#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
SEC24C	9632	broad.mit.edu	37	10	75528843	75528843	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr10:75528843A>G	ENST00000339365.2	+	18	2519	c.2357A>G	c.(2356-2358)gAc>gGc	p.D786G	SEC24C_ENST00000540668.1_Missense_Mutation_p.D34G|SEC24C_ENST00000535742.1_Missense_Mutation_p.D34G|SEC24C_ENST00000411652.2_Missense_Mutation_p.D667G|SEC24C_ENST00000345254.4_Missense_Mutation_p.D786G|SEC24C_ENST00000496827.1_3'UTR	NM_004922.3	NP_004913.2	P53992	SC24C_HUMAN	SEC24 family member C	786					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)	zinc ion binding (GO:0008270)	p.D786G(1)		breast(2)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(3)|lung(12)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	32	Prostate(51;0.0112)					CTAGATGGGGACAAAACAGTG	0.567																																					p.D786G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2357G	10						.						89.0	77.0	81.0					10																	75528843		2203	4300	6503	75198849	SO:0001583	missense	9632	exon17			D38555	CCDS7332.1	10q22	2013-10-21	2013-10-21		ENSG00000176986	ENSG00000176986			10705	protein-coding gene	gene with protein product		607185	"""SEC24 (S. cerevisiae) related gene family, member C"", ""SEC24 family, member C (S. cerevisiae)"""			10214955, 7584044	Standard	NM_004922		Approved	KIAA0079	uc001jux.3	P53992	OTTHUMG00000018476	ENST00000339365.2:c.2357A>G	10.37:g.75528843A>G	ENSP00000343405:p.Asp786Gly		75198849	NM_198597	B4DZT4|Q8WV25	Missense_Mutation	SNP	ENST00000339365.2	37	CCDS7332.1	.	.	.	.	.	.	.	.	.	.	A	25.8	4.672701	0.88445	.	.	ENSG00000176986	ENST00000535742;ENST00000345254;ENST00000540668;ENST00000339365;ENST00000411652	T;T;T;T;T	0.30448	1.53;1.53;1.53;1.53;1.53	5.72	5.72	0.89469	Sec23/Sec24 beta-sandwich (1);	0.128990	0.64402	D	0.000001	T	0.64249	0.2581	M	0.94142	3.5	0.80722	D	1	B;P;P	0.46512	0.182;0.493;0.879	B;B;P	0.57911	0.122;0.349;0.829	T	0.74819	-0.3535	10	0.87932	D	0	-5.2312	15.9993	0.80280	1.0:0.0:0.0:0.0	.	667;786;786	E7EP00;G5EA31;P53992	.;.;SC24C_HUMAN	G	34;786;34;786;667	ENSP00000446174:D34G;ENSP00000321845:D786G;ENSP00000445023:D34G;ENSP00000343405:D786G;ENSP00000402913:D667G	ENSP00000343405:D786G	D	+	2	0	SEC24C	75198849	1.000000	0.71417	1.000000	0.80357	0.761000	0.43186	9.339000	0.96797	2.184000	0.69523	0.383000	0.25322	GAC		0.567	SEC24C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048679.1		
KAT6B	23522	broad.mit.edu	37	10	76741653	76741653	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr10:76741653A>C	ENST00000287239.4	+	11	2829	c.2340A>C	c.(2338-2340)gaA>gaC	p.E780D	KAT6B_ENST00000490365.1_3'UTR|KAT6B_ENST00000372714.1_Missense_Mutation_p.E488D|KAT6B_ENST00000372711.1_Missense_Mutation_p.E597D|KAT6B_ENST00000372724.1_Missense_Mutation_p.E488D|KAT6B_ENST00000372725.1_Missense_Mutation_p.E488D	NM_001256468.1|NM_012330.3	NP_001243397.1|NP_036462.2	Q8WYB5	KAT6B_HUMAN	K(lysine) acetyltransferase 6B	780	Catalytic.|Interaction with BRPF1.|MYST-type HAT.				chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	acetyltransferase activity (GO:0016407)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.E780D(1)									CAGCAAATGAAATTTACCGAA	0.338																																					p.E780D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2340C	10						.						47.0	51.0	49.0					10																	76741653		2203	4299	6502	76411659	SO:0001583	missense	23522	exon11			AF113514	CCDS7345.1, CCDS58084.1, CCDS58085.1	10q22.2	2013-01-28	2011-07-21	2011-07-21	ENSG00000156650	ENSG00000156650		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	17582	protein-coding gene	gene with protein product	"""MOZ-related factor"""	605880	"""MYST histone acetyltransferase (monocytic leukemia) 4"""	MYST4		9205841, 10497217	Standard	NM_012330		Approved	querkopf, qkf, Morf, MOZ2, ZC2HC6B	uc001jwn.2	Q8WYB5	OTTHUMG00000018509	ENST00000287239.4:c.2340A>C	10.37:g.76741653A>C	ENSP00000287239:p.Glu780Asp		76411659	NM_012330	O15087|Q86Y05|Q8WU81|Q9UKW2|Q9UKW3|Q9UKX0	Missense_Mutation	SNP	ENST00000287239.4	37	CCDS7345.1	.	.	.	.	.	.	.	.	.	.	A	12.53	1.966940	0.34659	.	.	ENSG00000156650	ENST00000372725;ENST00000372724;ENST00000287239;ENST00000372714;ENST00000372711	D;D;D;D;D	0.81996	-1.52;-1.52;-1.56;-1.52;-1.54	5.98	-0.369	0.12534	.	0.000000	0.49916	D	0.000130	D	0.87589	0.6215	M	0.78456	2.415	0.50813	D	0.999896	D;B;P	0.63046	0.992;0.049;0.953	D;B;D	0.70227	0.968;0.013;0.938	D	0.84060	0.0374	10	0.87932	D	0	-14.5127	6.4018	0.21642	0.56:0.1233:0.3167:0.0	.	597;488;780	Q8WYB5-2;Q8WYB5-3;Q8WYB5	.;.;KAT6B_HUMAN	D	488;488;780;488;597	ENSP00000361810:E488D;ENSP00000361809:E488D;ENSP00000287239:E780D;ENSP00000361799:E488D;ENSP00000361796:E597D	ENSP00000287239:E780D	E	+	3	2	KAT6B	76411659	1.000000	0.71417	0.993000	0.49108	0.994000	0.84299	3.083000	0.50136	-0.298000	0.08921	-0.290000	0.09829	GAA		0.338	KAT6B-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048771.1	NM_012330	
SLC18A2	6571	broad.mit.edu	37	10	119014840	119014840	+	Silent	SNP	G	G	A			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr10:119014840G>A	ENST00000298472.5	+	7	896	c.753G>A	c.(751-753)ccG>ccA	p.P251P	SLC18A2_ENST00000497497.1_3'UTR	NM_003054.4	NP_003045.2	Q05940	VMAT2_HUMAN	solute carrier family 18 (vesicular monoamine transporter), member 2	251					aging (GO:0007568)|cellular response to ammonium ion (GO:0071242)|cellular response to drug (GO:0035690)|death (GO:0016265)|dopamine transport (GO:0015872)|endocytic recycling (GO:0032456)|glucose homeostasis (GO:0042593)|insulin secretion (GO:0030073)|locomotory behavior (GO:0007626)|monoamine transport (GO:0015844)|negative regulation of neurotransmitter transport (GO:0051589)|neurotransmitter loading into synaptic vesicle (GO:0098700)|neurotransmitter secretion (GO:0007269)|post-embryonic development (GO:0009791)|response to amphetamine (GO:0001975)|response to cocaine (GO:0042220)|response to corticosterone (GO:0051412)|response to herbicide (GO:0009635)|response to starvation (GO:0042594)|response to zinc ion (GO:0010043)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	clathrin-sculpted monoamine transport vesicle membrane (GO:0070083)|dense core granule (GO:0031045)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|synaptic vesicle membrane (GO:0030672)|terminal bouton (GO:0043195)	amine transmembrane transporter activity (GO:0005275)|drug binding (GO:0008144)|monoamine transmembrane transporter activity (GO:0008504)|serotonin transmembrane transporter activity (GO:0015222)	p.P251P(1)		NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(16)	29		Colorectal(252;0.19)		all cancers(201;0.029)	Amphetamine(DB00182)|Benzphetamine(DB00865)|Deserpidine(DB01089)|Dextroamphetamine(DB01576)|Ephedra(DB01363)|Ephedrine(DB01364)|Isometheptene(DB06706)|Methamphetamine(DB01577)|Norepinephrine(DB00368)|Propylhexedrine(DB06714)|Reserpine(DB00206)|Tetrabenazine(DB04844)	AGACGGCTCCGTTCCTGGTGC	0.642																																					p.P251P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G753A	10						.						68.0	64.0	66.0					10																	119014840		2203	4300	6503	119004830	SO:0001819	synonymous_variant	6571	exon7			L14269	CCDS7599.1	10q25	2013-07-18	2013-07-18		ENSG00000165646	ENSG00000165646		"""Solute carriers"""	10935	protein-coding gene	gene with protein product		193001		VMAT2			Standard	NM_003054		Approved	SVMT, SVAT	uc001ldd.2	Q05940	OTTHUMG00000019121	ENST00000298472.5:c.753G>A	10.37:g.119014840G>A			119004830	NM_003054	B2RC96|D3DRC4|Q15876|Q4G147|Q5VW49|Q9H3P6	Silent	SNP	ENST00000298472.5	37	CCDS7599.1																																																																																				0.642	SLC18A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050563.1	NM_003054	
MMP20	9313	broad.mit.edu	37	11	102487622	102487622	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr11:102487622G>T	ENST00000260228.2	-	2	307	c.295C>A	c.(295-297)Cgc>Agc	p.R99S	RP11-817J15.2_ENST00000542119.1_RNA	NM_004771.3	NP_004762.2	Q9NPA2	MMP25_HUMAN	matrix metallopeptidase 20	89					hard palate development (GO:0060022)|inflammatory response (GO:0006954)|proteolysis (GO:0006508)	anchored component of membrane (GO:0031225)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.R99S(1)		endometrium(1)|kidney(4)|large_intestine(3)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	27	all_cancers(8;8.95e-05)|all_epithelial(12;0.00227)|Lung NSC(15;0.139)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0033)	Epithelial(9;0.0216)|Lung(13;0.0711)|all cancers(10;0.0889)|LUSC - Lung squamous cell carcinoma(19;0.13)	BRCA - Breast invasive adenocarcinoma(274;0.0161)	Marimastat(DB00786)	ACTCCACAGCGAGGCTTCTTG	0.448																																					p.R99S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C295A	11						.						159.0	136.0	143.0					11																	102487622		2203	4299	6502	101992832	SO:0001583	missense	9313	exon2			Y12779	CCDS8318.1	11q22.3	2008-05-22	2008-05-22			ENSG00000137674			7167	protein-coding gene	gene with protein product	"""enamelysin"""	604629	"""matrix metalloproteinase 20 (enamelysin)"""			9398237	Standard	NM_004771		Approved		uc001phc.3	O60882		ENST00000260228.2:c.295C>A	11.37:g.102487622G>T	ENSP00000260228:p.Arg99Ser		101992832	NM_004771	D3DUA8|Q9H3Q0	Missense_Mutation	SNP	ENST00000260228.2	37	CCDS8318.1	.	.	.	.	.	.	.	.	.	.	G	18.40	3.616000	0.66672	.	.	ENSG00000137674	ENST00000260228	T	0.58652	0.32	5.09	5.09	0.68999	Peptidoglycan binding-like (1);Metallopeptidase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.85366	0.5680	H	0.99042	4.41	0.58432	D	0.999996	D	0.89917	1.0	D	0.97110	1.0	D	0.90430	0.4423	10	0.87932	D	0	.	14.6757	0.68978	0.0:0.0:0.8543:0.1456	.	99	O60882	MMP20_HUMAN	S	99	ENSP00000260228:R99S	ENSP00000260228:R99S	R	-	1	0	MMP20	101992832	0.981000	0.34729	0.999000	0.59377	0.502000	0.33828	1.776000	0.38594	2.804000	0.96469	0.655000	0.94253	CGC		0.448	MMP20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398012.1		
PATE1	160065	broad.mit.edu	37	11	125616235	125616235	+	Silent	SNP	G	G	T			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr11:125616235G>T	ENST00000305738.5	+	1	48	c.36G>T	c.(34-36)ctG>ctT	p.L12L	PATE1_ENST00000437148.2_Silent_p.L12L	NM_138294.2	NP_612151.1	Q8WXA2	PATE1_HUMAN	prostate and testis expressed 1	12						extracellular region (GO:0005576)		p.L12L(1)		large_intestine(1)|lung(5)	6						tccccatcctgctctgctgct	0.527																																					p.L12L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G36T	11						.						160.0	142.0	148.0					11																	125616235		2201	4299	6500	125121445	SO:0001819	synonymous_variant	160065	exon1			AF462605	CCDS8464.1	11q24.2	2008-12-17				ENSG00000171053		"""PATE family"""	24664	protein-coding gene	gene with protein product	"""expressed in prostate and testis"""	606861				11880645, 15798027	Standard	NM_138294		Approved	PATE	uc001qct.3	Q8WXA2		ENST00000305738.5:c.36G>T	11.37:g.125616235G>T			125121445	NM_138294	Q3KNX2	Silent	SNP	ENST00000305738.5	37	CCDS8464.1																																																																																				0.527	PATE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386726.2	NM_138294	
LDLRAD3	143458	broad.mit.edu	37	11	36248930	36248930	+	Silent	SNP	G	G	A	rs140347483	byFrequency	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr11:36248930G>A	ENST00000315571.5	+	5	771	c.750G>A	c.(748-750)gcG>gcA	p.A250A	LDLRAD3_ENST00000529759.1_3'UTR|LDLRAD3_ENST00000524419.1_Silent_p.A240A|LDLRAD3_ENST00000528989.1_Silent_p.A201A	NM_174902.2	NP_777562.1	Q86YD5	LRAD3_HUMAN	low density lipoprotein receptor class A domain containing 3	250					receptor-mediated endocytosis (GO:0006898)|regulation of protein processing (GO:0070613)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	beta-amyloid binding (GO:0001540)	p.A250A(1)		central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(14)|prostate(7)|skin(1)	28	all_lung(20;0.089)|Lung NSC(22;0.175)|all_epithelial(35;0.177)	all_hematologic(20;0.124)				AGCAGAATGCGTCGGAAGTAG	0.607																																					p.A250A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G750A	11						.	G		0,4404		0,0,2202	79.0	70.0	73.0		750	-9.1	0.1	11	dbSNP_134	73	2,8594	2.2+/-6.3	0,2,4296	no	coding-synonymous	LDLRAD3	NM_174902.2		0,2,6498	AA,AG,GG		0.0233,0.0,0.0154		250/346	36248930	2,12998	2202	4298	6500	36205506	SO:0001819	synonymous_variant	143458	exon5			AK075546	CCDS31462.1	11p13	2014-06-05			ENSG00000179241	ENSG00000179241			27046	protein-coding gene	gene with protein product						21795536	Standard	NM_174902		Approved	LRAD3	uc001mwk.1	Q86YD5	OTTHUMG00000166313	ENST00000315571.5:c.750G>A	11.37:g.36248930G>A			36205506	NM_174902	B7Z1U3|B9EG81|Q8NBJ0	Silent	SNP	ENST00000315571.5	37	CCDS31462.1																																																																																				0.607	LDLRAD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389085.1	NM_174902	
OR8K3	219473	broad.mit.edu	37	11	56085940	56085940	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr11:56085940C>A	ENST00000312711.1	+	1	158	c.158C>A	c.(157-159)tCc>tAc	p.S53Y		NM_001005202.1	NP_001005202.1	Q8NH51	OR8K3_HUMAN	olfactory receptor, family 8, subfamily K, member 3	53						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S53Y(1)		central_nervous_system(2)|endometrium(3)|large_intestine(6)|liver(2)|lung(15)|ovary(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	40	Esophageal squamous(21;0.00448)					AAGTTGGACTCCAGGTTGCAA	0.423																																					p.S53Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C158A	11						.						210.0	200.0	204.0					11																	56085940		2201	4296	6497	55842516	SO:0001583	missense	219473	exon1			AB065541	CCDS31527.1	11q11	2012-08-09			ENSG00000181689	ENSG00000181689		"""GPCR / Class A : Olfactory receptors"""	15313	protein-coding gene	gene with protein product							Standard	NM_001005202		Approved		uc010rjf.2	Q8NH51	OTTHUMG00000166855	ENST00000312711.1:c.158C>A	11.37:g.56085940C>A	ENSP00000323555:p.Ser53Tyr		55842516	NM_001005202	Q6IFC4	Missense_Mutation	SNP	ENST00000312711.1	37	CCDS31527.1	.	.	.	.	.	.	.	.	.	.	C	3.268	-0.149739	0.06585	.	.	ENSG00000181689	ENST00000312711	T	0.00441	7.41	4.56	1.55	0.23275	GPCR, rhodopsin-like superfamily (1);	0.790420	0.11658	N	0.542115	T	0.00552	0.0018	M	0.85462	2.755	0.09310	N	1	B	0.22541	0.071	B	0.28232	0.087	T	0.33929	-0.9849	10	0.66056	D	0.02	.	7.3709	0.26800	0.3103:0.3858:0.3039:0.0	.	53	Q8NH51	OR8K3_HUMAN	Y	53	ENSP00000323555:S53Y	ENSP00000323555:S53Y	S	+	2	0	OR8K3	55842516	0.000000	0.05858	0.013000	0.15412	0.033000	0.12548	-1.447000	0.02396	0.228000	0.21019	0.637000	0.83480	TCC		0.423	OR8K3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391602.1	NM_001005202	
VWCE	220001	broad.mit.edu	37	11	61040716	61040716	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr11:61040716G>A	ENST00000335613.5	-	13	2040	c.1654C>T	c.(1654-1656)Cct>Tct	p.P552S	VWCE_ENST00000535710.1_Missense_Mutation_p.P17S	NM_152718.2	NP_689931.2	Q96DN2	VWCE_HUMAN	von Willebrand factor C and EGF domains	552	VWFC 3. {ECO:0000255|PROSITE- ProRule:PRU00220}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)	p.P552S(1)		biliary_tract(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(17)|ovary(3)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	37						CACTGCCCAGGGCCCAGCCGC	0.647																																					p.P552S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1654T	11						.						28.0	28.0	28.0					11																	61040716		2203	4299	6502	60797292	SO:0001583	missense	220001	exon13			AK056571	CCDS8002.1	11q12.2	2006-08-04			ENSG00000167992	ENSG00000167992			26487	protein-coding gene	gene with protein product		611115				12869306	Standard	NM_152718		Approved	URG11, FLJ32009, VWC1	uc001nra.3	Q96DN2	OTTHUMG00000168208	ENST00000335613.5:c.1654C>T	11.37:g.61040716G>A	ENSP00000334186:p.Pro552Ser		60797292	NM_152718	A5PKV0|Q7Z7L6|Q86WK8	Missense_Mutation	SNP	ENST00000335613.5	37	CCDS8002.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.162232	0.78226	.	.	ENSG00000167992	ENST00000335613;ENST00000535710	T;T	0.79141	-1.24;-1.24	4.53	4.53	0.55603	von Willebrand factor, type C (4);	0.000000	0.41823	D	0.000807	D	0.85440	0.5697	L	0.58810	1.83	0.36852	D	0.887941	D	0.89917	1.0	D	0.91635	0.999	D	0.88812	0.3292	10	0.59425	D	0.04	.	15.0772	0.72084	0.0:0.0:1.0:0.0	.	552	Q96DN2	VWCE_HUMAN	S	552;17	ENSP00000334186:P552S;ENSP00000442570:P17S	ENSP00000334186:P552S	P	-	1	0	VWCE	60797292	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	6.296000	0.72751	2.092000	0.63282	0.471000	0.43371	CCT		0.647	VWCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398811.1	NM_152718	
AHNAK	79026	broad.mit.edu	37	11	62298426	62298426	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr11:62298426C>T	ENST00000378024.4	-	5	3737	c.3463G>A	c.(3463-3465)Gtt>Att	p.V1155I	AHNAK_ENST00000257247.7_Intron|AHNAK_ENST00000530124.1_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	1155					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)	p.V1155I(1)		NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				GAGACAACAACGTCAGCCTTA	0.532																																					p.V1155I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3463A	11						.						164.0	159.0	161.0					11																	62298426		2202	4299	6501	62055002	SO:0001583	missense	79026	exon5			M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.3463G>A	11.37:g.62298426C>T	ENSP00000367263:p.Val1155Ile		62055002	NM_001620	A1A586	Missense_Mutation	SNP	ENST00000378024.4	37	CCDS31584.1	.	.	.	.	.	.	.	.	.	.	c	0.004	-2.334960	0.00227	.	.	ENSG00000124942	ENST00000378024	T	0.00565	6.56	4.88	-0.269	0.12930	.	0.894418	0.09220	N	0.832096	T	0.00271	0.0008	N	0.03084	-0.415	0.09310	N	1	B	0.09022	0.002	B	0.09377	0.004	T	0.30179	-0.9987	10	0.18276	T	0.48	-1.5912	5.5602	0.17140	0.0:0.302:0.2513:0.4466	.	1155	Q09666	AHNK_HUMAN	I	1155	ENSP00000367263:V1155I	ENSP00000367263:V1155I	V	-	1	0	AHNAK	62055002	0.000000	0.05858	0.085000	0.20634	0.083000	0.17756	-3.470000	0.00460	-0.322000	0.08615	-0.288000	0.09946	GTT		0.532	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395572.1	NM_024060	
ANO1	55107	broad.mit.edu	37	11	69972281	69972282	+	Missense_Mutation	DNP	CA	CA	TG			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	CA	CA					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr11:69972281_69972282CA>TG	ENST00000355303.5	+	10	1382_1383	c.1077_1078CA>TG	c.(1075-1080)acCAtg>acTGtg	p.M360V	ANO1_ENST00000538023.1_Missense_Mutation_p.M360V|ANO1_ENST00000530676.1_Missense_Mutation_p.M244V|ANO1_ENST00000398543.2_Missense_Mutation_p.M244V|ANO1_ENST00000316296.5_Missense_Mutation_p.M332V|ANO1_ENST00000531349.1_Missense_Mutation_p.M95V	NM_018043.5	NP_060513.5	Q5XXA6	ANO1_HUMAN	anoctamin 1, calcium activated chloride channel	360					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|regulation of membrane potential (GO:0042391)|trachea development (GO:0060438)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|intracellular calcium activated chloride channel activity (GO:0005229)	p.T359>?(2)		central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(12)|ovary(3)|pancreas(1)|upper_aerodigestive_tract(1)	29					Crofelemer(DB04941)	GATGCGCCACCATGGATGAAAA	0.594																																					.												.	.	2	Complex(2)	large_intestine(2)	c.1077_1078TG	11						.																																			69649930	SO:0001583	missense	55107	exon10			BC033036	CCDS44663.1	11q13.2	2014-04-09	2008-08-28	2008-08-28	ENSG00000131620	ENSG00000131620		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	21625	protein-coding gene	gene with protein product		610108	"""oral cancer overexpressed 2"", ""transmembrane protein 16A"""	ORAOV2, TMEM16A		15067359, 18724360, 24692353	Standard	NM_018043		Approved	TAOS2, FLJ10261, DOG1	uc001opj.3	Q5XXA6	OTTHUMG00000167204	Exception_encountered	11.37:g.69972281_69972282delinsTG	ENSP00000347454:p.Met360Val		69649929	NM_018043	A8KAM3|Q8IYY8|Q8N7V3	Missense_Mutation	DNP	ENST00000355303.5	37	CCDS44663.1																																																																																				0.594	ANO1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000393685.1	NM_018043	
RPS3	6188	broad.mit.edu	37	11	75111750	75111750	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr11:75111750G>C	ENST00000531188.1	+	2	105	c.43G>C	c.(43-45)Ggc>Cgc	p.G15R	RPS3_ENST00000534440.1_Missense_Mutation_p.G15R|RPS3_ENST00000526608.1_Missense_Mutation_p.G15R|RPS3_ENST00000529285.1_3'UTR|SNORD15A_ENST00000384214.1_RNA|RPS3_ENST00000530164.1_Missense_Mutation_p.G15R|RPS3_ENST00000527446.1_Missense_Mutation_p.G15R|RPS3_ENST00000278572.6_Missense_Mutation_p.G15R|RPS3_ENST00000524851.1_Missense_Mutation_p.G15R	NM_001005.4|NM_001260506.1|NM_001260507.1	NP_000996.2|NP_001247435.1|NP_001247436.1	P23396	RS3_HUMAN	ribosomal protein S3	15					cellular protein metabolic process (GO:0044267)|cellular response to DNA damage stimulus (GO:0006974)|cytoplasmic translation (GO:0002181)|DNA catabolic process, endonucleolytic (GO:0000737)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|negative regulation of DNA repair (GO:0045738)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of DNA N-glycosylase activity (GO:1902546)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|ruffle membrane (GO:0032587)	damaged DNA binding (GO:0003684)|DNA-(apurinic or apyrimidinic site) lyase activity (GO:0003906)|enzyme binding (GO:0019899)|iron-sulfur cluster binding (GO:0051536)|mRNA binding (GO:0003729)|NF-kappaB binding (GO:0051059)|poly(A) RNA binding (GO:0044822)|protein kinase A binding (GO:0051018)|protein kinase binding (GO:0019901)|structural constituent of ribosome (GO:0003735)	p.G15R(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(2)	6						TGTCGCTGATGGCATCTTCAA	0.448																																					p.G15R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G43C	11						.						141.0	128.0	132.0					11																	75111750		2200	4293	6493	74789398	SO:0001583	missense	6188	exon2				CCDS8236.1, CCDS58161.1	11q13.3-q13.5	2011-04-05				ENSG00000149273		"""S ribosomal proteins"""	10420	protein-coding gene	gene with protein product	"""IMR-90 ribosomal protein S3"", ""40S ribosomal protein S3"""	600454				1712897, 7789996	Standard	NM_001005		Approved	FLJ26283, FLJ27450, MGC87870, S3	uc031qcs.1	P23396		ENST00000531188.1:c.43G>C	11.37:g.75111750G>C	ENSP00000434643:p.Gly15Arg		74789398	NM_001005	B2R7N5|J3KN86|Q498B5|Q8NI95	Missense_Mutation	SNP	ENST00000531188.1	37	CCDS8236.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	34|34	5.298560|5.298560	0.95574|0.95574	.|.	.|.	ENSG00000149273|ENSG00000149273	ENST00000531188;ENST00000530164;ENST00000530689;ENST00000278572;ENST00000534440;ENST00000527446;ENST00000526608;ENST00000527273;ENST00000524851|ENST00000525933	.|.	.|.	.|.	5.73|5.73	5.73|5.73	0.89815|0.89815	K homology domain-like, alpha/beta (1);K Homology, prokaryotic type (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.87545|0.87545	0.6204|0.6204	H|H	0.95260|0.95260	3.645|3.645	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.91635|.	0.999|.	D|D	0.90740|0.90740	0.4649|0.4649	9|5	0.87932|.	D|.	0|.	-10.7319|-10.7319	17.4078|17.4078	0.87477|0.87477	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	15|.	P23396|.	RS3_HUMAN|.	R|I	15|5	.|.	ENSP00000278572:G15R|.	G|M	+|+	1|3	0|0	RPS3|RPS3	74789398|74789398	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	9.713000|9.713000	0.98740|0.98740	2.712000|2.712000	0.92718|0.92718	0.557000|0.557000	0.71058|0.71058	GGC|ATG		0.448	RPS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384158.2	NM_001005	
OPCML	4978	broad.mit.edu	37	11	132306017	132306017	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr11:132306017G>T	ENST00000331898.7	-	6	1478	c.900C>A	c.(898-900)aaC>aaA	p.N300K	OPCML_ENST00000541867.1_Missense_Mutation_p.N300K|OPCML_ENST00000374778.4_Missense_Mutation_p.N259K|OPCML_ENST00000529038.1_5'UTR|OPCML_ENST00000524381.1_Missense_Mutation_p.N293K	NM_002545.3	NP_002536.1	Q14982	OPCM_HUMAN	opioid binding protein/cell adhesion molecule-like	300	Ig-like C2-type 3.				cell adhesion (GO:0007155)|neuron recognition (GO:0008038)|opioid receptor signaling pathway (GO:0038003)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	opioid receptor activity (GO:0004985)	p.N300K(1)		endometrium(5)|kidney(1)|large_intestine(12)|lung(17)|ovary(2)|skin(2)|urinary_tract(8)	47	all_hematologic(175;0.019)	all_cancers(12;5.86e-24)|all_epithelial(12;2.65e-17)|all_lung(97;2.89e-05)|Lung NSC(97;6.16e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0269)|all_neural(223;0.0326)|Esophageal squamous(93;0.129)		all cancers(11;4.61e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.012)		TCCCAAGCTTGTTCGTGGCCA	0.488																																					p.N293K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C879A	11						.						135.0	117.0	123.0					11																	132306017		2201	4297	6498	131811227	SO:0001583	missense	4978	exon7			BX537377	CCDS8492.1, CCDS31722.1	11q25	2013-01-11	2001-11-28		ENSG00000183715	ENSG00000183715		"""Immunoglobulin superfamily / I-set domain containing"""	8143	protein-coding gene	gene with protein product	"""IgLON family member 1"""	600632	"""opioid-binding protein/cell adhesion molecule-like"""			8244387	Standard	XM_005271578		Approved	OPCM, OBCAM, IGLON1	uc001qgs.3	Q14982	OTTHUMG00000163658	ENST00000331898.7:c.900C>A	11.37:g.132306017G>T	ENSP00000330862:p.Asn300Lys		131811227	NM_001012393	B2CZX2|B7ZLQ1|Q17RN7|Q7Z3W6	Missense_Mutation	SNP	ENST00000331898.7	37	CCDS8492.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.026229	0.75390	.	.	ENSG00000183715	ENST00000331898;ENST00000524381;ENST00000374778;ENST00000416724;ENST00000541867	T;T;T;T	0.81163	-1.46;-1.46;-1.46;-1.46	5.91	4.97	0.65823	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.94128	0.8117	H	0.99820	4.81	0.54753	D	0.999986	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.80764	0.994;0.994;0.994;0.994	D	0.94788	0.7959	10	0.87932	D	0	-32.5005	10.2529	0.43379	0.1571:0.0:0.8429:0.0	.	300;293;299;300	B7ZLQ1;Q7Z3W6;B7ZLQ0;Q14982	.;.;.;OPCM_HUMAN	K	300;293;259;267;300	ENSP00000330862:N300K;ENSP00000434750:N293K;ENSP00000363910:N259K;ENSP00000445496:N300K	ENSP00000330862:N300K	N	-	3	2	OPCML	131811227	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.729000	0.47327	1.442000	0.47568	0.650000	0.86243	AAC		0.488	OPCML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374689.3	NM_001012393	
CRACR2A	84766	broad.mit.edu	37	12	3782661	3782661	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr12:3782661G>A	ENST00000252322.1	-	7	1090	c.622C>T	c.(622-624)Ctc>Ttc	p.L208F	EFCAB4B_ENST00000440314.2_Missense_Mutation_p.L208F|EFCAB4B_ENST00000444507.1_Missense_Mutation_p.L208F	NM_032680.3	NP_116069.1	Q9BSW2	EFC4B_HUMAN		208					activation of store-operated calcium channel activity (GO:0032237)|immune system process (GO:0002376)|positive regulation of calcium ion transport (GO:0051928)|store-operated calcium entry (GO:0002115)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)	p.L208F(1)		breast(1)|endometrium(3)|large_intestine(2)|liver(1)|lung(12)|ovary(1)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(1)	24			OV - Ovarian serous cystadenocarcinoma(31;0.00287)|COAD - Colon adenocarcinoma(12;0.0264)			GCTTCTTGGAGCTGGGAGATG	0.478																																					p.L208F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C622T	12						.						150.0	140.0	144.0					12																	3782661		2203	4300	6503	3652922	SO:0001583	missense	84766	exon7																														ENST00000252322.1:c.622C>T	12.37:g.3782661G>A	ENSP00000252322:p.Leu208Phe		3652922	NM_001144959	B4E1X0|B9EK63	Missense_Mutation	SNP	ENST00000252322.1	37	CCDS8522.1	.	.	.	.	.	.	.	.	.	.	G	19.08	3.758449	0.69763	.	.	ENSG00000130038	ENST00000440314;ENST00000444507;ENST00000252322	T;T;T	0.24538	1.85;2.11;2.05	4.55	4.55	0.56014	.	0.063724	0.64402	D	0.000008	T	0.55097	0.1899	M	0.85299	2.745	0.37943	D	0.932402	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.974;0.989;0.997	T	0.67515	-0.5651	10	0.72032	D	0.01	-18.7922	14.8173	0.70045	0.0:0.0:1.0:0.0	.	208;208;208	D7UEQ6;Q9BSW2-2;Q9BSW2	.;.;EFC4B_HUMAN	F	208	ENSP00000409382:L208F;ENSP00000412496:L208F;ENSP00000252322:L208F	ENSP00000252322:L208F	L	-	1	0	EFCAB4B	3652922	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	5.280000	0.65603	2.064000	0.61679	0.650000	0.86243	CTC		0.478	EFCAB4B-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000398673.1		
ACSM4	341392	broad.mit.edu	37	12	7463188	7463188	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr12:7463188C>T	ENST00000399422.4	+	3	514	c.466C>T	c.(466-468)Cgg>Tgg	p.R156W		NM_001080454.1	NP_001073923.1	P0C7M7	ACSM4_HUMAN	acyl-CoA synthetase medium-chain family member 4	156					acyl-CoA metabolic process (GO:0006637)|fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|fatty-acyl-CoA synthase activity (GO:0004321)|metal ion binding (GO:0046872)			endometrium(6)|kidney(1)|lung(14)	21						CATCCTCTACCGGCTGCGAGC	0.547																																					p.R156W												.	.	0			c.C466T	12						.						33.0	35.0	34.0					12																	7463188		2029	4182	6211	7354455	SO:0001583	missense	341392	exon3				CCDS44825.1	12p13.31	2008-06-12			ENSG00000215009	ENSG00000215009		"""Acyl-CoA synthetase family"""	32016	protein-coding gene	gene with protein product	"""similar to olfactory specific medium-chain acyl CoA synthetase"""	614360				17762044	Standard	NM_001080454		Approved		uc001qsx.1	P0C7M7	OTTHUMG00000154975	ENST00000399422.4:c.466C>T	12.37:g.7463188C>T	ENSP00000382349:p.Arg156Trp		7354455	NM_001080454	A8MTI6	Missense_Mutation	SNP	ENST00000399422.4	37	CCDS44825.1	.	.	.	.	.	.	.	.	.	.	C	17.17	3.319989	0.60634	.	.	ENSG00000215009	ENST00000399422	T	0.42900	0.96	3.48	2.48	0.30137	AMP-dependent synthetase/ligase (1);	0.000000	0.35970	U	0.002867	T	0.72045	0.3412	H	0.96833	3.89	0.40449	D	0.980121	D	0.89917	1.0	D	0.97110	1.0	T	0.79759	-0.1668	10	0.87932	D	0	-16.6489	9.8458	0.41026	0.2043:0.7957:0.0:0.0	.	156	P0C7M7	ACSM4_HUMAN	W	156	ENSP00000382349:R156W	ENSP00000382349:R156W	R	+	1	2	ACSM4	7354455	0.025000	0.19082	1.000000	0.80357	0.932000	0.56968	0.039000	0.13884	1.964000	0.57103	0.655000	0.94253	CGG		0.547	ACSM4-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000337866.2	NM_001080454	
SLC2A14	144195	broad.mit.edu	37	12	7980192	7980192	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr12:7980192G>T	ENST00000543909.1	-	12	1591	c.832C>A	c.(832-834)Caa>Aaa	p.Q278K	SLC2A14_ENST00000396589.2_Missense_Mutation_p.Q278K|SLC2A14_ENST00000542505.1_Intron|SLC2A14_ENST00000535295.1_Missense_Mutation_p.Q169K|SLC2A14_ENST00000431042.2_Missense_Mutation_p.Q255K|SLC2A14_ENST00000340749.5_Missense_Mutation_p.Q255K|SLC2A14_ENST00000539924.1_Missense_Mutation_p.Q293K|SLC2A14_ENST00000542546.1_Missense_Mutation_p.Q169K			Q8TDB8	GTR14_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 14	278					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	glucose transmembrane transporter activity (GO:0005355)	p.Q278K(1)		central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(12)|ovary(2)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)	38				Kidney(36;0.0883)		ACGGTGACTTGCTTTTCTTGT	0.517																																					p.Q278K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C832A	12						.						92.0	106.0	101.0					12																	7980192		2203	4300	6503	7871459	SO:0001583	missense	144195	exon8			AF481878	CCDS8585.1, CCDS66300.1, CCDS66301.1, CCDS66302.1	12p13.31	2013-07-15			ENSG00000173262	ENSG00000173262		"""Solute carriers"""	18301	protein-coding gene	gene with protein product		611039	"""solute carrier family 2 (facilitated glucose transporter), member 3 pseudogene 3"""	SLC2A3P3		12504846	Standard	NM_001286234		Approved	GLUT14	uc001qtn.3	Q8TDB8	OTTHUMG00000168463	ENST00000543909.1:c.832C>A	12.37:g.7980192G>T	ENSP00000440480:p.Gln278Lys		7871459	NM_153449	B3KVB5|B3KWW7|B7Z844|B7ZAC3|Q6UY84|Q8TDB9	Missense_Mutation	SNP	ENST00000543909.1	37	CCDS8585.1	.	.	.	.	.	.	.	.	.	.	G	0.011	-1.703952	0.00719	.	.	ENSG00000173262	ENST00000340749;ENST00000543909;ENST00000431042;ENST00000396589;ENST00000535295;ENST00000542546;ENST00000539924	T;T;T;T;T;T;T	0.79141	-1.24;-1.24;-1.24;-1.24;-1.24;-1.24;-1.24	3.58	1.22	0.21188	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	2.242170	0.01830	N	0.034625	T	0.48409	0.1498	N	0.02120	-0.675	0.35557	D	0.804333	B;B;B;B	0.06786	0.0;0.0;0.001;0.001	B;B;B;B	0.06405	0.002;0.002;0.001;0.002	T	0.61879	-0.6972	10	0.02654	T	1	.	3.9559	0.09390	0.1379:0.0:0.3465:0.5156	.	293;169;255;278	B7ZAC3;B7Z844;Q8TDB8-2;Q8TDB8	.;.;.;GTR14_HUMAN	K	255;278;255;278;169;169;293	ENSP00000340450:Q255K;ENSP00000440480:Q278K;ENSP00000407287:Q255K;ENSP00000379834:Q278K;ENSP00000440492:Q169K;ENSP00000443903:Q169K;ENSP00000445929:Q293K	ENSP00000340450:Q255K	Q	-	1	0	SLC2A14	7871459	0.998000	0.40836	0.775000	0.31657	0.343000	0.28985	0.764000	0.26532	0.423000	0.26033	0.585000	0.79938	CAA		0.517	SLC2A14-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000399836.2	NM_153449	
KRAS	3845	broad.mit.edu	37	12	25380276	25380276	+	Missense_Mutation	SNP	T	T	A	rs121913240		TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr12:25380276T>A	ENST00000256078.4	-	3	245	c.182A>T	c.(181-183)cAa>cTa	p.Q61L	KRAS_ENST00000557334.1_Intron|AC087239.1_ENST00000594112.1_5'Flank|KRAS_ENST00000311936.3_Missense_Mutation_p.Q61L	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	61			Q -> H (in lung carcinoma; dbSNP:rs17851045). {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:16533793, ECO:0000269|Ref.7}.|Q -> R (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.Q61L(73)|p.Q61R(56)|p.Q61P(12)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GTACTCCTCTTGACCTGCTGT	0.418	Q61L(NCIH650_LUNG)|Q61L(SW948_LARGE_INTESTINE)|Q61R(PANC0213_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.Q61L	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)		Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	KRAS,thyroid,NS,Substitution - Missense,0 	.	141	Substitution - Missense(141)	large_intestine(63)|lung(27)|thyroid(14)|haematopoietic_and_lymphoid_tissue(9)|pancreas(6)|skin(5)|stomach(3)|cervix(3)|upper_aerodigestive_tract(2)|soft_tissue(1)|central_nervous_system(1)|biliary_tract(1)|endometrium(1)|urinary_tract(1)|gastrointestinal_tract_(site_indeterminate)(1)|breast(1)|prostate(1)|kidney(1)	c.A182T	12						.						109.0	97.0	101.0					12																	25380276		2203	4300	6503	25271543	SO:0001583	missense	3845	exon3	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.182A>T	12.37:g.25380276T>A	ENSP00000256078:p.Gln61Leu		25271543	NM_004985	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	T	28.1	4.889058	0.91814	.	.	ENSG00000133703	ENST00000311936;ENST00000256078	D;D	0.83992	-1.79;-1.79	5.77	5.77	0.91146	Small GTP-binding protein domain (1);	0.049057	0.85682	D	0.000000	D	0.92097	0.7495	H	0.96333	3.805	0.80722	D	1	D;P	0.58970	0.984;0.812	P;P	0.53689	0.732;0.69	D	0.94295	0.7532	10	0.72032	D	0.01	.	15.5753	0.76373	0.0:0.0:0.0:1.0	.	61;61	P01116-2;P01116	.;RASK_HUMAN	L	61	ENSP00000308495:Q61L;ENSP00000256078:Q61L	ENSP00000256078:Q61L	Q	-	2	0	KRAS	25271543	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.983000	0.88140	2.326000	0.78906	0.533000	0.62120	CAA		0.418	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360	
BICD1	636	broad.mit.edu	37	12	32447003	32447003	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr12:32447003C>T	ENST00000281474.5	+	3	605	c.502C>T	c.(502-504)Ctc>Ttc	p.L168F	BICD1_ENST00000548411.1_Missense_Mutation_p.L168F	NM_001714.2	NP_001705.2	Q96G01	BICD1_HUMAN	bicaudal D homolog 1 (Drosophila)	168					anatomical structure morphogenesis (GO:0009653)|intracellular mRNA localization (GO:0008298)|microtubule anchoring at microtubule organizing center (GO:0072393)|minus-end-directed organelle transport along microtubule (GO:0072385)|negative regulation of phospholipase C activity (GO:1900275)|negative regulation of phospholipase C-activating G-protein coupled receptor signaling pathway (GO:1900737)|positive regulation of receptor-mediated endocytosis (GO:0048260)|protein localization to organelle (GO:0033365)|regulation of proteinase activated receptor activity (GO:1900276)|RNA processing (GO:0006396)|stress granule assembly (GO:0034063)|viral process (GO:0016032)	cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|host cell viral assembly compartment (GO:0072517)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)	cytoskeletal adaptor activity (GO:0008093)|dynactin binding (GO:0034452)|dynein binding (GO:0045502)|proteinase activated receptor binding (GO:0031871)|Rab GTPase binding (GO:0017137)|structural constituent of cytoskeleton (GO:0005200)	p.L168F(1)		NS(1)|breast(2)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	46	all_cancers(9;5.13e-11)|all_epithelial(9;2.71e-11)|all_lung(12;6.66e-10)|Acute lymphoblastic leukemia(23;0.0122)|Lung SC(12;0.0213)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)		OV - Ovarian serous cystadenocarcinoma(6;0.0201)			GGAGGCACGGCTCCTTCAGGA	0.403																																					p.L168F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C502T	12						.						65.0	65.0	65.0					12																	32447003		2203	4300	6503	32338270	SO:0001583	missense	636	exon3			U90028	CCDS8726.1, CCDS44859.1	12p11.2-p11.1	2005-01-13	2001-11-28			ENSG00000151746			1049	protein-coding gene	gene with protein product		602204	"""Bicaudal D (Drosophila) homolog 1"""			9367685	Standard	NM_001714		Approved		uc001rku.3	Q96G01	OTTHUMG00000169307	ENST00000281474.5:c.502C>T	12.37:g.32447003C>T	ENSP00000281474:p.Leu168Phe		32338270	NM_001003398	A8K2C3|F8W113|O43892|O43893	Missense_Mutation	SNP	ENST00000281474.5	37	CCDS8726.1	.	.	.	.	.	.	.	.	.	.	C	27.3	4.817849	0.90790	.	.	ENSG00000151746	ENST00000548411;ENST00000281474	T;T	0.57907	0.37;0.37	5.14	5.14	0.70334	.	0.000000	0.64402	D	0.000002	T	0.77308	0.4111	M	0.89095	3.005	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.77963	-0.2390	10	0.36615	T	0.2	.	18.7935	0.91983	0.0:1.0:0.0:0.0	.	168;168	F8W113;Q96G01	.;BICD1_HUMAN	F	168	ENSP00000446793:L168F;ENSP00000281474:L168F	ENSP00000281474:L168F	L	+	1	0	BICD1	32338270	1.000000	0.71417	0.962000	0.40283	0.849000	0.48306	5.624000	0.67764	2.663000	0.90544	0.555000	0.69702	CTC		0.403	BICD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403380.1	NM_001714	
PCBP2	5094	broad.mit.edu	37	12	53854854	53854854	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr12:53854854G>A	ENST00000439930.3	+	6	453	c.431G>A	c.(430-432)cGg>cAg	p.R144Q	PCBP2_ENST00000541275.1_Missense_Mutation_p.R144Q|RP11-793H13.8_ENST00000547717.1_RNA|PCBP2_ENST00000546463.1_Missense_Mutation_p.R144Q|PCBP2_ENST00000359462.5_Missense_Mutation_p.R144Q|PCBP2_ENST00000552296.2_Missense_Mutation_p.R144Q|PCBP2_ENST00000552819.1_Missense_Mutation_p.R144Q|PCBP2_ENST00000455667.3_Missense_Mutation_p.R144Q|PCBP2_ENST00000437231.1_Missense_Mutation_p.R144Q|PCBP2_ENST00000359282.5_Missense_Mutation_p.R144Q|PCBP2_ENST00000549863.1_Missense_Mutation_p.R144Q|PCBP2_ENST00000548933.1_Missense_Mutation_p.R144Q|PCBP2_ENST00000447282.1_Missense_Mutation_p.R144Q|PCBP2_ENST00000603815.1_Missense_Mutation_p.R144Q			Q15366	PCBP2_HUMAN	poly(rC) binding protein 2	144	KH 2. {ECO:0000255|PROSITE- ProRule:PRU00117}.				defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of defense response to virus (GO:0050687)|negative regulation of type I interferon production (GO:0032480)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|ubiquitin protein ligase binding (GO:0031625)	p.R144Q(1)		central_nervous_system(4)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	15						TCAACTGAGCGGGCCATCACT	0.468																																					p.R144Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G431A	12						.						138.0	113.0	121.0					12																	53854854		2203	4300	6503	52141121	SO:0001583	missense	5094	exon7			BC035420	CCDS8859.1, CCDS44900.1, CCDS44901.1, CCDS44902.1, CCDS44903.1, CCDS44904.1, CCDS55830.1	12q13.13	2013-10-30	2001-11-28		ENSG00000197111	ENSG00000197111			8648	protein-coding gene	gene with protein product	"""heterogenous nuclear ribonucleoprotein E2"""	601210	"""poly(rC)-binding protein 2"""			8833161	Standard	NM_001098620		Approved	HNRPE2, hnRNP-E2, HNRNPE2	uc001sdc.4	Q15366	OTTHUMG00000169439	ENST00000439930.3:c.431G>A	12.37:g.53854854G>A	ENSP00000408949:p.Arg144Gln		52141121	NM_001128911	A8K7X6|F8VYL7|G3V0E8|I6L8F9|Q32Q82|Q59HD4|Q68Y55|Q6IPF4|Q6PKG5	Missense_Mutation	SNP	ENST00000439930.3	37	CCDS44901.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	28.7|28.7	4.943213|4.943213	0.92526|0.92526	.|.	.|.	ENSG00000197111|ENSG00000197111	ENST00000546652|ENST00000541275;ENST00000359282;ENST00000447282;ENST00000437231;ENST00000439930;ENST00000549863;ENST00000359462;ENST00000550927;ENST00000546463;ENST00000551104;ENST00000550520;ENST00000552296;ENST00000552083;ENST00000552819;ENST00000455667;ENST00000548933;ENST00000379777;ENST00000553064	T|T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.50001|0.35236	0.76|1.32;1.32;1.32;1.32;1.32;1.32;1.32;1.32;1.32;1.32;1.32;1.32;1.32;1.32	5.38|5.38	5.38|5.38	0.77491|0.77491	.|K Homology (1);K Homology, type 1, subgroup (1);K Homology, type 1 (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.59514|0.59514	0.2199|0.2199	M|M	0.90198|0.90198	3.095|3.095	0.80722|0.80722	D|D	1|1	.|P;P;P;P;P;P;P;P;B	.|0.52577	.|0.954;0.884;0.894;0.769;0.933;0.871;0.546;0.558;0.346	.|P;P;P;P;P;P;B;B;P	.|0.50825	.|0.63;0.627;0.651;0.48;0.473;0.519;0.215;0.431;0.536	T|T	0.69379|0.69379	-0.5161|-0.5161	7|10	0.22706|0.87932	T|D	0.39|0	.|.	18.1345|18.1345	0.89614|0.89614	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|144;105;144;144;144;144;144;144;144	.|B4DLC0;F8VRG9;Q15366;Q32Q82;G3V0E8;F8VYL7;Q68Y55;Q6IPF4;A8K7X6	.|.;.;PCBP2_HUMAN;.;.;.;.;.;.	R|Q	157|144;144;144;144;144;144;144;86;144;144;136;144;105;144;144;144;106;8	ENSP00000447068:G157R|ENSP00000446130:R144Q;ENSP00000352228:R144Q;ENSP00000394116:R144Q;ENSP00000390304:R144Q;ENSP00000408949:R144Q;ENSP00000447670:R144Q;ENSP00000352438:R144Q;ENSP00000448762:R144Q;ENSP00000446601:R144Q;ENSP00000448847:R136Q;ENSP00000448927:R144Q;ENSP00000449070:R144Q;ENSP00000388008:R144Q;ENSP00000449062:R144Q	ENSP00000447068:G157R|ENSP00000352228:R144Q	G|R	+|+	1|2	0|0	PCBP2|PCBP2	52141121|52141121	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	9.597000|9.597000	0.98273|0.98273	2.822000|2.822000	0.97130|0.97130	0.558000|0.558000	0.71614|0.71614	GGG|CGG		0.468	PCBP2-027	NOVEL	NAGNAG_splice_site|non_canonical_conserved|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000407545.2	NM_005016	
LRRC43	254050	broad.mit.edu	37	12	122677340	122677340	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr12:122677340G>T	ENST00000339777.4	+	7	1166	c.1138G>T	c.(1138-1140)Gaa>Taa	p.E380*	LRRC43_ENST00000425921.1_Nonsense_Mutation_p.E195*	NM_152759.4	NP_689972.3	Q8N309	LRC43_HUMAN	leucine rich repeat containing 43	380	Glu-rich.							p.E195*(1)|p.E380*(1)		NS(1)|endometrium(1)|large_intestine(4)|lung(10)|skin(1)|upper_aerodigestive_tract(2)	19	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000312)|Epithelial(86;0.000539)|BRCA - Breast invasive adenocarcinoma(302;0.225)		GGAATCTCCTGAAGAGGTCGT	0.512																																					p.E380X												.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.G1138T	12						.						108.0	105.0	106.0					12																	122677340		1979	4182	6161	121243293	SO:0001587	stop_gained	254050	exon7			AK124107	CCDS45001.1	12q24.31	2014-09-11			ENSG00000158113	ENSG00000158113			28562	protein-coding gene	gene with protein product						12477932	Standard	NM_152759		Approved	MGC35140	uc009zxm.3	Q8N309	OTTHUMG00000168915	ENST00000339777.4:c.1138G>T	12.37:g.122677340G>T	ENSP00000344233:p.Glu380*		121243293	NM_001098519	Q6ZVT9	Nonsense_Mutation	SNP	ENST00000339777.4	37	CCDS45001.1	.	.	.	.	.	.	.	.	.	.	G	16.64	3.180015	0.57800	.	.	ENSG00000158113	ENST00000339777;ENST00000289014;ENST00000425921	.	.	.	3.39	1.48	0.22813	.	0.719989	0.12543	N	0.459692	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.31617	T	0.26	-3.1366	9.4746	0.38864	0.0:0.4252:0.5748:0.0	.	.	.	.	X	380;251;195	.	ENSP00000289014:E251X	E	+	1	0	LRRC43	121243293	0.804000	0.28969	0.009000	0.14445	0.052000	0.14988	1.007000	0.29860	0.403000	0.25479	0.655000	0.94253	GAA		0.512	LRRC43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401589.1	NM_152759	
BRCA2	675	broad.mit.edu	37	13	32911879	32911879	+	Silent	SNP	G	G	A			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr13:32911879G>A	ENST00000380152.3	+	11	3620	c.3387G>A	c.(3385-3387)caG>caA	p.Q1129Q	BRCA2_ENST00000544455.1_Silent_p.Q1129Q			P51587	BRCA2_HUMAN	breast cancer 2, early onset	1129					brain development (GO:0007420)|cell aging (GO:0007569)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|female gonad development (GO:0008585)|hemopoiesis (GO:0030097)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|inner cell mass cell proliferation (GO:0001833)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|male meiosis I (GO:0007141)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|nucleotide-excision repair (GO:0006289)|oocyte maturation (GO:0001556)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokinesis (GO:0032465)|replication fork protection (GO:0048478)|response to gamma radiation (GO:0010332)|response to UV-C (GO:0010225)|response to X-ray (GO:0010165)|spermatogenesis (GO:0007283)	BRCA2-MAGE-D1 complex (GO:0033593)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|secretory granule (GO:0030141)	gamma-tubulin binding (GO:0043015)|H3 histone acetyltransferase activity (GO:0010484)|H4 histone acetyltransferase activity (GO:0010485)|protease binding (GO:0002020)|single-stranded DNA binding (GO:0003697)	p.Q1129Q(2)		NS(3)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(32)|liver(1)|lung(41)|oesophagus(5)|ovary(22)|pancreas(4)|prostate(3)|salivary_gland(1)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	183		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		AATTTACTCAGTTTAGAAAAC	0.343			"""D, Mis, N, F, S"""		"""breast, ovarian, pancreatic"""	"""breast, ovarian, pancreatic, leukemia  (FANCB, FANCD1)"""		Homologous recombination	Pancreatic Cancer, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Prostate Cancer;Hereditary Breast-Ovarian Cancer, BRCA2 type;Fanconi Anemia type D1, bi-allelic BRCA2 mutations;Fanconi Anemia	TCGA Ovarian(8;0.087)																											p.Q1129Q	Esophageal Squamous(138;838 1285 7957 30353 30468 36915 49332)	yes	Rec	yes	Hereditary breast/ovarian cancer	13	13q12	675	familial breast/ovarian cancer gene 2		"""L, E"""	.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G3387A	13						.						55.0	57.0	56.0					13																	32911879		2202	4298	6500	31809879	SO:0001819	synonymous_variant	675	exon11	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;HPC; ;FANCD1;Pancytopenia Dysmelia, FA (several complementation groups)	U43746	CCDS9344.1	13q12-q13	2014-09-17	2003-10-14		ENSG00000139618	ENSG00000139618		"""Fanconi anemia, complementation groups"""	1101	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 2"""	600185	"""Fanconi anemia, complementation group D1"""	FANCD1, FACD, FANCD		8091231, 7581463, 15057823	Standard	NM_000059		Approved	FAD, FAD1, BRCC2	uc001uub.1	P51587	OTTHUMG00000017411	ENST00000380152.3:c.3387G>A	13.37:g.32911879G>A			31809879	NM_000059	O00183|O15008|Q13879|Q5TBJ7	Silent	SNP	ENST00000380152.3	37	CCDS9344.1																																																																																				0.343	BRCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046000.2	NM_000059	
WDFY2	115825	broad.mit.edu	37	13	52313196	52313196	+	Missense_Mutation	SNP	G	G	A	rs138993465		TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr13:52313196G>A	ENST00000298125.5	+	7	790	c.610G>A	c.(610-612)Gct>Act	p.A204T		NM_052950.3	NP_443182.1	Q96P53	WDFY2_HUMAN	WD repeat and FYVE domain containing 2	204							metal ion binding (GO:0046872)	p.A204T(1)		breast(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(4)|skin(2)|upper_aerodigestive_tract(1)	16		Breast(56;0.000208)|Lung NSC(96;0.000517)|Prostate(109;0.0041)|Hepatocellular(98;0.0652)|Myeloproliferative disorder(33;0.164)|all_neural(104;0.191)		GBM - Glioblastoma multiforme(99;9e-08)		TGGGGTGACCGCTCTCTGTTG	0.517																																					p.A204T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G610A	13						.	G	THR/ALA	1,4405		0,1,2202	161.0	150.0	154.0		610	5.3	1.0	13	dbSNP_134	154	3,8597	3.0+/-9.4	0,3,4297	yes	missense	WDFY2	NM_052950.3	58	0,4,6499	AA,AG,GG		0.0349,0.0227,0.0308	benign	204/401	52313196	4,13002	2203	4300	6503	51211197	SO:0001583	missense	115825	exon7			AF411978	CCDS9429.1	13q14.12	2013-01-09	2003-03-13		ENSG00000139668	ENSG00000139668		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20482	protein-coding gene	gene with protein product		610418	"""WD40 and FYVE domain containing 2"""				Standard	NM_052950		Approved	ZFYVE22	uc001vfp.3	Q96P53	OTTHUMG00000017407	ENST00000298125.5:c.610G>A	13.37:g.52313196G>A	ENSP00000298125:p.Ala204Thr		51211197	NM_052950	B1AL86|Q96CS1	Missense_Mutation	SNP	ENST00000298125.5	37	CCDS9429.1	.	.	.	.	.	.	.	.	.	.	G	15.45	2.836725	0.50951	2.27E-4	3.49E-4	ENSG00000139668	ENST00000298125	T	0.61510	0.1	6.16	5.27	0.74061	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.094496	0.64402	D	0.000001	T	0.44787	0.1310	L	0.47190	1.495	0.58432	D	0.999999	P;B	0.42123	0.771;0.12	B;B	0.28305	0.088;0.034	T	0.50882	-0.8775	10	0.49607	T	0.09	-7.9892	13.1204	0.59323	0.0:0.0:0.7303:0.2697	.	101;204	Q96LK4;Q96P53	.;WDFY2_HUMAN	T	204	ENSP00000298125:A204T	ENSP00000298125:A204T	A	+	1	0	WDFY2	51211197	1.000000	0.71417	0.960000	0.40013	0.971000	0.66376	4.974000	0.63771	2.937000	0.99478	0.650000	0.86243	GCT		0.517	WDFY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045985.3	NM_052950	
PCDH20	64881	broad.mit.edu	37	13	61986782	61986782	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr13:61986782T>C	ENST00000409186.1	-	5	3555	c.1450A>G	c.(1450-1452)Aat>Gat	p.N484D	PCDH20_ENST00000409204.4_Missense_Mutation_p.N484D			Q8N6Y1	PCD20_HUMAN	protocadherin 20	484	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)	p.N457D(1)|p.N484D(1)		breast(3)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(14)|liver(1)|lung(23)|ovary(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	58		Breast(118;0.195)|Prostate(109;0.229)		GBM - Glioblastoma multiforme(99;0.000118)		TATTCATTATTGTATGGTTTG	0.408																																					p.N484D												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A1450G	13						.						112.0	111.0	111.0					13																	61986782		2203	4300	6503	60884783	SO:0001583	missense	64881	exon2			AF169693	CCDS9442.2	13q21	2010-01-26			ENSG00000197991	ENSG00000197991		"""Cadherins / Protocadherins : Non-clustered"""	14257	protein-coding gene	gene with protein product		614449					Standard	NM_022843		Approved	PCDH13, FLJ22218	uc001vid.4	Q8N6Y1	OTTHUMG00000017012	ENST00000409186.1:c.1450A>G	13.37:g.61986782T>C	ENSP00000386653:p.Asn484Asp		60884783	NM_022843	A8K1K9|B1AQU2|Q8NDN4|Q9NRT9	Missense_Mutation	SNP	ENST00000409186.1	37	CCDS9442.2	.	.	.	.	.	.	.	.	.	.	T	1.390	-0.580979	0.03854	.	.	ENSG00000197991	ENST00000409204;ENST00000409186;ENST00000358674	T;T	0.60672	0.17;0.17	5.95	5.95	0.96441	.	0.523932	0.19710	N	0.107839	T	0.41351	0.1155	N	0.25825	0.765	0.44227	D	0.997064	B	0.12630	0.006	B	0.14023	0.01	T	0.28299	-1.0048	10	0.06625	T	0.88	.	12.8711	0.57965	0.0:0.0:0.1357:0.8643	.	484	A8K1K9	.	D	484;484;230	ENSP00000387250:N484D;ENSP00000386653:N484D	ENSP00000351500:N230D	N	-	1	0	PCDH20	60884783	0.995000	0.38212	0.926000	0.36857	0.944000	0.59088	3.826000	0.55738	2.276000	0.75962	0.528000	0.53228	AAT		0.408	PCDH20-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333054.2	NM_022843	
ZNF839	55778	broad.mit.edu	37	14	102792654	102792654	+	Silent	SNP	C	C	T			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr14:102792654C>T	ENST00000558850.1	+	2	623	c.273C>T	c.(271-273)acC>acT	p.T91T	ZNF839_ENST00000262236.5_Silent_p.T91T|ZNF839_ENST00000559185.1_Silent_p.T91T|ZNF839_ENST00000442396.2_Silent_p.T207T	NM_001267827.1	NP_001254756.1	A8K0R7	ZN839_HUMAN	zinc finger protein 839	91							metal ion binding (GO:0046872)	p.T207T(1)		breast(2)|central_nervous_system(1)|endometrium(5)|large_intestine(2)|lung(5)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	19						CCATGTTGACCCCTTTGTCTG	0.517																																					p.T207T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C621T	14						.						29.0	29.0	29.0					14																	102792654		1907	4114	6021	101862407	SO:0001819	synonymous_variant	55778	exon2			AK093342	CCDS45164.1, CCDS58336.1	14q32.32	2010-05-06	2008-06-23	2008-06-23	ENSG00000022976	ENSG00000022976			20345	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 131"""	C14orf131			Standard	NM_018335		Approved		uc010awk.2	A8K0R7		ENST00000558850.1:c.273C>T	14.37:g.102792654C>T			101862407	NM_018335	B3KSD2|Q53FH5|Q6GPI5|Q86TU1|Q9BQ86|Q9NUU3	Silent	SNP	ENST00000558850.1	37	CCDS58336.1																																																																																				0.517	ZNF839-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000415492.2	NM_018335	
LRFN5	145581	broad.mit.edu	37	14	42355896	42355896	+	Missense_Mutation	SNP	G	G	A	rs553209511		TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr14:42355896G>A	ENST00000298119.4	+	3	1257	c.68G>A	c.(67-69)cGt>cAt	p.R23H	LRFN5_ENST00000554171.1_Missense_Mutation_p.R23H|LRFN5_ENST00000554120.1_Missense_Mutation_p.R23H	NM_152447.3	NP_689660.2	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III domain containing 5	23	LRRNT.					integral component of membrane (GO:0016021)		p.R23H(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(67)|ovary(5)|pancreas(3)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(2)	120			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)		TGTCCAAAGCGTTGTGTCTGT	0.398										HNSCC(30;0.082)			G|||	1	0.000199681	0.0	0.0	5008	,	,		17221	0.001		0.0	False		,,,				2504	0.0				p.R23H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G68A	14						.						94.0	85.0	88.0					14																	42355896		2203	4300	6503	41425646	SO:0001583	missense	145581	exon3			AK055365	CCDS9678.1	14q21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000165379	ENSG00000165379		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	20360	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 8"""	612811	"""chromosome 14 open reading frame 146"""	C14orf146		16828986	Standard	NM_152447		Approved	FIGLER8, SALM5	uc001wvm.3	Q96NI6	OTTHUMG00000140261	ENST00000298119.4:c.68G>A	14.37:g.42355896G>A	ENSP00000298119:p.Arg23His		41425646	NM_152447	B3KU78|Q86XL2	Missense_Mutation	SNP	ENST00000298119.4	37	CCDS9678.1	.	.	.	.	.	.	.	.	.	.	G	13.88	2.369914	0.42003	.	.	ENSG00000165379	ENST00000298119;ENST00000554120;ENST00000554171	T;T;T	0.52057	0.81;0.68;0.68	5.56	5.56	0.83823	Leucine-rich repeat-containing N-terminal (1);	0.000000	0.56097	D	0.000022	T	0.42359	0.1199	L	0.52905	1.665	0.58432	D	0.999999	B;P	0.37352	0.223;0.591	B;B	0.32724	0.112;0.151	T	0.28933	-1.0028	10	0.19590	T	0.45	.	17.0193	0.86429	0.0:0.0:1.0:0.0	.	23;23	G3V364;Q96NI6	.;LRFN5_HUMAN	H	23	ENSP00000298119:R23H;ENSP00000451897:R23H;ENSP00000451067:R23H	ENSP00000298119:R23H	R	+	2	0	LRFN5	41425646	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.062000	0.89475	2.595000	0.87683	0.650000	0.86243	CGT		0.398	LRFN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276786.1	NM_152447	
PRKCH	5583	broad.mit.edu	37	14	61997205	61997205	+	Silent	SNP	C	C	T			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr14:61997205C>T	ENST00000332981.5	+	12	2038	c.1653C>T	c.(1651-1653)caC>caT	p.H551H	RP11-47I22.4_ENST00000556347.1_Missense_Mutation_p.T56M|PRKCH_ENST00000555082.1_Silent_p.H390H	NM_006255.3	NP_006246.2	P24723	KPCL_HUMAN	protein kinase C, eta	551	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				blood coagulation (GO:0007596)|negative regulation of glial cell apoptotic process (GO:0034351)|platelet activation (GO:0030168)|positive regulation of B cell receptor signaling pathway (GO:0050861)|positive regulation of glial cell proliferation (GO:0060252)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein kinase C signaling (GO:0070528)|protein phosphorylation (GO:0006468)|regulation of tight junction assembly (GO:2000810)|signal transduction (GO:0007165)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-independent protein kinase C activity (GO:0004699)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)	p.H551H(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(4)|ovary(2)|pancreas(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	25				OV - Ovarian serous cystadenocarcinoma(108;0.045)|BRCA - Breast invasive adenocarcinoma(234;0.0906)|KIRC - Kidney renal clear cell carcinoma(182;0.182)		TCTGTGGTCACGCGCCTTTTG	0.552																																					p.H551H	Melanoma(135;863 1779 8064 14443 26348)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1653T	14						.						227.0	182.0	197.0					14																	61997205		2203	4300	6503	61066958	SO:0001819	synonymous_variant	5583	exon12			M55284	CCDS9752.1	14q23.1	2009-07-10			ENSG00000027075	ENSG00000027075	2.7.11.1		9403	protein-coding gene	gene with protein product		605437		PRKCL		1986216, 1545821	Standard	NM_006255		Approved	PKC-L, PKCL	uc001xfn.3	P24723	OTTHUMG00000152341	ENST00000332981.5:c.1653C>T	14.37:g.61997205C>T			61066958	NM_006255	B4DJN5|Q16246|Q8NE03	Silent	SNP	ENST00000332981.5	37	CCDS9752.1	.	.	.	.	.	.	.	.	.	.	C	0.904	-0.721293	0.03182	.	.	ENSG00000258989	ENST00000556347	.	.	.	5.63	-8.41	0.00961	.	.	.	.	.	T	0.65375	0.2685	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.71826	-0.4475	4	.	.	.	.	18.6888	0.91576	0.0:0.2196:0.0:0.7804	.	.	.	.	M	56	.	.	T	+	2	0	RP11-47I22.4	61066958	0.000000	0.05858	0.147000	0.22382	0.201000	0.24016	-4.501000	0.00224	-1.614000	0.01575	-0.808000	0.03180	ACG		0.552	PRKCH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276974.2	NM_006255	
TMED10	10972	broad.mit.edu	37	14	75601626	75601626	+	Frame_Shift_Del	DEL	G	G	-			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	G	G	G	-	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr14:75601626delG	ENST00000303575.4	-	5	673	c.622delC	c.(622-624)ctgfs	p.L208fs	TMED10_ENST00000557670.1_5'UTR|RP11-950C14.7_ENST00000556236.1_RNA	NM_006827.5	NP_006818.3	P49755	TMEDA_HUMAN	transmembrane emp24-like trafficking protein 10 (yeast)	208	Interaction with ARF1.|Interaction with COPG1.				beta-amyloid formation (GO:0034205)|cargo loading into vesicle (GO:0035459)|COPI coating of Golgi vesicle (GO:0048205)|COPI-coated vesicle budding (GO:0035964)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|Golgi organization (GO:0007030)|intracellular protein transport (GO:0006886)|kidney development (GO:0001822)|protein oligomerization (GO:0051259)|regulated secretory pathway (GO:0045055)|response to acid chemical (GO:0001101)|response to alkaloid (GO:0043279)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle targeting, to, from or within Golgi (GO:0048199)	cis-Golgi network (GO:0005801)|COPI-coated vesicle (GO:0030137)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|gamma-secretase complex (GO:0070765)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|secretory granule membrane (GO:0030667)|trans-Golgi network transport vesicle (GO:0030140)|zymogen granule membrane (GO:0042589)	syntaxin binding (GO:0019905)	p.L208fs*10(1)		endometrium(1)|large_intestine(5)|lung(3)	9				BRCA - Breast invasive adenocarcinoma(234;0.0126)		AAGCGTCGCAGGTAGAAGACC	0.453																																					p.L208fs												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.622delC	14						.						101.0	97.0	98.0					14																	75601626		2203	4300	6503	74671379	SO:0001589	frameshift_variant	10972	exon5			AL832012, X97442	CCDS9840.1	14q24.3	2008-08-11			ENSG00000170348	ENSG00000170348			16998	protein-coding gene	gene with protein product		605406				7596406, 8663407	Standard	NM_006827		Approved	TMP21, P24(DELTA)	uc001xrm.1	P49755		ENST00000303575.4:c.622delC	14.37:g.75601626delG	ENSP00000303145:p.Leu208fs		74671379	NM_006827	B2R605|Q15602|Q16536|Q86TC2|Q86TS5	Frame_Shift_Del	DEL	ENST00000303575.4	37	CCDS9840.1																																																																																				0.453	TMED10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415034.1	NM_006827	
TMED10	10972	broad.mit.edu	37	14	75601629	75601630	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	AG	AG					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr14:75601629_75601630delAG	ENST00000303575.4	-	5	669_670	c.618_619delCT	c.(616-621)ttctacfs	p.FY206fs	TMED10_ENST00000557670.1_5'UTR|RP11-950C14.7_ENST00000556236.1_RNA	NM_006827.5	NP_006818.3	P49755	TMEDA_HUMAN	transmembrane emp24-like trafficking protein 10 (yeast)	206	Interaction with COPG1.				beta-amyloid formation (GO:0034205)|cargo loading into vesicle (GO:0035459)|COPI coating of Golgi vesicle (GO:0048205)|COPI-coated vesicle budding (GO:0035964)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|Golgi organization (GO:0007030)|intracellular protein transport (GO:0006886)|kidney development (GO:0001822)|protein oligomerization (GO:0051259)|regulated secretory pathway (GO:0045055)|response to acid chemical (GO:0001101)|response to alkaloid (GO:0043279)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle targeting, to, from or within Golgi (GO:0048199)	cis-Golgi network (GO:0005801)|COPI-coated vesicle (GO:0030137)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|gamma-secretase complex (GO:0070765)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|secretory granule membrane (GO:0030667)|trans-Golgi network transport vesicle (GO:0030140)|zymogen granule membrane (GO:0042589)	syntaxin binding (GO:0019905)	p.F206fs*13(1)		endometrium(1)|large_intestine(5)|lung(3)	9				BRCA - Breast invasive adenocarcinoma(234;0.0126)		CGTCGCAGGTAGAAGACCTGCC	0.446																																					p.206_207del												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.618_619del	14						.																																			74671383	SO:0001589	frameshift_variant	10972	exon5			AL832012, X97442	CCDS9840.1	14q24.3	2008-08-11			ENSG00000170348	ENSG00000170348			16998	protein-coding gene	gene with protein product		605406				7596406, 8663407	Standard	NM_006827		Approved	TMP21, P24(DELTA)	uc001xrm.1	P49755		ENST00000303575.4:c.618_619delCT	14.37:g.75601629_75601630delAG	ENSP00000303145:p.Phe206fs		74671382	NM_006827	B2R605|Q15602|Q16536|Q86TC2|Q86TS5	Frame_Shift_Del	DEL	ENST00000303575.4	37	CCDS9840.1																																																																																				0.446	TMED10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415034.1	NM_006827	
ATG2B	55102	broad.mit.edu	37	14	96769547	96769547	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr14:96769547C>T	ENST00000359933.4	-	33	5781	c.4888G>A	c.(4888-4890)Gat>Aat	p.D1630N	ATG2B_ENST00000261834.5_5'UTR	NM_018036.5	NP_060506	Q96BY7	ATG2B_HUMAN	autophagy related 2B	1630					autophagic vacuole assembly (GO:0000045)|cellular response to nitrogen starvation (GO:0006995)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)	extrinsic component of membrane (GO:0019898)|lipid particle (GO:0005811)|pre-autophagosomal structure (GO:0000407)		p.D1630N(1)		breast(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(11)|liver(1)|lung(26)|ovary(1)|prostate(1)|skin(1)|urinary_tract(7)	64		all_cancers(154;0.0462)|all_epithelial(191;0.123)|Melanoma(154;0.155)		Epithelial(152;0.21)|COAD - Colon adenocarcinoma(157;0.244)		AGGCTGGAATCACAATCAGGT	0.428																																					p.D1630N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4888A	14						.						89.0	90.0	89.0					14																	96769547		2203	4300	6503	95839300	SO:0001583	missense	55102	exon33			AK001104	CCDS9944.2	14q32.31	2014-02-12	2012-06-06	2007-07-31	ENSG00000066739	ENSG00000066739			20187	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 103"", ""ATG2 autophagy related 2 homolog B (S. cerevisiae)"""	C14orf103		22350415	Standard	NM_018036		Approved	FLJ10242	uc001yfi.3	Q96BY7	OTTHUMG00000149933	ENST00000359933.4:c.4888G>A	14.37:g.96769547C>T	ENSP00000353010:p.Asp1630Asn		95839300	NM_018036	Q6ZRE7|Q96DQ3|Q9NW80	Missense_Mutation	SNP	ENST00000359933.4	37	CCDS9944.2	.	.	.	.	.	.	.	.	.	.	C	12.48	1.950197	0.34377	.	.	ENSG00000066739	ENST00000359933	T	0.10668	2.85	5.74	2.98	0.34508	.	1.180830	0.05551	N	0.567478	T	0.09555	0.0235	N	0.19112	0.55	0.09310	N	1	B	0.12630	0.006	B	0.14023	0.01	T	0.41466	-0.9507	10	0.34782	T	0.22	.	11.2991	0.49295	0.0:0.8045:0.0:0.1955	.	1630	Q96BY7	ATG2B_HUMAN	N	1630	ENSP00000353010:D1630N	ENSP00000261834:D274N	D	-	1	0	ATG2B	95839300	0.011000	0.17503	0.000000	0.03702	0.656000	0.38851	1.246000	0.32803	0.463000	0.27118	0.563000	0.77884	GAT		0.428	ATG2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314037.1	NM_018036	
EML1	2009	broad.mit.edu	37	14	100405582	100405582	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr14:100405582G>A	ENST00000262233.6	+	21	2379	c.2240G>A	c.(2239-2241)cGg>cAg	p.R747Q	EML1_ENST00000334192.4_Missense_Mutation_p.R766Q|EML1_ENST00000327921.9_Missense_Mutation_p.R735Q	NM_004434.2	NP_004425.2	O00423	EMAL1_HUMAN	echinoderm microtubule associated protein like 1	747	Tandem atypical propeller in EMLs.				brain development (GO:0007420)|hematopoietic progenitor cell differentiation (GO:0002244)|microtubule cytoskeleton organization (GO:0000226)|mitotic spindle organization (GO:0007052)|neuroblast proliferation (GO:0007405)	cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	calcium ion binding (GO:0005509)|microtubule binding (GO:0008017)|tubulin binding (GO:0015631)	p.R766Q(1)		breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	42		Melanoma(154;0.0879)|all_epithelial(191;0.216)				GCCGTCTGTCGGGCCCATGAG	0.552																																					p.R766Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2297A	14						.						125.0	112.0	116.0					14																	100405582		2203	4300	6503	99475335	SO:0001583	missense	2009	exon22			AK023861	CCDS32154.1, CCDS32155.1	14q32	2013-01-10		2002-02-15		ENSG00000066629		"""WD repeat domain containing"""	3330	protein-coding gene	gene with protein product		602033		EMAPL		9226380, 10521658	Standard	XM_005267397		Approved	EMAP, HuEMAP, ELP79	uc001ygr.3	O00423		ENST00000262233.6:c.2240G>A	14.37:g.100405582G>A	ENSP00000262233:p.Arg747Gln		99475335	NM_001008707	Q86U15|Q8N536|Q8N5C4|Q8WWL6	Missense_Mutation	SNP	ENST00000262233.6	37	CCDS32155.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.117755	0.77323	.	.	ENSG00000066629	ENST00000327921;ENST00000262233;ENST00000334192;ENST00000542138	T;T;T	0.17854	2.25;2.25;2.25	4.56	4.56	0.56223	.	0.051684	0.64402	D	0.000001	T	0.47710	0.1460	M	0.90082	3.085	0.80722	D	1	P;D;D	0.71674	0.926;0.998;0.959	B;P;B	0.61397	0.388;0.888;0.293	T	0.62205	-0.6903	10	0.87932	D	0	-22.3911	17.6609	0.88193	0.0:0.0:1.0:0.0	.	735;747;766	F8W717;O00423;O00423-3	.;EMAL1_HUMAN;.	Q	735;747;766;766	ENSP00000327384:R735Q;ENSP00000262233:R747Q;ENSP00000334314:R766Q	ENSP00000262233:R747Q	R	+	2	0	EML1	99475335	1.000000	0.71417	0.997000	0.53966	0.556000	0.35491	7.627000	0.83176	2.240000	0.73641	0.561000	0.74099	CGG		0.552	EML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413943.1	NM_001008707	
TRAF3	7187	broad.mit.edu	37	14	103342695	103342695	+	Splice_Site	SNP	G	G	A			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr14:103342695G>A	ENST00000560371.1	+	5	620	c.403G>A	c.(403-405)Gtg>Atg	p.V135M	TRAF3_ENST00000351691.5_Splice_Site_p.V135M|TRAF3_ENST00000539721.1_Splice_Site_p.V135M|TRAF3_ENST00000347662.4_Splice_Site_p.V135M|TRAF3_ENST00000392745.2_Splice_Site_p.V135M	NM_003300.3|NM_145725.2	NP_003291.2|NP_663777.1	Q13114	TRAF3_HUMAN	TNF receptor-associated factor 3	135					apoptotic process (GO:0006915)|innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)|regulation of apoptotic process (GO:0042981)|regulation of cytokine production (GO:0001817)|regulation of defense response to virus (GO:0050688)|regulation of interferon-beta production (GO:0032648)|regulation of proteolysis (GO:0030162)|signal transduction (GO:0007165)|Toll signaling pathway (GO:0008063)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	CD40 receptor complex (GO:0035631)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|endosome (GO:0005768)|mitochondrion (GO:0005739)	ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|thioesterase binding (GO:0031996)|tumor necrosis factor receptor binding (GO:0005164)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.V135M(1)		breast(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(10)|liver(2)|lung(7)|ovary(1)|prostate(2)	30		all_cancers(154;7.87e-06)|all_epithelial(191;0.0024)		Epithelial(152;9.92e-24)|all cancers(159;2.23e-21)|OV - Ovarian serous cystadenocarcinoma(161;7.85e-12)|Colorectal(3;0.0971)		TGTCTTACAGGTGCATTTAAA	0.378																																					p.V135M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G403A	14						.						80.0	79.0	79.0					14																	103342695		2203	4300	6503	102412448	SO:0001630	splice_region_variant	7187	exon6			U21092	CCDS9975.1, CCDS9976.1, CCDS55946.1	14q32.32	2014-09-17				ENSG00000131323			12033	protein-coding gene	gene with protein product		601896				7530216, 7859281	Standard	NM_145725		Approved	CAP-1, CD40bp, CRAF1, LAP1	uc001ymd.2	Q13114		ENST00000560371.1:c.403-1G>A	14.37:g.103342695G>A			102412448	NM_145725	B7Z8C4|Q12990|Q13076|Q13947|Q6AZX1|Q9UNL1	Missense_Mutation	SNP	ENST00000560371.1	37	CCDS9975.1	.	.	.	.	.	.	.	.	.	.	G	14.20	2.465396	0.43839	.	.	ENSG00000131323	ENST00000392745;ENST00000347662;ENST00000351691;ENST00000539721	T;T;T;T	0.25749	1.78;1.78;1.78;1.78	5.68	5.68	0.88126	Zinc finger, TRAF-type (1);TRAF-like (1);Seven In Absentia Homolog-type (1);	0.233421	0.45867	D	0.000337	T	0.13286	0.0322	N	0.14661	0.345	0.33505	D	0.590431	B;B;B	0.09022	0.002;0.001;0.002	B;B;B	0.09377	0.004;0.004;0.004	T	0.20240	-1.0281	9	.	.	.	-38.7074	7.7535	0.28911	0.1916:0.0:0.8084:0.0	.	135;135;135	Q13114-2;A6NHG8;Q13114	.;.;TRAF3_HUMAN	M	135	ENSP00000376500:V135M;ENSP00000328003:V135M;ENSP00000332468:V135M;ENSP00000445998:V135M	.	V	+	1	0	TRAF3	102412448	1.000000	0.71417	1.000000	0.80357	0.905000	0.53344	2.387000	0.44389	2.835000	0.97688	0.650000	0.86243	GTG		0.378	TRAF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415735.1	NM_145725	Missense_Mutation
IQCH	64799	broad.mit.edu	37	15	67687771	67687771	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr15:67687771A>G	ENST00000335894.4	+	13	1841	c.1775A>G	c.(1774-1776)gAc>gGc	p.D592G	IQCH_ENST00000358767.3_Intron|IQCH_ENST00000360277.4_Intron|IQCH_ENST00000546225.1_Intron	NM_001031715.2	NP_001026885	Q86VS3	IQCH_HUMAN	IQ motif containing H	592								p.D592G(1)		NS(1)|breast(1)|cervix(1)|endometrium(2)|large_intestine(9)|lung(9)|ovary(2)|pancreas(2)|skin(5)|upper_aerodigestive_tract(1)	33				Colorectal(3;0.0856)		GATATGTTAGACATACCCATC	0.473																																					p.D592G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1775G	15						.						134.0	124.0	127.0					15																	67687771		2201	4299	6500	65474825	SO:0001583	missense	64799	exon13			AY014282	CCDS10223.1, CCDS32273.1, CCDS10223.2, CCDS61680.1, CCDS61681.1	15q23	2005-10-24			ENSG00000103599	ENSG00000103599			25721	protein-coding gene	gene with protein product		612523				12477932	Standard	NM_022784		Approved	FLJ12476	uc002aqo.2	Q86VS3	OTTHUMG00000133231	ENST00000335894.4:c.1775A>G	15.37:g.67687771A>G	ENSP00000336861:p.Asp592Gly		65474825	NM_001031715	A8K8W3|C9JPR6|D6RJ88|Q4G0S6|Q8NEH9|Q9BWX2|Q9H9Y1|Q9UF88	Missense_Mutation	SNP	ENST00000335894.4	37	CCDS32273.1	.	.	.	.	.	.	.	.	.	.	A	5.048	0.194498	0.09599	.	.	ENSG00000103599	ENST00000335894	T	0.43688	0.94	6.17	5.05	0.67936	.	0.764469	0.13052	N	0.417595	T	0.33789	0.0875	L	0.32530	0.975	0.28283	N	0.923887	B	0.09022	0.002	B	0.15052	0.012	T	0.20840	-1.0263	10	0.26408	T	0.33	-3.91	12.4477	0.55659	0.935:0.0:0.065:0.0	.	592	Q86VS3	IQCH_HUMAN	G	592	ENSP00000336861:D592G	ENSP00000336861:D592G	D	+	2	0	IQCH	65474825	0.095000	0.21747	0.001000	0.08648	0.138000	0.21146	3.516000	0.53436	1.146000	0.42352	0.533000	0.62120	GAC		0.473	IQCH-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256969.1	NM_022784	
AKAP13	11214	broad.mit.edu	37	15	86124044	86124044	+	Silent	SNP	G	G	C	rs143505118	byFrequency	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr15:86124044G>C	ENST00000394518.2	+	7	2840	c.2745G>C	c.(2743-2745)ctG>ctC	p.L915L	RP11-815J21.2_ENST00000561409.1_RNA|AKAP13_ENST00000361243.2_Silent_p.L915L	NM_001270546.1|NM_007200.4	NP_001257475.1|NP_009131.2	Q12802	AKP13_HUMAN	A kinase (PRKA) anchor protein 13	915					apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nuclear export (GO:0051168)|positive regulation of apoptotic process (GO:0043065)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle hypertrophy (GO:0010611)|regulation of glucocorticoid mediated signaling pathway (GO:1900169)|regulation of protein kinase activity (GO:0045859)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	cAMP-dependent protein kinase activity (GO:0004691)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)	p.L915L(1)		NS(1)|breast(2)|central_nervous_system(4)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(13)|liver(1)|lung(43)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	98						GAAAACTTCTGGTGGTTTCAG	0.443													G|||	7	0.00139776	0.0	0.0101	5008	,	,		21629	0.0		0.0	False		,,,				2504	0.0				p.L915L	Melanoma(94;603 1453 3280 32295 32951)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2745C	15						.	G	,	4,4400	6.2+/-15.9	0,4,2198	65.0	69.0	67.0		2745,2745	-0.3	0.0	15	dbSNP_134	67	2,8596	2.2+/-6.3	0,2,4297	no	coding-synonymous,coding-synonymous	AKAP13	NM_006738.4,NM_007200.3	,	0,6,6495	CC,CG,GG		0.0233,0.0908,0.0461	,	915/2818,915/2814	86124044	6,12996	2202	4299	6501	83925048	SO:0001819	synonymous_variant	11214	exon7			M90360	CCDS32319.1, CCDS32320.1, CCDS73778.1	15q24-q25	2013-01-10	2002-06-13			ENSG00000170776		"""A-kinase anchor proteins"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	371	protein-coding gene	gene with protein product		604686	"""lymphoid blast crisis oncogene"""	LBC		9627117, 1860836	Standard	NM_007200		Approved	Ht31, BRX, AKAP-Lbc, c-lbc, PROTO-LB, HA-3, ARHGEF13	uc002blu.2	Q12802		ENST00000394518.2:c.2745G>C	15.37:g.86124044G>C			83925048	NM_006738	Q14572|Q59FP6|Q86W90|Q8WXQ6|Q96JP6|Q96P79|Q9Y5T0|Q9Y5T6	Silent	SNP	ENST00000394518.2	37	CCDS32319.1																																																																																				0.443	AKAP13-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417318.1	NM_007200	
MAN2A2	4122	broad.mit.edu	37	15	91448538	91448539	+	Missense_Mutation	DNP	AA	AA	CC			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	AA	AA					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr15:91448538_91448539AA>CC	ENST00000559717.1	+	3	649_650	c.190_191AA>CC	c.(190-192)AAc>CCc	p.N64P	MAN2A2_ENST00000360468.3_Missense_Mutation_p.N64P|MAN2A2_ENST00000431652.2_5'Flank			P49641	MA2A2_HUMAN	mannosidase, alpha, class 2A, member 2	64					cellular protein metabolic process (GO:0044267)|mannose metabolic process (GO:0006013)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|hydrolase activity, hydrolyzing N-glycosyl compounds (GO:0016799)|mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase activity (GO:0004572)|zinc ion binding (GO:0008270)	p.N64>?(1)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|lung(13)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.229)			TTTGGAGGAGAACCATGAGATT	0.545																																					.												.	.	1	Complex(1)	large_intestine(1)	c.190_191CC	15						.																																			89249543	SO:0001583	missense	4122	exon2			L28821	CCDS32332.1	15q25	2011-06-30			ENSG00000196547	ENSG00000196547			6825	protein-coding gene	gene with protein product		600988				8524845	Standard	NM_006122		Approved	MANA2X, HsT19662	uc002bqc.3	P49641		Exception_encountered	15.37:g.91448538_91448539delinsCC	ENSP00000452948:p.Asn64Pro		89249542	NM_006122	A6NH12|A8K1E8|Q13754	Missense_Mutation	DNP	ENST00000559717.1	37	CCDS32332.1																																																																																				0.545	MAN2A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418246.5	NM_006122	
MYH11	4629	broad.mit.edu	37	16	15917267	15917267	+	Splice_Site	SNP	G	G	A			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr16:15917267G>A	ENST00000300036.5	-	3	456	c.347C>T	c.(346-348)aCg>aTg	p.T116M	MYH11_ENST00000576790.2_Splice_Site_p.T116M|MYH11_ENST00000452625.2_Splice_Site_p.T116M|MYH11_ENST00000396324.3_Splice_Site_p.T116M	NM_002474.2	NP_002465.1	P35749	MYH11_HUMAN	myosin, heavy chain 11, smooth muscle	116	Myosin motor.				axon guidance (GO:0007411)|cardiac muscle fiber development (GO:0048739)|elastic fiber assembly (GO:0048251)|muscle contraction (GO:0006936)|skeletal muscle myosin thick filament assembly (GO:0030241)|smooth muscle contraction (GO:0006939)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|smooth muscle contractile fiber (GO:0030485)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)	p.T116M(2)		NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(34)|liver(1)|lung(37)|ovary(9)|pancreas(1)|prostate(7)|skin(7)|upper_aerodigestive_tract(1)	123						GCCAGAGTACGTCTGCAGACA	0.512			T	CBFB	AML																																p.T116M			Dom	yes		16	16p13.13-p13.12	4629	"""myosin, heavy polypeptide 11, smooth muscle"""		L	.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C347T	16						.						138.0	112.0	121.0					16																	15917267		2197	4300	6497	15824768	SO:0001630	splice_region_variant	4629	exon3			X69292	CCDS10565.1, CCDS10566.1, CCDS45423.1, CCDS45424.1	16p13.11	2011-09-27	2006-09-29		ENSG00000133392	ENSG00000133392		"""Myosins / Myosin superfamily : Class II"""	7569	protein-coding gene	gene with protein product		160745	"""myosin, heavy polypeptide 11, smooth muscle"""			7684189	Standard	NM_001040113		Approved	SMMHC, SMHC	uc002ddx.3	P35749	OTTHUMG00000129935	ENST00000300036.5:c.346-1C>T	16.37:g.15917267G>A			15824768	NM_001040114	D2JYH7|O00396|O94944|P78422|Q3MIV8|Q3MNF0|Q3MNF1	De_novo_Start_OutOfFrame	SNP	ENST00000300036.5	37	CCDS10565.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.294417	0.81025	.	.	ENSG00000133392	ENST00000300036;ENST00000338282;ENST00000396320;ENST00000396324;ENST00000452625	D;D;D;D	0.82984	-1.67;-1.67;-1.67;-1.67	5.58	5.58	0.84498	Myosin head, motor domain (3);	0.000000	0.85682	D	0.000000	D	0.96084	0.8724	H	0.99931	4.975	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.992;0.992;0.992;0.992	D	0.98281	1.0508	10	0.87932	D	0	.	18.557	0.91089	0.0:0.0:1.0:0.0	.	116;116;116;116;116	Q4G140;P35749;Q3MNF1;Q3MIV8;Q3MNF0	.;MYH11_HUMAN;.;.;.	M	116	ENSP00000300036:T116M;ENSP00000345136:T116M;ENSP00000379616:T116M;ENSP00000407821:T116M	ENSP00000300036:T116M	T	-	2	0	MYH11	15824768	1.000000	0.71417	1.000000	0.80357	0.604000	0.37047	9.813000	0.99286	2.626000	0.88956	0.655000	0.94253	ACG		0.512	MYH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252192.2	NM_001040113	Missense_Mutation
SRRM2	23524	broad.mit.edu	37	16	2815262	2815262	+	Missense_Mutation	SNP	G	G	A	rs184005236	byFrequency	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr16:2815262G>A	ENST00000301740.8	+	11	5282	c.4733G>A	c.(4732-4734)cGg>cAg	p.R1578Q		NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	1578	Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)	p.L1573_G1580delLRQRSRSG(1)|p.R1578Q(1)		breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						CAGAGGAGTCGGTCTGGATCA	0.517													G|||	3	0.000599042	0.0008	0.0	5008	,	,		18495	0.002		0.0	False		,,,				2504	0.0				p.R1578Q												.	.	2	Substitution - Missense(1)|Deletion - In frame(1)	large_intestine(1)|lung(1)	c.G4733A	16						.	G	GLN/ARG	0,4396		0,0,2198	78.0	68.0	72.0		4733	-0.9	0.5	16		72	1,8599	1.2+/-3.3	0,1,4299	no	missense	SRRM2	NM_016333.3	43	0,1,6497	AA,AG,GG		0.0116,0.0,0.0077	benign	1578/2753	2815262	1,12995	2198	4300	6498	2755263	SO:0001583	missense	23524	exon11			AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.4733G>A	16.37:g.2815262G>A	ENSP00000301740:p.Arg1578Gln		2755263	NM_016333	A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Missense_Mutation	SNP	ENST00000301740.8	37	CCDS32373.1	2	9.157509157509158E-4	0	0.0	0	0.0	2	0.0034965034965034965	0	0.0	G	9.598	1.127849	0.20959	0.0	1.16E-4	ENSG00000167978	ENST00000301740;ENST00000382301;ENST00000544933	T	0.25250	1.81	5.38	-0.849	0.10723	.	0.428231	0.22176	N	0.063562	T	0.17365	0.0417	L	0.46157	1.445	0.22066	N	0.999385	B	0.31519	0.327	B	0.20767	0.031	T	0.08513	-1.0718	10	0.44086	T	0.13	1.1459	9.2851	0.37753	0.4535:0.0:0.5465:0.0	.	1578	Q9UQ35	SRRM2_HUMAN	Q	1578;1578;830	ENSP00000301740:R1578Q	ENSP00000301740:R1578Q	R	+	2	0	SRRM2	2755263	0.570000	0.26651	0.513000	0.27749	0.995000	0.86356	1.109000	0.31135	-0.421000	0.07416	0.655000	0.94253	CGG		0.517	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436411.1		
IQCK	124152	broad.mit.edu	37	16	19838379	19838379	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr16:19838379G>A	ENST00000320394.6	+	9	1421	c.722G>A	c.(721-723)cGt>cAt	p.R241H	IQCK_ENST00000562762.1_3'UTR|IQCK_ENST00000541926.1_Missense_Mutation_p.V213I|IQCK_ENST00000564186.1_Missense_Mutation_p.R241H|IQCK_ENST00000433597.2_Missense_Mutation_p.R153H	NM_153208.1	NP_694940.1	Q8N0W5	IQCK_HUMAN	IQ motif containing K	241								p.R241H(1)		kidney(1)|large_intestine(2)|lung(2)|skin(1)	6						CAAGAACTGCGTCAGTGGCAG	0.448																																					p.R241H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G722A	16						.						125.0	120.0	122.0					16																	19838379		2197	4300	6497	19745880	SO:0001583	missense	124152	exon9			AF520569	CCDS10580.1	16p12.3	2008-02-05			ENSG00000174628	ENSG00000174628			28556	protein-coding gene	gene with protein product						10493829	Standard	NM_153208		Approved	MGC35048, FLJ36575	uc002dgr.3	Q8N0W5	OTTHUMG00000131453	ENST00000320394.6:c.722G>A	16.37:g.19838379G>A	ENSP00000324901:p.Arg241His		19745880	NM_153208	B2RDU0|O43327|Q8NFF4	Missense_Mutation	SNP	ENST00000320394.6	37	CCDS10580.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.00|16.00	2.998595|2.998595	0.54147|0.54147	.|.	.|.	ENSG00000174628|ENSG00000174628	ENST00000320394;ENST00000433597|ENST00000541926	T;T|.	0.23950|.	1.88;1.88|.	5.73|5.73	5.73|5.73	0.89815|0.89815	.|.	0.000000|.	0.56097|.	D|.	0.000039|.	T|T	0.71358|0.71358	0.3330|0.3330	M|M	0.75777|0.75777	2.31|2.31	0.46564|0.46564	D|D	0.999104|0.999104	D|D	0.89917|0.59767	1.0|0.986	D|P	0.91635|0.50082	0.999|0.63	T|T	0.72494|0.72494	-0.4276|-0.4276	9|7	.|.	.|.	.|.	-15.2706|-15.2706	17.7591|17.7591	0.88459|0.88459	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	241|213	Q8N0W5|B4DXE1	IQCK_HUMAN|.	H|I	241;153|213	ENSP00000324901:R241H;ENSP00000406013:R153H|.	.|.	R|V	+|+	2|1	0|0	IQCK|IQCK	19745880|19745880	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.972000|0.972000	0.66771|0.66771	6.311000|6.311000	0.72835|0.72835	2.854000|2.854000	0.98071|0.98071	0.655000|0.655000	0.94253|0.94253	CGT|GTC		0.448	IQCK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254273.2	NM_153208	
ALG1	56052	broad.mit.edu	37	16	5125440	5125440	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr16:5125440T>G	ENST00000262374.5	+	4	473	c.442T>G	c.(442-444)Tgt>Ggt	p.C148G	ALG1_ENST00000544428.1_Missense_Mutation_p.C37G|ALG1_ENST00000588623.1_Missense_Mutation_p.C37G	NM_019109.4	NP_061982.3	Q9BT22	ALG1_HUMAN	ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase	148					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|lipopolysaccharide biosynthetic process (GO:0009103)|mannosylation (GO:0097502)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	chitobiosyldiphosphodolichol beta-mannosyltransferase activity (GO:0004578)|mannosyltransferase activity (GO:0000030)	p.C148G(1)		breast(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13		Ovarian(90;0.0164)				GGGCTGCCTTTGTGGAAGCAA	0.562																																					p.C148G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T442G	16						.						195.0	165.0	175.0					16																	5125440		2197	4300	6497	5065441	SO:0001583	missense	56052	exon4			AB019038	CCDS10528.1	16p13.3	2013-02-22	2013-02-22		ENSG00000033011	ENSG00000033011	2.4.1.142	"""Glycosyltransferase group 1 domain containing"""	18294	protein-coding gene	gene with protein product		605907	"""asparagine-linked glycosylation 1 homolog (yeast, beta-1,4-mannosyltransferase)"", ""asparagine-linked glycosylation 1, beta-1,4-mannosyltransferase homolog (S. cerevisiae)"""			10704531	Standard	NM_019109		Approved	HMT-1, HMAT1	uc002cym.3	Q9BT22	OTTHUMG00000129529	ENST00000262374.5:c.442T>G	16.37:g.5125440T>G	ENSP00000262374:p.Cys148Gly		5065441	NM_019109	B4DP08|Q6UVZ9|Q8N5Y4|Q9P2Y2	Missense_Mutation	SNP	ENST00000262374.5	37	CCDS10528.1	.	.	.	.	.	.	.	.	.	.	T	11.63	1.695928	0.30052	.	.	ENSG00000033011	ENST00000262374;ENST00000544428	D;D	0.81996	-1.56;-1.56	5.74	3.43	0.39272	.	0.308479	0.36101	N	0.002795	T	0.71962	0.3402	L	0.47716	1.5	0.35567	D	0.805187	B;B	0.26195	0.144;0.121	B;B	0.25987	0.065;0.059	T	0.66337	-0.5949	10	0.26408	T	0.33	-3.0578	2.506	0.04645	0.1998:0.238:0.0:0.5622	.	37;148	B4DP08;Q9BT22	.;ALG1_HUMAN	G	148;37	ENSP00000262374:C148G;ENSP00000440019:C37G	ENSP00000262374:C148G	C	+	1	0	ALG1	5065441	0.734000	0.28142	0.996000	0.52242	0.996000	0.88848	0.950000	0.29122	1.005000	0.39183	0.528000	0.53228	TGT		0.562	ALG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251716.2	NM_019109	
LONP2	83752	broad.mit.edu	37	16	48311297	48311297	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr16:48311297G>T	ENST00000285737.4	+	8	1383	c.1290G>T	c.(1288-1290)aaG>aaT	p.K430N	LONP2_ENST00000535754.1_Missense_Mutation_p.K386N	NM_031490.2	NP_113678.2			lon peptidase 2, peroxisomal									p.K430N(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31						ACGGCTTGAAGACTGTGGGAG	0.502																																					p.K430N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1290T	16						.						120.0	108.0	112.0					16																	48311297		2200	4300	6500	46868798	SO:0001583	missense	83752	exon8			AJ548761	CCDS10734.1, CCDS73880.1	16q12.1	2010-04-21			ENSG00000102910	ENSG00000102910		"""ATPases / AAA-type"""	20598	protein-coding gene	gene with protein product						14561759	Standard	XM_005256191		Approved	MGC4840, LONP, LONPL	uc002efi.1	Q86WA8	OTTHUMG00000133144	ENST00000285737.4:c.1290G>T	16.37:g.48311297G>T	ENSP00000285737:p.Lys430Asn		46868798	NM_031490		Missense_Mutation	SNP	ENST00000285737.4	37	CCDS10734.1	.	.	.	.	.	.	.	.	.	.	G	26.1	4.701644	0.88924	.	.	ENSG00000102910	ENST00000285737;ENST00000544734;ENST00000535754;ENST00000416006	D;D;D	0.93488	-3.23;-3.23;-3.23	5.81	5.81	0.92471	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	D	0.97247	0.9100	M	0.88512	2.96	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.69142	0.947;0.962	D	0.96987	0.9719	10	0.54805	T	0.06	-25.1234	20.0762	0.97745	0.0:0.0:1.0:0.0	.	386;430	B7ZKL7;Q86WA8	.;LONP2_HUMAN	N	430;159;386;386	ENSP00000285737:K430N;ENSP00000445426:K386N;ENSP00000415983:K386N	ENSP00000285737:K430N	K	+	3	2	LONP2	46868798	1.000000	0.71417	1.000000	0.80357	0.687000	0.40016	5.749000	0.68704	2.756000	0.94617	0.655000	0.94253	AAG		0.502	LONP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256839.2	NM_031490	
ARL2BP	23568	broad.mit.edu	37	16	57286134	57286134	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr16:57286134C>A	ENST00000219204.3	+	6	717	c.447C>A	c.(445-447)tgC>tgA	p.C149*	ARL2BP_ENST00000562023.1_Nonsense_Mutation_p.C109*|RP11-407G23.3_ENST00000564376.1_RNA	NM_012106.3	NP_036238.1	Q9Y2Y0	AR2BP_HUMAN	ADP-ribosylation factor-like 2 binding protein	149					maintenance of protein location in nucleus (GO:0051457)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|regulation of catalytic activity (GO:0050790)|regulation of RNA biosynthetic process (GO:2001141)|signal transduction (GO:0007165)	centrosome (GO:0005813)|cilium (GO:0005929)|midbody (GO:0030496)|mitochondrial intermembrane space (GO:0005758)|nucleus (GO:0005634)	small GTPase regulator activity (GO:0005083)|transcription coactivator activity (GO:0003713)	p.C149*(1)|p.C149W(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(4)|urinary_tract(1)	12						CTTCATTGTGCAAATCATCTT	0.488																																					p.C149X												.	.	2	Substitution - Missense(1)|Substitution - Nonsense(1)	large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)	c.C447A	16						.						145.0	116.0	126.0					16																	57286134		2198	4300	6498	55843635	SO:0001587	stop_gained	23568	exon6			AF126062	CCDS10776.1	16q13	2014-01-30			ENSG00000102931	ENSG00000102931			17146	protein-coding gene	gene with protein product	"""binder of Arl2"""	615407	"""retinitis pigmentosa 66 (autosomal recessive)"""	RP66		10488091, 18981177, 23849777	Standard	NM_012106		Approved	BART1, BART	uc002elf.1	Q9Y2Y0	OTTHUMG00000133459	ENST00000219204.3:c.447C>A	16.37:g.57286134C>A	ENSP00000219204:p.Cys149*		55843635	NM_012106	B3KQJ5|Q504R0	Nonsense_Mutation	SNP	ENST00000219204.3	37	CCDS10776.1	.	.	.	.	.	.	.	.	.	.	C	22.7	4.329318	0.81690	.	.	ENSG00000102931	ENST00000219204	.	.	.	6.02	2.99	0.34606	.	0.673781	0.13107	U	0.413307	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	-9.4214	8.8503	0.35194	0.0:0.7383:0.1241:0.1377	.	.	.	.	X	149	.	ENSP00000219204:C149X	C	+	3	2	ARL2BP	55843635	1.000000	0.71417	0.993000	0.49108	0.978000	0.69477	2.486000	0.45259	0.414000	0.25790	0.650000	0.86243	TGC		0.488	ARL2BP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257334.2	NM_012106	
CDH16	1014	broad.mit.edu	37	16	66946430	66946430	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr16:66946430C>T	ENST00000299752.4	-	11	1529	c.1336G>A	c.(1336-1338)Gcc>Acc	p.A446T	CDH16_ENST00000565796.1_Missense_Mutation_p.A446T|CDH16_ENST00000394055.3_Missense_Mutation_p.A446T|CDH16_ENST00000568632.1_Missense_Mutation_p.A349T|CDH16_ENST00000570262.1_Missense_Mutation_p.A366T	NM_001204744.1|NM_001204745.1|NM_004062.3	NP_001191673.1|NP_001191674.1|NP_004053.1	O75309	CAD16_HUMAN	cadherin 16, KSP-cadherin	446	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)	p.A446T(1)		endometrium(1)|kidney(3)|large_intestine(10)|lung(15)|ovary(2)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	41		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0877)|Epithelial(162;0.203)		AACTCAGGGGCGTGATCATTG	0.577																																					p.A446T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1336A	16						.						137.0	123.0	128.0					16																	66946430		2200	4300	6500	65503931	SO:0001583	missense	1014	exon11			AF016272	CCDS10823.1, CCDS56002.1, CCDS58471.1, CCDS58472.1	16q22.1	2010-01-26			ENSG00000166589	ENSG00000166589		"""Cadherins / Major cadherins"""	1755	protein-coding gene	gene with protein product		603118				9721215, 7615566	Standard	NM_004062		Approved		uc002eql.3	O75309	OTTHUMG00000137518	ENST00000299752.4:c.1336G>A	16.37:g.66946430C>T	ENSP00000299752:p.Ala446Thr		65503931	NM_004062	B4DPA8|H3BPD3|Q6UW93	Missense_Mutation	SNP	ENST00000299752.4	37	CCDS10823.1	.	.	.	.	.	.	.	.	.	.	C	13.29	2.192769	0.38707	.	.	ENSG00000166589	ENST00000394055;ENST00000299752;ENST00000544875	T;T	0.61742	0.08;0.08	4.82	4.82	0.62117	Cadherin (3);Cadherin conserved site (1);Cadherin-like (1);	0.131519	0.50627	D	0.000107	T	0.68879	0.3049	M	0.71036	2.16	0.32330	N	0.561231	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.941;0.996;0.914	T	0.66677	-0.5863	10	0.02654	T	1	-17.9328	13.2824	0.60224	0.0:1.0:0.0:0.0	.	446;446;446	O75309-2;B2R7S8;O75309	.;.;CAD16_HUMAN	T	446;446;410	ENSP00000377619:A446T;ENSP00000299752:A446T	ENSP00000299752:A446T	A	-	1	0	CDH16	65503931	0.796000	0.28864	0.999000	0.59377	0.652000	0.38707	1.154000	0.31688	2.526000	0.85167	0.561000	0.74099	GCC		0.577	CDH16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268839.2	NM_004062	
DUS2	54920	broad.mit.edu	37	16	68112733	68112733	+	Silent	SNP	T	T	G			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr16:68112733T>G	ENST00000565263.1	+	17	1820	c.1326T>G	c.(1324-1326)ggT>ggG	p.G442G	DUS2_ENST00000358896.6_Silent_p.G442G|DUS2_ENST00000432752.1_Silent_p.G407G|RP11-67A1.2_ENST00000548144.1_RNA	NM_017803.3	NP_060273.1	Q9NX74	DUS2L_HUMAN	dihydrouridine synthase 2	442					negative regulation of cell death (GO:0060548)|negative regulation of protein kinase activity (GO:0006469)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)	double-stranded RNA binding (GO:0003725)|flavin adenine dinucleotide binding (GO:0050660)|protein kinase inhibitor activity (GO:0004860)|tRNA dihydrouridine synthase activity (GO:0017150)	p.G442G(1)									GTCGGCTGGGTGAGGAGAGCC	0.632																																					p.G442G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1326G	16						.						34.0	39.0	37.0					16																	68112733		2198	4300	6498	66670234	SO:0001819	synonymous_variant	54920	exon17				CCDS10859.1, CCDS61970.1	16q22.1	2013-07-23	2013-07-23	2013-07-23	ENSG00000167264	ENSG00000167264			26014	protein-coding gene	gene with protein product	"""SMM1 homolog (S. cerevisiae)"""	609707	"""dihydrouridine synthase 2-like (SMM1, S. cerevisiae)"", ""dihydrouridine synthase 2-like, SMM1 homolog (S. cerevisiae)"", ""dihydrouridine synthase 2-like"""	DUS2L		15994936, 22741570	Standard	NM_017803		Approved	FLJ20399, SMM1	uc002evj.4	Q9NX74	OTTHUMG00000137538	ENST00000565263.1:c.1326T>G	16.37:g.68112733T>G			66670234	NM_017803	A8K3G3|Q4H4D9	Silent	SNP	ENST00000565263.1	37	CCDS10859.1																																																																																				0.632	DUS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268869.2	NM_017803	
PLA2G15	23659	broad.mit.edu	37	16	68293226	68293227	+	Missense_Mutation	DNP	TC	TC	CA			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	TC	TC					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr16:68293226_68293227TC>CA	ENST00000219345.5	+	6	988_989	c.905_906TC>CA	c.(904-906)aTC>aCA	p.I302T	RP11-96D1.7_ENST00000569843.1_RNA|PLA2G15_ENST00000444212.2_Missense_Mutation_p.I102T|RP11-96D1.7_ENST00000563175.1_RNA|PLA2G15_ENST00000413021.2_Missense_Mutation_p.I208T|PLA2G15_ENST00000566188.1_3'UTR	NM_012320.3	NP_036452.1	Q8NCC3	PAG15_HUMAN	phospholipase A2, group XV	302					ceramide metabolic process (GO:0006672)|fatty acid catabolic process (GO:0009062)|phosphatidylcholine metabolic process (GO:0046470)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|mitochondrion (GO:0005739)	calcium-independent phospholipase A2 activity (GO:0047499)|lysophospholipase activity (GO:0004622)|O-acyltransferase activity (GO:0008374)|phospholipid binding (GO:0005543)	p.I302>?(1)		kidney(2)|large_intestine(2)|lung(2)|ovary(2)|prostate(3)|skin(1)	12						TTCCAGGACATCGGCTTTGAAG	0.574																																					.												.	.	1	Complex(1)	large_intestine(1)	c.905_906CA	16						.																																			66850728	SO:0001583	missense	23659	exon6			AB017494	CCDS10864.1	16q22.1	2008-09-19	2008-09-19	2008-09-19	ENSG00000103066	ENSG00000103066			17163	protein-coding gene	gene with protein product		609362	"""lysophospholipase 3 (lysosomal phospholipase A2)"""	LYPLA3		10092508, 16973413	Standard	XM_005255886		Approved	LLPL, GXVPLA2	uc002evr.3	Q8NCC3	OTTHUMG00000137554	Exception_encountered	16.37:g.68293226_68293227delinsCA	ENSP00000219345:p.Ile302Thr		66850727	NM_012320	B3KMF3|B4DUD1|Q53GZ1|Q9NPQ6|Q9UG04|Q9Y2B3	Missense_Mutation	DNP	ENST00000219345.5	37	CCDS10864.1																																																																																				0.574	PLA2G15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268888.2	NM_012320	
ARHGAP44	9912	broad.mit.edu	37	17	12888092	12888092	+	Silent	SNP	C	C	T			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr17:12888092C>T	ENST00000379672.5	+	20	2484	c.2184C>T	c.(2182-2184)ccC>ccT	p.P728P	ARHGAP44_ENST00000340825.3_Silent_p.P722P|ARHGAP44_ENST00000262444.9_Silent_p.P728P	NM_014859.4	NP_055674.4	Q17R89	RHG44_HUMAN	Rho GTPase activating protein 44	728					exocytosis (GO:0006887)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytosol (GO:0005829)|endosome (GO:0005768)|leading edge membrane (GO:0031256)|synapse (GO:0045202)	GTPase activator activity (GO:0005096)|phospholipid binding (GO:0005543)	p.P728P(1)		NS(2)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(7)|skin(1)|urinary_tract(1)	31						AATCGCGGCCCACTCCTAAGC	0.622																																					p.P728P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2184T	17						.						37.0	40.0	39.0					17																	12888092		1959	4150	6109	12828817	SO:0001819	synonymous_variant	9912	exon20				CCDS45616.1	17p12	2011-06-29			ENSG00000006740	ENSG00000006740		"""Rho GTPase activating proteins"""	29096	protein-coding gene	gene with protein product						19273615	Standard	NM_014859		Approved	KIAA0672, RICH-2, RICH2	uc002gnr.4	Q17R89	OTTHUMG00000058765	ENST00000379672.5:c.2184C>T	17.37:g.12888092C>T			12828817	NM_014859	A6NCP5|A8MQB2|O75160|Q7Z5Z7|Q9Y4Q4	Silent	SNP	ENST00000379672.5	37	CCDS45616.1																																																																																				0.622	ARHGAP44-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000441566.1	NM_014859	
METTL16	79066	broad.mit.edu	37	17	2323345	2323345	+	Silent	SNP	A	A	G			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr17:2323345A>G	ENST00000263092.6	-	10	1735	c.1608T>C	c.(1606-1608)gtT>gtC	p.V536V	METTL16_ENST00000571669.2_5'UTR|METTL16_ENST00000538844.1_Silent_p.V318V	NM_024086.3	NP_076991.3	Q86W50	MET16_HUMAN	methyltransferase like 16	536							methyltransferase activity (GO:0008168)|poly(A) RNA binding (GO:0044822)	p.V536V(1)		kidney(2)|large_intestine(9)|lung(4)|ovary(2)|skin(1)|urinary_tract(1)	19						TCTGGCCCTCAACCCAGTGCA	0.493																																					p.V536V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1608C	17						.						83.0	88.0	87.0					17																	2323345		2063	4204	6267	2270095	SO:0001819	synonymous_variant	79066	exon10			AK027410	CCDS42232.1	17p13.3	2011-03-02	2011-03-02	2011-03-02	ENSG00000127804	ENSG00000127804			28484	protein-coding gene	gene with protein product			"""methyltransferase 10 domain containing"""	METT10D		18021804	Standard	NM_024086		Approved	MGC3329	uc002fut.3	Q86W50		ENST00000263092.6:c.1608T>C	17.37:g.2323345A>G			2270095	NM_024086	D3DTI8|Q86TE5|Q96T16|Q9BVG7	Silent	SNP	ENST00000263092.6	37	CCDS42232.1																																																																																				0.493	METTL16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437653.2	NM_024086	
SPATA22	84690	broad.mit.edu	37	17	3370833	3370833	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr17:3370833G>A	ENST00000573128.1	-	3	542	c.59C>T	c.(58-60)cCg>cTg	p.P20L	SPATA22_ENST00000397168.3_Missense_Mutation_p.P20L|SPATA22_ENST00000575375.1_Missense_Mutation_p.P20L|SPATA22_ENST00000268981.5_Missense_Mutation_p.P20L|SPATA22_ENST00000541913.1_Missense_Mutation_p.P20L|SPATA22_ENST00000355380.4_Intron|SPATA22_ENST00000572969.1_Missense_Mutation_p.P20L			Q8NHS9	SPT22_HUMAN	spermatogenesis associated 22	20					fertilization (GO:0009566)|gamete generation (GO:0007276)|meiotic DNA repair synthesis (GO:0000711)|regulation of meiotic cell cycle (GO:0051445)|reproductive system development (GO:0061458)|synapsis (GO:0007129)	chromosome (GO:0005694)		p.P20L(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|skin(2)	19						ATTGAACAACGGAACAGGCAA	0.323																																					p.P20L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C59T	17						.						92.0	92.0	92.0					17																	3370833		2203	4300	6503	3317583	SO:0001583	missense	84690	exon3			AY035868	CCDS11027.1, CCDS54066.1, CCDS54067.1	17p13.3	2005-12-19							30705	protein-coding gene	gene with protein product						12477932	Standard	NM_001170696		Approved	NYD-SP20	uc002fvn.3	Q8NHS9		ENST00000573128.1:c.59C>T	17.37:g.3370833G>A	ENSP00000459580:p.Pro20Leu		3317583	NM_001170697	B4DXB1|D3DTI9|J3KN63|Q969H3|Q96JT4	Missense_Mutation	SNP	ENST00000573128.1	37	CCDS11027.1	.	.	.	.	.	.	.	.	.	.	g	20.8	4.052630	0.75960	.	.	ENSG00000141255	ENST00000397168;ENST00000268981;ENST00000541913	T;T;T	0.60171	0.21;0.62;0.43	5.38	5.38	0.77491	.	0.000000	0.46758	D	0.000277	T	0.67702	0.2921	L	0.32530	0.975	0.53005	D	0.999967	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;0.999	T	0.70281	-0.4915	10	0.87932	D	0	-3.0994	16.677	0.85281	0.0:0.0:1.0:0.0	.	20;20;20	F5GWB9;B4DXB1;Q8NHS9	.;.;SPT22_HUMAN	L	20	ENSP00000380354:P20L;ENSP00000268981:P20L;ENSP00000441920:P20L	ENSP00000268981:P20L	P	-	2	0	SPATA22	3317583	1.000000	0.71417	0.996000	0.52242	0.892000	0.51952	6.568000	0.73987	2.695000	0.91970	0.563000	0.77884	CCG		0.323	SPATA22-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438067.2	NM_032598	
FBXW10	10517	broad.mit.edu	37	17	18653069	18653069	+	Silent	SNP	C	C	T			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr17:18653069C>T	ENST00000395665.4	+	3	926	c.705C>T	c.(703-705)tcC>tcT	p.S235S	FBXW10_ENST00000308799.4_Silent_p.S235S|FBXW10_ENST00000395667.1_Silent_p.S235S|FBXW10_ENST00000301938.4_Silent_p.S235S			Q5XX13	FBW10_HUMAN	F-box and WD repeat domain containing 10	235								p.S235S(1)		NS(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	42						GGTGTATATCCGAAATGAATA	0.468																																					p.S235S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C705T	17						.						141.0	117.0	125.0					17																	18653069		2203	4300	6503	18593794	SO:0001819	synonymous_variant	10517	exon3			BC028364	CCDS11199.2, CCDS11199.3, CCDS58524.1	17p11	2013-01-09	2007-02-08	2004-07-21	ENSG00000171931	ENSG00000171931		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	1211	protein-coding gene	gene with protein product		611679	"""chromosome 17 open reading frame 1A"", ""F-box and WD-40 domain protein 10"""	C17orf1, C17orf1A		9787083, 7586531	Standard	NM_001267585		Approved	SM2SH2, HREP, Fbw10	uc002guk.3	Q5XX13	OTTHUMG00000059048	ENST00000395665.4:c.705C>T	17.37:g.18653069C>T			18593794	NM_031456	C9JRY8|C9JZD7|Q8TC00|Q9H0F0	Silent	SNP	ENST00000395665.4	37	CCDS11199.3																																																																																				0.468	FBXW10-003	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313531.2	NM_031456	
TP53	7157	broad.mit.edu	37	17	7577085	7577085	+	Nonsense_Mutation	SNP	C	C	A	rs112431538		TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr17:7577085C>A	ENST00000269305.4	-	8	1042	c.853G>T	c.(853-855)Gag>Tag	p.E285*	TP53_ENST00000455263.2_Nonsense_Mutation_p.E285*|TP53_ENST00000359597.4_Nonsense_Mutation_p.E285*|TP53_ENST00000413465.2_Intron|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Nonsense_Mutation_p.E285*|TP53_ENST00000420246.2_Nonsense_Mutation_p.E285*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	285	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		E -> A (in a sporadic cancer; somatic mutation).|E -> D (in sporadic cancers; somatic mutation).|E -> G (in sporadic cancers; somatic mutation).|E -> K (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1459726, ECO:0000269|PubMed:1694291}.|E -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation).|E -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.E285K(111)|p.E285*(24)|p.0?(8)|p.E285Q(4)|p.?(2)|p.R283fs*16(2)|p.C275fs*20(1)|p.R282_E287delRRTEEE(1)|p.L265_K305del41(1)|p.T284fs*57(1)|p.T284_G293del10(1)|p.E285_L289delEEENL(1)|p.E285fs*60(1)|p.G279fs*59(1)|p.R283fs*56(1)|p.E285fs*20(1)|p.E285fs*13(1)|p.R283fs*59(1)|p.V272_K292del21(1)|p.E285_N288delEEEN(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TTCTCTTCCTCTGTGCGCCGG	0.562		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.E285X	Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,haematopoietic_and_lymphoid_tissue,NS,Substitution - Missense,0 	.	165	Substitution - Missense(115)|Substitution - Nonsense(24)|Deletion - Frameshift(10)|Whole gene deletion(8)|Deletion - In frame(6)|Unknown(2)	urinary_tract(53)|breast(18)|large_intestine(15)|lung(11)|upper_aerodigestive_tract(10)|stomach(8)|haematopoietic_and_lymphoid_tissue(8)|central_nervous_system(6)|oesophagus(6)|liver(6)|skin(5)|prostate(4)|bone(4)|biliary_tract(3)|ovary(3)|adrenal_gland(1)|soft_tissue(1)|eye(1)|pancreas(1)|thyroid(1)	c.G853T	17	GRCh37	CM995136	TP53	M	rs112431538	.						91.0	78.0	82.0					17																	7577085		2203	4300	6503	7517810	SO:0001587	stop_gained	7157	exon8	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.853G>T	17.37:g.7577085C>A	ENSP00000269305:p.Glu285*		7517810	NM_001126114	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	36	5.741087	0.96873	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	.	.	.	4.99	4.99	0.66335	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-38.0538	15.807	0.78520	0.0:1.0:0.0:0.0	.	.	.	.	X	285;285;285;285;285;274;153	.	ENSP00000269305:E285X	E	-	1	0	TP53	7517810	1.000000	0.71417	0.900000	0.35374	0.716000	0.41182	7.587000	0.82613	2.579000	0.87056	0.462000	0.41574	GAG		0.562	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
DNAH2	146754	broad.mit.edu	37	17	7679354	7679354	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr17:7679354G>A	ENST00000572933.1	+	31	6294	c.4834G>A	c.(4834-4836)Gat>Aat	p.D1612N	DNAH2_ENST00000389173.2_Missense_Mutation_p.D1612N			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	1612	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.D1612N(1)		NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				CTGGCTTGGCGATGTGGAACA	0.607																																					p.D1612N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4834A	17						.						82.0	73.0	76.0					17																	7679354		2203	4300	6503	7620079	SO:0001583	missense	146754	exon30			U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.4834G>A	17.37:g.7679354G>A	ENSP00000458355:p.Asp1612Asn		7620079	NM_020877	A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Missense_Mutation	SNP	ENST00000572933.1	37	CCDS32551.1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.509518	0.85282	.	.	ENSG00000183914	ENST00000360606;ENST00000389173	T	0.60920	0.15	5.66	5.66	0.87406	Dynein heavy chain, domain-2 (1);	0.182827	0.45126	D	0.000395	T	0.55768	0.1941	L	0.43701	1.375	0.80722	D	1	P	0.35507	0.506	B	0.39339	0.297	T	0.51521	-0.8695	10	0.31617	T	0.26	.	18.5315	0.90993	0.0:0.0:1.0:0.0	.	1612	Q9P225	DYH2_HUMAN	N	1612	ENSP00000373825:D1612N	ENSP00000353818:D1612N	D	+	1	0	DNAH2	7620079	1.000000	0.71417	0.387000	0.26183	0.383000	0.30230	6.648000	0.74359	2.666000	0.90696	0.655000	0.94253	GAT		0.607	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440241.1	NM_020877	
GFAP	2670	broad.mit.edu	37	17	42985483	42985483	+	Silent	SNP	G	G	T			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr17:42985483G>T	ENST00000253408.5	-	8	1271	c.1206C>A	c.(1204-1206)ggC>ggA	p.G402G	GFAP_ENST00000588735.1_Splice_Site_p.G28G	NM_002055.4	NP_002046.1	P14136	GFAP_HUMAN	glial fibrillary acidic protein	402	Tail.				astrocyte development (GO:0014002)|Bergmann glial cell differentiation (GO:0060020)|extracellular matrix organization (GO:0030198)|intermediate filament organization (GO:0045109)|long-term synaptic potentiation (GO:0060291)|negative regulation of neuron projection development (GO:0010977)|neuron projection regeneration (GO:0031102)|positive regulation of Schwann cell proliferation (GO:0010625)|regulation of neurotransmitter uptake (GO:0051580)|response to wounding (GO:0009611)	astrocyte projection (GO:0097449)|cell body (GO:0044297)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament (GO:0005882)|membrane (GO:0016020)	structural constituent of cytoskeleton (GO:0005200)	p.G402G(1)		endometrium(3)|kidney(1)|large_intestine(2)|liver(1)|lung(11)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	23		Prostate(33;0.0959)				TCTTGAGGTGGCCTTCTGACA	0.592																																					p.G402G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1206A	17						.						223.0	184.0	197.0					17																	42985483		2203	4300	6503	40341009	SO:0001819	synonymous_variant	2670	exon8			S40719	CCDS11491.1, CCDS45708.1, CCDS59296.1	17q21	2013-01-16						"""Intermediate filaments type III"""	4235	protein-coding gene	gene with protein product	"""intermediate filament protein"""	137780				9693047	Standard	NM_002055		Approved	FLJ45472	uc002ihq.3	P14136		ENST00000253408.5:c.1206C>A	17.37:g.42985483G>T			40341009	NM_002055	B2RD44|D3DX59|E9PAX3|Q53H98|Q5D055|Q6ZQS3|Q7Z5J6|Q7Z5J7|Q96KS4|Q96P18|Q9UFD0	Silent	SNP	ENST00000253408.5	37	CCDS11491.1																																																																																				0.592	GFAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448701.1	NM_002055	
LAMA3	3909	broad.mit.edu	37	18	21481180	21481180	+	Missense_Mutation	SNP	G	G	A	rs373464847		TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr18:21481180G>A	ENST00000313654.9	+	48	6335	c.6094G>A	c.(6094-6096)Gaa>Aaa	p.E2032K	LAMA3_ENST00000399516.3_Missense_Mutation_p.E1976K|LAMA3_ENST00000587184.1_Missense_Mutation_p.E367K|LAMA3_ENST00000269217.6_Missense_Mutation_p.E423K|LAMA3_ENST00000588770.1_3'UTR	NM_198129.1	NP_937762.1	Q16787	LAMA3_HUMAN	laminin, alpha 3	2032	Domain II and I.				cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)	p.E2032K(1)		NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(24)|lung(54)|ovary(8)|prostate(6)|skin(7)|urinary_tract(4)	128	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)					AAATGAATACGAAGCCAAACT	0.512																																					p.E367K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1099A	18						.	G	LYS/GLU,LYS/GLU,LYS/GLU,LYS/GLU	0,4406		0,0,2203	70.0	67.0	68.0		1267,5926,1099,6094	5.7	1.0	18		68	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense	LAMA3	NM_000227.3,NM_001127717.1,NM_001127718.1,NM_198129.1	56,56,56,56	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging	423/1725,1976/3278,367/1669,2032/3334	21481180	1,13005	2203	4300	6503	19735178	SO:0001583	missense	3909	exon10			L34155	CCDS11880.1, CCDS42419.1, CCDS45838.1, CCDS59307.1	18q11.2	2013-03-01	2002-08-29		ENSG00000053747	ENSG00000053747		"""Laminins"""	6483	protein-coding gene	gene with protein product		600805	"""laminin, alpha 3 (nicein (150kD), kalinin (165kD), BM600 (150kD), epilegrin)"""	LAMNA		8077230	Standard	NM_000227		Approved	nicein-150kDa, kalinin-165kDa, BM600-150kDa, epiligrin	uc002kuq.3	Q16787	OTTHUMG00000131874	ENST00000313654.9:c.6094G>A	18.37:g.21481180G>A	ENSP00000324532:p.Glu2032Lys		19735178	NM_001127718	B0YJ33|Q13679|Q13680|Q6VU67|Q6VU68|Q6VU69|Q76E14|Q96TG0	Missense_Mutation	SNP	ENST00000313654.9	37	CCDS42419.1	.	.	.	.	.	.	.	.	.	.	G	29.8	5.036732	0.93630	0.0	1.16E-4	ENSG00000053747	ENST00000313654;ENST00000399516;ENST00000269217	T;D;T	0.82984	2.86;-1.67;2.86	5.65	5.65	0.86999	Laminin I (1);	.	.	.	.	D	0.91338	0.7268	M	0.77616	2.38	0.50467	D	0.99987	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.996;0.997;1.0;0.999	D	0.89168	0.3535	9	0.34782	T	0.22	.	20.0887	0.97806	0.0:0.0:1.0:0.0	.	367;423;1976;2032	Q6VU69;B0YJ33;Q6VU67;Q16787	.;.;.;LAMA3_HUMAN	K	2032;1976;423	ENSP00000324532:E2032K;ENSP00000382432:E1976K;ENSP00000269217:E423K	ENSP00000269217:E423K	E	+	1	0	LAMA3	19735178	1.000000	0.71417	0.995000	0.50966	0.806000	0.45545	3.936000	0.56568	2.825000	0.97269	0.655000	0.94253	GAA		0.512	LAMA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254824.3	NM_000227, NM_198129	
SMAD4	4089	broad.mit.edu	37	18	48575116	48575116	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr18:48575116C>T	ENST00000342988.3	+	3	848	c.310C>T	c.(310-312)Ctt>Ttt	p.L104F	SMAD4_ENST00000398417.2_Missense_Mutation_p.L104F|RP11-729L2.2_ENST00000590722.2_3'UTR|SMAD4_ENST00000588745.1_Missense_Mutation_p.L104F|SMAD4_ENST00000452201.2_Missense_Mutation_p.L104F	NM_005359.5	NP_005350.1	Q13485	SMAD4_HUMAN	SMAD family member 4	104	MH1. {ECO:0000255|PROSITE- ProRule:PRU00438}.				atrioventricular canal development (GO:0036302)|atrioventricular valve formation (GO:0003190)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|brainstem development (GO:0003360)|branching involved in ureteric bud morphogenesis (GO:0001658)|cardiac septum development (GO:0003279)|cell proliferation (GO:0008283)|developmental growth (GO:0048589)|endocardial cell differentiation (GO:0060956)|endoderm development (GO:0007492)|endothelial cell activation (GO:0042118)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|formation of anatomical boundary (GO:0048859)|gastrulation with mouth forming second (GO:0001702)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|metanephric mesenchyme morphogenesis (GO:0072133)|negative regulation of cell death (GO:0060548)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephrogenic mesenchyme morphogenesis (GO:0072134)|neural crest cell differentiation (GO:0014033)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation involved in heart valve morphogenesis (GO:0003251)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of binding (GO:0051098)|regulation of hair follicle development (GO:0051797)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|response to transforming growth factor beta (GO:0071559)|sebaceous gland development (GO:0048733)|SMAD protein complex assembly (GO:0007183)|SMAD protein signal transduction (GO:0060395)|somite rostral/caudal axis specification (GO:0032525)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	activin responsive factor complex (GO:0032444)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMAD protein complex (GO:0071141)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|R-SMAD binding (GO:0070412)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity (GO:0030616)	p.0?(36)|p.?(4)|p.L104F(1)		NS(2)|biliary_tract(19)|breast(9)|central_nervous_system(2)|endometrium(2)|gastrointestinal_tract_(site_indeterminate)(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(142)|liver(2)|lung(27)|oesophagus(4)|ovary(7)|pancreas(180)|prostate(3)|skin(1)|small_intestine(9)|stomach(5)|testis(2)|thyroid(19)|upper_aerodigestive_tract(10)|urinary_tract(2)|vulva(1)	454		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)		GTGGCCTGATCTTCACAAAAA	0.383																																					p.L104F												.	.	41	Whole gene deletion(36)|Unknown(4)|Substitution - Missense(1)	pancreas(26)|large_intestine(4)|stomach(3)|breast(3)|lung(2)|upper_aerodigestive_tract(1)|oesophagus(1)|NS(1)	c.C310T	18						.						161.0	147.0	152.0					18																	48575116		2203	4300	6503	46829114	SO:0001583	missense	4089	exon3			U44378	CCDS11950.1	18q21.1	2014-09-17	2006-11-06	2004-05-26	ENSG00000141646	ENSG00000141646		"""SMADs"""	6770	protein-coding gene	gene with protein product		600993	"""MAD, mothers against decapentaplegic homolog 4 (Drosophila)"", ""SMAD, mothers against DPP homolog 4 (Drosophila)"""	MADH4		8553070, 8774881	Standard	NM_005359		Approved	DPC4	uc010xdp.2	Q13485	OTTHUMG00000132696	ENST00000342988.3:c.310C>T	18.37:g.48575116C>T	ENSP00000341551:p.Leu104Phe		46829114	NM_005359	A8K405	Missense_Mutation	SNP	ENST00000342988.3	37	CCDS11950.1	.	.	.	.	.	.	.	.	.	.	C	26.6	4.750807	0.89753	.	.	ENSG00000141646	ENST00000452201;ENST00000342988;ENST00000544926;ENST00000398417	D;D;D	0.82984	-1.67;-1.67;-1.67	5.48	4.61	0.57282	MAD homology, MH1 (3);MAD homology 1, Dwarfin-type (2);	0.000000	0.85682	D	0.000000	D	0.92103	0.7497	M	0.90145	3.09	0.58432	D	0.999995	D	0.89917	1.0	D	0.97110	1.0	D	0.93270	0.6651	10	0.87932	D	0	.	13.1749	0.59621	0.0:0.9212:0.0:0.0788	.	104	Q13485	SMAD4_HUMAN	F	104	ENSP00000409551:L104F;ENSP00000341551:L104F;ENSP00000381452:L104F	ENSP00000341551:L104F	L	+	1	0	SMAD4	46829114	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.793000	0.85851	1.289000	0.44618	0.585000	0.79938	CTT		0.383	SMAD4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255993.3	NM_005359	
SERPINB12	89777	broad.mit.edu	37	18	61228355	61228355	+	Missense_Mutation	SNP	C	C	T	rs367909045		TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr18:61228355C>T	ENST00000269491.1	+	4	422	c.422C>T	c.(421-423)aCg>aTg	p.T141M	SERPINB12_ENST00000382768.1_Missense_Mutation_p.T161M	NM_080474.1	NP_536722.1	Q96P63	SPB12_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 12	141					hematopoietic progenitor cell differentiation (GO:0002244)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of protein catabolic process (GO:0042177)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	enzyme binding (GO:0019899)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.T141M(1)		kidney(1)|large_intestine(5)|lung(19)|skin(1)	26						TACCACACGACGATTGAAAGT	0.383																																					p.T141M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C422T	18						.	C	MET/THR	1,4405	2.1+/-5.4	0,1,2202	118.0	114.0	116.0		422	5.6	0.6	18		116	0,8600		0,0,4300	no	missense	SERPINB12	NM_080474.1	81	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	possibly-damaging	141/406	61228355	1,13005	2203	4300	6503	59379335	SO:0001583	missense	89777	exon4			AF411191	CCDS11984.1	18q21.33	2014-02-18	2005-08-18		ENSG00000166634	ENSG00000166634		"""Serine (or cysteine) peptidase inhibitors"""	14220	protein-coding gene	gene with protein product		615662	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 12"""			24172014	Standard	NM_080474		Approved	YUKOPIN	uc010xen.2	Q96P63	OTTHUMG00000132789	ENST00000269491.1:c.422C>T	18.37:g.61228355C>T	ENSP00000269491:p.Thr141Met		59379335	NM_080474	Q3SYB4	Missense_Mutation	SNP	ENST00000269491.1	37	CCDS11984.1	.	.	.	.	.	.	.	.	.	.	C	12.22	1.872010	0.33069	2.27E-4	0.0	ENSG00000166634	ENST00000269491;ENST00000382768	D;D	0.84730	-1.89;-1.89	5.59	5.59	0.84812	Serpin domain (3);	0.086453	0.50627	D	0.000114	D	0.91831	0.7415	M	0.73598	2.24	0.09310	N	0.999999	D;D	0.89917	1.0;1.0	D;D	0.79784	0.989;0.993	D	0.85719	0.1324	10	0.56958	D	0.05	.	16.439	0.83894	0.0:0.8601:0.1399:0.0	.	161;141	Q3SYB4;Q96P63	.;SPB12_HUMAN	M	141;161	ENSP00000269491:T141M;ENSP00000372218:T161M	ENSP00000269491:T141M	T	+	2	0	SERPINB12	59379335	0.000000	0.05858	0.559000	0.28332	0.134000	0.20937	-0.031000	0.12287	2.789000	0.95967	0.655000	0.94253	ACG		0.383	SERPINB12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256197.1	NM_080474	
MOB3A	126308	broad.mit.edu	37	19	2078278	2078279	+	Frame_Shift_Ins	INS	-	-	C	rs200521330		TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	-	-					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr19:2078278_2078279insC	ENST00000357066.3	-	3	660_661	c.281_282insG	c.(280-282)ggcfs	p.G94fs	MOB3A_ENST00000592280.1_Frame_Shift_Ins_p.G94fs|MOB3A_ENST00000592143.1_Intron	NM_130807.2	NP_570719.1	Q96BX8	MOB3A_HUMAN	MOB kinase activator 3A	94						intracellular (GO:0005622)	metal ion binding (GO:0046872)	p.K96fs*3(1)									CATACTTGGGGCCCCCCGACAT	0.614																																					p.G94fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.282_283insG	19						.																																			2029279	SO:0001589	frameshift_variant	126308	exon3			AK095471	CCDS12081.1	19p13.3	2011-09-28	2011-09-28	2011-09-28	ENSG00000172081	ENSG00000172081		"""MOB kinase activators"""	29802	protein-coding gene	gene with protein product	"""MOB LAK"""		"""MOB1, Mps One Binder kinase activator-like 2A (yeast)"""	MOBKL2A		12477932	Standard	NM_130807		Approved	MOB1C, MOB-LAK, moblak	uc002luv.3	Q96BX8		ENST00000357066.3:c.282dupG	19.37:g.2078284_2078284dupC	ENSP00000349575:p.Gly94fs		2029278	NM_130807	B3KTF1|O75249|Q8TF69	Frame_Shift_Ins	INS	ENST00000357066.3	37	CCDS12081.1																																																																																				0.614	MOB3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450893.1	NM_130807	
CACNA1A	773	broad.mit.edu	37	19	13414691	13414691	+	Missense_Mutation	SNP	G	G	A	rs121908212		TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr19:13414691G>A	ENST00000360228.5	-	16	1993	c.1994C>T	c.(1993-1995)aCg>aTg	p.T665M	CACNA1A_ENST00000573710.2_Missense_Mutation_p.T666M	NM_000068.3|NM_001127222.1|NM_001174080.1|NM_023035.2	NP_000059.3|NP_001120694.1|NP_001167551.1|NP_075461.2	O00555	CAC1A_HUMAN	calcium channel, voltage-dependent, P/Q type, alpha 1A subunit	666					adult walking behavior (GO:0007628)|behavioral response to pain (GO:0048266)|calcium ion import (GO:0070509)|calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cell death (GO:0008219)|cell growth (GO:0016049)|cellular chloride ion homeostasis (GO:0030644)|cerebellar molecular layer development (GO:0021679)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellum maturation (GO:0021590)|dendrite morphogenesis (GO:0048813)|energy reserve metabolic process (GO:0006112)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glucose metabolic process (GO:0006006)|hormone metabolic process (GO:0042445)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of hormone biosynthetic process (GO:0032353)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular process controlling balance (GO:0050885)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter metabolic process (GO:0042133)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|receptor clustering (GO:0043113)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion-dependent exocytosis (GO:0017158)|regulation of insulin secretion (GO:0050796)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|spinal cord motor neuron differentiation (GO:0021522)|sulfur amino acid metabolic process (GO:0000096)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmission of nerve impulse (GO:0019226)|vestibular nucleus development (GO:0021750)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|syntaxin binding (GO:0019905)|voltage-gated calcium channel activity (GO:0005245)	p.T666M(3)		breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(25)|prostate(2)|urinary_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Loperamide(DB00836)|Pregabalin(DB00230)|Spironolactone(DB00421)|Verapamil(DB00661)	GTCTTCGCCCGTCAGGATCTG	0.597																																					p.T666M												.	.	3	Substitution - Missense(3)	large_intestine(3)	c.C1997T	19	GRCh37	CM960238	CACNA1A	M	rs121908212	.						121.0	123.0	122.0					19																	13414691		2003	4160	6163	13275691	SO:0001583	missense	773	exon16			U79666	CCDS45998.1, CCDS45999.1	19p13	2014-09-17			ENSG00000141837	ENSG00000141837		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1388	protein-coding gene	gene with protein product		601011		CACNL1A4, SCA6, MHP1, MHP		8825650, 16382099, 23827678	Standard	NM_000068		Approved	Cav2.1, EA2, APCA, HPCA, FHM	uc010xne.2	O00555	OTTHUMG00000044590	ENST00000360228.5:c.1994C>T	19.37:g.13414691G>A	ENSP00000353362:p.Thr665Met		13275691	NM_001174080	J3KP41|P78510|P78511|Q16290|Q92690|Q99790|Q99791|Q99792|Q99793|Q9NS88|Q9UDC4	Missense_Mutation	SNP	ENST00000360228.5	37	CCDS45998.1	.	.	.	.	.	.	.	.	.	.	G	16.23	3.064260	0.55432	.	.	ENSG00000141837	ENST00000360228;ENST00000418012;ENST00000357018;ENST00000325084	D	0.98889	-5.21	4.58	3.55	0.40652	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99357	0.9774	H	0.97023	3.925	0.48901	A	0.999722	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.998	D	0.99624	1.0984	9	0.87932	D	0	.	11.6149	0.51083	0.0887:0.0:0.9113:0.0	.	666;666;665	O00555;E9PD31;Q9NS88	CAC1A_HUMAN;.;.	M	665;666;666;666	ENSP00000353362:T665M	ENSP00000317661:T666M	T	-	2	0	CACNA1A	13275691	1.000000	0.71417	0.966000	0.40874	0.989000	0.77384	9.507000	0.97996	1.151000	0.42436	-0.229000	0.12294	ACG		0.597	CACNA1A-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000104062.2	NM_000068	
CYP4F22	126410	broad.mit.edu	37	19	15661490	15661490	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr19:15661490C>A	ENST00000269703.3	+	13	1540	c.1341C>A	c.(1339-1341)taC>taA	p.Y447*	CYP4F22_ENST00000601005.2_Nonsense_Mutation_p.Y447*	NM_173483.3	NP_775754.2	Q6NT55	CP4FN_HUMAN	cytochrome P450, family 4, subfamily F, polypeptide 22	447						endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)	p.Y447*(1)		endometrium(6)|large_intestine(9)|lung(16)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|soft_tissue(1)	37						CCTAGGTGTACAACCCCTACC	0.607																																					p.Y447X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1341A	19						.						107.0	92.0	97.0					19																	15661490		2203	4300	6503	15522490	SO:0001587	stop_gained	126410	exon13				CCDS12331.1	19p13.12	2013-11-11			ENSG00000171954	ENSG00000171954		"""Cytochrome P450s"""	26820	protein-coding gene	gene with protein product		611495				16436457	Standard	NM_173483		Approved	FLJ39501	uc002nbh.4	Q6NT55	OTTHUMG00000182451	ENST00000269703.3:c.1341C>A	19.37:g.15661490C>A	ENSP00000269703:p.Tyr447*		15522490	NM_173483	Q8N8H4	Nonsense_Mutation	SNP	ENST00000269703.3	37	CCDS12331.1	.	.	.	.	.	.	.	.	.	.	C	31	5.103349	0.94245	.	.	ENSG00000171954	ENST00000269703	.	.	.	4.76	1.4	0.22301	.	0.182059	0.47455	D	0.000221	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.14656	T	0.56	.	6.4895	0.22107	0.0:0.6128:0.0:0.3872	.	.	.	.	X	447	.	ENSP00000269703:Y447X	Y	+	3	2	CYP4F22	15522490	0.998000	0.40836	0.387000	0.26183	0.980000	0.70556	0.736000	0.26130	0.530000	0.28619	0.557000	0.71058	TAC		0.607	CYP4F22-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461338.2	NM_173483	
CALR3	125972	broad.mit.edu	37	19	16594825	16594825	+	Silent	SNP	G	G	A	rs145046810	byFrequency	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr19:16594825G>A	ENST00000269881.3	-	5	656	c.594C>T	c.(592-594)taC>taT	p.Y198Y	CALR3_ENST00000602234.1_5'UTR|CTD-3222D19.2_ENST00000409035.1_Intron	NM_145046.4	NP_659483.2	Q96L12	CALR3_HUMAN	calreticulin 3	198	4 X approximate repeats.|P-domain.				cell differentiation (GO:0030154)|protein folding (GO:0006457)|spermatogenesis (GO:0007283)	endoplasmic reticulum (GO:0005783)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)	p.Y198Y(1)		NS(1)|breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|prostate(1)|skin(1)	15						AGTTCCAGTCGTACTCTATGC	0.423													G|||	3	0.000599042	0.0	0.0	5008	,	,		12800	0.001		0.0	False		,,,				2504	0.002				p.Y198Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C594T	19						.	G		0,4406		0,0,2203	131.0	114.0	120.0		594	-2.3	0.8	19	dbSNP_134	120	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	CALR3	NM_145046.3		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		198/385	16594825	1,13005	2203	4300	6503	16455825	SO:0001819	synonymous_variant	125972	exon5			AK058084	CCDS12344.1	19p13.11	2014-09-17				ENSG00000269058			20407	protein-coding gene	gene with protein product	"""cancer/testis antigen 93"", ""calsperin"""	611414				12384296	Standard	NM_145046		Approved	CRT2, FLJ25355, MGC26577, CT93	uc002ned.3	Q96L12		ENST00000269881.3:c.594C>T	19.37:g.16594825G>A			16455825	NM_145046	D9N574|Q96LN3	Silent	SNP	ENST00000269881.3	37	CCDS12344.1																																																																																				0.423	CALR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461089.1	NM_145046	
ZNF98	148198	broad.mit.edu	37	19	22574881	22574881	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr19:22574881C>G	ENST00000357774.5	-	4	1277	c.1156G>C	c.(1156-1158)Gct>Cct	p.A386P		NM_001098626.1	NP_001092096.1	A6NK75	ZNF98_HUMAN	zinc finger protein 98	386					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.A386P(2)		central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(16)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	37		all_cancers(12;0.0536)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00542)|Hepatocellular(1079;0.244)				TGTTTAAAAGCTTTGCCACAT	0.403																																					p.A386P												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1156C	19						.						4.0	4.0	4.0					19																	22574881		1449	3407	4856	22366721	SO:0001583	missense	148198	exon4				CCDS46031.1	19p12	2014-02-14	2010-04-20	2008-06-12	ENSG00000197360	ENSG00000197360		"""Zinc fingers, C2H2-type"", ""-"""	13174	protein-coding gene	gene with protein product	"""zinc finger protein 739"""	603980					Standard	NM_001098626		Approved	ZNF739, F7175	uc002nqt.2	A6NK75	OTTHUMG00000182940	ENST00000357774.5:c.1156G>C	19.37:g.22574881C>G	ENSP00000350418:p.Ala386Pro		22366721	NM_001098626		Missense_Mutation	SNP	ENST00000357774.5	37	CCDS46031.1	.	.	.	.	.	.	.	.	.	.	.	10.36	1.328296	0.24080	.	.	ENSG00000197360	ENST00000357774	T	0.36699	1.24	1.28	0.0656	0.14357	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.47838	0.1467	L	0.59967	1.855	0.09310	N	1	D	0.89917	1.0	D	0.83275	0.996	T	0.32771	-0.9894	9	0.87932	D	0	.	2.6633	0.05033	0.4315:0.3818:0.0:0.1867	.	386	A6NK75	ZNF98_HUMAN	P	386	ENSP00000350418:A386P	ENSP00000350418:A386P	A	-	1	0	ZNF98	22366721	0.000000	0.05858	0.001000	0.08648	0.027000	0.11550	-1.829000	0.01701	-0.117000	0.11872	-0.704000	0.03662	GCT		0.403	ZNF98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464398.1	NM_001098626	
ZNF492	57615	broad.mit.edu	37	19	22847640	22847640	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr19:22847640A>C	ENST00000456783.2	+	4	1413	c.1169A>C	c.(1168-1170)gAg>gCg	p.E390A	CTC-457E21.9_ENST00000601860.1_RNA	NM_020855.2	NP_065906.1	Q9P255	ZN492_HUMAN	zinc finger protein 492	390					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E390A(1)		endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		all_cancers(12;0.0266)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00203)|Hepatocellular(1079;0.244)				CATACTGGAGAGAAGCCCTAC	0.378																																					p.E390A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1169C	19						.						25.0	27.0	26.0					19																	22847640		2003	4145	6148	22639480	SO:0001583	missense	57615	exon4			AB040906	CCDS46032.1	19p13.11	2013-01-08				ENSG00000229676		"""Zinc fingers, C2H2-type"""	23707	protein-coding gene	gene with protein product			"""zinc finger protein 115 (Y20)"""	ZNF115		10819331	Standard	NM_020855		Approved	KIAA1473	uc002nqw.3	Q9P255		ENST00000456783.2:c.1169A>C	19.37:g.22847640A>C	ENSP00000413660:p.Glu390Ala		22639480	NM_020855	Q08EI7|Q08EI8	Missense_Mutation	SNP	ENST00000456783.2	37	CCDS46032.1	.	.	.	.	.	.	.	.	.	.	.	6.302	0.423905	0.11928	.	.	ENSG00000229676	ENST00000456783	T	0.27557	1.66	1.12	1.12	0.20585	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.43010	0.1228	M	0.78801	2.425	0.30562	N	0.764371	P	0.45594	0.862	P	0.52481	0.7	T	0.46247	-0.9205	9	0.66056	D	0.02	.	5.8144	0.18484	1.0:0.0:0.0:0.0	.	390	Q9P255	ZN492_HUMAN	A	390	ENSP00000413660:E390A	ENSP00000413660:E390A	E	+	2	0	ZNF492	22639480	0.955000	0.32602	0.217000	0.23759	0.219000	0.24729	2.939000	0.48995	0.231000	0.21079	0.228000	0.17796	GAG		0.378	ZNF492-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464581.1	NM_020855	
DMKN	93099	broad.mit.edu	37	19	36002330	36002330	+	Missense_Mutation	SNP	C	C	T	rs371442207		TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr19:36002330C>T	ENST00000339686.3	-	5	1077	c.901G>A	c.(901-903)Ggc>Agc	p.G301S	DMKN_ENST00000424570.2_Missense_Mutation_p.G301S|DMKN_ENST00000419602.1_Intron|DMKN_ENST00000447113.2_Missense_Mutation_p.G301S|DMKN_ENST00000462126.1_5'Flank|DMKN_ENST00000418261.1_Missense_Mutation_p.G301S|DMKN_ENST00000440396.1_Missense_Mutation_p.G301S|DMKN_ENST00000474928.1_5'Flank|DMKN_ENST00000402589.2_5'Flank|DMKN_ENST00000451297.2_Missense_Mutation_p.G301S|DMKN_ENST00000472252.2_5'Flank|DMKN_ENST00000461300.1_5'Flank|DMKN_ENST00000443640.1_5'Flank|DMKN_ENST00000429837.1_Intron|DMKN_ENST00000480502.1_5'Flank|DMKN_ENST00000492341.2_5'Flank|DMKN_ENST00000392206.2_5'Flank|DMKN_ENST00000436012.1_5'Flank|DMKN_ENST00000602781.1_5'Flank|DMKN_ENST00000458071.1_5'Flank|DMKN_ENST00000467637.1_5'Flank|DMKN_ENST00000488892.1_5'Flank|DMKN_ENST00000414866.2_5'Flank	NM_033317.4	NP_201574	Q6E0U4	DMKN_HUMAN	dermokine	301	Gly-rich.					extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)		p.G301S(1)		NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(7)|ovary(1)|prostate(1)|skin(2)	27	all_lung(56;1.89e-08)|Lung NSC(56;2.9e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			GACTCACTGCCGCTGTCACCT	0.642																																					p.G301S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G901A	19						.	C	,,SER/GLY,SER/GLY,SER/GLY,SER/GLY,SER/GLY	0,4404		0,0,2202	41.0	35.0	37.0		,,901,901,901,901,901	-2.0	0.0	19		37	1,8597	1.2+/-3.3	0,1,4298	no	intron,intron,missense,missense,missense,missense,missense	DMKN	NM_001126056.2,NM_001190347.1,NM_033317.4,NM_001190349.1,NM_001190348.1,NM_001126058.2,NM_001126057.2	,,56,56,56,56,56	0,1,6500	TT,TC,CC		0.0116,0.0,0.0077	,,benign,benign,benign,benign,benign	,,301/477,301/370,301/437,301/387,301/399	36002330	1,13001	2202	4299	6501	40694170	SO:0001583	missense	93099	exon5			BC035311	CCDS12463.1, CCDS42549.1, CCDS46051.1, CCDS46052.1, CCDS46053.1, CCDS46054.1, CCDS46054.2, CCDS54250.1, CCDS54251.1, CCDS54252.1	19q13.12	2008-10-27			ENSG00000161249	ENSG00000161249			25063	protein-coding gene	gene with protein product						16374476	Standard	NM_001035516		Approved	ZD52F10	uc002nzm.4	Q6E0U4	OTTHUMG00000048101	ENST00000339686.3:c.901G>A	19.37:g.36002330C>T	ENSP00000342012:p.Gly301Ser		40694170	NM_033317	A3EZ79|A3EZ80|A3EZ81|A3EZ82|A3EZ83|C9J4P6|C9J5N8|C9JAL3|Q32W58|Q32W62|Q32W63|Q32W64|Q32W65|Q32W66|Q32W67|Q6E0U5|Q6UXC7|Q96EW8|Q9BSY6	Missense_Mutation	SNP	ENST00000339686.3	37	CCDS12463.1	.	.	.	.	.	.	.	.	.	.	C	5.559	0.288064	0.10513	0.0	1.16E-4	ENSG00000161249	ENST00000339686;ENST00000392207;ENST00000447113;ENST00000440396;ENST00000418261;ENST00000424570;ENST00000451297	T;T;T;T;T;T	0.19394	2.84;2.15;2.29;2.26;2.2;2.35	2.42	-2.0	0.07433	.	1.748700	0.03862	N	0.274171	T	0.07143	0.0181	N	0.02011	-0.69	0.09310	N	1	B;B;B;B;B	0.31968	0.349;0.231;0.349;0.349;0.154	B;B;B;B;B	0.23852	0.049;0.049;0.049;0.049;0.022	T	0.18999	-1.0319	10	0.30854	T	0.27	.	6.2094	0.20621	0.0:0.585:0.0:0.415	.	301;301;301;301;301	E7EUS0;Q6E0U4-7;Q6E0U4-3;Q6E0U4-5;Q6E0U4	.;.;.;.;DMKN_HUMAN	S	301	ENSP00000342012:G301S;ENSP00000394908:G301S;ENSP00000415277:G301S;ENSP00000414743:G301S;ENSP00000388404:G301S;ENSP00000409513:G301S	ENSP00000342012:G301S	G	-	1	0	DMKN	40694170	0.002000	0.14202	0.000000	0.03702	0.189000	0.23516	-0.701000	0.05075	-0.362000	0.08113	-0.657000	0.03884	GGC		0.642	DMKN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000109461.2	NM_033317	
PPP1R15A	23645	broad.mit.edu	37	19	49377362	49377362	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr19:49377362C>A	ENST00000200453.5	+	2	1141	c.872C>A	c.(871-873)tCa>tAa	p.S291*		NM_014330.3	NP_055145.3	O75807	PR15A_HUMAN	protein phosphatase 1, regulatory subunit 15A	291	Glu-rich.				apoptotic process (GO:0006915)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|regulation of translation (GO:0006417)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)	protein kinase binding (GO:0019901)	p.S291*(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(8)|skin(2)|urinary_tract(1)	23		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000244)|all cancers(93;0.000694)|GBM - Glioblastoma multiforme(486;0.0222)|Epithelial(262;0.033)		CCGCAATCCTCAGCCCCAGCC	0.597																																					p.S291X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C872A	19						.						53.0	66.0	62.0					19																	49377362		2203	4300	6503	54069174	SO:0001587	stop_gained	23645	exon2			U83981	CCDS12738.1	19q13.2	2012-04-17	2011-10-04		ENSG00000087074	ENSG00000087074		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14375	protein-coding gene	gene with protein product	"""growth arrest and DNA-damage-inducible 34"""	611048	"""protein phosphatase 1, regulatory (inhibitor) subunit 15A"""			9153226, 9413226	Standard	NM_014330		Approved	GADD34	uc002pky.4	O75807		ENST00000200453.5:c.872C>A	19.37:g.49377362C>A	ENSP00000200453:p.Ser291*		54069174	NM_014330	B4DKQ3|Q6IA96|Q9NVU6	Nonsense_Mutation	SNP	ENST00000200453.5	37	CCDS12738.1	.	.	.	.	.	.	.	.	.	.	C	35	5.417171	0.96092	.	.	ENSG00000087074	ENST00000200453;ENST00000540695;ENST00000544084	.	.	.	4.64	-0.29	0.12847	.	1.819990	0.03232	N	0.179138	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06099	T	0.92	2.0683	3.938	0.09314	0.165:0.5533:0.0:0.2816	.	.	.	.	X	291;131;249	.	ENSP00000200453:S291X	S	+	2	0	PPP1R15A	54069174	0.000000	0.05858	0.000000	0.03702	0.028000	0.11728	0.041000	0.13927	-0.114000	0.11936	-0.145000	0.13849	TCA		0.597	PPP1R15A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466226.1	NM_014330	
SIGLEC9	27180	broad.mit.edu	37	19	51629341	51629341	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr19:51629341C>T	ENST00000250360.3	+	3	771	c.704C>T	c.(703-705)cCg>cTg	p.P235L	SIGLEC9_ENST00000440804.3_Missense_Mutation_p.P235L	NM_014441.2	NP_055256.1	Q9Y336	SIGL9_HUMAN	sialic acid binding Ig-like lectin 9	235					cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)	integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)	p.P235L(2)|p.P235Q(1)		NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|liver(3)|lung(25)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	45		all_neural(266;0.0529)		GBM - Glioblastoma multiforme(134;0.000826)|OV - Ovarian serous cystadenocarcinoma(262;0.00295)		GTCCCAGACCCGCCTCAGAAC	0.617																																					p.P235L												.	.	3	Substitution - Missense(3)	large_intestine(1)|lung(1)|endometrium(1)	c.C704T	19						.						96.0	86.0	89.0					19																	51629341		2203	4300	6503	56321153	SO:0001583	missense	27180	exon3			AF135027	CCDS12825.1, CCDS56100.1	19q13.3-q13.4	2013-01-29			ENSG00000129450	ENSG00000129450		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10878	protein-coding gene	gene with protein product		605640				10903842	Standard	NM_014441		Approved	CD329	uc002pvu.3	Q9Y336		ENST00000250360.3:c.704C>T	19.37:g.51629341C>T	ENSP00000250360:p.Pro235Leu		56321153	NM_001198558	Q6GTU4|Q9BYI9	Missense_Mutation	SNP	ENST00000250360.3	37	CCDS12825.1	.	.	.	.	.	.	.	.	.	.	.	9.265	1.044286	0.19748	.	.	ENSG00000129450	ENST00000440804;ENST00000250360	T;T	0.14144	2.53;2.72	3.02	1.95	0.26073	Immunoglobulin-like fold (1);	0.814645	0.10039	N	0.723659	T	0.13200	0.0320	M	0.71581	2.175	0.09310	N	1	P	0.44578	0.838	B	0.30401	0.115	T	0.20107	-1.0285	10	0.62326	D	0.03	.	7.6805	0.28511	0.0:0.7367:0.2633:0.0	.	235	Q9Y336	SIGL9_HUMAN	L	235	ENSP00000413861:P235L;ENSP00000250360:P235L	ENSP00000250360:P235L	P	+	2	0	SIGLEC9	56321153	0.005000	0.15991	0.004000	0.12327	0.011000	0.07611	1.712000	0.37940	0.443000	0.26582	-0.413000	0.06143	CCG		0.617	SIGLEC9-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464224.1	NM_014441	
FCAR	2204	broad.mit.edu	37	19	55396781	55396781	+	Nonsense_Mutation	SNP	C	C	T	rs587641627	byFrequency	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr19:55396781C>T	ENST00000355524.3	+	3	215	c.205C>T	c.(205-207)Cga>Tga	p.R69*	FCAR_ENST00000345937.4_Nonsense_Mutation_p.R69*|FCAR_ENST00000469767.1_Nonsense_Mutation_p.R69*|FCAR_ENST00000482092.2_3'UTR|FCAR_ENST00000391726.3_Nonsense_Mutation_p.R57*|FCAR_ENST00000353758.4_Intron|FCAR_ENST00000391725.3_Nonsense_Mutation_p.R69*|FCAR_ENST00000391723.3_Nonsense_Mutation_p.R57*|FCAR_ENST00000391724.3_Nonsense_Mutation_p.R57*|FCAR_ENST00000359272.4_Nonsense_Mutation_p.R57*	NM_002000.2	NP_001991.1	P24071	FCAR_HUMAN	Fc fragment of IgA, receptor for	69	Ig-like C2-type 1.				immune response (GO:0006955)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)		p.R69*(2)		breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(1)|skin(2)	24				GBM - Glioblastoma multiforme(193;0.0443)		CTCCACGTACCGAGAGATAGG	0.483																																					p.R69X												.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.C205T	19						.						122.0	110.0	114.0					19																	55396781		2203	4300	6503	60088593	SO:0001587	stop_gained	2204	exon3			X54150	CCDS12907.1, CCDS12908.1, CCDS12909.1, CCDS12910.1, CCDS42622.1, CCDS42623.1, CCDS42624.1, CCDS42625.1, CCDS46180.1	19q13.42	2013-01-29			ENSG00000186431	ENSG00000186431		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3608	protein-coding gene	gene with protein product		147045				1577457	Standard	NM_133269		Approved	CD89	uc002qhr.1	P24071	OTTHUMG00000065936	ENST00000355524.3:c.205C>T	19.37:g.55396781C>T	ENSP00000347714:p.Arg69*		60088593	NM_002000	Q13603|Q13604|Q15727|Q15728|Q1AJL7|Q1AJL8|Q1AJL9|Q53X38|Q53X39|Q92587|Q92588|Q92590|Q92592|Q92593|Q9UEK0	Nonsense_Mutation	SNP	ENST00000355524.3	37	CCDS12907.1	.	.	.	.	.	.	.	.	.	.	C	9.814	1.183887	0.21870	.	.	ENSG00000186431	ENST00000433231;ENST00000391726;ENST00000355524;ENST00000391725;ENST00000345937;ENST00000359272;ENST00000391723;ENST00000391724	.	.	.	3.05	-6.1	0.02138	.	7.999500	0.01094	N	0.005251	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.13108	T	0.6	.	1.053	0.01584	0.1762:0.2937:0.3063:0.2237	.	.	.	.	X	69;57;69;69;69;57;57;57	.	ENSP00000338257:R69X	R	+	1	2	FCAR	60088593	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-3.175000	0.00571	-2.165000	0.00781	-1.011000	0.02470	CGA		0.483	FCAR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000141243.1	NM_002000	
NLRP8	126205	broad.mit.edu	37	19	56473459	56473459	+	Missense_Mutation	SNP	G	G	A	rs187510597		TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr19:56473459G>A	ENST00000291971.3	+	4	2140	c.2069G>A	c.(2068-2070)cGt>cAt	p.R690H	NLRP8_ENST00000590542.1_Missense_Mutation_p.R690H	NM_176811.2	NP_789781.2	Q86W28	NALP8_HUMAN	NLR family, pyrin domain containing 8	690					neuron death (GO:0070997)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)	p.R690H(1)		breast(4)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|ovary(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)	35		Colorectal(82;0.000147)|Ovarian(87;0.17)		GBM - Glioblastoma multiforme(193;0.0695)		GGGCTGCATCGTTGGTGGCAA	0.483													G|||	1	0.000199681	0.0	0.0	5008	,	,		19775	0.001		0.0	False		,,,				2504	0.0				p.R690H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2069A	19						.						198.0	171.0	180.0					19																	56473459		2203	4300	6503	61165271	SO:0001583	missense	126205	exon4			AY154463	CCDS12937.1	19q13.43	2008-02-05	2006-12-08	2006-12-08		ENSG00000179709		"""Nucleotide-binding domain and leucine rich repeat containing"""	22940	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 8"""	609659	"""NACHT, leucine rich repeat and PYD containing 8"""	NALP8		12563287	Standard	NM_176811		Approved	NOD16, PAN4, CLR19.2	uc002qmh.3	Q86W28		ENST00000291971.3:c.2069G>A	19.37:g.56473459G>A	ENSP00000291971:p.Arg690His		61165271	NM_176811	Q7RTR4	Missense_Mutation	SNP	ENST00000291971.3	37	CCDS12937.1	11	0.005036630036630037	3	0.006097560975609756	0	0.0	1	0.0017482517482517483	7	0.009234828496042216	G	0.035	-1.309582	0.01342	.	.	ENSG00000179709	ENST00000291971	D	0.87491	-2.26	1.94	-3.89	0.04193	.	.	.	.	.	T	0.49457	0.1558	N	0.01188	-0.97	0.09310	N	1	B;B	0.12013	0.004;0.005	B;B	0.12156	0.0;0.007	T	0.49322	-0.8952	9	0.15066	T	0.55	.	1.1247	0.01732	0.2558:0.1391:0.4092:0.1959	.	690;690	Q86W28-2;Q86W28	.;NALP8_HUMAN	H	690	ENSP00000291971:R690H	ENSP00000291971:R690H	R	+	2	0	NLRP8	61165271	0.006000	0.16342	0.000000	0.03702	0.003000	0.03518	-0.180000	0.09754	-1.976000	0.00996	-1.196000	0.01674	CGT		0.483	NLRP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457462.1	NM_176811	
CHMP2A	27243	broad.mit.edu	37	19	59063081	59063081	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr19:59063081C>A	ENST00000600118.1	-	5	1029	c.604G>T	c.(604-606)Gcc>Tcc	p.A202S	CHMP2A_ENST00000312547.2_Missense_Mutation_p.A202S|CHMP2A_ENST00000601220.1_Missense_Mutation_p.A202S			O43633	CHM2A_HUMAN	charged multivesicular body protein 2A	202	Interaction with VPS4B.				endosomal transport (GO:0016197)|establishment of protein localization (GO:0045184)|membrane organization (GO:0061024)|positive regulation of viral release from host cell (GO:1902188)|protein transport (GO:0015031)|regulation of viral process (GO:0050792)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	protein domain specific binding (GO:0019904)	p.A202S(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(2)	7		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.0434)|all cancers(4;1.39e-13)|Epithelial(4;1.01e-10)|OV - Ovarian serous cystadenocarcinoma(4;2.34e-09)|GBM - Glioblastoma multiforme(193;0.0102)|Lung(386;0.179)		AGGGCTGAGGCTGCGGCCTCT	0.607																																					p.A202S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G604T	19						.						53.0	61.0	58.0					19																	59063081		2203	4300	6503	63754893	SO:0001583	missense	27243	exon6			AF042384	CCDS12986.1	19q13.43	2014-09-04	2011-09-21		ENSG00000130724	ENSG00000130724		"""Charged multivesicular body proteins"""	30216	protein-coding gene	gene with protein product	"""putative breast adenocarcinoma marker (32kD)"", ""VPS2 homolog A (S. cerevisiae)"""	610893	"""chromatin modifying protein 2A"""			15173323, 11559748	Standard	XM_005258746		Approved	BC-2, CHMP2, VPS2, VPS2A	uc002qtk.3	O43633	OTTHUMG00000183547	ENST00000600118.1:c.604G>T	19.37:g.59063081C>A	ENSP00000469240:p.Ala202Ser		63754893	NM_198426	B2R4W6|Q3ZTT0	Missense_Mutation	SNP	ENST00000600118.1	37	CCDS12986.1	.	.	.	.	.	.	.	.	.	.	C	13.34	2.209360	0.39003	.	.	ENSG00000130724	ENST00000312547	T	0.77750	-1.12	4.83	4.83	0.62350	.	0.054879	0.64402	D	0.000001	T	0.57125	0.2032	N	0.08118	0	0.58432	D	0.999999	B	0.25904	0.137	B	0.11329	0.006	T	0.55755	-0.8091	10	0.12766	T	0.61	.	15.8263	0.78709	0.0:1.0:0.0:0.0	.	202	O43633	CHM2A_HUMAN	S	202	ENSP00000310440:A202S	ENSP00000310440:A202S	A	-	1	0	CHMP2A	63754893	0.997000	0.39634	0.868000	0.34077	0.691000	0.40173	3.646000	0.54396	2.686000	0.91538	0.650000	0.86243	GCC		0.607	CHMP2A-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467088.1	NM_014453	
VAV3	10451	broad.mit.edu	37	1	108507465	108507465	+	Silent	SNP	C	C	T			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr1:108507465C>T	ENST00000370056.4	-	1	301	c.27G>A	c.(25-27)caG>caA	p.Q9Q	VAV3-AS1_ENST00000438318.1_RNA|VAV3_ENST00000527011.1_Silent_p.Q9Q|VAV3_ENST00000371846.4_De_novo_Start_OutOfFrame	NM_006113.4	NP_006104.4	Q9UKW4	VAV3_HUMAN	vav 3 guanine nucleotide exchange factor	9	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|cellular response to DNA damage stimulus (GO:0006974)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cell adhesion (GO:0045785)|positive regulation of GTPase activity (GO:0043547)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of signal transduction (GO:0009967)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to drug (GO:0042493)|small GTPase mediated signal transduction (GO:0007264)|vesicle fusion (GO:0006906)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|SH3/SH2 adaptor activity (GO:0005070)	p.Q9Q(1)		NS(2)|breast(5)|endometrium(4)|kidney(2)|large_intestine(14)|lung(20)|ovary(6)|prostate(3)|stomach(1)|urinary_tract(1)	58		all_epithelial(167;5.38e-05)|all_lung(203;0.000314)|Lung NSC(277;0.000594)		Colorectal(144;0.0331)|Lung(183;0.128)|Epithelial(280;0.204)		GGATGAGCCACTGCGCGCACT	0.726																																					p.Q9Q												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G27A	1						.						49.0	40.0	43.0					1																	108507465		2203	4300	6503	108308988	SO:0001819	synonymous_variant	10451	exon1			AF118886	CCDS785.1, CCDS44181.1	1p13.3	2013-02-14	2007-07-25		ENSG00000134215	ENSG00000134215		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	12659	protein-coding gene	gene with protein product		605541	"""vav 3 oncogene"""				Standard	NM_001079874		Approved		uc001dvk.1	Q9UKW4	OTTHUMG00000010995	ENST00000370056.4:c.27G>A	1.37:g.108507465C>T			108308988	NM_006113	B1AMM0|B1APV5|B4E232|B7ZLR1|E9PQ97|O60498|O95230|Q9Y5X8	Silent	SNP	ENST00000370056.4	37	CCDS785.1	.	.	.	.	.	.	.	.	.	.	C	11.25	1.583715	0.28268	.	.	ENSG00000134215	ENST00000490388	.	.	.	4.77	1.67	0.24075	.	.	.	.	.	T	0.39489	0.1080	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.24476	-1.0159	4	.	.	.	.	6.7393	0.23426	0.0:0.6878:0.1455:0.1667	.	.	.	.	N	4	.	.	S	-	2	0	VAV3	108308988	0.948000	0.32251	1.000000	0.80357	0.992000	0.81027	0.051000	0.14141	0.464000	0.27142	0.456000	0.33151	AGT		0.726	VAV3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030242.2	NM_006113	
CLCN6	1185	broad.mit.edu	37	1	11889346	11889346	+	Silent	SNP	G	G	A	rs374880026		TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr1:11889346G>A	ENST00000346436.6	+	13	1267	c.1215G>A	c.(1213-1215)tcG>tcA	p.S405S	CLCN6_ENST00000376496.3_Silent_p.S405S|CLCN6_ENST00000376492.3_3'UTR|CLCN6_ENST00000376487.3_Silent_p.S383S|CLCN6_ENST00000312413.6_Missense_Mutation_p.E350K	NM_001286.3	NP_001277	P51797	CLCN6_HUMAN	chloride channel, voltage-sensitive 6	405					cell volume homeostasis (GO:0006884)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|response to mechanical stimulus (GO:0009612)|signal transduction (GO:0007165)|transmembrane transport (GO:0055085)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|voltage-gated chloride channel activity (GO:0005247)	p.S405S(1)		cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(12)|prostate(2)|skin(4)	36	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.13e-06)|COAD - Colon adenocarcinoma(227;0.000274)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.000816)|KIRC - Kidney renal clear cell carcinoma(229;0.00268)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0649)		TGTCCTCTTCGAGTCAAATCG	0.502																																					p.E350K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1048A	1						.	G	,LYS/GLU	0,4406		0,0,2203	219.0	198.0	205.0		1215,1048	-1.2	0.0	1		205	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,missense	CLCN6	NM_001286.2,NM_021736.2	,56	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,	405/870,350/354	11889346	1,13005	2203	4300	6503	11811933	SO:0001819	synonymous_variant	1185	exon12			X83378	CCDS138.1, CCDS57972.1	1p36	2012-09-26	2012-02-23		ENSG00000011021	ENSG00000011021		"""Ion channels / Chloride channels : Voltage-sensitive"""	2024	protein-coding gene	gene with protein product		602726	"""chloride channel 6"""			8543009	Standard	NM_001286		Approved	CLC-6, KIAA0046, ClC-6	uc001ate.5	P51797	OTTHUMG00000002299	ENST00000346436.6:c.1215G>A	1.37:g.11889346G>A			11811933	NM_021736	A8K1T4|B4DGT7|F8W9R3|O60818|O60819|O60820|O60821|P78520|P78521|Q17R81|Q5SNW2|Q5SNW3|Q5SNX1|Q5SNX2|Q5SNX3|Q99427|Q99428|Q99429	Missense_Mutation	SNP	ENST00000346436.6	37	CCDS138.1	.	.	.	.	.	.	.	.	.	.	G	10.71	1.425728	0.25639	0.0	1.16E-4	ENSG00000011021	ENST00000312413;ENST00000376492	D	0.92446	-3.04	5.83	-1.2	0.09554	.	.	.	.	.	D	0.85647	0.5745	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.74711	-0.3573	8	0.66056	D	0.02	-2.4379	7.0666	0.25156	0.3642:0.3015:0.3343:0.0	.	350	P51797-3	.	K	350	ENSP00000308367:E350K	ENSP00000308367:E350K	E	+	1	0	CLCN6	11811933	.	.	0.004000	0.12327	0.008000	0.06430	.	.	-0.097000	0.12307	-0.140000	0.14226	GAG		0.502	CLCN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006639.2	NM_001286	
VPS13D	55187	broad.mit.edu	37	1	12331175	12331175	+	Silent	SNP	T	T	C			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr1:12331175T>C	ENST00000358136.3	+	17	2227	c.2097T>C	c.(2095-2097)gaT>gaC	p.D699D	VPS13D_ENST00000356315.4_Silent_p.D699D	NM_015378.2	NP_056193.2			vacuolar protein sorting 13 homolog D (S. cerevisiae)									p.D699D(1)		NS(1)|breast(6)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(28)|lung(44)|ovary(5)|pancreas(1)|prostate(8)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(4)	130	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		TAGTGGGTGATTTCATTGTAA	0.458																																					p.D699D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T2097C	1						.						88.0	82.0	84.0					1																	12331175		2203	4300	6503	12253762	SO:0001819	synonymous_variant	55187	exon17			AJ608774	CCDS30588.1, CCDS30589.1	1p36.21	2008-02-05	2006-04-04		ENSG00000048707	ENSG00000048707			23595	protein-coding gene	gene with protein product		608877	"""vacuolar protein sorting 13D (yeast)"""				Standard	NM_015378		Approved	FLJ10619, KIAA0453	uc001atv.3	Q5THJ4	OTTHUMG00000013155	ENST00000358136.3:c.2097T>C	1.37:g.12331175T>C			12253762	NM_018156		Silent	SNP	ENST00000358136.3	37	CCDS30588.1																																																																																				0.458	VPS13D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000036897.2	NM_015378	
BCAS2	10286	broad.mit.edu	37	1	115113321	115113321	+	Splice_Site	SNP	C	C	T			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr1:115113321C>T	ENST00000369541.3	-	5	517	c.470G>A	c.(469-471)aGa>aAa	p.R157K	BCAS2_ENST00000485021.1_5'UTR	NM_005872.2	NP_005863.1	O75934	SPF27_HUMAN	breast carcinoma amplified sequence 2	157					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	cell junction (GO:0030054)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)		p.R157K(1)		biliary_tract(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(4)	13	all_epithelial(7;9.54e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		AACAATTTACCTTAACTTCTG	0.303																																					p.R157K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G470A	1						.						35.0	29.0	31.0					1																	115113321		2184	4292	6476	114914844	SO:0001630	splice_region_variant	10286	exon5			AB020623	CCDS874.1	1p13.2	2010-01-25			ENSG00000116752	ENSG00000116752			975	protein-coding gene	gene with protein product		605783				9731529, 10403562	Standard	NM_005872		Approved	DAM1, SPF27, Snt309	uc001efa.3	O75934	OTTHUMG00000011898	ENST00000369541.3:c.470+1G>A	1.37:g.115113321C>T			114914844	NM_005872	Q6FGS0	Missense_Mutation	SNP	ENST00000369541.3	37	CCDS874.1	.	.	.	.	.	.	.	.	.	.	C	18.31	3.595112	0.66219	.	.	ENSG00000116752	ENST00000369541	.	.	.	5.68	5.68	0.88126	.	0.000000	0.85682	D	0.000000	T	0.37945	0.1022	L	0.28115	0.83	0.80722	D	1	B	0.17268	0.021	B	0.17098	0.017	T	0.22173	-1.0224	8	.	.	.	-22.1505	20.1467	0.98079	0.0:1.0:0.0:0.0	.	157	O75934	SPF27_HUMAN	K	157	.	.	R	-	2	0	BCAS2	114914844	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	7.129000	0.77225	2.838000	0.97847	0.655000	0.94253	AGA		0.303	BCAS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032871.1	NM_005872	Missense_Mutation
HRNR	388697	broad.mit.edu	37	1	152188118	152188118	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr1:152188118C>A	ENST00000368801.2	-	3	6062	c.5987G>T	c.(5986-5988)cGc>cTc	p.R1996L	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	1996					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)	p.R1996L(1)		autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTGTCCTGAGCGAGACTCTCG	0.567																																					p.R1996L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G5987T	1						.						15.0	23.0	21.0					1																	152188118		1514	3278	4792	150454742	SO:0001583	missense	388697	exon3			AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.5987G>T	1.37:g.152188118C>A	ENSP00000357791:p.Arg1996Leu		150454742	NM_001009931	Q5DT20|Q5U1F4	Missense_Mutation	SNP	ENST00000368801.2	37	CCDS30859.1	.	.	.	.	.	.	.	.	.	.	C	7.165	0.586458	0.13749	.	.	ENSG00000197915	ENST00000368801	T	0.02369	4.32	3.39	-2.43	0.06522	.	.	.	.	.	T	0.00580	0.0019	L	0.38175	1.15	0.09310	N	1	B	0.17465	0.022	B	0.09377	0.004	T	0.48328	-0.9045	9	0.21014	T	0.42	.	0.8288	0.01126	0.1527:0.2386:0.2994:0.3093	.	1996	Q86YZ3	HORN_HUMAN	L	1996	ENSP00000357791:R1996L	ENSP00000357791:R1996L	R	-	2	0	HRNR	150454742	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.278000	0.18753	-0.350000	0.08262	0.505000	0.49811	CGC		0.567	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034016.1	XM_373868	
KCNN3	3782	broad.mit.edu	37	1	154841979	154841979	+	Silent	SNP	C	C	A			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr1:154841979C>A	ENST00000271915.4	-	1	777	c.462G>T	c.(460-462)cgG>cgT	p.R154R	KCNN3_ENST00000358505.2_5'Flank	NM_001204087.1|NM_002249.5	NP_001191016.1|NP_002240.3	Q9UGI6	KCNN3_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3	159					potassium ion transmembrane transport (GO:0071805)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)	p.R154R(1)		cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(11)|prostate(4)|skin(1)	28	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)		Miconazole(DB01110)|Procaine(DB00721)	CCTGTCGGTGCCGGCTGCCTC	0.632																																					p.R154R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G462T	1						.						29.0	32.0	31.0					1																	154841979		2202	4299	6501	153108603	SO:0001819	synonymous_variant	3782	exon1			AF031815	CCDS1072.1, CCDS30880.1, CCDS72928.1	1q21.3	2012-07-05			ENSG00000143603	ENSG00000143603		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6292	protein-coding gene	gene with protein product		602983				9491810, 16382103	Standard	NM_002249		Approved	KCa2.3, hSK3, SKCA3	uc021pah.1	Q9UGI6	OTTHUMG00000037260	ENST00000271915.4:c.462G>T	1.37:g.154841979C>A			153108603	NM_002249	B1ANX0|O43517|Q86VF9|Q8WXG7	Silent	SNP	ENST00000271915.4	37	CCDS30880.1																																																																																				0.632	KCNN3-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090688.3	NM_002249	
AGMAT	79814	broad.mit.edu	37	1	15901300	15901300	+	Missense_Mutation	SNP	C	C	T	rs199886325		TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr1:15901300C>T	ENST00000375826.3	-	6	1079	c.937G>A	c.(937-939)Gtg>Atg	p.V313M	DNAJC16_ENST00000375849.1_3'UTR|DNAJC16_ENST00000483270.1_3'UTR	NM_024758.4	NP_079034.3	Q9BSE5	SPEB_HUMAN	agmatine ureohydrolase (agmatinase)	313					agmatine biosynthetic process (GO:0097055)|cellular nitrogen compound metabolic process (GO:0034641)|polyamine metabolic process (GO:0006595)|putrescine biosynthetic process from arginine (GO:0033388)|small molecule metabolic process (GO:0044281)|spermidine biosynthetic process (GO:0008295)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	agmatinase activity (GO:0008783)|metal ion binding (GO:0046872)	p.V313M(2)		endometrium(1)|kidney(2)|large_intestine(6)|lung(2)|skin(1)	12		Breast(348;0.000207)|Colorectal(325;0.000258)|Lung NSC(340;0.000359)|all_lung(284;0.000486)|Renal(390;0.000518)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.93e-07)|COAD - Colon adenocarcinoma(227;3.91e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000121)|KIRC - Kidney renal clear cell carcinoma(229;0.00257)|STAD - Stomach adenocarcinoma(313;0.00734)|READ - Rectum adenocarcinoma(331;0.0649)		CAGCCCATCACGTTCAGGCCT	0.463													C|||	1	0.000199681	0.0	0.0	5008	,	,		21008	0.001		0.0	False		,,,				2504	0.0				p.V313M	NSCLC(126;1678 1780 25805 43508 49531)											.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G937A	1						.						126.0	106.0	113.0					1																	15901300		2203	4300	6503	15773887	SO:0001583	missense	79814	exon6			AY057097	CCDS160.1	1p36.13	2009-01-05			ENSG00000116771	ENSG00000116771			18407	protein-coding gene	gene with protein product						11804860, 14648699, 11914032	Standard	NM_024758		Approved	FLJ23384	uc001awv.2	Q9BSE5	OTTHUMG00000002357	ENST00000375826.3:c.937G>A	1.37:g.15901300C>T	ENSP00000364986:p.Val313Met		15773887	NM_024758	Q5TDH1|Q9H5J3	Missense_Mutation	SNP	ENST00000375826.3	37	CCDS160.1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	C	15.23	2.771109	0.49680	.	.	ENSG00000116771	ENST00000375826	D	0.86366	-2.11	5.93	3.02	0.34903	Ureohydrolase domain (1);	0.245141	0.41605	D	0.000852	D	0.86814	0.6023	M	0.81179	2.53	0.39136	D	0.961941	B	0.25521	0.128	B	0.35770	0.21	D	0.83799	0.0235	10	0.54805	T	0.06	-21.7355	5.5346	0.17003	0.1508:0.6384:0.0:0.2109	.	313	Q9BSE5	SPEB_HUMAN	M	313	ENSP00000364986:V313M	ENSP00000364986:V313M	V	-	1	0	AGMAT	15773887	0.866000	0.29940	0.974000	0.42286	0.954000	0.61252	0.971000	0.29396	0.822000	0.34565	0.603000	0.83216	GTG		0.463	AGMAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006763.1	NM_024758	
FCRL2	79368	broad.mit.edu	37	1	157737124	157737124	+	Silent	SNP	G	G	T			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr1:157737124G>T	ENST00000361516.3	-	6	1107	c.1059C>A	c.(1057-1059)tcC>tcA	p.S353S	FCRL2_ENST00000469986.1_Silent_p.S100S|FCRL2_ENST00000368181.4_Intron|FCRL2_ENST00000392274.3_Silent_p.S353S	NM_030764.3	NP_110391.2	Q96LA5	FCRL2_HUMAN	Fc receptor-like 2	353	Ig-like C2-type 4.				cell-cell signaling (GO:0007267)|positive regulation of signal transduction (GO:0009967)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)	p.S353S(1)|p.S100S(1)		central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(29)|ovary(1)|pancreas(1)|prostate(3)|skin(2)	51	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			AGAGGTTGAAGGAGGCCCCTC	0.567																																					p.S353S												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C1059A	1						.						76.0	83.0	81.0					1																	157737124		2203	4300	6503	156003748	SO:0001819	synonymous_variant	79368	exon6			AF319438	CCDS1168.1	1q23.1	2013-01-14	2002-01-14	2005-03-23	ENSG00000132704	ENSG00000132704		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14875	protein-coding gene	gene with protein product		606509	"""SH2 domain-containing phosphatase anchor protein 1"""	SPAP1		11162587	Standard	NM_030764		Approved	FCRH2, IRTA4, CD307b	uc001fre.2	Q96LA5	OTTHUMG00000019399	ENST00000361516.3:c.1059C>A	1.37:g.157737124G>T			156003748	NM_030764	A0N0M5|A1L307|A6NMS0|Q6NTA1|Q9BZI4|Q9BZI5|Q9BZI6	Silent	SNP	ENST00000361516.3	37	CCDS1168.1																																																																																				0.567	FCRL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051408.2	NM_030764	
SPEN	23013	broad.mit.edu	37	1	16264407	16264408	+	Missense_Mutation	DNP	CC	CC	AT			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	CC	CC					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr1:16264407_16264408CC>AT	ENST00000375759.3	+	13	10814_10815	c.10610_10611CC>AT	c.(10609-10611)tCC>tAT	p.S3537Y		NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	3537	SPOC. {ECO:0000255|PROSITE- ProRule:PRU00249}.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)	p.S3537>?(1)		NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		GCCCATCGGTCCCTGCCCCTTT	0.619																																					.												.	.	1	Complex(1)	large_intestine(1)	c.10610_10611AT	1						.																																			16136995	SO:0001583	missense	23013	exon13				CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	Exception_encountered	1.37:g.16264407_16264408delinsAT	ENSP00000364912:p.Ser3537Tyr		16136994	NM_015001	Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Missense_Mutation	DNP	ENST00000375759.3	37	CCDS164.1																																																																																				0.619	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025993.1	NM_015001	
NIT1	4817	broad.mit.edu	37	1	161089332	161089332	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr1:161089332C>G	ENST00000368009.2	+	4	463	c.387C>G	c.(385-387)ttC>ttG	p.F129L	PFDN2_ENST00000368010.3_5'Flank|NIT1_ENST00000496861.1_3'UTR|PFDN2_ENST00000468311.1_5'Flank|NIT1_ENST00000368008.1_Missense_Mutation_p.F129L|NIT1_ENST00000392190.5_Missense_Mutation_p.F93L|NIT1_ENST00000368007.4_Missense_Mutation_p.F114L|DEDD_ENST00000489249.1_5'Flank	NM_005600.2	NP_005591.1	Q86X76	NIT1_HUMAN	nitrilase 1	129	CN hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00054}.				nitrogen compound metabolic process (GO:0006807)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	nitrilase activity (GO:0000257)	p.F129L(1)		NS(1)|breast(2)|endometrium(2)|large_intestine(3)|lung(3)|prostate(1)	12	all_cancers(52;3.39e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00165)			TGGGTGGTTTCCATGAGCGTG	0.517											OREG0013937	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.F129L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C387G	1						.						75.0	69.0	71.0					1																	161089332		2203	4300	6503	159355956	SO:0001583	missense	4817	exon4			AF069984	CCDS1218.1, CCDS53401.1, CCDS53402.1, CCDS53403.1	1q21-q22	2008-05-14			ENSG00000158793	ENSG00000158793			7828	protein-coding gene	gene with protein product		604618				9671749	Standard	NM_005600		Approved		uc001fxv.2	Q86X76	OTTHUMG00000031473	ENST00000368009.2:c.387C>G	1.37:g.161089332C>G	ENSP00000356988:p.Phe129Leu	1814	159355956	NM_001185092	B1AQP3|D3DVF4|O76091	Missense_Mutation	SNP	ENST00000368009.2	37	CCDS1218.1	.	.	.	.	.	.	.	.	.	.	C	13.83	2.354884	0.41700	.	.	ENSG00000158793	ENST00000368009;ENST00000368007;ENST00000368008;ENST00000392190	D;D;D;D	0.87103	-1.94;-1.94;-2.21;-1.94	4.67	3.68	0.42216	Nitrilase/cyanide hydratase and apolipoprotein N-acyltransferase (4);	0.000000	0.85682	D	0.000000	T	0.72011	0.3408	L	0.37750	1.13	0.53005	D	0.999969	B;B;B	0.31640	0.285;0.211;0.333	B;B;B	0.39660	0.132;0.208;0.306	T	0.66995	-0.5782	10	0.10902	T	0.67	-13.7426	9.5928	0.39557	0.0:0.8881:0.0:0.1119	.	114;129;129	Q86X76-4;B1AQP4;Q86X76	.;.;NIT1_HUMAN	L	129;114;129;93	ENSP00000356988:F129L;ENSP00000356986:F114L;ENSP00000356987:F129L;ENSP00000376028:F93L	ENSP00000356986:F114L	F	+	3	2	NIT1	159355956	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.000000	0.49481	2.421000	0.82119	0.467000	0.42956	TTC		0.517	NIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077060.1		
TSEN15	116461	broad.mit.edu	37	1	184041328	184041328	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr1:184041328G>A	ENST00000361641.1	+	4	470	c.391G>A	c.(391-393)Ggt>Agt	p.G131S	TSEN15_ENST00000533373.1_Splice_Site_p.E131K|TSEN15_ENST00000423085.2_Intron	NM_052965.2	NP_443197.1	Q8WW01	SEN15_HUMAN	TSEN15 tRNA splicing endonuclease subunit	131					mRNA processing (GO:0006397)|tRNA splicing, via endonucleolytic cleavage and ligation (GO:0006388)	nucleus (GO:0005634)	tRNA-intron endonuclease activity (GO:0000213)	p.G131S(1)		breast(1)|kidney(3)|large_intestine(2)|lung(2)	8						AAAGTTGCAAGGTGATCCAGA	0.398																																					p.G131S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G391A	1						.						147.0	136.0	140.0					1																	184041328		2203	4300	6503	182307951	SO:0001583	missense	116461	exon4			AF288394	CCDS1361.1, CCDS44286.1, CCDS72993.1	1q25	2013-08-06	2013-08-06	2008-06-12	ENSG00000198860	ENSG00000198860		"""tRNA splicing endonuclease subunits"""	16791	protein-coding gene	gene with protein product		608756	"""chromosome 1 open reading frame 19"", ""tRNA splicing endonuclease 15 homolog (S. cerevisiae)"""	C1orf19		11318611, 17166513	Standard	XM_006711148		Approved		uc001gqt.4	Q8WW01	OTTHUMG00000035461	ENST00000361641.1:c.391G>A	1.37:g.184041328G>A	ENSP00000355299:p.Gly131Ser		182307951	NM_052965	B4DKP0|Q9BZQ5	Missense_Mutation	SNP	ENST00000361641.1	37	CCDS1361.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.61|12.61	1.988651|1.988651	0.35131|0.35131	.|.	.|.	ENSG00000198860|ENSG00000198860	ENST00000533373|ENST00000361641	T|T	0.31769|0.43688	1.48|0.94	5.95|5.95	2.76|2.76	0.32466|0.32466	.|.	.|0.718988	.|0.13135	.|N	.|0.411138	T|T	0.15089|0.15089	0.0364|0.0364	N|N	0.03608|0.03608	-0.345|-0.345	0.09310|0.09310	N|N	0.999999|0.999999	.|B	.|0.02656	.|0.0	.|B	.|0.01281	.|0.0	T|T	0.29971|0.29971	-0.9994|-0.9994	7|10	0.87932|0.07813	D|T	0|0.8	-5.4584|-5.4584	4.4128|4.4128	0.11441|0.11441	0.0843:0.1527:0.6054:0.1576|0.0843:0.1527:0.6054:0.1576	.|.	.|131	.|Q8WW01	.|SEN15_HUMAN	K|S	131|131	ENSP00000436996:E131K|ENSP00000355299:G131S	ENSP00000436996:E131K|ENSP00000355299:G131S	E|G	+|+	1|1	0|0	TSEN15|TSEN15	182307951|182307951	0.831000|0.831000	0.29352|0.29352	0.605000|0.605000	0.28930|0.28930	0.989000|0.989000	0.77384|0.77384	1.563000|1.563000	0.36364|0.36364	1.530000|1.530000	0.49136|0.49136	0.655000|0.655000	0.94253|0.94253	GAA|GGT		0.398	TSEN15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086132.1		
HMCN1	83872	broad.mit.edu	37	1	186092143	186092143	+	Missense_Mutation	SNP	C	C	T	rs370916387		TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr1:186092143C>T	ENST00000271588.4	+	81	12519	c.12290C>T	c.(12289-12291)aCg>aTg	p.T4097M	HMCN1_ENST00000367492.2_Missense_Mutation_p.T4097M	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	4097	Ig-like C2-type 40.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)	p.T4097M(1)		NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						AAGCCCATCACGTTATCCTGT	0.433																																					p.T4097M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C12290T	1						.	C	MET/THR	0,4406		0,0,2203	116.0	97.0	103.0		12290	-1.2	0.0	1		103	1,8599	1.2+/-3.3	0,1,4299	no	missense	HMCN1	NM_031935.2	81	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	4097/5636	186092143	1,13005	2203	4300	6503	184358766	SO:0001583	missense	83872	exon81			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.12290C>T	1.37:g.186092143C>T	ENSP00000271588:p.Thr4097Met		184358766	NM_031935	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	ENST00000271588.4	37	CCDS30956.1	.	.	.	.	.	.	.	.	.	.	C	3.752	-0.051329	0.07407	0.0	1.16E-4	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.68181	-0.31;-0.31	5.85	-1.22	0.09494	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.637600	0.17373	N	0.176594	T	0.59404	0.2191	M	0.66378	2.025	0.09310	N	1	B	0.20261	0.043	B	0.15484	0.013	T	0.50259	-0.8849	10	0.38643	T	0.18	.	10.6051	0.45390	0.0:0.4481:0.0:0.5519	.	4097	Q96RW7	HMCN1_HUMAN	M	4097	ENSP00000271588:T4097M;ENSP00000356462:T4097M	ENSP00000271588:T4097M	T	+	2	0	HMCN1	184358766	0.036000	0.19791	0.000000	0.03702	0.027000	0.11550	0.404000	0.20999	-0.525000	0.06391	-0.302000	0.09304	ACG		0.433	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935	
PTPN14	5784	broad.mit.edu	37	1	214549706	214549706	+	Silent	SNP	C	C	T	rs146527644	byFrequency	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr1:214549706C>T	ENST00000366956.5	-	15	2957	c.2763G>A	c.(2761-2763)gcG>gcA	p.A921A	PTPN14_ENST00000543945.1_3'UTR	NM_005401.4	NP_005392.2	Q15678	PTN14_HUMAN	protein tyrosine phosphatase, non-receptor type 14	921	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				lymphangiogenesis (GO:0001946)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of protein export from nucleus (GO:0046825)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)	p.A921A(1)		NS(2)|breast(3)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(9)|liver(3)|lung(21)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	58				OV - Ovarian serous cystadenocarcinoma(81;0.00181)|all cancers(67;0.00194)|Epithelial(68;0.0157)|GBM - Glioblastoma multiforme(131;0.155)		AAATGCCATTCGCCTTTTTCT	0.463																																					p.A921A	Colon(92;557 1424 24372 34121 40073)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2763A	1						.						171.0	165.0	167.0					1																	214549706		2203	4300	6503	212616329	SO:0001819	synonymous_variant	5784	exon15			X82676	CCDS1514.1	1q32.2	2011-06-09			ENSG00000152104	ENSG00000152104		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9647	protein-coding gene	gene with protein product		603155				7733990	Standard	NM_005401		Approved	PEZ	uc001hkk.2	Q15678	OTTHUMG00000037039	ENST00000366956.5:c.2763G>A	1.37:g.214549706C>T			212616329	NM_005401	Q5VSI0	Silent	SNP	ENST00000366956.5	37	CCDS1514.1																																																																																				0.463	PTPN14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089918.2	NM_005401	
ACOT7	11332	broad.mit.edu	37	1	6393599	6393599	+	Silent	SNP	G	G	A			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr1:6393599G>A	ENST00000377855.2	-	4	624	c.478C>T	c.(478-480)Ctg>Ttg	p.L160L	ACOT7_ENST00000377842.3_Silent_p.L109L|ACOT7_ENST00000361521.4_Silent_p.L150L|ACOT7_ENST00000377845.3_Silent_p.L130L|ACOT7_ENST00000541130.1_Silent_p.L130L|ACOT7_ENST00000545482.1_Silent_p.L45L|ACOT7_ENST00000608083.1_Silent_p.L118L	NM_181864.2	NP_863654.1	O00154	BACH_HUMAN	acyl-CoA thioesterase 7	160					coenzyme A biosynthetic process (GO:0015937)|fatty acid catabolic process (GO:0009062)|long-chain fatty-acyl-CoA catabolic process (GO:0036116)|medium-chain fatty acid biosynthetic process (GO:0051792)|medium-chain fatty-acyl-CoA catabolic process (GO:0036114)|palmitic acid biosynthetic process (GO:1900535)	cell body (GO:0044297)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)	carboxylic ester hydrolase activity (GO:0052689)|fatty-acyl-CoA binding (GO:0000062)|long-chain fatty acyl-CoA binding (GO:0036042)|palmitoyl-CoA hydrolase activity (GO:0016290)|protein homodimerization activity (GO:0042803)	p.L150L(1)		kidney(1)|large_intestine(3)|lung(10)|pancreas(1)|prostate(1)	16	Ovarian(185;0.0634)|all_lung(157;0.175)	all_cancers(23;1.42e-38)|all_epithelial(116;3.96e-23)|all_lung(118;3.69e-08)|Lung NSC(185;8.52e-07)|all_hematologic(16;6.92e-06)|Colorectal(325;4.53e-05)|Acute lymphoblastic leukemia(12;5e-05)|all_neural(13;0.000164)|Breast(487;0.000688)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0393)|Medulloblastoma(700;0.211)		Epithelial(90;9.16e-37)|GBM - Glioblastoma multiforme(13;5.89e-29)|OV - Ovarian serous cystadenocarcinoma(86;7.63e-19)|Colorectal(212;1.27e-07)|COAD - Colon adenocarcinoma(227;2.06e-05)|Kidney(185;7.74e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00129)|BRCA - Breast invasive adenocarcinoma(365;0.00132)|STAD - Stomach adenocarcinoma(132;0.00195)|READ - Rectum adenocarcinoma(331;0.0481)		ACATACCACAGGGTGGCCTTA	0.547																																					p.L160L	GBM(74;673 1226 4974 11850 13190)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C478T	1						.						178.0	153.0	161.0					1																	6393599		2203	4300	6503	6316186	SO:0001819	synonymous_variant	11332	exon4			AB074417	CCDS65.1, CCDS66.1, CCDS67.1, CCDS30573.1	1p36	2008-08-14			ENSG00000097021	ENSG00000097021		"""Acyl CoA thioesterases"""	24157	protein-coding gene	gene with protein product	"""brain acyl CoA hydrolase"""	602587				10578051, 16103133, 16940157	Standard	XM_005263427		Approved	BACH, ACH1, ACT, CTE-II, LACH1, MGC1126, hBACH	uc001amt.3	O00154	OTTHUMG00000001295	ENST00000377855.2:c.478C>T	1.37:g.6393599G>A			6316186	NM_181864	A8K0K7|A8K232|A8K6B8|A8K837|B3KQ12|O43703|Q53Y78|Q5JYL2|Q5JYL3|Q5JYL4|Q5JYL5|Q5JYL6|Q5TGR4|Q9UJM9|Q9Y539|Q9Y540	Silent	SNP	ENST00000377855.2	37	CCDS65.1																																																																																				0.547	ACOT7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000003773.1	NM_007274	
PUM1	9698	broad.mit.edu	37	1	31426732	31426732	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr1:31426732G>A	ENST00000257075.5	-	15	2513	c.2420C>T	c.(2419-2421)cCg>cTg	p.P807L	PUM1_ENST00000373747.3_Missense_Mutation_p.P808L|PUM1_ENST00000423018.2_Missense_Mutation_p.P663L|PUM1_ENST00000440538.2_Missense_Mutation_p.P781L|PUM1_ENST00000424085.2_Missense_Mutation_p.P565L|PUM1_ENST00000373741.4_Missense_Mutation_p.P843L|PUM1_ENST00000373742.2_Missense_Mutation_p.P748L|PUM1_ENST00000426105.2_Missense_Mutation_p.P807L	NM_014676.2	NP_055491.1	Q14671	PUM1_HUMAN	pumilio RNA-binding family member 1	807	Ser-rich.				membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of translation (GO:0006417)	cytosol (GO:0005829)	poly(A) RNA binding (GO:0044822)	p.P807L(1)		breast(1)|central_nervous_system(2)|endometrium(8)|kidney(4)|large_intestine(8)|lung(17)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	48		Colorectal(325;0.0211)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|all_neural(195;0.0381)|Breast(348;0.0848)|Medulloblastoma(700;0.123)		STAD - Stomach adenocarcinoma(196;0.0232)|READ - Rectum adenocarcinoma(331;0.0681)		AGTGCTGCTCGGGCTGAAGAG	0.537																																					p.P807L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2420T	1						.						122.0	128.0	126.0					1																	31426732		2203	4300	6503	31199319	SO:0001583	missense	9698	exon15			AF315592	CCDS338.1, CCDS44099.1	1p35.2	2013-09-02	2013-09-02		ENSG00000134644	ENSG00000134644			14957	protein-coding gene	gene with protein product		607204	"""pumilio (Drosophila) homolog 1"", ""pumilio homolog 1 (Drosophila)"""				Standard	NM_001020658		Approved	PUMH1, KIAA0099	uc001bsh.1	Q14671	OTTHUMG00000003795	ENST00000257075.5:c.2420C>T	1.37:g.31426732G>A	ENSP00000257075:p.Pro807Leu		31199319	NM_001020658	A8K6W4|B4DG92|D3DPN3|E9PCJ0|Q53HH5|Q5VXY7|Q9HAN1	Missense_Mutation	SNP	ENST00000257075.5	37	CCDS338.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.173761	0.78452	.	.	ENSG00000134644	ENST00000424085;ENST00000257075;ENST00000373747;ENST00000373749;ENST00000426105;ENST00000440538;ENST00000373741;ENST00000423018;ENST00000373742	T;T;T;T;T;T;T;T	0.19394	2.19;2.15;2.43;2.43;2.47;2.42;2.47;2.17	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.26846	0.0657	L	0.51422	1.61	0.80722	D	1	P;D;P;P;P;P;P;P	0.55800	0.898;0.973;0.898;0.947;0.755;0.607;0.755;0.755	B;B;B;P;B;B;B;B	0.46510	0.29;0.394;0.201;0.519;0.189;0.069;0.126;0.189	T	0.02026	-1.1227	10	0.12103	T	0.63	-8.0362	19.8132	0.96556	0.0:0.0:1.0:0.0	.	748;663;843;781;807;807;808;807	B4DG92;E7EWT3;Q5T1Z8;Q14671-2;Q14671;E9PCJ0;Q5T1Z4;Q53HH5	.;.;.;.;PUM1_HUMAN;.;.;.	L	565;807;808;545;807;781;843;663;748	ENSP00000400141:P565L;ENSP00000257075:P807L;ENSP00000362852:P808L;ENSP00000391723:P807L;ENSP00000401777:P781L;ENSP00000362846:P843L;ENSP00000399440:P663L;ENSP00000362847:P748L	ENSP00000257075:P807L	P	-	2	0	PUM1	31199319	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.753000	0.98904	2.785000	0.95823	0.655000	0.94253	CCG		0.537	PUM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000010671.1		
MACF1	23499	broad.mit.edu	37	1	39853736	39853736	+	Silent	SNP	G	G	A			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr1:39853736G>A	ENST00000372915.3	+	57	15324	c.15237G>A	c.(15235-15237)caG>caA	p.Q5079Q	MACF1_ENST00000539005.1_Silent_p.Q2991Q|MACF1_ENST00000567887.1_Silent_p.Q5111Q|MACF1_ENST00000361689.2_Silent_p.Q3012Q|MACF1_ENST00000289893.4_Silent_p.Q3514Q|MACF1_ENST00000317713.7_Silent_p.Q3012Q|MACF1_ENST00000545844.1_Silent_p.Q3012Q|MACF1_ENST00000564288.1_Silent_p.Q5074Q			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	5079					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)	p.Q3012Q(1)|p.Q3514Q(1)		breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			ACTTTACTCAGGGTCTGGTAG	0.507																																					p.Q3012Q												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G9036A	1						.						50.0	52.0	51.0					1																	39853736		2203	4300	6503	39626323	SO:0001819	synonymous_variant	23499	exon54			AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.15237G>A	1.37:g.39853736G>A			39626323	NM_012090	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Silent	SNP	ENST00000372915.3	37		.	.	.	.	.	.	.	.	.	.	G	2.402	-0.337330	0.05278	.	.	ENSG00000127603	ENST00000372925	.	.	.	6.03	4.17	0.49024	.	.	.	.	.	T	0.59238	0.2179	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.55192	-0.8179	4	.	.	.	.	9.019	0.36188	0.2929:0.0:0.7071:0.0	.	.	.	.	R	2125	.	.	G	+	1	0	MACF1	39626323	0.870000	0.30015	0.994000	0.49952	0.944000	0.59088	1.159000	0.31749	0.887000	0.36136	-0.137000	0.14449	GGG		0.507	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000392096.1	NM_033044	
LRP8	7804	broad.mit.edu	37	1	53746321	53746321	+	Missense_Mutation	SNP	G	G	A	rs147119774		TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr1:53746321G>A	ENST00000306052.6	-	4	535	c.434C>T	c.(433-435)tCg>tTg	p.S145L	LRP8_ENST00000347547.2_Missense_Mutation_p.S145L|LRP8_ENST00000354412.3_Missense_Mutation_p.S145L|LRP8_ENST00000465675.1_5'UTR|LRP8_ENST00000371454.2_Missense_Mutation_p.S145L	NM_004631.4	NP_004622.2	Q14114	LRP8_HUMAN	low density lipoprotein receptor-related protein 8, apolipoprotein e receptor	145	LDL-receptor class A 3. {ECO:0000255|PROSITE-ProRule:PRU00124}.				ammon gyrus development (GO:0021541)|blood coagulation (GO:0007596)|cellular response to cholesterol (GO:0071397)|cellular response to growth factor stimulus (GO:0071363)|cytokine-mediated signaling pathway (GO:0019221)|endocytosis (GO:0006897)|layer formation in cerebral cortex (GO:0021819)|lipid metabolic process (GO:0006629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|phototransduction, visible light (GO:0007603)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendrite development (GO:1900006)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein tyrosine kinase activity (GO:0061098)|proteolysis (GO:0006508)|receptor-mediated endocytosis (GO:0006898)|reelin-mediated signaling pathway (GO:0038026)|regulation of synaptic transmission (GO:0050804)|response to drug (GO:0042493)|retinoid metabolic process (GO:0001523)|signal transduction (GO:0007165)	caveola (GO:0005901)|dendrite (GO:0030425)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|high-density lipoprotein particle binding (GO:0008035)|reelin receptor activity (GO:0038025)|transmembrane signaling receptor activity (GO:0004888)|very-low-density lipoprotein particle receptor activity (GO:0030229)	p.S145L(1)		endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|prostate(2)|skin(1)	21						GCAGCGCCACGAGGCAGGTAC	0.612																																					p.S145L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C434T	1						.	G	LEU/SER,LEU/SER,LEU/SER,LEU/SER	0,4406		0,0,2203	103.0	81.0	89.0		434,434,434,434	4.3	0.6	1	dbSNP_134	89	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense	LRP8	NM_001018054.2,NM_004631.4,NM_017522.4,NM_033300.3	145,145,145,145	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging	145/905,145/964,145/701,145/794	53746321	1,13005	2203	4300	6503	53518909	SO:0001583	missense	7804	exon4			D50678	CCDS578.1, CCDS579.1, CCDS580.1, CCDS30720.1	1p32.3	2013-05-29			ENSG00000157193	ENSG00000157193		"""Low density lipoprotein receptors"""	6700	protein-coding gene	gene with protein product		602600				8626535, 9079678	Standard	NM_004631		Approved	APOER2, MCI1, LRP-8, HSZ75190	uc001cvi.2	Q14114	OTTHUMG00000008924	ENST00000306052.6:c.434C>T	1.37:g.53746321G>A	ENSP00000303634:p.Ser145Leu		53518909	NM_017522	B1AMT6|B1AMT7|B1AMT8|O14968|Q86V27|Q99876|Q9BR78	Missense_Mutation	SNP	ENST00000306052.6	37	CCDS578.1	.	.	.	.	.	.	.	.	.	.	G	19.51	3.841991	0.71488	0.0	1.16E-4	ENSG00000157193	ENST00000306052;ENST00000371454;ENST00000354412;ENST00000347547	D;D;D;D	0.95622	-3.76;-3.76;-3.76;-3.76	4.26	4.26	0.50523	Low-density lipoprotein (LDL) receptor class A, conserved site (1);	.	.	.	.	D	0.96084	0.8724	L	0.50993	1.605	0.20563	N	0.999886	P;P;D;D	0.63880	0.913;0.886;0.993;0.981	B;B;D;P	0.63488	0.257;0.22;0.915;0.657	D	0.90373	0.4382	9	0.17832	T	0.49	.	15.982	0.80116	0.0:0.0:1.0:0.0	.	145;145;145;145	Q14114-2;Q14114-4;Q14114-3;Q14114	.;.;.;LRP8_HUMAN	L	145	ENSP00000303634:S145L;ENSP00000360509:S145L;ENSP00000346391:S145L;ENSP00000334522:S145L	ENSP00000303634:S145L	S	-	2	0	LRP8	53518909	0.169000	0.23002	0.576000	0.28549	0.894000	0.52154	2.517000	0.45529	2.400000	0.81607	0.561000	0.74099	TCG		0.612	LRP8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000024699.1	NM_004631	
ST6GALNAC5	81849	broad.mit.edu	37	1	77510258	77510258	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr1:77510258C>A	ENST00000477717.1	+	3	866	c.631C>A	c.(631-633)Cag>Aag	p.Q211K		NM_030965.1	NP_112227.1	Q9BVH7	SIA7E_HUMAN	ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 5	211					glycosphingolipid biosynthetic process (GO:0006688)|oligosaccharide biosynthetic process (GO:0009312)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	integral component of Golgi membrane (GO:0030173)	alpha-N-acetylgalactosaminide alpha-2,6-sialyltransferase activity (GO:0001665)|sialyltransferase activity (GO:0008373)	p.Q211K(2)		endometrium(2)|kidney(1)|large_intestine(6)|lung(5)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)	18						CAAGATGCTGCAGTTTGATGA	0.567																																					p.Q211K												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.C631A	1						.						117.0	118.0	118.0					1																	77510258		2203	4300	6503	77282846	SO:0001583	missense	81849	exon3				CCDS673.1	1p31.1	2013-03-01	2005-02-07	2005-02-07	ENSG00000117069	ENSG00000117069		"""Sialyltransferases"""	19342	protein-coding gene	gene with protein product		610134	"""sialyltransferase 7 ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltransferase) E"""	SIAT7E		10521438, 10601645	Standard	NM_030965		Approved	MGC3184, ST6GalNAcV	uc001dhi.3	Q9BVH7	OTTHUMG00000009687	ENST00000477717.1:c.631C>A	1.37:g.77510258C>A	ENSP00000417583:p.Gln211Lys		77282846	NM_030965	B1AK82	Missense_Mutation	SNP	ENST00000477717.1	37	CCDS673.1	.	.	.	.	.	.	.	.	.	.	C	5.766	0.325713	0.10900	.	.	ENSG00000117069	ENST00000477717;ENST00000438953	T	0.28666	1.6	5.46	5.46	0.80206	.	0.208574	0.51477	D	0.000096	T	0.12347	0.0300	N	0.16307	0.4	0.58432	D	0.999998	B	0.06786	0.001	B	0.17722	0.019	T	0.05500	-1.0881	10	0.29301	T	0.29	-36.9101	19.307	0.94167	0.0:1.0:0.0:0.0	.	211	Q9BVH7	SIA7E_HUMAN	K	211;121	ENSP00000417583:Q211K	ENSP00000436263:Q211K	Q	+	1	0	ST6GALNAC5	77282846	1.000000	0.71417	1.000000	0.80357	0.764000	0.43329	5.947000	0.70242	2.543000	0.85770	0.655000	0.94253	CAG		0.567	ST6GALNAC5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026692.2	NM_030965	
ESRRG	2104	broad.mit.edu	37	1	216896586	216896586	+	Splice_Site	SNP	T	T	C			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr1:216896586T>C	ENST00000408911.3	-	1	209	c.56A>G	c.(55-57)gAg>gGg	p.E19G	ESRRG_ENST00000366938.2_Intron|ESRRG_ENST00000391890.3_5'UTR|ESRRG_ENST00000359162.2_Intron|ESRRG_ENST00000360012.3_Intron|ESRRG_ENST00000463665.1_Intron|ESRRG_ENST00000361395.2_Intron|ESRRG_ENST00000366940.2_Intron|ESRRG_ENST00000487276.1_Intron|ESRRG_ENST00000366937.1_5'UTR|ESRRG_ENST00000493603.1_Intron|ESRRG_ENST00000361525.3_Intron|ESRRG_ENST00000493748.1_Intron	NM_001438.3	NP_001429.2	P62508	ERR3_HUMAN	estrogen-related receptor gamma	19				E -> K (in Ref. 4; AAQ93376). {ECO:0000305}.	gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)	AF-2 domain binding (GO:0050682)|retinoic acid receptor activity (GO:0003708)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)	p.E19G(1)		endometrium(5)|kidney(1)|large_intestine(8)|liver(1)|lung(29)|ovary(1)|skin(2)|stomach(1)|urinary_tract(1)	49				OV - Ovarian serous cystadenocarcinoma(81;0.0358)|all cancers(67;0.0693)|GBM - Glioblastoma multiforme(131;0.0713)	Diethylstilbestrol(DB00255)	AGGTACCTACTCTTCCTCGTA	0.478																																					p.E19G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A56G	1						.						87.0	85.0	85.0					1																	216896586		1888	4101	5989	214963209	SO:0001630	splice_region_variant	2104	exon1			AF058291	CCDS1517.1, CCDS41468.1, CCDS58060.1, CCDS58061.1	1q41	2014-02-18			ENSG00000196482	ENSG00000196482		"""Nuclear hormone receptors"""	3474	protein-coding gene	gene with protein product		602969				9676434, 10072763	Standard	NM_001243505		Approved	NR3B3	uc001hkw.2	P62508	OTTHUMG00000037025	ENST00000408911.3:c.56+1A>G	1.37:g.216896586T>C			214963209	NM_001438	A8K4I0|A8K6I2|B3KY84|E9PGB7|F8W8J3|O75454|O96021|Q68DA0|Q6P274|Q6PK28|Q6TS38|Q9R1F3|Q9UNJ4	Missense_Mutation	SNP	ENST00000408911.3	37	CCDS41468.1	.	.	.	.	.	.	.	.	.	.	T	16.08	3.020378	0.54576	.	.	ENSG00000196482	ENST00000408911	D	0.93604	-3.25	5.45	5.45	0.79879	.	0.427969	0.21090	N	0.080338	D	0.85405	0.5689	N	0.08118	0	0.80722	D	1	B	0.18461	0.028	B	0.15870	0.014	T	0.80975	-0.1142	10	0.23302	T	0.38	.	15.1643	0.72811	0.0:0.0:0.0:1.0	.	19	P62508	ERR3_HUMAN	G	19	ENSP00000386171:E19G	ENSP00000386171:E19G	E	-	2	0	ESRRG	214963209	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.276000	0.78559	2.056000	0.61249	0.482000	0.46254	GAG		0.478	ESRRG-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000089882.2	NM_206595	Missense_Mutation
HNF4A	3172	broad.mit.edu	37	20	43043249	43043249	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr20:43043249G>A	ENST00000316099.4	+	5	684	c.595G>A	c.(595-597)Gtt>Att	p.V199I	HNF4A_ENST00000443598.2_Missense_Mutation_p.V199I|HNF4A_ENST00000415691.2_Missense_Mutation_p.V199I|HNF4A_ENST00000316673.4_Missense_Mutation_p.V177I|HNF4A_ENST00000609795.1_Missense_Mutation_p.V177I|HNF4A_ENST00000457232.1_Missense_Mutation_p.V177I	NM_000457.4|NM_001258355.1|NM_178849.2	NP_000448.3|NP_001245284.1|NP_849180.1	P41235	HNF4A_HUMAN	hepatocyte nuclear factor 4, alpha	199					blood coagulation (GO:0007596)|endocrine pancreas development (GO:0031018)|gene expression (GO:0010467)|glucose homeostasis (GO:0042593)|lipid homeostasis (GO:0055088)|lipid metabolic process (GO:0006629)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|ornithine metabolic process (GO:0006591)|phospholipid homeostasis (GO:0055091)|positive regulation of cholesterol homeostasis (GO:2000189)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gastrulation (GO:0010470)|regulation of growth hormone receptor signaling pathway (GO:0060398)|regulation of insulin secretion (GO:0050796)|regulation of lipid metabolic process (GO:0019216)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to glucose (GO:0009749)|sex differentiation (GO:0007548)|signal transduction involved in regulation of gene expression (GO:0023019)|SMAD protein signal transduction (GO:0060395)|transcription initiation from RNA polymerase II promoter (GO:0006367)|triglyceride homeostasis (GO:0070328)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|fatty acid binding (GO:0005504)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.V177I(1)|p.V199I(1)		endometrium(4)|large_intestine(7)|lung(17)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(2)	34		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)			GCTGGTTCTCGTTGAGTGGGC	0.622																																					p.V177I	Colon(79;2 1269 8820 14841 52347)											.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G529A	20						.						109.0	82.0	91.0					20																	43043249		2203	4300	6503	42476663	SO:0001583	missense	3172	exon5			X76930	CCDS13330.1, CCDS13331.1, CCDS42876.1, CCDS46604.1, CCDS46605.1, CCDS68131.1, CCDS74728.1	20q13.12	2014-09-17			ENSG00000101076	ENSG00000101076		"""Nuclear hormone receptors"""	5024	protein-coding gene	gene with protein product		600281		TCF14, MODY, MODY1		7926813, 9048927	Standard	NM_001030003		Approved	NR2A1, HNF4	uc010zwo.1	P41235	OTTHUMG00000032531	ENST00000316099.4:c.595G>A	20.37:g.43043249G>A	ENSP00000312987:p.Val199Ile		42476663	NM_001030003	A5JW41|B2RPP8|O00659|O00723|Q14540|Q5QPB8|Q6B4V5|Q6B4V6|Q6B4V7|Q92653|Q92654|Q92655|Q99864|Q9NQH0	Missense_Mutation	SNP	ENST00000316099.4	37	CCDS13330.1	.	.	.	.	.	.	.	.	.	.	G	34	5.391721	0.95988	.	.	ENSG00000101076	ENST00000316673;ENST00000457232;ENST00000316099;ENST00000443598;ENST00000338692;ENST00000415691	D;D;D;D;D	0.95554	-3.74;-3.74;-3.74;-3.74;-3.74	5.75	5.75	0.90469	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.000000	0.85682	D	0.000000	D	0.95717	0.8607	L	0.46157	1.445	0.80722	D	1	P;B;B;P;P;P;B	0.48503	0.911;0.426;0.426;0.497;0.911;0.891;0.369	P;B;B;B;P;P;B	0.51355	0.667;0.383;0.312;0.398;0.667;0.537;0.316	D	0.95739	0.8781	10	0.66056	D	0.02	.	19.9577	0.97228	0.0:0.0:1.0:0.0	.	192;199;199;199;177;177;177	Q5QPB7;P41235;F1D8S2;P41235-3;F1D8T0;P41235-6;P41235-7	.;HNF4A_HUMAN;.;.;.;.;.	I	177;177;199;199;229;199	ENSP00000315180:V177I;ENSP00000396216:V177I;ENSP00000312987:V199I;ENSP00000410911:V199I;ENSP00000412111:V199I	ENSP00000312987:V199I	V	+	1	0	HNF4A	42476663	1.000000	0.71417	0.317000	0.25265	0.908000	0.53690	9.869000	0.99810	2.714000	0.92807	0.563000	0.77884	GTT		0.622	HNF4A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079363.3		
MATN4	8785	broad.mit.edu	37	20	43932965	43932965	+	Silent	SNP	G	G	A			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr20:43932965G>A	ENST00000372754.1	-	2	554	c.546C>T	c.(544-546)cgC>cgT	p.R182R	MATN4_ENST00000342716.4_Silent_p.R182R|MATN4_ENST00000353917.5_Silent_p.R182R|RBPJL_ENST00000372741.3_5'Flank|MATN4_ENST00000537548.1_Silent_p.R182R|MATN4_ENST00000372751.4_Intron|RBPJL_ENST00000343694.3_5'Flank|MATN4_ENST00000360607.6_Silent_p.R182R|RBPJL_ENST00000372743.1_5'Flank|MATN4_ENST00000372756.1_Silent_p.R182R			O95460	MATN4_HUMAN	matrilin 4	182	VWFA 1. {ECO:0000255|PROSITE- ProRule:PRU00219}.				extracellular matrix organization (GO:0030198)|response to axon injury (GO:0048678)	extracellular region (GO:0005576)		p.R182R(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	27		Myeloproliferative disorder(115;0.0122)				ATGCCATGGCGCGCAGGGAGC	0.697																																					p.R182R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C546T	20						.						29.0	28.0	29.0					20																	43932965		2199	4293	6492	43366379	SO:0001819	synonymous_variant	8785	exon3			AJ007581	CCDS13348.1, CCDS46607.1	20q13.1-q13.2	2008-07-07			ENSG00000124159	ENSG00000124159			6910	protein-coding gene	gene with protein product		603897				9827539, 9027493	Standard	NM_003833		Approved		uc002xnn.2	O95460	OTTHUMG00000033043	ENST00000372754.1:c.546C>T	20.37:g.43932965G>A			43366379	NM_003833	A6NH94|A6NKN5|Q5QPU2|Q5QPU3|Q5QPU4|Q8N2M5|Q8N2M7|Q9H1F8|Q9H1F9	Silent	SNP	ENST00000372754.1	37																																																																																					0.697	MATN4-002	KNOWN	non_canonical_conserved|non_canonical_U12|not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000080335.1		
ZNF335	63925	broad.mit.edu	37	20	44592468	44592468	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr20:44592468T>C	ENST00000322927.2	-	8	1364	c.1264A>G	c.(1264-1266)Aac>Gac	p.N422D	ZNF335_ENST00000426788.1_Missense_Mutation_p.N267D	NM_022095.3	NP_071378.1	Q9H4Z2	ZN335_HUMAN	zinc finger protein 335	422					brain development (GO:0007420)|brain morphogenesis (GO:0048854)|cerebral cortex neuron differentiation (GO:0021895)|histone H3-K4 trimethylation (GO:0080182)|in utero embryonic development (GO:0001701)|neuron projection morphogenesis (GO:0048812)|positive regulation of lymphocyte proliferation (GO:0050671)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of neurogenesis (GO:0050769)|regulation of gene expression, epigenetic (GO:0040029)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription regulatory region DNA binding (GO:0044212)	p.N422D(1)		NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(13)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	51		Myeloproliferative disorder(115;0.0122)				GGGGCTGCGTTCTCTGCATCT	0.637																																					p.N422D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1264G	20						.						80.0	77.0	78.0					20																	44592468		2203	4300	6503	44025875	SO:0001583	missense	63925	exon8			AK026157	CCDS13389.1	20q13.12	2011-09-12			ENSG00000198026	ENSG00000198026		"""Zinc fingers, C2H2-type"""	15807	protein-coding gene	gene with protein product	"""NRC-interacting factor 1"""	610827				12215545, 19131338	Standard	NM_022095		Approved	bA465L10.2, NIF-1	uc002xqw.3	Q9H4Z2	OTTHUMG00000032637	ENST00000322927.2:c.1264A>G	20.37:g.44592468T>C	ENSP00000325326:p.Asn422Asp		44025875	NM_022095	B4DLG7|Q548D0|Q9H684	Missense_Mutation	SNP	ENST00000322927.2	37	CCDS13389.1	.	.	.	.	.	.	.	.	.	.	T	14.94	2.683987	0.47991	.	.	ENSG00000198026	ENST00000322927;ENST00000243961;ENST00000426788	T;T	0.10573	3.01;2.86	4.81	2.52	0.30459	.	0.278333	0.39407	N	0.001361	T	0.07593	0.0191	L	0.32530	0.975	0.46044	D	0.99883	B;B	0.29301	0.241;0.023	B;B	0.29942	0.109;0.023	T	0.36212	-0.9757	10	0.25751	T	0.34	-7.7559	6.7685	0.23581	0.0:0.0802:0.1535:0.7663	.	267;422	Q9H4Z2-2;Q9H4Z2	.;ZN335_HUMAN	D	422;199;267	ENSP00000325326:N422D;ENSP00000397098:N267D	ENSP00000243961:N199D	N	-	1	0	ZNF335	44025875	1.000000	0.71417	0.001000	0.08648	0.831000	0.47069	4.007000	0.57093	0.338000	0.23692	0.454000	0.30748	AAC		0.637	ZNF335-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079553.1	NM_022095	
CDH22	64405	broad.mit.edu	37	20	44806600	44806600	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr20:44806600C>T	ENST00000372262.3	-	10	2300	c.1900G>A	c.(1900-1902)Gtt>Att	p.V634I	CDH22_ENST00000537909.1_Missense_Mutation_p.V634I	NM_021248.1	NP_067071.1	Q9UJ99	CAD22_HUMAN	cadherin 22, type 2	634					brain development (GO:0007420)|calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.V634I(2)		endometrium(3)|kidney(1)|large_intestine(9)|lung(16)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|urinary_tract(3)	44		Myeloproliferative disorder(115;0.0122)				AGGATGAGAACGCAGACCAAG	0.652																																					p.V634I												.	.	2	Substitution - Missense(2)	large_intestine(1)|kidney(1)	c.G1900A	20						.						59.0	53.0	55.0					20																	44806600		2203	4300	6503	44240007	SO:0001583	missense	64405	exon10			AF035300	CCDS13395.1	20q13.1	2010-01-26	2009-11-20		ENSG00000149654	ENSG00000149654		"""Cadherins / Major cadherins"""	13251	protein-coding gene	gene with protein product		609920	"""cadherin-like 22"""	C20orf25		8626716	Standard	NM_021248		Approved	dJ998H6.1	uc010ghk.2	Q9UJ99	OTTHUMG00000033073	ENST00000372262.3:c.1900G>A	20.37:g.44806600C>T	ENSP00000361336:p.Val634Ile		44240007	NM_021248	B9EGK7|O43205	Missense_Mutation	SNP	ENST00000372262.3	37	CCDS13395.1	.	.	.	.	.	.	.	.	.	.	C	2.424	-0.332413	0.05314	.	.	ENSG00000149654	ENST00000372262;ENST00000537909	T;T	0.36157	1.27;1.27	4.43	2.33	0.28932	.	0.213481	0.40640	N	0.001041	T	0.15089	0.0364	N	0.11064	0.09	0.34914	D	0.747784	B	0.18968	0.032	B	0.10450	0.005	T	0.27434	-1.0074	10	0.02654	T	1	.	9.8426	0.41008	0.0:0.7982:0.0:0.2018	.	634	Q9UJ99	CAD22_HUMAN	I	634	ENSP00000361336:V634I;ENSP00000437790:V634I	ENSP00000361336:V634I	V	-	1	0	CDH22	44240007	0.998000	0.40836	1.000000	0.80357	0.976000	0.68499	0.691000	0.25467	1.092000	0.41356	-0.140000	0.14226	GTT		0.652	CDH22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080491.1	NM_021248	
SS18L1	26039	broad.mit.edu	37	20	60747793	60747793	+	Silent	SNP	G	G	A			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr20:60747793G>A	ENST00000331758.3	+	9	998	c.972G>A	c.(970-972)caG>caA	p.Q324Q	SS18L1_ENST00000421564.1_Silent_p.Q324Q|SS18L1_ENST00000370848.4_Silent_p.Q327Q	NM_198935.1	NP_945173.1	O75177	CREST_HUMAN	synovial sarcoma translocation gene on chromosome 18-like 1	324	Gln-rich.				chromatin modification (GO:0016568)|dendrite development (GO:0016358)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of dendrite development (GO:0050773)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome, centromeric region (GO:0000780)|kinetochore (GO:0000776)|nuclear body (GO:0016604)|nucleus (GO:0005634)		p.Q324Q(1)	SS18L1/SSX1(2)	ovary(2)|skin(1)	3	Breast(26;3.97e-09)		BRCA - Breast invasive adenocarcinoma(19;1.92e-08)			CCGCGCAGCAGCAGACGTACT	0.667			T	SSX1	synovial sarcoma																																p.Q324Q			Dom	yes		20	20q13.3	26039	synovial sarcoma translocation gene on chromosome 18-like 1		M	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G972A	20						.						54.0	57.0	56.0					20																	60747793		2203	4300	6503	60181188	SO:0001819	synonymous_variant	26039	exon9			AB014593	CCDS13491.1	20q13.3	2008-07-28			ENSG00000184402	ENSG00000184402			15592	protein-coding gene	gene with protein product		606472					Standard	XM_005260389		Approved	KIAA0693	uc002ycb.3	O75177	OTTHUMG00000032902	ENST00000331758.3:c.972G>A	20.37:g.60747793G>A			60181188	NM_198935	A6NNE3|A8K620|B3KWR8|E1P5H7|Q5JXJ3|Q6MZV9|Q6NTH3|Q6XYD9|Q8NE69|Q9BR55|Q9H4K6	Silent	SNP	ENST00000331758.3	37	CCDS13491.1																																																																																				0.667	SS18L1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080004.2		
DSCAM	1826	broad.mit.edu	37	21	41684282	41684282	+	Silent	SNP	C	C	T	rs200014864		TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr21:41684282C>T	ENST00000400454.1	-	9	2265	c.1788G>A	c.(1786-1788)ccG>ccA	p.P596P		NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule	596	Ig-like C2-type 7.				cell adhesion (GO:0007155)|dendrite morphogenesis (GO:0048813)|dendrite self-avoidance (GO:0070593)|locomotory behavior (GO:0007626)|negative regulation of cell adhesion (GO:0007162)|nervous system development (GO:0007399)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)	axon (GO:0030424)|extracellular region (GO:0005576)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.P596P(2)		NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(22)|lung(47)|ovary(7)|pancreas(2)|prostate(3)|skin(14)|upper_aerodigestive_tract(6)|urinary_tract(4)	142		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				GTATGAAAGGCGGAACTGCAA	0.448													C|||	1	0.000199681	0.0008	0.0	5008	,	,		17079	0.0		0.0	False		,,,				2504	0.0				p.P596P	Melanoma(134;970 1778 1785 21664 32388)											.	.	2	Substitution - coding silent(2)	large_intestine(1)|prostate(1)	c.G1788A	21						.	C		1,3731		0,1,1865	32.0	30.0	31.0		1788	-3.8	0.9	21		31	0,8210		0,0,4105	no	coding-synonymous	DSCAM	NM_001389.3		0,1,5970	TT,TC,CC		0.0,0.0268,0.0084		596/2013	41684282	1,11941	1866	4105	5971	40606152	SO:0001819	synonymous_variant	1826	exon9			AF023449	CCDS42929.1	21q22.2-q22.3	2013-02-11			ENSG00000171587	ENSG00000171587		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	3039	protein-coding gene	gene with protein product		602523				9426258	Standard	NM_001271534		Approved	CHD2-42, CHD2-52	uc002yyq.1	O60469	OTTHUMG00000086732	ENST00000400454.1:c.1788G>A	21.37:g.41684282C>T			40606152	NM_001389	O60468	Silent	SNP	ENST00000400454.1	37	CCDS42929.1																																																																																				0.448	DSCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195029.1	NM_001389	
MICAL3	57553	broad.mit.edu	37	22	18293510	18293511	+	Missense_Mutation	DNP	GT	GT	CC			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	GT	GT					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr22:18293510_18293511GT>CC	ENST00000441493.2	-	28	5866_5867	c.5514_5515AC>GG	c.(5512-5517)agACag>agGGag	p.Q1839E	MICAL3_ENST00000580469.1_5'UTR|XXbac-B461K10.4_ENST00000476405.1_RNA	NM_015241.2	NP_056056.2	Q7RTP6	MICA3_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 3	1839					actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|exocytosis (GO:0006887)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|FAD binding (GO:0071949)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|zinc ion binding (GO:0008270)	p.R1838>?(1)|p.R216>?(1)		large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	4		all_epithelial(15;0.198)		Lung(27;0.0427)		TGCTTGGCCTGTCTCCGAGCTG	0.579																																					.												.	.	2	Complex(2)	large_intestine(2)	c.5514_5515GG	22						.																																			16673511	SO:0001583	missense	57553	exon28			AB037785	CCDS46659.1, CCDS46660.1, CCDS46661.1	22q11.21	2013-03-26	2013-03-26		ENSG00000243156	ENSG00000243156			24694	protein-coding gene	gene with protein product		608882				12110185	Standard	NM_015241		Approved	KIAA0819	uc002zng.4	Q7RTP6	OTTHUMG00000150067	ENST00000441493.2:c.5514_5515delinsCC	22.37:g.18293510_18293511delinsCC	ENSP00000416015:p.Gln1839Glu		16673510	NM_015241	B2RXJ5|E9PEF0|O94909|Q5U4P4|Q6ICK4|Q96DF2|Q9P2I3	Missense_Mutation	DNP	ENST00000441493.2	37	CCDS46659.1																																																																																				0.579	MICAL3-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447351.1		
DARS	1615	broad.mit.edu	37	2	136668998	136668998	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr2:136668998T>C	ENST00000264161.4	-	14	1511	c.1296A>G	c.(1294-1296)atA>atG	p.I432M	DARS_ENST00000537273.1_Missense_Mutation_p.I332M	NM_001349.2	NP_001340.2	P14868	SYDC_HUMAN	aspartyl-tRNA synthetase	432					aspartyl-tRNA aminoacylation (GO:0006422)|gene expression (GO:0010467)|protein complex assembly (GO:0006461)|translation (GO:0006412)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	aminoacylase activity (GO:0004046)|aspartate-tRNA ligase activity (GO:0004815)|ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)	p.I432M(1)		central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(3)|ovary(2)|urinary_tract(2)	15				BRCA - Breast invasive adenocarcinoma(221;0.168)	L-Aspartic Acid(DB00128)	GAGGATCATGTATTCTTTGAG	0.353																																					p.I432M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1296G	2						.						216.0	209.0	211.0					2																	136668998		2203	4300	6503	136385468	SO:0001583	missense	1615	exon14			J05032	CCDS2180.1	2q21.3	2011-07-01			ENSG00000115866	ENSG00000115866	6.1.1.12	"""Aminoacyl tRNA synthetases / Class II"""	2678	protein-coding gene	gene with protein product	"""aspartate tRNA ligase 1, cytoplasmic"""	603084				2674137	Standard	NM_001349		Approved		uc002tux.1	P14868	OTTHUMG00000131741	ENST00000264161.4:c.1296A>G	2.37:g.136668998T>C	ENSP00000264161:p.Ile432Met		136385468	NM_001349	A8K3J2|D3DP77|Q2TNI3|Q32Q69|Q53HV4|Q53YC5|Q68CR9|Q9BW52	Missense_Mutation	SNP	ENST00000264161.4	37	CCDS2180.1	.	.	.	.	.	.	.	.	.	.	T	17.70	3.454814	0.63290	.	.	ENSG00000115866	ENST00000264161;ENST00000422708;ENST00000537273	T;D;T	0.82255	0.81;-1.59;0.81	5.52	0.0525	0.14302	Aminoacyl-tRNA synthetase, class II (1);Aminoacyl-tRNA synthetase, class II (D/K/N) (1);	0.148983	0.64402	D	0.000012	D	0.91462	0.7305	H	0.96430	3.82	0.58432	D	0.999994	D	0.55605	0.972	D	0.74674	0.984	D	0.88313	0.2957	10	0.87932	D	0	-7.0996	5.227	0.15399	0.4051:0.0:0.3042:0.2907	.	432	P14868	SYDC_HUMAN	M	432;119;332	ENSP00000264161:I432M;ENSP00000387508:I119M;ENSP00000444192:I332M	ENSP00000264161:I432M	I	-	3	3	DARS	136385468	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.026000	0.30103	0.336000	0.23639	0.383000	0.25322	ATA		0.353	DARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254660.5	NM_001349	
KCNH7	90134	broad.mit.edu	37	2	163250944	163250944	+	Nonsense_Mutation	SNP	T	T	A			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr2:163250944T>A	ENST00000332142.5	-	12	2764	c.2665A>T	c.(2665-2667)Aaa>Taa	p.K889*		NM_033272.3	NP_150375.2	Q9NS40	KCNH7_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 7	889					circadian rhythm (GO:0007623)|potassium ion transmembrane transport (GO:0071805)|protein heterooligomerization (GO:0051291)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)|signal transducer activity (GO:0004871)|voltage-gated potassium channel activity (GO:0005249)	p.K889*(1)		NS(1)|biliary_tract(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(22)|lung(53)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	108					Doxazosin(DB00590)|Ibutilide(DB00308)|Miconazole(DB01110)|Prazosin(DB00457)|Terazosin(DB01162)	CTTCTTAGTTTACAGTTGTCT	0.338																																					p.K889X	GBM(196;1492 2208 17507 24132 45496)											.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.A2665T	2						.						164.0	152.0	156.0					2																	163250944		2203	4298	6501	162959190	SO:0001587	stop_gained	90134	exon12			AF032897	CCDS2219.1, CCDS2220.1	2q24.3	2012-07-05			ENSG00000184611	ENSG00000184611		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18863	protein-coding gene	gene with protein product		608169				16382104	Standard	NM_173162		Approved	Kv11.3, HERG3, erg3	uc002uch.2	Q9NS40	OTTHUMG00000132069	ENST00000332142.5:c.2665A>T	2.37:g.163250944T>A	ENSP00000331727:p.Lys889*		162959190	NM_033272	Q53QU4|Q53TB7|Q53TP9|Q8IV15	Nonsense_Mutation	SNP	ENST00000332142.5	37	CCDS2219.1	.	.	.	.	.	.	.	.	.	.	T	40	8.248740	0.98724	.	.	ENSG00000184611	ENST00000332142	.	.	.	5.84	5.84	0.93424	.	0.211412	0.48286	D	0.000188	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05620	T	0.96	.	16.2159	0.82217	0.0:0.0:0.0:1.0	.	.	.	.	X	889	.	ENSP00000331727:K889X	K	-	1	0	KCNH7	162959190	1.000000	0.71417	1.000000	0.80357	0.851000	0.48451	4.645000	0.61404	2.243000	0.73865	0.533000	0.62120	AAA		0.338	KCNH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255093.1	NM_033272	
SCN3A	6328	broad.mit.edu	37	2	165997367	165997367	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr2:165997367C>T	ENST00000360093.3	-	13	2304	c.1813G>A	c.(1813-1815)Gaa>Aaa	p.E605K	SCN3A_ENST00000283254.7_Missense_Mutation_p.E605K|SCN3A_ENST00000409101.3_Missense_Mutation_p.E605K	NM_001081677.1	NP_001075146.1	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha subunit	605					membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.E605K(1)		NS(1)|breast(7)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(19)|liver(2)|lung(47)|ovary(6)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(3)	120					Lacosamide(DB06218)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CTCCTGCTTTCGCTGTCTTCA	0.478																																					p.E605K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1813A	2						.						198.0	145.0	163.0					2																	165997367		2203	4300	6503	165705613	SO:0001583	missense	6328	exon13			AF035685	CCDS33312.1, CCDS46440.1	2q24	2012-02-26	2007-01-23		ENSG00000153253	ENSG00000153253		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10590	protein-coding gene	gene with protein product		182391	"""sodium channel, voltage-gated, type III, alpha polypeptide"""			9589372, 16382098	Standard	NM_001081676		Approved	Nav1.3	uc002ucx.3	Q9NY46	OTTHUMG00000044171	ENST00000360093.3:c.1813G>A	2.37:g.165997367C>T	ENSP00000353206:p.Glu605Lys		165705613	NM_006922	Q16142|Q53SX0|Q9BZB3|Q9C006|Q9NYK2|Q9P2J1|Q9UPD1|Q9Y6P4	Missense_Mutation	SNP	ENST00000360093.3	37		.	.	.	.	.	.	.	.	.	.	C	23.1	4.370473	0.82573	.	.	ENSG00000153253	ENST00000360093;ENST00000283254;ENST00000409101;ENST00000440431	D;D;D;D	0.92545	-3.06;-3.06;-3.06;-3.06	6.07	5.2	0.72013	Domain of unknown function DUF3451 (1);	0.000000	0.64402	D	0.000006	D	0.96466	0.8847	M	0.88704	2.975	0.80722	D	1	D;D;B;B;D	0.76494	0.992;0.999;0.007;0.007;0.99	P;D;B;B;B	0.73380	0.716;0.98;0.004;0.004;0.216	D	0.97017	0.9740	10	0.66056	D	0.02	.	15.3736	0.74587	0.0:0.9336:0.0:0.0664	.	605;605;605;605;605	Q9NY46;E7EUE6;Q9NY46-2;Q9NY46-4;Q9NY46-3	SCN3A_HUMAN;.;.;.;.	K	605	ENSP00000353206:E605K;ENSP00000283254:E605K;ENSP00000386726:E605K;ENSP00000403348:E605K	ENSP00000283254:E605K	E	-	1	0	SCN3A	165705613	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	5.935000	0.70145	1.587000	0.49959	-0.136000	0.14681	GAA		0.478	SCN3A-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_006922	
TTN	7273	broad.mit.edu	37	2	179648886	179648886	+	Missense_Mutation	SNP	C	C	T	rs376768790	byFrequency	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr2:179648886C>T	ENST00000591111.1	-	16	2910	c.2686G>A	c.(2686-2688)Gtt>Att	p.V896I	TTN_ENST00000342175.6_Missense_Mutation_p.V850I|TTN_ENST00000342992.6_Missense_Mutation_p.V896I|TTN_ENST00000359218.5_Missense_Mutation_p.V850I|TTN_ENST00000460472.2_Missense_Mutation_p.V850I|TTN_ENST00000360870.5_Missense_Mutation_p.V896I|TTN_ENST00000589042.1_Missense_Mutation_p.V896I			Q8WZ42	TITIN_HUMAN	titin	33718					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.V850I(3)|p.V896I(2)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTCACCTCAACGCCAGCTTCA	0.547													C|||	3	0.000599042	0.0008	0.0	5008	,	,		16490	0.001		0.001	False		,,,				2504	0.0				p.V896I												.	.	5	Substitution - Missense(5)	large_intestine(5)	c.G2686A	2						.	C	ILE/VAL,ILE/VAL,ILE/VAL,ILE/VAL,ILE/VAL	0,4406		0,0,2203	157.0	124.0	135.0		2548,2548,2686,2686,2548	1.8	1.0	2		135	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense,missense	TTN	NM_133437.3,NM_133432.3,NM_133379.3,NM_133378.4,NM_003319.4	29,29,29,29,29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign,benign,benign,benign,benign	850/27119,850/27052,896/5605,896/33424,850/26927	179648886	1,13005	2203	4300	6503	179357131	SO:0001583	missense	7273	exon16			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.2686G>A	2.37:g.179648886C>T	ENSP00000465570:p.Val896Ile		179357131	NM_133379	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	C	9.914	1.210309	0.22289	0.0	1.16E-4	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	T;T;T;T;T	0.61627	0.09;0.27;0.25;0.26;0.5	5.52	1.84	0.25277	Ribonuclease H-like (1);	.	.	.	.	T	0.31918	0.0812	N	0.02247	-0.625	0.19575	N	0.999969	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.04013	0.0;0.0;0.0;0.0;0.001	T	0.28459	-1.0043	9	0.87932	D	0	.	10.5203	0.44914	0.0:0.2293:0.0:0.7707	.	850;850;850;896;896	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	I	896;850;850;850;850;896	ENSP00000343764:V896I;ENSP00000434586:V850I;ENSP00000340554:V850I;ENSP00000352154:V850I;ENSP00000354117:V896I	ENSP00000340554:V850I	V	-	1	0	TTN	179357131	0.550000	0.26489	0.995000	0.50966	0.392000	0.30506	0.262000	0.18460	0.138000	0.18790	-1.084000	0.02203	GTT		0.547	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
COL5A2	1290	broad.mit.edu	37	2	189898826	189898826	+	Silent	SNP	G	G	A	rs142895373	byFrequency	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr2:189898826G>A	ENST00000374866.3	-	54	4744	c.4470C>T	c.(4468-4470)ggC>ggT	p.G1490G		NM_000393.3	NP_000384.2	P05997	CO5A2_HUMAN	collagen, type V, alpha 2	1490	Fibrillar collagen NC1. {ECO:0000255|PROSITE-ProRule:PRU00793}.				axon guidance (GO:0007411)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|negative regulation of endodermal cell differentiation (GO:1903225)|skeletal system development (GO:0001501)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)	p.G1490G(1)		NS(3)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(53)|ovary(3)|prostate(2)|skin(6)|urinary_tract(3)	95			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)			CAATTTCAACGCCGAATTCCT	0.473																																					p.G1490G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C4470T	2						.	G		1,4405	2.1+/-5.4	0,1,2202	154.0	125.0	135.0		4470	2.4	0.4	2	dbSNP_134	135	0,8600		0,0,4300	no	coding-synonymous	COL5A2	NM_000393.3		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		1490/1500	189898826	1,13005	2203	4300	6503	189607071	SO:0001819	synonymous_variant	1290	exon54			Y14690	CCDS33350.1	2q14-q32	2014-09-17			ENSG00000204262	ENSG00000204262		"""Collagens"""	2210	protein-coding gene	gene with protein product	"""AB collagen"""	120190				1572660	Standard	NM_000393		Approved		uc002uqk.3	P05997	OTTHUMG00000149842	ENST00000374866.3:c.4470C>T	2.37:g.189898826G>A			189607071	NM_000393	P78440|Q13908|Q53WR4|Q59GR4|Q6LDJ5|Q7KZ55|Q86XF6|Q96QB0|Q96QB3	Silent	SNP	ENST00000374866.3	37	CCDS33350.1																																																																																				0.473	COL5A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313523.1	NM_000393	
TNS1	7145	broad.mit.edu	37	2	218751339	218751339	+	Silent	SNP	G	G	A	rs13419876	byFrequency	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr2:218751339G>A	ENST00000171887.4	-	11	974	c.522C>T	c.(520-522)tcC>tcT	p.S174S	TNS1_ENST00000430930.1_Silent_p.S174S|TNS1_ENST00000419504.1_Silent_p.S174S|TNS1_ENST00000310858.6_Silent_p.S205S	NM_022648.4	NP_072174.3	Q9HBL0	TENS1_HUMAN	tensin 1	174	Phosphatase tensin-type. {ECO:0000255|PROSITE-ProRule:PRU00590}.				cell-substrate junction assembly (GO:0007044)|fibroblast migration (GO:0010761)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)	poly(A) RNA binding (GO:0044822)	p.S174S(1)		breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(23)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	79		Renal(207;0.0483)|Lung NSC(271;0.213)		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)		TGATGGAGCCGGAGAGCAGGC	0.522											OREG0015188	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	G|||	133	0.0265575	0.0953	0.0086	5008	,	,		20049	0.001		0.0	False		,,,				2504	0.0				p.S174S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C522T	2						.	G		340,4066	169.4+/-200.1	17,306,1880	137.0	118.0	124.0		522	-3.4	1.0	2	dbSNP_121	124	6,8594	3.7+/-12.6	0,6,4294	no	coding-synonymous	TNS1	NM_022648.4		17,312,6174	AA,AG,GG		0.0698,7.7167,2.6603		174/1736	218751339	346,12660	2203	4300	6503	218459584	SO:0001819	synonymous_variant	7145	exon11			AB209238	CCDS2407.1	2q35-q36	2014-06-13	2005-05-13	2005-05-13	ENSG00000079308	ENSG00000079308		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"", ""SH2 domain containing"""	11973	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 155"""	600076	"""tensin"", ""matrix-remodelling associated 6"""	TNS, MXRA6			Standard	NM_022648		Approved	DKFZp586K0617, PPP1R155	uc002vgt.2	Q9HBL0	OTTHUMG00000133056	ENST00000171887.4:c.522C>T	2.37:g.218751339G>A		2253	218459584	NM_022648	Q4ZG71|Q6IPI5	Silent	SNP	ENST00000171887.4	37	CCDS2407.1																																																																																				0.522	TNS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256672.2	NM_022648	
DAW1	164781	broad.mit.edu	37	2	228769723	228769723	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr2:228769723G>A	ENST00000309931.2	+	8	810	c.727G>A	c.(727-729)Gtt>Att	p.V243I	DAW1_ENST00000545118.1_Missense_Mutation_p.V228I|DAW1_ENST00000373666.2_Missense_Mutation_p.V243I	NM_178821.1	NP_849143.1	Q8N136	DAW1_HUMAN	dynein assembly factor with WDR repeat domains 1	243						cilium (GO:0005929)		p.V243I(1)									TGATCATACCGTTGTAGTGTG	0.408																																					p.V243I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G727A	2						.						162.0	166.0	165.0					2																	228769723		2203	4300	6503	228477967	SO:0001583	missense	164781	exon8				CCDS2470.1	2q36.3	2013-09-03	2013-02-19	2013-02-19	ENSG00000123977	ENSG00000123977		"""WD repeat domain containing"""	26383	protein-coding gene	gene with protein product	"""outer row dynein assembly 16 homolog (Chlamydomonas)"""		"""WD repeat domain 69"""	WDR69		20568242, 21953912	Standard	NM_178821		Approved	FLJ25955, ODA16	uc002vpn.1	Q8N136	OTTHUMG00000133190	ENST00000309931.2:c.727G>A	2.37:g.228769723G>A	ENSP00000311899:p.Val243Ile		228477967	NM_178821	Q6ZRY1|Q8N776	Missense_Mutation	SNP	ENST00000309931.2	37	CCDS2470.1	.	.	.	.	.	.	.	.	.	.	G	14.11	2.438736	0.43326	.	.	ENSG00000123977	ENST00000373666;ENST00000309931;ENST00000545118	T;T;T	0.57107	0.42;0.42;0.42	5.23	5.23	0.72850	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40 repeat, conserved site (1);WD40-repeat-containing domain (1);	0.423751	0.24564	N	0.037453	T	0.41073	0.1143	L	0.33245	0.995	0.24203	N	0.995502	B	0.21821	0.061	B	0.22152	0.038	T	0.16188	-1.0411	10	0.08381	T	0.77	.	16.2822	0.82697	0.0:0.0:1.0:0.0	.	243	Q8N136	WDR69_HUMAN	I	243;243;228	ENSP00000362770:V243I;ENSP00000311899:V243I;ENSP00000437887:V228I	ENSP00000311899:V243I	V	+	1	0	WDR69	228477967	1.000000	0.71417	0.283000	0.24790	0.780000	0.44128	6.399000	0.73248	2.449000	0.82847	0.491000	0.48974	GTT		0.408	DAW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331745.1	NM_178821	
FSHR	2492	broad.mit.edu	37	2	49190040	49190040	+	Silent	SNP	C	C	A			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr2:49190040C>A	ENST00000406846.2	-	10	2039	c.1920G>T	c.(1918-1920)ctG>ctT	p.L640L	FSHR_ENST00000304421.4_Silent_p.L614L|FSHR_ENST00000541117.1_Silent_p.L376L|FSHR_ENST00000346173.3_Silent_p.L578L	NM_000145.3	NP_000136.2	P23945	FSHR_HUMAN	follicle stimulating hormone receptor	640					female gamete generation (GO:0007292)|female gonad development (GO:0008585)|follicle-stimulating hormone signaling pathway (GO:0042699)|G-protein coupled receptor signaling pathway (GO:0007186)|gonad development (GO:0008406)|male gonad development (GO:0008584)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	follicle-stimulating hormone receptor activity (GO:0004963)	p.L640L(1)		NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(10)|liver(1)|lung(45)|ovary(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	73		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.181)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Choriogonadotropin alfa(DB00097)|Follitropin beta(DB00066)|Menotropins(DB00032)|Suramin(DB04786)|Urofollitropin(DB00094)	ACTTGCTCAGCAGAATGAAGA	0.458									Gonadal Dysgenesis, 46 XX																												p.L614L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1842T	2						.						81.0	82.0	81.0					2																	49190040		2203	4300	6503	49043544	SO:0001819	synonymous_variant	2492	exon9	Familial Cancer Database			CCDS1843.1, CCDS1844.1, CCDS1844.2	2p21-p16	2014-09-17			ENSG00000170820	ENSG00000170820		"""GPCR / Class A : Gonadotropin and TSH receptors"""	3969	protein-coding gene	gene with protein product		136435		ODG1		8230163, 8855829	Standard	NM_000145		Approved	FSHRO, LGR1	uc002rww.3	P23945	OTTHUMG00000129259	ENST00000406846.2:c.1920G>T	2.37:g.49190040C>A			49043544	NM_181446	A8K947|G5CBS7|G5E967|J3KQ00|Q05AH0|Q16225|Q4QRJ3|Q4ZFZ2|Q53RW2	Silent	SNP	ENST00000406846.2	37	CCDS1843.1																																																																																				0.458	FSHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251367.2		
FSHR	2492	broad.mit.edu	37	2	49190545	49190545	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr2:49190545G>T	ENST00000406846.2	-	10	1534	c.1415C>A	c.(1414-1416)aCg>aAg	p.T472K	FSHR_ENST00000304421.4_Missense_Mutation_p.T446K|FSHR_ENST00000541117.1_Missense_Mutation_p.T208K|FSHR_ENST00000346173.3_Missense_Mutation_p.T410K	NM_000145.3	NP_000136.2	P23945	FSHR_HUMAN	follicle stimulating hormone receptor	472					female gamete generation (GO:0007292)|female gonad development (GO:0008585)|follicle-stimulating hormone signaling pathway (GO:0042699)|G-protein coupled receptor signaling pathway (GO:0007186)|gonad development (GO:0008406)|male gonad development (GO:0008584)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	follicle-stimulating hormone receptor activity (GO:0004963)	p.T472K(1)		NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(10)|liver(1)|lung(45)|ovary(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	73		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.181)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Choriogonadotropin alfa(DB00097)|Follitropin beta(DB00066)|Menotropins(DB00032)|Suramin(DB04786)|Urofollitropin(DB00094)	CATGGCATGCGTGATGGTATG	0.542									Gonadal Dysgenesis, 46 XX																												p.T446K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1337A	2						.						56.0	50.0	52.0					2																	49190545		2203	4300	6503	49044049	SO:0001583	missense	2492	exon9	Familial Cancer Database			CCDS1843.1, CCDS1844.1, CCDS1844.2	2p21-p16	2014-09-17			ENSG00000170820	ENSG00000170820		"""GPCR / Class A : Gonadotropin and TSH receptors"""	3969	protein-coding gene	gene with protein product		136435		ODG1		8230163, 8855829	Standard	NM_000145		Approved	FSHRO, LGR1	uc002rww.3	P23945	OTTHUMG00000129259	ENST00000406846.2:c.1415C>A	2.37:g.49190545G>T	ENSP00000384708:p.Thr472Lys		49044049	NM_181446	A8K947|G5CBS7|G5E967|J3KQ00|Q05AH0|Q16225|Q4QRJ3|Q4ZFZ2|Q53RW2	Missense_Mutation	SNP	ENST00000406846.2	37	CCDS1843.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.281612	0.80692	.	.	ENSG00000170820	ENST00000406846;ENST00000346173;ENST00000304421;ENST00000541117	T;T;T;T	0.37752	1.18;1.18;1.18;1.18	5.65	5.65	0.86999	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.64371	0.2592	M	0.80982	2.52	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.996;0.999;0.996	T	0.63514	-0.6620	9	.	.	.	.	18.891	0.92403	0.0:0.0:1.0:0.0	.	446;410;472	Q05AH0;G5E967;P23945	.;.;FSHR_HUMAN	K	472;410;446;208	ENSP00000384708:T472K;ENSP00000333908:T410K;ENSP00000306780:T446K;ENSP00000444172:T208K	.	T	-	2	0	FSHR	49044049	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.657000	0.98554	2.941000	0.99782	0.655000	0.94253	ACG		0.542	FSHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251367.2		
CHRNG	1146	broad.mit.edu	37	2	233409534	233409534	+	Silent	SNP	T	T	A			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr2:233409534T>A	ENST00000389494.3	+	11	1323	c.1302T>A	c.(1300-1302)gcT>gcA	p.A434A	CHRNG_ENST00000389492.3_Silent_p.A382A	NM_005199.4	NP_005190.4	P07510	ACHG_HUMAN	cholinergic receptor, nicotinic, gamma (muscle)	434					muscle contraction (GO:0006936)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|channel activity (GO:0015267)	p.A434A(1)		breast(2)|endometrium(3)|large_intestine(4)|lung(12)|upper_aerodigestive_tract(1)	22		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;6.39e-16)|BRCA - Breast invasive adenocarcinoma(100;0.00079)|LUSC - Lung squamous cell carcinoma(224;0.00757)|Lung(119;0.0086)	Galantamine(DB00674)	TGAAGCAGGCTGCCCCAGCCA	0.557																																					p.A434A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1302A	2						.						26.0	30.0	29.0					2																	233409534		2203	4299	6502	233117778	SO:0001819	synonymous_variant	1146	exon11			X01715	CCDS33400.1	2q37.1	2012-10-02	2012-02-07		ENSG00000196811	ENSG00000196811		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1967	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, gamma (muscle)"""	100730	"""cholinergic receptor, nicotinic, gamma"""	ACHRG			Standard	NM_005199		Approved		uc002vsx.1	P07510	OTTHUMG00000153327	ENST00000389494.3:c.1302T>A	2.37:g.233409534T>A			233117778	NM_005199	B3KWM8|Q14DU4|Q53RG2	Silent	SNP	ENST00000389494.3	37	CCDS33400.1																																																																																				0.557	CHRNG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330743.1	NM_005199	
KIAA1407	57577	broad.mit.edu	37	3	113697080	113697080	+	Silent	SNP	C	C	T			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr3:113697080C>T	ENST00000295878.3	-	16	2705	c.2559G>A	c.(2557-2559)aaG>aaA	p.K853K		NM_020817.1	NP_065868.1	Q8NCU4	K1407_HUMAN	KIAA1407	853								p.K853K(1)		endometrium(9)|large_intestine(7)|lung(19)|ovary(2)|pancreas(1)|prostate(1)|urinary_tract(1)	40						GAGAATCGATCTTCACCTCCC	0.428																																					p.K853K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2559A	3						.						129.0	123.0	125.0					3																	113697080		2203	4300	6503	115179770	SO:0001819	synonymous_variant	57577	exon16			AF509494	CCDS2977.1	3q13.31	2005-01-10			ENSG00000163617	ENSG00000163617			29272	protein-coding gene	gene with protein product						10718198	Standard	NM_020817		Approved		uc003eax.3	Q8NCU4	OTTHUMG00000159337	ENST00000295878.3:c.2559G>A	3.37:g.113697080C>T			115179770	NM_020817	B4DYL1|Q9P2E0	Silent	SNP	ENST00000295878.3	37	CCDS2977.1																																																																																				0.428	KIAA1407-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354724.2	NM_020817	
CNTN6	27255	broad.mit.edu	37	3	1444040	1444040	+	Silent	SNP	T	T	C			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr3:1444040T>C	ENST00000446702.2	+	22	3483	c.2856T>C	c.(2854-2856)atT>atC	p.I952I	CNTN6_ENST00000350110.2_Silent_p.I952I|CNTN6_ENST00000539053.1_Silent_p.I880I			Q9UQ52	CNTN6_HUMAN	contactin 6	952	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|Notch signaling pathway (GO:0007219)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)		p.I952I(1)		breast(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(34)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	90		all_cancers(2;0.000164)|all_epithelial(2;0.107)		Epithelial(13;0.000233)|all cancers(10;0.0013)|OV - Ovarian serous cystadenocarcinoma(96;0.0139)		AAACTCATATTTTGGAAACAA	0.373																																					p.I952I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T2856C	3						.						93.0	96.0	95.0					3																	1444040		2203	4299	6502	1419040	SO:0001819	synonymous_variant	27255	exon22			AB003592	CCDS2557.1	3p26-p25	2013-02-11			ENSG00000134115	ENSG00000134115		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	2176	protein-coding gene	gene with protein product	"""neural adhesion molecule"""	607220				9486763	Standard	NM_014461		Approved	NB-3	uc003bpa.3	Q9UQ52	OTTHUMG00000119030	ENST00000446702.2:c.2856T>C	3.37:g.1444040T>C			1419040	NM_014461	Q2KHM2	Silent	SNP	ENST00000446702.2	37	CCDS2557.1																																																																																				0.373	CNTN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239235.2	NM_014461	
SUSD5	26032	broad.mit.edu	37	3	33216511	33216511	+	Silent	SNP	G	G	A	rs376717049		TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr3:33216511G>A	ENST00000309558.3	-	4	882	c.465C>T	c.(463-465)acC>acT	p.T155T		NM_015551.1	NP_056366.1	O60279	SUSD5_HUMAN	sushi domain containing 5	155	Sushi. {ECO:0000255|PROSITE- ProRule:PRU00302}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	hyaluronic acid binding (GO:0005540)	p.T155T(1)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	24						TTTCCAAGCCGGTGCGGCCCT	0.587																																					p.T155T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C465T	3						.	G		1,4089		0,1,2044	65.0	72.0	70.0		465	-11.4	0.2	3		70	0,8354		0,0,4177	no	coding-synonymous	SUSD5	NM_015551.1		0,1,6221	AA,AG,GG		0.0,0.0244,0.0080		155/630	33216511	1,12443	2045	4177	6222	33191515	SO:0001819	synonymous_variant	26032	exon4			AB011099	CCDS46787.1	3p23	2014-02-12	2006-01-13		ENSG00000173705	ENSG00000173705			29061	protein-coding gene	gene with protein product							Standard	NM_015551		Approved	KIAA0527	uc003cfo.1	O60279	OTTHUMG00000155829	ENST00000309558.3:c.465C>T	3.37:g.33216511G>A			33191515	NM_015551		Silent	SNP	ENST00000309558.3	37	CCDS46787.1																																																																																				0.587	SUSD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341902.1	XM_171054	
POMGNT2	84892	broad.mit.edu	37	3	43121536	43121536	+	Missense_Mutation	SNP	C	C	T	rs143394182	byFrequency	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr3:43121536C>T	ENST00000344697.2	-	2	1733	c.1388G>A	c.(1387-1389)cGc>cAc	p.R463H	POMGNT2_ENST00000441964.1_Missense_Mutation_p.R463H	NM_032806.5	NP_116195.2	Q8NAT1	PMGT2_HUMAN	protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-)	463					protein O-linked glycosylation (GO:0006493)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|protein O-GlcNAc transferase activity (GO:0097363)	p.R463H(1)									CTTCACCACGCGCCGTATGGT	0.627													C|||	4	0.000798722	0.003	0.0	5008	,	,		21085	0.0		0.0	False		,,,				2504	0.0				p.R463H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1388A	3						.	C	HIS/ARG	13,4393	20.2+/-43.8	0,13,2190	43.0	42.0	42.0		1388	4.7	0.9	3	dbSNP_134	42	1,8599	1.2+/-3.3	0,1,4299	no	missense	C3orf39	NM_032806.4	29	0,14,6489	TT,TC,CC		0.0116,0.2951,0.1076	benign	463/581	43121536	14,12992	2203	4300	6503	43096540	SO:0001583	missense	84892	exon2			AK092147	CCDS2709.1	3p22.1	2014-07-15	2013-08-22	2013-08-22	ENSG00000144647	ENSG00000144647			25902	protein-coding gene	gene with protein product		614828	"""chromosome 3 open reading frame 39"", ""glycosyltransferase-like domain containing 2"""	C3orf39, GTDC2		12477932	Standard	NM_032806		Approved	FLJ14566, AGO61	uc003cmr.2	Q8NAT1	OTTHUMG00000133038	ENST00000344697.2:c.1388G>A	3.37:g.43121536C>T	ENSP00000344125:p.Arg463His		43096540	NM_032806	B3KWC3|Q96SY3	Missense_Mutation	SNP	ENST00000344697.2	37	CCDS2709.1	3	0.0013736263736263737	3	0.006097560975609756	0	0.0	0	0.0	0	0.0	C	11.78	1.741508	0.30865	0.002951	1.16E-4	ENSG00000144647	ENST00000441964;ENST00000344697	T;T	0.77098	-1.07;-1.07	5.53	4.66	0.58398	.	0.462954	0.24312	N	0.039637	T	0.52041	0.1710	L	0.29908	0.895	0.27707	N	0.945591	P	0.39940	0.696	B	0.26969	0.075	T	0.56329	-0.7997	10	0.51188	T	0.08	-26.1697	9.5495	0.39301	0.0:0.8244:0.0:0.1756	.	463	Q8NAT1	AGO61_HUMAN	H	463	ENSP00000408992:R463H;ENSP00000344125:R463H	ENSP00000344125:R463H	R	-	2	0	C3orf39	43096540	0.991000	0.36638	0.872000	0.34217	0.944000	0.59088	2.476000	0.45171	1.347000	0.45714	0.650000	0.86243	CGC		0.627	POMGNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256643.1	NM_032806	
CCDC36	339834	broad.mit.edu	37	3	49294557	49294557	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr3:49294557G>A	ENST00000438782.1	+	8	1863	c.1627G>A	c.(1627-1629)Gac>Aac	p.D543N	CCDC36_ENST00000452691.2_Missense_Mutation_p.D543N|RP11-3B7.1_ENST00000440528.3_5'Flank|CCDC36_ENST00000296449.5_Missense_Mutation_p.D543N			Q8IYA8	CCD36_HUMAN	coiled-coil domain containing 36	543								p.D533N(1)		endometrium(1)|kidney(2)|large_intestine(3)|liver(1)|lung(3)|ovary(1)|urinary_tract(3)	14				BRCA - Breast invasive adenocarcinoma(193;9.11e-05)|Kidney(197;0.00248)|KIRC - Kidney renal clear cell carcinoma(197;0.00262)		CTCTTCCCAAGACAACTGGCT	0.537																																					p.D543N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1627A	3						.						72.0	75.0	74.0					3																	49294557		2203	4300	6503	49269561	SO:0001583	missense	339834	exon10			AK058049	CCDS33755.2	3p21.31	2009-08-06			ENSG00000173421	ENSG00000173421			27945	protein-coding gene	gene with protein product	"""cancer/testis antigen 74"""						Standard	NM_178173		Approved	FLJ25320, CT74	uc011bck.1	Q8IYA8	OTTHUMG00000155920	ENST00000438782.1:c.1627G>A	3.37:g.49294557G>A	ENSP00000391788:p.Asp543Asn		49269561	NM_178173	C9JJL0|Q05DG9|Q96LP7	Missense_Mutation	SNP	ENST00000438782.1	37	CCDS33755.2	.	.	.	.	.	.	.	.	.	.	G	18.14	3.556650	0.65425	.	.	ENSG00000173421	ENST00000296449;ENST00000438782;ENST00000452691;ENST00000309062	T;T;T	0.50277	0.75;0.75;0.75	4.31	-0.136	0.13473	.	0.802027	0.11380	N	0.569861	T	0.33644	0.0870	L	0.32530	0.975	0.09310	N	1	B	0.15930	0.015	B	0.16722	0.016	T	0.32188	-0.9916	10	0.72032	D	0.01	-3.7855	6.575	0.22560	0.5285:0.0:0.4715:0.0	.	543	Q8IYA8	CCD36_HUMAN	N	543;543;543;523	ENSP00000296449:D543N;ENSP00000391788:D543N;ENSP00000407837:D543N	ENSP00000296449:D543N	D	+	1	0	CCDC36	49269561	0.006000	0.16342	0.024000	0.17045	0.857000	0.48899	0.062000	0.14389	0.063000	0.16370	0.561000	0.74099	GAC		0.537	CCDC36-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342332.1	NM_178173	
CACNA2D3	55799	broad.mit.edu	37	3	54537563	54537563	+	Silent	SNP	C	C	T	rs532127932		TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr3:54537563C>T	ENST00000474759.1	+	5	474	c.426C>T	c.(424-426)gaC>gaT	p.D142D	CACNA2D3_ENST00000415676.2_Silent_p.D142D|CACNA2D3_ENST00000490478.1_Silent_p.D48D|CACNA2D3_ENST00000288197.5_Silent_p.D142D	NM_018398.2	NP_060868.2	Q8IZS8	CA2D3_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 3	142						integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)	p.D142D(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(17)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(3)	59				KIRC - Kidney renal clear cell carcinoma(284;0.00287)|Kidney(284;0.00327)	Amlodipine(DB00381)|Nilvadipine(DB06712)|Spironolactone(DB00421)	GGGACAAAGACGGGAATTTTT	0.393													C|||	1	0.000199681	0.0008	0.0	5008	,	,		20358	0.0		0.0	False		,,,				2504	0.0				p.D142D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C426T	3						.						138.0	128.0	131.0					3																	54537563		1840	4090	5930	54512603	SO:0001819	synonymous_variant	55799	exon5			AJ272268	CCDS54598.1	3p21.1	2010-10-05	2008-02-26		ENSG00000157445	ENSG00000157445		"""Calcium channel subunits"""	15460	protein-coding gene	gene with protein product		606399				11245980	Standard	XM_005265318		Approved	HSA272268	uc003dhf.3	Q8IZS8	OTTHUMG00000158580	ENST00000474759.1:c.426C>T	3.37:g.54537563C>T			54512603	NM_018398	B2RPL6|Q9NY16|Q9NY18	Silent	SNP	ENST00000474759.1	37	CCDS54598.1																																																																																				0.393	CACNA2D3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351402.1		
FRMD4B	23150	broad.mit.edu	37	3	69244463	69244463	+	Silent	SNP	T	T	C			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr3:69244463T>C	ENST00000398540.3	-	15	1370	c.1287A>G	c.(1285-1287)gaA>gaG	p.E429E	FRMD4B_ENST00000542259.1_Silent_p.E375E|FRMD4B_ENST00000478263.1_Silent_p.E81E	NM_015123.1	NP_055938	Q9Y2L6	FRM4B_HUMAN	FERM domain containing 4B	429					establishment of epithelial cell polarity (GO:0090162)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|ruffle (GO:0001726)		p.E375E(1)		NS(2)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(1)|ovary(3)|prostate(3)|skin(2)	19		Lung NSC(201;0.0138)|Prostate(884;0.11)		BRCA - Breast invasive adenocarcinoma(55;0.000201)|Epithelial(33;0.00141)|LUSC - Lung squamous cell carcinoma(21;0.00999)|Lung(16;0.0182)		TCTTCTTTAGTTCAAGGATTT	0.423																																					p.E429E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A1287G	3						.						83.0	81.0	81.0					3																	69244463		1824	4074	5898	69327153	SO:0001819	synonymous_variant	23150	exon15			AL832231	CCDS46863.1	3p14.2	2006-04-12			ENSG00000114541	ENSG00000114541			24886	protein-coding gene	gene with protein product						10231032, 11445584	Standard	XM_005264720		Approved	KIAA1013, GRSP1	uc003dnv.2	Q9Y2L6	OTTHUMG00000158772	ENST00000398540.3:c.1287A>G	3.37:g.69244463T>C			69327153	NM_015123	Q8TAI3	Silent	SNP	ENST00000398540.3	37	CCDS46863.1																																																																																				0.423	FRMD4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352111.1		
PDZRN3	23024	broad.mit.edu	37	3	73432900	73432900	+	Silent	SNP	C	C	T			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr3:73432900C>T	ENST00000263666.4	-	10	2931	c.2817G>A	c.(2815-2817)cgG>cgA	p.R939R	PDZRN3_ENST00000479530.1_Silent_p.R656R|PDZRN3_ENST00000466348.1_5'Flank|PDZRN3_ENST00000535920.1_Silent_p.R661R|PDZRN3_ENST00000462146.2_Silent_p.R596R|PDZRN3_ENST00000466780.1_Silent_p.R596R	NM_015009.1	NP_055824.1	Q9UPQ7	PZRN3_HUMAN	PDZ domain containing ring finger 3	939					neuromuscular junction development (GO:0007528)|protein ubiquitination (GO:0016567)	neuromuscular junction (GO:0031594)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.R939R(1)		breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(13)|lung(31)|ovary(4)|pancreas(2)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69		Prostate(10;0.114)|Lung NSC(201;0.187)|Lung SC(41;0.236)		BRCA - Breast invasive adenocarcinoma(55;0.00041)|Epithelial(33;0.0023)|LUSC - Lung squamous cell carcinoma(21;0.0048)|Lung(16;0.0105)|KIRC - Kidney renal clear cell carcinoma(39;0.111)|Kidney(39;0.134)		GCAGGCGGTCCCGCACGGGCC	0.677																																					p.R939R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2817A	3						.						34.0	35.0	35.0					3																	73432900		2203	4300	6503	73515590	SO:0001819	synonymous_variant	23024	exon10			AB029018	CCDS33789.1	3p14.1	2013-01-09	2008-08-14		ENSG00000121440	ENSG00000121440		"""RING-type (C3HC4) zinc fingers"""	17704	protein-coding gene	gene with protein product	"""likely ortholog of mouse semaF cytoplasmic domain associated protein 3"""	609729				10470851	Standard	XM_005264718		Approved	KIAA1095, SEMACAP3, LNX3	uc003dpl.1	Q9UPQ7	OTTHUMG00000158865	ENST00000263666.4:c.2817G>A	3.37:g.73432900C>T			73515590	NM_015009	A7MCZ6|Q8N2N7|Q96CC2|Q9NSQ2	Silent	SNP	ENST00000263666.4	37	CCDS33789.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	7.564|7.564	0.665309|0.665309	0.14710|0.14710	.|.	.|.	ENSG00000121440|ENSG00000121440	ENST00000494559|ENST00000416926	.|.	.|.	.|.	5.4|5.4	-3.69|-3.69	0.04450|0.04450	.|.	.|.	.|.	.|.	.|.	T|T	0.51669|0.51669	0.1688|0.1688	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.50092|0.50092	-0.8868|-0.8868	4|4	.|.	.|.	.|.	.|.	8.8133|8.8133	0.34981|0.34981	0.0811:0.5072:0.3234:0.0883|0.0811:0.5072:0.3234:0.0883	.|.	.|.	.|.	.|.	E|R	255|659	.|.	.|.	G|G	-|-	2|1	0|0	PDZRN3|PDZRN3	73515590|73515590	0.091000|0.091000	0.21658|0.21658	0.975000|0.975000	0.42487|0.42487	0.941000|0.941000	0.58515|0.58515	-0.543000|-0.543000	0.06084|0.06084	-0.589000|-0.589000	0.05874|0.05874	-0.951000|-0.951000	0.02657|0.02657	GGG|GGA		0.677	PDZRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352460.1	XM_041363	
MRAS	22808	broad.mit.edu	37	3	138117398	138117398	+	Silent	SNP	G	G	A			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr3:138117398G>A	ENST00000289104.4	+	4	1082	c.435G>A	c.(433-435)gcG>gcA	p.A145A	MRAS_ENST00000423968.2_Silent_p.A145A|MRAS_ENST00000464896.1_Silent_p.A69A|MRAS_ENST00000474559.1_Silent_p.A145A	NM_001085049.2|NM_001252090.1|NM_001252091.1|NM_012219.4	NP_001078518.1|NP_001239019.1|NP_001239020.1|NP_036351.3	O14807	RASM_HUMAN	muscle RAS oncogene homolog	145					actin cytoskeleton organization (GO:0030036)|multicellular organismal development (GO:0007275)|muscle organ development (GO:0007517)|Ras protein signal transduction (GO:0007265)	extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTP-dependent protein binding (GO:0030742)|GTPase activity (GO:0003924)	p.A145A(1)		kidney(1)|large_intestine(2)|lung(8)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	14						AAGAAATGGCGACCAAACACA	0.502																																					p.A145A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G435A	3						.						126.0	114.0	118.0					3																	138117398		2203	4300	6503	139600088	SO:0001819	synonymous_variant	22808	exon4			AF022080	CCDS3100.1, CCDS58855.1	3q22.3	2014-05-09			ENSG00000158186	ENSG00000158186			7227	protein-coding gene	gene with protein product		608435				9400994, 10446149	Standard	NM_012219		Approved	M-RAs, R-RAS3, RRAS3	uc003esi.4	O14807	OTTHUMG00000159888	ENST00000289104.4:c.435G>A	3.37:g.138117398G>A			139600088	NM_012219	B4DIK0|Q86WX8	Silent	SNP	ENST00000289104.4	37	CCDS3100.1																																																																																				0.502	MRAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357990.1		
TACR3	6870	broad.mit.edu	37	4	104640427	104640427	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr4:104640427C>T	ENST00000304883.2	-	1	546	c.406G>A	c.(406-408)Gcc>Acc	p.A136T		NM_001059.2	NP_001050.1	P29371	NK3R_HUMAN	tachykinin receptor 3	136					aging (GO:0007568)|hyperosmotic salinity response (GO:0042538)|positive regulation of blood pressure (GO:0045777)|positive regulation of heart rate (GO:0010460)|positive regulation of uterine smooth muscle contraction (GO:0070474)|regulation of dopamine metabolic process (GO:0042053)|regulation of feeding behavior (GO:0060259)|response to cocaine (GO:0042220)|response to estradiol (GO:0032355)|response to morphine (GO:0043278)|tachykinin receptor signaling pathway (GO:0007217)	cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|integral component of plasma membrane (GO:0005887)|neuronal cell body membrane (GO:0032809)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	tachykinin receptor activity (GO:0004995)	p.A136T(1)		breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(19)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	51		Hepatocellular(203;0.217)		UCEC - Uterine corpus endometrioid carcinoma (10;0.22)|OV - Ovarian serous cystadenocarcinoma(123;3.4e-08)		GTGTTGAAGGCGGCCATGGAG	0.517																																					p.A136T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G406A	4						.						110.0	100.0	103.0					4																	104640427		2203	4300	6503	104859876	SO:0001583	missense	6870	exon1			M89473	CCDS3664.1	4q25	2012-08-08			ENSG00000169836	ENSG00000169836		"""GPCR / Class A : Tachykinin receptors"""	11528	protein-coding gene	gene with protein product	"""neurokinin beta receptor"""	162332				1374246	Standard	NM_001059		Approved	NK3R	uc003hxe.1	P29371	OTTHUMG00000131124	ENST00000304883.2:c.406G>A	4.37:g.104640427C>T	ENSP00000303325:p.Ala136Thr		104859876	NM_001059	Q0P510	Missense_Mutation	SNP	ENST00000304883.2	37	CCDS3664.1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.609154	0.87258	.	.	ENSG00000169836	ENST00000304883	T	0.35973	1.28	5.26	5.26	0.73747	GPCR, rhodopsin-like superfamily (1);	0.120606	0.56097	D	0.000031	T	0.38374	0.1038	L	0.33093	0.98	0.80722	D	1	D	0.67145	0.996	P	0.48704	0.587	T	0.16276	-1.0408	10	0.48119	T	0.1	.	17.8687	0.88804	0.0:1.0:0.0:0.0	.	136	P29371	NK3R_HUMAN	T	136	ENSP00000303325:A136T	ENSP00000303325:A136T	A	-	1	0	TACR3	104859876	1.000000	0.71417	0.991000	0.47740	0.992000	0.81027	7.455000	0.80726	2.446000	0.82766	0.591000	0.81541	GCC		0.517	TACR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253804.1	NM_001059	
PDE5A	8654	broad.mit.edu	37	4	120528116	120528116	+	Silent	SNP	C	C	T			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr4:120528116C>T	ENST00000354960.3	-	2	808	c.489G>A	c.(487-489)ttG>ttA	p.L163L	PDE5A_ENST00000394439.1_Silent_p.L111L|PDE5A_ENST00000264805.5_Silent_p.L121L	NM_001083.3	NP_001074.2	O76074	PDE5A_HUMAN	phosphodiesterase 5A, cGMP-specific	163					blood coagulation (GO:0007596)|cGMP catabolic process (GO:0046069)|negative regulation of cardiac muscle contraction (GO:0055118)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of oocyte development (GO:0060282)|relaxation of cardiac muscle (GO:0055119)|signal transduction (GO:0007165)	cytosol (GO:0005829)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cGMP binding (GO:0030553)|metal ion binding (GO:0046872)	p.L163L(1)		breast(4)|endometrium(2)|kidney(3)|large_intestine(8)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	27					Avanafil(DB06237)|Caffeine(DB00201)|Dipyridamole(DB00975)|Pentoxifylline(DB00806)|Sildenafil(DB00203)|Tadalafil(DB00820)|Theophylline(DB00277)|Udenafil(DB06267)|Vardenafil(DB00862)	CTGTGACATCCAAATGACTAG	0.438																																					p.L111L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G333A	4						.						126.0	121.0	123.0					4																	120528116		2203	4300	6503	120747564	SO:0001819	synonymous_variant	8654	exon2			D89094	CCDS3713.1, CCDS34055.1	4q27	2008-05-15			ENSG00000138735	ENSG00000138735	3.1.4.17	"""Phosphodiesterases"""	8784	protein-coding gene	gene with protein product		603310				9714779, 9642111	Standard	NM_033437		Approved		uc003idh.3	O76074	OTTHUMG00000132971	ENST00000354960.3:c.489G>A	4.37:g.120528116C>T			120747564	NM_033437	A0AV69|A8K2C4|O75026|O75887|Q86UI0|Q86V66|Q9Y6Z6	Silent	SNP	ENST00000354960.3	37	CCDS3713.1																																																																																				0.438	PDE5A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256529.1	NM_001083	
EPHA5	2044	broad.mit.edu	37	4	66189890	66189890	+	Missense_Mutation	SNP	A	A	T			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr4:66189890A>T	ENST00000273854.3	-	18	3656	c.3056T>A	c.(3055-3057)aTc>aAc	p.I1019N	EPHA5_ENST00000432638.2_Missense_Mutation_p.I856N|EPHA5_ENST00000354839.4_Missense_Mutation_p.I997N	NM_001281765.1|NM_004439.5	NP_001268694.1|NP_004430.4	P54756	EPHA5_HUMAN	EPH receptor A5	1019	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.				axon guidance (GO:0007411)|cAMP-mediated signaling (GO:0019933)|ephrin receptor signaling pathway (GO:0048013)|hippocampus development (GO:0021766)|negative regulation of synapse assembly (GO:0051964)|neuron development (GO:0048666)|positive regulation of CREB transcription factor activity (GO:0032793)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of Rac GTPase activity (GO:0032314)	dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|GPI-linked ephrin receptor activity (GO:0005004)|transmembrane-ephrin receptor activity (GO:0005005)	p.I1019N(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(25)|liver(1)|lung(76)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	142						GCTGTTCATGATCTTCTTCTG	0.433										TSP Lung(17;0.13)																											p.I1019N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T3056A	4						.						122.0	110.0	114.0					4																	66189890		2203	4300	6503	65872485	SO:0001583	missense	2044	exon18			L36644	CCDS3513.1, CCDS3514.1, CCDS75131.1, CCDS75132.1, CCDS75133.1	4q13.1	2013-02-11	2004-10-28		ENSG00000145242	ENSG00000145242		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3389	protein-coding gene	gene with protein product		600004	"""EphA5"""			9267020, 7528718	Standard	NM_004439		Approved	Hek7, TYRO4, CEK7, EHK1	uc003hcy.3	P54756	OTTHUMG00000129273	ENST00000273854.3:c.3056T>A	4.37:g.66189890A>T	ENSP00000273854:p.Ile1019Asn		65872485	NM_004439	Q7Z3F2	Missense_Mutation	SNP	ENST00000273854.3	37	CCDS3513.1	.	.	.	.	.	.	.	.	.	.	A	20.6	4.012359	0.75046	.	.	ENSG00000145242	ENST00000273854;ENST00000432638;ENST00000354839	T;T;T	0.68765	-0.35;-0.35;-0.35	5.25	5.25	0.73442	Sterile alpha motif domain (2);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 1 (1);	0.000000	0.56097	D	0.000025	D	0.86527	0.5954	M	0.94142	3.5	0.80722	D	1	D;D;D;D	0.89917	0.972;1.0;0.981;1.0	D;D;P;D	0.97110	0.933;1.0;0.89;0.99	D	0.90453	0.4440	10	0.87932	D	0	.	15.1623	0.72793	1.0:0.0:0.0:0.0	.	998;1020;997;1019	B7ZKW7;B7ZKJ3;P54756-2;P54756	.;.;.;EPHA5_HUMAN	N	1019;856;997	ENSP00000273854:I1019N;ENSP00000389208:I856N;ENSP00000346899:I997N	ENSP00000273854:I1019N	I	-	2	0	EPHA5	65872485	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.910000	0.92685	1.980000	0.57719	0.455000	0.32223	ATC		0.433	EPHA5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251388.2	NM_004439	
SLC4A4	8671	broad.mit.edu	37	4	72429564	72429564	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr4:72429564A>G	ENST00000264485.5	+	24	3271	c.3154A>G	c.(3154-3156)Atg>Gtg	p.M1052V	SLC4A4_ENST00000340595.3_Missense_Mutation_p.M1008V|SLC4A4_ENST00000425175.1_Intron|SLC4A4_ENST00000351898.6_Missense_Mutation_p.M968V	NM_001098484.2	NP_001091954.1	Q9Y6R1	S4A4_HUMAN	solute carrier family 4 (sodium bicarbonate cotransporter), member 4	1052					bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|sodium:bicarbonate symporter activity (GO:0008510)	p.M1008V(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(1)|lung(21)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	58			Lung(101;0.0739)|LUSC - Lung squamous cell carcinoma(112;0.225)		Sodium bicarbonate(DB01390)	AATGGACATCATGGAACAGCA	0.358																																					p.M1008V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A3022G	4						.						152.0	158.0	156.0					4																	72429564		2203	4300	6503	72648428	SO:0001583	missense	8671	exon21			AF007216	CCDS3549.1, CCDS43236.1, CCDS47071.1	4q13.3	2013-07-19	2013-07-19		ENSG00000080493	ENSG00000080493		"""Solute carriers"""	11030	protein-coding gene	gene with protein product		603345	"""solute carrier family 4, sodium bicarbonate cotransporter, member 4"""	SLC4A5		9235899, 9651366	Standard	NM_001098484		Approved	NBC1, HNBC1, NBC2, pNBC, hhNMC	uc010iic.3	Q9Y6R1	OTTHUMG00000129907	ENST00000264485.5:c.3154A>G	4.37:g.72429564A>G	ENSP00000264485:p.Met1052Val		72648428	NM_003759	C4B714|O15153|Q8NEJ2|Q9H262|Q9NRZ1|Q9UIC0|Q9UIC1|Q9UP50	Missense_Mutation	SNP	ENST00000264485.5	37	CCDS43236.1	.	.	.	.	.	.	.	.	.	.	A	7.750	0.703080	0.15172	.	.	ENSG00000080493	ENST00000264485;ENST00000351898;ENST00000340595	T;T;T	0.75154	-0.91;-0.58;-0.91	5.46	4.25	0.50352	.	0.037886	0.85682	D	0.000000	T	0.56572	0.1994	N	0.24115	0.695	0.80722	D	1	B;B;B	0.20164	0.012;0.042;0.025	B;B;B	0.21546	0.017;0.035;0.01	T	0.49643	-0.8918	10	0.02654	T	1	.	12.5178	0.56042	0.8603:0.1397:0.0:0.0	.	968;1008;1052	Q9Y6R1-4;Q9Y6R1-2;Q9Y6R1	.;.;S4A4_HUMAN	V	1052;968;1008	ENSP00000264485:M1052V;ENSP00000307349:M968V;ENSP00000344272:M1008V	ENSP00000264485:M1052V	M	+	1	0	SLC4A4	72648428	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	6.988000	0.76212	0.885000	0.36088	-0.619000	0.04042	ATG		0.358	SLC4A4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362090.1	NM_003759	
IBSP	3381	broad.mit.edu	37	4	88732921	88732921	+	Silent	SNP	C	C	T			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr4:88732921C>T	ENST00000226284.5	+	7	880	c.813C>T	c.(811-813)taC>taT	p.Y271Y		NM_004967.3	NP_004958.2	P21815	SIAL_HUMAN	integrin-binding sialoprotein	271					biomineral tissue development (GO:0031214)|cell adhesion (GO:0007155)|cellular response to growth factor stimulus (GO:0071363)|extracellular matrix organization (GO:0030198)|osteoblast differentiation (GO:0001649)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|membrane-bounded vesicle (GO:0031988)		p.Y271Y(2)		breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(10)	21		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000333)|COAD - Colon adenocarcinoma(81;0.154)		CCAATGAATACGACAATGGAT	0.478																																					p.Y271Y												.	.	2	Substitution - coding silent(2)	large_intestine(1)|kidney(1)	c.C813T	4						.						67.0	63.0	64.0					4																	88732921		2203	4300	6503	88951945	SO:0001819	synonymous_variant	3381	exon7				CCDS3624.1	4q21.1	2008-07-28	2008-07-28		ENSG00000029559	ENSG00000029559			5341	protein-coding gene	gene with protein product	"""bone sialoprotein"", ""bone sialoprotein II"""	147563				8406493	Standard	NM_004967		Approved	BSP, SP-II, BSP-II	uc003hqx.4	P21815	OTTHUMG00000130600	ENST00000226284.5:c.813C>T	4.37:g.88732921C>T			88951945	NM_004967		Silent	SNP	ENST00000226284.5	37	CCDS3624.1																																																																																				0.478	IBSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253050.2		
QRFPR	84109	broad.mit.edu	37	4	122250509	122250509	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr4:122250509G>C	ENST00000394427.2	-	6	1667	c.1256C>G	c.(1255-1257)tCt>tGt	p.S419C	QRFPR_ENST00000334383.5_3'UTR|Y_RNA_ENST00000384419.1_RNA	NM_198179.2	NP_937822.2	Q96P65	QRFPR_HUMAN	pyroglutamylated RFamide peptide receptor	419					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide Y receptor activity (GO:0004983)	p.S419C(1)		endometrium(1)|kidney(2)|large_intestine(9)|lung(10)|prostate(2)|skin(3)|stomach(1)	28						AGCCAGTTCAGACCTAAAGAG	0.368																																					p.S419C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1256G	4						.						137.0	130.0	132.0					4																	122250509		2203	4300	6503	122469959	SO:0001583	missense	84109	exon6			AF411117	CCDS3719.1	4q27	2012-08-10	2008-12-18	2008-12-18	ENSG00000186867	ENSG00000186867		"""GPCR / Class A : RF amide peptide receptors"""	15565	protein-coding gene	gene with protein product		606925	"""G protein-coupled receptor 103"""	GPR103		11574155	Standard	NM_198179		Approved		uc010inj.1	Q96P65	OTTHUMG00000133036	ENST00000394427.2:c.1256C>G	4.37:g.122250509G>C	ENSP00000377948:p.Ser419Cys		122469959	NM_198179		Missense_Mutation	SNP	ENST00000394427.2	37	CCDS3719.1	.	.	.	.	.	.	.	.	.	.	G	15.26	2.780705	0.49891	.	.	ENSG00000186867	ENST00000394427	T	0.74209	-0.82	4.63	3.78	0.43462	.	0.325600	0.25938	N	0.027332	T	0.64692	0.2621	L	0.29908	0.895	0.80722	D	1	B	0.21821	0.061	B	0.22152	0.038	T	0.63269	-0.6675	10	0.59425	D	0.04	.	14.5419	0.68002	0.0:0.164:0.836:0.0	.	419	Q96P65	QRFPR_HUMAN	C	419	ENSP00000377948:S419C	ENSP00000377948:S419C	S	-	2	0	QRFPR	122469959	0.998000	0.40836	0.696000	0.30242	0.644000	0.38419	3.633000	0.54295	1.139000	0.42245	0.313000	0.20887	TCT		0.368	QRFPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256641.2	NM_198179	
PJA2	9867	broad.mit.edu	37	5	108679941	108679941	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr5:108679941G>C	ENST00000361189.2	-	9	2190	c.1951C>G	c.(1951-1953)Ccc>Gcc	p.P651A	PJA2_ENST00000361557.3_Missense_Mutation_p.P651A	NM_014819.4	NP_055634.3	O43164	PJA2_HUMAN	praja ring finger 2, E3 ubiquitin protein ligase	651	Interaction with PRKAR1A, PRKAR2A and PRKAR2B.				long-term memory (GO:0007616)|protein ubiquitination (GO:0016567)|regulation of protein kinase A signaling (GO:0010738)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ligase activity (GO:0016874)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.P651A(1)		endometrium(2)|kidney(2)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	21		all_cancers(142;4.4e-06)|all_epithelial(76;8.17e-08)|Prostate(80;0.00676)|Lung NSC(167;0.0436)|Ovarian(225;0.0443)|all_lung(232;0.053)|Colorectal(57;0.0946)|Breast(839;0.151)		OV - Ovarian serous cystadenocarcinoma(64;3.46e-10)|Epithelial(69;6.02e-09)|COAD - Colon adenocarcinoma(37;0.224)		TGGTGACAGGGCAACTCTGTT	0.338																																					p.P651A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1951G	5						.						83.0	77.0	79.0					5																	108679941		2202	4300	6502	108707840	SO:0001583	missense	9867	exon9			AB007898	CCDS4099.1	5q22.1	2013-01-09	2012-02-23	2003-06-05	ENSG00000198961	ENSG00000198961		"""RING-type (C3HC4) zinc fingers"""	17481	protein-coding gene	gene with protein product			"""ring finger protein 131"", ""praja ring finger 2"""	RNF131			Standard	NM_014819		Approved	KIAA0438, Neurodap1	uc003kos.4	O43164	OTTHUMG00000128750	ENST00000361189.2:c.1951C>G	5.37:g.108679941G>C	ENSP00000354775:p.Pro651Ala		108707840	NM_014819	A8K6U4|D3DSZ5|Q68D49|Q8N1G5	Missense_Mutation	SNP	ENST00000361189.2	37	CCDS4099.1	.	.	.	.	.	.	.	.	.	.	G	26.3	4.723733	0.89298	.	.	ENSG00000198961	ENST00000361189;ENST00000361557	T;T	0.72282	-0.64;-0.64	6.17	6.17	0.99709	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, C3HC4 RING-type (1);	0.000000	0.64402	D	0.000001	D	0.87095	0.6092	M	0.85197	2.74	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.87287	0.2296	10	0.87932	D	0	-9.1349	20.8794	0.99867	0.0:0.0:1.0:0.0	.	651	O43164	PJA2_HUMAN	A	651	ENSP00000354775:P651A;ENSP00000355284:P651A	ENSP00000354775:P651A	P	-	1	0	PJA2	108707840	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.635000	0.83286	2.941000	0.99782	0.655000	0.94253	CCC		0.338	PJA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250663.1	NM_014819	
APC	324	broad.mit.edu	37	5	112175216	112175216	+	Nonsense_Mutation	SNP	G	G	T	rs121913224		TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr5:112175216G>T	ENST00000457016.1	+	16	4305	c.3925G>T	c.(3925-3927)Gaa>Taa	p.E1309*	APC_ENST00000257430.4_Nonsense_Mutation_p.E1309*|CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000508376.2_Nonsense_Mutation_p.E1309*			P25054	APC_HUMAN	adenomatous polyposis coli	1309	Responsible for down-regulation through a process mediated by direct ubiquitination.|Ser-rich.			E -> G (in Ref. 1; AAA60353/AAA60354). {ECO:0000305}.	anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.E1309fs*4(42)|p.E1309*(25)|p.I1311fs*4(2)|p.?(1)|p.E1309fs*6(1)|p.E1309fs*5(1)|p.K1192fs*3(1)|p.E1309K(1)|p.K1308fs*4(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		AGAAATAAAAGAAAAGATTGG	0.423		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.E1291X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,upper_aerodigestive_tract,sinonasal_and_nasal_cavity,Substitution - Missense,0 	.	75	Deletion - Frameshift(45)|Substitution - Nonsense(25)|Insertion - Frameshift(3)|Unknown(1)|Substitution - Missense(1)	large_intestine(71)|upper_aerodigestive_tract(1)|stomach(1)|soft_tissue(1)|skin(1)	c.G3871T	5	GRCh37	CD084022|CD941590|CM920052	APC	D|M		.						54.0	55.0	55.0					5																	112175216		2202	4300	6502	112203115	SO:0001587	stop_gained	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.3925G>T	5.37:g.112175216G>T	ENSP00000413133:p.Glu1309*		112203115	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	G	37	6.023820	0.97211	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376	.	.	.	5.73	5.73	0.89815	.	0.365794	0.32503	N	0.006002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-11.1954	19.8705	0.96849	0.0:0.0:1.0:0.0	.	.	.	.	X	1309	.	.	E	+	1	0	APC	112203115	1.000000	0.71417	0.971000	0.41717	0.520000	0.34377	7.454000	0.80714	2.861000	0.98227	0.655000	0.94253	GAA		0.423	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
PCDHGA9	56107	broad.mit.edu	37	5	140782967	140782967	+	Missense_Mutation	SNP	G	G	A	rs370218984		TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr5:140782967G>A	ENST00000573521.1	+	1	448	c.448G>A	c.(448-450)Gca>Aca	p.A150T	PCDHGA1_ENST00000517417.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB2_ENST00000522605.1_Intron	NM_018921.2|NM_032089.1	NP_061744.1|NP_114478.1	Q9Y5G4	PCDG9_HUMAN	protocadherin gamma subfamily A, 9	150	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGTTCCTGGAGCACGTTATCC	0.488																																					p.A150T												.	.	0			c.G448A	5						.						74.0	77.0	76.0					5																	140782967		1946	4150	6096	140763151	SO:0001583	missense	56107	exon1			AF152516	CCDS58981.1, CCDS75341.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8707	other	protocadherin		606296				10380929	Standard	NM_018921		Approved	PCDH-GAMMA-A9		Q9Y5G4		ENST00000573521.1:c.448G>A	5.37:g.140782967G>A	ENSP00000460274:p.Ala150Thr		140763151	NM_018921	A2RU65|Q9Y5C9	Missense_Mutation	SNP	ENST00000573521.1	37	CCDS58981.1																																																																																				0.488	PCDHGA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437105.1	NM_018921	
SLC1A3	6507	broad.mit.edu	37	5	36671175	36671175	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr5:36671175C>T	ENST00000265113.4	+	4	840	c.364C>T	c.(364-366)Cga>Tga	p.R122*	SLC1A3_ENST00000381918.3_Nonsense_Mutation_p.R122*|CTD-2353F22.1_ENST00000510740.1_RNA	NM_004172.4	NP_004163.3	P43003	EAA1_HUMAN	solute carrier family 1 (glial high affinity glutamate transporter), member 3	122					auditory behavior (GO:0031223)|cell morphogenesis involved in neuron differentiation (GO:0048667)|cranial nerve development (GO:0021545)|D-aspartate import (GO:0070779)|gamma-aminobutyric acid biosynthetic process (GO:0009449)|glutamate biosynthetic process (GO:0006537)|ion transport (GO:0006811)|L-glutamate import (GO:0051938)|neuromuscular process controlling balance (GO:0050885)|neurotransmitter uptake (GO:0001504)|positive regulation of synaptic transmission (GO:0050806)|response to antibiotic (GO:0046677)|response to drug (GO:0042493)|response to light stimulus (GO:0009416)|response to wounding (GO:0009611)|sensory perception of sound (GO:0007605)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell projection (GO:0042995)|cell surface (GO:0009986)|fibril (GO:0043205)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	glutamate binding (GO:0016595)|high-affinity glutamate transmembrane transporter activity (GO:0005314)|L-glutamate transmembrane transporter activity (GO:0005313)|sodium:dicarboxylate symporter activity (GO:0017153)	p.R122*(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|liver(1)|lung(23)|skin(1)	41	all_lung(31;0.000245)		Epithelial(62;0.0444)|Lung(74;0.111)|all cancers(62;0.128)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			GATGGGAATGCGAGCTGTAGT	0.468																																					p.R122X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C364T	5						.						119.0	107.0	111.0					5																	36671175		2203	4300	6503	36706932	SO:0001587	stop_gained	6507	exon3				CCDS3919.1, CCDS54844.1	5p13	2013-05-22			ENSG00000079215	ENSG00000079215		"""Solute carriers"""	10941	protein-coding gene	gene with protein product	"""glutamate transporter variant EAAT1ex9skip"""	600111				7521911, 7698014	Standard	NM_004172		Approved	EAAT1, GLAST, EA6	uc003jkj.4	P43003	OTTHUMG00000090793	ENST00000265113.4:c.364C>T	5.37:g.36671175C>T	ENSP00000265113:p.Arg122*		36706932	NM_001166695	B2R5T3|Q4JCQ8	Nonsense_Mutation	SNP	ENST00000265113.4	37	CCDS3919.1	.	.	.	.	.	.	.	.	.	.	C	40	8.070883	0.98638	.	.	ENSG00000079215	ENST00000265113;ENST00000427100;ENST00000381918	.	.	.	4.7	3.76	0.43208	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.1434	13.5571	0.61765	0.2394:0.7606:0.0:0.0	.	.	.	.	X	122;70;122	.	ENSP00000265113:R122X	R	+	1	2	SLC1A3	36706932	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.520000	0.45554	2.421000	0.82119	0.655000	0.94253	CGA		0.468	SLC1A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207579.2	NM_004172	
CDHR2	54825	broad.mit.edu	37	5	175995737	175995737	+	Silent	SNP	G	G	T			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr5:175995737G>T	ENST00000510636.1	+	4	457	c.183G>T	c.(181-183)ggG>ggT	p.G61G	CDHR2_ENST00000261944.5_Silent_p.G61G|CDHR2_ENST00000506348.1_Silent_p.G61G	NM_001171976.1	NP_001165447.1	Q9BYE9	CDHR2_HUMAN	cadherin-related family member 2	61	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|negative regulation of cell growth (GO:0030308)	cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G61G(1)		breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(8)|liver(1)|lung(23)|ovary(3)|prostate(5)|skin(4)|urinary_tract(1)	56						TGACCTATGGGATGAGCGGCC	0.607																																					p.G61G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G183T	5						.						108.0	101.0	104.0					5																	175995737		2203	4300	6503	175928343	SO:0001819	synonymous_variant	54825	exon4			AB047004	CCDS34297.1	5q35.2	2011-07-01	2010-01-25	2010-01-25		ENSG00000074276		"""Cadherins / Cadherin-related"""	18231	protein-coding gene	gene with protein product	"""protocadherin LKC"""		"""protocadherin 24"""	PCDH24		11082270, 12117771	Standard	NM_001171976		Approved	PC-LKC, FLJ20124, FLJ20383, PCLKC	uc003mem.2	Q9BYE9		ENST00000510636.1:c.183G>T	5.37:g.175995737G>T			175928343	NM_001171976	A1L3U4|A6NC80|Q9NXP8	Silent	SNP	ENST00000510636.1	37	CCDS34297.1																																																																																				0.607	CDHR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372201.1	NM_017675	
FOXF2	2295	broad.mit.edu	37	6	1394987	1394987	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr6:1394987G>A	ENST00000259806.1	+	2	1342	c.1228G>A	c.(1228-1230)Gtc>Atc	p.V410I		NM_001452.1	NP_001443.1	Q12947	FOXF2_HUMAN	forkhead box F2	410					embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digestive tract development (GO:0048566)|epithelial to mesenchymal transition (GO:0001837)|establishment of planar polarity of embryonic epithelium (GO:0042249)|extracellular matrix organization (GO:0030198)|genitalia development (GO:0048806)|negative regulation of transcription, DNA-templated (GO:0045892)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.V410I(1)		large_intestine(2)|lung(5)|prostate(1)	8	Ovarian(93;0.0733)	all_lung(73;0.0713)|all_hematologic(90;0.0895)		OV - Ovarian serous cystadenocarcinoma(45;0.095)		AAAAGATTTCGTCCTCAACTT	0.453																																					p.V410I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1228A	6						.						217.0	189.0	198.0					6																	1394987		2203	4300	6503	1339986	SO:0001583	missense	2295	exon2			U13220	CCDS4472.1	6p25.3	2008-04-10			ENSG00000137273	ENSG00000137273		"""Forkhead boxes"""	3810	protein-coding gene	gene with protein product		603250		FKHL6		9799607, 7957066	Standard	NM_001452		Approved	FREAC2	uc003mtm.3	Q12947	OTTHUMG00000016243	ENST00000259806.1:c.1228G>A	6.37:g.1394987G>A	ENSP00000259806:p.Val410Ile		1339986	NM_001452	Q5TGJ1|Q9UQ85	Missense_Mutation	SNP	ENST00000259806.1	37	CCDS4472.1	.	.	.	.	.	.	.	.	.	.	G	27.9	4.869074	0.91587	.	.	ENSG00000137273	ENST00000259806	D	0.94576	-3.46	5.76	5.76	0.90799	.	0.086095	0.45361	D	0.000361	D	0.96473	0.8849	M	0.66939	2.045	0.80722	D	1	D	0.76494	0.999	D	0.71184	0.972	D	0.95932	0.8939	10	0.52906	T	0.07	.	18.9641	0.92689	0.0:0.0:1.0:0.0	.	410	Q12947	FOXF2_HUMAN	I	410	ENSP00000259806:V410I	ENSP00000259806:V410I	V	+	1	0	FOXF2	1339986	1.000000	0.71417	0.992000	0.48379	0.721000	0.41392	7.305000	0.78891	2.713000	0.92767	0.655000	0.94253	GTC		0.453	FOXF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043558.1		
MED23	9439	broad.mit.edu	37	6	131929191	131929191	+	Silent	SNP	A	A	G			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr6:131929191A>G	ENST00000368068.3	-	12	1277	c.1098T>C	c.(1096-1098)atT>atC	p.I366I	MED23_ENST00000368060.3_Silent_p.I366I|MED23_ENST00000540546.1_Silent_p.I372I|MED23_ENST00000368058.1_Silent_p.I372I|MED23_ENST00000403834.3_Silent_p.I372I|MED23_ENST00000354577.4_Silent_p.I372I|MED23_ENST00000545957.1_Intron|MED23_ENST00000368053.4_Silent_p.I372I|MED23_ENST00000539158.1_Silent_p.I366I	NM_004830.3	NP_004821.2	Q9ULK4	MED23_HUMAN	mediator complex subunit 23	366					gene expression (GO:0010467)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	transcription coactivator activity (GO:0003713)	p.I366I(1)|p.I372I(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(12)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	44	Breast(56;0.0753)			GBM - Glioblastoma multiforme(226;0.0115)|OV - Ovarian serous cystadenocarcinoma(155;0.0608)		CTCTGCCTTTAATCAGTCCTC	0.363																																					p.I372I												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.T1116C	6						.						89.0	90.0	90.0					6																	131929191		2203	4300	6503	131970884	SO:0001819	synonymous_variant	9439	exon13			AF104255	CCDS5146.1, CCDS5147.1, CCDS59039.1	6q22.33-q24.1	2008-02-05	2007-08-08	2007-07-30	ENSG00000112282	ENSG00000112282			2372	protein-coding gene	gene with protein product		605042	"""cofactor required for Sp1 transcriptional activation, subunit 3, 130kDa"""	CRSP3		9989412	Standard	NM_004830		Approved	CRSP130, DRIP130, Sur2	uc003qcs.2	Q9ULK4	OTTHUMG00000015565	ENST00000368068.3:c.1098T>C	6.37:g.131929191A>G			131970884	NM_015979	B9TX55|O95403|Q5JWT3|Q5JWT4|Q6P9H6|Q9H0J2|Q9NTT9|Q9NTU0|Q9Y5P7|Q9Y667	Silent	SNP	ENST00000368068.3	37	CCDS5147.1																																																																																				0.363	MED23-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000042215.1		
LTV1	84946	broad.mit.edu	37	6	144179116	144179116	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr6:144179116T>A	ENST00000367576.5	+	6	901	c.767T>A	c.(766-768)cTg>cAg	p.L256Q		NM_032860.3	NP_116249.2	Q96GA3	LTV1_HUMAN	LTV1 ribosome biogenesis factor	256						cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.L256Q(1)		breast(2)|endometrium(1)|large_intestine(2)|lung(5)|ovary(2)|prostate(1)	13				OV - Ovarian serous cystadenocarcinoma(155;2.72e-06)|GBM - Glioblastoma multiforme(68;0.0372)		AATGAACAGCTGACCCTACAT	0.408																																					p.L256Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T767A	6						.						70.0	71.0	71.0					6																	144179116		2203	4300	6503	144220809	SO:0001583	missense	84946	exon6			BC009855	CCDS5201.1	6q24.2	2014-02-03	2014-02-03	2006-02-06	ENSG00000135521	ENSG00000135521			21173	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 93"", ""LTV1 homolog (S. cerevisiae)"""	C6orf93			Standard	NM_032860		Approved	FLJ14909, dJ468K18.4	uc003qjs.3	Q96GA3	OTTHUMG00000015733	ENST00000367576.5:c.767T>A	6.37:g.144179116T>A	ENSP00000356548:p.Leu256Gln		144220809	NM_032860	Q96JX8	Missense_Mutation	SNP	ENST00000367576.5	37	CCDS5201.1	.	.	.	.	.	.	.	.	.	.	T	27.8	4.866561	0.91511	.	.	ENSG00000135521	ENST00000367576	.	.	.	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	T	0.75591	0.3870	M	0.80746	2.51	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	T	0.77705	-0.2488	9	0.48119	T	0.1	-7.1932	16.1445	0.81555	0.0:0.0:0.0:1.0	.	256	Q96GA3	LTV1_HUMAN	Q	256	.	ENSP00000356548:L256Q	L	+	2	0	LTV1	144220809	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.650000	0.83521	2.223000	0.72356	0.477000	0.44152	CTG		0.408	LTV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042532.1	NM_032860	
HLA-A	3105	broad.mit.edu	37	6	29911183	29911183	+	Missense_Mutation	SNP	A	A	C	rs72555400		TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr6:29911183A>C	ENST00000396634.1	+	5	823	c.482A>C	c.(481-483)gAc>gCc	p.D161A	HLA-A_ENST00000376809.5_Missense_Mutation_p.D161A|HLA-A_ENST00000376806.5_Missense_Mutation_p.D161A|HLA-A_ENST00000376802.2_Missense_Mutation_p.D161A			P16189	1A31_HUMAN	major histocompatibility complex, class I, A	161	Alpha-2.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	beta-2-microglobulin binding (GO:0030881)|peptide antigen binding (GO:0042605)|TAP binding (GO:0046977)	p.D161A(1)		central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	30						ACCGCGGCGGACATGGCGGCT	0.672									Osteosarcoma, Familial Clustering of;Naso-/Oropharyngeal/Laryngeal Cancer, Familial Clustering of;Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of	Multiple Myeloma(9;0.094)																											p.D161A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A482C	6						.						43.0	31.0	35.0					6																	29911183		1506	2708	4214	30019162	SO:0001583	missense	3105	exon3	Familial Cancer Database	Familial Osteogenic Sarcoma;incl.: Familial Head and Neck Cancer; ;Lichen Sclerosis, Familial	D32129	CCDS34373.1	6p21.3	2013-01-11			ENSG00000206503	ENSG00000206503		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4931	protein-coding gene	gene with protein product		142800				8838351	Standard	NM_001242758		Approved		uc003nol.3	P01891	OTTHUMG00000130501	ENST00000396634.1:c.482A>C	6.37:g.29911183A>C	ENSP00000379873:p.Asp161Ala		30019162	NM_002116	O62924|O98009|O98137|Q8MHM1|Q9TPQ3|Q9TQ24|Q9UQU6|Q9UQU7	Missense_Mutation	SNP	ENST00000396634.1	37	CCDS34373.1	.	.	.	.	.	.	.	.	.	.	.	3.022	-0.201625	0.06219	.	.	ENSG00000206503	ENST00000396634;ENST00000376806;ENST00000376809;ENST00000376802	T;T;T;T	0.00011	9.34;9.34;9.34;9.34	3.78	1.3	0.21679	MHC class I, alpha chain, alpha1/alpha2 (4);MHC classes I/II-like antigen recognition protein (4);MHC class I-like antigen recognition (4);	0.000000	0.37623	U	0.002003	T	0.00210	0.0006	H	0.97365	3.99	0.09310	N	1	B;B;D;B;B;B;B	0.71674	0.0;0.02;0.998;0.001;0.0;0.036;0.007	B;B;D;B;B;B;B	0.87578	0.001;0.025;0.998;0.008;0.004;0.041;0.025	T	0.42582	-0.9443	10	0.87932	D	0	.	3.8027	0.08764	0.6588:0.2215:0.1197:0.0	.	40;161;161;161;161;161;161	B4DVB9;P13746;Q5SRN7;P16188;Q5SRN5;P30455;P04439	.;1A11_HUMAN;.;1A30_HUMAN;.;1A36_HUMAN;1A03_HUMAN	A	161	ENSP00000379873:D161A;ENSP00000366002:D161A;ENSP00000366005:D161A;ENSP00000365998:D161A	ENSP00000365998:D161A	D	+	2	0	HLA-A	30019162	0.000000	0.05858	0.014000	0.15608	0.192000	0.23643	-0.054000	0.11826	0.164000	0.19529	0.397000	0.26171	GAC		0.672	HLA-A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252909.1	NM_002116	
LTB	4050	broad.mit.edu	37	6	31548597	31548597	+	Silent	SNP	G	G	A			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr6:31548597G>A	ENST00000429299.2	-	4	631	c.624C>T	c.(622-624)ggC>ggT	p.G208G	LTB_ENST00000483972.1_5'UTR|LTB_ENST00000446745.2_3'UTR	NM_002341.1	NP_002332.1	Q06643	TNFC_HUMAN	lymphotoxin beta (TNF superfamily, member 3)	208					cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|immune response (GO:0006955)|lymph node development (GO:0048535)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|signal transduction (GO:0007165)|skin development (GO:0043588)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor binding (GO:0005102)	p.G208G(2)		haematopoietic_and_lymphoid_tissue(3)|large_intestine(2)|lung(2)|prostate(1)|upper_aerodigestive_tract(1)	9						GCACCAGGCCGCCGAACCCCA	0.657																																					p.G208G												.	.	2	Substitution - coding silent(2)	large_intestine(1)|lung(1)	c.C624T	6						.						48.0	31.0	37.0					6																	31548597		1510	2709	4219	31656576	SO:0001819	synonymous_variant	4050	exon4			L11015	CCDS4703.1, CCDS4704.1	6p21.3	2013-05-22			ENSG00000227507	ENSG00000227507		"""Tumor necrosis factor (ligand) superfamily"""	6711	protein-coding gene	gene with protein product		600978		TNFC		7916655, 1714477	Standard	NM_002341		Approved	p33, TNFSF3	uc003nuk.3	Q06643	OTTHUMG00000031136	ENST00000429299.2:c.624C>T	6.37:g.31548597G>A			31656576	NM_002341	P78370|Q52LU8|Q99761	Silent	SNP	ENST00000429299.2	37	CCDS4703.1																																																																																				0.657	LTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076239.3		
GLTSCR1L	23506	broad.mit.edu	37	6	42819912	42819912	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr6:42819912G>A	ENST00000314073.5	+	7	2098	c.1922G>A	c.(1921-1923)gGg>gAg	p.G641E	GLTSCR1L_ENST00000394168.1_Missense_Mutation_p.G641E			Q6AI39	GSC1L_HUMAN	GLTSCR1-like	641								p.G641E(1)									CAGATCCCTGGGCTCTTGAGC	0.527																																					p.G641E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1922A	6						.						97.0	80.0	86.0					6																	42819912		2203	4300	6503	42927890	SO:0001583	missense	23506	exon6			AL833540	CCDS34451.1	6p21.1	2012-11-29	2012-11-29	2012-11-29	ENSG00000112624	ENSG00000112624			21111	protein-coding gene	gene with protein product			"""KIAA0240"""	KIAA0240			Standard	XM_005248972		Approved		uc003osp.1	Q6AI39	OTTHUMG00000014706	ENST00000314073.5:c.1922G>A	6.37:g.42819912G>A	ENSP00000313933:p.Gly641Glu		42927890	NM_015349	A1L3W2|Q5TFZ3|Q92514	Missense_Mutation	SNP	ENST00000314073.5	37	CCDS34451.1	.	.	.	.	.	.	.	.	.	.	G	17.40	3.380584	0.61845	.	.	ENSG00000112624	ENST00000394167;ENST00000536004;ENST00000314073;ENST00000394168	T;T	0.47177	0.85;0.85	5.14	5.14	0.70334	.	0.184794	0.38663	N	0.001612	T	0.31857	0.0810	L	0.36672	1.1	0.37443	D	0.914492	P;P	0.47762	0.835;0.9	P;P	0.44990	0.466;0.466	T	0.07558	-1.0766	10	0.33141	T	0.24	-2.1386	16.7878	0.85578	0.0:0.0:1.0:0.0	.	641;641	Q6AI39;B7Z2G7	K0240_HUMAN;.	E	641	ENSP00000313933:G641E;ENSP00000377723:G641E	ENSP00000313933:G641E	G	+	2	0	KIAA0240	42927890	1.000000	0.71417	0.975000	0.42487	0.928000	0.56348	4.180000	0.58296	2.377000	0.81083	0.462000	0.41574	GGG		0.527	GLTSCR1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040562.3	NM_015349	
TMEM63B	55362	broad.mit.edu	37	6	44114658	44114658	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr6:44114658C>A	ENST00000259746.9	+	11	1040	c.857C>A	c.(856-858)gCa>gAa	p.A286E	TMEM63B_ENST00000323267.6_Missense_Mutation_p.A286E			Q5T3F8	CSCL2_HUMAN	transmembrane protein 63B	286					ion transport (GO:0006811)	integral component of membrane (GO:0016021)	nucleotide binding (GO:0000166)	p.A286E(1)		breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|pancreas(2)|prostate(2)|stomach(4)	35	all_cancers(18;1.66e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00309)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0215)			TTCCTCGATGCAGAGAGGTAA	0.552																																					p.A286E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C857A	6						.						85.0	72.0	76.0					6																	44114658		2203	4300	6503	44222636	SO:0001583	missense	55362	exon11			BC022095	CCDS34461.1	6p21.1	2008-02-05	2005-07-25	2005-07-25	ENSG00000137216	ENSG00000137216			17735	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 110"""	C6orf110			Standard	XM_005249211		Approved	DKFZp434P0531, dJ421H19.2	uc003owr.3	Q5T3F8	OTTHUMG00000014757	ENST00000259746.9:c.857C>A	6.37:g.44114658C>A	ENSP00000259746:p.Ala286Glu		44222636	NM_018426	B9EGU3|Q5T3F9|Q6AHX4|Q6P5A0|Q8N219|Q8NDE1|Q9NSG5	Missense_Mutation	SNP	ENST00000259746.9	37	CCDS34461.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.10|14.10	2.434962|2.434962	0.43224|0.43224	.|.	.|.	ENSG00000137216|ENSG00000137216	ENST00000259746;ENST00000323267|ENST00000371893	T;T|.	0.36520|.	1.25;1.25|.	4.54|4.54	3.59|3.59	0.41128|0.41128	.|.	0.117031|.	0.64402|.	D|.	0.000019|.	T|T	0.43010|0.43010	0.1228|0.1228	L|L	0.31926|0.31926	0.97|0.97	0.48901|0.48901	D|D	0.999729|0.999729	B;P|.	0.34724|.	0.015;0.465|.	B;B|.	0.34242|.	0.011;0.178|.	T|T	0.28744|0.28744	-1.0034|-1.0034	10|5	0.07813|.	T|.	0.8|.	.|.	13.6798|13.6798	0.62476|0.62476	0.1544:0.8455:0.0:0.0|0.1544:0.8455:0.0:0.0	.|.	286;286|.	Q5T3F8;Q5T3F8-2|.	TM63B_HUMAN;.|.	E|K	286|215	ENSP00000259746:A286E;ENSP00000327154:A286E|.	ENSP00000259746:A286E|.	A|Q	+|+	2|1	0|0	TMEM63B|TMEM63B	44222636|44222636	0.981000|0.981000	0.34729|0.34729	0.989000|0.989000	0.46669|0.46669	0.981000|0.981000	0.71138|0.71138	2.554000|2.554000	0.45845|0.45845	2.501000|2.501000	0.84356|0.84356	0.650000|0.650000	0.86243|0.86243	GCA|CAG		0.552	TMEM63B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040712.2	XM_166410	
CCDC170	80129	broad.mit.edu	37	6	151857487	151857487	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr6:151857487C>T	ENST00000239374.7	+	2	191	c.92C>T	c.(91-93)aCg>aTg	p.T31M	CCDC170_ENST00000544131.1_3'UTR|CCDC170_ENST00000367290.5_Missense_Mutation_p.T31M	NM_025059.3	NP_079335.2	Q8IYT3	CC170_HUMAN	coiled-coil domain containing 170	31								p.T31M(1)									GTCCCGGTCACGCGGGAGCAG	0.433																																					p.T31M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C92T	6						.						104.0	97.0	99.0					6																	151857487		1854	4094	5948	151899180	SO:0001583	missense	80129	exon2			AK026958	CCDS43515.1	6q25.1	2012-03-26	2012-03-26	2012-03-26	ENSG00000120262	ENSG00000120262			21177	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 97"""	C6orf97			Standard	NM_025059		Approved	FLJ23305, bA282P11.1	uc003qol.3	Q8IYT3	OTTHUMG00000015839	ENST00000239374.7:c.92C>T	6.37:g.151857487C>T	ENSP00000239374:p.Thr31Met		151899180	NM_025059	Q5VXB7|Q6P9E4|Q96KA9|Q9H5M3	Missense_Mutation	SNP	ENST00000239374.7	37	CCDS43515.1	.	.	.	.	.	.	.	.	.	.	C	12.93	2.086199	0.36855	.	.	ENSG00000120262	ENST00000239374;ENST00000367290	T;T	0.11821	2.75;2.74	5.95	3.17	0.36434	.	0.491298	0.22181	N	0.063519	T	0.16257	0.0391	M	0.73962	2.25	0.26952	N	0.966002	D	0.71674	0.998	P	0.59288	0.855	T	0.05451	-1.0884	10	0.87932	D	0	-1.2721	9.129	0.36833	0.0:0.7463:0.1219:0.1318	.	31	Q8IYT3	CF097_HUMAN	M	31	ENSP00000239374:T31M;ENSP00000356259:T31M	ENSP00000239374:T31M	T	+	2	0	C6orf97	151899180	0.675000	0.27558	0.047000	0.18901	0.001000	0.01503	1.302000	0.33459	0.389000	0.25086	-0.157000	0.13467	ACG		0.433	CCDC170-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000042727.2	NM_025059	
SRRT	51593	broad.mit.edu	37	7	100485102	100485102	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr7:100485102T>G	ENST00000347433.4	+	16	2295	c.2137T>G	c.(2137-2139)Tgg>Ggg	p.W713G	SRRT_ENST00000432932.1_Missense_Mutation_p.W712G|SRRT_ENST00000457580.2_Missense_Mutation_p.W713G|SRRT_ENST00000388793.4_Missense_Mutation_p.W712G			Q9BXP5	SRRT_HUMAN	serrate, RNA effector molecule	713					cell proliferation (GO:0008283)|neuronal stem cell maintenance (GO:0097150)|primary miRNA processing (GO:0031053)|regulation of transcription, DNA-templated (GO:0006355)|response to arsenic-containing substance (GO:0046685)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)	p.W713G(1)		breast(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(5)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	40						CAAGGATAAGTGGCTGTGTCC	0.572																																					p.W712G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2134G	7						.						139.0	114.0	122.0					7																	100485102		2203	4300	6503	100323038	SO:0001583	missense	51593	exon16				CCDS34709.1, CCDS47665.1, CCDS47666.1, CCDS47667.1	7q21	2014-04-14	2014-04-14		ENSG00000087087	ENSG00000087087			24101	protein-coding gene	gene with protein product	"""arsenite resistance protein"""	614469	"""serrate RNA effector molecule homolog (Arabidopsis)"""			11239002, 11230166	Standard	NM_015908		Approved	Asr2, serrate, ARS2	uc003uwy.2	Q9BXP5	OTTHUMG00000157031	ENST00000347433.4:c.2137T>G	7.37:g.100485102T>G	ENSP00000314491:p.Trp713Gly		100323038	NM_001128852	A4D2E5|A4D2E6|A6NK22|B4DJL4|B4DZA6|O95808|Q32MI4|Q6NT74|Q8TDQ5|Q9BWP6|Q9BXP4|Q9Y4S4	Missense_Mutation	SNP	ENST00000347433.4	37	CCDS34709.1	.	.	.	.	.	.	.	.	.	.	T	20.5	3.993414	0.74703	.	.	ENSG00000087087	ENST00000457580;ENST00000388793;ENST00000342198;ENST00000432932;ENST00000347433;ENST00000448764	.	.	.	4.83	4.83	0.62350	Arsenite-resistance protein 2 (1);	0.000000	0.85682	D	0.000000	T	0.79793	0.4507	M	0.85197	2.74	0.80722	D	1	D;D;D;D	0.69078	0.996;0.996;0.996;0.997	D;D;D;D	0.81914	0.986;0.991;0.991;0.995	T	0.83196	-0.0081	9	0.87932	D	0	.	12.3543	0.55165	0.0:0.0:0.0:1.0	.	712;712;713;713	Q9BXP5-3;Q9BXP5-4;Q9BXP5-2;Q9BXP5	.;.;.;SRRT_HUMAN	G	713;712;78;712;713;343	.	ENSP00000344670:W78G	W	+	1	0	SRRT	100323038	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	7.440000	0.80464	2.020000	0.59435	0.247000	0.18012	TGG		0.572	SRRT-004	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347168.1	NM_015908	
AKR1B10	57016	broad.mit.edu	37	7	134221874	134221874	+	Silent	SNP	G	G	A	rs568011657		TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr7:134221874G>A	ENST00000359579.4	+	6	944	c.624G>A	c.(622-624)acG>acA	p.T208T		NM_020299.4	NP_064695.3	O60218	AK1BA_HUMAN	aldo-keto reductase family 1, member B10 (aldose reductase)	208					cellular aldehyde metabolic process (GO:0006081)|daunorubicin metabolic process (GO:0044597)|digestion (GO:0007586)|doxorubicin metabolic process (GO:0044598)|farnesol catabolic process (GO:0016488)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|steroid metabolic process (GO:0008202)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	aldo-keto reductase (NADP) activity (GO:0004033)|geranylgeranyl reductase activity (GO:0045550)|indanol dehydrogenase activity (GO:0047718)|retinal dehydrogenase activity (GO:0001758)	p.T208T(2)		NS(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(9)|skin(5)	20						TCACCGTTACGGCCTACAGCC	0.483													g|||	1	0.000199681	0.0	0.0	5008	,	,		16791	0.0		0.0	False		,,,				2504	0.001				p.T208T												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G624A	7						.						15.0	24.0	21.0					7																	134221874		2145	4279	6424	133872414	SO:0001819	synonymous_variant	57016	exon6			AF052577	CCDS5832.1	7q33	2010-04-08			ENSG00000198074	ENSG00000198074		"""Aldo-keto reductases"""	382	protein-coding gene	gene with protein product	"""aldose reductase-like 1"", ""aldo-keto reductase family 1, member B11 (aldose reductase-like)"", ""aldose reductase-like peptide"", ""aldose reductase-related protein"", ""small intestine reductase"""	604707		AKR1B11		9765596, 9565553	Standard	NM_020299		Approved	AKR1B12, ARL-1, HIS, ARL1, HSI, ALDRLn	uc003vrr.3	O60218	OTTHUMG00000155356	ENST00000359579.4:c.624G>A	7.37:g.134221874G>A			133872414	NM_020299	A4D1P1|O75890|Q6FHF3|Q8IWZ1	Silent	SNP	ENST00000359579.4	37	CCDS5832.1																																																																																				0.483	AKR1B10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339615.1	NM_020299	
NUP205	23165	broad.mit.edu	37	7	135286244	135286244	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr7:135286244C>T	ENST00000285968.6	+	17	2527	c.2501C>T	c.(2500-2502)gCc>gTc	p.A834V		NM_015135.2	NP_055950	Q92621	NU205_HUMAN	nucleoporin 205kDa	834					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|nucleocytoplasmic transport (GO:0006913)|protein import into nucleus, docking (GO:0000059)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)	p.A834V(1)		breast(4)|central_nervous_system(2)|endometrium(9)|kidney(7)|large_intestine(17)|liver(4)|lung(36)|ovary(5)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	93						GACACCTATGCCCCCTTTCCT	0.398																																					p.A834V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2501T	7						.						176.0	169.0	171.0					7																	135286244		2203	4300	6503	134936784	SO:0001583	missense	23165	exon17			D86978	CCDS34759.1	7q31.32	2007-03-26	2004-01-06	2004-01-07	ENSG00000155561	ENSG00000155561			18658	protein-coding gene	gene with protein product		614352	"""chromosome 7 open reading frame 14"""	C7orf14		9039502, 9348540	Standard	NM_015135		Approved	KIAA0225	uc003vsw.3	Q92621	OTTHUMG00000155497	ENST00000285968.6:c.2501C>T	7.37:g.135286244C>T	ENSP00000285968:p.Ala834Val		134936784	NM_015135	A6H8X3|Q86YC1	Missense_Mutation	SNP	ENST00000285968.6	37	CCDS34759.1	.	.	.	.	.	.	.	.	.	.	C	21.4	4.144823	0.77888	.	.	ENSG00000155561	ENST00000285968	T	0.32272	1.46	5.76	5.76	0.90799	.	0.046469	0.85682	D	0.000000	T	0.33118	0.0852	L	0.40543	1.245	0.80722	D	1	B	0.33777	0.425	B	0.37508	0.252	T	0.02844	-1.1103	10	0.35671	T	0.21	-32.9722	19.9616	0.97254	0.0:1.0:0.0:0.0	.	834	Q92621	NU205_HUMAN	V	834	ENSP00000285968:A834V	ENSP00000285968:A834V	A	+	2	0	NUP205	134936784	1.000000	0.71417	0.995000	0.50966	0.922000	0.55478	5.956000	0.70315	2.724000	0.93272	0.561000	0.74099	GCC		0.398	NUP205-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340358.1		
DGKI	9162	broad.mit.edu	37	7	137148244	137148244	+	Missense_Mutation	SNP	C	C	T	rs568336252		TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr7:137148244C>T	ENST00000288490.5	-	28	2750	c.2750G>A	c.(2749-2751)cGc>cAc	p.R917H	DGKI_ENST00000453654.2_Intron|DGKI_ENST00000446122.1_Missense_Mutation_p.R899H|DGKI_ENST00000424189.2_Missense_Mutation_p.R930H	NM_004717.2	NP_004708.1	O75912	DGKI_HUMAN	diacylglycerol kinase, iota	917					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|positive regulation of Ras protein signal transduction (GO:0046579)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of Rap GTPase activity (GO:0032317)	cytoplasm (GO:0005737)|guanyl-nucleotide exchange factor complex (GO:0032045)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|GTPase inhibitor activity (GO:0005095)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)	p.R917H(1)		breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(46)|ovary(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	84						CTGTAGCACGCGGGAGTGGCT	0.532													C|||	1	0.000199681	0.0	0.0	5008	,	,		20781	0.001		0.0	False		,,,				2504	0.0				p.R917H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2750A	7						.						116.0	105.0	109.0					7																	137148244		2203	4300	6503	136798784	SO:0001583	missense	9162	exon28			AF061936	CCDS5845.1	7q32.3-q33	2013-01-10			ENSG00000157680	ENSG00000157680		"""Ankyrin repeat domain containing"""	2855	protein-coding gene	gene with protein product		604072				9830018	Standard	NM_004717		Approved	DGK-IOTA	uc003vtt.3	O75912	OTTHUMG00000155697	ENST00000288490.5:c.2750G>A	7.37:g.137148244C>T	ENSP00000288490:p.Arg917His		136798784	NM_004717	A4D1Q9|Q9NZ49	Missense_Mutation	SNP	ENST00000288490.5	37	CCDS5845.1	.	.	.	.	.	.	.	.	.	.	C	10.82	1.457715	0.26161	.	.	ENSG00000157680	ENST00000424189;ENST00000288490;ENST00000446122	T;T	0.35048	1.33;1.53	5.91	0.421	0.16451	.	3.008490	0.00744	N	0.001024	T	0.19967	0.0480	N	0.08118	0	0.19300	N	0.999976	B	0.02656	0.0	B	0.01281	0.0	T	0.16100	-1.0414	10	0.15066	T	0.55	.	7.5503	0.27793	0.0:0.3563:0.0:0.6437	.	917	O75912	DGKI_HUMAN	H	920;917;899	ENSP00000288490:R917H;ENSP00000399131:R899H	ENSP00000288490:R917H	R	-	2	0	DGKI	136798784	0.674000	0.27549	0.295000	0.24960	0.937000	0.57800	0.853000	0.27777	0.134000	0.18681	-0.136000	0.14681	CGC		0.532	DGKI-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341286.3	NM_004717	
SNX13	23161	broad.mit.edu	37	7	17861245	17861245	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr7:17861245A>G	ENST00000409389.1	-	18	1937	c.1765T>C	c.(1765-1767)Tat>Cat	p.Y589H	SNX13_ENST00000496855.1_5'UTR|SNX13_ENST00000428135.3_Missense_Mutation_p.Y578H			Q9Y5W8	SNX13_HUMAN	sorting nexin 13	589	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				intracellular protein transport (GO:0006886)|positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	early endosome (GO:0005769)|membrane (GO:0016020)	phosphatidylinositol binding (GO:0035091)	p.Y578H(1)		breast(1)|central_nervous_system(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(10)|lung(13)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	38	Lung NSC(10;0.0261)|all_lung(11;0.0521)					TATAATGCATATGTCTTGCCA	0.413																																					p.Y578H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1732C	7						.						127.0	122.0	124.0					7																	17861245		1939	4137	6076	17827770	SO:0001583	missense	23161	exon18			AF420470	CCDS47551.1	7p21.1	2008-03-11			ENSG00000071189	ENSG00000071189		"""Sorting nexins"""	21335	protein-coding gene	gene with protein product		606589				11485546, 11729322	Standard	NM_015132		Approved	RGS-PX1, KIAA0713	uc003stv.3	Q9Y5W8	OTTHUMG00000152730	ENST00000409389.1:c.1765T>C	7.37:g.17861245A>G	ENSP00000386705:p.Tyr589His		17827770	NM_015132	B2RCI9|O94821|Q8WVZ2|Q8WXH8	Missense_Mutation	SNP	ENST00000409389.1	37		.	.	.	.	.	.	.	.	.	.	A	18.04	3.535385	0.64972	.	.	ENSG00000071189	ENST00000409389;ENST00000428135;ENST00000242044	T;T	0.38722	1.12;1.12	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	T	0.52322	0.1727	L	0.55743	1.74	0.80722	D	1	P;P;D	0.53151	0.941;0.599;0.958	P;B;P	0.53313	0.723;0.345;0.601	T	0.50398	-0.8833	10	0.42905	T	0.14	-5.253	16.056	0.80805	1.0:0.0:0.0:0.0	.	375;589;578	B3KN60;B8ZZT9;Q9Y5W8-2	.;.;.	H	589;578;626	ENSP00000386705:Y589H;ENSP00000398789:Y578H	ENSP00000242044:Y626H	Y	-	1	0	SNX13	17827770	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	8.887000	0.92456	2.178000	0.69098	0.533000	0.62120	TAT		0.413	SNX13-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000327608.1	NM_015132	
ZSCAN25	221785	broad.mit.edu	37	7	99227098	99227098	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr7:99227098G>A	ENST00000394152.2	+	8	1417	c.1090G>A	c.(1090-1092)Gtc>Atc	p.V364I	ZSCAN25_ENST00000262941.6_Missense_Mutation_p.V292I|ZSCAN25_ENST00000466948.1_Intron|ZSCAN25_ENST00000334715.3_Missense_Mutation_p.V364I	NM_145115.2	NP_660090.2	Q6NSZ9	ZSC25_HUMAN	zinc finger and SCAN domain containing 25	364					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.V364I(1)									CTCCAATCTCGTCAGGCACCA	0.547																																					p.V364I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1090A	7						.						76.0	70.0	72.0					7																	99227098		2203	4300	6503	99065034	SO:0001583	missense	221785	exon8			AK057030	CCDS5671.2	7q22.1	2013-01-09	2013-01-09	2013-01-09	ENSG00000197037	ENSG00000197037		"""-"", ""Zinc fingers, C2H2-type"""	21961	protein-coding gene	gene with protein product			"""zinc finger protein 498"""	ZNF498		11179890	Standard	XM_005250194		Approved	FLJ32468	uc003url.1	Q6NSZ9	OTTHUMG00000074055	ENST00000394152.2:c.1090G>A	7.37:g.99227098G>A	ENSP00000377708:p.Val364Ile		99065034	NM_145115	A4D290|D6W5T5|Q14C82|Q14C99|Q5EBM9|Q6DJZ0|Q6N032|Q6ZML3	Missense_Mutation	SNP	ENST00000394152.2	37	CCDS5671.2	.	.	.	.	.	.	.	.	.	.	G	8.305	0.820861	0.16678	.	.	ENSG00000197037	ENST00000394152;ENST00000334715;ENST00000262941	T;T;T	0.52295	0.67;0.67;0.67	3.77	3.77	0.43336	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.41194	D	0.000933	T	0.30230	0.0758	N	0.10837	0.055	0.09310	N	1	P;P	0.52061	0.882;0.95	P;P	0.49597	0.482;0.616	T	0.14227	-1.0480	10	0.07813	T	0.8	-19.2235	9.5985	0.39589	0.0:0.2138:0.7862:0.0	.	292;364	Q6NSZ9-2;Q6NSZ9	.;ZN498_HUMAN	I	364;364;292	ENSP00000377708:V364I;ENSP00000334800:V364I;ENSP00000262941:V292I	ENSP00000262941:V292I	V	+	1	0	ZNF498	99065034	0.000000	0.05858	0.333000	0.25482	0.823000	0.46562	0.508000	0.22692	2.394000	0.81467	0.561000	0.74099	GTC		0.547	ZSCAN25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157203.4	NM_145115	
HIPK2	28996	broad.mit.edu	37	7	139416487	139416487	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr7:139416487C>T	ENST00000406875.3	-	2	441	c.347G>A	c.(346-348)cGt>cAt	p.R116H	HIPK2_ENST00000428878.2_Missense_Mutation_p.R116H|HIPK2_ENST00000342645.6_Missense_Mutation_p.R116H	NM_022740.4	NP_073577.3	Q9H2X6	HIPK2_HUMAN	homeodomain interacting protein kinase 2	116	Transcriptional corepression. {ECO:0000250}.				adult walking behavior (GO:0007628)|anterior/posterior pattern specification (GO:0009952)|cellular response to hypoxia (GO:0071456)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|erythrocyte differentiation (GO:0030218)|eye development (GO:0001654)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|iris morphogenesis (GO:0061072)|lens induction in camera-type eye (GO:0060235)|modulation by virus of host morphology or physiology (GO:0019048)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron differentiation (GO:0030182)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|PML body organization (GO:0030578)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of JNK cascade (GO:0046330)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|retina layer formation (GO:0010842)|SMAD protein signal transduction (GO:0060395)|smoothened signaling pathway (GO:0007224)|transforming growth factor beta receptor signaling pathway (GO:0007179)|voluntary musculoskeletal movement (GO:0050882)	cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription coactivator activity (GO:0001105)|SMAD binding (GO:0046332)|transcription corepressor activity (GO:0003714)|virion binding (GO:0046790)	p.R116H(1)		breast(4)|central_nervous_system(4)|endometrium(7)|kidney(2)|large_intestine(5)|lung(11)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Melanoma(164;0.205)					AGTGCTTCGACGCATTAGGTT	0.557																																					p.R116H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G347A	7						.						102.0	86.0	91.0					7																	139416487		1568	3582	5150	139062973	SO:0001583	missense	28996	exon2			AF208291	CCDS75666.1, CCDS75667.1	7q32-q34	2004-01-29	2001-11-29		ENSG00000064393	ENSG00000064393			14402	protein-coding gene	gene with protein product		606868	"""homeodomain-interacting protein kinase 2"""			11120354	Standard	NM_001113239		Approved		uc003vvf.4	Q9H2X6	OTTHUMG00000157704	ENST00000406875.3:c.347G>A	7.37:g.139416487C>T	ENSP00000385571:p.Arg116His		139062973	NM_022740	Q75MR7|Q8WWI4|Q9H2Y1	Missense_Mutation	SNP	ENST00000406875.3	37		.	.	.	.	.	.	.	.	.	.	C	14.93	2.682968	0.47991	.	.	ENSG00000064393	ENST00000406875;ENST00000428878;ENST00000342645	T;T;T	0.52983	0.64;0.66;0.69	5.28	5.28	0.74379	.	.	.	.	.	T	0.68109	0.2965	.	.	.	0.80722	D	1	P;D	0.76494	0.703;0.999	B;D	0.80764	0.103;0.994	T	0.64888	-0.6301	8	0.30078	T	0.28	.	18.9194	0.92519	0.0:1.0:0.0:0.0	.	116;116	Q9H2X6;Q9H2X6-3	HIPK2_HUMAN;.	H	116	ENSP00000385571:R116H;ENSP00000413724:R116H;ENSP00000343108:R116H	ENSP00000343108:R116H	R	-	2	0	HIPK2	139062973	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.070000	0.71220	2.454000	0.82982	0.563000	0.77884	CGT		0.557	HIPK2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000349430.3	NM_022740	
ANK1	286	broad.mit.edu	37	8	41545720	41545720	+	Silent	SNP	C	C	T			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr8:41545720C>T	ENST00000347528.4	-	35	4295	c.4212G>A	c.(4210-4212)gaG>gaA	p.E1404E	ANK1_ENST00000352337.4_Silent_p.E1404E|ANK1_ENST00000289734.7_Silent_p.E1404E|ANK1_ENST00000396945.1_Silent_p.E1404E|ANK1_ENST00000265709.8_Silent_p.E1445E|ANK1_ENST00000379758.2_Silent_p.E1404E|ANK1_ENST00000396942.1_Silent_p.E1404E	NM_020475.2|NM_020476.2|NM_020477.2	NP_065208.2|NP_065209.2|NP_065210.2	P16157	ANK1_HUMAN	ankyrin 1, erythrocytic	1404	55 kDa regulatory domain.|Death. {ECO:0000255|PROSITE- ProRule:PRU00064}.				axon guidance (GO:0007411)|cytoskeleton organization (GO:0007010)|ER to Golgi vesicle-mediated transport (GO:0006888)|erythrocyte development (GO:0048821)|exocytosis (GO:0006887)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|monovalent inorganic cation transport (GO:0015672)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of organelle organization (GO:0010638)|protein targeting to plasma membrane (GO:0072661)|signal transduction (GO:0007165)	axolemma (GO:0030673)|basolateral plasma membrane (GO:0016323)|cortical cytoskeleton (GO:0030863)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|M band (GO:0031430)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|cytoskeletal adaptor activity (GO:0008093)|enzyme binding (GO:0019899)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.E1404E(1)		breast(5)|central_nervous_system(4)|endometrium(9)|kidney(1)|large_intestine(26)|lung(62)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	122	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			CCATCTTCATCTCTGCCTGCT	0.542																																					p.E1404E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G4212A	8						.						271.0	226.0	241.0					8																	41545720		2203	4300	6503	41664877	SO:0001819	synonymous_variant	286	exon35			M28880	CCDS6119.1, CCDS6121.1, CCDS6122.1, CCDS47849.1, CCDS55227.1	8p11.21	2013-01-10			ENSG00000029534	ENSG00000029534		"""Ankyrin repeat domain containing"""	492	protein-coding gene	gene with protein product		612641		ANK		1689849	Standard	NM_001142445		Approved	SPH1	uc003xom.3	P16157	OTTHUMG00000150281	ENST00000347528.4:c.4212G>A	8.37:g.41545720C>T			41664877	NM_020475	A0PJN8|A6NJ23|E5RFL7|O43400|Q13768|Q53ER1|Q59FP2|Q8N604|Q99407	Silent	SNP	ENST00000347528.4	37	CCDS6119.1	.	.	.	.	.	.	.	.	.	.	C	0.619	-0.822042	0.02755	.	.	ENSG00000029534	ENST00000520299	.	.	.	5.53	-11.1	0.00147	.	.	.	.	.	T	0.33381	0.0861	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.40683	-0.9550	4	.	.	.	.	2.9288	0.05793	0.4892:0.0906:0.2541:0.1662	.	.	.	.	N	726	.	.	D	-	1	0	ANK1	41664877	0.977000	0.34250	0.029000	0.17559	0.174000	0.22865	0.281000	0.18810	-2.044000	0.00911	-0.309000	0.09137	GAT		0.542	ANK1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317297.1	NM_020475	
ZNF34	80778	broad.mit.edu	37	8	146003460	146003460	+	Silent	SNP	G	G	A			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr8:146003460G>A	ENST00000343459.4	-	4	251	c.186C>T	c.(184-186)gaC>gaT	p.D62D	ZNF34_ENST00000429371.2_Silent_p.D41D			Q8IZ26	ZNF34_HUMAN	zinc finger protein 34	62	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.D62D(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(4)|skin(1)	11	all_cancers(97;3.54e-11)|all_epithelial(106;2.65e-10)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)	Acute lymphoblastic leukemia(644;0.221)	OV - Ovarian serous cystadenocarcinoma(54;2.75e-39)|Epithelial(56;5.18e-38)|all cancers(56;4.41e-33)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.11)	GBM - Glioblastoma multiforme(99;0.0179)		CCAGCATCACGTCCCTGTAGA	0.637																																					p.D62D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C186T	8						.						39.0	43.0	41.0					8																	146003460		2185	4297	6482	145974264	SO:0001819	synonymous_variant	80778	exon4			BC028136	CCDS47945.1, CCDS69562.1	8q24	2013-01-08	2006-05-11					"""Zinc fingers, C2H2-type"", ""-"""	13098	protein-coding gene	gene with protein product		194526	"""zinc finger protein 34 (KOX 32)"""			8104631, 2014798	Standard	XM_005272349		Approved	KOX32	uc003zdy.4	Q8IZ26		ENST00000343459.4:c.186C>T	8.37:g.146003460G>A			145974264	NM_030580	D3DWN1|Q9BSZ0	De_novo_Start_OutOfFrame	SNP	ENST00000343459.4	37	CCDS47945.1																																																																																				0.637	ZNF34-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000382936.1	NM_030580	
TAF1L	138474	broad.mit.edu	37	9	32631660	32631660	+	Silent	SNP	C	C	A			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr9:32631660C>A	ENST00000242310.4	-	1	4007	c.3918G>T	c.(3916-3918)gtG>gtT	p.V1306V	RP11-555J4.4_ENST00000430787.1_RNA	NM_153809.2	NP_722516.1	Q8IZX4	TAF1L_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa-like	1306					DNA-templated transcription, initiation (GO:0006352)|histone acetylation (GO:0016573)|male meiosis (GO:0007140)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|protein serine/threonine kinase activity (GO:0004674)|TBP-class protein binding (GO:0017025)	p.V1306V(1)		breast(6)|central_nervous_system(4)|endometrium(14)|kidney(11)|large_intestine(32)|liver(2)|lung(68)|ovary(2)|pancreas(2)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	159			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		TCGAAGGTGGCACATTTGTTT	0.433																																					p.V1306V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G3918T	9						.						189.0	188.0	188.0					9																	32631660		2203	4300	6503	32621660	SO:0001819	synonymous_variant	138474	exon1			AF390562	CCDS35003.1	9p12	2007-07-27	2007-07-27		ENSG00000122728	ENSG00000122728			18056	protein-coding gene	gene with protein product		607798	"""TAF1-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa"""			12217962	Standard	NM_153809		Approved		uc003zrg.1	Q8IZX4	OTTHUMG00000019747	ENST00000242310.4:c.3918G>T	9.37:g.32631660C>A			32621660	NM_153809	Q0VG57	Silent	SNP	ENST00000242310.4	37	CCDS35003.1																																																																																				0.433	TAF1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052012.2		
UBAP2	55833	broad.mit.edu	37	9	33988990	33988990	+	Silent	SNP	G	G	A	rs140158168	byFrequency	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chr9:33988990G>A	ENST00000379238.1	-	5	540	c.423C>T	c.(421-423)ggC>ggT	p.G141G	UBAP2_ENST00000418786.2_Silent_p.G141G|UBAP2_ENST00000449054.1_Silent_p.G141G|UBAP2_ENST00000539807.1_Intron|UBAP2_ENST00000360802.1_Silent_p.G141G|UBAP2_ENST00000379239.4_5'UTR					ubiquitin associated protein 2									p.G141G(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(13)|ovary(3)|stomach(1)	32			LUSC - Lung squamous cell carcinoma(29;0.00575)	GBM - Glioblastoma multiforme(74;0.168)		CACGATTGCCGCCTCTTCCTT	0.438													G|||	2	0.000399361	0.0015	0.0	5008	,	,		16625	0.0		0.0	False		,,,				2504	0.0				p.G141G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C423T	9						.						247.0	232.0	237.0					9																	33988990		2203	4300	6503	33978990	SO:0001819	synonymous_variant	55833	exon5			AB040924	CCDS6547.1, CCDS75828.1	9p11.2	2008-02-05			ENSG00000137073	ENSG00000137073			14185	protein-coding gene	gene with protein product						8871400	Standard	NM_018449		Approved	KIAA1491, bA176F3.5, FLJ22435	uc003ztq.1	Q5T6F2	OTTHUMG00000000427	ENST00000379238.1:c.423C>T	9.37:g.33988990G>A			33978990	NM_018449		Silent	SNP	ENST00000379238.1	37	CCDS6547.1																																																																																				0.438	UBAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001071.1	NM_018449	
RAB40AL	282808	broad.mit.edu	37	X	102192956	102192956	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chrX:102192956G>A	ENST00000218249.5	+	1	757	c.710G>A	c.(709-711)cGa>cAa	p.R237Q	LL0XNC01-237H1.3_ENST00000413528.1_RNA	NM_001031834.1	NP_001027004.1	P0C0E4	RB40L_HUMAN	RAB40A, member RAS oncogene family-like	237					protein transport (GO:0015031)|protein ubiquitination (GO:0016567)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)	p.R237Q(2)		endometrium(4)|large_intestine(2)|lung(3)|ovary(3)	12						AGGATGATGCGAGGCCTCTCC	0.572																																					p.R237Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G710A	X						.						137.0	121.0	126.0					X																	102192956		2203	4300	6503	102079612	SO:0001583	missense	282808	exon1			BC101169	CCDS35353.1	Xq22.2	2008-02-05			ENSG00000102128	ENSG00000102128			25410	protein-coding gene	gene with protein product	"""Ras like GTPase"""	300405					Standard	NM_001031834		Approved	RAR2, RLGP	uc004ejs.3	P0C0E4	OTTHUMG00000022084	ENST00000218249.5:c.710G>A	X.37:g.102192956G>A	ENSP00000218249:p.Arg237Gln		102079612	NM_001031834	Q495H3	Missense_Mutation	SNP	ENST00000218249.5	37	CCDS35353.1	.	.	.	.	.	.	.	.	.	.	.	12.10	1.838037	0.32513	.	.	ENSG00000102128	ENST00000218249	T	0.70631	-0.5	0.819	-1.01	0.10169	.	0.150621	0.24377	U	0.039052	T	0.35595	0.0937	N	0.02011	-0.69	0.23138	N	0.998234	B	0.02656	0.0	B	0.01281	0.0	T	0.19516	-1.0303	10	0.38643	T	0.18	.	4.3847	0.11311	0.7076:0.0:0.2924:0.0	.	237	P0C0E4	RB40L_HUMAN	Q	237	ENSP00000218249:R237Q	ENSP00000218249:R237Q	R	+	2	0	RAB40AL	102079612	1.000000	0.71417	0.817000	0.32601	0.433000	0.31745	4.587000	0.60991	-0.422000	0.07405	-0.386000	0.06593	CGA		0.572	RAB40AL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057679.1	NM_001031834	
ELF4	2000	broad.mit.edu	37	X	129205130	129205130	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chrX:129205130T>A	ENST00000308167.5	-	7	1073	c.694A>T	c.(694-696)Acc>Tcc	p.T232S	ELF4_ENST00000335997.7_Missense_Mutation_p.T232S	NM_001421.3	NP_001412.1			E74-like factor 4 (ets domain transcription factor)									p.T232S(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(6)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	22						TCTCGCTGGGTCCACTTGATG	0.527			T	ERG	AML																																p.T232S			Dom	yes		X	Xq26	2000	E74-like factor 4 (ets domain transcription factor)		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A694T	X						.						153.0	126.0	135.0					X																	129205130		2203	4300	6503	129032811	SO:0001583	missense	2000	exon7			U32645	CCDS14617.1	Xq26	2014-09-17			ENSG00000102034	ENSG00000102034			3319	protein-coding gene	gene with protein product		300775				8895518	Standard	NM_001421		Approved	MEF, ELFR	uc004eve.4	Q99607	OTTHUMG00000022390	ENST00000308167.5:c.694A>T	X.37:g.129205130T>A	ENSP00000311280:p.Thr232Ser		129032811	NM_001421		Missense_Mutation	SNP	ENST00000308167.5	37	CCDS14617.1	.	.	.	.	.	.	.	.	.	.	T	28.1	4.893576	0.91889	.	.	ENSG00000102034	ENST00000335997;ENST00000308167	T;T	0.57752	0.38;0.38	5.45	5.45	0.79879	Winged helix-turn-helix transcription repressor DNA-binding (1);Ets (3);	0.053268	0.85682	D	0.000000	T	0.70736	0.3258	M	0.73598	2.24	0.58432	D	0.999998	D	0.62365	0.991	D	0.74348	0.983	T	0.74648	-0.3595	10	0.87932	D	0	.	12.3614	0.55205	0.0:0.0:0.0:1.0	.	232	Q99607	ELF4_HUMAN	S	232	ENSP00000338608:T232S;ENSP00000311280:T232S	ENSP00000311280:T232S	T	-	1	0	ELF4	129032811	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.013000	0.88655	1.823000	0.53134	0.417000	0.27973	ACC		0.527	ELF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058243.1	NM_001421	
MAGEH1	28986	broad.mit.edu	37	X	55479265	55479265	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chrX:55479265G>A	ENST00000342972.1	+	1	728	c.458G>A	c.(457-459)cGt>cAt	p.R153H	hsa-mir-4536-2_ENST00000583537.1_RNA	NM_014061.3	NP_054780.2	Q9H213	MAGH1_HUMAN	melanoma antigen family H, 1	153	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.				apoptotic process (GO:0006915)	cytoplasm (GO:0005737)		p.R153H(1)		central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(6)|ovary(1)|skin(2)	15						CCGGTGCCCCGTAGCAGTCCG	0.527																																					p.R153H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G458A	X						.						87.0	84.0	85.0					X																	55479265		2203	4300	6503	55495990	SO:0001583	missense	28986	exon1			AF320912	CCDS14369.1	Xp11.22	2008-02-05			ENSG00000187601	ENSG00000187601			24092	protein-coding gene	gene with protein product		300548				12414813, 9485030	Standard	NM_014061		Approved	APR1	uc004dum.3	Q9H213	OTTHUMG00000021655	ENST00000342972.1:c.458G>A	X.37:g.55479265G>A	ENSP00000343706:p.Arg153His		55495990	NM_014061	B2R8V9|Q5JRJ3|Q9Y5M2	Missense_Mutation	SNP	ENST00000342972.1	37	CCDS14369.1	.	.	.	.	.	.	.	.	.	.	.	0.257	-1.002332	0.02128	.	.	ENSG00000187601	ENST00000342972	T	0.04706	3.57	3.17	-0.924	0.10462	.	0.243358	0.21702	N	0.070413	T	0.01287	0.0042	N	0.00991	-1.07	0.09310	N	1	B	0.25206	0.12	B	0.19148	0.024	T	0.43766	-0.9371	10	0.33141	T	0.24	-4.3863	3.4565	0.07518	0.3952:0.1997:0.4051:0.0	.	153	Q9H213	MAGH1_HUMAN	H	153	ENSP00000343706:R153H	ENSP00000343706:R153H	R	+	2	0	MAGEH1	55495990	0.000000	0.05858	0.003000	0.11579	0.002000	0.02628	0.110000	0.15437	-0.365000	0.08076	-0.195000	0.12781	CGT		0.527	MAGEH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056868.1	NM_014061	
TREX2	11219	broad.mit.edu	37	X	152728110	152728110	+	De_novo_Start_OutOfFrame	SNP	G	G	A	rs368562448		TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A02X-01A-01W-A00E-09	TCGA-AG-A02X-10A-01W-A00E-09	g.chrX:152728110G>A	ENST00000334497.2	-	0	341				TREX2_ENST00000330912.2_De_novo_Start_OutOfFrame|HAUS7_ENST00000421080.2_De_novo_Start_OutOfFrame|HAUS7_ENST00000370210.1_Silent_p.H104H|TREX2_ENST00000338525.2_De_novo_Start_InFrame|TREX2_ENST00000370232.1_De_novo_Start_InFrame|HAUS7_ENST00000370211.4_Silent_p.H114H|HAUS7_ENST00000370212.3_Silent_p.H114H			Q9BQ50	TREX2_HUMAN	three prime repair exonuclease 2						DNA catabolic process, exonucleolytic (GO:0000738)|DNA metabolic process (GO:0006259)|DNA repair (GO:0006281)	nucleus (GO:0005634)	3'-5'-exodeoxyribonuclease activity (GO:0008296)|exodeoxyribonuclease III activity (GO:0008853)|magnesium ion binding (GO:0000287)|nucleic acid binding (GO:0003676)|protein homodimerization activity (GO:0042803)	p.H114H(1)		endometrium(4)|large_intestine(2)|lung(3)|ovary(2)	11	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GCATCAGCTCGTGGCCCAGCT	0.612								Editing and processing nucleases																													p.H114H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C342T	X						.	A		0,3835		0,0,1632,571	94.0	69.0	77.0		342	-1.1	0.8	X		77	1,6727		0,1,2427,1872	no	coding-synonymous	HAUS7	NM_017518.6		0,1,4059,2443	AA,AG,GG,G		0.0149,0.0,0.0095		114/369	152728110	1,10562	2203	4300	6503	152381304			55559	exon4			AF151107	CCDS35437.1	Xq28	2012-05-08			ENSG00000183479	ENSG00000183479			12270	protein-coding gene	gene with protein product		300370				10391904	Standard	NM_080701		Approved		uc011myp.2	Q9BQ50	OTTHUMG00000159319	ENST00000334497.2:c.-801C>T	X.37:g.152728110G>A			152381304	NM_017518	Q45F08|Q9UN77	Silent	SNP	ENST00000334497.2	37																																																																																					0.612	TREX2-001	KNOWN	alternative_5_UTR|basic	protein_coding	protein_coding	OTTHUMT00000060966.1	NM_080701	
