#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_Description	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_AccessionNumbers	i_HGNC_CCDS IDs	i_HGNC_CCDSIDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_DateModified	i_HGNC_DateNameChanged	i_HGNC_DateSymbolChanged	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_EnsemblGeneID	i_HGNC_EnsemblIDsuppliedbyEnsembl	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_Genefamilydescription	i_HGNC_HGNC ID	i_HGNC_HGNCID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_LocusGroup	i_HGNC_LocusType	i_HGNC_Name Synonyms	i_HGNC_NameSynonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_OMIMIDsuppliedbyNCBI	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_PreviousNames	i_HGNC_PreviousSymbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_PubmedIDs	i_HGNC_Record Type	i_HGNC_RecordType	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_RefSeqsuppliedbyNCBI	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UCSCIDsuppliedbyUCSC	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_UniProtIDsuppliedbyUniProt	i_HGNC_VEGA IDs	i_HGNC_VEGAIDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Region	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_init_n_lod	i_init_t_lod	i_n_alt_count	i_n_alt_count_full	i_n_ref_count	i_n_ref_count_full	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_lod_fstar	i_t_lod_fstar_full	i_t_ref_count_full	i_tumor_f_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	tumor_f
FAM214A	56204	broad.mit.edu	37	15	52903343	52903343	+	Nonsense_Mutation	SNP	G	G	A			TCGA-YZ-A982-01A-11D-A39W-08	TCGA-YZ-A982-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6dd88bd4-a48e-4288-8b66-2a1c65794e06	926d3706-e1ae-4b81-aaac-c8b57a5bb970	g.chr15:52903343G>A	ENST00000261844.7	-	5	666	c.514C>T	c.(514-516)Cga>Tga	p.R172*	FAM214A_ENST00000546305.2_Nonsense_Mutation_p.R179*	NM_019600.2	NP_062546.2	Q32MH5	F214A_HUMAN	family with sequence similarity 214, member A	172																	AGAATATTTCGTGGAATAGCA	0.413																																						ENST00000261844.7											0										c.(514-516)Cga>Tga	family with sequence similarity 214, member A						120.0	117.0	118.0					15																	52903343		1868	4107	5975	SO:0001587	stop_gained	56204						g.chr15:52903343G>A	AB037791	AB037791	CCDS45263.1, CCDS66773.1	CCDS45263.1, CCDS66773.1	15q21.2-q21.3	2011-12-01	2011-12-01	2011-12-01	2011-12-01	2011-12-01	2011-12-01	ENSG00000047346	ENSG00000047346	ENSG00000047346	ENSG00000047346				25609	25609	protein-coding gene	gene with protein product	protein-coding gene	gene with protein product					"""KIAA1370"""	KIAA1370	"""KIAA1370"""	KIAA1370		10718198	10718198	Standard	Standard	XM_005254547	XM_005254547		Approved	FLJ10980	uc002acg.4	uc002acg.4	Q32MH5	Q32MH5			ENST00000261844.7:c.514C>T	15.37:g.52903343G>A	ENSP00000261844:p.Arg172*		FAM214A_ENST00000546305.2_Nonsense_Mutation_p.R179*	p.R172*	NM_019600.2	NP_062546.2	Q32MH5	K1370_HUMAN			5	666	-			172		A8KA52|B4DEP5|B4DF40|F5H8G0|Q32MH6|Q4G0R7|Q5XJ16|Q6PDA3|Q9NV24|Q9P2H7	Nonsense_Mutation	SNP	ENST00000261844.7	37	c.514C>T	CCDS45263.1	.	.	.	.	.	.	.	.	.	.	G	35	5.541354	0.96474	.	.	ENSG00000047346	ENST00000261844;ENST00000399202;ENST00000534964;ENST00000546305	.	.	.	6.17	5.25	0.73442	6.17	5.25	0.73442	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.9456	0.86229	0.0:0.0:0.8711:0.1289	.	.	.	.	X	172;172;171;179	.	ENSP00000261844:R172X	R	-	1	2	2	KIAA1370	50690635	50690635	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.702000	0.47102	1.602000	0.50124	0.655000	0.94253	CGA		0.413	FAM214A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419914.1		19.976668	12	12	91	91	NM_019600		11	28.741902	28.741902	63	0.148649	0	0	0	1	0	11	63	0.148649
PAPPA2	60676	broad.mit.edu	37	1	176563716	176563716	+	Missense_Mutation	SNP	C	C	T	rs368485332		TCGA-YZ-A982-01A-11D-A39W-08	TCGA-YZ-A982-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6dd88bd4-a48e-4288-8b66-2a1c65794e06	926d3706-e1ae-4b81-aaac-c8b57a5bb970	g.chr1:176563716C>T	ENST00000367662.3	+	3	2140	c.976C>T	c.(976-978)Cgc>Tgc	p.R326C	PAPPA2_ENST00000367661.3_Missense_Mutation_p.R326C	NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	326					bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.R326C(2)		NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						CCTGGGGATCCGCTCAGGGAA	0.537																																						ENST00000367662.3											2	Substitution - Missense(2)	lung(2)	NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						c.(976-978)Cgc>Tgc	pappalysin 2						51.0	51.0	51.0					1																	176563716		1979	4160	6139	SO:0001583	missense	60676			cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding	g.chr1:176563716C>T	BG354569	BG354569	CCDS41438.1, CCDS41439.1	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183	ENSG00000116183	ENSG00000116183				14615	14615	protein-coding gene	gene with protein product	protein-coding gene	gene with protein product					"""placenta-specific 3"""	PLAC3	"""placenta-specific 3"""	PLAC3		11018262, 11264294	11018262, 11264294	Standard	Standard	NM_021936	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	uc001gkz.3	Q9BXP8	Q9BXP8	OTTHUMG00000035025	OTTHUMG00000035025	ENST00000367662.3:c.976C>T	1.37:g.176563716C>T	ENSP00000356634:p.Arg326Cys		PAPPA2_ENST00000367661.3_Missense_Mutation_p.R326C	p.R326C	NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN			3	2140	+			326		A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Missense_Mutation	SNP	ENST00000367662.3	37	c.976C>T	CCDS41438.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.947902	0.73787	.	.	ENSG00000116183	ENST00000367662;ENST00000367661	T;T	0.74209	-0.82;-0.82	5.45	5.45	0.79879	5.45	5.45	0.79879	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.111801	0.64402	D	0.000007	D	0.83806	0.5334	M	0.68593	2.085	0.51767	D	0.999937	D;D	0.89917	0.999;1.0	P;D	0.67900	0.901;0.954	D	0.85377	0.1117	10	0.87932	D	0	-19.5477	14.6197	0.68574	0.1464:0.8536:0.0:0.0	.	326;326	Q9BXP8;A9Z1Y8	PAPP2_HUMAN;.	C	326	ENSP00000356634:R326C;ENSP00000356633:R326C	ENSP00000356633:R326C	R	+	1	0	0	PAPPA2	174830339	174830339	0.017000	0.18338	1.000000	0.80357	0.983000	0.72400	1.902000	0.39848	2.555000	0.86185	0.650000	0.86243	CGC		0.537	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084763.1		41.703860	10	10	63	63			15	43.944299	43.944299	38	0.283019	0	0	0	1	0	15	38	0.283019
ASB6	140459	broad.mit.edu	37	9	132400196	132400196	+	Missense_Mutation	SNP	C	C	T	rs371398374		TCGA-YZ-A982-01A-11D-A39W-08	TCGA-YZ-A982-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6dd88bd4-a48e-4288-8b66-2a1c65794e06	926d3706-e1ae-4b81-aaac-c8b57a5bb970	g.chr9:132400196C>T	ENST00000277458.4	-	6	1304	c.1139G>A	c.(1138-1140)cGt>cAt	p.R380H	ASB6_ENST00000450050.2_Missense_Mutation_p.R301H|ASB6_ENST00000277459.4_3'UTR|RP11-483H20.4_ENST00000455074.1_RNA	NM_017873.3	NP_060343.1	Q9NWX5	ASB6_HUMAN	ankyrin repeat and SOCS box containing 6	380	SOCS box. {ECO:0000255|PROSITE- ProRule:PRU00194}.				intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)				NS(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(4)|prostate(2)	15		Ovarian(14;0.00556)				GATGGCCACACGGCACAGGTG	0.622																																						ENST00000277458.4											0			NS(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(4)|prostate(2)	15						c.(1138-1140)cGt>cAt	ankyrin repeat and SOCS box containing 6	C	HIS/ARG,HIS/ARG,	0,4406		0,0,2203	49.0	49.0	49.0		1052,1139,	4.1	0.9	9		49	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,utr-3	ASB6	NM_001202403.1,NM_017873.3,NM_177999.2	29,29,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,	351/393,380/422,	132400196	1,13005	2203	4300	6503	SO:0001583	missense	140459			intracellular signal transduction	cytoplasm		g.chr9:132400196C>T			CCDS6924.1, CCDS6925.1, CCDS75919.1	CCDS6924.1, CCDS6925.1, CCDS75919.1	9q34.13	2013-01-10	2011-01-25		2013-01-10	2011-01-25		ENSG00000148331	ENSG00000148331	ENSG00000148331	ENSG00000148331		"""Ankyrin repeat domain containing"""	"""Ankyrin repeat domain containing"""	17181	17181	protein-coding gene	gene with protein product	protein-coding gene	gene with protein product			615051	615051	"""ankyrin repeat and SOCS box-containing 6"""		"""ankyrin repeat and SOCS box-containing 6"""					Standard	Standard	NM_017873	NM_017873		Approved		uc004byf.2	uc004byf.2	Q9NWX5	Q9NWX5	OTTHUMG00000020787	OTTHUMG00000020787	ENST00000277458.4:c.1139G>A	9.37:g.132400196C>T	ENSP00000277458:p.Arg380His		ASB6_ENST00000450050.2_Missense_Mutation_p.R301H|ASB6_ENST00000277459.4_3'UTR	p.R380H	NM_017873.3	NP_060343.1	Q9NWX5	ASB6_HUMAN			6	1304	-		Ovarian(14;0.00556)	380	SOCS box.	Q5SZB7|Q9BV15	Missense_Mutation	SNP	ENST00000277458.4	37	c.1139G>A	CCDS6924.1	.	.	.	.	.	.	.	.	.	.	C	23.2	4.392911	0.83011	0.0	1.16E-4	ENSG00000148331	ENST00000277458;ENST00000450050	D;D	0.85861	-2.04;-2.04	5.06	4.13	0.48395	5.06	4.13	0.48395	SOCS protein, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.90338	0.6977	M	0.71036	2.16	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.64687	0.928;0.928;0.928	D	0.90727	0.4639	10	0.59425	D	0.04	-34.9039	14.1624	0.65454	0.1497:0.8503:0.0:0.0	.	301;380;380	B4DRC4;A8K9U2;Q9NWX5	.;.;ASB6_HUMAN	H	380;301	ENSP00000277458:R380H;ENSP00000416172:R301H	ENSP00000277458:R380H	R	-	2	0	0	ASB6	131440017	131440017	0.999000	0.42202	0.921000	0.36526	0.826000	0.46750	4.145000	0.58065	2.635000	0.89317	0.462000	0.41574	CGT		0.622	ASB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054594.1		56.780252	23	23	64	64	NM_017873		17	56.968595	56.968595	12	0.586207	0	0	0	1	0	17	12	0.586207
SPTA1	6708	broad.mit.edu	37	1	158612731	158612731	+	Missense_Mutation	SNP	C	C	T	rs544007770		TCGA-YZ-A982-01A-11D-A39W-08	TCGA-YZ-A982-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6dd88bd4-a48e-4288-8b66-2a1c65794e06	926d3706-e1ae-4b81-aaac-c8b57a5bb970	g.chr1:158612731C>T	ENST00000368147.4	-	32	4658	c.4478G>A	c.(4477-4479)cGg>cAg	p.R1493Q		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1493					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					AAGCTTTGTCCGCTCATCAAT	0.507																																						ENST00000368147.4											0			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307						c.(4477-4479)cGg>cAg	spectrin, alpha, erythrocytic 1 (elliptocytosis 2)						128.0	117.0	121.0					1																	158612731		1990	4169	6159	SO:0001583	missense	6708			actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton	g.chr1:158612731C>T	M61877	M61877	CCDS41423.1	CCDS41423.1	1q21	2014-06-23	2014-06-23		2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554	ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	"""EF-hand domain containing"""	11272	11272	protein-coding gene	gene with protein product	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	"""elliptocytosis 2"""	182860	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""		"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""					Standard	Standard	NM_003126	NM_003126		Approved	EL2	uc001fst.1	uc001fst.1	P02549	P02549	OTTHUMG00000019636	OTTHUMG00000019636	ENST00000368147.4:c.4478G>A	1.37:g.158612731C>T	ENSP00000357129:p.Arg1493Gln			p.R1493Q	NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN			32	4658	-	all_hematologic(112;0.0378)				Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	ENST00000368147.4	37	c.4478G>A	CCDS41423.1	.	.	.	.	.	.	.	.	.	.	C	14.08	2.429834	0.43122	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.51325	0.71;0.71	5.2	-3.76	0.04359	5.2	-3.76	0.04359	.	0.695078	0.11044	N	0.605789	T	0.31544	0.0800	M	0.64997	1.995	0.09310	N	1	D	0.67145	0.996	P	0.59012	0.85	T	0.16837	-1.0389	10	0.26408	T	0.33	.	4.1679	0.10315	0.0966:0.4825:0.091:0.3299	.	1493	P02549	SPTA1_HUMAN	Q	1493	ENSP00000357130:R1493Q;ENSP00000357129:R1493Q	ENSP00000357129:R1493Q	R	-	2	0	0	SPTA1	156879355	156879355	0.015000	0.18098	0.000000	0.03702	0.009000	0.06853	0.767000	0.26575	-1.363000	0.02164	-0.797000	0.03246	CGG		0.507	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3		127.560244	3	3	87	87	NM_003126		38	127.824042	127.824042	29	0.567164	0	0	0	1	0	38	29	0.567164
PPP2R1A	5518	broad.mit.edu	37	19	52724255	52724255	+	Missense_Mutation	SNP	A	A	C			TCGA-YZ-A982-01A-11D-A39W-08	TCGA-YZ-A982-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6dd88bd4-a48e-4288-8b66-2a1c65794e06	926d3706-e1ae-4b81-aaac-c8b57a5bb970	g.chr19:52724255A>C	ENST00000322088.6	+	12	1445	c.1387A>C	c.(1387-1389)Acc>Ccc	p.T463P	CTD-2525I3.3_ENST00000593857.1_RNA|PPP2R1A_ENST00000462990.1_Missense_Mutation_p.T284P|PPP2R1A_ENST00000444322.2_Missense_Mutation_p.T408P	NM_014225.5	NP_055040.2	P30153	2AAA_HUMAN	protein phosphatase 2, regulatory subunit A, alpha	463	PP2A subunit C binding.				apoptotic process (GO:0006915)|ceramide metabolic process (GO:0006672)|chromosome segregation (GO:0007059)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|inactivation of MAPK activity (GO:0000188)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope reassembly (GO:0007084)|mRNA metabolic process (GO:0016071)|negative regulation of cell growth (GO:0030308)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine dephosphorylation (GO:0070262)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|protein complex assembly (GO:0006461)|protein dephosphorylation (GO:0006470)|regulation of cell adhesion (GO:0030155)|regulation of cell differentiation (GO:0045595)|regulation of DNA replication (GO:0006275)|regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|response to organic substance (GO:0010033)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|second-messenger-mediated signaling (GO:0019932)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)	antigen binding (GO:0003823)|protein heterodimerization activity (GO:0046982)|protein phosphatase type 2A regulator activity (GO:0008601)|protein serine/threonine phosphatase activity (GO:0004722)			NS(1)|breast(4)|cervix(2)|endometrium(62)|kidney(1)|large_intestine(7)|lung(21)|ovary(32)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	135				GBM - Glioblastoma multiforme(134;0.00456)|OV - Ovarian serous cystadenocarcinoma(262;0.015)		CGAGGCAGCCACCAGCAACCT	0.537			Mis		clear cell ovarian carcinoma																																	ENST00000322088.6		Dom?	yes		19	19q13.41	5518	"""protein phosphatase 2, regulatory subunit A, alpha"""		E	0			NS(1)|breast(4)|cervix(2)|endometrium(62)|kidney(1)|large_intestine(7)|lung(21)|ovary(32)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	135						c.(1387-1389)Acc>Ccc	protein phosphatase 2, regulatory subunit A, alpha						107.0	98.0	101.0					19																	52724255		2203	4300	6503	SO:0001583	missense	5518			ceramide metabolic process|chromosome segregation|G2/M transition of mitotic cell cycle|inactivation of MAPK activity|induction of apoptosis|negative regulation of cell growth|negative regulation of tyrosine phosphorylation of Stat3 protein|protein complex assembly|protein dephosphorylation|regulation of cell adhesion|regulation of cell differentiation|regulation of DNA replication|regulation of transcription, DNA-dependent|regulation of Wnt receptor signaling pathway|response to organic substance|RNA splicing|second-messenger-mediated signaling	chromosome, centromeric region|cytosol|membrane|microtubule cytoskeleton|mitochondrion|nucleus|protein phosphatase type 2A complex|soluble fraction	antigen binding|protein heterodimerization activity|protein phosphatase type 2A regulator activity	g.chr19:52724255A>C			CCDS12849.1	CCDS12849.1	19q13	2010-06-18	2010-04-14		2010-06-18	2010-04-14		ENSG00000105568	ENSG00000105568	ENSG00000105568	ENSG00000105568	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9302	9302	protein-coding gene	gene with protein product	protein-coding gene	gene with protein product	"""protein phosphatase 2A, regulatory subunit A, alpha isoform"", ""protein phosphatase 2, 65kDa regulatory subunit A"""	"""protein phosphatase 2A, regulatory subunit A, alpha isoform"", ""protein phosphatase 2, 65kDa regulatory subunit A"""	605983	605983	"""protein phosphatase 2 (formerly 2A), regulatory subunit A (PR 65), alpha isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit A, alpha isoform"""		"""protein phosphatase 2 (formerly 2A), regulatory subunit A (PR 65), alpha isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit A, alpha isoform"""					Standard	Standard	NR_033500	NR_033500		Approved	PR65A, PP2A-Aalpha	uc002pyp.3	uc002pyp.3	P30153	P30153	OTTHUMG00000137367	OTTHUMG00000137367	ENST00000322088.6:c.1387A>C	19.37:g.52724255A>C	ENSP00000324804:p.Thr463Pro		PPP2R1A_ENST00000444322.2_Missense_Mutation_p.T408P|PPP2R1A_ENST00000462990.1_Missense_Mutation_p.T284P	p.T463P	NM_014225.5	NP_055040.2	P30153	2AAA_HUMAN		GBM - Glioblastoma multiforme(134;0.00456)|OV - Ovarian serous cystadenocarcinoma(262;0.015)	12	1445	+			463	PP2A subunit C binding.	Q13773|Q6ICQ3|Q96DH3	Missense_Mutation	SNP	ENST00000322088.6	37	c.1387A>C	CCDS12849.1	.	.	.	.	.	.	.	.	.	.	A	21.1	4.100738	0.76983	.	.	ENSG00000105568	ENST00000423369;ENST00000391791;ENST00000322088;ENST00000444322	T;T	0.18016	2.24;2.24	4.5	4.5	0.54988	4.5	4.5	0.54988	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.64402	D	0.000012	T	0.33147	0.0853	M	0.87827	2.91	0.58432	D	0.999998	P;B	0.36065	0.535;0.067	B;B	0.43360	0.417;0.035	T	0.29181	-1.0020	10	0.87932	D	0	-41.0631	12.1013	0.53785	1.0:0.0:0.0:0.0	.	408;463	F5H3X9;P30153	.;2AAA_HUMAN	P	453;383;463;408	ENSP00000324804:T463P;ENSP00000415067:T408P	ENSP00000324804:T463P	T	+	1	0	0	PPP2R1A	57416067	57416067	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	8.373000	0.90131	2.026000	0.59711	0.533000	0.62120	ACC		0.537	PPP2R1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000267967.2		49.695932	8	8	84	84	NM_014225		16	49.792622	49.792622	20	0.444444	0	0	0	1	0	16	20	0.444444
SDE2	163859	broad.mit.edu	37	1	226179008	226179008	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A982-01A-11D-A39W-08	TCGA-YZ-A982-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6dd88bd4-a48e-4288-8b66-2a1c65794e06	926d3706-e1ae-4b81-aaac-c8b57a5bb970	g.chr1:226179008G>A	ENST00000272091.7	-	5	595	c.577C>T	c.(577-579)Cgg>Tgg	p.R193W		NM_152608.3	NP_689821.3	Q6IQ49	SDE2_HUMAN	SDE2 telomere maintenance homolog (S. pombe)	193																	GGCCATTGCCGTTTCCGATTC	0.438																																						ENST00000272091.7											0										c.(577-579)Cgg>Tgg	SDE2 telomere maintenance homolog (S. pombe)						110.0	105.0	106.0					1																	226179008		1940	4159	6099	SO:0001583	missense	163859						g.chr1:226179008G>A	BC071563	BC071563	CCDS41473.1	CCDS41473.1	1q42.12	2012-06-26	2012-06-26	2012-06-26	2012-06-26	2012-06-26	2012-06-26	ENSG00000143751	ENSG00000143751	ENSG00000143751	ENSG00000143751				26643	26643	protein-coding gene	gene with protein product	protein-coding gene	gene with protein product					"""chromosome 1 open reading frame 55"""	C1orf55	"""chromosome 1 open reading frame 55"""	C1orf55		21333630	21333630	Standard	Standard	NM_152608	NM_152608		Approved	FLJ35382	uc001hpu.4	uc001hpu.4	Q6IQ49	Q6IQ49	OTTHUMG00000037504	OTTHUMG00000037504	ENST00000272091.7:c.577C>T	1.37:g.226179008G>A	ENSP00000272091:p.Arg193Trp			p.R193W	NM_152608.3	NP_689821.3					5	595	-					A8K4P3|Q5TD36|Q6ZS26|Q8NAG7	Missense_Mutation	SNP	ENST00000272091.7	37	c.577C>T	CCDS41473.1	.	.	.	.	.	.	.	.	.	.	G	16.12	3.031833	0.54790	.	.	ENSG00000143751	ENST00000272091;ENST00000366818;ENST00000366817	T;T	0.59364	0.57;0.27	5.85	3.95	0.45737	5.85	3.95	0.45737	.	0.104425	0.64402	D	0.000005	T	0.73860	0.3641	M	0.68593	2.085	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.76804	-0.2824	10	0.87932	D	0	-23.9175	15.3002	0.73945	0.0:0.0:0.7441:0.2559	.	181;193	Q6IQ49-2;Q6IQ49	.;CA055_HUMAN	W	193;181;98	ENSP00000272091:R193W;ENSP00000355782:R98W	ENSP00000272091:R193W	R	-	1	2	2	C1orf55	224245631	224245631	1.000000	0.71417	0.985000	0.45067	0.113000	0.19764	2.713000	0.47194	0.785000	0.33685	0.557000	0.71058	CGG		0.438	SDE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091310.1		-10.235343	8	8	75	75	NM_152608		3	6.30067	6.300670	70	0.041096	0	0	0	1	0	3	70	0.041096
IGSF10	285313	broad.mit.edu	37	3	151165887	151165887	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A982-01A-11D-A39W-08	TCGA-YZ-A982-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6dd88bd4-a48e-4288-8b66-2a1c65794e06	926d3706-e1ae-4b81-aaac-c8b57a5bb970	g.chr3:151165887C>T	ENST00000282466.3	-	4	1881	c.1882G>A	c.(1882-1884)Ggc>Agc	p.G628S		NM_001178145.1|NM_001178146.1|NM_178822.4	NP_001171616.1|NP_001171617.1|NP_849144.2	Q6WRI0	IGS10_HUMAN	immunoglobulin superfamily, member 10	628	Ig-like C2-type 2.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)	extracellular region (GO:0005576)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(24)|liver(4)|lung(43)|ovary(8)|prostate(4)|skin(9)|stomach(1)|urinary_tract(3)	116			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			CTTAATGTGCCATTGTTTAGA	0.418																																						ENST00000282466.3											0			NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(24)|liver(4)|lung(43)|ovary(8)|prostate(4)|skin(9)|stomach(1)|urinary_tract(3)	116						c.(1882-1884)Ggc>Agc	immunoglobulin superfamily, member 10						178.0	157.0	164.0					3																	151165887		2203	4300	6503	SO:0001583	missense	285313			cell differentiation|multicellular organismal development|ossification	extracellular region		g.chr3:151165887C>T	AY273815	AY273815	CCDS3160.1	CCDS3160.1	3q25.1	2013-01-11			2013-01-11			ENSG00000152580	ENSG00000152580	ENSG00000152580	ENSG00000152580		"""Immunoglobulin superfamily / I-set domain containing"""	"""Immunoglobulin superfamily / I-set domain containing"""	26384	26384	protein-coding gene	gene with protein product	protein-coding gene	gene with protein product										12477932	12477932	Standard	Standard	NM_178822	NM_178822		Approved	FLJ25972, CMF608	uc011bod.2	uc011bod.2	Q6WRI0	Q6WRI0	OTTHUMG00000159856	OTTHUMG00000159856	ENST00000282466.3:c.1882G>A	3.37:g.151165887C>T	ENSP00000282466:p.Gly628Ser			p.G628S	NM_001178145.1|NM_001178146.1|NM_178822.4	NP_001171616.1|NP_001171617.1|NP_849144.2	Q6WRI0	IGS10_HUMAN	LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)		4	1881	-			628	Ig-like C2-type 2.	Q86YJ9|Q8N772|Q8NA84	Missense_Mutation	SNP	ENST00000282466.3	37	c.1882G>A	CCDS3160.1	.	.	.	.	.	.	.	.	.	.	C	17.01	3.279642	0.59758	.	.	ENSG00000152580	ENST00000282466	T	0.35605	1.3	5.35	4.47	0.54385	5.35	4.47	0.54385	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.284299	0.24806	N	0.035443	T	0.61375	0.2342	M	0.85041	2.73	0.46167	D	0.998908	D	0.69078	0.997	D	0.64506	0.926	T	0.66889	-0.5809	10	0.52906	T	0.07	.	13.9244	0.63952	0.0:0.9264:0.0:0.0736	.	628	Q6WRI0	IGS10_HUMAN	S	628	ENSP00000282466:G628S	ENSP00000282466:G628S	G	-	1	0	0	IGSF10	152648577	152648577	1.000000	0.71417	0.102000	0.21198	0.371000	0.29859	4.646000	0.61411	1.248000	0.43934	0.655000	0.94253	GGC		0.418	IGSF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357782.1		42.608711	8	8	116	116	NM_178822		18	47.605276	47.605276	59	0.233766	0	0	0	1	0	18	59	0.233766
PPM1L	151742	broad.mit.edu	37	3	160786656	160786656	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A982-01A-11D-A39W-08	TCGA-YZ-A982-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6dd88bd4-a48e-4288-8b66-2a1c65794e06	926d3706-e1ae-4b81-aaac-c8b57a5bb970	g.chr3:160786656G>A	ENST00000498165.1	+	4	895	c.794G>A	c.(793-795)cGg>cAg	p.R265Q	PPM1L_ENST00000480117.1_3'UTR|PPM1L_ENST00000295839.9_Missense_Mutation_p.R138Q|PPM1L_ENST00000464260.1_Missense_Mutation_p.R86Q	NM_139245.2	NP_640338.2	Q5SGD2	PPM1L_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1L	265	PP2C-like.				MAPK cascade (GO:0000165)|protein dephosphorylation (GO:0006470)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)			breast(1)|endometrium(1)|large_intestine(4)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	13			Lung(72;0.00149)|LUSC - Lung squamous cell carcinoma(72;0.00216)			GCCATGTCTCGGTCCCTGGGG	0.512																																					Pancreas(86;250 1994 13715 43211)	ENST00000498165.1											0			breast(1)|endometrium(1)|large_intestine(4)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	13						c.(793-795)cGg>cAg	protein phosphatase, Mg2+/Mn2+ dependent, 1L						82.0	80.0	81.0					3																	160786656		2203	4300	6503	SO:0001583	missense	151742			protein dephosphorylation|sphingolipid metabolic process	endoplasmic reticulum membrane|integral to membrane|protein serine/threonine phosphatase complex	metal ion binding|protein serine/threonine phosphatase activity	g.chr3:160786656G>A	AK055115	AK055115	CCDS33886.1	CCDS33886.1	3q26.1	2012-04-17	2010-03-05		2012-04-17	2010-03-05		ENSG00000163590	ENSG00000163590	ENSG00000163590	ENSG00000163590	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	16381	16381	protein-coding gene	gene with protein product	protein-coding gene	gene with protein product	"""PP2Cepsilon"", ""Protein phosphatase 2C epsilon isoform"""	"""PP2Cepsilon"", ""Protein phosphatase 2C epsilon isoform"""	611931	611931	"""protein phosphatase 1 (formerly 2C)-like"""		"""protein phosphatase 1 (formerly 2C)-like"""			12556533	12556533	Standard	Standard	XM_006713507	XM_006713507		Approved	PP2CE	uc003fdr.3	uc003fdr.3	Q5SGD2	Q5SGD2	OTTHUMG00000159048	OTTHUMG00000159048	ENST00000498165.1:c.794G>A	3.37:g.160786656G>A	ENSP00000417659:p.Arg265Gln		PPM1L_ENST00000295839.9_Missense_Mutation_p.R138Q|PPM1L_ENST00000464260.1_Missense_Mutation_p.R86Q|PPM1L_ENST00000480117.1_3'UTR	p.R265Q	NM_139245.2	NP_640338.2	Q5SGD2	PPM1L_HUMAN	Lung(72;0.00149)|LUSC - Lung squamous cell carcinoma(72;0.00216)		4	895	+			265	PP2C-like.	Q2M3J2|Q96NM7	Missense_Mutation	SNP	ENST00000498165.1	37	c.794G>A	CCDS33886.1	.	.	.	.	.	.	.	.	.	.	G	34	5.396248	0.96009	.	.	ENSG00000163590	ENST00000498165;ENST00000464260;ENST00000295839	T;T;T	0.59638	0.25;0.25;0.25	5.27	5.27	0.74061	5.27	5.27	0.74061	Protein phosphatase 2C-like (5);	0.000000	0.85682	D	0.000000	D	0.86768	0.6012	H	0.99211	4.47	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.92512	0.6017	10	0.87932	D	0	.	17.8556	0.88761	0.0:0.0:1.0:0.0	.	138;265	Q5SGD2-3;Q5SGD2	.;PPM1L_HUMAN	Q	265;86;138	ENSP00000417659:R265Q;ENSP00000420746:R86Q;ENSP00000295839:R138Q	ENSP00000295839:R138Q	R	+	2	0	0	PPM1L	162269350	162269350	1.000000	0.71417	0.992000	0.48379	0.978000	0.69477	9.447000	0.97595	2.476000	0.83614	0.555000	0.69702	CGG		0.512	PPM1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353019.1		-3.048509	5	5	50	50	NM_139245		4	9.441278	9.441278	59	0.063492	0	0	0	1	0	4	59	0.063492
NFX1	4799	broad.mit.edu	37	9	33301353	33301353	+	Missense_Mutation	SNP	A	A	T			TCGA-YZ-A982-01A-11D-A39W-08	TCGA-YZ-A982-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6dd88bd4-a48e-4288-8b66-2a1c65794e06	926d3706-e1ae-4b81-aaac-c8b57a5bb970	g.chr9:33301353A>T	ENST00000379540.3	+	3	1188	c.1126A>T	c.(1126-1128)Agc>Tgc	p.S376C	NFX1_ENST00000379521.4_Missense_Mutation_p.S376C|NFX1_ENST00000318524.6_Missense_Mutation_p.S376C	NM_002504.4	NP_002495.2	Q12986	NFX1_HUMAN	nuclear transcription factor, X-box binding 1	376					inflammatory response (GO:0006954)|negative regulation of MHC class II biosynthetic process (GO:0045347)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(4)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	25			LUSC - Lung squamous cell carcinoma(29;0.00506)	GBM - Glioblastoma multiforme(74;0.224)		GAGTTGTCAGAGCTGTTACCA	0.418																																						ENST00000379540.3											0			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(4)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	25						c.(1126-1128)Agc>Tgc	nuclear transcription factor, X-box binding 1						217.0	205.0	209.0					9																	33301353		2203	4300	6503	SO:0001583	missense	0			inflammatory response|interspecies interaction between organisms|negative regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	DNA binding|ligase activity|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr9:33301353A>T	U19759	U19759	CCDS6538.1, CCDS6539.1, CCDS6540.1	CCDS6538.1, CCDS6539.1, CCDS6540.1	9p12	2013-12-13			2013-12-13			ENSG00000086102	ENSG00000086102	ENSG00000086102	ENSG00000086102				7803	7803	protein-coding gene	gene with protein product	protein-coding gene	gene with protein product			603255	603255						7964459, 2511169	7964459, 2511169	Standard	Standard	NM_002504	NM_002504		Approved	NFX2, MGC20369, Tex42, TEG-42	uc003zsq.3	uc003zsq.3	Q12986	Q12986	OTTHUMG00000019772	OTTHUMG00000019772	ENST00000379540.3:c.1126A>T	9.37:g.33301353A>T	ENSP00000368856:p.Ser376Cys		NFX1_ENST00000318524.6_Missense_Mutation_p.S376C|NFX1_ENST00000379521.4_Missense_Mutation_p.S376C	p.S376C	NM_002504.4	NP_002495.2	Q12986	NFX1_HUMAN	LUSC - Lung squamous cell carcinoma(29;0.00506)	GBM - Glioblastoma multiforme(74;0.224)	3	1188	+			376		A8K6H8|Q5VXW6|Q96EL5|Q9BXI1	Missense_Mutation	SNP	ENST00000379540.3	37	c.1126A>T	CCDS6538.1	.	.	.	.	.	.	.	.	.	.	A	22.1	4.242547	0.79912	.	.	ENSG00000086102	ENST00000379540;ENST00000379521;ENST00000536210;ENST00000318524	T;T;T	0.43688	0.94;0.94;0.94	5.76	4.63	0.57726	5.76	4.63	0.57726	Zinc finger, PHD-finger (1);Zinc finger, PHD-type, conserved site (1);Zinc finger, RING-type (2);	0.117858	0.85682	D	0.000000	T	0.57169	0.2035	L	0.60957	1.885	0.51012	D	0.999908	D;D;B;D;P	0.89917	1.0;0.999;0.295;1.0;0.461	D;P;B;D;B	0.72075	0.976;0.907;0.067;0.936;0.236	T	0.58042	-0.7706	10	0.66056	D	0.02	-5.4191	9.7406	0.40416	0.9185:0.0:0.0815:0.0	.	376;260;376;376;376	F5GXD0;A0JLR2;Q12986;Q12986-2;Q12986-3	.;.;NFX1_HUMAN;.;.	C	376	ENSP00000368856:S376C;ENSP00000368836:S376C;ENSP00000317695:S376C	ENSP00000317695:S376C	S	+	1	0	0	NFX1	33291353	33291353	1.000000	0.71417	1.000000	0.80357	0.888000	0.51559	6.290000	0.72712	1.015000	0.39444	0.450000	0.29827	AGC		0.418	NFX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052069.1		73.750870	5	5	125	125			28	79.419393	79.419393	80	0.259259	0	0	0	1	0	28	80	0.259259
TP53INP1	94241	broad.mit.edu	37	8	95952120	95952120	+	Silent	SNP	C	C	T			TCGA-YZ-A982-01A-11D-A39W-08	TCGA-YZ-A982-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6dd88bd4-a48e-4288-8b66-2a1c65794e06	926d3706-e1ae-4b81-aaac-c8b57a5bb970	g.chr8:95952120C>T	ENST00000342697.4	-	3	848	c.441G>A	c.(439-441)ggG>ggA	p.G147G	TP53INP1_ENST00000448464.2_Silent_p.G147G|TP53INP1_ENST00000378776.4_Silent_p.G147G|NDUFAF6_ENST00000396113.1_Intron	NM_033285.3	NP_150601.1	Q96A56	T53I1_HUMAN	tumor protein p53 inducible nuclear protein 1	147					apoptotic process (GO:0006915)|autophagic cell death (GO:0048102)|autophagy (GO:0006914)|cell cycle arrest (GO:0007050)|cellular response to ethanol (GO:0071361)|cellular response to hydroperoxide (GO:0071447)|cellular response to methyl methanesulfonate (GO:0072703)|cellular response to UV (GO:0034644)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of autophagy (GO:0010508)|positive regulation of transcription, DNA-templated (GO:0045893)|response to heat (GO:0009408)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|nucleus (GO:0005634)	antioxidant activity (GO:0016209)			kidney(2)|large_intestine(3)|lung(2)|prostate(1)|skin(1)	9	Breast(36;8.75e-07)					ATTCATCAGTCCCACGGGTGG	0.463																																						ENST00000342697.4											0			kidney(2)|large_intestine(3)|lung(2)|prostate(1)|skin(1)	9						c.(439-441)ggG>ggA	tumor protein p53 inducible nuclear protein 1						122.0	107.0	112.0					8																	95952120		2203	4300	6503	SO:0001819	synonymous_variant	0			apoptosis	PML body		g.chr8:95952120C>T	AF409115	AF409115	CCDS6265.1, CCDS47899.1	CCDS6265.1, CCDS47899.1	8q22	2004-03-11			2004-03-11				ENSG00000164938		ENSG00000164938				18022	18022	protein-coding gene	gene with protein product	protein-coding gene	gene with protein product			606185	606185						11511362, 12438758	11511362, 12438758	Standard	Standard	NM_033285	NM_033285		Approved	DKFZp434M1317, FLJ22139, P53DINP1, SIP, TP53INP1A, TP53INP1B, Teap	uc003yhg.3	uc003yhg.3	Q96A56	Q96A56			ENST00000342697.4:c.441G>A	8.37:g.95952120C>T			NDUFAF6_ENST00000396113.1_Intron|TP53INP1_ENST00000448464.2_Silent_p.G147G|TP53INP1_ENST00000378776.4_Silent_p.G147G	p.G147G	NM_033285.3	NP_150601.1	Q96A56	T53I1_HUMAN			3	848	-	Breast(36;8.75e-07)		147		B2RCE5|Q969R9	Silent	SNP	ENST00000342697.4	37	c.441G>A	CCDS6265.1																																																																																									0.463	TP53INP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379818.1		37.856316	27	27	72	72			16	43.947089	43.947089	61	0.207792	0	0	0	1	0	16	61	0.207792
MUC17	140453	broad.mit.edu	37	7	100679352	100679352	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A982-01A-11D-A39W-08	TCGA-YZ-A982-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6dd88bd4-a48e-4288-8b66-2a1c65794e06	926d3706-e1ae-4b81-aaac-c8b57a5bb970	g.chr7:100679352G>A	ENST00000306151.4	+	3	4719	c.4655G>A	c.(4654-4656)aGt>aAt	p.S1552N		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	1552	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					TCTCAAGCCAGTTCATCTCCT	0.488																																						ENST00000306151.4											0			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343						c.(4654-4656)aGt>aAt	mucin 17, cell surface associated						264.0	243.0	250.0					7																	100679352		2203	4300	6503	SO:0001583	missense	140453				extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity	g.chr7:100679352G>A	AJ606307	AJ606307	CCDS34711.1	CCDS34711.1	7q22	2007-01-17	2006-03-14		2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876	ENSG00000169876	ENSG00000169876		"""Mucins"""	"""Mucins"""	16800	16800	protein-coding gene	gene with protein product	protein-coding gene	gene with protein product			608424	608424						11855812	11855812	Standard	Standard	NM_001040105	NM_001040105		Approved		uc003uxp.1	uc003uxp.1	Q685J3	Q685J3	OTTHUMG00000157030	OTTHUMG00000157030	ENST00000306151.4:c.4655G>A	7.37:g.100679352G>A	ENSP00000302716:p.Ser1552Asn			p.S1552N	NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN			3	4719	+	Lung NSC(181;0.136)|all_lung(186;0.182)		1552	59 X approximate tandem repeats.|Ser-rich.	O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	37	c.4655G>A	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	G	1.785	-0.481048	0.04383	.	.	ENSG00000169876	ENST00000306151	T	0.01998	4.51	0.922	-0.204	0.13200	0.922	-0.204	0.13200	.	.	.	.	.	T	0.01189	0.0039	L	0.27053	0.805	0.09310	N	1	P	0.47604	0.898	B	0.28638	0.092	T	0.51647	-0.8679	9	0.24483	T	0.36	.	4.9771	0.14146	0.0:0.4345:0.5654:0.0	.	1552	Q685J3	MUC17_HUMAN	N	1552	ENSP00000302716:S1552N	ENSP00000302716:S1552N	S	+	2	0	0	MUC17	100466072	100466072	0.000000	0.05858	0.002000	0.10522	0.020000	0.10135	-1.672000	0.01952	-0.040000	0.13580	0.121000	0.15741	AGT		0.488	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1		3.020481	78	78	357	357	NM_001040105		11	25.526268	25.526268	118	0.085271	0	0	0	1	0	11	118	0.085271
MUC16	94025	broad.mit.edu	37	19	9083332	9083332	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A982-01A-11D-A39W-08	TCGA-YZ-A982-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6dd88bd4-a48e-4288-8b66-2a1c65794e06	926d3706-e1ae-4b81-aaac-c8b57a5bb970	g.chr19:9083332G>A	ENST00000397910.4	-	1	8686	c.8483C>T	c.(8482-8484)gCc>gTc	p.A2828V		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	2828	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TTCAGACATGGCTGTAACCTC	0.502																																						ENST00000397910.4											0			NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						c.(8482-8484)gCc>gTc	mucin 16, cell surface associated						114.0	109.0	111.0					19																	9083332		2023	4180	6203	SO:0001583	missense	94025			cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9083332G>A	AF414442	AF414442	CCDS54212.1	CCDS54212.1	19p13.2	2008-02-05	2006-03-14		2008-02-05	2006-03-14			ENSG00000181143		ENSG00000181143		"""Mucins"""	"""Mucins"""	15582	15582	protein-coding gene	gene with protein product	protein-coding gene	gene with protein product			606154	606154						11369781	11369781	Standard	Standard	XM_006722941	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	uc002mkp.3	Q8WXI7	Q8WXI7			ENST00000397910.4:c.8483C>T	19.37:g.9083332G>A	ENSP00000381008:p.Ala2828Val			p.A2828V	NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN			1	8686	-			2828	Ser-rich.|Thr-rich.	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	c.8483C>T	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	10.70	1.425415	0.25639	.	.	ENSG00000181143	ENST00000397910	T	0.02709	4.19	0.869	0.869	0.19096	0.869	0.869	0.19096	.	.	.	.	.	T	0.03434	0.0099	N	0.08118	0	.	.	.	D	0.60575	0.988	P	0.59948	0.866	T	0.44314	-0.9336	8	0.87932	D	0	.	5.0445	0.14477	0.0:0.0:1.0:0.0	.	2828	B5ME49	.	V	2828	ENSP00000381008:A2828V	ENSP00000381008:A2828V	A	-	2	0	0	MUC16	8944332	8944332	0.001000	0.12720	0.071000	0.20095	0.869000	0.49853	0.168000	0.16622	0.740000	0.32651	0.313000	0.20887	GCC		0.502	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1		17.343858	16	16	39	39	NM_024690		6	17.78674	17.786740	12	0.333333	0	0	0	1	0	6	12	0.333333
EPHA2	1969	broad.mit.edu	37	1	16458656	16458656	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A982-01A-11D-A39W-08	TCGA-YZ-A982-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6dd88bd4-a48e-4288-8b66-2a1c65794e06	926d3706-e1ae-4b81-aaac-c8b57a5bb970	g.chr1:16458656C>T	ENST00000358432.5	-	13	2382	c.2228G>A	c.(2227-2229)cGc>cAc	p.R743H		NM_004431.3	NP_004422.2	P29317	EPHA2_HUMAN	EPH receptor A2	743	Mediates interaction with ARHGEF16 and ELMO2.|Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of Rac GTPase activity (GO:0032863)|angiogenesis (GO:0001525)|axial mesoderm formation (GO:0048320)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell migration (GO:0016477)|ephrin receptor signaling pathway (GO:0048013)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|keratinocyte differentiation (GO:0030216)|lens fiber cell morphogenesis (GO:0070309)|mammary gland epithelial cell proliferation (GO:0033598)|multicellular organismal development (GO:0007275)|negative regulation of protein kinase B signaling (GO:0051898)|neural tube development (GO:0021915)|neuron differentiation (GO:0030182)|notochord cell development (GO:0060035)|notochord formation (GO:0014028)|osteoblast differentiation (GO:0001649)|osteoclast differentiation (GO:0030316)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|post-anal tail morphogenesis (GO:0036342)|protein kinase B signaling (GO:0043491)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of lamellipodium assembly (GO:0010591)|response to growth factor (GO:0070848)|skeletal system development (GO:0001501)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cell projection (GO:0042995)|cell surface (GO:0009986)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|leading edge membrane (GO:0031256)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|pancreas(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	42		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|Colorectal(212;3.63e-07)|COAD - Colon adenocarcinoma(227;2.25e-05)|BRCA - Breast invasive adenocarcinoma(304;9.58e-05)|Kidney(64;0.000175)|KIRC - Kidney renal clear cell carcinoma(64;0.00261)|STAD - Stomach adenocarcinoma(313;0.00669)|READ - Rectum adenocarcinoma(331;0.0649)	Dasatinib(DB01254)|Regorafenib(DB08896)	GAGGATGTTGCGGGCAGCCAG	0.612																																						ENST00000358432.5											0			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|pancreas(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	42						c.(2227-2229)cGc>cAc	EPH receptor A2						177.0	152.0	161.0					1																	16458656		2203	4300	6503	SO:0001583	missense	1969			activation of Rac GTPase activity|angiogenesis|apoptosis|cell chemotaxis|negative regulation of protein kinase B signaling cascade|positive regulation of establishment of protein localization in plasma membrane|protein kinase B signaling cascade|regulation of blood vessel endothelial cell migration|regulation of cell adhesion mediated by integrin|regulation of lamellipodium assembly|response to growth factor stimulus	focal adhesion|integral to plasma membrane|lamellipodium membrane|ruffle membrane	ATP binding|ephrin receptor activity|protein binding	g.chr1:16458656C>T	BC037166	BC037166	CCDS169.1	CCDS169.1	1p36	2013-02-11	2004-10-28		2013-02-11	2004-10-28		ENSG00000142627	ENSG00000142627	ENSG00000142627	ENSG00000142627	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3386	3386	protein-coding gene	gene with protein product	protein-coding gene	gene with protein product			176946	176946	"""EphA2"""	ECK	"""EphA2"""	ECK		9119409	9119409	Standard	Standard	NM_004431	NM_004431		Approved		uc001aya.2	uc001aya.2	P29317	P29317	OTTHUMG00000009527	OTTHUMG00000009527	ENST00000358432.5:c.2228G>A	1.37:g.16458656C>T	ENSP00000351209:p.Arg743His			p.R743H	NM_004431.3	NP_004422.2	P29317	EPHA2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|Colorectal(212;3.63e-07)|COAD - Colon adenocarcinoma(227;2.25e-05)|BRCA - Breast invasive adenocarcinoma(304;9.58e-05)|Kidney(64;0.000175)|KIRC - Kidney renal clear cell carcinoma(64;0.00261)|STAD - Stomach adenocarcinoma(313;0.00669)|READ - Rectum adenocarcinoma(331;0.0649)	13	2382	-		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)	743	Mediates interaction with ARHGEF16 and ELMO2.|Protein kinase.	B5A968|Q8N3Z2	Missense_Mutation	SNP	ENST00000358432.5	37	c.2228G>A	CCDS169.1	.	.	.	.	.	.	.	.	.	.	C	35	5.577998	0.96565	.	.	ENSG00000142627	ENST00000358432	D	0.87729	-2.29	6.07	6.07	0.98685	6.07	6.07	0.98685	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000015	D	0.95277	0.8468	M	0.92122	3.275	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.95654	0.8709	10	0.87932	D	0	.	18.1378	0.89627	0.0:1.0:0.0:0.0	.	743	P29317	EPHA2_HUMAN	H	743	ENSP00000351209:R743H	ENSP00000351209:R743H	R	-	2	0	0	EPHA2	16331243	16331243	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.818000	0.86416	2.884000	0.98904	0.655000	0.94253	CGC		0.612	EPHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026322.1		-5.120437	43	43	191	191	NM_004431		3	6.378385	6.378385	52	0.054545	0	0	0	1	0	3	52	0.054545
MRPS24	64951	hgsc.bcm.edu	37	7	43906327	43906327	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A982-01A-11D-A39W-08	TCGA-YZ-A982-10A-01D-A39Z-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6dd88bd4-a48e-4288-8b66-2a1c65794e06	926d3706-e1ae-4b81-aaac-c8b57a5bb970	g.chr7:43906327G>A	ENST00000317534.5	-	4	536	c.475C>T	c.(475-477)Ccc>Tcc	p.P159S	MRPS24_ENST00000467084.1_5'Flank|URGCP-MRPS24_ENST00000603700.1_3'UTR	NM_032014.2	NP_114403.1	Q96EL2	RT24_HUMAN	mitochondrial ribosomal protein S24	159					translation (GO:0006412)	mitochondrial large ribosomal subunit (GO:0005762)|mitochondrial small ribosomal subunit (GO:0005763)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	5						ACCTTTGAGGGCACAGTTTGG	0.468																																																	0																	80.0	82.0	81.0					7																	43906327		2203	4300	6503	SO:0001583	missense	64951							AB061207	AB061207	CCDS5473.1	CCDS5473.1	7p14	2012-09-13			2012-09-13			ENSG00000062582	ENSG00000062582	ENSG00000062582	ENSG00000062582		"""Mitochondrial ribosomal proteins / small subunits"""	"""Mitochondrial ribosomal proteins / small subunits"""	14510	14510	protein-coding gene	gene with protein product	protein-coding gene	gene with protein product			611986	611986						8127713, 11279123	8127713, 11279123	Standard	Standard	NM_032014	NM_032014		Approved	MRP-S24, HSPC335	uc003tit.1	uc003tit.1	Q96EL2	Q96EL2	OTTHUMG00000023175	OTTHUMG00000023175	ENST00000317534.5:c.475C>T	7.37:g.43906327G>A	ENSP00000318158:p.Pro159Ser																	A4D1U9|P82668|Q96Q23|Q9P047	Missense_Mutation	SNP	ENST00000317534.5	37		CCDS5473.1	.	.	.	.	.	.	.	.	.	.	G	16.77	3.216026	0.58452	.	.	ENSG00000062582	ENST00000317534	T	0.40225	1.04	5.07	5.07	0.68467	5.07	5.07	0.68467	.	0.312621	0.36374	N	0.002622	T	0.54983	0.1892	M	0.64997	1.995	0.35726	D	0.817525	D	0.59767	0.986	P	0.60886	0.88	T	0.62267	-0.6890	10	0.33141	T	0.24	.	11.799	0.52116	0.0:0.1774:0.8226:0.0	.	159	Q96EL2	RT24_HUMAN	S	159	ENSP00000318158:P159S	ENSP00000318158:P159S	P	-	1	0	0	MRPS24	43872852	43872852	1.000000	0.71417	1.000000	0.80357	0.733000	0.41908	3.611000	0.54132	2.359000	0.80004	0.643000	0.83706	CCC		0.468	MRPS24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250949.1			15	15	86	86	NM_032014		5			91							5	91	
C6orf211	79624	broad.mit.edu	37	6	151790148	151790148	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A982-01A-11D-A39W-08	TCGA-YZ-A982-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6dd88bd4-a48e-4288-8b66-2a1c65794e06	926d3706-e1ae-4b81-aaac-c8b57a5bb970	g.chr6:151790148G>A	ENST00000367294.3	+	5	1488	c.1229G>A	c.(1228-1230)gGt>gAt	p.G410D	C6orf211_ENST00000545879.1_Missense_Mutation_p.G291D	NM_024573.1	NP_078849.1	Q9H993	CF211_HUMAN	chromosome 6 open reading frame 211	410										breast(1)|cervix(1)|endometrium(1)|large_intestine(5)|lung(7)	15			BRCA - Breast invasive adenocarcinoma(37;0.183)	OV - Ovarian serous cystadenocarcinoma(155;5.27e-11)		ATTCAGGTTGGTCTGCAGCCT	0.478																																						ENST00000367294.3											0			breast(1)|cervix(1)|endometrium(1)|large_intestine(5)|lung(7)	15						c.(1228-1230)gGt>gAt	chromosome 6 open reading frame 211						36.0	40.0	39.0					6																	151790148		2155	4277	6432	SO:0001583	missense	79624					protein binding	g.chr6:151790148G>A	AJ420548	AJ420548	CCDS5233.1, CCDS69224.1	CCDS5233.1, CCDS69224.1	6q25.1	2013-01-07			2013-01-07			ENSG00000146476	ENSG00000146476	ENSG00000146476	ENSG00000146476				17872	17872	protein-coding gene	gene with protein product	protein-coding gene	gene with protein product												Standard	Standard	NM_001286562	NM_001286562		Approved	FLJ12910	uc003qok.1	uc003qok.1	Q9H993	Q9H993	OTTHUMG00000015838	OTTHUMG00000015838	ENST00000367294.3:c.1229G>A	6.37:g.151790148G>A	ENSP00000356263:p.Gly410Asp		C6orf211_ENST00000545879.1_Missense_Mutation_p.G291D	p.G410D	NM_024573.1	NP_078849.1	Q9H993	CF211_HUMAN	BRCA - Breast invasive adenocarcinoma(37;0.183)	OV - Ovarian serous cystadenocarcinoma(155;5.27e-11)	5	1488	+			410		Q96FC6|Q9UFY5	Missense_Mutation	SNP	ENST00000367294.3	37	c.1229G>A	CCDS5233.1	.	.	.	.	.	.	.	.	.	.	G	32	5.118330	0.94385	.	.	ENSG00000146476	ENST00000367294;ENST00000545879	T;T	0.07021	3.23;3.23	6.16	6.16	0.99307	6.16	6.16	0.99307	Domain of unknown function DUF89 (2);	0.000000	0.85682	D	0.000000	T	0.38134	0.1029	H	0.94345	3.525	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.50398	-0.8833	10	0.72032	D	0.01	.	20.8598	0.99761	0.0:0.0:1.0:0.0	.	410	Q9H993	CF211_HUMAN	D	410;291	ENSP00000356263:G410D;ENSP00000444121:G291D	ENSP00000356263:G410D	G	+	2	0	0	C6orf211	151831841	151831841	1.000000	0.71417	0.946000	0.38457	0.940000	0.58332	9.526000	0.98042	2.937000	0.99478	0.650000	0.86243	GGT		0.478	C6orf211-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042724.1		56.110152	6	6	65	65	NM_024573		19	57.04484	57.044840	34	0.358491	0	0	0	1	0	19	34	0.358491
SCN9A	6335	broad.mit.edu	37	2	167056074	167056074	+	Missense_Mutation	SNP	A	A	G			TCGA-YZ-A982-01A-11D-A39W-08	TCGA-YZ-A982-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6dd88bd4-a48e-4288-8b66-2a1c65794e06	926d3706-e1ae-4b81-aaac-c8b57a5bb970	g.chr2:167056074A>G	ENST00000409435.1	-	26	5074	c.5075T>C	c.(5074-5076)tTc>tCc	p.F1692S	SCN9A_ENST00000409672.1_Missense_Mutation_p.F1681S|SCN9A_ENST00000375387.4_Missense_Mutation_p.F1693S|AC010127.3_ENST00000447809.2_RNA|SCN9A_ENST00000303354.6_Missense_Mutation_p.F1693S			Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha subunit	1692					behavioral response to pain (GO:0048266)|inflammatory response (GO:0006954)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|post-embryonic development (GO:0009791)|response to toxic substance (GO:0009636)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	sodium ion binding (GO:0031402)|voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(5)|central_nervous_system(6)|endometrium(6)|kidney(3)|large_intestine(27)|lung(38)|ovary(6)|prostate(8)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	108					Lacosamide(DB06218)|Lidocaine(DB00281)|Ranolazine(DB00243)|Rufinamide(DB06201)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TGTAATTTGGAACAGGCAAAT	0.413																																						ENST00000303354.6											0			NS(1)|breast(5)|central_nervous_system(6)|endometrium(6)|kidney(3)|large_intestine(27)|lung(38)|ovary(6)|prostate(8)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	108						c.(5077-5079)tTc>tCc	sodium channel, voltage-gated, type IX, alpha subunit						178.0	189.0	185.0					2																	167056074		2203	4300	6503	SO:0001583	missense	6335				voltage-gated sodium channel complex	voltage-gated sodium channel activity	g.chr2:167056074A>G	X82835	X82835	CCDS46441.1	CCDS46441.1	2q24	2014-09-17	2007-01-23		2014-09-17	2007-01-23		ENSG00000169432	ENSG00000169432	ENSG00000169432	ENSG00000169432		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10597	10597	protein-coding gene	gene with protein product	protein-coding gene	gene with protein product			603415	603415	"""sodium channel, voltage-gated, type IX, alpha polypeptide"""		"""sodium channel, voltage-gated, type IX, alpha polypeptide"""			7720699, 10198179, 16382098	7720699, 10198179, 16382098	Standard	Standard	NM_002977	NM_002977		Approved	Nav1.7, PN1, NE-NA, NENA, ETHA	uc010fpl.3	uc010fpl.3	Q15858	Q15858	OTTHUMG00000154044	OTTHUMG00000154044	ENST00000409435.1:c.5075T>C	2.37:g.167056074A>G	ENSP00000386330:p.Phe1692Ser		AC010127.3_ENST00000447809.2_RNA|SCN9A_ENST00000409672.1_Missense_Mutation_p.F1681S|SCN9A_ENST00000375387.4_Missense_Mutation_p.F1693S|SCN9A_ENST00000409435.1_Missense_Mutation_p.F1692S	p.F1693S			Q15858	SCN9A_HUMAN			27	5418	-			1692		A1BUH5|Q6B4R9|Q6B4S0|Q6B4S1|Q70HX1|Q70HX2|Q8WTU1|Q8WWN4	Missense_Mutation	SNP	ENST00000409435.1	37	c.5078T>C	CCDS46441.1	.	.	.	.	.	.	.	.	.	.	A	18.11	3.550797	0.65311	.	.	ENSG00000169432	ENST00000409672;ENST00000375387;ENST00000303354;ENST00000409435	D;D;D;D	0.99259	-5.64;-5.64;-5.64;-5.64	5.86	5.86	0.93980	5.86	5.86	0.93980	.	0.000000	0.64402	D	0.000005	D	0.99799	0.9914	H	0.99946	5.015	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.96411	0.9304	10	0.87932	D	0	.	16.2479	0.82454	1.0:0.0:0.0:0.0	.	1681	E7EUN6	.	S	1681;1693;1693;1692	ENSP00000386306:F1681S;ENSP00000364536:F1693S;ENSP00000304748:F1693S;ENSP00000386330:F1692S	ENSP00000304748:F1693S	F	-	2	0	0	SCN9A	166764320	166764320	1.000000	0.71417	1.000000	0.80357	0.700000	0.40528	9.031000	0.93731	2.241000	0.73720	0.533000	0.62120	TTC		0.413	SCN9A-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333639.1		337.727435	19	19	199	199	NM_002977		103	337.847344	337.847344	114	0.474654	0	0	0	1	0	103	114	0.474654
KIAA0430	9665	broad.mit.edu	37	16	15690613	15690613	+	Missense_Mutation	SNP	C	C	G			TCGA-YZ-A982-01A-11D-A39W-08	TCGA-YZ-A982-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6dd88bd4-a48e-4288-8b66-2a1c65794e06	926d3706-e1ae-4b81-aaac-c8b57a5bb970	g.chr16:15690613C>G	ENST00000396368.3	-	27	5372	c.5166G>C	c.(5164-5166)aaG>aaC	p.K1722N	KIAA0430_ENST00000548025.1_Missense_Mutation_p.K1719N|KIAA0430_ENST00000344181.3_Missense_Mutation_p.K1410N|KIAA0430_ENST00000551742.1_Missense_Mutation_p.K1722N|KIAA0430_ENST00000540441.2_Missense_Mutation_p.K1557N|KIAA0430_ENST00000602337.1_Missense_Mutation_p.K1719N	NM_001184998.1|NM_001184999.1|NM_014647.3	NP_001171927.1|NP_001171928.1|NP_055462.2	Q9Y4F3	MARF1_HUMAN	KIAA0430	1722					double-strand break repair (GO:0006302)|female meiotic division (GO:0007143)|negative regulation of phosphatase activity (GO:0010923)|oogenesis (GO:0048477)|regulation of gene expression (GO:0010468)	membrane (GO:0016020)|peroxisome (GO:0005777)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(4)|endometrium(8)|kidney(4)|large_intestine(2)|lung(13)|ovary(3)|prostate(5)|skin(1)	40						TTTTGGGTTGCTTTTTGGCCG	0.512																																						ENST00000396368.3											0			breast(4)|endometrium(8)|kidney(4)|large_intestine(2)|lung(13)|ovary(3)|prostate(5)|skin(1)	40						c.(5164-5166)aaG>aaC	KIAA0430						162.0	153.0	156.0					16																	15690613		1886	4113	5999	SO:0001583	missense	9665				peroxisome	nucleotide binding|RNA binding	g.chr16:15690613C>G	AB007890	AB007890	CCDS10562.2, CCDS53990.1, CCDS55991.1	CCDS10562.2, CCDS53990.1, CCDS55991.1	16p13.11	2013-01-11			2013-01-11			ENSG00000166783	ENSG00000166783	ENSG00000166783	ENSG00000166783		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	29562	29562	protein-coding gene	gene with protein product	protein-coding gene	gene with protein product	"""limkain b1"", ""protein phosphatase 1, regulatory subunit 34"", ""meiosis arrest female 1"""	"""limkain b1"", ""protein phosphatase 1, regulatory subunit 34"", ""meiosis arrest female 1"""	614593	614593						9455477, 10493829, 15932519, 22442484, 23090997	9455477, 10493829, 15932519, 22442484, 23090997	Standard	Standard	NM_014647	NM_014647		Approved	LKAP, PPP1R34, Marf1	uc010uzw.2	uc010uzw.2	Q9Y4F3	Q9Y4F3	OTTHUMG00000129884	OTTHUMG00000129884	ENST00000396368.3:c.5166G>C	16.37:g.15690613C>G	ENSP00000379654:p.Lys1722Asn		KIAA0430_ENST00000540441.2_Missense_Mutation_p.K1557N|KIAA0430_ENST00000551742.1_Missense_Mutation_p.K1722N|KIAA0430_ENST00000548025.1_Missense_Mutation_p.K1719N|KIAA0430_ENST00000602337.1_Missense_Mutation_p.K1719N|KIAA0430_ENST00000344181.3_Missense_Mutation_p.K1410N	p.K1722N	NM_001184998.1|NM_001184999.1|NM_014647.3	NP_001171927.1|NP_001171928.1|NP_055462.2	Q9Y4F3	LKAP_HUMAN			27	5372	-			1721		A8MSK2|B2RNX2|B4DYY9|B7ZMG1|B7ZMG2|F8VV09|Q6P1R6|Q8WYR2|Q9Y4J9	Missense_Mutation	SNP	ENST00000396368.3	37	c.5166G>C	CCDS10562.2	.	.	.	.	.	.	.	.	.	.	C	25.2	4.617441	0.87359	.	.	ENSG00000166783	ENST00000396368;ENST00000540441;ENST00000321370;ENST00000344181;ENST00000548025;ENST00000551742;ENST00000551298	.	.	.	5.45	4.5	0.54988	5.45	4.5	0.54988	.	0.108400	0.64402	D	0.000008	T	0.38054	0.1026	L	0.27053	0.805	0.28490	N	0.914539	D;P;P;P	0.54772	0.968;0.897;0.897;0.947	P;P;P;B	0.48654	0.585;0.552;0.552;0.381	T	0.34004	-0.9846	9	0.72032	D	0.01	.	13.6211	0.62138	0.0:0.9258:0.0:0.0742	.	1721;1719;1718;1721	Q9Y4F3-5;F8VV09;Q9Y4F3-4;Q9Y4F3	.;.;.;LKAP_HUMAN	N	1722;1557;1662;1410;1719;1722;1588	.	ENSP00000315718:K1662N	K	-	3	2	2	KIAA0430	15598114	15598114	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	1.892000	0.39748	2.538000	0.85594	0.655000	0.94253	AAG		0.512	KIAA0430-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252131.2		172.511271	-2	-2	103	103	NM_014647		51	174.538248	174.538248	25	0.671053	0	0	0	1	0	51	25	0.671053
SERTM1	400120	broad.mit.edu	37	13	37269336	37269336	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A982-01A-11D-A39W-08	TCGA-YZ-A982-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6dd88bd4-a48e-4288-8b66-2a1c65794e06	926d3706-e1ae-4b81-aaac-c8b57a5bb970	g.chr13:37269336G>A	ENST00000315190.3	+	2	567	c.121G>A	c.(121-123)Gtc>Atc	p.V41I		NM_203451.2	NP_982276.2	A2A2V5	SRTM1_HUMAN	serine-rich and transmembrane domain containing 1	41						integral component of membrane (GO:0016021)											CCTGTCAAACGTCTACATCTA	0.473																																						ENST00000315190.3											0										c.(121-123)Gtc>Atc	serine-rich and transmembrane domain containing 1						242.0	207.0	219.0					13																	37269336		2203	4300	6503	SO:0001583	missense	400120				integral to membrane		g.chr13:37269336G>A			CCDS9358.1	CCDS9358.1	13q13.3	2011-08-10	2011-08-10	2011-08-09	2011-08-10	2011-08-10	2011-08-09	ENSG00000180440	ENSG00000180440	ENSG00000180440	ENSG00000180440				33792	33792	protein-coding gene	gene with protein product	protein-coding gene	gene with protein product					"""chromosome 13 open reading frame 36"""	C13orf36	"""chromosome 13 open reading frame 36"""	C13orf36				Standard	Standard	NM_203451	NM_203451		Approved		uc001uvt.4	uc001uvt.4	A2A2V5	A2A2V5	OTTHUMG00000016735	OTTHUMG00000016735	ENST00000315190.3:c.121G>A	13.37:g.37269336G>A	ENSP00000325776:p.Val41Ile			p.V41I	NM_203451.2	NP_982276.2	A2A2V5	CM036_HUMAN			2	567	+			41		Q8N469	Missense_Mutation	SNP	ENST00000315190.3	37	c.121G>A	CCDS9358.1	.	.	.	.	.	.	.	.	.	.	G	17.45	3.392539	0.62066	.	.	ENSG00000180440	ENST00000315190	.	.	.	5.1	5.1	0.69264	5.1	5.1	0.69264	.	0.068670	0.56097	D	0.000023	T	0.41511	0.1162	N	0.19112	0.55	0.41441	D	0.987924	P	0.44776	0.843	B	0.39904	0.313	T	0.51434	-0.8706	9	0.87932	D	0	-25.5942	17.4901	0.87701	0.0:0.0:1.0:0.0	.	41	A2A2V5	SRTM1_HUMAN	I	41	.	ENSP00000325776:V41I	V	+	1	0	0	SERTM1	36167336	36167336	1.000000	0.71417	0.998000	0.56505	0.983000	0.72400	5.830000	0.69324	2.345000	0.79718	0.563000	0.77884	GTC		0.473	SERTM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044518.2		-23.516816	15	15	137	137	NM_203451		7	13.851158	13.851158	159	0.042169	0	0	0	1	0	7	159	0.042169
COMMD4	54939	ucsc.edu	37	15	75632318	75632318	+	Missense_Mutation	SNP	C	C	A			TCGA-YZ-A982-01A-11D-A39W-08	TCGA-YZ-A982-10A-01D-A39Z-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6dd88bd4-a48e-4288-8b66-2a1c65794e06	926d3706-e1ae-4b81-aaac-c8b57a5bb970	g.chr15:75632318C>A	ENST00000267935.8	+	8	771	c.572C>A	c.(571-573)gCc>gAc	p.A191D	COMMD4_ENST00000567195.1_Missense_Mutation_p.A105D|COMMD4_ENST00000338995.6_Missense_Mutation_p.A132D|COMMD4_ENST00000564815.1_Missense_Mutation_p.A169D|COMMD4_ENST00000562789.1_Missense_Mutation_p.A138D	NM_017828.3	NP_060298.2	Q9H0A8	COMD4_HUMAN	COMM domain containing 4	191	COMM. {ECO:0000255|PROSITE- ProRule:PRU00602}.					cytoplasm (GO:0005737)				breast(3)|endometrium(2)|kidney(2)|large_intestine(1)|lung(1)|prostate(1)	10						CTGAAGCAGGCCCAGACCCTG	0.632																																																	0																	71.0	63.0	66.0					15																	75632318		2197	4294	6491	SO:0001583	missense	54939							AY542160	AY542160	CCDS10277.1, CCDS66834.1, CCDS66835.1, CCDS73764.1	CCDS10277.1, CCDS66834.1, CCDS66835.1, CCDS73764.1	15q24.2	2012-09-20			2012-09-20			ENSG00000140365	ENSG00000140365	ENSG00000140365	ENSG00000140365				26027	26027	protein-coding gene	gene with protein product	protein-coding gene	gene with protein product										15799966	15799966	Standard	Standard	XM_005254511	XM_005254511		Approved	FLJ20452	uc002azy.3	uc002azy.3	Q9H0A8	Q9H0A8	OTTHUMG00000142823	OTTHUMG00000142823	ENST00000267935.8:c.572C>A	15.37:g.75632318C>A	ENSP00000267935:p.Ala191Asp																	B2RBN4|H3BUL2|Q7L637|Q9NX43	Missense_Mutation	SNP	ENST00000267935.8	37		CCDS10277.1	.	.	.	.	.	.	.	.	.	.	C	16.44	3.124113	0.56613	.	.	ENSG00000140365	ENST00000267935;ENST00000338995	T	0.13538	2.58	4.95	4.03	0.46877	4.95	4.03	0.46877	COMM domain (1);	0.000000	0.85682	D	0.000000	T	0.42314	0.1197	M	0.89715	3.055	0.34154	D	0.667854	P;D	0.71674	0.801;0.998	P;D	0.70935	0.681;0.971	T	0.64972	-0.6281	10	0.87932	D	0	.	12.1941	0.54288	0.0:0.9167:0.0:0.0833	.	132;191	Q9H0A8-2;Q9H0A8	.;COMD4_HUMAN	D	191;132	ENSP00000267935:A191D	ENSP00000267935:A191D	A	+	2	0	0	COMMD4	73419371	73419371	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	4.170000	0.58229	1.076000	0.40961	0.655000	0.94253	GCC		0.632	COMMD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286414.1			2	2	50	50	NM_017828		4			29							4	29	
SPEG	10290	broad.mit.edu	37	2	220352973	220352973	+	Missense_Mutation	SNP	C	C	G			TCGA-YZ-A982-01A-11D-A39W-08	TCGA-YZ-A982-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6dd88bd4-a48e-4288-8b66-2a1c65794e06	926d3706-e1ae-4b81-aaac-c8b57a5bb970	g.chr2:220352973C>G	ENST00000312358.7	+	32	7931	c.7799C>G	c.(7798-7800)gCa>gGa	p.A2600G	SPEG_ENST00000485813.1_3'UTR|AC053503.11_ENST00000429882.1_RNA	NM_005876.4	NP_005867.3	Q15772	SPEG_HUMAN	SPEG complex locus	2600	Ig-like 9.				cardiac muscle cell development (GO:0055013)|in utero embryonic development (GO:0001701)|muscle organ development (GO:0007517)|negative regulation of cell proliferation (GO:0008285)|respiratory system development (GO:0060541)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(3)|endometrium(10)|kidney(2)|large_intestine(9)|lung(42)|ovary(5)|pancreas(1)|prostate(8)|skin(1)|stomach(9)|upper_aerodigestive_tract(4)|urinary_tract(4)	100		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		GAGGGGGAGGCAGCCACCCTG	0.602																																						ENST00000312358.7											0			breast(2)|central_nervous_system(3)|endometrium(10)|kidney(2)|large_intestine(9)|lung(42)|ovary(5)|pancreas(1)|prostate(8)|skin(1)|stomach(9)|upper_aerodigestive_tract(4)|urinary_tract(4)	100						c.(7798-7800)gCa>gGa	SPEG complex locus						59.0	63.0	62.0					2																	220352973		2043	4203	6246	SO:0001583	missense	10290			muscle organ development|negative regulation of cell proliferation	nucleus	ATP binding|protein serine/threonine kinase activity	g.chr2:220352973C>G	BC006346	BC006346	CCDS42824.1, CCDS54432.1	CCDS42824.1, CCDS54432.1	2q35	2013-01-11	2006-04-27	2006-04-27	2013-01-11	2006-04-27	2006-04-27	ENSG00000072195	ENSG00000072195	ENSG00000072195	ENSG00000072195		"""Immunoglobulin superfamily / I-set domain containing"""	"""Immunoglobulin superfamily / I-set domain containing"""	16901	16901	protein-coding gene	gene with protein product	protein-coding gene	gene with protein product			615950	615950	"""aortic preferentially expressed gene 1"""	APEG1	"""aortic preferentially expressed gene 1"""	APEG1		8663449, 10973969	8663449, 10973969	Standard	Standard	NM_005876	NM_005876		Approved	MGC12676, KIAA1297, SPEGalpha, SPEGbeta, BPEG	uc010fwg.3	uc010fwg.3	Q15772	Q15772	OTTHUMG00000058925	OTTHUMG00000058925	ENST00000312358.7:c.7799C>G	2.37:g.220352973C>G	ENSP00000311684:p.Ala2600Gly		AC053503.11_ENST00000429882.1_RNA|SPEG_ENST00000485813.1_3'UTR	p.A2600G	NM_005876.4	NP_005867.3	Q15772	SPEG_HUMAN		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)	32	7931	+		Renal(207;0.0183)	2600	Ig-like 9.	A8K0G6|A8MRU0|Q27J74|Q695L1|Q6FGA6|Q6ZQW1|Q6ZTL8|Q9P2P9	Missense_Mutation	SNP	ENST00000312358.7	37	c.7799C>G	CCDS42824.1	.	.	.	.	.	.	.	.	.	.	C	18.44	3.624120	0.66901	.	.	ENSG00000072195	ENST00000312358;ENST00000265327	T	0.68181	-0.31	4.89	3.95	0.45737	4.89	3.95	0.45737	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.38778	N	0.001570	T	0.63698	0.2533	L	0.31476	0.935	0.80722	D	1	P	0.52170	0.951	P	0.52343	0.696	T	0.61302	-0.7090	10	0.28530	T	0.3	.	14.5901	0.68359	0.0:0.8533:0.1467:0.0	.	2600	Q15772	SPEG_HUMAN	G	2600	ENSP00000311684:A2600G	ENSP00000265327:A2600G	A	+	2	0	0	SPEG	220061217	220061217	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.917000	0.69989	2.282000	0.76494	0.591000	0.81541	GCA		0.602	SPEG-004	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130252.2		57.500203	5	5	94	94	NM_005876		20	58.966258	58.966258	40	0.333333	0	0	0	1	0	20	40	0.333333
MIR450A1	554214	broad.mit.edu	37	X	133674386	133674386	+	RNA	SNP	C	C	A			TCGA-YZ-A982-01A-11D-A39W-08	TCGA-YZ-A982-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6dd88bd4-a48e-4288-8b66-2a1c65794e06	926d3706-e1ae-4b81-aaac-c8b57a5bb970	g.chrX:133674386C>A	ENST00000362262.1	-	0	75				MIR450A2_ENST00000385022.1_RNA|MIR450B_ENST00000401182.1_RNA|MIR542_ENST00000385050.1_RNA	NR_029962.1				microRNA 450a-1																		TGATACAAAACTATACATGCA	0.328																																						ENST00000362262.1											0																	122.0	96.0	104.0					X																	133674386		1566	3580	5146			0						g.chrX:133674386C>A					Xq26.3	2011-09-12	2007-10-23	2008-12-18	2011-09-12	2007-10-23	2008-12-18	ENSG00000199132	ENSG00000199132	ENSG00000199132	ENSG00000199132		"""ncRNAs / Micro RNAs"""	"""ncRNAs / Micro RNAs"""	28008	28008	non-coding RNA	RNA, micro	non-coding RNA	RNA, micro					"""microRNA 450"", ""microRNA 450-1"""	MIRN450, MIRN450-1, MIRN450A1	"""microRNA 450"", ""microRNA 450-1"""	MIRN450, MIRN450-1, MIRN450A1				Standard	Standard	NR_029962	NR_029962		Approved	hsa-mir-450, hsa-mir-450-1, hsa-mir-450a-1	uc011mvl.2	uc011mvl.2						X.37:g.133674386C>A					NR_029962.1						0	75	-						RNA	SNP	ENST00000362262.1	37																																																																																											0.328	MIR450A1-201	KNOWN	basic	miRNA	miRNA			0.259303	-16	-16	95	95	NR_029962		4	8.994595	8.994595	45	0.081633	1	0	0.00909568	1	0.00909568	4	45	0.081633
CYSLTR2	57105	broad.mit.edu	37	13	49281339	49281339	+	Missense_Mutation	SNP	T	T	A			TCGA-YZ-A982-01A-11D-A39W-08	TCGA-YZ-A982-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6dd88bd4-a48e-4288-8b66-2a1c65794e06	926d3706-e1ae-4b81-aaac-c8b57a5bb970	g.chr13:49281339T>A	ENST00000282018.3	+	1	389	c.386T>A	c.(385-387)cTg>cAg	p.L129Q		NM_020377.2	NP_065110.1	Q9NS75	CLTR2_HUMAN	cysteinyl leukotriene receptor 2	129					immune response (GO:0006955)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell death (GO:0010942)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cysteinyl leukotriene receptor activity (GO:0001631)|leukotriene receptor activity (GO:0004974)			endometrium(2)|large_intestine(4)|lung(12)|skin(2)	20		all_cancers(8;1.66e-53)|all_epithelial(8;1.96e-19)|all_lung(13;9.94e-09)|all_hematologic(8;7.13e-07)|Lung NSC(96;1.72e-06)|Breast(56;1.53e-05)|Acute lymphoblastic leukemia(8;6.86e-05)|Prostate(109;0.00174)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0416)|Lung SC(185;0.0787)		GBM - Glioblastoma multiforme(99;1.19e-09)	Nedocromil(DB00716)	ATTTATTTCCTGACCGTGCTG	0.468																																						ENST00000282018.3											0			endometrium(2)|large_intestine(4)|lung(12)|skin(2)	20						c.(385-387)cTg>cAg	cysteinyl leukotriene receptor 2						209.0	201.0	204.0					13																	49281339		2203	4300	6503	SO:0001583	missense	57105			immune response	integral to membrane|plasma membrane		g.chr13:49281339T>A	AB038269	AB038269	CCDS9412.1	CCDS9412.1	13q14.2	2012-08-10			2012-08-10			ENSG00000152207	ENSG00000152207	ENSG00000152207	ENSG00000152207		"""GPCR / Class A : Leukotriene receptors"""	"""GPCR / Class A : Leukotriene receptors"""	18274	18274	protein-coding gene	gene with protein product	protein-coding gene	gene with protein product			605666	605666						10913337, 1085123	10913337, 1085123	Standard	Standard	NM_020377	NM_020377		Approved	CysLT(2), CYSLT2R	uc001vck.2	uc001vck.2	Q9NS75	Q9NS75	OTTHUMG00000016906	OTTHUMG00000016906	ENST00000282018.3:c.386T>A	13.37:g.49281339T>A	ENSP00000282018:p.Leu129Gln			p.L129Q	NM_020377.2	NP_065110.1	Q9NS75	CLTR2_HUMAN		GBM - Glioblastoma multiforme(99;1.19e-09)	1	389	+		all_cancers(8;1.66e-53)|all_epithelial(8;1.96e-19)|all_lung(13;9.94e-09)|all_hematologic(8;7.13e-07)|Lung NSC(96;1.72e-06)|Breast(56;1.53e-05)|Acute lymphoblastic leukemia(8;6.86e-05)|Prostate(109;0.00174)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0416)|Lung SC(185;0.0787)	129		Q9HCQ2	Missense_Mutation	SNP	ENST00000282018.3	37	c.386T>A	CCDS9412.1	.	.	.	.	.	.	.	.	.	.	T	25.8	4.679001	0.88542	.	.	ENSG00000152207	ENST00000282018	D	0.81579	-1.51	6.08	6.08	0.98989	6.08	6.08	0.98989	GPCR, rhodopsin-like superfamily (1);	0.000000	0.52532	D	0.000066	D	0.93756	0.8004	H	0.97783	4.075	0.54753	D	0.999982	D	0.89917	1.0	D	0.85130	0.997	D	0.95820	0.8849	10	0.87932	D	0	.	15.825	0.78698	0.0:0.0:0.0:1.0	.	129	Q9NS75	CLTR2_HUMAN	Q	129	ENSP00000282018:L129Q	ENSP00000282018:L129Q	L	+	2	0	0	CYSLTR2	48179340	48179340	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	8.004000	0.88535	2.333000	0.79357	0.533000	0.62120	CTG		0.468	CYSLTR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044894.1		327.125322	35	35	188	188			102	327.764818	327.764818	128	0.443478	0	0	0	1	0	102	128	0.443478
SPRY2	10253	broad.mit.edu	37	13	80911791	80911791	+	Missense_Mutation	SNP	G	G	A	rs372480996		TCGA-YZ-A982-01A-11D-A39W-08	TCGA-YZ-A982-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6dd88bd4-a48e-4288-8b66-2a1c65794e06	926d3706-e1ae-4b81-aaac-c8b57a5bb970	g.chr13:80911791G>A	ENST00000377102.1	-	2	1027	c.50C>T	c.(49-51)aCg>aTg	p.T17M	SPRY2_ENST00000540649.1_Missense_Mutation_p.T17M|SPRY2_ENST00000377104.3_Missense_Mutation_p.T17M			O43597	SPY2_HUMAN	sprouty homolog 2 (Drosophila)	17					bud elongation involved in lung branching (GO:0060449)|cell fate commitment (GO:0045165)|epidermal growth factor receptor signaling pathway (GO:0007173)|establishment of mitotic spindle orientation (GO:0000132)|fibroblast growth factor receptor signaling pathway (GO:0008543)|inner ear morphogenesis (GO:0042472)|lung growth (GO:0060437)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of neurotrophin TRK receptor signaling pathway (GO:0051387)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|negative regulation of Ras GTPase activity (GO:0034261)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|sensory perception of sound (GO:0007605)	cell projection (GO:0042995)|cytosol (GO:0005829)|microtubule (GO:0005874)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein serine/threonine kinase activator activity (GO:0043539)|protein serine/threonine kinase inhibitor activity (GO:0030291)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)	12	Medulloblastoma(90;0.18)	Acute lymphoblastic leukemia(28;0.218)|Breast(118;0.244)		GBM - Glioblastoma multiforme(99;0.0318)		GTCACGGGGCGTCTGCAGCAA	0.607																																						ENST00000377102.1											0			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)	12						c.(49-51)aCg>aTg	sprouty homolog 2 (Drosophila)	G	MET/THR	1,4405	2.1+/-5.4	0,1,2202	58.0	60.0	59.0		50	3.5	0.2	13		59	0,8600		0,0,4300	no	missense	SPRY2	NM_005842.2	81	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	17/316	80911791	1,13005	2203	4300	6503	SO:0001583	missense	10253			epidermal growth factor receptor signaling pathway|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|positive regulation of ERK1 and ERK2 cascade|positive regulation of gene expression|positive regulation of peptidyl-serine phosphorylation|positive regulation of protein kinase B signaling cascade	cytosol|microtubule|ruffle membrane	protein serine/threonine kinase activator activity	g.chr13:80911791G>A	AF039843	AF039843	CCDS9463.1	CCDS9463.1	13q31.1	2008-05-14	2001-11-28		2008-05-14	2001-11-28		ENSG00000136158	ENSG00000136158	ENSG00000136158	ENSG00000136158				11270	11270	protein-coding gene	gene with protein product	protein-coding gene	gene with protein product			602466	602466	"""sprouty (Drosophila) homolog 2"""		"""sprouty (Drosophila) homolog 2"""			9458049	9458049	Standard	Standard	NM_005842	NM_005842		Approved	hSPRY2	uc001vlj.3	uc001vlj.3	O43597	O43597	OTTHUMG00000017140	OTTHUMG00000017140	ENST00000377102.1:c.50C>T	13.37:g.80911791G>A	ENSP00000366306:p.Thr17Met		SPRY2_ENST00000540649.1_Missense_Mutation_p.T17M|SPRY2_ENST00000377104.3_Missense_Mutation_p.T17M	p.T17M			O43597	SPY2_HUMAN		GBM - Glioblastoma multiforme(99;0.0318)	2	1027	-	Medulloblastoma(90;0.18)	Acute lymphoblastic leukemia(28;0.218)|Breast(118;0.244)	17		B2R9J9|Q5T6Z7	Missense_Mutation	SNP	ENST00000377102.1	37	c.50C>T	CCDS9463.1	.	.	.	.	.	.	.	.	.	.	G	9.716	1.158497	0.21454	2.27E-4	0.0	ENSG00000136158	ENST00000377104;ENST00000377102;ENST00000541655;ENST00000540649	T;T;T	0.55588	0.51;0.51;0.51	5.2	3.45	0.39498	5.2	3.45	0.39498	.	0.558410	0.19137	N	0.121790	T	0.29190	0.0726	N	0.08118	0	0.24756	N	0.992952	B	0.06786	0.001	B	0.04013	0.001	T	0.17018	-1.0383	10	0.54805	T	0.06	1.0E-4	6.2473	0.20825	0.0725:0.1336:0.6553:0.1386	.	17	O43597	SPY2_HUMAN	M	17	ENSP00000366308:T17M;ENSP00000366306:T17M;ENSP00000439027:T17M	ENSP00000366306:T17M	T	-	2	0	0	SPRY2	79809792	79809792	0.695000	0.27747	0.199000	0.23439	0.956000	0.61745	1.187000	0.32090	0.588000	0.29660	0.650000	0.86243	ACG		0.607	SPRY2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045387.1		139.773313	26	26	102	102			45	139.775679	139.775679	46	0.494505	0	0	0	1	0	45	46	0.494505
BAHCC1	57597	broad.mit.edu	37	17	79411771	79411771	+	Missense_Mutation	SNP	T	T	A			TCGA-YZ-A982-01A-11D-A39W-08	TCGA-YZ-A982-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6dd88bd4-a48e-4288-8b66-2a1c65794e06	926d3706-e1ae-4b81-aaac-c8b57a5bb970	g.chr17:79411771T>A	ENST00000307745.7	+	12	2590	c.2590T>A	c.(2590-2592)Ttc>Atc	p.F864I																								GCCCTCTGTCTTCCCCCTCCC	0.716																																						ENST00000307745.7											0										c.(2590-2592)Ttc>Atc							28.0	36.0	33.0					17																	79411771		2008	4155	6163	SO:0001583	missense	0						g.chr17:79411771T>A																																																	ENST00000307745.7:c.2590T>A	17.37:g.79411771T>A	ENSP00000303486:p.Phe864Ile			p.F864I							12	2590	+						Missense_Mutation	SNP	ENST00000307745.7	37	c.2590T>A		.	.	.	.	.	.	.	.	.	.	T	15.01	2.707394	0.48412	.	.	ENSG00000171282	ENST00000307745	T	0.51817	0.69	4.63	4.63	0.57726	4.63	4.63	0.57726	.	0.217184	0.30338	N	0.009858	T	0.52789	0.1756	L	0.57536	1.79	0.39085	D	0.96098	D;D	0.56287	0.958;0.975	B;P	0.50570	0.386;0.644	T	0.56854	-0.7910	10	0.37606	T	0.19	.	13.8629	0.63571	0.0:0.0:0.0:1.0	.	864;864	Q9P281;F8WBW8	BAHC1_HUMAN;.	I	864	ENSP00000303486:F864I	ENSP00000303486:F864I	F	+	1	0	0	AC110285.1	77026366	77026366	1.000000	0.71417	1.000000	0.80357	0.244000	0.25665	2.686000	0.46968	1.929000	0.55896	0.402000	0.26972	TTC		0.716	RP11-1055B8.7-201	KNOWN	basic|appris_principal	protein_coding	protein_coding			46.493683	-12	-12	41	41			16	46.519469	46.519469	18	0.470588	0	0	0	1	0	16	18	0.470588
ANK2	287	broad.mit.edu	37	4	114274935	114274935	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A982-01A-11D-A39W-08	TCGA-YZ-A982-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6dd88bd4-a48e-4288-8b66-2a1c65794e06	926d3706-e1ae-4b81-aaac-c8b57a5bb970	g.chr4:114274935G>A	ENST00000357077.4	+	38	5214	c.5161G>A	c.(5161-5163)Gct>Act	p.A1721T	ANK2_ENST00000394537.3_Intron|ANK2_ENST00000264366.6_Missense_Mutation_p.A1688T|ANK2_ENST00000510275.2_Intron|ANK2_ENST00000506722.1_Intron|ANK2_ENST00000509550.1_Intron	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	1721					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		AGGTTTACAAGCTAGTGCAGA	0.423																																						ENST00000357077.4											0			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248						c.(5161-5163)Gct>Act	ankyrin 2, neuronal						167.0	175.0	172.0					4																	114274935		2203	4300	6503	SO:0001583	missense	287			axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding	g.chr4:114274935G>A	M37123	M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362	ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	"""Ankyrin repeat domain containing"""	493	493	protein-coding gene	gene with protein product	protein-coding gene	gene with protein product			106410	106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	7485162, 12571597	Standard	Standard	NM_001148	NM_001148		Approved		uc003ibe.4	uc003ibe.4	Q01484	Q01484	OTTHUMG00000132912	OTTHUMG00000132912	ENST00000357077.4:c.5161G>A	4.37:g.114274935G>A	ENSP00000349588:p.Ala1721Thr		ANK2_ENST00000510275.2_Intron|ANK2_ENST00000506722.1_Intron|ANK2_ENST00000264366.6_Missense_Mutation_p.A1688T|ANK2_ENST00000509550.1_Intron|ANK2_ENST00000394537.3_Intron	p.A1721T	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)	38	5214	+		Ovarian(17;0.0448)|Hepatocellular(203;0.218)	1688		Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	ENST00000357077.4	37	c.5161G>A	CCDS3702.1	.	.	.	.	.	.	.	.	.	.	G	0	-2.862920	0.00064	.	.	ENSG00000145362	ENST00000357077;ENST00000264366	T;T	0.67345	-0.25;-0.26	5.51	-2.69	0.06022	5.51	-2.69	0.06022	.	1.019830	0.07828	N	0.960992	T	0.50514	0.1620	L	0.36672	1.1	0.09310	N	1	B;B	0.16166	0.003;0.016	B;B	0.11329	0.002;0.006	T	0.30966	-0.9960	9	.	.	.	.	7.1289	0.25488	0.397:0.2027:0.4003:0.0	.	1688;1721	Q01484;Q01484-4	ANK2_HUMAN;.	T	1721;1688	ENSP00000349588:A1721T;ENSP00000264366:A1688T	.	A	+	1	0	0	ANK2	114494384	114494384	0.000000	0.05858	0.000000	0.03702	0.031000	0.12232	-0.017000	0.12590	-0.496000	0.06650	-0.768000	0.03414	GCT		0.423	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2		341.674806	9	9	205	205	NM_001148		106	343.384366	343.384366	69	0.605714	0	0	0	1	0	106	69	0.605714
PGBD1	84547	broad.mit.edu	37	6	28268896	28268896	+	Missense_Mutation	SNP	T	T	G			TCGA-YZ-A982-01A-11D-A39W-08	TCGA-YZ-A982-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6dd88bd4-a48e-4288-8b66-2a1c65794e06	926d3706-e1ae-4b81-aaac-c8b57a5bb970	g.chr6:28268896T>G	ENST00000405948.2	+	7	1685	c.1265T>G	c.(1264-1266)cTt>cGt	p.L422R	PGBD1_ENST00000259883.3_Missense_Mutation_p.L422R	NM_001184743.1|NM_032507.3	NP_001171672.1|NP_115896.1	Q96JS3	PGBD1_HUMAN	piggyBac transposable element derived 1	422						membrane (GO:0016020)|nucleus (GO:0005634)	scavenger receptor activity (GO:0005044)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(2)|large_intestine(7)|lung(16)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	41						CCAGTAGAGCTTTTTGAATTA	0.358																																						ENST00000405948.2											0			endometrium(2)|kidney(2)|large_intestine(7)|lung(16)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	41						c.(1264-1266)cTt>cGt	piggyBac transposable element derived 1						78.0	84.0	82.0					6																	28268896		2199	4293	6492	SO:0001583	missense	84547			viral reproduction	membrane|nucleus	scavenger receptor activity|sequence-specific DNA binding transcription factor activity	g.chr6:28268896T>G	D88259	D88259	CCDS4648.1	CCDS4648.1	6p22.1	2013-01-09			2013-01-09			ENSG00000137338	ENSG00000137338	ENSG00000137338	ENSG00000137338		"""-"""	"""-"""	19398	19398	protein-coding gene	gene with protein product	protein-coding gene	gene with protein product												Standard	Standard	NM_001184743	NM_001184743		Approved	HUCEP-4, dJ874C20.4, SCAND4	uc003nkz.3	uc003nkz.3	Q96JS3	Q96JS3	OTTHUMG00000014520	OTTHUMG00000014520	ENST00000405948.2:c.1265T>G	6.37:g.28268896T>G	ENSP00000385213:p.Leu422Arg		PGBD1_ENST00000259883.3_Missense_Mutation_p.L422R	p.L422R	NM_001184743.1|NM_032507.3	NP_001171672.1|NP_115896.1	Q96JS3	PGBD1_HUMAN			7	1685	+			422		Q53F43|Q6NTF5|Q8WWS4	Missense_Mutation	SNP	ENST00000405948.2	37	c.1265T>G	CCDS4648.1	.	.	.	.	.	.	.	.	.	.	T	15.62	2.888013	0.52014	.	.	ENSG00000137338	ENST00000405948;ENST00000259883	T;T	0.22336	1.96;1.96	4.54	4.54	0.55810	4.54	4.54	0.55810	.	0.193558	0.25789	N	0.028285	T	0.25457	0.0619	L	0.59436	1.845	0.35363	D	0.788404	D	0.62365	0.991	P	0.60541	0.876	T	0.05225	-1.0898	10	0.59425	D	0.04	-23.6211	10.4662	0.44609	0.0:0.0:0.0:1.0	.	422	Q96JS3	PGBD1_HUMAN	R	422	ENSP00000385213:L422R;ENSP00000259883:L422R	ENSP00000259883:L422R	L	+	2	0	0	PGBD1	28376875	28376875	0.984000	0.35163	0.996000	0.52242	0.979000	0.70002	1.793000	0.38764	2.039000	0.60335	0.533000	0.62120	CTT		0.358	PGBD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040188.2		354.834423	-24	-24	104	104			108	357.056878	357.056878	66	0.620690	0	0	0	1	0	108	66	0.62069
TBCD	6904	broad.mit.edu	37	17	80828169	80828169	+	Missense_Mutation	SNP	T	T	C			TCGA-YZ-A982-01A-11D-A39W-08	TCGA-YZ-A982-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6dd88bd4-a48e-4288-8b66-2a1c65794e06	926d3706-e1ae-4b81-aaac-c8b57a5bb970	g.chr17:80828169T>C	ENST00000355528.4	+	14	1518	c.1388T>C	c.(1387-1389)gTc>gCc	p.V463A	TBCD_ENST00000397466.2_Missense_Mutation_p.V77A|TBCD_ENST00000539345.2_Missense_Mutation_p.V463A	NM_005993.4	NP_005984.3	Q9BTW9	TBCD_HUMAN	tubulin folding cofactor D	463					'de novo' posttranslational protein folding (GO:0051084)|adherens junction assembly (GO:0034333)|cellular protein metabolic process (GO:0044267)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of microtubule polymerization (GO:0031115)|positive regulation of GTPase activity (GO:0043547)|post-chaperonin tubulin folding pathway (GO:0007023)|protein folding (GO:0006457)|tight junction assembly (GO:0070830)	adherens junction (GO:0005912)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)|microtubule (GO:0005874)|tight junction (GO:0005923)	beta-tubulin binding (GO:0048487)|chaperone binding (GO:0051087)|GTPase activator activity (GO:0005096)					Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0266)|all_epithelial(8;0.0696)	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.18)			GGCACCAACGTCAGGGACGCC	0.622																																						ENST00000355528.4											0										c.(1387-1389)gTc>gCc	tubulin folding cofactor D						49.0	56.0	54.0					17																	80828169		2149	4243	6392	SO:0001583	missense	6904			'de novo' posttranslational protein folding|adherens junction assembly|negative regulation of cell-substrate adhesion|negative regulation of microtubule polymerization|post-chaperonin tubulin folding pathway|tight junction assembly	adherens junction|cytoplasm|lateral plasma membrane|microtubule|tight junction	beta-tubulin binding|chaperone binding|GTPase activator activity	g.chr17:80828169T>C	BC003094	BC003094	CCDS45818.1	CCDS45818.1	17q25.3	2006-11-21	2006-11-21		2006-11-21	2006-11-21			ENSG00000141556		ENSG00000141556				11581	11581	protein-coding gene	gene with protein product	protein-coding gene	gene with protein product			604649	604649	"""tubulin-specific chaperone d"""		"""tubulin-specific chaperone d"""					Standard	Standard	NM_005993	NM_005993		Approved		uc002kfz.3	uc002kfz.3	Q9BTW9	Q9BTW9			ENST00000355528.4:c.1388T>C	17.37:g.80828169T>C	ENSP00000347719:p.Val463Ala		TBCD_ENST00000397466.2_Missense_Mutation_p.V77A|TBCD_ENST00000539345.2_Missense_Mutation_p.V463A	p.V463A	NM_005993.4	NP_005984.3	Q9BTW9	TBCD_HUMAN	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.18)		14	1518	+	Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0266)|all_epithelial(8;0.0696)	463		O95458|Q7L8K1|Q8IXP6|Q8NAX0|Q8WYH4|Q96E74|Q9UF82|Q9UG46|Q9Y2J3	Missense_Mutation	SNP	ENST00000355528.4	37	c.1388T>C	CCDS45818.1	.	.	.	.	.	.	.	.	.	.	T	20.5	4.000039	0.74818	.	.	ENSG00000141556	ENST00000355528;ENST00000334614;ENST00000397466;ENST00000536182	T;T	0.74947	-0.89;-0.89	5.53	5.53	0.82687	5.53	5.53	0.82687	Armadillo-like helical (1);Armadillo-type fold (1);	0.167192	0.39146	N	0.001446	D	0.87245	0.6129	M	0.91663	3.23	0.54753	D	0.999987	P;P;D	0.55605	0.892;0.935;0.972	P;P;P	0.61800	0.459;0.661;0.894	D	0.89780	0.3960	9	.	.	.	.	13.036	0.58873	0.0:0.0:0.0:1.0	.	463;463;463	Q9BTW9;Q9BTW9-4;F5H8C7	TBCD_HUMAN;.;.	A	463;214;77;463	ENSP00000347719:V463A;ENSP00000380608:V77A	.	V	+	2	0	0	TBCD	78421458	78421458	1.000000	0.71417	0.996000	0.52242	0.167000	0.22549	7.211000	0.77933	2.094000	0.63399	0.533000	0.62120	GTC		0.622	TBCD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439415.1		76.097957	3	3	59	59	NM_005993		24	76.164539	76.164539	28	0.461538	0	0	0	1	0	24	28	0.461538
CCDC73	493860	broad.mit.edu	37	11	32637519	32637520	+	Frame_Shift_Ins	INS	-	-	T			TCGA-YZ-A982-01A-11D-A39W-08	TCGA-YZ-A982-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6dd88bd4-a48e-4288-8b66-2a1c65794e06	926d3706-e1ae-4b81-aaac-c8b57a5bb970	g.chr11:32637519_32637520insT	ENST00000335185.5	-	15	1384_1385	c.1341_1342insA	c.(1339-1344)aaagaafs	p.E448fs	CCDC73_ENST00000534415.1_5'UTR	NM_001008391.2	NP_001008392.2	Q6ZRK6	CCD73_HUMAN	coiled-coil domain containing 73	448										NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|lung(20)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	51	Breast(20;0.112)					AATGAGCCTTCTTTTTTTTCTT	0.248																																						ENST00000335185.5											0			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|lung(20)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	51						c.(1339-1344)aaagaafs	coiled-coil domain containing 73																																			SO:0001589	frameshift_variant	493860						g.chr11:32637519_32637520insT	AK128159	AK128159	CCDS41630.1	CCDS41630.1	11p13	2006-02-11			2006-02-11			ENSG00000186714	ENSG00000186714	ENSG00000186714	ENSG00000186714				23261	23261	protein-coding gene	gene with protein product	protein-coding gene	gene with protein product			612328	612328								Standard	Standard	NM_001008391	NM_001008391		Approved	NY-SAR-79	uc001mtv.4	uc001mtv.4	Q6ZRK6	Q6ZRK6	OTTHUMG00000166279	OTTHUMG00000166279	ENST00000335185.5:c.1342dupA	11.37:g.32637527_32637527dupT	ENSP00000335325:p.Glu448fs		CCDC73_ENST00000534415.1_5'UTR	p.E448fs	NM_001008391.2	NP_001008392.2	Q6ZRK6	CCD73_HUMAN			15	1384_1385	-	Breast(20;0.112)		448		Q6P5Q7|Q6ZMW0|Q86WE7	Frame_Shift_Ins	INS	ENST00000335185.5	37	c.1341_1342insA	CCDS41630.1																																																																																									0.248	CCDC73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388874.2	.	.	-17	-17	24	24	NM_001008391		2			4	0.33						2	4	0.33
ZNF844	284391	broad.mit.edu	37	19	12187762	12187762	+	Frame_Shift_Del	DEL	G	G	-			TCGA-YZ-A982-01A-11D-A39W-08	TCGA-YZ-A982-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6dd88bd4-a48e-4288-8b66-2a1c65794e06	926d3706-e1ae-4b81-aaac-c8b57a5bb970	g.chr19:12187762delG	ENST00000439326.3	+	4	2002	c.1827delG	c.(1825-1827)ctgfs	p.L609fs	ZNF844_ENST00000441304.2_3'UTR	NM_001136501.1	NP_001129973.1	Q08AG5	ZN844_HUMAN	zinc finger protein 844	609					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|lung(1)|prostate(1)	10						AACACACCCTGGAGAGAAACC	0.403																																						ENST00000439326.3											0			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|lung(1)|prostate(1)	10						c.(1825-1827)ctgfs	zinc finger protein 844						107.0	101.0	103.0					19																	12187762		692	1591	2283	SO:0001589	frameshift_variant	284391			regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:12187762delG	AL832297	AL832297	CCDS45985.1	CCDS45985.1	19p13.2	2013-01-08			2013-01-08			ENSG00000223547	ENSG00000223547	ENSG00000223547	ENSG00000223547		"""Zinc fingers, C2H2-type"", ""-"""	"""Zinc fingers, C2H2-type"", ""-"""	25932	25932	protein-coding gene	gene with protein product	protein-coding gene	gene with protein product												Standard	Standard	NM_001136501	NM_001136501		Approved	FLJ14959	uc002mtb.2	uc002mtb.2	Q08AG5	Q08AG5	OTTHUMG00000156405	OTTHUMG00000156405	ENST00000439326.3:c.1827delG	19.37:g.12187762delG	ENSP00000392024:p.Leu609fs		ZNF844_ENST00000441304.2_3'UTR	p.L609fs	NM_001136501.1	NP_001129973.1	Q08AG5	ZN844_HUMAN			4	2002	+			609		Q5JPI8	Frame_Shift_Del	DEL	ENST00000439326.3	37	c.1827delG	CCDS45985.1																																																																																									0.403	ZNF844-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344086.2	.	.	3	3	13	13			2			4	0.33						2	4	0.33
