.	13.4102	0.60938	0.0:0.0:1.0:0.0	.	114;114	P07949;P07949-2	RET_HUMAN;.	H	114	ENSP00000347942:R114H;ENSP00000344798:R114H	ENSP00000344798:R114H	R	+	2	0	RET	42917799	0.652000	0.27349	0.587000	0.28692	0.010000	0.07245	2.402000	0.44521	2.214000	0.71695	0.655000	0.94253	CGC		0.627	RET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047694.2	NM_020975	
DNAJC12	56521	hgsc.bcm.edu	37	10	69571294	69571294	+	Silent	SNP	G	G	A	rs377051523		TCGA-AF-2691-01A-01W-0831-10	TCGA-AF-2691-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	0a041965-3054-4091-9dae-8b6b40cc7a03	0dc37a16-724e-44fe-a593-b1efde8ccf36	g.chr10:69571294G>A	ENST00000225171.2	-	3	437	c.285C>T	c.(283-285)gaC>gaT	p.D95D	DNAJC12_ENST00000339758.7_Silent_p.D95D|RNU6-1250P_ENST00000391218.1_RNA|DNAJC12_ENST00000483798.2_Silent_p.D125D	NM_021800.2	NP_068572.1	Q9UKB3	DJC12_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 12	95								p.D95D(1)		breast(2)|kidney(2)|large_intestine(1)|lung(6)|upper_aerodigestive_tract(1)	12						TCTTCACTGAGTCATTCAAAG	0.502																																					p.D95D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C285T	10						.						193.0	153.0	167.0					10																	69571294		2203	4300	6503	69241300	SO:0001819	synonymous_variant	56521	exon3			AF176012	CCDS7271.1, CCDS7272.1	10q21.3	2011-09-02			ENSG00000108176	ENSG00000108176		"""Heat shock proteins / DNAJ (HSP40)"""	28908	protein-coding gene	gene with protein product	"""J domain protein 1"""	606060				10760603	Standard	NM_021800		Approved	JDP1	uc001jnb.3	Q9UKB3	OTTHUMG00000018339	ENST00000225171.2:c.285C>T	10.37:g.69571294G>A			69241300	NM_201262	Q5JVQ1|Q9UKB2	Silent	SNP	ENST00000225171.2	37	CCDS7271.1																																																																																				0.502	DNAJC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048291.1	NM_021800	
PPP1R3C	5507	hgsc.bcm.edu	37	10	93390322	93390322	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AF-2691-01A-01W-0831-10	TCGA-AF-2691-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	0a041965-3054-4091-9dae-8b6b40cc7a03	0dc37a16-724e-44fe-a593-b1efde8ccf36	g.chr10:93390322C>A	ENST00000238994.5	-	2	400	c.316G>T	c.(316-318)Gaa>Taa	p.E106*		NM_005398.5	NP_005389.1			protein phosphatase 1, regulatory subunit 3C									p.E106*(1)		breast(1)|endometrium(1)|large_intestine(5)|lung(4)|upper_aerodigestive_tract(1)	12		Colorectal(252;0.235)				GCTGGTTCTTCTGGGAGGTCG	0.488																																					p.E106X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G316T	10						.						86.0	88.0	88.0					10																	93390322		2203	4300	6503	93380302	SO:0001587	stop_gained	5507	exon2			Y18207	CCDS7416.1	10q23-q24	2012-04-17	2011-10-04	2001-08-01	ENSG00000119938	ENSG00000119938		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9293	protein-coding gene	gene with protein product	"""Phosphatase 1, regulatory inhibitor subunit 5"", ""protein targeting to glycogen"""	602999	"""protein phosphatase 1, regulatory (inhibitor) subunit 3C"""	PPP1R5		8985175	Standard	NM_005398		Approved	PTG	uc001kho.3	Q9UQK1	OTTHUMG00000018745	ENST00000238994.5:c.316G>T	10.37:g.93390322C>A	ENSP00000238994:p.Glu106*		93380302	NM_005398		Nonsense_Mutation	SNP	ENST00000238994.5	37	CCDS7416.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	35|35	5.497069|5.497069	0.96355|0.96355	.|.	.|.	ENSG00000119938|ENSG00000119938	ENST00000500094|ENST00000238994;ENST00000438999	.|.	.|.	.|.	5.79|5.79	5.79|5.79	0.91817|0.91817	.|.	.|0.099447	.|0.64402	.|D	.|0.000002	.|.	.|.	.|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|0.16420	.|T	.|0.52	.|-23.8977	20.04|20.04	0.97581|0.97581	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	.|X	-1|106	.|.	.|ENSP00000238994:E106X	.|E	-|-	.|1	.|0	PPP1R3C|PPP1R3C	93380302|93380302	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.978000|0.978000	0.69477|0.69477	7.381000|7.381000	0.79718|0.79718	2.733000|2.733000	0.93635|0.93635	0.655000|0.655000	0.94253|0.94253	.|GAA		0.488	PPP1R3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049372.1	NM_005398	
PNLIP	5406	hgsc.bcm.edu	37	10	118321070	118321070	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AF-2691-01A-01W-0831-10	TCGA-AF-2691-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	0a041965-3054-4091-9dae-8b6b40cc7a03	0dc37a16-724e-44fe-a593-b1efde8ccf36	g.chr10:118321070G>A	ENST00000369221.2	+	12	1284	c.1256G>A	c.(1255-1257)tGg>tAg	p.W419*		NM_000936.2	NP_000927.1	P16233	LIPP_HUMAN	pancreatic lipase	419	PLAT. {ECO:0000255|PROSITE- ProRule:PRU00152}.				intestinal cholesterol absorption (GO:0030299)|lipid catabolic process (GO:0016042)|lipid digestion (GO:0044241)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)	metal ion binding (GO:0046872)|triglyceride lipase activity (GO:0004806)	p.W419*(1)		central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(6)|liver(2)|lung(22)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	43				all cancers(201;0.0131)	Glycerol Phenylbutyrate(DB08909)|Orlistat(DB01083)	AAATTTATTTGGTATAACAAT	0.383																																					p.W419X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G1256A	10						.						140.0	135.0	137.0					10																	118321070		2203	4300	6503	118311060	SO:0001587	stop_gained	5406	exon12			BC014309	CCDS7594.1	10q25.3	2012-07-31			ENSG00000175535	ENSG00000175535	3.1.1.3		9155	protein-coding gene	gene with protein product		246600				1783385	Standard	NM_000936		Approved	PL	uc001lcm.3	P16233	OTTHUMG00000019103	ENST00000369221.2:c.1256G>A	10.37:g.118321070G>A	ENSP00000358223:p.Trp419*		118311060	NM_000936	Q5VSQ2	Nonsense_Mutation	SNP	ENST00000369221.2	37	CCDS7594.1	.	.	.	.	.	.	.	.	.	.	G	19.41	3.822981	0.71028	.	.	ENSG00000175535	ENST00000369221	.	.	.	5.99	5.99	0.97316	.	0.000000	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.2471	0.93906	0.0:0.0:1.0:0.0	.	.	.	.	X	419	.	ENSP00000358223:W419X	W	+	2	0	PNLIP	118311060	1.000000	0.71417	0.992000	0.48379	0.106000	0.19336	6.756000	0.74919	2.847000	0.97988	0.655000	0.94253	TGG		0.383	PNLIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050524.1	NM_000936	
NAT10	55226	hgsc.bcm.edu	37	11	34140023	34140023	+	Missense_Mutation	SNP	G	G	T			TCGA-AF-2691-01A-01W-0831-10	TCGA-AF-2691-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	0a041965-3054-4091-9dae-8b6b40cc7a03	0dc37a16-724e-44fe-a593-b1efde8ccf36	g.chr11:34140023G>T	ENST00000257829.3	+	8	959	c.753G>T	c.(751-753)ttG>ttT	p.L251F	NAT10_ENST00000527971.1_Missense_Mutation_p.L251F|NAT10_ENST00000531159.2_Missense_Mutation_p.L179F	NM_024662.2	NP_078938	Q9H0A0	NAT10_HUMAN	N-acetyltransferase 10 (GCN5-related)	251						membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|N-acetyltransferase activity (GO:0008080)|poly(A) RNA binding (GO:0044822)	p.L251F(1)		endometrium(4)|large_intestine(8)|lung(8)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	23		Acute lymphoblastic leukemia(5;0.0119)|all_hematologic(20;0.0231)				TGGGTGTGTTGGTGGACTGCT	0.522																																					p.L179F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G537T	11						.						110.0	103.0	106.0					11																	34140023		2202	4298	6500	34096599	SO:0001583	missense	55226	exon6			AF489535	CCDS7889.1, CCDS44568.1	11p13	2011-11-16	2008-09-24		ENSG00000135372	ENSG00000135372	2.3.1.-		29830	protein-coding gene	gene with protein product		609221	"""N-acetyltransferase 10"""			14592445, 21177859	Standard	NM_024662		Approved	hALP, FLJ10774, FLJ12179, NET43, KIAA1709	uc001mvk.3	Q9H0A0	OTTHUMG00000166249	ENST00000257829.3:c.753G>T	11.37:g.34140023G>T	ENSP00000257829:p.Leu251Phe		34096599	NM_001144030	B4DFD5|E7ESU4|E9PMN9|Q86WK5|Q9C0F4|Q9HA61|Q9NVF2	Missense_Mutation	SNP	ENST00000257829.3	37	CCDS7889.1	.	.	.	.	.	.	.	.	.	.	G	18.55	3.649050	0.67358	.	.	ENSG00000135372	ENST00000257829;ENST00000531159;ENST00000527971	T;T	0.45276	0.9;0.93	5.29	2.18	0.27775	.	0.147232	0.42682	D	0.000665	T	0.53206	0.1782	M	0.88512	2.96	0.58432	D	0.999999	P	0.49783	0.928	P	0.50231	0.635	T	0.54970	-0.8213	10	0.66056	D	0.02	-12.0696	5.4514	0.16566	0.0701:0.1247:0.5476:0.2576	.	251	Q9H0A0	NAT10_HUMAN	F	251;179;251	ENSP00000257829:L251F;ENSP00000433011:L179F	ENSP00000257829:L251F	L	+	3	2	NAT10	34096599	1.000000	0.71417	0.999000	0.59377	0.983000	0.72400	0.777000	0.26718	0.570000	0.29347	0.555000	0.69702	TTG		0.522	NAT10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388693.1	NM_024662	
UBASH3B	84959	hgsc.bcm.edu	37	11	122669731	122669731	+	Missense_Mutation	SNP	A	A	G			TCGA-AF-2691-01A-01W-0831-10	TCGA-AF-2691-10A-01W-0831-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	0a041965-3054-4091-9dae-8b6b40cc7a03	0dc37a16-724e-44fe-a593-b1efde8ccf36	g.chr11:122669731A>G	ENST00000284273.5	+	10	1814	c.1439A>G	c.(1438-1440)aAt>aGt	p.N480S		NM_032873.4	NP_116262.2	Q8TF42	UBS3B_HUMAN	ubiquitin associated and SH3 domain containing B	480	Protein tyrosine phosphatase. {ECO:0000250}.				negative regulation of platelet aggregation (GO:0090331)|negative regulation of protein kinase activity (GO:0006469)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)	p.N480S(1)		breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(11)|prostate(1)|skin(2)|stomach(2)	26		Breast(109;0.00254)|Medulloblastoma(222;0.00877)|Lung NSC(97;0.0183)|all_lung(97;0.0186)|all_neural(223;0.0381)|all_hematologic(192;0.104)		BRCA - Breast invasive adenocarcinoma(274;1.37e-05)|OV - Ovarian serous cystadenocarcinoma(99;0.0463)		ACTGCACACAATATCTTGAAA	0.438																																					p.N480S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1439G	11						.						115.0	103.0	107.0					11																	122669731		2202	4299	6501	122174941	SO:0001583	missense	84959	exon10			AB075839	CCDS31694.1	11q24.1	2010-04-28	2010-04-28		ENSG00000154127	ENSG00000154127			29884	protein-coding gene	gene with protein product	"""SH3 domain-containing 70 kDa protein, suppressor of T-cell receptor signaling 1, nm23-phosphorylated unknown substrate"""	609201				11853319, 12370296	Standard	NM_032873		Approved	KIAA1959, STS-1	uc001pyi.4	Q8TF42	OTTHUMG00000166025	ENST00000284273.5:c.1439A>G	11.37:g.122669731A>G	ENSP00000284273:p.Asn480Ser		122174941	NM_032873	Q53GT5|Q53GT8|Q8NBV7|Q96IG9|Q96NZ2	Missense_Mutation	SNP	ENST00000284273.5	37	CCDS31694.1	.	.	.	.	.	.	.	.	.	.	A	11.67	1.708622	0.30322	.	.	ENSG00000154127	ENST00000284273	T	0.28666	1.6	6.07	4.92	0.64577	Histidine phosphatase superfamily, clade-1 (1);	0.086335	0.85682	D	0.000000	T	0.15825	0.0381	N	0.17312	0.475	0.51767	D	0.999938	P	0.37423	0.594	B	0.32393	0.145	T	0.03910	-1.0993	10	0.07482	T	0.82	-0.6699	13.0746	0.59079	0.8657:0.1343:0.0:0.0	.	480	Q8TF42	UBS3B_HUMAN	S	480	ENSP00000284273:N480S	ENSP00000284273:N480S	N	+	2	0	UBASH3B	122174941	1.000000	0.71417	0.990000	0.47175	0.968000	0.65278	8.704000	0.91351	1.081000	0.41110	0.533000	0.62120	AAT		0.438	UBASH3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387499.1	NM_032873	
CCDC63	160762	hgsc.bcm.edu	37	12	111342486	111342486	+	Silent	SNP	C	C	G			TCGA-AF-2691-01A-01W-0831-10	TCGA-AF-2691-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	0a041965-3054-4091-9dae-8b6b40cc7a03	0dc37a16-724e-44fe-a593-b1efde8ccf36	g.chr12:111342486C>G	ENST00000308208.5	+	11	1679	c.1437C>G	c.(1435-1437)ccC>ccG	p.P479P	CCDC63_ENST00000552694.1_Silent_p.P400P|CCDC63_ENST00000545036.1_Silent_p.P439P	NM_152591.1	NP_689804.1	Q8NA47	CCD63_HUMAN	coiled-coil domain containing 63	479								p.P479P(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(15)|ovary(1)|pancreas(1)|prostate(2)|skin(7)|urinary_tract(1)	39						TCCCGCCACCCTTCATCAACC	0.597																																					p.P479P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1437G	12						.						75.0	70.0	72.0					12																	111342486		2203	4300	6503	109826869	SO:0001819	synonymous_variant	160762	exon11			AK093162	CCDS9151.1, CCDS66470.1, CCDS73528.1	12q24.11	2013-02-19				ENSG00000173093			26669	protein-coding gene	gene with protein product	"""outer row dynein assembly 5 homolog (Chlamydomonas)"""						Standard	NM_001286243		Approved	ODA5, FLJ35843	uc001trv.1	Q8NA47	OTTHUMG00000169534	ENST00000308208.5:c.1437C>G	12.37:g.111342486C>G			109826869	NM_152591	B4DY03|Q0P603|Q6P2E1	Silent	SNP	ENST00000308208.5	37	CCDS9151.1																																																																																				0.597	CCDC63-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000404673.2	NM_152591	
KRAS	3845	hgsc.bcm.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	T	rs121913529		TCGA-AF-2691-01A-01W-0831-10	TCGA-AF-2691-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	0a041965-3054-4091-9dae-8b6b40cc7a03	0dc37a16-724e-44fe-a593-b1efde8ccf36	g.chr12:25398284C>T	ENST00000256078.4	-	2	98	c.35G>A	c.(34-36)gGt>gAt	p.G12D	KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000556131.1_Missense_Mutation_p.G12D|KRAS_ENST00000311936.3_Missense_Mutation_p.G12D	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.G12D	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)		Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	KRAS,haematopoietic_and_lymphoid_tissue,NS,Substitution - Missense,0 	.	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	c.G35A	12						.						91.0	81.0	85.0					12																	25398284		2203	4300	6503	25289551	SO:0001583	missense	3845	exon2	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>A	12.37:g.25398284C>T	ENSP00000256078:p.Gly12Asp		25289551	NM_004985	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.409094	0.83340	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.85919	0.5809	M	0.91818	3.245	0.80722	D	1	B;P	0.35714	0.385;0.517	B;B	0.41619	0.257;0.361	D	0.87870	0.2670	10	0.87932	D	0	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	D	12	ENSP00000308495:G12D;ENSP00000452512:G12D;ENSP00000256078:G12D;ENSP00000451856:G12D	ENSP00000256078:G12D	G	-	2	0	KRAS	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360	
ASB8	140461	hgsc.bcm.edu	37	12	48543494	48543494	+	Silent	SNP	G	G	A			TCGA-AF-2691-01A-01W-0831-10	TCGA-AF-2691-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	0a041965-3054-4091-9dae-8b6b40cc7a03	0dc37a16-724e-44fe-a593-b1efde8ccf36	g.chr12:48543494G>A	ENST00000317697.3	-	4	691	c.522C>T	c.(520-522)ggC>ggT	p.G174G	ASB8_ENST00000539528.1_3'UTR|ASB8_ENST00000536549.1_Silent_p.G174G|ASB8_ENST00000537754.1_5'UTR|ASB8_ENST00000536953.1_3'UTR	NM_024095.3	NP_077000.1	Q9H765	ASB8_HUMAN	ankyrin repeat and SOCS box containing 8	174					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)		p.G174G(1)		breast(1)|kidney(2)|large_intestine(2)|lung(5)|soft_tissue(1)	11						TGACCTCTGCGCCATAATCCA	0.532																																					p.G174G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C522T	12						.						76.0	73.0	74.0					12																	48543494		2203	4300	6503	46829761	SO:0001819	synonymous_variant	140461	exon4			AK024908	CCDS8761.1	12q13.12	2013-01-10	2011-01-25			ENSG00000177981		"""Ankyrin repeat domain containing"""	17183	protein-coding gene	gene with protein product		615053	"""ankyrin repeat and SOCS box-containing 8"""			12076535	Standard	NM_024095		Approved	MGC5540, FLJ21255	uc001rrh.3	Q9H765		ENST00000317697.3:c.522C>T	12.37:g.48543494G>A			46829761	NM_024095	A8K1P2|Q547Q2	Silent	SNP	ENST00000317697.3	37	CCDS8761.1																																																																																				0.532	ASB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396497.1		
LRRC10	376132	hgsc.bcm.edu	37	12	70004051	70004051	+	Missense_Mutation	SNP	G	G	T			TCGA-AF-2691-01A-01W-0831-10	TCGA-AF-2691-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	0a041965-3054-4091-9dae-8b6b40cc7a03	0dc37a16-724e-44fe-a593-b1efde8ccf36	g.chr12:70004051G>T	ENST00000361484.3	-	1	891	c.568C>A	c.(568-570)Ccc>Acc	p.P190T		NM_201550.2	NP_963844.2	Q5BKY1	LRC10_HUMAN	leucine rich repeat containing 10	190					cardiac muscle cell development (GO:0055013)	cytoskeleton (GO:0005856)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|sarcomere (GO:0030017)		p.P190T(1)		large_intestine(2)|lung(6)	8	all_cancers(2;2.83e-105)|Breast(13;9.83e-07)|Esophageal squamous(21;0.187)		Epithelial(6;1.98e-18)|GBM - Glioblastoma multiforme(2;7.43e-12)|Lung(24;0.000185)|OV - Ovarian serous cystadenocarcinoma(12;0.00126)|STAD - Stomach adenocarcinoma(21;0.00501)|Kidney(9;0.143)|LUSC - Lung squamous cell carcinoma(43;0.24)			TCCAGGAAGGGCATGTGAAGC	0.587																																					p.P190T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C568A	12						.						91.0	81.0	84.0					12																	70004051		2203	4300	6503	68290318	SO:0001583	missense	376132	exon1			AK095935	CCDS31856.1	12q15	2009-09-08				ENSG00000198812			20264	protein-coding gene	gene with protein product		610846				14751244	Standard	NM_201550		Approved	HRLRRP, LRRC10A	uc001svc.3	Q5BKY1		ENST00000361484.3:c.568C>A	12.37:g.70004051G>T	ENSP00000355166:p.Pro190Thr		68290318	NM_201550	Q6ZVY4	Missense_Mutation	SNP	ENST00000361484.3	37	CCDS31856.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.029477	0.75504	.	.	ENSG00000198812	ENST00000361484	T	0.23950	1.88	5.63	5.63	0.86233	.	0.098837	0.64402	D	0.000001	T	0.41650	0.1168	M	0.63428	1.95	0.51482	D	0.999925	D	0.63880	0.993	P	0.56343	0.796	T	0.10800	-1.0614	10	0.08837	T	0.75	.	20.0471	0.97613	0.0:0.0:1.0:0.0	.	190	Q5BKY1	LRC10_HUMAN	T	190	ENSP00000355166:P190T	ENSP00000355166:P190T	P	-	1	0	LRRC10	68290318	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	6.488000	0.73637	2.815000	0.96918	0.561000	0.74099	CCC		0.587	LRRC10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403834.1	NM_201550	
SCARB1	949	hgsc.bcm.edu	37	12	125284769	125284769	+	Silent	SNP	G	G	T			TCGA-AF-2691-01A-01W-0831-10	TCGA-AF-2691-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	0a041965-3054-4091-9dae-8b6b40cc7a03	0dc37a16-724e-44fe-a593-b1efde8ccf36	g.chr12:125284769G>T	ENST00000415380.2	-	8	1154	c.1029C>A	c.(1027-1029)tcC>tcA	p.S343S	SCARB1_ENST00000540495.1_Silent_p.S306S|SCARB1_ENST00000339570.5_Silent_p.S343S|SCARB1_ENST00000376788.1_Silent_p.S243S|SCARB1_ENST00000541205.1_Silent_p.S302S|SCARB1_ENST00000535005.1_5'UTR|SCARB1_ENST00000546215.1_Silent_p.S343S|SCARB1_ENST00000544327.1_Silent_p.S289S|SCARB1_ENST00000261693.6_Silent_p.S343S			Q8WTV0	SCRB1_HUMAN	scavenger receptor class B, member 1	343					adhesion of symbiont to host (GO:0044406)|androgen biosynthetic process (GO:0006702)|blood vessel endothelial cell migration (GO:0043534)|cell adhesion (GO:0007155)|cholesterol catabolic process (GO:0006707)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol import (GO:0070508)|detection of lipopolysaccharide (GO:0032497)|endothelial cell proliferation (GO:0001935)|high-density lipoprotein particle clearance (GO:0034384)|high-density lipoprotein particle remodeling (GO:0034375)|lipopolysaccharide transport (GO:0015920)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|lipoprotein metabolic process (GO:0042157)|low-density lipoprotein particle clearance (GO:0034383)|phospholipid transport (GO:0015914)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of triglyceride biosynthetic process (GO:0010867)|receptor-mediated endocytosis (GO:0006898)|recognition of apoptotic cell (GO:0043654)|regulation of phagocytosis (GO:0050764)|regulation of phosphatidylcholine catabolic process (GO:0010899)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|triglyceride homeostasis (GO:0070328)|viral process (GO:0016032)|wound healing (GO:0042060)	caveola (GO:0005901)|cell surface (GO:0009986)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)	1-phosphatidylinositol binding (GO:0005545)|apolipoprotein A-I binding (GO:0034186)|apolipoprotein binding (GO:0034185)|high-density lipoprotein particle binding (GO:0008035)|high-density lipoprotein particle receptor activity (GO:0070506)|lipopolysaccharide binding (GO:0001530)|lipopolysaccharide receptor activity (GO:0001875)|low-density lipoprotein particle binding (GO:0030169)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)	p.S343S(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(7)|prostate(1)	17	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000116)|Epithelial(86;0.000415)|all cancers(50;0.00395)	Phosphatidylserine(DB00144)	AGTGAGGATGGGAGAGAAACA	0.602																																					p.S343S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1029A	12						.						86.0	83.0	84.0					12																	125284769		2203	4300	6503	123850722	SO:0001819	synonymous_variant	949	exon8			Z22555	CCDS9259.1, CCDS45008.1	12q24.32	2008-08-05	2002-09-06	2002-09-06	ENSG00000073060	ENSG00000073060			1664	protein-coding gene	gene with protein product		601040	"""CD36 antigen (collagen type I receptor, thrombospondin receptor)-like 1"""	CD36L1		7689561	Standard	NM_001082959		Approved	SRB1, CLA-1, CLA1, SR-BI	uc001ugm.4	Q8WTV0	OTTHUMG00000168544	ENST00000415380.2:c.1029C>A	12.37:g.125284769G>T			123850722	NM_005505	F8W8N0|Q14016|Q52LZ5|Q6KFX4	Silent	SNP	ENST00000415380.2	37																																																																																					0.602	SCARB1-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000400165.1	NM_005505	
ZC3H13	23091	hgsc.bcm.edu	37	13	46541918	46541918	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AF-2691-01A-01W-0831-10	TCGA-AF-2691-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	0a041965-3054-4091-9dae-8b6b40cc7a03	0dc37a16-724e-44fe-a593-b1efde8ccf36	g.chr13:46541918C>A	ENST00000242848.4	-	15	4390	c.4042G>T	c.(4042-4044)Gaa>Taa	p.E1348*	ZC3H13_ENST00000282007.3_Nonsense_Mutation_p.E1348*|ZC3H13_ENST00000378921.2_Nonsense_Mutation_p.E304*			Q5T200	ZC3HD_HUMAN	zinc finger CCCH-type containing 13	1348							metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.E1348*(1)		cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|lung(25)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	79		Lung NSC(96;7.26e-05)|Breast(56;0.000118)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;4.18e-05)		ttgtctcgttctctctctcgt	0.473																																					p.E1348X	Esophageal Squamous(187;747 2077 11056 31291 44172)											.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G4042T	13						.						274.0	196.0	223.0					13																	46541918		2203	4299	6502	45439919	SO:0001587	stop_gained	23091	exon15			AB020660	CCDS9400.1	13q14.11	2012-07-05	2006-05-15	2006-05-15	ENSG00000123200	ENSG00000123200		"""Zinc fingers, CCCH-type domain containing"""	20368	protein-coding gene	gene with protein product			"""KIAA0853"""	KIAA0853		10048485	Standard	XM_005266301		Approved	DKFZp434D1812	uc001vas.1	Q5T200	OTTHUMG00000016863	ENST00000242848.4:c.4042G>T	13.37:g.46541918C>A	ENSP00000242848:p.Glu1348*		45439919	NM_015070	A2A323|O94936|Q5T1Z9|Q7Z7J3|Q8NDT6|Q9H0L6	Nonsense_Mutation	SNP	ENST00000242848.4	37		.	.	.	.	.	.	.	.	.	.	C	46	12.303638	0.99655	.	.	ENSG00000123200	ENST00000242848;ENST00000378921;ENST00000282007	.	.	.	5.0	5.0	0.66597	.	0.128939	0.33631	N	0.004720	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.30078	T	0.28	.	14.4519	0.67392	0.0:0.852:0.148:0.0	.	.	.	.	X	1348;304;1348	.	ENSP00000242848:E1348X	E	-	1	0	ZC3H13	45439919	1.000000	0.71417	0.998000	0.56505	0.932000	0.56968	2.661000	0.46758	2.319000	0.78375	0.591000	0.81541	GAA		0.473	ZC3H13-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000044789.1	NM_015070	
SPTB	6710	hgsc.bcm.edu	37	14	65263288	65263288	+	Missense_Mutation	SNP	C	C	T			TCGA-AF-2691-01A-01W-0831-10	TCGA-AF-2691-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	0a041965-3054-4091-9dae-8b6b40cc7a03	0dc37a16-724e-44fe-a593-b1efde8ccf36	g.chr14:65263288C>T	ENST00000389721.5	-	10	1360	c.1328G>A	c.(1327-1329)cGc>cAc	p.R443H	SPTB_ENST00000556626.1_Missense_Mutation_p.R443H|SPTB_ENST00000389720.3_Missense_Mutation_p.R443H|SPTB_ENST00000389722.3_Missense_Mutation_p.R443H|SPTB_ENST00000542895.1_Missense_Mutation_p.R443H	NM_000347.5	NP_000338.3	P11277	SPTB1_HUMAN	spectrin, beta, erythrocytic	443					actin filament capping (GO:0051693)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)	actin cytoskeleton (GO:0015629)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ankyrin binding (GO:0030506)|structural constituent of cytoskeleton (GO:0005200)	p.R443H(1)		breast(5)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(36)|ovary(8)|pancreas(1)|prostate(4)|skin(10)|urinary_tract(3)	106		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)		GGCCACGAGGCGCTGGTTTTC	0.587																																					p.R443H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1328A	14						.						73.0	73.0	73.0					14																	65263288		2203	4300	6503	64333041	SO:0001583	missense	6710	exon10				CCDS32099.1, CCDS32100.1	14q24.1-q24.2	2013-01-10	2008-07-29			ENSG00000070182		"""Pleckstrin homology (PH) domain containing"""	11274	protein-coding gene	gene with protein product	"""spherocytosis, clinical type I"""	182870				2209094	Standard	NM_001024858		Approved		uc001xhr.3	P11277		ENST00000389721.5:c.1328G>A	14.37:g.65263288C>T	ENSP00000374371:p.Arg443His		64333041	NM_001024858	Q15510|Q15519	Missense_Mutation	SNP	ENST00000389721.5	37	CCDS32100.1	.	.	.	.	.	.	.	.	.	.	C	24.6	4.546756	0.86022	.	.	ENSG00000070182	ENST00000389723;ENST00000389722;ENST00000556626;ENST00000389721;ENST00000542895;ENST00000389720	T;T;T;T;T	0.51574	0.7;0.7;0.7;0.7;0.7	5.81	4.93	0.64822	.	0.000000	0.85682	D	0.000000	T	0.58680	0.2139	M	0.69463	2.115	0.53005	D	0.999965	P;D	0.56746	0.752;0.977	P;P	0.53224	0.458;0.721	T	0.63479	-0.6628	10	0.62326	D	0.03	.	14.0503	0.64732	0.0:0.9265:0.0:0.0735	.	443;447	P11277;Q59FP5	SPTB1_HUMAN;.	H	447;443;443;443;443;443	ENSP00000374372:R443H;ENSP00000451752:R443H;ENSP00000374371:R443H;ENSP00000443882:R443H;ENSP00000374370:R443H	ENSP00000374370:R443H	R	-	2	0	SPTB	64333041	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.953000	0.63624	1.474000	0.48178	-0.137000	0.14449	CGC		0.587	SPTB-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000414080.1		
TSHR	7253	hgsc.bcm.edu	37	14	81610318	81610318	+	Missense_Mutation	SNP	C	C	A			TCGA-AF-2691-01A-01W-0831-10	TCGA-AF-2691-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	0a041965-3054-4091-9dae-8b6b40cc7a03	0dc37a16-724e-44fe-a593-b1efde8ccf36	g.chr14:81610318C>A	ENST00000541158.2	+	11	2238	c.1916C>A	c.(1915-1917)cCa>cAa	p.P639Q	RP11-114N19.3_ENST00000557775.1_RNA|TSHR_ENST00000298171.2_Missense_Mutation_p.P639Q			P16473	TSHR_HUMAN	thyroid stimulating hormone receptor	639			P -> A (in TTNs). {ECO:0000269|PubMed:11434721}.|P -> S (in HTNA; gain of function). {ECO:0000269|PubMed:10199795}.		adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adult locomotory behavior (GO:0008344)|B cell differentiation (GO:0030183)|cell-cell signaling (GO:0007267)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|positive regulation of cell proliferation (GO:0008284)|positive regulation of multicellular organism growth (GO:0040018)|regulation of locomotion (GO:0040012)|thyroid-stimulating hormone signaling pathway (GO:0038194)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	thyroid-stimulating hormone receptor activity (GO:0004996)	p.P639Q(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(10)|lung(18)|ovary(6)|prostate(3)|skin(2)|stomach(1)|thyroid(291)|upper_aerodigestive_tract(1)	337				BRCA - Breast invasive adenocarcinoma(234;0.0402)	Thyrotropin Alfa(DB00024)	TGCATGGCCCCAATCTCATTC	0.453			Mis		toxic thyroid adenoma	thyroid  adenoma	Hereditary nonautoimmune hyperthyroidism; subclinical hypothyroidism																														p.P639Q		yes	Dom	yes		14	14q31	7253	thyroid stimulating hormone receptor	yes	E	TSHR,thyroid,NS,Substitution - Missense,+1 	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1916A	14						.						187.0	171.0	177.0					14																	81610318		2203	4300	6503	80680071	SO:0001583	missense	7253	exon10			AY429111	CCDS9872.1, CCDS32131.1, CCDS55935.1	14q24-q31	2014-09-17			ENSG00000165409	ENSG00000165409		"""GPCR / Class A : Gonadotropin and TSH receptors"""	12373	protein-coding gene	gene with protein product		603372				2558651, 2610690	Standard	NM_001018036		Approved	LGR3	uc001xvd.1	P16473		ENST00000541158.2:c.1916C>A	14.37:g.81610318C>A	ENSP00000441235:p.Pro639Gln		80680071	NM_000369	A0PJU7|F5GYU5|G3V2A9|Q16503|Q8TB90|Q96GT6|Q9P1V4|Q9ULA3|Q9UPH3	Missense_Mutation	SNP	ENST00000541158.2	37	CCDS9872.1	.	.	.	.	.	.	.	.	.	.	C	19.48	3.835497	0.71373	.	.	ENSG00000165409	ENST00000541158;ENST00000412429;ENST00000298171	T;T	0.80393	-1.37;-1.37	5.05	5.05	0.67936	.	0.000000	0.85682	D	0.000000	D	0.93933	0.8058	H	0.98218	4.175	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96321	0.9236	10	0.87932	D	0	.	18.4246	0.90605	0.0:1.0:0.0:0.0	.	639	F5GYU5	.	Q	639;286;639	ENSP00000441235:P639Q;ENSP00000298171:P639Q	ENSP00000298171:P639Q	P	+	2	0	TSHR	80680071	1.000000	0.71417	0.988000	0.46212	0.943000	0.58893	7.818000	0.86416	2.350000	0.79820	0.561000	0.74099	CCA		0.453	TSHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413364.1	NM_000369	
WARS	7453	hgsc.bcm.edu	37	14	100803478	100803478	+	Missense_Mutation	SNP	C	C	A			TCGA-AF-2691-01A-01W-0831-10	TCGA-AF-2691-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	0a041965-3054-4091-9dae-8b6b40cc7a03	0dc37a16-724e-44fe-a593-b1efde8ccf36	g.chr14:100803478C>A	ENST00000355338.2	-	10	1793	c.1175G>T	c.(1174-1176)gGc>gTc	p.G392V	RP11-638I2.9_ENST00000556212.1_RNA|WARS_ENST00000358655.4_Missense_Mutation_p.G351V|WARS_ENST00000557135.1_Missense_Mutation_p.G392V|RP11-638I2.8_ENST00000557226.1_RNA|WARS_ENST00000556645.1_Missense_Mutation_p.G351V|WARS_ENST00000344102.5_Missense_Mutation_p.G351V|WARS_ENST00000392882.2_Missense_Mutation_p.G392V	NM_173701.1	NP_776049.1	P23381	SYWC_HUMAN	tryptophanyl-tRNA synthetase	392					angiogenesis (GO:0001525)|gene expression (GO:0010467)|negative regulation of cell proliferation (GO:0008285)|regulation of angiogenesis (GO:0045765)|translation (GO:0006412)|tRNA aminoacylation for protein translation (GO:0006418)|tryptophanyl-tRNA aminoacylation (GO:0006436)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|tryptophan-tRNA ligase activity (GO:0004830)	p.G392V(1)		breast(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)	20		all_cancers(154;0.00223)|all_lung(585;2.48e-06)|all_epithelial(191;0.000564)|Melanoma(154;0.152)			L-Tryptophan(DB00150)	ATCACAGTTGCCCCCAAACTG	0.557																																					p.G392V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1175T	14						.						296.0	250.0	266.0					14																	100803478		2203	4300	6503	99873231	SO:0001583	missense	7453	exon10			M61715	CCDS9960.1, CCDS9961.1	14q32.2	2014-03-19			ENSG00000140105	ENSG00000140105	6.1.1.2	"""Aminoacyl tRNA synthetases / Class I"""	12729	protein-coding gene	gene with protein product	"""tryptophan tRNA ligase 1, cytoplasmic"""	191050		IFI53		1537332, 1763065	Standard	NM_004184		Approved	IFP53	uc001yhl.1	P23381	OTTHUMG00000171572	ENST00000355338.2:c.1175G>T	14.37:g.100803478C>A	ENSP00000347495:p.Gly392Val		99873231	NM_173701	A6NGN1|A6NID3|P78535|Q502Y0|Q53XB6|Q9UDI5|Q9UDL3	Missense_Mutation	SNP	ENST00000355338.2	37	CCDS9960.1	.	.	.	.	.	.	.	.	.	.	C	32	5.108232	0.94292	.	.	ENSG00000140105	ENST00000392882;ENST00000358655;ENST00000355338;ENST00000344102;ENST00000557135;ENST00000556645	T;T;T;T;T;T	0.50277	0.75;0.75;0.75;0.75;0.75;0.75	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	T	0.78559	0.4302	M	0.93420	3.415	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.83152	-0.0103	10	0.72032	D	0.01	-5.3317	20.1169	0.97940	0.0:1.0:0.0:0.0	.	392	P23381	SYWC_HUMAN	V	392;351;392;351;392;351	ENSP00000376620:G392V;ENSP00000351481:G351V;ENSP00000347495:G392V;ENSP00000339485:G351V;ENSP00000451460:G392V;ENSP00000451887:G351V	ENSP00000339485:G351V	G	-	2	0	WARS	99873231	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	5.980000	0.70516	2.835000	0.97688	0.591000	0.81541	GGC		0.557	WARS-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414236.1	NM_004184	
ZNF106	64397	hgsc.bcm.edu	37	15	42742302	42742302	+	Missense_Mutation	SNP	T	T	C			TCGA-AF-2691-01A-01W-0831-10	TCGA-AF-2691-10A-01W-0831-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	0a041965-3054-4091-9dae-8b6b40cc7a03	0dc37a16-724e-44fe-a593-b1efde8ccf36	g.chr15:42742302T>C	ENST00000263805.4	-	2	2425	c.2099A>G	c.(2098-2100)gAt>gGt	p.D700G	ZNF106_ENST00000565380.1_Intron|ZNF106_ENST00000565611.1_Intron	NM_001284306.1|NM_001284307.1|NM_022473.1	NP_001271235.1|NP_001271236.1|NP_071918.1	Q9H2Y7	ZN106_HUMAN	zinc finger protein 106	700					insulin receptor signaling pathway (GO:0008286)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.D700G(1)									AAGCTCTGCATCCAAGCTAGC	0.453																																					p.D700G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2099G	15						.						118.0	119.0	118.0					15																	42742302		2203	4299	6502	40529594	SO:0001583	missense	64397	exon2			AF205632	CCDS32208.1, CCDS61602.1, CCDS61603.1	15q15.1	2012-11-27	2012-11-27		ENSG00000103994	ENSG00000103994		"""Zinc fingers, C2H2-type"""	12886	protein-coding gene	gene with protein product	"""SH3-domain binding protein 3"""		"""zinc finger protein 106 homolog (mouse)"""	ZFP106			Standard	XM_005254591		Approved	ZNF474, SH3BP3	uc001zpw.3	Q9H2Y7	OTTHUMG00000173244	ENST00000263805.4:c.2099A>G	15.37:g.42742302T>C	ENSP00000263805:p.Asp700Gly		40529594	NM_022473	B4DZ40|E9PE29|Q6NSD9|Q6PEK1|Q86T43|Q86T45|Q86T50|Q86T58|Q86TA9|Q96M37|Q9H7B8	Missense_Mutation	SNP	ENST00000263805.4	37	CCDS32208.1	.	.	.	.	.	.	.	.	.	.	T	13.93	2.382639	0.42207	.	.	ENSG00000103994	ENST00000263805	T	0.42900	0.96	5.52	5.52	0.82312	.	0.524948	0.20820	N	0.085081	T	0.46347	0.1388	M	0.63843	1.955	0.80722	D	1	P;B	0.43231	0.801;0.189	B;B	0.42625	0.393;0.112	T	0.45279	-0.9272	10	0.42905	T	0.14	-18.3465	15.9235	0.79592	0.0:0.0:0.0:1.0	.	483;700	B4DGC7;Q9H2Y7	.;ZF106_HUMAN	G	700	ENSP00000263805:D700G	ENSP00000263805:D700G	D	-	2	0	ZFP106	40529594	1.000000	0.71417	0.989000	0.46669	0.965000	0.64279	4.088000	0.57678	2.218000	0.71995	0.528000	0.53228	GAT		0.453	ZNF106-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422587.1	NM_022473	
TLN2	83660	hgsc.bcm.edu	37	15	62990971	62990971	+	Silent	SNP	C	C	T	rs12905981	byFrequency	TCGA-AF-2691-01A-01W-0831-10	TCGA-AF-2691-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	0a041965-3054-4091-9dae-8b6b40cc7a03	0dc37a16-724e-44fe-a593-b1efde8ccf36	g.chr15:62990971C>T	ENST00000561311.1	+	15	1722	c.1492C>T	c.(1492-1494)Ctg>Ttg	p.L498L	TLN2_ENST00000306829.6_Silent_p.L498L			Q9Y4G6	TLN2_HUMAN	talin 2	498					cell adhesion (GO:0007155)|cell-cell junction assembly (GO:0007043)|cytoskeletal anchoring at plasma membrane (GO:0007016)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	actin binding (GO:0003779)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.L498L(1)		NS(3)|breast(6)|central_nervous_system(3)|endometrium(8)|kidney(8)|large_intestine(20)|lung(34)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)	99						CCAGCAGGCCCTGATGGGGAC	0.552													C|||	1755	0.350439	0.1899	0.3718	5008	,	,		19202	0.6855		0.2942	False		,,,				2504	0.2648				p.L498L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1492T	15						.	C		929,3477	353.3+/-312.1	94,741,1368	73.0	63.0	67.0		1492	5.0	1.0	15	dbSNP_121	67	2729,5871	432.8+/-357.2	420,1889,1991	no	coding-synonymous	TLN2	NM_015059.2		514,2630,3359	TT,TC,CC		31.7326,21.0849,28.1255		498/2543	62990971	3658,9348	2203	4300	6503	60778263	SO:0001819	synonymous_variant	83660	exon13			AB002318	CCDS32261.1	15q15-q21	2008-07-03			ENSG00000171914	ENSG00000171914			15447	protein-coding gene	gene with protein product		607349				9205841, 11527381	Standard	NM_015059		Approved	KIAA0320, ILWEQ	uc002alb.4	Q9Y4G6	OTTHUMG00000133679	ENST00000561311.1:c.1492C>T	15.37:g.62990971C>T			60778263	NM_015059	A6NLB8	Silent	SNP	ENST00000561311.1	37	CCDS32261.1																																																																																				0.552	TLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257878.2		
ZNF597	146434	hgsc.bcm.edu	37	16	3490874	3490874	+	Silent	SNP	C	C	A			TCGA-AF-2691-01A-01W-0831-10	TCGA-AF-2691-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	0a041965-3054-4091-9dae-8b6b40cc7a03	0dc37a16-724e-44fe-a593-b1efde8ccf36	g.chr16:3490874C>A	ENST00000301744.4	-	3	328	c.93G>T	c.(91-93)ctG>ctT	p.L31L	NAA60_ENST00000407558.4_5'Flank|NAA60_ENST00000424546.2_5'Flank|NAA60_ENST00000573580.1_5'Flank|NAA60_ENST00000608722.1_5'Flank	NM_152457.1	NP_689670.1	Q96LX8	ZN597_HUMAN	zinc finger protein 597	31	KRAB.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.L31L(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(1)|urinary_tract(1)	13						GGGCAGGGTGCAGAGTCACGC	0.498																																					p.L31L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G93T	16						.						94.0	81.0	86.0					16																	3490874		2197	4300	6497	3430875	SO:0001819	synonymous_variant	146434	exon3			AK057633	CCDS10505.1	16p13.3	2013-01-08			ENSG00000167981	ENSG00000167981		"""Zinc fingers, C2H2-type"", ""-"""	26573	protein-coding gene	gene with protein product		614685				12477932	Standard	NM_152457		Approved	FLJ33071	uc002cvd.3	Q96LX8	OTTHUMG00000129359	ENST00000301744.4:c.93G>T	16.37:g.3490874C>A			3430875	NM_152457		Silent	SNP	ENST00000301744.4	37	CCDS10505.1																																																																																				0.498	ZNF597-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251511.2	NM_152457	
ABCC12	94160	hgsc.bcm.edu	37	16	48138174	48138174	+	Missense_Mutation	SNP	C	C	T			TCGA-AF-2691-01A-01W-0831-10	TCGA-AF-2691-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	0a041965-3054-4091-9dae-8b6b40cc7a03	0dc37a16-724e-44fe-a593-b1efde8ccf36	g.chr16:48138174C>T	ENST00000311303.3	-	20	3124	c.2779G>A	c.(2779-2781)Gca>Aca	p.A927T	ABCC12_ENST00000416054.1_3'UTR|ABCC12_ENST00000448542.1_Intron	NM_033226.2	NP_150229.2	Q96J65	MRP9_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 12	927	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.					integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)	p.A927T(1)		NS(1)|breast(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|liver(1)|lung(43)|ovary(2)|prostate(3)|skin(7)|urinary_tract(1)	90		all_cancers(37;0.0474)|all_lung(18;0.047)				AAGTTCTCTGCGTGAAACGGC	0.488																																					p.A927T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2779A	16						.						170.0	160.0	164.0					16																	48138174		2201	4300	6501	46695675	SO:0001583	missense	94160	exon20			AY040220	CCDS10730.1	16q12.1	2012-03-14			ENSG00000140798	ENSG00000140798		"""ATP binding cassette transporters / subfamily C"""	14640	protein-coding gene	gene with protein product		607041				11435397, 11483364	Standard	NM_033226		Approved	MRP9	uc002efc.1	Q96J65	OTTHUMG00000133143	ENST00000311303.3:c.2779G>A	16.37:g.48138174C>T	ENSP00000311030:p.Ala927Thr		46695675	NM_033226	Q49AL2|Q8TAF0|Q8TEY2	Missense_Mutation	SNP	ENST00000311303.3	37	CCDS10730.1	.	.	.	.	.	.	.	.	.	.	C	16.18	3.050415	0.55218	.	.	ENSG00000140798	ENST00000311303;ENST00000449939	D	0.89681	-2.55	5.55	3.61	0.41365	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.308605	0.37857	N	0.001905	T	0.80639	0.4661	L	0.31526	0.94	0.80722	D	1	B	0.31989	0.35	B	0.34180	0.177	T	0.73742	-0.3887	10	0.18710	T	0.47	.	8.941	0.35729	0.0:0.8273:0.0:0.1727	.	927	Q96J65	MRP9_HUMAN	T	927;845	ENSP00000311030:A927T	ENSP00000311030:A927T	A	-	1	0	ABCC12	46695675	0.939000	0.31865	0.327000	0.25402	0.960000	0.62799	1.982000	0.40638	1.336000	0.45506	0.655000	0.94253	GCA		0.488	ABCC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256837.1	NM_033226	
TP53	7157	hgsc.bcm.edu	37	17	7577530	7577530	+	Missense_Mutation	SNP	T	T	A			TCGA-AF-2691-01A-01W-0831-10	TCGA-AF-2691-10A-01W-0831-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	0a041965-3054-4091-9dae-8b6b40cc7a03	0dc37a16-724e-44fe-a593-b1efde8ccf36	g.chr17:7577530T>A	ENST00000269305.4	-	7	940	c.751A>T	c.(751-753)Atc>Ttc	p.I251F	TP53_ENST00000445888.2_Missense_Mutation_p.I251F|TP53_ENST00000420246.2_Missense_Mutation_p.I251F|TP53_ENST00000413465.2_Missense_Mutation_p.I251F|TP53_ENST00000455263.2_Missense_Mutation_p.I251F|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Missense_Mutation_p.I251F	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	251	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		I -> F (in sporadic cancers; somatic mutation).|I -> L (in sporadic cancers; somatic mutation).|I -> M (in LFS; germline mutation).|I -> N (in sporadic cancers; somatic mutation).|I -> S (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:17224074}.|I -> T (in sporadic cancers; somatic mutation).|I -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.I251F(9)|p.0?(8)|p.I251fs*94(6)|p.I251L(5)|p.I251_T253delILT(4)|p.I251del(2)|p.I251V(2)|p.P250_L252delPIL(2)|p.I251fs*12(1)|p.P250_T253delPILT(1)|p.P250_I251insXXXXXX(1)|p.P250_I251insX(1)|p.P250_I251insXXXXXXX(1)|p.I251fs*96(1)|p.R249_T256delRPILTIIT(1)|p.R249_I251delRPI(1)|p.I251fs*13(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ATGGTGAGGATGGGCCTCCGG	0.577		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.I251F	Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,soft_tissue,fat,Substitution - Missense,+1 	.	47	Substitution - Missense(16)|Deletion - In frame(11)|Whole gene deletion(8)|Deletion - Frameshift(7)|Insertion - In frame(3)|Insertion - Frameshift(2)	stomach(9)|breast(7)|large_intestine(6)|haematopoietic_and_lymphoid_tissue(5)|bone(4)|upper_aerodigestive_tract(3)|central_nervous_system(3)|liver(3)|urinary_tract(2)|lung(2)|oesophagus(2)|skin(1)	c.A751T	17						.						153.0	111.0	126.0					17																	7577530		2203	4300	6503	7518255	SO:0001583	missense	7157	exon7	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.751A>T	17.37:g.7577530T>A	ENSP00000269305:p.Ile251Phe		7518255	NM_001126114	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	T	21.6	4.175686	0.78564	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D;D	0.99854	-7.19;-7.19;-7.19;-7.19;-7.19;-7.19;-7.19	4.62	4.62	0.57501	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99825	0.9922	M	0.82323	2.585	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.997;0.992;0.999;0.997;1.0	D	0.96557	0.9412	10	0.87932	D	0	-1.7057	12.3101	0.54924	0.0:0.0:0.0:1.0	.	251;251;251;251;251	P04637-2;P04637-3;P04637;Q1MSW8;E7EQX7	.;.;P53_HUMAN;.;.	F	251;251;251;251;251;251;240;119	ENSP00000410739:I251F;ENSP00000352610:I251F;ENSP00000269305:I251F;ENSP00000398846:I251F;ENSP00000391127:I251F;ENSP00000391478:I251F;ENSP00000425104:I119F	ENSP00000269305:I251F	I	-	1	0	TP53	7518255	1.000000	0.71417	1.000000	0.80357	0.615000	0.37417	7.824000	0.86668	2.074000	0.62210	0.379000	0.24179	ATC		0.577	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
CDH19	28513	hgsc.bcm.edu	37	18	64197181	64197181	+	Silent	SNP	C	C	G			TCGA-AF-2691-01A-01W-0831-10	TCGA-AF-2691-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	0a041965-3054-4091-9dae-8b6b40cc7a03	0dc37a16-724e-44fe-a593-b1efde8ccf36	g.chr18:64197181C>G	ENST00000540086.1	-	9	1605	c.1359G>C	c.(1357-1359)tcG>tcC	p.S453S	CDH19_ENST00000262150.2_Silent_p.S453S	NM_001271028.1	NP_001257957.1	Q96JQ0	PCD16_HUMAN	cadherin 19, type 2	561	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.S453S(2)		NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(22)|ovary(1)|prostate(3)|skin(7)	61		Esophageal squamous(42;0.0132)				ACAGTGGGATCGAAGAGATCT	0.313																																					p.S453S												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G1359C	18						.						107.0	103.0	104.0					18																	64197181		2203	4300	6503	62348161	SO:0001819	synonymous_variant	28513	exon9			AJ007607	CCDS11994.1, CCDS59325.1	18q22.1	2010-01-26			ENSG00000071991	ENSG00000071991		"""Cadherins / Major cadherins"""	1758	protein-coding gene	gene with protein product		603016				10995570	Standard	NM_021153		Approved	CDH7	uc002lkc.2	Q9H159	OTTHUMG00000132802	ENST00000540086.1:c.1359G>C	18.37:g.64197181C>G			62348161	NM_021153	O15098	Silent	SNP	ENST00000540086.1	37	CCDS59325.1																																																																																				0.313	CDH19-005	PUTATIVE	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000442285.1	NM_021153	
NPHS1	4868	hgsc.bcm.edu	37	19	36332649	36332649	+	Nonsense_Mutation	SNP	G	G	T	rs386833926		TCGA-AF-2691-01A-01W-0831-10	TCGA-AF-2691-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	0a041965-3054-4091-9dae-8b6b40cc7a03	0dc37a16-724e-44fe-a593-b1efde8ccf36	g.chr19:36332649G>T	ENST00000378910.5	-	20	2782	c.2783C>A	c.(2782-2784)tCg>tAg	p.S928*	NPHS1_ENST00000353632.6_Nonsense_Mutation_p.S928*	NM_004646.3	NP_004637.1	O60500	NPHN_HUMAN	nephrosis 1, congenital, Finnish type (nephrin)	928	Ig-like C2-type 8.				cell adhesion (GO:0007155)|excretion (GO:0007588)|glomerular basement membrane development (GO:0032836)|glomerular visceral epithelial cell development (GO:0072015)|JNK cascade (GO:0007254)|myoblast fusion (GO:0007520)|positive regulation of actin filament polymerization (GO:0030838)|regulation of excretion (GO:0044062)|skeletal muscle tissue development (GO:0007519)	cell projection (GO:0042995)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)	myosin binding (GO:0017022)	p.S928*(1)		NS(2)|breast(1)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|liver(1)|lung(26)|ovary(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	74	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			GGTTTGGTCCGAGCCAAGGGC	0.587																																					p.S928X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C2783A	19						.						195.0	145.0	162.0					19																	36332649		2203	4300	6503	41024489	SO:0001587	stop_gained	4868	exon20				CCDS32996.1	19q12-q13.1	2014-09-17				ENSG00000161270		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7908	protein-coding gene	gene with protein product		602716				9915943, 9660941	Standard	NM_004646		Approved	CNF, NPHN	uc002oby.3	O60500		ENST00000378910.5:c.2783C>A	19.37:g.36332649G>T	ENSP00000368190:p.Ser928*		41024489	NM_004646	A6NDH2|C3RX61	Nonsense_Mutation	SNP	ENST00000378910.5	37	CCDS32996.1	.	.	.	.	.	.	.	.	.	.	G	41	8.838174	0.98972	.	.	ENSG00000161270	ENST00000378910;ENST00000353632	.	.	.	5.4	5.4	0.78164	.	0.283025	0.33813	N	0.004532	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.2146	10.2195	0.43188	0.0898:0.0:0.9102:0.0	.	.	.	.	X	928	.	ENSP00000343634:S928X	S	-	2	0	NPHS1	41024489	0.891000	0.30450	0.984000	0.44739	0.764000	0.43329	2.019000	0.41001	2.567000	0.86603	0.558000	0.71614	TCG		0.587	NPHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452553.1		
RYR1	6261	hgsc.bcm.edu	37	19	39075643	39075643	+	Missense_Mutation	SNP	G	G	A	rs372418113		TCGA-AF-2691-01A-01W-0831-10	TCGA-AF-2691-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	0a041965-3054-4091-9dae-8b6b40cc7a03	0dc37a16-724e-44fe-a593-b1efde8ccf36	g.chr19:39075643G>A	ENST00000359596.3	+	102	14707	c.14707G>A	c.(14707-14709)Gag>Aag	p.E4903K	RYR1_ENST00000355481.4_Missense_Mutation_p.E4898K|RYR1_ENST00000360985.3_Missense_Mutation_p.E4898K			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	4903					calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)	p.E4903K(1)		NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	GGACGAGATCGAGGACCCCGC	0.562																																					p.E4898K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G14692A	19						.	G	LYS/GLU,LYS/GLU	0,4406		0,0,2203	239.0	187.0	204.0		14707,14692	5.1	1.0	19		204	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	RYR1	NM_000540.2,NM_001042723.1	56,56	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	4903/5039,4898/5034	39075643	1,13005	2203	4300	6503	43767483	SO:0001583	missense	6261	exon101			J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.14707G>A	19.37:g.39075643G>A	ENSP00000352608:p.Glu4903Lys		43767483	NM_001042723	Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	ENST00000359596.3	37	CCDS33011.1	.	.	.	.	.	.	.	.	.	.	G	19.38	3.815596	0.70912	0.0	1.16E-4	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	D;D;D	0.92299	-3.01;-3.01;-3.01	5.08	5.08	0.68730	Ion transport (1);	0.000000	0.64402	U	0.000002	D	0.95680	0.8595	M	0.71581	2.175	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.81914	0.992;0.995	D	0.95774	0.8811	10	0.66056	D	0.02	.	18.3248	0.90250	0.0:0.0:1.0:0.0	.	4898;4903	P21817-2;P21817	.;RYR1_HUMAN	K	4903;4898;4898	ENSP00000352608:E4903K;ENSP00000347667:E4898K;ENSP00000354254:E4898K	ENSP00000347667:E4898K	E	+	1	0	RYR1	43767483	1.000000	0.71417	0.991000	0.47740	0.927000	0.56198	9.656000	0.98514	2.658000	0.90341	0.449000	0.29647	GAG		0.562	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1		
SARS2	54938	hgsc.bcm.edu	37	19	39416935	39416935	+	Silent	SNP	C	C	G	rs144229840	byFrequency	TCGA-AF-2691-01A-01W-0831-10	TCGA-AF-2691-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	0a041965-3054-4091-9dae-8b6b40cc7a03	0dc37a16-724e-44fe-a593-b1efde8ccf36	g.chr19:39416935C>G	ENST00000221431.6	-	2	432	c.273G>C	c.(271-273)tcG>tcC	p.S91S	SARS2_ENST00000594171.1_5'UTR|SARS2_ENST00000448145.2_Silent_p.S91S|CTC-360G5.8_ENST00000599996.1_Missense_Mutation_p.D161H|SARS2_ENST00000430193.3_Silent_p.S91S|SARS2_ENST00000600042.1_Silent_p.S91S	NM_017827.3	NP_060297.1	Q9NP81	SYSM_HUMAN	seryl-tRNA synthetase 2, mitochondrial	91					gene expression (GO:0010467)|selenocysteinyl-tRNA(Sec) biosynthetic process (GO:0097056)|seryl-tRNA aminoacylation (GO:0006434)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|serine-tRNA ligase activity (GO:0004828)	p.S91S(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	15	all_cancers(60;2.74e-06)|all_epithelial(25;4.36e-06)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			CCTGCCATGTCGAGATCTGGG	0.612																																					p.S91S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G273C	19						.						50.0	42.0	45.0					19																	39416935		2203	4300	6503	44108775	SO:0001819	synonymous_variant	54938	exon2			AB029948	CCDS33017.1, CCDS54265.1	19q13.2	2014-05-06	2007-02-23			ENSG00000104835	6.1.1.11	"""Aminoacyl tRNA synthetases / Class II"""	17697	protein-coding gene	gene with protein product	"""serine tRNA ligase 2, mitochondrial"""	612804	"""serine-tRNA ligase, mitochondrial"", ""seryl-tRNA synthetase 2"""	SARSM		10764807	Standard	NM_001145901		Approved	FLJ20450, mtSerRS, SerRSmt, SARS, SERS, SYS	uc010xup.1	Q9NP81	OTTHUMG00000182691	ENST00000221431.6:c.273G>C	19.37:g.39416935C>G			44108775	NM_001145901	A6NHW7|B4DE10|Q9BVP3	Silent	SNP	ENST00000221431.6	37	CCDS33017.1																																																																																				0.612	SARS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000463139.1	NM_017827	
TSKS	60385	hgsc.bcm.edu	37	19	50243068	50243068	+	Missense_Mutation	SNP	G	G	T			TCGA-AF-2691-01A-01W-0831-10	TCGA-AF-2691-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	0a041965-3054-4091-9dae-8b6b40cc7a03	0dc37a16-724e-44fe-a593-b1efde8ccf36	g.chr19:50243068G>T	ENST00000246801.3	-	11	1826	c.1744C>A	c.(1744-1746)Ccc>Acc	p.P582T	TSKS_ENST00000358830.3_Missense_Mutation_p.P382T	NM_021733.1	NP_068379.1	Q9UJT2	TSKS_HUMAN	testis-specific serine kinase substrate	582					negative regulation of phosphatase activity (GO:0010923)	centriole (GO:0005814)	protein kinase binding (GO:0019901)	p.P582T(1)		breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(12)|liver(1)|lung(9)|prostate(3)|skin(3)	38		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00153)|GBM - Glioblastoma multiforme(134;0.0145)		TGTTTTGGGGGGGTTCCTGCA	0.542																																					p.P582T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1744A	19						.						99.0	99.0	99.0					19																	50243068		2203	4300	6503	54934880	SO:0001583	missense	60385	exon11			BC058862	CCDS12780.1	19q13.3	2014-06-13							30719	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 161"""	608253				11444856, 18495105	Standard	NM_021733		Approved	TSSKS, PPP1R161	uc002ppm.3	Q9UJT2		ENST00000246801.3:c.1744C>A	19.37:g.50243068G>T	ENSP00000246801:p.Pro582Thr		54934880	NM_021733	Q8WXJ0	Missense_Mutation	SNP	ENST00000246801.3	37	CCDS12780.1	.	.	.	.	.	.	.	.	.	.	G	10.69	1.421361	0.25639	.	.	ENSG00000126467	ENST00000246801;ENST00000358830	T;T	0.33654	1.4;1.4	5.29	5.29	0.74685	.	0.145674	0.31963	N	0.006784	T	0.45074	0.1324	N	0.24115	0.695	0.35190	D	0.773322	D	0.71674	0.998	D	0.68943	0.961	T	0.57900	-0.7731	10	0.66056	D	0.02	-15.0189	14.4234	0.67200	0.0:0.0:1.0:0.0	.	582	Q9UJT2	TSKS_HUMAN	T	582;382	ENSP00000246801:P582T;ENSP00000351691:P382T	ENSP00000246801:P582T	P	-	1	0	TSKS	54934880	0.995000	0.38212	0.964000	0.40570	0.014000	0.08584	2.845000	0.48254	2.471000	0.83476	0.609000	0.83330	CCC		0.542	TSKS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465795.1	NM_021733	
ZNF175	7728	hgsc.bcm.edu	37	19	52090211	52090211	+	Silent	SNP	A	A	T			TCGA-AF-2691-01A-01W-0831-10	TCGA-AF-2691-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	0a041965-3054-4091-9dae-8b6b40cc7a03	0dc37a16-724e-44fe-a593-b1efde8ccf36	g.chr19:52090211A>T	ENST00000262259.2	+	5	985	c.627A>T	c.(625-627)ctA>ctT	p.L209L	ZNF175_ENST00000436511.2_Intron	NM_007147.2	NP_009078.1	Q9Y473	ZN175_HUMAN	zinc finger protein 175	209					defense response to virus (GO:0051607)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.L209L(1)		NS(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	24		all_neural(266;0.0299)		GBM - Glioblastoma multiforme(134;0.000426)|OV - Ovarian serous cystadenocarcinoma(262;0.0257)		AGCTGAACCTAGAAGTGAACG	0.463																																					p.L209L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A627T	19						.						83.0	78.0	80.0					19																	52090211		2203	4299	6502	56782023	SO:0001819	synonymous_variant	7728	exon5			D50419	CCDS12837.1	19q13.4	2013-01-08			ENSG00000105497	ENSG00000105497		"""Zinc fingers, C2H2-type"", ""-"""	12964	protein-coding gene	gene with protein product		601139				8838321	Standard	NM_007147		Approved	OTK18	uc002pxb.3	Q9Y473	OTTHUMG00000167771	ENST00000262259.2:c.627A>T	19.37:g.52090211A>T			56782023	NM_007147	A8K9H2	Silent	SNP	ENST00000262259.2	37	CCDS12837.1																																																																																				0.463	ZNF175-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396205.1	NM_007147	
NRAS	4893	hgsc.bcm.edu	37	1	115258748	115258748	+	Missense_Mutation	SNP	C	C	A	rs121913250		TCGA-AF-2691-01A-01W-0831-10	TCGA-AF-2691-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	0a041965-3054-4091-9dae-8b6b40cc7a03	0dc37a16-724e-44fe-a593-b1efde8ccf36	g.chr1:115258748C>A	ENST00000369535.4	-	2	287	c.34G>T	c.(34-36)Ggt>Tgt	p.G12C	CSDE1_ENST00000483407.1_5'Flank	NM_002524.4	NP_002515.1	P01111	RASN_HUMAN	neuroblastoma RAS viral (v-ras) oncogene homolog	12			G -> C (in leukemia). {ECO:0000269|PubMed:2998510}.|G -> D (in KNEN). {ECO:0000269|PubMed:22499344}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of skeletal muscle tissue development (GO:0048642)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|small GTPase mediated signal transduction (GO:0007264)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12S(133)|p.G12C(81)|p.G12R(18)|p.G12N(2)|p.G12P(1)|p.G12Y(1)		NS(134)|adrenal_gland(9)|autonomic_ganglia(9)|biliary_tract(6)|bone(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(11)|eye(3)|haematopoietic_and_lymphoid_tissue(1115)|kidney(3)|large_intestine(105)|liver(10)|lung(42)|meninges(2)|ovary(7)|pancreas(5)|prostate(8)|skin(1144)|soft_tissue(37)|stomach(5)|testis(8)|thyroid(359)|upper_aerodigestive_tract(28)|urinary_tract(13)	3085	all_epithelial(7;5.11e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		CCAACACCACCTGCTCCAACC	0.493	G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(MOLT4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(P31FUJ_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12S(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)	50	Mis		"""melanoma, MM, AML, thyroid"""				Noonan syndrome	TSP Lung(23;0.16)|Multiple Myeloma(1;<1E-6)																											p.G12C			Dom	yes		1	1p13.2	4893	neuroblastoma RAS viral (v-ras) oncogene homolog		"""L, E"""	NRAS,haematopoietic_and_lymphoid_tissue,NS,Substitution - Missense,+1 	.	236	Substitution - Missense(236)	haematopoietic_and_lymphoid_tissue(149)|skin(29)|upper_aerodigestive_tract(21)|large_intestine(13)|thyroid(8)|prostate(6)|lung(4)|soft_tissue(2)|urinary_tract(1)|NS(1)|kidney(1)|pancreas(1)	c.G34T	1						.						203.0	181.0	189.0					1																	115258748		2203	4300	6503	115060271	SO:0001583	missense	4893	exon2	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	BC005219	CCDS877.1	1p13.2	2014-09-17			ENSG00000213281	ENSG00000213281			7989	protein-coding gene	gene with protein product		164790					Standard	NM_002524		Approved	N-ras	uc009wgu.3	P01111	OTTHUMG00000012059	ENST00000369535.4:c.34G>T	1.37:g.115258748C>A	ENSP00000358548:p.Gly12Cys		115060271	NM_002524	Q14971|Q15104|Q15282	Missense_Mutation	SNP	ENST00000369535.4	37	CCDS877.1	.	.	.	.	.	.	.	.	.	.	C	33	5.208516	0.95069	.	.	ENSG00000213281	ENST00000369535	T	0.79141	-1.24	5.58	5.58	0.84498	Small GTP-binding protein domain (1);	0.000000	0.56097	U	0.000025	D	0.85826	0.5787	M	0.89904	3.07	0.80722	D	1	P	0.39480	0.675	P	0.49276	0.605	D	0.87171	0.2221	10	0.72032	D	0.01	.	19.3769	0.94514	0.0:1.0:0.0:0.0	.	12	P01111	RASN_HUMAN	C	12	ENSP00000358548:G12C	ENSP00000358548:G12C	G	-	1	0	NRAS	115060271	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.651000	0.83577	2.906000	0.99361	0.655000	0.94253	GGT		0.493	NRAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033395.2	NM_002524	
OR10X1	128367	hgsc.bcm.edu	37	1	158548822	158548822	+	Missense_Mutation	SNP	G	G	T			TCGA-AF-2691-01A-01W-0831-10	TCGA-AF-2691-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	0a041965-3054-4091-9dae-8b6b40cc7a03	0dc37a16-724e-44fe-a593-b1efde8ccf36	g.chr1:158548822G>T	ENST00000368150.1	-	1	867	c.868C>A	c.(868-870)Cct>Act	p.P290T		NM_001004477.1	NP_001004477.1	Q8NGY0	O10X1_HUMAN	olfactory receptor, family 10, subfamily X, member 1 (gene/pseudogene)	290						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.P290T(1)		breast(1)|cervix(1)|endometrium(2)|large_intestine(6)|lung(22)|ovary(2)|skin(2)|urinary_tract(1)	37	all_hematologic(112;0.0378)					ACAGTATAAGGGACTGCTATG	0.443																																					p.P290T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C868A	1						.						108.0	112.0	111.0					1																	158548822		2203	4300	6503	156815446	SO:0001583	missense	128367	exon1			BK004194	CCDS30900.1	1q23.1	2013-10-10	2013-10-10	2004-03-10	ENSG00000186400	ENSG00000186400		"""GPCR / Class A : Olfactory receptors"""	14995	protein-coding gene	gene with protein product			"""olfactory receptor, family 10, subfamily X, member 1"""	OR10X1P			Standard	NM_001004477		Approved		uc010pin.2	Q8NGY0	OTTHUMG00000019635	ENST00000368150.1:c.868C>A	1.37:g.158548822G>T	ENSP00000357132:p.Pro290Thr		156815446	NM_001004477	Q6IFR8	Missense_Mutation	SNP	ENST00000368150.1	37	CCDS30900.1	.	.	.	.	.	.	.	.	.	.	G	1.803	-0.476599	0.04414	.	.	ENSG00000186400	ENST00000368150	T	0.00051	8.81	4.5	3.51	0.40186	.	0.000000	0.48286	D	0.000184	T	0.00039	0.0001	N	0.00392	-1.555	0.09310	N	1	D	0.89917	1.0	D	0.97110	1.0	T	0.56129	-0.8030	10	0.02654	T	1	.	7.2998	0.26413	0.0934:0.0:0.7359:0.1707	.	290	Q8NGY0	O10X1_HUMAN	T	290	ENSP00000357132:P290T	ENSP00000357132:P290T	P	-	1	0	OR10X1	156815446	0.000000	0.05858	0.641000	0.29422	0.995000	0.86356	0.061000	0.14366	2.473000	0.83533	0.563000	0.77884	CCT		0.443	OR10X1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051850.2	NM_001004477	
CCDC181	57821	hgsc.bcm.edu	37	1	169364428	169364428	+	Missense_Mutation	SNP	G	G	A	rs370391570		TCGA-AF-2691-01A-01W-0831-10	TCGA-AF-2691-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	0a041965-3054-4091-9dae-8b6b40cc7a03	0dc37a16-724e-44fe-a593-b1efde8ccf36	g.chr1:169364428G>A	ENST00000367806.3	-	6	1539	c.1387C>T	c.(1387-1389)Cgg>Tgg	p.R463W	CCDC181_ENST00000367805.3_Missense_Mutation_p.R462W|BLZF1_ENST00000329281.2_Intron|CCDC181_ENST00000545005.1_Missense_Mutation_p.R462W	NM_021179.1	NP_067002.1	Q5TID7	CC181_HUMAN	coiled-coil domain containing 181	463						nucleus (GO:0005634)		p.R462W(1)									TTTTCCATCCGTTTCCTTCTT	0.388																																					p.R462W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1384T	1						.	G	TRP/ARG,	0,4406		0,0,2203	127.0	121.0	123.0		1384,	5.2	1.0	1		123	1,8599	1.2+/-3.3	0,1,4299	no	missense,intron	BLZF1,C1orf114	NM_021179.1,NM_003666.2	101,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,	462/509,	169364428	1,13005	2203	4300	6503	167631052	SO:0001583	missense	57821	exon6			AL049687	CCDS1279.1, CCDS72979.1	1q24	2013-03-14	2013-03-14	2013-03-14	ENSG00000117477	ENSG00000117477			28051	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 114"""	C1orf114			Standard	XM_005245381		Approved	FLJ25846	uc001gfz.1	Q5TID7	OTTHUMG00000035448	ENST00000367806.3:c.1387C>T	1.37:g.169364428G>A	ENSP00000356780:p.Arg463Trp		167631052	NM_021179	O60780|Q53FD5|Q5TID9|Q8TC48	Missense_Mutation	SNP	ENST00000367806.3	37		.	.	.	.	.	.	.	.	.	.	G	18.43	3.622097	0.66787	0.0	1.16E-4	ENSG00000117477	ENST00000367805;ENST00000367806;ENST00000545005	T;T;T	0.26810	1.71;1.71;1.71	6.07	5.16	0.70880	.	0.234953	0.43110	D	0.000601	T	0.34774	0.0909	M	0.61703	1.905	0.39929	D	0.974262	D;D	0.89917	1.0;1.0	D;D	0.63703	0.917;0.917	T	0.38222	-0.9671	9	0.87932	D	0	-2.1492	13.6219	0.62143	0.0:0.0:0.5805:0.4195	.	463;462	Q5TID7;Q5TID7-3	CA114_HUMAN;.	W	462;463;462	ENSP00000356779:R462W;ENSP00000356780:R463W;ENSP00000442297:R462W	ENSP00000356779:R462W	R	-	1	2	C1orf114	167631052	1.000000	0.71417	0.966000	0.40874	0.737000	0.42083	3.041000	0.49807	1.553000	0.49476	0.655000	0.94253	CGG		0.388	CCDC181-002	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000086099.1	NM_021179	
PIK3C2B	5287	hgsc.bcm.edu	37	1	204401488	204401488	+	Missense_Mutation	SNP	T	T	C			TCGA-AF-2691-01A-01W-0831-10	TCGA-AF-2691-10A-01W-0831-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	0a041965-3054-4091-9dae-8b6b40cc7a03	0dc37a16-724e-44fe-a593-b1efde8ccf36	g.chr1:204401488T>C	ENST00000367187.3	-	28	4551	c.3995A>G	c.(3994-3996)aAt>aGt	p.N1332S	RP11-739N20.2_ENST00000443515.1_RNA|PIK3C2B_ENST00000424712.2_Missense_Mutation_p.N1304S	NM_002646.3	NP_002637.3	O00750	P3C2B_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 beta	1332	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|protein kinase B signaling (GO:0043491)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|lipid kinase activity (GO:0001727)|phosphatidylinositol binding (GO:0035091)	p.N1332S(1)		breast(3)|central_nervous_system(1)|cervix(2)|endometrium(4)|large_intestine(11)|lung(24)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	52	all_cancers(21;0.00347)|all_neural(3;0.0218)|Glioma(3;0.0382)|all_epithelial(62;0.171)|Breast(84;0.179)|Prostate(682;0.227)		GBM - Glioblastoma multiforme(2;2.69e-45)|all cancers(3;1.66e-30)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)|Epithelial(59;0.193)			GATGAAAAAATTGAGCTTTGT	0.507																																					p.N1332S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A3995G	1						.						75.0	67.0	70.0					1																	204401488		2203	4300	6503	202668111	SO:0001583	missense	5287	exon28			Y11312	CCDS1446.1	1q32	2012-07-13	2012-07-13		ENSG00000133056	ENSG00000133056	2.7.1.154		8972	protein-coding gene	gene with protein product		602838	"""phosphoinositide-3-kinase, class 2, beta polypeptide"""			9144573, 9830063	Standard	NM_002646		Approved	C2-PI3K, PI3K-C2beta	uc001haw.3	O00750	OTTHUMG00000036101	ENST00000367187.3:c.3995A>G	1.37:g.204401488T>C	ENSP00000356155:p.Asn1332Ser		202668111	NM_002646	O95666|Q5SW99	Missense_Mutation	SNP	ENST00000367187.3	37	CCDS1446.1	.	.	.	.	.	.	.	.	.	.	T	25.0	4.593717	0.86953	.	.	ENSG00000133056	ENST00000367187;ENST00000424712	T;T	0.81330	-1.48;-1.48	6.08	4.96	0.65561	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (2);	0.257228	0.42053	D	0.000777	D	0.89757	0.6807	M	0.86028	2.79	0.47341	D	0.999397	D;B	0.89917	1.0;0.208	D;B	0.85130	0.997;0.03	D	0.90477	0.4457	10	0.87932	D	0	.	11.6762	0.51432	0.0:0.0691:0.0:0.9309	.	1304;1332	F5GWN5;O00750	.;P3C2B_HUMAN	S	1332;1304	ENSP00000356155:N1332S;ENSP00000400561:N1304S	ENSP00000356155:N1332S	N	-	2	0	PIK3C2B	202668111	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	8.040000	0.89188	1.134000	0.42165	0.533000	0.62120	AAT		0.507	PIK3C2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087965.1	NM_002646	
SLC26A9	115019	hgsc.bcm.edu	37	1	205899064	205899064	+	Missense_Mutation	SNP	C	C	T			TCGA-AF-2691-01A-01W-0831-10	TCGA-AF-2691-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	0a041965-3054-4091-9dae-8b6b40cc7a03	0dc37a16-724e-44fe-a593-b1efde8ccf36	g.chr1:205899064C>T	ENST00000367135.3	-	6	786	c.673G>A	c.(673-675)Gga>Aga	p.G225R	SLC26A9_ENST00000367134.2_Missense_Mutation_p.G225R|SLC26A9_ENST00000340781.4_Missense_Mutation_p.G225R	NM_052934.3	NP_443166.1	Q7LBE3	S26A9_HUMAN	solute carrier family 26 (anion exchanger), member 9	225					anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|positive regulation of gene expression (GO:0010628)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	anion:anion antiporter activity (GO:0015301)|ATPase binding (GO:0051117)|bicarbonate transmembrane transporter activity (GO:0015106)|chloride channel activity (GO:0005254)|secondary active sulfate transmembrane transporter activity (GO:0008271)	p.G225R(1)		NS(1)|breast(3)|endometrium(11)|kidney(1)|large_intestine(6)|lung(17)|ovary(1)|skin(7)|urinary_tract(5)	52	Breast(84;0.201)		BRCA - Breast invasive adenocarcinoma(75;0.0458)			ATGGTCAGTCCGAAGATGTAC	0.587																																					p.G225R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G673A	1						.						81.0	71.0	74.0					1																	205899064		2203	4300	6503	204165687	SO:0001583	missense	115019	exon6			AF331525	CCDS30989.1, CCDS30990.1	1q32.1	2013-07-18	2013-07-18		ENSG00000174502	ENSG00000174502		"""Solute carriers"""	14469	protein-coding gene	gene with protein product	"""anion transporter/exchanger-9"""	608481	"""solute carrier family 26, member 9"""			11834742	Standard	NM_134325		Approved		uc001hdp.3	Q7LBE3	OTTHUMG00000036001	ENST00000367135.3:c.673G>A	1.37:g.205899064C>T	ENSP00000356103:p.Gly225Arg		204165687	NM_134325	A7E2V6|B1AVM8|B1AVM9|B7ZKK2|Q96PK9|Q96RN0	Missense_Mutation	SNP	ENST00000367135.3	37	CCDS30990.1	.	.	.	.	.	.	.	.	.	.	C	24.3	4.514953	0.85389	.	.	ENSG00000174502	ENST00000340781;ENST00000367135;ENST00000367134	D;D;D	0.94758	-3.51;-3.51;-3.51	5.6	5.6	0.85130	Sulphate transporter (1);	0.000000	0.85682	D	0.000000	D	0.97945	0.9324	M	0.91354	3.2	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98609	1.0662	10	0.87932	D	0	.	19.1973	0.93695	0.0:1.0:0.0:0.0	.	225;225	Q7LBE3;B1AVM8	S26A9_HUMAN;.	R	225	ENSP00000341682:G225R;ENSP00000356103:G225R;ENSP00000356102:G225R	ENSP00000341682:G225R	G	-	1	0	SLC26A9	204165687	1.000000	0.71417	0.920000	0.36463	0.437000	0.31866	5.957000	0.70323	2.653000	0.90120	0.561000	0.74099	GGA		0.587	SLC26A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087742.1	NM_052934	
CD55	1604	hgsc.bcm.edu	37	1	207504512	207504512	+	Missense_Mutation	SNP	C	C	T			TCGA-AF-2691-01A-01W-0831-10	TCGA-AF-2691-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	0a041965-3054-4091-9dae-8b6b40cc7a03	0dc37a16-724e-44fe-a593-b1efde8ccf36	g.chr1:207504512C>T	ENST00000367064.3	+	6	982	c.724C>T	c.(724-726)Cat>Tat	p.H242Y	CD55_ENST00000391920.4_Missense_Mutation_p.H242Y|CD55_ENST00000391921.4_Missense_Mutation_p.H178Y|CD55_ENST00000314754.8_Missense_Mutation_p.H242Y|CD55_ENST00000367062.4_Missense_Mutation_p.H242Y|CD55_ENST00000367065.5_Missense_Mutation_p.H242Y|CD55_ENST00000465534.1_3'UTR|CD55_ENST00000367063.2_Missense_Mutation_p.H242Y|CD55_ENST00000367067.4_3'UTR	NM_000574.3	NP_000565.1	P08174	DAF_HUMAN	CD55 molecule, decay accelerating factor for complement (Cromer blood group)	242	Sushi 4. {ECO:0000255|PROSITE- ProRule:PRU00302}.				CD4-positive, alpha-beta T cell cytokine production (GO:0035743)|complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)|maternal process involved in parturition (GO:0060137)|negative regulation of complement activation (GO:0045916)|positive regulation of CD4-positive, alpha-beta T cell activation (GO:2000516)|positive regulation of CD4-positive, alpha-beta T cell proliferation (GO:2000563)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of complement activation (GO:0030449)|regulation of lipopolysaccharide-mediated signaling pathway (GO:0031664)|respiratory burst (GO:0045730)|response to peptide hormone (GO:0043434)|response to virus (GO:0009615)|spermatogenesis (GO:0007283)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	enzyme inhibitor activity (GO:0004857)|lipid binding (GO:0008289)|virus receptor activity (GO:0001618)	p.H242Y(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	16					Chloramphenicol(DB00446)	GGAACGTGACCATTATGGATA	0.323																																					p.H242Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C724T	1						.						161.0	147.0	152.0					1																	207504512		2203	4300	6503	205571135	SO:0001583	missense	1604	exon6			BC001288	CCDS31006.1, CCDS44307.1, CCDS73022.1	1q32	2014-09-17	2006-03-28	2006-02-23	ENSG00000196352	ENSG00000196352		"""CD molecules"", ""Blood group antigens"""	2665	protein-coding gene	gene with protein product		125240	"""decay accelerating factor for complement (CD55, Cromer blood group system)"""	DAF			Standard	XM_005273077		Approved	CR, TC, CROM	uc001hfr.4	P08174	OTTHUMG00000036255	ENST00000367064.3:c.724C>T	1.37:g.207504512C>T	ENSP00000356031:p.His242Tyr		205571135	NM_000574	B1AP14|D3DT83|D3DT84|E7ER69|P09679|P78361|Q14UF2|Q14UF3|Q14UF4|Q14UF5|Q14UF6	Missense_Mutation	SNP	ENST00000367064.3	37	CCDS31006.1	.	.	.	.	.	.	.	.	.	.	C	2.464	-0.323525	0.05350	.	.	ENSG00000196352	ENST00000367064;ENST00000367063;ENST00000391921;ENST00000536840;ENST00000314754;ENST00000367065;ENST00000391920;ENST00000367062	T;T;T;T;T;T;T	0.63417	-0.04;-0.04;-0.04;-0.04;-0.04;-0.04;-0.04	5.13	-7.5	0.01351	Complement control module (2);Sushi/SCR/CCP (3);	2.529520	0.01294	N	0.010122	T	0.40015	0.1100	N	0.12502	0.225	0.09310	N	0.999998	P;P;P;D;P	0.56035	0.873;0.953;0.484;0.974;0.795	B;B;B;P;P	0.47102	0.335;0.44;0.258;0.537;0.47	T	0.50346	-0.8839	10	0.33940	T	0.23	.	0.2036	0.00148	0.2226:0.2084:0.235:0.3341	.	178;242;242;242;242	B1AP15;Q14UF4;P08174-2;P08174;B1AP13	.;.;.;DAF_HUMAN;.	Y	242;242;178;178;242;242;242;242	ENSP00000356031:H242Y;ENSP00000356030:H242Y;ENSP00000375788:H178Y;ENSP00000316333:H242Y;ENSP00000356032:H242Y;ENSP00000375787:H242Y;ENSP00000356029:H242Y	ENSP00000316333:H242Y	H	+	1	0	CD55	205571135	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.496000	0.06436	-1.429000	0.01987	-0.979000	0.02580	CAT		0.323	CD55-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000088208.2	NM_000574	
CSMD2	114784	hgsc.bcm.edu	37	1	33992805	33992805	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AF-2691-01A-01W-0831-10	TCGA-AF-2691-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	0a041965-3054-4091-9dae-8b6b40cc7a03	0dc37a16-724e-44fe-a593-b1efde8ccf36	g.chr1:33992805G>A	ENST00000373381.4	-	65	10401	c.10225C>T	c.(10225-10227)Caa>Taa	p.Q3409*		NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	3265						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.Q3265*(1)		NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				CTCAAGGCTTGGGTGAGCGGT	0.517																																					p.Q3265X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C9793T	1						.						100.0	94.0	96.0					1																	33992805		2203	4300	6503	33765392	SO:0001587	stop_gained	114784	exon64			AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373381.4:c.10225C>T	1.37:g.33992805G>A	ENSP00000362479:p.Gln3409*		33765392	NM_052896	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Nonsense_Mutation	SNP	ENST00000373381.4	37		.	.	.	.	.	.	.	.	.	.	G	51	18.017117	0.99897	.	.	ENSG00000121904	ENST00000373381	.	.	.	5.41	4.43	0.53597	.	0.353980	0.27831	N	0.017669	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.13470	T	0.59	.	9.9737	0.41770	0.0:0.0:0.7073:0.2927	.	.	.	.	X	3409	.	ENSP00000241312:Q3265X	Q	-	1	0	CSMD2	33765392	0.998000	0.40836	0.915000	0.36163	0.145000	0.21501	3.056000	0.49923	2.562000	0.86427	0.655000	0.94253	CAA		0.517	CSMD2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_052896	
LRRC7	57554	hgsc.bcm.edu	37	1	70504566	70504566	+	Missense_Mutation	SNP	A	A	T			TCGA-AF-2691-01A-01W-0831-10	TCGA-AF-2691-10A-01W-0831-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	0a041965-3054-4091-9dae-8b6b40cc7a03	0dc37a16-724e-44fe-a593-b1efde8ccf36	g.chr1:70504566A>T	ENST00000035383.5	+	19	2975	c.2945A>T	c.(2944-2946)gAt>gTt	p.D982V	LRRC7_ENST00000310961.5_Missense_Mutation_p.D987V|LRRC7_ENST00000415775.2_Missense_Mutation_p.D266V	NM_020794.2	NP_065845.1	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	982						cell junction (GO:0030054)|cytoplasm (GO:0005737)|postsynaptic membrane (GO:0045211)		p.D982V(1)		breast(11)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(3)|lung(81)|ovary(9)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	162						GAACGACCGGATAAGATGCTG	0.458																																					p.D982V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2945T	1						.						70.0	62.0	64.0					1																	70504566		2203	4300	6503	70277154	SO:0001583	missense	57554	exon19				CCDS645.1	1p31.1	2008-02-05			ENSG00000033122	ENSG00000033122			18531	protein-coding gene	gene with protein product		614453				12525888	Standard	NM_020794		Approved	KIAA1365, densin-180	uc001dep.3	Q96NW7	OTTHUMG00000059194	ENST00000035383.5:c.2945A>T	1.37:g.70504566A>T	ENSP00000035383:p.Asp982Val		70277154	NM_020794	Q5VXC2|Q5VXC3|Q68D07|Q86VE8|Q8WX20|Q9P2I2	Missense_Mutation	SNP	ENST00000035383.5	37	CCDS645.1	.	.	.	.	.	.	.	.	.	.	A	10.40	1.339864	0.24339	.	.	ENSG00000033122	ENST00000310961;ENST00000035383;ENST00000415775;ENST00000370957	T;T;T	0.38401	1.14;1.23;2.31	5.69	5.69	0.88448	.	0.165122	0.51477	D	0.000089	T	0.42653	0.1212	L	0.50333	1.59	0.80722	D	1	D;D;D	0.76494	0.991;0.999;0.998	P;D;P	0.68192	0.798;0.956;0.905	T	0.21895	-1.0232	10	0.33940	T	0.23	.	15.1202	0.72438	1.0:0.0:0.0:0.0	.	266;982;982	F8WE45;Q96NW7-2;Q96NW7	.;.;LRRC7_HUMAN	V	987;982;266;805	ENSP00000309245:D987V;ENSP00000035383:D982V;ENSP00000394867:D266V	ENSP00000035383:D982V	D	+	2	0	LRRC7	70277154	1.000000	0.71417	0.086000	0.20670	0.069000	0.16628	8.664000	0.91139	2.174000	0.68829	0.460000	0.39030	GAT		0.458	LRRC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131261.1	NM_020794	
SLC44A5	204962	hgsc.bcm.edu	37	1	75708640	75708640	+	Missense_Mutation	SNP	C	C	A			TCGA-AF-2691-01A-01W-0831-10	TCGA-AF-2691-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	0a041965-3054-4091-9dae-8b6b40cc7a03	0dc37a16-724e-44fe-a593-b1efde8ccf36	g.chr1:75708640C>A	ENST00000370855.5	-	8	515	c.402G>T	c.(400-402)ttG>ttT	p.L134F	SLC44A5_ENST00000370859.3_Missense_Mutation_p.L134F|SLC44A5_ENST00000469525.1_5'UTR|SLC44A5_ENST00000535611.1_Missense_Mutation_p.L4F	NM_152697.4	NP_689910.2	Q8NCS7	CTL5_HUMAN	solute carrier family 44, member 5	134					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.L134F(1)		kidney(1)|large_intestine(13)|lung(35)|ovary(2)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	61						CTTTTGTGTACAAAAGTTGCA	0.398																																					p.L134F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G402T	1						.						137.0	138.0	138.0					1																	75708640		2203	4300	6503	75481228	SO:0001583	missense	204962	exon8			BC034580	CCDS667.1, CCDS44164.1	1p31.1	2013-05-22			ENSG00000137968	ENSG00000137968		"""Solute carriers"""	28524	protein-coding gene	gene with protein product						15715662	Standard	NM_152697		Approved	MGC34032, CTL5	uc001dgu.3	Q8NCS7	OTTHUMG00000009721	ENST00000370855.5:c.402G>T	1.37:g.75708640C>A	ENSP00000359892:p.Leu134Phe		75481228	NM_152697	B5MCU3|Q4G0K0|Q8NA44|Q8NB86	Missense_Mutation	SNP	ENST00000370855.5	37	CCDS667.1	.	.	.	.	.	.	.	.	.	.	C	9.837	1.190055	0.21954	.	.	ENSG00000137968	ENST00000370859;ENST00000536707;ENST00000370855;ENST00000535611;ENST00000535790	T;T;T	0.28255	1.62;1.62;2.48	5.07	-2.77	0.05877	.	2.259400	0.01762	N	0.030633	T	0.08358	0.0208	L	0.50333	1.59	0.09310	N	1	B;B;B;B;B	0.17852	0.011;0.024;0.011;0.02;0.02	B;B;B;B;B	0.18263	0.014;0.009;0.009;0.021;0.021	T	0.11227	-1.0596	10	0.10111	T	0.7	7.2797	6.1512	0.20313	0.0:0.3033:0.247:0.4497	.	128;173;134;134;173	B7Z5Y4;B7Z470;Q8NCS7;Q8NCS7-2;F5GYS0	.;.;CTL5_HUMAN;.;.	F	134;173;134;4;127	ENSP00000359896:L134F;ENSP00000359892:L134F;ENSP00000443090:L4F	ENSP00000359892:L134F	L	-	3	2	SLC44A5	75481228	0.000000	0.05858	0.000000	0.03702	0.724000	0.41520	-0.865000	0.04250	-0.468000	0.06922	-0.137000	0.14449	TTG		0.398	SLC44A5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000026921.1	NM_152697	
KIAA1804	84451	hgsc.bcm.edu	37	1	233518135	233518135	+	Missense_Mutation	SNP	A	A	T			TCGA-AF-2691-01A-01W-0831-10	TCGA-AF-2691-10A-01W-0831-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	0a041965-3054-4091-9dae-8b6b40cc7a03	0dc37a16-724e-44fe-a593-b1efde8ccf36	g.chr1:233518135A>T	ENST00000366624.3	+	10	3050	c.2789A>T	c.(2788-2790)gAg>gTg	p.E930V	MLK4_ENST00000366622.1_Missense_Mutation_p.E376V	NM_032435.2	NP_115811.2												p.E930V(1)									CTGCCAAGGGAGGTCTCACCC	0.587																																					p.E930V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2789T	1						.						102.0	91.0	94.0					1																	233518135		2203	4300	6503	231584758	SO:0001583	missense	84451	exon10																														ENST00000366624.3:c.2789A>T	1.37:g.233518135A>T	ENSP00000355583:p.Glu930Val		231584758	NM_032435		Missense_Mutation	SNP	ENST00000366624.3	37	CCDS1598.1	.	.	.	.	.	.	.	.	.	.	A	8.760	0.923431	0.18056	.	.	ENSG00000143674	ENST00000366624;ENST00000366622	T;T	0.75050	-0.9;3.17	4.64	2.24	0.28232	.	0.715684	0.10475	U	0.670255	T	0.58836	0.2150	N	0.14661	0.345	0.09310	N	1	D;B	0.55172	0.97;0.139	P;B	0.47981	0.563;0.027	T	0.46925	-0.9156	10	0.33141	T	0.24	.	3.5314	0.07778	0.5874:0.1995:0.2131:0.0	.	377;930	Q5TCX8-3;Q5TCX8	.;M3KL4_HUMAN	V	930;376	ENSP00000355583:E930V;ENSP00000355581:E376V	ENSP00000355581:E376V	E	+	2	0	RP5-862P8.2	231584758	0.783000	0.28701	0.001000	0.08648	0.055000	0.15305	1.874000	0.39568	0.268000	0.21939	0.383000	0.25322	GAG		0.587	MLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092495.1		
RTEL1	51750	hgsc.bcm.edu	37	20	62303953	62303953	+	Silent	SNP	C	C	T			TCGA-AF-2691-01A-01W-0831-10	TCGA-AF-2691-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	0a041965-3054-4091-9dae-8b6b40cc7a03	0dc37a16-724e-44fe-a593-b1efde8ccf36	g.chr20:62303953C>T	ENST00000360203.5	+	9	1069	c.744C>T	c.(742-744)atC>atT	p.I248I	RTEL1_ENST00000318100.4_Silent_p.I248I|RTEL1_ENST00000508582.2_Silent_p.I272I|RTEL1-TNFRSF6B_ENST00000482936.1_Silent_p.I248I|RTEL1_ENST00000370018.3_Silent_p.I248I					regulator of telomere elongation helicase 1									p.I248I(1)		NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	all_cancers(38;6.47e-12)|all_epithelial(29;3.75e-13)		Epithelial(9;1.25e-09)|all cancers(9;5.13e-09)|BRCA - Breast invasive adenocarcinoma(10;7.26e-05)|OV - Ovarian serous cystadenocarcinoma(5;0.00223)|Colorectal(105;0.107)			CAGTCGTGATCTTTGACGAAG	0.557																																					p.I248I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C744T	20						.						92.0	67.0	75.0					20																	62303953		2203	4300	6503	61774397	SO:0001819	synonymous_variant	51750	exon9			AB029011	CCDS13530.2, CCDS13531.1, CCDS13530.3, CCDS63331.1, CCDS74751.1	20q13.3	2012-06-27	2004-10-29	2004-10-29	ENSG00000258366	ENSG00000258366			15888	protein-coding gene	gene with protein product		608833	"""chromosome 20 open reading frame 41"""	C20orf41		10655513, 15210109	Standard	NM_016434		Approved	bK3184A7.3, NHL, DKFZP434C013, KIAA1088, RTEL	uc011abd.2	Q9NZ71	OTTHUMG00000032992	ENST00000360203.5:c.744C>T	20.37:g.62303953C>T			61774397	NM_016434		Silent	SNP	ENST00000360203.5	37																																																																																					0.557	RTEL1-011	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000289781.1	NM_032957	
ISX	91464	hgsc.bcm.edu	37	22	35463236	35463236	+	Silent	SNP	A	A	T			TCGA-AF-2691-01A-01W-0831-10	TCGA-AF-2691-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	0a041965-3054-4091-9dae-8b6b40cc7a03	0dc37a16-724e-44fe-a593-b1efde8ccf36	g.chr22:35463236A>T	ENST00000308700.6	+	1	1108	c.156A>T	c.(154-156)ccA>ccT	p.P52P	ISX_ENST00000404699.2_Silent_p.P52P|RP1-272J12.1_ENST00000448318.4_RNA	NM_001008494.1	NP_001008494.1	Q2M1V0	ISX_HUMAN	intestine-specific homeobox	52					regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of vitamin A metabolic process (GO:1901738)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.P52P(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(12)|ovary(3)|prostate(1)|skin(4)	26						CAGAAGGGCCAGGTGAAGAGG	0.577																																					p.P52P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A156T	22						.						32.0	34.0	33.0					22																	35463236		2202	4299	6501	33793236	SO:0001819	synonymous_variant	91464	exon1			AK025181	CCDS33640.1	22q12.3	2011-06-20			ENSG00000175329	ENSG00000175329		"""Homeoboxes / PRD class"""	28084	protein-coding gene	gene with protein product		612019					Standard	NM_001008494		Approved	RAXLX	uc003anj.3	Q2M1V0	OTTHUMG00000150962	ENST00000308700.6:c.156A>T	22.37:g.35463236A>T			33793236	NM_001008494	Q68DJ5	Silent	SNP	ENST00000308700.6	37	CCDS33640.1																																																																																				0.577	ISX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320662.1	NM_001008494	
MCM5	4174	hgsc.bcm.edu	37	22	35808565	35808565	+	Missense_Mutation	SNP	C	C	A			TCGA-AF-2691-01A-01W-0831-10	TCGA-AF-2691-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	0a041965-3054-4091-9dae-8b6b40cc7a03	0dc37a16-724e-44fe-a593-b1efde8ccf36	g.chr22:35808565C>A	ENST00000216122.4	+	8	1136	c.982C>A	c.(982-984)Ctc>Atc	p.L328I	MCM5_ENST00000382011.5_Missense_Mutation_p.L285I|MCM5_ENST00000465557.1_3'UTR	NM_006739.3	NP_006730.2	P33992	MCM5_HUMAN	minichromosome maintenance complex component 5	328					DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	MCM complex (GO:0042555)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)	p.L328I(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(13)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	29						CCTGGCTGCCCTCCCAAATGT	0.612																																					p.L328I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C982A	22						.						81.0	75.0	77.0					22																	35808565		2203	4300	6503	34138565	SO:0001583	missense	4174	exon8				CCDS13915.1	22q13.1-q13.2	2007-04-04	2007-04-04		ENSG00000100297	ENSG00000100297			6948	protein-coding gene	gene with protein product		602696	"""minichromosome maintenance deficient (S. cerevisiae) 5 (cell division cycle 46)"", ""MCM5 minichromosome maintenance deficient 5, cell division cycle 46 (S. cerevisiae)"""	CDC46		8751386, 10591208	Standard	NM_006739		Approved		uc003anu.4	P33992	OTTHUMG00000150961	ENST00000216122.4:c.982C>A	22.37:g.35808565C>A	ENSP00000216122:p.Leu328Ile		34138565	NM_006739	O60785|Q14578|Q9BTJ4|Q9BWL8	Missense_Mutation	SNP	ENST00000216122.4	37	CCDS13915.1	.	.	.	.	.	.	.	.	.	.	C	9.837	1.189897	0.21954	.	.	ENSG00000100297	ENST00000216122;ENST00000382011;ENST00000444582	T;T	0.06449	3.3;3.3	5.62	4.52	0.55395	.	0.454514	0.24993	N	0.033964	T	0.07458	0.0188	L	0.39245	1.2	0.23406	N	0.997743	B;B;B;B	0.21071	0.01;0.051;0.051;0.01	B;B;B;B	0.22386	0.039;0.039;0.039;0.039	T	0.16867	-1.0388	10	0.52906	T	0.07	-28.1623	13.257	0.60085	0.2738:0.7262:0.0:0.0	.	328;328;285;328	B1AHB0;Q53FG5;B1AHB1;P33992	.;.;.;MCM5_HUMAN	I	328;285;237	ENSP00000216122:L328I;ENSP00000371441:L285I	ENSP00000216122:L328I	L	+	1	0	MCM5	34138565	0.471000	0.25862	0.959000	0.39883	0.100000	0.18952	0.946000	0.29069	2.651000	0.90000	0.561000	0.74099	CTC		0.612	MCM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320661.3		
FBLN1	2192	hgsc.bcm.edu	37	22	45929716	45929716	+	Missense_Mutation	SNP	G	G	A			TCGA-AF-2691-01A-01W-0831-10	TCGA-AF-2691-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	0a041965-3054-4091-9dae-8b6b40cc7a03	0dc37a16-724e-44fe-a593-b1efde8ccf36	g.chr22:45929716G>A	ENST00000327858.6	+	7	817	c.722G>A	c.(721-723)cGc>cAc	p.R241H	FBLN1_ENST00000348697.2_Missense_Mutation_p.R241H|FBLN1_ENST00000442170.2_Missense_Mutation_p.R241H|FBLN1_ENST00000262722.7_Missense_Mutation_p.R241H|FBLN1_ENST00000402984.3_Missense_Mutation_p.R279H|FBLN1_ENST00000340923.5_Missense_Mutation_p.R241H	NM_006486.2	NP_006477	P23142	FBLN1_HUMAN	fibulin 1	241	EGF-like 2; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				embryo implantation (GO:0007566)|extracellular matrix organization (GO:0030198)|viral process (GO:0016032)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)|peptidase activator activity (GO:0016504)	p.R241H(1)		biliary_tract(1)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|skin(1)	30		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)		GGCTCTTTCCGCTGCCAGCGG	0.587																																					p.R241H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G722A	22						.						112.0	115.0	114.0					22																	45929716		2203	4300	6503	44308380	SO:0001583	missense	2192	exon7				CCDS14067.1, CCDS14068.1, CCDS14069.1, CCDS43028.1	22q13.31	2010-06-15			ENSG00000077942	ENSG00000077942		"""Fibulins"""	3600	protein-coding gene	gene with protein product		135820				2269669, 1400330	Standard	NM_006485		Approved	FBLN	uc003bgj.1	P23142	OTTHUMG00000151340	ENST00000327858.6:c.722G>A	22.37:g.45929716G>A	ENSP00000331544:p.Arg241His		44308380	NM_006487	B0QY42|B1AHL4|P23143|P23144|P37888|Q5TIC4|Q8TBH8|Q9HBQ5|Q9UC21|Q9UGR4|Q9UH41	Missense_Mutation	SNP	ENST00000327858.6	37	CCDS14067.1	.	.	.	.	.	.	.	.	.	.	G	29.6	5.016401	0.93404	.	.	ENSG00000077942	ENST00000348697;ENST00000402984;ENST00000262722;ENST00000327858;ENST00000442170;ENST00000340923;ENST00000451475	D;D;D;D;D;D;D	0.92446	-3.04;-3.04;-3.04;-3.04;-3.04;-3.04;-3.04	5.19	5.19	0.71726	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);	0.000000	0.85682	D	0.000000	D	0.92964	0.7761	L	0.29908	0.895	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.999;0.999;0.999	D	0.90238	0.4284	10	0.15066	T	0.55	.	18.6997	0.91615	0.0:0.0:1.0:0.0	.	279;241;241;241	B1AHL2;P23142;B1AHL4;P23142-4	.;FBLN1_HUMAN;.;.	H	241;279;241;241;241;241;161	ENSP00000262723:R241H;ENSP00000385521:R279H;ENSP00000262722:R241H;ENSP00000331544:R241H;ENSP00000393812:R241H;ENSP00000342212:R241H;ENSP00000415160:R161H	ENSP00000262722:R241H	R	+	2	0	FBLN1	44308380	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	6.217000	0.72218	2.412000	0.81896	0.305000	0.20034	CGC		0.587	FBLN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000322287.1	NM_006486	
IL36G	56300	hgsc.bcm.edu	37	2	113742478	113742478	+	Missense_Mutation	SNP	G	G	A			TCGA-AF-2691-01A-01W-0831-10	TCGA-AF-2691-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	0a041965-3054-4091-9dae-8b6b40cc7a03	0dc37a16-724e-44fe-a593-b1efde8ccf36	g.chr2:113742478G>A	ENST00000259205.4	+	5	431	c.362G>A	c.(361-363)cGt>cAt	p.R121H	IL36G_ENST00000376489.2_Missense_Mutation_p.R86H	NM_019618.2	NP_062564.1	Q9NZH8	IL36G_HUMAN	interleukin 36, gamma	121					cell-cell signaling (GO:0007267)|immune response (GO:0006955)|inflammatory response (GO:0006954)|positive regulation of interleukin-6 production (GO:0032755)	extracellular space (GO:0005615)		p.R121H(2)		breast(1)|central_nervous_system(1)|large_intestine(1)|lung(8)|ovary(1)|prostate(1)|skin(1)	14						CTTTTCTACCGTGCCAAGACT	0.512																																					p.R121H												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.G362A	2						.						145.0	130.0	135.0					2																	113742478		2203	4300	6503	113458949	SO:0001583	missense	56300	exon5			AF200492	CCDS2108.1, CCDS62992.1	2q12-q21	2011-07-14	2011-06-06	2011-06-06	ENSG00000136688	ENSG00000136688		"""Interleukins and interleukin receptors"""	15741	protein-coding gene	gene with protein product	"""interleukin-1 homolog 1"", ""interleukin 1-related protein 2"", ""interleukin-1 epsilon"""	605542	"""interleukin 1 family, member 9"""	IL1F9		10860666, 10744718, 11991722, 11991723	Standard	NM_019618		Approved	IL-1H1, IL-1RP2, IL-1F9, IL1H1, IL1E	uc002tio.1	Q9NZH8	OTTHUMG00000131336	ENST00000259205.4:c.362G>A	2.37:g.113742478G>A	ENSP00000259205:p.Arg121His		113458949	NM_019618	Q56B91|Q6UVX7|Q7RTZ9	Missense_Mutation	SNP	ENST00000259205.4	37	CCDS2108.1	.	.	.	.	.	.	.	.	.	.	G	1.244	-0.620440	0.03636	.	.	ENSG00000136688	ENST00000376489;ENST00000259205	T;T	0.21734	1.99;1.99	4.7	-0.563	0.11778	.	0.447148	0.21593	N	0.072074	T	0.06690	0.0171	N	0.04373	-0.215	0.09310	N	0.999999	B;B	0.13145	0.004;0.007	B;B	0.13407	0.0;0.009	T	0.30621	-0.9972	10	0.20046	T	0.44	-10.2763	3.2889	0.06942	0.4651:0.0:0.3516:0.1832	.	86;121	Q9NZH8-2;Q9NZH8	.;IL36G_HUMAN	H	86;121	ENSP00000365672:R86H;ENSP00000259205:R121H	ENSP00000259205:R121H	R	+	2	0	IL36G	113458949	0.000000	0.05858	0.065000	0.19835	0.035000	0.12851	-0.972000	0.03802	-0.166000	0.10890	0.561000	0.74099	CGT		0.512	IL36G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330713.2	NM_019618	
ADI1	55256	hgsc.bcm.edu	37	2	3504621	3504621	+	Silent	SNP	G	G	A	rs562498332		TCGA-AF-2691-01A-01W-0831-10	TCGA-AF-2691-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	0a041965-3054-4091-9dae-8b6b40cc7a03	0dc37a16-724e-44fe-a593-b1efde8ccf36	g.chr2:3504621G>A	ENST00000327435.6	-	3	632	c.384C>T	c.(382-384)ccC>ccT	p.P128P	ADI1_ENST00000382093.5_Silent_p.P122P	NM_018269.3	NP_060739.2			acireductone dioxygenase 1									p.P128P(1)		breast(2)|large_intestine(2)|lung(4)|ovary(1)|stomach(1)	10	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)			OV - Ovarian serous cystadenocarcinoma(76;0.0729)|Epithelial(75;0.173)|all cancers(51;0.228)		AGATCCCCGCGGGGAGCGTCA	0.617																																					p.P128P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C384T	2						.						172.0	134.0	147.0					2																	3504621		2203	4300	6503	3483628	SO:0001819	synonymous_variant	55256	exon3				CCDS1653.1	2p25.2	2013-05-29			ENSG00000182551	ENSG00000182551	1.13.11.54		30576	protein-coding gene	gene with protein product	"""membrane-type 1 matrix metalloproteinase cytoplasmic tail binding protein-1"""	613400				14718544, 15938715	Standard	NM_018269		Approved	SIPL, MTCBP-1, ARD, APL1, FLJ10913, HMFT1638, mtnD	uc002qxp.4	Q9BV57	OTTHUMG00000112441	ENST00000327435.6:c.384C>T	2.37:g.3504621G>A			3483628	NM_018269		Silent	SNP	ENST00000327435.6	37	CCDS1653.1																																																																																				0.617	ADI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000231914.6	NM_018269	
PPIG	9360	hgsc.bcm.edu	37	2	170493428	170493428	+	Missense_Mutation	SNP	G	G	T			TCGA-AF-2691-01A-01W-0831-10	TCGA-AF-2691-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	0a041965-3054-4091-9dae-8b6b40cc7a03	0dc37a16-724e-44fe-a593-b1efde8ccf36	g.chr2:170493428G>T	ENST00000260970.3	+	14	1880	c.1660G>T	c.(1660-1662)Ggt>Tgt	p.G554C	PPIG_ENST00000409714.3_Missense_Mutation_p.G539C|PPIG_ENST00000448752.2_Missense_Mutation_p.G554C	NM_004792.2	NP_004783.2	Q13427	PPIG_HUMAN	peptidylprolyl isomerase G (cyclophilin G)	554	Arg/Ser-rich (RS domain).				protein folding (GO:0006457)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	cyclosporin A binding (GO:0016018)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|poly(A) RNA binding (GO:0044822)	p.G554C(1)		NS(2)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(17)|ovary(2)|stomach(1)|urinary_tract(1)	43					L-Proline(DB00172)	TATAACTAAAGGTAAACACAG	0.403																																					p.G554C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1660T	2						.						96.0	92.0	93.0					2																	170493428		2203	4300	6503	170201674	SO:0001583	missense	9360	exon14			X99717	CCDS2235.1	2q31.1	2010-07-23	2006-01-12		ENSG00000138398	ENSG00000138398	6.1.1.16		14650	protein-coding gene	gene with protein product	"""SR-related CTD-associated factor 10"""	606093	"""peptidyl-prolyl isomerase G (cyclophilin G)"""			8973360, 9153302	Standard	NM_004792		Approved	CARS-Cyp, SRCyp, SCAF10	uc002uez.3	Q13427	OTTHUMG00000132206	ENST00000260970.3:c.1660G>T	2.37:g.170493428G>T	ENSP00000260970:p.Gly554Cys		170201674	NM_004792	D3DPC5|D3DPC6|O00706|Q53R40|Q53SN4|Q96DG9	Missense_Mutation	SNP	ENST00000260970.3	37	CCDS2235.1	.	.	.	.	.	.	.	.	.	.	G	14.21	2.468248	0.43839	.	.	ENSG00000138398	ENST00000260970;ENST00000409714;ENST00000448752	T;T;T	0.16743	2.32;2.32;2.32	5.74	-1.34	0.09143	.	0.642536	0.16893	N	0.195231	T	0.22126	0.0533	N	0.24115	0.695	0.26645	N	0.972206	B;D;B	0.76494	0.221;0.999;0.221	B;D;B	0.64042	0.159;0.921;0.159	T	0.16689	-1.0394	10	0.72032	D	0.01	0.3236	12.1594	0.54096	0.655:0.0:0.345:0.0	.	539;539;554	E9PG73;Q2NKQ6;Q13427	.;.;PPIG_HUMAN	C	554;539;554	ENSP00000260970:G554C;ENSP00000386245:G539C;ENSP00000407083:G554C	ENSP00000260970:G554C	G	+	1	0	PPIG	170201674	1.000000	0.71417	0.925000	0.36789	0.974000	0.67602	0.810000	0.27183	-0.623000	0.05618	-0.136000	0.14681	GGT		0.403	PPIG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255264.2		
SSUH2	51066	hgsc.bcm.edu	37	3	8672496	8672496	+	Missense_Mutation	SNP	C	C	G			TCGA-AF-2691-01A-01W-0831-10	TCGA-AF-2691-10A-01W-0831-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	0a041965-3054-4091-9dae-8b6b40cc7a03	0dc37a16-724e-44fe-a593-b1efde8ccf36	g.chr3:8672496C>G	ENST00000317371.4	-	13	1679	c.454G>C	c.(454-456)Gtc>Ctc	p.V152L	SSUH2_ENST00000415132.1_Missense_Mutation_p.V152L|SSUH2_ENST00000544814.1_Missense_Mutation_p.V174L|SSUH2_ENST00000341795.3_Missense_Mutation_p.V152L			Q9Y2M2	SSUH2_HUMAN	ssu-2 homolog (C. elegans)	152						cytoplasm (GO:0005737)		p.V152L(1)									ATTACCTTGACCAGTGACGAG	0.522																																					p.V152L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G454C	3						.						118.0	93.0	101.0					3																	8672496		2203	4300	6503	8647496	SO:0001583	missense	51066	exon6			AB024705	CCDS2568.1, CCDS58815.1	3p25.3	2012-11-05	2012-11-05	2012-11-05	ENSG00000125046	ENSG00000125046			24809	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 32"""	C3orf32		20205943	Standard	NM_001256748		Approved	fls485, ssu-2	uc011atg.3	Q9Y2M2	OTTHUMG00000122075	ENST00000317371.4:c.454G>C	3.37:g.8672496C>G	ENSP00000324551:p.Val152Leu		8647496	NM_015931	A6NFA9|B3KS84|B7Z6E3|F5H2S5|Q7Z7K4	Missense_Mutation	SNP	ENST00000317371.4	37	CCDS2568.1	.	.	.	.	.	.	.	.	.	.	C	17.27	3.346498	0.61073	.	.	ENSG00000125046	ENST00000341795;ENST00000317371;ENST00000415132;ENST00000544814	T;T;T;T	0.51325	0.76;0.76;0.71;0.76	5.72	5.72	0.89469	.	0.119039	0.56097	D	0.000028	T	0.56848	0.2013	M	0.70595	2.14	0.35091	D	0.764289	D;D	0.57571	0.98;0.976	P;P	0.50405	0.606;0.64	T	0.66077	-0.6013	10	0.32370	T	0.25	-47.1844	15.3754	0.74602	0.0:1.0:0.0:0.0	.	174;152	F5H2S5;Q9Y2M2	.;CC032_HUMAN	L	152;152;152;174	ENSP00000339150:V152L;ENSP00000324551:V152L;ENSP00000410757:V152L;ENSP00000439378:V174L	ENSP00000324551:V152L	V	-	1	0	C3orf32	8647496	1.000000	0.71417	0.996000	0.52242	0.333000	0.28666	4.666000	0.61554	2.699000	0.92147	0.591000	0.81541	GTC		0.522	SSUH2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000337900.1	NM_015931	
CRELD1	78987	hgsc.bcm.edu	37	3	9985616	9985616	+	Intron	SNP	C	C	G			TCGA-AF-2691-01A-01W-0831-10	TCGA-AF-2691-10A-01W-0831-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	0a041965-3054-4091-9dae-8b6b40cc7a03	0dc37a16-724e-44fe-a593-b1efde8ccf36	g.chr3:9985616C>G	ENST00000383811.3	+	9	1647				CRELD1_ENST00000326434.5_Missense_Mutation_p.P360R|CRELD1_ENST00000489674.1_Intron|CRELD1_ENST00000452070.1_Intron|CRELD1_ENST00000397170.3_Intron	NM_015513.4	NP_056328	Q96HD1	CREL1_HUMAN	cysteine-rich with EGF-like domains 1						cardiac septum development (GO:0003279)|endocardial cushion development (GO:0003197)	integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)	p.P360R(1)		NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|stomach(1)|urinary_tract(1)	14						gatttaacccctgaaacaacc	0.468																																					p.P360R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1079G	3						.						112.0	105.0	107.0					3																	9985616		2203	4300	6503	9960616	SO:0001627	intron_variant	78987	exon11			AF452623	CCDS2593.1, CCDS33693.1	3p25.3	2005-12-08	2004-02-13		ENSG00000163703	ENSG00000163703			14630	protein-coding gene	gene with protein product		607170	"""atrioventricular septal defect 2"""	AVSD2		10922384, 12137942	Standard	NM_015513		Approved		uc003buf.3	Q96HD1	OTTHUMG00000128653	ENST00000383811.3:c.1048+417C>G	3.37:g.9985616C>G			9960616	NM_001031717	A8MX90|B2RAA9|Q6I9X5|Q8NFT4|Q9Y409	Missense_Mutation	SNP	ENST00000383811.3	37	CCDS2593.1	.	.	.	.	.	.	.	.	.	.	C	8.253	0.809504	0.16537	.	.	ENSG00000163703	ENST00000326434	T	0.63255	-0.03	3.28	1.44	0.22558	.	3.505800	0.02289	N	0.070138	T	0.46927	0.1418	.	.	.	0.09310	N	1	B	0.19817	0.039	B	0.19391	0.025	T	0.22730	-1.0208	8	.	.	.	.	5.7999	0.18408	0.0:0.7687:0.0:0.2313	.	360	Q96HD1-2	.	R	360	ENSP00000321856:P360R	.	P	+	2	0	CRELD1	9960616	0.002000	0.14202	0.000000	0.03702	0.023000	0.10783	1.012000	0.29924	0.239000	0.21243	0.591000	0.81541	CCT		0.468	CRELD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250533.1	NM_015513	
SETD2	29072	hgsc.bcm.edu	37	3	47084094	47084094	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AF-2691-01A-01W-0831-10	TCGA-AF-2691-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	0a041965-3054-4091-9dae-8b6b40cc7a03	0dc37a16-724e-44fe-a593-b1efde8ccf36	g.chr3:47084094G>A	ENST00000409792.3	-	17	7237	c.7195C>T	c.(7195-7197)Cga>Tga	p.R2399*		NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	2399	WW. {ECO:0000255|PROSITE- ProRule:PRU00224}.				angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)	p.R1896*(2)|p.R2399*(2)		breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		TCTGGATCTCGAGCTGTCTTC	0.453			"""N, F, S, Mis"""		clear cell renal carcinoma																																p.R2399X			Rec	yes		3	3p21.31	29072	SET domain containing 2		E	.	.	4	Substitution - Nonsense(4)	large_intestine(2)|breast(2)	c.C7195T	3						.						113.0	112.0	112.0					3																	47084094		2203	4300	6503	47059098	SO:0001587	stop_gained	29072	exon17			AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.7195C>T	3.37:g.47084094G>A	ENSP00000386759:p.Arg2399*		47059098	NM_014159	O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Nonsense_Mutation	SNP	ENST00000409792.3	37	CCDS2749.2	.	.	.	.	.	.	.	.	.	.	G	48	14.190842	0.99783	.	.	ENSG00000181555	ENST00000451092;ENST00000409792	.	.	.	5.51	3.7	0.42460	.	0.000000	0.43110	D	0.000617	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.4304	0.44405	0.0695:0.0:0.796:0.1346	.	.	.	.	X	2399	.	ENSP00000386759:R2399X	R	-	1	2	SETD2	47059098	1.000000	0.71417	0.995000	0.50966	0.974000	0.67602	3.171000	0.50824	0.685000	0.31468	-0.182000	0.12963	CGA		0.453	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2	NM_014159	
SLC51A	200931	hgsc.bcm.edu	37	3	195955768	195955768	+	Missense_Mutation	SNP	G	G	A			TCGA-AF-2691-01A-01W-0831-10	TCGA-AF-2691-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	0a041965-3054-4091-9dae-8b6b40cc7a03	0dc37a16-724e-44fe-a593-b1efde8ccf36	g.chr3:195955768G>A	ENST00000296327.5	+	6	819	c.610G>A	c.(610-612)Gac>Aac	p.D204N		NM_152672.5	NP_689885.4	Q86UW1	OSTA_HUMAN	solute carrier family 51, alpha subunit	204					bile acid and bile salt transport (GO:0015721)|transport (GO:0006810)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|transporter activity (GO:0005215)	p.D204N(1)								Conjugated Estrogens(DB00286)|Digoxin(DB00390)|Dinoprostone(DB00917)	TCTCGTCCCCGACGGCATCTA	0.522																																					p.D204N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G610A	3						.						118.0	103.0	108.0					3																	195955768		2203	4300	6503	197440165	SO:0001583	missense	200931	exon6				CCDS3314.1	3q29	2013-05-22			ENSG00000163959	ENSG00000163959		"""Solute carriers"""	29955	protein-coding gene	gene with protein product	"""organic solute transporter, alpha subunit"""	612084				12719432, 20538072	Standard	NM_152672		Approved	OSTalpha	uc003fwd.3	Q86UW1	OTTHUMG00000155684	ENST00000296327.5:c.610G>A	3.37:g.195955768G>A	ENSP00000296327:p.Asp204Asn		197440165	NM_152672	Q6ZMC7	Missense_Mutation	SNP	ENST00000296327.5	37	CCDS3314.1	.	.	.	.	.	.	.	.	.	.	G	18.43	3.622018	0.66787	.	.	ENSG00000163959	ENST00000296327	T	0.40225	1.04	6.07	6.07	0.98685	.	0.000000	0.51477	D	0.000091	T	0.42562	0.1208	L	0.42581	1.335	0.80722	D	1	D	0.58970	0.984	P	0.46172	0.506	T	0.09058	-1.0692	10	0.14656	T	0.56	.	19.6321	0.95713	0.0:0.0:1.0:0.0	.	204	Q86UW1	OSTA_HUMAN	N	204	ENSP00000296327:D204N	ENSP00000296327:D204N	D	+	1	0	AC069257.9	197440165	1.000000	0.71417	1.000000	0.80357	0.840000	0.47671	6.403000	0.73264	2.884000	0.98904	0.655000	0.94253	GAC		0.522	SLC51A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341253.1	NM_152672	
MAP9	79884	hgsc.bcm.edu	37	4	156268950	156268950	+	Silent	SNP	G	G	A	rs373425298		TCGA-AF-2691-01A-01W-0831-10	TCGA-AF-2691-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	0a041965-3054-4091-9dae-8b6b40cc7a03	0dc37a16-724e-44fe-a593-b1efde8ccf36	g.chr4:156268950G>A	ENST00000311277.4	-	14	2192	c.1929C>T	c.(1927-1929)ttC>ttT	p.F643F	AC097467.2_ENST00000595760.1_RNA|AC097467.2_ENST00000608092.1_RNA|AC097467.2_ENST00000593387.2_RNA|AC097467.2_ENST00000608762.1_RNA|AC097467.2_ENST00000597939.1_RNA|AC097467.2_ENST00000512269.1_RNA|AC097467.2_ENST00000601977.1_RNA|AC097467.2_ENST00000593486.1_RNA|AC097467.2_ENST00000609716.1_RNA|AC097467.2_ENST00000610249.1_RNA|AC097467.2_ENST00000609254.1_RNA|MAP9_ENST00000515654.1_Silent_p.F619F|AC097467.2_ENST00000595229.1_RNA|AC097467.2_ENST00000609486.1_RNA|AC097467.2_ENST00000608463.1_RNA|AC097467.2_ENST00000608406.1_RNA|AC097467.2_ENST00000598252.1_RNA|AC097467.2_ENST00000597955.1_RNA|AC097467.2_ENST00000599555.2_RNA|AC097467.2_ENST00000608544.1_RNA	NM_001039580.1	NP_001034669.1	Q49MG5	MAP9_HUMAN	microtubule-associated protein 9	643					cytokinesis (GO:0000910)|regulation of mitosis (GO:0007088)|spindle assembly involved in mitosis (GO:0090307)	astral microtubule (GO:0000235)|mitotic spindle midzone (GO:1990023)		p.F643F(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(8)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	26	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.143)		ACACTTTTGCGAACACAGTTC	0.343																																					p.F643F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1929T	4						.	G		0,4406		0,0,2203	94.0	91.0	92.0		1929	2.5	0.4	4		92	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	MAP9	NM_001039580.1		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		643/648	156268950	1,13005	2203	4300	6503	156488400	SO:0001819	synonymous_variant	79884	exon14			AK024812	CCDS35493.1	4q32.1	2008-02-05			ENSG00000164114	ENSG00000164114			26118	protein-coding gene	gene with protein product	"""aster-associated protein"""	610070				16049101	Standard	XM_006714306		Approved	ASAP, FLJ21159	uc003ios.3	Q49MG5	OTTHUMG00000133628	ENST00000311277.4:c.1929C>T	4.37:g.156268950G>A			156488400	NM_001039580	Q4W5I7|Q68DU1|Q9H781|Q9H7B6	Silent	SNP	ENST00000311277.4	37	CCDS35493.1																																																																																				0.343	MAP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257771.3	NM_001039580	
DNAH5	1767	hgsc.bcm.edu	37	5	13751296	13751296	+	Missense_Mutation	SNP	G	G	C			TCGA-AF-2691-01A-01W-0831-10	TCGA-AF-2691-10A-01W-0831-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	0a041965-3054-4091-9dae-8b6b40cc7a03	0dc37a16-724e-44fe-a593-b1efde8ccf36	g.chr5:13751296G>C	ENST00000265104.4	-	65	11206	c.11102C>G	c.(11101-11103)cCa>cGa	p.P3701R		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	3701	AAA 5. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.P3701R(1)		NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					GGTGTAGGCTGGGTTAGGCAA	0.418									Kartagener syndrome																												p.P3701R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C11102G	5						.						175.0	159.0	164.0					5																	13751296		2203	4300	6503	13804296	SO:0001583	missense	1767	exon65	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.11102C>G	5.37:g.13751296G>C	ENSP00000265104:p.Pro3701Arg		13804296	NM_001369	Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	ENST00000265104.4	37	CCDS3882.1	.	.	.	.	.	.	.	.	.	.	G	25.8	4.680119	0.88542	.	.	ENSG00000039139	ENST00000265104	T	0.35605	1.3	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	T	0.78635	0.4314	H	0.99286	4.5	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.87571	0.2478	10	0.87932	D	0	.	19.9403	0.97159	0.0:0.0:1.0:0.0	.	3701	Q8TE73	DYH5_HUMAN	R	3701	ENSP00000265104:P3701R	ENSP00000265104:P3701R	P	-	2	0	DNAH5	13804296	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	9.343000	0.97047	2.712000	0.92718	0.650000	0.86243	CCA		0.418	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369	
APC	324	hgsc.bcm.edu	37	5	112175328	112175328	+	Nonsense_Mutation	SNP	C	C	G			TCGA-AF-2691-01A-01W-0831-10	TCGA-AF-2691-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	0a041965-3054-4091-9dae-8b6b40cc7a03	0dc37a16-724e-44fe-a593-b1efde8ccf36	g.chr5:112175328C>G	ENST00000457016.1	+	16	4417	c.4037C>G	c.(4036-4038)tCa>tGa	p.S1346*	APC_ENST00000508376.2_Nonsense_Mutation_p.S1346*|CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000257430.4_Nonsense_Mutation_p.S1346*			P25054	APC_HUMAN	adenomatous polyposis coli	1346	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.S1346*(14)|p.K1192fs*3(1)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		TCTTCAGAATCAGCCAGGCAC	0.483		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.S1328X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,large_intestine,colon,Substitution - Nonsense,0 	.	16	Substitution - Nonsense(14)|Unknown(1)|Deletion - Frameshift(1)	large_intestine(14)|soft_tissue(1)|skin(1)	c.C3983G	5						.						59.0	63.0	61.0					5																	112175328		2202	4300	6502	112203227	SO:0001587	stop_gained	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.4037C>G	5.37:g.112175328C>G	ENSP00000413133:p.Ser1346*		112203227	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	41	8.934355	0.99008	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376	.	.	.	6.03	6.03	0.97812	.	0.386425	0.26734	N	0.022770	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-3.3113	20.1672	0.98154	0.0:1.0:0.0:0.0	.	.	.	.	X	1346	.	.	S	+	2	0	APC	112203227	0.997000	0.39634	0.940000	0.37924	0.981000	0.71138	5.272000	0.65559	2.861000	0.98227	0.655000	0.94253	TCA		0.483	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
FAT2	2196	hgsc.bcm.edu	37	5	150922845	150922845	+	Missense_Mutation	SNP	C	C	T			TCGA-AF-2691-01A-01W-0831-10	TCGA-AF-2691-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	0a041965-3054-4091-9dae-8b6b40cc7a03	0dc37a16-724e-44fe-a593-b1efde8ccf36	g.chr5:150922845C>T	ENST00000261800.5	-	9	7855	c.7843G>A	c.(7843-7845)Ggt>Agt	p.G2615S		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	2615	Cadherin 23. {ECO:0000255|PROSITE- ProRule:PRU00043}.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G2615S(1)		NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GCGTTCTGACCTTCATCTGCA	0.463																																					p.G2615S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G7843A	5						.						219.0	215.0	216.0					5																	150922845		2203	4300	6503	150903038	SO:0001583	missense	2196	exon9			AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.7843G>A	5.37:g.150922845C>T	ENSP00000261800:p.Gly2615Ser		150903038	NM_001447	O75091|Q9NSR7	Missense_Mutation	SNP	ENST00000261800.5	37	CCDS4317.1	.	.	.	.	.	.	.	.	.	.	C	22.1	4.249683	0.80024	.	.	ENSG00000086570	ENST00000261800	T	0.64618	-0.11	5.36	5.36	0.76844	Cadherin (4);Cadherin-like (1);	0.000000	0.64402	D	0.000005	D	0.85915	0.5808	H	0.95437	3.67	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89427	0.3714	10	0.56958	D	0.05	.	19.0961	0.93251	0.0:1.0:0.0:0.0	.	2615	Q9NYQ8	FAT2_HUMAN	S	2615	ENSP00000261800:G2615S	ENSP00000261800:G2615S	G	-	1	0	FAT2	150903038	1.000000	0.71417	0.973000	0.42090	0.969000	0.65631	7.755000	0.85180	2.506000	0.84524	0.462000	0.41574	GGT		0.463	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252434.1	NM_001447	
SYNE1	23345	hgsc.bcm.edu	37	6	152652802	152652802	+	Missense_Mutation	SNP	C	C	A			TCGA-AF-2691-01A-01W-0831-10	TCGA-AF-2691-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	0a041965-3054-4091-9dae-8b6b40cc7a03	0dc37a16-724e-44fe-a593-b1efde8ccf36	g.chr6:152652802C>A	ENST00000367255.5	-	78	13619	c.13018G>T	c.(13018-13020)Gtc>Ttc	p.V4340F	SYNE1_ENST00000341594.5_Missense_Mutation_p.V4205F|SYNE1_ENST00000448038.1_Missense_Mutation_p.V4269F|SYNE1_ENST00000265368.4_Missense_Mutation_p.V4340F|SYNE1_ENST00000423061.1_Missense_Mutation_p.V4269F	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	4340					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.V4340F(2)		NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		AAGTTGGTGACTGACACTTGG	0.453										HNSCC(10;0.0054)																											p.V4269F												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G12805T	6						.						153.0	142.0	146.0					6																	152652802		2203	4300	6503	152694495	SO:0001583	missense	23345	exon77			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.13018G>T	6.37:g.152652802C>A	ENSP00000356224:p.Val4340Phe		152694495	NM_033071	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	37	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	C	9.400	1.077651	0.20227	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594	T;T;T;T;T	0.34472	1.36;1.36;1.36;1.36;1.36	5.84	2.15	0.27550	.	0.113042	0.39083	N	0.001465	T	0.23289	0.0563	L	0.60455	1.87	0.80722	D	1	P;P;P;P	0.47962	0.903;0.498;0.498;0.631	P;B;B;B	0.45037	0.467;0.232;0.232;0.387	T	0.03139	-1.1068	10	0.56958	D	0.05	.	10.8306	0.46659	0.0:0.7588:0.0:0.2412	.	4340;4340;4340;4269	Q8NF91-7;Q8NF91;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.	F	4340;4269;4340;4269;4205	ENSP00000356224:V4340F;ENSP00000396024:V4269F;ENSP00000265368:V4340F;ENSP00000390975:V4269F;ENSP00000341887:V4205F	ENSP00000265368:V4340F	V	-	1	0	SYNE1	152694495	0.095000	0.21747	0.165000	0.22776	0.989000	0.77384	0.650000	0.24858	0.113000	0.18004	0.655000	0.94253	GTC		0.453	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
ARMC12	221481	hgsc.bcm.edu	37	6	35704997	35704997	+	Missense_Mutation	SNP	G	G	A			TCGA-AF-2691-01A-01W-0831-10	TCGA-AF-2691-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	0a041965-3054-4091-9dae-8b6b40cc7a03	0dc37a16-724e-44fe-a593-b1efde8ccf36	g.chr6:35704997G>A	ENST00000373866.3	+	1	134	c.112G>A	c.(112-114)Ggc>Agc	p.G38S	ARMC12_ENST00000288065.2_Missense_Mutation_p.G38S|ARMC12_ENST00000373869.3_Missense_Mutation_p.G38S|RP3-510O8.4_ENST00000452048.1_RNA			Q5T9G4	ARM12_HUMAN	armadillo repeat containing 12	38						nucleus (GO:0005634)		p.G38S(1)									CATCAAGGCTGGCATAAAATG	0.622											OREG0017379	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G38S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G112A	6						.						116.0	106.0	110.0					6																	35704997		2203	4300	6503	35812975	SO:0001583	missense	221481	exon1			AK058119	CCDS4809.1, CCDS69093.1, CCDS69094.1	6p21.31	2013-02-14	2011-12-14	2011-12-14	ENSG00000157343	ENSG00000157343		"""Armadillo repeat containing"""	21099	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 81"""	C6orf81			Standard	XM_005248920		Approved	FLJ25390	uc003ola.3	Q5T9G4	OTTHUMG00000014577	ENST00000373866.3:c.112G>A	6.37:g.35704997G>A	ENSP00000362973:p.Gly38Ser	857	35812975	NM_145028	Q8NEB2|Q96LL8	Missense_Mutation	SNP	ENST00000373866.3	37		.	.	.	.	.	.	.	.	.	.	G	21.0	4.083624	0.76642	.	.	ENSG00000157343	ENST00000373869;ENST00000288065;ENST00000373866	T;T;T	0.53857	0.6;0.6;0.6	4.86	4.86	0.63082	.	0.000000	0.49916	D	0.000139	T	0.49508	0.1561	L	0.32530	0.975	0.37317	D	0.909396	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.45775	-0.9238	10	0.25751	T	0.34	-2.1982	13.5383	0.61659	0.0:0.0:1.0:0.0	.	38;38	Q5T9G4-3;Q5T9G4-2	.;.	S	38	ENSP00000362976:G38S;ENSP00000288065:G38S;ENSP00000362973:G38S	ENSP00000288065:G38S	G	+	1	0	C6orf81	35812975	1.000000	0.71417	0.897000	0.35233	0.793000	0.44817	4.957000	0.63652	2.261000	0.74972	0.449000	0.29647	GGC		0.622	ARMC12-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000040311.2	NM_145028	
NFYA	4800	hgsc.bcm.edu	37	6	41057388	41057388	+	Missense_Mutation	SNP	G	G	T			TCGA-AF-2691-01A-01W-0831-10	TCGA-AF-2691-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	0a041965-3054-4091-9dae-8b6b40cc7a03	0dc37a16-724e-44fe-a593-b1efde8ccf36	g.chr6:41057388G>T	ENST00000341376.6	+	5	581	c.380G>T	c.(379-381)gGc>gTc	p.G127V	OARD1_ENST00000480585.1_Intron|NFYA_ENST00000353205.5_Missense_Mutation_p.G98V	NM_002505.4	NP_002496.1	P23511	NFYA_HUMAN	nuclear transcription factor Y, alpha	127	Gln-rich.				cellular lipid metabolic process (GO:0044255)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription, DNA-templated (GO:0006355)|rhythmic process (GO:0048511)|small molecule metabolic process (GO:0044281)|transcription from RNA polymerase II promoter (GO:0006366)	CCAAT-binding factor complex (GO:0016602)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G127V(1)		cervix(1)|endometrium(1)|large_intestine(4)|lung(2)|urinary_tract(1)	9	Ovarian(28;0.0418)|Colorectal(47;0.196)					GGCCAGCAGGGCCAGACCCAG	0.537																																					p.G127V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G380T	6						.						66.0	65.0	66.0					6																	41057388		2203	4300	6503	41165366	SO:0001583	missense	4800	exon5				CCDS4849.1, CCDS4850.1	6p21.3	2008-11-11			ENSG00000001167	ENSG00000001167			7804	protein-coding gene	gene with protein product		189903				1774067, 9612081	Standard	NM_002505		Approved	HAP2, CBF-B, NF-YA	uc003opo.3	P23511	OTTHUMG00000014669	ENST00000341376.6:c.380G>T	6.37:g.41057388G>T	ENSP00000345702:p.Gly127Val		41165366	NM_002505	Q8IXU0	Missense_Mutation	SNP	ENST00000341376.6	37	CCDS4849.1	.	.	.	.	.	.	.	.	.	.	G	18.50	3.637267	0.67130	.	.	ENSG00000001167	ENST00000341376;ENST00000353205	.	.	.	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	T	0.69070	0.3070	L	0.54323	1.7	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.80764	0.988;0.994	T	0.61352	-0.7080	9	0.24483	T	0.36	-0.1332	18.4308	0.90624	0.0:0.0:1.0:0.0	.	98;127	P23511-2;P23511	.;NFYA_HUMAN	V	127;98	.	ENSP00000345702:G127V	G	+	2	0	NFYA	41165366	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	9.425000	0.97467	2.831000	0.97527	0.650000	0.86243	GGC		0.537	NFYA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040496.1		
UBR2	23304	hgsc.bcm.edu	37	6	42571414	42571414	+	Missense_Mutation	SNP	C	C	T			TCGA-AF-2691-01A-01W-0831-10	TCGA-AF-2691-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	0a041965-3054-4091-9dae-8b6b40cc7a03	0dc37a16-724e-44fe-a593-b1efde8ccf36	g.chr6:42571414C>T	ENST00000372899.1	+	5	878	c.620C>T	c.(619-621)aCc>aTc	p.T207I	UBR2_ENST00000372901.1_Missense_Mutation_p.T207I|UBR2_ENST00000372903.2_Missense_Mutation_p.T207I	NM_015255.2	NP_056070.1	Q8IWV8	UBR2_HUMAN	ubiquitin protein ligase E3 component n-recognin 2	207					cellular response to leucine (GO:0071233)|chromatin silencing (GO:0006342)|histone H2A ubiquitination (GO:0033522)|male meiosis I (GO:0007141)|negative regulation of TOR signaling (GO:0032007)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)	chromatin (GO:0000785)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	leucine binding (GO:0070728)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.T207I(1)		breast(1)|central_nervous_system(1)|endometrium(10)|kidney(7)|large_intestine(14)|lung(22)|ovary(3)|pancreas(1)|skin(5)	64	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|all cancers(41;0.004)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.196)			GAAATATTAACCTGGGAAAAA	0.318																																					p.T207I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C620T	6						.						113.0	118.0	117.0					6																	42571414		2203	4299	6502	42679392	SO:0001583	missense	23304	exon5			BC024217	CCDS4870.1, CCDS55001.1	6p21.1	2008-06-23	2005-01-10	2005-01-12	ENSG00000024048	ENSG00000024048		"""Ubiquitin protein ligase E3 component n-recognins"""	21289	protein-coding gene	gene with protein product		609134	"""chromosome 6 open reading frame 133"""	C6orf133			Standard	NM_015255		Approved	bA49A4.1, dJ392M17.3, KIAA0349	uc011dur.2	Q8IWV8	OTTHUMG00000014703	ENST00000372899.1:c.620C>T	6.37:g.42571414C>T	ENSP00000361990:p.Thr207Ile		42679392	NM_001184801	O15057|Q4VXK2|Q5TFH6|Q6P2I2|Q6ZUD0	Missense_Mutation	SNP	ENST00000372899.1	37	CCDS4870.1	.	.	.	.	.	.	.	.	.	.	C	13.00	2.106793	0.37145	.	.	ENSG00000024048	ENST00000372903;ENST00000372899;ENST00000372901	T;T;T	0.73258	-0.73;0.25;0.25	5.58	5.58	0.84498	.	0.214637	0.47093	D	0.000258	T	0.48114	0.1482	N	0.17723	0.515	0.80722	D	1	B;B	0.28998	0.23;0.12	B;B	0.34536	0.05;0.185	T	0.49021	-0.8982	10	0.20519	T	0.43	-2.3523	19.62	0.95651	0.0:1.0:0.0:0.0	.	207;207	Q8IWV8;Q8IWV8-2	UBR2_HUMAN;.	I	207	ENSP00000361994:T207I;ENSP00000361990:T207I;ENSP00000361992:T207I	ENSP00000361990:T207I	T	+	2	0	UBR2	42679392	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.225000	0.78051	2.627000	0.88993	0.650000	0.86243	ACC		0.318	UBR2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040558.2	NM_015255	
CUL9	23113	hgsc.bcm.edu	37	6	43166413	43166413	+	Missense_Mutation	SNP	G	G	T	rs397840127|rs3215697	byFrequency	TCGA-AF-2691-01A-01W-0831-10	TCGA-AF-2691-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	0a041965-3054-4091-9dae-8b6b40cc7a03	0dc37a16-724e-44fe-a593-b1efde8ccf36	g.chr6:43166413G>T	ENST00000252050.4	+	12	2954	c.2870G>T	c.(2869-2871)gGg>gTg	p.G957V	CUL9_ENST00000354495.3_Missense_Mutation_p.G847V|CUL9_ENST00000372647.2_Missense_Mutation_p.G957V	NM_015089.2	NP_055904.1	Q8IWT3	CUL9_HUMAN	cullin 9	957					microtubule cytoskeleton organization (GO:0000226)|protein ubiquitination (GO:0016567)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|zinc ion binding (GO:0008270)	p.G957V(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|liver(1)|lung(30)|ovary(5)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(4)	92						TCCCTGGTTGGGGGCCCATCT	0.622																																					p.G957V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2870T	6						.						112.0	116.0	114.0					6																	43166413		2203	4300	6503	43274391	SO:0001583	missense	23113	exon12			AB014608	CCDS4890.1	6p21.1	2011-05-24			ENSG00000112659	ENSG00000112659			15982	protein-coding gene	gene with protein product	"""parkin-like cytoplasmic p53 binding protein"", ""p53-associated parkin-like cytoplasmic protein"""	607489				17332328, 10521492, 12526791	Standard	NM_015089		Approved	H7AP1, KIAA0708, PARC	uc003ouk.3	Q8IWT3	OTTHUMG00000014723	ENST00000252050.4:c.2870G>T	6.37:g.43166413G>T	ENSP00000252050:p.Gly957Val		43274391	NM_015089	O75188|Q5TCY3|Q68CP2|Q68D92|Q8N3W9|Q9BU56	Missense_Mutation	SNP	ENST00000252050.4	37	CCDS4890.1	.	.	.	.	.	.	.	.	.	.	G	19.38	3.816426	0.70912	.	.	ENSG00000112659	ENST00000252050;ENST00000354495;ENST00000372647	T;T;T	0.72942	-0.7;-0.7;-0.6	5.28	4.35	0.52113	Armadillo-type fold (1);	0.147667	0.44483	D	0.000446	T	0.73450	0.3588	L	0.54323	1.7	0.58432	D	0.999998	D;D;D	0.76494	0.995;0.999;0.999	D;D;D	0.68621	0.909;0.925;0.959	T	0.74064	-0.3785	10	0.48119	T	0.1	-32.7779	12.4476	0.55659	0.0:0.1689:0.8311:0.0	.	847;957;957	Q8IWT3-3;E9PEZ1;Q8IWT3	.;.;CUL9_HUMAN	V	957;847;957	ENSP00000252050:G957V;ENSP00000346490:G847V;ENSP00000361730:G957V	ENSP00000252050:G957V	G	+	2	0	CUL9	43274391	1.000000	0.71417	0.998000	0.56505	0.986000	0.74619	3.439000	0.52878	2.463000	0.83235	0.555000	0.69702	GGG		0.622	CUL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040582.2	NM_015089	
GPR116	221395	hgsc.bcm.edu	37	6	46847725	46847725	+	Missense_Mutation	SNP	A	A	G			TCGA-AF-2691-01A-01W-0831-10	TCGA-AF-2691-10A-01W-0831-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	0a041965-3054-4091-9dae-8b6b40cc7a03	0dc37a16-724e-44fe-a593-b1efde8ccf36	g.chr6:46847725A>G	ENST00000283296.7	-	9	1154	c.866T>C	c.(865-867)gTc>gCc	p.V289A	GPR116_ENST00000456426.2_Intron|GPR116_ENST00000265417.7_Missense_Mutation_p.V289A|GPR116_ENST00000362015.4_Missense_Mutation_p.V289A	NM_001098518.1	NP_001091988.1	Q8IZF2	GP116_HUMAN	G protein-coupled receptor 116	289	Ig-like 1.				energy reserve metabolic process (GO:0006112)|fat cell differentiation (GO:0045444)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|neuropeptide signaling pathway (GO:0007218)|regulation of lipid metabolic process (GO:0019216)|surfactant homeostasis (GO:0043129)	cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.V289A(1)		breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(21)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	59			Lung(136;0.192)			CACCAGACTGACTGTGTCCCC	0.403																																					p.V289A	NSCLC(59;410 1274 8751 36715 50546)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T866C	6						.						132.0	115.0	120.0					6																	46847725		2203	4300	6503	46955684	SO:0001583	missense	221395	exon9			AB018301	CCDS4919.1	6p12.3	2014-08-08			ENSG00000069122	ENSG00000069122		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19030	protein-coding gene	gene with protein product						12435584	Standard	NM_001098518		Approved	DKFZp564O1923, KIAA0758	uc003oyo.3	Q8IZF2	OTTHUMG00000014793	ENST00000283296.7:c.866T>C	6.37:g.46847725A>G	ENSP00000283296:p.Val289Ala		46955684	NM_001098518	O94858|Q5TF06|Q6RGN2|Q86SP0|Q9Y3Z2	Missense_Mutation	SNP	ENST00000283296.7	37	CCDS4919.1	.	.	.	.	.	.	.	.	.	.	A	15.24	2.775438	0.49786	.	.	ENSG00000069122	ENST00000452370;ENST00000283296;ENST00000362015;ENST00000265417	T;T;T	0.65732	-0.17;-0.17;-0.17	5.9	5.9	0.94986	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.111000	0.39909	N	0.001233	T	0.69788	0.3150	M	0.62154	1.92	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.75020	0.985;0.985	T	0.74813	-0.3537	10	0.87932	D	0	-13.1872	12.715	0.57109	1.0:0.0:0.0:0.0	.	289;289	A8K0D8;Q8IZF2	.;GP116_HUMAN	A	289	ENSP00000283296:V289A;ENSP00000354563:V289A;ENSP00000265417:V289A	ENSP00000265417:V289A	V	-	2	0	GPR116	46955684	0.836000	0.29430	0.511000	0.27724	0.176000	0.22953	4.472000	0.60189	2.254000	0.74563	0.482000	0.46254	GTC		0.403	GPR116-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040806.2	NM_015234	
CRISP1	167	hgsc.bcm.edu	37	6	49808641	49808641	+	Missense_Mutation	SNP	C	C	T	rs267601065		TCGA-AF-2691-01A-01W-0831-10	TCGA-AF-2691-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	0a041965-3054-4091-9dae-8b6b40cc7a03	0dc37a16-724e-44fe-a593-b1efde8ccf36	g.chr6:49808641C>T	ENST00000335847.4	-	6	604	c.503G>A	c.(502-504)cGa>cAa	p.R168Q	CRISP1_ENST00000507853.1_Missense_Mutation_p.R168Q|CRISP1_ENST00000505118.1_Missense_Mutation_p.R168Q|CRISP1_ENST00000329411.5_Missense_Mutation_p.R168Q|CRISP1_ENST00000355791.2_Missense_Mutation_p.R168Q|CRISP1_ENST00000536021.1_Missense_Mutation_p.R168Q	NM_001131.2	NP_001122.2	P54107	CRIS1_HUMAN	cysteine-rich secretory protein 1	168	SCP.				binding of sperm to zona pellucida (GO:0007339)|fusion of sperm to egg plasma membrane (GO:0007342)|regulation of acrosome reaction (GO:0060046)	extracellular space (GO:0005615)|nucleus (GO:0005634)	calcium channel regulator activity (GO:0005246)	p.R168Q(1)		endometrium(1)|kidney(2)|large_intestine(6)|lung(15)|skin(2)|upper_aerodigestive_tract(1)	27	Lung NSC(77;0.0358)					GTAGAGATATCGAGGTGATCC	0.348																																					p.R168Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G503A	6						.						103.0	92.0	96.0					6																	49808641		2203	4300	6503	49916600	SO:0001583	missense	167	exon6			D38451	CCDS4931.1, CCDS4932.1	6p21.2-p21.1	2008-02-05	2003-09-03	2003-09-05	ENSG00000124812	ENSG00000124812			304	protein-coding gene	gene with protein product		601193	"""acidic epididymal glycoprotein-like 1"""	AEGL1		8838800	Standard	NM_001131		Approved	CRISP-1, ARP, HUMARP, HSCRISP1D, HSCRISP1G	uc003ozw.2	P54107	OTTHUMG00000014827	ENST00000335847.4:c.503G>A	6.37:g.49808641C>T	ENSP00000338276:p.Arg168Gln		49916600	NM_001131	B5BU98|O00698|Q13248|Q14082|Q96SF6	Missense_Mutation	SNP	ENST00000335847.4	37	CCDS4931.1	.	.	.	.	.	.	.	.	.	.	C	9.913	1.210049	0.22289	.	.	ENSG00000124812	ENST00000507853;ENST00000335847;ENST00000355791;ENST00000329411;ENST00000505118;ENST00000536021	T;T;T;T;T;T	0.07567	3.18;3.18;3.18;3.18;3.18;3.18	4.8	-2.5	0.06384	CAP domain (3);	2.898410	0.01360	N	0.012197	T	0.01124	0.0037	N	0.11284	0.12	0.09310	N	1	B;B	0.09022	0.001;0.002	B;B	0.04013	0.001;0.001	T	0.44251	-0.9340	9	.	.	.	.	5.1795	0.15152	0.0:0.159:0.2845:0.5565	.	168;168	P54107-2;P54107	.;CRIS1_HUMAN	Q	168	ENSP00000425020:R168Q;ENSP00000338276:R168Q;ENSP00000348044:R168Q;ENSP00000331317:R168Q;ENSP00000427589:R168Q;ENSP00000441798:R168Q	.	R	-	2	0	CRISP1	49916600	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.080000	0.11339	-0.771000	0.04608	-0.812000	0.03155	CGA		0.348	CRISP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040875.2	NM_001131	
MLLT4	4301	hgsc.bcm.edu	37	6	168298993	168298993	+	Missense_Mutation	SNP	C	C	T			TCGA-AF-2691-01A-01W-0831-10	TCGA-AF-2691-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	0a041965-3054-4091-9dae-8b6b40cc7a03	0dc37a16-724e-44fe-a593-b1efde8ccf36	g.chr6:168298993C>T	ENST00000447894.2	+	11	1426	c.1426C>T	c.(1426-1428)Cgc>Tgc	p.R476C	MLLT4_ENST00000351017.4_Missense_Mutation_p.R476C|MLLT4_ENST00000400822.3_Missense_Mutation_p.R475C|MLLT4_ENST00000344191.4_Missense_Mutation_p.R476C|MLLT4_ENST00000392108.3_Missense_Mutation_p.R476C|MLLT4_ENST00000366806.2_Missense_Mutation_p.R476C|MLLT4_ENST00000392112.1_Missense_Mutation_p.R460C			P55196	AFAD_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4	476	FHA.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	apical part of cell (GO:0045177)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein C-terminus binding (GO:0008022)	p.R460C(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(13)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	65		Breast(66;1.07e-05)|Ovarian(120;0.024)		Epithelial(4;2.38e-32)|OV - Ovarian serous cystadenocarcinoma(33;9.99e-23)|BRCA - Breast invasive adenocarcinoma(4;1.2e-11)|GBM - Glioblastoma multiforme(31;0.00117)		GGAAGGCCAGCGCATCTCAGA	0.532			T	MLL	AL																																p.R476C			Dom	yes		6	6q27	4301	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4 (AF6)"""		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1426T	6						.						100.0	85.0	90.0					6																	168298993		2203	4300	6503	168041842	SO:0001583	missense	4301	exon11			AB011399	CCDS47517.1, CCDS75553.1	6q27	2008-02-05	2001-11-28		ENSG00000130396	ENSG00000130396			7137	protein-coding gene	gene with protein product		159559	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 4"""			8242616	Standard	NM_001040000		Approved	AF-6, AF6	uc021zij.1	P55196	OTTHUMG00000016031	ENST00000447894.2:c.1426C>T	6.37:g.168298993C>T	ENSP00000404595:p.Arg476Cys		168041842	NM_001040000	O75087|O75088|O75089|Q59FP0|Q5TIG6|Q5TIG7|Q9NSN7|Q9NU92	Missense_Mutation	SNP	ENST00000447894.2	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	33|33	5.263277|5.263277	0.95399|0.95399	.|.	.|.	ENSG00000130396|ENSG00000130396	ENST00000423229|ENST00000344191;ENST00000351017;ENST00000392108;ENST00000366806;ENST00000392112;ENST00000341575;ENST00000400822;ENST00000447894	.|D;D;D;D;D;D;D	.|0.89746	.|-2.56;-2.56;-2.56;-2.56;-2.56;-2.56;-2.56	5.56|5.56	5.56|5.56	0.83823|0.83823	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.93374|0.93374	0.7887|0.7887	M|M	0.70842|0.70842	2.15|2.15	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.76494	.|0.997;0.999;0.998;0.998	.|D;D;D;D	.|0.68943	.|0.961;0.912;0.954;0.941	D|D	0.93623|0.93623	0.6949|0.6949	5|10	.|0.87932	.|D	.|0	-14.2475|-14.2475	19.5218|19.5218	0.95187|0.95187	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|174;475;476;460	.|Q96C95;P55196-5;P55196-6;P55196-2	.|.;.;.;.	V|C	174|476;476;476;476;460;476;475;476	.|ENSP00000341118:R476C;ENSP00000252692:R476C;ENSP00000375956:R476C;ENSP00000355771:R476C;ENSP00000375960:R460C;ENSP00000383623:R475C;ENSP00000404595:R476C	.|ENSP00000345834:R476C	A|R	+|+	2|1	0|0	MLLT4|MLLT4	168041842|168041842	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.986000|0.986000	0.74619|0.74619	7.618000|7.618000	0.83043|0.83043	2.609000|2.609000	0.88269|0.88269	0.650000|0.650000	0.86243|0.86243	GCG|CGC		0.532	MLLT4-013	PUTATIVE	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000372077.1	NM_005936	
SAMD9L	219285	hgsc.bcm.edu	37	7	92761049	92761049	+	Missense_Mutation	SNP	C	C	A			TCGA-AF-2691-01A-01W-0831-10	TCGA-AF-2691-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	0a041965-3054-4091-9dae-8b6b40cc7a03	0dc37a16-724e-44fe-a593-b1efde8ccf36	g.chr7:92761049C>A	ENST00000318238.4	-	5	5452	c.4236G>T	c.(4234-4236)gaG>gaT	p.E1412D	SAMD9L_ENST00000411955.1_Missense_Mutation_p.E1412D|SAMD9L_ENST00000437805.1_Missense_Mutation_p.E1412D	NM_152703.2	NP_689916.2	Q8IVG5	SAM9L_HUMAN	sterile alpha motif domain containing 9-like	1412					common myeloid progenitor cell proliferation (GO:0035726)|endosomal vesicle fusion (GO:0034058)|hematopoietic progenitor cell differentiation (GO:0002244)|regulation of protein catabolic process (GO:0042176)|spleen development (GO:0048536)|stem cell division (GO:0017145)	early endosome (GO:0005769)		p.E1412D(1)		central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(23)|liver(2)|lung(31)|ovary(5)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	88	all_cancers(62;4.15e-11)|all_epithelial(64;2.29e-10)|Breast(17;0.000675)|Lung NSC(181;0.0755)|all_lung(186;0.0989)		STAD - Stomach adenocarcinoma(171;0.000302)			ATTGCAAGACCTCTCGGAGTT	0.403																																					p.E1412D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4236T	7						.						147.0	148.0	148.0					7																	92761049		2203	4300	6503	92598985	SO:0001583	missense	219285	exon5			AB095926	CCDS34681.1	7q21.2	2013-01-10		2005-04-26	ENSG00000177409	ENSG00000177409		"""Sterile alpha motif (SAM) domain containing"""	1349	protein-coding gene	gene with protein product		611170	"""chromosome 7 open reading frame 6"""	C7orf6			Standard	NM_152703		Approved	KIAA2005, FLJ39885	uc003umh.1	Q8IVG5	OTTHUMG00000155807	ENST00000318238.4:c.4236G>T	7.37:g.92761049C>A	ENSP00000326247:p.Glu1412Asp		92598985	NM_152703	A0JP23|A0JP24|A0PJG8|A4D1G8|D6W5Q6|Q2TV71|Q2TV75|Q2UZV8|Q8IWI4|Q8N3L9|Q8N875	Missense_Mutation	SNP	ENST00000318238.4	37	CCDS34681.1	.	.	.	.	.	.	.	.	.	.	C	7.886	0.731350	0.15507	.	.	ENSG00000177409	ENST00000318238;ENST00000411955;ENST00000437805;ENST00000394472	T;T;T	0.24723	1.84;1.84;1.84	5.22	1.61	0.23674	.	0.449320	0.22432	N	0.060122	T	0.19927	0.0479	L	0.59436	1.845	0.19300	N	0.999974	P	0.36412	0.552	B	0.33042	0.157	T	0.11470	-1.0586	10	0.41790	T	0.15	-19.5054	5.1827	0.15169	0.1562:0.4406:0.0:0.4033	.	1412	Q8IVG5	SAM9L_HUMAN	D	1412;1412;1412;234	ENSP00000326247:E1412D;ENSP00000405760:E1412D;ENSP00000408796:E1412D	ENSP00000326247:E1412D	E	-	3	2	SAMD9L	92598985	0.000000	0.05858	0.951000	0.38953	0.074000	0.17049	-0.693000	0.05121	0.126000	0.18424	-0.373000	0.07131	GAG		0.403	SAMD9L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341730.1	NM_152703	
COL14A1	7373	hgsc.bcm.edu	37	8	121209172	121209172	+	Missense_Mutation	SNP	G	G	T			TCGA-AF-2691-01A-01W-0831-10	TCGA-AF-2691-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	0a041965-3054-4091-9dae-8b6b40cc7a03	0dc37a16-724e-44fe-a593-b1efde8ccf36	g.chr8:121209172G>T	ENST00000297848.3	+	6	849	c.579G>T	c.(577-579)gaG>gaT	p.E193D	COL14A1_ENST00000432943.2_3'UTR|COL14A1_ENST00000309791.4_Missense_Mutation_p.E193D|COL14A1_ENST00000537875.1_Missense_Mutation_p.E193D|COL14A1_ENST00000247781.3_Missense_Mutation_p.E193D	NM_021110.1	NP_066933.1			collagen, type XIV, alpha 1									p.E193D(1)		NS(1)|autonomic_ganglia(1)|breast(11)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(9)|large_intestine(31)|lung(42)|ovary(5)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	119	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			TGGGCTCAGAGAAGACACGAA	0.388																																					p.E193D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G579T	8						.						164.0	154.0	157.0					8																	121209172		2203	4300	6503	121278353	SO:0001583	missense	7373	exon6				CCDS34938.1	8q23	2013-02-11	2008-02-04		ENSG00000187955	ENSG00000187955		"""Collagens"", ""Fibronectin type III domain containing"""	2191	protein-coding gene	gene with protein product		120324	"""undulin"""	UND		1716629, 9427527	Standard	NM_021110		Approved		uc003yox.4	Q05707	OTTHUMG00000149877	ENST00000297848.3:c.579G>T	8.37:g.121209172G>T	ENSP00000297848:p.Glu193Asp		121278353	NM_021110		Missense_Mutation	SNP	ENST00000297848.3	37	CCDS34938.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.97|15.97	2.988782|2.988782	0.53934|0.53934	.|.	.|.	ENSG00000187955|ENSG00000187955	ENST00000537875;ENST00000309791;ENST00000297848;ENST00000247781;ENST00000434620|ENST00000523142	D;D;D;D;D|.	0.82893|.	-1.66;-1.66;-1.66;-1.66;-1.66|.	5.43|5.43	3.48|3.48	0.39840|0.39840	von Willebrand factor, type A (3);|.	0.267459|0.267459	0.42053|0.42053	D|D	0.000778|0.000778	T|.	0.10852|.	0.0265|.	N|N	0.00387|0.00387	-1.565|-1.565	0.33246|0.33246	D|D	0.557834|0.557834	B|.	0.09022|.	0.002|.	B|.	0.06405|.	0.002|.	T|.	0.10268|.	-1.0637|.	10|.	0.15499|0.42905	T|T	0.54|0.14	.|.	9.1228|9.1228	0.36797|0.36797	0.0787:0.0:0.6989:0.2224|0.0787:0.0:0.6989:0.2224	.|.	193|.	Q05707|.	COEA1_HUMAN|.	D|X	193;193;193;193;6|45	ENSP00000443974:E193D;ENSP00000311809:E193D;ENSP00000297848:E193D;ENSP00000247781:E193D;ENSP00000409461:E6D|.	ENSP00000247781:E193D|ENSP00000429123:E45X	E|E	+|+	3|1	2|0	COL14A1|COL14A1	121278353|121278353	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.980000|0.980000	0.70556|0.70556	1.281000|1.281000	0.33214|0.33214	1.504000|1.504000	0.48704|0.48704	0.650000|0.650000	0.86243|0.86243	GAG|GAA		0.388	COL14A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313657.2	NM_021110	
TRIM35	23087	hgsc.bcm.edu	37	8	27151776	27151776	+	Missense_Mutation	SNP	G	G	A	rs369635979		TCGA-AF-2691-01A-01W-0831-10	TCGA-AF-2691-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	0a041965-3054-4091-9dae-8b6b40cc7a03	0dc37a16-724e-44fe-a593-b1efde8ccf36	g.chr8:27151776G>A	ENST00000305364.4	-	3	666	c.583C>T	c.(583-585)Cgc>Tgc	p.R195C	TRIM35_ENST00000521253.1_Missense_Mutation_p.R163C	NM_171982.3	NP_741983.2	Q9UPQ4	TRI35_HUMAN	tripartite motif containing 35	195					apoptotic process (GO:0006915)|innate immune response (GO:0045087)|negative regulation of cell proliferation (GO:0008285)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of viral release from host cell (GO:1902187)|positive regulation of apoptotic process (GO:0043065)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)	p.R195C(1)		breast(1)|endometrium(6)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)	14		Ovarian(32;2.61e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0213)|Epithelial(17;9.34e-10)|Colorectal(74;0.141)		AAGAACTCGCGAAGCTTATCA	0.577																																					p.R195C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C583T	8						.	G	CYS/ARG	0,4406		0,0,2203	59.0	52.0	54.0		583	5.8	0.1	8		54	1,8599	1.2+/-3.3	0,1,4299	no	missense	TRIM35	NM_171982.3	180	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging	195/494	27151776	1,13005	2203	4300	6503	27207693	SO:0001583	missense	23087	exon3			AB029021	CCDS6056.2	8p21.2	2013-01-09	2011-01-25		ENSG00000104228	ENSG00000104228		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16285	protein-coding gene	gene with protein product			"""tripartite motif-containing 35"""			11331580, 14662771, 12692137	Standard	XM_005273451		Approved	KIAA1098, MAIR, HLS5	uc003xfl.1	Q9UPQ4	OTTHUMG00000102047	ENST00000305364.4:c.583C>T	8.37:g.27151776G>A	ENSP00000301924:p.Arg195Cys		27207693	NM_171982	Q86XQ0|Q8WVA4	Missense_Mutation	SNP	ENST00000305364.4	37	CCDS6056.2	.	.	.	.	.	.	.	.	.	.	G	17.58	3.425368	0.62733	0.0	1.16E-4	ENSG00000104228	ENST00000305364;ENST00000521253	T;T	0.68331	-0.22;-0.32	5.82	5.82	0.92795	.	.	.	.	.	T	0.74245	0.3691	L	0.56769	1.78	0.35117	D	0.766649	D;D	0.89917	1.0;0.999	P;P	0.54706	0.759;0.642	T	0.81854	-0.0741	9	0.72032	D	0.01	.	15.5931	0.76554	0.0:0.0:1.0:0.0	.	163;195	E5RGB3;Q9UPQ4	.;TRI35_HUMAN	C	195;163	ENSP00000301924:R195C;ENSP00000428770:R163C	ENSP00000301924:R195C	R	-	1	0	TRIM35	27207693	1.000000	0.71417	0.076000	0.20297	0.281000	0.26958	8.210000	0.89753	2.756000	0.94617	0.561000	0.74099	CGC		0.577	TRIM35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219848.2	NM_171982	
ADCY8	114	hgsc.bcm.edu	37	8	131916038	131916038	+	Missense_Mutation	SNP	T	T	C			TCGA-AF-2691-01A-01W-0831-10	TCGA-AF-2691-10A-01W-0831-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	0a041965-3054-4091-9dae-8b6b40cc7a03	0dc37a16-724e-44fe-a593-b1efde8ccf36	g.chr8:131916038T>C	ENST00000286355.5	-	7	3983	c.1891A>G	c.(1891-1893)Aat>Gat	p.N631D	ADCY8_ENST00000377928.3_Missense_Mutation_p.N631D	NM_001115.2	NP_001106.1	P40145	ADCY8_HUMAN	adenylate cyclase 8 (brain)	631					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)	p.N631D(1)		NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(21)|lung(67)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(5)|urinary_tract(2)	134	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			CCCACGATATTATCAAAGGGC	0.507										HNSCC(32;0.087)																											p.N631D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1891G	8						.						107.0	94.0	99.0					8																	131916038		2203	4300	6503	131985220	SO:0001583	missense	114	exon7			Z35309	CCDS6363.1	8q24	2013-02-04			ENSG00000155897	ENSG00000155897	4.6.1.1	"""Adenylate cyclases"""	239	protein-coding gene	gene with protein product		103070		ADCY3		8076676	Standard	NM_001115		Approved	HBAC1, AC8	uc003ytd.4	P40145	OTTHUMG00000164756	ENST00000286355.5:c.1891A>G	8.37:g.131916038T>C	ENSP00000286355:p.Asn631Asp		131985220	NM_001115		Missense_Mutation	SNP	ENST00000286355.5	37	CCDS6363.1	.	.	.	.	.	.	.	.	.	.	T	21.0	4.085180	0.76642	.	.	ENSG00000155897	ENST00000286355;ENST00000377928;ENST00000522949	T;T;T	0.81415	-1.49;-1.49;-1.33	6.08	6.08	0.98989	.	0.085300	0.85682	D	0.000000	D	0.85796	0.5780	M	0.62723	1.935	0.41718	D	0.98949	D;B	0.63046	0.992;0.116	P;B	0.57152	0.814;0.085	D	0.85721	0.1325	10	0.42905	T	0.14	.	15.8323	0.78764	0.0:0.0:0.0:1.0	.	631;631	E7EVL1;P40145	.;ADCY8_HUMAN	D	631;631;246	ENSP00000286355:N631D;ENSP00000367161:N631D;ENSP00000428010:N246D	ENSP00000286355:N631D	N	-	1	0	ADCY8	131985220	1.000000	0.71417	1.000000	0.80357	0.770000	0.43624	7.314000	0.78988	2.333000	0.79357	0.482000	0.46254	AAT		0.507	ADCY8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380080.1		
PTPRD	5789	hgsc.bcm.edu	37	9	8518185	8518185	+	Silent	SNP	C	C	T			TCGA-AF-2691-01A-01W-0831-10	TCGA-AF-2691-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	0a041965-3054-4091-9dae-8b6b40cc7a03	0dc37a16-724e-44fe-a593-b1efde8ccf36	g.chr9:8518185C>T	ENST00000381196.4	-	18	1749	c.1206G>A	c.(1204-1206)ggG>ggA	p.G402G	PTPRD_ENST00000397617.3_Silent_p.G392G|PTPRD_ENST00000540109.1_Silent_p.G402G|PTPRD_ENST00000356435.5_Silent_p.G402G|PTPRD_ENST00000397606.3_Silent_p.G392G|PTPRD_ENST00000397611.3_Silent_p.G399G|PTPRD_ENST00000537002.1_Silent_p.G399G|PTPRD_ENST00000360074.4_Silent_p.G389G|PTPRD_ENST00000358503.5_Silent_p.G389G|PTPRD_ENST00000355233.5_Silent_p.G402G|PTPRD_ENST00000486161.1_Silent_p.G402G	NM_002839.3	NP_002830.1	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	402	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				heterophilic cell-cell adhesion (GO:0007157)|neuron differentiation (GO:0030182)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|protein dephosphorylation (GO:0006470)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	cell adhesion molecule binding (GO:0050839)|receptor binding (GO:0005102)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.G402G(1)		NS(1)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(83)|ovary(4)|pancreas(1)|prostate(7)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	168		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		CGCTGGGAGGCCCCCGCCCAA	0.537										TSP Lung(15;0.13)																											p.G399G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1197A	9						.						138.0	134.0	135.0					9																	8518185		2203	4300	6503	8508185	SO:0001819	synonymous_variant	5789	exon9			X54133	CCDS6472.1, CCDS43786.1, CCDS6472.2, CCDS55288.1, CCDS55289.1, CCDS55290.1, CCDS75813.1	9p24.1-p23	2013-02-11			ENSG00000153707	ENSG00000153707		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9668	protein-coding gene	gene with protein product		601598				7896816, 8355697	Standard	NM_002839		Approved	PTPD, HPTP	uc003zkk.3	P23468	OTTHUMG00000021005	ENST00000381196.4:c.1206G>A	9.37:g.8518185C>T			8508185	NM_001040712	B1ALA0|F5GWT7|Q3KPJ0|Q3KPJ1|Q3KPJ2	Silent	SNP	ENST00000381196.4	37	CCDS43786.1																																																																																				0.537	PTPRD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055395.3		
COL15A1	1306	hgsc.bcm.edu	37	9	101788194	101788194	+	Missense_Mutation	SNP	G	G	T			TCGA-AF-2691-01A-01W-0831-10	TCGA-AF-2691-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	0a041965-3054-4091-9dae-8b6b40cc7a03	0dc37a16-724e-44fe-a593-b1efde8ccf36	g.chr9:101788194G>T	ENST00000375001.3	+	16	2412	c.1989G>T	c.(1987-1989)gaG>gaT	p.E663D		NM_001855.3	NP_001846.3	P39059	COFA1_HUMAN	collagen, type XV, alpha 1	663	Collagen-like 1.|Triple-helical region 2 (COL2).				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|signal transduction (GO:0007165)	collagen type XV trimer (GO:0005582)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	extracellular matrix structural constituent (GO:0005201)	p.E663D(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(20)|liver(1)|lung(42)|ovary(6)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	107		Acute lymphoblastic leukemia(62;0.0562)				AGGGCCCTGAGGGACAGCCTG	0.582																																					p.E663D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1989T	9						.						75.0	66.0	69.0					9																	101788194		2203	4300	6503	100828015	SO:0001583	missense	1306	exon16			L25286	CCDS35081.1	9q21-q22	2013-01-16			ENSG00000204291	ENSG00000204291		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2192	protein-coding gene	gene with protein product	"""collagen type XV proteoglycan"""	120325				1427836	Standard	NM_001855		Approved		uc004azb.2	P39059	OTTHUMG00000020351	ENST00000375001.3:c.1989G>T	9.37:g.101788194G>T	ENSP00000364140:p.Glu663Asp		100828015	NM_001855	Q5T6J4|Q9UDC5|Q9Y4W4	Missense_Mutation	SNP	ENST00000375001.3	37	CCDS35081.1	.	.	.	.	.	.	.	.	.	.	G	11.88	1.770986	0.31320	.	.	ENSG00000204291	ENST00000375001;ENST00000536083	D	0.93712	-3.27	4.58	-1.27	0.09347	.	0.587826	0.16489	N	0.212195	T	0.82075	0.4958	N	0.17312	0.475	0.26422	N	0.976083	B	0.18610	0.029	B	0.17098	0.017	T	0.68265	-0.5454	10	0.21014	T	0.42	-7.5686	3.7584	0.08595	0.3961:0.0:0.4292:0.1747	.	663	P39059	COFA1_HUMAN	D	663;633	ENSP00000364140:E663D	ENSP00000364140:E663D	E	+	3	2	COL15A1	100828015	0.997000	0.39634	0.773000	0.31616	0.988000	0.76386	0.294000	0.19047	-0.050000	0.13356	0.491000	0.48974	GAG		0.582	COL15A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053386.3	NM_001855	
ARHGEF6	9459	hgsc.bcm.edu	37	X	135862981	135862981	+	Nonsense_Mutation	SNP	T	T	A			TCGA-AF-2691-01A-01W-0831-10	TCGA-AF-2691-10A-01W-0831-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	0a041965-3054-4091-9dae-8b6b40cc7a03	0dc37a16-724e-44fe-a593-b1efde8ccf36	g.chrX:135862981T>A	ENST00000250617.6	-	1	1266	c.61A>T	c.(61-63)Aaa>Taa	p.K21*		NM_004840.2	NP_004831.1	Q15052	ARHG6_HUMAN	Rac/Cdc42 guanine nucleotide exchange factor (GEF) 6	21	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell junction assembly (GO:0034329)|JNK cascade (GO:0007254)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|intracellular (GO:0005622)|lamellipodium (GO:0030027)	GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.K21*(1)		cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|liver(1)|lung(14)|prostate(1)	38	Acute lymphoblastic leukemia(192;0.000127)					ATGGTCTTTTTAGGGGACTCT	0.463																																					p.K21X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.A61T	X						.						117.0	110.0	112.0					X																	135862981		2203	4300	6503	135690647	SO:0001587	stop_gained	9459	exon1			D13631	CCDS14660.1	Xq26	2013-01-10	2002-05-23		ENSG00000129675	ENSG00000129675		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	685	protein-coding gene	gene with protein product	"""Rac/Cdc42 guanine exchange factor (GEF) 6"", ""PAK-interacting exchange factor, alpha"", ""rho guanine nucleotide exchange factor 6"""	300267	"""mental retardation, X-linked 46"""	MRX46		7584048, 9659915	Standard	NM_004840		Approved	alphaPIX, Cool-2, KIAA0006, alpha-PIX, Cool2	uc004fab.3	Q15052	OTTHUMG00000022518	ENST00000250617.6:c.61A>T	X.37:g.135862981T>A	ENSP00000250617:p.Lys21*		135690647	NM_004840	A6NMW9|A8K6S7|B1AL37|Q15396|Q5JQ66|Q7Z3W1|Q86XH0	Nonsense_Mutation	SNP	ENST00000250617.6	37	CCDS14660.1	.	.	.	.	.	.	.	.	.	.	T	48	14.733252	0.99808	.	.	ENSG00000129675	ENST00000250617	.	.	.	6.04	6.04	0.98038	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.4762	0.75481	0.0:0.0:0.0:1.0	.	.	.	.	X	21	.	ENSP00000250617:K21X	K	-	1	0	ARHGEF6	135690647	1.000000	0.71417	0.996000	0.52242	0.855000	0.48748	7.698000	0.84413	2.039000	0.60335	0.417000	0.27973	AAA		0.463	ARHGEF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058511.2	NM_004840	
CXorf66	347487	hgsc.bcm.edu	37	X	139040347	139040347	+	Missense_Mutation	SNP	T	T	C			TCGA-AF-2691-01A-01W-0831-10	TCGA-AF-2691-10A-01W-0831-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	0a041965-3054-4091-9dae-8b6b40cc7a03	0dc37a16-724e-44fe-a593-b1efde8ccf36	g.chrX:139040347T>C	ENST00000370540.1	-	2	141	c.118A>G	c.(118-120)Aaa>Gaa	p.K40E		NM_001013403.2	NP_001013421.1	Q5JRM2	CX066_HUMAN	chromosome X open reading frame 66	40						integral component of membrane (GO:0016021)		p.K40E(1)		breast(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(13)|skin(1)|stomach(1)	26						TAGTTCAATTTTGTCTGCATT	0.313																																					p.K40E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A118G	X						.						151.0	143.0	146.0					X																	139040347		2203	4300	6503	138868013	SO:0001583	missense	347487	exon2				CCDS35411.1	Xq27.1	2014-05-30			ENSG00000203933	ENSG00000203933			33743	protein-coding gene	gene with protein product	"""secreted glycoprotein, X-linked"""					24709545	Standard	NM_001013403		Approved	RP11-35F15.2, SGPX	uc004fbb.3	Q5JRM2	OTTHUMG00000022539	ENST00000370540.1:c.118A>G	X.37:g.139040347T>C	ENSP00000359571:p.Lys40Glu		138868013	NM_001013403		Missense_Mutation	SNP	ENST00000370540.1	37	CCDS35411.1	.	.	.	.	.	.	.	.	.	.	T	13.51	2.260093	0.39995	.	.	ENSG00000203933	ENST00000370540	T	0.49720	0.77	3.56	2.36	0.29203	.	.	.	.	.	T	0.50463	0.1617	L	0.34521	1.04	0.09310	N	1	D	0.76494	0.999	D	0.67725	0.953	T	0.28459	-1.0043	8	.	.	.	-11.2112	6.115	0.20122	0.0:0.0:0.261:0.739	.	40	Q5JRM2	CX066_HUMAN	E	40	ENSP00000359571:K40E	.	K	-	1	0	CXorf66	138868013	0.000000	0.05858	0.001000	0.08648	0.093000	0.18481	-0.031000	0.12287	0.555000	0.29079	0.430000	0.28490	AAA		0.313	CXorf66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058572.1	NM_001013403	
ZNF645	158506	hgsc.bcm.edu	37	X	22292316	22292316	+	Missense_Mutation	SNP	G	G	T			TCGA-AF-2691-01A-01W-0831-10	TCGA-AF-2691-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	0a041965-3054-4091-9dae-8b6b40cc7a03	0dc37a16-724e-44fe-a593-b1efde8ccf36	g.chrX:22292316G>T	ENST00000323684.1	+	1	1252	c.1208G>T	c.(1207-1209)cGg>cTg	p.R403L		NM_152577.3	NP_689790.1	Q8N7E2	ZN645_HUMAN	zinc finger protein 645	403					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.R403L(1)		cervix(1)|endometrium(4)|large_intestine(8)|lung(9)|ovary(2)|pancreas(1)|skin(1)|urinary_tract(1)	27						CCACCAACGCGGAGTCCACCT	0.458																																					p.R403L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1208T	X						.																																			22202237	SO:0001583	missense	158506	exon1			AK098601	CCDS14205.1	Xp22.11	2014-01-21			ENSG00000175809	ENSG00000175809			26371	protein-coding gene	gene with protein product							Standard	NM_152577		Approved	FLJ25735, HAKAIL, CT138	uc004dai.2	Q8N7E2	OTTHUMG00000021242	ENST00000323684.1:c.1208G>T	X.37:g.22292316G>T	ENSP00000323348:p.Arg403Leu		22202237	NM_152577	A0AV29|A0AV31|E3SBK4|Q6DJY9	Missense_Mutation	SNP	ENST00000323684.1	37	CCDS14205.1	.	.	.	.	.	.	.	.	.	.	G	9.237	1.037232	0.19669	.	.	ENSG00000175809	ENST00000323684	T	0.32023	1.47	2.34	-0.0796	0.13710	.	0.427893	0.23192	U	0.050891	T	0.13030	0.0316	N	0.08118	0	0.09310	N	1	B	0.14012	0.009	B	0.15052	0.012	T	0.15206	-1.0445	10	0.62326	D	0.03	.	5.3193	0.15872	0.6682:0.0:0.3318:0.0	.	403	Q8N7E2	ZN645_HUMAN	L	403	ENSP00000323348:R403L	ENSP00000323348:R403L	R	+	2	0	ZNF645	22202237	1.000000	0.71417	0.000000	0.03702	0.001000	0.01503	2.456000	0.44997	-0.109000	0.12044	-0.340000	0.08031	CGG		0.458	ZNF645-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056037.1	NM_152577	
KLHL4	56062	hgsc.bcm.edu	37	X	86869032	86869032	+	Missense_Mutation	SNP	G	G	A			TCGA-AF-2691-01A-01W-0831-10	TCGA-AF-2691-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	0a041965-3054-4091-9dae-8b6b40cc7a03	0dc37a16-724e-44fe-a593-b1efde8ccf36	g.chrX:86869032G>A	ENST00000373119.4	+	2	720	c.575G>A	c.(574-576)cGc>cAc	p.R192H	KLHL4_ENST00000373114.4_Missense_Mutation_p.R192H	NM_019117.4	NP_061990.2	Q9C0H6	KLHL4_HUMAN	kelch-like family member 4	192	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.					cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.R192H(1)		NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|lung(29)|ovary(2)|prostate(1)|skin(1)	67						GGACACCTCCGCATCCCAGCC	0.368																																					p.R192H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G575A	X						.						110.0	97.0	101.0					X																	86869032		2203	4300	6503	86755688	SO:0001583	missense	56062	exon2			AF284765	CCDS14456.1, CCDS14457.1	Xq21.3	2013-01-30	2013-01-30		ENSG00000102271	ENSG00000102271		"""Kelch-like"", ""BTB/POZ domain containing"""	6355	protein-coding gene	gene with protein product		300348	"""kelch (Drosophila)-like 4"", ""kelch-like 4 (Drosophila)"""			11401425	Standard	NM_019117		Approved	KIAA1687, DKELCHL, KHL4	uc004efa.2	Q9C0H6	OTTHUMG00000021946	ENST00000373119.4:c.575G>A	X.37:g.86869032G>A	ENSP00000362211:p.Arg192His		86755688	NM_057162	B2RTW2|Q9Y3J5	Missense_Mutation	SNP	ENST00000373119.4	37	CCDS14457.1	.	.	.	.	.	.	.	.	.	.	g	11.45	1.642508	0.29246	.	.	ENSG00000102271	ENST00000373119;ENST00000373114	T;T	0.68903	-0.36;-0.36	5.14	0.425	0.16473	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.721802	0.12544	N	0.459631	T	0.55401	0.1918	L	0.60957	1.885	0.09310	N	1	B;B	0.33044	0.395;0.343	B;B	0.29785	0.107;0.104	T	0.51301	-0.8723	10	0.62326	D	0.03	.	4.5665	0.12189	0.4719:0.3108:0.2173:0.0	.	192;192	Q9C0H6;Q9C0H6-2	KLHL4_HUMAN;.	H	192	ENSP00000362211:R192H;ENSP00000362206:R192H	ENSP00000362206:R192H	R	+	2	0	KLHL4	86755688	1.000000	0.71417	0.113000	0.21522	0.703000	0.40648	1.773000	0.38563	0.379000	0.24794	0.502000	0.49764	CGC		0.368	KLHL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057413.1		
MAGEC1	9947	hgsc.bcm.edu	37	X	140994556	140994556	+	Silent	SNP	T	T	C	rs61701368		TCGA-AF-2691-01A-01W-0831-10	TCGA-AF-2691-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	0a041965-3054-4091-9dae-8b6b40cc7a03	0dc37a16-724e-44fe-a593-b1efde8ccf36	g.chrX:140994556T>C	ENST00000285879.4	+	4	1652	c.1366T>C	c.(1366-1368)Ttg>Ctg	p.L456L	MAGEC1_ENST00000406005.2_Intron	NM_005462.4	NP_005453.2	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	456								p.L456L(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(22)|lung(60)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(1)	127	Acute lymphoblastic leukemia(192;6.56e-05)					CTACACTTTATTGAGTCTTTT	0.483										HNSCC(15;0.026)																											p.L456L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1366C	X						.	A		6,3828		1,0,4,1631,566	94.0	104.0	101.0		1366	-0.3	0.0	X	dbSNP_129	101	2,6720		0,0,2,2428,1864	no	coding-synonymous	MAGEC1	NM_005462.4		1,0,6,4059,2430	CC,CT,C,TT,T		0.0298,0.1565,0.0758		456/1143	140994556	8,10548	2202	4294	6496	140822222	SO:0001819	synonymous_variant	9947	exon4			AF064589	CCDS35417.1	Xq26	2009-03-18			ENSG00000155495	ENSG00000155495			6812	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 1"""	300223				9485030, 9618514	Standard	NM_005462		Approved	MAGE-C1, CT7, MGC39366, CT7.1	uc004fbt.3	O60732	OTTHUMG00000022569	ENST00000285879.4:c.1366T>C	X.37:g.140994556T>C			140822222	NM_005462	A0PK03|O75451|Q8TCV4	Silent	SNP	ENST00000285879.4	37	CCDS35417.1																																																																																				0.483	MAGEC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058604.1	NM_005462	
GAB3	139716	hgsc.bcm.edu	37	X	153940899	153940899	+	Missense_Mutation	SNP	T	T	G			TCGA-AF-2691-01A-01W-0831-10	TCGA-AF-2691-10A-01W-0831-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	0a041965-3054-4091-9dae-8b6b40cc7a03	0dc37a16-724e-44fe-a593-b1efde8ccf36	g.chrX:153940899T>G	ENST00000369575.3	-	4	702	c.671A>C	c.(670-672)gAc>gCc	p.D224A	GAB3_ENST00000496390.1_Intron|GAB3_ENST00000424127.2_Missense_Mutation_p.D225A	NM_001081573.1|NM_080612.2	NP_001075042.1|NP_542179.1	Q8WWW8	GAB3_HUMAN	GRB2-associated binding protein 3	224					macrophage differentiation (GO:0030225)			p.D224A(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(7)|lung(6)|ovary(2)|prostate(1)|skin(1)	25	all_cancers(53;8.15e-17)|all_epithelial(53;1.1e-10)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					CTGCAGGCAGTCAACAAAAAC	0.537																																					p.D225A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A674C	X						.						81.0	78.0	79.0					X																	153940899		2203	4300	6503	153594093	SO:0001583	missense	139716	exon4			AY057989	CCDS14760.1, CCDS48198.1, CCDS65357.1	Xq28	2013-01-10			ENSG00000160219	ENSG00000160219		"""Pleckstrin homology (PH) domain containing"""	17515	protein-coding gene	gene with protein product	"""DOS/Gab family member 3"", ""Gab3 scaffolding protein"""	300482				11739737	Standard	XM_005274648		Approved		uc004fmk.1	Q8WWW8	OTTHUMG00000024245	ENST00000369575.3:c.671A>C	X.37:g.153940899T>G	ENSP00000358588:p.Asp224Ala		153594093	NM_001081573	A6NHF8|E9PB44	Missense_Mutation	SNP	ENST00000369575.3	37	CCDS14760.1	.	.	.	.	.	.	.	.	.	.	T	16.20	3.057261	0.55325	.	.	ENSG00000160219	ENST00000369575;ENST00000369568;ENST00000424127	T;T;T	0.33654	1.4;1.4;1.4	5.53	5.53	0.82687	.	0.044671	0.85682	D	0.000000	T	0.59689	0.2212	M	0.77616	2.38	0.80722	D	1	D;P;P	0.89917	1.0;0.911;0.911	D;P;P	0.83275	0.996;0.609;0.609	T	0.61715	-0.7006	10	0.44086	T	0.13	-1.5326	12.3926	0.55366	0.0:0.0:0.0:1.0	.	225;225;224	A6NHF8;E9PB44;Q8WWW8	.;.;GAB3_HUMAN	A	224;225;225	ENSP00000358588:D224A;ENSP00000358581:D225A;ENSP00000399588:D225A	ENSP00000358581:D225A	D	-	2	0	GAB3	153594093	1.000000	0.71417	0.222000	0.23844	0.485000	0.33311	5.108000	0.64609	1.831000	0.53308	0.412000	0.27726	GAC		0.537	GAB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061192.2	NM_001081573	
