#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_Description	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_AccessionNumbers	i_HGNC_CCDS IDs	i_HGNC_CCDSIDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_DateModified	i_HGNC_DateNameChanged	i_HGNC_DateSymbolChanged	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_EnsemblGeneID	i_HGNC_EnsemblIDsuppliedbyEnsembl	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_Genefamilydescription	i_HGNC_HGNC ID	i_HGNC_HGNCID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_LocusGroup	i_HGNC_LocusType	i_HGNC_Name Synonyms	i_HGNC_NameSynonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_OMIMIDsuppliedbyNCBI	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_PreviousNames	i_HGNC_PreviousSymbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_PubmedIDs	i_HGNC_Record Type	i_HGNC_RecordType	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_RefSeqsuppliedbyNCBI	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UCSCIDsuppliedbyUCSC	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_UniProtIDsuppliedbyUniProt	i_HGNC_VEGA IDs	i_HGNC_VEGAIDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Region	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_init_n_lod	i_init_t_lod	i_n_alt_count	i_n_alt_count_full	i_n_ref_count	i_n_ref_count_full	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_lod_fstar	i_t_lod_fstar_full	i_t_ref_count_full	i_tumor_f_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	tumor_f
SIK3	23387	broad.mit.edu	37	11	116729379	116729379	+	Missense_Mutation	SNP	G	G	T			TCGA-VD-A8KA-01B-11D-A39W-08	TCGA-VD-A8KA-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2739b097-1916-48a4-b585-bb514e2dcf40	63607a4e-c047-4242-8e10-86e52e9c523a	g.chr11:116729379G>T	ENST00000292055.4	-	20	2519	c.2484C>A	c.(2482-2484)gaC>gaA	p.D828E	SIK3_ENST00000434315.2_Intron|SIK3_ENST00000375288.1_Intron|SIK3_ENST00000375300.1_Missense_Mutation_p.D886E|AP006216.12_ENST00000444200.1_RNA|SIK3_ENST00000542607.1_Intron|SIK3_ENST00000488337.1_Intron|SIK3_ENST00000446921.2_Intron	NM_025164.3	NP_079440.3	Q9Y2K2	SIK3_HUMAN	SIK family kinase 3	828	Gln-rich.				protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(18)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	57						AATGCGCCTGGTCGTAGTTAG	0.547																																						ENST00000375300.1											0			breast(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(18)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	57						c.(2656-2658)gaC>gaA	SIK family kinase 3						79.0	78.0	78.0					11																	116729379		2201	4296	6497	SO:0001583	missense	23387				cytoplasm	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity	g.chr11:116729379G>T	AB023216	AB023216	CCDS8379.1, CCDS60974.1, CCDS8379.2	CCDS8379.1, CCDS60974.1, CCDS8379.2	11q23.3	2010-02-17			2010-02-17			ENSG00000160584	ENSG00000160584	ENSG00000160584	ENSG00000160584				29165	29165	protein-coding gene	gene with protein product	protein-coding gene	gene with protein product			614776	614776						10231032, 8889548	10231032, 8889548	Standard	Standard	NM_025164	NM_025164		Approved	FLJ12240, L19, KIAA0999, QSK	uc001ppy.3	uc001ppy.3	Q9Y2K2	Q9Y2K2	OTTHUMG00000066628	OTTHUMG00000066628	ENST00000292055.4:c.2484C>A	11.37:g.116729379G>T	ENSP00000292055:p.Asp828Glu		SIK3_ENST00000434315.2_Intron|SIK3_ENST00000292055.4_Missense_Mutation_p.D828E|SIK3_ENST00000375288.1_Intron|SIK3_ENST00000488337.1_Intron|SIK3_ENST00000542607.1_Intron|SIK3_ENST00000446921.2_Intron	p.D886E			Q9Y2K2	SIK3_HUMAN			20	2663	-			828	Gln-rich.	A1A5A8|Q59FY2|Q5M9N1|Q6P3R6|Q8IYM8|Q9HA50	Missense_Mutation	SNP	ENST00000292055.4	37	c.2658C>A	CCDS8379.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.35|16.35	3.097827|3.097827	0.56075|0.56075	.|.	.|.	ENSG00000160584|ENSG00000160584	ENST00000375300;ENST00000292055|ENST00000445177	T;T|.	0.74002|.	-0.76;-0.8|.	5.57|5.57	5.57|5.57	0.84162|0.84162	5.57|5.57	5.57|5.57	0.84162|0.84162	.|.	0.000000|.	0.43747|.	U|.	0.000532|.	T|T	0.51805|0.51805	0.1696|0.1696	N|N	0.14661|0.14661	0.345|0.345	0.80722|0.80722	D|D	1|1	P;P|.	0.38223|.	0.623;0.489|.	B;B|.	0.32289|.	0.143;0.068|.	T|T	0.46331|0.46331	-0.9199|-0.9199	10|5	0.39692|.	T|.	0.17|.	.|.	19.5356|19.5356	0.95253|0.95253	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	828;828|.	Q9Y2K2-3;Q9Y2K2|.	.;SIK3_HUMAN|.	E|T	886;828|928	ENSP00000364449:D886E;ENSP00000292055:D828E|.	ENSP00000292055:D828E|.	D|P	-|-	3|1	2|0	2|0	SIK3|SIK3	116234589|116234589	116234589|116234589	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	6.731000|6.731000	0.74785|0.74785	2.596000|2.596000	0.87737|0.87737	0.655000|0.655000	0.94253|0.94253	GAC|CCA		0.547	SIK3-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding			117.746644	-28	-28	65	65	NM_025164		38	117.771358	117.771358	41	0.481013	1	0	4.14481e-20	1	5.4537e-20	38	41	0.481013
GBA2	57704	broad.mit.edu	37	9	35741704	35741704	+	Missense_Mutation	SNP	G	G	A			TCGA-VD-A8KA-01B-11D-A39W-08	TCGA-VD-A8KA-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2739b097-1916-48a4-b585-bb514e2dcf40	63607a4e-c047-4242-8e10-86e52e9c523a	g.chr9:35741704G>A	ENST00000378103.3	-	4	1274	c.751C>T	c.(751-753)Cgt>Tgt	p.R251C	GBA2_ENST00000545786.1_Missense_Mutation_p.R257C|GBA2_ENST00000467252.1_5'UTR|GBA2_ENST00000378094.4_Missense_Mutation_p.R251C	NM_020944.2	NP_065995.1	Q9HCG7	GBA2_HUMAN	glucosidase, beta (bile acid) 2	251					bile acid metabolic process (GO:0008206)|cell death (GO:0008219)|central nervous system neuron development (GO:0021954)|glucosylceramide catabolic process (GO:0006680)|glycoside catabolic process (GO:0016139)|glycosphingolipid metabolic process (GO:0006687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|smooth endoplasmic reticulum (GO:0005790)	beta-glucosidase activity (GO:0008422)|glucosylceramidase activity (GO:0004348)			NS(1)|kidney(3)|large_intestine(5)|lung(5)|ovary(4)|skin(3)	21	all_epithelial(49;0.167)		Lung(28;0.00416)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			GTGATCTGACGGCAGGTGAGG	0.572																																						ENST00000378094.4											0			NS(1)|kidney(3)|large_intestine(5)|lung(5)|ovary(4)|skin(3)	21						c.(751-753)Cgt>Tgt	glucosidase, beta (bile acid) 2						158.0	151.0	153.0					9																	35741704		2203	4300	6503	SO:0001583	missense	57704			bile acid metabolic process|glucosylceramide catabolic process|O-glycoside catabolic process	integral to membrane|microsome|plasma membrane|smooth endoplasmic reticulum	beta-glucosidase activity|glucosylceramidase activity	g.chr9:35741704G>A	AJ309567	AJ309567	CCDS6589.1	CCDS6589.1	9p13.2	2013-09-11			2013-09-11			ENSG00000070610	ENSG00000070610	ENSG00000070610	ENSG00000070610				18986	18986	protein-coding gene	gene with protein product	protein-coding gene	gene with protein product	"""bile acid beta-glucosidase"", ""non-lysosomal glucosylceramidase"""	"""bile acid beta-glucosidase"", ""non-lysosomal glucosylceramidase"""	609471	609471	"""spastic paraplegia 46 (autosomal recessive)"""	SPG46	"""spastic paraplegia 46 (autosomal recessive)"""	SPG46		11489889, 23332916, 23332917	11489889, 23332916, 23332917	Standard	Standard	NM_020944	NM_020944		Approved	KIAA1605, AD035, DKFZp762K054	uc003zxw.3	uc003zxw.3	Q9HCG7	Q9HCG7	OTTHUMG00000021024	OTTHUMG00000021024	ENST00000378103.3:c.751C>T	9.37:g.35741704G>A	ENSP00000367343:p.Arg251Cys		GBA2_ENST00000378103.3_Missense_Mutation_p.R251C|GBA2_ENST00000467252.1_5'UTR|GBA2_ENST00000545786.1_Missense_Mutation_p.R257C	p.R251C			Q9HCG7	GBA2_HUMAN	Lung(28;0.00416)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)		4	1264	-	all_epithelial(49;0.167)		251		D3DRP2|Q5TCV6|Q96A51|Q96LY1|Q96SJ2|Q9H2L8	Missense_Mutation	SNP	ENST00000378103.3	37	c.751C>T	CCDS6589.1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.381320	0.82792	.	.	ENSG00000070610	ENST00000378103;ENST00000378094;ENST00000545786	.	.	.	5.38	4.48	0.54585	5.38	4.48	0.54585	Beta-glucosidase, GBA2 type, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.84179	0.5415	M	0.91196	3.185	0.80722	D	1	P;D;P	0.89917	0.766;1.0;0.804	B;D;B	0.69307	0.158;0.963;0.244	D	0.87981	0.2743	9	0.87932	D	0	-7.9104	14.1405	0.65316	0.0722:0.0:0.9278:0.0	.	257;251;251	F5H7P6;Q9HCG7-2;Q9HCG7	.;.;GBA2_HUMAN	C	251;251;257	.	ENSP00000367334:R251C	R	-	1	0	0	GBA2	35731704	35731704	1.000000	0.71417	0.997000	0.53966	0.987000	0.75469	4.033000	0.57282	1.404000	0.46819	0.563000	0.77884	CGT		0.572	GBA2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000055456.1		210.113086	-21	-21	114	114	NM_020944		65	210.121008	210.121008	63	0.507812	0	0	0	1	0	65	63	0.507812
PAG1	55824	broad.mit.edu	37	8	81888831	81888831	+	Missense_Mutation	SNP	T	T	G			TCGA-VD-A8KA-01B-11D-A39W-08	TCGA-VD-A8KA-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2739b097-1916-48a4-b585-bb514e2dcf40	63607a4e-c047-4242-8e10-86e52e9c523a	g.chr8:81888831T>G	ENST00000220597.4	-	9	1957	c.1247A>C	c.(1246-1248)gAc>gCc	p.D416A	PAG1_ENST00000523463.1_5'Flank	NM_018440.3	NP_060910.3	Q9NWQ8	PHAG1_HUMAN	phosphoprotein membrane anchor with glycosphingolipid microdomains 1	416					epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular signal transduction (GO:0035556)|negative regulation of T cell activation (GO:0050868)|positive regulation of signal transduction (GO:0009967)|regulation of T cell activation (GO:0050863)|signal transduction (GO:0007165)|T cell receptor signaling pathway (GO:0050852)	integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	SH2 domain binding (GO:0042169)|SH3/SH2 adaptor activity (GO:0005070)			breast(2)|cervix(1)|endometrium(1)|large_intestine(3)|lung(2)|prostate(2)	11	Lung NSC(7;5.76e-06)|all_lung(9;2e-05)		BRCA - Breast invasive adenocarcinoma(6;0.0567)|Epithelial(68;0.0634)|all cancers(69;0.197)			GCTCTCGTAGTCGTTCTCCTT	0.532																																						ENST00000220597.4											0			breast(2)|cervix(1)|endometrium(1)|large_intestine(3)|lung(2)|prostate(2)	11						c.(1246-1248)gAc>gCc	phosphoprotein associated with glycosphingolipid microdomains 1						158.0	128.0	138.0					8																	81888831		2203	4300	6503	SO:0001583	missense	55824			epidermal growth factor receptor signaling pathway|intracellular signal transduction|T cell receptor signaling pathway	integral to membrane|intracellular|membrane raft|plasma membrane	SH2 domain binding|SH3/SH2 adaptor activity	g.chr8:81888831T>G	AF240634	AF240634	CCDS6227.1	CCDS6227.1	8q21.13	2014-04-30	2014-04-30		2014-04-30	2014-04-30									30043	30043	protein-coding gene	gene with protein product	protein-coding gene	gene with protein product	"""Csk-binding protein"", ""transmembrane adaptor protein PAG"""	"""Csk-binding protein"", ""transmembrane adaptor protein PAG"""	605767	605767	"""phosphoprotein associated with glycosphingolipid microdomains 1"""		"""phosphoprotein associated with glycosphingolipid microdomains 1"""			10790433	10790433	Standard	Standard	XM_006716461	XM_006716461		Approved	PAG, CBP	uc003ybz.3	uc003ybz.3	Q9NWQ8	Q9NWQ8			ENST00000220597.4:c.1247A>C	8.37:g.81888831T>G	ENSP00000220597:p.Asp416Ala			p.D416A	NM_018440.3	NP_060910.3	Q9NWQ8	PAG1_HUMAN	BRCA - Breast invasive adenocarcinoma(6;0.0567)|Epithelial(68;0.0634)|all cancers(69;0.197)		9	1957	-	Lung NSC(7;5.76e-06)|all_lung(9;2e-05)		416		A8K1A3|Q2M1Z9|Q5BKU4|Q9NYK0	Missense_Mutation	SNP	ENST00000220597.4	37	c.1247A>C	CCDS6227.1	.	.	.	.	.	.	.	.	.	.	T	22.8	4.340158	0.81911	.	.	ENSG00000076641	ENST00000220597	.	.	.	4.84	4.84	0.62591	4.84	4.84	0.62591	.	0.000000	0.85682	D	0.000000	T	0.77054	0.4074	M	0.69823	2.125	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.77846	-0.2436	9	0.44086	T	0.13	-34.4554	14.3431	0.66641	0.0:0.0:0.0:1.0	.	416	Q9NWQ8	PAG1_HUMAN	A	416	.	ENSP00000220597:D416A	D	-	2	0	0	PAG1	82051386	82051386	1.000000	0.71417	0.998000	0.56505	0.905000	0.53344	5.673000	0.68109	1.920000	0.55613	0.533000	0.62120	GAC		0.532	PAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379352.3		-10.206879	-17	-17	49	49	NM_018440		5	10.714425	10.714425	93	0.051020	0	0	0	1	0	5	93	0.05102
GNA11	2767	broad.mit.edu	37	19	3118942	3118942	+	Missense_Mutation	SNP	A	A	T			TCGA-VD-A8KA-01B-11D-A39W-08	TCGA-VD-A8KA-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2739b097-1916-48a4-b585-bb514e2dcf40	63607a4e-c047-4242-8e10-86e52e9c523a	g.chr19:3118942A>T	ENST00000078429.4	+	5	868	c.626A>T	c.(625-627)cAg>cTg	p.Q209L	AC005262.2_ENST00000585980.1_RNA|GNA11_ENST00000586180.1_3'UTR|AC005262.3_ENST00000587701.1_RNA	NM_002067.2	NP_002058.2	P29992	GNA11_HUMAN	guanine nucleotide binding protein (G protein), alpha 11 (Gq class)	209					action potential (GO:0001508)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|blood coagulation (GO:0007596)|cellular response to pH (GO:0071467)|developmental pigmentation (GO:0048066)|heart development (GO:0007507)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|platelet activation (GO:0030168)|regulation of melanocyte differentiation (GO:0045634)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)|type 2A serotonin receptor binding (GO:0031826)	p.Q209L(80)|p.Q209P(2)		endometrium(2)|eye(132)|kidney(1)|large_intestine(2)|lung(1)|meninges(5)|ovary(1)|prostate(1)|skin(16)	161		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.79e-05)|OV - Ovarian serous cystadenocarcinoma(105;2.68e-113)|Epithelial(107;1.22e-111)|all cancers(105;5.78e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00141)|STAD - Stomach adenocarcinoma(1328;0.181)		GTGGGGGGCCAGCGGTCGGAG	0.612			Mis		uveal melanoma																																	ENST00000078429.4		Dom	yes		19	19p13.3	2767	"""guanine nucleotide binding protein (G protein), alpha 11 (Gq class)"""		E	82	Substitution - Missense(82)	eye(69)|skin(8)|meninges(5)	endometrium(2)|eye(132)|kidney(1)|large_intestine(2)|lung(1)|meninges(5)|ovary(1)|prostate(1)|skin(16)	161						c.(625-627)cAg>cTg	guanine nucleotide binding protein (G protein), alpha 11 (Gq class)						104.0	89.0	94.0					19																	3118942		2203	4300	6503	SO:0001583	missense	2767			activation of phospholipase C activity by dopamine receptor signaling pathway|G-protein signaling, coupled to cAMP nucleotide second messenger|platelet activation|protein ADP-ribosylation|regulation of action potential	cytoplasm|heterotrimeric G-protein complex	G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GTP binding|GTPase activity|signal transducer activity	g.chr19:3118942A>T	AF493900	AF493900	CCDS12103.1	CCDS12103.1	19p13.3	2014-02-04			2014-02-04			ENSG00000088256	ENSG00000088256	ENSG00000088256	ENSG00000088256				4379	4379	protein-coding gene	gene with protein product	protein-coding gene	gene with protein product			139313	139313	"""hypocalciuric hypercalcemia 2"""	HHC2	"""hypocalciuric hypercalcemia 2"""	HHC2		1302014, 23802516	1302014, 23802516	Standard	Standard	NM_002067	NM_002067		Approved	FBH, FBH2, FHH2	uc002lxd.3	uc002lxd.3	P29992	P29992	OTTHUMG00000180631	OTTHUMG00000180631	ENST00000078429.4:c.626A>T	19.37:g.3118942A>T	ENSP00000078429:p.Gln209Leu		GNA11_ENST00000586180.1_3'UTR|AC005262.3_ENST00000587701.1_RNA	p.Q209L	NM_002067.2	NP_002058.2	P29992	GNA11_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.79e-05)|OV - Ovarian serous cystadenocarcinoma(105;2.68e-113)|Epithelial(107;1.22e-111)|all cancers(105;5.78e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00141)|STAD - Stomach adenocarcinoma(1328;0.181)	5	868	+		Hepatocellular(1079;0.137)	209		O15109|Q14350|Q6IB00	Missense_Mutation	SNP	ENST00000078429.4	37	c.626A>T	CCDS12103.1	.	.	.	.	.	.	.	.	.	.	.	15.05	2.718086	0.48622	.	.	ENSG00000088256	ENST00000078429	D	0.91237	-2.81	3.26	3.26	0.37387	3.26	3.26	0.37387	.	0.000000	0.64402	U	0.000006	D	0.96950	0.9004	H	0.99357	4.53	0.80722	D	1	D	0.59767	0.986	D	0.68483	0.958	D	0.96823	0.9605	10	0.87932	D	0	.	10.7338	0.46113	1.0:0.0:0.0:0.0	.	209	P29992	GNA11_HUMAN	L	209	ENSP00000078429:Q209L	ENSP00000078429:Q209L	Q	+	2	0	0	GNA11	3069942	3069942	1.000000	0.71417	0.438000	0.26821	0.027000	0.11550	9.104000	0.94239	1.256000	0.44068	0.379000	0.24179	CAG		0.612	GNA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452261.2		75.537062	-5	-5	76	76	NM_002067		26	76.105397	76.105397	39	0.400000	0	0	0	1	0	26	39	0.4
INPP5E	56623	broad.mit.edu	37	9	139333192	139333192	+	Missense_Mutation	SNP	A	A	C			TCGA-VD-A8KA-01B-11D-A39W-08	TCGA-VD-A8KA-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2739b097-1916-48a4-b585-bb514e2dcf40	63607a4e-c047-4242-8e10-86e52e9c523a	g.chr9:139333192A>C	ENST00000371712.3	-	1	1082	c.680T>G	c.(679-681)cTg>cGg	p.L227R	SEC16A_ENST00000467838.1_5'Flank	NM_019892.4	NP_063945.2	Q10713	MPPA_HUMAN	inositol polyphosphate-5-phosphatase, 72 kDa	0					cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)|proteolysis (GO:0006508)	extracellular space (GO:0005615)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			NS(1)|endometrium(1)|lung(4)|skin(3)	9		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;8.36e-06)|Epithelial(140;1.4e-05)		GGCCCGCACCAGGAGCGGCTG	0.692																																						ENST00000371712.3											0			NS(1)|endometrium(1)|lung(4)|skin(3)	9						c.(679-681)cTg>cGg	inositol polyphosphate-5-phosphatase, 72 kDa						11.0	14.0	13.0					9																	139333192		2183	4279	6462	SO:0001583	missense	56623				cilium axoneme|cytoskeleton|Golgi cisterna membrane	inositol-polyphosphate 5-phosphatase activity|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity	g.chr9:139333192A>C	AF187891	AF187891	CCDS7000.1	CCDS7000.1	9q34.3	2011-02-11			2011-02-11			ENSG00000148384	ENSG00000148384	ENSG00000148384	ENSG00000148384				21474	21474	protein-coding gene	gene with protein product	protein-coding gene	gene with protein product			613037	613037	"""Joubert syndrome 1"""	JBTS1	"""Joubert syndrome 1"""	JBTS1		10764818, 10577920, 19668216	10764818, 10577920, 19668216	Standard	Standard	NM_019892	NM_019892		Approved	PPI5PIV, CORS1	uc004cho.3	uc004cho.3	Q9NRR6	Q9NRR6	OTTHUMG00000020927	OTTHUMG00000020927	ENST00000371712.3:c.680T>G	9.37:g.139333192A>C	ENSP00000360777:p.Leu227Arg			p.L227R	NM_019892.4	NP_063945.2	Q9NRR6	INP5E_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;8.36e-06)|Epithelial(140;1.4e-05)	1	1082	-		Myeloproliferative disorder(178;0.0511)	227	13 X 4 AA repeats of P-X-X-P.	B4DKL3|E7ET61|Q16639|Q5SXM9|Q8N513	Missense_Mutation	SNP	ENST00000371712.3	37	c.680T>G	CCDS7000.1	.	.	.	.	.	.	.	.	.	.	A	10.68	1.417168	0.25552	.	.	ENSG00000148384	ENST00000371712	D	0.97906	-4.6	3.7	2.52	0.30459	3.7	2.52	0.30459	.	0.781982	0.10826	N	0.629868	D	0.96156	0.8747	L	0.60455	1.87	0.09310	N	1	D;B	0.55172	0.97;0.325	P;B	0.44696	0.458;0.06	D	0.90299	0.4328	10	0.66056	D	0.02	-19.3516	8.5999	0.33738	0.9054:0.0:0.0946:0.0	.	227;227	Q9NRR6-2;Q9NRR6	.;INP5E_HUMAN	R	227	ENSP00000360777:L227R	ENSP00000360777:L227R	L	-	2	0	0	INPP5E	138453013	138453013	0.031000	0.19500	0.064000	0.19789	0.134000	0.20937	2.304000	0.43655	0.579000	0.29504	0.460000	0.39030	CTG		0.692	INPP5E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055058.1		21.523777	8	8	23	23	NM_019892		7	21.538276	21.538276	8	0.466667	0	0	0	1	0	7	8	0.466667
PAG1	55824	broad.mit.edu	37	8	81889006	81889006	+	Missense_Mutation	SNP	G	G	A			TCGA-VD-A8KA-01B-11D-A39W-08	TCGA-VD-A8KA-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2739b097-1916-48a4-b585-bb514e2dcf40	63607a4e-c047-4242-8e10-86e52e9c523a	g.chr8:81889006G>A	ENST00000220597.4	-	9	1782	c.1072C>T	c.(1072-1074)Ctc>Ttc	p.L358F	PAG1_ENST00000523463.1_5'Flank	NM_018440.3	NP_060910.3	Q9NWQ8	PHAG1_HUMAN	phosphoprotein membrane anchor with glycosphingolipid microdomains 1	358					epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular signal transduction (GO:0035556)|negative regulation of T cell activation (GO:0050868)|positive regulation of signal transduction (GO:0009967)|regulation of T cell activation (GO:0050863)|signal transduction (GO:0007165)|T cell receptor signaling pathway (GO:0050852)	integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	SH2 domain binding (GO:0042169)|SH3/SH2 adaptor activity (GO:0005070)			breast(2)|cervix(1)|endometrium(1)|large_intestine(3)|lung(2)|prostate(2)	11	Lung NSC(7;5.76e-06)|all_lung(9;2e-05)		BRCA - Breast invasive adenocarcinoma(6;0.0567)|Epithelial(68;0.0634)|all cancers(69;0.197)			GTAGCATAGAGATCATTACAG	0.507																																						ENST00000220597.4											0			breast(2)|cervix(1)|endometrium(1)|large_intestine(3)|lung(2)|prostate(2)	11						c.(1072-1074)Ctc>Ttc	phosphoprotein associated with glycosphingolipid microdomains 1						96.0	98.0	97.0					8																	81889006		2203	4300	6503	SO:0001583	missense	55824			epidermal growth factor receptor signaling pathway|intracellular signal transduction|T cell receptor signaling pathway	integral to membrane|intracellular|membrane raft|plasma membrane	SH2 domain binding|SH3/SH2 adaptor activity	g.chr8:81889006G>A	AF240634	AF240634	CCDS6227.1	CCDS6227.1	8q21.13	2014-04-30	2014-04-30		2014-04-30	2014-04-30									30043	30043	protein-coding gene	gene with protein product	protein-coding gene	gene with protein product	"""Csk-binding protein"", ""transmembrane adaptor protein PAG"""	"""Csk-binding protein"", ""transmembrane adaptor protein PAG"""	605767	605767	"""phosphoprotein associated with glycosphingolipid microdomains 1"""		"""phosphoprotein associated with glycosphingolipid microdomains 1"""			10790433	10790433	Standard	Standard	XM_006716461	XM_006716461		Approved	PAG, CBP	uc003ybz.3	uc003ybz.3	Q9NWQ8	Q9NWQ8			ENST00000220597.4:c.1072C>T	8.37:g.81889006G>A	ENSP00000220597:p.Leu358Phe			p.L358F	NM_018440.3	NP_060910.3	Q9NWQ8	PAG1_HUMAN	BRCA - Breast invasive adenocarcinoma(6;0.0567)|Epithelial(68;0.0634)|all cancers(69;0.197)		9	1782	-	Lung NSC(7;5.76e-06)|all_lung(9;2e-05)		358		A8K1A3|Q2M1Z9|Q5BKU4|Q9NYK0	Missense_Mutation	SNP	ENST00000220597.4	37	c.1072C>T	CCDS6227.1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.269666	0.80469	.	.	ENSG00000076641	ENST00000220597	.	.	.	5.35	5.35	0.76521	5.35	5.35	0.76521	.	0.139432	0.49916	D	0.000138	T	0.75989	0.3925	M	0.67953	2.075	0.49051	D	0.999749	D	0.76494	0.999	D	0.74023	0.982	T	0.77081	-0.2720	9	0.54805	T	0.06	-19.9645	13.6026	0.62029	0.0:0.0:0.8445:0.1555	.	358	Q9NWQ8	PAG1_HUMAN	F	358	.	ENSP00000220597:L358F	L	-	1	0	0	PAG1	82051561	82051561	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	5.085000	0.64468	2.501000	0.84356	0.655000	0.94253	CTC		0.507	PAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379352.3		9.843739	7	7	63	63	NM_018440		11	26.157975	26.157975	94	0.104762	0	0	0	1	0	11	94	0.104762
CEP63	80254	broad.mit.edu	37	3	134278127	134278127	+	Silent	SNP	C	C	A			TCGA-VD-A8KA-01B-11D-A39W-08	TCGA-VD-A8KA-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2739b097-1916-48a4-b585-bb514e2dcf40	63607a4e-c047-4242-8e10-86e52e9c523a	g.chr3:134278127C>A	ENST00000337090.3	+	14	1982	c.1809C>A	c.(1807-1809)atC>atA	p.I603I	CEP63_ENST00000383229.3_Intron|CEP63_ENST00000513612.2_Silent_p.I603I|CEP63_ENST00000354446.3_Intron|CEP63_ENST00000332047.5_Intron|CEP63_ENST00000606977.1_Silent_p.I603I			Q96MT8	CEP63_HUMAN	centrosomal protein 63kDa	603					centriole replication (GO:0007099)|DNA damage checkpoint (GO:0000077)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|signal transduction in response to DNA damage (GO:0042770)|spindle assembly (GO:0051225)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|spindle pole (GO:0000922)				kidney(1)|large_intestine(6)|lung(12)|ovary(1)|prostate(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27						GTCCTCAAATCAGCCCTTGCA	0.453																																						ENST00000337090.3											0			kidney(1)|large_intestine(6)|lung(12)|ovary(1)|prostate(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27						c.(1807-1809)atC>atA	centrosomal protein 63kDa						174.0	172.0	173.0					3																	134278127		2203	4300	6503	SO:0001819	synonymous_variant	80254			cell division|DNA damage checkpoint|G2/M transition of mitotic cell cycle|mitosis|signal transduction in response to DNA damage|spindle assembly	centrosome|cytosol|spindle pole	protein binding	g.chr3:134278127C>A	AK056465	AK056465	CCDS3086.1, CCDS43152.1, CCDS43153.1, CCDS43154.1	CCDS3086.1, CCDS43152.1, CCDS43153.1, CCDS43154.1	3q22.1	2014-02-20			2014-02-20			ENSG00000182923	ENSG00000182923	ENSG00000182923	ENSG00000182923				25815	25815	protein-coding gene	gene with protein product	protein-coding gene	gene with protein product			614724	614724						14654843, 24240477	14654843, 24240477	Standard	Standard	NM_001042383	NM_001042383		Approved	FLJ13386	uc003eqo.1	uc003eqo.1	Q96MT8	Q96MT8	OTTHUMG00000159725	OTTHUMG00000159725	ENST00000337090.3:c.1809C>A	3.37:g.134278127C>A			CEP63_ENST00000383229.3_Intron|CEP63_ENST00000513612.2_Silent_p.I603I|CEP63_ENST00000332047.5_Intron|CEP63_ENST00000354446.3_Intron|CEP63_ENST00000606977.1_Silent_p.I603I	p.I603I			Q96MT8	CEP63_HUMAN			14	1982	+			603		D3DND8|D3DND9|D3DNE0|Q96CR0|Q9H8F5|Q9H8N0	Silent	SNP	ENST00000337090.3	37	c.1809C>A	CCDS3086.1																																																																																									0.453	CEP63-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000470139.1		-33.749739	1	1	139	139	NM_025180		4	6.302497	6.302497	156	0.025000	1	0	1	1	1	4	156	0.025
GLIS3	169792	broad.mit.edu	37	9	4125772	4125772	+	Missense_Mutation	SNP	C	C	A			TCGA-VD-A8KA-01B-11D-A39W-08	TCGA-VD-A8KA-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2739b097-1916-48a4-b585-bb514e2dcf40	63607a4e-c047-4242-8e10-86e52e9c523a	g.chr9:4125772C>A	ENST00000324333.10	-	2	286	c.93G>T	c.(91-93)atG>atT	p.M31I	GLIS3_ENST00000381971.3_Missense_Mutation_p.M186I	NM_152629.3	NP_689842.3	Q8NEA6	GLIS3_HUMAN	GLIS family zinc finger 3	31					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(12)|lung(4)|ovary(2)|prostate(1)|skin(1)	26		Acute lymphoblastic leukemia(2;0.00464)|Breast(48;0.148)		Lung(2;0.00163)|GBM - Glioblastoma multiforme(50;0.00301)|LUSC - Lung squamous cell carcinoma(2;0.0148)		TGGCTGCATTCATTGCCCTCT	0.463																																						ENST00000324333.10											0			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(12)|lung(4)|ovary(2)|prostate(1)|skin(1)	26						c.(91-93)atG>atT	GLIS family zinc finger 3						230.0	201.0	211.0					9																	4125772		2203	4300	6503	SO:0001583	missense	169792			negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter		DNA binding|zinc ion binding	g.chr9:4125772C>A	BC033899	BC033899	CCDS6451.1, CCDS43784.1	CCDS6451.1, CCDS43784.1	9p24.2	2008-05-02	2004-07-16	2004-07-16	2008-05-02	2004-07-16	2004-07-16	ENSG00000107249	ENSG00000107249	ENSG00000107249	ENSG00000107249		"""Zinc fingers, C2H2-type"""	"""Zinc fingers, C2H2-type"""	28510	28510	protein-coding gene	gene with protein product	protein-coding gene	gene with protein product			610192	610192	"""zinc finger protein 515"""	ZNF515	"""zinc finger protein 515"""	ZNF515		14500813	14500813	Standard	Standard	NM_152629	NM_152629		Approved	MGC33662	uc003zhx.1	uc003zhx.1	Q8NEA6	Q8NEA6	OTTHUMG00000019463	OTTHUMG00000019463	ENST00000324333.10:c.93G>T	9.37:g.4125772C>A	ENSP00000325494:p.Met31Ile		GLIS3_ENST00000381971.3_Missense_Mutation_p.M186I	p.M31I	NM_152629.3	NP_689842.3	Q8NEA6	GLIS3_HUMAN		Lung(2;0.00163)|GBM - Glioblastoma multiforme(50;0.00301)|LUSC - Lung squamous cell carcinoma(2;0.0148)	2	286	-		Acute lymphoblastic leukemia(2;0.00464)|Breast(48;0.148)	31		B1AL19|Q1PHK5	Missense_Mutation	SNP	ENST00000324333.10	37	c.93G>T	CCDS6451.1	.	.	.	.	.	.	.	.	.	.	C	14.41	2.525742	0.44969	.	.	ENSG00000107249	ENST00000324333;ENST00000381971;ENST00000477901;ENST00000478844;ENST00000481827;ENST00000478315;ENST00000462164	T;T	0.10573	2.89;2.86	5.27	5.27	0.74061	5.27	5.27	0.74061	.	0.425772	0.21640	N	0.071346	T	0.08044	0.0201	N	0.14661	0.345	0.26454	N	0.97555	B;B;B	0.12013	0.005;0.005;0.003	B;B;B	0.16289	0.009;0.015;0.004	T	0.21008	-1.0258	10	0.48119	T	0.1	.	14.1821	0.65580	0.1497:0.8503:0.0:0.0	.	61;186;31	Q1PHJ1;Q8NEA6-2;Q8NEA6	.;.;GLIS3_HUMAN	I	31;186;186;31;186;31;31	ENSP00000325494:M31I;ENSP00000371398:M186I	ENSP00000325494:M31I	M	-	3	0	0	GLIS3	4115772	4115772	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.524000	0.53495	2.632000	0.89209	0.650000	0.86243	ATG		0.463	GLIS3-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000051559.1		187.406679	-7	-7	108	108	NM_152629		63	187.599349	187.599349	74	0.459854	1	0	3.61411e-23	1	5.0196e-23	63	74	0.459854
EHD3	30845	broad.mit.edu	37	2	31484502	31484502	+	Missense_Mutation	SNP	C	C	G			TCGA-VD-A8KA-01B-11D-A39W-08	TCGA-VD-A8KA-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2739b097-1916-48a4-b585-bb514e2dcf40	63607a4e-c047-4242-8e10-86e52e9c523a	g.chr2:31484502C>G	ENST00000322054.5	+	5	1288	c.1003C>G	c.(1003-1005)Ctg>Gtg	p.L335V	EHD3_ENST00000541626.1_Intron	NM_014600.2	NP_055415.1	Q9NZN3	EHD3_HUMAN	EH-domain containing 3	335					blood coagulation (GO:0007596)|endocytic recycling (GO:0032456)|protein homooligomerization (GO:0051260)|protein targeting to plasma membrane (GO:0072661)|regulation of cardiac muscle cell membrane potential (GO:0086036)	cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|endosome membrane (GO:0010008)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|nucleic acid binding (GO:0003676)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(11)|lung(12)|ovary(1)|skin(3)	33	Acute lymphoblastic leukemia(172;0.155)					GGTCAACAACCTGGCCGAGAT	0.567																																						ENST00000322054.5											0			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(11)|lung(12)|ovary(1)|skin(3)	33						c.(1003-1005)Ctg>Gtg	EH-domain containing 3						144.0	134.0	138.0					2																	31484502		2203	4300	6503	SO:0001583	missense	30845			blood coagulation|endocytic recycling|protein homooligomerization	nucleus|plasma membrane|recycling endosome membrane	ATP binding|calcium ion binding|GTP binding|GTPase activity|nucleic acid binding|protein binding	g.chr2:31484502C>G	AF181264	AF181264	CCDS1774.1	CCDS1774.1	2p21	2013-01-10			2013-01-10			ENSG00000013016	ENSG00000013016	ENSG00000013016	ENSG00000013016		"""EF-hand domain containing"""	"""EF-hand domain containing"""	3244	3244	protein-coding gene	gene with protein product	protein-coding gene	gene with protein product			605891	605891		PAST3		PAST3		10673336	10673336	Standard	Standard	NM_014600	NM_014600		Approved		uc002rnu.3	uc002rnu.3	Q9NZN3	Q9NZN3	OTTHUMG00000099365	OTTHUMG00000099365	ENST00000322054.5:c.1003C>G	2.37:g.31484502C>G	ENSP00000327116:p.Leu335Val		EHD3_ENST00000541626.1_Intron	p.L335V	NM_014600.2	NP_055415.1	Q9NZN3	EHD3_HUMAN			5	1288	+	Acute lymphoblastic leukemia(172;0.155)		335		B4DFR5|D6W574|Q8N514|Q9NZB3	Missense_Mutation	SNP	ENST00000322054.5	37	c.1003C>G	CCDS1774.1	.	.	.	.	.	.	.	.	.	.	C	15.86	2.956379	0.53293	.	.	ENSG00000013016	ENST00000322054	T	0.21734	1.99	6.04	5.16	0.70880	6.04	5.16	0.70880	.	0.000000	0.85682	D	0.000000	T	0.48926	0.1527	H	0.94925	3.6	0.80722	D	1	D	0.63046	0.992	P	0.58577	0.841	T	0.58978	-0.7540	10	0.87932	D	0	-21.9698	7.1544	0.25628	0.0:0.722:0.0:0.278	.	335	Q9NZN3	EHD3_HUMAN	V	335	ENSP00000327116:L335V	ENSP00000327116:L335V	L	+	1	2	2	EHD3	31338006	31338006	1.000000	0.71417	1.000000	0.80357	0.291000	0.27294	2.600000	0.46240	1.568000	0.49683	0.561000	0.74099	CTG		0.567	EHD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216810.1		339.193050	22	22	125	125	NM_014600		108	339.682481	339.682481	87	0.553846	0	0	0	1	0	108	87	0.553846
OR5L2	26338	broad.mit.edu	37	11	55594926	55594926	+	Missense_Mutation	SNP	G	G	T			TCGA-VD-A8KA-01B-11D-A39W-08	TCGA-VD-A8KA-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2739b097-1916-48a4-b585-bb514e2dcf40	63607a4e-c047-4242-8e10-86e52e9c523a	g.chr11:55594926G>T	ENST00000378397.1	+	1	232	c.232G>T	c.(232-234)Gtg>Ttg	p.V78L		NM_001004739.1	NP_001004739.1	Q8NGL0	OR5L2_HUMAN	olfactory receptor, family 5, subfamily L, member 2	78						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|kidney(1)|large_intestine(1)|lung(42)|ovary(1)|prostate(3)|skin(1)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	59		all_epithelial(135;0.208)				CTCAATAATTGTGCCAAAGAT	0.458										HNSCC(27;0.073)																												ENST00000378397.1											0			breast(2)|kidney(1)|large_intestine(1)|lung(42)|ovary(1)|prostate(3)|skin(1)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	59						c.(232-234)Gtg>Ttg	olfactory receptor, family 5, subfamily L, member 2						215.0	200.0	206.0					11																	55594926		2200	4296	6496	SO:0001583	missense	26338			sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55594926G>T	AB065782	AB065782	CCDS31511.1	CCDS31511.1	11q11	2012-08-09			2012-08-09			ENSG00000205030	ENSG00000205030	ENSG00000205030	ENSG00000205030		"""GPCR / Class A : Olfactory receptors"""	"""GPCR / Class A : Olfactory receptors"""	8351	8351	protein-coding gene	gene with protein product	protein-coding gene	gene with protein product										1370859	1370859	Standard	Standard	NM_001004739	NM_001004739		Approved	HTPCRX16, HSHTPCRX16	uc001nhy.1	uc001nhy.1	Q8NGL0	Q8NGL0	OTTHUMG00000166812	OTTHUMG00000166812	ENST00000378397.1:c.232G>T	11.37:g.55594926G>T	ENSP00000367650:p.Val78Leu			p.V78L	NM_001004739.1	NP_001004739.1	Q8NGL0	OR5L2_HUMAN			1	232	+		all_epithelial(135;0.208)	78		Q6IF66|Q96RB2	Missense_Mutation	SNP	ENST00000378397.1	37	c.232G>T	CCDS31511.1	.	.	.	.	.	.	.	.	.	.	.	10.38	1.333860	0.24253	.	.	ENSG00000205030	ENST00000378397	T	0.01347	4.99	5.13	1.12	0.20585	5.13	1.12	0.20585	GPCR, rhodopsin-like superfamily (1);	0.484376	0.17323	N	0.178425	T	0.01489	0.0048	L	0.37800	1.135	0.09310	N	1	B	0.17852	0.024	B	0.18871	0.023	T	0.43556	-0.9384	10	0.72032	D	0.01	-7.7101	7.5047	0.27538	0.4833:0.0:0.5167:0.0	.	78	Q8NGL0	OR5L2_HUMAN	L	78	ENSP00000367650:V78L	ENSP00000367650:V78L	V	+	1	0	0	OR5L2	55351502	55351502	0.000000	0.05858	0.632000	0.29296	0.484000	0.33280	-0.976000	0.03786	0.306000	0.22856	-0.180000	0.13094	GTG		0.458	OR5L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391516.1		81.926459	5	5	173	173	NM_001004739		38	100.112822	100.112822	163	0.189055	1	0	2.87052e-16	1	3.58815e-16	38	163	0.189055
PAG1	55824	broad.mit.edu	37	8	81888821	81888821	+	Missense_Mutation	SNP	G	G	T			TCGA-VD-A8KA-01B-11D-A39W-08	TCGA-VD-A8KA-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2739b097-1916-48a4-b585-bb514e2dcf40	63607a4e-c047-4242-8e10-86e52e9c523a	g.chr8:81888821G>T	ENST00000220597.4	-	9	1967	c.1257C>A	c.(1255-1257)agC>agA	p.S419R	PAG1_ENST00000523463.1_5'Flank	NM_018440.3	NP_060910.3	Q9NWQ8	PHAG1_HUMAN	phosphoprotein membrane anchor with glycosphingolipid microdomains 1	419					epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular signal transduction (GO:0035556)|negative regulation of T cell activation (GO:0050868)|positive regulation of signal transduction (GO:0009967)|regulation of T cell activation (GO:0050863)|signal transduction (GO:0007165)|T cell receptor signaling pathway (GO:0050852)	integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	SH2 domain binding (GO:0042169)|SH3/SH2 adaptor activity (GO:0005070)			breast(2)|cervix(1)|endometrium(1)|large_intestine(3)|lung(2)|prostate(2)	11	Lung NSC(7;5.76e-06)|all_lung(9;2e-05)		BRCA - Breast invasive adenocarcinoma(6;0.0567)|Epithelial(68;0.0634)|all cancers(69;0.197)			AGTCACTTATGCTCTCGTAGT	0.512																																						ENST00000220597.4											0			breast(2)|cervix(1)|endometrium(1)|large_intestine(3)|lung(2)|prostate(2)	11						c.(1255-1257)agC>agA	phosphoprotein associated with glycosphingolipid microdomains 1						165.0	133.0	144.0					8																	81888821		2203	4300	6503	SO:0001583	missense	55824			epidermal growth factor receptor signaling pathway|intracellular signal transduction|T cell receptor signaling pathway	integral to membrane|intracellular|membrane raft|plasma membrane	SH2 domain binding|SH3/SH2 adaptor activity	g.chr8:81888821G>T	AF240634	AF240634	CCDS6227.1	CCDS6227.1	8q21.13	2014-04-30	2014-04-30		2014-04-30	2014-04-30									30043	30043	protein-coding gene	gene with protein product	protein-coding gene	gene with protein product	"""Csk-binding protein"", ""transmembrane adaptor protein PAG"""	"""Csk-binding protein"", ""transmembrane adaptor protein PAG"""	605767	605767	"""phosphoprotein associated with glycosphingolipid microdomains 1"""		"""phosphoprotein associated with glycosphingolipid microdomains 1"""			10790433	10790433	Standard	Standard	XM_006716461	XM_006716461		Approved	PAG, CBP	uc003ybz.3	uc003ybz.3	Q9NWQ8	Q9NWQ8			ENST00000220597.4:c.1257C>A	8.37:g.81888821G>T	ENSP00000220597:p.Ser419Arg			p.S419R	NM_018440.3	NP_060910.3	Q9NWQ8	PAG1_HUMAN	BRCA - Breast invasive adenocarcinoma(6;0.0567)|Epithelial(68;0.0634)|all cancers(69;0.197)		9	1967	-	Lung NSC(7;5.76e-06)|all_lung(9;2e-05)		419		A8K1A3|Q2M1Z9|Q5BKU4|Q9NYK0	Missense_Mutation	SNP	ENST00000220597.4	37	c.1257C>A	CCDS6227.1	.	.	.	.	.	.	.	.	.	.	G	19.01	3.743857	0.69418	.	.	ENSG00000076641	ENST00000220597	.	.	.	4.84	2.98	0.34508	4.84	2.98	0.34508	.	0.092128	0.64402	D	0.000001	T	0.70954	0.3283	M	0.69823	2.125	0.48135	D	0.999596	D	0.76494	0.999	D	0.85130	0.997	T	0.72587	-0.4248	9	0.87932	D	0	-23.8918	9.0924	0.36619	0.2471:0.0:0.7529:0.0	.	419	Q9NWQ8	PAG1_HUMAN	R	419	.	ENSP00000220597:S419R	S	-	3	2	2	PAG1	82051376	82051376	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	0.990000	0.29642	1.136000	0.42199	0.655000	0.94253	AGC		0.512	PAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379352.3		-8.400084	-29	-29	45	45	NM_018440		5	10.032392	10.032392	84	0.056180	1	0	0.00116845	1	0.00132778	5	84	0.05618
APBA3	9546	hgsc.bcm.edu	37	19	3759879	3759879	+	Silent	SNP	A	A	G			TCGA-VD-A8KA-01B-11D-A39W-08	TCGA-VD-A8KA-10A-01D-A39Z-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2739b097-1916-48a4-b585-bb514e2dcf40	63607a4e-c047-4242-8e10-86e52e9c523a	g.chr19:3759879A>G	ENST00000316757.3	-	2	584	c.384T>C	c.(382-384)ccT>ccC	p.P128P	MRPL54_ENST00000330133.4_5'Flank	NM_004886.3	NP_004877.1	O96018	APBA3_HUMAN	amyloid beta (A4) precursor protein-binding, family A, member 3	128					in utero embryonic development (GO:0001701)|negative regulation of catalytic activity (GO:0043086)|protein transport (GO:0015031)|regulation of gene expression (GO:0010468)|synaptic transmission (GO:0007268)	perinuclear region of cytoplasm (GO:0048471)	beta-amyloid binding (GO:0001540)|enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)			endometrium(1)|large_intestine(1)|skin(1)	3		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00467)|STAD - Stomach adenocarcinoma(1328;0.18)		GAGGCTCTTCAGGACCAGTCT	0.642																																																	0																	31.0	39.0	36.0					19																	3759879		2201	4298	6499	SO:0001819	synonymous_variant	9546							AB021638	AB021638	CCDS12110.1	CCDS12110.1	19p13.3	2008-07-18	2008-07-18		2008-07-18	2008-07-18			ENSG00000011132		ENSG00000011132				580	580	protein-coding gene	gene with protein product	protein-coding gene	gene with protein product	"""X11-like 2"""	"""X11-like 2"""	604262	604262						10049767	10049767	Standard	Standard	NM_004886	NM_004886		Approved	X11L2, mint3	uc002lyp.1	uc002lyp.1	O96018	O96018			ENST00000316757.3:c.384T>C	19.37:g.3759879A>G																		O60483|Q9UPZ2	Silent	SNP	ENST00000316757.3	37		CCDS12110.1																																																																																									0.642	APBA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453634.2			-21	-21	58	58			7			111							7	111	
LCE3D	84648	broad.mit.edu	37	1	152552268	152552268	+	Missense_Mutation	SNP	C	C	T	rs201921868		TCGA-VD-A8KA-01B-11D-A39W-08	TCGA-VD-A8KA-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2739b097-1916-48a4-b585-bb514e2dcf40	63607a4e-c047-4242-8e10-86e52e9c523a	g.chr1:152552268C>T	ENST00000368787.3	-	2	201	c.145G>A	c.(145-147)Gag>Aag	p.E49K		NM_032563.1	NP_115952.1	Q9BYE3	LCE3D_HUMAN	late cornified envelope 3D	49					keratinization (GO:0031424)					breast(1)|endometrium(1)|large_intestine(2)|lung(7)|pancreas(1)|skin(1)|stomach(2)	15	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)	UCEC - Uterine corpus endometrioid carcinoma (5;0.153)|KIRC - Kidney renal clear cell carcinoma(4;0.0323)|Kidney(5;0.0378)		CAGCCGCCCTCGGAGCTAGGG	0.672																																						ENST00000368787.3											0			breast(1)|endometrium(1)|large_intestine(2)|lung(7)|pancreas(1)|skin(1)|stomach(2)	15						c.(145-147)Gag>Aag	late cornified envelope 3D						48.0	57.0	54.0					1																	152552268		2203	4296	6499	SO:0001583	missense	84648			keratinization			g.chr1:152552268C>T	BI670519	BI670519	CCDS1014.1	CCDS1014.1	1q21	2008-02-05	2004-05-21	2004-10-15	2008-02-05	2004-05-21	2004-10-15	ENSG00000163202	ENSG00000163202	ENSG00000163202	ENSG00000163202		"""Late cornified envelopes"""	"""Late cornified envelopes"""	16615	16615	protein-coding gene	gene with protein product	protein-coding gene	gene with protein product			612616	612616	"""small proline rich-like (epidermal differentiation complex) 6B"""	SPRL6B, SPRL6A	"""small proline rich-like (epidermal differentiation complex) 6B"""	SPRL6B, SPRL6A		11698679	11698679	Standard	Standard	NM_032563	NM_032563		Approved	LEP16	uc001fab.3	uc001fab.3	Q9BYE3	Q9BYE3	OTTHUMG00000012384	OTTHUMG00000012384	ENST00000368787.3:c.145G>A	1.37:g.152552268C>T	ENSP00000357776:p.Glu49Lys			p.E49K	NM_032563.1	NP_115952.1	Q9BYE3	LCE3D_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)	UCEC - Uterine corpus endometrioid carcinoma (5;0.153)|KIRC - Kidney renal clear cell carcinoma(4;0.0323)|Kidney(5;0.0378)	2	201	-	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		49		Q3MIL1	Missense_Mutation	SNP	ENST00000368787.3	37	c.145G>A	CCDS1014.1	.	.	.	.	.	.	.	.	.	.	C	9.089	1.001242	0.19121	.	.	ENSG00000163202	ENST00000368787	T	0.03920	3.76	3.6	2.68	0.31781	3.6	2.68	0.31781	.	.	.	.	.	T	0.01765	0.0056	.	.	.	0.09310	N	1	P	0.50710	0.938	B	0.40741	0.339	T	0.46176	-0.9210	8	0.87932	D	0	.	7.1674	0.25698	0.0:0.872:0.0:0.128	.	49	Q9BYE3	LCE3D_HUMAN	K	49	ENSP00000357776:E49K	ENSP00000357776:E49K	E	-	1	0	0	LCE3D	150818892	150818892	0.001000	0.12720	0.111000	0.21465	0.678000	0.39670	0.483000	0.22292	0.850000	0.35239	0.655000	0.94253	GAG		0.672	LCE3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034504.1		83.551137	-22	-22	62	62	NM_032563		29	85.211735	85.211735	54	0.349398	0	0	0	1	0	29	54	0.349398
NELFE	7936	broad.mit.edu	37	6	31921529	31921529	+	Missense_Mutation	SNP	C	C	T			TCGA-VD-A8KA-01B-11D-A39W-08	TCGA-VD-A8KA-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2739b097-1916-48a4-b585-bb514e2dcf40	63607a4e-c047-4242-8e10-86e52e9c523a	g.chr6:31921529C>T	ENST00000375429.3	-	10	1248	c.1022G>A	c.(1021-1023)gGc>gAc	p.G341D	NELFE_ENST00000444811.2_Missense_Mutation_p.G311D|NELFE_ENST00000375425.5_Missense_Mutation_p.G348D	NM_002904.5	NP_002895.3	P18615	NELFE_HUMAN	negative elongation factor complex member E	341					gene expression (GO:0010467)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|positive regulation of viral transcription (GO:0050434)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	NELF complex (GO:0032021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)										GACAGACTTGCCAGTAGCGGC	0.562																																						ENST00000375429.3											0										c.(1021-1023)gGc>gAc	negative elongation factor complex member E						128.0	130.0	129.0					6																	31921529		1510	2708	4218	SO:0001583	missense	7936						g.chr6:31921529C>T	M33230	M33230	CCDS4730.1	CCDS4730.1	6p21.3	2013-02-12	2013-01-31	2013-01-31	2013-02-12	2013-01-31	2013-01-31	ENSG00000204356	ENSG00000204356	ENSG00000204356	ENSG00000204356		"""RNA binding motif (RRM) containing"""	"""RNA binding motif (RRM) containing"""	13974	13974	protein-coding gene	gene with protein product	protein-coding gene	gene with protein product			154040	154040	"""RD RNA-binding protein"", ""RD RNA binding protein"""	RDBP	"""RD RNA-binding protein"", ""RD RNA binding protein"""	RDBP				Standard	Standard	XM_006715205	XM_006715205		Approved	RD, D6S45, NELF-E, RDP	uc003nyk.3	uc003nyk.3	P18615	P18615	OTTHUMG00000031046	OTTHUMG00000031046	ENST00000375429.3:c.1022G>A	6.37:g.31921529C>T	ENSP00000364578:p.Gly341Asp		NELFE_ENST00000444811.2_Missense_Mutation_p.G311D|NELFE_ENST00000375425.5_Missense_Mutation_p.G348D	p.G341D	NM_002904.5	NP_002895.3					10	1248	-					A2BE08|B4DUN1|B4DYX9|Q5JP74|Q5JP75|Q96F56|Q9NPK2	Missense_Mutation	SNP	ENST00000375429.3	37	c.1022G>A	CCDS4730.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.112182	0.77210	.	.	ENSG00000204356	ENST00000375429;ENST00000375425;ENST00000444811	T;T;T	0.48522	0.85;0.84;0.81	6.07	5.2	0.72013	6.07	5.2	0.72013	.	0.000000	0.85682	D	0.000000	T	0.48003	0.1476	L	0.36672	1.1	0.58432	D	0.999999	D;D;D	0.67145	0.996;0.982;0.982	D;P;P	0.68039	0.955;0.834;0.772	T	0.49051	-0.8979	10	0.40728	T	0.16	-28.8283	16.444	0.83910	0.0:0.8684:0.1316:0.0	.	311;336;341	B4DUN1;E9PCL7;P18615	.;.;NELFE_HUMAN	D	341;348;311	ENSP00000364578:G341D;ENSP00000364574:G348D;ENSP00000388400:G311D	ENSP00000364574:G348D	G	-	2	0	0	RDBP	32029508	32029508	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.094000	0.76944	1.567000	0.49668	0.655000	0.94253	GGC		0.562	NELFE-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076047.4		-50.595356	-22	-22	93	93			4	6.359201	6.359201	214	0.018349	0	0	0	1	0	4	214	0.018349
POM121	9883	broad.mit.edu	37	7	72398976	72398976	+	Missense_Mutation	SNP	A	A	G	rs147859349		TCGA-VD-A8KA-01B-11D-A39W-08	TCGA-VD-A8KA-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2739b097-1916-48a4-b585-bb514e2dcf40	63607a4e-c047-4242-8e10-86e52e9c523a	g.chr7:72398976A>G	ENST00000434423.2	+	4	1076	c.1076A>G	c.(1075-1077)aAt>aGt	p.N359S	POM121_ENST00000358357.3_Missense_Mutation_p.N94S|POM121_ENST00000446813.1_Missense_Mutation_p.N94S|POM121_ENST00000257622.4_Missense_Mutation_p.N94S|POM121_ENST00000395270.1_Missense_Mutation_p.N94S			Q96HA1	P121A_HUMAN	POM121 transmembrane nucleoporin	359	Pore side. {ECO:0000255}.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)				NS(1)|breast(1)|endometrium(9)|kidney(4)|large_intestine(6)|lung(12)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	41		Lung NSC(55;0.163)				CTGGTGGCCAATGGAGTCCCC	0.468													.|||	1	0.000199681	0.0008	0.0	5008	,	,		16715	0.0		0.0	False		,,,				2504	0.0					ENST00000395270.1											0			NS(1)|breast(1)|endometrium(9)|kidney(4)|large_intestine(6)|lung(12)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	41						c.(280-282)aAt>aGt	POM121 transmembrane nucleoporin						189.0	188.0	188.0					7																	72398976		2203	4300	6503	SO:0001583	missense	9883			carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	endoplasmic reticulum membrane|nuclear membrane|nuclear pore		g.chr7:72398976A>G	AB014518	AB014518	CCDS5542.1, CCDS59059.1	CCDS5542.1, CCDS59059.1	7q11.23	2013-01-08	2012-03-13		2013-01-08	2012-03-13		ENSG00000196313	ENSG00000196313	ENSG00000196313	ENSG00000196313		"""-"""	"""-"""	19702	19702	protein-coding gene	gene with protein product	protein-coding gene	gene with protein product			615753	615753	"""POM121 membrane glycoprotein (rat)"", ""POM121 membrane glycoprotein"""		"""POM121 membrane glycoprotein (rat)"", ""POM121 membrane glycoprotein"""			8335683, 9734811, 17900573	8335683, 9734811, 17900573	Standard	Standard	NM_172020	NM_172020		Approved	KIAA0618, DKFZP586G1822, DKFZP586P2220, POM121A	uc003twk.2	uc003twk.2	Q96HA1	Q96HA1	OTTHUMG00000023527	OTTHUMG00000023527	ENST00000434423.2:c.1076A>G	7.37:g.72398976A>G	ENSP00000405562:p.Asn359Ser		POM121_ENST00000257622.4_Missense_Mutation_p.N94S|POM121_ENST00000358357.3_Missense_Mutation_p.N94S|POM121_ENST00000434423.2_Missense_Mutation_p.N359S|POM121_ENST00000446813.1_Missense_Mutation_p.N94S	p.N94S	NM_001257190.1	NP_001244119.1	Q96HA1	P121A_HUMAN			7	1322	+		Lung NSC(55;0.163)	359	Pore side (Potential).|Required for targeting to the nucleus and nuclear pore complex.	A6NFS9|A8CDT4|A8K933|A8MXF9|O75115|Q96DI0|Q9H9X1|Q9Y2N3|Q9Y4S7	Missense_Mutation	SNP	ENST00000434423.2	37	c.281A>G		.	.	.	.	.	.	.	.	.	.	G	12.65	2.002131	0.35320	.	.	ENSG00000196313	ENST00000446813;ENST00000257622;ENST00000395270;ENST00000358357;ENST00000434423	T;T;T;T;T	0.14266	2.52;2.52;2.52;2.52;2.52	3.99	3.99	0.46301	3.99	3.99	0.46301	.	0.154071	0.30020	N	0.010614	T	0.13457	0.0326	L	0.57536	1.79	0.32153	N	0.584002	B;B	0.31193	0.312;0.006	B;B	0.26202	0.067;0.053	T	0.08066	-1.0740	10	0.30078	T	0.28	.	10.8045	0.46509	1.0:0.0:0.0:0.0	.	94;359	A8MXF9;Q96HA1	.;P121A_HUMAN	S	94;94;94;94;359	ENSP00000393020:N94S;ENSP00000257622:N94S;ENSP00000378687:N94S;ENSP00000351124:N94S;ENSP00000405562:N359S	ENSP00000257622:N94S	N	+	2	0	0	POM121	72036912	72036912	1.000000	0.71417	1.000000	0.80357	0.786000	0.44442	5.143000	0.64826	1.663000	0.50791	0.373000	0.22412	AAT		0.468	POM121-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000347344.1		-69.552490	-46	-46	228	228			4	6.499716	6.499716	279	0.014134	0	0	0	1	0	4	279	0.014134
SF3B1	23451	broad.mit.edu	37	2	198267484	198267484	+	Missense_Mutation	SNP	G	G	A			TCGA-VD-A8KA-01B-11D-A39W-08	TCGA-VD-A8KA-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2739b097-1916-48a4-b585-bb514e2dcf40	63607a4e-c047-4242-8e10-86e52e9c523a	g.chr2:198267484G>A	ENST00000335508.6	-	14	1964	c.1873C>T	c.(1873-1875)Cgt>Tgt	p.R625C	SF3B1_ENST00000462613.1_5'Flank|SNORA4_ENST00000365564.1_RNA	NM_012433.2	NP_036565.2	O75533	SF3B1_HUMAN	splicing factor 3b, subunit 1, 155kDa	625					anterior/posterior pattern specification (GO:0009952)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)	p.R625C(5)		NS(35)|breast(10)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(524)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|pancreas(4)|prostate(6)|salivary_gland(1)|skin(4)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	633			OV - Ovarian serous cystadenocarcinoma(117;0.246)			GTTGTGTTACGGACATACTCA	0.433			Mis		myelodysplastic syndrome																																	ENST00000335508.6		Dom	yes		2	2q33.1	23451	"""splicing factor 3b, subunit 1, 155kDa"""		L	5	Substitution - Missense(5)	haematopoietic_and_lymphoid_tissue(5)	NS(35)|breast(10)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(524)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|pancreas(4)|prostate(6)|salivary_gland(1)|skin(4)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	633						c.(1873-1875)Cgt>Tgt	splicing factor 3b, subunit 1, 155kDa						93.0	90.0	91.0					2																	198267484		2203	4300	6503	SO:0001583	missense	23451			nuclear mRNA splicing, via spliceosome	catalytic step 2 spliceosome|nuclear speck|U12-type spliceosomal complex	protein binding	g.chr2:198267484G>A	AF054284	AF054284	CCDS33356.1, CCDS46479.1	CCDS33356.1, CCDS46479.1	2q33.1	2014-09-17	2002-08-29		2014-09-17	2002-08-29		ENSG00000115524	ENSG00000115524	ENSG00000115524	ENSG00000115524				10768	10768	protein-coding gene	gene with protein product	protein-coding gene	gene with protein product			605590	605590	"""splicing factor 3b, subunit 1, 155kD"""		"""splicing factor 3b, subunit 1, 155kD"""			9585501	9585501	Standard	Standard	XM_005246428	XM_005246428		Approved	SAP155, SF3b155, PRPF10, Prp10, Hsh155	uc002uue.3	uc002uue.3	O75533	O75533	OTTHUMG00000154447	OTTHUMG00000154447	ENST00000335508.6:c.1873C>T	2.37:g.198267484G>A	ENSP00000335321:p.Arg625Cys			p.R625C	NM_012433.2	NP_036565.2	O75533	SF3B1_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.246)		14	1964	-					E9PCH3	Missense_Mutation	SNP	ENST00000335508.6	37	c.1873C>T	CCDS33356.1	.	.	.	.	.	.	.	.	.	.	G	19.68	3.873082	0.72180	.	.	ENSG00000115524	ENST00000335508	T	0.74421	-0.84	5.82	4.93	0.64822	5.82	4.93	0.64822	Armadillo-like helical (1);Armadillo-type fold (1);	0.053241	0.64402	D	0.000001	D	0.90331	0.6975	H	0.96333	3.805	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	D	0.93337	0.6706	10	0.87932	D	0	.	15.2676	0.73675	0.0:0.0:0.7451:0.2549	.	625	O75533	SF3B1_HUMAN	C	625	ENSP00000335321:R625C	ENSP00000335321:R625C	R	-	1	0	0	SF3B1	197975729	197975729	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.689000	0.61723	1.444000	0.47605	-0.182000	0.12963	CGT		0.433	SF3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335245.2		91.705124	9	9	63	63			28	91.811864	91.811864	23	0.549020	0	0	0	1	0	28	23	0.54902
GPATCH3	63906	broad.mit.edu	37	1	27223862	27223862	+	Missense_Mutation	SNP	G	G	T			TCGA-VD-A8KA-01B-11D-A39W-08	TCGA-VD-A8KA-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2739b097-1916-48a4-b585-bb514e2dcf40	63607a4e-c047-4242-8e10-86e52e9c523a	g.chr1:27223862G>T	ENST00000361720.5	-	2	829	c.806C>A	c.(805-807)cCa>cAa	p.P269Q		NM_022078.2	NP_071361.2	Q96I76	GPTC3_HUMAN	G patch domain containing 3	269	Glu-rich.						nucleic acid binding (GO:0003676)			endometrium(2)|large_intestine(1)|lung(11)|skin(1)	15		all_cancers(24;1.29e-21)|all_epithelial(13;2.35e-19)|Colorectal(325;0.000147)|all_lung(284;0.00122)|Lung NSC(340;0.00128)|Breast(348;0.00131)|Renal(390;0.00211)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;3.97e-51)|OV - Ovarian serous cystadenocarcinoma(117;9.55e-30)|Colorectal(126;5.31e-09)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000513)|STAD - Stomach adenocarcinoma(196;0.000595)|KIRC - Kidney renal clear cell carcinoma(1967;0.00072)|READ - Rectum adenocarcinoma(331;0.0419)		GGGGCTGGCTGGTATATCTGC	0.517																																						ENST00000361720.5											0			endometrium(2)|large_intestine(1)|lung(11)|skin(1)	15						c.(805-807)cCa>cAa	G patch domain containing 3						180.0	181.0	181.0					1																	27223862		2203	4300	6503	SO:0001583	missense	63906				intracellular	nucleic acid binding	g.chr1:27223862G>T	BC007767	BC007767	CCDS290.1	CCDS290.1	1p35.3-p35.1	2013-01-28		2006-12-13	2013-01-28		2006-12-13	ENSG00000198746	ENSG00000198746	ENSG00000198746	ENSG00000198746		"""G patch domain containing"""	"""G patch domain containing"""	25720	25720	protein-coding gene	gene with protein product	protein-coding gene	gene with protein product						GPATC3		GPATC3				Standard	Standard	NM_022078	NM_022078		Approved	FLJ12455	uc001bne.3	uc001bne.3	Q96I76	Q96I76	OTTHUMG00000004229	OTTHUMG00000004229	ENST00000361720.5:c.806C>A	1.37:g.27223862G>T	ENSP00000354645:p.Pro269Gln			p.P269Q	NM_022078.2	NP_071361.2	Q96I76	GPTC3_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;3.97e-51)|OV - Ovarian serous cystadenocarcinoma(117;9.55e-30)|Colorectal(126;5.31e-09)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000513)|STAD - Stomach adenocarcinoma(196;0.000595)|KIRC - Kidney renal clear cell carcinoma(1967;0.00072)|READ - Rectum adenocarcinoma(331;0.0419)	2	829	-		all_cancers(24;1.29e-21)|all_epithelial(13;2.35e-19)|Colorectal(325;0.000147)|all_lung(284;0.00122)|Lung NSC(340;0.00128)|Breast(348;0.00131)|Renal(390;0.00211)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)|all_neural(195;0.0966)	269	Glu-rich.	Q5JYH2|Q8NDJ2|Q9H9Z3	Missense_Mutation	SNP	ENST00000361720.5	37	c.806C>A	CCDS290.1	.	.	.	.	.	.	.	.	.	.	G	3.448	-0.112556	0.06881	.	.	ENSG00000198746	ENST00000361720;ENST00000536641;ENST00000374122	T	0.42900	0.96	4.65	3.74	0.42951	4.65	3.74	0.42951	.	0.345073	0.30969	N	0.008508	T	0.15782	0.0380	N	0.03115	-0.41	0.09310	N	1	B	0.14438	0.01	B	0.09377	0.004	T	0.10245	-1.0638	10	0.23302	T	0.38	-0.0884	3.3644	0.07198	0.2438:0.0:0.562:0.1942	.	269	Q96I76	GPTC3_HUMAN	Q	269;251;80	ENSP00000354645:P269Q	ENSP00000354645:P269Q	P	-	2	0	0	GPATCH3	27096449	27096449	0.037000	0.19845	0.054000	0.19295	0.085000	0.17905	0.759000	0.26461	1.165000	0.42670	0.655000	0.94253	CCA		0.517	GPATCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012181.1		-12.179015	-12	-12	121	121	NM_022078		4	7.808092	7.808092	86	0.044444	1	0	0.150653	1	0.163754	4	86	0.044444
SELE	6401	broad.mit.edu	37	1	169698338	169698338	+	Missense_Mutation	SNP	G	G	T			TCGA-VD-A8KA-01B-11D-A39W-08	TCGA-VD-A8KA-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2739b097-1916-48a4-b585-bb514e2dcf40	63607a4e-c047-4242-8e10-86e52e9c523a	g.chr1:169698338G>T	ENST00000333360.7	-	7	1218	c.1079C>A	c.(1078-1080)cCa>cAa	p.P360Q	SELE_ENST00000367776.1_Missense_Mutation_p.P360Q|SELE_ENST00000367779.4_Missense_Mutation_p.P360Q|SELE_ENST00000367782.4_Missense_Mutation_p.P360Q|C1orf112_ENST00000498289.1_Intron|SELE_ENST00000367781.4_Missense_Mutation_p.P360Q|SELE_ENST00000367780.4_Missense_Mutation_p.P298Q|SELE_ENST00000367775.1_Missense_Mutation_p.P298Q|SELE_ENST00000367774.1_Missense_Mutation_p.P360Q|SELE_ENST00000367777.1_Missense_Mutation_p.P360Q	NM_000450.2	NP_000441.2	P16581	LYAM2_HUMAN	selectin E	360	Sushi 3. {ECO:0000255|PROSITE- ProRule:PRU00302}.				actin filament-based process (GO:0030029)|activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|heterophilic cell-cell adhesion (GO:0007157)|inflammatory response (GO:0006954)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte migration involved in inflammatory response (GO:0002523)|leukocyte tethering or rolling (GO:0050901)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of receptor internalization (GO:0002092)|regulation of inflammatory response (GO:0050727)|response to interleukin-1 (GO:0070555)|response to lipopolysaccharide (GO:0032496)|response to tumor necrosis factor (GO:0034612)	caveola (GO:0005901)|coated pit (GO:0005905)|cortical cytoskeleton (GO:0030863)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	oligosaccharide binding (GO:0070492)|phospholipase binding (GO:0043274)|sialic acid binding (GO:0033691)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(12)|ovary(3)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	32	all_hematologic(923;0.208)				Carvedilol(DB01136)	TTCACAAACTGGGATTTGCTG	0.428																																						ENST00000333360.7											0			breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(12)|ovary(3)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	32						c.(1078-1080)cCa>cAa	selectin E						86.0	83.0	84.0					1																	169698338		2203	4300	6503	SO:0001583	missense	6401			actin filament-based process|activation of phospholipase C activity|calcium-mediated signaling|heterophilic cell-cell adhesion|leukocyte migration involved in inflammatory response|leukocyte tethering or rolling|positive regulation of receptor internalization|regulation of inflammatory response|response to interleukin-1|response to lipopolysaccharide|response to tumor necrosis factor	caveola|coated pit|cortical cytoskeleton|extracellular space|integral to membrane|perinuclear region of cytoplasm	oligosaccharide binding|phospholipase binding|sialic acid binding|transmembrane receptor activity	g.chr1:169698338G>T	M30640	M30640	CCDS1283.1	CCDS1283.1	1q22-q25	2008-07-31	2008-07-31		2008-07-31	2008-07-31		ENSG00000007908	ENSG00000007908	ENSG00000007908	ENSG00000007908		"""CD molecules"""	"""CD molecules"""	10718	10718	protein-coding gene	gene with protein product	protein-coding gene	gene with protein product			131210	131210	"""endothelial adhesion molecule 1"""	ELAM1, ELAM	"""endothelial adhesion molecule 1"""	ELAM1, ELAM		1375831	1375831	Standard	Standard	NM_000450	NM_000450		Approved	ESEL, CD62E	uc001ggm.4	uc001ggm.4	P16581	P16581	OTTHUMG00000034851	OTTHUMG00000034851	ENST00000333360.7:c.1079C>A	1.37:g.169698338G>T	ENSP00000331736:p.Pro360Gln		SELE_ENST00000367775.1_Missense_Mutation_p.P298Q|SELE_ENST00000367776.1_Missense_Mutation_p.P360Q|SELE_ENST00000367779.4_Missense_Mutation_p.P360Q|SELE_ENST00000367774.1_Missense_Mutation_p.P360Q|SELE_ENST00000367777.1_Missense_Mutation_p.P360Q|C1orf112_ENST00000498289.1_Intron|SELE_ENST00000367781.4_Missense_Mutation_p.P360Q|SELE_ENST00000367780.4_Missense_Mutation_p.P298Q|SELE_ENST00000367782.4_Missense_Mutation_p.P360Q	p.P360Q	NM_000450.2	NP_000441.2	P16581	LYAM2_HUMAN			7	1218	-	all_hematologic(923;0.208)		360	Sushi 3.	A2RRD6|P16111	Missense_Mutation	SNP	ENST00000333360.7	37	c.1079C>A	CCDS1283.1	.	.	.	.	.	.	.	.	.	.	G	14.92	2.678221	0.47886	.	.	ENSG00000007908	ENST00000367781;ENST00000367782;ENST00000367780;ENST00000367779;ENST00000333360;ENST00000367777;ENST00000367775;ENST00000367776;ENST00000367774	D;D;D;T;T;D;D;D;T	0.86562	-2.14;-2.14;-2.14;-1.08;-1.08;-2.14;-2.14;-2.14;-1.08	5.13	5.13	0.70059	5.13	5.13	0.70059	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.41294	D	0.000906	D	0.96636	0.8902	H	0.99659	4.685	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98501	1.0614	10	0.87932	D	0	-13.107	16.1046	0.81212	0.0:0.0:1.0:0.0	.	360	P16581	LYAM2_HUMAN	Q	360;360;298;360;360;360;298;360;360	ENSP00000356755:P360Q;ENSP00000356756:P360Q;ENSP00000356754:P298Q;ENSP00000356753:P360Q;ENSP00000331736:P360Q;ENSP00000356751:P360Q;ENSP00000356749:P298Q;ENSP00000356750:P360Q;ENSP00000356748:P360Q	ENSP00000331736:P360Q	P	-	2	0	0	SELE	167964962	167964962	1.000000	0.71417	0.066000	0.19879	0.006000	0.05464	8.765000	0.91724	2.378000	0.81104	0.650000	0.86243	CCA		0.428	SELE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084333.1		55.510713	-16	-16	52	52	NM_000450		19	56.339646	56.339646	33	0.365385	1	0	1.28384e-07	1	1.52838e-07	19	33	0.365385
KATNBL1	79768	broad.mit.edu	37	15	34439412	34439412	+	Missense_Mutation	SNP	G	G	T			TCGA-VD-A8KA-01B-11D-A39W-08	TCGA-VD-A8KA-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2739b097-1916-48a4-b585-bb514e2dcf40	63607a4e-c047-4242-8e10-86e52e9c523a	g.chr15:34439412G>T	ENST00000256544.3	-	7	829	c.687C>A	c.(685-687)agC>agA	p.S229R		NM_024713.2	NP_078989.1	Q9H079	KTBL1_HUMAN	katanin p80 subunit B-like 1	229						nucleolus (GO:0005730)											CTTCAAATTTGCTTTTAAGTA	0.333																																						ENST00000256544.3											0										c.(685-687)agC>agA	katanin p80 subunit B-like 1						59.0	60.0	60.0					15																	34439412		2201	4298	6499	SO:0001583	missense	79768						g.chr15:34439412G>T	AL136908	AL136908	CCDS10034.1	CCDS10034.1	15q13.2	2012-09-27	2012-09-27	2012-09-27	2012-09-27	2012-09-27	2012-09-27	ENSG00000134152	ENSG00000134152	ENSG00000134152	ENSG00000134152				26199	26199	protein-coding gene	gene with protein product	protein-coding gene	gene with protein product					"""chromosome 15 open reading frame 29"""	C15orf29	"""chromosome 15 open reading frame 29"""	C15orf29		11230166	11230166	Standard	Standard	NM_024713	NM_024713		Approved	FLJ22557	uc001zhp.3	uc001zhp.3	Q9H079	Q9H079	OTTHUMG00000129368	OTTHUMG00000129368	ENST00000256544.3:c.687C>A	15.37:g.34439412G>T	ENSP00000256544:p.Ser229Arg			p.S229R	NM_024713.2	NP_078989.1					7	829	-					A8KAF6|Q2TAC0|Q9H670	Missense_Mutation	SNP	ENST00000256544.3	37	c.687C>A	CCDS10034.1	.	.	.	.	.	.	.	.	.	.	G	19.19	3.780327	0.70222	.	.	ENSG00000134152	ENST00000256544;ENST00000540594	.	.	.	5.7	4.6	0.57074	5.7	4.6	0.57074	.	0.070397	0.85682	D	0.000000	T	0.75729	0.3889	M	0.71036	2.16	0.49582	D	0.999802	D	0.76494	0.999	D	0.75020	0.985	T	0.77558	-0.2543	9	0.72032	D	0.01	.	11.9943	0.53191	0.1472:0.0:0.8528:0.0	.	229	Q9H079	CO029_HUMAN	R	229;133	.	ENSP00000256544:S229R	S	-	3	2	2	C15orf29	32226704	32226704	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.573000	0.53856	2.692000	0.91855	0.591000	0.81541	AGC		0.333	KATNBL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251520.1		-5.724703	-26	-26	24	24	NM_024713		3	6.330435	6.330435	54	0.052632	1	0	1	1	1	3	54	0.052632
LOC100130331	100130331	broad.mit.edu	37	1	238090905	238090905	+	RNA	DEL	C	C	-			TCGA-VD-A8KA-01B-11D-A39W-08	TCGA-VD-A8KA-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2739b097-1916-48a4-b585-bb514e2dcf40	63607a4e-c047-4242-8e10-86e52e9c523a	g.chr1:238090905delC	ENST00000450451.1	+	0	2411					NR_027247.2																						CATCCCGGTGCCACTAATGTG	0.488																																						ENST00000450451.1											0																																																0						g.chr1:238090905delC																																																		1.37:g.238090905delC					NR_027247.2						0	2411	+						RNA	DEL	ENST00000450451.1	37																																																																																											0.488	RP11-193H5.1-001	KNOWN	basic	antisense	antisense	OTTHUMT00000095477.1	.	.	-3	-3	7	7			2			4	0.33						2	4	0.33
LLNLF-65H9.1	0	broad.mit.edu	37	19	28388014	28388015	+	RNA	INS	-	-	T			TCGA-VD-A8KA-01B-11D-A39W-08	TCGA-VD-A8KA-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2739b097-1916-48a4-b585-bb514e2dcf40	63607a4e-c047-4242-8e10-86e52e9c523a	g.chr19:28388014_28388015insT	ENST00000592806.1	+	0	163																											GGACTTCTCTGTTTTTTTTCCT	0.554																																						ENST00000592806.1											0																																																0						g.chr19:28388014_28388015insT																																																		19.37:g.28388022_28388022dupT											0	163	+						RNA	INS	ENST00000592806.1	37																																																																																											0.554	LLNLF-65H9.1-001	KNOWN	basic|readthrough_transcript	processed_transcript	processed_transcript	OTTHUMT00000452876.1	.	.	0	0	5	5			2			4	0.33						2	4	0.33
