#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_Description	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_AccessionNumbers	i_HGNC_CCDS IDs	i_HGNC_CCDSIDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_DateModified	i_HGNC_DateNameChanged	i_HGNC_DateSymbolChanged	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_EnsemblGeneID	i_HGNC_EnsemblIDsuppliedbyEnsembl	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_Genefamilydescription	i_HGNC_HGNC ID	i_HGNC_HGNCID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_LocusGroup	i_HGNC_LocusType	i_HGNC_Name Synonyms	i_HGNC_NameSynonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_OMIMIDsuppliedbyNCBI	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_PreviousNames	i_HGNC_PreviousSymbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_PubmedIDs	i_HGNC_Record Type	i_HGNC_RecordType	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_RefSeqsuppliedbyNCBI	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UCSCIDsuppliedbyUCSC	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_UniProtIDsuppliedbyUniProt	i_HGNC_VEGA IDs	i_HGNC_VEGAIDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Region	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_init_n_lod	i_init_t_lod	i_n_alt_count	i_n_alt_count_full	i_n_ref_count	i_n_ref_count_full	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_lod_fstar	i_t_lod_fstar_full	i_t_ref_count_full	i_tumor_f_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	tumor_f
MYO15A	51168	broad.mit.edu	37	17	18047195	18047195	+	Missense_Mutation	SNP	G	G	T			TCGA-VD-A8KN-01A-11D-A39W-08	TCGA-VD-A8KN-10B-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6723c159-82da-425d-9dee-4682a5d82ba2	cd2ffb2b-44a4-4a4e-93f6-33dbd404cc2e	g.chr17:18047195G>T	ENST00000205890.5	+	28	6396	c.6058G>T	c.(6058-6060)Gcc>Tcc	p.A2020S	snoU13_ENST00000459354.1_RNA	NM_016239.3	NP_057323.3	Q9UKN7	MYO15_HUMAN	myosin XVA	2020	Neck or regulatory domain.				inner ear morphogenesis (GO:0042472)|locomotory behavior (GO:0007626)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|stereocilium (GO:0032420)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(5)|central_nervous_system(2)|endometrium(17)|kidney(3)|large_intestine(16)|lung(27)|ovary(3)|pancreas(1)|prostate(6)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	99	all_neural(463;0.228)					CCTCGGGCTGGCCCAGGTGCC	0.642																																						ENST00000205890.5											0			breast(5)|central_nervous_system(2)|endometrium(17)|kidney(3)|large_intestine(16)|lung(27)|ovary(3)|pancreas(1)|prostate(6)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	99						c.(6058-6060)Gcc>Tcc	myosin XVA						21.0	25.0	23.0					17																	18047195		2062	4198	6260	SO:0001583	missense	51168			sensory perception of sound	cytoplasm|myosin complex|stereocilium	actin binding|ATP binding|calmodulin binding|motor activity	g.chr17:18047195G>T	AF144094	AF144094	CCDS42271.1	CCDS42271.1	17p11.2	2011-09-27			2011-09-27			ENSG00000091536	ENSG00000091536	ENSG00000091536	ENSG00000091536		"""Myosins / Myosin superfamily : Class XV"""	"""Myosins / Myosin superfamily : Class XV"""	7594	7594	protein-coding gene	gene with protein product	protein-coding gene	gene with protein product			602666	602666		DFNB3, MYO15		DFNB3, MYO15		9603736	9603736	Standard	Standard	NM_016239	NM_016239		Approved		uc021trl.1	uc021trl.1	Q9UKN7	Q9UKN7	OTTHUMG00000059390	OTTHUMG00000059390	ENST00000205890.5:c.6058G>T	17.37:g.18047195G>T	ENSP00000205890:p.Ala2020Ser			p.A2020S	NM_016239.3	NP_057323.3	Q9UKN7	MYO15_HUMAN			28	6396	+	all_neural(463;0.228)		2020	Neck or regulatory domain.	B4DFC7	Missense_Mutation	SNP	ENST00000205890.5	37	c.6058G>T	CCDS42271.1	.	.	.	.	.	.	.	.	.	.	G	9.092	1.001985	0.19121	.	.	ENSG00000091536	ENST00000205890	D	0.87491	-2.26	4.98	-5.43	0.02632	4.98	-5.43	0.02632	.	.	.	.	.	T	0.71298	0.3323	L	0.38531	1.155	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.59663	-0.7412	9	0.08179	T	0.78	.	1.339	0.02150	0.1737:0.3149:0.2678:0.2436	.	2020	Q9UKN7	MYO15_HUMAN	S	2020	ENSP00000205890:A2020S	ENSP00000205890:A2020S	A	+	1	0	0	MYO15A	17987920	17987920	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-0.163000	0.09997	-1.249000	0.02500	-1.415000	0.01116	GCC		0.642	MYO15A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132048.1		35.931665	6	6	17	17	NM_016239		11	36.986756	36.986756	3	0.785714	1	0	3.07112e-06	1	3.19908e-06	11	3	0.785714
CA7	766	broad.mit.edu	37	16	66887373	66887373	+	Missense_Mutation	SNP	G	G	C			TCGA-VD-A8KN-01A-11D-A39W-08	TCGA-VD-A8KN-10B-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6723c159-82da-425d-9dee-4682a5d82ba2	cd2ffb2b-44a4-4a4e-93f6-33dbd404cc2e	g.chr16:66887373G>C	ENST00000338437.2	+	7	876	c.767G>C	c.(766-768)cGc>cCc	p.R256P	CA7_ENST00000394069.3_Missense_Mutation_p.R200P|RP11-61A14.1_ENST00000551187.1_RNA	NM_005182.2	NP_005173.1	P43166	CAH7_HUMAN	carbonic anhydrase VII	256					bicarbonate transport (GO:0015701)|one-carbon metabolic process (GO:0006730)|positive regulation of cellular pH reduction (GO:0032849)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|regulation of chloride transport (GO:2001225)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	carbonate dehydratase activity (GO:0004089)|zinc ion binding (GO:0008270)			kidney(1)|large_intestine(1)|lung(4)	6		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.088)|Epithelial(162;0.204)	Acetazolamide(DB00819)|Diclofenamide(DB01144)|Methazolamide(DB00703)|Zonisamide(DB00909)	CTGAAGGGCCGCGTGGTAAAG	0.592																																						ENST00000394069.3											0			kidney(1)|large_intestine(1)|lung(4)	6						c.(598-600)cGc>cCc	carbonic anhydrase VII						42.0	40.0	41.0					16																	66887373		2200	4300	6500	SO:0001583	missense	766			one-carbon metabolic process	cytoplasm	carbonate dehydratase activity|zinc ion binding	g.chr16:66887373G>C			CCDS10821.1, CCDS42173.1	CCDS10821.1, CCDS42173.1	16q22.1	2008-02-05			2008-02-05			ENSG00000168748	ENSG00000168748	ENSG00000168748	ENSG00000168748	4.2.1.1	"""Carbonic anhydrases"""	"""Carbonic anhydrases"""	1381	1381	protein-coding gene	gene with protein product	protein-coding gene	gene with protein product			114770	114770						1783392	1783392	Standard	Standard	XM_005256135	XM_005256135		Approved		uc002eqi.3	uc002eqi.3	P43166	P43166	OTTHUMG00000137524	OTTHUMG00000137524	ENST00000338437.2:c.767G>C	16.37:g.66887373G>C	ENSP00000345659:p.Arg256Pro		CA7_ENST00000338437.2_Missense_Mutation_p.R256P	p.R200P	NM_001014435.1	NP_001014435.1	P43166	CAH7_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.088)|Epithelial(162;0.204)	7	1030	+		Ovarian(137;0.0563)	256		Q541F0|Q86YU0	Missense_Mutation	SNP	ENST00000338437.2	37	c.599G>C	CCDS10821.1	.	.	.	.	.	.	.	.	.	.	G	19.65	3.866597	0.72065	.	.	ENSG00000168748	ENST00000338437;ENST00000394069	T;T	0.78707	-1.2;-1.2	5.18	4.22	0.49857	5.18	4.22	0.49857	Carbonic anhydrase, alpha-class, catalytic domain (4);	0.105223	0.64402	D	0.000008	D	0.92492	0.7616	H	0.98769	4.325	0.58432	D	0.999996	D	0.89917	1.0	D	0.97110	1.0	D	0.94532	0.7737	10	0.87932	D	0	-8.7296	12.7996	0.57578	0.0805:0.0:0.9195:0.0	.	256	P43166	CAH7_HUMAN	P	256;200	ENSP00000345659:R256P;ENSP00000377632:R200P	ENSP00000345659:R256P	R	+	2	0	0	CA7	65444874	65444874	1.000000	0.71417	0.917000	0.36280	0.777000	0.43975	8.592000	0.90828	1.316000	0.45131	-0.258000	0.10820	CGC		0.592	CA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268847.1		-0.407282	3	3	44	44			3	7.00564	7.005640	37	0.075000	0	0	0	1	0	3	37	0.075
OR2L2	26246	broad.mit.edu	37	1	248201776	248201776	+	Missense_Mutation	SNP	C	C	G			TCGA-VD-A8KN-01A-11D-A39W-08	TCGA-VD-A8KN-10B-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6723c159-82da-425d-9dee-4682a5d82ba2	cd2ffb2b-44a4-4a4e-93f6-33dbd404cc2e	g.chr1:248201776C>G	ENST00000366479.2	+	1	303	c.207C>G	c.(205-207)gaC>gaG	p.D69E	OR2L13_ENST00000366478.2_Intron	NM_001004686.2	NP_001004686.1	Q8NH16	OR2L2_HUMAN	olfactory receptor, family 2, subfamily L, member 2	69						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(28)|ovary(1)|skin(4)|urinary_tract(1)	42	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0278)			CCCTCATTGACCTAAATTACA	0.388																																						ENST00000366479.2											0			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(28)|ovary(1)|skin(4)|urinary_tract(1)	42						c.(205-207)gaC>gaG	olfactory receptor, family 2, subfamily L, member 2						284.0	260.0	268.0					1																	248201776		2203	4300	6503	SO:0001583	missense	26246			sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248201776C>G	X64978	X64978	CCDS31103.1	CCDS31103.1	1q44	2012-08-09			2012-08-09			ENSG00000203663	ENSG00000203663	ENSG00000203663	ENSG00000203663		"""GPCR / Class A : Olfactory receptors"""	"""GPCR / Class A : Olfactory receptors"""	8266	8266	protein-coding gene	gene with protein product	protein-coding gene	gene with protein product						OR2L4P, OR2L12		OR2L4P, OR2L12		1370859	1370859	Standard	Standard	NM_001004686	NM_001004686		Approved	HTPCRH07, HSHTPCRH07	uc001idw.3	uc001idw.3	Q8NH16	Q8NH16	OTTHUMG00000040214	OTTHUMG00000040214	ENST00000366479.2:c.207C>G	1.37:g.248201776C>G	ENSP00000355435:p.Asp69Glu		OR2L13_ENST00000366478.2_Intron	p.D69E	NM_001004686.2	NP_001004686.1	Q8NH16	OR2L2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0278)		1	303	+	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		69		Q2M3T5	Missense_Mutation	SNP	ENST00000366479.2	37	c.207C>G	CCDS31103.1	.	.	.	.	.	.	.	.	.	.	.	10.08	1.250922	0.22880	.	.	ENSG00000203663	ENST00000366479	T	0.66460	-0.21	1.9	-0.286	0.12862	1.9	-0.286	0.12862	GPCR, rhodopsin-like superfamily (1);	0.000000	0.33572	U	0.004779	T	0.59155	0.2173	M	0.65677	2.01	0.09310	N	1	P	0.40553	0.721	B	0.40134	0.32	T	0.54977	-0.8212	10	0.62326	D	0.03	.	6.5569	0.22466	0.0:0.4672:0.0:0.5328	.	69	Q8NH16	OR2L2_HUMAN	E	69	ENSP00000355435:D69E	ENSP00000355435:D69E	D	+	3	2	2	OR2L2	246268399	246268399	0.000000	0.05858	0.007000	0.13788	0.159000	0.22180	-1.686000	0.01929	0.037000	0.15575	0.194000	0.17425	GAC		0.388	OR2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096871.1		104.711349	-19	-19	197	197	NM_001004686		34	108.56558	108.565580	78	0.303571	0	0	0	1	0	34	78	0.303571
OBSL1	23363	broad.mit.edu	37	2	220432798	220432798	+	Missense_Mutation	SNP	C	C	T	rs371966827		TCGA-VD-A8KN-01A-11D-A39W-08	TCGA-VD-A8KN-10B-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6723c159-82da-425d-9dee-4682a5d82ba2	cd2ffb2b-44a4-4a4e-93f6-33dbd404cc2e	g.chr2:220432798C>T	ENST00000404537.1	-	2	1317	c.1261G>A	c.(1261-1263)Gtg>Atg	p.V421M	OBSL1_ENST00000491370.1_5'Flank|OBSL1_ENST00000373873.4_Missense_Mutation_p.V421M|OBSL1_ENST00000289656.3_Missense_Mutation_p.V8M|OBSL1_ENST00000373876.1_Missense_Mutation_p.V421M|OBSL1_ENST00000265318.4_Missense_Mutation_p.V421M|OBSL1_ENST00000603926.1_Missense_Mutation_p.V421M	NM_015311.2	NP_056126.1	O75147	OBSL1_HUMAN	obscurin-like 1	421	Ig-like 4.				cardiac myofibril assembly (GO:0055003)|cytoskeleton organization (GO:0007010)|Golgi organization (GO:0007030)|microtubule cytoskeleton organization (GO:0000226)|positive regulation of dendrite morphogenesis (GO:0050775)|protein localization to Golgi apparatus (GO:0034067)|regulation of mitosis (GO:0007088)	3M complex (GO:1990393)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|M band (GO:0031430)|perinuclear region of cytoplasm (GO:0048471)|Z disc (GO:0030018)	cytoskeletal adaptor activity (GO:0008093)						Renal(207;0.0376)		Epithelial(149;2.02e-07)|all cancers(144;1.68e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00834)		ACGTTGGCCACGGTGCGCACC	0.622											OREG0003988	type=REGULATORY REGION|Gene=OBSL1|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																										ENST00000404537.1											0										c.(1261-1263)Gtg>Atg	obscurin-like 1						71.0	79.0	76.0					2																	220432798		2150	4244	6394	SO:0001583	missense	23363			cardiac myofibril assembly	intercalated disc|M band|perinuclear region of cytoplasm|Z disc	cytoskeletal adaptor activity	g.chr2:220432798C>T	BC007201	BC007201	CCDS46520.1, CCDS54433.1, CCDS63134.1	CCDS46520.1, CCDS54433.1, CCDS63134.1	2q35	2013-01-29			2013-01-29			ENSG00000124006	ENSG00000124006	ENSG00000124006	ENSG00000124006		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	29092	29092	protein-coding gene	gene with protein product	protein-coding gene	gene with protein product			610991	610991						9734811	9734811	Standard	Standard	NM_015311	NM_015311		Approved	KIAA0657	uc010fwk.3	uc010fwk.3	O75147	O75147	OTTHUMG00000059157	OTTHUMG00000059157	ENST00000404537.1:c.1261G>A	2.37:g.220432798C>T	ENSP00000385636:p.Val421Met	2266	OBSL1_ENST00000603926.1_Missense_Mutation_p.V421M|OBSL1_ENST00000289656.3_Missense_Mutation_p.V8M|OBSL1_ENST00000373876.1_Missense_Mutation_p.V421M|OBSL1_ENST00000373873.4_Missense_Mutation_p.V421M|OBSL1_ENST00000265318.4_Missense_Mutation_p.V421M	p.V421M	NM_015311.2	NP_056126.1	O75147	OBSL1_HUMAN		Epithelial(149;2.02e-07)|all cancers(144;1.68e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00834)	2	1317	-		Renal(207;0.0376)	421	Ig-like 4.	A4KVA4|A4KVA5|Q96IW3|S4R3M6	Missense_Mutation	SNP	ENST00000404537.1	37	c.1261G>A	CCDS46520.1	.	.	.	.	.	.	.	.	.	.	C	19.94	3.919854	0.73098	.	.	ENSG00000124006	ENST00000265318;ENST00000404537;ENST00000373876;ENST00000373873;ENST00000289656	T;T;T;T;T	0.50548	3.53;3.53;3.53;3.53;0.74	5.17	5.17	0.71159	5.17	5.17	0.71159	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.57577	0.2063	L	0.54323	1.7	0.37490	D	0.91636	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.945;0.984	T	0.59658	-0.7413	9	0.32370	T	0.25	.	6.1951	0.20546	0.0:0.7843:0.0:0.2157	.	421;8;421	O75147;A8MSZ8;O75147-2	OBSL1_HUMAN;.;.	M	421;421;421;421;8	ENSP00000265318:V421M;ENSP00000385636:V421M;ENSP00000362983:V421M;ENSP00000362980:V421M;ENSP00000289656:V8M	ENSP00000265318:V421M	V	-	1	0	0	OBSL1	220141042	220141042	0.922000	0.31269	0.962000	0.40283	0.969000	0.65631	3.139000	0.50577	2.694000	0.91930	0.650000	0.86243	GTG		0.622	OBSL1-014	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322012.1		87.631196	-1	-1	115	115			30	88.633291	88.633291	49	0.379747	0	0	0	1	0	30	49	0.379747
IVL	3713	broad.mit.edu	37	1	152883896	152883896	+	Missense_Mutation	SNP	G	G	C			TCGA-VD-A8KN-01A-11D-A39W-08	TCGA-VD-A8KN-10B-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6723c159-82da-425d-9dee-4682a5d82ba2	cd2ffb2b-44a4-4a4e-93f6-33dbd404cc2e	g.chr1:152883896G>C	ENST00000368764.3	+	2	1687	c.1623G>C	c.(1621-1623)gaG>gaC	p.E541D	IVL_ENST00000392667.2_Missense_Mutation_p.E395D			P07476	INVO_HUMAN	involucrin	541	39 X 10 AA approximate tandem repeats of [LP]-[EKG]-[LHVYQEK]-[PLSQE]-[EQDV]- [QHEKRGA]-Q-[EMVQLP]-[GKLE]-[QHVNLD].				isopeptide cross-linking via N6-(L-isoglutamyl)-L-lysine (GO:0018153)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|response to UV-B (GO:0010224)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)			breast(1)|endometrium(6)|kidney(1)|large_intestine(5)|lung(11)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	29	Lung NSC(65;3.97e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			ggcagctggagcagcCTGTGT	0.587																																						ENST00000368764.3											0			breast(1)|endometrium(6)|kidney(1)|large_intestine(5)|lung(11)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	29						c.(1621-1623)gaG>gaC	involucrin						53.0	53.0	53.0					1																	152883896		2203	4300	6503	SO:0001583	missense	3713			isopeptide cross-linking via N6-(L-isoglutamyl)-L-lysine|keratinization|response to UV-B	cornified envelope|cytoplasm	protein binding, bridging|structural molecule activity	g.chr1:152883896G>C	BC046391	BC046391	CCDS1030.1	CCDS1030.1	1q21	2008-02-05			2008-02-05			ENSG00000163207	ENSG00000163207	ENSG00000163207	ENSG00000163207				6187	6187	protein-coding gene	gene with protein product	protein-coding gene	gene with protein product			147360	147360						2873896	2873896	Standard	Standard	NM_005547	NM_005547		Approved		uc001fau.3	uc001fau.3	P07476	P07476	OTTHUMG00000012451	OTTHUMG00000012451	ENST00000368764.3:c.1623G>C	1.37:g.152883896G>C	ENSP00000357753:p.Glu541Asp		IVL_ENST00000392667.2_Missense_Mutation_p.E395D	p.E541D			P07476	INVO_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.171)		2	1687	+	Lung NSC(65;3.97e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		541	39 X 10 AA approximate tandem repeats of [LP]-[EKG]-[LHVYQEK]-[PLSQE]-[EQDV]- [QHEKRGA]-Q-[EMVQLP]-[GKLE]-[QHVNLD].	Q5T7P4	Missense_Mutation	SNP	ENST00000368764.3	37	c.1623G>C	CCDS1030.1	.	.	.	.	.	.	.	.	.	.	G	13.88	2.367675	0.42003	.	.	ENSG00000163207	ENST00000368764;ENST00000392667	T;T	0.18810	2.19;3.0	3.88	0.895	0.19247	3.88	0.895	0.19247	.	.	.	.	.	T	0.16938	0.0407	L	0.61218	1.895	0.24190	N	0.995553	D	0.65815	0.995	D	0.69307	0.963	T	0.10847	-1.0612	9	0.15066	T	0.55	.	5.6123	0.17412	0.1569:0.0:0.679:0.1641	.	541	P07476	INVO_HUMAN	D	541;395	ENSP00000357753:E541D;ENSP00000376435:E395D	ENSP00000357753:E541D	E	+	3	2	2	IVL	151150520	151150520	0.004000	0.15560	0.004000	0.12327	0.068000	0.16541	0.077000	0.14738	0.207000	0.20607	0.563000	0.77884	GAG		0.587	IVL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034664.1		22.926792	14	14	36	36	NM_005547		7	22.999517	22.999517	5	0.583333	0	0	0	1	0	7	5	0.583333
ANKRD19P	138649	broad.mit.edu	37	9	95599650	95599650	+	RNA	SNP	G	G	C			TCGA-VD-A8KN-01A-11D-A39W-08	TCGA-VD-A8KN-10B-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6723c159-82da-425d-9dee-4682a5d82ba2	cd2ffb2b-44a4-4a4e-93f6-33dbd404cc2e	g.chr9:95599650G>C	ENST00000473204.1	+	0	1731							Q9H560	ANR19_HUMAN	ankyrin repeat domain 19, pseudogene							extracellular vesicular exosome (GO:0070062)											ACCTGCTGCAGCTCCTGTACC	0.662																																						ENST00000473204.1											0																																																0						g.chr9:95599650G>C	BC038951	BC038951			9q22.32	2011-04-27	2011-04-27	2011-04-27	2011-04-27	2011-04-27	2011-04-27	ENSG00000187984	ENSG00000187984	ENSG00000187984	ENSG00000187984				22567	22567	pseudogene	pseudogene	pseudogene	pseudogene					"""ankyrin repeat domain 19"", ""ankyrin repeat domain 19 pseudogene"""	ANKRD19	"""ankyrin repeat domain 19"", ""ankyrin repeat domain 19 pseudogene"""	ANKRD19				Standard	Standard	NR_026868	NR_026868		Approved	FLJ36178	uc011lua.1	uc011lua.1	Q9H560	Q9H560	OTTHUMG00000020237	OTTHUMG00000020237		9.37:g.95599650G>C											0	1731	+					A8K853|Q17RD3	RNA	SNP	ENST00000473204.1	37																																																																																											0.662	ANKRD19P-004	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000053116.3		34.725559	-21	-21	16	16	NR_026868		11	34.735931	34.735931	10	0.523810	0	0	0	1	0	11	10	0.52381
CHRNE	1145	broad.mit.edu	37	17	4798399	4798399	+	IGR	SNP	G	G	A			TCGA-VD-A8KN-01A-11D-A39W-08	TCGA-VD-A8KN-10B-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6723c159-82da-425d-9dee-4682a5d82ba2	cd2ffb2b-44a4-4a4e-93f6-33dbd404cc2e	g.chr17:4798399G>A	ENST00000293780.4	-	0	2455				MINK1_ENST00000453408.3_Missense_Mutation_p.D963N|MINK1_ENST00000347992.7_Missense_Mutation_p.D954N|MINK1_ENST00000355280.6_Missense_Mutation_p.D983N	NM_000080.3	NP_000071.1	Q04844	ACHE_HUMAN	cholinergic receptor, nicotinic, epsilon (muscle)						cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|muscle contraction (GO:0006936)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|cation transmembrane transporter activity (GO:0008324)			central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(5)|lung(3)|prostate(1)	12					Galantamine(DB00674)	CACTCGGCTCGACCAGCTGCA	0.602																																						ENST00000355280.6											0			central_nervous_system(2)|large_intestine(1)|lung(1)|skin(1)|stomach(1)	6						c.(2947-2949)Gac>Aac	misshapen-like kinase 1						412.0	382.0	392.0					17																	4798399		2036	4176	6212	SO:0001628	intergenic_variant	50488			JNK cascade	cytoplasm	ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity	g.chr17:4798399G>A	X66403	AY775058	CCDS11058.1	CCDS45588.1, CCDS45589.1, CCDS45590.1	17p13.2	2012-02-11	2012-02-07		2011-04-14	2010-06-24		ENSG00000108556	ENSG00000108556	ENSG00000141503	ENSG00000141503		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""		1966	17565	protein-coding gene	gene with protein product	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, epsilon (muscle)"""	"""misshapen/NIK-related kinase"""	100725	609426	"""cholinergic receptor, nicotinic, epsilon"""		"""misshapen-like kinase 1 (zebrafish)"""			7688301	10708748, 12087176	Standard	Standard	NM_000080	NM_015716		Approved	ACHRE	uc002fzk.1	uc010vsl.2	Q04844	Q8N4C8	OTTHUMG00000090778			17.37:g.4798399G>A			MINK1_ENST00000347992.7_Missense_Mutation_p.D954N|MINK1_ENST00000453408.3_Missense_Mutation_p.D963N	p.D983N	NM_001024937.3|NM_015716.4|NM_153827.4	NP_001020108.1|NP_056531.1|NP_722549.2	Q8N4C8	MINK1_HUMAN			25	3143	+			983	Mediates interaction with RAP2A.	D3DTK6	Missense_Mutation	SNP	ENST00000293780.4	37	c.2947G>A	CCDS11058.1	.	.	.	.	.	.	.	.	.	.	G	18.98	3.737018	0.69304	.	.	ENSG00000141503	ENST00000355280;ENST00000453408;ENST00000347992	T;T;T	0.74632	-0.84;-0.86;-0.84	5.11	5.11	0.69529	5.11	5.11	0.69529	.	0.177372	0.48767	D	0.000161	T	0.63212	0.2492	L	0.34521	1.04	0.45690	D	0.998601	B;P;B;P	0.34546	0.272;0.456;0.327;0.456	B;B;B;B	0.24701	0.055;0.034;0.015;0.034	T	0.67684	-0.5607	10	0.62326	D	0.03	.	16.0869	0.81060	0.0:0.0:1.0:0.0	.	946;963;983;954	Q8N4C8-2;Q8N4C8-4;Q8N4C8;Q8N4C8-3	.;.;MINK1_HUMAN;.	N	983;963;954	ENSP00000347427:D983N;ENSP00000406487:D963N;ENSP00000269296:D954N	ENSP00000269296:D954N	D	+	1	0	0	MINK1	4739175	4739175	1.000000	0.71417	0.985000	0.45067	0.955000	0.61496	5.526000	0.67116	2.655000	0.90218	0.655000	0.94253	GAC		0.602	CHRNE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207560.3		142.805309	13	13	180	180			47	143.792463	143.792463	70	0.401709	0	0	0	1	0	47	70	0.401709
OR4E2	26686	broad.mit.edu	37	14	22134222	22134222	+	Missense_Mutation	SNP	C	C	T	rs376029887		TCGA-VD-A8KN-01A-11D-A39W-08	TCGA-VD-A8KN-10B-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6723c159-82da-425d-9dee-4682a5d82ba2	cd2ffb2b-44a4-4a4e-93f6-33dbd404cc2e	g.chr14:22134222C>T	ENST00000408935.1	+	1	926	c.926C>T	c.(925-927)aCg>aTg	p.T309M		NM_001001912.1	NP_001001912.1	Q8NGC2	OR4E2_HUMAN	olfactory receptor, family 4, subfamily E, member 2	309						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	15	all_cancers(95;0.00113)	Acute lymphoblastic leukemia(2;0.0279)		GBM - Glioblastoma multiforme(265;0.0137)		GTTTTTTTCACGAAATCATAT	0.393																																						ENST00000408935.1											0			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	15						c.(925-927)aCg>aTg	olfactory receptor, family 4, subfamily E, member 2						33.0	30.0	31.0					14																	22134222		1924	4142	6066	SO:0001583	missense	26686			sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr14:22134222C>T			CCDS41916.1	CCDS41916.1	14q11.2	2013-09-23			2013-09-23			ENSG00000221977	ENSG00000221977	ENSG00000221977	ENSG00000221977		"""GPCR / Class A : Olfactory receptors"""	"""GPCR / Class A : Olfactory receptors"""	8297	8297	protein-coding gene	gene with protein product	protein-coding gene	gene with protein product												Standard	Standard	NM_001001912	NM_001001912		Approved		uc010tmd.2	uc010tmd.2	Q8NGC2	Q8NGC2	OTTHUMG00000168979	OTTHUMG00000168979	ENST00000408935.1:c.926C>T	14.37:g.22134222C>T	ENSP00000386195:p.Thr309Met			p.T309M	NM_001001912.1	NP_001001912.1	Q8NGC2	OR4E2_HUMAN		GBM - Glioblastoma multiforme(265;0.0137)	1	926	+	all_cancers(95;0.00113)	Acute lymphoblastic leukemia(2;0.0279)	309		Q6IET6|Q96R62	Missense_Mutation	SNP	ENST00000408935.1	37	c.926C>T	CCDS41916.1	.	.	.	.	.	.	.	.	.	.	c	1.122	-0.655064	0.03480	.	.	ENSG00000221977	ENST00000408935	T	0.11169	2.8	5.76	0.553	0.17235	5.76	0.553	0.17235	.	.	.	.	.	T	0.06600	0.0169	N	0.19112	0.55	0.09310	N	0.999999	B	0.14805	0.011	B	0.06405	0.002	T	0.36601	-0.9741	9	0.42905	T	0.14	.	6.5188	0.22262	0.2067:0.1356:0.0:0.6577	.	309	Q8NGC2	OR4E2_HUMAN	M	309	ENSP00000386195:T309M	ENSP00000386195:T309M	T	+	2	0	0	OR4E2	21204062	21204062	0.003000	0.15002	0.163000	0.22734	0.253000	0.25986	-0.232000	0.09055	-0.079000	0.12707	-2.249000	0.00283	ACG		0.393	OR4E2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401874.1		13.367488	-2	-2	25	25			5	14.167134	14.167134	13	0.277778	0	0	0	1	0	5	13	0.277778
TLDC1	57707	broad.mit.edu	37	16	84520354	84520354	+	Nonsense_Mutation	SNP	G	G	A			TCGA-VD-A8KN-01A-11D-A39W-08	TCGA-VD-A8KN-10B-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6723c159-82da-425d-9dee-4682a5d82ba2	cd2ffb2b-44a4-4a4e-93f6-33dbd404cc2e	g.chr16:84520354G>A	ENST00000343629.6	-	5	1023	c.841C>T	c.(841-843)Cag>Tag	p.Q281*	TLDC1_ENST00000561807.1_5'Flank|TLDC1_ENST00000535580.1_Nonsense_Mutation_p.Q254*	NM_020947.3	NP_065998.3	Q6P9B6	TLDC1_HUMAN	TBC/LysM-associated domain containing 1	281	TLD.					lysosomal membrane (GO:0005765)											CCACAGAGCTGGGAGAAGCTG	0.597																																						ENST00000343629.6											0										c.(841-843)Cag>Tag	TBC/LysM-associated domain containing 1						68.0	62.0	64.0					16																	84520354		2200	4300	6500	SO:0001587	stop_gained	57707						g.chr16:84520354G>A	AB046829	AB046829	CCDS32498.1	CCDS32498.1	16q24.1	2013-03-14	2013-03-14	2013-03-14	2013-03-14	2013-03-14	2013-03-14	ENSG00000140950	ENSG00000140950	ENSG00000140950	ENSG00000140950				29325	29325	protein-coding gene	gene with protein product	protein-coding gene	gene with protein product	"""TLD domain containing 1"""	"""TLD domain containing 1"""			"""KIAA1609"""	KIAA1609	"""KIAA1609"""	KIAA1609		10997877	10997877	Standard	Standard	NM_020947	NM_020947		Approved		uc002fib.3	uc002fib.3	Q6P9B6	Q6P9B6	OTTHUMG00000176739	OTTHUMG00000176739	ENST00000343629.6:c.841C>T	16.37:g.84520354G>A	ENSP00000343635:p.Gln281*		TLDC1_ENST00000535580.1_Nonsense_Mutation_p.Q254*	p.Q281*	NM_020947.3	NP_065998.3					5	1023	-					Q8IZ64|Q9HCG3|Q9NTE8	Nonsense_Mutation	SNP	ENST00000343629.6	37	c.841C>T	CCDS32498.1	.	.	.	.	.	.	.	.	.	.	G	37	6.267690	0.97426	.	.	ENSG00000140950	ENST00000343629;ENST00000535580	.	.	.	5.32	4.33	0.51752	5.32	4.33	0.51752	.	0.054163	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.31617	T	0.26	-38.7056	14.4712	0.67517	0.0:0.0:0.8529:0.1471	.	.	.	.	X	281;254	.	ENSP00000343635:Q281X	Q	-	1	0	0	KIAA1609	83077855	83077855	1.000000	0.71417	0.983000	0.44433	0.773000	0.43773	4.555000	0.60767	2.476000	0.83614	0.655000	0.94253	CAG		0.597	TLDC1-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433421.1		40.637228	-15	-15	50	50	NM_020947		14	41.548009	41.548009	27	0.341463	0	0	0	1	0	14	27	0.341463
MGAT5	4249	broad.mit.edu	37	2	135107438	135107438	+	Missense_Mutation	SNP	C	C	T			TCGA-VD-A8KN-01A-11D-A39W-08	TCGA-VD-A8KN-10B-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6723c159-82da-425d-9dee-4682a5d82ba2	cd2ffb2b-44a4-4a4e-93f6-33dbd404cc2e	g.chr2:135107438C>T	ENST00000409645.1	+	10	1427	c.1175C>T	c.(1174-1176)gCc>gTc	p.A392V	MGAT5_ENST00000281923.2_Missense_Mutation_p.A392V			Q09328	MGT5A_HUMAN	mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase	392					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	alpha-1,6-mannosylglycoprotein 6-beta-N-acetylglucosaminyltransferase activity (GO:0030144)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|liver(1)|lung(18)|ovary(3)|pancreas(1)|skin(3)	36				BRCA - Breast invasive adenocarcinoma(221;0.0964)		GCAAATTATGCCCAATCGAAA	0.413																																						ENST00000409645.1											0			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|liver(1)|lung(18)|ovary(3)|pancreas(1)|skin(3)	36						c.(1174-1176)gCc>gTc	mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase						145.0	139.0	141.0					2																	135107438		2203	4300	6503	SO:0001583	missense	4249			post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-1,6-mannosyl-glycoprotein 6-beta-N-acetylglucosaminyltransferase activity	g.chr2:135107438C>T	D17716	D17716	CCDS2171.1	CCDS2171.1	2q21	2013-02-25			2013-02-25			ENSG00000152127	ENSG00000152127	ENSG00000152127	ENSG00000152127	2.4.1.155	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	7049	7049	protein-coding gene	gene with protein product	protein-coding gene	gene with protein product			601774	601774						8292036	8292036	Standard	Standard	NM_002410	NM_002410		Approved	GNT-V	uc002ttw.4	uc002ttw.4	Q09328	Q09328	OTTHUMG00000131681	OTTHUMG00000131681	ENST00000409645.1:c.1175C>T	2.37:g.135107438C>T	ENSP00000386377:p.Ala392Val		MGAT5_ENST00000281923.2_Missense_Mutation_p.A392V	p.A392V			Q09328	MGT5A_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.0964)	10	1427	+			392		D3DP70	Missense_Mutation	SNP	ENST00000409645.1	37	c.1175C>T	CCDS2171.1	.	.	.	.	.	.	.	.	.	.	C	17.30	3.354094	0.61293	.	.	ENSG00000152127	ENST00000409645;ENST00000281923	.	.	.	5.12	4.23	0.50019	5.12	4.23	0.50019	.	0.049024	0.85682	D	0.000000	T	0.64416	0.2596	M	0.62266	1.93	0.80722	D	1	P	0.44627	0.839	P	0.48704	0.587	T	0.69367	-0.5164	9	0.72032	D	0.01	-14.4403	15.2536	0.73568	0.1416:0.8584:0.0:0.0	.	392	Q09328	MGT5A_HUMAN	V	392	.	ENSP00000281923:A392V	A	+	2	0	0	MGAT5	134823908	134823908	1.000000	0.71417	1.000000	0.80357	0.182000	0.23217	7.772000	0.85439	1.238000	0.43771	-0.182000	0.12963	GCC		0.413	MGAT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254584.3		-7.129610	-23	-23	84	84	NM_002410		3	6.318004	6.318004	59	0.048387	0	0	0	1	0	3	59	0.048387
FAM71A	149647	broad.mit.edu	37	1	212798742	212798742	+	Missense_Mutation	SNP	C	C	T	rs528047581		TCGA-VD-A8KN-01A-11D-A39W-08	TCGA-VD-A8KN-10B-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6723c159-82da-425d-9dee-4682a5d82ba2	cd2ffb2b-44a4-4a4e-93f6-33dbd404cc2e	g.chr1:212798742C>T	ENST00000294829.3	+	1	954	c.523C>T	c.(523-525)Cgg>Tgg	p.R175W	RP11-338C15.5_ENST00000427949.1_RNA	NM_153606.3	NP_705834.2	Q8IYT1	FA71A_HUMAN	family with sequence similarity 71, member A	175						nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(7)|liver(1)|lung(12)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				OV - Ovarian serous cystadenocarcinoma(81;0.00631)|all cancers(67;0.00981)|GBM - Glioblastoma multiforme(131;0.0715)|Epithelial(68;0.094)		TTACCTCTTGCGGCCACCCAT	0.517													C|||	1	0.000199681	0.0	0.0	5008	,	,		22325	0.0		0.0	False		,,,				2504	0.001					ENST00000294829.3											0			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(7)|liver(1)|lung(12)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						c.(523-525)Cgg>Tgg	family with sequence similarity 71, member A						108.0	113.0	112.0					1																	212798742		2203	4300	6503	SO:0001583	missense	149647						g.chr1:212798742C>T			CCDS1507.1	CCDS1507.1	1q32.3	2008-02-05			2008-02-05			ENSG00000162771	ENSG00000162771	ENSG00000162771	ENSG00000162771				26541	26541	protein-coding gene	gene with protein product	protein-coding gene	gene with protein product										12477932	12477932	Standard	Standard	NM_153606	NM_153606		Approved	FLJ32796	uc010pth.1	uc010pth.1	Q8IYT1	Q8IYT1	OTTHUMG00000041084	OTTHUMG00000041084	ENST00000294829.3:c.523C>T	1.37:g.212798742C>T	ENSP00000294829:p.Arg175Trp		RP11-338C15.5_ENST00000427949.1_RNA	p.R175W	NM_153606.3	NP_705834.2	Q8IYT1	FA71A_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.00631)|all cancers(67;0.00981)|GBM - Glioblastoma multiforme(131;0.0715)|Epithelial(68;0.094)	1	954	+			175		Q5VTZ1	Missense_Mutation	SNP	ENST00000294829.3	37	c.523C>T	CCDS1507.1	.	.	.	.	.	.	.	.	.	.	C	6.928	0.540844	0.13250	.	.	ENSG00000162771	ENST00000294829	T	0.26660	1.72	4.54	2.6	0.31112	4.54	2.6	0.31112	.	0.279284	0.23893	N	0.043524	T	0.46171	0.1379	M	0.84846	2.72	0.09310	N	1	D	0.61080	0.989	D	0.64237	0.923	T	0.31779	-0.9931	10	0.66056	D	0.02	-6.1149	5.4741	0.16686	0.2046:0.6922:0.0:0.1032	.	175	Q8IYT1	FA71A_HUMAN	W	175	ENSP00000294829:R175W	ENSP00000294829:R175W	R	+	1	2	2	FAM71A	210865365	210865365	0.084000	0.21492	0.004000	0.12327	0.174000	0.22865	0.277000	0.18734	0.607000	0.29982	0.563000	0.77884	CGG		0.517	FAM71A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098529.1		185.451920	-17	-17	170	170	NM_153606		61	186.184833	186.184833	83	0.423611	0	0	0	1	0	61	83	0.423611
GNAQ	2776	broad.mit.edu	37	9	80409488	80409488	+	Missense_Mutation	SNP	T	T	G	rs121913492		TCGA-VD-A8KN-01A-11D-A39W-08	TCGA-VD-A8KN-10B-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6723c159-82da-425d-9dee-4682a5d82ba2	cd2ffb2b-44a4-4a4e-93f6-33dbd404cc2e	g.chr9:80409488T>G	ENST00000286548.4	-	5	848	c.626A>C	c.(625-627)cAa>cCa	p.Q209P	GNAQ_ENST00000397476.3_Missense_Mutation_p.Q7P	NM_002072.3	NP_002063.2	P50148	GNAQ_HUMAN	guanine nucleotide binding protein (G protein), q polypeptide	209			Q -> L (found in blue naevi and uveal melanoma samples; somatic mutation; constitutive activation).		action potential (GO:0001508)|activation of phospholipase C activity (GO:0007202)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|developmental pigmentation (GO:0048066)|embryonic digit morphogenesis (GO:0042733)|forebrain neuron development (GO:0021884)|glutamate receptor signaling pathway (GO:0007215)|heart development (GO:0007507)|maternal behavior (GO:0042711)|negative regulation of protein kinase activity (GO:0006469)|neuron remodeling (GO:0016322)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|platelet activation (GO:0030168)|positive regulation of GTPase activity (GO:0043547)|post-embryonic development (GO:0009791)|protein stabilization (GO:0050821)|regulation of catenin import into nucleus (GO:0035412)|regulation of melanocyte differentiation (GO:0045634)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|GTP binding (GO:0005525)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)|type 2A serotonin receptor binding (GO:0031826)	p.Q209L(87)|p.Q209P(64)|p.Q209Y(1)|p.Q209R(1)		NS(1)|endometrium(3)|eye(229)|kidney(1)|large_intestine(4)|lung(6)|meninges(11)|ovary(1)|prostate(1)|skin(44)|upper_aerodigestive_tract(1)	302						CTCTGACCTTTGGCCCCCTAC	0.348			Mis		uveal melanoma																																	ENST00000286548.4		Dom	yes		9	9q21	2776	"""guanine nucleotide binding protein (G protein), q polypeptide"""		E	153	Substitution - Missense(153)	eye(99)|skin(43)|meninges(10)|NS(1)	NS(1)|endometrium(3)|eye(229)|kidney(1)|large_intestine(4)|lung(6)|meninges(11)|ovary(1)|prostate(1)|skin(44)|upper_aerodigestive_tract(1)	302						c.(625-627)cAa>cCa	guanine nucleotide binding protein (G protein), q polypeptide						108.0	105.0	106.0					9																	80409488		2203	4300	6503	SO:0001583	missense	2776			activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity by dopamine receptor signaling pathway|glutamate signaling pathway|negative regulation of protein kinase activity|platelet activation|protein ADP-ribosylation|protein stabilization|regulation of action potential|regulation of catenin import into nucleus	cytoplasm|heterotrimeric G-protein complex	G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GTP binding|GTPase activator activity|GTPase activity|signal transducer activity	g.chr9:80409488T>G			CCDS6658.1	CCDS6658.1	9q21	2010-03-17			2010-03-17			ENSG00000156052	ENSG00000156052	ENSG00000156052	ENSG00000156052				4390	4390	protein-coding gene	gene with protein product	protein-coding gene	gene with protein product			600998	600998						8825633	8825633	Standard	Standard	NM_002072	NM_002072		Approved	G-ALPHA-q, GAQ	uc004akw.3	uc004akw.3	P50148	P50148	OTTHUMG00000020059	OTTHUMG00000020059	ENST00000286548.4:c.626A>C	9.37:g.80409488T>G	ENSP00000286548:p.Gln209Pro		GNAQ_ENST00000397476.3_Missense_Mutation_p.Q7P	p.Q209P	NM_002072.3	NP_002063.2	P50148	GNAQ_HUMAN			5	848	-			209		O15108|Q13462|Q6NT27|Q92471|Q9BZB9	Missense_Mutation	SNP	ENST00000286548.4	37	c.626A>C	CCDS6658.1	.	.	.	.	.	.	.	.	.	.	T	25.2	4.614273	0.87359	.	.	ENSG00000156052	ENST00000286548;ENST00000397476	D;D	0.91237	-2.81;-2.81	5.69	5.69	0.88448	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	D	0.97164	0.9073	H	0.97291	3.975	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	D	0.98607	1.0661	10	0.87932	D	0	.	15.9502	0.79827	0.0:0.0:0.0:1.0	.	209	P50148	GNAQ_HUMAN	P	209;7	ENSP00000286548:Q209P;ENSP00000443197:Q7P	ENSP00000286548:Q209P	Q	-	2	0	0	GNAQ	79599308	79599308	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	8.040000	0.89188	2.167000	0.68274	0.460000	0.39030	CAA		0.348	GNAQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052761.1		82.904633	-30	-30	82	82	NM_002072		27	84.198665	84.198665	48	0.360000	0	0	0	1	0	27	48	0.36
LRRC42	115353	broad.mit.edu	37	1	54426038	54426038	+	Silent	SNP	G	G	A			TCGA-VD-A8KN-01A-11D-A39W-08	TCGA-VD-A8KN-10B-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6723c159-82da-425d-9dee-4682a5d82ba2	cd2ffb2b-44a4-4a4e-93f6-33dbd404cc2e	g.chr1:54426038G>A	ENST00000371370.3	+	5	1136	c.615G>A	c.(613-615)caG>caA	p.Q205Q	LRRC42_ENST00000319223.4_Silent_p.Q205Q	NM_001256409.1	NP_001243338.1	Q9Y546	LRC42_HUMAN	leucine rich repeat containing 42	205										breast(2)|kidney(1)|large_intestine(1)|lung(5)	9						GTGTAACTCAGCTCCACCTGA	0.363																																						ENST00000371370.3											0			breast(2)|kidney(1)|large_intestine(1)|lung(5)	9						c.(613-615)caG>caA	leucine rich repeat containing 42						124.0	123.0	123.0					1																	54426038		2203	4300	6503	SO:0001819	synonymous_variant	115353						g.chr1:54426038G>A	AK075201	AK075201	CCDS585.1	CCDS585.1	1p33-p32.1	2014-02-12			2014-02-12			ENSG00000116212	ENSG00000116212	ENSG00000116212	ENSG00000116212				28792	28792	protein-coding gene	gene with protein product	protein-coding gene	gene with protein product										12477932	12477932	Standard	Standard	NM_001256409	NM_001256409		Approved	MGC8974	uc001cwj.2	uc001cwj.2	Q9Y546	Q9Y546	OTTHUMG00000008436	OTTHUMG00000008436	ENST00000371370.3:c.615G>A	1.37:g.54426038G>A			LRRC42_ENST00000319223.4_Silent_p.Q205Q	p.Q205Q	NM_001256409.1	NP_001243338.1	Q9Y546	LRC42_HUMAN			5	1136	+			205		D3DQ46|Q8N2Q8	Silent	SNP	ENST00000371370.3	37	c.615G>A	CCDS585.1																																																																																									0.363	LRRC42-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023250.1		94.442829	1	1	75	75	NM_052940		30	94.561627	94.561627	36	0.454545	0	0	0	1	0	30	36	0.454545
UBL3	5412	broad.mit.edu	37	13	30341440	30341440	+	Missense_Mutation	SNP	C	C	A			TCGA-VD-A8KN-01A-11D-A39W-08	TCGA-VD-A8KN-10B-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6723c159-82da-425d-9dee-4682a5d82ba2	cd2ffb2b-44a4-4a4e-93f6-33dbd404cc2e	g.chr13:30341440C>A	ENST00000380680.4	-	5	1451	c.306G>T	c.(304-306)caG>caT	p.Q102H		NM_007106.3	NP_009037.1	O95164	UBL3_HUMAN	ubiquitin-like 3	102						extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|plasma membrane (GO:0005886)				large_intestine(3)|lung(1)	4		Lung SC(185;0.0281)		all cancers(112;0.0598)|GBM - Glioblastoma multiforme(144;0.142)|OV - Ovarian serous cystadenocarcinoma(117;0.147)		CACGATTCCTCTGACCTAGGG	0.418																																						ENST00000380680.4											0			large_intestine(3)|lung(1)	4						c.(304-306)caG>caT	ubiquitin-like 3						101.0	86.0	91.0					13																	30341440		2203	4300	6503	SO:0001583	missense	5412				intracellular|plasma membrane		g.chr13:30341440C>A	AF044221	AF044221	CCDS9334.1	CCDS9334.1	13q12-q13	2008-07-18			2008-07-18			ENSG00000122042	ENSG00000122042	ENSG00000122042	ENSG00000122042				12504	12504	protein-coding gene	gene with protein product	protein-coding gene	gene with protein product			604711	604711		PNSC1		PNSC1		10375635	10375635	Standard	Standard	NM_007106	NM_007106		Approved	HCG-1, DKFZP434K151, FLJ32018	uc001usp.3	uc001usp.3	O95164	O95164	OTTHUMG00000016661	OTTHUMG00000016661	ENST00000380680.4:c.306G>T	13.37:g.30341440C>A	ENSP00000370055:p.Gln102His			p.Q102H	NM_007106.3	NP_009037.1	O95164	UBL3_HUMAN		all cancers(112;0.0598)|GBM - Glioblastoma multiforme(144;0.142)|OV - Ovarian serous cystadenocarcinoma(117;0.147)	5	1451	-		Lung SC(185;0.0281)	102		B2R4J1|Q5RL72|Q5VZS0|Q6FIG8|Q96SG7	Missense_Mutation	SNP	ENST00000380680.4	37	c.306G>T	CCDS9334.1	.	.	.	.	.	.	.	.	.	.	C	19.31	3.803775	0.70682	.	.	ENSG00000122042	ENST00000380680	.	.	.	5.84	2.14	0.27477	5.84	2.14	0.27477	.	0.000000	0.85682	D	0.000000	T	0.50956	0.1646	M	0.65975	2.015	0.58432	D	0.999996	P	0.46952	0.887	P	0.47118	0.538	T	0.40365	-0.9567	9	0.36615	T	0.2	-14.1466	5.9535	0.19261	0.0:0.5674:0.1296:0.303	.	102	O95164	UBL3_HUMAN	H	102	.	ENSP00000370055:Q102H	Q	-	3	2	2	UBL3	29239440	29239440	0.997000	0.39634	0.998000	0.56505	0.941000	0.58515	0.539000	0.23175	0.088000	0.17205	0.557000	0.71058	CAG		0.418	UBL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044342.1		-1.309407	10	10	65	65	NM_007106		3	6.373218	6.373218	38	0.073171	1	0	0.004672	1	0.004672	3	38	0.073171
CEP152	22995	broad.mit.edu	37	15	49064766	49064766	+	Missense_Mutation	SNP	A	A	G			TCGA-VD-A8KN-01A-11D-A39W-08	TCGA-VD-A8KN-10B-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6723c159-82da-425d-9dee-4682a5d82ba2	cd2ffb2b-44a4-4a4e-93f6-33dbd404cc2e	g.chr15:49064766A>G	ENST00000380950.2	-	13	1887	c.1700T>C	c.(1699-1701)tTa>tCa	p.L567S	CEP152_ENST00000399334.3_Missense_Mutation_p.L567S|CEP152_ENST00000325747.5_Missense_Mutation_p.L474S|CEP152_ENST00000559398.1_5'UTR	NM_001194998.1|NM_014985.3	NP_001181927.1|NP_055800.2	O94986	CE152_HUMAN	centrosomal protein 152kDa	567					cell projection organization (GO:0030030)|centriole replication (GO:0007099)|centrosome duplication (GO:0051298)|de novo centriole assembly (GO:0098535)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytosol (GO:0005829)|deuterosome (GO:0098536)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)			breast(3)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(16)|lung(30)|ovary(1)|prostate(2)|skin(2)	63		all_lung(180;0.0428)		all cancers(107;1.08e-07)|GBM - Glioblastoma multiforme(94;2.32e-06)		GTCATTTTGTAACTGAGACAC	0.388																																						ENST00000380950.2											0			breast(3)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(16)|lung(30)|ovary(1)|prostate(2)|skin(2)	63						c.(1699-1701)tTa>tCa	centrosomal protein 152kDa						168.0	153.0	157.0					15																	49064766		1902	4130	6032	SO:0001583	missense	22995			centrosome duplication|G2/M transition of mitotic cell cycle	centrosome|cytosol	protein kinase binding	g.chr15:49064766A>G	AB020719	AB020719	CCDS42033.1, CCDS58361.1	CCDS42033.1, CCDS58361.1	15q21.1	2014-02-20			2014-02-20										29298	29298	protein-coding gene	gene with protein product	protein-coding gene	gene with protein product	"""asterless"""	"""asterless"""	613529	613529	"""microcephaly, primary autosomal recessive 4"""	MCPH4	"""microcephaly, primary autosomal recessive 4"""	MCPH4		14654843, 21131973	14654843, 21131973	Standard	Standard	NM_014985	NM_014985		Approved	KIAA0912, SCKL5	uc001zwz.3	uc001zwz.3	O94986	O94986			ENST00000380950.2:c.1700T>C	15.37:g.49064766A>G	ENSP00000370337:p.Leu567Ser		CEP152_ENST00000559398.1_5'UTR|CEP152_ENST00000399334.3_Missense_Mutation_p.L567S|CEP152_ENST00000325747.5_Missense_Mutation_p.L474S	p.L567S	NM_001194998.1|NM_014985.3	NP_001181927.1|NP_055800.2	O94986	CE152_HUMAN		all cancers(107;1.08e-07)|GBM - Glioblastoma multiforme(94;2.32e-06)	13	1887	-		all_lung(180;0.0428)	567		E7ER66|Q17RV1|Q6NTA0	Missense_Mutation	SNP	ENST00000380950.2	37	c.1700T>C	CCDS58361.1	.	.	.	.	.	.	.	.	.	.	A	23.5	4.429259	0.83776	.	.	ENSG00000103995	ENST00000380950;ENST00000325747;ENST00000399334;ENST00000541880	D;D;D	0.84660	-1.88;-1.88;-1.88	5.78	5.78	0.91487	5.78	5.78	0.91487	.	0.000000	0.64402	D	0.000001	D	0.91436	0.7297	M	0.78049	2.395	0.40781	D	0.98317	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.997;0.999;0.999	D	0.89976	0.4097	10	0.22706	T	0.39	-9.033	14.6461	0.68762	1.0:0.0:0.0:0.0	.	474;567;567	O94986-1;E7ER66;O94986	.;.;CE152_HUMAN	S	567;474;567;567	ENSP00000370337:L567S;ENSP00000321000:L474S;ENSP00000382271:L567S	ENSP00000321000:L474S	L	-	2	0	0	CEP152	46852058	46852058	1.000000	0.71417	0.958000	0.39756	0.982000	0.71751	6.222000	0.72249	2.333000	0.79357	0.482000	0.46254	TTA		0.388	CEP152-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417365.1		-17.857655	-19	-19	121	121	NM_014985		3	6.383278	6.383278	97	0.030000	0	0	0	1	0	3	97	0.03
RPH3A	22895	broad.mit.edu	37	12	113285537	113285537	+	Silent	SNP	G	G	A			TCGA-VD-A8KN-01A-11D-A39W-08	TCGA-VD-A8KN-10B-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6723c159-82da-425d-9dee-4682a5d82ba2	cd2ffb2b-44a4-4a4e-93f6-33dbd404cc2e	g.chr12:113285537G>A	ENST00000389385.4	+	5	617	c.120G>A	c.(118-120)caG>caA	p.Q40Q	RPH3A_ENST00000420983.2_Silent_p.Q40Q|RPH3A_ENST00000543106.2_Silent_p.Q40Q|RPH3A_ENST00000415485.3_Silent_p.Q40Q|RPH3A_ENST00000548866.1_Intron|RPH3A_ENST00000447659.2_Intron|RPH3A_ENST00000551052.1_Silent_p.Q36Q	NM_001143854.1|NM_014954.3	NP_001137326.1|NP_055769.2	Q9Y2J0	RP3A_HUMAN	rabphilin 3A	40					intracellular protein transport (GO:0006886)	cell junction (GO:0030054)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phosphatidylinositol phosphate binding (GO:1901981)|transporter activity (GO:0005215)			breast(1)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(16)|ovary(3)|prostate(4)|skin(6)|urinary_tract(1)	47				BRCA - Breast invasive adenocarcinoma(302;0.00453)		CCGGTGGTCAGCCTGACAGGC	0.532																																						ENST00000389385.4											0			breast(1)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(16)|ovary(3)|prostate(4)|skin(6)|urinary_tract(1)	47						c.(118-120)caG>caA	rabphilin 3A homolog (mouse)						77.0	70.0	72.0					12																	113285537		2203	4300	6503	SO:0001819	synonymous_variant	22895			intracellular protein transport	cell junction|synaptic vesicle	Rab GTPase binding|transporter activity|zinc ion binding	g.chr12:113285537G>A	AB023202	AB023202	CCDS31904.1, CCDS44979.1	CCDS31904.1, CCDS44979.1	12q24.13	2014-07-02	2014-07-02		2014-07-02	2014-07-02		ENSG00000089169	ENSG00000089169	ENSG00000089169	ENSG00000089169		"""Synaptotagmins"""	"""Synaptotagmins"""	17056	17056	protein-coding gene	gene with protein product	protein-coding gene	gene with protein product			612159	612159	"""rabphilin 3A homolog (mouse)"""		"""rabphilin 3A homolog (mouse)"""			10231032, 7822236	10231032, 7822236	Standard	Standard	NM_014954	NM_014954		Approved	KIAA0985, rabphilin, exophilin-1	uc001ttz.3	uc001ttz.3	Q9Y2J0	Q9Y2J0	OTTHUMG00000169713	OTTHUMG00000169713	ENST00000389385.4:c.120G>A	12.37:g.113285537G>A			RPH3A_ENST00000447659.2_Intron|RPH3A_ENST00000543106.2_Silent_p.Q40Q|RPH3A_ENST00000551052.1_Silent_p.Q36Q|RPH3A_ENST00000415485.3_Silent_p.Q40Q|RPH3A_ENST00000548866.1_Intron|RPH3A_ENST00000420983.2_Silent_p.Q40Q	p.Q40Q	NM_001143854.1|NM_014954.3	NP_001137326.1|NP_055769.2	Q9Y2J0	RP3A_HUMAN		BRCA - Breast invasive adenocarcinoma(302;0.00453)	5	617	+			40		B7Z3C3|Q96AE0	Silent	SNP	ENST00000389385.4	37	c.120G>A	CCDS44979.1																																																																																									0.532	RPH3A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000405561.1		-2.949267	-23	-23	73	73	NM_014954		4	8.1917	8.191700	54	0.068966	0	0	0	1	0	4	54	0.068966
ABCD1	215	broad.mit.edu	37	X	153008790	153008790	+	Frame_Shift_Del	DEL	C	C	-			TCGA-VD-A8KN-01A-11D-A39W-08	TCGA-VD-A8KN-10B-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6723c159-82da-425d-9dee-4682a5d82ba2	cd2ffb2b-44a4-4a4e-93f6-33dbd404cc2e	g.chrX:153008790delC	ENST00000218104.3	+	9	2380	c.1981delC	c.(1981-1983)cccfs	p.P661fs	U52111.14_ENST00000434284.1_RNA	NM_000033.3	NP_000024.2	P33897	ABCD1_HUMAN	ATP-binding cassette, sub-family D (ALD), member 1	661	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.				alpha-linolenic acid metabolic process (GO:0036109)|ATP catabolic process (GO:0006200)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|linoleic acid metabolic process (GO:0043651)|long-chain fatty acid catabolic process (GO:0042758)|peroxisomal long-chain fatty acid import (GO:0015910)|peroxisomal membrane transport (GO:0015919)|peroxisome organization (GO:0007031)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|unsaturated fatty acid metabolic process (GO:0033559)|very long-chain fatty acid catabolic process (GO:0042760)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of peroxisomal membrane (GO:0005779)|membrane (GO:0016020)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|peroxisomal fatty-acyl-CoA transporter activity (GO:0005325)|protein homodimerization activity (GO:0042803)|transporter activity (GO:0005215)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(6)|urinary_tract(2)	18	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CACCCACCGGCCCTCCCTGTG	0.692																																						ENST00000218104.3											0			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(6)|urinary_tract(2)	18						c.(1981-1983)cccfs	ATP-binding cassette, sub-family D (ALD), member 1						19.0	16.0	17.0					X																	153008790		2186	4274	6460	SO:0001589	frameshift_variant	215			fatty acid beta-oxidation using acyl-CoA oxidase|peroxisomal membrane transport|peroxisome organization	cytosol|integral to peroxisomal membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances|identical protein binding|peroxisomal fatty-acyl-CoA transporter activity	g.chrX:153008790delC	Z21876	Z21876	CCDS14728.1	CCDS14728.1	Xq28	2012-03-14			2012-03-14			ENSG00000101986	ENSG00000101986	ENSG00000101986	ENSG00000101986		"""ATP binding cassette transporters / subfamily D"""	"""ATP binding cassette transporters / subfamily D"""	61	61	protein-coding gene	gene with protein product	protein-coding gene	gene with protein product			300371	300371		ALD		ALD		8441467, 6795626	8441467, 6795626	Standard	Standard	NM_000033	NM_000033		Approved	AMN, ALDP, adrenoleukodystrophy	uc004fif.2	uc004fif.2	P33897	P33897	OTTHUMG00000024215	OTTHUMG00000024215	ENST00000218104.3:c.1981delC	X.37:g.153008790delC	ENSP00000218104:p.Pro661fs		U52111.14_ENST00000434284.1_RNA	p.P661fs	NM_000033.3	NP_000024.2	P33897	ABCD1_HUMAN			9	2380	+	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)		661	ABC transporter.	Q6GTZ2	Frame_Shift_Del	DEL	ENST00000218104.3	37	c.1981delC	CCDS14728.1																																																																																									0.692	ABCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061041.1	.	.	4	4	12	12	NM_000033		2			4	0.33						2	4	0.33
RP5-1158E12.1	0	broad.mit.edu	37	X	45772800	45772800	+	lincRNA	DEL	A	A	-			TCGA-VD-A8KN-01A-11D-A39W-08	TCGA-VD-A8KN-10B-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6723c159-82da-425d-9dee-4682a5d82ba2	cd2ffb2b-44a4-4a4e-93f6-33dbd404cc2e	g.chrX:45772800delA	ENST00000420585.1	-	0	668																											GATGGTGCAGAAATATTAGGC	0.443																																						ENST00000420585.1											0																																																0						g.chrX:45772800delA																																																		X.37:g.45772800delA											0	668	-						RNA	DEL	ENST00000420585.1	37																																																																																											0.443	RP5-1158E12.1-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000056345.1	.	.	5	5	18	18			2			4	0.33						2	4	0.33
