#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
RSU1	6251	hgsc.bcm.edu	37	10	16796931	16796931	+	Silent	SNP	A	A	T			TCGA-AG-3612-01A-01W-0833-10	TCGA-AG-3612-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	93a27bfa-33be-4eec-863e-5c85a11493e2	e350ce5e-3bd3-4c1a-a212-a3b2294e180c	g.chr10:16796931A>T	ENST00000377921.3	-	4	640	c.339T>A	c.(337-339)gtT>gtA	p.V113V	RSU1_ENST00000602389.1_Silent_p.V60V|RSU1_ENST00000345264.5_Silent_p.V113V|RSU1_ENST00000464074.2_5'UTR			Q15404	RSU1_HUMAN	Ras suppressor protein 1	113					cell junction assembly (GO:0034329)|positive regulation of neural precursor cell proliferation (GO:2000179)|Ras protein signal transduction (GO:0007265)|signal transduction (GO:0007165)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)		p.V113V(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(7)|stomach(1)|upper_aerodigestive_tract(1)	14				GBM - Glioblastoma multiforme(1;7.54e-08)		TCAAGTCCAGAACCTCAAGAG	0.448																																					p.V60V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T180A	10						.						82.0	91.0	88.0					10																	16796931		2203	4300	6503	16836937	SO:0001819	synonymous_variant	6251	exon4			AK055596	CCDS7112.1, CCDS31157.1	10p13	2012-09-20			ENSG00000148484	ENSG00000148484			10464	protein-coding gene	gene with protein product		179555				8288261	Standard	NM_152724		Approved	RSP-1, FLJ31034	uc001iol.3	Q15404	OTTHUMG00000017740	ENST00000377921.3:c.339T>A	10.37:g.16796931A>T			16836937	NM_152724	A8KA46|D3DRU3|Q6FI17	Silent	SNP	ENST00000377921.3	37	CCDS7112.1																																																																																				0.448	RSU1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047006.1	NM_012425, NM_152724	
CUBN	8029	hgsc.bcm.edu	37	10	16992025	16992025	+	Silent	SNP	G	G	A	rs565623595		TCGA-AG-3612-01A-01W-0833-10	TCGA-AG-3612-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	93a27bfa-33be-4eec-863e-5c85a11493e2	e350ce5e-3bd3-4c1a-a212-a3b2294e180c	g.chr10:16992025G>A	ENST00000377833.4	-	34	5120	c.5055C>T	c.(5053-5055)ggC>ggT	p.G1685G		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	1685	CUB 11. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)	p.G1685G(1)		breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	CTTCGTGGCCGCCATCCAAAA	0.448													g|||	1	0.000199681	0.0	0.0	5008	,	,		16066	0.0		0.0	False		,,,				2504	0.001				p.G1685G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C5055T	10						.						74.0	67.0	69.0					10																	16992025		2203	4300	6503	17032031	SO:0001819	synonymous_variant	8029	exon34			AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.5055C>T	10.37:g.16992025G>A			17032031	NM_001081	B0YIZ4|Q5VTA6|Q96RU9	Silent	SNP	ENST00000377833.4	37	CCDS7113.1																																																																																				0.448	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	NM_001081	
RASSF4	83937	hgsc.bcm.edu	37	10	45485159	45485159	+	Silent	SNP	C	C	T			TCGA-AG-3612-01A-01W-0833-10	TCGA-AG-3612-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	93a27bfa-33be-4eec-863e-5c85a11493e2	e350ce5e-3bd3-4c1a-a212-a3b2294e180c	g.chr10:45485159C>T	ENST00000340258.5	+	8	788	c.675C>T	c.(673-675)caC>caT	p.H225H	RASSF4_ENST00000472561.1_3'UTR|RASSF4_ENST00000334940.6_Silent_p.H234H|RASSF4_ENST00000374417.2_3'UTR	NM_032023.3	NP_114412.2	Q8WYP3	RIN2_HUMAN	Ras association (RalGDS/AF-6) domain family member 4	0					endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of catalytic activity (GO:0050790)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	GTPase activator activity (GO:0005096)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|small GTPase regulator activity (GO:0005083)	p.H225H(1)		NS(1)|endometrium(2)|large_intestine(6)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16						ACATCGTTCACGAGTCTGGGG	0.547																																					p.H225H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C675T	10						.						138.0	109.0	119.0					10																	45485159		2203	4300	6503	44805165	SO:0001819	synonymous_variant	83937	exon8			BC032593	CCDS7208.1	10q11.1	2008-02-22	2008-02-22		ENSG00000107551	ENSG00000107551			20793	protein-coding gene	gene with protein product		610559					Standard	NM_032023		Approved	AD037, MGC44914	uc001jbo.3	Q9H2L5	OTTHUMG00000018060	ENST00000340258.5:c.675C>T	10.37:g.45485159C>T			44805165	NM_032023	Q00425|Q5TFT8|Q9BQL3|Q9H071	Silent	SNP	ENST00000340258.5	37	CCDS7208.1																																																																																				0.547	RASSF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047745.2	NM_032023	
SFTPD	6441	hgsc.bcm.edu	37	10	81706265	81706265	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3612-01A-01W-0833-10	TCGA-AG-3612-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	93a27bfa-33be-4eec-863e-5c85a11493e2	e350ce5e-3bd3-4c1a-a212-a3b2294e180c	g.chr10:81706265C>T	ENST00000372292.3	-	2	191	c.151G>A	c.(151-153)Gat>Aat	p.D51N		NM_003019.4	NP_003010.4	P35247	SFTPD_HUMAN	surfactant protein D	51	Collagen-like.				defense response to bacterium (GO:0042742)|innate immune response (GO:0045087)|lung alveolus development (GO:0048286)|macrophage chemotaxis (GO:0048246)|negative regulation of interleukin-2 biosynthetic process (GO:0045085)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of phagocytosis (GO:0050766)|reactive oxygen species metabolic process (GO:0072593)|receptor-mediated endocytosis (GO:0006898)|regulation of cytokine production (GO:0001817)|respiratory gaseous exchange (GO:0007585)|surfactant homeostasis (GO:0043129)	collagen trimer (GO:0005581)|endocytic vesicle (GO:0030139)|extracellular region (GO:0005576)|lysosome (GO:0005764)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)	p.D51N(1)		endometrium(1)|kidney(3)|large_intestine(5)|lung(3)|skin(4)|urinary_tract(1)	17	Breast(12;0.000615)|Prostate(51;0.0095)|all_epithelial(25;0.027)		Epithelial(14;0.0244)|all cancers(16;0.0558)|Colorectal(32;0.109)			TCCCGTCCATCGCGACCAGGC	0.607																																					p.D51N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G151A	10						.						80.0	70.0	73.0					10																	81706265		2203	4300	6503	81696245	SO:0001583	missense	6441	exon2			L05485	CCDS7362.1	10q22.2-q23.1	2012-11-02	2008-08-26		ENSG00000133661	ENSG00000133661		"""Collectins"""	10803	protein-coding gene	gene with protein product		178635	"""surfactant, pulmonary-associated protein D"""	SFTP4		1898081, 1339284	Standard	NM_003019		Approved	SP-D, COLEC7	uc001kbh.3	P35247	OTTHUMG00000018590	ENST00000372292.3:c.151G>A	10.37:g.81706265C>T	ENSP00000361366:p.Asp51Asn		81696245	NM_003019	Q5T0M3|Q6FH08|Q86YK9|Q8TCD8|Q9UCJ2|Q9UCJ3	Missense_Mutation	SNP	ENST00000372292.3	37	CCDS7362.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.075409	0.76415	.	.	ENSG00000133661	ENST00000372292;ENST00000444384	D;D	0.90504	-2.68;-2.68	5.53	4.63	0.57726	.	0.000000	0.64402	D	0.000016	D	0.86493	0.5946	L	0.50993	1.605	0.35204	D	0.774514	P	0.46784	0.884	B	0.40165	0.321	D	0.87726	0.2576	10	0.28530	T	0.3	-16.3504	11.9983	0.53216	0.0:0.915:0.0:0.085	.	51	P35247	SFTPD_HUMAN	N	51;64	ENSP00000361366:D51N;ENSP00000394325:D64N	ENSP00000361366:D51N	D	-	1	0	SFTPD	81696245	0.958000	0.32768	0.853000	0.33588	0.540000	0.34992	2.138000	0.42140	1.336000	0.45506	0.655000	0.94253	GAT		0.607	SFTPD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049011.1		
KIF11	3832	hgsc.bcm.edu	37	10	94353174	94353174	+	Silent	SNP	G	G	A			TCGA-AG-3612-01A-01W-0833-10	TCGA-AG-3612-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	93a27bfa-33be-4eec-863e-5c85a11493e2	e350ce5e-3bd3-4c1a-a212-a3b2294e180c	g.chr10:94353174G>A	ENST00000260731.3	+	1	132	c.42G>A	c.(40-42)gaG>gaA	p.E14E		NM_004523.3	NP_004514.2	P52732	KIF11_HUMAN	kinesin family member 11	14					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|chromosome segregation (GO:0007059)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic centrosome separation (GO:0007100)|mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|spindle assembly involved in mitosis (GO:0090307)|spindle organization (GO:0007051)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|spindle (GO:0005819)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)|protein complex binding (GO:0032403)|protein kinase binding (GO:0019901)	p.E14E(1)		breast(1)|endometrium(5)|kidney(2)|large_intestine(9)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						AGAAAGAGGAGAAGGGGAAGA	0.637																																					p.E14E	Colon(47;212 1003 2764 4062 8431)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G42A	10						.						76.0	66.0	70.0					10																	94353174		2203	4300	6503	94343154	SO:0001819	synonymous_variant	3832	exon1			X85137	CCDS7422.1	10q24.1	2008-03-03	2003-01-09	2003-01-10	ENSG00000138160	ENSG00000138160		"""Kinesins"""	6388	protein-coding gene	gene with protein product		148760	"""kinesin-like 1"""	KNSL1		1505978, 8548803	Standard	NM_004523		Approved	Eg5, HKSP, TRIP5	uc001kic.3	P52732	OTTHUMG00000018761	ENST00000260731.3:c.42G>A	10.37:g.94353174G>A			94343154	NM_004523	A0AV49|B2RMV3|Q15716|Q5VWX0	Silent	SNP	ENST00000260731.3	37	CCDS7422.1																																																																																				0.637	KIF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049401.1	NM_004523	
ABCC2	1244	hgsc.bcm.edu	37	10	101567927	101567927	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-3612-01A-01W-0833-10	TCGA-AG-3612-10A-01W-0833-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	93a27bfa-33be-4eec-863e-5c85a11493e2	e350ce5e-3bd3-4c1a-a212-a3b2294e180c	g.chr10:101567927T>A	ENST00000370449.4	+	13	1869	c.1756T>A	c.(1756-1758)Ttc>Atc	p.F586I		NM_000392.3	NP_000383	Q92887	MRP2_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 2	586	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				cellular chloride ion homeostasis (GO:0030644)|drug transmembrane transport (GO:0006855)|prostaglandin transport (GO:0015732)|response to arsenic-containing substance (GO:0046685)|response to estrogen (GO:0043627)|response to heat (GO:0009408)|response to methotrexate (GO:0031427)|response to oxidative stress (GO:0006979)|thyroid hormone transport (GO:0070327)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)	p.F586I(1)		NS(1)|breast(5)|endometrium(9)|kidney(2)|large_intestine(20)|liver(1)|lung(20)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	67		Colorectal(252;0.234)		Epithelial(162;2.77e-10)|all cancers(201;2.47e-08)	Adenosine triphosphate(DB00171)|Aminohippurate(DB00345)|Arsenic trioxide(DB01169)|Atorvastatin(DB01076)|Canagliflozin(DB08907)|Carbamazepine(DB00564)|Carboplatin(DB00958)|Cisplatin(DB00515)|Clotrimazole(DB00257)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dexamethasone(DB01234)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Eprosartan(DB00876)|Ethinyl Estradiol(DB00977)|Etoposide(DB00773)|Ezetimibe(DB00973)|Furosemide(DB00695)|Fusidic Acid(DB02703)|Gadoxetate(DB08884)|Glutathione(DB00143)|Glyburide(DB01016)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Ivermectin(DB00602)|Lamivudine(DB00709)|Leucovorin(DB00650)|Levetiracetam(DB01202)|Lomefloxacin(DB00978)|Lovastatin(DB00227)|Methotrexate(DB00563)|Mycophenolate mofetil(DB00688)|Nifedipine(DB01115)|Norgestimate(DB00957)|Ofloxacin(DB01165)|Olmesartan(DB00275)|Oxaliplatin(DB00526)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pitavastatin(DB08860)|Pranlukast(DB01411)|Pravastatin(DB00175)|Probenecid(DB01032)|Quinidine(DB00908)|Reserpine(DB00206)|Rifampicin(DB01045)|Ritonavir(DB00503)|Saquinavir(DB01232)|Simvastatin(DB00641)|Sorafenib(DB00398)|Sparfloxacin(DB01208)|Spironolactone(DB00421)|Sulfasalazine(DB00795)|Sulfinpyrazone(DB01138)|Sunitinib(DB01268)|Tamoxifen(DB00675)|Telmisartan(DB00966)|Tenofovir(DB00300)|Tetrahydrofolic acid(DB00116)|Ursodeoxycholic acid(DB01586)|Vasopressin(DB00067)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)	CATTACCCTCTTCAATATCCT	0.478																																					p.F586I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1756A	10						.						272.0	236.0	248.0					10																	101567927		2203	4300	6503	101557917	SO:0001583	missense	1244	exon13			U63970	CCDS7484.1	10q24	2012-03-14			ENSG00000023839	ENSG00000023839		"""ATP binding cassette transporters / subfamily C"""	53	protein-coding gene	gene with protein product		601107	"""canalicular multispecific organic anion transporter 1"""	CMOAT		8797578, 9284939	Standard	XM_006717630		Approved	DJS, MRP2, cMRP	uc001kqf.2	Q92887	OTTHUMG00000018895	ENST00000370449.4:c.1756T>A	10.37:g.101567927T>A	ENSP00000359478:p.Phe586Ile		101557917	NM_000392	B2RMT8|Q14022|Q5T2B1|Q92500|Q92798|Q99663|Q9UMS2	Missense_Mutation	SNP	ENST00000370449.4	37	CCDS7484.1	.	.	.	.	.	.	.	.	.	.	T	25.2	4.608367	0.87258	.	.	ENSG00000023839	ENST00000370449	T	0.12984	2.63	5.73	5.73	0.89815	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.000000	0.85682	D	0.000000	T	0.45856	0.1363	M	0.90542	3.125	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	T	0.54323	-0.8311	10	0.54805	T	0.06	-22.5997	15.9985	0.80270	0.0:0.0:0.0:1.0	.	586	Q92887	MRP2_HUMAN	I	586	ENSP00000359478:F586I	ENSP00000359478:F586I	F	+	1	0	ABCC2	101557917	1.000000	0.71417	1.000000	0.80357	0.667000	0.39255	6.295000	0.72744	2.183000	0.69458	0.459000	0.35465	TTC		0.478	ABCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049825.1	NM_000392	
OR4C11	219429	hgsc.bcm.edu	37	11	55371516	55371516	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3612-01A-01W-0833-10	TCGA-AG-3612-10A-01W-0833-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	93a27bfa-33be-4eec-863e-5c85a11493e2	e350ce5e-3bd3-4c1a-a212-a3b2294e180c	g.chr11:55371516C>A	ENST00000302231.4	-	1	358	c.334G>T	c.(334-336)Gtc>Ttc	p.V112F		NM_001004700.2	NP_001004700.2	Q6IEV9	OR4CB_HUMAN	olfactory receptor, family 4, subfamily C, member 11	112						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V112F(1)		endometrium(1)|kidney(1)|large_intestine(5)|lung(23)|ovary(1)|prostate(1)|skin(1)	33						AGAATGAGGACAAAGATCTCC	0.428																																					p.V112F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G334T	11						.						103.0	86.0	92.0					11																	55371516		2179	4005	6184	55128092	SO:0001583	missense	219429	exon1			AB065774	CCDS31503.1	11q11	2012-08-09		2004-03-10	ENSG00000172188	ENSG00000172188		"""GPCR / Class A : Olfactory receptors"""	15167	protein-coding gene	gene with protein product				OR4C11P			Standard	NM_001004700		Approved		uc010rii.2	Q6IEV9	OTTHUMG00000165290	ENST00000302231.4:c.334G>T	11.37:g.55371516C>A	ENSP00000306651:p.Val112Phe		55128092	NM_001004700	B9EIL4|Q8NGL8	Missense_Mutation	SNP	ENST00000302231.4	37	CCDS31503.1	.	.	.	.	.	.	.	.	.	.	C	11.75	1.733093	0.30684	.	.	ENSG00000172188	ENST00000302231	T	0.01133	5.29	4.34	2.41	0.29592	GPCR, rhodopsin-like superfamily (1);	0.155734	0.29799	U	0.011169	T	0.01870	0.0059	L	0.31294	0.92	0.09310	N	0.999995	D	0.58620	0.983	P	0.56563	0.801	T	0.48422	-0.9037	10	0.87932	D	0	.	4.8604	0.13581	0.0:0.6262:0.1756:0.1981	.	112	Q6IEV9	OR4CB_HUMAN	F	112	ENSP00000306651:V112F	ENSP00000306651:V112F	V	-	1	0	OR4C11	55128092	0.000000	0.05858	0.950000	0.38849	0.235000	0.25334	-3.615000	0.00414	0.563000	0.29222	0.478000	0.44815	GTC		0.428	OR4C11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383268.1	NM_001004700	
CLECL1	160365	hgsc.bcm.edu	37	12	9875397	9875397	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-3612-01A-01W-0833-10	TCGA-AG-3612-10A-01W-0833-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	93a27bfa-33be-4eec-863e-5c85a11493e2	e350ce5e-3bd3-4c1a-a212-a3b2294e180c	g.chr12:9875397A>G	ENST00000327839.3	-	2	363	c.329T>C	c.(328-330)tTt>tCt	p.F110S		NM_172004.3	NP_742001.1	Q8IZS7	CLCL1_HUMAN	C-type lectin-like 1	110						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)	p.F110S(1)		breast(1)|kidney(1)|large_intestine(4)|lung(3)	9						GACAGTAGAAAAGTTGAAAGA	0.328																																					p.F110S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T329C	12						.						55.0	51.0	52.0					12																	9875397		2203	4299	6502	9766664	SO:0001583	missense	160365	exon2			AF518873	CCDS8603.1, CCDS73441.1	12p13.31	2007-06-21				ENSG00000184293			24462	protein-coding gene	gene with protein product	"""dendritic cell associated lectin 1"""	607467				12421943	Standard	NM_172004		Approved	DCAL1	uc001qwi.3	Q8IZS7		ENST00000327839.3:c.329T>C	12.37:g.9875397A>G	ENSP00000331766:p.Phe110Ser		9766664	NM_172004		Missense_Mutation	SNP	ENST00000327839.3	37	CCDS8603.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	3.357|3.357	-0.131378|-0.131378	0.06753|0.06753	.|.	.|.	ENSG00000184293|ENSG00000184293	ENST00000542530|ENST00000327839	T|T	0.15139|0.15952	2.45|2.38	2.49|2.49	-0.559|-0.559	0.11792|0.11792	.|.	.|.	.|.	.|.	.|.	T|T	0.10895|0.10895	0.0266|0.0266	L|L	0.39898|0.39898	1.24|1.24	0.09310|0.09310	N|N	1|1	.|B	.|0.06786	.|0.001	.|B	.|0.04013	.|0.001	T|T	0.36016|0.36016	-0.9765|-0.9765	6|8	.|.	.|.	.|.	.|.	2.8791|2.8791	0.05641|0.05641	0.311:0.2443:0.4447:0.0|0.311:0.2443:0.4447:0.0	.|.	.|110	.|Q8IZS7	.|CLCL1_HUMAN	L|S	62|110	ENSP00000438981:F62L|ENSP00000331766:F110S	.|.	F|F	-|-	1|2	0|0	CLECL1|CLECL1	9766664|9766664	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.003000|0.003000	0.03518|0.03518	-0.547000|-0.547000	0.06055|0.06055	-0.135000|-0.135000	0.11495|0.11495	-0.244000|-0.244000	0.11960|0.11960	TTT|TTT		0.328	CLECL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399815.1	NM_172004	
VDR	7421	hgsc.bcm.edu	37	12	48238710	48238710	+	Missense_Mutation	SNP	C	C	T	rs376903517		TCGA-AG-3612-01A-01W-0833-10	TCGA-AG-3612-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	93a27bfa-33be-4eec-863e-5c85a11493e2	e350ce5e-3bd3-4c1a-a212-a3b2294e180c	g.chr12:48238710C>T	ENST00000395324.2	-	10	1371	c.1103G>A	c.(1102-1104)cGc>cAc	p.R368H	VDR_ENST00000535672.1_Missense_Mutation_p.R336H|VDR_ENST00000549336.1_Missense_Mutation_p.R368H|VDR_ENST00000550325.1_Missense_Mutation_p.R418H|VDR_ENST00000229022.3_Missense_Mutation_p.R368H			P11473	VDR_HUMAN	vitamin D (1,25- dihydroxyvitamin D3) receptor	368	Ligand-binding.				bile acid signaling pathway (GO:0038183)|calcium ion transport (GO:0006816)|cell morphogenesis (GO:0000902)|cellular calcium ion homeostasis (GO:0006874)|decidualization (GO:0046697)|gene expression (GO:0010467)|intestinal absorption (GO:0050892)|lactation (GO:0007595)|mammary gland branching involved in pregnancy (GO:0060745)|negative regulation of cell proliferation (GO:0008285)|negative regulation of keratinocyte proliferation (GO:0010839)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|organ morphogenesis (GO:0009887)|positive regulation of apoptotic process involved in mammary gland involution (GO:0060058)|positive regulation of gene expression (GO:0010628)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vitamin D 24-hydroxylase activity (GO:0010980)|regulation of calcidiol 1-monooxygenase activity (GO:0060558)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|transcription initiation from RNA polymerase II promoter (GO:0006367)|vitamin D receptor signaling pathway (GO:0070561)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	calcitriol binding (GO:1902098)|calcitriol receptor activity (GO:0008434)|DNA binding (GO:0003677)|lithocholic acid binding (GO:1902121)|lithocholic acid receptor activity (GO:0038186)|retinoid X receptor binding (GO:0046965)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)	p.R368H(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(10)|ovary(3)|skin(2)	22		Acute lymphoblastic leukemia(13;0.109)|all_hematologic(14;0.214)		GBM - Glioblastoma multiforme(48;0.17)	Alfacalcidol(DB01436)|Calcidiol(DB00146)|Calcipotriol(DB02300)|Calcitriol(DB00136)|Cholecalciferol(DB00169)|Dihydrotachysterol(DB01070)|Ergocalciferol(DB00153)|Paricalcitol(DB00910)	GTGGCGGCAGCGGATGTACGT	0.632																																					p.R368H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1103A	12						.						103.0	112.0	109.0					12																	48238710		2203	4299	6502	46524977	SO:0001583	missense	7421	exon10			J03258	CCDS8757.1, CCDS55820.1	12q12-q14	2014-06-13				ENSG00000111424		"""Nuclear hormone receptors"""	12679	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 163"""	601769				1662663	Standard	NM_001017536		Approved	NR1I1, PPP1R163	uc001rql.3	P11473		ENST00000395324.2:c.1103G>A	12.37:g.48238710C>T	ENSP00000378734:p.Arg368His		46524977	NM_000376	B2R5Q1|G3V1V9|Q5PSV3	Missense_Mutation	SNP	ENST00000395324.2	37	CCDS8757.1	.	.	.	.	.	.	.	.	.	.	C	13.51	2.258548	0.39896	.	.	ENSG00000111424	ENST00000395324;ENST00000229022;ENST00000549336;ENST00000550325;ENST00000535672	D;D;D;D;D	0.96685	-4.09;-4.09;-4.09;-4.09;-4.09	4.05	4.05	0.47172	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.177032	0.50627	D	0.000109	D	0.94843	0.8334	M	0.73962	2.25	0.49299	D	0.99977	B;B;B	0.20671	0.017;0.015;0.047	B;B;B	0.21546	0.022;0.035;0.024	D	0.93182	0.6575	10	0.51188	T	0.08	.	10.6927	0.45882	0.1912:0.8088:0.0:0.0	.	336;368;418	B4DRV7;P11473;G3V1V9	.;VDR_HUMAN;.	H	368;368;368;418;336	ENSP00000378734:R368H;ENSP00000229022:R368H;ENSP00000449573:R368H;ENSP00000447173:R418H;ENSP00000442145:R336H	ENSP00000229022:R368H	R	-	2	0	VDR	46524977	0.999000	0.42202	1.000000	0.80357	0.523000	0.34469	1.000000	0.29770	2.268000	0.75426	0.462000	0.41574	CGC		0.632	VDR-001	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406433.1		
GPN3	51184	hgsc.bcm.edu	37	12	110897524	110897524	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3612-01A-01W-0833-10	TCGA-AG-3612-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	93a27bfa-33be-4eec-863e-5c85a11493e2	e350ce5e-3bd3-4c1a-a212-a3b2294e180c	g.chr12:110897524C>T	ENST00000228827.3	-	3	363	c.301G>A	c.(301-303)Gac>Aac	p.D101N	GPN3_ENST00000543199.1_Missense_Mutation_p.D140N|GPN3_ENST00000537466.2_Missense_Mutation_p.D111N|GPN3_ENST00000552180.1_5'Flank	NM_016301.3	NP_057385.3			GPN-loop GTPase 3									p.D101N(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|urinary_tract(1)	8						AGGATATAGTCGTCCTCTACA	0.418																																					p.D101N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G301A	12						.						140.0	133.0	135.0					12																	110897524		2203	4300	6503	109381907	SO:0001583	missense	51184	exon3			BC008416	CCDS9147.1, CCDS53830.1, CCDS53831.1	12q24.11	2012-12-18	2008-04-30	2008-04-30	ENSG00000111231	ENSG00000111231		"""GPN-loop GTPases"""	30186	protein-coding gene	gene with protein product			"""ATP binding domain 1 family, member C"""	ATPBD1C		12975309	Standard	NM_016301		Approved	MGC14560	uc021rdu.1	Q9UHW5	OTTHUMG00000169524	ENST00000228827.3:c.301G>A	12.37:g.110897524C>T	ENSP00000228827:p.Asp101Asn		109381907	NM_016301		Missense_Mutation	SNP	ENST00000228827.3	37	CCDS9147.1	.	.	.	.	.	.	.	.	.	.	C	28.1	4.888394	0.91814	.	.	ENSG00000111231	ENST00000228827;ENST00000543199;ENST00000537466;ENST00000550974	T;T;T;T	0.25250	1.81;1.81;1.81;1.81	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	T	0.55162	0.1903	M	0.75085	2.285	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.998	T	0.55692	-0.8101	10	0.87932	D	0	-20.9086	20.089	0.97809	0.0:1.0:0.0:0.0	.	111;101	Q9UHW5-2;Q9UHW5	.;GPN3_HUMAN	N	101;140;111;79	ENSP00000228827:D101N;ENSP00000442770:D140N;ENSP00000443068:D111N;ENSP00000447480:D79N	ENSP00000228827:D101N	D	-	1	0	GPN3	109381907	1.000000	0.71417	0.997000	0.53966	0.476000	0.33039	7.356000	0.79445	2.765000	0.95021	0.591000	0.81541	GAC		0.418	GPN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404607.1	NM_016301	
SOHLH2	54937	hgsc.bcm.edu	37	13	36744713	36744713	+	Silent	SNP	G	G	A	rs550456759		TCGA-AG-3612-01A-01W-0833-10	TCGA-AG-3612-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	93a27bfa-33be-4eec-863e-5c85a11493e2	e350ce5e-3bd3-4c1a-a212-a3b2294e180c	g.chr13:36744713G>A	ENST00000379881.3	-	10	1300	c.1212C>T	c.(1210-1212)tgC>tgT	p.C404C	SOHLH2_ENST00000554962.1_Silent_p.C481C|CCDC169-SOHLH2_ENST00000511166.1_Silent_p.C481C	NM_017826.2	NP_060296.2	Q9NX45	SOLH2_HUMAN	spermatogenesis and oogenesis specific basic helix-loop-helix 2	404					multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.C404C(1)		autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(13)|lung(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.184)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;4.63e-08)|Epithelial(112;2.67e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00272)|BRCA - Breast invasive adenocarcinoma(63;0.00685)|GBM - Glioblastoma multiforme(144;0.0273)		ACCCAGAAGTGCAGTGCCGAG	0.517																																					p.C404C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1212T	13						.						84.0	71.0	75.0					13																	36744713		2203	4300	6503	35642713	SO:0001819	synonymous_variant	54937	exon10			AK000456	CCDS9355.1, CCDS61309.1	13q13.3	2013-05-21			ENSG00000120669	ENSG00000120669		"""Basic helix-loop-helix proteins"""	26026	protein-coding gene	gene with protein product	"""spermatogenesis associated 28"""					12477932	Standard	NM_017826		Approved	FLJ20449, TEB1, bHLHe81, SPATA28		Q9NX45	OTTHUMG00000016728	ENST00000379881.3:c.1212C>T	13.37:g.36744713G>A			35642713	NM_017826	B4DX90|Q5EGC3|Q8TC74|Q96QX4	Silent	SNP	ENST00000379881.3	37	CCDS9355.1																																																																																				0.517	SOHLH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044477.2	NM_017826	
FREM2	341640	hgsc.bcm.edu	37	13	39265931	39265931	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AG-3612-01A-01W-0833-10	TCGA-AG-3612-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	93a27bfa-33be-4eec-863e-5c85a11493e2	e350ce5e-3bd3-4c1a-a212-a3b2294e180c	g.chr13:39265931C>T	ENST00000280481.7	+	1	4666	c.4450C>T	c.(4450-4452)Cag>Tag	p.Q1484*		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	1484					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.Q1484*(1)		NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		GTCTTTCACTCAGCTGCAACT	0.483																																					p.Q1484X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C4450T	13						.						90.0	77.0	82.0					13																	39265931		2203	4300	6503	38163931	SO:0001587	stop_gained	341640	exon1			BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.4450C>T	13.37:g.39265931C>T	ENSP00000280481:p.Gln1484*		38163931	NM_207361	Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Nonsense_Mutation	SNP	ENST00000280481.7	37	CCDS31960.1	.	.	.	.	.	.	.	.	.	.	C	46	12.324773	0.99657	.	.	ENSG00000150893	ENST00000280481	.	.	.	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	20.0826	0.97783	0.0:1.0:0.0:0.0	.	.	.	.	X	1484	.	ENSP00000280481:Q1484X	Q	+	1	0	FREM2	38163931	1.000000	0.71417	1.000000	0.80357	0.882000	0.50991	7.814000	0.86154	2.746000	0.94184	0.655000	0.94253	CAG		0.483	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044599.2	NM_207361	
RNF219	79596	hgsc.bcm.edu	37	13	79213138	79213138	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3612-01A-01W-0833-10	TCGA-AG-3612-10A-01W-0833-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	93a27bfa-33be-4eec-863e-5c85a11493e2	e350ce5e-3bd3-4c1a-a212-a3b2294e180c	g.chr13:79213138C>A	ENST00000282003.6	-	4	427	c.369G>T	c.(367-369)caG>caT	p.Q123H		NM_024546.3	NP_078822.3	Q5W0B1	RN219_HUMAN	ring finger protein 219	123							zinc ion binding (GO:0008270)	p.Q123H(1)		breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(11)|liver(1)|lung(11)|prostate(1)|skin(1)	32		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.0848)		GBM - Glioblastoma multiforme(99;0.0414)		TAGTTTTGATCTGTGACTCCA	0.383																																					p.Q123H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G369T	13						.						133.0	128.0	129.0					13																	79213138		2203	4300	6503	78111139	SO:0001583	missense	79596	exon4			BC028586	CCDS31997.1	13q31.1	2011-05-23	2008-03-26	2008-03-26	ENSG00000152193	ENSG00000152193		"""RING-type (C3HC4) zinc fingers"""	20308	protein-coding gene	gene with protein product		615906	"""chromosome 13 open reading frame 7"""	C13orf7			Standard	XM_006719865		Approved	FLJ13449	uc001vkw.1	Q5W0B1	OTTHUMG00000017122	ENST00000282003.6:c.369G>T	13.37:g.79213138C>A	ENSP00000282003:p.Gln123His		78111139	NM_024546	B2RN99|Q8TBY2|Q9H0T2|Q9H8M0	Missense_Mutation	SNP	ENST00000282003.6	37	CCDS31997.1	.	.	.	.	.	.	.	.	.	.	C	13.15	2.152490	0.38021	.	.	ENSG00000152193	ENST00000282003	.	.	.	5.38	2.5	0.30297	.	0.191546	0.45867	D	0.000321	T	0.30634	0.0771	N	0.17082	0.46	0.35911	D	0.831126	B	0.26775	0.159	B	0.19148	0.024	T	0.30736	-0.9968	9	0.42905	T	0.14	-4.7486	7.2706	0.26254	0.1209:0.6784:0.0:0.2007	.	123	Q5W0B1	RN219_HUMAN	H	123	.	ENSP00000282003:Q123H	Q	-	3	2	RNF219	78111139	0.991000	0.36638	1.000000	0.80357	0.993000	0.82548	0.287000	0.18920	1.272000	0.44329	0.655000	0.94253	CAG		0.383	RNF219-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045363.1	NM_024546	
UBR1	197131	hgsc.bcm.edu	37	15	43294805	43294805	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-3612-01A-01W-0833-10	TCGA-AG-3612-10A-01W-0833-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	93a27bfa-33be-4eec-863e-5c85a11493e2	e350ce5e-3bd3-4c1a-a212-a3b2294e180c	g.chr15:43294805G>C	ENST00000290650.4	-	32	3685	c.3607C>G	c.(3607-3609)Ctg>Gtg	p.L1203V	UBR1_ENST00000382177.2_3'UTR|UBR1_ENST00000568782.1_5'Flank	NM_174916.2	NP_777576.1	Q8IWV7	UBR1_HUMAN	ubiquitin protein ligase E3 component n-recognin 1	1203					cellular response to leucine (GO:0071233)|negative regulation of TOR signaling (GO:0032007)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|proteasome complex (GO:0000502)|ubiquitin ligase complex (GO:0000151)	leucine binding (GO:0070728)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.L1203V(1)		NS(2)|endometrium(2)|kidney(7)|large_intestine(12)|lung(25)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	58		all_cancers(109;4.32e-15)|all_epithelial(112;4.05e-13)|Lung NSC(122;1.75e-08)|all_lung(180;2e-07)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;4.08e-07)|COAD - Colon adenocarcinoma(120;0.185)|Colorectal(105;0.214)		GTATTGCACAGAGATTTGCAA	0.373																																					p.L1203V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3607G	15						.						71.0	68.0	69.0					15																	43294805		2203	4299	6502	41082097	SO:0001583	missense	197131	exon32				CCDS10091.1	15q13	2008-06-23			ENSG00000159459	ENSG00000159459		"""Ubiquitin protein ligase E3 component n-recognins"""	16808	protein-coding gene	gene with protein product		605981				9653112	Standard	NM_174916		Approved		uc001zqq.3	Q8IWV7	OTTHUMG00000130702	ENST00000290650.4:c.3607C>G	15.37:g.43294805G>C	ENSP00000290650:p.Leu1203Val		41082097	NM_174916	O60708|O75492|Q14D45|Q68DN9|Q8IWY6|Q96JY4	Missense_Mutation	SNP	ENST00000290650.4	37	CCDS10091.1	.	.	.	.	.	.	.	.	.	.	G	14.43	2.534188	0.45073	.	.	ENSG00000159459	ENST00000290650	T	0.64085	-0.08	5.29	2.31	0.28768	Zinc finger, RING/FYVE/PHD-type (1);	0.162619	0.42053	N	0.000773	T	0.61274	0.2334	M	0.77313	2.365	0.80722	D	1	B	0.21452	0.056	B	0.20577	0.03	T	0.64002	-0.6509	10	0.72032	D	0.01	-16.322	11.2436	0.48982	0.2639:0.0:0.7361:0.0	.	1203	Q8IWV7	UBR1_HUMAN	V	1203	ENSP00000290650:L1203V	ENSP00000290650:L1203V	L	-	1	2	UBR1	41082097	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.781000	0.55394	0.791000	0.33826	0.460000	0.39030	CTG		0.373	UBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253202.1	NM_174916	
GRIN2A	2903	hgsc.bcm.edu	37	16	9858209	9858209	+	Silent	SNP	C	C	T			TCGA-AG-3612-01A-01W-0833-10	TCGA-AG-3612-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	93a27bfa-33be-4eec-863e-5c85a11493e2	e350ce5e-3bd3-4c1a-a212-a3b2294e180c	g.chr16:9858209C>T	ENST00000396573.2	-	14	3501	c.3192G>A	c.(3190-3192)acG>acA	p.T1064T	GRIN2A_ENST00000535259.1_Silent_p.T907T|GRIN2A_ENST00000396575.2_Silent_p.T1064T|GRIN2A_ENST00000562109.1_Silent_p.T1064T|GRIN2A_ENST00000404927.2_Silent_p.T1064T|GRIN2A_ENST00000330684.3_Silent_p.T1064T	NM_000833.3	NP_000824.1	Q12879	NMDE1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	1064					directional locomotion (GO:0033058)|dopamine metabolic process (GO:0042417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning or memory (GO:0007611)|memory (GO:0007613)|negative regulation of protein catabolic process (GO:0042177)|neurogenesis (GO:0022008)|positive regulation of apoptotic process (GO:0043065)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to wounding (GO:0009611)|sensory perception of pain (GO:0019233)|serotonin metabolic process (GO:0042428)|sleep (GO:0030431)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)	p.T1064T(1)		NS(7)|breast(5)|cervix(1)|endometrium(11)|kidney(6)|large_intestine(36)|lung(71)|ovary(4)|prostate(9)|skin(45)|upper_aerodigestive_tract(2)|urinary_tract(1)	198					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	CCCGATTTGACGTTTCTGAAA	0.502																																					p.T1064T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G3192A	16						.						131.0	127.0	128.0					16																	9858209		2197	4300	6497	9765710	SO:0001819	synonymous_variant	2903	exon13				CCDS10539.1, CCDS45407.1	16p13.2	2012-08-29			ENSG00000183454	ENSG00000183454		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4585	protein-coding gene	gene with protein product		138253		NMDAR2A		9480759	Standard	XM_005255267		Approved	GluN2A	uc002czo.4	Q12879	OTTHUMG00000129721	ENST00000396573.2:c.3192G>A	16.37:g.9858209C>T			9765710	NM_001134408	O00669|Q17RZ6	Silent	SNP	ENST00000396573.2	37	CCDS10539.1																																																																																				0.502	GRIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251930.3		
TP53	7157	hgsc.bcm.edu	37	17	7577509	7577509	+	Nonsense_Mutation	SNP	C	C	A	rs121912652		TCGA-AG-3612-01A-01W-0833-10	TCGA-AG-3612-10A-01W-0833-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	93a27bfa-33be-4eec-863e-5c85a11493e2	e350ce5e-3bd3-4c1a-a212-a3b2294e180c	g.chr17:7577509C>A	ENST00000269305.4	-	7	961	c.772G>T	c.(772-774)Gaa>Taa	p.E258*	TP53_ENST00000420246.2_Nonsense_Mutation_p.E258*|TP53_ENST00000455263.2_Nonsense_Mutation_p.E258*|TP53_ENST00000413465.2_Nonsense_Mutation_p.E258*|TP53_ENST00000445888.2_Nonsense_Mutation_p.E258*|TP53_ENST00000359597.4_Nonsense_Mutation_p.E258*|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	258	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		E -> A (in sporadic cancers; somatic mutation).|E -> D (in sporadic cancers; somatic mutation).|E -> G (in sporadic cancers; somatic mutation).|E -> K (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1978757}.|E -> L (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|E -> Q (in sporadic cancers; somatic mutation).|E -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.E258K(40)|p.E258*(15)|p.E258Q(9)|p.0?(8)|p.?(1)|p.E258fs*85(1)|p.E258>XX(1)|p.E258fs*71(1)|p.E258fs*2(1)|p.E258_S260delEDS(1)|p.E258del(1)|p.T256fs*87(1)|p.E258L(1)|p.E258fs*87(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CTGGAGTCTTCCAGTGTGATG	0.587		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.E258X	Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,central_nervous_system,brain,Substitution - Missense,0 	.	82	Substitution - Missense(50)|Substitution - Nonsense(15)|Whole gene deletion(8)|Deletion - Frameshift(5)|Deletion - In frame(2)|Unknown(1)|Complex - insertion inframe(1)	large_intestine(14)|urinary_tract(10)|upper_aerodigestive_tract(7)|haematopoietic_and_lymphoid_tissue(7)|skin(7)|lung(6)|oesophagus(5)|central_nervous_system(4)|breast(4)|ovary(4)|bone(4)|stomach(2)|liver(2)|thyroid(1)|soft_tissue(1)|peritoneum(1)|biliary_tract(1)|endometrium(1)|pancreas(1)	c.G772T	17	GRCh37	CM900213	TP53	M	rs121912652	.						137.0	97.0	111.0					17																	7577509		2203	4300	6503	7518234	SO:0001587	stop_gained	7157	exon7	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.772G>T	17.37:g.7577509C>A	ENSP00000269305:p.Glu258*		7518234	NM_001126114	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	15.63	2.891139	0.52014	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	.	.	.	4.62	3.62	0.41486	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-21.9865	12.6215	0.56605	0.0:0.8318:0.1682:0.0	.	.	.	.	X	258;258;258;258;258;258;247;126	.	ENSP00000269305:E258X	E	-	1	0	TP53	7518234	1.000000	0.71417	1.000000	0.80357	0.402000	0.30811	7.609000	0.82925	1.266000	0.44231	0.462000	0.41574	GAA		0.587	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
DNAH2	146754	hgsc.bcm.edu	37	17	7702525	7702525	+	Silent	SNP	C	C	T			TCGA-AG-3612-01A-01W-0833-10	TCGA-AG-3612-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	93a27bfa-33be-4eec-863e-5c85a11493e2	e350ce5e-3bd3-4c1a-a212-a3b2294e180c	g.chr17:7702525C>T	ENST00000572933.1	+	56	10124	c.8664C>T	c.(8662-8664)atC>atT	p.I2888I	DNAH2_ENST00000389173.2_Silent_p.I2888I			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	2888	AAA 4. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.I2888I(1)		NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				ACCTGCACATCGTGCTCTGCC	0.592																																					p.I2888I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C8664T	17						.						109.0	87.0	95.0					17																	7702525		2203	4300	6503	7643250	SO:0001819	synonymous_variant	146754	exon55			U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.8664C>T	17.37:g.7702525C>T			7643250	NM_020877	A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Silent	SNP	ENST00000572933.1	37	CCDS32551.1																																																																																				0.592	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440241.1	NM_020877	
SLFN12	55106	hgsc.bcm.edu	37	17	33738414	33738414	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-3612-01A-01W-0833-10	TCGA-AG-3612-10A-01W-0833-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	93a27bfa-33be-4eec-863e-5c85a11493e2	e350ce5e-3bd3-4c1a-a212-a3b2294e180c	g.chr17:33738414T>C	ENST00000394562.1	-	6	2203	c.1680A>G	c.(1678-1680)atA>atG	p.I560M	SLFN12_ENST00000460530.1_5'UTR|RP11-686D22.8_ENST00000587012.1_RNA|SLFN12_ENST00000304905.5_Missense_Mutation_p.I560M|SLFN12_ENST00000452764.3_Missense_Mutation_p.I560M			Q8IYM2	SLN12_HUMAN	schlafen family member 12	560							ATP binding (GO:0005524)	p.I560M(1)		breast(1)|kidney(2)|large_intestine(3)|lung(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	18		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		GAAAGCAATCTATACCGATTA	0.353																																					p.I560M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1680G	17						.						51.0	55.0	54.0					17																	33738414		2203	4300	6503	30762527	SO:0001583	missense	55106	exon4			AK001122	CCDS11295.1	17q12	2006-04-05			ENSG00000172123	ENSG00000172123			25500	protein-coding gene	gene with protein product		614955				12477932	Standard	NM_018042		Approved	FLJ10260	uc002hji.4	Q8IYM2	OTTHUMG00000132952	ENST00000394562.1:c.1680A>G	17.37:g.33738414T>C	ENSP00000378063:p.Ile560Met		30762527	NM_018042	A8K711|Q9NP47	Missense_Mutation	SNP	ENST00000394562.1	37	CCDS11295.1	.	.	.	.	.	.	.	.	.	.	T	9.717	1.158632	0.21454	.	.	ENSG00000172123	ENST00000394562;ENST00000304905;ENST00000452764	T;T;T	0.03801	3.8;3.8;3.8	2.75	-3.75	0.04372	.	.	.	.	.	T	0.02119	0.0066	N	0.08118	0	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.44620	-0.9316	9	0.33141	T	0.24	.	3.694	0.08357	0.2032:0.4815:0.0:0.3154	.	560	Q8IYM2	SLN12_HUMAN	M	560	ENSP00000378063:I560M;ENSP00000302077:I560M;ENSP00000394903:I560M	ENSP00000302077:I560M	I	-	3	3	SLFN12	30762527	0.000000	0.05858	0.000000	0.03702	0.067000	0.16453	-1.161000	0.03144	-1.014000	0.03379	0.164000	0.16699	ATA		0.353	SLFN12-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256491.1	NM_018042	
SERPINB5	5268	hgsc.bcm.edu	37	18	61166415	61166415	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3612-01A-01W-0833-10	TCGA-AG-3612-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	93a27bfa-33be-4eec-863e-5c85a11493e2	e350ce5e-3bd3-4c1a-a212-a3b2294e180c	g.chr18:61166415C>A	ENST00000382771.4	+	6	922	c.630C>A	c.(628-630)gaC>gaA	p.D210E	SERPINB5_ENST00000464346.1_3'UTR	NM_002639.4	NP_002630.2	P36952	SPB5_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 5	210					cellular component movement (GO:0006928)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelium (GO:0002009)|negative regulation of endopeptidase activity (GO:0010951)|prostate gland morphogenesis (GO:0060512)|regulation of epithelial cell proliferation (GO:0050678)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.D210E(1)		kidney(3)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)	12						GAAACATTGACAGTATCAATT	0.418																																					p.D210E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C630A	18						.						131.0	113.0	119.0					18																	61166415		2203	4300	6503	59317395	SO:0001583	missense	5268	exon6			U04313	CCDS32839.1	18q21.33	2014-02-18	2005-08-18		ENSG00000206075	ENSG00000206075		"""Serine (or cysteine) peptidase inhibitors"""	8949	protein-coding gene	gene with protein product	"""protease inhibitor 5 (maspin)"""	154790	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 5"""	PI5		8290962, 7724531, 16720730, 24172014	Standard	NM_002639		Approved	maspin	uc002liz.4	P36952	OTTHUMG00000141307	ENST00000382771.4:c.630C>A	18.37:g.61166415C>A	ENSP00000372221:p.Asp210Glu		59317395	NM_002639	B2R6Y4|Q6N0B4|Q8WW89	Missense_Mutation	SNP	ENST00000382771.4	37	CCDS32839.1	.	.	.	.	.	.	.	.	.	.	C	1.308	-0.602884	0.03744	.	.	ENSG00000206075	ENST00000382771	T	0.16743	2.32	5.03	-10.1	0.00402	Serpin domain (3);	0.277161	0.35235	N	0.003354	T	0.02848	0.0085	N	0.03050	-0.425	0.24412	N	0.994654	B	0.10296	0.003	B	0.13407	0.009	T	0.32079	-0.9920	10	0.02654	T	1	.	3.5112	0.07709	0.1031:0.0886:0.2188:0.5894	.	210	P36952	SPB5_HUMAN	E	210	ENSP00000372221:D210E	ENSP00000372221:D210E	D	+	3	2	SERPINB5	59317395	0.007000	0.16637	0.000000	0.03702	0.846000	0.48090	-1.441000	0.02409	-1.537000	0.01736	0.511000	0.50034	GAC		0.418	SERPINB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280629.1	NM_002639	
SERPINB5	5268	hgsc.bcm.edu	37	18	61166430	61166430	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-3612-01A-01W-0833-10	TCGA-AG-3612-10A-01W-0833-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	93a27bfa-33be-4eec-863e-5c85a11493e2	e350ce5e-3bd3-4c1a-a212-a3b2294e180c	g.chr18:61166430G>C	ENST00000382771.4	+	6	937	c.645G>C	c.(643-645)aaG>aaC	p.K215N	SERPINB5_ENST00000464346.1_3'UTR	NM_002639.4	NP_002630.2	P36952	SPB5_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 5	215					cellular component movement (GO:0006928)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelium (GO:0002009)|negative regulation of endopeptidase activity (GO:0010951)|prostate gland morphogenesis (GO:0060512)|regulation of epithelial cell proliferation (GO:0050678)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.K215N(1)		kidney(3)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)	12						TCAATTGTAAGATCATAGAGC	0.428																																					p.K215N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G645C	18						.						130.0	112.0	118.0					18																	61166430		2203	4300	6503	59317410	SO:0001583	missense	5268	exon6			U04313	CCDS32839.1	18q21.33	2014-02-18	2005-08-18		ENSG00000206075	ENSG00000206075		"""Serine (or cysteine) peptidase inhibitors"""	8949	protein-coding gene	gene with protein product	"""protease inhibitor 5 (maspin)"""	154790	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 5"""	PI5		8290962, 7724531, 16720730, 24172014	Standard	NM_002639		Approved	maspin	uc002liz.4	P36952	OTTHUMG00000141307	ENST00000382771.4:c.645G>C	18.37:g.61166430G>C	ENSP00000372221:p.Lys215Asn		59317410	NM_002639	B2R6Y4|Q6N0B4|Q8WW89	Missense_Mutation	SNP	ENST00000382771.4	37	CCDS32839.1	.	.	.	.	.	.	.	.	.	.	G	11.34	1.611281	0.28712	.	.	ENSG00000206075	ENST00000382771	D	0.85556	-2.0	5.14	3.33	0.38152	Serpin domain (3);	0.360177	0.29396	N	0.012278	T	0.81856	0.4911	M	0.70275	2.135	0.42499	D	0.992925	B	0.25312	0.123	B	0.20767	0.031	T	0.77983	-0.2382	10	0.66056	D	0.02	.	7.928	0.29887	0.141:0.2479:0.6111:0.0	.	215	P36952	SPB5_HUMAN	N	215	ENSP00000372221:K215N	ENSP00000372221:K215N	K	+	3	2	SERPINB5	59317410	1.000000	0.71417	0.767000	0.31495	0.773000	0.43773	0.857000	0.27831	0.663000	0.31027	-0.416000	0.06073	AAG		0.428	SERPINB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280629.1	NM_002639	
ZNF146	7705	hgsc.bcm.edu	37	19	36728063	36728063	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3612-01A-01W-0833-10	TCGA-AG-3612-10A-01W-0833-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	93a27bfa-33be-4eec-863e-5c85a11493e2	e350ce5e-3bd3-4c1a-a212-a3b2294e180c	g.chr19:36728063G>T	ENST00000443387.2	+	4	1713	c.721G>T	c.(721-723)Ggt>Tgt	p.G241C	ZNF565_ENST00000355114.5_Intron|ZNF146_ENST00000456324.1_Missense_Mutation_p.G241C	NM_007145.2	NP_009076.2	Q15072	OZF_HUMAN	zinc finger protein 146	241	Interaction with TERF2IP.				regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|heparin binding (GO:0008201)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.G241C(1)		kidney(1)|large_intestine(2)|lung(4)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	11	Esophageal squamous(110;0.162)					GAAGCCCTATGGTTGTAATGA	0.448																																					p.G241C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G721T	19						.						122.0	112.0	115.0					19																	36728063		2203	4300	6503	41419903	SO:0001583	missense	7705	exon3			X70394	CCDS12492.1	19q13.1	2013-01-08				ENSG00000167635		"""Zinc fingers, C2H2-type"""	12931	protein-coding gene	gene with protein product		601505				10449921, 8641144	Standard	NM_001099639		Approved	OZF	uc010eeu.3	Q15072		ENST00000443387.2:c.721G>T	19.37:g.36728063G>T	ENSP00000392095:p.Gly241Cys		41419903	NM_001099639	Q2TB94	Missense_Mutation	SNP	ENST00000443387.2	37	CCDS12492.1	.	.	.	.	.	.	.	.	.	.	G	14.00	2.405784	0.42715	.	.	ENSG00000167635	ENST00000443387;ENST00000456324	T;T	0.16324	2.35;2.35	4.48	4.48	0.54585	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.40818	N	0.001015	T	0.22936	0.0554	N	0.21448	0.665	0.21984	N	0.999438	D	0.89917	1.0	D	0.97110	1.0	T	0.05835	-1.0861	10	0.87932	D	0	-5.3835	5.8534	0.18707	0.0951:0.0:0.7122:0.1927	.	241	Q15072	OZF_HUMAN	C	241	ENSP00000392095:G241C;ENSP00000400391:G241C	ENSP00000392095:G241C	G	+	1	0	ZNF146	41419903	0.000000	0.05858	1.000000	0.80357	0.891000	0.51852	-1.343000	0.02642	2.780000	0.95670	0.561000	0.74099	GGT		0.448	ZNF146-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451706.1	NM_007145	
MRPS12	6183	hgsc.bcm.edu	37	19	39423124	39423124	+	Silent	SNP	C	C	A			TCGA-AG-3612-01A-01W-0833-10	TCGA-AG-3612-10A-01W-0833-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			SOLID	93a27bfa-33be-4eec-863e-5c85a11493e2	e350ce5e-3bd3-4c1a-a212-a3b2294e180c	g.chr19:39423124C>A	ENST00000407800.2	+	2	542	c.201C>A	c.(199-201)acC>acA	p.T67T	SARS2_ENST00000221431.6_5'Flank|SARS2_ENST00000600042.1_5'Flank|CTC-360G5.8_ENST00000599996.1_Intron|SARS2_ENST00000430193.3_5'Flank|MRPS12_ENST00000308018.4_Silent_p.T67T|SARS2_ENST00000594171.1_5'Flank|MRPS12_ENST00000402029.3_Silent_p.T67T|CTC-360G5.9_ENST00000599320.1_lincRNA|SARS2_ENST00000448145.2_Intron	NM_021107.1	NP_066930.1	O15235	RT12_HUMAN	mitochondrial ribosomal protein S12	67					translation (GO:0006412)	mitochondrial ribosome (GO:0005761)|small ribosomal subunit (GO:0015935)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)	p.T67T(1)		endometrium(1)|large_intestine(1)	2	all_cancers(60;8.37e-07)|all_lung(34;3.71e-07)|Lung NSC(34;4.17e-07)|all_epithelial(25;1.13e-06)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			GCACGTTTACCCGCAAGCCGA	0.682																																					p.T67T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C201A	19						.						51.0	49.0	50.0					19																	39423124		2203	4300	6503	44114964	SO:0001819	synonymous_variant	6183	exon2			Y11681	CCDS12525.1	19q13.1-q13.2	2012-09-13			ENSG00000128626	ENSG00000128626		"""Mitochondrial ribosomal proteins / small subunits"""	10380	protein-coding gene	gene with protein product		603021		RPMS12		9545647, 9790755	Standard	NM_021107		Approved	RPS12, RPSM12	uc002oke.3	O15235		ENST00000407800.2:c.201C>A	19.37:g.39423124C>A			44114964	NM_021107	Q53X98	Silent	SNP	ENST00000407800.2	37	CCDS12525.1																																																																																				0.682	MRPS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463154.1		
RPS16	6217	hgsc.bcm.edu	37	19	39924346	39924346	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3612-01A-01W-0833-10	TCGA-AG-3612-10A-01W-0833-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	93a27bfa-33be-4eec-863e-5c85a11493e2	e350ce5e-3bd3-4c1a-a212-a3b2294e180c	g.chr19:39924346C>A	ENST00000251453.3	-	3	258	c.206G>T	c.(205-207)cGt>cTt	p.R69L	RPS16_ENST00000599539.1_Missense_Mutation_p.R69L|RPS16_ENST00000339471.4_Missense_Mutation_p.R69L|RPS16_ENST00000601655.1_Missense_Mutation_p.R52L	NM_001020.4	NP_001011.1	P62249	RS16_HUMAN	ribosomal protein S16	69					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|ribosomal small subunit biogenesis (GO:0042274)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|small ribosomal subunit (GO:0015935)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)	p.R69L(1)		central_nervous_system(1)|large_intestine(2)|lung(2)|skin(2)	7	all_cancers(60;3.08e-07)|all_lung(34;2.66e-08)|Lung NSC(34;3e-08)|all_epithelial(25;6.57e-07)|Ovarian(47;0.0569)		Epithelial(26;4.14e-26)|all cancers(26;2.68e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)			TACACGGACACGGATGTCTAC	0.562																																					p.R69L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G206T	19						.						92.0	71.0	78.0					19																	39924346		2203	4300	6503	44616186	SO:0001583	missense	6217	exon3			M60854	CCDS12535.1	19q13.1	2011-04-05				ENSG00000105193		"""S ribosomal proteins"""	10396	protein-coding gene	gene with protein product	"""40S ribosomal protein S16"""	603675				2016298, 9582194	Standard	XM_005259137		Approved	S16	uc002olk.3	P62249		ENST00000251453.3:c.206G>T	19.37:g.39924346C>A	ENSP00000251453:p.Arg69Leu		44616186	NM_001020	B2RDD5|P17008	Missense_Mutation	SNP	ENST00000251453.3	37	CCDS12535.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.058575	0.76074	.	.	ENSG00000105193	ENST00000251453;ENST00000339471	.	.	.	5.14	5.14	0.70334	Ribosomal protein S5 domain 2-type fold (1);Ribosomal protein S5 domain 2-type fold, subgroup (1);	0.000000	0.85682	D	0.000000	T	0.79034	0.4378	M	0.83312	2.635	0.80722	D	1	D;B	0.57571	0.98;0.008	P;B	0.62885	0.908;0.125	T	0.81269	-0.1009	8	.	.	.	-7.9873	16.0972	0.81135	0.0:1.0:0.0:0.0	.	69;69	Q6IPX4;P62249	.;RS16_HUMAN	L	69	.	.	R	-	2	0	RPS16	44616186	1.000000	0.71417	0.939000	0.37840	0.835000	0.47333	4.468000	0.60162	2.372000	0.80975	0.643000	0.83706	CGT		0.562	RPS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464511.1	NM_001020	
FCAR	2204	hgsc.bcm.edu	37	19	55396680	55396680	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3612-01A-01W-0833-10	TCGA-AG-3612-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	93a27bfa-33be-4eec-863e-5c85a11493e2	e350ce5e-3bd3-4c1a-a212-a3b2294e180c	g.chr19:55396680C>T	ENST00000355524.3	+	3	114	c.104C>T	c.(103-105)tCg>tTg	p.S35L	FCAR_ENST00000482092.2_3'UTR|FCAR_ENST00000345937.4_Missense_Mutation_p.S35L|FCAR_ENST00000469767.1_Missense_Mutation_p.S35L|FCAR_ENST00000391726.3_Missense_Mutation_p.S23L|FCAR_ENST00000391724.3_Missense_Mutation_p.S23L|FCAR_ENST00000391725.3_Missense_Mutation_p.S35L|FCAR_ENST00000353758.4_Intron|FCAR_ENST00000359272.4_Missense_Mutation_p.S23L|FCAR_ENST00000391723.3_Missense_Mutation_p.S23L	NM_002000.2	NP_001991.1	P24071	FCAR_HUMAN	Fc fragment of IgA, receptor for	35					immune response (GO:0006955)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)		p.S35L(2)		breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(1)|skin(2)	24				GBM - Glioblastoma multiforme(193;0.0443)		TCTGCCAAATCGAGTCCTGTG	0.498																																					p.S35L												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C104T	19						.						67.0	65.0	66.0					19																	55396680		2203	4300	6503	60088492	SO:0001583	missense	2204	exon3			X54150	CCDS12907.1, CCDS12908.1, CCDS12909.1, CCDS12910.1, CCDS42622.1, CCDS42623.1, CCDS42624.1, CCDS42625.1, CCDS46180.1	19q13.42	2013-01-29			ENSG00000186431	ENSG00000186431		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3608	protein-coding gene	gene with protein product		147045				1577457	Standard	NM_133269		Approved	CD89	uc002qhr.1	P24071	OTTHUMG00000065936	ENST00000355524.3:c.104C>T	19.37:g.55396680C>T	ENSP00000347714:p.Ser35Leu		60088492	NM_002000	Q13603|Q13604|Q15727|Q15728|Q1AJL7|Q1AJL8|Q1AJL9|Q53X38|Q53X39|Q92587|Q92588|Q92590|Q92592|Q92593|Q9UEK0	Missense_Mutation	SNP	ENST00000355524.3	37	CCDS12907.1	.	.	.	.	.	.	.	.	.	.	C	12.43	1.934890	0.34189	.	.	ENSG00000186431	ENST00000433231;ENST00000391726;ENST00000355524;ENST00000391725;ENST00000345937;ENST00000359272;ENST00000391723;ENST00000391724	T;T;T;T;T;T;T	0.11604	2.76;2.76;2.76;2.76;2.76;2.76;2.76	3.19	2.1	0.27182	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	0.788741	0.10353	N	0.684825	T	0.18341	0.0440	M	0.61703	1.905	0.09310	N	1	D;D;D;D;D;D;D;D	0.69078	0.995;0.959;0.973;0.997;0.98;0.989;0.994;0.981	P;P;P;P;P;P;P;P	0.51101	0.659;0.607;0.529;0.636;0.467;0.452;0.588;0.56	T	0.12811	-1.0533	10	0.87932	D	0	.	7.3977	0.26946	0.2597:0.7403:0.0:0.0	.	23;23;23;23;35;35;35;35	Q92588;Q92593;Q92587;Q9UEK0;Q53X39;P24071-3;P24071;P24071-4	.;.;.;.;.;.;FCAR_HUMAN;.	L	35;23;35;35;35;23;23;23	ENSP00000375606:S23L;ENSP00000347714:S35L;ENSP00000375605:S35L;ENSP00000338257:S35L;ENSP00000352218:S23L;ENSP00000375603:S23L;ENSP00000375604:S23L	ENSP00000338257:S35L	S	+	2	0	FCAR	60088492	0.001000	0.12720	0.001000	0.08648	0.001000	0.01503	1.083000	0.30815	0.852000	0.35287	0.563000	0.77884	TCG		0.498	FCAR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000141243.1	NM_002000	
ZNF667	63934	hgsc.bcm.edu	37	19	56953007	56953007	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3612-01A-01W-0833-10	TCGA-AG-3612-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	93a27bfa-33be-4eec-863e-5c85a11493e2	e350ce5e-3bd3-4c1a-a212-a3b2294e180c	g.chr19:56953007C>T	ENST00000504904.3	-	7	2076	c.1357G>A	c.(1357-1359)Ggc>Agc	p.G453S	ZNF667_ENST00000591790.1_3'UTR|ZNF667_ENST00000342634.3_Missense_Mutation_p.G581S|ZNF667_ENST00000292069.6_Missense_Mutation_p.G453S			Q5HYK9	ZN667_HUMAN	zinc finger protein 667	453					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G453S(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(18)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)	38		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0615)		GATTGGCGGCCGAAAACTTTA	0.368																																					p.G453S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1357A	19						.						49.0	50.0	50.0					19																	56953007		2203	4300	6503	61644819	SO:0001583	missense	63934	exon5				CCDS12944.1	19q13.43	2013-01-08				ENSG00000198046		"""Zinc fingers, C2H2-type"", ""-"""	28854	protein-coding gene	gene with protein product		611024					Standard	NM_022103		Approved	FLJ14011	uc002qnd.3	Q5HYK9		ENST00000504904.3:c.1357G>A	19.37:g.56953007C>T	ENSP00000439402:p.Gly453Ser		61644819	NM_022103	B2RMS6|B9EK36|Q6B093|Q9H807	Missense_Mutation	SNP	ENST00000504904.3	37	CCDS12944.1	.	.	.	.	.	.	.	.	.	.	C	0.516	-0.864405	0.02590	.	.	ENSG00000198046	ENST00000342634;ENST00000504904;ENST00000292069;ENST00000452518;ENST00000360227	T;T;T	0.07114	3.22;3.22;3.22	5.03	2.81	0.32909	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.45126	D	0.000386	T	0.01730	0.0055	N	0.01424	-0.875	0.09310	N	0.99999	P;P	0.39665	0.682;0.682	B;B	0.29716	0.106;0.106	T	0.40757	-0.9546	10	0.02654	T	1	-9.6494	6.2343	0.20754	0.0:0.7729:0.0:0.2271	.	581;453	E7EPS0;Q5HYK9	.;ZN667_HUMAN	S	581;453;453;235;168	ENSP00000344699:G581S;ENSP00000439402:G453S;ENSP00000292069:G453S	ENSP00000292069:G453S	G	-	1	0	ZNF667	61644819	0.000000	0.05858	0.899000	0.35326	0.001000	0.01503	0.312000	0.19397	1.339000	0.45563	-0.140000	0.14226	GGC		0.368	ZNF667-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458394.1	NM_022103	
UBR4	23352	hgsc.bcm.edu	37	1	19488941	19488941	+	Silent	SNP	T	T	C			TCGA-AG-3612-01A-01W-0833-10	TCGA-AG-3612-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	93a27bfa-33be-4eec-863e-5c85a11493e2	e350ce5e-3bd3-4c1a-a212-a3b2294e180c	g.chr1:19488941T>C	ENST00000375254.3	-	35	4956	c.4929A>G	c.(4927-4929)gaA>gaG	p.E1643E	UBR4_ENST00000375217.2_Silent_p.E1643E|UBR4_ENST00000375226.2_Silent_p.E1643E|UBR4_ENST00000375267.2_Silent_p.E1643E	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	1643					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.E1643E(1)		breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		AATCTTCCTCTTCCACCGCCA	0.502																																					p.E1643E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A4929G	1						.						132.0	122.0	126.0					1																	19488941		2203	4300	6503	19361528	SO:0001819	synonymous_variant	23352	exon35			AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.4929A>G	1.37:g.19488941T>C			19361528	NM_020765	A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Silent	SNP	ENST00000375254.3	37	CCDS189.1																																																																																				0.502	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007085.1	NM_020765	
ZNF648	127665	hgsc.bcm.edu	37	1	182027037	182027037	+	Missense_Mutation	SNP	C	C	T	rs144839806		TCGA-AG-3612-01A-01W-0833-10	TCGA-AG-3612-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	93a27bfa-33be-4eec-863e-5c85a11493e2	e350ce5e-3bd3-4c1a-a212-a3b2294e180c	g.chr1:182027037C>T	ENST00000339948.3	-	2	316	c.109G>A	c.(109-111)Gat>Aat	p.D37N		NM_001009992.1	NP_001009992.1	Q5T619	ZN648_HUMAN	zinc finger protein 648	37					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.D37N(1)		breast(1)|endometrium(7)|large_intestine(10)|lung(17)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	40						CCATCTTCATCGTCACTCTCT	0.577																																					p.D37N	NSCLC(71;908 1374 5429 20458 35642)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G109A	1						.	C	ASN/ASP	1,4405	2.1+/-5.4	0,1,2202	97.0	91.0	93.0		109	2.8	0.2	1	dbSNP_134	93	0,8600		0,0,4300	no	missense	ZNF648	NM_001009992.1	23	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	possibly-damaging	37/569	182027037	1,13005	2203	4300	6503	180293660	SO:0001583	missense	127665	exon2			AK128654	CCDS30952.1	1q25.3	2013-01-08			ENSG00000179930	ENSG00000179930		"""Zinc fingers, C2H2-type"""	18190	protein-coding gene	gene with protein product							Standard	NM_001009992		Approved	FLJ46813	uc001goz.3	Q5T619	OTTHUMG00000037302	ENST00000339948.3:c.109G>A	1.37:g.182027037C>T	ENSP00000344129:p.Asp37Asn		180293660	NM_001009992	B2RP16	Missense_Mutation	SNP	ENST00000339948.3	37	CCDS30952.1	.	.	.	.	.	.	.	.	.	.	C	13.64	2.297595	0.40694	2.27E-4	0.0	ENSG00000179930	ENST00000339948	T	0.09073	3.02	2.76	2.76	0.32466	.	.	.	.	.	T	0.05686	0.0149	N	0.24115	0.695	0.20196	N	0.99993	P	0.35328	0.495	B	0.22601	0.04	T	0.30534	-0.9975	9	0.62326	D	0.03	.	11.7128	0.51635	0.0:1.0:0.0:0.0	.	37	Q5T619	ZN648_HUMAN	N	37	ENSP00000344129:D37N	ENSP00000344129:D37N	D	-	1	0	ZNF648	180293660	0.000000	0.05858	0.224000	0.23877	0.014000	0.08584	-0.425000	0.07017	1.864000	0.54056	0.655000	0.94253	GAT		0.577	ZNF648-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090794.1	XM_060597	
MCOLN3	55283	hgsc.bcm.edu	37	1	85498583	85498583	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-3612-01A-01W-0833-10	TCGA-AG-3612-10A-01W-0833-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	93a27bfa-33be-4eec-863e-5c85a11493e2	e350ce5e-3bd3-4c1a-a212-a3b2294e180c	g.chr1:85498583T>G	ENST00000370589.2	-	5	659	c.607A>C	c.(607-609)Aaa>Caa	p.K203Q	MCOLN3_ENST00000341115.4_Missense_Mutation_p.K147Q|MCOLN3_ENST00000370587.1_Missense_Mutation_p.K203Q|WDR63_ENST00000370596.1_Intron	NM_018298.10	NP_060768.8	Q8TDD5	MCLN3_HUMAN	mucolipin 3	203					auditory receptor cell differentiation (GO:0042491)|calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|locomotory behavior (GO:0007626)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.K203Q(1)		endometrium(6)|kidney(3)|large_intestine(9)|lung(12)|prostate(3)|skin(1)	34				all cancers(265;0.00957)|Epithelial(280;0.0254)		AAGTTCAGTTTATTTTCTGCT	0.408																																					p.K203Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A607C	1						.						261.0	252.0	255.0					1																	85498583		2203	4300	6503	85271171	SO:0001583	missense	55283	exon5			AF475085	CCDS701.1, CCDS58009.1	1p22.3	2011-12-16			ENSG00000055732	ENSG00000055732		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	13358	protein-coding gene	gene with protein product		607400				16382100	Standard	NM_018298		Approved	TRPML3, FLJ11006, TRP-ML3	uc001dkp.3	Q8TDD5	OTTHUMG00000009955	ENST00000370589.2:c.607A>C	1.37:g.85498583T>G	ENSP00000359621:p.Lys203Gln		85271171	NM_018298	Q5T4H5|Q5T4H6|Q9NV09	Missense_Mutation	SNP	ENST00000370589.2	37	CCDS701.1	.	.	.	.	.	.	.	.	.	.	T	11.33	1.608081	0.28623	.	.	ENSG00000055732	ENST00000370589;ENST00000302814;ENST00000370588;ENST00000341115;ENST00000370587	T;T;T	0.57273	0.41;0.41;0.41	5.53	5.53	0.82687	.	0.243503	0.40469	N	0.001096	T	0.20007	0.0481	L	0.29908	0.895	0.34095	D	0.661221	B;B;B;B	0.33694	0.295;0.141;0.365;0.421	B;B;B;B	0.31751	0.122;0.114;0.135;0.095	T	0.07558	-1.0766	10	0.12103	T	0.63	1.5112	11.4312	0.50041	0.135:0.0:0.0:0.865	.	203;203;147;203	A8K841;B1ANB7;Q8TDD5-2;Q8TDD5	.;.;.;MCLN3_HUMAN	Q	203;203;147;147;203	ENSP00000359621:K203Q;ENSP00000342698:K147Q;ENSP00000359619:K203Q	ENSP00000304843:K203Q	K	-	1	0	MCOLN3	85271171	0.436000	0.25586	0.993000	0.49108	0.968000	0.65278	1.926000	0.40084	2.096000	0.63516	0.528000	0.53228	AAA		0.408	MCOLN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027569.2	NM_018298	
DPYD	1806	hgsc.bcm.edu	37	1	98187122	98187122	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-3612-01A-01W-0833-10	TCGA-AG-3612-10A-01W-0833-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	93a27bfa-33be-4eec-863e-5c85a11493e2	e350ce5e-3bd3-4c1a-a212-a3b2294e180c	g.chr1:98187122A>C	ENST00000370192.3	-	5	527	c.427T>G	c.(427-429)Tat>Gat	p.Y143D	DPYD_ENST00000423006.2_Missense_Mutation_p.Y106D|DPYD_ENST00000306031.5_Missense_Mutation_p.Y143D|DPYD_ENST00000474241.1_5'UTR	NM_000110.3	NP_000101	Q12882	DPYD_HUMAN	dihydropyrimidine dehydrogenase	143					beta-alanine biosynthetic process (GO:0019483)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase catabolic process (GO:0006145)|pyrimidine nucleobase catabolic process (GO:0006208)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)|thymidine catabolic process (GO:0006214)|thymine catabolic process (GO:0006210)|UMP biosynthetic process (GO:0006222)|uracil catabolic process (GO:0006212)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	4 iron, 4 sulfur cluster binding (GO:0051539)|dihydroorotate dehydrogenase activity (GO:0004152)|dihydropyrimidine dehydrogenase (NADP+) activity (GO:0017113)|flavin adenine dinucleotide binding (GO:0050660)|metal ion binding (GO:0046872)|NADP binding (GO:0050661)|protein homodimerization activity (GO:0042803)	p.Y143D(1)		NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(18)|lung(30)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(1)	83		all_epithelial(167;0.000185)|all_lung(203;0.00318)|Lung NSC(277;0.00994)		Colorectal(170;0.0165)|Epithelial(280;0.0526)|all cancers(265;0.104)|READ - Rectum adenocarcinoma(84;0.171)|Lung(183;0.216)	Capecitabine(DB01101)|Flavin adenine dinucleotide(DB03147)|Fluorouracil(DB00544)	TCAGTGGCATATAAATTGCAT	0.428																																					p.Y143D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T427G	1						.						127.0	118.0	121.0					1																	98187122		2203	4299	6502	97959710	SO:0001583	missense	1806	exon5			U20938	CCDS30777.1, CCDS53346.1	1p22	2014-09-17			ENSG00000188641	ENSG00000188641	1.3.1.2		3012	protein-coding gene	gene with protein product		612779				7713523	Standard	NM_000110		Approved	DPD	uc001drv.3	Q12882	OTTHUMG00000039683	ENST00000370192.3:c.427T>G	1.37:g.98187122A>C	ENSP00000359211:p.Tyr143Asp		97959710	NM_001160301	A2RRQ2|A2RRQ3|A8K5A2|A8MWG9|B1AN21|E9PFN1|Q16694|Q16761|Q32NB0|Q96HL6|Q96TH1	Missense_Mutation	SNP	ENST00000370192.3	37	CCDS30777.1	.	.	.	.	.	.	.	.	.	.	A	14.37	2.515664	0.44763	.	.	ENSG00000188641	ENST00000370192;ENST00000423006;ENST00000306031	T;T;T	0.80824	-1.42;-1.42;-1.42	5.88	3.59	0.41128	Fumarate reductase, C-terminal (1);Alpha-helical ferredoxin (1);	0.189289	0.47852	D	0.000205	T	0.68183	0.2973	M	0.70595	2.14	0.45962	D	0.998788	P;P	0.38922	0.651;0.599	B;B	0.39706	0.307;0.271	T	0.65615	-0.6125	10	0.36615	T	0.2	-2.7339	9.774	0.40607	0.8591:0.0:0.1409:0.0	.	143;143	E9PFN1;Q12882	.;DPYD_HUMAN	D	143;106;143	ENSP00000359211:Y143D;ENSP00000398884:Y106D;ENSP00000307107:Y143D	ENSP00000307107:Y143D	Y	-	1	0	DPYD	97959710	1.000000	0.71417	0.870000	0.34147	0.985000	0.73830	4.967000	0.63722	0.491000	0.27793	-0.280000	0.10049	TAT		0.428	DPYD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095698.3	NM_000110	
OR2T10	127069	hgsc.bcm.edu	37	1	248756878	248756878	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3612-01A-01W-0833-10	TCGA-AG-3612-10A-01W-0833-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	93a27bfa-33be-4eec-863e-5c85a11493e2	e350ce5e-3bd3-4c1a-a212-a3b2294e180c	g.chr1:248756878G>T	ENST00000330500.2	-	1	222	c.192C>A	c.(190-192)aaC>aaA	p.N64K	Y_RNA_ENST00000364732.1_RNA	NM_001004693.1	NP_001004693.1	Q8NGZ9	O2T10_HUMAN	olfactory receptor, family 2, subfamily T, member 10	64						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.N64K(1)		breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(17)|skin(3)|upper_aerodigestive_tract(1)	26	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GTGAGAGCTGGTTTATAAAGA	0.423																																					p.N64K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C192A	1						.						79.0	89.0	86.0					1																	248756878		2049	4236	6285	246823501	SO:0001583	missense	127069	exon1				CCDS31121.1	1q44	2012-08-09			ENSG00000184022	ENSG00000184022		"""GPCR / Class A : Olfactory receptors"""	19573	protein-coding gene	gene with protein product							Standard	NM_001004693		Approved		uc010pzn.2	Q8NGZ9	OTTHUMG00000040388	ENST00000330500.2:c.192C>A	1.37:g.248756878G>T	ENSP00000329210:p.Asn64Lys		246823501	NM_001004693	B2RNK7	Missense_Mutation	SNP	ENST00000330500.2	37	CCDS31121.1	.	.	.	.	.	.	.	.	.	.	.	8.329	0.825977	0.16749	.	.	ENSG00000184022	ENST00000330500	T	0.00388	7.59	2.34	-0.0309	0.13912	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00144	0.0004	N	0.02802	-0.49	0.09310	N	1	B	0.09022	0.002	B	0.10450	0.005	T	0.37079	-0.9721	9	0.87932	D	0	.	2.2657	0.04078	0.3362:0.0:0.279:0.3848	.	64	Q8NGZ9	O2T10_HUMAN	K	64	ENSP00000329210:N64K	ENSP00000329210:N64K	N	-	3	2	OR2T10	246823501	0.000000	0.05858	0.267000	0.24556	0.909000	0.53808	-1.502000	0.02279	0.179000	0.19938	0.441000	0.28932	AAC		0.423	OR2T10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097139.1	NM_001004693	
SUN5	140732	hgsc.bcm.edu	37	20	31590400	31590400	+	Silent	SNP	T	T	A			TCGA-AG-3612-01A-01W-0833-10	TCGA-AG-3612-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	93a27bfa-33be-4eec-863e-5c85a11493e2	e350ce5e-3bd3-4c1a-a212-a3b2294e180c	g.chr20:31590400T>A	ENST00000356173.3	-	3	296	c.204A>T	c.(202-204)ggA>ggT	p.G68G	SUN5_ENST00000375519.2_Silent_p.G68G|SUN5_ENST00000375523.3_Intron	NM_080675.3	NP_542406.2	Q8TC36	SUN5_HUMAN	Sad1 and UNC84 domain containing 5	68					spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)		p.G68G(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	25						TACACACACATCCCAGCATGC	0.552																																					p.G68G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A204T	20						.						196.0	143.0	161.0					20																	31590400		2203	4300	6503	31054061	SO:0001819	synonymous_variant	140732	exon3			AL121756	CCDS13209.1	20q11.21	2010-01-27	2010-01-27	2010-01-27	ENSG00000167098	ENSG00000167098			16252	protein-coding gene	gene with protein product	"""testis and spermatogenesis related gene 4"""	613942	"""sperm associated antigen 4-like"""	SPAG4L		9691178, 10373309	Standard	NM_080675		Approved	dJ726C3.1, TSARG4	uc002wyi.3	Q8TC36	OTTHUMG00000032239	ENST00000356173.3:c.204A>T	20.37:g.31590400T>A			31054061	NM_080675	A6NJ82|Q5T9R0	Silent	SNP	ENST00000356173.3	37	CCDS13209.1																																																																																				0.552	SUN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078659.1	NM_080675	
KCNB1	3745	hgsc.bcm.edu	37	20	47990392	47990392	+	Missense_Mutation	SNP	C	C	T	rs376490656		TCGA-AG-3612-01A-01W-0833-10	TCGA-AG-3612-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	93a27bfa-33be-4eec-863e-5c85a11493e2	e350ce5e-3bd3-4c1a-a212-a3b2294e180c	g.chr20:47990392C>T	ENST00000371741.4	-	2	1871	c.1705G>A	c.(1705-1707)Gta>Ata	p.V569I		NM_004975.2	NP_004966.1	Q14721	KCNB1_HUMAN	potassium voltage-gated channel, Shab-related subfamily, member 1	569					energy reserve metabolic process (GO:0006112)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|dendrite membrane (GO:0032590)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)	p.V569I(1)		central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(22)|pancreas(2)|prostate(7)|skin(4)|stomach(1)|urinary_tract(1)	53			BRCA - Breast invasive adenocarcinoma(12;0.000405)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)		Dalfampridine(DB06637)	AGAGGGGCTACGGGGCTGGGG	0.522																																					p.V569I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1705A	20						.	C	ILE/VAL	0,4406		0,0,2203	97.0	86.0	90.0		1705	-0.3	0.0	20		90	1,8599	1.2+/-3.3	0,1,4299	no	missense	KCNB1	NM_004975.2	29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	569/859	47990392	1,13005	2203	4300	6503	47423799	SO:0001583	missense	3745	exon2			AF026005	CCDS13418.1	20q13.2	2012-07-05			ENSG00000158445	ENSG00000158445		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6231	protein-coding gene	gene with protein product		600397				7774931, 16382104	Standard	NM_004975		Approved	Kv2.1	uc002xur.1	Q14721	OTTHUMG00000033051	ENST00000371741.4:c.1705G>A	20.37:g.47990392C>T	ENSP00000360806:p.Val569Ile		47423799	NM_004975	Q14193	Missense_Mutation	SNP	ENST00000371741.4	37	CCDS13418.1	.	.	.	.	.	.	.	.	.	.	C	4.218	0.039215	0.08148	0.0	1.16E-4	ENSG00000158445	ENST00000371741;ENST00000538812	T	0.22945	1.93	6.07	-0.292	0.12839	.	2.114130	0.01750	N	0.029865	T	0.22399	0.0540	L	0.29908	0.895	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.31223	-0.9951	10	0.36615	T	0.2	.	11.1674	0.48552	0.0:0.4126:0.0:0.5874	.	569	Q14721	KCNB1_HUMAN	I	569;524	ENSP00000360806:V569I	ENSP00000360806:V569I	V	-	1	0	KCNB1	47423799	0.000000	0.05858	0.006000	0.13384	0.711000	0.40976	-0.038000	0.12144	-0.248000	0.09583	0.655000	0.94253	GTA		0.522	KCNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080374.3	NM_004975	
KCNQ2	3785	hgsc.bcm.edu	37	20	62044879	62044879	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3612-01A-01W-0833-10	TCGA-AG-3612-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	93a27bfa-33be-4eec-863e-5c85a11493e2	e350ce5e-3bd3-4c1a-a212-a3b2294e180c	g.chr20:62044879C>T	ENST00000359125.2	-	15	1861	c.1687G>A	c.(1687-1689)Gac>Aac	p.D563N	KCNQ2_ENST00000344462.4_Missense_Mutation_p.D532N|KCNQ2_ENST00000359689.1_Missense_Mutation_p.D563N|KCNQ2_ENST00000357249.2_Missense_Mutation_p.D545N|KCNQ2_ENST00000360480.3_Missense_Mutation_p.D535N|KCNQ2_ENST00000370224.1_Missense_Mutation_p.D535N|KCNQ2_ENST00000354587.3_Missense_Mutation_p.D535N	NM_172107.2	NP_742105.1	O43526	KCNQ2_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 2	563					axon guidance (GO:0007411)|nervous system development (GO:0007399)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	ankyrin binding (GO:0030506)|delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)	p.D563N(2)		biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(4)|liver(1)|lung(30)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65	all_cancers(38;1.24e-11)		BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		Amitriptyline(DB00321)|Diclofenac(DB00586)|Ezogabine(DB04953)|Meclofenamic acid(DB00939)	TCCATCACGTCGTAGGGCCGC	0.642																																					p.D563N												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.G1687A	20						.						111.0	100.0	104.0					20																	62044879		2203	4300	6503	61515323	SO:0001583	missense	3785	exon15			AF033348	CCDS13518.1, CCDS13519.1, CCDS13520.1, CCDS13521.1, CCDS46629.1	20q13.33	2012-07-05			ENSG00000075043	ENSG00000075043		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6296	protein-coding gene	gene with protein product		602235		EBN, EBN1		9425895, 16382104	Standard	NM_172107		Approved	Kv7.2, ENB1, BFNC, KCNA11, HNSPC	uc002yex.3	O43526	OTTHUMG00000033049	ENST00000359125.2:c.1687G>A	20.37:g.62044879C>T	ENSP00000352035:p.Asp563Asn		61515323	NM_172107	O43796|O75580|O95845|Q4VXP4|Q4VXR6|Q5VYT8|Q96J59|Q99454	Missense_Mutation	SNP	ENST00000359125.2	37	CCDS13520.1	.	.	.	.	.	.	.	.	.	.	c	26.7	4.758246	0.89843	.	.	ENSG00000075043	ENST00000357249;ENST00000359125;ENST00000370226;ENST00000354587;ENST00000359689;ENST00000430658;ENST00000360480;ENST00000344462;ENST00000370224;ENST00000370222	D;D;D;D;D;D;D;D;D;D	0.99886	-7.52;-7.52;-7.52;-7.52;-7.52;-7.52;-7.52;-7.52;-7.52;-7.52	4.99	4.99	0.66335	Potassium channel, voltage dependent, KCNQ, C-terminal (1);	0.054789	0.64402	D	0.000001	D	0.99894	0.9949	M	0.87547	2.89	0.58432	D	0.999992	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;0.999;0.999;1.0	D	0.96075	0.9049	10	0.87932	D	0	-21.3948	18.2551	0.90017	0.0:1.0:0.0:0.0	.	535;545;532;563	O43526-3;O43526-2;O43526-4;O43526	.;.;.;KCNQ2_HUMAN	N	545;563;533;535;563;532;535;523;535;535	ENSP00000349789:D545N;ENSP00000352035:D563N;ENSP00000359246:D533N;ENSP00000346601:D535N;ENSP00000352718:D563N;ENSP00000399612:D532N;ENSP00000353668:D535N;ENSP00000339611:D523N;ENSP00000359244:D535N;ENSP00000359242:D535N	ENSP00000339611:D523N	D	-	1	0	KCNQ2	61515323	1.000000	0.71417	0.600000	0.28864	0.493000	0.33554	7.660000	0.83776	2.323000	0.78572	0.556000	0.70494	GAC		0.642	KCNQ2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080353.1	NM_172109	
OSBPL6	114880	hgsc.bcm.edu	37	2	179236884	179236884	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3612-01A-01W-0833-10	TCGA-AG-3612-10A-01W-0833-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	93a27bfa-33be-4eec-863e-5c85a11493e2	e350ce5e-3bd3-4c1a-a212-a3b2294e180c	g.chr2:179236884G>T	ENST00000190611.4	+	14	1695	c.1319G>T	c.(1318-1320)cGg>cTg	p.R440L	OSBPL6_ENST00000357080.4_Intron|OSBPL6_ENST00000409045.3_Missense_Mutation_p.R409L|OSBPL6_ENST00000409631.1_Intron|OSBPL6_ENST00000315022.2_Missense_Mutation_p.R444L|OSBPL6_ENST00000392505.2_Missense_Mutation_p.R465L|OSBPL6_ENST00000359685.3_Intron	NM_032523.3	NP_115912.1	Q9BZF3	OSBL6_HUMAN	oxysterol binding protein-like 6	440					lipid transport (GO:0006869)	cytosol (GO:0005829)|nuclear membrane (GO:0031965)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)	p.R440L(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(13)|lung(18)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	46			OV - Ovarian serous cystadenocarcinoma(117;0.00578)|Epithelial(96;0.00847)|all cancers(119;0.0335)			CTAAGGAGTCGGTTGAACAGA	0.328																																					p.R440L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1319T	2						.						132.0	135.0	134.0					2																	179236884		2203	4300	6503	178945130	SO:0001583	missense	114880	exon14			AF392448	CCDS2277.1, CCDS2278.1, CCDS56150.1, CCDS56151.1, CCDS56152.1	2q32.1	2008-05-27			ENSG00000079156	ENSG00000079156		"""Oxysterol binding proteins"""	16388	protein-coding gene	gene with protein product	"""OSBP-related protein 6"""	606734				11483621	Standard	NM_001201480		Approved	ORP6	uc002uly.3	Q9BZF3	OTTHUMG00000132579	ENST00000190611.4:c.1319G>T	2.37:g.179236884G>T	ENSP00000190611:p.Arg440Leu		178945130	NM_032523	B4DTW1|C4AMC0|C4AME4|D3DPF6|D3DPF7|Q4ZG68|Q53T68|Q59H61|Q7Z4Q1|Q86V84|Q8N9T0|Q96SR1	Missense_Mutation	SNP	ENST00000190611.4	37	CCDS2277.1	.	.	.	.	.	.	.	.	.	.	G	35	5.525989	0.96431	.	.	ENSG00000079156	ENST00000392505;ENST00000409045;ENST00000190611;ENST00000315022	T;T;T;T	0.14640	2.5;2.55;2.52;2.49	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.32466	0.0830	L	0.61218	1.895	0.80722	D	1	P;D;D;P	0.61697	0.949;0.99;0.99;0.915	P;P;P;B	0.58660	0.66;0.843;0.843;0.35	T	0.00334	-1.1809	10	0.37606	T	0.19	-15.714	19.8529	0.96746	0.0:0.0:1.0:0.0	.	409;444;465;440	Q9BZF3-4;Q9BZF3-3;Q9BZF3-5;Q9BZF3	.;.;.;OSBL6_HUMAN	L	465;409;440;444	ENSP00000376293:R465L;ENSP00000387248:R409L;ENSP00000190611:R440L;ENSP00000318723:R444L	ENSP00000190611:R440L	R	+	2	0	OSBPL6	178945130	1.000000	0.71417	0.998000	0.56505	0.926000	0.56050	9.152000	0.94680	2.755000	0.94549	0.655000	0.94253	CGG		0.328	OSBPL6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000334393.2	NM_032523	
TFPI	7035	hgsc.bcm.edu	37	2	188343482	188343482	+	Intron	SNP	T	T	A			TCGA-AG-3612-01A-01W-0833-10	TCGA-AG-3612-10A-01W-0833-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	93a27bfa-33be-4eec-863e-5c85a11493e2	e350ce5e-3bd3-4c1a-a212-a3b2294e180c	g.chr2:188343482T>A	ENST00000233156.3	-	6	923				TFPI_ENST00000392365.1_Intron|AC007319.1_ENST00000412276.1_RNA|TFPI_ENST00000339091.4_Missense_Mutation_p.Y226F|TFPI_ENST00000409676.1_Missense_Mutation_p.Y226F|AC007319.1_ENST00000453517.1_RNA	NM_006287.4	NP_006278.1	P10646	TFPI1_HUMAN	tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor)						blood coagulation (GO:0007596)|blood coagulation, extrinsic pathway (GO:0007598)|negative regulation of endopeptidase activity (GO:0010951)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.Y226F(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|skin(1)	9			OV - Ovarian serous cystadenocarcinoma(117;0.0554)		Coagulation factor VIIa(DB00036)|Dalteparin(DB06779)	AAAGACTTGGTAAATATGAGC	0.343																																					p.Y226F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A677T	2						.						149.0	132.0	138.0					2																	188343482		2203	4300	6503	188051727	SO:0001627	intron_variant	7035	exon7				CCDS2294.1, CCDS33349.1	2q32	2008-06-02			ENSG00000003436	ENSG00000003436			11760	protein-coding gene	gene with protein product	"""extrinsic pathway inhibitor"""	152310		LACI		1993173	Standard	XM_005246818		Approved	EPI, TFI, TFPI1	uc002upy.3	P10646	OTTHUMG00000132634	ENST00000233156.3:c.628+5368A>T	2.37:g.188343482T>A			188051727	NM_001032281	O95103|Q53TS4	Missense_Mutation	SNP	ENST00000233156.3	37	CCDS2294.1	.	.	.	.	.	.	.	.	.	.	T	19.79	3.892504	0.72524	.	.	ENSG00000003436	ENST00000409676;ENST00000339091	T;T	0.66638	-0.22;-0.22	4.72	0.975	0.19721	.	.	.	.	.	T	0.72946	0.3524	.	.	.	0.80722	D	1	D	0.61697	0.99	P	0.58266	0.836	T	0.69518	-0.5124	8	0.52906	T	0.07	.	8.1202	0.30967	0.0:0.3451:0.0:0.6549	.	226	P10646-2	.	F	226	ENSP00000386344:Y226F;ENSP00000342306:Y226F	ENSP00000342306:Y226F	Y	-	2	0	TFPI	188051727	1.000000	0.71417	0.994000	0.49952	0.943000	0.58893	0.422000	0.21296	-0.077000	0.12752	0.455000	0.32223	TAC		0.343	TFPI-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255881.1	NM_006287	
PIKFYVE	200576	hgsc.bcm.edu	37	2	209190426	209190426	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3612-01A-01W-0833-10	TCGA-AG-3612-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	93a27bfa-33be-4eec-863e-5c85a11493e2	e350ce5e-3bd3-4c1a-a212-a3b2294e180c	g.chr2:209190426C>T	ENST00000264380.4	+	20	3049	c.2891C>T	c.(2890-2892)cCg>cTg	p.P964L		NM_015040.3	NP_055855.2	Q9Y2I7	FYV1_HUMAN	phosphoinositide kinase, FYVE finger containing	964					cellular protein metabolic process (GO:0044267)|intracellular signal transduction (GO:0035556)|myelin assembly (GO:0032288)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phospholipid metabolic process (GO:0006644)|protein localization to nucleus (GO:0034504)|retrograde transport, endosome to Golgi (GO:0042147)|small molecule metabolic process (GO:0044281)	cell-cell junction (GO:0005911)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|vesicle membrane (GO:0012506)	1-phosphatidylinositol-3-phosphate 5-kinase activity (GO:0000285)|1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)|phosphatidylinositol-3,5-bisphosphate 5-phosphatase activity (GO:0043813)|zinc ion binding (GO:0008270)	p.P964L(1)		NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(14)|kidney(6)|large_intestine(25)|lung(40)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	107						ACAGCTTGCCCGGCGGGTCTC	0.502																																					p.P964L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2891T	2						.						66.0	65.0	65.0					2																	209190426		2203	4300	6503	208898671	SO:0001583	missense	200576	exon20			AB023198	CCDS2382.1, CCDS33368.1, CCDS54431.1	2q34	2014-01-15	2009-04-17	2009-04-17	ENSG00000115020	ENSG00000115020		"""Zinc fingers, FYVE domain containing"""	23785	protein-coding gene	gene with protein product	"""zinc finger, FYVE domain containing 29"""	609414	"""phosphatidylinositol-3-phosphate/phosphatidylinositol 5-kinase, type III"""	PIP5K3		9858586, 12270933	Standard	NM_015040		Approved	MGC40423, KIAA0981, PIKfyve, PIP5K, p235, ZFYVE29, FAB1	uc002vcz.3	Q9Y2I7	OTTHUMG00000132945	ENST00000264380.4:c.2891C>T	2.37:g.209190426C>T	ENSP00000264380:p.Pro964Leu		208898671	NM_015040	Q08AR7|Q08AR8|Q53ST3|Q53T36|Q8N5H0|Q8NB67	Missense_Mutation	SNP	ENST00000264380.4	37	CCDS2382.1	.	.	.	.	.	.	.	.	.	.	C	6.701	0.498060	0.12762	.	.	ENSG00000115020	ENST00000264380;ENST00000392200;ENST00000452564	T;T	0.27890	1.64;1.81	6.07	4.22	0.49857	.	0.284775	0.28187	N	0.016268	T	0.23926	0.0579	L	0.56769	1.78	0.52099	D	0.999943	B;B	0.28880	0.226;0.031	B;B	0.17098	0.017;0.006	T	0.05533	-1.0879	10	0.21014	T	0.42	-1.1002	6.4434	0.21863	0.1432:0.6971:0.0:0.1596	.	964;908	Q9Y2I7;E9PDH4	FYV1_HUMAN;.	L	964;540;908	ENSP00000264380:P964L;ENSP00000405736:P908L	ENSP00000264380:P964L	P	+	2	0	PIKFYVE	208898671	0.000000	0.05858	0.381000	0.26106	0.040000	0.13550	0.619000	0.24388	0.830000	0.34757	0.650000	0.86243	CCG		0.502	PIKFYVE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256477.2	NM_015040	
DYSF	8291	hgsc.bcm.edu	37	2	71896834	71896834	+	Silent	SNP	C	C	T			TCGA-AG-3612-01A-01W-0833-10	TCGA-AG-3612-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	93a27bfa-33be-4eec-863e-5c85a11493e2	e350ce5e-3bd3-4c1a-a212-a3b2294e180c	g.chr2:71896834C>T	ENST00000258104.3	+	50	5902	c.5625C>T	c.(5623-5625)ttC>ttT	p.F1875F	DYSF_ENST00000429174.2_Silent_p.F1896F|DYSF_ENST00000409762.1_Silent_p.F1892F|DYSF_ENST00000410041.1_Silent_p.F1893F|DYSF_ENST00000479049.2_3'UTR|DYSF_ENST00000413539.2_Silent_p.F1906F|DYSF_ENST00000409366.1_Silent_p.F1897F|DYSF_ENST00000409744.1_Silent_p.F1883F|DYSF_ENST00000394120.2_Silent_p.F1876F|DYSF_ENST00000409582.3_Silent_p.F1913F|DYSF_ENST00000409651.1_Silent_p.F1907F|DYSF_ENST00000410020.3_Silent_p.F1914F	NM_001130976.1|NM_003494.3	NP_001124448.1|NP_003485.1	O75923	DYSF_HUMAN	dysferlin	1875	C2 7. {ECO:0000255|PROSITE- ProRule:PRU00041}.				plasma membrane repair (GO:0001778)|vesicle fusion (GO:0006906)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phospholipid binding (GO:0005543)	p.F1875F(1)		autonomic_ganglia(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(57)|ovary(3)|pancreas(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(2)	111						TTTTCCCCTTCGACTACCTGC	0.502																																					p.F1907F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C5721T	2						.						190.0	155.0	167.0					2																	71896834		2203	4300	6503	71750342	SO:0001819	synonymous_variant	8291	exon51			AF075575	CCDS1918.1, CCDS46323.1, CCDS46324.1, CCDS46325.1, CCDS46326.1, CCDS46327.1, CCDS46328.1, CCDS46329.1, CCDS46330.1, CCDS46331.1, CCDS46332.1	2p13.3	2014-09-17	2013-09-12		ENSG00000135636	ENSG00000135636			3097	protein-coding gene	gene with protein product	"""fer-1-like family member 1"""	603009	"""limb girdle muscular dystrophy 2B (autosomal recessive)"""	LGMD2B		8320700	Standard	NM_003494		Approved	FER1L1	uc010fen.3	O75923	OTTHUMG00000129757	ENST00000258104.3:c.5625C>T	2.37:g.71896834C>T			71750342	NM_001130982	A0FK00|B1PZ70|B1PZ71|B1PZ72|B1PZ73|B1PZ74|B1PZ75|B1PZ76|B1PZ77|B1PZ78|B1PZ79|B1PZ80|B1PZ81|B3KQB9|O75696|Q09EX5|Q0H395|Q53QY3|Q53TD2|Q8TEL8|Q9UEN7	Silent	SNP	ENST00000258104.3	37	CCDS1918.1																																																																																				0.502	DYSF-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251970.3	NM_003494	
MAP2	4133	hgsc.bcm.edu	37	2	210559149	210559149	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3612-01A-01W-0833-10	TCGA-AG-3612-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	93a27bfa-33be-4eec-863e-5c85a11493e2	e350ce5e-3bd3-4c1a-a212-a3b2294e180c	g.chr2:210559149C>T	ENST00000360351.4	+	7	2761	c.2255C>T	c.(2254-2256)gCa>gTa	p.A752V	MAP2_ENST00000361559.4_Intron|MAP2_ENST00000447185.1_Missense_Mutation_p.A748V|MAP2_ENST00000199940.6_Intron|MAP2_ENST00000392194.1_Intron	NM_002374.3	NP_002365.3	P11137	MTAP2_HUMAN	microtubule-associated protein 2	752					axonogenesis (GO:0007409)|cellular response to organic substance (GO:0071310)|central nervous system neuron development (GO:0021954)|dendrite morphogenesis (GO:0048813)|microtubule bundle formation (GO:0001578)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|nuclear periphery (GO:0034399)	dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)	p.A752V(1)		breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(36)|liver(2)|lung(42)|ovary(11)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	124		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Docetaxel(DB01248)|Estramustine(DB01196)|Paclitaxel(DB01229)	ACCACACCTGCACTGGAGAAA	0.468																																					p.A752V	Pancreas(27;423 979 28787 29963)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2255T	2						.						70.0	70.0	70.0					2																	210559149		2203	4300	6503	210267394	SO:0001583	missense	4133	exon7				CCDS2384.1, CCDS2385.1, CCDS33369.1	2q34-q35	2008-05-27			ENSG00000078018	ENSG00000078018		"""A-kinase anchor proteins"""	6839	protein-coding gene	gene with protein product		157130				3103857, 7479905	Standard	XM_005246554		Approved	MAP2A, MAP2B, MAP2C	uc002vde.1	P11137	OTTHUMG00000132962	ENST00000360351.4:c.2255C>T	2.37:g.210559149C>T	ENSP00000353508:p.Ala752Val		210267394	NM_002374	Q17S04|Q8IUX2|Q99975|Q99976	Missense_Mutation	SNP	ENST00000360351.4	37	CCDS2384.1	.	.	.	.	.	.	.	.	.	.	C	19.52	3.842336	0.71488	.	.	ENSG00000078018	ENST00000360351;ENST00000447185	T;T	0.25579	1.79;1.79	5.96	5.04	0.67666	MAP2/Tau projection (1);	0.000000	0.64402	D	0.000006	T	0.46425	0.1392	L	0.56769	1.78	0.51233	D	0.999917	D;D	0.69078	0.996;0.997	P;D	0.65323	0.892;0.934	T	0.39078	-0.9631	10	0.87932	D	0	-20.4248	16.6757	0.85278	0.0:0.8706:0.1294:0.0	.	748;752	P11137-3;P11137	.;MAP2_HUMAN	V	752;748	ENSP00000353508:A752V;ENSP00000392164:A748V	ENSP00000353508:A752V	A	+	2	0	MAP2	210267394	0.997000	0.39634	0.889000	0.34880	0.703000	0.40648	3.582000	0.53921	2.833000	0.97629	0.650000	0.86243	GCA		0.468	MAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256521.2	NM_001039538	
BOC	91653	hgsc.bcm.edu	37	3	112991422	112991422	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3612-01A-01W-0833-10	TCGA-AG-3612-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	93a27bfa-33be-4eec-863e-5c85a11493e2	e350ce5e-3bd3-4c1a-a212-a3b2294e180c	g.chr3:112991422G>A	ENST00000495514.1	+	7	1537	c.833G>A	c.(832-834)cGc>cAc	p.R278H	BOC_ENST00000273395.4_Missense_Mutation_p.R278H|BOC_ENST00000355385.3_Missense_Mutation_p.R278H			Q9BWV1	BOC_HUMAN	BOC cell adhesion associated, oncogene regulated	278	Ig-like C2-type 3.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast differentiation (GO:0045663)|smoothened signaling pathway (GO:0007224)	axonal growth cone (GO:0044295)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)		p.R278H(1)		NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(17)|lung(18)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	68			Epithelial(53;0.227)			AACAAGACGCGCTTCCTGCTG	0.642																																					p.R278H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G833A	3						.						133.0	127.0	129.0					3																	112991422		2203	4300	6503	114474112	SO:0001583	missense	91653	exon7			AY027658	CCDS2971.1	3q13.2	2013-02-11	2012-12-07		ENSG00000144857	ENSG00000144857		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	17173	protein-coding gene	gene with protein product	"""brother of CDO"", ""brother of CDON"", ""cell adhesion associated, oncogene regulated 2"""	608708	"""Boc homolog (mouse)"""			11782431	Standard	NM_033254		Approved	CDON2	uc003dzy.3	Q9BWV1	OTTHUMG00000159305	ENST00000495514.1:c.833G>A	3.37:g.112991422G>A	ENSP00000418663:p.Arg278His		114474112	NM_033254	A6NJ30|B2RMS8|D3DN70|Q6UXJ5|Q8N2P7|Q8NF26	Missense_Mutation	SNP	ENST00000495514.1	37	CCDS2971.1	.	.	.	.	.	.	.	.	.	.	G	18.30	3.594470	0.66219	.	.	ENSG00000144857	ENST00000495514;ENST00000273395;ENST00000355385	T;T;T	0.68479	-0.33;-0.33;-0.33	5.92	5.92	0.95590	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.104866	0.64402	D	0.000003	T	0.61236	0.2331	L	0.42632	1.34	0.54753	D	0.99998	P;P	0.37083	0.525;0.581	B;B	0.36845	0.098;0.234	T	0.56208	-0.8017	10	0.15066	T	0.55	.	20.3213	0.98679	0.0:0.0:1.0:0.0	.	278;278	Q9BWV1-3;Q9BWV1	.;BOC_HUMAN	H	278	ENSP00000418663:R278H;ENSP00000273395:R278H;ENSP00000347546:R278H	ENSP00000273395:R278H	R	+	2	0	BOC	114474112	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	6.170000	0.71920	2.810000	0.96702	0.650000	0.86243	CGC		0.642	BOC-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000354485.3	NM_033254	
TMEM108	66000	hgsc.bcm.edu	37	3	133098766	133098766	+	Missense_Mutation	SNP	G	G	T	rs372281436		TCGA-AG-3612-01A-01W-0833-10	TCGA-AG-3612-10A-01W-0833-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	93a27bfa-33be-4eec-863e-5c85a11493e2	e350ce5e-3bd3-4c1a-a212-a3b2294e180c	g.chr3:133098766G>T	ENST00000321871.6	+	4	421	c.211G>T	c.(211-213)Gat>Tat	p.D71Y	TMEM108_ENST00000393130.3_Missense_Mutation_p.D71Y|TMEM108_ENST00000515826.1_Missense_Mutation_p.D71Y|TMEM108_ENST00000508711.1_Intron	NM_001136469.1|NM_023943.2	NP_001129941.1|NP_076432.1	Q6UXF1	TM108_HUMAN	transmembrane protein 108	71	Pro-rich.					integral component of membrane (GO:0016021)		p.D71Y(1)		endometrium(3)|kidney(1)|large_intestine(5)|lung(22)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	38						CCCCAATCCCGATGGACCCCC	0.622																																					p.D71Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G211T	3						.						99.0	97.0	98.0					3																	133098766		2203	4300	6503	134581456	SO:0001583	missense	66000	exon4			AL136578	CCDS33858.1, CCDS75012.1	3q22.1	2014-04-07			ENSG00000144868	ENSG00000144868			28451	protein-coding gene	gene with protein product	"""cancer/testis antigen 124"""					11214970	Standard	XM_005247726		Approved	MGC3040, CT124	uc003epi.3	Q6UXF1	OTTHUMG00000159685	ENST00000321871.6:c.211G>T	3.37:g.133098766G>T	ENSP00000324651:p.Asp71Tyr		134581456	NM_001136469	D3DNC9|Q9BQH1|Q9BW81|Q9C0H3	Missense_Mutation	SNP	ENST00000321871.6	37	CCDS33858.1	.	.	.	.	.	.	.	.	.	.	g	1.725	-0.495606	0.04291	.	.	ENSG00000144868	ENST00000321871;ENST00000393130;ENST00000514894;ENST00000512662;ENST00000512137;ENST00000511555;ENST00000515826;ENST00000510183	T;T;T;T;T;T;T;T	0.52057	0.68;0.68;0.68;0.68;0.68;0.68;0.68;0.68	3.8	1.88	0.25563	.	0.189876	0.25771	N	0.028407	T	0.48822	0.1521	L	0.51422	1.61	0.09310	N	1	P;D	0.55172	0.57;0.97	B;P	0.54664	0.364;0.758	T	0.36114	-0.9761	10	0.62326	D	0.03	-0.9379	5.5797	0.17243	0.2822:0.0:0.7178:0.0	.	71;71	E9PB58;Q6UXF1	.;TM108_HUMAN	Y	71;71;22;22;71;71;71;71	ENSP00000324651:D71Y;ENSP00000376838:D71Y;ENSP00000422072:D22Y;ENSP00000427447:D22Y;ENSP00000426301:D71Y;ENSP00000422196:D71Y;ENSP00000423338:D71Y;ENSP00000421486:D71Y	ENSP00000324651:D71Y	D	+	1	0	TMEM108	134581456	0.000000	0.05858	0.014000	0.15608	0.035000	0.12851	-0.258000	0.08733	0.342000	0.23796	-0.261000	0.10672	GAT		0.622	TMEM108-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356907.2	NM_023943	
TTC14	151613	hgsc.bcm.edu	37	3	180322377	180322377	+	Missense_Mutation	SNP	A	A	T			TCGA-AG-3612-01A-01W-0833-10	TCGA-AG-3612-10A-01W-0833-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	93a27bfa-33be-4eec-863e-5c85a11493e2	e350ce5e-3bd3-4c1a-a212-a3b2294e180c	g.chr3:180322377A>T	ENST00000296015.4	+	5	815	c.683A>T	c.(682-684)gAg>gTg	p.E228V	RP11-496B10.3_ENST00000472596.1_lincRNA|TTC14_ENST00000382584.4_Missense_Mutation_p.E228V|TTC14_ENST00000412756.2_Missense_Mutation_p.E228V	NM_133462.3	NP_597719.1	Q96N46	TTC14_HUMAN	tetratricopeptide repeat domain 14	228							RNA binding (GO:0003723)	p.E228V(1)		endometrium(3)|kidney(5)|large_intestine(9)|lung(24)|ovary(2)|pancreas(1)|skin(1)	45	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			AGCTCTGAAGAGCTTCCTTTA	0.343																																					p.E228V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A683T	3						.						58.0	58.0	58.0					3																	180322377		2203	4295	6498	181805071	SO:0001583	missense	151613	exon5			AB075860	CCDS3237.1, CCDS46963.1, CCDS75055.1	3q27.2	2013-01-10			ENSG00000163728	ENSG00000163728		"""Tetratricopeptide (TTC) repeat domain containing"""	24697	protein-coding gene	gene with protein product						11853319	Standard	NM_001042601		Approved	FLJ00166, KIAA1980	uc003fkk.3	Q96N46	OTTHUMG00000157859	ENST00000296015.4:c.683A>T	3.37:g.180322377A>T	ENSP00000296015:p.Glu228Val		181805071	NM_133462	G5E9X0|Q6UWJ7|Q8TF22	Missense_Mutation	SNP	ENST00000296015.4	37	CCDS3237.1	.	.	.	.	.	.	.	.	.	.	A	28.6	4.936033	0.92458	.	.	ENSG00000163728	ENST00000296015;ENST00000412756;ENST00000382584;ENST00000492617;ENST00000495660	T;T	0.51325	0.73;0.71	5.71	5.71	0.89125	.	0.094536	0.64402	D	0.000001	T	0.52125	0.1715	L	0.27053	0.805	0.80722	D	1	D;P;P	0.67145	0.996;0.95;0.938	P;P;P	0.57548	0.823;0.719;0.502	T	0.57004	-0.7885	10	0.87932	D	0	-18.1689	15.9836	0.80130	1.0:0.0:0.0:0.0	.	228;228;228	Q96N46-2;G5E9X0;Q96N46	.;.;TTC14_HUMAN	V	228;228;228;128;128	ENSP00000296015:E228V;ENSP00000372027:E228V	ENSP00000296015:E228V	E	+	2	0	TTC14	181805071	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.108000	0.94275	2.185000	0.69588	0.528000	0.53228	GAG		0.343	TTC14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349786.1	NM_133462	
CPZ	8532	hgsc.bcm.edu	37	4	8608503	8608503	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3612-01A-01W-0833-10	TCGA-AG-3612-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	93a27bfa-33be-4eec-863e-5c85a11493e2	e350ce5e-3bd3-4c1a-a212-a3b2294e180c	g.chr4:8608503G>A	ENST00000360986.4	+	6	1120	c.946G>A	c.(946-948)Gcg>Acg	p.A316T	CPZ_ENST00000429646.2_5'UTR|CPZ_ENST00000382480.2_Missense_Mutation_p.A179T|CPZ_ENST00000315782.6_Missense_Mutation_p.A305T	NM_001014447.2	NP_001014447	Q66K79	CBPZ_HUMAN	carboxypeptidase Z	316					proteolysis (GO:0006508)|Wnt signaling pathway (GO:0016055)	extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)	p.A316T(1)		cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(23)|ovary(3)|pancreas(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						GAGGCAGAACGCGCAGAACCT	0.657																																					p.A305T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G913A	4						.						70.0	69.0	69.0					4																	8608503		2203	4300	6503	8659403	SO:0001583	missense	8532	exon5			U83411	CCDS3404.1, CCDS33953.1, CCDS43212.1	4p16.1	2012-02-10			ENSG00000109625	ENSG00000109625			2333	protein-coding gene	gene with protein product	"""metallocarboxypeptidase Z"""	603105				9099699	Standard	NM_001014447		Approved		uc003glm.3	Q66K79	OTTHUMG00000090513	ENST00000360986.4:c.946G>A	4.37:g.8608503G>A	ENSP00000354255:p.Ala316Thr		8659403	NM_003652	O00520|Q96MX2	Missense_Mutation	SNP	ENST00000360986.4	37	CCDS33953.1	.	.	.	.	.	.	.	.	.	.	g	17.95	3.513537	0.64522	.	.	ENSG00000109625	ENST00000360986;ENST00000382480;ENST00000315782	T;T;T	0.03889	3.77;3.77;3.77	3.31	2.33	0.28932	Peptidase M14, carboxypeptidase A (2);	0.202783	0.41605	U	0.000853	T	0.12178	0.0296	M	0.87038	2.855	0.80722	D	1	D;P	0.59767	0.986;0.868	P;B	0.47102	0.537;0.319	T	0.10965	-1.0607	10	0.52906	T	0.07	-20.6085	11.0173	0.47696	0.0:0.0:0.8005:0.1995	.	305;316	Q66K79-2;Q66K79	.;CBPZ_HUMAN	T	316;179;305	ENSP00000354255:A316T;ENSP00000371920:A179T;ENSP00000315074:A305T	ENSP00000315074:A305T	A	+	1	0	CPZ	8659403	1.000000	0.71417	1.000000	0.80357	0.886000	0.51366	5.549000	0.67261	1.672000	0.50884	0.450000	0.29827	GCG		0.657	CPZ-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207001.4	NM_003652	
STIM2	57620	hgsc.bcm.edu	37	4	27019361	27019361	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-3612-01A-01W-0833-10	TCGA-AG-3612-10A-01W-0833-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	93a27bfa-33be-4eec-863e-5c85a11493e2	e350ce5e-3bd3-4c1a-a212-a3b2294e180c	g.chr4:27019361A>C	ENST00000467011.1	+	11	1943	c.1518A>C	c.(1516-1518)ttA>ttC	p.L506F	STIM2_ENST00000467087.1_Missense_Mutation_p.L506F|STIM2_ENST00000237364.5_Missense_Mutation_p.L593F|STIM2_ENST00000412829.2_Missense_Mutation_p.L593F|STIM2_ENST00000382009.3_Missense_Mutation_p.L601F|STIM2_ENST00000465503.1_Missense_Mutation_p.L514F	NM_001169117.1	NP_001162588	Q9P246	STIM2_HUMAN	stromal interaction molecule 2	506					activation of store-operated calcium channel activity (GO:0032237)|calcium ion transmembrane transport (GO:0070588)|cellular calcium ion homeostasis (GO:0006874)|positive regulation of calcium ion transport (GO:0051928)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|store-operated calcium channel activity (GO:0015279)	p.L593F(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(7)|prostate(1)|skin(2)|urinary_tract(1)	25		Breast(46;0.0503)				CTGGATCATTAGCCAGAAGCA	0.552																																					p.L506F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1518C	4						.						149.0	147.0	148.0					4																	27019361		2203	4300	6503	26628459	SO:0001583	missense	57620	exon11			AB040915	CCDS3440.1, CCDS3440.2, CCDS54751.1, CCDS54752.1	4p15.2	2013-01-10			ENSG00000109689	ENSG00000109689		"""Sterile alpha motif (SAM) domain containing"""	19205	protein-coding gene	gene with protein product		610841				11463338	Standard	NM_020860		Approved		uc003gsh.4	Q9P246	OTTHUMG00000097805	ENST00000467011.1:c.1518A>C	4.37:g.27019361A>C	ENSP00000419383:p.Leu506Phe		26628459	NM_001169117	A6H8L7|B7ZVY0|Q96BF1|Q9BQH2|Q9H8R1	Missense_Mutation	SNP	ENST00000467011.1	37	CCDS54752.1	.	.	.	.	.	.	.	.	.	.	A	17.14	3.314109	0.60414	.	.	ENSG00000109689	ENST00000467087;ENST00000382009;ENST00000237364;ENST00000467011;ENST00000412829;ENST00000465503;ENST00000473519;ENST00000477474	T;T;T;T;T;T;D;D	0.83075	-1.26;-1.28;-1.29;-1.27;-1.31;-1.24;-1.68;-1.68	5.68	2.02	0.26589	.	0.084168	0.50627	D	0.000116	D	0.85173	0.5636	L	0.55990	1.75	0.49687	D	0.999815	D;D;D;D	0.89917	0.999;0.999;0.999;1.0	D;D;D;D	0.85130	0.994;0.994;0.994;0.997	T	0.79983	-0.1573	10	0.37606	T	0.19	.	4.7338	0.12977	0.5322:0.0:0.3309:0.137	.	506;593;601;593	Q9P246;A6H8L7;E9PGD0;F5GXJ4	STIM2_HUMAN;.;.;.	F	506;601;593;506;593;514;214;108	ENSP00000419073:L506F;ENSP00000371439:L601F;ENSP00000237364:L593F;ENSP00000419383:L506F;ENSP00000404812:L593F;ENSP00000417569:L514F;ENSP00000420113:L214F;ENSP00000419536:L108F	ENSP00000237364:L593F	L	+	3	2	STIM2	26628459	1.000000	0.71417	0.815000	0.32552	0.712000	0.41017	1.343000	0.33930	0.123000	0.18342	0.528000	0.53228	TTA		0.552	STIM2-003	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000356861.1	NM_020860	
HTN3	3347	hgsc.bcm.edu	37	4	70896510	70896510	+	Splice_Site	SNP	T	T	A			TCGA-AG-3612-01A-01W-0833-10	TCGA-AG-3612-10A-01W-0833-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	93a27bfa-33be-4eec-863e-5c85a11493e2	e350ce5e-3bd3-4c1a-a212-a3b2294e180c	g.chr4:70896510T>A	ENST00000530128.1	+	2	126		c.e2+2		HTN3_ENST00000526767.1_Splice_Site|HTN3_ENST00000381057.3_Splice_Site			P15516	HIS3_HUMAN	histatin 3						biomineral tissue development (GO:0031214)|defense response to bacterium (GO:0042742)|defense response to fungus (GO:0050832)|killing of cells of other organism (GO:0031640)	extracellular region (GO:0005576)	metal ion binding (GO:0046872)	p.?(1)		breast(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)	8						TCCATGACTGTAAGTATATCT	0.333																																					.												.	.	1	Unknown(1)	large_intestine(1)	.	4						.						112.0	109.0	110.0					4																	70896510		2203	4298	6501	70931099	SO:0001630	splice_region_variant	3347	.				CCDS33999.1	4q13	2008-08-29							5284	protein-coding gene	gene with protein product		142702					Standard	NM_000200		Approved	HIS2	uc003hew.2	P15516		ENST00000530128.1:c.51+2T>A	4.37:g.70896510T>A			70931099	.	Q16243|Q502Z1	Splice_Site	SNP	ENST00000530128.1	37	CCDS33999.1	.	.	.	.	.	.	.	.	.	.	T	12.96	2.095107	0.36952	.	.	ENSG00000205649	ENST00000526767;ENST00000530128;ENST00000381057	.	.	.	2.62	2.62	0.31277	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.1135	0.25403	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	HTN3	70931099	1.000000	0.71417	0.998000	0.56505	0.280000	0.26924	2.719000	0.47244	1.459000	0.47892	0.413000	0.27773	.		0.333	HTN3-006	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387375.1	NM_000200	Intron
TRIML2	205860	hgsc.bcm.edu	37	4	189012815	189012815	+	Silent	SNP	C	C	T			TCGA-AG-3612-01A-01W-0833-10	TCGA-AG-3612-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	93a27bfa-33be-4eec-863e-5c85a11493e2	e350ce5e-3bd3-4c1a-a212-a3b2294e180c	g.chr4:189012815C>T	ENST00000512729.1	-	7	1250	c.876G>A	c.(874-876)acG>acA	p.T292T	TRIML2_ENST00000326754.3_Silent_p.T317T	NM_173553.1	NP_775824.1	Q8N7C3	TRIMM_HUMAN	tripartite motif family-like 2	292	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				protein ubiquitination (GO:0016567)|response to retinoic acid (GO:0032526)		ligase activity (GO:0016874)	p.T292T(1)		central_nervous_system(2)|kidney(1)|large_intestine(7)|lung(25)|prostate(3)|urinary_tract(1)	39		all_cancers(14;3.11e-44)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|all_hematologic(60;0.0202)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)		OV - Ovarian serous cystadenocarcinoma(60;1.79e-11)|BRCA - Breast invasive adenocarcinoma(30;4.52e-06)|GBM - Glioblastoma multiforme(59;1.62e-05)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.0091)|READ - Rectum adenocarcinoma(43;0.163)		TCACCGACCCCGTGAGCAAGA	0.572																																					p.T292T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G876A	4						.						142.0	152.0	149.0					4																	189012815		2203	4300	6503	189249809	SO:0001819	synonymous_variant	205860	exon7			AK098667	CCDS3850.1	4q35.2	2014-02-12	2007-12-14		ENSG00000179046	ENSG00000179046			26378	protein-coding gene	gene with protein product	"""SPRY domain containing 6"""						Standard	NM_173553		Approved	FLJ25801, SPRYD6	uc003izl.2	Q8N7C3	OTTHUMG00000160225	ENST00000512729.1:c.876G>A	4.37:g.189012815C>T			189249809	NM_173553	B7Z6J6	Silent	SNP	ENST00000512729.1	37	CCDS3850.1																																																																																				0.572	TRIML2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000359733.1	NM_173553	
APC	324	hgsc.bcm.edu	37	5	112175507	112175507	+	Nonsense_Mutation	SNP	C	C	T	rs587782518		TCGA-AG-3612-01A-01W-0833-10	TCGA-AG-3612-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	93a27bfa-33be-4eec-863e-5c85a11493e2	e350ce5e-3bd3-4c1a-a212-a3b2294e180c	g.chr5:112175507C>T	ENST00000457016.1	+	16	4596	c.4216C>T	c.(4216-4218)Cag>Tag	p.Q1406*	CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000257430.4_Nonsense_Mutation_p.Q1406*|APC_ENST00000508376.2_Nonsense_Mutation_p.Q1406*			P25054	APC_HUMAN	adenomatous polyposis coli	1406	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.Q1406*(15)|p.Q1406fs*11(1)|p.?(1)|p.K1192fs*3(1)|p.I1401fs*2(1)|p.Y1376fs*41(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		CAGCTCCGTTCAGAGTGAACC	0.468		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.Q1388X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,large_intestine,colon,Substitution - Nonsense,0 	.	20	Substitution - Nonsense(15)|Deletion - Frameshift(3)|Unknown(1)|Insertion - Frameshift(1)	large_intestine(18)|soft_tissue(1)|skin(1)	c.C4162T	5	GRCh37	CI084250|CM023011	APC	I|M		.						113.0	105.0	108.0					5																	112175507		2202	4300	6502	112203406	SO:0001587	stop_gained	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.4216C>T	5.37:g.112175507C>T	ENSP00000413133:p.Gln1406*		112203406	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	41	8.658788	0.98903	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376	.	.	.	6.17	5.3	0.74995	.	0.187376	0.50627	D	0.000103	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-8.0613	15.6825	0.77381	0.0:0.8637:0.1363:0.0	.	.	.	.	X	1406	.	.	Q	+	1	0	APC	112203406	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.175000	0.77632	1.615000	0.50252	0.655000	0.94253	CAG		0.468	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
FAT2	2196	hgsc.bcm.edu	37	5	150930323	150930323	+	Missense_Mutation	SNP	C	C	T	rs200746707		TCGA-AG-3612-01A-01W-0833-10	TCGA-AG-3612-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	93a27bfa-33be-4eec-863e-5c85a11493e2	e350ce5e-3bd3-4c1a-a212-a3b2294e180c	g.chr5:150930323C>T	ENST00000261800.5	-	7	4418	c.4406G>A	c.(4405-4407)cGa>cAa	p.R1469Q		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	1469	Cadherin 13. {ECO:0000255|PROSITE- ProRule:PRU00043}.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R1469Q(1)		NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GGCCTGGACTCGCAGGAGCTC	0.537																																					p.R1469Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4406A	5						.	C	GLN/ARG	0,4406		0,0,2203	103.0	85.0	91.0		4406	0.1	0.1	5		91	2,8598	2.2+/-6.3	0,2,4298	yes	missense	FAT2	NM_001447.2	43	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	benign	1469/4350	150930323	2,13004	2203	4300	6503	150910516	SO:0001583	missense	2196	exon7			AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.4406G>A	5.37:g.150930323C>T	ENSP00000261800:p.Arg1469Gln		150910516	NM_001447	O75091|Q9NSR7	Missense_Mutation	SNP	ENST00000261800.5	37	CCDS4317.1	.	.	.	.	.	.	.	.	.	.	C	2.128	-0.399693	0.04865	0.0	2.33E-4	ENSG00000086570	ENST00000261800	T	0.52526	0.66	5.0	0.112	0.14623	Cadherin (3);Cadherin-like (1);	0.426434	0.19824	N	0.105241	T	0.18509	0.0444	N	0.03917	-0.325	0.32026	N	0.600197	B	0.16802	0.019	B	0.17098	0.017	T	0.41142	-0.9525	10	0.02654	T	1	.	10.5163	0.44892	0.0:0.5245:0.0:0.4755	.	1469	Q9NYQ8	FAT2_HUMAN	Q	1469	ENSP00000261800:R1469Q	ENSP00000261800:R1469Q	R	-	2	0	FAT2	150910516	0.045000	0.20229	0.132000	0.22025	0.678000	0.39670	0.126000	0.15769	-0.315000	0.08703	0.655000	0.94253	CGA		0.537	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252434.1	NM_001447	
LIFR	3977	hgsc.bcm.edu	37	5	38486060	38486060	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-3612-01A-01W-0833-10	TCGA-AG-3612-10A-01W-0833-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	93a27bfa-33be-4eec-863e-5c85a11493e2	e350ce5e-3bd3-4c1a-a212-a3b2294e180c	g.chr5:38486060C>G	ENST00000263409.4	-	17	2520	c.2358G>C	c.(2356-2358)aaG>aaC	p.K786N	LIFR_ENST00000453190.2_Missense_Mutation_p.K786N	NM_002310.5	NP_002301.1	P42702	LIFR_HUMAN	leukemia inhibitory factor receptor alpha	786	Fibronectin type-III 6. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell surface receptor signaling pathway (GO:0007166)|ciliary neurotrophic factor-mediated signaling pathway (GO:0070120)|cytokine-mediated signaling pathway (GO:0019221)|leukemia inhibitory factor signaling pathway (GO:0048861)|oncostatin-M-mediated signaling pathway (GO:0038165)|positive regulation of cell proliferation (GO:0008284)|response to cytokine (GO:0034097)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ciliary neurotrophic factor receptor binding (GO:0005127)|growth factor binding (GO:0019838)|leukemia inhibitory factor receptor activity (GO:0004923)	p.K786N(1)		NS(2)|breast(4)|endometrium(6)|kidney(2)|large_intestine(30)|liver(2)|lung(21)|ovary(3)|skin(5)|stomach(1)|urinary_tract(2)	78	all_lung(31;0.00021)					CAGTAATATTCTTAACTTTTA	0.398			T	PLAG1	salivary adenoma																																p.K786N	Melanoma(13;4 730 6426 9861 34751)		Dom	yes		5	5p13-p12	3977	leukemia inhibitory factor receptor		E	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2358C	5						.						88.0	83.0	85.0					5																	38486060		2203	4300	6503	38521817	SO:0001583	missense	3977	exon17			X61615	CCDS3927.1	5p13-p12	2013-02-11	2006-05-17		ENSG00000113594	ENSG00000113594		"""CD molecules"", ""Fibronectin type III domain containing"""	6597	protein-coding gene	gene with protein product		151443	"""leukemia inhibitory factor receptor"""			1915266	Standard	NM_001127671		Approved	CD118	uc003jli.2	P42702	OTTHUMG00000131138	ENST00000263409.4:c.2358G>C	5.37:g.38486060C>G	ENSP00000263409:p.Lys786Asn		38521817	NM_001127671	Q6LCD9	Missense_Mutation	SNP	ENST00000263409.4	37	CCDS3927.1	.	.	.	.	.	.	.	.	.	.	C	14.18	2.457793	0.43634	.	.	ENSG00000113594	ENST00000263409;ENST00000453190	T;T	0.58358	0.34;0.34	5.43	4.56	0.56223	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000001	T	0.44350	0.1289	M	0.73962	2.25	0.37877	D	0.93025	P	0.42409	0.779	B	0.35182	0.197	T	0.48479	-0.9032	10	0.23891	T	0.37	-21.3193	5.729	0.18028	0.1407:0.6467:0.1363:0.0764	.	786	P42702	LIFR_HUMAN	N	786	ENSP00000263409:K786N;ENSP00000398368:K786N	ENSP00000263409:K786N	K	-	3	2	LIFR	38521817	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	1.244000	0.32778	1.280000	0.44463	0.563000	0.77884	AAG		0.398	LIFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253823.1	NM_002310	
C6	729	hgsc.bcm.edu	37	5	41159345	41159345	+	Silent	SNP	G	G	A	rs79523005	byFrequency	TCGA-AG-3612-01A-01W-0833-10	TCGA-AG-3612-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	93a27bfa-33be-4eec-863e-5c85a11493e2	e350ce5e-3bd3-4c1a-a212-a3b2294e180c	g.chr5:41159345G>A	ENST00000263413.3	-	12	1959	c.1695C>T	c.(1693-1695)gaC>gaT	p.D565D	C6_ENST00000337836.5_Silent_p.D565D|C6_ENST00000475349.1_5'Flank	NM_001115131.1	NP_001108603.2	P13671	CO6_HUMAN	complement component 6	565	TSP type-1 3. {ECO:0000255|PROSITE- ProRule:PRU00210}.				complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)		p.D565D(1)		central_nervous_system(2)|cervix(2)|endometrium(2)|kidney(7)|large_intestine(16)|liver(1)|lung(51)|ovary(3)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)	96		Breast(839;1.07e-05)|Ovarian(839;0.0228)|Lung SC(612;0.0548)|Lung NSC(810;0.128)|all_neural(839;0.157)				CCCACTGTCCGTCTACTGCAT	0.498													A|||	29	0.00579073	0.0008	0.0	5008	,	,		18505	0.0278		0.0	False		,,,				2504	0.0				p.D565D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1695T	5						.	A	,	11,4395	824.5+/-416.5	0,11,2192	65.0	65.0	65.0		1695,1695	2.8	1.0	5	dbSNP_132	65	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	C6	NM_000065.2,NM_001115131.1	,	0,11,6492	AA,AG,GG		0.0,0.2497,0.0846	,	565/935,565/935	41159345	11,12995	2203	4300	6503	41195102	SO:0001819	synonymous_variant	729	exon12			J05024	CCDS3936.1	5p13.1	2014-09-17			ENSG00000039537	ENSG00000039537		"""Complement system"""	1339	protein-coding gene	gene with protein product		217050					Standard	NM_001115131		Approved		uc003jmk.3	P13671	OTTHUMG00000094781	ENST00000263413.3:c.1695C>T	5.37:g.41159345G>A			41195102	NM_000065		Silent	SNP	ENST00000263413.3	37	CCDS3936.1																																																																																				0.498	C6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211592.1		
ANKRD34B	340120	hgsc.bcm.edu	37	5	79855019	79855019	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-3612-01A-01W-0833-10	TCGA-AG-3612-10A-01W-0833-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	93a27bfa-33be-4eec-863e-5c85a11493e2	e350ce5e-3bd3-4c1a-a212-a3b2294e180c	g.chr5:79855019C>G	ENST00000338682.3	-	5	1492	c.820G>C	c.(820-822)Gag>Cag	p.E274Q		NM_001004441.2	NP_001004441.2	A5PLL1	AN34B_HUMAN	ankyrin repeat domain 34B	274						cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.E274Q(1)		NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(13)|pancreas(1)|prostate(1)|urinary_tract(1)	28		Lung NSC(167;0.0427)|all_lung(232;0.0464)|Ovarian(174;0.113)		OV - Ovarian serous cystadenocarcinoma(54;2.17e-46)|Epithelial(54;5.64e-41)|all cancers(79;3.24e-36)		AGTTCTTCCTCTGGTGTAATA	0.483																																					p.E274Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G820C	5						.						60.0	64.0	62.0					5																	79855019		2203	4300	6503	79890775	SO:0001583	missense	340120	exon5				CCDS34194.1	5q14.1	2014-08-12			ENSG00000189127	ENSG00000189127		"""Ankyrin repeat domain containing"""	33736	protein-coding gene	gene with protein product							Standard	NM_001004441		Approved	DP58	uc003kgw.3	A5PLL1	OTTHUMG00000162541	ENST00000338682.3:c.820G>C	5.37:g.79855019C>G	ENSP00000339802:p.Glu274Gln		79890775	NM_001004441	B2RPH1|Q68D79	Missense_Mutation	SNP	ENST00000338682.3	37	CCDS34194.1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.236898	0.79800	.	.	ENSG00000189127	ENST00000338682	T	0.22539	1.95	5.96	5.96	0.96718	.	0.181275	0.34291	N	0.004083	T	0.35885	0.0947	M	0.66939	2.045	0.40692	D	0.9824	D	0.60575	0.988	P	0.53313	0.723	T	0.08659	-1.0711	10	0.62326	D	0.03	-25.3487	13.2531	0.60062	0.0:0.924:0.0:0.076	.	274	A5PLL1	AN34B_HUMAN	Q	274	ENSP00000339802:E274Q	ENSP00000339802:E274Q	E	-	1	0	ANKRD34B	79890775	0.991000	0.36638	0.997000	0.53966	0.991000	0.79684	3.239000	0.51360	2.832000	0.97577	0.655000	0.94253	GAG		0.483	ANKRD34B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369475.1	NM_001004441	
ADAM19	8728	hgsc.bcm.edu	37	5	156918659	156918659	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3612-01A-01W-0833-10	TCGA-AG-3612-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	93a27bfa-33be-4eec-863e-5c85a11493e2	e350ce5e-3bd3-4c1a-a212-a3b2294e180c	g.chr5:156918659C>T	ENST00000517905.1	-	18	2103	c.2059G>A	c.(2059-2061)Ggg>Agg	p.G687R	ADAM19_ENST00000257527.4_Missense_Mutation_p.G687R|ADAM19_ENST00000430702.2_Missense_Mutation_p.G420R|ADAM19_ENST00000394020.1_Missense_Mutation_p.G689R			Q9H013	ADA19_HUMAN	ADAM metallopeptidase domain 19	687					heart development (GO:0007507)|membrane protein ectodomain proteolysis (GO:0006509)	integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.G688R(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(33)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	53	Renal(175;0.00488)	Medulloblastoma(196;0.0359)|all_neural(177;0.14)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			ATACTGCCCCCGTGGCCCGGT	0.637																																					p.G687R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2059A	5						.						21.0	22.0	22.0					5																	156918659		2202	4299	6501	156851237	SO:0001583	missense	8728	exon18			AF311317	CCDS4338.1	5q33.3	2010-06-24	2010-06-24		ENSG00000135074	ENSG00000135074		"""ADAM metallopeptidase domain containing"""	197	protein-coding gene	gene with protein product	"""meltrin beta"""	603640	"""a disintegrin and metalloproteinase domain 19 (meltrin beta)"""			9806848	Standard	NM_033274		Approved	MLTNB	uc003lwz.4	Q9H013	OTTHUMG00000130242	ENST00000517905.1:c.2059G>A	5.37:g.156918659C>T	ENSP00000428654:p.Gly687Arg		156851237	NM_033274	Q9BZL5|Q9UHP2	Missense_Mutation	SNP	ENST00000517905.1	37		.	.	.	.	.	.	.	.	.	.	C	25.4	4.629763	0.87660	.	.	ENSG00000135074	ENST00000430702;ENST00000257527;ENST00000394020;ENST00000517905	D;D;D;D	0.99051	-5.37;-5.37;-5.37;-5.37	4.93	4.93	0.64822	.	0.000000	0.64402	D	0.000010	D	0.99530	0.9832	H	0.95079	3.62	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;0.999	D	0.98029	1.0375	10	0.87932	D	0	.	18.1389	0.89631	0.0:1.0:0.0:0.0	.	687;687;420	Q9H013-2;Q9H013;E9PD32	.;ADA19_HUMAN;.	R	420;687;689;687	ENSP00000414088:G420R;ENSP00000257527:G687R;ENSP00000377588:G689R;ENSP00000428654:G687R	ENSP00000257527:G687R	G	-	1	0	ADAM19	156851237	1.000000	0.71417	0.892000	0.35008	0.565000	0.35776	7.818000	0.86416	2.286000	0.76751	0.563000	0.77884	GGG		0.637	ADAM19-003	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000373918.1	NM_033274	
ASCC3	10973	hgsc.bcm.edu	37	6	101110342	101110342	+	Missense_Mutation	SNP	A	A	T			TCGA-AG-3612-01A-01W-0833-10	TCGA-AG-3612-10A-01W-0833-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	93a27bfa-33be-4eec-863e-5c85a11493e2	e350ce5e-3bd3-4c1a-a212-a3b2294e180c	g.chr6:101110342A>T	ENST00000369162.2	-	15	2701	c.2357T>A	c.(2356-2358)aTg>aAg	p.M786K		NM_006828.2	NP_006819.2	Q8N3C0	ASCC3_HUMAN	activating signal cointegrator 1 complex subunit 3	786	Helicase C-terminal 1. {ECO:0000255|PROSITE-ProRule:PRU00542}.				cell proliferation (GO:0008283)|DNA dealkylation involved in DNA repair (GO:0006307)|DNA duplex unwinding (GO:0032508)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|poly(A) RNA binding (GO:0044822)	p.M786K(1)		breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(20)|liver(1)|lung(36)|ovary(6)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	92		all_cancers(76;1.45e-07)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(87;0.00149)|Hepatocellular(1;0.0893)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0539)|all cancers(137;0.103)|GBM - Glioblastoma multiforme(226;0.199)		CTGCCGAAGCATTCCTGCATG	0.398																																					p.M786K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2357A	6						.						90.0	89.0	89.0					6																	101110342		2203	4299	6502	101217063	SO:0001583	missense	10973	exon15			AJ223948	CCDS5046.1, CCDS5047.1, CCDS75497.1	6q16	2008-02-05		2004-07-28	ENSG00000112249	ENSG00000112249			18697	protein-coding gene	gene with protein product	"""RNA helicase family"""	614217	"""helicase, ATP binding 1"""	HELIC1		10218103	Standard	NM_006828		Approved	RNAH, ASC1p200, dJ121G13.4, dJ467N11.1	uc003pqk.3	Q8N3C0	OTTHUMG00000015279	ENST00000369162.2:c.2357T>A	6.37:g.101110342A>T	ENSP00000358159:p.Met786Lys		101217063	NM_006828	E7EW23|O43738|Q4G1A0|Q5VTN2|Q9H1I9|Q9H5A2|Q9NTR0	Missense_Mutation	SNP	ENST00000369162.2	37	CCDS5046.1	.	.	.	.	.	.	.	.	.	.	A	24.1	4.495279	0.85069	.	.	ENSG00000112249	ENST00000369162	T	0.76968	-1.06	5.52	5.52	0.82312	Helicase, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.90868	0.7131	H	0.96111	3.77	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.93702	0.7016	10	0.87932	D	0	.	15.9507	0.79835	1.0:0.0:0.0:0.0	.	786	Q8N3C0	HELC1_HUMAN	K	786	ENSP00000358159:M786K	ENSP00000358159:M786K	M	-	2	0	ASCC3	101217063	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.203000	0.95033	2.232000	0.73038	0.528000	0.53228	ATG		0.398	ASCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041632.2	NM_006828	
AIM1	202	hgsc.bcm.edu	37	6	106968273	106968273	+	Missense_Mutation	SNP	G	G	A	rs201201445	byFrequency	TCGA-AG-3612-01A-01W-0833-10	TCGA-AG-3612-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	93a27bfa-33be-4eec-863e-5c85a11493e2	e350ce5e-3bd3-4c1a-a212-a3b2294e180c	g.chr6:106968273G>A	ENST00000369066.3	+	2	2453	c.1966G>A	c.(1966-1968)Gga>Aga	p.G656R		NM_001624.2	NP_001615	Q9UMX9	S45A2_HUMAN	absent in melanoma 1	0					developmental pigmentation (GO:0048066)|melanin biosynthetic process (GO:0042438)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)		p.G656R(1)		breast(8)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(7)|large_intestine(13)|lung(20)|ovary(5)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	69	Breast(9;0.0138)|all_epithelial(6;0.169)	all_cancers(87;4.67e-25)|all_epithelial(87;5.46e-21)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|Colorectal(196;3.46e-05)|all_lung(197;5.94e-05)|Lung NSC(302;7.26e-05)|Ovarian(999;0.00473)	Epithelial(6;0.00114)|all cancers(7;0.00726)|BRCA - Breast invasive adenocarcinoma(8;0.0114)|OV - Ovarian serous cystadenocarcinoma(5;0.0305)	all cancers(137;1.73e-50)|Epithelial(106;2.42e-48)|OV - Ovarian serous cystadenocarcinoma(136;1.51e-27)|BRCA - Breast invasive adenocarcinoma(108;0.00104)|GBM - Glioblastoma multiforme(226;0.00858)		TCCCAGCAGCGGAAATCACTT	0.517													G|||	2	0.000399361	0.0	0.0	5008	,	,		19198	0.001		0.0	False		,,,				2504	0.001				p.G656R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1966A	6						.						51.0	49.0	50.0					6																	106968273		2203	4300	6503	107074966	SO:0001583	missense	202	exon2			U83115	CCDS34506.1	6q21	2014-01-29			ENSG00000112297	ENSG00000112297			356	protein-coding gene	gene with protein product	"""suppression of tumorigenicity 4"", ""beta-gamma crystallin domain containing 1"""	601797	"""suppression of tumorigenicity 4 (malignant melanoma)"""	ST4		1680551, 12693952	Standard	NM_001624		Approved	CRYBG1	uc003prh.3	Q9Y4K1	OTTHUMG00000015302	ENST00000369066.3:c.1966G>A	6.37:g.106968273G>A	ENSP00000358062:p.Gly656Arg		107074966	NM_001624	Q6P2P0|Q9BTM3	Missense_Mutation	SNP	ENST00000369066.3	37	CCDS34506.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	0.258	-1.001738	0.02128	.	.	ENSG00000112297	ENST00000285105;ENST00000369066	T	0.68765	-0.35	5.45	-0.999	0.10208	.	1.007710	0.07983	N	0.985969	T	0.13072	0.0317	N	0.02916	-0.46	0.09310	N	0.999996	B	0.09022	0.002	B	0.04013	0.001	T	0.18366	-1.0339	10	0.10902	T	0.67	.	4.9282	0.13903	0.4548:0.1703:0.3749:0.0	.	656	Q9Y4K1	AIM1_HUMAN	R	1064;656	ENSP00000358062:G656R	ENSP00000285105:G1064R	G	+	1	0	AIM1	107074966	0.000000	0.05858	0.001000	0.08648	0.013000	0.08279	-0.077000	0.11394	-0.167000	0.10871	-0.793000	0.03317	GGA		0.517	AIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041669.1		
SLC17A4	10050	hgsc.bcm.edu	37	6	25777143	25777143	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3612-01A-01W-0833-10	TCGA-AG-3612-10A-01W-0833-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	93a27bfa-33be-4eec-863e-5c85a11493e2	e350ce5e-3bd3-4c1a-a212-a3b2294e180c	g.chr6:25777143C>A	ENST00000377905.4	+	10	1343	c.1224C>A	c.(1222-1224)ttC>ttA	p.F408L	SLC17A4_ENST00000397076.2_Missense_Mutation_p.F206L|SLC17A4_ENST00000439485.2_Missense_Mutation_p.F178L	NM_005495.2	NP_005486.1	Q9Y2C5	S17A4_HUMAN	solute carrier family 17, member 4	408					phosphate ion transmembrane transport (GO:0035435)|phosphate-containing compound metabolic process (GO:0006796)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	sodium:phosphate symporter activity (GO:0005436)	p.F408L(1)		breast(4)|endometrium(1)|kidney(4)|large_intestine(3)|lung(21)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39						TCAGCAGCTTCTGTGAATCAG	0.517																																					p.F408L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1224A	6						.						134.0	119.0	124.0					6																	25777143		2203	4300	6503	25885122	SO:0001583	missense	10050	exon10			AB020527	CCDS4564.1, CCDS75411.1	6p22.2	2013-07-18	2013-07-18		ENSG00000146039	ENSG00000146039		"""Solute carriers"""	10932	protein-coding gene	gene with protein product		604216	"""solute carrier family 17 (sodium phosphate), member 4"""			10319585	Standard	NM_005495		Approved	KIAA2138	uc003nfe.3	Q9Y2C5	OTTHUMG00000014410	ENST00000377905.4:c.1224C>A	6.37:g.25777143C>A	ENSP00000367137:p.Phe408Leu		25885122	NM_005495	B4DDV9|E7EPE8|E7EU17|Q32MB7|Q32MB8	Missense_Mutation	SNP	ENST00000377905.4	37	CCDS4564.1	.	.	.	.	.	.	.	.	.	.	C	10.03	1.238262	0.22711	.	.	ENSG00000146039	ENST00000377905;ENST00000439485;ENST00000397076	T;T;T	0.69040	0.39;0.53;-0.37	5.62	3.71	0.42584	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	1.121880	0.06752	N	0.780235	T	0.27169	0.0666	L	0.33189	0.99	0.18873	N	0.999987	B;B;B	0.15473	0.0;0.013;0.0	B;B;B	0.19391	0.001;0.025;0.006	T	0.36890	-0.9729	10	0.02654	T	1	.	6.7938	0.23715	0.0:0.6783:0.2254:0.0963	.	178;206;408	E7EPE8;E7EU17;Q9Y2C5	.;.;S17A4_HUMAN	L	408;178;206	ENSP00000367137:F408L;ENSP00000391345:F178L;ENSP00000380266:F206L	ENSP00000367137:F408L	F	+	3	2	SLC17A4	25885122	0.622000	0.27085	0.066000	0.19879	0.895000	0.52256	1.509000	0.35780	1.516000	0.48900	0.650000	0.86243	TTC		0.517	SLC17A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040068.1		
BAI3	577	hgsc.bcm.edu	37	6	69666543	69666543	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3612-01A-01W-0833-10	TCGA-AG-3612-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	93a27bfa-33be-4eec-863e-5c85a11493e2	e350ce5e-3bd3-4c1a-a212-a3b2294e180c	g.chr6:69666543G>A	ENST00000370598.1	+	8	2188	c.1367G>A	c.(1366-1368)gGt>gAt	p.G456D		NM_001704.2	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	456	TSP type-1 4. {ECO:0000255|PROSITE- ProRule:PRU00210}.				G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.G456D(1)		NS(2)|breast(4)|central_nervous_system(5)|endometrium(5)|kidney(2)|large_intestine(28)|liver(1)|lung(111)|ovary(10)|pancreas(4)|prostate(7)|skin(22)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	210		all_lung(197;0.212)				TCAGCCAATGGTCAATGGAAT	0.438																																					p.G456D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1367A	6						.						160.0	161.0	160.0					6																	69666543		2203	4300	6503	69723264	SO:0001583	missense	577	exon8			AB005299	CCDS4968.1	6q12	2014-08-08			ENSG00000135298	ENSG00000135298		"""-"", ""GPCR / Class B : Orphans"""	945	protein-coding gene	gene with protein product		602684				9533023	Standard	NM_001704		Approved	KIAA0550	uc003pev.4	O60242	OTTHUMG00000014982	ENST00000370598.1:c.1367G>A	6.37:g.69666543G>A	ENSP00000359630:p.Gly456Asp		69723264	NM_001704	B7Z1K0|O60297|Q2NKN6|Q5VY37|Q9BX54	Missense_Mutation	SNP	ENST00000370598.1	37	CCDS4968.1	.	.	.	.	.	.	.	.	.	.	G	28.6	4.931796	0.92389	.	.	ENSG00000135298	ENST00000370598	T	0.62364	0.03	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	T	0.82139	0.4972	M	0.91510	3.215	0.80722	D	1	D	0.89917	1.0	D	0.72075	0.976	D	0.85554	0.1223	10	0.87932	D	0	.	19.6195	0.95650	0.0:0.0:1.0:0.0	.	456	O60242	BAI3_HUMAN	D	456	ENSP00000359630:G456D	ENSP00000359630:G456D	G	+	2	0	BAI3	69723264	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.420000	0.97426	2.710000	0.92621	0.650000	0.86243	GGT		0.438	BAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041120.1		
ROS1	6098	hgsc.bcm.edu	37	6	117715385	117715385	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-3612-01A-01W-0833-10	TCGA-AG-3612-10A-01W-0833-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	93a27bfa-33be-4eec-863e-5c85a11493e2	e350ce5e-3bd3-4c1a-a212-a3b2294e180c	g.chr6:117715385T>A	ENST00000368508.3	-	10	1302	c.1104A>T	c.(1102-1104)ttA>ttT	p.L368F	GOPC_ENST00000467125.1_Intron|ROS1_ENST00000368507.3_Missense_Mutation_p.L377F	NM_002944.2	NP_002935.2	P08922	ROS1_HUMAN	ROS proto-oncogene 1 , receptor tyrosine kinase	368					cell differentiation (GO:0030154)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|columnar/cuboidal epithelial cell development (GO:0002066)|negative regulation of gene expression (GO:0010629)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of phosphate transport (GO:0010966)|regulation of TOR signaling (GO:0032006)|spermatogenesis (GO:0007283)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.L368F(2)	TPM3_ENST00000368530/ROS1(4)|LRIG3/ROS1(2)|CD74_ENST00000009530/ROS1(32)|SLC34A2/ROS1(14)|EZR/ROS1(4)|GOPC/ROS1(14)|SDC4/ROS1(7)	NS(2)|breast(7)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(28)|lung(56)|ovary(8)|prostate(5)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	162		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		TAGAAGAAATTAATCCTGAAC	0.368			T	"""GOPC, SDC4, SLC34A2, EZR, LRIG3"""	"""glioblastoma, NSCLC"""																																p.L368F			Dom	yes		6	6q22	6098	v-ros UR2 sarcoma virus oncogene homolog 1 (avian)		"""O, E"""	.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A1104T	6						.						52.0	55.0	54.0					6																	117715385		2202	4300	6502	117822078	SO:0001583	missense	6098	exon10			M13599	CCDS5116.1	6q21-q22	2014-06-26	2014-06-26		ENSG00000047936	ENSG00000047936		"""Fibronectin type III domain containing"""	10261	protein-coding gene	gene with protein product		165020	"""v-ros avian UR2 sarcoma virus oncogene homolog 1"", ""v-ros UR2 sarcoma virus oncogene homolog 1 (avian)"", ""c-ros oncogene 1 , receptor tyrosine kinase"""			1611909	Standard	NM_002944		Approved	MCF3, ROS, c-ros-1	uc003pxp.1	P08922	OTTHUMG00000016188	ENST00000368508.3:c.1104A>T	6.37:g.117715385T>A	ENSP00000357494:p.Leu368Phe		117822078	NM_002944	Q15368|Q5TDB5	Missense_Mutation	SNP	ENST00000368508.3	37	CCDS5116.1	.	.	.	.	.	.	.	.	.	.	T	10.34	1.322541	0.23994	.	.	ENSG00000047936	ENST00000368508;ENST00000368507	D;D	0.91124	-2.79;-2.79	5.12	-1.31	0.09230	.	0.898111	0.09327	N	0.817477	T	0.70771	0.3262	L	0.44542	1.39	0.23685	N	0.997115	B	0.12013	0.005	B	0.10450	0.005	T	0.58880	-0.7558	10	0.56958	D	0.05	.	0.8758	0.01223	0.2163:0.308:0.2392:0.2365	.	368	P08922	ROS1_HUMAN	F	368;377	ENSP00000357494:L368F;ENSP00000357493:L377F	ENSP00000357493:L377F	L	-	3	2	ROS1	117822078	0.097000	0.21791	0.920000	0.36463	0.949000	0.60115	-0.114000	0.10757	-0.089000	0.12484	0.528000	0.53228	TTA		0.368	ROS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043464.1		
AKR1D1	6718	hgsc.bcm.edu	37	7	137792252	137792252	+	Missense_Mutation	SNP	C	C	T	rs267606650		TCGA-AG-3612-01A-01W-0833-10	TCGA-AG-3612-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	93a27bfa-33be-4eec-863e-5c85a11493e2	e350ce5e-3bd3-4c1a-a212-a3b2294e180c	g.chr7:137792252C>T	ENST00000242375.3	+	7	823	c.781C>T	c.(781-783)Cgt>Tgt	p.R261C	AKR1D1_ENST00000468877.2_3'UTR|AKR1D1_ENST00000432161.1_Missense_Mutation_p.R261C|AKR1D1_ENST00000411726.2_Missense_Mutation_p.R220C	NM_005989.3	NP_005980.1	P51857	AK1D1_HUMAN	aldo-keto reductase family 1, member D1	261			R -> C (in CBAS2). {ECO:0000269|PubMed:15030995}.		androgen metabolic process (GO:0008209)|bile acid biosynthetic process (GO:0006699)|bile acid catabolic process (GO:0030573)|bile acid metabolic process (GO:0008206)|C21-steroid hormone metabolic process (GO:0008207)|cholesterol catabolic process (GO:0006707)|digestion (GO:0007586)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	delta4-3-oxosteroid 5beta-reductase activity (GO:0047787)|steroid binding (GO:0005496)	p.R261C(2)		endometrium(1)|kidney(2)|large_intestine(1)|lung(14)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	23					Azelaic Acid(DB00548)|Finasteride(DB01216)	AATTGTTTTGCGTTTCAACAT	0.373																																					p.R220C												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.C658T	7	GRCh37	CM044568	AKR1D1	M		.						146.0	136.0	140.0					7																	137792252		2203	4300	6503	137442792	SO:0001583	missense	6718	exon6			Z28339	CCDS5846.1, CCDS55169.1, CCDS55170.1	7q32-q33	2012-12-04	2012-12-04		ENSG00000122787	ENSG00000122787	1.3.99.6	"""Aldo-keto reductases"""	388	protein-coding gene	gene with protein product	"""delta 4-3-ketosteroid-5-beta-reductase"""	604741	"""aldo-keto reductase family 1, member D1 (delta 4-3-ketosteroid-5-beta-reductase)"""	SRD5B1		7508385, 10343119	Standard	NM_005989		Approved		uc003vtz.3	P51857	OTTHUMG00000155787	ENST00000242375.3:c.781C>T	7.37:g.137792252C>T	ENSP00000242375:p.Arg261Cys		137442792	NM_001190906	A1L4P6|A8K060|B4DPN3|B4DPN8	Missense_Mutation	SNP	ENST00000242375.3	37	CCDS5846.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.103412	0.76983	.	.	ENSG00000122787	ENST00000432161;ENST00000411726;ENST00000242375	T;T;T	0.29142	1.58;1.58;1.58	5.55	5.55	0.83447	NADP-dependent oxidoreductase domain (3);	0.000000	0.85682	D	0.000000	T	0.68495	0.3007	H	0.95645	3.7	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.984	T	0.77624	-0.2518	10	0.87932	D	0	.	17.0553	0.86532	0.0:1.0:0.0:0.0	.	220;261;261	B4DPN8;B4DPN3;P51857	.;.;AK1D1_HUMAN	C	261;220;261	ENSP00000389197:R261C;ENSP00000402374:R220C;ENSP00000242375:R261C	ENSP00000242375:R261C	R	+	1	0	AKR1D1	137442792	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	4.151000	0.58105	2.894000	0.99253	0.591000	0.81541	CGT		0.373	AKR1D1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341637.1	NM_005989	
TRPV5	56302	hgsc.bcm.edu	37	7	142627221	142627221	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3612-01A-01W-0833-10	TCGA-AG-3612-10A-01W-0833-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	93a27bfa-33be-4eec-863e-5c85a11493e2	e350ce5e-3bd3-4c1a-a212-a3b2294e180c	g.chr7:142627221G>T	ENST00000265310.1	-	3	629	c.281C>A	c.(280-282)gCg>gAg	p.A94E	TRPV5_ENST00000442623.1_Missense_Mutation_p.A94E	NM_019841.4	NP_062815.2	Q9NQA5	TRPV5_HUMAN	transient receptor potential cation channel, subfamily V, member 5	94					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|ion transmembrane transport (GO:0034220)|protein tetramerization (GO:0051262)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)	p.A94E(1)		NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(14)|lung(32)|ovary(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	67	Melanoma(164;0.059)					CACCAAGGCCGCCTCCAAGTT	0.547																																					p.A94E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C281A	7						.						73.0	73.0	73.0					7																	142627221		2203	4300	6503	142337343	SO:0001583	missense	56302	exon3			AJ271207	CCDS5875.1	7q34	2013-01-10	2002-01-29	2002-02-01	ENSG00000127412	ENSG00000127412		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	3145	protein-coding gene	gene with protein product		606679	"""epithelial calcium channel 1"""	ECAC1		10944439, 10945469, 16382100	Standard	NM_019841		Approved	CaT2	uc003wby.1	Q9NQA5	OTTHUMG00000157157	ENST00000265310.1:c.281C>A	7.37:g.142627221G>T	ENSP00000265310:p.Ala94Glu		142337343	NM_019841	A4D2H7|E9PBZ6|Q8N4C1|Q8NDW5|Q8NDX7|Q8NDX8|Q96PM6	Missense_Mutation	SNP	ENST00000265310.1	37	CCDS5875.1	.	.	.	.	.	.	.	.	.	.	G	19.03	3.748289	0.69533	.	.	ENSG00000127412	ENST00000265310;ENST00000439304;ENST00000442623	T;T;T	0.66995	0.57;-0.24;-0.2	4.3	3.42	0.39159	Ankyrin repeat-containing domain (3);	0.000000	0.85682	D	0.000000	T	0.80265	0.4591	M	0.79926	2.475	0.80722	D	1	D;D	0.89917	0.997;1.0	D;D	0.81914	0.987;0.995	T	0.81439	-0.0932	10	0.54805	T	0.06	-16.145	11.4912	0.50381	0.0895:0.0:0.9105:0.0	.	94;94	E9PBZ6;Q9NQA5	.;TRPV5_HUMAN	E	94;88;94	ENSP00000265310:A94E;ENSP00000406361:A88E;ENSP00000406572:A94E	ENSP00000265310:A94E	A	-	2	0	TRPV5	142337343	1.000000	0.71417	0.700000	0.30305	0.818000	0.46254	4.257000	0.58816	1.167000	0.42706	-0.657000	0.03884	GCG		0.547	TRPV5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347660.1	NM_019841	
PDE1C	5137	hgsc.bcm.edu	37	7	31890286	31890286	+	Missense_Mutation	SNP	C	C	T	rs559775895		TCGA-AG-3612-01A-01W-0833-10	TCGA-AG-3612-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	93a27bfa-33be-4eec-863e-5c85a11493e2	e350ce5e-3bd3-4c1a-a212-a3b2294e180c	g.chr7:31890286C>T	ENST00000396191.1	-	8	1275	c.820G>A	c.(820-822)Gga>Aga	p.G274R	PDE1C_ENST00000396182.2_Missense_Mutation_p.G274R|PDE1C_ENST00000396184.3_Missense_Mutation_p.G274R|PDE1C_ENST00000321453.7_Missense_Mutation_p.G274R|PDE1C_ENST00000396193.1_Missense_Mutation_p.G334R	NM_001191057.1	NP_001177986.1	Q14123	PDE1C_HUMAN	phosphodiesterase 1C, calmodulin-dependent 70kDa	274	Catalytic. {ECO:0000250}.				activation of phospholipase C activity (GO:0007202)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|metabolic process (GO:0008152)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)	cytosol (GO:0005829)	calmodulin-dependent cyclic-nucleotide phosphodiesterase activity (GO:0004117)|metal ion binding (GO:0046872)	p.G274R(2)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(38)|prostate(4)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	81			GBM - Glioblastoma multiforme(11;0.216)		Caffeine(DB00201)	TTGGTGGTTCCGGTATGCTCG	0.448																																					p.G274R												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G820A	7						.						204.0	181.0	189.0					7																	31890286		2203	4300	6503	31856811	SO:0001583	missense	5137	exon8			U40371	CCDS5437.1, CCDS55099.1, CCDS55100.1	7p15.1-p14.3	2008-05-15	2002-08-29		ENSG00000154678	ENSG00000154678	3.1.4.17	"""Phosphodiesterases"""	8776	protein-coding gene	gene with protein product		602987	"""phosphodiesterase 1C, calmodulin-dependent (70kD)"""			8557689	Standard	XM_005249769		Approved	Hcam3	uc003tco.2	Q14123	OTTHUMG00000023836	ENST00000396191.1:c.820G>A	7.37:g.31890286C>T	ENSP00000379494:p.Gly274Arg		31856811	NM_001191056	B3KPC6|E9PE92|Q14124|Q8NB10	Missense_Mutation	SNP	ENST00000396191.1	37	CCDS55099.1	.	.	.	.	.	.	.	.	.	.	c	35	5.545009	0.96488	.	.	ENSG00000154678	ENST00000396193;ENST00000396191;ENST00000321453;ENST00000396184;ENST00000396182	D;D;D;D;D	0.97529	-4.42;-4.42;-4.42;-4.42;-4.42	5.91	5.91	0.95273	Metal-dependent phosphohydrolase, HD domain (1);-cyclic nucleotide phosphodiesterase, conserved site (1);5&apos (3);-cyclic nucleotide phosphodiesterase, catalytic domain (2);3&apos (3);	0.000000	0.85682	D	0.000000	D	0.99199	0.9722	H	0.97918	4.105	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.98847	1.0757	10	0.87932	D	0	.	19.9008	0.96985	0.0:1.0:0.0:0.0	.	274;334;274	Q14123-2;E9PE92;Q14123	.;.;PDE1C_HUMAN	R	334;274;274;274;274	ENSP00000379496:G334R;ENSP00000379494:G274R;ENSP00000318105:G274R;ENSP00000379487:G274R;ENSP00000379485:G274R	ENSP00000318105:G274R	G	-	1	0	PDE1C	31856811	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	7.818000	0.86416	2.805000	0.96524	0.651000	0.88453	GGA		0.448	PDE1C-006	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000328458.1		
SMARCD3	6604	hgsc.bcm.edu	37	7	150936210	150936210	+	Silent	SNP	C	C	T			TCGA-AG-3612-01A-01W-0833-10	TCGA-AG-3612-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	93a27bfa-33be-4eec-863e-5c85a11493e2	e350ce5e-3bd3-4c1a-a212-a3b2294e180c	g.chr7:150936210C>T	ENST00000262188.8	-	13	1841	c.1431G>A	c.(1429-1431)tcG>tcA	p.S477S	SMARCD3_ENST00000356800.2_Silent_p.S464S|MIR671_ENST00000390183.1_RNA|SMARCD3_ENST00000477169.1_5'Flank|RP4-548D19.3_ENST00000607902.1_RNA|SMARCD3_ENST00000392811.2_Silent_p.S464S	NM_001003801.1	NP_001003801.1	Q6STE5	SMRD3_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 3	477					cardiac right ventricle formation (GO:0003219)|cellular lipid metabolic process (GO:0044255)|chromatin remodeling (GO:0006338)|muscle cell differentiation (GO:0042692)|neural retina development (GO:0003407)|nucleosome disassembly (GO:0006337)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of protein binding (GO:0043393)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|secondary heart field specification (GO:0003139)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|receptor binding (GO:0005102)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)	p.S464S(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(6)|ovary(2)	15			OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GCACAACCAGCGACTGCTCCA	0.577																																					p.S464S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1392A	7						.						124.0	122.0	122.0					7																	150936210		2203	4300	6503	150567143	SO:0001819	synonymous_variant	6604	exon14			U66619	CCDS5924.1, CCDS34780.1	7q35-q36	2008-07-18			ENSG00000082014	ENSG00000082014			11108	protein-coding gene	gene with protein product	"""mammalian chromatin remodeling complex BRG1-associated factor 60C"", ""Swp73-like protein"", ""SWI/SNF complex 60 kDa subunit C"", ""60kDa BRG-1/Brm associated factor subunit c"""	601737				8804307, 9693044	Standard	NM_001003801		Approved	BAF60C, Rsc6p, CRACD3	uc003wjs.3	Q6STE5	OTTHUMG00000157431	ENST00000262188.8:c.1431G>A	7.37:g.150936210C>T			150567143	NM_003078	D3DX10|Q2YD86|Q75MJ2|Q75MR8|Q92926|Q9BUH1	Silent	SNP	ENST00000262188.8	37	CCDS34780.1																																																																																				0.577	SMARCD3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348825.1	NM_001003801	
UBR5	51366	hgsc.bcm.edu	37	8	103341610	103341610	+	Silent	SNP	G	G	A			TCGA-AG-3612-01A-01W-0833-10	TCGA-AG-3612-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	93a27bfa-33be-4eec-863e-5c85a11493e2	e350ce5e-3bd3-4c1a-a212-a3b2294e180c	g.chr8:103341610G>A	ENST00000520539.1	-	10	1722	c.1116C>T	c.(1114-1116)atC>atT	p.I372I	UBR5_ENST00000220959.4_Silent_p.I372I|UBR5_ENST00000521922.1_Silent_p.I366I	NM_001282873.1|NM_015902.5	NP_001269802.1|NP_056986.2	O95071	UBR5_HUMAN	ubiquitin protein ligase E3 component n-recognin 5	372					cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of protein import into nucleus, translocation (GO:0033160)|progesterone receptor signaling pathway (GO:0050847)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-ubiquitin ligase activity (GO:0034450)|zinc ion binding (GO:0008270)	p.I372I(1)		NS(1)|breast(13)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(19)|liver(1)|lung(51)|ovary(6)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	124	all_cancers(14;8e-07)|all_epithelial(15;2.18e-08)|Lung NSC(17;2.55e-05)|all_lung(17;8.85e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000442)			CCCCAATACAGATGAATTTTG	0.358																																					p.I372I	Ovarian(131;96 1741 5634 7352 27489)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1116T	8						.						103.0	113.0	109.0					8																	103341610		2202	4300	6502	103410786	SO:0001819	synonymous_variant	51366	exon10			AF006010	CCDS34933.1, CCDS64946.1	8q22	2008-06-23	2007-06-19	2007-06-19	ENSG00000104517	ENSG00000104517		"""Ubiquitin protein ligase E3 component n-recognins"""	16806	protein-coding gene	gene with protein product		608413	"""E3 ubiquitin protein ligase, HECT domain containing, 1"""	EDD1		10030672, 16055722	Standard	NM_015902		Approved	DD5, HYD, EDD, KIAA0896	uc003ykr.2	O95071	OTTHUMG00000164755	ENST00000520539.1:c.1116C>T	8.37:g.103341610G>A			103410786	NM_015902	B2RP24|J3KMW7|O94970|Q9NPL3	Silent	SNP	ENST00000520539.1	37	CCDS34933.1																																																																																				0.358	UBR5-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000380075.2	NM_015902	
STC1	6781	hgsc.bcm.edu	37	8	23702526	23702526	+	Silent	SNP	C	C	T			TCGA-AG-3612-01A-01W-0833-10	TCGA-AG-3612-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	93a27bfa-33be-4eec-863e-5c85a11493e2	e350ce5e-3bd3-4c1a-a212-a3b2294e180c	g.chr8:23702526C>T	ENST00000290271.2	-	4	784	c.501G>A	c.(499-501)ctG>ctA	p.L167L	STC1_ENST00000524323.1_Silent_p.L98L	NM_003155.2	NP_003146.1	P52823	STC1_HUMAN	stanniocalcin 1	167					bone development (GO:0060348)|cellular calcium ion homeostasis (GO:0006874)|cellular response to cAMP (GO:0071320)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to hypoxia (GO:0071456)|chondrocyte proliferation (GO:0035988)|decidualization (GO:0046697)|embryo implantation (GO:0007566)|endothelial cell morphogenesis (GO:0001886)|growth plate cartilage axis specification (GO:0003421)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of cell migration (GO:0030336)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of renal phosphate excretion (GO:1903403)|ossification (GO:0001503)|positive regulation of calcium ion import (GO:0090280)|regulation of anion transport (GO:0044070)|regulation of cardiac muscle cell contraction (GO:0086004)|response to vitamin D (GO:0033280)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleus (GO:0005634)		p.L167L(1)		breast(1)|cervix(1)|endometrium(3)|large_intestine(4)|lung(9)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	26		Prostate(55;0.055)|Breast(100;0.116)		Colorectal(74;0.0155)|COAD - Colon adenocarcinoma(73;0.0632)		CACATTCCAGCAGGCTTCGGA	0.532																																					p.L167L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G501A	8						.						141.0	128.0	133.0					8																	23702526		2203	4300	6503	23758471	SO:0001819	synonymous_variant	6781	exon4				CCDS6043.1	8p22-p12	2008-06-23			ENSG00000159167	ENSG00000159167			11373	protein-coding gene	gene with protein product		601185		STC		9480753	Standard	NM_003155		Approved		uc003xdw.1	P52823	OTTHUMG00000097853	ENST00000290271.2:c.501G>A	8.37:g.23702526C>T			23758471	NM_003155	B4DN22|Q71UE5	Silent	SNP	ENST00000290271.2	37	CCDS6043.1																																																																																				0.532	STC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215143.1		
ADAM7	8756	hgsc.bcm.edu	37	8	24359065	24359065	+	Silent	SNP	C	C	A	rs143083584		TCGA-AG-3612-01A-01W-0833-10	TCGA-AG-3612-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	93a27bfa-33be-4eec-863e-5c85a11493e2	e350ce5e-3bd3-4c1a-a212-a3b2294e180c	g.chr8:24359065C>A	ENST00000175238.6	+	20	2267	c.2184C>A	c.(2182-2184)atC>atA	p.I728I	ADAM7_ENST00000380789.1_Silent_p.I728I|RP11-624C23.1_ENST00000519689.1_RNA|RP11-561E1.1_ENST00000519364.1_RNA|ADAM7_ENST00000520720.1_Silent_p.I500I|RP11-624C23.1_ENST00000523578.1_RNA	NM_003817.3	NP_003808.2	Q9H2U9	ADAM7_HUMAN	ADAM metallopeptidase domain 7	728						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.I728I(1)		NS(1)|endometrium(5)|kidney(1)|large_intestine(17)|lung(24)|ovary(1)|skin(15)	64		Prostate(55;0.0181)		Colorectal(74;0.0199)|COAD - Colon adenocarcinoma(73;0.0754)|BRCA - Breast invasive adenocarcinoma(99;0.182)		CTGAGCCAATCCTGCCAGAAA	0.368																																					p.I728I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2184A	8						.	C		1,4405	2.1+/-5.4	0,1,2202	81.0	82.0	81.0		2184	0.7	0.0	8	dbSNP_134	81	0,8600		0,0,4300	no	coding-synonymous	ADAM7	NM_003817.2		0,1,6502	AA,AC,CC		0.0,0.0227,0.0077		728/755	24359065	1,13005	2203	4300	6503	24414955	SO:0001819	synonymous_variant	8756	exon20			AF090327	CCDS6045.1	8p21.2	2005-08-18	2005-08-18		ENSG00000069206	ENSG00000069206		"""ADAM metallopeptidase domain containing"""	214	protein-coding gene	gene with protein product		607310	"""a disintegrin and metalloproteinase domain 7"""				Standard	NM_003817		Approved	GP-83, EAPI	uc003xeb.3	Q9H2U9	OTTHUMG00000097859	ENST00000175238.6:c.2184C>A	8.37:g.24359065C>A			24414955	NM_003817	A8K8X7|O75959|Q6PEJ6	Silent	SNP	ENST00000175238.6	37	CCDS6045.1																																																																																				0.368	ADAM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215150.1	NM_003817	
EXTL3	2137	hgsc.bcm.edu	37	8	28573810	28573810	+	Silent	SNP	C	C	T	rs200105783	byFrequency	TCGA-AG-3612-01A-01W-0833-10	TCGA-AG-3612-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	93a27bfa-33be-4eec-863e-5c85a11493e2	e350ce5e-3bd3-4c1a-a212-a3b2294e180c	g.chr8:28573810C>T	ENST00000220562.4	+	3	1136	c.234C>T	c.(232-234)caC>caT	p.H78H	EXTL3_ENST00000519886.1_Intron|EXTL3_ENST00000523149.1_Intron	NM_001440.2	NP_001431.1	O43909	EXTL3_HUMAN	exostosin-like glycosyltransferase 3	78					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|positive regulation of cell growth (GO:0030307)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)	glucuronyl-galactosyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity (GO:0001888)|metal ion binding (GO:0046872)	p.H78H(1)		biliary_tract(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(8)|ovary(1)|prostate(2)|skin(2)|soft_tissue(1)|urinary_tract(1)	36		Ovarian(32;0.069)		KIRC - Kidney renal clear cell carcinoma(542;0.107)|Kidney(114;0.129)|Colorectal(74;0.228)		AGGTGAAGCACGTGCTGGATC	0.597													C|||	2	0.000399361	0.0015	0.0	5008	,	,		20435	0.0		0.0	False		,,,				2504	0.0				p.H78H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C234T	8						.	C		1,4405	2.1+/-5.4	0,1,2202	95.0	90.0	92.0		234	-4.9	0.9	8		92	1,8599	1.2+/-3.3	0,1,4299	yes	coding-synonymous	EXTL3	NM_001440.2		0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154		78/920	28573810	2,13004	2203	4300	6503	28629729	SO:0001819	synonymous_variant	2137	exon3			U76188	CCDS6070.1	8p22-p12	2013-03-01	2013-03-01		ENSG00000012232	ENSG00000012232	2.4.1.223	"""Exostosin glycosyltransferase family"""	3518	protein-coding gene	gene with protein product	"""REG receptor"", ""glucuronyl-galactosyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase"""	605744	"""exostoses (multiple)-like 3"""			9479495, 9450183, 11257457	Standard	NM_001440		Approved	botv, REGR	uc003xgz.2	O43909	OTTHUMG00000102146	ENST00000220562.4:c.234C>T	8.37:g.28573810C>T			28629729	NM_001440	D3DST8|O00225|Q53XT3	Silent	SNP	ENST00000220562.4	37	CCDS6070.1																																																																																				0.597	EXTL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219987.3	NM_001440	
SAMD12	401474	hgsc.bcm.edu	37	8	119391878	119391878	+	Silent	SNP	G	G	A			TCGA-AG-3612-01A-01W-0833-10	TCGA-AG-3612-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	93a27bfa-33be-4eec-863e-5c85a11493e2	e350ce5e-3bd3-4c1a-a212-a3b2294e180c	g.chr8:119391878G>A	ENST00000314727.4	-	4	520	c.384C>T	c.(382-384)aaC>aaT	p.N128N	SAMD12_ENST00000527515.1_5'Flank|SAMD12_ENST00000409003.4_Silent_p.N128N|AC023590.1_ENST00000430457.1_Intron	NM_207506.2	NP_997389.2	Q8N8I0	SAM12_HUMAN	sterile alpha motif domain containing 12	128	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.							p.N128N(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|ovary(2)	9	all_cancers(13;3.91e-25)|Lung NSC(37;1.13e-07)|Ovarian(258;0.0249)		STAD - Stomach adenocarcinoma(47;0.00391)			GCTGCCGGAGGTTCTCCTGGG	0.483																																					p.N128N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C384T	8						.						147.0	131.0	136.0					8																	119391878		2203	4300	6503	119461059	SO:0001819	synonymous_variant	401474	exon4			AK096777	CCDS6325.1, CCDS47913.1	8q24.12	2013-01-10			ENSG00000177570	ENSG00000177570		"""Sterile alpha motif (SAM) domain containing"""	31750	protein-coding gene	gene with protein product							Standard	NM_207506		Approved	FLJ39458	uc003yom.2	Q8N8I0	OTTHUMG00000059817	ENST00000314727.4:c.384C>T	8.37:g.119391878G>A			119461059	NM_001101676	Q0P502	Silent	SNP	ENST00000314727.4	37	CCDS6325.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	9.642|9.642	1.139157|1.139157	0.21205|0.21205	.|.	.|.	ENSG00000177570|ENSG00000177570	ENST00000453675|ENST00000526765	.|.	.|.	.|.	6.17|6.17	4.39|4.39	0.52855|0.52855	.|.	.|.	.|.	.|.	.|.	T|T	0.61362|0.61362	0.2341|0.2341	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.57871|0.57871	-0.7736|-0.7736	4|4	.|.	.|.	.|.	-13.1067|-13.1067	10.1023|10.1023	0.42513|0.42513	0.202:0.0:0.798:0.0|0.202:0.0:0.798:0.0	.|.	.|.	.|.	.|.	S|I	115|143	.|.	.|.	P|T	-|-	1|2	0|0	SAMD12|SAMD12	119461059|119461059	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.962000|0.962000	0.63368|0.63368	2.428000|2.428000	0.44749|0.44749	0.942000|0.942000	0.37525|0.37525	-0.136000|-0.136000	0.14681|0.14681	CCT|ACC		0.483	SAMD12-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000132989.3	NM_207506	
GOLGA2	2801	hgsc.bcm.edu	37	9	131030738	131030738	+	Silent	SNP	A	A	C			TCGA-AG-3612-01A-01W-0833-10	TCGA-AG-3612-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	93a27bfa-33be-4eec-863e-5c85a11493e2	e350ce5e-3bd3-4c1a-a212-a3b2294e180c	g.chr9:131030738A>C	ENST00000421699.2	-	3	285	c.273T>G	c.(271-273)ccT>ccG	p.P91P	GOLGA2_ENST00000609374.1_Silent_p.P79P	NM_004486.4	NP_004477.3	Q08379	GOGA2_HUMAN	golgin A2	91					mitotic cell cycle (GO:0000278)	cis-Golgi network (GO:0005801)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)		p.P79P(1)		NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	34						CACCAGGGGAAGGGACACCGC	0.567																																					p.P91P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T273G	9						.						94.0	67.0	76.0					9																	131030738		2203	4300	6503	130070559	SO:0001819	synonymous_variant	2801	exon3			L06147	CCDS6896.2	9q34.13	2010-06-28	2010-02-12		ENSG00000167110	ENSG00000167110			4425	protein-coding gene	gene with protein product	"""Golgi matrix protein GM130"", ""SY11 protein"""	602580	"""golgi autoantigen, golgin subfamily a, 2"""			8315394	Standard	NM_004486		Approved	GM130, golgin-95	uc011maw.2	Q08379	OTTHUMG00000020732	ENST00000421699.2:c.273T>G	9.37:g.131030738A>C			130070559	NM_004486	Q6GRM9|Q9BRB0|Q9NYF9	Silent	SNP	ENST00000421699.2	37	CCDS6896.2	.	.	.	.	.	.	.	.	.	.	a	5.824	0.336341	0.11013	.	.	ENSG00000167110	ENST00000458730	.	.	.	5.63	0.721	0.18219	.	.	.	.	.	T	0.24314	0.0589	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.23762	-1.0179	4	.	.	.	.	4.5307	0.12004	0.609:0.162:0.2289:0.0	.	.	.	.	V	51	.	.	F	-	1	0	GOLGA2	130070559	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.114000	0.15520	0.394000	0.25230	-0.263000	0.10527	TTC		0.567	GOLGA2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054358.2	NM_004486	
PTPDC1	138639	hgsc.bcm.edu	37	9	96859681	96859681	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3612-01A-01W-0833-10	TCGA-AG-3612-10A-01W-0833-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	93a27bfa-33be-4eec-863e-5c85a11493e2	e350ce5e-3bd3-4c1a-a212-a3b2294e180c	g.chr9:96859681G>T	ENST00000375360.3	+	7	1011	c.671G>T	c.(670-672)cGa>cTa	p.R224L	PTPDC1_ENST00000288976.3_Missense_Mutation_p.R276L	NM_001253830.1|NM_177995.2	NP_001240759.1|NP_818931.1	A2A3K4	PTPC1_HUMAN	protein tyrosine phosphatase domain containing 1	224	Tyrosine-protein phosphatase.				cilium morphogenesis (GO:0060271)|smoothened signaling pathway (GO:0007224)		protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.R276Q(1)|p.R224L(1)|p.R276L(1)|p.R224Q(1)		endometrium(1)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	32						CGGGCAAAGCGACCCAATTCC	0.413																																					p.R276L												.	.	4	Substitution - Missense(4)	large_intestine(4)	c.G827T	9						.						79.0	77.0	77.0					9																	96859681		2203	4300	6503	95899502	SO:0001583	missense	138639	exon6			BC051654	CCDS6707.1, CCDS6708.1, CCDS75860.1	9q22.32	2011-06-09			ENSG00000158079	ENSG00000158079		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : CDC14s"""	30184	protein-coding gene	gene with protein product	"""protein tyrosine phosphatase PTP9Q22"""					14702039	Standard	NM_152422		Approved	PTP9Q22, FLJ37312	uc010mrj.2	A2A3K4	OTTHUMG00000020258	ENST00000375360.3:c.671G>T	9.37:g.96859681G>T	ENSP00000364509:p.Arg224Leu		95899502	NM_152422	Q5T3M4|Q6NXE8|Q8IWM1|Q8N1X4|Q8N9F5	Missense_Mutation	SNP	ENST00000375360.3	37	CCDS6707.1	.	.	.	.	.	.	.	.	.	.	.	27.7	4.857074	0.91433	.	.	ENSG00000158079	ENST00000375360;ENST00000288976	T;T	0.50548	0.74;0.74	5.55	5.55	0.83447	Dual specificity phosphatase, catalytic domain (1);Protein-tyrosine/Dual-specificity phosphatase (1);	0.000000	0.85682	D	0.000000	T	0.81959	0.4933	H	0.98388	4.22	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.999;1.0;1.0	D	0.89000	0.3421	10	0.87932	D	0	-10.6174	18.4793	0.90806	0.0:0.0:1.0:0.0	.	278;276;278;224	E7EN59;A2A3K4-2;A8K0X7;A2A3K4	.;.;.;PTPC1_HUMAN	L	224;276	ENSP00000364509:R224L;ENSP00000288976:R276L	ENSP00000288976:R276L	R	+	2	0	PTPDC1	95899502	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.269000	0.95684	2.610000	0.88304	0.591000	0.81541	CGA		0.413	PTPDC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000215007.1	NM_177995, NM_152422	
OLFM1	10439	hgsc.bcm.edu	37	9	138011768	138011768	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-3612-01A-01W-0833-10	TCGA-AG-3612-10A-01W-0833-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	93a27bfa-33be-4eec-863e-5c85a11493e2	e350ce5e-3bd3-4c1a-a212-a3b2294e180c	g.chr9:138011768G>C	ENST00000371793.3	+	6	1453	c.1202G>C	c.(1201-1203)aGc>aCc	p.S401T	OLFM1_ENST00000371796.3_Missense_Mutation_p.S374T|OLFM1_ENST00000252854.4_Missense_Mutation_p.S383T	NM_001282611.1	NP_001269540.1	Q99784	NOE1_HUMAN	olfactomedin 1	401	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of neuron migration (GO:2001223)|nervous system development (GO:0007399)|protein oligomerization (GO:0051259)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|extracellular space (GO:0005615)|synapse (GO:0045202)	beta-amyloid binding (GO:0001540)	p.S383T(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(2)	21		Myeloproliferative disorder(178;0.0333)		Epithelial(140;5.49e-08)|OV - Ovarian serous cystadenocarcinoma(145;9.68e-08)|all cancers(34;1.88e-07)		CCCAAGCGCAGCGCCGGGGAG	0.617																																					p.S383T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1148C	9						.						74.0	63.0	67.0					9																	138011768		2203	4300	6503	137151589	SO:0001583	missense	10439	exon6			AF035301	CCDS6986.1, CCDS6987.1, CCDS65183.1, CCDS65184.1	9q34.3	2014-01-20			ENSG00000130558	ENSG00000130558			17187	protein-coding gene	gene with protein product	"""pancortin"""	605366				9039501	Standard	NM_006334		Approved	NOE1, OlfA, AMY, NOELIN	uc004cfl.4	Q99784	OTTHUMG00000020897	ENST00000371793.3:c.1202G>C	9.37:g.138011768G>C	ENSP00000360858:p.Ser401Thr		137151589	NM_014279	Q53XZ8|Q6IMJ4|Q6IMJ5|Q8N8R0|Q969S7|Q99452	Missense_Mutation	SNP	ENST00000371793.3	37		.	.	.	.	.	.	.	.	.	.	G	24.3	4.511282	0.85389	.	.	ENSG00000130558	ENST00000252854;ENST00000371796;ENST00000371793	D;D;D	0.90004	-2.6;-2.6;-2.6	4.7	4.7	0.59300	Olfactomedin-like (3);Quinonprotein alcohol dehydrogenase-like (1);	0.000000	0.85682	D	0.000000	D	0.94355	0.8185	M	0.79614	2.46	0.80722	D	1	D;D	0.65815	0.992;0.995	D;D	0.76071	0.987;0.969	D	0.95205	0.8320	10	0.87932	D	0	.	17.6361	0.88122	0.0:0.0:1.0:0.0	.	401;383	Q99784;Q6IMJ8	NOE1_HUMAN;.	T	383;374;401	ENSP00000252854:S383T;ENSP00000360861:S374T;ENSP00000360858:S401T	ENSP00000252854:S383T	S	+	2	0	OLFM1	137151589	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.571000	0.98176	2.166000	0.68216	0.491000	0.48974	AGC		0.617	OLFM1-004	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000054974.1	NM_014279	
GPR112	139378	hgsc.bcm.edu	37	X	135431746	135431746	+	Silent	SNP	T	T	C			TCGA-AG-3612-01A-01W-0833-10	TCGA-AG-3612-10A-01W-0833-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	93a27bfa-33be-4eec-863e-5c85a11493e2	e350ce5e-3bd3-4c1a-a212-a3b2294e180c	g.chrX:135431746T>C	ENST00000394143.1	+	6	6172	c.5881T>C	c.(5881-5883)Tta>Cta	p.L1961L	GPR112_ENST00000370652.1_Silent_p.L1961L|GPR112_ENST00000412101.1_Silent_p.L1756L|GPR112_ENST00000287534.4_Silent_p.L1898L|GPR112_ENST00000394141.1_Silent_p.L1756L	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	1961					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.L1961L(1)		NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					ATCAACATCTTTAAGAGCTAT	0.413																																					p.L1961L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T5881C	X						.						105.0	100.0	101.0					X																	135431746		2203	4299	6502	135259412	SO:0001819	synonymous_variant	139378	exon6			AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.5881T>C	X.37:g.135431746T>C			135259412	NM_153834	A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Silent	SNP	ENST00000394143.1	37	CCDS35409.1																																																																																				0.413	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000286639.1		
NLGN4X	57502	hgsc.bcm.edu	37	X	5821193	5821193	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3612-01A-01W-0833-10	TCGA-AG-3612-10A-01W-0833-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	93a27bfa-33be-4eec-863e-5c85a11493e2	e350ce5e-3bd3-4c1a-a212-a3b2294e180c	g.chrX:5821193C>A	ENST00000381095.3	-	5	2153	c.1526G>T	c.(1525-1527)aGt>aTt	p.S509I	NLGN4X_ENST00000275857.6_Missense_Mutation_p.S509I|NLGN4X_ENST00000381093.2_Missense_Mutation_p.S529I|NLGN4X_ENST00000381092.1_Missense_Mutation_p.S509I|NLGN4X_ENST00000538097.1_Missense_Mutation_p.S509I	NM_001282145.1|NM_001282146.1|NM_181332.1	NP_001269074.1|NP_001269075.1|NP_851849.1	Q8N0W4	NLGNX_HUMAN	neuroligin 4, X-linked	509					adult behavior (GO:0030534)|brainstem development (GO:0003360)|cell-cell junction organization (GO:0045216)|cerebellum development (GO:0021549)|learning (GO:0007612)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|neuron cell-cell adhesion (GO:0007158)|neuron differentiation (GO:0030182)|organ growth (GO:0035265)|presynaptic membrane assembly (GO:0097105)|social behavior (GO:0035176)|synapse organization (GO:0050808)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|chloride ion binding (GO:0031404)|neurexin family protein binding (GO:0042043)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)	p.S509I(1)		breast(1)|cervix(2)|endometrium(4)|large_intestine(21)|lung(39)|ovary(4)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	81						AAAGTTACAACTGAAGAGCTC	0.542																																					p.S509I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1526T	X						.						109.0	90.0	96.0					X																	5821193		2203	4300	6503	5831193	SO:0001583	missense	57502	exon5			AB033086	CCDS14126.1	Xp22.33	2008-02-05	2004-05-21	2004-05-26	ENSG00000146938	ENSG00000146938			14287	protein-coding gene	gene with protein product		300427	"""neuroligin 4"""	NLGN4		10574462	Standard	XM_005274564		Approved	KIAA1260, NLGN, HLNX	uc004crr.3	Q8N0W4	OTTHUMG00000021093	ENST00000381095.3:c.1526G>T	X.37:g.5821193C>A	ENSP00000370485:p.Ser509Ile		5831193	NM_020742	Q6UX10|Q9ULG0	Missense_Mutation	SNP	ENST00000381095.3	37	CCDS14126.1	.	.	.	.	.	.	.	.	.	.	C	9.460	1.092826	0.20471	.	.	ENSG00000146938	ENST00000381095;ENST00000381093;ENST00000275857;ENST00000381092;ENST00000538097	T;T;T;T;T	0.67171	-0.25;-0.25;-0.25;-0.25;-0.25	3.8	3.8	0.43715	Carboxylesterase, type B (1);	.	.	.	.	T	0.56514	0.1990	L	0.39566	1.225	0.32066	N	0.595033	B;B;B	0.23990	0.095;0.047;0.008	B;B;B	0.31101	0.088;0.124;0.053	T	0.62845	-0.6768	9	0.72032	D	0.01	.	5.4324	0.16460	0.0:0.7351:0.0:0.2649	.	566;509;529	A6NMU8;Q8N0W4;Q8N0W4-2	.;NLGNX_HUMAN;.	I	509;529;509;509;509	ENSP00000370485:S509I;ENSP00000370483:S529I;ENSP00000275857:S509I;ENSP00000370482:S509I;ENSP00000439203:S509I	ENSP00000275857:S509I	S	-	2	0	NLGN4X	5831193	1.000000	0.71417	1.000000	0.80357	0.526000	0.34562	1.336000	0.33850	1.512000	0.48834	0.513000	0.50165	AGT		0.542	NLGN4X-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055673.1	NM_020742	
FAM47A	158724	hgsc.bcm.edu	37	X	34148936	34148936	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3612-01A-01W-0833-10	TCGA-AG-3612-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	93a27bfa-33be-4eec-863e-5c85a11493e2	e350ce5e-3bd3-4c1a-a212-a3b2294e180c	g.chrX:34148936C>T	ENST00000346193.3	-	1	1511	c.1460G>A	c.(1459-1461)cGg>cAg	p.R487Q		NM_203408.3	NP_981953.2	Q5JRC9	FA47A_HUMAN	family with sequence similarity 47, member A	487								p.R487Q(1)		NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(5)|large_intestine(17)|lung(44)|ovary(5)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	97						ACTGGACCTCCGACGTGTCTT	0.642																																					p.R487Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1460A	X						.						47.0	54.0	51.0					X																	34148936		2192	4286	6478	34058857	SO:0001583	missense	158724	exon1			BC026171	CCDS43926.1	Xp21.1	2004-08-09			ENSG00000185448	ENSG00000185448			29962	protein-coding gene	gene with protein product	"""similar to hypothetical protein FLJ35782"""					12477932	Standard	NM_203408		Approved	MGC27003	uc004ddg.3	Q5JRC9	OTTHUMG00000021339	ENST00000346193.3:c.1460G>A	X.37:g.34148936C>T	ENSP00000345029:p.Arg487Gln		34058857	NM_203408	A8K8I9|Q8TAA0	Missense_Mutation	SNP	ENST00000346193.3	37	CCDS43926.1	.	.	.	.	.	.	.	.	.	.	c	9.489	1.100058	0.20552	.	.	ENSG00000185448	ENST00000346193	T	0.16196	2.36	0.446	0.446	0.16602	.	.	.	.	.	T	0.10380	0.0254	N	0.24115	0.695	0.09310	N	1	D	0.62365	0.991	P	0.44811	0.461	T	0.23762	-1.0179	8	0.13470	T	0.59	.	.	.	.	.	487	Q5JRC9	FA47A_HUMAN	Q	487	ENSP00000345029:R487Q	ENSP00000345029:R487Q	R	-	2	0	FAM47A	34058857	0.022000	0.18835	0.006000	0.13384	0.016000	0.09150	0.010000	0.13242	0.435000	0.26365	0.183000	0.17082	CGG		0.642	FAM47A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056205.1	NM_203408	
CXorf22	170063	hgsc.bcm.edu	37	X	35985861	35985861	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-3612-01A-01W-0833-10	TCGA-AG-3612-10A-01W-0833-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	93a27bfa-33be-4eec-863e-5c85a11493e2	e350ce5e-3bd3-4c1a-a212-a3b2294e180c	g.chrX:35985861T>C	ENST00000297866.5	+	10	1792	c.1726T>C	c.(1726-1728)Tgt>Cgt	p.C576R		NM_152632.3	NP_689845.2	Q6ZTR5	CX022_HUMAN	chromosome X open reading frame 22	576								p.C576R(2)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(18)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(3)	44						TCATCGCTCATGTGAAGAGCC	0.433													T|||	1	0.000264901	0.0008	0.0	3775	,	,		9084	0.0		0.0	False		,,,				2504	0.0				p.C576R												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T1726C	X						.						126.0	94.0	105.0					X																	35985861		2202	4300	6502	35895782	SO:0001583	missense	170063	exon10			BC027936	CCDS14237.2	Xp21.1	2014-08-07			ENSG00000165164	ENSG00000165164			28546	protein-coding gene	gene with protein product						12477932	Standard	NM_152632		Approved	MGC34831	uc004ddj.3	Q6ZTR5	OTTHUMG00000021350	ENST00000297866.5:c.1726T>C	X.37:g.35985861T>C	ENSP00000297866:p.Cys576Arg		35895782	NM_152632	Q5JRM8|Q8N6X8	Missense_Mutation	SNP	ENST00000297866.5	37	CCDS14237.2	.	.	.	.	.	.	.	.	.	.	T	1.603	-0.526150	0.04141	.	.	ENSG00000165164	ENST00000297866	T	0.12879	2.64	5.35	-2.03	0.07365	.	1.723700	0.02720	N	0.113892	T	0.06188	0.0160	N	0.12182	0.205	0.09310	N	0.999999	B	0.02656	0.0	B	0.04013	0.001	T	0.22556	-1.0213	10	0.14656	T	0.56	-24.162	0.3028	0.00275	0.3888:0.1361:0.1986:0.2765	.	576	Q6ZTR5	CX022_HUMAN	R	576	ENSP00000297866:C576R	ENSP00000297866:C576R	C	+	1	0	CXorf22	35895782	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	0.269000	0.18589	-0.869000	0.04052	-1.266000	0.01441	TGT		0.433	CXorf22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056216.2	NM_152632	
MCF2	4168	hgsc.bcm.edu	37	X	138701838	138701838	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-3612-01A-01W-0833-10	TCGA-AG-3612-10A-01W-0833-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	93a27bfa-33be-4eec-863e-5c85a11493e2	e350ce5e-3bd3-4c1a-a212-a3b2294e180c	g.chrX:138701838T>G	ENST00000370576.4	-	7	924	c.715A>C	c.(715-717)Aac>Cac	p.N239H	MCF2_ENST00000520602.1_Missense_Mutation_p.N299H|MCF2_ENST00000370578.4_Missense_Mutation_p.N384H|MCF2_ENST00000536274.1_Missense_Mutation_p.N200H|MCF2_ENST00000338585.6_Missense_Mutation_p.N239H|MCF2_ENST00000370573.4_Missense_Mutation_p.N239H|MCF2_ENST00000414978.1_Missense_Mutation_p.N299H|MCF2_ENST00000519895.1_Missense_Mutation_p.N299H	NM_001171879.1|NM_005369.4	NP_001165350.1|NP_005360.3	P10911	MCF2_HUMAN	MCF.2 cell line derived transforming sequence	239					apoptotic signaling pathway (GO:0097190)|dendrite development (GO:0016358)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.N239H(1)|p.N299H(1)		NS(2)|cervix(2)|endometrium(4)|kidney(2)|large_intestine(15)|lung(34)|pancreas(1)|pleura(1)|prostate(1)	62	Acute lymphoblastic leukemia(192;0.000127)					GCTTGTTGGTTTAATAGAAAT	0.289																																					p.N299H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A895C	X						.						37.0	35.0	35.0					X																	138701838		2202	4282	6484	138529504	SO:0001583	missense	4168	exon10				CCDS14667.1, CCDS48175.1, CCDS55514.1, CCDS55515.1, CCDS55516.1, CCDS55517.1	Xq26.3-q27.1	2012-07-24			ENSG00000101977	ENSG00000101977		"""Rho guanine nucleotide exchange factors"""	6940	protein-coding gene	gene with protein product	"""Oncogene MCF2 (oncogene DBL)"""	311030				2577874, 1611909	Standard	NM_001099855		Approved	DBL, ARHGEF21	uc011mwo.1	P10911	OTTHUMG00000022537	ENST00000370576.4:c.715A>C	X.37:g.138701838T>G	ENSP00000359608:p.Asn239His		138529504	NM_001099855	B7Z3Y5|B7Z869|B7ZAV1|E9PH77|F5H091|P14919|Q5JYJ2|Q5JYJ3|Q5JYJ4|Q8IUF3|Q8IUF4|Q9UJB3	Missense_Mutation	SNP	ENST00000370576.4	37	CCDS14667.1	.	.	.	.	.	.	.	.	.	.	T	14.50	2.553508	0.45487	.	.	ENSG00000101977	ENST00000520602;ENST00000370576;ENST00000536274;ENST00000370578;ENST00000414978;ENST00000519895;ENST00000370573;ENST00000338585	T;T;T;T;T;T;T;T	0.43294	0.95;0.95;0.95;0.95;0.95;0.95;0.95;0.95	5.2	2.49	0.30216	.	1.080410	0.06815	N	0.791067	T	0.41994	0.1183	L	0.36672	1.1	0.09310	N	1	P;P;P;P;P;P;P;P	0.50943	0.79;0.939;0.867;0.79;0.681;0.79;0.94;0.79	P;P;P;P;P;P;P;P	0.53062	0.492;0.525;0.6;0.492;0.6;0.492;0.717;0.492	T	0.25676	-1.0125	10	0.48119	T	0.1	.	2.3296	0.04232	0.0:0.213:0.2928:0.4942	.	299;384;200;239;239;384;239;239	E9PH77;B7Z3Z2;F5H091;B2R9S6;P10911-2;Q5JYJ7;P10911-4;P10911	.;.;.;.;.;.;.;MCF2_HUMAN	H	299;239;200;384;299;299;239;239	ENSP00000427745:N299H;ENSP00000359608:N239H;ENSP00000438155:N200H;ENSP00000359610:N384H;ENSP00000397055:N299H;ENSP00000430276:N299H;ENSP00000359605:N239H;ENSP00000342204:N239H	ENSP00000342204:N239H	N	-	1	0	MCF2	138529504	0.151000	0.22747	0.010000	0.14722	0.182000	0.23217	1.540000	0.36115	0.711000	0.32018	-0.378000	0.06908	AAC		0.289	MCF2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000058560.1	NM_005369	
